
Sample records for hyalomma dromedarii synganglion

  1. Rickettsia africae in Hyalomma dromedarii ticks from sub-Saharan Algeria. (United States)

    Kernif, Tahar; Djerbouh, Amel; Mediannikov, Oleg; Ayach, Bouhous; Rolain, Jean-Marc; Raoult, Didier; Parola, Philippe; Bitam, Idir


    Spotted fever group (SFG) rickettsioses are caused by obligate, intracellular Gram-negative bacteria of the genus Rickettsia. In recent years, several species and subspecies of rickettsias have been identified as emerging pathogens throughout the world, including sub-Saharan Africa. We report here the detection of Rickettsia africae, the agent responsible for African tick-bite fever, by amplification of fragments of gltA and ompA genes and multi-spacer typing from Hyalomma dromedarii ticks collected from the camel Camelus dromedarius in the Adrar and Béchar region (sub-Saharan Algeria). To date, R. africae has been associated mainly with Amblyomma spp. The role of H. dromedarii in the epidemiology of R. africae requires further investigation.

  2. Gram-negative bacteria from the camel tick Hyalomma dromedarii (Ixodidae) and the chicken tick Argas persicus (Argasidae) and their antibiotic sensitivities. (United States)

    Montasser, Ashraf A


    A total of nine species of gram-negative bacteria were isolated from organs and haemolymph of the hard tick Hyalomma (Hyalomma) dromedarii and the soft tick Argas (Persicargas) persicus. Four species namely Serratia liquefaciens, Stenotrophomonas maltophilia, Klebsiella ornithinolytica and Aeromonas hydrophila were isolated from H. dromedarii and five species namely Rahnella aquatilis, Pseudomonas fluorescens, Enterobacter cloacae, Chryseomonas luteola and Chryseobacterium meningosepticum were isolated from A. persicus. Isolated bacteria were identified using the analytical profile index 20E. Disk diffusion test was carried out on all isolated bacteria to determine antibiotic sensitivity of chloramphenicol, amoxillin/clavulanic acid, neomycin, streptomycin, triplesulphur tetracycline and nitrofurantion. The results were discussed.

  3. Variations in free radical scavenging activities and antioxidant responses in salivary glands of Hyalomma anatolicum anatolicum and Hyalomma dromedarii (Acari: Ixodidae ticks

    Directory of Open Access Journals (Sweden)

    Mayukh Ghosh


    Full Text Available Aim: Hyalomma anatolicum anatolicum and Hyalomma dromedarii ticks are of major economic importance in the livestock sector as the vector of tropical theileriosis causing huge production loss, mostly in tropical countries. The release of different reactive oxygen and nitrogen species by exogenous and endogenous means can potentially induce oxidative damage to the ticks during their prolonged feeding on their vertebrate hosts. Hence, ticks need an effective free radical scavenging and antioxidant defense system for their successful feeding of a blood meal. Therefore, the present study was undertaken to evaluate the interspecies variations in antioxidant response, free radical scavenging, and anti-inflammatory activities in salivary gland extracts (SGE of the two species as they differ considerably in relation to feeding behavior and host specificity. Materials and Methods: Tick salivary glands were dissected out under ice from semi-fed female ticks of both the species and homogenized at low temperature to prepare SGE. SGE was stored at −40°C for analysis of free radical scavenging activities and antioxidant status. Results: Significant depletion in reduced glutathione concentrations, malondialdehyde level and elevation in free radical scavenging activity, superoxide dismutase, anti-inflammatory activity were found in SGE of engorging female H. dromedarii ticks as compared to H. a. anatolicum. Conclusion: Higher antioxidant status and free radical scavenging activities in H. dromedarii might have enabled these ticks to suck more blood from the host in spite of continuous host’s immune responses. These findings about tick biology will help in improving tick control strategies.

  4. Hyalomma anatolicum anatolicum and Hyalomma dromedarii (Acari: Ixodidae) imbibe bovine blood in vitro by utilizing an artificial feeding system. (United States)

    Tajeri, S; Razmi, G R


    Hard ticks have great importance because of blood feeding and transmitting dangerous human and animal diseases. Each year, they cause a lot of economical damage to the livestock industry. Control of ticks and tick-borne diseases is a major priority in most parts of the world and many studies have been done in this field. We know that studying haemoparasites and assessing the effect of different compounds on ticks requires a lot of money, support and sometimes it is time consuming. Considering all of these problems, today, in some research laboratories throughout the world, artificial in vitro feeding of ticks has become common. Development and application of such methods provide a cheap and accessible background for investigating haemoparasitic diseases under controlled conditions. For the first time we report successful in vitro feeding of two important ixodid ticks of the genus Hyalomma. Copyright © 2011 Elsevier B.V. All rights reserved.

  5. The Camel Tick, Hyalomma (Hyalomma dromedarii Koch, 1844 (Ixodoidea: Ixodidae: Description of the Egg and Redescription of the Larva by Scanning Electron Microscopy

    Directory of Open Access Journals (Sweden)

    Ashraf Ahmed Montasser


    Full Text Available The present study describes the egg of Hyalomma (H. dromedarii for the first time and adds more features to the larva using Scanning Electron Microscopy (SEM in order to extend our knowledge on these acarine stages to be useful for further taxonomical or control studies. With the purpose of presenting exact description of acarine eggs, it is preferable to examine them both with and without SEM processing. SEM processing caused partial removal of the chorion which makes the egg shell clear and easily observed. The study revealed rough surface of egg shell which was surrounded by the chorion. The egg shell was perforated particularly at poles. The chorion appeared as a finely perforated cloth. Different forms of bumps were noticed between egg shell and chorion. Length, width, l/w ratio and pore diameter of the egg were measured. SEM investigation of the larva revealed smooth scutum with slight irregular ornamentation and horizontally folded extensible cuticle with vertical ridges. At least 2 types of cuticular openings were noticed on the extensible cuticle of the idiosoma. The first type was represented by 1 pair on dorsal side and 2 pairs on ventral one. It was surrounded with thick integumental ring and guarded with 2 internal lips. The second type was numerous, slit-like and without rings or lips. Dorsolateral plate of the hypostome carried numerous oval, tile-like and elevated denticles while ventral one carried 4 rows of posteriorly directed retrograde conical denticles. Mouth enclosed 2 cheliceral digits, each terminated with 3 lobes. Each lobe is supported with 2 or 3 conical denticles which were externally directed to the posterior. Haller`s organ on the tarsus of the first pair of legs consisted of anterior pit and posterior capsule. The pit contained 6 conical sensillae while the capsule opening had extensively branched margin. Measurements of the whole body, idiosoma, scutum, eye, capitulum, hypostome, palp, cuticular pores, legs and

  6. Morphological and molecular identification of the brown dog tick Rhipicephalus sanguineus and the camel tick Hyalomma dromedarii (Acari: Ixodidae vectors of Rickettsioses in Egypt

    Directory of Open Access Journals (Sweden)

    Hend H. A. M. Abdullah


    Full Text Available Aim: Rickettsioses have an epidemiological importance that includes pathogens, vectors, and hosts. The dog tick Rhipicephalus sanguineus and the camel tick Hyalomma dromedarii play important roles as vectors and reservoirs of Rickettsiae. The aim of this study was to determine the prevalence of Rickettsiae in ixodid ticks species infesting dogs and camels in Egypt, in addition to, the morphological and molecular identification of R. sanguineus and H. dromedarii. Materials and Methods: A total of 601 and 104 of ticks’ specimens were collected from dogs and camels, respectively, in Cairo, Giza and Sinai provinces. Hemolymph staining technique and OmpA and gltA genes amplification were performed to estimate the prevalence rate of Rickettsiae in ticks. For morphological identification of tick species, light microscope (LM and scanning electron microscope (SEM were used. In addition to the phylogenetic analyses of 18S rDNA, Second internal transcript spacer, 12S rDNA, cytochrome c oxidase subunit-1, and 16S rDNA were performed for molecular identification of two tick species. Results: The prevalence rate of Rickettsiae in ticks was 11.6% using hemolymph staining technique and 6.17% by OmpA and gltA genes amplification. Morphological identification revealed that 100% of dogs were infested by R. sanguineus while 91.9% of camels had been infested by H. dromedarii. The phylogenetic analyses of five DNA markers confirmed morphological identification by LM and SEM. The two tick species sequences analyses proved 96-100% sequences identities when compared with the reference data in Genbank records. Conclusion: The present studies confirm the suitability of mitochondrial DNA markers for reliable identification of ticks at both intra- and inter-species level over the nuclear ones. In addition to, the detection of Rickettsiae in both ticks’ species and establishment of the phylogenetic status of R. sanguineus and H. dromedarii would be useful in

  7. Morphological and molecular identification of the brown dog tick Rhipicephalus sanguineus and the camel tick Hyalomma dromedarii (Acari: Ixodidae) vectors of Rickettsioses in Egypt. (United States)

    Abdullah, Hend H A M; El-Molla, Amal; Salib, Fayez A; Allam, Nesreen A T; Ghazy, Alaa A; Abdel-Shafy, Sobhy


    Rickettsioses have an epidemiological importance that includes pathogens, vectors, and hosts. The dog tick Rhipicephalus sanguineus and the camel tick Hyalomma dromedarii play important roles as vectors and reservoirs of Rickettsiae. The aim of this study was to determine the prevalence of Rickettsiae in ixodid ticks species infesting dogs and camels in Egypt, in addition to, the morphological and molecular identification of R. sanguineus and H. dromedarii. A total of 601 and 104 of ticks' specimens were collected from dogs and camels, respectively, in Cairo, Giza and Sinai provinces. Hemolymph staining technique and OmpA and gltA genes amplification were performed to estimate the prevalence rate of Rickettsiae in ticks. For morphological identification of tick species, light microscope (LM) and scanning electron microscope (SEM) were used. In addition to the phylogenetic analyses of 18S rDNA, Second internal transcript spacer, 12S rDNA, cytochrome c oxidase subunit-1, and 16S rDNA were performed for molecular identification of two tick species. The prevalence rate of Rickettsiae in ticks was 11.6% using hemolymph staining technique and 6.17% by OmpA and gltA genes amplification. Morphological identification revealed that 100% of dogs were infested by R. sanguineus while 91.9% of camels had been infested by H. dromedarii. The phylogenetic analyses of five DNA markers confirmed morphological identification by LM and SEM. The two tick species sequences analyses proved 96-100% sequences identities when compared with the reference data in Genbank records. The present studies confirm the suitability of mitochondrial DNA markers for reliable identification of ticks at both intra- and inter-species level over the nuclear ones. In addition to, the detection of Rickettsiae in both ticks' species and establishment of the phylogenetic status of R. sanguineus and H. dromedarii would be useful in understanding the epidemiology of ticks and tick borne rickettsioses in Egypt.

  8. Photosensitizers in the fight against ticks: safranin as a novel photodynamic fluorescent acaricide to control the camel tick Hyalomma dromedarii (Ixodidae). (United States)

    Khater, Hanem; Hendawy, Nabil; Govindarajan, Marimuthu; Murugan, Kadarkarai; Benelli, Giovanni


    Ticks transmit more pathogen species than any other group of blood-feeding arthropods worldwide, affecting humans, livestock, and companion animals. Hyalomma dromedarii is the predominant tick species infesting camels, and its effective control is of pivotal importance. In this research, we compared the phytoefficacy of safranin (SF), a fluorescent dye applied as an acaricide for the first time, to that of tetramethrin (TM) against engorged females of H. dromedarii through in vitro immersion bioassays. Furthermore, the effect of SF exposure was evaluated on the reproductive potential of surviving tick females. Different concentrations of SF (0.03, 0.06, 0.3, 1, and 4 % w:v) and TM (0.03, 0.13, 0.5, 2, and 4 %) were prepared in distilled water and administered to engorged females of H. dromedarii. SF-treated ticks were illuminated with a light source for 30 min post-treatment (PT). Photophysical properties of SF were studied, and the relative efficacy of the used light source and sunlight was calculated. Results showed that the minimum least concentration that causes 100 % acaricidal effect was 4 % PT with SF and TM, for 8 and 48 h, respectively. LC50 values 8 and 24 h PT were 0.08, 0.03 and 0.78, 0.20 %, respectively. Comparing LC50 and LC90 2 h PT, SF was 33 and 22 times more potent than TM. LT50 of 4 % SF and TM were 0.80 and 2.17 h, respectively. Treatment with the lowest concentrations of SF and TM induced reduction of the number of ovipositing females, eggs per female, ticks laying viable eggs, and hatched eggs. Overall, our results highlighted that SF is highly effective if compared to TM, allowing use to candidate it for the development of novel and safer acaricides.

  9. Molecular detection of Rickettsia africae, Rickettsia aeschlimannii, and Rickettsia sibirica mongolitimonae in camels and Hyalomma spp. ticks from Israel. (United States)

    Kleinerman, Gabriela; Baneth, Gad; Mumcuoglu, Kosta Y; van Straten, Michael; Berlin, Dalia; Apanaskevich, Dmitry A; Abdeen, Ziad; Nasereddin, Abed; Harrus, Shimon


    In this study, we aimed to identify and genetically characterize spotted fever group (SFG) rickettsiae in ticks, domestic one-humped camels, and horses from farms and Bedouin communities in southern Israel. A total of 618 ixodid ticks (Hyalomma dromedarii, Hyalomma turanicum, Hyalomma excavatum, and Hyalomma impeltatum) collected from camels and horses, as well as 152 blood samples from 148 camels and four horses were included in the study. Initial screening for rickettsiae was carried out by targeting the gltA gene. Positive samples were further analyzed for rickettsial ompA, 17kDa, ompB, and 16S rRNA genes. Rickettsia aeschlimannii DNA was detected in the blood of three camels and 14 ticks (H. dromedarii, H. turanicum, and H. excavatum). Rickettsia africae was found in six ticks (H. turanicum, H. impeltatum, H. dromedarii, and H. excavatum). In addition, Rickettsia sibirica mongolitimonae was detected in one H. turanicum tick. These findings represent the first autochthonous detection of R. africae in Israel. Previous detections of R. africae in Asia were reported from the Sinai Peninsula (Egypt) and Istanbul, only. Furthermore, we report for the first time the finding of R. aeschlimannii in H. turanicum and H. excavatum ticks, as well as the first identification of R. sibirica mongolitimonae in H. turanicum ticks. The tick species identified to harbor R. africae and other SFG rickettsiae have been reported to occasionally feed on people, and, therefore, physicians should be aware of the possible exposure of local communities and travelers, especially those in contact with camels, to these tick-borne rickettsial pathogens.

  10. Neurosecretory Cell Types and Distribution in Unfed Female Hyalomma Dromedari (Acari: Ixodoidea: Ixodidae) Synganglion (United States)


    of the cell in subtype VIh (Fig. 2). Type IX : In these oval celo, 2 subtypes are distinguished according to cell size and NSG distribution. The NSG...1977) : Neurosecretion in Ornithodoros savignyi (Audouin) (Ixodoidea : Arga- sidae ). The distribution of neurosecretory cells in the brain. J. Vet. Res

  11. Life cycle and morphology of development stages of Physocephalus dromedarii (Nematoda:Spirocercidae)

    Institute of Scientific and Technical Information of China (English)

    Rolf Karl Schuster; Saritha Sivakumar; J ¨org Kinne


    Objective: To study the development of Physocephalus dromedarii (P. dromedarii) in the final host. Methods: For this, 5 adult dromedaries were orally infected with third larval stages of P. dromedarii obtained from naturally infected scarab beetles (Scarabaeus cristatus). The camels were necropsied 14, 42, 70, 84 and 280 days after infection and their abomasi were examined for the presence of nematodes. Results: Early 4th stage larva occurred already 2 weeks after infection. They were still in the sheet of the 3rd stage larva. Six weeks after infection, the nematodes became juvenile male and female adults measuring 9 and 10 mm, respectively. Their size doubled at 10 weeks post infection and patency was reached at 12 weeks. P. dromedarii was still present in the camel that was examined 40 weeks after infection. Conclusions: As a result of experimental infection of the natural host, the determined prepatent period of P. dromedarii equalled 12 weeks.

  12. Neuronal projections from the Haller's organ and palp sensilla to the synganglion of Amblyomma americanum (United States)

    The present study was conducted to elucidate the neuronal pathways between peripheral olfactory and taste sensilla and the synganglion in an Ixodidae tick species. The tarsus of the front legs (olfactory nerves) and the fourth palpal segment (gustatory nerves) of unfed Amblyomma americanum males and...

  13. Mevalonate-Farnesal Biosynthesis in Ticks: Comparative Synganglion Transcriptomics and a New Perspective.

    Directory of Open Access Journals (Sweden)

    Jiwei Zhu

    Full Text Available Juvenile hormone (JH controls the growth, development, metamorphosis, and reproduction of insects. For many years, the general assumption has been that JH regulates tick and other acarine development and reproduction the same as in insects. Although researchers have not been able to find the common insect JHs in hard and soft tick species and JH applications appear to have no effect on tick development, it is difficult to prove the negative or to determine whether precursors to JH are made in ticks. The tick synganglion contains regions which are homologous to the corpora allata, the biosynthetic source for JH in insects. Next-gen sequencing of the tick synganglion transcriptome was conducted separately in adults of the American dog tick, Dermacentor variabilis, the deer tick, Ixodes scapularis, and the relapsing fever tick, Ornithodoros turicata as a new approach to determine whether ticks can make JH or a JH precursor. All of the enzymes that make up the mevalonate pathway from acetyl-CoA to farnesyl diphosphate (acetoacetyl-CoA thiolase, HMG-S, HMG-R, mevalonate kinase, phosphomevalonate kinase, diphosphomevalonate decarboxylase, and farnesyl diphosphate synthase were found in at least one of the ticks studied but most were found in all three species. Sequence analysis of the last enzyme in the mevalonate pathway, farnesyl diphosphate synthase, demonstrated conservation of the seven prenyltransferase regions and the aspartate rich motifs within those regions typical of this enzyme. In the JH branch from farnesyl diphosphate to JH III, we found a putative farnesol oxidase used for the conversion of farnesol to farnesal in the synganglion transcriptome of I. scapularis and D. variabilis. Methyltransferases (MTs that add a methyl group to farnesoic acid to make methyl farnesoate were present in all of the ticks studied with similarities as high as 36% at the amino acid level to insect JH acid methyltransferase (JHAMT. However, when the tick MTs

  14. Mevalonate-Farnesal Biosynthesis in Ticks: Comparative Synganglion Transcriptomics and a New Perspective. (United States)

    Zhu, Jiwei; Khalil, Sayed M; Mitchell, Robert D; Bissinger, Brooke W; Egekwu, Noble; Sonenshine, Daniel E; Roe, R Michael


    Juvenile hormone (JH) controls the growth, development, metamorphosis, and reproduction of insects. For many years, the general assumption has been that JH regulates tick and other acarine development and reproduction the same as in insects. Although researchers have not been able to find the common insect JHs in hard and soft tick species and JH applications appear to have no effect on tick development, it is difficult to prove the negative or to determine whether precursors to JH are made in ticks. The tick synganglion contains regions which are homologous to the corpora allata, the biosynthetic source for JH in insects. Next-gen sequencing of the tick synganglion transcriptome was conducted separately in adults of the American dog tick, Dermacentor variabilis, the deer tick, Ixodes scapularis, and the relapsing fever tick, Ornithodoros turicata as a new approach to determine whether ticks can make JH or a JH precursor. All of the enzymes that make up the mevalonate pathway from acetyl-CoA to farnesyl diphosphate (acetoacetyl-CoA thiolase, HMG-S, HMG-R, mevalonate kinase, phosphomevalonate kinase, diphosphomevalonate decarboxylase, and farnesyl diphosphate synthase) were found in at least one of the ticks studied but most were found in all three species. Sequence analysis of the last enzyme in the mevalonate pathway, farnesyl diphosphate synthase, demonstrated conservation of the seven prenyltransferase regions and the aspartate rich motifs within those regions typical of this enzyme. In the JH branch from farnesyl diphosphate to JH III, we found a putative farnesol oxidase used for the conversion of farnesol to farnesal in the synganglion transcriptome of I. scapularis and D. variabilis. Methyltransferases (MTs) that add a methyl group to farnesoic acid to make methyl farnesoate were present in all of the ticks studied with similarities as high as 36% at the amino acid level to insect JH acid methyltransferase (JHAMT). However, when the tick MTs were compared to

  15. Neuronal projections from the Haller's organ and palp sensilla to the synganglion of Amblyomma americanum§. (United States)

    Borges, Lígia Miranda Ferreira; Li, Andrew Yongsheng; Olafson, Pia Untalan; Renthal, Robert; Bauchan, Gary Roy; Lohmeyer, Kimberly Hutchison; León, Adalberto Angel Pérez de


    The present study was conducted to elucidate the neuronal pathways between peripheral olfactory and taste sensilla and the synganglion in an Ixodidae tick species. The tarsus of the front legs (olfactory nerves) and the fourth palpal segment (gustatory nerves) of unfed Amblyomma americanum males and females were excised. A neuronal tracer, dextran tetramethylrhodamine, was used for filling of the sensory neurons. The synganglion preparations were examined using a confocal microscope. Neuronal arborizations from the Haller's organ were confined to the olfactory lobes and the first pedal ganglion. The estimated number of olfactory glomeruli ranged from 16 to 22 per olfactory lobe in the females. The number of glomeruli was not counted in males because they were densely packed. Sensory neurons associated with sensilla at the distal end of the palpal organ projected into the palpal ganglion in the synganglion through the palpal nerve. Gustatory sensory neurons associated with palpal sensilla projected into a commissure with several bulges, which are confined in the palpal ganglion. The findings of distinct projection patterns of sensory neurons associated with the Haller's organ and palpal organ in the lone star tick from this study advanced our knowledge on mechanisms of sensory information processing in ticks.

  16. Morphometric Study on Male Specimens of Hyalomma anatolicum (Acari: Ixodidae in West of Iran

    Directory of Open Access Journals (Sweden)

    A Hosseini


    Conclusion: Morphometric variation in Hyalomma spp is poorly studied. The variation in range and quantity of the mor­phometric parameters of H.anatolicum ‎underlies that the correct recognition and key construction for Hyalomma spe­cies dependes ‎on a complement morphometric study on the other species.

  17. Transcriptome analysis of the synganglion from the honey bee mite, Varroa destructor and RNAi knockdown of neural peptide targets. (United States)

    Campbell, Ewan M; Budge, Giles E; Watkins, Max; Bowman, Alan S


    Varroa mites (Varroa destructor) and the viruses that they transmit are one of the major contributing factors to the global honey bee crisis. Gene products within the nervous system are the targets of all the insecticides currently used to control Varroa but there is a paucity of transcriptomic data available for Varroa neural tissues. A cDNA library from the synganglia ("brains") of adult female Varroa was constructed and 600 ESTs sequenced and analysed revealing several current and potential druggable targets. Contigs coding for the deformed wing virus (DWV) variants V. destructor virus-1 (VDV-1) and the recombinant (VDV-1DVD) were present in the synganglion library. Negative-sense RNA-specific PCR indicated that VDV-1 replicates in the Varroa synganglion and all other tissues tested, but we could not detect DWV replicating in any Varroa tissue. Two neuropeptides were identified in the synganlion EST library: a B-type allatostatin and a member of the crustacean hyperglycaemic hormone (CHH) superfamily. Knockdown of the allatostatin or the CHH-like gene by double-stranded RNA-interference (dsRNAi) resulted in 85% and 55% mortality, respectively, of Varroa. Here, we present the first transcriptomic survey in Varroa and demonstrate that neural genes can be targeted by dsRNAi either for genetic validation of putative targets during drug discovery programmes or as a potential control measure in itself.

  18. First detection of Babesia occultans in Hyalomma ticks from Tunisia. (United States)

    Ros-García, A; M'Ghirbi, Y; Bouattour, A; Hurtado, A


    Descriptions of Babesia occultans have previously been restricted to sub-Saharan Africa. Here, we report the finding, for the first time, of this low or non-pathogenic bovine Babesia species in Tunisia, northern Africa. B. occultans DNA was detected by molecular methods in Hyalomma marginatum unfed ticks collected in 3 bioclimatic regions of Tunisia. The near-full-length 18S rRNA gene was sequenced and compared with related sequences retrieved from GenBank. Phylogenetic analysis indicated that other sequences deposited as Babesia sp. could also correspond to B. occultans, suggesting that this species may have a wide distribution in Mediterranean and Asiatic regions, and not only in sub-Saharan Africa as previously described. A B. occultans-specific Reverse Line Blot (RLB) oligonucleotide probe was designed for future epidemiological studies that would help to clarify this possibility.

  19. Bartonella dromedarii sp. nov. isolated from domesticated camels (Camelus dromedarius) in Israel. (United States)

    Rasis, Michal; Rudoler, Nir; Schwartz, David; Giladi, Michael


    Bartonella spp. are fastidious, Gram-negative bacilli that cause a wide spectrum of diseases in humans. Most Bartonella spp. have adapted to a specific host, generally a domestic or wild mammal. Dromedary camels (Camelus dromedarius) have become a focus of growing public-health interest because they have been identified as a reservoir host for the Middle East respiratory syndrome coronavirus. Nevertheless, data on camel zoonoses are limited. We aimed to study the occurrence of Bartonella bacteremia among dromedaries in Israel. Nine of 51 (17.6%) camels were found to be bacteremic with Bartonella spp.; bacteremia levels ranged from five to >1000 colony-forming units/mL. Phylogenetic reconstruction based on the concatenated sequences of gltA and rpoB genes demonstrated that the dromedary Bartonella isolates are closely related to other ruminant-derived Bartonella spp., with B. bovis being the nearest relative. Using electron microscopy, the novel isolates were shown to be flagellated, whereas B. bovis is nonflagellated. Sequence comparisons analysis of the housekeeping genes ftsZ, ribC, and groEL showed the highest homology to B. chomelii, B. capreoli, and B. birtlesii, respectively. Sequence analysis of the gltA and rpoB revealed ∼96% identity to B. bovis, a previously suggested cutoff value for sequence-based differentiation of Bartonella spp., suggesting that this approach does not have sufficient discriminatory power for differentiating ruminant-related Bartonella spp. A comprehensive multilocus sequence typing (MLST) analysis based on nine genetic loci (gltA, rpoB, ftsZ, internal transcribed spacer (ITS), 16S rRNA, ribC, groEL, nuoG, and SsrA) identified seven sequence types of the new dromedary isolates. This is the first description of a Bartonella sp. from camelids. On the basis of a distinct reservoir and ecological niche, sequence analyses, and expression of flagella, we designate these isolates as a novel Bartonella sp. named Bartonella dromedarii sp

  20. Comparison of synganglion neuropeptides, neuropeptide receptors and neurotransmitter receptors and their gene expression in response to feeding in Ixodes scapularis (Ixodidae) vs. Ornithodoros turicata (Argasidae). (United States)

    Egekwu, N; Sonenshine, D E; Garman, H; Barshis, D J; Cox, N; Bissinger, B W; Zhu, J; M Roe, R


    Illumina GAII high-throughput sequencing was used to compare expressed genes for female synganglion neuropeptides, neuropeptide receptors and neurotransmitter receptors of the soft tick Ornithodoros turicata with the hard tick Ixodes scapularis. Gene ontology molecular level three mapping revealed no significant differences amongst the same categories represented in O. turicata and I. scapularis. Transcripts predicting 22 neuropeptides or their receptors in the O. turicata synganglion were similar to annotations for 23 neuropeptides or receptors previously identified from I scapularis, with minor exceptions. A transcript predicting ecdysis triggering hormone receptor was identified in O. turicata; transcripts encoding for proprotein convertase and glycoprotein B were identified in both species. Transcripts predicting the same neurotransmitter receptors were found in the synganglion of both species. Gene expression of the transcripts showed numerous differences in response to feeding. Major differences were observed in expression of genes believed important in regulating slow vs. rapid feeding, blood water elimination, cuticle synthesis plasticity and in signalling reproductive activity. Although the glutamate receptor was strongly upregulated in both species, the gamma aminobutyric acid receptor, which inhibits glutamate, was upregulated significantly only in I. scapularis. These differences are consistent with the slow vs. rapid action of the pharyngeal pump in the two species.

  1. Transstadial transmission of Borrelia turcica in Hyalomma aegyptium ticks. (United States)

    Kalmár, Zsuzsa; Cozma, Vasile; Sprong, Hein; Jahfari, Setareh; D'Amico, Gianluca; Mărcuțan, Daniel I; Ionică, Angela M; Magdaş, Cristian; Modrý, David; Mihalca, Andrei D


    Borrelia turcica comprises the third major group of arthropod-transmitted borreliae and is phylogenetically divergent from other Borrelia groups. The novel group of Borrelia was initially isolated from Hyalomma aegyptium ticks in Turkey and it was recently found in blood and multiple organs of tortoises exported from Jordan to Japan. However, the ecology of these spirochetes and their development in ticks or the vertebrate hosts were not investigated in detail; our aims were to isolate the pathogen and to evaluate the possibility of transstadial transmission of Borrelia turcica by H. aegyptium ticks. Ticks were collected from Testudo graeca tortoises during the summer of 2013 from southeastern Romania. Engorged nymphs were successfully molted to the adult stage. Alive B. turcica was isolated from molted ticks by using Barbour-Stoenner-Kelly (BSK) II medium. Four pure cultures of spirochetes were obtained and analyzed by PCR and sequencing. Sequence analysis of glpQ, gyrB and flaB revealed 98%-100% similarities with B. turcica. H. aegyptium ticks collected from T. graeca tortoises were able to pass the infection with B. turcica via transstadial route, suggesting its vectorial capacity.

  2. Scarabaeus cristatus (Coleoptera: Scarabaeidae) as intermediate host of Physocephalus dromedarii (Nematoda: Spirocercidae)--a contribution to the epidemiology of camel physocephalidosis. (United States)

    Schuster, Rolf K; Sivakumar, Saritha; Ismail, Akhmad A; Baumann, Maximilian P O


    In UAE, camel Physocephalus dromedarii was diagnosed for the first time in 2011 in dromedaries from a farm that previously had imported animals from foreign countries. The large scarab beetle, Scarabaeus cristatus, was found to be the major intermediate host for this parasite in Dubai. A total of 638 specimens of S. cristatus were collected and examined for the presence of third-stage larvae of nematode larvae at two sites in the Dubai Emirate (Emirates Industry for Camel Milk and Products and horse endurance training track) within a distance of 15 km. Third-stage larvae of P. dromedarii were detected in 94 and 97 % of beetles collected from the territory of the camel milk farm and the endurance training track, respectively. In addition to third-stage larvae, 264 beetles contained second-stage larvae. Only four beetles were infected with other than P. dromedarii larvae. The average larval burden in beetles from camel milk farm was significantly higher compared to those in beetles collected from the other site (1538 vs. 697). Comparison of larval burdens in juvenile and adult beetles collected at the camel milk farm showed a significantly higher intensity in adult specimens (501 vs. 1734) while in beetles found on the horse endurance track, larval burdens were comparable (548 vs. 858). The results suggest that S. cristatus become infected at the camel milk farm, and in search for other sources of food, they fly to places where they were found feeding on feces of other animals.


    Directory of Open Access Journals (Sweden)

    V. I. Trukhachev


    Full Text Available Aim. To determine the characteristics of the modern dissemination, distribution and seasonal activity of Hyalomma ixodid ticks in the Stavropol region.Methods. The study of the spread of Ixodes Hyalomma ticks was conducted in all administrative districts of the Stavropol Territory in the period of 2000-2015. Collection of ixodid ticks in natural habitats, home to wild mammals and birds, was carried out according to conventional techniques.Results. Hyalomma marginatum is a two-host tick. In the region, H. marginatum of an adult stage becomes active in early spring (late March - early April; appearance of the larvae is observed in early July; the nymphs in the third decade of July. The peculiarity of biological development of H. scupense is the activation of adult species in the cold season (winter; development is only of one-host cycle. The peak number of ticks of an adult stage in cattle falls on the last days of January and February.Conclusion. Hyalomma ixodid ticks in the Stavropol region are distributed mosaicly, with the dominance of some species depending on climatic and landscape-geographical features of the territories they inhabit. The dominant species are H. marginatum and H. scupense, but H. anatolicum tick species occur sporadically in the east region.

  4. Morphometric Study on Male Specimens of Hyalomma Anatolicum (Acari: Ixodidae in West of Iran

    Directory of Open Access Journals (Sweden)

    M Abdigoudarzi


    Full Text Available Background: Hyalomma anatolicum is the well-known hard tick, which is one of the most important livestock and hu­man pathogens vector, wide range in host and distributed in all over the Hyalomma geographic fauna as well as in Iran. Taxonomy of the Hyalomma ssp. is debatable whereas their identification is a problematic work. The reasons for this claim is time consuming Delpy’s researches in Iran also Schulze School, Feldman-Muhsam and the Russian tick workers. We would like to understand morphometric variation in the field collected H. anatolicum in Iran also validat­ing some morphologic quantitative and qualitative characters.Methods: A total 247 field-collected tick specimens from different geographical regions in west of Iran includes Khuzestan and Lorestan Provinces were studied. The morphologic characters of the ticks were measured by the cali­brated stereomicroscope ‎armed scaled lens. The measurements were analyzed using SPSS ‎for windows, version 16 on an IBM PC, ‎so varied shapes of species in different geographic ‎regions were drawn by the ‎aid of a drawing tube con­nected to a light stereomicroscope.‎Results: One way ANOVA test revealed significant differences among the quantitative parameters in five zones (P<‎‎ 0.‎‎00‎‎1‎ also each zone to other zone by Post Hoc Tests e.g. LSD. No significant differences in the lateral grooves length/conscutum length ratio parameter were found.Conclusion: Morphometric variation in Hyalomma spp is poorly studied. The variation in range and quantity of the mor­phometric parameters of H.anatolicum ‎underlies that the correct recognition and key construction for Hyalomma spe­cies dependes ‎on a complement morphometric study on the other species.

  5. Morphological alterations in the synganglion and integument of Rhipicephalus sanguineus ticks exposed to aqueous extracts of neem leaves (Azadirachta indica A. JUSS). (United States)

    Remedio, R N; Nunes, P H; Anholeto, L A; Camargo-Mathias, M I


    Currently, the necessity of controlling infestation by ticks, especially by Rhipicephalus sanguineus, has led researchers and public health managers around the world to search for new and more efficient control methods. This way, we can highlight neem (Azadirachta indica A. Juss) leaf, bark, and seed extracts, which have been very effective on tick control, and moreover causing less damage to the environment and to the host. This study showed the potential of neem as a control method for R. sanguineus through morphological and morphometric evaluation of the integument and synganglion of females, in semiengorged stage. To attain this, routine techniques of optical microscopy, scanning electron microscopy and morphometry of the cuticle and subcuticle of the integument were applied. Expressive morphological alterations were observed in both organs, presenting a dose-dependent effect. Integument epithelial cells and nerve cells of the synganglion showed signs of cell vacuolation, dilated intercellular boundaries, and cellular disorganization, alterations not previously reported in studies with neem. In addition, variations in subcuticle thickness were also observed. In general, the effects of neem are multiple, and affect the morphology and physiology of target animals in various ways. The results presented in this work are the first evidence of its effects in the coating and nervous system of ticks, thus allowing an indication of neem aqueous extracts as a potential control method of the brown dog tick and opening new perspectives on acaricide use. © 2014 Wiley Periodicals, Inc.

  6. The synganglion of the jumping spider Marpissa muscosa (Arachnida: Salticidae): Insights from histology, immunohistochemistry and microCT analysis. (United States)

    Steinhoff, Philip O M; Sombke, Andy; Liedtke, Jannis; Schneider, Jutta M; Harzsch, Steffen; Uhl, Gabriele


    Jumping spiders are known for their extraordinary cognitive abilities. The underlying nervous system structures, however, are largely unknown. Here, we explore and describe the anatomy of the brain in the jumping spider Marpissa muscosa (Clerck, 1757) by means of paraffin histology, X-ray microCT analysis and immunohistochemistry as well as three-dimensional reconstruction. In the prosoma, the CNS is a clearly demarcated mass that surrounds the esophagus. The anteriormost neuromere, the protocerebrum, comprises nine bilaterally paired neuropils, including the mushroom bodies and one unpaired midline neuropil, the arcuate body. Further ventrally, the synganglion comprises the cheliceral (deutocerebrum) and pedipalpal neuropils (tritocerebrum). Synapsin-immunoreactivity in all neuropils is generally strong, while allatostatin-immunoreactivity is mostly present in association with the arcuate body and the stomodeal bridge. The most prominent neuropils in the spider brain, the mushroom bodies and the arcuate body, were suggested to be higher integrating centers of the arthropod brain. The mushroom body in M. muscosa is connected to first and second order visual neuropils of the lateral eyes, and the arcuate body to the second order neuropils of the anterior median eyes (primary eyes) through a visual tract. The connection of both, visual neuropils and eyes and arcuate body, as well as their large size corroborates the hypothesis that these neuropils play an important role in cognition and locomotion control of jumping spiders. In addition, we show that the architecture of the brain of M. muscosa and some previously investigated salticids differs significantly from that of the wandering spider Cupiennius salei, especially with regard to structure and arrangement of visual neuropils and mushroom body. Thus, we need to explore the anatomical conformities and specificities of the brains of different spider taxa in order to understand evolutionary transformations of the

  7. A review of Hyalomma scupense (Acari, Ixodidae in the Maghreb region: from biology to control

    Directory of Open Access Journals (Sweden)


    Full Text Available Hyalomma scupense (syn. Hyalomma detritum is a two-host domestic endophilic tick of cattle and secondarily other ungulates in the Maghreb region (Africa. This species transmits several pathogens, among which two are major livestock diseases: Theileria annulata and Theileria equi. Various other pathogens are also transmitted by this tick species, such as Anaplasma phagocytophilum and Ehrlichia bovis. Hyalomma scupense is common in sub-humid and semi-arid areas of several regions in the world, mainly in the Maghreb region. In this region, adults attach to animals during the summer season; larvae and nymphs attach to their hosts during autumn, but there is a regional difference in H. scupense phenology. There is an overlap between immature and adult ticks, leading in some contexts to a dramatic modification of the epidemiology of tick-borne diseases. This tick species attaches preferentially to the posterior udder quarters and thighs. Tick burdens can reach 130 ticks per animal, with a mean of 60 ticks. Calves are 70 times less infested than adult cattle. The control can be implemented through six options: (i rehabilitation of the farm buildings by roughcasting and smoothing the outer and inner surfaces of the enclosures and walls. This control option should be recommended to be combined with a thorough cleaning of the farm and its surrounding area. With regard to Theileria annulata infection, this control option is the most beneficial. (ii Acaricide application to animals during the summer season, targeting adults. (iii Acaricide application during the autumn period for the control of the immature stages. (iv Acaricide application to the walls: many field veterinarians have suggested this option but it is only partially efficient since nymphs enter deep into the cracks and crevices. It should be used if there is a very high tick burden or if there is a high risk of tick-borne diseases. (v Manual tick removal: this method is not efficient since the

  8. Facial nerve paralysis due to intra-aural Hyalomma tick infestation. (United States)

    Doğan, Müzeyyen; Devge, Cem; Tanrıöver, Ozlem; Pata, Yavuz Selim; Sönmezoğlu, Meral


    We present the case of a 33 year-old man from a village of the north-eastern part of central Anatolia admitted to the otolaryngology department of Yeditepe University Hospital with right facial asymmetry and pain on the right ear. A tick of the genus Hyalomma was observed in the external auditory canal of the right ear and it was removed with fine cup forceps under otomicroscopy. We are of the opinion that in patients presenting with sudden acute ear pain and facial palsy, the ear canal should be examined to exclude an infestation by ticks.

  9. Metarhizium anisopliae as a biological control agent against Hyalomma anatolicum (Acari: Ixodidae). (United States)

    Suleiman, Elham A; Shigidi, M T; Hassan, S M


    In the Sudan, ticks and Tick-borne Diseases (TBDs) with subsequent costs of control and treatment are causing substantial economic loss. Control of ticks is mainly by chemical insecticides. The rising environmental hazards and problem of resistance has motivated research on biological agents as alternative methods of control. The present study aims at controlling livestock ticks using fungi for their unique mode of action besides their ability to adhere to the cuticle, to germinate and penetrate enzymatically. The study was conducted to evaluate the fungus Metarhizium anisopliae for tick control as an alternative mean to chemical acaricides. Pathogenicity of the fungus was tested on different developmental stages of the tick Hyalomma anatolicum. The fungus induced high mortality to flat immature stages. It, also, affected reproductive potential of the females. Egg laid, hatching percent, fertility and moulting percent of immature stages were significantly (p anisopliae to control ticks is discussed.

  10. Natural infection rates and transmission of Theileria annulata by Hyalomma anatolicum anatolicum ticks in the Sudan

    Directory of Open Access Journals (Sweden)

    D.A. Salih


    Full Text Available Hyalomma anatolicum anatolicum nymphs were collected from two localities in the Sudan: Eddamer in Northern Sudan and Wad-Medani in Central Sudan. They were allowed to moult to adult ticks, which were assessed for Theileria infection in their salivary glands using Feulgen stain. At Eddamer, 49.6 % of 123 ticks examined were infected with Theileria and the mean intensity of infection was 1.3 (i.e. the number of infected acini / number of infected ticks. At Wad-Medani, 8.6 % of 162 ticks were infected and the mean intensity of infection was 7.9. The prevalence of infection was higher in female than in male ticks at both localities. When adult H. a. anatolicum were applied onto two susceptible calves, both animals developed the severe form of theileriosis.

  11. 小亚璃眼蜱和亚洲璃眼蜱对环形泰勒虫传播能力的研究%Studies on ability to transmit Theileria annulata with Hyalomma anatolicum anatolicum and Hyalomma asiaticum asiaticum

    Institute of Scientific and Technical Information of China (English)

    罗建勋; 殷宏; 关贵全; 马米玲; 张其才; 吕文顺


    将实验室培养的小亚璃眼蜱(Hyalomma anatolicum anatolicum)和亚洲璃眼蜱(Hyalomma asiaticum asiaticum)清洁幼虫和若虫饲喂于感染环形泰勒虫的牛体,收集饱血幼虫和若虫,用所孵化的若虫和成虫感染试验牛.结果显示,小亚璃眼蜱幼虫、若虫阶段感染,所发育之若虫、成虫均可传播环形泰勒虫;而亚洲璃眼蜱各阶段的传播试验结果均为阴性.

  12. The dependence of Hyalomma aegyptium on its tortoise host Testudo graeca in Algeria. (United States)

    Tiar, G; Tiar-Saadi, M; Benyacoub, S; Rouag, R; Široký, P


    Hyalomma aegyptium (Linnaeus, 1758) (Ixodida: Ixodidae) has recently been confirmed as a carrier of numerous pathogenic, including zoonotic, agents. Four environmentally distinct regions of Algeria, located between the humid coastal zone and the arid Saharan Atlas range, were selected in order to compare differences in tick abundance among localities, and the correlations between tick abundance and host population characteristics and other environmental conditions. Sampling was carried out during May and early June in 2010-2012. A total of 1832 H. aegyptium were removed from 201 tortoises. Adult ticks accounted for 52% of the collection. In the pre-adult stages, larvae were dominant. Data on prevalence, intensity (mean ± standard deviation, range) and abundance of tick infestation were calculated for each locality. Locally, prevalences reached 100%. The sex ratio was biased in favour of males (4.2). Intensities of infestation differed significantly among the localities studied for all developmental stages of the tick. The intensity of infestation by adult ticks was positively correlated to the size of the tortoise and with tortoise population density in the habitat. However, findings for immature tick stages were independent of both variables. No significant correlations between infestation intensities and the climatic parameters tested were found. Immature ticks were observed to prefer the front parts of their tortoise hosts, whereas the majority of adults were attached to the rear parts.

  13. Hyalomma aegyptium on Spur-thighed Tortoise (Testudo graeca in Urmia Region West Azerbaijan, Iran

    Directory of Open Access Journals (Sweden)

    M Tavassoli


    Full Text Available Background: Ticks are obligate blood feeders that parasitize a wide variety of animals. Hyalomma aegyptium, parasitize tortoises and other small wild life and livestock. This study was carried out to determine spur-thighed tortoise (Testudo graeca infestation to H. ageyptium in Urmia region West Azerbaijan of Iran. Methods: The study was carried out over a 16 month period from the spring of 2004 to the fall of 2005. A total of 32 tor¬toises were sampled. Results: The results indicated that 14 tortoises infected with ticks. A total of 117 ticks were collected from infested animals, the minimum and maximum tick infestation was 1-60. Ticks were attached to the axilla of fore and hind legs of tortoises. All ticks were determined to be H. aegyptium. Conclusion: H. aegyptium was the most common tick species in the study area. Due to tendency of some people to keeping tortoise as pet animal, more attention must be done to tortoise’s tick infestation. Due to existence of H. aegyptium on tor¬toises in this region more study will need to evaluate presence of this tick on other animal species and its role on transmis¬sion of diseases.

  14. [The importance of gamma irradiations with caesium-137 for Hyalomma anatolicum anatolicum (Metastigmata, Ixodidae) control]. (United States)

    Karaer, Zafer; Kar, Sirri; Düzgün, Ali; Güven, Esin; Pekmezci, Zafer; Emre, Zişan


    In this study, male ticks belonging to the Hyalomma anatolicum anatolicum species were subjected to gamma radiation doses of 5, 10, 15, 20 and 50 Gy, emitted by a gamma-ray source of Caesium 137. In females that fed with these male ticks, proportional to the increase in radiation dose, the period of feeding was found to shorten. A decrease was demonstrated in the number of engorged female ticks, engorgement weights, number of laying ticks and number of eggs. The hatching period of larvae from eggs was found to increase despite the decrease in the number of hatched larvae. Moreover no larvae were observed to hatch from any of the eggs of female ticks treated with a radiation dose of 50 Gy. Similarly, proportional to the applied dose of radiation, rates of viability and activity were observed to decrease in male ticks. In conclusion, taking into consideration the feeding periods and fertility rates of female ticks as indicators of male activity, this study has demonstrated that in combating with H. anatolicum anatolicum, radiation may be successful and a radiation dose of 10 Gy is most favorable.

  15. Transovarial Transmission of Babesia Ovis by Rhipicephalus Sanguineus and Hyalomma Marginatum

    Directory of Open Access Journals (Sweden)

    E Nouroozi


    Full Text Available Background: Rhipicephalus sanguineus and Hyalomma marginatum are the most common spe­cies in sheep herds in Northeast of Iran. There is preliminary evidence that these species may be the vectors of Babesia ovis in Iran. We carried out two experiments in Mashhad area, Khorasan Razavi Province to determine whether B. ovis could be transovarially transmitted by R. san­guineus and H. marginatum.Methods: In experiment 1, adults of laboratory reared H. marginatum and R.sanguineus were infected with B. ovis isolated from naturally infected sheep in Mashhad area by feeding the ticks on the sheep inoculated intravenously by infected blood samples. The inoculated sheep showed clinical signs with parasitaemia while the adult ticks were engorging on them. The engorged fe­males were collected and kept at 28°C and 85% relative humidity in incubator. Then, larval, nym­phal and adult stages derived from engorged females were used to infest the clean sheep. In experiment 2, two splenectomized sheep were infested only with the same adult ticks of two spe­cies.Results: Examination of smears and PCR of blood samples to detect of B. ovis in infested sheep in two experiments were negative.Conclusion: It seems that R. sanguineus and H. marginatum can not transovarially transmit B. ovis in sheep.

  16. Molecular detection of Rickettsia aeschlimannii in Hyalomma spp. ticks from camels (Camelus dromedarius) in Nigeria, West Africa. (United States)

    Kamani, J; Baneth, G; Apanaskevich, D A; Mumcuoglu, K Y; Harrus, S


    Several species of the spotted fever group rickettsiae have been identified as emerging pathogens throughout the world, including in Africa. In this study, 197 Hyalomma ticks (Ixodida: Ixodidae) collected from 51 camels (Camelus dromedarius) in Kano, northern Nigeria, were screened by amplification and sequencing of the citrate synthase (gltA), outer membrane protein A (ompA) and 17-kDa antigen gene fragments. Rickettsia sp. gltA fragments were detected in 43.3% (42/97) of the tick pools tested. Rickettsial ompA gene fragments (189 bp and 630 bp) were detected in 64.3% (n = 27) and 23.8% (n = 10) of the gltA-positive tick pools by real-time and conventional polymerase chain reaction (PCR), respectively. The amplicons were 99-100% identical to Rickettsia aeschlimannii TR/Orkun-H and R. aeschlimannii strain EgyRickHimp-El-Arish in GenBank. Furthermore, 17-kDa antigen gene fragments of 214 bp and 265 bp were detected in 59.5% (n = 25) and 38.1% (n = 16), respectively, of tick pools, and sequences were identical to one another and 99-100% identical to those of the R. aeschlimannii strain Ibadan A1 in GenBank. None of the Hyalomma impressum ticks collected were positive for Rickettsia sp. DNA. Rickettsia sp. gltA fragments (133 bp) were detected in 18.8% of camel blood samples, but all samples were negative for the other genes targeted. This is the first report to describe the molecular detection of R. aeschlimannii in Hyalomma spp. ticks from camels in Nigeria.

  17. Repellent activities of dichloromethane extract of Allium sativum (garlic (Liliaceae against Hyalomma rufipes (Acari

    Directory of Open Access Journals (Sweden)

    Felix Nchu


    Full Text Available Dichloromethane (DCM extract of garlic (Allium sativum Linn. bulbs was assessed for its repellent effect against the hard tick, Hyalomma rufipes (Acari: Ixodidae using two tick behavioural bioassays; Type A and Type B repellency bioassays, under laboratory conditions. These bioassays exploit the questing behaviour of H. rufipes, a tick that in nature displays ambush strategy, seeking its host by climbing up on vegetation and attaching to a passing host. One hundred microlitres (100 µL of the test solution containing DCM extract of garlic bulbs and DCM at concentrations of 0.35%, 0.7% or 1.4% w/v were evaluated. DCM only was used for control. Tick repellency increased significantly (R2 = 0.98 with increasing concentration (40.03% – 86.96% yielding an EC50 of 0.45% w/v in Type B repellency bioassay. At concentration of 1.4% w/v, the DCM extract of garlic bulbs produced high repellency index of 87% (male ticks and 87.5% (female ticks in the Type A repellency bioassay. Only 4% avoidance of male ticks or female ticks was recorded in the Type B repellency bioassay. In the corresponding controls, the mean numbers of non-repelled male or female ticks were 80% and 41 males or 38 females of 50 ticks in the Type A and Type B repellency bioassays, respectively. The variations in the results could be attributed to the difference in tick repellent behaviours that were assessed by the two repellency bioassays; the Type A repellency bioassay assessed repellent effect of garlic extracts without discriminating between deterrence and avoidance whereas the Type B repellency bioassay only assessed avoidance response. Generally, DCM extract of garlic was repellent against H. rufipes, albeit weak tick repellency was obtained in the Type B repellency bioassay. Furthermore, this study established that the tick repellent activity of garlic extracts is predominantly by deterrence.

  18. Repellent activities of dichloromethane extract of Allium sativum (garlic) (Liliaceae) against Hyalomma rufipes (Acari). (United States)

    Nchu, Felix; Magano, Solomon R; Eloff, Jacobus N


    Dichloromethane (DCM) extract of garlic (Allium sativum Linn.) bulbs was assessed for its repellent effect against the hard tick, Hyalomma rufipes (Acari: Ixodidae) using two tick behavioural bioassays; Type A and Type B repellency bioassays, under laboratory conditions. These bioassays exploit the questing behaviour of H. rufipes, a tick that in nature displays ambush strategy, seeking its host by climbing up on vegetation and attaching to a passing host. One hundred microlitres (100 µL) of the test solution containing DCM extract of garlic bulbs and DCM at concentrations of 0.35%, 0.7% or 1.4% w/v were evaluated. DCM only was used for control. Tick repellency increased significantly (R2 = 0.98) with increasing concentration (40.03% - 86.96%) yielding an EC50 of 0.45% w/v in Type B repellency bioassay. At concentration of 1.4% w/v, the DCM extract of garlic bulbs produced high repellency index of 87% (male ticks) and 87.5% (female ticks) in the Type A repellency bioassay. Only 4% avoidance of male ticks or female ticks was recorded in the Type B repellency bioassay. In the corresponding controls, the mean numbers of non-repelled male or female ticks were 80% and 41 males or 38 females of 50 ticks in the Type A and Type B repellency bioassays, respectively. The variations in the results could be attributed to the difference in tick repellent behaviours that were assessed by the two repellency bioassays; the Type A repellency bioassay assessed repellent effect of garlic extracts without discriminating between deterrence and avoidance whereas the Type B repellency bioassay only assessed avoidance response. Generally, DCM extract of garlic was repellent against H. rufipes, albeit weak tick repellency was obtained in the Type B repellency bioassay. Furthermore, this study established that the tick repellent activity of garlic extracts is predominantly by deterrence.

  19. Population dynamics of ticks infesting the one-humped camel (Camelus dromedarius) in central Tunisia. (United States)

    Gharbi, Mohamed; Moussi, Nawfel; Jedidi, Mohamed; Mhadhbi, Moez; Sassi, Limam; Darghouth, Mohamed Aziz


    A tick population was monitored on 30 camels (Camelus dromedarius) over one year in Kairouan region, Central Tunisia. A total of 1630 ticks was collected and identified resulting in an estimate of different parasitological indicators. The ticks belonged to 2 genera and 5 species: Hyalomma impeltatum (53%) and Hyalomma dromedarii (45%) were the dominant species followed by Hyalomma excavatum (1%), Hyalomma marginatum (0.5%), and Rhipicephalus turanicus (0.5%) (pTunisia.

  20. Hyalomma (Hyalommina) arabica sp. n. parasitizing goats and sheep in the Yemen Arab Republic and Saudi Arabia. (United States)

    Pegram, R G; Hoogstraal, H; Wassef, H Y


    Hyalomma (Hyalommina) arabica sp. n. is described from 62 adults (29 males, 33 females) taken throughout the year from 23 goats and two sheep, mostly at 200 m altitude in the southern tihama foothills of Ta'izz Province, Yemen Arab Republic. One female from a goat at 2,300 m altitude in this Province may have attached to the host elsewhere and a male from Mecca, Saudi Arabia, was on a goat imported from an unknown source for the traditional religious pilgrimage feast. We postulate that the original host of adults was the Nubian ibex, Capra ibex nubiana F. Cuvier (Artiodactyla: Caprinae). This parasite is most closely related to H. (H.) kumari Sharif, which infests chiefly wild and domestic Caprinae from India to northwestern Iran and Tadzhik, SSR. It also shows relationships to H. (H.) punt Hoogstraal, Kaiser and Pedersen, which parasitizes gazelles and domestic mammals in Somalia and Ethiopia, but differs more widely from the third African-Arabian member of this subgenus, H. (H.) rhipicephaloides Neumann, which feeds on the Nubian ibex and gazelles in the Red Sea and Dead Sea areas. The Hyalomma subgenus Hyalommina now contains seven species, four confined to the Indian subcontinent (including Nepal, Burma, India, Sri Lanka, Pakistan, and Afghanistan) and Southwest Asia, and three in eastern Africa north of the equator and Arabia.

  1. Molecular analysis of Crimean-Congo hemorrhagic fever virus and Rickettsia in Hyalomma marginatum ticks removed from patients (Spain) and birds (Spain and Morocco), 2009-2015. (United States)

    Palomar, Ana M; Portillo, Aránzazu; Mazuelas, David; Roncero, Lidia; Arizaga, Juan; Crespo, Ariñe; Gutiérrez, Óscar; Márquez, Francisco J; Cuadrado, Juan F; Eiros, José M; Oteo, José A


    Crimean-Congo hemorrhagic fever virus (CCHFV) was detected in Spain in 2010. The presence of CCHFV in Hyalomma marginatum ticks from migratory birds passing through Morocco during the spring migration strengthened the hypothesis of the arrival of infected ticks transported by birds to the Iberian Peninsula. Furthermore, Hyalomma species are vectors of bacterial infections such as spotted fever rickettsioses. CCHFV and Rickettsia were screened in Hyalomma ticks from Spain attached to patients (n=12) and birds (n=149). In addition, Rickettsia was investigated in 52 Hyalomma ticks from Morocco (previously reported as CCHFV-infected). No sample collected in Spain showed an infection with CCHFV. Two ticks removed from patients (16.7%), as well as 47 (31.5%) and 4 (7.7%) from birds, collected in Spain and Morocco respectively, were infected with Rickettsia aeschlimannii. Rickettsia sibirica subsp. mongolitimonae was also found in 2 ticks from birds collected in Spain (1.3%). The risk of CCHFV-infected ticks attached to migratory birds to reach the North of Spain is low. This study corroborates the presence of R. aeschlimannii in Spain and Morocco, and supports that H. marginatum can be a potential vector of R. sibirica subsp. mongolitimonae in the Iberian Peninsula.

  2. HA03 as an Iranian Candidate Concealed Antigen for Vaccination against Hyalomma anatolicum anatolicum: Comparative Structural and In silico Studies

    Directory of Open Access Journals (Sweden)

    Mohammadi, A.


    Full Text Available In the last decades researchers had focused on developing a vaccine against tick based on protective antigen. Recombinant vaccines based on concealed antigen from Boophilus microplus have been developed in Australia and Cuba by the name of TICKGARD and GAVAC (De La Fuente and Kocan, 2006. Further studies on this antigen have shown some extent of protection against other species (De Vos et al., 2001. In Iran most important species is Hyalomma anatolicum and limited information about its control are available. This paper reports structural and polymorphic analysis of HA03 as an Iranian candidate concealed antigen of H. a. anatolicum deposited in Gen-Bank .(Aghaeipour et al. GQ228820. The comparison between this antigen and other mid gut concealed antigen that their characteristics are available in GenBank showed there are high rate of similarity between them. The HA03 amino acid sequence had a homology of around 89%, 64%, 56% with HA98, BM86, BM95 respectively. Potential of MHC class I and II binding region indicated a considerable variation between BM86 antigen and its efficiency against Iranian H. a. anatolicum. In addition, predicted major of hydrophobisity and similarity in N-glycosylation besides large amount of cystein and seven EGF like regions presented in protein structure revealed that value of HA03 as a new protective antigen and the necessity of the development, BM86 homolog of H. a. anatolicum HA03 based recombinant vaccine.

  3. The Midgut Bacterial Flora of Laboratory-Reared Hard Ticks, Haemaphysalis longicornis, Hyalomma asiaticum, and Rhipicephalus haemaphysaloides

    Institute of Scientific and Technical Information of China (English)

    LI Chun-hong; CAO Jie; ZHOU Yong-zhi; ZHANG Hou-shuang; GONG Hai-yan; ZHOU Jin-lin


    Ixodid ticks play an important role in the transmission of a variety of zoonoses of viral, bacterial and protozoan origin, and they also harbor a wealth of microorganisms. To gain more detailed insights into the potential interactions between bacterial lfora and tick-borne pathogens, we investigated the midgut bacterial lfora of laboratory-reared Haemaphysalis longicornis, Hyalomma asiaticum and Rhipicephalus haemaphysaloides. Based on morphological, biochemical, and 16S rDNA sequencing results, we identiifed 15 species belonging to 12 genera in the midgut of the three ticks. The bacterial communities were similar to those found in other studies of hematophagous arthropods. Kocuria sp. was the most frequently isolated species and its 16S rDNA gene sequence was very similar to Kocuria koreensis P31T. To our knowledge, this is the ifrst report of the bacterial lfora of tick midguts and the results show that there were many different bacterial species in each tick species. Among the most common genera, there may have been a novel species in the genus Kocuria. The results might be the ifrst step for looking for different aspects of the pathogen and tick interaction.

  4. Effect of Hyalomma Ticks (Acari: Ixodidae on Milk Production of Dairy Buffaloes (Bos Bubalus Bubalis of Punjab (Pakistan

    Directory of Open Access Journals (Sweden)

    M.U. Iqbal


    Full Text Available The objective of this study was to estimate economic losses in terms of milk production caused by tick infestation in dairy buffaloes (Bos bubalus bubalis of Punjab (Pakistan. To this end, six hundred Nili-Ravi buffaloes infested with Hyalomma ticks (Acari: Ixodidae were selected and divided into two equal groups viz; A & B. The animals of group A were treated with various doses of 5% cypermethrine pour-on (Cipermetriven, Ivan Labs, Spain while those of group B were treated with propylene glycol (Propandiol - (1, 2, Merck as a sham treatment. Average milk production (L and butter fat (% was recorded before and after treatment in order to calculate post-treatment increase in these parameters (if any. An average daily increase of 1.15L in milk yield per animal with 1.31% more fat was observed in acaricide- treated animals. A dose-dependent effect of acaricide was found on the number of ticks as well as milk production and fat. The results provided a baseline data for further research on economic impact of tick nuisance to the smallholder dairy farming systems of Pakistan.

  5. Laboratory assessment of acaricidal activity of Cymbopogon winterianus, Vitex negundo and Withania somnifera extracts against deltamethrin resistant Hyalomma anatolicum. (United States)

    Singh, Nirbhay Kumar; Jyoti; Vemu, Bhaskar; Nandi, Abhijit; Singh, Harkirat; Kumar, Rajender; Dumka, V K


    Larval packet test was used for detection of resistance levels against cypermethrin and deltamethrin, the most commonly used synthetic pyrethroids, in the multi-host tick Hyalomma anatolicum collected from district Moga, Punjab (India). Results indicated the presence of level I resistance against deltamethrin (RF = 2.81), whereas the tick isolate was susceptible to cypermethrin (RF = 0.2). The aqueous and ethanolic extracts of leaves of Cymbopogon winterianus, Vitex negundo and Withania somnifera along with roots of Vitex negundo were assessed for their acaricidal activity against the larvae of deltamethrin resistant H. anatolicum. The efficacy was assessed by measuring per cent larval mortality and determination of LC50 values. The various ethanolic extracts produced a concentration dependent increase in larval tick mortality, whereas the aqueous extracts exhibited a much lower mortality. The highest mortality (93.7 ± 0.66 %) was observed at the 5.0 % concentration of ethanolic extract of leaves of C. winterianus and the lowest LC50 value (0.011 %) was recorded for ethanolic extracts of leaves of V. negundo. The results indicated that these plant extracts have potential to be developed as herbal acaricides.

  6. Partial characterization of a novel anti-inflammatory protein from salivary gland extract of Hyalomma anatolicum anatolicum (Acari: Ixodidae ticks

    Directory of Open Access Journals (Sweden)

    Mayukh Ghosh


    Full Text Available Aim: Hyalomma anatolicum anatolicum ticks transmit Theileria annulata, causative agent of tropical theileriosis to cattle and buffaloes causing a major economic loss in terms of production and mortality in tropical countries. Ticks have evolved several immune evading strategies to circumvent hosts’ rejection and achieve engorgement. Successful feeding of ticks relies on a pharmacy of chemicals located in their complex salivary glands and secreted saliva. These chemicals in saliva could inhibit host inflammatory responses through modulating cytokine secretion and detoxifying reactive oxygen species. Therefore, the present study was aimed to characterize anti-inflammatory peptides from salivary gland extract (SGE of H. a. anatolicum ticks with a view that this information could be utilized in raising vaccines, designing synthetic peptides or peptidomimetics which can further be developed as novel therapeutics. Materials and Methods: Salivary glands were dissected out from partially fed adult female H. a. anatolicum ticks and homogenized under the ice to prepare SGE. Gel filtration chromatography was performed using Sephadex G-50 column to fractionate the crude extract. Protein was estimated in each fraction and analyzed for identification of anti-inflammatory activity. Sodium dodecyl sulfate - polyacrylamide gel electrophoresis (SDS-PAGE was run for further characterization of protein in desired fractions. Results: A novel 28 kDa protein was identified in H. a. anatolicum SGE with pronounced anti-inflammatory activity. Conclusion: Purification and partial characterization of H. a. anatolicum SGE by size-exclusion chromatography and SDSPAGE depicted a 28 kDa protein with prominent anti-inflammatory activity.

  7. First report of adult Hyalomma marginatum rufipes (vector of Crimean-Congo haemorrhagic fever virus on cattle under a continental climate in Hungary

    Directory of Open Access Journals (Sweden)

    Hornok Sándor


    Full Text Available Abstract Background South Hungary is being monitored for the northward spreading of thermophilic ixodid species, therefore ticks were collected from cattle and wild ruminants (red, fallow and roe deer in the autumn of 2011. Findings Besides indigenous species (1185 Dermacentor reticulatus and 976 Ixodes ricinus, two Hyalomma marginatum rufipes males were found on two cows, in September eight days apart. Conclusions This is the northernmost autochthonous infestation of the type host (cattle with H. m. rufipes, vector of Crimean-Congo haemorrhagic fever virus. The present findings are suggestive of the moulting success of this Afro-Mediterranean tick species in a continental climate in Central Europe.

  8. Zoonotic pathogens associated with Hyalomma aegyptium in endangered tortoises: evidence for host-switching behaviour in ticks?

    Directory of Open Access Journals (Sweden)

    Paștiu Anamaria I


    Full Text Available Abstract Background Hyalomma aegyptium is a hard-tick with a typical three-host life cycle. The main hosts are Palearctic tortoises of genus Testudo. However, other hosts can be used by immature ticks for feeding in natural conditions. Given this complex ecology and multiple host use, the circulation of pathogens by H. aegyptium between various hosts can be important from epidemiological point of view. The aim of this study was to evaluate the role of H. aegyptium as natural carrier of four important zoonotic pathogens. Methods From 2008 to 2011, 448 H. aegyptium ticks were collected from 45 Spur-thighed tortoises, Testudo graeca in Romania. DNA was extracted individually from each tick using a commercial kit. DNA was examined for the presence of specific sequences of Borrelia burgdorferi s.l., Anaplasma phagocytophilum, Ehrlichia canis and Coxiella burnetii by PCR, according to previously described protocols. Results PCR analysis of H. aegyptium revealed the presence of A. phagocytophilum (18.8%, E. canis (14.1% and C. burnetii (10%. 32.4% of the ticks were infected with at least one pathogen and 9.8% had co-infections. The stages most frequently infected were nymphs (50% followed by males (33.9% and females (27%. The number of tortoises which harboured infected ticks was 27/45 examined (60%. From all tested T. graeca, 40% harboured ticks infected with A. phagocytophilum, 46.7% had ticks infected with E. canis and 33.3% had ticks with C. burnetii. This study reports for the first time the presence of A. phagocytophilum and E. canis in H. aegyptium. Conclusions The presence and relatively high prevalence of three important zoonotic pathogens in H. aegyptium raises the question of their epidemiologic importance in disease ecology. As tortoises are unlikely to be reservoir hosts for A. phagocytophilum and E. canis and both these pathogens are common in H. aegyptium, this is an important indication for (1 a possible increased host

  9. Identification and characterization of microRNAs by deep-sequencing in Hyalomma anatolicum anatolicum (Acari: Ixodidae) ticks. (United States)

    Luo, Jin; Liu, Guang-Yuan; Chen, Ze; Ren, Qiao-Yun; Yin, Hong; Luo, Jian-Xun; Wang, Hui


    Hyalomma anatolicum anatolicum (H.a. anatolicum) (Acari: Ixodidae) ticks are globally distributed ectoparasites with veterinary and medical importance. These ticks not only weaken animals by sucking their blood but also transmit different species of parasitic protozoans. Multiple factors influence these parasitic infections including miRNAs, which are non-coding, small regulatory RNA molecules essential for the complex life cycle of parasites. To identify and characterize miRNAs in H.a. anatolicum, we developed an integrative approach combining deep sequencing, bioinformatics and real-time PCR analysis. Here we report the use of this approach to identify miRNA expression, family distribution, and nucleotide characteristics, and discovered novel miRNAs in H.a. anatolicum. The result showed that miR-1-3p, miR-275-3p, and miR-92a were expressed abundantly. There was a strong bias on miRNA, family members, and nucleotide compositions at certain positions in H.a. anatolicum miRNA. Uracil was the dominant nucleotide, particularly at positions 1, 6, 16, and 18, which were located approximately at the beginning, middle, and end of conserved miRNAs. Analysis of the conserved miRNAs indicated that miRNAs in H.a. anatolicum were concentrated along three diverse phylogenetic branches of bilaterians, insects and coelomates. Two possible roles for the use of miRNA in H.a. anatolicum could be presumed based on its parasitic life cycle: to maintain a large category of miRNA families of different animals, and/or to preserve stringent conserved seed regions with active changes in other places of miRNAs mainly in the middle and the end regions. These might help the parasite to undergo its complex life style in different hosts and adapt more readily to the host changes. The present study represents the first large scale characterization of H.a. anatolicum miRNAs, which could further the understanding of the complex biology of this zoonotic parasite, as well as initiate miRNA studies

  10. First survey of hard ticks (Acari:Ixodidae) on cattle, sheep and goats in Boeen Zahra and Takistan counties, Iran

    Institute of Scientific and Technical Information of China (English)

    Masoomeh Shemshad; Khadijeh Shemshad; Mohammad Mehdi Sedaghat; Majid Shokri; Alireza Barmaki; Mojgan Baniardalani; Javad Rafinejad


    Objective: To carry out the distribution survey of hard ticks of livestock in Boeen Zahra and Takistan counties of Qazvin province from April 2010 to September 2010. Methods:Nearly about 2 638 sheep, 461 goats and 318 cattle of 38 herds in different geographical areas were searched for tick infestation. Results:The species compositions collected from the livestock of Boeen Zahra and Takistan were Haemaphysalis concinna (0.63%), Haemaphysalis sulcata (12.66%), Hyalomma anatolicum (3.80%), Hyalomma asiaticum (3.16%), Hyalomma detritum (5.70%), Hyalomma dromedarii (28.48%), Hyalomma marginatum (13.29%), Hyalomma schulzei (1.89%), Rhipicephalus bursa (3.16%) and Rhipicephalus sanguineus (3.16%), and for Takistan’s livestock were Hyalomma dromedarii (9.86%), Hyalomma marginatum (13.29%), Hyalomma schulzei (1.89%) and Rhipicephalus sanguineus (3.16%), respectively. Hard ticks compositions in different topographic areas were different. Hyalomma species had the most prevalence in the areas. Conclusions:The veterinary and public health investigation of the above species should be taken.

  11. Influence of laboratory animal hosts on the life cycle of Hyalomma marginatum and implications for an in vivo transmission model for Crimean-Congo hemorrhagic fever virus

    Directory of Open Access Journals (Sweden)

    Aysen eGargili


    Full Text Available Crimean-Congo hemorrhagic fever virus (CCHFV is one of the most geographically widespread arboviruses and causes a severe hemorrhagic syndrome in humans. The virus circulates in nature in a vertebrate-tick cycle and ticks of the genus Hyalomma are the main vectors and reservoirs. Although the tick vector plays a central role in the maintenance and transmission of CCHFV in nature, comparatively little is known of CCHFV-tick interactions. This is mostly due to the fact that establishing tick colonies is laborious, and working with CCHFV requires a biosafety level 4 laboratory (BSL4 in many countries. Nonetheless, an in vivo transmission model is essential to understand the epidemiology of the transmission cycle of CCHFV. In addition, important parameters such as vectorial capacity of tick species, levels of infection in the host necessary to infect the tick, and aspects of virus transmission by tick bite including the influence of tick saliva, cannot be investigated any other way. Here, we evaluate the influence of different laboratory animal species as hosts supporting the life cycle of Hyalomma marginatum, a two-host tick. Rabbits were considered the host of choice for the maintenance of the uninfected colonies due to high larval attachment rates, shorter larval-nymphal feeding times, higher nymphal molting rates, high egg hatching rates and higher conversion efficiency index. Furthermore, we describe the successful establishment of an in vivo transmission model CCHFV in a BSL4 biocontainment setting using interferon knockout mice. This will give us a new tool to study the transmission and interaction of CCHFV with its tick vector.

  12. Influence of laboratory animal hosts on the life cycle of Hyalomma marginatum and implications for an in vivo transmission model for Crimean-Congo hemorrhagic fever virus. (United States)

    Gargili, Aysen; Thangamani, Saravanan; Bente, Dennis


    Crimean-Congo hemorrhagic fever virus (CCHFV) is one of the most geographically widespread arboviruses and causes a severe hemorrhagic syndrome in humans. The virus circulates in nature in a vertebrate-tick cycle and ticks of the genus Hyalomma are the main vectors and reservoirs. Although the tick vector plays a central role in the maintenance and transmission of CCHFV in nature, comparatively little is known of CCHFV-tick interactions. This is mostly due to the fact that establishing tick colonies is laborious, and working with CCHFV requires a biosafety level 4 laboratory (BSL4) in many countries. Nonetheless, an in vivo transmission model is essential to understand the epidemiology of the transmission cycle of CCHFV. In addition, important parameters such as vectorial capacity of tick species, levels of infection in the host necessary to infect the tick, and aspects of virus transmission by tick bite including the influence of tick saliva, cannot be investigated any other way. Here, we evaluate the influence of different laboratory animal species as hosts supporting the life cycle of Hyalomma marginatum, a two-host tick. Rabbits were considered the host of choice for the maintenance of the uninfected colonies due to high larval attachment rates, shorter larval-nymphal feeding times, higher nymphal molting rates, high egg hatching rates, and higher conversion efficiency index (CEI). Furthermore, we describe the successful establishment of an in vivo transmission model for CCHFV in a BSL4 biocontainment setting using interferon knockout mice. This will give us a new tool to study the transmission and interaction of CCHFV with its tick vector.

  13. Screening for bacterial DNA in the hard tick Hyalomma marginatum (Ixodidae from Socotra Island (Yemen: detection of Francisella-like endosymbiont

    Directory of Open Access Journals (Sweden)

    M. Montagna


    Full Text Available Thirty-four adult ticks collected from livestock on Socotra Island (Yemen were identified as Hyalomma marginatum using traditional morphological characteristics. Morphological identification was confirmed for all the collected specimens using a molecular approach targeting a fragment of the mitochondrial gene 12S rRNA. All the specimens were examined for the presence of tick-borne pathogens and the tick endosymbiont Candidatus Midichloria mitochondrii using polymerase chain reaction. Three specimens out of the 34 analyzed tested positive to the presence of Francisella spp. leading to the first detection of these bacteria in H. marginatum on Socotra Island. The phylogenetic analyses conducted on a 660 bp fragment of the ribosomal gene 16S rRNA of Francisella spp. (including F. philomiragia as outgroup, the four subspecies of F. tularensis and the Francisella-like endosymbiont of ticks confirm that the newly detected Francisella strains cluster into the Francisella-like endosymbionts of ticks. Interestingly, the detected Francisella-like endosymbiont, shows a different genotype to that previously isolated from H. marginatum collected in Bulgaria. No specimen was positive for the presence of Rickettsia spp., Coxiella burnetii, Borrelia burgdorferi or M. mitochondrii.

  14. [Comparison of the ability to fertilize females by Hyalomma anatolicum anatolicum males irradiated with gamma radiation from caesium 137 with non-irradiated males]. (United States)

    Karaer, Zafer; Kar, Sirri; Düzgün, Ali; Güven, Esin; Cakmak, Ayşe; Emre, Zişan; Nalbantoğlu, Serpil; Saribaş, Taner; Akçay, Aytaç


    In this study, Hyalomma anatolicum anatolicum male ticks were subjected to gamma radiation with a dose of 10 Gy emitted by a gamma-ray source of Caesium 137. Female ticks were divided into 3 groups and placed in rabbit ears to feed. In the first group, the females fed with normal and irradiated males, in the second group females fed only with irradiated males and in last group females fed with normal males. Biological parameters such as the feeding period, weights, period of time from dropping until egg-laying began, the number of eggs and the number of larva hatching from eggs were recorded. With the results of statistical analysis it was found that the average egg laying period of females in the second group was clearly less (22.77 days) than other groups and the difference between these groups was statistically important (P < 0.05). After evaluation of numbers of larva, also there was a statistically important difference between the groups and the average number of larva was clearly higher (2519.30) in third group than other groups. In conclusion, in this study it was found that irradiated males could not compete with normal males in mating with females and because of this they couldn't affect the feeding and reproductivity of females.

  15. In vitro investigation of the toxic effects of extracts of Allium sativum bulbs on adults of Hyalomma marginatum rufipes and Rhipicephalus pulchellus

    Directory of Open Access Journals (Sweden)

    F. Nchu


    Full Text Available The toxic effects of the extracts of Allium sativum (Garlic were evaluated against adults of Hyalomma marginatum rufipes and Rhipicephalus pulchellus using three types (Types A, B and C of contact toxicity bioassays. A. sativum bulbs were extracted with acetone, ethanol and dichloromethane (DCM solvents. Among these three solvents, it is the DCM extract of A. sativum that appears to have anti-tick activity. In the Type A contact toxicity bioassay, DCM extracts of A. sativum demonstrated a high acaricidal bioactivity against H. m. rufipes with 100 % of ticks killed in less than an hour, and toxicity persisted to the second day. A weak acaricidal activity of aqueous extracts of A. sativum was observed in the Type B contact toxicity bioassay. In the Type C contact toxicity bioassay, a concentration of 24 % w/v of DCM extracts of garlic in sunflower oil (Helianthus annuus had killed 100% of H. m. rufipes (LC50= 5.9 % w/v and R. pulchellus (LC50 = 10.3 % w/v by 24 hours post-treatment of ticks. The results obtained from this study suggest that DCM extract of A. sativum is a potential source of novel acaricidal agents.

  16. In vitro assessment of the acaricidal activity of Piper longum, Piper nigrum, and Zingiber officinale extracts against Hyalomma anatolicum ticks. (United States)

    Singh, Nirbhay K; Saini, S P S; Singh, Harkirat; Jyoti; Sharma, S K; Rath, S S


    Ticks and tick-borne diseases are a major constraint for the sustainable cattle industry in the tropical and subtropical regions including the Indian subcontinent. The development of resistance to most of the commonly used acaricides leads to an attempt to screen plant extracts and their combinations for their possible acaricidal activity to develop an eco-friendly tick control alternative. An alcoholic and various aqueous extracts of Piper longum, Piper nigrum and Zingiber officinale and their combinations were evaluated for acaricidal activity against the three-host ixodid tick, Hyalomma anatolicum by larval immersion test using 14-21 days old unfed larvae. The efficacy was assessed by measuring larval mortality (%) and the lethal concentrations for 50% (LC50) and 95% (LC95) with their 95% confidence limits (CL) values were estimated by applying regression equation analysis to the probit transformed data of mortality. A concentration-dependent mortality response was recorded in all extracts prepared from seeds of P. longum and P. nigrum and their combinations. The highest acaricidal property was exhibited by the alcoholic extract of P. longum seeds with the minimum LC50 and LC95 (95% CL) values of 0.071% (0.07-0.072) and 0.135% (0.13-0.14), respectively, followed by alcoholic combinations. Interestingly, no acaricidal activity was recorded in extracts prepared from the rhizome of Z. officinale. The results indicated that the ethanolic extracts of P. longum and P. nigrum and their combinations can be used effectively for tick control in an integrated format.

  17. Control of Hyalomma lusitanicum (Acari: Ixodidade) Ticks Infesting Oryctolagus cuniculus (Lagomorpha: Leporidae) Using the Entomopathogenic Fungus Beauveria bassiana (Hyocreales: Clavicipitaceae) in Field Conditions. (United States)

    González, J; Valcárcel, F; Pérez-Sánchez, J L; Tercero-Jaime, J M; Cutuli, M T; Olmeda, A S


    Entomopathogenic fungi are widely used to control arthropods not just in agricultural settings but also in Veterinary Medicine and Public Health. These products have been employed to control tick populations and tick-borne diseases. The effectiveness of these control measures not only depends on the fungi, but also on the tick species and environmental conditions. In Mesomediterranean areas, tick species are adapted to extreme climatic conditions and it is therefore especially important to develop suitable tick control strategies. The aim of this study was to evaluate the effectiveness of a new method of tick control which entails the application of a commercial strain of Beauveria bassiana (Balsamo, Vuillemin) on wild rabbit burrows under field conditions. Aqueous solutions of the product were applied using a mist blower sprayer into 1,717 burrows. Two trials were performed, one in spring and the other in summer. The parasitic index (PI) was calculated for 10 rabbits per treatment per time point on day +30, +60, and +90 posttreatment and efficiency was calculated by comparing the PI for ticks in treated and untreated rabbits. A total of 20,234 ixodid ticks were collected. Hyalomma lusitanicum Koch, 1844 was the most abundant tick feeding on rabbits. Treatment significantly reduced the PI in spring (by 78.63% and 63.28% on day +30 and +60, respectively; P < 0.05), but appeared to be less effective in summer, with a marginally significant tick reduction of 35.72% on day +30 (P = 0.05). Results suggest that the efficacy of applications inside burrows could be temperature-dependent and that such applications could be an economic alternative to rabbit tick control during at least two months using a diluted solution of B. bassiana conidia.

  18. Solanum trilobatum extract-mediated synthesis of titanium dioxide nanoparticles to control Pediculus humanus capitis, Hyalomma anatolicum anatolicum and Anopheles subpictus. (United States)

    Rajakumar, Govindasamy; Rahuman, Abdul Abdul; Jayaseelan, Chidambaram; Santhoshkumar, Thirunavukkarasu; Marimuthu, Sampath; Kamaraj, Chinnaperumal; Bagavan, Asokan; Zahir, Abdul Abduz; Kirthi, Arivarasan Vishnu; Elango, Gandhi; Arora, Pooja; Karthikeyan, Rajan; Manikandan, Sivan; Jose, Sujin


    Titanium dioxide nanoparticles (TiO2 NPs) are widely used in paints, printing ink, rubber, paper, cosmetics, sunscreens, car materials, cleaning air products, industrial photocatalytic processes, and decomposing organic matters in wastewater due to their unique physical, chemical, and biological properties. The present study was conducted to assess the antiparasitic efficacies of synthesized TiO2 NPs utilizing leaf aqueous extract of Solanum trilobatum against the adult head louse, Pediculus humanus capitis De Geer (Phthiraptera: Pediculidae); larvae of cattle tick Hyalomma anatolicum (a.) anatolicum Koch (Acari: Ixodidae), and fourth instar larvae of malaria vector Anopheles subpictus Grassi (Diptera: Culicidae). The green synthesized TiO2 NPs were analyzed by X-ray diffraction (XRD), Fourier transform infrared spectroscopy (FTIR), Scanning electron microscopy (SEM), Energy-dispersive X-ray spectroscopy analysis (EDX), and Atomic force microscopy (AFM). XRD analysis of synthesized TiO2 NPs revealed that the particles were in the form of nanocrystals as evidenced by the major peaks at 2θ values of 27.52°, 36.21°, and 54.43° identified as 110, 101, and 211 reflections, respectively. FTIR spectra exhibited a prominent peak at 3,466 cm(-1) and showed OH stretching due to the alcoholic group, and the OH group may act as a capping agent. SEM images displayed NPs that were spherical, oval in shape, individual, and some in aggregates with an average size of 70 nm. Characterization of the synthesized TiO2 NPs using AFM offered a three-dimensional visualization and uneven surface morphology. The pediculocidal and acaricidal activities of synthesized TiO2 NPs showed the percent mortality of 31, 42, 63, 82, 100; 36, 44, 67, 89, and 100 at 2, 4, 6, 8, and 10 mg/L, respectively, against P. h. capitis and H. a. anatolicum. The average larval percent mortality of synthesized TiO2 NPs was 38, 47, 66, 79, and 100 at 1, 2, 3, 4, and 5 mg/L, respectively, against A. subpictus

  19. The complete sequence of a West Nile virus lineage 2 strain detected in a Hyalomma marginatum marginatum tick collected from a song thrush (Turdus philomelos) in eastern Romania in 2013 revealed closest genetic relationship to strain Volgograd 2007. (United States)

    Kolodziejek, Jolanta; Marinov, Mihai; Kiss, Botond J; Alexe, Vasile; Nowotny, Norbert


    In this study the first complete sequence of the West Nile virus (WNV) lineage 2 strain currently circulating in Romania was determined. The virus was detected in a Hyalomma marginatum marginatum tick collected from a juvenile song thrush (Turdus philomelos) in the Romanian Danube Delta close to the city of Tulcea, end of August 2013. Our finding emphasizes the role of ticks in introduction and maintenance of WNV infections. Sequence analyses revealed close genetic relationship of the Romanian WNV strain to strain Reb_Volgograd_07_H, which was isolated from human brain tissue during an outbreak of West Nile neuroinvasive disease (WNND) in Russia in 2007. In 2010 the Eastern European lineage 2 WNV caused an outbreak of human WNND in Romania. Partial sequences from subsequent years demonstrated that this WNV strain became endemic in Eastern Europe and has been causing outbreaks of varying sizes in southern Russia since 2007 and in Romania since 2010.

  20. Effect of various levels of dietary Jatropha curcas seed meal on rabbits infested by the adult ticks of Hyalomma marginatum marginatum I. Animal performance, anti-tick feeding and haemogram. (United States)

    Abdel-Shafy, Sobhy; Nasr, Soad M; Abdel-Rahman, Hashem H; Habeeb, Salwa M


    The goal of this study was to investigate the use of Jatropha curcas seed meal (JCSM) in different levels as acaricide in diet of rabbits experimentally infested by Hyalomma marginatum marginatum then determining animal performance, anti-tick feeding and its effects on haemogram of rabbits. Thirty healthy mixed-breed rabbits were randomly divided into five equal groups. The first group was kept as a control fed soya bean meal (20%) as a source of protein. Groups from the second to the fifth fed diets contained 2.5%, 5%, 7.5% and 10% of JCSM instead of soya bean meal as a source of protein, respectively. Feeding and watering were given freely throughout the study. Animal performance for treatment groups were recorded from the 1st week up to the 6th week. Then each group divided into two subgroups, and the ticks were introduced to all of one subgroup and the other kept as control, following them until dropped at the end of the 8th week for all groups of the experiment. Feeding and reproductive performance of the adult tick females were determined. Blood samples were collected and analysed for haematological examination at the 0, 6th and 8th weeks post-treatment from all animals. Result revealed that rabbits received diets containing 5%, 7.5% and 10% had significantly (P Egg mass and reproductive index per female were marked increase (P drop in the group received 7.5% JCSM. Also, monocytosis was recorded in 7.5% and 10% JCSM groups. In conclusion, JCSM could be use in the treatment of ectoparasites at level less than 10% in diet. Further investigations should be done to detoxification the Jatropha seed meal to decrease the level of its toxicity.

  1. Distribution and ecology of ticks (Acari: Ixodidae) infesting livestock in Tunisia: an overview of eighth years field collections. (United States)

    Bouattour, A; Darghouth, M A; Daoud, A


    Ticks (Ixodidae) play a significant role as vectors of pathogens of domestic animals in Tunisia. The major losses caused by ticks are related to transmission of protozoan parasites. These include agents of tropical theileriosis and babesiosis in ruminants. Since 1991, we conducted research studies on tick population of livestock in Tunisia. This overview reports a synthesis on tick distribution, their biology and their role as vectors of pathogens in domestic animals, particularly cattle. During the whole period of the study about 15,000 tick specimens were collected from different zones of the country. A total of 14 species were identified. Hyalomma detritum detritum was the most abundant and important (vector of Theileria annulata) species infesting cattle. Hyalomma dromedarii and Hyalomma impeltatum were collected on domestic ruminants in the arid and desertic zones. Hyalomma marginatum marginatum and Hyalomma anatolicum excavatum were widespread and found on livestock hosts. Ixodes ricinus, vector of Babesia divergens and Borrelia burgdorferi sl, colonises mainly the humid zone. Boophilus annulatus and Rhipicephalus bursa infesting cattle, sheep and goats were found in the sub-humid and semi-arid zones. Haemaphysalis sulcata and Hae. punctata were collected in humid and sub-humid zones on cattle and sheep. Rhipicephalus turanicus were collected in different regions, on different animal species. Rhipicephalus sanguineus, tick of dogs, were often collected on livestock. Only few specimens of Hyalomma marginatum rufipes and Hyalomma franchinii were collected.

  2. Crimean-Congo hemorrhagic fever:a molecular survey on hard ticks (Ixodidae) in Yazd province, Iran

    Institute of Scientific and Technical Information of China (English)

    Salim Abadi Yaser; Chinikar Sadegh; Telmadarraiy Zakkyeh; Vatandoost Hassan; Moradi Maryam; Oshaghi Mohammad Ali; Ghiasi Seyed Mojtaba


    Objective: To determine the rate of Crimean-Congo hemorrhagic fever virus (CCHFV) infection in hard ticks (Ixodidae) in Yazd province of Iran. Methods: A molecular survey on hard ticks(Ixodidae) was conducted in Yazd province during 2008 -2009. A total of 140 hard ticks (three genera and 7 species) were collected from randomly selected villages and were exanimate for presence of CCHFV reverse transcription-polymerase chain reaction (RT-PCR) method. Results:CCHFV genome was found in 5.71% of hard ticks. All positive ticks were from Hyalomma genus. Positive ticks including: Hyalomma dromedarii, Hyalomma marginatum, Hyalomma anatolicum,Hyalomma detritum, Hyalomma asiaticum . We were not able to find virus in in Rhipicephalus sanguineus and Dermacentor marginatus. Results exhibited that Hyalomma is the main vector in the study area. Conclusions: Due to the presence of virus in 24 provinces' out of 31, we recommend the use of acaricides and repellent to prevent disease transmission among humans. Greta care should be taken by the people who are working in slaughter houses.

  3. Species diversity and geographic distribution of hard ticks (Acari: Ixodoidea: Ixodidae) infesting domestic ruminants, in Qazvin Province, Iran. (United States)

    Shemshad, Khadijeh; Rafinejad, Javad; Kamali, Karim; Piazak, Norayer; Sedaghat, Mohammad Mahdi; Shemshad, Masoomeh; Biglarian, Akbar; Nourolahi, Fathollah; Valad Beigi, Enshallah; Enayati, Ahmad Ali


    This report presents the results of the first faunistic study of hard ticks in Qazvin province of Iran. The primary objective was to determine the species diversity and geographic distribution of hard ticks that parasitize domestic ruminants. Information about the abiotic preferences of these species has been provided. A total of 286 cattle, 1,053 goats, and 2,050 sheep were examined in 13 villages in 28 flocks distributed throughout the studied areas. Total direct body collections of ticks were made from each domestic ruminant. A total of 228 Ixodid specimens belonging to nine species in three different genera were recorded in the areas, including Boophilus annulatus (Say, 1821), Hyalomma anatolicum Koch, 1844, Hyalomma asiaticum (Schulze and Schlettke, 1929), Hyalomma detritum Schulze, 1919, Hyalomma dromedarii Koch, 1844, Hyalomma marginatum Koch 1844, Hyalomma schulzei Olenev, 1931, Rhipicephalus bursa Canestrini and Fanz, 1878 and Rhipicephalus sanguineus (Latreille, 1806). The most abundant species on sheep was R. sanguineus (46.92%), while B. annulatus (6.6%) found only on cattle. A finding of great significance was that R. sanguineus, the main vector of babesiosis, is firmly established throughout the counties. A further objective of the study was to compare the abundance of the major tick species on domestic ruminants. This was carried out at 19 sampling sites. The highest number of ticks was collected in July-August during the hot season.

  4. Determination of hard tick species (Acarina:Ixodidae) on sheep and cattle in Hamedan Province, Iran

    Institute of Scientific and Technical Information of China (English)

    Jamal Gharekhani; Abbas Gerami-Sadeghian; Zivar Sadeghi-Dehkordi; Mohammadreza Youssefi


    Objective: To determine the fauna and frequency of hard tick species on sheep and cattle in Hamedan Province, Western Iran. Methods: Tick sampling was performed on the whole body of 18000 sheep and 4200 cattle in 3 rural regions (mountain, plateau, and plain-mountainous zone) during the year of 2010 to 2011. The ticks were identified with appropriate identification keys. Results: A total of 1534 hard ticks (62.1% male and 37.9% female) were collected in animals. The infestation rate was found 2.4% in animals (4.2% in cattle and 2.0% in sheep). The ticks were classified into 3 genera and 7 species including: Hyalomma marginatum (34.1%), Hyalomma excavatum (29.7%), Rhipicephalus bursa (13.8%), Rhipicephalus sanguineus (7.5%), Hyalomma detritum (7.1%), Haemaphysalis punctata (5.1%) and Hyalomma dromedarii (2.7%). Conclusions: Current study is the first report of fauna and frequency of hard ticks in this region. The results showed that Hyalomma marginatum is the dominant hard tick species. Further studies are needed to determine the importance of Ixodidae ticks of veterinary and public health in this region of Iran.

  5. High infection of Anaplasma and Ehrlichia spp. among tick species collected from different geographical locations of Iran

    Directory of Open Access Journals (Sweden)

    Leila Tajedin


    Full Text Available Objective: To ascertain the prevalence of the Anaplasma/Ehrlichia infections in tick population within four provinces of Iran. Methods: A total of 384 tick specimens were collected from domestic animals inhabiting in four provinces (East Azerbaijan, Gilan, South Khorasan and Yazd. Specimens were identified based on morphological analysis. The detection of Anaplasma spp./Ehrlichia spp. within tick samples was carried out by nested PCR amplification of the 16S ribosomal RNA gene accompanied by DNA sequencing and analysis for verification. Results: A total of 10 tick species were identified as follows: Ornithodoros lahorensis (O. lahorensis (44.8%, Hyalomma dromedarii (15.6%, Dermacentor marginatus (13.5%, Hyalomma anatolicum (11.2%, Hyalomma asiaticum (5.7%, Hyalomma marginatum (4.9%, Rhipicephalus sanguineus (2.3%, Hyalomma detritum (1.0%, Dermacentor niveus (0.5% and Argas persicus (0.3%. The percentage distribution of Anaplasma/Ehrlichia was 55.5% (213 across 384 studied ticks. Conclusions: To the best of our knowledge, this is the first report of Anaplasma ovis infection in O. lahorensis in Iran. We also conjecture the prevalence of Ehrlichia spp. in Yazd Province based on sequencing results; also, it is suggested that O. lahorensis is a potential vector in the studied area. This survey highlights the importance of Argasidae family to verify and correlate their threat in causing anaplasmosis and other diseases in animals.

  6. Preliminary survey of ticks (Acari : Ixodidae on cattle in northern Sudan

    Directory of Open Access Journals (Sweden)

    D.A. Salih


    Full Text Available In a cross sectional survey conducted during the period June 2001 to July 2002, the geographical distribution of ticks on cattle in the Sudan was determined. Seventeen locations were surveyed from Northern, Central, Eastern, Western, Blue Nile and White Nile Provinces. Total body collections of ticks were made from 20 cattle at each location. Four tick genera and 11 species were identified. The tick species collected included Amblyomma lepidum, Amblyomma variegatum, Boophilus decoloratus, Hyalomma anatolicum anatolicum, Hyalomma dromedarii, Hyalomma impeltatum, Hyalomma marginatum rufipes, Hyalomma truncatum, Rhipicephalus evertsi evertsi, Rhipicephalus sanguineus group and Rhipicephalus simus simus. Major ecological changes have occurred due to extensive animal movement, deforestation, desertification and establishment of large mechanized agricultural schemes. These factors have certainly affected the distribution of ticks and tick-borne diseases in the Sudan. The absence of A. variegatum and A. lepidum in northern Sudan was not surprising, since these tick species are known to survive in humid areas and not in the desert and semi-desert areas of northern Sudan. The absence of B. annulatus in northern and central Sudan is in accordance with the finding that this tick species is restricted to the southern parts of the central Sudan. The presence of H. anatolicum anatolicum in Um Benin in relatively high abundance is an interesting finding. The present finding may indicate that the southern limit of this species has changed and moved southwards to latitude 13o N. It is concluded that major changes in tick distribution have taken place in the Sudan

  7. Tick paralysis: first zoonosis record in Egypt. (United States)

    Mosabah, Amira A Abd El-rahman; Morsy, Tosson A


    Tick paralysis caused by the secretion of toxin with saliva while taking a blood meal is an important veterinary disease, but is rare in humans. Although it has certain geographical proclivities, it exists worldwide. Tick paralysis was demonstrated for the first time in Egypt among four children living in rural area at Giza Governorate. The clinical pictures were confused with rabies; myasthensia gravis; botulism; diphtheritic polyneuropathy encountered in rural areas. The recovery of tick infesting the four little children and negative clinical and laboratory data of all diseases denoted tick paralysis. The encountered ticks infesting their animals were Rhipicephalus sanguineus on dogs, Hyalomma dromedarii on camels and Hyalomma anatolicum excavatum and Haemaphysalis sp. on goats. The case was recognized as first record of tick paralysis in Egypt.

  8. Hard ticks (Ixodidae and Crimean-Congo hemorrhagic fever virus in south west of Iran.

    Directory of Open Access Journals (Sweden)

    Narges Sharifinia


    Full Text Available Ticks are vectors of some important arthropod-borne diseases in both fields of veterinary and medicine, such as Lyme, tularemia, Rocky Mountain spotted fever, and some types of encephalitis as well as Crimean Congo hemorrhagic fever (CCHF. Iran is known as one of the main foci of CCHF in west of Asia. This study was conducted in DarrehShahr County because of the development of animal husbandry in this area to detect the fauna and viral infection of the hard ticks of livestock. A cross-sectional survey was conducted during 2011-2012 with random sampling in four villages. A sample of ticks was subjected to RT-PCR method for detection of viral infection. During the study period, 592 Ixodidae ticks were collected and identified as seven species of Hyalomma asiaticum, Hy. marginatum, Hy. anatolicum, Hy. dromedarii, Hy. detritum, Rhipicephalus bursa and Rh. sanguineus. More than 20% of these ticks were examined to detect the genome of CCHF virus while 6.6% were positive. All species of Hyalomma were found to be positive. A high rate of livestock was found to be infected with hard ticks, which can act as the vectors of the CCHF disease. Regarding infection of all five Hyalomma species captured in this area, this genus should be considered as the main vector of CCHF. Planning control program can be performed based on the obtained data on seasonal activity of Ixodidae to prevent animal infestation as well as to reduce the risk of CCHF transmission.

  9. Analysis of the Relative Expression of microRNA-10 in Different Developmental Stages and Various Tissues of Hyalomma asiaticum%亚洲璃眼蜱不同发育阶段及其组织中microRNA-10表达分析

    Institute of Scientific and Technical Information of China (English)

    袁小松; 罗金; 田占成; 谢俊仁; 王芳芳; 田美媛; 张以芳; 刘光远


    [Objective] MicroRNAs (miRNAs) are a conserved class of non-coding 20-22 nt small RNAs. miRNAs have been reported in many viruses, animals and plants such as Mareks diseased virus, fruit flies, zebra fish, humans and Arabidopsis so far. MiRNAs regulate gene expression by binding to mRNA at post-transcriptional levels, leading to mRNA inhibition or degradation. MiRNAs regulate a variety of biological processes, including cell proliferation, differentiation, metabolism and apoptosis. The purpose of this experiment is to understand the potential biological function of miR-10 in Hyalomma asiaticum. To obtain the precursor and mature of microRNA-10 (miR-10), its relative expression and the biologic significance in different developmental stages and various tissues from Hyalomma asiaticum were analyzed, which will be helpful for further study the relationship between the function of miR-10 and development of H. asiaticum. [Method] Total RNA of the different developmental stages and various tissues were extracted using Trizol Reagent, then transcripted to cDNA using SYBR ®Prime Script TM miRNA RT-PCR Kit( TaKaRa Code:RR716). To obtain the miR-10 precursor sequence from H. asiaticum, the specific primers were designed according to the miRBase database (Accession number:MI0012262). Then its homology was compared with the sequence from miRBas database by the MEGA4 software. The expression of miR-10 from different developmental stages and various tissues of H. asiaticum was assessed by qPCR. The biological function of miR-10 in H. asiaticum was presumed.[Result]A 73 bp gene was cloned by PCR, which was CUACAUCUACCCUGUAGAUCCGAAUUUGUUUGCCA CUAGACUACAAAUUCGGUUCUAGAGAGGCUUUGUGUGG. There was a relatively high genetic similarity among 16 varieties. The similarity between H. asiaticum and Ixodes scapularis was 95.9%, and 88.9%-91.7% compared with other arthropods. The miR-10 sequence was highly conserved in various species. The mature sequence of miR-10 was UACCCUGUAGAUCCGAAUUUGU

  10. One-Humped Camels (Camelus dromedaries Hard Ticks Infestation in Qeshm Island, Iran

    Directory of Open Access Journals (Sweden)

    Saeed Nazifi


    Full Text Available The economic importance of tick infestation on camels are important as they are important meat and milk producer animals in the less vegetation area of Iran and their health and production are greatly affected by the high tick infestation. In this investigation, tick infestations on camels (Camelus dromedarius were determined in Qeshm Island, Iran. A total number of 912 adult ticks (472 males and 440 females were collected and identified. Hyalomma dromedarii was the predominant tick specie and accounted for 61.9% of the adult ticks. Other hard ticks were H. anatolicum excavatum (22 %, H. asiaticum asiaticum (14.2 %, H. marginatum (1.9 %, H. impeltatum (0.4 % and Ripicephalus bursa (0.4 %. In conclusion, The provision of tick control programs in the Qeshm Island would seem a prerequisite for improving camel meat and milk production.

  11. Investigation of hemorrhagic fever viruses inside wild populations of ticks: One of the pioneer studies in Saudi Arabia

    Directory of Open Access Journals (Sweden)

    Rania Ali El Hadi Mohamed


    Full Text Available Objective: To screen hemorrhagic fever viruses inside wild populations of ticks collected from Riyadh, Saudi Arabia between January and March 2016. Methods: Ticks were identified depending on their morphological features using classical keys then grouped into pools. Ticks in each pool were processed separately using the sterile pestles and mortars. Viral RNA was extracted using Qiagen RNeasy Mini Kit and Qiagen RNAeasy Columns (Qiagen, Hilden, Germany according to the instructions of manufacturers. A total number of 1 282 hard ticks were collected, and 582 of them were precisely identified then screened for the presence of arboviruses using quantitative real-time PCR. The four species were screened for six viruses: Rift Valley fever virus (RVFV, Chikungunya virus (CHIKV, Crimean-Congo hemorrhagic fever virus (CCHFV, Alkhurma virus (INKV, Sindbis virus (SINV, and Pan Hanta virus (HANTA. CT value for the negative control (RNA free water was zero. Negative and positive controls were tested for each test to confirm the specificity of the selected primer pairs. SYBR Green One step RT-PCR Master Mix (KAPA Biosystems, Boston, MA was tested along with primers. Results: Ticks identification resulted into four species: Hyalomma schulzei, Hyalomma onatoli, Boophilus kdhlsi, and Hyalomm dromedarii. All the ticks’ species (except Boophilus kdhlsi were positive for the following viruses: SINV, RVFV, CHIKV, and CCHFV. While HANTA viruses have been detected in a single species (Hyalomm dromedarii. Conclusions: According to our knowledge this research may be one of the pioneer studies in Kingdom of Saudi Arabia. Incrimination of the above mentioned ticks species as well as their vectorial capacity are highly recommended for investigation in the upcoming researches.

  12. Hard Ticks on Domestic Ruminants and their SeasonalPopulation Dynamics in Yazd Province, Iran

    Directory of Open Access Journals (Sweden)

    Y Salim abadi


    Full Text Available Background: Ticks are the main vectors for transmission of different pathogens to human and animals. This survey was performed to find out distribution of ticks, which infested the domestic ruminants in Yazd Province, central Iran during year 2008-2009.Methods: A total number of 30 villages from both mountainous (20% and plateau (80% regions of the province were selected randomly. Ticks were colleted from the body of infested animals and transported to the laboratory of Medical Entomology, School of Public Health, Tehran University of Medical Sciences and then were identified to space level using valid identification key.Results: A total of 583 hard ticks were collected. The ticks were classified into three genera and 7 species including:  Hyalomma dromedarii (55.92%, Hy. marginatum (13.20%, Hy. anatolicum (9.78%, Hy. detritum (4.98%,  Hy. asiaticum (3.94%, Rhipicephalus sanguineus (11.84%, and Dermacentor marginatus (0.34%. The highest seasonal activities occurred in summer. The prevalence of the Ixodidae ticks was more evident in plateaus area in Yazd Province. Among the hosts including: cow, goat, sheep and camel, the ticks that collected from camel was more prevalent. The ratio of male was more than female ticks. Hyalomma. dromedarii was the predominant tick species and accounted for 55.92% of the ticks.Conclusion: Some of the collected ticks may play an important role for transmission of vector borne disease to human; therefore, the results of this study will provide a clue for vectors of tick-borne diseases in the region for local authorities for implementation of disease control.

  13. Prevalence of tick infestation in dromedary camels (Camelus dromedarius) brought for slaughter in Mashhad abattoir, Iran. (United States)

    Moshaverinia, Ali; Moghaddas, Elham


    This study was carried out to investigate the prevalence of tick infestation and identify tick species that parasitize dromedary camels. Since April 2012 through March 2013, a total of 400 camels that brought for slaughter in Mashhad abattoir were examined for tick infestation. Out of the total 400 camels examined, 237 were infested and annual prevalence of tick infestation 59.25 % (95 % CI 54-64) was calculated. The higher prevalence rates were found in the summer and spring, especially the summer that prevalence rate was the highest. A total of 1,122 ticks were collected from the infested camels and identified by stereomicroscopy. Hyalomma dromedarii was the predominant tick species and comprised 70.76 % of the collected ticks. The frequency of other species was as follows: H. excavatum (19.25 %), H. anatolicum (4.81 %), H. asiaticum (4.72 %), Rhipicephalus turanicus (0.17 %), H. detritum (0.09 %), H. impeltatum (0.09 %) and H. schulzei (0.09 %). Based on the results of present study, it is concluded that camels mostly harbor Hyalomma spp. The species of this genus are the most notorious ticks for transmission of human and animal diseases. Therefore, appropriate tick control measures need to be employed and pour-on method for acaricide application is suggested because this method is fast, easy and suitable for use by camel owners in deserts.

  14. Anaplasma infection of Bactrian camels (Camelus bactrianus) and ticks in Xinjiang, China. (United States)

    Li, Youquan; Yang, Jifei; Chen, Ze; Qin, Gege; Li, Yaqiong; Li, Qian; Liu, Junlong; Liu, Zhijie; Guan, Guiquan; Yin, Hong; Luo, Jianxun; Zhang, Lin


    To date, anaplasmosis has been reported to be a subclinical disease in Indian and Arabian one-humped camels (Camelus dromedarius) and llamas (Lama glama). However, no information on Anaplasma infection in two-humped Bactrian camels (Camelus bactrianus) in China has been published to date. The aim of this study was to investigate the prevalence of Anaplasma spp. in domestic Bactrian camels and ticks in Xinjiang, China. A total of 382 ticks were collected from the Bactrian camels and from environmental sources. Of these, 84 were morphologically identified as belonging to the Rhipicephalus sanguineus group and genetically identified (12S rDNA, 16S rDNA and the cytochrome c oxidase 1 genes) as R. sanguineus group ticks (temporally designated as Rhipicephalus sp. Xinjiang). PCR testing showed that 7.2% (20/279) of the camels harbored Anaplasma platys DNA. However, microscopic examination revealed no A. platys inclusions in blood smears from the camels. The PCR prevalence of A. platys DNA was 9.5% (6/63) in Rhipicephalus sp. Xinjiang from the Bactrian camels and 14.3% (3/21) in Rhipicephalus sp. Xinjiang from the vegetation. A. platys DNA was not detected by PCR in other tick species (Hyalomma asiaticum, Dermacentor niveus and Hyalomma dromedarii), and no other Anaplasma species were detected in these samples. This is the first report of A. platys in Bactrian camels in Xinjiang, China. The moderate positivity observed indicates that these animals might be a natural host for this pathogen in China.

  15. Vectors of Crimean Congo Hemorrhagic Fever Virus in Iran

    Directory of Open Access Journals (Sweden)

    Zakkyeh Telmadarraiy


    Full Text Available Background: Ticks are important vectors and reservoirs of Crimean Congo Hemorrhagic Fever (CCHF virus. Human beings may be infected whenever the normal life cycle of the infected ticks on non- human vertebrate hosts is interrupted by the undesirable presence of humans in the cycle. A total of 26 species of Argasid and Ixodid ticks have been recorded in Iran; including nine Hyalomma, two Rhipicephalus, two Dermacentor, five Haemaphysalis, two Boophilus, one Ixodes and two Argas as well as three Ornithodoros species as blood sucking ectoparasites of livestock and poultries. The present paper reviews tick vectors of CCHF virus in Iran, focusing on the role of ticks in different provinces of Iran using reverse transcription polymerase chain reaction (RT-PCR assay.Methods: During ten years study, 1054 tick specimens; including two species of Argasidae and 17 species of Ixodidae were examined for their infection to CCHF virus genome. The output of all studies as well as related publications were discussed in the current paper.Results: The results show that Rhipicephalus sanguineus, Hyalomma marginatum, H. anatolicum, H. asiaticum and H. dromedarii were known as the most frequent species which were positive for CCHF virus.Conclusion: The status of ticks which were positive for CCHF virus revealed that unlike the most common idea that Hyalomma species are the most important vectors of CCHF virus, other ticks including Rhipicephalus,Haemaphysalis and Dermacentor can be reservoir of this virus; thus, considering geographical distribution, type of host and environmental conditions, different tick control measurements should be carried out in areas with high incidence of CCHF disease.

  16. Molecular epidemiology of Crimean-Congo hemorrhagic fever virus detected from ticks of one humped camels (Camelus dromedarius) population in northeastern Iran. (United States)

    Champour, Mohsen; Chinikar, Sadegh; Mohammadi, Gholamreza; Razmi, Gholamreza; Shah-Hosseini, Nariman; Khakifirouz, Sahar; Mostafavi, Ehsan; Jalali, Tahmineh


    A comprehensive study was conducted on camel ticks to assess the epidemiological aspects of the infection in camels. From May 2012 to January 2013, 11 cities and towns from the Khorasan provinces, northeastern Iran, were randomly selected as a "cluster" and at least 14 camels were sampled from each cluster. A total of 200 camels were examined in this study, reverse transcriptase polymerase chain reaction was used for the detection of the Crimean-Congo hemorrhagic fever virus (CCHFV) genome. Tick infestation was observed in 171 of the 200 camels, 480 ixodid ticks were collected, and one genus was identified as Hyalomma. Four species were reported to be the major tick species infesting camels. Among these, Hyalomma dromedarii was the most predominant tick species (90.7 %), followed by H. anatolicum (6 %), H. marginatum (2.9 %), and H. asiaticum (0.4 %). The genome of the CCHFV was detected in 49 (10.2 %) of the 480 ticks. The CCHFV RNA was detected in two of the four tick species, and the viral genome was detected from tick samples in three South Khorasan cities. The positivity rate of ticks was as follows: Boshroyeh, 25 out of 480 (5.2 %); Birjand, 17 out of 480 (3.5 %); and Nehbandan, 7 out of 480 (1.5 %). We recommend the use of acaricides to prevent disease transmission to humans and to reduce the tick population in camels. Care should be taken by abattoir workers and by those who work closely with camels.

  17. Detection of novel strains genetically related to Anaplasma platys in Tunisian one-humped camels (Camelus dromedarius). (United States)

    Belkahia, Hanène; Ben Said, Mourad; Sayahi, Lotfi; Alberti, Alberto; Messadi, Lilia


    Little information is currently available regarding the presence of Anaplasma species in North African dromedaries. To fill this gap in knowledge, the prevalence, risk factors, and genetic diversity of Anaplasma species were investigated in Tunisian dromedary camels. A total of 226 camels from three different bioclimatic areas were sampled and tested for the presence of Anaplasma species by quantitative polymerase chain reaction (qPCR) and nested polymerase chain reaction (nPCR) assays. Detected Anaplasma strains were characterized by 16S rRNA sequence analysis. Overall infection rate of Anaplasma spp. was 17.7%, and was significantly higher in females. Notably, A. marginale, A. centrale, A. bovis, and A. phagocytophilum were not detected. Animals were severely infested by three tick species belonging to the genus Hyalomma (H. dromedarii, H. impeltatum, and H. excavatum). Alignment, similarity comparison, and phylogenetic analysis of the 16S rRNA sequence variants obtained in this study suggest that Tunisian dromedaries are infected by more than one novel Anaplasma strain genetically related to A. platys. This study reports the presence of novel Anaplasma sp. strains genetically related to A. platys in dromedaries from various bioclimatic areas of Tunisia. Findings raise new concerns about the specificity of the direct and indirect diagnostic tests routinely used to detect different Anaplasma species in ruminants and provide useful molecular information to elucidate the evolutionary history of bacterial species related to A. platys.

  18. Molecular Investigation of Francisella-Like Endosymbiont in Ticks and Francisella tularensis in Ixodid Ticks and Mosquitoes in Turkey. (United States)

    Duzlu, Onder; Yildirim, Alparslan; Inci, Abdullah; Gumussoy, Kadir Semih; Ciloglu, Arif; Onder, Zuhal


    This study was carried out to investigate the molecular prevalence of Francisella-like endosymbionts (FLEs) and Francisella tularensis in ticks (Acari: Ixodidae) and mosquitoes in Turkey. Genomic DNA pools were constructed from a total of 1477 adult hard ticks of Rhipicephalus (Rh.) annulatus, Rh. turanicus, Rh. sanguineus, Rh. bursa, Haemaphysalis (Hae.) parva, Hae. sulcata, Hyalomma marginatum marginatum, H. anatolicum anatolicum, H. anatolicum excavatum, H. detritum detritum, H. dromedarii, Dermacentor marginatus, and Ixodes ricinus species, which were collected from several barns, cattle, and people. Genomic DNA was also extracted from pools consisting of 6203 adult female mosquito species belonging to Aedes vexans, Culex (Cx.) pipiens, Cx. hortensis, Cx. theileri, Culiseta annulata, and Anopheles maculipennis species. Conventional PCR and TaqMan probe-based real- time PCR targeting the 16S rRNA gene for FLEs and the lpnA gene for F. tularensis, respectively, were performed on the DNA isolates obtained. FLEs and F. tularensis were not found in any genomic DNA pools constructed from ixodid ticks and mosquitos. This study represents the first investigation of F. tularensis and FLEs in potential vector ticks and mosquitoes by molecular methods in Turkey. The present study provides useful insights into the molecular epidemiology of F. tularensis and FLEs. One of the major conclusions of the study is that tularemia outbreaks may be essentially due to direct transmission from the environment (especially from water) in Turkey and not to vector-borne transmission.

  19. Tick Infestation Rate of Sheep and Their Distribution in Abdanan County, Ilam Province, Iran, 2007-2008

    Directory of Open Access Journals (Sweden)

    MA Oshaghi


    Full Text Available "nAbstract "nBackground: Ticks are hematophagous arthropod belonging to the Class of Arachnids. Ticks are also one of the major vectors of pathogens to animal and human. This study was conducted to determine tick infestation rate of sheep in Abdanan during 2007–2008. "nMethods: Sampling was performed seasonally in 19 villages during spring 2007 until winter 2008. A total of 1095 sheep were selected and tested for tick infestation.  After collection, all ticks were transported to laboratory of Medi­cal Entomology and were identified with appropriate identification keys. "nResults: Totally, 864 hard ticks were collected. The ticks were classified into two genera and 5 species including: Hyalomma marginatum (44.67%, Hy. anatolicum (43.17%, Hy.asiaticum (6.37%, Hy. dromedarii (5.55%, Hea­maphysalis sulcata (0.24%. The highest seasonal activity was observed in spring (36.46 % and the lowest seasonal was in winter (11.57%. The rate of tick frequency in mountainous region was 48.15% and it was 51.85% in plateau regions. In this study, tick infestation of sheep was 11.41%. "nConclusion: Hy.marginatum has the more frequent density in the study area. "n  "nKeywords: Ticks, sheep, Iran

  20. Colonization and Containment of Hyalomma Marginatum Rufipes for Studies on the Transmission of Crimean-Congo Hemorrhagic Fever (United States)


    Russian) Tabl. anal. Faune URSS 4 125pp Olenev, NO. 1931 Die Zecken (Ixodidea) der fauna Russlands. Zeits chr. Parasitenk. 4(1) 126-139 Olenev, NO. 1931...Parasitenk 4 126 Olenev, NO. 1931 Mag. Paras. Zool. Acad. Scien. URSS . 2 249 q Oliver, JH. 1972 Cytogenetics of ticks (Acari: Ixodoidea). 8. Chr...USA. Pomeranzev, BI. 1946 Tableaux analytiques Faunne URSS . Publ. Ins. Zool. Acad. Science. Popov, GV, Levi, VD, Vasilenko, SM, and Chumakov, MP

  1. Hepatozoon kisrae n. sp. infecting the lizard Agama stellio is transmitted by the tick Hyalomma cf. aegyptium

    Directory of Open Access Journals (Sweden)

    Paperna I.


    Full Text Available Hepatozoon kisrae n. sp. was found infecting a starred lizard at a site in southeastern Samaria, Palestine. These lizards were also hosts to the ixodid tick Hyolomma cf. aegyptium, which was demonstrated to be the vector of this hemogregarine. Hepatozoon and tick infections occurred in lizards within a very restricted locality; at a second site, nearby, ticks occurred without Hepatozoon infection. Micro- and macromeronts occurred mainly in the lungs, while cyst-like merogonic stages, mainly dizoic, occurred in the liver. Mature intraerythrocytic gametocytes were stout and encapsulated. Development from oocysts to sporocysts took place in the tick hemocoel, and was examined by transmission electron microscopy. Lizards were successfully infected when fed on sporocyst-infected ticks or viscera of infected lizards. Ticks become infected when fed on infected lizards; sporogony was complete when the ticks reached adult stage, over 40 days after initial attachment.

  2. New data regarding distribution of cattle ticks in the south-western Indian Ocean islands. (United States)

    Stachurski, Frédéric; Tortosa, Pablo; Rahajarison, Patrick; Jacquet, Stéphanie; Yssouf, Amina; Huber, Karine


    Recent studies have produced new insight into the origin and distribution of some cattle ticks in the south-western Indian Ocean islands. Rhipicephalus appendiculatus, introduced from Tanzania in 2002, is now well established on Grande Comore but has not yet reached the other islands of the archipelago (Mohéli, Anjouan and Mayotte). Only one of the two clades identified in Africa has settled so far. Amblyomma variegatum, which was not supposed to be able to persist in the Antananarivo region (1300 m) nor in other Malagasy regions of high altitude without regular introductions of ticks by infested cattle, is now endemic as a general rule up to 1600 m although other regions of lower altitude (1400 m) are still free of the tick. This species remains confined in a small area of the west coast on La Reunion Island. On the contrary, Hyalomma dromedarii could not settle on Madagascar where it was introduced in 2008 and Rhipicephalus evertsi evertsi is not yet present in Grande Comore despite regular introductions by infested cattle from Tanzania. A phylogeographic approach has been carried out at an intra-specific level for A. variegatum. This study has led to the identification of two main lineages, one covering all species distribution and one restricted to East Africa and the Indian Ocean area. These two lineages are in sympatry in Madagascar where a high genetic diversity has been described, whereas a lower genetic diversity is observed on other islands. These results seem to agree with the historical data concerning the introduction of the tick in the Indian Ocean area.

  3. Molecular cloning and expression of a larval immunogenic protein from the cattle tick Boophilus annulatus. (United States)

    Shahein, Yasser Ezzat


    A full-length cDNA of an immunogenic protein was cloned from a cDNA library of the local Egyptian cattle tick Boophilus annulatus. Antibodies raised against B. annulatus larval proteins were used to screen a cDNA expression library. A 936bp cloned fragment was sequenced and showed an open reading frame of 516bp encoding a protein of 171 amino acids. Comparison of the deduced amino acid sequence with protein data bank revealed that the sequence is related to a sequence isolated from the hard tick Haemaphysalis qinghaiensis (Hq05). Southern blot analysis of B. annulatus genomic DNA showed that the cloned cDNA hybridized to double bands per restriction digest, suggesting that the cloned cDNA is a double copy gene. Amino acid analysis of the cloned gene revealed the presence of two casein kinase II phosphorylation sites in the N-terminal domain suggesting that this molecule may be involved in the signal transduction or gene expression pathways. RT-PCR and northern blotting revealed the presence of two isoforms of the Ba05 gene in salivary glands and in the 3-day-old eggs. The cloned gene without the signal peptide, was expressed in Escherichia coli under T7 promotor of pET-30b vector, and purified under denaturation conditions. The purified protein appeared as a single band on 12% SDS-PAGE with a molecular weight around 22.8kDa including the histidine tag of the vector. Antibodies raised against the purified molecule were used to detect the B. annulatus homologue to the Hq05 gene in whole tick, larvae and gut protein extracts. Immunoblotting revealed the presence of this molecule Ba05 only in whole tick and larval protein extracts and not in the gut protein extract. Using the same antibodies, homologues to the Ba05 gene were detected in other tick species as Hyalomma dromedarii and Rhipicephalus sp. but not in Ornithodoros moubata.

  4. Molecular cloning, expression and characterization of a functional GSTmu class from the cattle tick Boophilus annulatus. (United States)

    Shahein, Yasser Ezzat; El Sayed El-Hakim, Amr; Abouelella, Amira Mohamed Kamal; Hamed, Ragaa Reda; Allam, Shaimaa Abdul-Moez; Farid, Nevin Mahmoud


    A full-length cDNA of a glutathione S-transferase (GST) was cloned from a cDNA library of the local Egyptian cattle tick Boophilus annulatus. The 672 bp cloned fragment was sequenced and showed an open reading frame encoding a protein of 223 amino acids. Comparison of the deduced amino acid sequence with GSTs from other species revealed that the sequence is closely related to the mammalian mu-class GST. The cloned gene was expressed in E. coli under T7 promotor of pET-30b vector, and purified under native conditions. The purified enzyme appeared as a single band on 12% SDS-PAGE and has a molecular weight of 30.8 kDa including the histidine tag of the vector. The purified enzyme was assayed upon the chromogenic substrate 1-chloro-2,4-dinitrobenzene (CDNB) and the recombinant enzyme showed high level of activity even in the presence of the beta-galactosidase region on its 5' end and showed maximum activity at pH 7.5. The Km values for CDNB and GSH were 0.57 and 0.79 mM, respectively. The over expressed rBaGST showed high activity toward CDNB (121 units/mg protein) and less toward DCNB (29.3 units/mg protein). rBaGST exhibited peroxidatic activity on cumene hydroperoxide sharing this property with GSTs belonging to the GST alpha class. I50 values for cibacron blue and bromosulfophthalein were 0.22 and 8.45 microM, respectively, sharing this property with the mammalian GSTmu class. Immunoblotting revealed the presence of the GST molecule in B. annulatus protein extracts; whole tick, larvae, gut, salivary gland and ovary. Homologues to the GSTmu were also detected in other tick species as Hyalomma dromedarii and Rhipicephalus sp. while in Ornithodoros moubata, GSTmu homologue could not be detected.

  5. Hormonal Interference with Pheromone Systems in Parasitic Acarines, Especially Ixodid Ticks. (United States)


    1) Precocity of molting as evidenced by stadium (larval, nymphal) deletion, (2) antigonadotrophic activity , (3) diapause induction, (4) ovicidal ...females. Studies to determine whether sex pheromone activity in D. variabilis can be affected by administration of ecdysteroids are being continued, but...Pheromone Activity in Hyalomm- dromedarii, With Evidence of the Existence of Ecdysteroids in H. dromedarii and Dermacentor variabilis

  6. An Annotated List of Tick (Acari: Ixodida) Common Names Authored by Harry Hoogstraal (1917-1986) (United States)


    America, 63, 590–606. Pegram, R.G., Hoogstraal, H. & Wassef, H.Y. (1982) Hyalomma (Hyalommina) arabica sp. n. parasitizing goats and sheep in the...Hoogstraal et al. (1972a) Arabian goat hyalomminid, Hyalomma arabica Pegram, Hoogstraal and Wassef, 1982 ― Pegram et al. (1982) Arabian goat ...hyalomminine [sic], "Hyalomma sp. in press Pegram, Hoogstraal and Wassef, 1982"—this species was named Hyalomma arabica, "Arabian goat hyalomminid," q.v

  7. Ticks (Ixodida) from the collection of the Natural History Department, Museum of Upper Silesia in Bytom, Poland - A contribution to knowledge on tick fauna and the first record of Hyalomma marginatum presence in Poland. (United States)

    Cuber, Piotr Krzysztof


    There is no doubt that museum collections provide a wide variety of information on ticks. The tick collection at the Natural History Department of the Museum of Upper Silesia in Bytom consists only of 37 specimens as the department is focused mainly on building collections of insects and birds. However, this does not mean that such collection cannot contribute to our knowledge about these arthropods. The most valuable results of studies on the museum's tick collection concerned Polish fauna. There are specimens of I. ricinus dating back as far as 1930-1948, which are the first known records of the presence of this tick in the Upper Silesia. Two specimens collected in copula in 1941 might be the earliest record of the mating behaviour of this species in Poland. The most important result was the detection of 2 cases of H. marginatum presence in Poland, which by far are the oldest documented cases of its presence in this country.

  8. Serotonin-like immunoreactivity in the central nervous system of two Ixodid tick species (United States)

    Immunocytochemistry was used to detect the presence of serotonin-like immunoreactive (5HT-IR) neurons and neuronal processes in the central nervous system (CNS), the synganglion, of two Ixodid tick species; the winter tick, Dermacentor albipictus and the lone star tick, Amblyomma americanum. Seroto...

  9. Evaluation of Animal and Plant Pathogens as Terrorism and Warfare Agents, Vectors and Pests (United States)


    Acari Arachnida Hyalomma Anatolicumn Anatolicumn Dermacentor andersoni Acari Arachnida Dermacentor varabilis Amblyimma Cajennese Rhipicephalus sanguineus...Mansonia spp. Diptera Insecta Culex spp. Culiseta spp. Pediculus humanus Anopluraa Insect Ixodides Dermacentor spp. Acari Arachnida Rhipicephalus spp

  10. Biological Warfare Agents, Toxins, Vectors and Pests as Biological Terrorism Agents (United States)


    synthesis of >100 amino acid polypeptides, advanced genetic manipulation). Toxins as terrorism agents: 1. Botulinum toxin 2. Ricin 3...marginatum 5. Hyalomma Anatolicum Anatolicum 6. Dermacentor spp. 7. Rhipicephalus spp. 8. Amblyomma spp. 9. Mansonia spp. 10. Culex spp. 11



    Амирханова, С.


    Изучен жизненный цикл и выживаемость отдельных стадий клеща H. marginatum как в природных, так и в лабораторных условиях. В результате исследований нами уточнены температурные границы активации клеща H. marginatum в Дагестане, сроки превращения стадии личинок в нимф, имаго в зависимости от температурных показателей и степени насыщенности крови самками, влияние температуры на процесс овогенеза....

  12. Lyme borreliosis spirochetes and spotted fever group rickettsiae in ixodid ticks from Pianosa island, Tuscany Archipelago, Italy. (United States)

    Tomassone, L; Grego, E; Auricchio, D; Iori, A; Giannini, F; Rambozzi, L


    A study on tick fauna and tick-borne pathogens was undertaken in Pianosa, an island in the Tuscany Archipelago that constitutes an important stopping and nesting point for migratory birds. Ticks were removed from feral cats and a few terrestrial birds, and host-seeking ticks were collected by dragging. A total of 89 ticks were found on animals: 57 Ixodes ventalloi Gil Collado, 1936 and 32 Ixodes acuminatus Neumann, 1901. Host-seeking ticks were 354 Hyalomma spp. larvae and 18 Hyalomma spp. adults, identified as Hyalomma marginatum C.L. Koch, 1844 (n=11) and 7 Hyalomma detritum Schulze, 1919 (n=7). A sample of adult ticks was subjected to molecular analyses to look for Rickettsia spp. and Borrelia burgdorferi sensu lato (s.l.). Sequence analysis of the 5S-23S intergenic spacer region and OspA gene of B. burgdorferi s.l.-positive samples showed the presence of Borrelia spielmanii (n=3; 3.7%, 95% confidence interval [CI] 0.08-10.4) and Borrelia valaisiana (n=13; 13.6%, 95% CI 7.0-23.0) in Ixodes ticks from cats and terrestrial birds. Ixodes spp. were also infected by Rickettsia helvetica (n=19; 23.4%, 95% CI 14.7-34.2). Finally, we detected Rickettsia aeschlimannii in 3 out of 12 host-seeking Hyalomma spp. adults tested (25%, 95% CI 5.5-57.2). Our study shows the presence of several tick-borne pathogens in Pianosa. Hyalomma spp. and Ixodes ticks other than I. ricinus seem to be involved in their epidemiological cycle, and birds could contribute to the pathogen dispersal along their migration routes. This is the first finding of B. spielmanii in Italy. We hypothesize the involvement of peridomestic rodents or hedgehogs in its maintenance in Pianosa.

  13. Ticks (Acari: Ixodidae infesting cattle and African buffaloes in the Tsavo conservation area, Kenya

    Directory of Open Access Journals (Sweden)

    Edward K. Kariuki


    Full Text Available Several ixodid tick species are shared between domestic cattle and African buffaloes (Syncerus caffer. So too, are a number of tick-borne diseases. The aim of the study was to compare the species composition of ticks that infest cattle and buffaloes utilising the same habitat within the Tsavo Conservation Area, Kenya. To this end, 25 cattle and 62 buffaloes were each opportunistically sampled for ticks on a single occasion in February 2010. Eight species, namely Amblyomma gemma, Amblyomma lepidum, Hyalomma albiparmatum, Hyalomma rufipes, Hyalomma truncatum, Rhipicephalus evertsi evertsi, Rhipicephalus pravus and Rhipicephalus pulchellus infested both cattle and buffaloes. Three species, Rhipicephalus (Boophilus sp., Rhipicephalus kochi, and Rhipicephalus muehlensi were collected only from cattle, and three species, Hyalomma impeltatum, Rhipicephalus humeralis and Rhipicephalus praetextatus were present only on buffaloes. The attachment sites of the various tick species were also recorded. New locality records for H. impeltatum and H. truncatum and the first confirmed locality record for Rhipicephalus praetextatus sensu stricto in Kenya were documented.

  14. On the potential roles of ticks and migrating birds in the ecology of West Nile virus

    Directory of Open Access Journals (Sweden)

    Karl Hagman


    Full Text Available Background: Mosquitoes are the primary vectors of West Nile virus (WNV. Ticks have, however, been suggested to be potential reservoirs of WNV. To investigate their role in the spread of the virus, ticks, which had been collected from birds migrating northward from Africa to Europe, were analyzed for the potential presence of WNV RNA. Methods: On the Mediterranean islands of Capri and Antikythira, a total of 14,824 birds were captured and investigated from which 747 ticks were collected. Results and conclusions: Most of the identified ticks (93% were nymphs and larvae of Hyalomma marginatum sensu lato (s.l., most of which were or appear to be Hyalomma rufipes. Of these ticks, 729 were individually screened for WNV RNA. None of the ticks was found to be WNV positive. Thus, there was no evidence that H. marginatum s.l. ticks play a role in the spread of WNV from Africa to Europe.

  15. Identification of rickettsial pathogens in ixodid ticks in northern Senegal. (United States)

    Sambou, Masse; Faye, Ngor; Bassène, Hubert; Diatta, Georges; Raoult, Didier; Mediannikov, Oleg


    The spotted fevers, caused by the Rickettsia bacteria, are a group of emerging diseases that are responsible for significant human morbidity. In Africa, the distribution of different species of Rickettsia in their tick vectors is poorly studied. We have collected 1169 hard ticks from 5 different species in the northern Senegal, close to the Saharan border. In a far northern collection site, corresponding to the Rickettsia africae distribution area, we collected three Amblyomma variegatum ticks infected by R. africae. Rickettsia africae was also identified in a Hyalomma marginatum rufipes tick, which may represent the secondary host for the pathogen. Rickettsia aeschlimannii was identified in H. m. rufipes, Rhipicephalus evertsi evertsi, and Hyalomma impeltatum ticks.

  16. General review of tick species present in Portugal. (United States)

    Caeiro, V


    At present, 24 species are known to occur in Portugal: Argas vespertilionis, Ornithodoros maritimus and Ornithodoros erraticus in Argasidae; Ixodes acuminatus, Ixodes bivari, Ixodes canisuga, Ixodes frontalis, Ixodes hexagonus, Ixodes ricinus, Ixodes simplex simplex, Ixodes ventalloi, Ixodes vespertilionis, Dermacentor marginatus, Dermacentor pictus', Haemaphysalis hispanica, Haemaphysalis inermis, Haemaphysalis punctata, Rhipicephalus bursa, Rhipicephalus pusillus, Rhipicephalus sanguineus, Rhipicephalus turanicus, Hyalomma lusitanicum, Hyalomma marginatum marginatum and Boophilus annulatus in Ixodidae. The more relevant diseases transmitted to cattle by ticks, particulary in Ribatejo and Alentejo regions, are the babesiosis due to Babesia bigemina and Babesia bovis, the theileriosis by Theileria annulata and the anaplasmosis due to Anaplasma marginale; the theileriosis by Theileria mutans2 may not be considered significant. The sheep and goats parasitoses transmitted by ticks are of less importance than the cattle diseases. However the babesiosis due to Babesia motasi and Babesia ovis and also theileriosis by Theileria hirci3 are present in some districts of the country.

  17. PCR-Detection of Coxiella burnetii in Ticks Collected from Sheep and Goats in Southeast Iran

    Directory of Open Access Journals (Sweden)

    SR Nourollahi Fard


    Results: Three pools, each consisting of five female of Hyalomma anatolicum anatolicum and one pool (6 ticks of Rhipicephalus sanguineus ticks collected from goats and sheep were found to be positive by Trans-PCR. Conclusion: This paper documents the first molecular detection of C. burnetii in ticks, which shows their role as puta­tive vectors and reservoirs for this pathogenic agent.  


    Directory of Open Access Journals (Sweden)

    Bahzad H.S. Mustafa


    Full Text Available This study was conducted in Sulaimani governorate in order to identify the biological control of some Ixodidae genera among different flocks of cattle, sheep and goats. Four genera of Ixodidae; Boophilus spp., Hyalomma spp., Rhipicephalus spp. and Haemaphysalis spp., were identified in these infested animals. According to chi–square test, the highest distribution of Boophulis spp., was recorded in cattle (56.51%, and the highest distribution of Hyalomma spp., (49.82% and Rhipicephalus spp., (28.16% which were in sheep. The highest number of Haemophasylas spp., was obtained from goats (6.67%, whereas the lowest number of this genus (2.88% and 2.89% was collected from cattle and sheep respectively. The toxicity of Sorghum bicolor seed extract was tested against the more distributed Ixodidae genera (Boophilus spp. and Hyalomma spp. by immersion method on mature ticks, four concentrations (23.2, 17.4, 11.6 and 5.8 mg/dl, in addition to the control treatment (0 mg/dl of the seed were used to evaluate the engorged females in vitro. The results showed that 100% of absolute cumulative mortality of Boophilus spp., was gain after 72 hr by 23.2 mg/dl extract concentration, followed by 17.4 mg/dl which gave 90% mortality, whereas 100% absolute cumulative mortality for Hyalomma spp., was obtained by 23.2 mg/dl extract concentration after 48 hr, followed by 17.4, 11.6 and 5.8 mg/dl concentration that gave 90%, 80% and 40% mortality after 72 hr.

  19. NAMRU-3 Reprint Accession List 1982. Number 12. (United States)


    TuberculousMeningitli. J. Clin. Lab. Inwnunol, 8:37-42, 1982. 1295 SIPPEL, I.E., EL-MASRY, N.A., FARID, Z.: Diagnosis of Human Brucellosis with ELISA. The Lancet...Hyalomma (Hyalonunina) arabica sp. N. Parasitizing Goats andSheep In the Yemen Arab Republic and Saudi Arabia. J. Parasitol., 68(1):150-156, 1982. 1298...Accession Number BACTERIOLOGY Brucellosis 1295 Identification of micro-organisms by gas-chromatography 1282 Meningitis 1294, 1302, 1305, 1311, 1321

  20. Identification of attenuation markers of a Theileria lestoquardi cell line to be used for the development of live vaccine against malignant ovine theileriosis


    Mousa, Awadia Mohamed Ali Mohamed


    Theileria lestoquardi is a tick-borne protozoan parasite and highly pathogenic for sheep. The disease caused by the pathogen is known as malignant ovine theileriosis (MOT) and is transmitted by Hyalomma ticks. Control of the disease can be achieved by immunization of sheep with attenuated T. lestoquardi schizont-infected ovine cells that provides the animal with solid immunity. The approach of using the attenuated vaccine against malignant ovine theileriosis has been carried out successfully ...

  1. Reverse transcription PCR-based detection of Crimean-Congo hemorrhagic fever virus isolated from ticks of domestic ruminants in Kurdistan province of Iran. (United States)

    Fakoorziba, Mohammad Reza; Golmohammadi, Parvaneh; Moradzadeh, Rahmatollah; Moemenbellah-Fard, Mohammad Djaefar; Azizi, Kourosh; Davari, Behrooz; Alipour, Hamzeh; Ahmadnia, Sara; Chinikar, Sadegh


    Crimean-Congo hemorrhagic fever (CCHF) is a potentially fatal viral vector-borne zoonosis which has a mortality rate of up to 30% without treatment in humans. CCHF virus is transmitted to humans by ticks, predominantly from the Hyalomma genus. Following the report of two confirmed and one suspected death due to CCHF virus in Kurdistan province of Iran in 2007, this study was undertaken to determine the fauna of hard ticks on domestic ruminants (cattle, sheep, and goats) and their possible infection with CCHF virus using reverse transcription PCR technique. This is the first detection of CCHF virus in ticks from the Kurdistan province of Iran. Overall, 414 ixodid ticks were collected from two districts in this province. They represented four genera from which 10 separate species were identified. The Hyalomma genus was the most abundant tick genus (70%). It was the only genus shown to be infected with the CCHF virus using RT-PCR technique. The number of ticks positive for CCHF virus was 5 out of 90 (5.6%) adult ticks. The three remaining genera (Haemaphysalis, Rhipicephalus, and Dermacentor) were all negative following molecular survey. Four of the five virally-infected ticks were from cattle mainly in the Sanandaj district. We concluded that CCHF virus is present in the Hyalomma ticks on domestic ruminants (cattle) in Kurdistan province of Iran.

  2. A molecular survey of Theileria and Babesia parasites in cattle, with a note on the distribution of ticks in Tunisia. (United States)

    M'ghirbi, Y; Hurtado, A; Barandika, J F; Brandika, J; Khlif, K; Ketata, Z; Bouattour, A


    Between October and November 2006, a total of 278 bovine blood samples were examined, and 104 (37.4%) were positive for piroplasms by microscopy. A reverse line blot hybridisation with polymerase chain reaction detected Theileria annulata, T. buffeli, Babesia bovis and B. bigemina in cattle accounting for 48.6% of positive samples. The most frequently found species was T. buffeli, which was present in 39.2% of the samples. T. annulata was found in 48 samples (17.3%). Babesia infections were less frequently detected: B. bovis was found in 6.8% of the samples and B. bigemina in 4.3%. Mixed infections were detected in 45 samples, accounting for seven different combinations of species. Seven Ixodid tick species (Boophilus annulatus, Ixodes ricinus, Hyalomma marginatum, Hyalomma excavatum, Hyalomma detritum, Haemaphysalis punctata and Haemaphysalis sulcata) were collected from examined cattle in the 23 visited farms. I. ricinus was the dominant species (36%), mainly collected in the humid zone, while it seemed to be very rare in the semi-arid zone (where only 15 specimens were collected), whereas B. annulatus was the most commonly collected species in the sub-humid area (68.5% of ticks collected in this zone).

  3. Parasites of domestic and wild animals in South Africa. XLIX. Ticks (Acari: Ixodidae infesting white and black rhinoceroses in southern Africa

    Directory of Open Access Journals (Sweden)

    Ivan G. Horak


    Full Text Available The objectives of the study were to determine the species composition of ticks infesting white and black rhinoceroses in southern Africa as well as the conservation status of those tick species that prefer rhinos as hosts. Ticks were collected opportunistically from rhinos that had been immobilised for management purposes, and 447 white rhinoceroses (Ceratotherium simum and 164 black rhinoceroses (Diceros bicornis were sampled in South Africa, 61 black rhinos in Namibia, 18 white and 12 black rhinos in Zimbabwe, and 24 black rhinos in Zambia. Nineteen tick species were recovered, of which two species, Amblyomma rhinocerotis and Dermacentor rhinocerinus, prefer rhinos as hosts. A. rhinocerotis was collected only in the northeastern KwaZulu-Natal reserves of South Africa and is endangered, while D. rhinocerinus is present in these reserves as well as in the Kruger National Park and surrounding conservancies. Eight of the tick species collected from the rhinos are ornate, and seven species are regularly collected from cattle. The species present on rhinos in the eastern, moister reserves of South Africa were amongst others Amblyomma hebraeum, A. rhinocerotis, D. rhinocerinus, Rhipicephalus maculatus, Rhipicephalus simus and Rhipicephalus zumpti, while those on rhinos in the Karoo and the drier western regions, including Namibia, were the drought-tolerant species, Hyalomma glabrum, Hyalomma rufipes, Hyalomma truncatum and Rhipicephalus gertrudae. The species composition of ticks on rhinoceroses in Zambia differed markedly from those of the other southern African countries in that Amblyomma sparsum, Amblyomma tholloni and Amblyomma variegatum accounted for the majority of infestations.

  4. Ticks (Acari: Ixodidae of livestock and their seasonal activities, northwest of Iran

    Directory of Open Access Journals (Sweden)

    Zahra Ramezani


    Full Text Available Objective: To identify the ticks (Acari: Ixodidae of livestock and their seasonal activities, in northwest of Iran, including the combination of two of the geographical regions of Iran (Caspian and mountain plateau where the majority of the domestic ruminants in Iran exist. Methods: Fifteen villages of Meshkin-Shahr County were selected randomly from different areas of the county. The animal dwellings were visited and the whole body of sheep, cows, goats and dogs were examined for their probable infestation. Samples were identified at the level of species according to the standard morphological key. Results: In this study 1 208 specimen were collected and totally nine species (Dermacentor marginatus, Dermacentor niveus, Haemaphysalis erinacei, Haemaphysalis punctata, Hyalomma anatolicum, Hyalomma asiaticum, Hyalomma marginatum, Rhipicephalus bursa and Rhipicephalus sanguineus were identified in this study. Also 569 host including 40 cows, 450 sheep, 70 goats and 9 dogs were examined for infestation and among them 255 were infested which showed a 44% of infestation among examined livestock. The infestation rate among sheep (46% was higher than other hosts. The infestation rates among the rest of hosts were as: cows (40%, goat (37% and dogs (33%. Conclusions: The results of this study and other studies of the region showed the probability of the establishment and development of the burden of several tick-borne diseases.

  5. Molecular detection of Crimean-Congo haemorrhagic fever (CCHF) virus in ticks from southeastern Iran. (United States)

    Mehravaran, Ahmad; Moradi, Maryam; Telmadarraiy, Zakyeh; Mostafavi, Ehsan; Moradi, Ali Reza; Khakifirouz, Sahar; Shah-Hosseini, Nariman; Varaie, Fereshteh Sadat Rasi; Jalali, Tahmineh; Hekmat, Soheila; Ghiasi, Seyed Mojtaba; Chinikar, Sadegh


    Crimean-Congo haemorrhagic fever (CCHF) virus is a tick-borne member of the genus Nairovirus, family Bunyaviridae. CCHF virus has been isolated from at least 31 different species of ticks. The virus is transmitted through the bite of an infected tick or by direct contact with CCHF virus-infected patients or the products of infected livestock. This study was conducted to determine the rate of CCHF virus infection in ticks in the district of Zahedan, in the province of Sistan and Baluchistan, southeastern Iran. A total of 140 ticks were collected from Sistan and Baluchistan. Reverse transcriptase-polymerase chain reaction (RT-PCR) was used for the detection of the CCHF virus genome in the tick population. This genome was detected in 4.3% of ticks collected from livestock of different regions of Zahedan. The infected tick genera belonged to Hyalomma and Haemaphysalis. Although in the epidemiology of CCHF virus Hyalomma ticks are considered to be the most important vectors and reservoirs, the virus has also been reported to occur in other genera of ticks, which conforms to the current data in our study from Sistan and Baluchistan. Given that animals are common hosts for Hyalomma and Haemaphysalis, regular monitoring programmes for livestock should be applied for CCHF virus control.

  6. Distribution of ticks (Acari:Ixodidae) infesting domestic ruminants in mountainous areas of Golestan province, Iran

    Institute of Scientific and Technical Information of China (English)

    Moslem Sarani; Zakkyeh Telmadarraiy; Abdolreza Salahi Moghaddam; Kamal Azam; Mohammad Mehdi Sedaghat


    Objective: To determine the prevalence of ticks on cattle in the mountainous areas of Golestan province and their geographical distribution.Methods:collection was carried out during four seasons, twice per season over a period of 12 month from March 2009 through February 2010 in two districts, Azadshahr and Ramian. Meteorological data were obtained from Iran Meteorological Organization. The geographical points recorded using a Garmin eTrex®H GPS.Results:In total, 498 animals from 25 herds were selected to search for ticks in 2009-2010. Tick 63 goats, 99 cows and 13 camels in two districts of the mountainous area of Golestan province, including Azadshahr and Ramian. Five species of ixodid ticks were identified: Rhipicephalussanguineus A total of 255 ticks were collected from a total of 219 ruminants including 44 sheep, anatolicum (6%) and Hyalomma asiaticum (4%). The densities of infestations were calculated for sheep, goats, cows and camels 0.9, 0.79, 0.16 and 0.43 respectively. Seasonal activity of each ixodid tick infesting domestic ruminants was determined. The distribution maps showed ixodid ticks on domestic ruminants, and Rhipicephalus sanguineus were dominant species in the area.Conclusions:Such research provides necessary information for human and animal health (66.5%), Rhipicephalus bursa (4.6%), Hyalomma marginatum (19.9%), Hyalomma service mangers to have a better understanding of prevention and control of vector borne diseases especially during the outbreaks.

  7. Expressão e atividade enzimática de glutationa s-transferase em tecidos de fêmeas de Boophilus microplus Expression and enzymatic activity of glutathione s-transferase in tissues of Boophilus microplus females

    Directory of Open Access Journals (Sweden)

    Daniela R. J. de Freitas


    Full Text Available Enzimas de detoxificação e excreção celular são importantes para a manutenção da homeostase celular. Neste trabalho foi caracterizada a transcrição de mRNA, a expressão da proteína e a atividade enzimática de glutationa S-transfersases (GSTs, enzimas que atuam em rotas de excreção de substâncias endo e xenobióticas, protegendo as células contra toxicidade química e estresse, em diferentes tecidos (glândula salivar, ovário e singânglio de fêmeas adultas semi-ingurgitadas e ingurgitadas do carrapato do bovino Boophilus microplus. Os resultados mostraram que a atividade de GST é mais alta em fêmeas semi-ingurgitadas e diminui em fêmeas ingurgitadas de acordo com o final do período de pré-postura. A expressão de mRNA de GST foi detectada em glândulas salivares e singânglios de fêmeas adultas semi-ingurgitadas e ingurgitadas, mas não em ovários. Estes dados podem ajudar a compreender melhor o papel de enzimas antioxidantes durante a preparação das fêmeas do carrapato para a postura.Cellular detoxification and excretion enzymes are important to the maintenance of cellular homeostasis. In this work mRNA transcription, protein expression and enzymatic activity of Glutathione S-transferases (GSTs, enzymes involved in the excretion of endo and xenobiotic compounds were analyzed. These parameters are elements believed to protect cells against chemical toxicity and oxidative stress in different tissues (salivary gland, ovary and synganglion from partially engorged females and engorged females of Boophilus microplus. The results presented showed elevated GST activity in partially engorged females. The enzymatic activity decreased during the preoviposition period in engorged females. GST mRNA transcription was detected in salivary glands and synganglion from partially engorged and engorged females, but not in ovary. The results of this work help to elucidate the role of GST in tick development and assist in the

  8. Detection, isolation and confirmation of Crimean-Congo hemorrhagic fever virus in human, ticks and animals in Ahmadabad, India, 2010-2011.

    Directory of Open Access Journals (Sweden)

    Devendra T Mourya

    Full Text Available BACKGROUND: In January 2011, human cases with hemorrhagic manifestations in the hospital staff were reported from a tertiary care hospital in Ahmadabad, India. This paper reports a detailed epidemiological investigation of nosocomial outbreak from the affected area of Ahmadabad, Gujarat, India. PRINCIPAL FINDINGS: Samples from 3 suspected cases, 83 contacts, Hyalomma ticks and livestock were screened for Crimean-Congo hemorrhagic fever (CCHF virus by qRT-PCR of which samples of two medical professionals (case C and E and the husband of the index case (case D were positive for CCHFV. The sensitivity and specificity of indigenous developed IgM ELISA to screen CCHFV specific antibodies in human serum was 75.0% and 97.5% respectively as compared to commercial kit. About 17.0% domestic animals from Kolat, Ahmadabad were positive for IgG antibodies while only two cattle and a goat showed positivity by qRT-PCR. Surprisingly, 43.0% domestic animals (Buffalo, cattle, sheep and goat showed IgG antibodies in the adjoining village Jivanpara but only one of the buffalo was positive for CCHFV. The Hyalomma anatolicum anatolicum ticks were positive in PCR and virus isolation. CCHFV was isolated from the blood sample of case C, E in Vero E-6 cells and Swiss albino mice. In partial nucleocapsid gene phylogeny from CCHFV positive human samples of the years 2010 and 2011, livestock and ticks showed this virus was similar to Tajikistan (strain TAJ/H08966, which belongs in the Asian/middle east genetic lineage IV. CONCLUSIONS: The likely source of CCHFV was identified as virus infected Hyalomma ticks and livestock at the rural village residence of the primary case (case A. In addition, retrospective sample analysis revealed the existence of CCHFV in Gujarat and Rajasthan states before this outbreak. An indigenous developed IgM ELISA kit will be of great use for screening this virus in India.

  9. Evaluation of Certain Insecticides and Repellents Against Ticks

    Directory of Open Access Journals (Sweden)

    D. Kapoor


    Full Text Available The susceptibility of two commonly occurring species of Ixodid ticks viz., the cattle tick, Hyalomma anatolicum anatolicum Koch and the brown dog tick, Rhipicephalus sanguineus Latr to certain newer insecticdes was investigated under controlled environmental conditions. The repellency of diethyl toluamide (Deet to the two species of ticks was also investigated by a specially devised laboratory technique. It was found that based on LC/sub 50/ values, the two species were most susceptible to pyrethrins followed by carbaryl whereas malathion was found least toxic to the ticks.

  10. Molecular and serological detection of Theileria equi and Babesia caballi infection in horses and ixodid ticks in Iran. (United States)

    Abedi, Vali; Razmi, Golamreza; Seifi, Hesam; Naghibi, Abolghasem


    Equine piroplasmosis is a hemoprotozoan tick-borne disease with worldwide distribution that is caused by Theileria equi and Babesia caballi. However, the geographical distribution of equine piroplasmosis in Iran is unknown. The aim of the current study was to determine the causative agents and vector ticks of equine piroplasmosis in horses in the North Khorasan Province. In the year 2011, 100 horses were randomly selected from 14 villages. Blood samples and ixodid ticks were collected and examined using microscopical, molecular, and serological methods. Theileria equi infection was microscopically detected in 5 (5%) of the blood smears with low parasitemia, while serum samples were tested by the indirect immunofluorescent antibody test (IFAT). Antibodies against T. equi, B. caballi, and a mixed infection were detected in 48 (48%), 2 (2%), and 3 (3%) of the serum samples, respectively. A multiplex PCR was used to detect T. equi and B. caballi DNA in blood samples. No B. caballi infections could be found, but Theileria equi DNA was detected in 45 (45%) of the blood samples, and a BLAST analysis of the sequenced samples indicated a 99% similarity with T. equi 18S rRNA gene sequences in GenBank. Both molecular and serological results did not identify any significant association between T. equi infection and risk factors. A comparision of the results of 3 diagnostic methods demonstrated a poor agreement between microscopical examination with IFAT and PCR and a moderate agreement between IFAT and PCR. Thirty-seven adult ticks (20 females and 17 males) were collected from 15 horses. The most common tick was Hyalomma marginatum marginatum (n=19), followed by Hyalomma anatolicum excavatum (n=10), Rhipicephalus bursa (n=4), Hyalomma marginatum turanicum (n=3), and Hyalomma anatolicum anatolicum (n=1). The salivary glands and ovaries were also examined using PCR. The genomic DNA samples of the salivary glands of 3 ticks, H. a. excavatum (n=2) and R. bursa (n=1), had a

  11. Alguns ectoparasitas e protozoários em bovinos da República da Guiné-Bissau


    ROSA, FERNANDA; Crespo, Maria Virgínia; Travassos Dias, J. A.


    Os autores assinalam a presença de algumas espécies de ixodídeos (Amblyomma variegatum, Boophilus annulatus, B. geigy e Hyalomma sp.) localizados em diferentes regiões do corpo de bovinos autóctones da República da Guiné-Bissau, colhidos entre Novembro de 1990 e Março de 1991. A pesquisa de protozoários, efectuada principalmente em esfregaços de sangue revelou a presença de Anaplasma marginale, Theileria mutans, Babesia bigemina e Sarcocystis sp. Não foram encontradas lesões relacionada...

  12. [Lymphangitis-associated rickettsiosis caused by Rickettsia sibirica mongolitimonae]. (United States)

    Foissac, M; Socolovschi, C; Raoult, D


    Rickettsia sibirica mongolitimonae was first isolated 20 years ago in Asia but has now been identified on three continents. Hyalomma spp. and Rhipicephalus pusillus ticks are vectors but only a small number of cases have been reported to date, mainly on the Mediterranean coast. This bacterium induces the lymphangitis-associated rickettsiosis, a still unfamiliar rickettsiosis that is mainly characterized by fever with a rope-like lymphangitis and/or lymphadenopathy and skin eschar occurring after tick bites. These features are especially evocative if they occur in spring. Sequellae are very rare and treatment with doxycycline is recommended.

  13. Molecular detection of Ehrlichia canis, Anaplasma bovis, Anaplasma platys, Candidatus Midichloria mitochondrii and Babesia canis vogeli in ticks from Israel. (United States)

    Harrus, S; Perlman-Avrahami, A; Mumcuoglu, K Y; Morick, D; Eyal, O; Baneth, G


    : Ticks are vectors of important pathogens of human and animals. Therefore, their microbial carriage capacity is constantly being investigated. The aim of this study was to characterize the diversity of domestic animal pathogens in ticks collected from vegetation and the ground, from different parts of Israel. Non-engorged questing adult ticks were collected from 13 localities. A total of 1196 ticks in 131 pools-83 pools of Rhipicephalus turanicus and 48 of Rhipicephalus sanguineus (with two to ten ticks per pool)-were included in this study. In addition, 13 single free-roaming Hyalomma spp. ticks were collected. Screening by molecular techniques revealed the presence of Ehrlichia canis, Anaplasma platys, Anaplasma bovis and Babesia canis vogeli DNA in R. turanicus ticks. E. canis, A. bovis, B. canis vogeli and Candidatus Midichloria mitochondrii DNA sequences were detected in R. sanguineus ticks. Candidatus Midichloria mitochondrii DNA was also detected in Hyalomma spp. ticks. Neither Hepatozoon spp. nor Bartonella spp. DNA was detected in any of the ticks examined. This study describes the first detection of E. canis in the tick R. turanicus, which may serve as a vector of this canine pathogen; E. canis was the most common pathogen detected in the collected questing ticks. It also describes the first detection of A. bovis and Candidatus Midichloria mitochondrii in Israel. To the best of the author's knowledge, this is the first report describing the detection of DNA of the latter two pathogens in R. sanguineus, and of A. bovis in R. turanicus.

  14. The international trade in reptiles (Reptilia)--the cause of the transfer of exotic ticks (Acari: Ixodida) to Poland. (United States)

    Nowak, Magdalena


    The problem of the unnatural transfer of exotic ticks (Acari: Ixodida) on reptiles (Reptilia) imported to Poland is presented. In the period from 2003 to 2007, 382 specimens of reptiles belonging to the following genera were investigated: Testudo, Iguana, Varanus, Gongylophis, Python, Spalerosophis, Psammophis. The reptiles most infested with ticks are imported to Poland from Ghana in Africa, and are the commonly bred terrarium reptiles: Varanus exanthematicus and Python regius. As a result of the investigations, the transfer of exotic ticks on reptiles to Poland was confirmed. There were 2104 specimens of the genera Amblyomma and Hyalomma. The following species were found: Amblyomma exornatum Koch, 1844, Amblyomma flavomaculatum (Lucas, 1846), Amblyomma latum Koch, 1844, Amblyomma nuttalli Donitz, 1909, Amblyomma quadricavum (Schulze, 1941), Amblyomma transversale (Lucas, 1844), Amblyomma varanense (Supino, 1897), Amblyomma sp. Koch, 1844, Hyalomma aegyptium (Linnaeus, 1758). All the species of ticks of genus Amblyomma revealed have been discovered in Poland for the first time. During the research, 13 cases of anomalies of morphological structure were confirmed in the ticks A. flavomaculatum, A. latum and H. aegyptium. The expanding phenomenon of the import of exotic reptiles in Poland and Central Europe is important for parasitological and epidemiological considerations, and therefore requires monitoring and wide-ranging prophylactic activities to prevent the inflow of exotic parasites to Poland.

  15. Detection of naturally infected vector ticks (acari: ixodidae by different species of babesia and theileria agents from three different enzootic parts of iran.

    Directory of Open Access Journals (Sweden)

    Mohammad Abdigoudarzi


    Full Text Available Diagnostic study of vector ticks for different pathogens transmitted specifically have been done by Iranian old scientists working on the basis of biological transmission of pathogens. In this study we decided to confirm natural infection of different collected ticks from three different provinces of Iran.Ticks were collected from livestock (sheep, goats and cattle during favorable seasons (April to September 2007 and 2008. Slide preparations were stained by Giemsa and Feulgen and were studied searching for any trace of infection. Positive DNA from infected blood or tissue samples was provided and was used as positive control. First, PCR optimization for positive DNA was done, and then tick samples were subjected to specific PCR.Eleven pairs of primers were designed for detection of Theileria, Babesia and Anaplasma spp. Totally 21 tick samples were detected to be infected with protozoa. Hyalomma anatolicum anatolicum and Rhipicephalus turanicus from Fars Province were infected with T. lestoquardi at two different places. Hyalomma detritum was infected with T. lestoquardi in Lorestan Province and Rh. turanicus was infected to Ba. ovis from Fars Province.Totally 21 tick samples were detected to be infected with protozoa. Every sample is regarded with host-environment related factors. Since there are complex relations of vectors and their relevant protozoa, different procedures are presented for future studies.

  16. 南疆部分散养户牛场梨形虫及其媒介蜱感染情况的调查

    Institute of Scientific and Technical Information of China (English)

    吴永红; 刘玲; 王真; 巴音查汗


    [ Objective ] Piropiasmosis often occurred in the scattered feeding cattie farm in Southern Xinjiang. This disease is a tick - borne endemic biood protozoai disease with high mortaiity rate. This research aimed to investigate the prevaience rate of piropiasmosis and vector tick in some cattie farms better prevent and controi piropiasmosis and reduce the ioss that was caused by this disease to the raisers. [ method ] The author coiiected materiais with iocai veterinarians and owners, took them back to the schooi iaboratory, identified and anaiyzed the vector ticks and pathogen by microscope and the data about piropiasmosis. [ Result ] Bovine tropicai theiieriosis and bovine babesiosis were judged by comprehensive judgment, and the main vector ticks were Hyalomma detritum Hyalomma asiaticum and Boophilus microplus. The infection rate of biood protozoa was 84% : bovine theiieria annuiata 71. 4% ; Babesia bigemina 40. 5% ; babesia bovis 29%. [ Conclusion ] Through this survey we detaiied the occurrence and epidemic status of piropiasmosis in some cattie farms and the predominant distributive species of the iocai vector ticks, and found that there were severai piropiasmosis cross - infection. The resuit provides some scientific basis for the prevention of piropiasmosis.

  17. Prevalence and genetic diversity of piroplasm species in horses and ticks from Tunisia. (United States)

    Ros-García, Amaia; M'ghirbi, Youmna; Hurtado, Ana; Bouattour, Ali


    The genetic diversity and prevalence of Babesia and Theileria species in the equine population of Tunisia were studied using reverse line blot (RLB) hybridization on blood samples and unfed adult ticks collected from apparently healthy horses from three bioclimatic zones in Tunisia. Piroplasms were identified in 13 of 104 of the horse blood samples analyzed (12.5%) and five genotype groups were identified: Theileria equi group A (nine animals, 8.7%), group C (one animal, 1.0%) and group D (three animals, 2.9%), and Babesia caballi groups A and B (one animal each). All horses from the semi-arid zone were negative and prevalence in the humid and sub-humid zones were 12.9% and 20.0%, respectively. Three Ixodid tick species (Hyalomma marginatum, Hyalomma excavatum and Rhipicephalus bursa) were collected from examined horses and equine piroplasms were detected in 10.8% of them. T. equi groups A and D (9.2%), and B. caballi group B (1.6%) were identified in ticks. This work represents the first epidemiological report of equine piroplasmosis in Tunisia. Results showed a high level of diversity within the 18S rRNA gene of equine piroplasm species, and confirmed the presence in Tunisia of two T. equi genetic groups, C and D, only reported before in South Africa and Sudan.

  18. Ticks (Acari: Ixodida) parasitizing humans in Corum and Yozgat provinces, Turkey. (United States)

    Keskin, Adem; Keskin, Aysun; Bursali, Ahmet; Tekin, Saban


    In order to identify ticks infesting humans in Corum and Yozgat provinces in Turkey, a total of 2110 ticks representing 14 species were collected on humans, between June and September 2009. Of those, 1551 (687♂, 450♀, 407 nymphs, 7 larvae) were collected from Corum and 559 (330♂, 180♀, 49 nymphs) were collected from Yozgat. The majority of ticks (n = 1121, 53.1 %) was Hyalomma marginatum. Other common ticks infesting humans were Dermacentor marginatus (n = 209, 9.9 %) and Rhipicephalus turanicus sensu lato (n = 145, 6.9 %) in the study area. In addition, a total of 386 immature Hyalomma were found on humans in Corum (335 nymphs, 7 larvae) and Yozgat (44 nymphs). Ixodes laguri and Haemaphysalis erinacei taurica were recorded for the first time in Corum. To the best of our knowledge, this study is the first detailed investigation on ticks infesting humans in Corum and Yozgat, except individual or incidental records. The present study provides useful information for those concerned with ticks and tick-borne diseases in Turkey.

  19. Biogeography of Tick-Borne Bhanja Virus (Bunyaviridae in Europe

    Directory of Open Access Journals (Sweden)

    Zdenek Hubálek


    Full Text Available Bhanja virus (BHAV is pathogenic for young domestic ruminants and also for humans, causing fever and affections of the central nervous system. This generally neglected arbovirus of the family Bunyaviridae is transmitted by metastriate ticks of the genera Haemaphysalis, Dermacentor, Hyalomma, Rhipicephalus, Boophilus, and Amblyomma. Geographic distribution of BHAV covers southern and Central Asia, Africa, and southern (partially also central Europe. Comparative biogeographic study of eight known natural foci of BHAV infections in Europe (in Italy, Croatia, Bulgaria, Slovakia has revealed their common features. (1 submediterranean climatic pattern with dry growing season and wet mild winter (or microlimatically similar conditions, e.g., limestone karst areas in central Europe, (2 xerothermic woodland-grassland ecosystem, with plant alliances Quercetalia pubescentis, Festucetalia valesiacae, and Brometalia erecti, involving pastoral areas, (3 presence of at least one of the tick species Haemaphysalis punctata, Dermacentor marginatus, Rhipicephalus bursa, and/or Hyalomma marginatum, and (4 presence of ≥60% of the 180 BHAV bioindicator (157 plant, 4 ixodid tick, and 19 vertebrate spp.. On that basis, Greece, France (southern, including Corsica, Albania, Spain, Hungary, European Turkey, Ukraine (southern, Switzerland (southern, Austria (southeastern, Germany (southern, Moldova, and European Russia (southern have been predicted as additional European regions where BHAV might occur.

  20. Long term study of ixodid ticks feeding on red deer (Cervus elaphus) in a meso-Mediterranean climate. (United States)

    Valcárcel, F; González, J; Tercero Jaime, J M; Olmeda, A S


    Red deer (Cervus elaphus L.) are very valuable in trophy-hunting but also contribute to the preservation of natural areas. They are affected by many parasites and pathogens, including hard ticks that are not only important parasites themselves but can also act as vectors and/or reservoirs of pathogens. Tick phenology is complex insofar as population dynamics depend on environmental conditions, vegetation, host availability and their own intrinsic characteristic. Ticks were collected monthly from January 2007 to December 2014 from red deer on a natural reserve located in a meso-Mediterranean environment in Central Spain. A total of 8978 specimens of ixodid ticks were recovered with a mean Parasitization Index of 65.06 ticks/deer. Red deer were infected the whole year round with a summer-spring pattern and two secondary peaks in February and October. The main species was Hyalomma lusitanicum Koch followed by Rhipicephalus bursa Canestrini and Fanzago, Rhipicephalus pusillus Gil Collado, Dermacentor marginatus Sulzer and Ixodes ricinus L. Hyalomma lusitanicum has a complex life cycle in which several generations initiate their cycle at different times throughout the year, most probably lasting more than 1 year. We also describe the ability of nymphs to feed on large ungulates even though their habitual host is wild rabbit.

  1. Identification and functional characterization of a pyrokinin neuropeptide receptor in the Lyme disease vector, Ixodes scapularis. (United States)

    Gondalia, Kinsi; Qudrat, Anam; Bruno, Brigida; Fleites Medina, Janet; Paluzzi, Jean-Paul V


    Pyrokinin-related peptides are pleiotropic factors that are defined by their conserved C-terminal sequence FXPRL-NH2. The pyrokinin nomenclature derives from their originally identified myotropic actions and, as seen in some family members, a blocked amino terminus with pyroglutamate. The black-legged tick, Ixodes scapularis, is well known as a vector of Lyme disease and various other illnesses; however, in comparison to blood-feeding insects, knowledge on its physiology (along with other Ixodid ticks) is rather limited. In this study, we have isolated, examined the expression profile, and functionally deorphanized the pyrokinin peptide receptor in the medically important tick, I. scapularis. Phylogenetic analysis supports that the cloned receptor is indeed a bona fide member of the pyrokinin-related peptide receptor family. The tick pyrokinin receptor transcript expression is most abundant in the central nervous system (i.e. synganglion), but is also detected in trachea, female reproductive tissues, and in a pooled sample comprised of Malpighian (renal) tubules and the hindgut. Finally, functional characterization of the identified receptor confirmed it as a pyrokinin peptide receptor as it was activated equally by four endogenous pyrokinin-related peptides. The receptor was slightly promiscuous as it was also activated by a peptide sharing some structural similarity, namely the CAPA-periviserokinin (CAPA-PVK) peptide. Nonetheless, the I. scapularis pyrokinin receptor required a CAPA-PVK peptide concentration of well over three orders of magnitude to achieve a comparable receptor activation response, which indicates it is quite selective for its native pyrokinin peptide ligands. This study sets the stage for future research to examine the prospective tissue targets identified in order to resolve the physiological roles of this family of peptides in Ixodid ticks.

  2. First phylogenetic analysis of a Crimean-Congo hemorrhagic fever virus genome in naturally infected Rhipicephalus appendiculatus ticks (Acari: Ixodidae). (United States)

    Fakoorziba, Mohammad Reza; Naddaf-Sani, Ali Asghar; Moemenbellah-Fard, Mohammad Djaefar; Azizi, Kourosh; Ahmadnia, Sara; Chinikar, Sadegh


    Crimean-Congo haemorrhagic fever (CCHF) is a potentially fatal systemic viral disease in many parts of the world, including Iran. The nationwide incidence of human CCHF in endemic areas was 870 confirmed cases with 126 deaths (case fatality rate, CFR = 17.6 %) in the decade leading to 2012. The detection of the CCHF virus (CCHFV) genome in tick vectors is of fundamental importance for identifying these ticks as potential reservoirs of CCHFV infection. From May to October 2013, following detection of four new clinical cases resulting in two deaths in the city of Mashhad (northeast Iran), hard ticks were recovered from infested livestock in 40 villages in Khorasan-Razavi province and examined by the microscopic method for species identification. About a quarter of the ticks were then subjected to reverse-transcription polymerase chain reaction (RT-PCR) to detect the CCHFV genome. The PCR products were then sequenced, and their phylogenetic lineages were determined. A total of 407 hard ticks were captured, representing seven different species in two distinct genera. Members of the genus Hyalomma were widely distributed in all but two of the villages studied, and this was also the most frequent (83.3 %) tick genus. Of 105 adult ticks subjected to RT-PCR, four (3.8 %) ticks were found positive for the CCHFV genome. One brown ear tick, Rhipicephalus appendiculatus, was found to be naturally infected for the first time anywhere in the world. Ticks of Hyalomma asiaticum, Hyalomma marginatum, and Rhipicephalus turanicus were also found to be naturally infected with CCHFV. CCHFV found in these four different tick species were clustered in the same lineage with the Matin and SR3 strains from Pakistan and some other strains from Iran, indicating that these tick species were naturally infected with genetically closely related CCHFV in the region. The presence of CCHFV infection in four different hard tick species was confirmed using RT-PCR in northeast Iran. Part of this

  3. Hemolivia mauritanica (Haemogregarinidae: Apicomplexa infection in the tortoise Testudo graeca in the Near East with data on sporogonous development in the tick vector Hyalomna aegyptium

    Directory of Open Access Journals (Sweden)

    Paperna I.


    Full Text Available Testudo graeca tortoises were collected in the northern and southern Golan Heights (Israeli occupied territory of south Syria, and various locations in Israel and Palestine. Hyalomma aegyptium ticks were found only on Golan Height tortoises, and only the tortoises and ticks from the northern Golan Heights were infected with Hemolivia mauritanica. Tortoises became infected after ingesting infected ticks. Male ticks carrying sporocysts, which remain attached to tortoises for extended durations, apparently served as the source for dissemination of new infections among tortoises. Sporogenesis followed the pattern observed in the two other known species of Hemolivia, though there was some evident variation in fine-structural detail. The sutural slit detected in the H. mauritanica mature sporocyst wall was reminiscent of the suture characteristic of Coccidia of heterothermic vertebrate hosts; it could be a common ancestral character for both hemogregarines and Coccidia.

  4. Tick cell lines for study of Crimean-Congo hemorrhagic fever virus and other arboviruses. (United States)

    Bell-Sakyi, Lesley; Kohl, Alain; Bente, Dennis A; Fazakerley, John K


    Continuous cell lines derived from many of the vectors of tick-borne arboviruses of medical and veterinary importance are now available. Their role as tools in arbovirus research to date is reviewed and their potential application in studies of tick cell responses to virus infection is explored, by comparison with recent progress in understanding mosquito immunity to arbovirus infection. A preliminary study of propagation of the human pathogen Crimean-Congo hemorrhagic fever virus (CCHFV) in tick cell lines is reported; CCHFV replicated in seven cell lines derived from the ticks Hyalomma anatolicum (a known vector), Amblyomma variegatum, Rhipicephalus (Boophilus) decoloratus, Rhipicephalus (Boophilus) microplus, and Ixodes ricinus, but not in three cell lines derived from Rhipicephalus appendiculatus and Ornithodoros moubata. This indicates that tick cell lines can be used to study growth of CCHFV in arthropod cells and that there may be species-specific restriction in permissive CCHFV infection at the cellular level.

  5. 残缘璃眼蜱人工培育及对环形泰勒虫的实验性传播

    Institute of Scientific and Technical Information of China (English)

    罗建勋; 殷宏; 关贵全; 马米玲; 张其才; 吕文顺; 吕文祥


    将采自内蒙古自治区的残缘璃眼蜱(Hyalomma detritum)饲喂于牛体,观察了成虫、幼虫、若虫在实验室饲喂条件下的生活周期及滞育现象;通过蜱传播试验证实,残缘璃眼蜱饥饿幼虫、若虫吸入病原,其蜕化之若虫、成虫能将环形泰勒虫(Theileria annulata)传播给敏感动物,而幼虫阶段吸入病原,如若虫阶段在兔体饱血,所蜕化产生的饥饿成虫不传播该病.

  6. Ixodoidea of the Western Palaearctic: A review of available literature for identification of species. (United States)

    Estrada-Peña, Agustín; Pfäffle, Miriam; Baneth, Gad; Kleinerman, Gabriela; Petney, Trevor N


    We aim to produce a review of the most important literature references necessary for the identification of ticks of the families Ixodidae and Argasidae in Europe and northern Africa (i.e. the Western Palaearctic region). The purpose of this paper is to pinpoint a set of critically selected papers that contain reliable information on morphology, taxonomic keys, and comparative discussions which are critical for the identification of the ticks reported in the target region. When necessary, comments are provided on the systematic position of a species, or on suitable papers already addressing the issue. This review includes a list of 216 references which cover all Ixodoidea species reported as permanent residents of the Western Palaearctic, namely 28 species of the genus Ixodes, two Dermacentor, seven Haemaphysalis, nine Hyalomma, eight Rhipicephalus, five Argas and about seven species of Ornithodoros. Copyright © 2017 Elsevier GmbH. All rights reserved.

  7. Molecular epidemiology of Crimean- Congo hemorrhagic fever virus genome isolated from ticks of Hamadan province of Iran

    DEFF Research Database (Denmark)

    Tahmasebi, F; Ghiasi, Seyed Mojtaba; Mostafavi, E


    .2% of the ticks collected from livestock of different regions of the Hamadan province in western Iran. The infected species belonged to Hyalomma detritum, H. anatolicum, Rhipicephalus sanguineus and Argas reflexus. With one exception, genetic analysis of the virus genome isolates showed high sequence identity......BACKGROUND & OBJECTIVES: Crimean-Congo hemorrhagic fever (CCHF) virus is a tick-borne member of the genus Nairovirus, family Bunyaviridae. CCHFV has been isolated from at least 31 different tick species. The virus is transmitted through the bite of an infected tick, or by direct contact with CCHFV......-infected patients or the products of infected livestock. This study was undertaken to study the genetic relationship and distribution of CCHFV in the tick population of Hamadan province of Iran. METHOD: In this study, RT-PCR has been used for detection of the CCHFV genome. RESULTS: This genome was detected in 19...

  8. Rickettsia conorii israelensis in Rhipicephalus sanguineus ticks, Sardinia, Italy. (United States)

    Chisu, Valentina; Masala, Giovanna; Foxi, Cipriano; Socolovschi, Cristina; Raoult, Didier; Parola, Philippe


    The presence of tick-borne Rickettsia spp. was examined by PCR using DNA samples extracted from 254 ticks collected from mammals originating from northern and eastern Sardinia, Italy. The spotted fever group rickettsial agent Rickettsia conorii israelensis was detected in 3 Rhipicephalus sanguineus ticks from a dog for the first time in this geographical area. In addition, Ri. massiliae, Ri. slovaca, and Ri. aeschlimannii were detected in Rh. turanicus, Rh. sanguineus, Dermacentor marginatus, and Hyalomma marginatum marginatum ticks from dogs, goats, wild boar, and horse. Moreover, Candidatus Rickettsia barbariae was detected in 2 Rh. turanicus ticks from goats. The detection of Ri. conorii israelensis, an emergent agent which causes Israeli spotted fever, increases our knowledge on tick-borne rickettsioses in Sardinia.

  9. Rickettsia africae and Candidatus Rickettsia barbariae in ticks in Israel. (United States)

    Waner, Trevor; Keysary, Avi; Eremeeva, Marina E; Din, Adi Beth; Mumcuoglu, Kosta Y; King, Roni; Atiya-Nasagi, Yafit


    DNA of several spotted fever group rickettsiae was found in ticks in Israel. The findings include evidence for the existence of Rickettsia africae and Candidatus Rickettsia barbariae in ticks in Israel. The DNA of R. africae was detected in a Hyalomma detritum tick from a wild boar and DNA of C. Rickettsia barbariae was detected in Rhipicephalus turanicus and Rhipicephalus sanguineus collected from vegetation. The DNA of Rickettsia massiliae was found in Rh. sanguineus and Haemaphysalis erinacei, whereas DNA of Rickettsia sibirica mongolitimonae was detected in a Rhipicephalus (Boophilus) annulatus. Clinicians should be aware that diseases caused by a variety of rickettsiae previously thought to be present only in other countries outside of the Middle East may infect residents of Israel who have not necessarily traveled overseas. Furthermore, this study reveals again that the epidemiology of the spotted fever group rickettsiae may not only involve Rickettsia conorii but may include other rickettsiae.

  10. Molecular detection and characterization of spotted fever group rickettsiae in ticks from Central Italy. (United States)

    Scarpulla, M; Barlozzari, G; Marcario, A; Salvato, L; Blanda, V; De Liberato, C; D'Agostini, C; Torina, A; Macrì, G


    The aim of this study was to investigate the presence of rickettsial pathogens in ticks from Central Italy. A total of 113 ticks hailed from Latium and Tuscany regions were identified and tested by PCR to detect gltA, ompA, ompB genes of Rickettsia. Positive amplicons were sequenced and identified at species level. Ticks were analyzed individually or in pools. The percentage of positivity for SFG rickettsiae was 12.4%, expressed as minimum infection rate (MIR) assuming that one tick was positive in each positive pool. Rickettsia aeschlimannii was detected in Hyalomma marginatum, Rickettsia monacensis in Ixodes ricinus and Rickettsia massiliae and Rickettsia conorii in Rhipicephalus sanguineus sensu lato. These findings confirm the circulation of pathogenic rickettsiae in Latium and Tuscany regions. To our knowledge this is the first report of R. massiliae in Latium region.

  11. Genetic Analysis of Crimean-Congo Hemorrhagic Fever Virus in Russia (United States)

    Yashina, Lyudmila; Vyshemirskii, Oleg; Seregin, Sergei; Petrova, Irina; Samokhvalov, Evgeny; Lvov, Dmitry; Gutorov, Valery; Kuzina, Irina; Tyunnikov, Georgy; Tang, Yi-Wei; Netesov, Sergei; Petrov, Vladimir


    Genetic analysis of wild-type Crimean-Congo hemorrhagic fever (CCHF) virus strains recovered in the European part of Russia was performed. Reverse transcriptase PCR followed by direct sequencing was used to recover partial sequences of the CCHF virus medium (M) genome segment (M segment) from four pools of Hyalomma marginatum ticks and six human patients. Phylogenetic analysis of the M-segment sequences from Russian strains revealed a close relatedness of the strains (nucleotide sequence diversity, ≤5.0%). The strains differed significantly from CCHF viruses from other regions of the world (nucleotide sequence diversity, 10.3 to 20.4%), suggesting that CCHF virus strains recovered in the European part of Russia form a distinct group. PMID:12574301

  12. Ixodid ticks on cattle belonging to small-scale farmers at 4 communal grazing areas in South Africa

    Directory of Open Access Journals (Sweden)

    N.R. Bryson


    Full Text Available Ixodid ticks were collected during the period September 1991 to August 1993 from cattle belonging to small-scale farmers utilising 4 communal grazing areas. Three of these were in North West Province and 1 in Mpumalanga province, South Africa. Ten tick species were collected in North West Province and 7 in Mpumalanga. The adults of Amblyomma hebraeum, Rhipicephalus appendiculatus and Rhipicephalus evertsi evertsi were most numerous in North West Province, while in Mpumalanga Boophilus decoloratus comprised more than 75% of the total population. Amblyomma hebraeum was present on all grazing areas, and heavy infestations of adults occurred during the period October to May on 1 of these. Few B. decoloratus were collected in North West Province, chiefly because the sampling method was inadequate, and most of these were present during early summer (October to December and late summer and autumn (March to May. The initially low population of B. decoloratus in Mpumalanga increased substantially towards the conclusion of the survey, probably because of the cessation of dipping. Boophilus microplus was present in small numbers on 2 grazing areas in the North West Province. Adult Hyalomma marginatum rufipes reached peak numbers from December to February and Hyalomma truncatum from February to April in the North West Province. Only H. marginatum rufipes was collected in Mpumalanga. Rhipicephalus appendiculatus was present on all the grazing areas, with most adults present from December to April. Most adult Rhipicephalus evertsi evertsi were collected from September to April and Rhipicephalus simus was present during the period October-April.

  13. Growth of Ehrlichia canis, the causative agent of canine monocytic ehrlichiosis, in vector and non-vector ixodid tick cell lines. (United States)

    Ferrolho, Joana; Simpson, Jennifer; Hawes, Philippa; Zweygarth, Erich; Bell-Sakyi, Lesley


    Canine monocytic ehrlichiosis is caused by Ehrlichia canis, a small gram-negative coccoid bacterium that infects circulating monocytes. The disease is transmitted by the brown dog tick Rhipicephalus sanguineus s.l. and is acknowledged as an important infectious disease of dogs and other members of the family Canidae worldwide. E. canis is routinely cultured in vitro in the canine monocyte-macrophage cell line DH82 and in non-vector Ixodes scapularis tick cell lines, but not in cells derived from its natural vector. Here we report infection and limited propagation of E. canis in the tick cell line RSE8 derived from the vector R. sanguineus s.l., and successful propagation through six passages in a cell line derived from the experimental vector Dermacentor variabilis. In addition, using bacteria semi-purified from I. scapularis cells we attempted to infect a panel of cell lines derived from non-vector species of the tick genera Amblyomma, Dermacentor, Hyalomma, Ixodes and Rhipicephalus with E. canis and, for comparison, the closely-related Ehrlichia ruminantium, causative agent of heartwater in ruminants. Amblyomma and non-vector Dermacentor spp. cell lines appeared refractory to infection with E. canis but supported growth of E. ruminantium, while some, but not all, cell lines derived from Hyalomma, Ixodes and Rhipicephalus spp. ticks supported growth of both pathogens. We also illustrated and compared the ultrastructural morphology of E. canis in DH82, RSE8 and I. scapularis IDE8 cells. This study confirms that E. canis, like E. ruminantium, is able to grow not only in cell lines derived from natural and experimental tick vectors but also in a wide range of other cell lines derived from tick species not known to transmit this pathogen.

  14. Isolation of tick and mosquito-borne arboviruses from ticks sampled from livestock and wild animal hosts in Ijara District, Kenya. (United States)

    Lwande, Olivia Wesula; Lutomiah, Joel; Obanda, Vincent; Gakuya, Francis; Mutisya, James; Mulwa, Francis; Michuki, George; Chepkorir, Edith; Fischer, Anne; Venter, Marietjie; Sang, Rosemary


    Tick-borne viruses infect humans through the bite of infected ticks during opportunistic feeding or through crushing of ticks by hand and, in some instances, through contact with infected viremic animals. The Ijara District, an arid to semiarid region in northern Kenya, is home to a pastoralist community for whom livestock keeping is a way of life. Part of the Ijara District lies within the boundaries of a Kenya Wildlife Service-protected conservation area. Arbovirus activity among mosquitoes, animals, and humans is reported in the region, mainly because prevailing conditions necessitate that people continuously move their animals in search of pasture, bringing them in contact with ongoing arbovirus transmission cycles. To identify the tick-borne viruses circulating among these communities, we analyzed ticks sampled from diverse animal hosts. A total of 10,488 ticks were sampled from both wildlife and livestock hosts and processed in 1520 pools of up to eight ticks per pool. The sampled ticks were classified to species, processed for virus screening by cell culture using Vero cells and RT-PCR (in the case of Hyalomma species), followed by amplicon sequencing. The tick species sampled included Rhipicephalus pulchellus (76.12%), Hyalomma truncatum (8.68%), Amblyomma gemma (5.00%), Amblyomma lepidum (4.34%), and others (5.86%). We isolated and identified Bunyamwera (44), Dugbe (5), Ndumu (2), Semliki forest (25), Thogoto (3), and West Nile (3) virus strains. This observation constitutes a previously unreported detection of mosquito-borne Semliki forest and Bunyamwera viruses in ticks, and association of West Nile virus with A. gemma and Rh. pulchellus ticks. These findings provide additional evidence on the potential role of ticks and associated animals in the circulation of diverse arboviruses in northeastern Kenya, including viruses previously known to be essentially mosquito borne.


    Directory of Open Access Journals (Sweden)



    Full Text Available Crimean-Congo hemorrhagic fever (CCHF is a viral disease of Buynaviridae family. Disease is primarily zoonosis but sporadic and epidemic human infection can occur. During year 2001 many outbreaks have been reported from Kosovo, Iran, Albania and Pakistan. A Hyalomma tick can transmit the disease and virus reservoirs are rodents, ostrich, ground frequenting birds and hyalomma tick. Another way of human infection is contact with infected animal blood and products or crushing a tick with bare hands. Contact with infected human blood can also transmit the disease. During outbreak, 18 cases were confirmed by serologic methods. 12 men and 6 women aged 20-40 years old. Ten of men and 5 of women had history of contact with infected animal blood or tissue and a lady had been bitten by a tick. A young assistant of internal medicine who came in contact with the first patient, developed the disease. We were not able to determine route of transmission in one case. The most frequent clinical signs included fever, myalgia, weakness, fatique, bleeding tendency, petechia, purpura and jundice. Lab exam revealed thrombocytopenia, elevated liver enzymes and prolongation of prothrombin time. Althoug the most common route of human infection is tick bite, but in this outbreak the main route was contact with infected animal blood and tissue. This point confirms that unsanitary slaughtering of animal could be dangerous. It seems that reeducating physicians, veterinarians and those who take care of such patients maybe helpful to neighboring countries triggered the outbreak, so that educating people who are involved in husbandry may limiting human infection.

  16. Prevalence of Theileria equi and Babesia caballi as well as the identification of associated ticks in sympatric Grevy's zebras (Equus grevyi) and donkeys (Equus africanus asinus) in northern Kenya. (United States)

    Hawkins, Elaine; Kock, Richard; McKeever, Declan; Gakuya, Francis; Musyoki, Charles; Chege, Stephen M; Mutinda, Mathew; Kariuki, Edward; Davidson, Zeke; Low, Belinda; Skilton, Robert A; Njahira, Moses N; Wamalwa, Mark; Maina, Elsie


    The role of equine piroplasmosis as a factor in the population decline of the Grevy's zebra is not known. We determined the prevalence of Babesia caballi and Theileria equi in cograzing Grevy's zebras (Equus grevyi) and donkeys (Equus africanus asinus) in northern Kenya and identified the associated tick vectors. Blood samples were taken from 71 donkeys and 16 Grevy's zebras from March to May 2011. A nested PCR reaction using 18s ribosomal (r)RNA primers on 87 blood spots showed 72% (51/71; 95% confidence interval [CI] 60.4-81.0%) of donkeys and 100% (16/16; 95% CI, 77.3-100%) of Grevy's zebras were T. equi positive. No samples were positive for B. caballi. Sequence comparison using the National Center for Biotechnology Information's basic local alignment search tool identified homologous 18s rRNA sequences with a global geographic spread. The T. equi-derived sequences were evaluated using Bayesian approaches with independent Metropolis-coupled Markov chain Monte Carlo runs. The sequences clustered with those found in Sudan, Croatia, Mongolia, and the US, with statistical support greater than 80% for the two main clades. Hyalomma tick species were found on both donkeys and Grevy's zebras, whereas Rhipicephalus pulchellus was found exclusively on Grevy's zebras and Hyalomma marginatum rupfipes on donkeys. The prevalence of T. equi was 100% in Grevy's zebras and 72% in donkeys with common tick vectors identified. Our results suggest that donkeys and Grevy's zebras can be asymptomatic carriers and that piroplasmosis is endemic in the study area.

  17. Molecular detection of Theileria spp. and Babesia spp. in sheep and ixodid ticks from the northeast of Iran. (United States)

    Razmi, Gholamreza; Pourhosseini, Moslem; Yaghfouri, Saeed; Rashidi, Ahmad; Seidabadi, Mohsen


    Theilerioses and babesioses are important diseases in Iranian sheep. The present study was undertaken to identify and classify/specify Theileria spp. and Babesia spp. in sheep and vector ticks. Investigation was carried out from 2009 to 2011 in the Khorasan Razavi Province, Iran. In total, 302 sheep originating from 60 different flocks were clinically examined and their blood collected. In addition, from the same flocks, ixodid ticks were sampled. Stained blood smears were microscopically examined for the presence of Theileria and Babesia organisms, and a semi-nested PCR was used for subsequent molecular specification. From the ticks, salivary glands and uterus were isolated and subsequently analyzed by semi-nested PCR. Piroplasm organisms were observed in 29% of the blood smears with low parasitemia, whereas 65% of the blood samples yielded positive PCR findings. The presence of Theileria ovis (55.6%), Theileria lestoquardi, and mixed infection with Theileria spp. and Babesia ovis were detected by semi-nested PCR in 0.3%, 5.6%, and 0.99%, respectively. In total, 429 ixodid ticks were collected from different areas of the province. The most prevalent ticks were Rhipicephalus turanicus (n = 376; 87.6% of the total), followed by Hyalomma marginatum turanicum (n = 30; 7.0%), Dermacentor raskemensis (n = 12; 2.8%), Hyalomma anatolicum anatolicum (n = 7; 1.6%), Dermacentor marginatus (n = 2; 0.5%), Rhipicephalus bursa (n = 1; 0.2%), and Haemaphysalis sp. (n = 1; 0.2%). Of the positive R. turanicus samples, 5 (5.7%) were infected with T. ovis and 2 (2.9%) with T. lestoquardi. Neither Babesia ovis nor Babesia motasi infection was detected in salivary glands or uterine samples of the ticks. The results also suggest that R. turanicus could be the vector responsible for transmission of the 2 Theileria species.

  18. Tick burden and prevalence of Theileria parva infection in Tarime zebu cattle in the lake zone of Tanzania. (United States)

    Laisser, Emmanuel Levillal Katamboi; Kipanyula, Maulilio John; Msalya, George; Mdegela, Robinson Hammerthon; Karimuribo, Esron Daniel; Mwilawa, Anjello Joseph; Mwega, Elisa Daniel; Kusiluka, Lughano; Chenyambuga, Sebastian Wilson


    This study was carried out to assess the distribution, abundance of different tick genera and prevalence of Theileria parva infection in Tarime zebu cattle kept in selected wards of Serengeti and Tarime districts in Mara region. Adult ticks were identified and counted from half body parts of 360 animals which were extensively managed in communal land with natural pastures. Concurrently, blood samples were collected and thereafter DNA extracted and a nested polymerase chain reaction (nPCR) was done using primers specific for p104 gene to detect the presence of T. parva DNA. Ticks were identified into four groups: Amblyomma genus, Boophilus sub-genus of Rhipicephalus genus, other species of Rhipicephalus, and Hyalomma genus. Rhipicephalus genus accounted for 71.8 % of the total ticks, whereas Amblyomma, Boophilus sub-genus of Rhipicephalus genus and Hyalomma constituted 14.1, 14.0 and 0.1 %, respectively. There were more animals (p < 0.05) infested with ticks in Tarime district (96.1 %) than in Serengeti (61.7 %). The average counts of ticks were higher in adult animals (p < 0.05) than in young animals. The overall prevalence of T. parva was 27.7 % and was higher (p < 0.05) in Serengeti (38.3 %) than in Tarime district (16.7 %). However, all animals tested positive for T. parva did not show any clinical signs of East Coast fever (ECF), suggesting the existence of subclinical infection in Tarime zebu. These results suggest that Tarime cattle can tolerate ECF infection and are likely to serve as potential carriers of T. parva to other less-tolerant cattle breeds in mixed herds. Since Tarime cattle are preferred by most farmers with mixed herds, routine screening for T. parva is highly recommended to minimize introduction of infected cattle into an immunologically naive population.

  19. Histamine release factor from Dermanyssus gallinae (De Geer): characterization and in vitro assessment as a protective antigen. (United States)

    Bartley, Kathryn; Nisbet, Alasdair J; Offer, Jill E; Sparks, Nicholas H C; Wright, Harry W; Huntley, John F


    A cDNA encoding a 174-amino-acid orthologue of a tick histamine release factor (HRF) was identified from the haematophagous poultry red mite Dermanyssus gallinae. The predicted D. gallinae HRF protein (Dg-HRF-1) sequence is highly conserved with the tick HRFs (identity 52-54%) and to a lesser degree with translationally controlled tumour proteins (TCTP) from mammals and other invertebrates (range 38-47%). Phylogenetically, Dg-HRF-1 partitions with the tick HRF clade suggesting a shared linage and potentially similar function(s). A recombinant Dg-HRF-1 protein (rDg-HRF-1) was produced and shown to induce degranulation of rat peritoneal mast cells in vitro, confirming conservation of the histamine-releasing function in D. gallinae. Polyclonal antibodies were generated in rabbits and hens to rDg-HRF-1. Western blotting demonstrated that native Dg-HRF is a soluble protein and immunohistochemical staining of mite sections revealed that the distribution of Dg-HRF, although ubiquitous, is more common in mite reproductive, digestive and synganglion tissues. A survey of hens housed continuously in a mite-infested commercial poultry unit failed to identify IgY specific for recombinant or native Dg-HRF, indicating that Dg-HRF is not exposed to the host during infestation/feeding and may therefore have potential as a vaccine using the concealed antigen approach. To test the protective capability of rDg-HRF-1, fresh heparinised chicken blood was enriched with yolk-derived anti-Dg-HRF IgY antibodies and fed to semi-starved mites using an in vitro feeding system. A statistically significant increase in mortality was shown (P=0.004) in mites fed with anti-Dg-HRF IgY after just one blood meal. The work presented here demonstrates, to our knowledge for the first time, the feasibility of vaccinating hens with recombinant D. gallinae antigens to control mite infestation and the potential of rDg-HRF-1 as a vaccine antigen.

  20. Acetylcholinesterases of blood-feeding flies and ticks. (United States)

    Temeyer, Kevin B; Tuckow, Alexander P; Brake, Danett K; Li, Andrew Y; Pérez de León, Adalberto A


    Acetylcholinesterase (AChE) is the biochemical target of organophosphate (OP) and carbamate pesticides for invertebrates, vertebrate nerve agents, and AChE inhibitors used to reduce effects of Alzheimer's disease. Organophosphate pesticides (OPs) are widely used to control blood-feeding arthropods, including biting flies and ticks. However, resistance to OPs in pests affecting animal and human health has compromised control efficacy. OP resistance often results from mutations producing an OP-insensitive AChE. Our studies have demonstrated production of OP-insensitive AChEs in biting flies and ticks. Complementary DNA (cDNA) sequences encoding AChEs were obtained for the horn fly, stable fly, sand fly, and the southern cattle tick. The availability of cDNA sequences enables the identification of mutations, expression and characterization of recombinant proteins, gene silencing for functional studies, as well as in vitro screening of novel inhibitors. The southern cattle tick expresses at least three different genes encoding AChE in their synganglion, i.e. brain. Gene amplification for each of the three known cattle tick AChE genes and expression of multiple alleles for each gene may reduce fitness cost associated with OP-resistance. AChE hydrolyzes the neurotransmitter, acetylcholine, but may have additional roles in physiology and development. The three cattle tick AChEs possess significantly different biochemical properties, and are expressed in neural and non-neural tissues, which suggest separation of structure and function. The remarkable complexity of AChEs in ticks suggested by combining genomic data from Ixodes scapularis with our genetic and biochemical data from Rhipicephalus microplus is suggestive of previously unknown gene duplication and diversification. Comparative studies between invertebrate and vertebrate AChEs could enhance our understanding of structure-activity relationships. Research with ticks as a model system offers the opportunity to

  1. Molecular surveillance of Theileria ovis, Theileria lestoquardi and Theileria annulata infection in sheep and ixodid ticks in Iran

    Directory of Open Access Journals (Sweden)

    Gholamreza Razmi


    Full Text Available A molecular study was undertaken to detect Theileria ovis, Theileria lestoquardi and Theileria annulatain sheep and tick vectors. Investigation was conducted from 2010 to 2011 in the south of Khorasan Razavi Province, Iran. A total of 150 blood samples were collected from 30 different sheep flocks. In addition, ixodid ticks were sampled from the same flocks. The stained blood smears were microscopically examined for the presence of piroplasms and a semi-nested polymerase chain reaction-restriction (PCR was used for subsequent molecular speciation. Salivary glands were isolated from the ticks and subsequently analysed by semi-nested PCR. polymerase chain reaction-restriction fragment length polymorphism (PCR-RFLP was used to differentiate between T. lestoquardi and T. annulata from PCR-positive samples. Theileria species infection was microscopically detected in 18.6% of blood smears. The presence of T. ovis and T. lestoquardi or T. annulata was detected by semi-nested PCR in 58.6% and 6.6% of blood samples respectively. In total, 169 ixodid ticks were collected from different areas of the province. The most prevalent ticks were Rhipicephalus turanicus (n = 155; 91.7% of the total, followed by Hyalomma anatolicum anatolicum (n = 8; 4.7% and Hyalomma marginatum turanicum (n = 6; 3.5%. From an organ pooling of 33 ticks, three pools of salivary glands from R. turanicus were positive for Theileria species by semi-nested PCR. Of the three R. turanicus samples testing positive for Theileria species, two (6.1% were positive for T. ovis and one (3.0% for T. lestoquardi or T. annulata. Amongst the 11 PCR-positive samples for T. lestoquardi or T. annulata, 10 were positive for T. lestoquardi and one sample was positive for both T. lestoquardi and T. annulata using PCR-RFLP. The results also demonstrated that PCR-RFLP could be used for the detection of T. ovis. Based on the results, it can be concluded that T. ovis has a higher

  2. Molecular surveillance of Theileria ovis, Theileria lestoquardi and Theileria annulata infection in sheep and ixodid ticks in Iran. (United States)

    Razmi, Gholamreza; Yaghfoori, Saeed


    A molecular study was undertaken to detect Theileria ovis, Theileria lestoquardi and Theileria annulata in sheep and tick vectors. Investigation was conducted from 2010 to 2011 in the south of Khorasan Razavi Province, Iran. A total of 150 blood samples were collected from 30 different sheep flocks. In addition, ixodid ticks were sampled from the same flocks. The stained blood smears were microscopically examined for the presence of piroplasms and a semi-nested polymerase chain reaction-restriction (PCR) was used for subsequent molecular speciation. Salivary glands were isolated from the ticks and subsequently analysed by semi-nested PCR. polymerase chain reaction-restriction fragment length polymorphism (PCR-RFLP) was used to differentiate between T. lestoquardi and T. annulata from PCR-positive samples. Theileria species infection was microscopically detected in 18.6% of blood smears. The presence of T. ovis and T. lestoquardi or T. annulata was detected by semi-nested PCR in 58.6% and 6.6% of blood samples respectively. In total, 169 ixodid ticks were collected from different areas of the province. The most prevalent ticks were Rhipicephalus turanicus (n = 155; 91.7% of the total), followed by Hyalomma anatolicum anatolicum (n = 8; 4.7%) and Hyalomma marginatum turanicum (n = 6; 3.5%). From an organ pooling of 33 ticks, three pools of salivary glands from R. turanicus were positive for Theileria species by semi-nested PCR. Of the three R. turanicus samples testing positive for Theileria species, two (6.1%) were positive for T. ovis and one (3.0%) for T. lestoquardi or T.annulata. Amongst the 11 PCR-positive samples for T. lestoquardi or T. annulata, 10 were positive for T. lestoquardi and one sample was positive for both T. lestoquardi and T. annulata using PCR-RFLP. The results also demonstrated that PCR-RFLP could be used for the detection of T. ovis. Based on the results, it can be concluded that T. ovis has a higher prevalence than T. lestoquardi, and that R

  3. Identification of tick-borne pathogens in ticks feeding on humans in Turkey.

    Directory of Open Access Journals (Sweden)

    Ömer Orkun


    Full Text Available The importance of tick-borne diseases is increasing all over the world, including Turkey. The tick-borne disease outbreaks reported in recent years and the abundance of tick species and the existence of suitable habitats increase the importance of studies related to the epidemiology of ticks and tick-borne pathogens in Turkey. The aim of this study was to investigate the presence of and to determine the infection rates of some tick-borne pathogens, including Babesia spp., Borrelia burgdorferi sensu lato and spotted fever group rickettsiae in the ticks removed from humans in different parts of Ankara.A total of 169 ticks belonging to the genus Haemaphysalis, Hyalomma, Ixodes and Rhipicephalus were collected by removing from humans in different parts of Ankara. Ticks were molecularly screened for Babesia spp., Borrelia burgdorferi sensu lato and spotted fever group rickettsiae by PCR and sequencing analysis. We detected 4 Babesia spp.; B. crassa, B. major, B. occultans and B. rossi, one Borrelia spp.; B. burgdorferi sensu stricto and 3 spotted fever group rickettsiae; R. aeschlimannii, R. slovaca and R. hoogstraalii in the tick specimens analyzed. This is the report showing the presence of B. rossi in a region that is out of Africa and in the host species Ha. parva. In addition, B. crassa, for which limited information is available on its distribution and vector species, and B. occultans, for which no conclusive information is available on its presence in Turkey, were identified in Ha. parva and H. marginatum, respectively. Two human pathogenic rickettsia species (R. aeschlimannii and R. slovaca were detected with a high prevalence in ticks. Additionally, B. burgdorferi sensu stricto was detected in unusual tick species (H. marginatum, H. excavatum, Hyalomma spp. (nymph and Ha. parva.This study investigates both the distribution of several tick-borne pathogens affecting humans and animals, and the presence of new tick-borne pathogens in Turkey

  4. Influence of sheep breed and application site on the efficacy of a flumethrin pour-on formulation against ticks

    Directory of Open Access Journals (Sweden)

    L.J. Fourie


    Full Text Available The objectives of this study were to determine the influence of application site and sheep breed on the efficacy of a flumethrin (1 % m/v solution for the control of 'bont'-legged (Hyalomma spp. and red-legged ticks (Rhipicephalus evertsi evertsi. This study was conducted from November 1996 to February 1997 on 3 farms in the southwestern Free State Province. Two trials were conducted on Dorper sheep and 2 on Merino sheep. For each specific application 30 sheep were selected and allocated to 3 groups of 10 animals each using randomisation through minimisation, with pre-treatment total tick count as only criterion. Groups consisted of an untreated control group, a group treated with 3 m of a flumethrin (1 % m/v solution applied only to the anogenital region, and a group treated at a dose rate of 1 m flumethrin (1% m/v/5 kg host body mass. The total dose volume for animals in the last group was divided into 3 equal parts and applied to the brisket/axillae, groin and anogenital regions respectively. Animals grazed under extensive farming conditions and were infested by ticks that occurred naturally in the environment. Ticks were counted and removed weekly over a 6-week period. In all 4 trials, Rhipicephalus e. evertsi was the dominant tick species, followed, in 3 of the trials, by Hyalomma spp. Efficacy (% of control against ticks for Dorper sheep, treated only on the anogenital region, was variable, ranging between 29.5 and 97 %. In Merino sheep the efficacy values ranged between 23.1 and 90 %. The site-spcific (anogenital region efficacy of control against ticks infesting Merino sheep was in general 100 % or almost 100 %. In Dorper sheep the efficacy values were >80 % for 3-5 weeks. The efficacy (% of control against ticks for sheep treated on the brisket/axillae, groin and anogenital regions was always higher compared to sheep treated only on the anogenital region. In Dorper sheep, efficacy of control was >80 % for up to 4 weeks and in Merino

  5. Identification of tick-borne pathogens in ticks feeding on humans in Turkey. (United States)

    Orkun, Ömer; Karaer, Zafer; Çakmak, Ayşe; Nalbantoğlu, Serpil


    The importance of tick-borne diseases is increasing all over the world, including Turkey. The tick-borne disease outbreaks reported in recent years and the abundance of tick species and the existence of suitable habitats increase the importance of studies related to the epidemiology of ticks and tick-borne pathogens in Turkey. The aim of this study was to investigate the presence of and to determine the infection rates of some tick-borne pathogens, including Babesia spp., Borrelia burgdorferi sensu lato and spotted fever group rickettsiae in the ticks removed from humans in different parts of Ankara. A total of 169 ticks belonging to the genus Haemaphysalis, Hyalomma, Ixodes and Rhipicephalus were collected by removing from humans in different parts of Ankara. Ticks were molecularly screened for Babesia spp., Borrelia burgdorferi sensu lato and spotted fever group rickettsiae by PCR and sequencing analysis. We detected 4 Babesia spp.; B. crassa, B. major, B. occultans and B. rossi, one Borrelia spp.; B. burgdorferi sensu stricto and 3 spotted fever group rickettsiae; R. aeschlimannii, R. slovaca and R. hoogstraalii in the tick specimens analyzed. This is the report showing the presence of B. rossi in a region that is out of Africa and in the host species Ha. parva. In addition, B. crassa, for which limited information is available on its distribution and vector species, and B. occultans, for which no conclusive information is available on its presence in Turkey, were identified in Ha. parva and H. marginatum, respectively. Two human pathogenic rickettsia species (R. aeschlimannii and R. slovaca) were detected with a high prevalence in ticks. Additionally, B. burgdorferi sensu stricto was detected in unusual tick species (H. marginatum, H. excavatum, Hyalomma spp. (nymph) and Ha. parva). This study investigates both the distribution of several tick-borne pathogens affecting humans and animals, and the presence of new tick-borne pathogens in Turkey. More

  6. Tick repellents and acaricides of botanical origin: a green roadmap to control tick-borne diseases? (United States)

    Benelli, Giovanni; Pavela, Roman; Canale, Angelo; Mehlhorn, Heinz


    Arthropods are dangerous vectors of agents of deadly diseases, which may hit as epidemics or pandemics in the increasing world population of humans and animals. Among them, ticks transmit more pathogen species than any other group of blood-feeding arthropods worldwide. Thus, the effective and eco-friendly control of tick vectors in a constantly changing environment is a crucial challenge. A number of novel routes have been attempted to prevent and control tick-borne diseases, including the development of (i) vaccines against viruses vectored by ticks; (ii) pheromone-based control tools, with special reference to the "lure and kill" techniques; (iii) biological control programmes relying on ticks' natural enemies and pathogens; and (iv) the integrated pest management practices aimed at reducing tick interactions with livestock. However, the extensive employment of acaricides and tick repellents still remains the two most effective and ready-to-use strategies. Unfortunately, the first one is limited by the rapid development of resistance in ticks, as well as by serious environmental concerns. On the other hand, the exploitation of plants as sources of effective tick repellents is often promising. Here, we reviewed current knowledge concerning the effectiveness of plant extracts as acaricides or repellents against tick vectors of public health importance, with special reference to Ixodes ricinus, Ixodes persulcatus, Amblyomma cajennense, Haemaphysalis bispinosa, Haemaphysalis longicornis, Hyalomma anatolicum, Hyalomma marginatum rufipes, Rhipicephalus appendiculatus, Rhipicephalus (Boophilus) microplus, Rhipicephalus pulchellus, Rhipicephalus sanguineus and Rhipicephalus turanicus. Eighty-three plant species from 35 botanical families were selected. The most frequent botanical families exploited as sources of acaricides and repellents against ticks were Asteraceae (15 % of the selected studies), Fabaceae (9 %), Lamiaceae (10 %), Meliaceae (5 %), Solanaceae (6

  7. Efficacy of larvicidal activity of green synthesized titanium dioxide nanoparticles using Mangifera indica extract against blood-feeding parasites. (United States)

    Rajakumar, Govindasamy; Rahuman, Abdul Abdul; Roopan, Selvaraj Mohana; Chung, Ill-Min; Anbarasan, Karunanithi; Karthikeyan, Viswanathan


    Titanium dioxide nanoparticles (TiO2 NPs) are considered to be among the best photocatalytic materials due to their long-term thermodynamic stability, strong oxidizing power, and relative non-toxicity. Nano-preparations with TiO2 NPs are currently under investigation as novel treatments for acne vulgaris, recurrent condyloma acuminata, atopic dermatitis, hyperpigmented skin lesions, and other non-dermatologic diseases. The present study was to investigate the acaricidal and larvicidal activity of synthesized TiO2 NPs utilizing leaf aqueous extract of Mangifera indica L. (Anacardiaceae) against hematophagous parasites. The anti-parasitic activity of TiO2 NPs against the larvae of Rhipicephalus (Boophilus) microplus, Hyalomma anatolicum anatolicum and Haemaphysalis bispinosa (Acari: Ixodidae), fourth instar larvae of Anopheles subpictus, and Culex quinquefasciatus (Diptera: Culicidae) were assessed. The green synthesized TiO2 NPs were analyzed by UV-Vis, FTIR, X-ray diffraction (XRD), AFM, SEM, and TEM. The XRD analysis of synthesized TiO2 NPs revealed the dominant peak at 2θ value of 27.81 which matched the 110 crystallographic plane of the rutile structure indicating the crystal structure. The FTIR spectra exhibited a prominent peak at 3,448 cm(-1) and showed OH stretching due to the alcoholic group, and the OH group may act as a capping agent. The SEM images of TiO2 NPs displayed spherical, oval in shape, individual, and some in aggregates. Characterization of the synthesized TiO2 NPs using AFM offered three-dimensional visualization and uneven surface morphology. The TEM micrograph showed agglomerates, round and slight elongation with an average size of 30 ± 5 nm. The maximum efficacy was observed in synthesized TiO2 NPs against the larvae of R. microplus, Hyalomma anatolicum anatolicum, Haemaphysalis bispinosa, A. subpictus, and Culex quinquefasciatus with LC50 value of 28.56, 33.17, 23.81, 5.84, and 4.34 mg/L, respectively. In the present study, a novel

  8. Determination of Rodent Ectoparasite Fauna in Sarpole-Zahab District, Kermanshah Province, Iran, 2004-2005

    Directory of Open Access Journals (Sweden)

    Z Telmadarraiy


    Full Text Available Ectoparasites of various species of rodents were examined from Sarepole Zehab, Kermanshah Province Iran during 2005. This city is bordered with Iraq. A total of 139 rodents included 6 species of hosts were captured during all different seasons and examined for ectoparasites using live trap. The area of study was mainly plateu (70% and mountanous. The hosts including: Microtus socialis, Mus musculus, Rattus rattus, Nesokia indica, Meriones persicus and Tatera indica. The 9 species of ectoparasites recovered included 3 fleas (Pulex irritans, Xenopsylla buxtoni, Nosopsyllus medus, one sucking lice (Polyplax spinolosa, two ticks (Rhipicephalus sp., Hyalomma sp., and 3 mites (Lealaps nuttalli, Dermanysus sanguineus, Ornithonussus bacoti. Among all arthropod collected, the lice and flea had the most and least frequency, i.e. 77.7% and 4.4%, respectivelly. The data showed that the ectoparasites on some rodent hosts tend to prefer particular host body sites, and that some ectoparasite species sites may overlap owing to their inaccessibility to the host.

  9. Determination of Rodent Ectoparasite Fauna in Sarpole-Zahab District, Kermanshah Province, Iran, 2004-2005

    Directory of Open Access Journals (Sweden)

    Z Telmadarraiy


    Full Text Available Ectoparasites of various species of rodents were examined from Sarepole Zehab, Kermanshah Province Iran during 2005. This city is bordered with Iraq. A total of 139 rodents included 6 species of hosts were captured during all different seasons and examined for ectoparasites using live trap. The area of study was mainly plateu (70% and mountanous. The hosts including: Microtus socialis, Mus musculus, Rattus rattus, Nesokia indica, Meriones persicus and Tatera indica. The 9 species of ectoparasites recovered included 3 fleas (Pulex irritans, Xenopsylla buxtoni, Nosopsyllus medus, one sucking lice (Polyplax spinolosa, two ticks (Rhipicephalus sp., Hyalomma sp., and 3 mites (Lealaps nuttalli, Dermanysus sanguineus, Ornithonussus bacoti. Among all arthropod collected, the lice and flea had the most and least frequency, i.e. 77.7% and 4.4%, respectivelly. The data showed that the ectoparasites on some rodent hosts tend to prefer particular host body sites, and that some ectoparasite species sites may overlap owing to their inaccessibility to the host.

  10. Fatal cases of Theileria annulata infection in calves in Portugal associated with neoplastic-like lymphoid cell proliferation (United States)

    Orvalho, João; Leitão, Alexandre; Pereira, Isadora; Malta, Manuel; Mariano, Isabel; Carvalho, Tânia; Baptista, Rui; Shiels, Brian R.; Peleteiro, Maria C.


    This study was carried out to investigate fifteen cases of acute lethal infection of calves (≤ 4 months of age) by the protozoan parasite Theileria (T.) annulata in the south of Portugal. Calves developed multifocal to coalescent nodular skin lesions, similar to multicentric malignant lymphoma. Infestation with ticks (genus Hyalomma) was intense. Theileria was seen in blood and lymph node smears, and T. annulata infection was confirmed by isolation of schizont-transformed cells and sequencing of hypervariable region 4 of the 18S rRNA gene. At necropsy, hemorrhagic nodules or nodules with a hemorrhagic halo were seen, particularly in the skin, subcutaneous tissue, skeletal and cardiac muscles, pharynx, trachea and intestinal serosa. Histologically, nodules were formed by large, round, lymphoblastoid neoplastic-like cells. Immunohistochemistry (IHC) identified these cells as mostly CD3 positive T lymphocytes and MAC387 positive macrophages. A marker for B lymphocytes (CD79αcy) labeled very few cells. T. annulata infected cells in these nodules were also identified by IHC through the use of two monoclonal antibodies (1C7 and 1C12) which are diagnostic for the parasite. It was concluded that the pathological changes observed in the different organs and tissues were caused by proliferation of schizont-infected macrophages, which subsequently stimulate a severe uncontrolled proliferation of uninfected T lymphocytes. PMID:20195062

  11. Acaricide efficiency of amitraz / cypermethrin and abamectin pour-on preparations in game

    Directory of Open Access Journals (Sweden)

    J.S. Van der Merwe


    Full Text Available The efficacy of an amitraz / cypermethrin pour-on preparation (1 % w/v each was tested against natural tick infestations of buffaloes, eland and blesbok in three separate trials. The eland were also treated with a 0.02 % abamectin (w/v acaricidal pour-on preparation. The amitraz / cypermethrin pour-on was effective against Amblyomma hebraeum, Rhipicephalus evertsi evertsi, Rhipicephalus appendiculatus and Hyalomma marginatum rufipes on the buffaloes. Both acaricides were effective against R. appendiculatus and Rhipicephalus (Boophilus decoloratus in the eland. The amitraz / cypermethrin acaricide was effective against R. (Boophilus decoloratus in the blesbok. Ticks can cause damage to the skins, secondary infections, abscesses, anaemia, loss of condition, tick toxicosis and act as vectors of infectious diseases. Introduction of hosts and / or ticks from endemic to non-endemic areas because of translocation of game, may lead to severe losses. The pouron acaricides tested were effective against natural tick infestations and should always be used according to the manufacturer's instructions and efficacy claims.

  12. Acaricide efficiency of amitraz/cypermethrin and abamectin pour-on preparations in game. (United States)

    Van Der Merwe, J S; Smit, F J; Durand, A M; Krüger, L P; Michael, L M


    The efficacy of an amitraz/cypermethrin pour-on preparation (1% w/v each) was tested against natural tick infestations of buffaloes, eland and blesbok in three separate trials. The eland were also treated with a 0.02% abamectin (w/v) acaricidal pour-on preparation. The amitraz/cypermethrin pour-on was effective against Amblyomma hebraeum, Rhipicephalus evertsi evertsi, Rhipicephalus appendiculatus and Hyalomma marginatum rufipes on the buffaloes. Both acaricides were effective against R. appendiculatus and Rhipicephalus (Boophilus) decoloratus in the eland. The amitraz/cypermethrin acaricide was effective against R. (Boophilus) decoloratus in the blesbok. Ticks can cause damage to the skins, secondary infections, abscesses, anaemia, loss of condition, tick toxicosis and act as vectors of infectious diseases. Introduction of hosts and/or ticks from endemic to non-endemic areas because of translocation of game, may lead to severe losses. The pouron acaricides tested were effective against natural tick infestations and should always be used according to the manufacturer's instructions and efficacy claims.

  13. Molecular detection of Theileria spp. in sheep and vector ticks in the North Khorasan Province, Iran. (United States)

    Rashidi, Ahmad; Razmi, Gholamreza


    A survey was carried in North Khorasan Province, Iran in 2010-2011, designed to identify Theileria spp. infections of both sheep and ticks. The tick species were also examined. Ninety sheep from different flocks were clinically examined, and blood samples and ixodid ticks were collected. Light microscopy of blood smears revealed Theileria spp. infection in 37 (41.1 %), while 74 (82.2 %) of blood samples were positive using semi-nested PCR. Theileria ovis, Theileria lestoquardi, and mixed infection were detected in 63/90 (70 %), 5/90 (5.5 %), and 6/90 (6.6 %) of samples, respectively. Of the 434 ticks that were collected, the most prevalent species was Rhipicephalus turanicus (69.3 %) followed by Hyalomma marginatum turanicum (18.4 %), Dermacentor marginatus (6.4 %), and Rhipicephalus bursa (5.7 %). The ticks were separated into 42 tick pools, and the salivary glands were dissected out in 0.85 % (w/v) saline under a stereomicroscope and examined using semi-nested PCR. Three pools of H. marginatum turanicum salivary glands were infected with T. ovis and T. lestoquardi, and one pool of R. turanicus was infected with T. ovis. Based on these results, it is concluded that the prevalence of T. ovis is higher than T. lestoquardi and that H. marginatum turanicum and R. turanicus are likely vectors of T. lestoquardi and T. ovis in this area.

  14. Theileria ovis discovered in China. (United States)

    Li, Youquan; Guan, Guiquan; Ma, Miling; Liu, Junlong; Ren, Qiaoyun; Luo, Jianxun; Yin, Hong


    A polymerase chain reaction (PCR) using 989/990 primers was conducted to identify a newly isolated Theileria sp. in Xinjiang Province of China. The target DNA fragments of the complete 18S rRNA gene were cloned and sequenced. The phylogenetic relationship of newly isolated Theileria spp. was inferred based on the 18S rRNA gene. The results showed that the new Theileria sp. belonged to the cluster of Theileria ovis. Moreover, the findings were confirmed by T. ovis species-specific PCR. An expected 520 bp fragment of T. ovis DNA was obtained from 25 out of 320 (8%) field blood samples, and blood of an experimental sheep infested by Hyalomma anatolicum anatolicum collected in Xinjiang. The infection rate of T. ovis was 78% (25/32) in Xinjiang province. The investigation did not find T. ovis positive samples from the field samples collected from the other twelve provinces. This study indicates that T. ovis is prevalent in Xinjiang province of China and its transmission vector is H. anatolicum anatolicum.

  15. Current Status of Tick Fauna in North of Iran

    Directory of Open Access Journals (Sweden)

    P Shayan


    Full Text Available Background: The distribution and ecological preferences of ticks of domestic animals in North of Iran were studied four times a year from 2002 to 2005. Methods: A total of 1720 tick specimens were collected from cattle, sheep and goats from different localities of Caspian Sea areas consisting of Guilan, Mazandaran, Golestan and Ardebil provinces, Iran. Results: Fourteen tick species were identified as Hyalomma anatolicum anatolicum (5.23%, H.marginatum (20.34%, H.detritum (3.48%, Haemaphysalis punctata (12.79%, Haem. Parva (0.58%, Haem.concinna (0.58%, Haem.choldokovsky (6.97%, Ixodes ricinus (2.32%, Rhipicephalus sanguineus (19.76%, Rh.bursa (4.65%, Boophilus annulatus (9.88%, Dermacentor niveus (6.39%, D. marginatus (1.74% and Ornithodoros lahorensis (5.23%. Both Dermacentor and Ornithodoros were found only in Ardebil with cold climatic conditions and high altitude. The only ticks, which were found in forest area, were Boophilus annulatus and Ixodes ricinus. Conclusion: The veterinary and public health importance of the above species should be emphasized.

  16. Review of cattle ticks (Acari, Ixodida) in Ivory Coast and geographic distribution of Rhipicephalus (Boophilus) microplus, an emerging tick in West Africa. (United States)

    Boka, O M; Achi, L; Adakal, H; Azokou, A; Yao, P; Yapi, Y G; Kone, M; Dagnogo, K; Kaboret, Y Y


    The exotic tick Rhipicephalus (Boophilus) microplus was discovered in Ivory Coast in 2007 and then gradually in other countries in West Africa. It is known to induce significant losses in farming and to replace other species of the same genus. In order to contribute to improve health and productivity of cattle in Ivory Coast regarding the emergence of this dreaded tick, a study was conducted to determine the current geographic distribution of the tick R. (B.) microplus and review cattle ticks in general. To this end, 23,460 ticks were collected from 180 farms located throughout the country. Ten species of ticks belonging to the genus Rhipicephalus (including those of the subgenus Boophilus), Hyalomma and Ambyomma were identified. It was found that the exotic tick R. (B.) microplus has invaded the entire Ivorian territory and is now the main cattle tick (63.6% of ticks collected), followed by Amblyomma variegatum that remains still dominant in the North. The population of indigenous species of Rhipicephalus (Boophilus) is in drastic decline.

  17. [Results of the 20-year study of tick-borne encephalitis in Crimea]. (United States)

    Evstaf'ev, I L


    The history of tick-borne encephalitis (TBE) study in the Crimea was retraced and the possibility of introduction of TBE virus to the Crimea in the process of the acclimatization of vertebrates from areas enzootic for TBE is discussed. The foci of TBE were found throughout the whole of the mountain forest zone of the Crimea and coincided with the habitat area of lxodes ricinus, the main vector of TBE. Such ticks as Dermacentor reticulatus, D. marginatus and Hyalomma marginatum were also found to take part in the circulation of the virus. Among the residents of the mountain forest zone, 13.9% were found to have immunity to TBE, testifying to the wide contact of the population with the pathogen. TBE morbidity had pronounced seasonal character and the morbidity rate was low with the prevalence of mild clinical forms. The characteristic feature of the virus population was polymorphism: strains identical to the Far-Eastern strains Sofyin (about 60-70%) and strains differing in their antigenic structure circulated here.

  18. Development and evaluation of a real-time RT-qPCR for detection of Crimean-Congo hemorrhagic fever virus representing different genotypes. (United States)

    Jääskeläinen, Anne J; Kallio-Kokko, Hannimari; Ozkul, Aykut; Bodur, Hurrem; Korukruoglu, Gulay; Mousavi, Mehrdad; Pranav, Patel; Vaheri, Antti; Mirazimi, Ali; Vapalahti, Olli


    Crimean-Congo hemorrhagic fever (CCHF) is a zoonotic disease caused by a nairovirus belonging to family Bunyaviridae. The CCHF virus (CCHFV) can be transmitted to humans by Hyalomma ticks as well as by direct contact with infected body fluids or tissues from viremic livestock or humans. Our aim was to set up a fast RT-qPCR for detection of the different CCHFV genotypes in clinical samples, including an inactivation step to make the sample handling possible in lower biosafety levels (BSL) than BSL-4. This method was evaluated against commercial reference assays and international External Quality Assessment (EQA) samples. The analytical limit of detection for the developed CCHFV-S RT-qPCR was 11 CCHFV genomes per reaction. After exclusion of four dubious samples, we studied 38 CCHFV-positive samples (using reference tests) of which 38 were found positive by CCHFV-S RT-qPCR, suggesting a sensitivity of 100%. CCHFV-S RT q-PCR detected all eight different CCHFV strains representing five different CCHFV genotypes. In conclusion, the CCHFV-S RT-qPCR described in this study was evaluated using various sources of CCHFV samples and shown to be an accurate tool to detect human CCHFV infection caused by different genotypes of the virus.

  19. Detection of tick-borne Anaplasma bovis, Anaplasma phagocytophilum and Anaplasma centrale in Spain. (United States)

    Palomar, A M; Portillo, A; Santibáñez, P; Mazuelas, D; Roncero, L; García-Álvarez, L; Santibáñez, S; Gutiérrez, Ó; Oteo, J A


    The genus Anaplasma (Rickettsiales: Anaplasmataceae) includes species of medical and veterinary importance. The presence of Anaplasma spp. in ticks from birds, as well as in Haemaphysalis punctata (Ixodida: Ixodidae) specimens collected from cattle and vegetation in northern Spain was investigated. A total of 336 ticks from birds [174 Ixodes frontalis (Ixodida: Ixodidae), 108 H. punctata, 34 Hyalomma marginatum (Ixodida: Ixodidae), 17 Ixodes ricinus (Ixodida: Ixodidae) and three Ixodes spp.], and 181 H. punctata specimens collected from cattle (n = 71) and vegetation (n = 110) were analysed. Anaplasma bovis was detected in five H. punctata, including two from birds (1.9%) and three from vegetation (2.7%). Four I. frontalis (2.3%) (one co-infected with 'Candidatus Midichloria mitochondrii') and one I. ricinus (5.9%) removed from birds, as well as four H. punctata (5.6%) collected from cattle showed Anaplasma phagocytophilum infection. In addition, Anaplasma centrale was found in two H. punctata, one from a cow (1.4%) and the other from vegetation (0.9%). This study represents the first evidence of the presence of A. bovis in European ticks, and reports the first detection of A. bovis and A. centrale in H. punctata, and the first finding of A. phagocytophilum and 'Ca. Midichloria mitochondrii' in I. frontalis. © 2015 The Royal Entomological Society.

  20. Molecular evidence for bacterial and protozoan pathogens in hard ticks from Romania. (United States)

    Ionita, Mariana; Mitrea, Ioan Liviu; Pfister, Kurt; Hamel, Dietmar; Silaghi, Cornelia


    The aim of the present study was to provide a preliminary insight into the diversity of tick-borne pathogens circulating at the domestic host-tick interface in Romania. For this, feeding and questing ticks were analyzed by real-time polymerase chain reaction (PCR) for the presence of Anaplasma phagocytophilum, Anaplasma platys, Ehrlichia canis, Borrelia burgdorferi sensu latu, and by PCR and subsequent sequencing for Rickettsia spp., Babesia spp. and Theileria spp. A total of 382 ticks, encompassing 5 species from 4 genera, were collected in April-July 2010 from different areas of Romania; of them, 40 were questing ticks and the remainder was collected from naturally infested cattle, sheep, goats, horses or dogs. Tick species analyzed included Ixodes ricinus, Dermacentor marginatus, Hyalomma marginatum, Rhipicephalus bursa, and Rhipicephalus sanguineus. Four rickettsiae of the spotted fever group of zoonotic concern were identified for the first time in Romania: Rickettsia monacensis and Rickettsia helvetica in I. ricinus, and Rickettsia slovaca and Rickettsia raoultii in D. marginatus. Other zoonotic pathogens such as A. phagocytophilum, Borrelia afzelii, and Babesia microti were found in I. ricinus. Pathogens of veterinary importance were also identified, including Theileria equi in H. marginatum, Babesia occultans in D. marginatus and H. marginatum, Theileria orientalis/sergenti/buffeli-group in I. ricinus and in H. marginatum and E. canis in R. sanguineus. These findings show a wide distribution of very diverse bacterial and protozoan pathogens at the domestic host-tick interface in Romania, with the potential of causing both animal and human diseases.

  1. Identifying main drivers and testing control strategies for CCHFV spread. (United States)

    Hoch, T; Breton, E; Josse, M; Deniz, A; Guven, E; Vatansever, Z


    Crimean Congo Haemorrhagic Fever (CCHF) is an emerging zoonotic disease. The causative agent is a virus (CCHFV), mainly transmitted by ticks of the species Hyalomma marginatum in Eastern Europe and Turkey. In order to test potential scenarios for the control of pathogen spread, the basic reproduction number (R0) for CCHF was calculated. This calculation was based on a population dynamics model and parameter values from the literature for pathogen transmission. The tick population dynamics model takes into account the major processes involved and gives estimates for tick survival from one stage to the other and number of feeding ticks. It also considers the influence of abiotic (meteorological variables) and biotic factors (host densities) on model outputs, which were compared with data collected in Central Anatolia (Turkey). R0 computation was thereafter used to test control strategies and especially the effect of acaricide treatment. Simulation results indicate that such treatments could have valuable effects provided that the acaricide is applied regularly throughout the spring and summer, and over several years. Furthermore, a sensitivity analysis to abiotic and biotic factors showed that, even though temperature has a strong impact on model outputs, host (mainly hare) densities also play a role. The kind of model we have developed provides insight into the ability of different strategies to prevent and control disease spread and has proved its relevance when associated with field trials.

  2. Investigation of the Cases Presenting To Manisa Moris Şinasi Children’s Hospital with a Tick Bite Between 2007 and 2010

    Directory of Open Access Journals (Sweden)

    Tonay İnceboz


    Full Text Available Introduction: The purpose of this study was to investigate the cases with a tick bite in Moris Sinasi Children’s Hospital between January 2007 and December 2010. We aimed to retrospectively determine the types of the tick, distribution of the cases according to months and years and personal characteristics of the cases. Materials and Methods: Total number of cases with tick bite in this period was 433. All withdrawn samples were put into alcohol and glycerine and examined under the light microscope. Demographic characteristics including residential areas of the patients, symptoms related to tick borne diseases of the patients and species and other characteristics of ticks removed from the subjects were investigated. Results: Of all 433 children, 182 (42% were female and 251 (58%, male. In 285 (65.8% of 433 tick bite suspected samples, various ectoparasites were detected microscopically. Removed ticks were classified in five genera. The overwhelmingly dominant genera were Hyalomma nymph and it comprised 54% of the collected samples. In terms of ages of children with tick bite suspected samples, 68 (15.7% were 0-1 year old and accordingly 207 (47.8% were 2-5 years old, 124 (28.6% were 6-10 years old and 34 (7.9% were 11-16 years old. Conclusion: Children are at risk for tick bites and tick-borne diseases, and therefore attention should be given, especially during the summer months. (Journal of Current Pediatrics 2011; 9: 116-21

  3. The influence of interspecific competition and host preference on the phylogeography of two African ixodid tick species. (United States)

    Cangi, Nídia; Horak, Ivan G; Apanaskevich, Dmitry A; Matthee, Sonja; das Neves, Luís C B G; Estrada-Peña, Agustín; Matthee, Conrad A


    A comparative phylogeographic study on two economically important African tick species, Amblyomma hebraeum and Hyalomma rufipes was performed to test the influence of host specificity and host movement on dispersion. Pairwise AMOVA analyses of 277 mtDNA COI sequences supported significant population differentiation among the majority of sampling sites. The geographic mitochondrial structure was not supported by nuclear ITS-2 sequencing, probably attributed to a recent divergence. The three-host generalist, A. hebraeum, showed less mtDNA geographic structure, and a lower level of genetic diversity, while the more host-specific H. rufipes displayed higher levels of population differentiation and two distinct mtDNA assemblages (one predominantly confined to South Africa/Namibia and the other to Mozambique and East Africa). A zone of overlap is present in southern Mozambique. A mechanistic climate model suggests that climate alone cannot be responsible for the disruption in female gene flow. Our findings furthermore suggest that female gene dispersal of ticks is more dependent on the presence of juvenile hosts in the environment than on the ability of adult hosts to disperse across the landscape. Documented interspecific competition between the juvenile stages of H. rufipes and H. truncatum is implicated as a contributing factor towards disrupting gene flow between the two southern African H. rufipes genetic assemblages.

  4. The influence of interspecific competition and host preference on the phylogeography of two African ixodid tick species.

    Directory of Open Access Journals (Sweden)

    Nídia Cangi

    Full Text Available A comparative phylogeographic study on two economically important African tick species, Amblyomma hebraeum and Hyalomma rufipes was performed to test the influence of host specificity and host movement on dispersion. Pairwise AMOVA analyses of 277 mtDNA COI sequences supported significant population differentiation among the majority of sampling sites. The geographic mitochondrial structure was not supported by nuclear ITS-2 sequencing, probably attributed to a recent divergence. The three-host generalist, A. hebraeum, showed less mtDNA geographic structure, and a lower level of genetic diversity, while the more host-specific H. rufipes displayed higher levels of population differentiation and two distinct mtDNA assemblages (one predominantly confined to South Africa/Namibia and the other to Mozambique and East Africa. A zone of overlap is present in southern Mozambique. A mechanistic climate model suggests that climate alone cannot be responsible for the disruption in female gene flow. Our findings furthermore suggest that female gene dispersal of ticks is more dependent on the presence of juvenile hosts in the environment than on the ability of adult hosts to disperse across the landscape. Documented interspecific competition between the juvenile stages of H. rufipes and H. truncatum is implicated as a contributing factor towards disrupting gene flow between the two southern African H. rufipes genetic assemblages.

  5. Tick-borne rickettsiae in Guinea and Liberia. (United States)

    Mediannikov, Oleg; Diatta, Georges; Zolia, Yah; Balde, Mamadou Cellou; Kohar, Henry; Trape, Jean-François; Raoult, Didier


    While the high seroprevalence for the rickettsiae that cause spotted fevers and the multiple pathogenic rickettsiae is known, the data on the distribution of rickettsial diseases in Africa are often incomplete. We collected ticks from domestic or wild animals (generally a source of bushmeat) that were in contact with humans in 2 neighboring countries of tropical West Africa, Guinea and Liberia. In total, 382 ticks representing 6 species were collected in Liberia and 655 ticks representing 7 species were collected in Guinea. We found rickettsiae in 9 different species of ticks from both countries. Rickettsia africae was found in 93-100% of Amblyomma variegatum, in 14-93% of Rhipicephalus (B.) geigyi, Rh. (B.) annulatus, and Rh. (B.) decoloratus, and in several Hyalomma marginatum rufipes and Haemaphysalis paraleachi. A genetic variant of R. africae was found in Amblyomma compressum. R. massiliae was found in 10/61 (16%) of Rh. senegalensis ticks and in 2% of Haemaphysalis paraleachi ticks collected from dogs. We identified a new rickettsia in one of 44 (2%) Ixodes muniensis collected from a dog in Liberia. As this rickettsia is not yet isolated, we propose the provisional name "Candidatus Rickettsia liberiensis" (for the West African country where the host tick was collected).

  6. The feasibility of developing a risk assessment for the impact of climate change on the emergence of Crimean-Congo haemorrhagic fever in livestock in Europe: a review. (United States)

    Gale, P; Estrada-Peña, A; Martinez, M; Ulrich, R G; Wilson, A; Capelli, G; Phipps, P; de la Torre, A; Muñoz, M J; Dottori, M; Mioulet, V; Fooks, A R


    Crimean-Congo haemorrhagic fever virus (CCHFV) is one of the most widespread of all medically important arboviruses with ticks of the Hyalomma spp. serving as the main vectors. Infection of livestock by CCHFV serves as a route of exposure to humans, as a reservoir of disease and as a route of importation. This study discusses the pathways and data requirements for a qualitative risk assessment for the emergence of CCHFV in livestock in Europe. A risk map approach is proposed based on layers that include the potential routes of release (e.g. by migrating birds carrying infected ticks) together with the main components for exposure, namely the distributions of the tick vectors, the small vertebrate host reservoirs and the livestock. A layer on landscape fragmentation serves as a surrogate for proximity of livestock to the tick cycle. Although the impact of climate change on the emergence of CCHF is not clear, comparing the distribution of risk factors in each layer currently with those predicted in the 2080s with climate change can be used to speculate how potential high-risk areas may shift. According to the risk pathway, transstadial and/or transovarial transmission in the tick vector are crucial for CCHFV spread. Vector competence and tick vector switching, however, remain critical factors for CCHFV colonization of new regions in Europe. The species of migratory bird is also an important consideration in the release assessment with greater abundance and biodiversity of ground-dwelling birds in southern Europe than in northern Europe.

  7. First molecular evidence of [i]Borrelia burgdorferi[/i] sensu lato in goats, sheep, cattle and camels in Tunisia. (United States)

    Ben Said, Mourad; Belkahia, Hanène; Alberti, Alberto; Abdi, Khaoula; Zhioua, Manel; Daaloul-Jedidi, Monia; Messadi, Lilia


    Borrelia burgdorferi sensu lato (s.l.) are tick-transmitted spirochaetes of veterinary and human importance. Molecular epidemiology data on ruminants are still lacking in most countries of the world. Therefore, the aim of this study was to estimate the rate of B. burgdorferi s.l. infection in ruminants from Tunisia. A total of 1,021 ruminants (303 goats, 260 sheep, 232 cattle and 226 camels) from different bioclimatic areas in Tunisia were investigated for the presence of B. burgdorferi s.l. DNA in blood by real time PCR. Prevalence rates were 30.4% (92/303) in goats, 6.2% (16/260) in sheep, 1.3% (3/232) in cattle, and 1.8% (4/226) in camels. Only tick species belonging to Rhipicephalus and Hyalomma genera were found on the investigated animals. In small ruminants, the prevalence of B. burgdorferi s.l. varied significantly according to localities and farms. Goats located in humid areas were statistically more infected than those located in sub-humid areas. Prevalence rates varied significantly according to age and breed in sheep, and age and tick infestation in goats. This study provides the first insight into the presence of B. burgdorferi s.l. DNA in ruminants in Tunisia, and demonstrates that host species such as goats and sheep may play an important role in natural Lyme disease cycles in this country.

  8. Ticks (Acari: Ixodidae) associated with wildlife and vegetation of Haller park along the Kenyan coastline. (United States)

    Wanzala, W; Okanga, S


    This artcile describes the results obtained from a tick survey conducted in Haller park along the Kenyan coastline. The survey aimed at evaluating tick-host associations, assessing tick population density, and providing baseline information for planning future tick control and management in the park. Ticks (2,968) were collected by handpicking from eight species of wildlife and by dragging in 14 selected sites within the park. A considerable proportion of ticks were also collected from leaves, stems, and bark of most dominant trees, namely, Casuarina equisetifolia L. (Forst. and Forst.), Cocos nucifera L., Adansonia digitata L., Musa paradisiaca L., and Azadiracta indica Adr. Juss. Dragging was conducted in sites predominantly occupied by Cynodon dactylon L. (Pers.), Cenchrus ciliaris L., Stenotaphrum dimidiatum L. (Kuntze.) Brongn., and Brachiaria xantholeuca Hack. Ex Schinz Stapf. and Loudetia kagerensis K. Schum. Hutch. Eight tick species were identified, and the collection included Rhipicephalus pravus Dönitz 1910, Rhipicephalus pulchellus Gerstäcker 1873, Hyalomma marginatum rufipes Koch 1844, Amblyomma gemma Dönitz 1910, Amblyomma hebraeum Koch 1844, Amblyomma sparsum Neumann 1899, Amblyomma nuttalli Dönitz 1909, and Boophilus decoloratus Koch 1844. Given that the identified tick species are known to parasitize humans as well as livestock, there exist risks of emergence of zoonotic infections mediated by tick vectors. In the recreational environment of Haller park, where tick vectors share habitats with hosts, there is a need to develop sustainable and effective tick control and management strategies to minimize economic losses that tick infestation may cause.

  9. Epidemiology of ixodid ticks in cattle population of various agro-climatic zones of Punjab, India

    Institute of Scientific and Technical Information of China (English)

    Nirbhay Kumar Singh; Shitanshu Shekhar Rath


    Objective:To determine the epidemiology of ixodid ticks in bovines of different agro-climatic zones ofPunjab state,India.Methods:A total of4459 cattle of all age groups and sex were examined from eighteen districts of five major agro-climatic zones ofPunjab state, India.Results:The overall prevalence of ixodid ticks,Rhipicephalus microplus(R. microplus), Hyalomma anatolicum anatolicum(H. a. anatolicum) and mixed infestation were58.06%,50.16%, 11.34% and3.45%, respectively.Amongthe various agro-climatic zones highest prevalence rate ofR. microplus andH. a. anatolicumwere recorded in submountain undulating region(79.36%) and western region(20.40%), respectively indicating thatR. microplus prefers a hot and humid environment whereas, arid and semi arid conditions suit better forH. a. anatolicum.The overall prevalence of ixodid ticks was highest in monsoon season(83.74%), followed by summer(69.01%) and least in winters(31.64%) and a significant variation(P1year age group(55.02%) and the difference was statistically significant(P<0.01). Also a significantly higher(P<0.01) infestation rates of ixodid ticks was observed in males. Conclusions:The findings of the current study would provide a basis for evolving effective control strategy for the management of ticks in bovines of the region.

  10. Sero-epidemiological survey of Crimean-Congo hemorrhagic fever virus in Tunisia

    Directory of Open Access Journals (Sweden)

    Wasfi Fares


    Full Text Available Crimean-Congo hemorrhagic fever (CCHF is a tick-borne disease associated with a high case fatality rate and transmitted mainly by Hyalomma marginatum. The geographical distribution of H. marginatum covers most of the Western Mediterranean basin. We aimed to investigate whether CCHF virus (CCHFv is circulating in Tunisia. Samples from unexplained acute febrile patients (n = 181 and a high risk group of humans, mainly slaughter workers (n = 38, were collected in the summer of 2014 and analyzed for exposure to CCHFv using serological tests and real-time RT-PCR. Ticks were collected from Northern and Southern Tunisia during May–June 2014 and examined for the presence of CCHFv by real-time RT-PCR. Of the 181 febrile patients, 5 showed only high titers of IgM suggesting a recent exposure to CCHFv. Among 38 slaughter workers, 2 had IgG anti-CCHFv responses yielding a seroprevalence of 5.2%. No CCHFv was detected in ticks and sera. Our results provide evidence of human exposure to CCHFv in Tunisia.

  11. Sero-epidemiological survey of Crimean-Congo hemorrhagic fever virus in Tunisia (United States)

    Wasfi, Fares; Dowall, Stuart; Ghabbari, Tayssir; Bosworth, Andrew; Chakroun, Mohamed; Varghese, Anitha; Tiouiri, Hanene; Ben Jemaa, Mounir; Znazen, Abir; Hewson, Roger; Zhioua, Elyes; Letaief, Amel


    Crimean-Congo hemorrhagic fever (CCHF) is a tick-borne disease associated with a high case fatality rate and transmitted mainly by Hyalomma marginatum. The geographical distribution of H. marginatum covers most of the Western Mediterranean basin. We aimed to investigate whether CCHF virus (CCHFv) is circulating in Tunisia. Samples from unexplained acute febrile patients (n = 181) and a high risk group of humans, mainly slaughter workers (n = 38), were collected in the summer of 2014 and analyzed for exposure to CCHFv using serological tests and real-time RT-PCR. Ticks were collected from Northern and Southern Tunisia during May–June 2014 and examined for the presence of CCHFv by real-time RT-PCR. Of the 181 febrile patients, 5 showed only high titers of IgM suggesting a recent exposure to CCHFv. Among 38 slaughter workers, 2 had IgG anti-CCHFv responses yielding a seroprevalence of 5.2%. No CCHFv was detected in ticks and sera. Our results provide evidence of human exposure to CCHFv in Tunisia. PMID:26956221

  12. Consensus report: Preventive measures for Crimean-Congo Hemorrhagic Fever during Eid-al-Adha festival

    Directory of Open Access Journals (Sweden)

    Hakan Leblebicioglu


    Full Text Available Crimean-Congo hemorrhagic fever (CCHF is endemic in Eurasian countries such as, Turkey, Pakistan, Afghanistan and Iran. CCHF virus is spread by the Hyalomma tick, which is found mainly on cattle and sheep. Muslim countries, in which these animals are sacrificed during Eid-Al-Adha, are among the countries where CCHF is endemic, and it has been observed that CCHF is associated with practices surrounding the Eid-ad-Adha festival. The dates for Eid-Al-Adha drift 10 days earlier in each year according to Georgian calendar. In previous years Eid-al-Adha occurred in autumn-winter months however in the next 10-15 years it will be take place in the summer months when CCHF is more prevalent. This may lead to a rise in the number of cases due to increased dissemination of CCHF virus with uncontrolled animal movements in and between countries. This consensus report focuses on the variable practices regarding animal handling in different regions and possible preventative measures to reduce the incidence of CCHF. Environmental hygiene and personal protection are essential parts of prevention. There is a need for international collaborative preparedness and response plans for prevention and management of CCHF during Eid-Al-Adha in countries where the disease is prevalent.

  13. Ixodid ticks on domestic dogs in the Northern Cape Province of South Africa and in Namibia : short communication

    Directory of Open Access Journals (Sweden)

    S. Matthee


    Full Text Available The objective of this study was to determine the species composition of ixodid ticks infesting domestic dogs in the northwestern region of the Northern Cape Province of South Africa and in Namibia. Ticks were collected from February 2008 to January 2009 from dogs presented for a variety of reasons at a veterinary clinic in the Northern Cape Province and at 3 clinics in Namibia. The ticks collected at each place were pooled separately for each month at each locality. Eleven ixodid tick species were collected from dogs in the Northern Cape Province and new locality records for Haemaphysalis colesbergensis and Ixodes rubicundus, new locality and host records for Hyalomma glabrum, and a new host record for Rhipicephalus neumanni are reported. Six tick species were collected from dogs at the 3 clinics in Namibia. The most numerous species on dogs in both countries was R. sanguineus. The present results increase the total number of ixodid tick species collected from dogs in South Africa from 25 to 28.

  14. Arthropod parasites of Nubian ibexes (Capra ibex nubiana) and gazelles (Gazella gazella) in Israel. (United States)

    Yeruham, I; Rosen, S; Hadani, A; Braverman, Y


    In a 20-year survey the following ectoparasites were collected from Nubian ibexes: larvae of an unidentified Oestrus sp. collected from the nasal cavities, sinuses and horns, hippoboscid flies (Lipoptena chalcomelaena) specific to the Nubian ibex, blood sucking lice (Linognathus africanus) and unidentified biting lice (Damalinia sp.). Ibexes were severely infested with the cattle tick, Boophilus annulatus; a few Hyalomma anatolicum excavatum ticks were also collected. In five ibexes kept in two zoos, showing otitis, Psoroptes cuniculi, was identified, and from skin scrpaings of nine animals with severe dermatitis in three other zoos, Sarcoptes scabiei was isolated. Infestation of Nubian ibexes with sucking and biting lice as well as H. anatolicum excavatum is reported for the first time. The ectoparasites collected from gazelles were: hippoboscid flies (Lipoptena capreoli), calliphorid flies (Lucilia sericata and Calliphora sp.), sucking lice (Linognathus africanus and Solenopotes capillatus) and unidentified biting lice (Damalinia sp.), fleas (Ctenocephalides felis felis), and ticks, B. annulatus, Rhipicepahlus bursa, Rhipicephalus turanicus, H. anatolicum excavatum and H. marginatum rufipes. In skin scrapings of four gazelles with local dermatitis in the fetlocks Chorioptes bovis was identified. Neoschoengastia sp. was found in craters between the claws in three gazelles.

  15. A Study on Babesia Infection in Sheep of Pars Abad Moghan Region, Ardabil Province (2014

    Directory of Open Access Journals (Sweden)

    SHahram Dastouri Dastgir


    Full Text Available Background & objectives: Pars Abad Moghan city, due to the mild weather and numerous Pastures for animals feeding, is a suitable place for breeding sheep and goat. Babesiosis is one of the most important parasitic infection in animals, especially ruminants. Babesia is a protozoa living inside the red blood cells and transmitted to the host by hard Tick especially Rhipicephalus, Hyalomma, Dermacentor and Haemaphysalis. The aim of this study was to consider Babesia infection in sheep of Pars Abad Moghan city. Methods: In order to investigate the prevalence of babesia, 105 sheep in two different seasons of spring and summer were prepared and blood sample was taken and thin and thick smears were done. Thin blood smear was fixed with methanol and in order to determine the presence of the protozoan parasite, Giemsa with ratio of 1 to 14 in distilled water was used for staining. Results: The results showed that the number of 33 samples (31.42% were infected with Babesia. Among these, 18 samples (17.14% were infected with Babesia ovis, 9 (8.57% with babesia motasi and 6 samples (5.71% were infected simultaneously with both species of Babesia ovis and Babesia motasi. Conclusion: The rate of infection to Babesia among the sheep in Pars Abad Moghan city is remarkable. Early diagnosis and early treatment can prevent spread of the disease in this area.

  16. Seasonal fluctuation of parasitic infestation in donkeys (Equus asinus in Oodi village, Kgatleng District, Botswana : short communication

    Directory of Open Access Journals (Sweden)

    E.Z. Mushi


    Full Text Available During the period March to September 2000, a study was conducted in Oodi village, Kgatleng District, Botswana, to investigate the seasonal fluctuation of internal, external and blood parasites of donkeys. Twelve adult donkeys were randomly selected from a farmer with a herd of 15 donkeys. Monthly visits were made to the farmer when the donkeys were examined for parasites. The only ectoparasites recovered from the donkeys were instars of various tick species. The most prevalent tick was Rhipicephalus evertsi evertsi (98.4 %, followed by Amblyomma hebraeum and Hyalomma species. The only haemoparasite seen on microscopy was Babesia equi at low parasitaemia in 26.8% of the donkeys. However, no clinical babesiosis was evident. Coprological examination showed the presence of strongyle eggs in moderate numbers. Very low numbers of coccidia oocysts were found in the faecal samples. High tick numbers and worm egg counts coincided with the warm, wet months in contrast to the low numbers recovered during the cold, dry months. An interview conducted by the authors indicated that donkeys were nutritionally marginalised by owners. Supplementary feeding was therefore recommended, especially during the winter months when grazing is poor.

  17. Diversity and distribution of tick species (Acari: Ixodidae) associated with human otoacariasis and socio-ecological risk factors of tick infestations in Sri Lanka. (United States)

    Ariyarathne, S; Apanaskevich, D A; Amarasinghe, P H; Rajakaruna, R S


    Tick infestation in humans is a major public health concern. The diversity and distribution of tick species associated with human otoacariasis was studied in five districts: Anuradhapura, Kandy, Kurunegala, Nuwara Eliya and Ratnapura in the main agro-climatic zones of Sri Lanka. Ticks from patients attending the ear, nose and throat clinics of the General Hospitals were collected during a 3 year period. In total 426 ticks were collected. Most human otoacariasis cases were reported from Kandy (33.8 %) and the fewest from Nuwara Eliya (8.2 %). Of the five tick species identified, nymphs of Dermacentor auratus constituted 90.6 % of the collection. Rhipicephalus sanguineus, Hyalomma isaaci, Haemaphysalis bispinosa and Otobius megnini were found rarely infesting humans possibly as an accidental host; H. bispinosa and O. megnini in the human ear canal were first time records in Sri Lanka. Females and children under 10 years were identified as risk groups of human otoacariasis. Subsequently, a field study was carried out to determine socio-ecological risk factors of human tick infestations in the five districts. Based on hospital data, eight villages with high prevalence of otoacariasis were selected from each district. A total 40 villages were visited and 1674 household members were interviewed. Involvement in outdoor activities, presence of wild animals around the house, location of the house in close proximity to a forest and occupation were identified as major risk factors.

  18. Diversity and seasonal patterns of ticks parasitizing wild birds in western Portugal. (United States)

    Norte, A C; de Carvalho, I Lopes; Ramos, J A; Gonçalves, M; Gern, L; Núncio, M S


    The diversity and abundance of questing ticks and ticks parasitizing birds was assessed during 1 year in two recreational forests in western Portugal, a suburban forest and an enclosed game area. The aim of this study was to assess the distribution and seasonality of tick species and to understand the role of bird species as hosts for ticks. Ixodes ricinus was the most abundant questing tick collected in the enclosed game area, whereas in the suburban forest, only three ticks were collected by blanket dragging. Tick species parasitizing birds included I. ricinus, I. frontalis, I. arboricola, I. acuminatus, Haemaphysalis punctata, Hyalomma marginatum and H. lusitanicum. This is the first record of I. arboricola in Portugal. Tick prevalence and intensity of infestation differed between study areas and was higher in birds from the game area where a large population of deer and wild boar may support tick populations. Ground and shrub dwelling bird species such as Turdus merula, Erithacus rubecula and Sylvia melanocephala were the most heavily parasitized by ticks, but the importance of different bird species as hosts of larvae and nymphs of I. ricinus and I. frontalis differed. Therefore, different bird species may contribute differently for tick population maintenance.

  19. Microscopic Visualisation of Zoonotic Arbovirus Replication in Tick Cell and Organ Cultures Using Semliki Forest Virus Reporter Systems

    Directory of Open Access Journals (Sweden)

    Lesley Bell-Sakyi


    Full Text Available Ticks are vectors and reservoirs of many arboviruses pathogenic for humans or domestic animals; in addition, during bloodfeeding they can acquire and harbour pathogenic arboviruses normally transmitted by other arthropods such as mosquitoes. Tick cell and organ cultures provide convenient tools for propagation and study of arboviruses, both tick-borne and insect-borne, enabling elucidation of virus-tick cell interaction and yielding insight into the mechanisms behind vector competence and reservoir potential for different arbovirus species. The mosquito-borne zoonotic alphavirus Semliki Forest virus (SFV, which replicates well in tick cells, has been isolated from Rhipicephalus, Hyalomma, and Amblyomma spp. ticks removed from mammalian hosts in East Africa; however nothing is known about any possible role of ticks in SFV epidemiology. Here we present a light and electron microscopic study of SFV infecting cell lines and organ cultures derived from African Rhipicephalus spp. ticks. As well as demonstrating the applicability of these culture systems for studying virus-vector interactions, we provide preliminary evidence to support the hypothesis that SFV is not normally transmitted by ticks because the virus does not infect midgut cells.

  20. Species diversity and abundance of ticks in three habitats in southern Italy. (United States)

    Dantas-Torres, Filipe; Otranto, Domenico


    A 2-year study was conducted from March 2010 to March 2012 in a forested area in southern Italy to evaluate the species diversity and abundance of free-living ticks in 3 different habitats: (i) a meadow habitat within an enclosure inhabited by roe deer (Capreolus capreolus); (ii) a man-made trail located in a high-altitude, forested area; and (iii) a grassland near a house inhabited by 3 people. In total, 10,795 ticks were collected. Ixodes ricinus was the most abundant species (69.0%), followed by Haemaphysalis inermis (19.1%), Rhipicephalus turanicus (6.7%), Dermacentor marginatus (3.2%), and Hyalomma marginatum (1.0%). The least frequently collected species were Rhipicephalus bursa, Haemaphysalis parva, Haemaphysalis sulcata, and Haemaphysalis concinna, representing together less than 1% of the collections. Immature ticks predominated over adult ticks. In particular, immature stages of Ix. ricinus (i.e., 3246 larvae and 3554 nymphs) represented 63% of the total number of ticks collected. High levels of species diversity and abundance of ticks were recorded in all habitats and the daily number of ticks collected was negatively correlated with daily mean temperature, evapotranspiration, and saturation deficit. This study indicates that the southern Italian climate is suitable for different tick species, which may find a preferred 'climate niche' during a specific season, when a combination of factors (e.g., suitable meteorological and environmental conditions) associated with the presence of suitable hosts will facilitate their development and reproduction.

  1. A Preliminary Investigation on Ticks (Acari: Ixodidae) Infesting Birds in Kızılırmak Delta, Turkey. (United States)

    Keskin, Adem; Erciyas-Yavuz, Kiraz


    Ticks are mandatory blood-feeding ectoparasites of mammals, birds, reptiles, and even amphibians. Turkey has a rich bird fauna and is located on the main migration route for many birds. However, information on ticks infesting birds is very limited. In the present study, we aimed to determine ticks infesting birds in Kızılırmak Delta, Turkey. In 2014 autumn bird migration season, a total of 7,452 birds belonging to 79 species, 52 genera, 35 families, and 14 orders were examined for tick infestation. In total, 287 (234 larvae, 47 nymphs, 6♀) ticks were collected from 54 passerine birds (prevalence = 0.72%) belonging to 12 species. Ticks were identified as Amblyomma sp., Dermacentor marginatus (Sulzer), Haemaphysalis concinna Koch, Haemaphysalis punctata Canestrini and Fanzago, Hyalomma sp., Ixodes frontalis (Panzer), and Ixodes ricinus (L). The most common tick species were I. frontalis (223 larvae, 23 nymphs, 6♀) followed by I. ricinus (3 larvae, 12 nymphs) and H. concinna (4 larvae, 6 nymphs). Based on our results, it can be said that Erithacus rubecula (L.) is the main host of immature I. frontalis, whereas Turdus merula L. is the most important carrier of immature stages of some ticks in Kızılırmak Delta, Turkey. To the best of our knowledge, most of the tick-host associations found in this study have never been documented in the literature.

  2. Laboratory Study on Biological Control of Ticks (Acari: Ixodidae by Entomopathogenic Indigenous Fungi (Beauveria bassiana

    Directory of Open Access Journals (Sweden)

    M Abdigoudarzi


    Full Text Available Background: Chemical control method using different acaricides as spray, dipping solution or pour-on is routinely used for controlling ticks. Biological control agents are favorable due to their safety for animals and environment. Entomopathogenic fungi such as Beauveria bassiana are well known for controlling ticks. In this study, two Iranian indigenous strains of B. bassiana (B. bassiana 5197 and B. bassiana Evin were selected and grown on specific me­dia. The pathogenic effects of these strains were evaluated on adult stages of two Iranian Ixodidae members (H. anatolicum anatolicum Koch 1844, and H. marginatum Koch 1844 by dipping method.Methods: Two Iranian strains of Beauveria bassiana (Beauveria bassiana 5197 and Beauveria bassiana Evin were selected and were grown successfully on specific media. The pathogenic effects of these strains were evaluated on adult stages of Iranian Ixodidae members such as, Hyalomma anatolicum anatolicum and H. marginatum by dipping method (these ticks were grown up at laboratory conditions during 2002 up to 2003 and still it is continued .Results: There was no effect of strain 5197 on mortality or fecundity rates for ticks. There was acute phase sign of paralysis in test group after dipping ticks in suspension made from Evin strain of B. bassiana. In addition, the test groups were totally died after four months, but the control groups survived for six months.Conclusion: High concentration of fungal spores is needed for inducing fungal infection. Additional study using different strains and fungi on Iranian ticks is proposed. 

  3. Detection of Lyme disease pathogens in isolated ticks at Aibi Lake, Alataw Pass, Xinjiang Autonomous Region%新疆阿拉山口艾比湖湿地蜱种莱姆病病原体检测

    Institute of Scientific and Technical Information of China (English)

    王安东; 徐军; 王远志; 徐新龙; 戴莉; 杜景云; 王丽娜; 牟路萌; 肖云霞


    Objective In order to understand the major tick species,Borrelia burgdorferi infection and genotype status at Aibi Lake,Alataw Pass,Xinjiang Autonomous Region.Methods Free-living ticks were collected by drag-flag method from April to August,2014,and the morphological identification was carried out.Borrelia spp.was detected by 5S-23S rRNA gene primers.The PCR products were sequenced and analyzed with BLAST.Results One hundred fifty-two isolated ticks were collected,including Rhipicephalus sanguineus (12),Hyalomma asiaticum (59) and Dermacentor Marginatus (81).The positive rate of Borrelia spp.was 34.87% (53/152).The positive rate of Hyalomma asiaticum (57.63%,34/59) was higher than that of Dermacentor Marginatus (22.22%,18/81,x2 =18.328,P < 0.05) and Rhipicephalus sanguineus (8.33%,1/12,x2 =9.694,P < 0.05).The analysis of 5S-23S rRNA sequencing indicated the pathogen was Borrelia burgdorferi sensu stricto.Conclusions Borrelia burgdorferi sensu stricto in ticks is firstly detected in Alataw region.The results conveyed us Aibi Lake was natural epidemic focus of Lyme disease.%目的 了解新疆阿拉山口艾比湖湿地主要蜱种莱姆病螺旋体感染与基因型状况.方法 2014年4-8月,在新疆艾比湖湿地选取3个采集点,采用布旗法采集游离蜱,经形态学鉴定蜱种后,采用巢式PCR法扩增莱姆病病原5S-23S rRNA基因,将PCR产物测序并进行BLAST比对分析.结果 共检测游离蜱152只,其中血红扇头蜱12只、亚洲璃眼蜱59只、边缘革蜱81只.各蜱种莱姆病病原总体阳性率为34.87%(53/152),其中亚洲璃眼蜱阳性率为(57.63%,34/59),边缘革蜱阳性率为(22.22%,18/81),血红扇头蜱阳性率为(8.33%,1/12),亚洲璃眼蜱的阳性率高于边缘革蜱和血红扇头蜱(x2=18.328、9.694,P均<0.05);5S-23SrRNA基因测序比对显示艾比湖湿地莱姆病基因型为伯氏疏螺旋体.结论 首次在新疆阿拉山口艾比湖湿地硬蜱检测到伯氏疏螺旋体,提示新

  4. First international external quality assessment of molecular detection of Crimean-Congo hemorrhagic fever virus.

    Directory of Open Access Journals (Sweden)

    Camille Escadafal

    Full Text Available Crimean-Congo hemorrhagic fever (CCHF is a zoonosis caused by a Nairovirus of the family Bunyaviridae. Infection is transmitted to humans mostly by Hyalomma ticks and also by direct contact with the blood or tissues of infected humans or viremic livestock. Clinical features usually include a rapid progression characterized by hemorrhage, myalgia and fever, with a lethality rate up to 30%. CCHF is one of the most widely distributed viral hemorrhagic fevers and has been reported in Africa, the Middle East and Asia, as well as parts of Europe. There is no approved vaccine or specific treatment against CCHF virus (CCHFV infections. In this context, an accurate diagnosis as well as a reliable surveillance of CCHFV infections is essential. Diagnostic techniques include virus culture, serology and molecular methods, which are now increasingly used. The European Network for the Diagnostics of "Imported" Viral Diseases organized the first international external quality assessment of CCHVF molecular diagnostics in 2011 to assess the efficiency and accurateness of CCHFV molecular methods applied by expert laboratories. A proficiency test panel of 15 samples was distributed to the participants including 10 different CCHFV preparations generated from infected cell cultures, a preparation of plasmid cloned with the nucleoprotein of CCHFV, two CCHFV RNA preparations and two negative controls. Forty-four laboratories worldwide participated in the EQA study and 53 data sets were received. Twenty data sets (38% met all criteria with optimal performance, 10 (19% with acceptable performance, while 23 (43% reported results showing a need for improvement. Differences in performance depended on the method used, the type of strain tested, the concentration of the sample tested and the laboratory performing the test. These results indicate that there is still a need for improving testing conditions and standardizing protocols for the molecular detection of Crimean

  5. Epidemic Situation and Prevention of Bovine Tropical Theileriosis in Xinjiang%新疆牛环形泰勒虫病的流行现状和防治

    Institute of Scientific and Technical Information of China (English)

    曹雯丽; 陈亮; 刘启生; 巴音查汗


    环形泰勒虫病是由泰勒科属的环形泰勒原虫寄生于牛、羊和其它野生动物巨噬细胞、淋巴细胞和红细胞内引起的一种危害严重的疾病。该病的传播媒介为璃眼蜱属的多种蜱,是一种季节性很强的地方性流行病,多呈急性型经过,发病率和死亡率均很高,尤其是对外来牛和改良牛,严重影响我区牛业的健康发展。本文从环形泰勒虫的病原形态、生活史、流行病学、我区流行现状及其防治等方面进行综述。%Tropical theileriosis is a serious disease that is caused by Theileria annulata of Theileria which parasitic in macrophages,lymphocytes and red blood cell of cattle,sheep and other wildlifes.The spread of the disease is various ticks of Hyalomma,it is a Strong seasonal local endemic diseases,it is shown more acute type,the morbidity and mortality of the disease are high,especially for foreign cows and improved cattle,it seriously affects the development of cattle.In this essay I will write about the Pathogen morphology,life cycle,epidemiology,epidemic status and prevention of Theileria annulata in Xinjiang.

  6. Coinfections of Rickettsia slovaca and Rickettsia helvetica with Borrelia lusitaniae in ticks collected in a Safari Park, Portugal. (United States)

    Milhano, Natacha; de Carvalho, Isabel Lopes; Alves, Ana Sofia; Arroube, Sofia; Soares, Jorge; Rodriguez, Pablo; Carolino, Manuela; Núncio, Maria Sofia; Piesman, Joseph; de Sousa, Rita


    Borrelia and Rickettsia bacteria are the most important tick-borne agents causing disease in Portugal. Identification and characterization of these circulating agents, mainly in recreational areas, is crucial for the development of preventive measures in response to the gradually increasing exposure of humans to tick vectors. A total of 677 questing ticks including Dermacentor marginatus, Rhipicephalus sanguineus, Ixodes ricinus, Hyalomma lusitanicum, H. marginatum, and Haemaphysalis punctata were collected in a Safari Park in Alentejo, Portugal, to investigate the prevalences of infection and characterize Borrelia and Rickettsia species. From a total of 371 ticks tested by PCR for Borrelia burgdorferi sensu lato (s.l.), of which 247 were tested for Rickettsia, an infection prevalence of 18.3% was found for B. lusitaniae and 55.1% for Rickettsia spp. Sequence analysis of positive amplicons identified the presence of B. lusitaniae (18.3%), R. monacensis strain IRS3 (51.7%), and R. helvetica (48.3%) in I. ricinus. R. slovaca (41.5%), R. raoultii (58.5%), and also B. lusitaniae (21%) were identified in D. marginatus ticks. One (5.9%) H. lusitanicum was infected with B. lusitaniae, and R. massiliae was found in one Rhipicephalus sanguineus. Coinfection was found in 7 (20%) I. ricinus and 34 (23.3%) D. marginatus ticks. We report, for the first time, simultaneous infection with R. helvetica and B. lusitaniae and also R. slovaca, the agent of TIBOLA/DEBONEL, with B. lusitaniae. Additionally, 6 isolates of B. lusitaniae were established, and isolates of Rickettsia were also obtained for the detected species using tick macerates cultured in mammalian and mosquito cell lines. This report describes the detection and isolation of tick-borne agents from a Portuguese Safari Park, highlighting the increased likelihood of infection with multiple agents to potential visitors or staff. Copyright © 2010 Elsevier GmbH. All rights reserved.

  7. Ticks imported to Europe with exotic reptiles. (United States)

    Mihalca, Andrei Daniel


    It is known that traded exotic animals carry with them an immense number of associated symbionts, including parasites. Reptiles are no exception. Most of the imported reptiles originate from tropical countries and their possibility to carry potentially dangerous pathogens is high. According to CITES, Europe is currently the main reptile importer in the world. Despite this, there is no review or analysis available for the risk related to the importation of tick-borne diseases with traded reptile to the EU. The main aim of the manuscript is to provide a review on the available literature on ticks introduced to and exchanged between European countries via the live reptile trade. So far, the published reports of ticks imported on reptiles are limited to few European countries: Italy, Poland, Spain, Netherlands, Belgium, Slovenia and UK. The following species have been reported: Hyalomma aegyptium, Amblyomma dissimile, Amblyomma exornatum, Amblyomma flavomaculatum, Amblyomma fuscolineatum, Amblyomma latum, Amblyomma quadricavum, Amblyomma marmoreum, Amblyomma nuttalli, Amblyomma sparsum, Amblyomma sphenodonti, Amblyomma transversale and Amblyomma varanense. The majority of species are of African origin, followed by American and Asian species. All groups of reptiles (chelonians, snakes, lizards, crocodiles, tuataras) were involved. However, it seems that certain groups (i.e. tortoises of genus Testudo, monitor lizards of genus Varanus, snakes of genus Python) are more important as host for imported ticks, but this may be related to higher levels of international trade. Even fewer are the reports of tick-borne pathogens associated with imported reptile ticks. Despite the diversity of tick species reported on imported reptiles, the situations of truly invasive species are atypical and are limited in natural environments to maximum two cases where H. aegyptium was involved. Otherwise, the risk associated with reptile trade for introduction of invasive tick to Europe is low

  8. Control of Tick Infestations in Oryctolagus cuniculus (Lagomorpha: Leporidae) With Spinosad Under Laboratory and Field Conditions. (United States)

    ValcÁrcel, Félix; SÁnchez, J L Pérez; Jaime, J M Tercero; Basco-Basco, P I; Guajardo, S C Cota; Cutuli, M T; GonzÁlez, J; Olmeda, A S


    Because of great economic loss in the world's livestock industry, and the serious risks to human health, the control of ticks and tick-borne diseases is one of the most important health management issues today. Current methodology involves integrated tick control for preventing the development of resistance. Rabbits are hosts for immature stages of the three-host tick Hyalomma lusitanicum Koch; so, we focus on this host as a strategy to interrupt the tick life cycle. Spinosad is an insecticide-acaricide, produced by the fermentation of metabolites of the actinomycete bacterium Saccharopolyspora spinosa. We administered spinosad orally by force-feeding naturally and artificially infested rabbits, and under field conditions by administering treated food via a hopper during the period of peak infestation and reinfestation risk for rabbits. No living larvae were recovered from treated laboratory rabbits. In naturally infested rabbits, the number of live ticks collected from treated rabbits (mean = 0.62 ticks per ear) was significantly lower than those recovered from untreated rabbits (mean = 7.27; P < 0.001), whereas the number of dead ticks collected from untreated rabbits (mean = 6.53) was significantly lower than those recovered from treated rabbits (mean = 18.62; P < 0.001). In addition, free and continually reinfested rabbits freely ingested low doses of spinosad, reducing the tick burden from 48.00 (Day 0) to 26.09 ticks per ear in treated rabbits (Day 16), whereas controls maintained the infection (46.64). This strategy could be useful as an alternative or supplement to traditional acaricides in tick control programs.

  9. Crimean-Congo hemorrhagic fever virus clades V and VI (Europe 1 and 2) in ticks in Kosovo, 2012. (United States)

    Sherifi, Kurtesh; Cadar, Daniel; Muji, Skender; Robaj, Avni; Ahmeti, Salih; Jakupi, Xhevat; Emmerich, Petra; Krüger, Andreas


    Despite being a small country, Kosovo represents one of the few foci of Crimean-Congo hemorrhagic fever (CCHF) in Europe. The distribution of Kosovar tick vectors and the evolution of CCHF virus in ticks are both as yet unknown. A better description of the extent and the genetic diversity of CCHFV in ticks from endemic settings is essential, in order to be controlled. We investigated the 2012 distribution of Kosovar ticks alongside the prevalence and the phylogeography of tick-derived CCHFV. Hyalomma marginatum dominated in the endemic municipalities with 90.2% versus 24.3% in the non-endemic regions. Of 1,102 tested ticks, 40 (3.6%) were CCHFV-positive, belonging to H. marginatum (29), Rhipicephalus bursa (10), and Ixodes ricinus (1). The virus strains clustered with clade V and VI related sequences. They fell into two lineages: Kosovo I and II. Kosovo I comprised strains recovered exclusively from R. bursa ticks and was closely related to AP92 prototype strain. Kosovo II clustered into Kosovo IIa, including human-derived strains, and IIb including only strains detected in H. marginatum and I. ricinus. Our phylogeographic reconstruction suggests two temporally distinct CCHFV introductions: the most probable location of the most recent common ancestor of Kosovo I lineage was in Greece (63 years ago) and that of lineages IIa-b in Turkey (35 years ago). After each CCHFV introduction into Kosovo, subsequent lineage expansions suggest periods of in situ evolution. The study provides the first insight into the genetic variability and the origin of CCHFV in ticks from Kosovo. Our findings indicate the spreading of CCHFV to non-endemic areas, which underlines the importance of further studies in order to monitor and predict future CCHF outbreaks in Kosovo. The AP92-like strains appear to be more widespread than previously thought and may provide a promising target for experimental studies due to their assumed low pathogenicity.

  10. Isolation of aerobic bacteria from ticks infested sheep in Iraq

    Institute of Scientific and Technical Information of China (English)

    Waleed Ibrahem Jalil; Mohammad Mushgil Zenad


    Objective:To highlight the presence of aerobic bacteria in live ticks infested sheep,in Diyala Governorate,Iraq.Methods:One hundred and thirty adult alive ticks were picked up from sheep which were reared in different farms in Diyala Governorate,Iraq,during the period from November 2012 to May 2013.Ticks were classified in the Natural History Museum in Baghdad.They were dissected aseptically for extraction of the salivary gland and midgut.The removed tissue from each organ was inoculated in buffer peptone water(1%)and incubated for 2 h at 37 °C,to maintain weak and/or injured bacterial cells,then transmitted to nutrient broth incubated at 37 °C for 18 h.Culturing was done on three solid bacteriological media(nutrient,blood and McConkey agars),and then incubated at37 ℃ for 24 h.Bacterial identification was performed by using multiple biochemical tests and API-20 strips.Data were analyzed by using Statistical Analysis System version 9.1,2010.Chi-square test was used for comparison at significant level of P ≤ 0.05.Results:Two species of ticks were identified[Rhipicephalus(Boophilus) annulatus and Hyalomma turanicum].High bacterial isolation rate was observed(483 isolates).A significant high isolation rate was recorded from Rhipicephalus annulatus(63.14%).Six bacterial species were identified[Escherichia coli(28.36%),Pseudomonas aeruginosa(18.01%),Bacillus cereus(14.69%),Staphylococcus aureus(13.66%),Citrobacter freundii(13.04%),and Enterobacter species(12.21%)].Also the high bacterial isolation rates were recorded in the temperate months(November,March and April);these coincided with high reproductive performance of ticks.Conclusions:The high isolation rate of aerobic pathogens from ticks might reflect the active contribution of this arthropod in environmental contamination and increase the probability of transmitting bacterial pathogens to their hosts.

  11. Isolation of aerobic bacteria from ticks infested sheep in Iraq

    Institute of Scientific and Technical Information of China (English)

    Waleed Ibrahem Jalil; Mohammad Mushgil Zenad


    Objective: To highlight the presence of aerobic bacteria in live ticks infested sheep, in Diyala Governorate, Iraq. Methods: One hundred and thirty adult alive ticks were picked up from sheep which were reared in different farms in Diyala Governorate, Iraq, during the period from November 2012 to May 2013. Ticks were classified in the Natural History Museum in Baghdad. They were dissected aseptically for extraction of the salivary gland and mid-gut. The removed tissue from each organ was inoculated in buffer peptone water (1%) and incubated for 2 h at 37℃, to maintain weak and/or injured bacterial cells, then transmitted to nutrient broth incubated at 37℃ for 18 h. Culturing was done on three solid bacteriological media (nutrient, blood and McConkey agars), and then incubated at 37℃ for 24 h. Bacterial identification was performed by using multiple biochemical tests and API-20 strips. Data were analyzed by using Statistical Analysis System version 9.1, 2010. Chi-square test was used for comparison at significant level of P ≤0.05. Results: Two species of ticks were identified [Rhipicephalus (Boophilus) annulatus and Hyalomma turanicum]. High bacterial isolation rate was observed (483 isolates). A significant high isolation rate was recorded from Rhipicephalus annulatus (63.14%). Six bacterial species were identified [Escherichia coli (28.36%), Pseudomonas aeruginosa (18.01%), Bacillus cereus (14.69%), Staphylococcus aureus (13.66%), Citrobacter freundii (13.04%), and Enterobacter species (12.21%)]. Also the high bacterial isolation rates were recorded in the temperate months (November, March and April); these coin-cided with high reproductive performance of ticks. Conclusions: The high isolation rate of aerobic pathogens from ticks might reflect the active contribution of this arthropod in environmental contamination and increase the probability of transmitting bacterial pathogens to their hosts.

  12. Molecular identification of Theileria and Babesia in ticks collected from sheep and goats in the Black Sea region of Turkey. (United States)

    Aydin, Mehmet Fatih; Aktas, Munir; Dumanli, Nazir


    A molecular survey was undertaken in the Black Sea region of Turkey to determine the presence of Theileria and Babesia species of medical and veterinary importance. The ticks were removed from sheep and goats, pooled according to species and locations, and analyzed by PCR-based reverse line blot (RLB) and sequencing. A total of 2241 ixodid ticks belonging to 5 genus and 12 species were collected and divided into 310 pools. Infection rates were calculated as the maximum likelihood estimation (MLE) with 95% confidence intervals (CI). Of the 310 pools tested, 46 (14.83%) were found to be infected with Theileria or Babesia species, and the overall MLE of the infection rate was calculated as 2.27% (CI 1.67-2.99). The MLE of the infection rates were calculated as 0.691% (CI 0.171-1.78) in Haemaphysalis parva, 1.47% (CI 0.081-6.37) in Rhipicephalus sanguineus, 1.84% (CI 0.101-7.87) in Ixodes ricinus, 2.86% (CI 1.68-4.48) in Rhipicephalus turanicus, 5.57% (CI 0.941-16.3) in Hyalomma marginatum, and 6.2% (CI 4.02-9.02) in Rhipicephalus bursa. Pathogens identified in ticks included Theileria ovis, Babesia ovis, Babesia bigemina, and Babesia microti. Most tick pools were infected with a single pathogen. However, five pools displayed mixed infections with T. ovis and B. ovis. This study provides the first molecular evidence for the presence of B. microti in ticks in Turkey.

  13. Isolation and characterization of Babesia pecorum sp. nov. from farmed red deer (Cervus elaphus). (United States)

    Jouglin, Maggy; Fernández-de-Mera, Isabel G; de la Cotte, Nathalie; Ruiz-Fons, Francisco; Gortázar, Christian; Moreau, Emmanuelle; Bastian, Suzanne; de la Fuente, José; Malandrin, Laurence


    The diversity of Babesia species infecting cervids in parts of central and southern Spain was analyzed by collecting blood from farmed red deer (Cervus elaphus). Babesia sp. was isolated in vitro from two red deer herds in Cádiz and Ciudad Real. The number of Babesia sp. carriers differed between the two herds: 36/77 in Cádiz and 1/35 in Ciudad Real. Hyalomma lusitanicum was the most prevalent tick species identified on the Cádiz farm vegetation and on sampled animals, and is therefore a candidate vector. The molecular characteristics of 21 isolates were determined by complete (8 isolates) or partial (13 isolates) 18S rRNA gene sequencing. The sequences were highly similar (over 99.4% identity) and 6 sequence types were identified at the level of one herd only, demonstrating a rather high genetic diversity. They formed a monophyletic clade, and members of the three main sequence types shared a similar morphology and the same erythrocyte susceptibility pattern. This clade also included Babesia sp. Xinjiang isolated from sheep in China and Babesia sp. identified in giraffe in South Africa, with identities higher than 98.3% and statistically relevant phylogenetic support. None of the biological properties analyzed for both Babesia from red deer and Babesia sp. Xinjiang allowed their differentiation (ability to develop in vitro in erythrocytes from cattle and sheep, as well as in erythrocytes from different cervids, unsuccessful infection of calves). We propose the Babesia isolated from red deer as a new species named B. pecorum. Whether Babesia sp. Xinjiang and the Babesia characterized in South Africa belong to the same species is debated.

  14. Transcriptome and microRNome of Theileria annulata Host Cells

    KAUST Repository

    Rchiad, Zineb


    Tropical Theileriosis is a parasitic disease of calves with a profound economic impact caused by Theileria annulata, an apicomplexan parasite of the genus Theileria. Transmitted by Hyalomma ticks, T. annulata infects and transforms bovine lymphocytes and macrophages into a cancer-like phenotype characterized by all six hallmarks of cancer. In the current study we investigate the transcriptional landscape of T. annulata-infected lymphocytes to define genes and miRNAs regulated by host cell transformation using next generation sequencing. We also define genes and miRNAs differentially expressed as a result of the attenuation of a T.annulata-infected macrophage cell line used as a vaccine. By comparing the transcriptional landscape of one attenuated and two transformed cell lines we identify four genes that we propose as key factors in transformation and virulence of the T. annulata host cells. We also identify miR- 126-5p as a key regulator of infected cells proliferation, adhesion, survival and invasiveness. In addition to the host cell trascriptome we studied T. annulata transcriptome and identified the role of ROS and TGF-β2 in controlling parasite gene expression. Moreover, we have used the deep parasite ssRNA-seq data to refine the available T. annulata annotation. Taken together, this study provides the full list of host cell’s genes and miRNAs transcriptionally perturbed after infection with T. annulata and after attenuation and describes genes and miRNAs never identified before as players in this type of host cell transformation. Moreover, this study provides the first database for the transcriptome of T. annulata and its host cells using next generation sequencing.

  15. [Prevalence of Anaplasma spp. infection in a desert landscape region of Heshuo, Xinjiang]. (United States)

    Zhang, Gui-lin; Sun, Xiang; Zhao, Yan; Liu, Xiao-min; Zheng, Zhong; Sun, Yi; Liu, Ran


    To study the prevalence of Anaplasmosis among human, domestic sheep and tick population in Heshuo area, southern Xinjiang and to investigate the diversity of Anaplasma species. Ticks were captured from wild field and blood samples were collected from healthy residents and their domestic sheep. Indirect fluorescent assay was carried out to determine the presence of Anaplasma specific IgG antibodies in blood sample of human and goats, respectively. Nested PCR and sequence alignment of Anaplasma partial 16S rDNA were used to investigate the diversity of Anaplasma species. 43.31% (55/127) of human beings and 27.50% (55/200) of the goats were found positive for Anaplasma specific IgG. In total, 367 ticks were captured, including 3 genus and 4 species, which mainly consisting of dominate Hyalomma (H.) asiaticum (47.41%) and Rhipicephalus (R.) pumilio (37.60%). 5.00% (18/360) of the questing ticks and 4.49% (7/156) of the goat blood samples were found to have had 16S rDNA, representing Anaplasma sp. by nested PCR, but none was found from human beings. Results from sequential alignment revealed that the positive amplicons were identified to be Anaplasma phagocytophilum (99.2% GU046565, 99.5% GU064897 and 99.5% AB196721) and Anaplasma central (99.2% GU064903). Human and zoonotic anaplasmosis, which were probably transmitted by H. asiaticum and R. pumilio, were co-circulating in the desert landscape of Heshuo area, Xinjiang.

  16. Anaplasma phagocytophilum in sheep and goats in central and southeastern China. (United States)

    Yang, Jifei; Liu, Zhijie; Niu, Qingli; Liu, Junlong; Han, Rong; Guan, Guiquan; Li, Youquan; Liu, Guangyuan; Luo, Jianxun; Yin, Hong


    Anaplasma phagocytophilum is wide spread throughout the world and impacts both human and animal health. Several distinct ecological clusters and ecotypes of the agent have been established on the basis of various genetic loci. However, information on the genetic variability of A. phagocytophilum isolates in China represents a gap in knowledge. The objective of this study was to determine the prevalence and genetic characterization of A. phagocytophilum in small ruminants in central and southeastern China. The presence of A. phagocytophilum was determined in 421 blood samples collected from small ruminants by PCR. Positive samples were genetically characterized based on 16S rRNA and groEL genes. Statistical analyses were conducted to identify ecotypes of A. phagocytophilum strains, to assess their host range and zoonotic potential. Out of 421 sampled small ruminants, 106 (25.2%) were positive for A. phagocytophilum. The positive rate was higher in sheep (35.1%, 40/114) than in goats (26.4%, 66/307) (P Anaplasma sp. was identified and closely related to an isolate previously reported in Hyalomma asiaticum, which clustered independently from all recognized Anaplasma species. A molecular survey of A. phagocytophilum was conducted in sheep and goats from ten provinces in central and southeastern China. Two 16S rRNA variants and a new ecotype of A. phagocytophilum were identified in small ruminants in China. Moreover, a potential novel Anaplasma species was reported in goats. Our findings provide additional information on the complexity of A. phagocytophilum in terms of genetic diversity in China.

  17. Laboratory Study on Biological Control of Ticks (Acari: Ixodidae by Entomopathogenic Indigenous Fungi (Beauveria bassiana

    Directory of Open Access Journals (Sweden)

    M Abdigoudarzi


    Full Text Available Background: Chemical control method using different acaricides as spray, dipping solution or pour-on is routinely used for controlling ticks. Biological control agents are favorable due to their safety for animals and environment. Entomopathogenic fungi such as Beauveria bassiana are well known for controlling ticks. In this study, two Iranian indigenous strains of B. bassiana (B. bassiana 5197 and B. bassiana Evin were selected and grown on specific me­dia. The pathogenic effects of these strains were evaluated on adult stages of two Iranian Ixodidae members (H. anatolicum anatolicum Koch 1844, and H. marginatum Koch 1844 by dipping method."nMethods: Two Iranian strains of Beauveria bassiana (Beauveria bassiana 5197 and Beauveria bassiana Evin were selected and were grown successfully on specific media. The pathogenic effects of these strains were evaluated on adult stages of Iranian Ixodidae members such as, Hyalomma anatolicum anatolicum and H. marginatum by dipping method (these ticks were grown up at laboratory conditions during 2002 up to 2003 and still it is continued ."nResults: There was no effect of strain 5197 on mortality or fecundity rates for ticks. There was acute phase sign of paralysis in test group after dipping ticks in suspension made from Evin strain of B. bassiana. In addition, the test groups were totally died after four months, but the control groups survived for six months."nConclusion: High concentration of fungal spores is needed for inducing fungal infection. Additional study using different strains and fungi on Iranian ticks is proposed.   Keywords: Biological control, fungi, Beauveria bassiana, ticks, Ixodidae, Iran

  18. Detection and identification of putative bacterial endosymbionts and endogenous viruses in tick cell lines. (United States)

    Alberdi, M Pilar; Dalby, Matthew J; Rodriguez-Andres, Julio; Fazakerley, John K; Kohl, Alain; Bell-Sakyi, Lesley


    As well as being vectors of many viral, bacterial, and protozoan pathogens of medical and veterinary importance, ticks harbour a variety of microorganisms which are not known to be pathogenic for vertebrate hosts. Continuous cell lines established from ixodid and argasid ticks could be infected with such endosymbiotic bacteria and endogenous viruses, but to date very few cell lines have been examined for their presence. DNA and RNA extracted from over 50 tick cell lines deposited in the Roslin Wellcome Trust Tick Cell Biobank ( were screened for presence of bacteria and RNA viruses, respectively. Sequencing of PCR products amplified using pan-16S rRNA primers revealed the presence of DNA sequences from bacterial endosymbionts in several cell lines derived from Amblyomma and Dermacentor spp. ticks. Identification to species level was attempted using Rickettsia- and Francisella-specific primers. Pan-Nairovirus primers amplified PCR products of uncertain specificity in cell lines derived from Rhipicephalus, Hyalomma, Ixodes, Carios, and Ornithodoros spp. ticks. Further characterisation attempted with primers specific for Crimean-Congo haemorrhagic fever virus segments confirmed the absence of this arbovirus in the cells. A set of pan-Flavivirus primers did not detect endogenous viruses in any of the cell lines. Transmission electron microscopy revealed the presence of endogenous reovirus-like viruses in many of the cell lines; only 4 of these lines gave positive results with primers specific for the tick Orbivirus St Croix River virus, indicating that there may be additional, as yet undescribed 'tick-only' viruses inhabiting tick cell lines.

  19. Tick (Acari: Ixodidae) infestations in cattle along Geba River basin in Guinea-Bissau. (United States)

    Zúquete, Sara Tudela; Coelho, João; Rosa, Fernanda; Vaz, Yolanda; Cassamá, Bernardo; Padre, Ludovina; Santos, Dulce; Basto, Afonso P; Leitão, Alexandre


    Tick infestations are a major problem for animal production in tropical areas where prevention and control remain deficient. The present study sought to assess the awareness of traditional cattle producers towards the importance of ticks and aimed at the identification of tick species infesting bovines within the Geba River basin, Guinea-Bissau. Interviews with producers revealed that the majority directly correlates the presence of ticks with the occurrence of diseases in cattle. However, insufficient or inadequate control approaches prevail. A total of 337 ticks were collected on bovines at 18 different villages (10 during dry season, and 8 during rainy season). The tick species collected during the dry season were Rhipicephalus (Boophilus) geigyi (56.5%), followed by Amblyomma variegatum (23.3%), Rhipicephalus (Boophilus) annulatus (17.6%) and Hyalomma truncatum (1%). In the rainy season A. variegatum was the most collected (88.9%), followed by R. (Boophilus) geigyi (4.2%), R. (Boophilus) annulatus (3.4%), Rhipicephalus sanguineus group (2.8%) and H. truncatum (0.7%). To support species identification, segments of both cytochrome c oxidase I (COI) and 12S ribosomal RNA (12S) genes were sequenced and the data gathered were analysed by maximum likelihood and parsimony. Morphological and genetic data of individual specimens gathered in this study provide relevant information for future studies on tick population dynamics in the region. In addition, it led to a deeper characterization of R. sulcatus and a R. sanguineus-like specimen, exploring their genetic relationship with other R. sanguineus, which supports their classification as distinct species within R. sanguineus group.

  20. Crimean-Congo hemorrhagic fever virus clades V and VI (Europe 1 and 2 in ticks in Kosovo, 2012.

    Directory of Open Access Journals (Sweden)

    Kurtesh Sherifi


    Full Text Available Despite being a small country, Kosovo represents one of the few foci of Crimean-Congo hemorrhagic fever (CCHF in Europe. The distribution of Kosovar tick vectors and the evolution of CCHF virus in ticks are both as yet unknown. A better description of the extent and the genetic diversity of CCHFV in ticks from endemic settings is essential, in order to be controlled. We investigated the 2012 distribution of Kosovar ticks alongside the prevalence and the phylogeography of tick-derived CCHFV. Hyalomma marginatum dominated in the endemic municipalities with 90.2% versus 24.3% in the non-endemic regions. Of 1,102 tested ticks, 40 (3.6% were CCHFV-positive, belonging to H. marginatum (29, Rhipicephalus bursa (10, and Ixodes ricinus (1. The virus strains clustered with clade V and VI related sequences. They fell into two lineages: Kosovo I and II. Kosovo I comprised strains recovered exclusively from R. bursa ticks and was closely related to AP92 prototype strain. Kosovo II clustered into Kosovo IIa, including human-derived strains, and IIb including only strains detected in H. marginatum and I. ricinus. Our phylogeographic reconstruction suggests two temporally distinct CCHFV introductions: the most probable location of the most recent common ancestor of Kosovo I lineage was in Greece (63 years ago and that of lineages IIa-b in Turkey (35 years ago. After each CCHFV introduction into Kosovo, subsequent lineage expansions suggest periods of in situ evolution. The study provides the first insight into the genetic variability and the origin of CCHFV in ticks from Kosovo. Our findings indicate the spreading of CCHFV to non-endemic areas, which underlines the importance of further studies in order to monitor and predict future CCHF outbreaks in Kosovo. The AP92-like strains appear to be more widespread than previously thought and may provide a promising target for experimental studies due to their assumed low pathogenicity.

  1. PCR screening of tick-borne agents in sensitive conservation areas, Southeast Portugal. (United States)

    Santos-Silva, Maria Margarida; Melo, Pedro; Santos, Nuno; Antunes, Sandra; Duarte, Luís Raposo; Ferrolho, Joana; Milhano, Natacha; Santos, Patrícia Tavares; Domingos, Ana; Santos, Ana Sofia


    The Southeast region of Portugal, particularly the Guadiana valley, is currently the reintroduction territory of Lynx pardinus (Iberian lynx), one of the most endangered felids in the world that is only found in the Iberian Peninsula. Over the last century, populations have declined, placing L. pardinus at extremely high risk of extinction in the wild and relying on reintroduction projects. Among the aspects taken into account in the establishment of new populations is the sanitary status of the selected habitats, especially concerning infectious diseases, including tick-borne pathogens (TBPs). This study presents the results of TBPs survey on ticks collected at sensitive conservation areas of Southeast Portugal. From 2012 to 2014, 231 ticks obtained from vegetation, sympatric domestic and wild animals were submitted for analysis. The presence of Babesia spp., Cytauxzoon spp., Theileria spp., Hepatozoon spp., Anaplasma spp., Ehrlichia spp., Candidatus Neoehrlichia mikurensis, among other Anaplasmataceae, and Coxiella burnetii were investigated by PCR. Six tick species were recorded, Dermacentor marginatus (n = 13/5.6%), Hyalomma lusitanicum (n = 175/75.8%), Ixodes ricinus (n = 4/1.7%), Rhipicephalus bursa (n = 7/3.0%), R. pusillus (n = 21/9.1%) and R. sanguineus sensu lato (n = 11/4.8%). The molecular screening confirmed the presence of two tick-borne pathogens, C. burnetii (N = 34) and Anaplasma platys (N = 1), and one tick-endosymbiont, Candidatus Midichloria mitochondrii (N = 45). The results obtained provide new information on the circulation of ticks and TBPs with potential veterinary importance in Iberian lynx habitat. Copyright © 2016 Elsevier Ltd. All rights reserved.

  2. A GIS framework for the assessment of tick impact on human health in a changing climate

    Directory of Open Access Journals (Sweden)

    Agustin Estrada-Peña


    Full Text Available A framework to evaluate the impact of ticks on human health under various scenarios of climate change is proposed. The purpose is not to provide a comprehensive plan (e.g. the economic impact of ticks on human society is not included, instead we wish to describe a series of indices that would be helpful by obtaining homogeneous comparisons of impact and vulnerability exerted by ticks in different regions, countries or continents, using normalized sets of population, vegetation, climate and physical attributes of the territory. Three tick species, i.e. Dermacentor marginatus, Rhipicephalus turanicus and Hyalomma marginatum, have been traced over the territory of Spain to further explain the computation of these indices. The discussion is based on tick habitat suitability, used as a measure of the abiotic (climate fitness of the habitat for the species in question, and the sensitivity of each tick species to the rate of change of habitat suitability with respect to climate change. The impact is the rate of change in habitat suitability weighted with a fuzzy logic function evaluating the total number of people in an area, percent of rural population and accessibility of the geographical divisions (expressed as hexagons with a 10 km radius used in the study. The different climate scenarios evaluated in relation to ticks show that the north-western part of Spain would suffer the greatest impact in case the mean temperature would increase, while the Mediterranean region would suffer the highest impact if temperatures decreased. Vulnerability, based on the sanitary structure of the territory and on the impact on human activities due to the change in tick distribution and abundance, is proposed as a measure of adaptation of society to these climate scenarios. The cost is evaluated as a function of land use and tick habitat suitability in a buffer zone surrounding each geographic division. All indices proposed have been obtained by search of common and

  3. Studies on prevalence, risk indicators and control options for tick infestation in ruminants

    Directory of Open Access Journals (Sweden)

    Nady M. Asmaa


    Full Text Available An epidemiological study was conducted at Benisuef district to determine the current situation and associated determinants of tick infestations in ruminants and to assess the efficacy of three different types of insecticides against tick infestation under field conditions. Total of (1082 animals of different species (540 cattle, 230 buffaloes, 108 of each sheep & goats and 96 camels were selected randomly and examined carefully for tick infestation. About (30.1% of total observed animals were found tick infested with highest rate in cattle (60.5% followed by goats (25.9%, buffaloes (17.8%, sheep (14.8% while no tick infestation recorded in camels. The most prevalent tick's species affecting ruminants was Boophilus annulatus (26.5% followed by Hyalomma anatolicum (6.1% then Rhipicephalus turanicus (3.4%. Regarding the associated risk factors, tick infestation was found statistically significant (P 3 years (78.8% followed by at age, ≤2 months (57.8% and during summer months were found highly significant (P < 0.01 in cattle ( 76.5% followed by goats and sheep (33.3% & 22.9% resp., comparing with results in winter. The preferred sites of ticks' attachment to infested animals were udders and external genitalia (70.7% of each then Neck & chest (63.0% of each, inner thighs (61.1%, perineum (41.7%, ears (14.6%, around eyes (11.7%. The obtained results revealed that poor husbandry practices of small holder farmers be a determinant making the animals more prone to tick infestation in this district. Improving the hygienic conditions associated with treatment of infested cattle with Ivermectin (0.2 mg/kg b.wt, S/C and spraying of Deltamethrin (1% for surrounding environment twice every 14 days are recommended for control of tick infestation under field condition.

  4. Development of three quantitative real-time PCR assays for the detection of Rickettsia raoultii, Rickettsia slovaca, and Rickettsia aeschlimannii and their validation with ticks from the country of Georgia and the Republic of Azerbaijan. (United States)

    Jiang, Ju; You, Brian J; Liu, Evan; Apte, Anisha; Yarina, Tamasin R; Myers, Todd E; Lee, John S; Francesconi, Stephen C; O'Guinn, Monica L; Tsertsvadze, Nikoloz; Vephkhvadze, Nino; Babuadze, Giorgi; Sidamonidze, Ketevan; Kokhreidze, Maka; Donduashvili, Marina; Onashvili, Tinatin; Ismayilov, Afrail; Agayev, Nigar; Aliyev, Mubariz; Muttalibov, Nizam; Richards, Allen L


    A previous surveillance study of human pathogens within ticks collected in the country of Georgia showed a relatively high infection rate for Rickettsia raoultii, R. slovaca, and R. aeschlimannii. These 3 spotted fever group rickettsiae are human pathogens: R. raoultii and R. slovaca cause tick-borne lymphadenopathy (TIBOLA), and R. aeschlimannii causes an infection characterized by fever and maculopapular rash. Three quantitative real-time polymerase chain reaction (qPCR) assays, Rraoul, Rslov, and Raesch were developed and optimized to detect R. raoultii, R. slovaca, and R. aeschlimannii, respectively, by targeting fragments of the outer membrane protein B gene (ompB) using species-specific molecular beacon or TaqMan probes. The 3 qPCR assays showed 100% specificity when tested against a rickettsiae DNA panel (n=20) and a bacteria DNA panel (n=12). The limit of detection was found to be at least 3 copies per reaction for all assays. Validation of the assays using previously investigated tick nucleic acid preparations, which included Rickettsia-free tick samples, tick samples that contain R. raoultii, R. slovaca, R. aeschlimannii, and other Rickettsia spp., gave 100% sensitivity for all 3 qPCR assays. In addition, a total of 65 tick nucleic acid preparations (representing 259 individual ticks) collected from the country of Georgia and the Republic of Azerbaijan in 2009 was tested using the 3 qPCR assays. R. raoultii, R. slovaca, and R. aeschlimannii were not detected in any ticks (n=31) from the Republic of Azerbaijan, but in the ticks from the country of Georgia (n=228) the minimal infection rate for R. raoultii and R. slovaca in Dermacentor marginatus was 10% and 4%, respectively, and for R. aeschlimannii in Haemaphysalis sulcata and Hyalomma spp. it was 1.9% and 20%, respectively.

  5. Hedgehogs (Erinaceus europaeus as a Source of Ectoparasites in Urban-suburban Areas of Northwest of Iran

    Directory of Open Access Journals (Sweden)

    Nasser Hajipour


    Full Text Available Background: Hedgehogs are small, nocturnal mammals which become popular in the world and have important role in transmission of zoonotic agents. Thus, the present study aimed to survey ectoparasite infestation from April 2010 to December 2011 in urban and suburban parts of Urmia and Tabriz Cities, Northwest of Iran.Methods: A total number of 84 hedgehogs (40 females and 44 males were examined. They have been carefully inspected for ectoparasites and collected arthropods were stored in 70% ethanol solution. The identification of arthropods was carried out using morphological diagnostic keys.Results: The occurrence of ticks on hedgehogs was 23 (67.7% with Rhipicephalus turanicus in Urmia and 11 (22% as well as 1(2% with Rh. turanicus and Hyalomma anatolicum anatolicum in Tabriz, respectively. One flea species, Archaeopsylla erinacei, was found with prevalence of 19 (55.9% and 27 (54% in Urmia and Tabriz Cities, respectively. Prevalence of infestation with Rh. turanicus and A. erinacei were not different (P> 0.05 between sexes of hedgehogs in two study areas. Highest prevalence of tick and flea infestation was in June in Urmia, whereas it was observed in August in Tabriz. Both tick and flea parasitizing hedgehogs showed seasonal difference in prevalence (P< 0.05 in Urmia, but it was not detected in Tabriz (P> 0.05.Conclusion: The result showed the high occurrence of ectoparasites in hedgehog population and according to the zoonotic potential of these animals as vector of some agents further studies are needed to investigate in different parts of Iran.

  6. The comparative host status of red veld rats (Aethomys chrysophilus) and bushveld gerbils (Tatera leucogaster) for epifaunal arthropods in the southern Kruger National Park, South Africa. (United States)

    Braack, L E; Horak, I G; Jordaan, L C; Segerman, J; Louw, J P


    Red veld rats (Aethomys chrysophilus) and bushveld gerbils (Tatera leucogaster) were trapped at monthly intervals, when possible, over a 2-year period, in the southern Kruger National Park, Mpumalanga Province. Forty-six specimens of each species were caught, euthenased and microscopically examined for fleas, lice, ticks and mites. Clear differences existed between the two rodent hosts in infestation intensity and also parasite species. The flea, Xenopsylla brasiliensis, commonly and exclusively utilized red veld rats, whereas Xenopsylla frayi was common and specific to bushveld gerbils. T. leucogaster were commonly infested with the lice Hoplopleura biseriata and Polyplax biseriata, while only a single A. chrysophilus hosted the louse, Hoplopleura patersoni. Red veld rats harboured small numbers of the immature stages of Haemaphysalis leachi/spinulosa and relatively large numbers of Rhipicephalus simus. The larvae of R. simus were irregularly collected from February to September and the nymphs from March to November. Bushveld gerbils hosted fewer ticks than did the rats, with a single specimen of H. leachi/spinulosa and low numbers of immature Hyalomma truncatum, the latter erratically present from June to October. Miles were abundant on both rodent hosts, A. chrysophilus hosting 13 species in six families, and T. leucogaster hosting 12 species representing seven families, with clear differences in mite assemblages between the two rodents. As the rats and gerbils were collected from the same trap lines at the same times, the differences in species composition and infestation intensity of their parasites, suggest that immunological behavioural or other segregating mechanisms are in operation to maintain discrete parasite assemblages.

  7. Scientific Opinion on the Role of Tick Vectors in the Epidemiology of Crimean-Congo Hemorrhagic Fever and African Swine Fever in Eurasia

    Directory of Open Access Journals (Sweden)

    EFSA Panel on Animal Health and Welfare (AHAW


    Full Text Available The report provides an update on the role of the tick vectors in the epidemiology of African swine fever (ASF and Crimean and Congo haemorrhagic fever (CCHF in Eurasia, specifically to review of the geographical distribution of the relevant ticks with presentation of maps of their occurrence in Europe and Mediterranean basin; a description of the factors that define the relevant tick population dynamics and identify possible high risk areas in the EU; an update on the role of tick vectors associated with CCHF and ASF in Eurasia; and reviews available methods for the control of the relevant tick vectors. Data were collected through systematic literature review in a database from which maps of geographic distribution of ticks, CCHF virus and ASF virus were issued. The main vectors for CCHF are Hyalomma spp, Increase in the number of fragmented areas and the degradation of agricultural lands to bush lands are the two main factors in the creation of new foci of CCHF in endemic areas. Movement of livestock and wildlife species, which may carry infected ticks, contributes to the spread of the infection. The Middle East and Balkan countries are the most likely sources of introduction of CCHFV into other European countries. All the Ornithodoros species investigated so far can become infective with ASF virus and are perhaps biological vectors. These ticks are important in maintaining the local foci of the ASFV, but do not play an active role in the geographical spread of the virus. Wild boars have never been found infested by Ornithodoros spp. because wild boars normally do not rest inside protected burrows, but above the ground. There is no single ideal solution to the control of ticks relevant for CCHF or ASF. The integrated control approach is probably the most effective.

  8. Occurrence of Soft and Hard Ticks on Ruminants in Zagros Mountainous Areas of Iran

    Directory of Open Access Journals (Sweden)

    S Nabian


    Full Text Available Background:The distribution and preferences of ticks of animals in central of Iran were studied four times a year. Methods: One thousand seven tick specimens were collected from different localities including Isfahan, Chaharmahalbak­htiary, EastAzarbaijan, West Azerbaijan, Kordestan, Kermanshah, Lorestan and Fars. Results: Most of sampled animals in this area were infested. We also encountered with a wild goat (Capra hircus aegagrus in Kolah Qazi national park in this part that was infested intensively by Boophilus kohlsi. Fifteen ixodid tick species were identified over the study period from cattle, sheep and domestic and wild goats namely B. kohlsi (3.6% Rhipicephalus sanguineus (4.5%, Rh.bursa (21.9%, Rh.turanicus (2.9%, Dermacentor niveus (12.9%, D.raskemensis (4.1%, D.marginatus (7.3%, Haemaphysalis punctata (3.5%, H. Parva (0.6%, H. Choldokovskyi (2%, Hyalomma anatolicum excavatum (4.8%, H.anatolicum anatolicum (5.2%, H. asiaticum asiaticum (7.3%, H. marginatum marginatum (13%, and H. detritum detritum (5.9%. The only soft tick found was Ornithodoros canestrinii which occurred in all localities of Isfahan Province but with significant differences in abundance. Clear pattern of seasonality was evident for this species and it was generally present from November to March, while ixodid ticks were present throughout the year. The largest numbers of adult ixodid ticks were generally present from April to August. Conclusion: The results showed that Rh.bursa, D.niveus and H.marginatum marginatum are dominant tick species

  9. Detection and identification of putative bacterial endosymbionts and endogenous viruses in tick cell lines☆ (United States)

    Alberdi, M. Pilar; Dalby, Matthew J.; Rodriguez-Andres, Julio; Fazakerley, John K.; Kohl, Alain; Bell-Sakyi, Lesley


    As well as being vectors of many viral, bacterial, and protozoan pathogens of medical and veterinary importance, ticks harbour a variety of microorganisms which are not known to be pathogenic for vertebrate hosts. Continuous cell lines established from ixodid and argasid ticks could be infected with such endosymbiotic bacteria and endogenous viruses, but to date very few cell lines have been examined for their presence. DNA and RNA extracted from over 50 tick cell lines deposited in the Roslin Wellcome Trust Tick Cell Biobank ( were screened for presence of bacteria and RNA viruses, respectively. Sequencing of PCR products amplified using pan-16S rRNA primers revealed the presence of DNA sequences from bacterial endosymbionts in several cell lines derived from Amblyomma and Dermacentor spp. ticks. Identification to species level was attempted using Rickettsia- and Francisella-specific primers. Pan-Nairovirus primers amplified PCR products of uncertain specificity in cell lines derived from Rhipicephalus, Hyalomma, Ixodes, Carios, and Ornithodoros spp. ticks. Further characterisation attempted with primers specific for Crimean-Congo haemorrhagic fever virus segments confirmed the absence of this arbovirus in the cells. A set of pan-Flavivirus primers did not detect endogenous viruses in any of the cell lines. Transmission electron microscopy revealed the presence of endogenous reovirus-like viruses in many of the cell lines; only 4 of these lines gave positive results with primers specific for the tick Orbivirus St Croix River virus, indicating that there may be additional, as yet undescribed ‘tick-only’ viruses inhabiting tick cell lines. PMID:22743047

  10. Gene silencing in tick cell lines using small interfering or long double-stranded RNA. (United States)

    Barry, Gerald; Alberdi, Pilar; Schnettler, Esther; Weisheit, Sabine; Kohl, Alain; Fazakerley, John K; Bell-Sakyi, Lesley


    Gene silencing by RNA interference (RNAi) is an important research tool in many areas of biology. To effectively harness the power of this technique in order to explore tick functional genomics and tick-microorganism interactions, optimised parameters for RNAi-mediated gene silencing in tick cells need to be established. Ten cell lines from four economically important ixodid tick genera (Amblyomma, Hyalomma, Ixodes and Rhipicephalus including the sub-species Boophilus) were used to examine key parameters including small interfering RNA (siRNA), double stranded RNA (dsRNA), transfection reagent and incubation time for silencing virus reporter and endogenous tick genes. Transfection reagents were essential for the uptake of siRNA whereas long dsRNA alone was taken up by most tick cell lines. Significant virus reporter protein knockdown was achieved using either siRNA or dsRNA in all the cell lines tested. Optimum conditions varied according to the cell line. Consistency between replicates and duration of incubation with dsRNA were addressed for two Ixodes scapularis cell lines; IDE8 supported more consistent and effective silencing of the endogenous gene subolesin than ISE6, and highly significant knockdown of the endogenous gene 2I1F6 in IDE8 cells was achieved within 48 h incubation with dsRNA. In summary, this study shows that gene silencing by RNAi in tick cell lines is generally more efficient with dsRNA than with siRNA but results vary between cell lines and optimal parameters need to be determined for each experimental system.

  11. Identification and Mechanistic Analysis of a Novel Tick-Derived Inhibitor of Thrombin.

    Directory of Open Access Journals (Sweden)

    Willy Jablonka

    Full Text Available A group of peptides from the salivary gland of the tick Hyalomma marginatum rufipes, a vector of Crimean Congo hemorrhagic fever show weak similarity to the madanins, a group of thrombin-inhibitory peptides from a second tick species, Haemaphysalis longicornis. We have evaluated the anti-serine protease activity of one of these H. marginatum peptides that has been given the name hyalomin-1. Hyalomin-1 was found to be a selective inhibitor of thrombin, blocking coagulation of plasma and inhibiting S2238 hydrolysis in a competitive manner with an inhibition constant (Ki of 12 nM at an ionic strength of 150 mM. It also blocks the thrombin-mediated activation of coagulation factor XI, thrombin-mediated platelet aggregation, and the activation of coagulation factor V by thrombin. Hyalomin-1 is cleaved at a canonical thrombin cleavage site but the cleaved products do not inhibit coagulation. However, the C-terminal cleavage product showed non-competitive inhibition of S2238 hydrolysis. A peptide combining the N-terminal parts of the molecule with the cleavage region did not interact strongly with thrombin, but a 24-residue fragment containing the cleavage region and the C-terminal fragment inhibited the enzyme in a competitive manner and also inhibited coagulation of plasma. These results suggest that the peptide acts by binding to the active site as well as exosite I or the autolysis loop of thrombin. Injection of 2.5 mg/kg of hyalomin-1 increased arterial occlusion time in a mouse model of thrombosis, suggesting this peptide could be a candidate for clinical use as an antithrombotic.

  12. Detection of Bartonella tamiae, Coxiella burnetii and rickettsiae in arthropods and tissues from wild and domestic animals in northeastern Algeria. (United States)

    Leulmi, Hamza; Aouadi, Atef; Bitam, Idir; Bessas, Amina; Benakhla, Ahmed; Raoult, Didier; Parola, Philippe


    In recent years, the scope and importance of emergent vector-borne diseases has increased dramatically. In Algeria, only limited information is currently available concerning the presence and prevalence of these zoonotic diseases. For this reason, we conducted a survey of hematophagous ectoparasites of domestic mammals and/or spleens of wild animals in El Tarf and Souk Ahras, Algeria. Using real-time PCR, standard PCR and sequencing, the presence of Bartonella spp., Rickettsia spp., Borrelia spp. and Coxiella burnetii was evaluated in 268/1626 ticks, 136 fleas, 11 Nycteribiidae flies and 16 spleens of domestic and/or wild animals from the El Tarf and Souk Ahras areas. For the first time in Algeria, Bartonella tamiae was detected in 12/19 (63.2%) Ixodes vespertilionis ticks, 8/11 (72.7%) Nycteribiidae spp. flies and in 6/10 (60%) bat spleens (Chiroptera spp.). DNA from Coxiella burnetii, the agent of Q fever, was also identified in 3/19 (15.8%) I. vespertilionis from bats. Rickettsia slovaca, the agent of tick-borne lymphadenopathy, was detected in 1/1 (100%) Haemaphysalis punctata and 2/3 (66.7%) Dermacentor marginatus ticks collected from two boars (Sus scrofa algira) respectively. Ri. massiliae, an agent of spotted fever, was detected in 38/94 (40.4%) Rhipicephalus sanguineus sensu lato collected from cattle, sheep, dogs, boars and jackals. DNA of Ri. aeschlimannii was detected in 6/20 (30%) Hyalomma anatolicum excavatum and 6/20 (30%) Hy. scupense from cattle. Finally, Ri. felis, an emerging rickettsial pathogen, was detected in 80/110 (72.7%) Archaeopsylla erinacei and 2/2 (100%) Ctenocephalides felis of hedgehogs (Atelerix algirus). In this study, we expanded knowledge about the repertoire of ticks and flea-borne bacteria present in ectoparasites and/or tissues of domestic and wild animals in Algeria.

  13. Climate suitability for European ticks: assessing species distribution models against null models and projection under AR5 climate. (United States)

    Williams, Hefin Wyn; Cross, Dónall Eoin; Crump, Heather Louise; Drost, Cornelis Jan; Thomas, Christopher James


    There is increasing evidence that the geographic distribution of tick species is changing. Whilst correlative Species Distribution Models (SDMs) have been used to predict areas that are potentially suitable for ticks, models have often been assessed without due consideration for spatial patterns in the data that may inflate the influence of predictor variables on species distributions. This study used null models to rigorously evaluate the role of climate and the potential for climate change to affect future climate suitability for eight European tick species, including several important disease vectors. We undertook a comparative assessment of the performance of Maxent and Mahalanobis Distance SDMs based on observed data against those of null models based on null species distributions or null climate data. This enabled the identification of species whose distributions demonstrate a significant association with climate variables. Latest generation (AR5) climate projections were subsequently used to project future climate suitability under four Representative Concentration Pathways (RCPs). Seven out of eight tick species exhibited strong climatic signals within their observed distributions. Future projections intimate varying degrees of northward shift in climate suitability for these tick species, with the greatest shifts forecasted under the most extreme RCPs. Despite the high performance measure obtained for the observed model of Hyalomma lusitanicum, it did not perform significantly better than null models; this may result from the effects of non-climatic factors on its distribution. By comparing observed SDMs with null models, our results allow confidence that we have identified climate signals in tick distributions that are not simply a consequence of spatial patterns in the data. Observed climate-driven SDMs for seven out of eight species performed significantly better than null models, demonstrating the vulnerability of these tick species to the effects of

  14. Effect of Peganum harmala (wild rue extract on experimental ovine malignant theileriosis : pathological and parasitological findings

    Directory of Open Access Journals (Sweden)

    A. Derakhshanfar


    Full Text Available Malignant theileriosis of sheep is a highly fatal, acute or subacute disease is caused by the tick-borne protozoan parasite, Theileria hirci. In this investigation ten healthy male lambs aged 5-6 months were randomly divided into two groups, A and B and were kept in isolated tick-proof pens. They were treated for internal and external parasite before commencement of the experiment. The lambs were experimentally infected with T. hirci by placing ticks Hyalomma anatolicum anatolicum infected with T. hirci on them. The ticks used in this survey had originally been isolated from sheep and colonies of them were established in an insectarium. Before and after infection rectal temperatures and clinical signs of the lambs were recorded, blood and prescapular lymph node smears were prepared and examined to determine the extent of the parasitaemia, and blood samples were analyzed to evaluate their haemoglobin (Hb and packed cell volume (PCV rates. Three days after the commencement of a febrile reaction and appearance of the schizonts in the lymph node smears, treatment of the lambs in Group A with an extract containing the alkaloids of Peganum harmala (wild rue was commenced. Group B lambs were kept untreated controls. Before treatment there were no significant differences in the rectal temperature, parasitaemia rate, and the Hb and PCV values between animals in the two groups but after treatment significant differences in these values was detected (P < 0.05. After treatment, the clinical signs and parasites in the lymph node smears of the animals in Group A disappeared and they all animals recovered. These parameters in the animals of Group B progressed until their death. Pathological studies showed the characteristic lesions of theileriosis in lambs in Group B, but not in Group A. The results indicate a therapeutic effect of the alkaloids of P. harmala for treatment of ovine malignant theileriosis.

  15. Seasonal dynamics of ixodid ticks on wild rabbits Oryctolagus cuniculus (Leporidae) from Central Spain. (United States)

    González, J; Valcárcel, F; Pérez-Sánchez, J L; Tercero-Jaime, J M; Olmeda, A S


    Rabbit Hemorrhagic Disease and Myxomatosis caused a decline in the rabbit population in the second half of the last century. Despite some recovery, the risk of vector-borne disease is present and thus the importance of controlling vector populations. In the current study, we describe the ixodid tick fauna in wild rabbit in a natural reserve in Ciudad Real (Central Spain) during the course of two 3-year periods (2007-2009 and 2012-2014). Of all the ticks collected on average 72.5 % were larvae, 24.4 % nymphs and 3.1 % adults, although the percentage varied monthly. Seven tick species were identified: Hyalomma lusitanicum Koch (Parasitic indicator [PI] = number of ticks per examined rabbit = 96.47), Rhipicephalus pusillus Gil Collado (PI = 47.37), Haemaphysalis hispanica Gil Collado (PI = 12.15), Ixodes ventalloi Gil Collado (PI = 0.65), R. bursa Canestrini and Fanzago (PI = 0.18), R. sanguineus Latreille (PI = 0.11), Dermacentor marginatus Sulzer (PI = 0.01). In spring and summer, most abundant were larvae of H. lusitanicum, followed by immature stages of R. pusillus and Ha. hispanica. In autumn, the main tick species were nymphs of I. ventalloi whereas in winter adults of Ha. hispanica were more numerous. Rhipicephalus pusillus was present all year long, although not always in high percentage. PI of other species (R. bursa, R. sanguineus and D. marginatus) were too low to be representative. The seasonal dynamics of ticks on wild rabbit defined in this study could be useful to design species-specific control strategies.

  16. [Transfer of exotic ticks (Acari: ixodida) on reptiles (Reptilia) imported to Poland]. (United States)


    In the of period 2003-2007, a total of 382 specimens of reptiles belonging to the following genera were investigated: Testudo, Iguana, Varanus, Gongylophis, Python, Spalerosophis, Psammophis. The material for the present study was a collection of reptiles owned by the "Animals" Ltd from Swietochłowice (Upper Silesia, Poland), specialising in import of exotic animals to Poland, as well as the reptile collections of private breeders. The reptiles that turned out to be the most heavily infected with ticks were the commonly bred terrarium reptiles: Varanus exanthematicus and Python regius and they were imported to Poland from Ghana, Africa. Exotic reptiles are also imported from Southern Europe, Asia and Central America. The presently reported study helped to confirm the fact of transfer of exotic ticks on reptiles to Poland. A total of 2104 tick specimens, representing all stages of development (males, females, nymphs, larvae), were collected. They represented species of the genera Amblyomma and Hyalomma. The following species were found: Amblyomma exornatum Koch, 1844, Amblyomma flavomaculatum (Lucas, 1846), Amblyomma latum Koch, 1844, Amblyomma nuttalli Dönitz, 1909, Amblyomma quadricavum Schulze, 1941, Amblyomma transversale (Lucas, 1844), Amblyomma varanense (Supino, 1897), Amblyomma spp. Koch, 1844, Hyalomma aegyptium (Linnaeus, 1758). All the species of ticks of genus Ambylomma revealed have been discovered in Poland for the first time. The overall prevalence of infection was 77.6%. The highest prevalence value (81.2%) was observed on pythons (Python regius) and (78.7%) on monitor lizards (Varanus exanthematicus). The highest number of ticks was collected from Python regius and Varanus exanthematicus. The mean infection intensity for V. exanthematicus was 7.6 ticks per host, while for P. regius the intensity reached 4.7 ticks. The most abundant tick transferred to Poland on a host was an African tick, Amblyomma latum. Fifty eight specimens of monitor lizards

  17. Association of environmental traits with the geographic ranges of ticks (Acari: Ixodidae) of medical and veterinary importance in the western Palearctic. A digital data set. (United States)

    Estrada-Peña, A; Farkas, Robert; Jaenson, Thomas G T; Koenen, Frank; Madder, Maxime; Pascucci, Ilaria; Salman, Mo; Tarrés-Call, Jordi; Jongejan, Frans


    We compiled information on the distribution of ticks in the western Palearctic (11°W, 45°E; 29°N, 71°N), published during 1970-2010. The literature search was filtered by the tick's species name and an unambiguous reference to the point of capture. Records from some curated collections were included. We focused on tick species of importance to human and animal health, in particular: Ixodes ricinus, Dermacentor marginatus, D. reticulatus, Haemaphysalis punctata, H. sulcata, Hyalomma marginatum, Hy. lusitanicum, Rhipicephalus annulatus, R. bursa, and the R. sanguineus group. A few records of other species (I. canisuga, I. hexagonus, Hy. impeltatum, Hy. anatolicum, Hy. excavatum, Hy. scupense) were also included. A total of 10,280 records was included in the data set. Almost 42 % of published references are not adequately referenced (and not included in the data set), host is reported for only 61 % of records and a reference to time of collection is missed for 84 % of published records. Ixodes ricinus accounted for 44.3 % of total records, with H. marginatum and D. marginatus accounting for 7.1 and 8.1 % of records, respectively. The lack of homogeneity of the references and potential pitfalls in the compilation were addressed to create a digital data set of the records of the ticks. We attached to every record a coherent set of quantitative descriptors for the site of reporting, namely gridded interpolated monthly climate and remotely sensed data on vegetation (NDVI). We also attached categorical descriptors of the habitat: a standard classification of land biomes and an ad hoc classification of the target territory from remotely sensed temperature and NDVI data. A descriptive analysis of the data revealed that a principal components reduction of the environmental (temperature and NDVI) variables described the distribution of the species in the target territory. However, categorical descriptors of the habitat were less effective. We stressed the importance of

  18. Prevalence and seasonal abundance of ticks on dogs and the role of Rhipicephalus sanguineus in transmitting Babesia species in Maidugiri, North-Eastern Nigeria

    Directory of Open Access Journals (Sweden)

    M. Konto


    Full Text Available Aim: An investigation on ticks and haemoparasites of dogs that belonged to Maiduguri metropolis (Borno State was conducted. Materials and Methods: Survey of ticks and haemo-parasites on 400 stray dogs was conducted in Maiduguri from December 2009 to November 2011, using a stratified random sampling technique from different locations of the town. The town was divided into 10 districts out of which a total of 40 dogs were sampled at random from each district. Results: Four genera of ticks were identified on the infested dogs 384 (96.0, all of which belonged to the family Ixodidae (hard ticks. The genus Boophilus was predominant with a prevalence of 88.0%, Rhipicephalus 10.8%, Hyalomma 0.9% and Amblyomma 0.3% at (p ˂ 0.05. Dogs within the age-group of 6-12 months were the most infested, while those within the age-group of 24 –120 months were the least infested. Sex appeared to have a less significant influence (p > 0.05 on the prevalence of ticks among the dog population as females were more infested than the males. The perineum and the ear were the most commonly infested areas, with 328 (85.4% and 252 (65.4% respectively, while the scrotal and abdominal regions were the least infested areas 12 (3.1% each. The month of August showed the highest mean tick burden of 462.5±3.2 ranging from 450-475, while the month of February showed the least number of ticks with a mean of 244.5±3.8 ranging from 239-250. Dogs found to be infected with Babesia canis are all harboring ticks of the genus Rhipicephalus. Female dogs were more infected (66.7% with Babesia canis than their male counterparts (33.3% (p ˂ 0.05 and dogs within the age group of 1-6 months were more infected. Conclusion: Prevalence of ticks on dogs in this study area is relatively high and the occurrence of Babesia species is vector dependent, with ticks of the genus Rhipicephalus sanguineous being the most common vector in transmission of the parasite. Seasons also play a vital role in the

  19. Abundance of questing ticks and molecular evidence for pathogens in ticks in three parks of Emilia-Romagna region of Northern Italy

    Directory of Open Access Journals (Sweden)

    Sara Aureli


    Full Text Available Introduction and objective. Infectious and parasitic diseases transmitted by ticks, such as Lyme diseases, granulocytic anaplasmosis and piroplasmosis, have been frequently reported in Europe, with increasing attention to them as an emerging zoonotic problem. The presented study was performed to assess the distribution and the density of questing ticks in three regional parks of Emilia-Romagna region of Northern Italy, and to seek molecular evidence of potential human pathogens in tick populations. Materials and Methods. In the period April-October 2010, 8,139 questing ticks were collected: 6,734 larvae, 1,344 nymphs and only a few adults – 28 females and 33 males. The abundance of[i] Ixodes ricinus[/i] questing ticks was compared among different sampling sites and related to microclimate parameters. 1,544 out of 8,139 ticks were examined for the presence of pathogens: PCR was used to detect piroplasms DNA and Real time Taqman PCR for [i]Anaplasma phagocytophilum[/i] and [i]Borrelia burgdorferi[/i] s.l. Results. The predominant species was [i]I. ricinus[/i] (overall abundance 1,075.9/100 m[sup]2[/sup] ; more rarely, [i]Dermacentor marginatus[/i] (n = 37 – 0.45%, [i]Scaphixodes frontalis[/i] (n = 13 – 0.16%, [i]Hyalomma[/i] spp. (n = 6 – 0.07% and [i]Ixodes acuminatus[/i] (n = 3 – 0.04% were also found. 28 out of 324 (8.6% samples of ticks were PCR-positive for piroplasm DNA. 11 amplicons of 18S rRNA gene were identical to each other and had 100% identity with[i] Babesia[/i] EU1 ([i]Babesia venatorum[/i] using BLAST analysis. Real time Taqman PCR gave positive results for [i]A. phagocytophilum[/i] in 23 out of 292 samples (7.9%, and for [i]B. burgdorferi[/i] s.l. in 78 out of 292 samples (26.7%. [i]I. ricinu[/i]s was the only species found positive for pathogens by molecular analysis; 16 tick samples were co-infected with at least 2 pathogens. Discussion. The peak of nymph presence was in May, and the higher prevalence of pathogens

  20. Zoonotic surveillance for rickettsiae in domestic animals in Kenya. (United States)

    Mutai, Beth K; Wainaina, James M; Magiri, Charles G; Nganga, Joseph K; Ithondeka, Peter M; Njagi, Obadiah N; Jiang, Ju; Richards, Allen L; Waitumbi, John N


    Abstract Rickettsiae are obligate intracellular bacteria that cause zoonotic and human diseases. Arthropod vectors, such as fleas, mites, ticks, and lice, transmit rickettsiae to vertebrates during blood meals. In humans, the disease can be life threatening. This study was conducted amidst rising reports of rickettsioses among travelers to Kenya. Ticks and whole blood were collected from domestic animals presented for slaughter at major slaughterhouses in Nairobi and Mombasa that receive animals from nearly all counties in the country. Blood samples and ticks were collected from 1019 cattle, 379 goats, and 299 sheep and were screened for rickettsiae by a quantitative PCR (qPCR) assay (Rick17b) using primers and probe that target the genus-specific 17-kD gene (htrA). The ticks were identified using standard taxonomic keys. All Rick17b-positive tick DNA samples were amplified and sequenced with primers sets that target rickettsial outer membrane protein genes (ompA and ompB) and the citrate-synthase encoding gene (gltA). Using the Rick17b qPCR, rickettsial infections in domestic animals were found in 25/32 counties sampled (78.1% prevalence). Infection rates were comparable in cattle (16.3%) and sheep (15.1%) but were lower in goats (7.1%). Of the 596 ticks collected, 139 had rickettsiae (23.3%), and the detection rates were highest in Amblyomma (62.3%; n=104), then Rhipicephalus (45.5%; n=120), Hyalomma (35.9%; n=28), and Boophilus (34.9%; n=30). Following sequencing, 104 out of the 139 Rick17b-positive tick DNA had good reverse and forward sequences for the 3 target genes. On querying GenBank with the generated consensus sequences, homologies of 92-100% for the following spotted fever group (SFG) rickettsiae were identified: Rickettsia africae (93.%, n=97), Rickettsia aeschlimannii (1.9%, n=2), Rickettsia mongolotimonae (0.96%, n=1), Rickettsia conorii subsp. israelensis (0.96%, n=1), Candidatus Rickettsia kulagini (0.96% n=1), and Rickettsia spp. (1.9% n=2). In

  1. Ectoparasites of sheep in three agro-ecological zones in central Oromia, Ethiopia

    Directory of Open Access Journals (Sweden)

    Bersissa Kumsa


    Full Text Available A cross-sectional study was conducted to determine the prevalence and risk factors for ectoparasites infestation in sheep in three agro-ecological zones in central Oromia, Ethiopia, from October 2009 to April 2010. The study revealed that 637 (48.1% of the 1325 sheep examined were infested with one or more ectoparasites. The ectoparasites identified were Bovicola ovis (27.2%, Melophagus ovinus (16.4%, Ctenocephalides sp. (2.3%, Linognathus africanus (1.2%, Linognathus ovillus (0.3%, Sarcoptes sp. (1.2%, Amblyomma variegatum (4.4%, Rhipicephalus evertsi evertsi (1.9%, Rhipicephalus pravus (1.9%, Rhipicephalus (Boophilus decoloratus (1.1%, Rhipicephalus sanguineus (0.9%, Rhipicephalus praetextatus (1.1% and Hyalomma truncatum (1.6%. Statistically significant difference was observed in prevalence of B. ovis amongst study agroecological zones: highland 36.6%, midland 20.9% and lowland 14.0%. Significantly higher prevalence was recorded in highland agroecological zone. A significantly (OR = 0.041, p < 0.001 higher prevalence of M. ovinus in the highland (31.7% than in both the lowland (0% and midland (1.9% was observed. The risk of tick infestation in the lowland and midland was 9.883 times and 13.988 times higher than the risk in the highland, respectively. A significantly higher prevalence of Ctenocephalides species was encountered in both the lowland (OR = 4.738, p = 0.011 and midland (OR = 8.078, p = 0.000 than in the highland agro-ecological zone. However, a significant difference (p = 0.191 amongst agro-ecological zones was not found for the prevalence of Linognathus and Sarcoptes species. Statistically significant variation (p > 0.05 was never recorded in the prevalence of all the identified species of ectoparasites between male and female sheep hosts. However, a significantly (p = 0.006 higher prevalence of B. ovis was recorded between young and adult sheep. The risk of B. ovis infestation was 1.45 times higher in young than the adult sheep

  2. Prevalence, associated determinants, and in vivo chemotherapeutic control of hard ticks (Acari: Ixodidae) infesting domestic goats (Capra hircus) of lower Punjab, Pakistan. (United States)

    Sajid, Muhammad Sohail; Iqbal, Zafar; Khan, Muhammad Nisar; Muhammad, Ghulam; Needham, Glen; Khan, Muhammad Kasib


    A total of 800 goats of various breeds, age, and sex were randomly selected from Muzaffargarh (M. garh) and Layyah districts of lower Punjab, Pakistan. The selected goats were visited twice a month to collect information about determinants influencing goat tick infestation prevalence. For acaricidal efficacy, 360 tick-infested adult goats were subjected to an acaricidal treatment and post-treatment quantitative assessment of tick burden. Quantification of adult tick detachment 24 h post-treatment and the duration of treatment efficacy were calculated. Overall prevalence of goat tick infestation in both study districts was 60.1% (481/800). The prevalence was higher in district M. garh than in district Layyah. Tehsil-wise prevalence in district Layyah was highest in tehsil Layyah followed in order by Chaubara and Karor. In district M. garh, highest prevalence was found in tehsil M. garh followed by Kot Addu, Alipur, and Jatoi. Hyalomma a. anatolicum (75.9%; 365/481) and Rhipicephalus sanguineus (24.1%; 116/481) were the predominant species in both the districts. The highest month-wise prevalence was 56.9% and 62.7% in Layyah and M. garh districts, respectively, during July 2008, and the minimum (0%) prevalence was reported in November and December, respectively. Regarding host determinants, female goats were more heavily infested (72.8%) than males (47.5%), and younger animals were (63.5%) more burdened than older ones (56.7%). Teddy goats were the most susceptible breeds followed in order by Beetal, cross-bred, Nachi, and Dera Din Pannah. The preferred sites of attachment were inside and outside of the ear. Both the ivermectin (IVM)- and cypermethrin (CYM)-treated groups resulted in significantly lower (P < 0.05) tick counts relative to controls on all post-treatment counting days. The lowest tick burden in the IVM-treated group was significantly higher (P < 0.05) as compared to the CYM-treated group, the latter being close to zero. Hence, the in vivo efficacy

  3. Detection of Rickettsia and Ehrlichia spp. in Ticks Associated with Exotic Reptiles and Amphibians Imported into Japan.

    Directory of Open Access Journals (Sweden)

    Masako Andoh

    Full Text Available One of the major routes of transmission of rickettsial and ehrlichial diseases is via ticks that infest numerous host species, including humans. Besides mammals, reptiles and amphibians also carry ticks that may harbor Rickettsia and Ehrlichia strains that are pathogenic to humans. Furthermore, reptiles and amphibians are exempt from quarantine in Japan, thus facilitating the entry of parasites and pathogens to the country through import. Accordingly, in the current study, we examined the presence of Rickettsia and Ehrlichia spp. genes in ticks associated with reptiles and amphibians originating from outside Japan. Ninety-three ticks representing nine tick species (genera Amblyomma and Hyalomma were isolated from at least 28 animals spanning 10 species and originating from 12 countries (Ghana, Jordan, Madagascar, Panama, Russia, Sri Lanka, Sudan, Suriname, Tanzania, Togo, Uzbekistan, and Zambia. None of the nine tick species are indigenous in Japan. The genes encoding the common rickettsial 17-kDa antigen, citrate synthase (gltA, and outer membrane protein A (ompA were positively detected in 45.2% (42/93, 40.9% (38/93, and 23.7% (22/93 of the ticks, respectively, by polymerase chain reaction (PCR. The genes encoding ehrlichial heat shock protein (groEL and major outer membrane protein (omp-1 were PCR-positive in 7.5% (7/93 and 2.2% (2/93 of the ticks, respectively. The p44 gene, which encodes the Anaplasma outer membrane protein, was not detected. Phylogenetic analysis showed that several of the rickettsial and ehrlichial sequences isolated in this study were highly similar to human pathogen genes, including agents not previously detected in Japan. These data demonstrate the global transportation of pathogenic Rickettsia and Ehrlichia through reptile- and amphibian-associated ticks. These imported animals have potential to transfer pathogens into human life. These results highlight the need to control the international transportation of known

  4. Detection of Rickettsia and Ehrlichia spp. in Ticks Associated with Exotic Reptiles and Amphibians Imported into Japan. (United States)

    Andoh, Masako; Sakata, Akiko; Takano, Ai; Kawabata, Hiroki; Fujita, Hiromi; Une, Yumi; Goka, Koichi; Kishimoto, Toshio; Ando, Shuji


    One of the major routes of transmission of rickettsial and ehrlichial diseases is via ticks that infest numerous host species, including humans. Besides mammals, reptiles and amphibians also carry ticks that may harbor Rickettsia and Ehrlichia strains that are pathogenic to humans. Furthermore, reptiles and amphibians are exempt from quarantine in Japan, thus facilitating the entry of parasites and pathogens to the country through import. Accordingly, in the current study, we examined the presence of Rickettsia and Ehrlichia spp. genes in ticks associated with reptiles and amphibians originating from outside Japan. Ninety-three ticks representing nine tick species (genera Amblyomma and Hyalomma) were isolated from at least 28 animals spanning 10 species and originating from 12 countries (Ghana, Jordan, Madagascar, Panama, Russia, Sri Lanka, Sudan, Suriname, Tanzania, Togo, Uzbekistan, and Zambia). None of the nine tick species are indigenous in Japan. The genes encoding the common rickettsial 17-kDa antigen, citrate synthase (gltA), and outer membrane protein A (ompA) were positively detected in 45.2% (42/93), 40.9% (38/93), and 23.7% (22/93) of the ticks, respectively, by polymerase chain reaction (PCR). The genes encoding ehrlichial heat shock protein (groEL) and major outer membrane protein (omp-1) were PCR-positive in 7.5% (7/93) and 2.2% (2/93) of the ticks, respectively. The p44 gene, which encodes the Anaplasma outer membrane protein, was not detected. Phylogenetic analysis showed that several of the rickettsial and ehrlichial sequences isolated in this study were highly similar to human pathogen genes, including agents not previously detected in Japan. These data demonstrate the global transportation of pathogenic Rickettsia and Ehrlichia through reptile- and amphibian-associated ticks. These imported animals have potential to transfer pathogens into human life. These results highlight the need to control the international transportation of known and

  5. Genetic characterization and molecular clock analyses of the Crimean-Congo hemorrhagic fever virus from human and ticks in India, 2010-2011. (United States)

    Yadav, Pragya D; Cherian, Sarah S; Zawar, Divya; Kokate, Prasad; Gunjikar, Rashmi; Jadhav, Santosh; Mishra, Akhilesh C; Mourya, Devendra T


    A nosocomial outbreak of Crimean Congo hemorrhagic fever (CCHF) was reported among humans in Ahmadabad district, Gujarat, India during January, 2011. In the present study we provide the complete genomic sequences of four CCHFV isolates derived from two human patients and two pools of Hyalomma anatolicum ticks during the period of this outbreak and the complete S segment sequence of two retrospective human serum samples, positive for CCHFV in 2010. Sequence-based molecular characterization of the Indian CCHFV showed that they possessed the functional motifs known to occur in the S, M and L gene segment products as in other CCHF viruses. The S segment of the six Indian CCHF viruses showed 99.8% nucleotide identity. Notably both tick isolates shared 100% nucleotide identity with one of the Indian human isolates of 2011. Phylogenetic analysis based on the S segment demonstrated that the Indian CCHFV isolates formed a distinct cluster in the Asian-Middle East group IV of CCHF viruses. The S segment was closest to a Tajikistan strain TADJ/HU8966 of 1990 (98.5% nucleotide identity) and was of South-Asia 2 type while the M segment was of type M2. Both M and L segments were closest to an Afghanistan strain Afg09-2990 of 2009 (93% and 98% nucleotide identity, respectively). The Indian isolates were thus identified as a South-Asia 2/M2 far-east virus combination and the differing parental origin in the S and L/M segments is suggestive that it may be an intra-genotypic reassortant. Molecular clock studies further revealed that the ancestry of the viruses was not very recent and dated back to about 33years on the basis of the S segment while it was about 15years based on the M segment. Thus though the 2011 outbreak may not have resulted from a very recent introduction, considering that so far there is no evidence of multiple circulating strains in the country, the possibility of a recent re-introduction of the virus from any of the neighboring countries cannot be ruled out. The