WorldWideScience

Sample records for hyalomma dromedarii acari

  1. Hyalomma anatolicum anatolicum and Hyalomma dromedarii (Acari: Ixodidae) imbibe bovine blood in vitro by utilizing an artificial feeding system.

    Science.gov (United States)

    Tajeri, S; Razmi, G R

    2011-08-25

    Hard ticks have great importance because of blood feeding and transmitting dangerous human and animal diseases. Each year, they cause a lot of economical damage to the livestock industry. Control of ticks and tick-borne diseases is a major priority in most parts of the world and many studies have been done in this field. We know that studying haemoparasites and assessing the effect of different compounds on ticks requires a lot of money, support and sometimes it is time consuming. Considering all of these problems, today, in some research laboratories throughout the world, artificial in vitro feeding of ticks has become common. Development and application of such methods provide a cheap and accessible background for investigating haemoparasitic diseases under controlled conditions. For the first time we report successful in vitro feeding of two important ixodid ticks of the genus Hyalomma. Copyright © 2011 Elsevier B.V. All rights reserved.

  2. Variations in free radical scavenging activities and antioxidant responses in salivary glands of Hyalomma anatolicum anatolicum and Hyalomma dromedarii (Acari: Ixodidae ticks

    Directory of Open Access Journals (Sweden)

    Mayukh Ghosh

    2014-10-01

    Full Text Available Aim: Hyalomma anatolicum anatolicum and Hyalomma dromedarii ticks are of major economic importance in the livestock sector as the vector of tropical theileriosis causing huge production loss, mostly in tropical countries. The release of different reactive oxygen and nitrogen species by exogenous and endogenous means can potentially induce oxidative damage to the ticks during their prolonged feeding on their vertebrate hosts. Hence, ticks need an effective free radical scavenging and antioxidant defense system for their successful feeding of a blood meal. Therefore, the present study was undertaken to evaluate the interspecies variations in antioxidant response, free radical scavenging, and anti-inflammatory activities in salivary gland extracts (SGE of the two species as they differ considerably in relation to feeding behavior and host specificity. Materials and Methods: Tick salivary glands were dissected out under ice from semi-fed female ticks of both the species and homogenized at low temperature to prepare SGE. SGE was stored at −40°C for analysis of free radical scavenging activities and antioxidant status. Results: Significant depletion in reduced glutathione concentrations, malondialdehyde level and elevation in free radical scavenging activity, superoxide dismutase, anti-inflammatory activity were found in SGE of engorging female H. dromedarii ticks as compared to H. a. anatolicum. Conclusion: Higher antioxidant status and free radical scavenging activities in H. dromedarii might have enabled these ticks to suck more blood from the host in spite of continuous host’s immune responses. These findings about tick biology will help in improving tick control strategies.

  3. Morphological and molecular identification of the brown dog tick Rhipicephalus sanguineus and the camel tick Hyalomma dromedarii (Acari: Ixodidae vectors of Rickettsioses in Egypt

    Directory of Open Access Journals (Sweden)

    Hend H. A. M. Abdullah

    2016-10-01

    Full Text Available Aim: Rickettsioses have an epidemiological importance that includes pathogens, vectors, and hosts. The dog tick Rhipicephalus sanguineus and the camel tick Hyalomma dromedarii play important roles as vectors and reservoirs of Rickettsiae. The aim of this study was to determine the prevalence of Rickettsiae in ixodid ticks species infesting dogs and camels in Egypt, in addition to, the morphological and molecular identification of R. sanguineus and H. dromedarii. Materials and Methods: A total of 601 and 104 of ticks’ specimens were collected from dogs and camels, respectively, in Cairo, Giza and Sinai provinces. Hemolymph staining technique and OmpA and gltA genes amplification were performed to estimate the prevalence rate of Rickettsiae in ticks. For morphological identification of tick species, light microscope (LM and scanning electron microscope (SEM were used. In addition to the phylogenetic analyses of 18S rDNA, Second internal transcript spacer, 12S rDNA, cytochrome c oxidase subunit-1, and 16S rDNA were performed for molecular identification of two tick species. Results: The prevalence rate of Rickettsiae in ticks was 11.6% using hemolymph staining technique and 6.17% by OmpA and gltA genes amplification. Morphological identification revealed that 100% of dogs were infested by R. sanguineus while 91.9% of camels had been infested by H. dromedarii. The phylogenetic analyses of five DNA markers confirmed morphological identification by LM and SEM. The two tick species sequences analyses proved 96-100% sequences identities when compared with the reference data in Genbank records. Conclusion: The present studies confirm the suitability of mitochondrial DNA markers for reliable identification of ticks at both intra- and inter-species level over the nuclear ones. In addition to, the detection of Rickettsiae in both ticks’ species and establishment of the phylogenetic status of R. sanguineus and H. dromedarii would be useful in

  4. Morphological and molecular identification of the brown dog tick Rhipicephalus sanguineus and the camel tick Hyalomma dromedarii (Acari: Ixodidae) vectors of Rickettsioses in Egypt.

    Science.gov (United States)

    Abdullah, Hend H A M; El-Molla, Amal; Salib, Fayez A; Allam, Nesreen A T; Ghazy, Alaa A; Abdel-Shafy, Sobhy

    2016-10-01

    Rickettsioses have an epidemiological importance that includes pathogens, vectors, and hosts. The dog tick Rhipicephalus sanguineus and the camel tick Hyalomma dromedarii play important roles as vectors and reservoirs of Rickettsiae. The aim of this study was to determine the prevalence of Rickettsiae in ixodid ticks species infesting dogs and camels in Egypt, in addition to, the morphological and molecular identification of R. sanguineus and H. dromedarii. A total of 601 and 104 of ticks' specimens were collected from dogs and camels, respectively, in Cairo, Giza and Sinai provinces. Hemolymph staining technique and OmpA and gltA genes amplification were performed to estimate the prevalence rate of Rickettsiae in ticks. For morphological identification of tick species, light microscope (LM) and scanning electron microscope (SEM) were used. In addition to the phylogenetic analyses of 18S rDNA, Second internal transcript spacer, 12S rDNA, cytochrome c oxidase subunit-1, and 16S rDNA were performed for molecular identification of two tick species. The prevalence rate of Rickettsiae in ticks was 11.6% using hemolymph staining technique and 6.17% by OmpA and gltA genes amplification. Morphological identification revealed that 100% of dogs were infested by R. sanguineus while 91.9% of camels had been infested by H. dromedarii. The phylogenetic analyses of five DNA markers confirmed morphological identification by LM and SEM. The two tick species sequences analyses proved 96-100% sequences identities when compared with the reference data in Genbank records. The present studies confirm the suitability of mitochondrial DNA markers for reliable identification of ticks at both intra- and inter-species level over the nuclear ones. In addition to, the detection of Rickettsiae in both ticks' species and establishment of the phylogenetic status of R. sanguineus and H. dromedarii would be useful in understanding the epidemiology of ticks and tick borne rickettsioses in Egypt.

  5. Rickettsia africae in Hyalomma dromedarii ticks from sub-Saharan Algeria.

    Science.gov (United States)

    Kernif, Tahar; Djerbouh, Amel; Mediannikov, Oleg; Ayach, Bouhous; Rolain, Jean-Marc; Raoult, Didier; Parola, Philippe; Bitam, Idir

    2012-12-01

    Spotted fever group (SFG) rickettsioses are caused by obligate, intracellular Gram-negative bacteria of the genus Rickettsia. In recent years, several species and subspecies of rickettsias have been identified as emerging pathogens throughout the world, including sub-Saharan Africa. We report here the detection of Rickettsia africae, the agent responsible for African tick-bite fever, by amplification of fragments of gltA and ompA genes and multi-spacer typing from Hyalomma dromedarii ticks collected from the camel Camelus dromedarius in the Adrar and Béchar region (sub-Saharan Algeria). To date, R. africae has been associated mainly with Amblyomma spp. The role of H. dromedarii in the epidemiology of R. africae requires further investigation.

  6. Gram-negative bacteria from the camel tick Hyalomma dromedarii (Ixodidae) and the chicken tick Argas persicus (Argasidae) and their antibiotic sensitivities.

    Science.gov (United States)

    Montasser, Ashraf A

    2005-04-01

    A total of nine species of gram-negative bacteria were isolated from organs and haemolymph of the hard tick Hyalomma (Hyalomma) dromedarii and the soft tick Argas (Persicargas) persicus. Four species namely Serratia liquefaciens, Stenotrophomonas maltophilia, Klebsiella ornithinolytica and Aeromonas hydrophila were isolated from H. dromedarii and five species namely Rahnella aquatilis, Pseudomonas fluorescens, Enterobacter cloacae, Chryseomonas luteola and Chryseobacterium meningosepticum were isolated from A. persicus. Isolated bacteria were identified using the analytical profile index 20E. Disk diffusion test was carried out on all isolated bacteria to determine antibiotic sensitivity of chloramphenicol, amoxillin/clavulanic acid, neomycin, streptomycin, triplesulphur tetracycline and nitrofurantion. The results were discussed.

  7. The Camel Tick, Hyalomma (Hyalomma dromedarii Koch, 1844 (Ixodoidea: Ixodidae: Description of the Egg and Redescription of the Larva by Scanning Electron Microscopy

    Directory of Open Access Journals (Sweden)

    Ashraf Ahmed Montasser

    2006-01-01

    Full Text Available The present study describes the egg of Hyalomma (H. dromedarii for the first time and adds more features to the larva using Scanning Electron Microscopy (SEM in order to extend our knowledge on these acarine stages to be useful for further taxonomical or control studies. With the purpose of presenting exact description of acarine eggs, it is preferable to examine them both with and without SEM processing. SEM processing caused partial removal of the chorion which makes the egg shell clear and easily observed. The study revealed rough surface of egg shell which was surrounded by the chorion. The egg shell was perforated particularly at poles. The chorion appeared as a finely perforated cloth. Different forms of bumps were noticed between egg shell and chorion. Length, width, l/w ratio and pore diameter of the egg were measured. SEM investigation of the larva revealed smooth scutum with slight irregular ornamentation and horizontally folded extensible cuticle with vertical ridges. At least 2 types of cuticular openings were noticed on the extensible cuticle of the idiosoma. The first type was represented by 1 pair on dorsal side and 2 pairs on ventral one. It was surrounded with thick integumental ring and guarded with 2 internal lips. The second type was numerous, slit-like and without rings or lips. Dorsolateral plate of the hypostome carried numerous oval, tile-like and elevated denticles while ventral one carried 4 rows of posteriorly directed retrograde conical denticles. Mouth enclosed 2 cheliceral digits, each terminated with 3 lobes. Each lobe is supported with 2 or 3 conical denticles which were externally directed to the posterior. Haller`s organ on the tarsus of the first pair of legs consisted of anterior pit and posterior capsule. The pit contained 6 conical sensillae while the capsule opening had extensively branched margin. Measurements of the whole body, idiosoma, scutum, eye, capitulum, hypostome, palp, cuticular pores, legs and

  8. Photosensitizers in the fight against ticks: safranin as a novel photodynamic fluorescent acaricide to control the camel tick Hyalomma dromedarii (Ixodidae).

    Science.gov (United States)

    Khater, Hanem; Hendawy, Nabil; Govindarajan, Marimuthu; Murugan, Kadarkarai; Benelli, Giovanni

    2016-10-01

    Ticks transmit more pathogen species than any other group of blood-feeding arthropods worldwide, affecting humans, livestock, and companion animals. Hyalomma dromedarii is the predominant tick species infesting camels, and its effective control is of pivotal importance. In this research, we compared the phytoefficacy of safranin (SF), a fluorescent dye applied as an acaricide for the first time, to that of tetramethrin (TM) against engorged females of H. dromedarii through in vitro immersion bioassays. Furthermore, the effect of SF exposure was evaluated on the reproductive potential of surviving tick females. Different concentrations of SF (0.03, 0.06, 0.3, 1, and 4 % w:v) and TM (0.03, 0.13, 0.5, 2, and 4 %) were prepared in distilled water and administered to engorged females of H. dromedarii. SF-treated ticks were illuminated with a light source for 30 min post-treatment (PT). Photophysical properties of SF were studied, and the relative efficacy of the used light source and sunlight was calculated. Results showed that the minimum least concentration that causes 100 % acaricidal effect was 4 % PT with SF and TM, for 8 and 48 h, respectively. LC50 values 8 and 24 h PT were 0.08, 0.03 and 0.78, 0.20 %, respectively. Comparing LC50 and LC90 2 h PT, SF was 33 and 22 times more potent than TM. LT50 of 4 % SF and TM were 0.80 and 2.17 h, respectively. Treatment with the lowest concentrations of SF and TM induced reduction of the number of ovipositing females, eggs per female, ticks laying viable eggs, and hatched eggs. Overall, our results highlighted that SF is highly effective if compared to TM, allowing use to candidate it for the development of novel and safer acaricides.

  9. Repellent activities of dichloromethane extract of Allium sativum (garlic (Liliaceae against Hyalomma rufipes (Acari

    Directory of Open Access Journals (Sweden)

    Felix Nchu

    2016-02-01

    Full Text Available Dichloromethane (DCM extract of garlic (Allium sativum Linn. bulbs was assessed for its repellent effect against the hard tick, Hyalomma rufipes (Acari: Ixodidae using two tick behavioural bioassays; Type A and Type B repellency bioassays, under laboratory conditions. These bioassays exploit the questing behaviour of H. rufipes, a tick that in nature displays ambush strategy, seeking its host by climbing up on vegetation and attaching to a passing host. One hundred microlitres (100 µL of the test solution containing DCM extract of garlic bulbs and DCM at concentrations of 0.35%, 0.7% or 1.4% w/v were evaluated. DCM only was used for control. Tick repellency increased significantly (R2 = 0.98 with increasing concentration (40.03% – 86.96% yielding an EC50 of 0.45% w/v in Type B repellency bioassay. At concentration of 1.4% w/v, the DCM extract of garlic bulbs produced high repellency index of 87% (male ticks and 87.5% (female ticks in the Type A repellency bioassay. Only 4% avoidance of male ticks or female ticks was recorded in the Type B repellency bioassay. In the corresponding controls, the mean numbers of non-repelled male or female ticks were 80% and 41 males or 38 females of 50 ticks in the Type A and Type B repellency bioassays, respectively. The variations in the results could be attributed to the difference in tick repellent behaviours that were assessed by the two repellency bioassays; the Type A repellency bioassay assessed repellent effect of garlic extracts without discriminating between deterrence and avoidance whereas the Type B repellency bioassay only assessed avoidance response. Generally, DCM extract of garlic was repellent against H. rufipes, albeit weak tick repellency was obtained in the Type B repellency bioassay. Furthermore, this study established that the tick repellent activity of garlic extracts is predominantly by deterrence.

  10. Repellent activities of dichloromethane extract of Allium sativum (garlic) (Liliaceae) against Hyalomma rufipes (Acari).

    Science.gov (United States)

    Nchu, Felix; Magano, Solomon R; Eloff, Jacobus N

    2016-12-02

    Dichloromethane (DCM) extract of garlic (Allium sativum Linn.) bulbs was assessed for its repellent effect against the hard tick, Hyalomma rufipes (Acari: Ixodidae) using two tick behavioural bioassays; Type A and Type B repellency bioassays, under laboratory conditions. These bioassays exploit the questing behaviour of H. rufipes, a tick that in nature displays ambush strategy, seeking its host by climbing up on vegetation and attaching to a passing host. One hundred microlitres (100 µL) of the test solution containing DCM extract of garlic bulbs and DCM at concentrations of 0.35%, 0.7% or 1.4% w/v were evaluated. DCM only was used for control. Tick repellency increased significantly (R2 = 0.98) with increasing concentration (40.03% - 86.96%) yielding an EC50 of 0.45% w/v in Type B repellency bioassay. At concentration of 1.4% w/v, the DCM extract of garlic bulbs produced high repellency index of 87% (male ticks) and 87.5% (female ticks) in the Type A repellency bioassay. Only 4% avoidance of male ticks or female ticks was recorded in the Type B repellency bioassay. In the corresponding controls, the mean numbers of non-repelled male or female ticks were 80% and 41 males or 38 females of 50 ticks in the Type A and Type B repellency bioassays, respectively. The variations in the results could be attributed to the difference in tick repellent behaviours that were assessed by the two repellency bioassays; the Type A repellency bioassay assessed repellent effect of garlic extracts without discriminating between deterrence and avoidance whereas the Type B repellency bioassay only assessed avoidance response. Generally, DCM extract of garlic was repellent against H. rufipes, albeit weak tick repellency was obtained in the Type B repellency bioassay. Furthermore, this study established that the tick repellent activity of garlic extracts is predominantly by deterrence.

  11. Morphometric Study on Male Specimens of Hyalomma anatolicum (Acari: Ixodidae in West of Iran

    Directory of Open Access Journals (Sweden)

    A Hosseini

    2011-12-01

    Conclusion: Morphometric variation in Hyalomma spp is poorly studied. The variation in range and quantity of the mor­phometric parameters of H.anatolicum ‎underlies that the correct recognition and key construction for Hyalomma spe­cies dependes ‎on a complement morphometric study on the other species.

  12. Morphometric Study on Male Specimens of Hyalomma Anatolicum (Acari: Ixodidae in West of Iran

    Directory of Open Access Journals (Sweden)

    M Abdigoudarzi

    2011-12-01

    Full Text Available Background: Hyalomma anatolicum is the well-known hard tick, which is one of the most important livestock and hu­man pathogens vector, wide range in host and distributed in all over the Hyalomma geographic fauna as well as in Iran. Taxonomy of the Hyalomma ssp. is debatable whereas their identification is a problematic work. The reasons for this claim is time consuming Delpy’s researches in Iran also Schulze School, Feldman-Muhsam and the Russian tick workers. We would like to understand morphometric variation in the field collected H. anatolicum in Iran also validat­ing some morphologic quantitative and qualitative characters.Methods: A total 247 field-collected tick specimens from different geographical regions in west of Iran includes Khuzestan and Lorestan Provinces were studied. The morphologic characters of the ticks were measured by the cali­brated stereomicroscope ‎armed scaled lens. The measurements were analyzed using SPSS ‎for windows, version 16 on an IBM PC, ‎so varied shapes of species in different geographic ‎regions were drawn by the ‎aid of a drawing tube con­nected to a light stereomicroscope.‎Results: One way ANOVA test revealed significant differences among the quantitative parameters in five zones (P<‎‎ 0.‎‎00‎‎1‎ also each zone to other zone by Post Hoc Tests e.g. LSD. No significant differences in the lateral grooves length/conscutum length ratio parameter were found.Conclusion: Morphometric variation in Hyalomma spp is poorly studied. The variation in range and quantity of the mor­phometric parameters of H.anatolicum ‎underlies that the correct recognition and key construction for Hyalomma spe­cies dependes ‎on a complement morphometric study on the other species.

  13. Effect of Hyalomma Ticks (Acari: Ixodidae on Milk Production of Dairy Buffaloes (Bos Bubalus Bubalis of Punjab (Pakistan

    Directory of Open Access Journals (Sweden)

    M.U. Iqbal

    2010-02-01

    Full Text Available The objective of this study was to estimate economic losses in terms of milk production caused by tick infestation in dairy buffaloes (Bos bubalus bubalis of Punjab (Pakistan. To this end, six hundred Nili-Ravi buffaloes infested with Hyalomma ticks (Acari: Ixodidae were selected and divided into two equal groups viz; A & B. The animals of group A were treated with various doses of 5% cypermethrine pour-on (Cipermetriven, Ivan Labs, Spain while those of group B were treated with propylene glycol (Propandiol - (1, 2, Merck as a sham treatment. Average milk production (L and butter fat (% was recorded before and after treatment in order to calculate post-treatment increase in these parameters (if any. An average daily increase of 1.15L in milk yield per animal with 1.31% more fat was observed in acaricide- treated animals. A dose-dependent effect of acaricide was found on the number of ticks as well as milk production and fat. The results provided a baseline data for further research on economic impact of tick nuisance to the smallholder dairy farming systems of Pakistan.

  14. A review of Hyalomma scupense (Acari, Ixodidae in the Maghreb region: from biology to control

    Directory of Open Access Journals (Sweden)

    2014-01-01

    Full Text Available Hyalomma scupense (syn. Hyalomma detritum is a two-host domestic endophilic tick of cattle and secondarily other ungulates in the Maghreb region (Africa. This species transmits several pathogens, among which two are major livestock diseases: Theileria annulata and Theileria equi. Various other pathogens are also transmitted by this tick species, such as Anaplasma phagocytophilum and Ehrlichia bovis. Hyalomma scupense is common in sub-humid and semi-arid areas of several regions in the world, mainly in the Maghreb region. In this region, adults attach to animals during the summer season; larvae and nymphs attach to their hosts during autumn, but there is a regional difference in H. scupense phenology. There is an overlap between immature and adult ticks, leading in some contexts to a dramatic modification of the epidemiology of tick-borne diseases. This tick species attaches preferentially to the posterior udder quarters and thighs. Tick burdens can reach 130 ticks per animal, with a mean of 60 ticks. Calves are 70 times less infested than adult cattle. The control can be implemented through six options: (i rehabilitation of the farm buildings by roughcasting and smoothing the outer and inner surfaces of the enclosures and walls. This control option should be recommended to be combined with a thorough cleaning of the farm and its surrounding area. With regard to Theileria annulata infection, this control option is the most beneficial. (ii Acaricide application to animals during the summer season, targeting adults. (iii Acaricide application during the autumn period for the control of the immature stages. (iv Acaricide application to the walls: many field veterinarians have suggested this option but it is only partially efficient since nymphs enter deep into the cracks and crevices. It should be used if there is a very high tick burden or if there is a high risk of tick-borne diseases. (v Manual tick removal: this method is not efficient since the

  15. Metarhizium anisopliae as a biological control agent against Hyalomma anatolicum (Acari: Ixodidae).

    Science.gov (United States)

    Suleiman, Elham A; Shigidi, M T; Hassan, S M

    2013-12-15

    In the Sudan, ticks and Tick-borne Diseases (TBDs) with subsequent costs of control and treatment are causing substantial economic loss. Control of ticks is mainly by chemical insecticides. The rising environmental hazards and problem of resistance has motivated research on biological agents as alternative methods of control. The present study aims at controlling livestock ticks using fungi for their unique mode of action besides their ability to adhere to the cuticle, to germinate and penetrate enzymatically. The study was conducted to evaluate the fungus Metarhizium anisopliae for tick control as an alternative mean to chemical acaricides. Pathogenicity of the fungus was tested on different developmental stages of the tick Hyalomma anatolicum. The fungus induced high mortality to flat immature stages. It, also, affected reproductive potential of the females. Egg laid, hatching percent, fertility and moulting percent of immature stages were significantly (p anisopliae to control ticks is discussed.

  16. Identification and characterization of microRNAs by deep-sequencing in Hyalomma anatolicum anatolicum (Acari: Ixodidae) ticks.

    Science.gov (United States)

    Luo, Jin; Liu, Guang-Yuan; Chen, Ze; Ren, Qiao-Yun; Yin, Hong; Luo, Jian-Xun; Wang, Hui

    2015-06-15

    Hyalomma anatolicum anatolicum (H.a. anatolicum) (Acari: Ixodidae) ticks are globally distributed ectoparasites with veterinary and medical importance. These ticks not only weaken animals by sucking their blood but also transmit different species of parasitic protozoans. Multiple factors influence these parasitic infections including miRNAs, which are non-coding, small regulatory RNA molecules essential for the complex life cycle of parasites. To identify and characterize miRNAs in H.a. anatolicum, we developed an integrative approach combining deep sequencing, bioinformatics and real-time PCR analysis. Here we report the use of this approach to identify miRNA expression, family distribution, and nucleotide characteristics, and discovered novel miRNAs in H.a. anatolicum. The result showed that miR-1-3p, miR-275-3p, and miR-92a were expressed abundantly. There was a strong bias on miRNA, family members, and nucleotide compositions at certain positions in H.a. anatolicum miRNA. Uracil was the dominant nucleotide, particularly at positions 1, 6, 16, and 18, which were located approximately at the beginning, middle, and end of conserved miRNAs. Analysis of the conserved miRNAs indicated that miRNAs in H.a. anatolicum were concentrated along three diverse phylogenetic branches of bilaterians, insects and coelomates. Two possible roles for the use of miRNA in H.a. anatolicum could be presumed based on its parasitic life cycle: to maintain a large category of miRNA families of different animals, and/or to preserve stringent conserved seed regions with active changes in other places of miRNAs mainly in the middle and the end regions. These might help the parasite to undergo its complex life style in different hosts and adapt more readily to the host changes. The present study represents the first large scale characterization of H.a. anatolicum miRNAs, which could further the understanding of the complex biology of this zoonotic parasite, as well as initiate miRNA studies

  17. Partial characterization of a novel anti-inflammatory protein from salivary gland extract of Hyalomma anatolicum anatolicum (Acari: Ixodidae ticks

    Directory of Open Access Journals (Sweden)

    Mayukh Ghosh

    2015-06-01

    Full Text Available Aim: Hyalomma anatolicum anatolicum ticks transmit Theileria annulata, causative agent of tropical theileriosis to cattle and buffaloes causing a major economic loss in terms of production and mortality in tropical countries. Ticks have evolved several immune evading strategies to circumvent hosts’ rejection and achieve engorgement. Successful feeding of ticks relies on a pharmacy of chemicals located in their complex salivary glands and secreted saliva. These chemicals in saliva could inhibit host inflammatory responses through modulating cytokine secretion and detoxifying reactive oxygen species. Therefore, the present study was aimed to characterize anti-inflammatory peptides from salivary gland extract (SGE of H. a. anatolicum ticks with a view that this information could be utilized in raising vaccines, designing synthetic peptides or peptidomimetics which can further be developed as novel therapeutics. Materials and Methods: Salivary glands were dissected out from partially fed adult female H. a. anatolicum ticks and homogenized under the ice to prepare SGE. Gel filtration chromatography was performed using Sephadex G-50 column to fractionate the crude extract. Protein was estimated in each fraction and analyzed for identification of anti-inflammatory activity. Sodium dodecyl sulfate - polyacrylamide gel electrophoresis (SDS-PAGE was run for further characterization of protein in desired fractions. Results: A novel 28 kDa protein was identified in H. a. anatolicum SGE with pronounced anti-inflammatory activity. Conclusion: Purification and partial characterization of H. a. anatolicum SGE by size-exclusion chromatography and SDSPAGE depicted a 28 kDa protein with prominent anti-inflammatory activity.

  18. Control of Hyalomma lusitanicum (Acari: Ixodidade) Ticks Infesting Oryctolagus cuniculus (Lagomorpha: Leporidae) Using the Entomopathogenic Fungus Beauveria bassiana (Hyocreales: Clavicipitaceae) in Field Conditions.

    Science.gov (United States)

    González, J; Valcárcel, F; Pérez-Sánchez, J L; Tercero-Jaime, J M; Cutuli, M T; Olmeda, A S

    2016-11-01

    Entomopathogenic fungi are widely used to control arthropods not just in agricultural settings but also in Veterinary Medicine and Public Health. These products have been employed to control tick populations and tick-borne diseases. The effectiveness of these control measures not only depends on the fungi, but also on the tick species and environmental conditions. In Mesomediterranean areas, tick species are adapted to extreme climatic conditions and it is therefore especially important to develop suitable tick control strategies. The aim of this study was to evaluate the effectiveness of a new method of tick control which entails the application of a commercial strain of Beauveria bassiana (Balsamo, Vuillemin) on wild rabbit burrows under field conditions. Aqueous solutions of the product were applied using a mist blower sprayer into 1,717 burrows. Two trials were performed, one in spring and the other in summer. The parasitic index (PI) was calculated for 10 rabbits per treatment per time point on day +30, +60, and +90 posttreatment and efficiency was calculated by comparing the PI for ticks in treated and untreated rabbits. A total of 20,234 ixodid ticks were collected. Hyalomma lusitanicum Koch, 1844 was the most abundant tick feeding on rabbits. Treatment significantly reduced the PI in spring (by 78.63% and 63.28% on day +30 and +60, respectively; P < 0.05), but appeared to be less effective in summer, with a marginally significant tick reduction of 35.72% on day +30 (P = 0.05). Results suggest that the efficacy of applications inside burrows could be temperature-dependent and that such applications could be an economic alternative to rabbit tick control during at least two months using a diluted solution of B. bassiana conidia.

  19. First survey of hard ticks (Acari:Ixodidae) on cattle, sheep and goats in Boeen Zahra and Takistan counties, Iran

    Institute of Scientific and Technical Information of China (English)

    Masoomeh Shemshad; Khadijeh Shemshad; Mohammad Mehdi Sedaghat; Majid Shokri; Alireza Barmaki; Mojgan Baniardalani; Javad Rafinejad

    2012-01-01

    Objective: To carry out the distribution survey of hard ticks of livestock in Boeen Zahra and Takistan counties of Qazvin province from April 2010 to September 2010. Methods:Nearly about 2 638 sheep, 461 goats and 318 cattle of 38 herds in different geographical areas were searched for tick infestation. Results:The species compositions collected from the livestock of Boeen Zahra and Takistan were Haemaphysalis concinna (0.63%), Haemaphysalis sulcata (12.66%), Hyalomma anatolicum (3.80%), Hyalomma asiaticum (3.16%), Hyalomma detritum (5.70%), Hyalomma dromedarii (28.48%), Hyalomma marginatum (13.29%), Hyalomma schulzei (1.89%), Rhipicephalus bursa (3.16%) and Rhipicephalus sanguineus (3.16%), and for Takistan’s livestock were Hyalomma dromedarii (9.86%), Hyalomma marginatum (13.29%), Hyalomma schulzei (1.89%) and Rhipicephalus sanguineus (3.16%), respectively. Hard ticks compositions in different topographic areas were different. Hyalomma species had the most prevalence in the areas. Conclusions:The veterinary and public health investigation of the above species should be taken.

  20. Molecular detection of Rickettsia africae, Rickettsia aeschlimannii, and Rickettsia sibirica mongolitimonae in camels and Hyalomma spp. ticks from Israel.

    Science.gov (United States)

    Kleinerman, Gabriela; Baneth, Gad; Mumcuoglu, Kosta Y; van Straten, Michael; Berlin, Dalia; Apanaskevich, Dmitry A; Abdeen, Ziad; Nasereddin, Abed; Harrus, Shimon

    2013-12-01

    In this study, we aimed to identify and genetically characterize spotted fever group (SFG) rickettsiae in ticks, domestic one-humped camels, and horses from farms and Bedouin communities in southern Israel. A total of 618 ixodid ticks (Hyalomma dromedarii, Hyalomma turanicum, Hyalomma excavatum, and Hyalomma impeltatum) collected from camels and horses, as well as 152 blood samples from 148 camels and four horses were included in the study. Initial screening for rickettsiae was carried out by targeting the gltA gene. Positive samples were further analyzed for rickettsial ompA, 17kDa, ompB, and 16S rRNA genes. Rickettsia aeschlimannii DNA was detected in the blood of three camels and 14 ticks (H. dromedarii, H. turanicum, and H. excavatum). Rickettsia africae was found in six ticks (H. turanicum, H. impeltatum, H. dromedarii, and H. excavatum). In addition, Rickettsia sibirica mongolitimonae was detected in one H. turanicum tick. These findings represent the first autochthonous detection of R. africae in Israel. Previous detections of R. africae in Asia were reported from the Sinai Peninsula (Egypt) and Istanbul, only. Furthermore, we report for the first time the finding of R. aeschlimannii in H. turanicum and H. excavatum ticks, as well as the first identification of R. sibirica mongolitimonae in H. turanicum ticks. The tick species identified to harbor R. africae and other SFG rickettsiae have been reported to occasionally feed on people, and, therefore, physicians should be aware of the possible exposure of local communities and travelers, especially those in contact with camels, to these tick-borne rickettsial pathogens.

  1. Distribution and ecology of ticks (Acari: Ixodidae) infesting livestock in Tunisia: an overview of eighth years field collections.

    Science.gov (United States)

    Bouattour, A; Darghouth, M A; Daoud, A

    1999-09-01

    Ticks (Ixodidae) play a significant role as vectors of pathogens of domestic animals in Tunisia. The major losses caused by ticks are related to transmission of protozoan parasites. These include agents of tropical theileriosis and babesiosis in ruminants. Since 1991, we conducted research studies on tick population of livestock in Tunisia. This overview reports a synthesis on tick distribution, their biology and their role as vectors of pathogens in domestic animals, particularly cattle. During the whole period of the study about 15,000 tick specimens were collected from different zones of the country. A total of 14 species were identified. Hyalomma detritum detritum was the most abundant and important (vector of Theileria annulata) species infesting cattle. Hyalomma dromedarii and Hyalomma impeltatum were collected on domestic ruminants in the arid and desertic zones. Hyalomma marginatum marginatum and Hyalomma anatolicum excavatum were widespread and found on livestock hosts. Ixodes ricinus, vector of Babesia divergens and Borrelia burgdorferi sl, colonises mainly the humid zone. Boophilus annulatus and Rhipicephalus bursa infesting cattle, sheep and goats were found in the sub-humid and semi-arid zones. Haemaphysalis sulcata and Hae. punctata were collected in humid and sub-humid zones on cattle and sheep. Rhipicephalus turanicus were collected in different regions, on different animal species. Rhipicephalus sanguineus, tick of dogs, were often collected on livestock. Only few specimens of Hyalomma marginatum rufipes and Hyalomma franchinii were collected.

  2. Species diversity and geographic distribution of hard ticks (Acari: Ixodoidea: Ixodidae) infesting domestic ruminants, in Qazvin Province, Iran.

    Science.gov (United States)

    Shemshad, Khadijeh; Rafinejad, Javad; Kamali, Karim; Piazak, Norayer; Sedaghat, Mohammad Mahdi; Shemshad, Masoomeh; Biglarian, Akbar; Nourolahi, Fathollah; Valad Beigi, Enshallah; Enayati, Ahmad Ali

    2012-01-01

    This report presents the results of the first faunistic study of hard ticks in Qazvin province of Iran. The primary objective was to determine the species diversity and geographic distribution of hard ticks that parasitize domestic ruminants. Information about the abiotic preferences of these species has been provided. A total of 286 cattle, 1,053 goats, and 2,050 sheep were examined in 13 villages in 28 flocks distributed throughout the studied areas. Total direct body collections of ticks were made from each domestic ruminant. A total of 228 Ixodid specimens belonging to nine species in three different genera were recorded in the areas, including Boophilus annulatus (Say, 1821), Hyalomma anatolicum Koch, 1844, Hyalomma asiaticum (Schulze and Schlettke, 1929), Hyalomma detritum Schulze, 1919, Hyalomma dromedarii Koch, 1844, Hyalomma marginatum Koch 1844, Hyalomma schulzei Olenev, 1931, Rhipicephalus bursa Canestrini and Fanz, 1878 and Rhipicephalus sanguineus (Latreille, 1806). The most abundant species on sheep was R. sanguineus (46.92%), while B. annulatus (6.6%) found only on cattle. A finding of great significance was that R. sanguineus, the main vector of babesiosis, is firmly established throughout the counties. A further objective of the study was to compare the abundance of the major tick species on domestic ruminants. This was carried out at 19 sampling sites. The highest number of ticks was collected in July-August during the hot season.

  3. Life cycle and morphology of development stages of Physocephalus dromedarii (Nematoda:Spirocercidae)

    Institute of Scientific and Technical Information of China (English)

    Rolf Karl Schuster; Saritha Sivakumar; J ¨org Kinne

    2016-01-01

    Objective: To study the development of Physocephalus dromedarii (P. dromedarii) in the final host. Methods: For this, 5 adult dromedaries were orally infected with third larval stages of P. dromedarii obtained from naturally infected scarab beetles (Scarabaeus cristatus). The camels were necropsied 14, 42, 70, 84 and 280 days after infection and their abomasi were examined for the presence of nematodes. Results: Early 4th stage larva occurred already 2 weeks after infection. They were still in the sheet of the 3rd stage larva. Six weeks after infection, the nematodes became juvenile male and female adults measuring 9 and 10 mm, respectively. Their size doubled at 10 weeks post infection and patency was reached at 12 weeks. P. dromedarii was still present in the camel that was examined 40 weeks after infection. Conclusions: As a result of experimental infection of the natural host, the determined prepatent period of P. dromedarii equalled 12 weeks.

  4. Preliminary survey of ticks (Acari : Ixodidae on cattle in northern Sudan

    Directory of Open Access Journals (Sweden)

    D.A. Salih

    2004-11-01

    Full Text Available In a cross sectional survey conducted during the period June 2001 to July 2002, the geographical distribution of ticks on cattle in the Sudan was determined. Seventeen locations were surveyed from Northern, Central, Eastern, Western, Blue Nile and White Nile Provinces. Total body collections of ticks were made from 20 cattle at each location. Four tick genera and 11 species were identified. The tick species collected included Amblyomma lepidum, Amblyomma variegatum, Boophilus decoloratus, Hyalomma anatolicum anatolicum, Hyalomma dromedarii, Hyalomma impeltatum, Hyalomma marginatum rufipes, Hyalomma truncatum, Rhipicephalus evertsi evertsi, Rhipicephalus sanguineus group and Rhipicephalus simus simus. Major ecological changes have occurred due to extensive animal movement, deforestation, desertification and establishment of large mechanized agricultural schemes. These factors have certainly affected the distribution of ticks and tick-borne diseases in the Sudan. The absence of A. variegatum and A. lepidum in northern Sudan was not surprising, since these tick species are known to survive in humid areas and not in the desert and semi-desert areas of northern Sudan. The absence of B. annulatus in northern and central Sudan is in accordance with the finding that this tick species is restricted to the southern parts of the central Sudan. The presence of H. anatolicum anatolicum in Um Benin in relatively high abundance is an interesting finding. The present finding may indicate that the southern limit of this species has changed and moved southwards to latitude 13o N. It is concluded that major changes in tick distribution have taken place in the Sudan

  5. Ticks (Acari: Ixodidae of livestock and their seasonal activities, northwest of Iran

    Directory of Open Access Journals (Sweden)

    Zahra Ramezani

    2014-09-01

    Full Text Available Objective: To identify the ticks (Acari: Ixodidae of livestock and their seasonal activities, in northwest of Iran, including the combination of two of the geographical regions of Iran (Caspian and mountain plateau where the majority of the domestic ruminants in Iran exist. Methods: Fifteen villages of Meshkin-Shahr County were selected randomly from different areas of the county. The animal dwellings were visited and the whole body of sheep, cows, goats and dogs were examined for their probable infestation. Samples were identified at the level of species according to the standard morphological key. Results: In this study 1 208 specimen were collected and totally nine species (Dermacentor marginatus, Dermacentor niveus, Haemaphysalis erinacei, Haemaphysalis punctata, Hyalomma anatolicum, Hyalomma asiaticum, Hyalomma marginatum, Rhipicephalus bursa and Rhipicephalus sanguineus were identified in this study. Also 569 host including 40 cows, 450 sheep, 70 goats and 9 dogs were examined for infestation and among them 255 were infested which showed a 44% of infestation among examined livestock. The infestation rate among sheep (46% was higher than other hosts. The infestation rates among the rest of hosts were as: cows (40%, goat (37% and dogs (33%. Conclusions: The results of this study and other studies of the region showed the probability of the establishment and development of the burden of several tick-borne diseases.

  6. Neurosecretory Cell Types and Distribution in Unfed Female Hyalomma Dromedari (Acari: Ixodoidea: Ixodidae) Synganglion

    Science.gov (United States)

    1987-01-01

    of the cell in subtype VIh (Fig. 2). Type IX : In these oval celo, 2 subtypes are distinguished according to cell size and NSG distribution. The NSG...1977) : Neurosecretion in Ornithodoros savignyi (Audouin) (Ixodoidea : Arga- sidae ). The distribution of neurosecretory cells in the brain. J. Vet. Res

  7. Acari in archaeology.

    Science.gov (United States)

    Baker, Anne S

    2009-10-01

    Mites and ticks (Acari) have been found in a variety of archaeological situations. Their identification has enabled data on habitat and dietary preferences to be obtained, and these have been used to interpret study sites. Despite this, Acari are not routinely considered in analyses in the way that other environmental components are. Like forensic science, archaeology draws on biological material to rebuild past human activity, and acarology has the potential to provide a much greater amount of evidence to both than is currently the case. As an aid to workers in these fields, an overview is presented of the Acari that have been extracted from archaeological samples, the situations in which they were found and the contribution their presence can make to the interpretation of sites.

  8. ACARI, CIDADE (MAIS) LIMPA

    OpenAIRE

    Maria Luiza de Medeiros Galvão

    2013-01-01

    Este trabalho tem por objetivo realizar uma breve reflexão acerca da concepção empírica de Acari como a cidade mais limpa do Brasil, assim referenciada na década de 70 do século XX. Como introdução, desenvolvemos considerações iniciais sobre cidade, tendo como recurso metodológico os conhecimentos adquiridos com a disciplina Arquitetura e Cidade no Brasil. Dando sequência ao texto, refletimos conceitualmente sobre cidade, espaço balizador para compreensão de Acari - cidade mais limpa; territó...

  9. Acari uit Ambon

    NARCIS (Netherlands)

    Oudemans, A.C.

    1927-01-01

    Prof. Dr. E. D. VAN OORT, Directeur van 's Rijks Museum van Natuurlijke Historie te Leiden, was zoo vriendelijk, het materiaal aan Acari, door den Gouvernements-Arts Dr. PH. F. KOPSTEIN, thans te Weltevreden bij Batavia, gedurende zijn verblijf op Ambon 1922 en 1923 verzameld, mij ter determineering

  10. First detection of Babesia occultans in Hyalomma ticks from Tunisia.

    Science.gov (United States)

    Ros-García, A; M'Ghirbi, Y; Bouattour, A; Hurtado, A

    2011-04-01

    Descriptions of Babesia occultans have previously been restricted to sub-Saharan Africa. Here, we report the finding, for the first time, of this low or non-pathogenic bovine Babesia species in Tunisia, northern Africa. B. occultans DNA was detected by molecular methods in Hyalomma marginatum unfed ticks collected in 3 bioclimatic regions of Tunisia. The near-full-length 18S rRNA gene was sequenced and compared with related sequences retrieved from GenBank. Phylogenetic analysis indicated that other sequences deposited as Babesia sp. could also correspond to B. occultans, suggesting that this species may have a wide distribution in Mediterranean and Asiatic regions, and not only in sub-Saharan Africa as previously described. A B. occultans-specific Reverse Line Blot (RLB) oligonucleotide probe was designed for future epidemiological studies that would help to clarify this possibility.

  11. ACARI, CIDADE (MAIS LIMPA

    Directory of Open Access Journals (Sweden)

    Maria Luiza Medeiros Galvão

    2013-10-01

    Full Text Available Este trabalho tem por objetivo realizar uma breve reflexão acerca da concepção empírica de Acari como a cidade mais limpa do Brasil, assim referenciada na década de 70 do século XX. Como introdução, desenvolvemos considerações iniciais sobre cidade, tendo como recurso metodológico os conhecimentos adquiridos com a disciplina Arquitetura e Cidade no Brasil. Dando sequência ao texto, refletimos conceitualmente sobre cidade, espaço balizador para compreensão de Acari - cidade mais limpa; território, para compreensão da cidade como construção histórica; e o Ambiente, cujo propósito foi associar o tema do trabalho à sustentabilidade socioambiental. Utilizamos dois contextos: o primeiro de crise e divulgação do título cidade mais limpa. O segundo, dizendo respeito à legislação urbanística e códigos de postura elaborados nos períodos imperial e republicano, que ordenaram o território de Acari nos dois últimos séculos, marcando a tradição de asseio, limpeza e higiene urbanas.

  12. Bartonella dromedarii sp. nov. isolated from domesticated camels (Camelus dromedarius) in Israel.

    Science.gov (United States)

    Rasis, Michal; Rudoler, Nir; Schwartz, David; Giladi, Michael

    2014-11-01

    Bartonella spp. are fastidious, Gram-negative bacilli that cause a wide spectrum of diseases in humans. Most Bartonella spp. have adapted to a specific host, generally a domestic or wild mammal. Dromedary camels (Camelus dromedarius) have become a focus of growing public-health interest because they have been identified as a reservoir host for the Middle East respiratory syndrome coronavirus. Nevertheless, data on camel zoonoses are limited. We aimed to study the occurrence of Bartonella bacteremia among dromedaries in Israel. Nine of 51 (17.6%) camels were found to be bacteremic with Bartonella spp.; bacteremia levels ranged from five to >1000 colony-forming units/mL. Phylogenetic reconstruction based on the concatenated sequences of gltA and rpoB genes demonstrated that the dromedary Bartonella isolates are closely related to other ruminant-derived Bartonella spp., with B. bovis being the nearest relative. Using electron microscopy, the novel isolates were shown to be flagellated, whereas B. bovis is nonflagellated. Sequence comparisons analysis of the housekeeping genes ftsZ, ribC, and groEL showed the highest homology to B. chomelii, B. capreoli, and B. birtlesii, respectively. Sequence analysis of the gltA and rpoB revealed ∼96% identity to B. bovis, a previously suggested cutoff value for sequence-based differentiation of Bartonella spp., suggesting that this approach does not have sufficient discriminatory power for differentiating ruminant-related Bartonella spp. A comprehensive multilocus sequence typing (MLST) analysis based on nine genetic loci (gltA, rpoB, ftsZ, internal transcribed spacer (ITS), 16S rRNA, ribC, groEL, nuoG, and SsrA) identified seven sequence types of the new dromedary isolates. This is the first description of a Bartonella sp. from camelids. On the basis of a distinct reservoir and ecological niche, sequence analyses, and expression of flagella, we designate these isolates as a novel Bartonella sp. named Bartonella dromedarii sp

  13. Transstadial transmission of Borrelia turcica in Hyalomma aegyptium ticks.

    Science.gov (United States)

    Kalmár, Zsuzsa; Cozma, Vasile; Sprong, Hein; Jahfari, Setareh; D'Amico, Gianluca; Mărcuțan, Daniel I; Ionică, Angela M; Magdaş, Cristian; Modrý, David; Mihalca, Andrei D

    2015-01-01

    Borrelia turcica comprises the third major group of arthropod-transmitted borreliae and is phylogenetically divergent from other Borrelia groups. The novel group of Borrelia was initially isolated from Hyalomma aegyptium ticks in Turkey and it was recently found in blood and multiple organs of tortoises exported from Jordan to Japan. However, the ecology of these spirochetes and their development in ticks or the vertebrate hosts were not investigated in detail; our aims were to isolate the pathogen and to evaluate the possibility of transstadial transmission of Borrelia turcica by H. aegyptium ticks. Ticks were collected from Testudo graeca tortoises during the summer of 2013 from southeastern Romania. Engorged nymphs were successfully molted to the adult stage. Alive B. turcica was isolated from molted ticks by using Barbour-Stoenner-Kelly (BSK) II medium. Four pure cultures of spirochetes were obtained and analyzed by PCR and sequencing. Sequence analysis of glpQ, gyrB and flaB revealed 98%-100% similarities with B. turcica. H. aegyptium ticks collected from T. graeca tortoises were able to pass the infection with B. turcica via transstadial route, suggesting its vectorial capacity.

  14. The international trade in reptiles (Reptilia)--the cause of the transfer of exotic ticks (Acari: Ixodida) to Poland.

    Science.gov (United States)

    Nowak, Magdalena

    2010-05-11

    The problem of the unnatural transfer of exotic ticks (Acari: Ixodida) on reptiles (Reptilia) imported to Poland is presented. In the period from 2003 to 2007, 382 specimens of reptiles belonging to the following genera were investigated: Testudo, Iguana, Varanus, Gongylophis, Python, Spalerosophis, Psammophis. The reptiles most infested with ticks are imported to Poland from Ghana in Africa, and are the commonly bred terrarium reptiles: Varanus exanthematicus and Python regius. As a result of the investigations, the transfer of exotic ticks on reptiles to Poland was confirmed. There were 2104 specimens of the genera Amblyomma and Hyalomma. The following species were found: Amblyomma exornatum Koch, 1844, Amblyomma flavomaculatum (Lucas, 1846), Amblyomma latum Koch, 1844, Amblyomma nuttalli Donitz, 1909, Amblyomma quadricavum (Schulze, 1941), Amblyomma transversale (Lucas, 1844), Amblyomma varanense (Supino, 1897), Amblyomma sp. Koch, 1844, Hyalomma aegyptium (Linnaeus, 1758). All the species of ticks of genus Amblyomma revealed have been discovered in Poland for the first time. During the research, 13 cases of anomalies of morphological structure were confirmed in the ticks A. flavomaculatum, A. latum and H. aegyptium. The expanding phenomenon of the import of exotic reptiles in Poland and Central Europe is important for parasitological and epidemiological considerations, and therefore requires monitoring and wide-ranging prophylactic activities to prevent the inflow of exotic parasites to Poland.

  15. Scarabaeus cristatus (Coleoptera: Scarabaeidae) as intermediate host of Physocephalus dromedarii (Nematoda: Spirocercidae)--a contribution to the epidemiology of camel physocephalidosis.

    Science.gov (United States)

    Schuster, Rolf K; Sivakumar, Saritha; Ismail, Akhmad A; Baumann, Maximilian P O

    2016-03-01

    In UAE, camel Physocephalus dromedarii was diagnosed for the first time in 2011 in dromedaries from a farm that previously had imported animals from foreign countries. The large scarab beetle, Scarabaeus cristatus, was found to be the major intermediate host for this parasite in Dubai. A total of 638 specimens of S. cristatus were collected and examined for the presence of third-stage larvae of nematode larvae at two sites in the Dubai Emirate (Emirates Industry for Camel Milk and Products and horse endurance training track) within a distance of 15 km. Third-stage larvae of P. dromedarii were detected in 94 and 97 % of beetles collected from the territory of the camel milk farm and the endurance training track, respectively. In addition to third-stage larvae, 264 beetles contained second-stage larvae. Only four beetles were infected with other than P. dromedarii larvae. The average larval burden in beetles from camel milk farm was significantly higher compared to those in beetles collected from the other site (1538 vs. 697). Comparison of larval burdens in juvenile and adult beetles collected at the camel milk farm showed a significantly higher intensity in adult specimens (501 vs. 1734) while in beetles found on the horse endurance track, larval burdens were comparable (548 vs. 858). The results suggest that S. cristatus become infected at the camel milk farm, and in search for other sources of food, they fly to places where they were found feeding on feces of other animals.

  16. DISTRIBUTION AND ECOLOGICAL CHARACTERISTICS OF HYALOMMA IXODID TICKS IN THE ECOSYSTEMS OF THE STAVROPOL REGION

    Directory of Open Access Journals (Sweden)

    V. I. Trukhachev

    2016-01-01

    Full Text Available Aim. To determine the characteristics of the modern dissemination, distribution and seasonal activity of Hyalomma ixodid ticks in the Stavropol region.Methods. The study of the spread of Ixodes Hyalomma ticks was conducted in all administrative districts of the Stavropol Territory in the period of 2000-2015. Collection of ixodid ticks in natural habitats, home to wild mammals and birds, was carried out according to conventional techniques.Results. Hyalomma marginatum is a two-host tick. In the region, H. marginatum of an adult stage becomes active in early spring (late March - early April; appearance of the larvae is observed in early July; the nymphs in the third decade of July. The peculiarity of biological development of H. scupense is the activation of adult species in the cold season (winter; development is only of one-host cycle. The peak number of ticks of an adult stage in cattle falls on the last days of January and February.Conclusion. Hyalomma ixodid ticks in the Stavropol region are distributed mosaicly, with the dominance of some species depending on climatic and landscape-geographical features of the territories they inhabit. The dominant species are H. marginatum and H. scupense, but H. anatolicum tick species occur sporadically in the east region.

  17. Facial nerve paralysis due to intra-aural Hyalomma tick infestation.

    Science.gov (United States)

    Doğan, Müzeyyen; Devge, Cem; Tanrıöver, Ozlem; Pata, Yavuz Selim; Sönmezoğlu, Meral

    2012-01-01

    We present the case of a 33 year-old man from a village of the north-eastern part of central Anatolia admitted to the otolaryngology department of Yeditepe University Hospital with right facial asymmetry and pain on the right ear. A tick of the genus Hyalomma was observed in the external auditory canal of the right ear and it was removed with fine cup forceps under otomicroscopy. We are of the opinion that in patients presenting with sudden acute ear pain and facial palsy, the ear canal should be examined to exclude an infestation by ticks.

  18. An Annotated List of Tick (Acari: Ixodida) Common Names Authored by Harry Hoogstraal (1917-1986)

    Science.gov (United States)

    2011-01-01

    America, 63, 590–606. Pegram, R.G., Hoogstraal, H. & Wassef, H.Y. (1982) Hyalomma (Hyalommina) arabica sp. n. parasitizing goats and sheep in the...Hoogstraal et al. (1972a) Arabian goat hyalomminid, Hyalomma arabica Pegram, Hoogstraal and Wassef, 1982 ― Pegram et al. (1982) Arabian goat ...hyalomminine [sic], "Hyalomma sp. in press Pegram, Hoogstraal and Wassef, 1982"—this species was named Hyalomma arabica, "Arabian goat hyalomminid," q.v

  19. Evaluation of Animal and Plant Pathogens as Terrorism and Warfare Agents, Vectors and Pests

    Science.gov (United States)

    2001-09-01

    Acari Arachnida Hyalomma Anatolicumn Anatolicumn Dermacentor andersoni Acari Arachnida Dermacentor varabilis Amblyimma Cajennese Rhipicephalus sanguineus...Mansonia spp. Diptera Insecta Culex spp. Culiseta spp. Pediculus humanus Anopluraa Insect Ixodides Dermacentor spp. Acari Arachnida Rhipicephalus spp

  20. Natural infection rates and transmission of Theileria annulata by Hyalomma anatolicum anatolicum ticks in the Sudan

    Directory of Open Access Journals (Sweden)

    D.A. Salih

    2005-09-01

    Full Text Available Hyalomma anatolicum anatolicum nymphs were collected from two localities in the Sudan: Eddamer in Northern Sudan and Wad-Medani in Central Sudan. They were allowed to moult to adult ticks, which were assessed for Theileria infection in their salivary glands using Feulgen stain. At Eddamer, 49.6 % of 123 ticks examined were infected with Theileria and the mean intensity of infection was 1.3 (i.e. the number of infected acini / number of infected ticks. At Wad-Medani, 8.6 % of 162 ticks were infected and the mean intensity of infection was 7.9. The prevalence of infection was higher in female than in male ticks at both localities. When adult H. a. anatolicum were applied onto two susceptible calves, both animals developed the severe form of theileriosis.

  1. Atlas van de Nederlandse watermijten (Acari: Hydrachnidia)

    NARCIS (Netherlands)

    Smit, H.; Hammen, van der H.

    2000-01-01

    Atlas of the Dutch water mites (Acari: Hydrachnidia) Few biogeographic studies have been published on water mites. Only Lundblad (1962) has published an atlas of the Swedish water mites. So far, there are no complete publications on the distribution of Dutch water mites. Acarologists who worked on D

  2. 小亚璃眼蜱和亚洲璃眼蜱对环形泰勒虫传播能力的研究%Studies on ability to transmit Theileria annulata with Hyalomma anatolicum anatolicum and Hyalomma asiaticum asiaticum

    Institute of Scientific and Technical Information of China (English)

    罗建勋; 殷宏; 关贵全; 马米玲; 张其才; 吕文顺

    2003-01-01

    将实验室培养的小亚璃眼蜱(Hyalomma anatolicum anatolicum)和亚洲璃眼蜱(Hyalomma asiaticum asiaticum)清洁幼虫和若虫饲喂于感染环形泰勒虫的牛体,收集饱血幼虫和若虫,用所孵化的若虫和成虫感染试验牛.结果显示,小亚璃眼蜱幼虫、若虫阶段感染,所发育之若虫、成虫均可传播环形泰勒虫;而亚洲璃眼蜱各阶段的传播试验结果均为阴性.

  3. Solanum trilobatum extract-mediated synthesis of titanium dioxide nanoparticles to control Pediculus humanus capitis, Hyalomma anatolicum anatolicum and Anopheles subpictus.

    Science.gov (United States)

    Rajakumar, Govindasamy; Rahuman, Abdul Abdul; Jayaseelan, Chidambaram; Santhoshkumar, Thirunavukkarasu; Marimuthu, Sampath; Kamaraj, Chinnaperumal; Bagavan, Asokan; Zahir, Abdul Abduz; Kirthi, Arivarasan Vishnu; Elango, Gandhi; Arora, Pooja; Karthikeyan, Rajan; Manikandan, Sivan; Jose, Sujin

    2014-02-01

    Titanium dioxide nanoparticles (TiO2 NPs) are widely used in paints, printing ink, rubber, paper, cosmetics, sunscreens, car materials, cleaning air products, industrial photocatalytic processes, and decomposing organic matters in wastewater due to their unique physical, chemical, and biological properties. The present study was conducted to assess the antiparasitic efficacies of synthesized TiO2 NPs utilizing leaf aqueous extract of Solanum trilobatum against the adult head louse, Pediculus humanus capitis De Geer (Phthiraptera: Pediculidae); larvae of cattle tick Hyalomma anatolicum (a.) anatolicum Koch (Acari: Ixodidae), and fourth instar larvae of malaria vector Anopheles subpictus Grassi (Diptera: Culicidae). The green synthesized TiO2 NPs were analyzed by X-ray diffraction (XRD), Fourier transform infrared spectroscopy (FTIR), Scanning electron microscopy (SEM), Energy-dispersive X-ray spectroscopy analysis (EDX), and Atomic force microscopy (AFM). XRD analysis of synthesized TiO2 NPs revealed that the particles were in the form of nanocrystals as evidenced by the major peaks at 2θ values of 27.52°, 36.21°, and 54.43° identified as 110, 101, and 211 reflections, respectively. FTIR spectra exhibited a prominent peak at 3,466 cm(-1) and showed OH stretching due to the alcoholic group, and the OH group may act as a capping agent. SEM images displayed NPs that were spherical, oval in shape, individual, and some in aggregates with an average size of 70 nm. Characterization of the synthesized TiO2 NPs using AFM offered a three-dimensional visualization and uneven surface morphology. The pediculocidal and acaricidal activities of synthesized TiO2 NPs showed the percent mortality of 31, 42, 63, 82, 100; 36, 44, 67, 89, and 100 at 2, 4, 6, 8, and 10 mg/L, respectively, against P. h. capitis and H. a. anatolicum. The average larval percent mortality of synthesized TiO2 NPs was 38, 47, 66, 79, and 100 at 1, 2, 3, 4, and 5 mg/L, respectively, against A. subpictus

  4. The dependence of Hyalomma aegyptium on its tortoise host Testudo graeca in Algeria.

    Science.gov (United States)

    Tiar, G; Tiar-Saadi, M; Benyacoub, S; Rouag, R; Široký, P

    2016-09-01

    Hyalomma aegyptium (Linnaeus, 1758) (Ixodida: Ixodidae) has recently been confirmed as a carrier of numerous pathogenic, including zoonotic, agents. Four environmentally distinct regions of Algeria, located between the humid coastal zone and the arid Saharan Atlas range, were selected in order to compare differences in tick abundance among localities, and the correlations between tick abundance and host population characteristics and other environmental conditions. Sampling was carried out during May and early June in 2010-2012. A total of 1832 H. aegyptium were removed from 201 tortoises. Adult ticks accounted for 52% of the collection. In the pre-adult stages, larvae were dominant. Data on prevalence, intensity (mean ± standard deviation, range) and abundance of tick infestation were calculated for each locality. Locally, prevalences reached 100%. The sex ratio was biased in favour of males (4.2). Intensities of infestation differed significantly among the localities studied for all developmental stages of the tick. The intensity of infestation by adult ticks was positively correlated to the size of the tortoise and with tortoise population density in the habitat. However, findings for immature tick stages were independent of both variables. No significant correlations between infestation intensities and the climatic parameters tested were found. Immature ticks were observed to prefer the front parts of their tortoise hosts, whereas the majority of adults were attached to the rear parts.

  5. Hyalomma aegyptium on Spur-thighed Tortoise (Testudo graeca in Urmia Region West Azerbaijan, Iran

    Directory of Open Access Journals (Sweden)

    M Tavassoli

    2007-05-01

    Full Text Available Background: Ticks are obligate blood feeders that parasitize a wide variety of animals. Hyalomma aegyptium, parasitize tortoises and other small wild life and livestock. This study was carried out to determine spur-thighed tortoise (Testudo graeca infestation to H. ageyptium in Urmia region West Azerbaijan of Iran. Methods: The study was carried out over a 16 month period from the spring of 2004 to the fall of 2005. A total of 32 tor¬toises were sampled. Results: The results indicated that 14 tortoises infected with ticks. A total of 117 ticks were collected from infested animals, the minimum and maximum tick infestation was 1-60. Ticks were attached to the axilla of fore and hind legs of tortoises. All ticks were determined to be H. aegyptium. Conclusion: H. aegyptium was the most common tick species in the study area. Due to tendency of some people to keeping tortoise as pet animal, more attention must be done to tortoise’s tick infestation. Due to existence of H. aegyptium on tor¬toises in this region more study will need to evaluate presence of this tick on other animal species and its role on transmis¬sion of diseases.

  6. [The importance of gamma irradiations with caesium-137 for Hyalomma anatolicum anatolicum (Metastigmata, Ixodidae) control].

    Science.gov (United States)

    Karaer, Zafer; Kar, Sirri; Düzgün, Ali; Güven, Esin; Pekmezci, Zafer; Emre, Zişan

    2006-01-01

    In this study, male ticks belonging to the Hyalomma anatolicum anatolicum species were subjected to gamma radiation doses of 5, 10, 15, 20 and 50 Gy, emitted by a gamma-ray source of Caesium 137. In females that fed with these male ticks, proportional to the increase in radiation dose, the period of feeding was found to shorten. A decrease was demonstrated in the number of engorged female ticks, engorgement weights, number of laying ticks and number of eggs. The hatching period of larvae from eggs was found to increase despite the decrease in the number of hatched larvae. Moreover no larvae were observed to hatch from any of the eggs of female ticks treated with a radiation dose of 50 Gy. Similarly, proportional to the applied dose of radiation, rates of viability and activity were observed to decrease in male ticks. In conclusion, taking into consideration the feeding periods and fertility rates of female ticks as indicators of male activity, this study has demonstrated that in combating with H. anatolicum anatolicum, radiation may be successful and a radiation dose of 10 Gy is most favorable.

  7. Transovarial Transmission of Babesia Ovis by Rhipicephalus Sanguineus and Hyalomma Marginatum

    Directory of Open Access Journals (Sweden)

    E Nouroozi

    2010-09-01

    Full Text Available Background: Rhipicephalus sanguineus and Hyalomma marginatum are the most common spe­cies in sheep herds in Northeast of Iran. There is preliminary evidence that these species may be the vectors of Babesia ovis in Iran. We carried out two experiments in Mashhad area, Khorasan Razavi Province to determine whether B. ovis could be transovarially transmitted by R. san­guineus and H. marginatum.Methods: In experiment 1, adults of laboratory reared H. marginatum and R.sanguineus were infected with B. ovis isolated from naturally infected sheep in Mashhad area by feeding the ticks on the sheep inoculated intravenously by infected blood samples. The inoculated sheep showed clinical signs with parasitaemia while the adult ticks were engorging on them. The engorged fe­males were collected and kept at 28°C and 85% relative humidity in incubator. Then, larval, nym­phal and adult stages derived from engorged females were used to infest the clean sheep. In experiment 2, two splenectomized sheep were infested only with the same adult ticks of two spe­cies.Results: Examination of smears and PCR of blood samples to detect of B. ovis in infested sheep in two experiments were negative.Conclusion: It seems that R. sanguineus and H. marginatum can not transovarially transmit B. ovis in sheep.

  8. Cryptic speciation in the Acari: a function of species lifestyles or our ability to separate species?

    Science.gov (United States)

    There are approximately 55,000 described Acari species, accounting for almost half of all known Arachnida species, but total estimated Acari diversity is reckoned to be far greater. One important source of currently hidden Acari diversity is cryptic speciation, which poses challenges to taxonomists ...

  9. Colonization and Containment of Hyalomma Marginatum Rufipes for Studies on the Transmission of Crimean-Congo Hemorrhagic Fever

    Science.gov (United States)

    1987-07-31

    Russian) Tabl. anal. Faune URSS 4 125pp Olenev, NO. 1931 Die Zecken (Ixodidea) der fauna Russlands. Zeits chr. Parasitenk. 4(1) 126-139 Olenev, NO. 1931...Parasitenk 4 126 Olenev, NO. 1931 Mag. Paras. Zool. Acad. Scien. URSS . 2 249 q Oliver, JH. 1972 Cytogenetics of ticks (Acari: Ixodoidea). 8. Chr...USA. Pomeranzev, BI. 1946 Tableaux analytiques Faunne URSS . Publ. Ins. Zool. Acad. Science. Popov, GV, Levi, VD, Vasilenko, SM, and Chumakov, MP

  10. Molecular detection of Rickettsia aeschlimannii in Hyalomma spp. ticks from camels (Camelus dromedarius) in Nigeria, West Africa.

    Science.gov (United States)

    Kamani, J; Baneth, G; Apanaskevich, D A; Mumcuoglu, K Y; Harrus, S

    2015-06-01

    Several species of the spotted fever group rickettsiae have been identified as emerging pathogens throughout the world, including in Africa. In this study, 197 Hyalomma ticks (Ixodida: Ixodidae) collected from 51 camels (Camelus dromedarius) in Kano, northern Nigeria, were screened by amplification and sequencing of the citrate synthase (gltA), outer membrane protein A (ompA) and 17-kDa antigen gene fragments. Rickettsia sp. gltA fragments were detected in 43.3% (42/97) of the tick pools tested. Rickettsial ompA gene fragments (189 bp and 630 bp) were detected in 64.3% (n = 27) and 23.8% (n = 10) of the gltA-positive tick pools by real-time and conventional polymerase chain reaction (PCR), respectively. The amplicons were 99-100% identical to Rickettsia aeschlimannii TR/Orkun-H and R. aeschlimannii strain EgyRickHimp-El-Arish in GenBank. Furthermore, 17-kDa antigen gene fragments of 214 bp and 265 bp were detected in 59.5% (n = 25) and 38.1% (n = 16), respectively, of tick pools, and sequences were identical to one another and 99-100% identical to those of the R. aeschlimannii strain Ibadan A1 in GenBank. None of the Hyalomma impressum ticks collected were positive for Rickettsia sp. DNA. Rickettsia sp. gltA fragments (133 bp) were detected in 18.8% of camel blood samples, but all samples were negative for the other genes targeted. This is the first report to describe the molecular detection of R. aeschlimannii in Hyalomma spp. ticks from camels in Nigeria.

  11. Population dynamics of ticks infesting the one-humped camel (Camelus dromedarius) in central Tunisia.

    Science.gov (United States)

    Gharbi, Mohamed; Moussi, Nawfel; Jedidi, Mohamed; Mhadhbi, Moez; Sassi, Limam; Darghouth, Mohamed Aziz

    2013-12-01

    A tick population was monitored on 30 camels (Camelus dromedarius) over one year in Kairouan region, Central Tunisia. A total of 1630 ticks was collected and identified resulting in an estimate of different parasitological indicators. The ticks belonged to 2 genera and 5 species: Hyalomma impeltatum (53%) and Hyalomma dromedarii (45%) were the dominant species followed by Hyalomma excavatum (1%), Hyalomma marginatum (0.5%), and Rhipicephalus turanicus (0.5%) (pTunisia.

  12. Hyalomma (Hyalommina) arabica sp. n. parasitizing goats and sheep in the Yemen Arab Republic and Saudi Arabia.

    Science.gov (United States)

    Pegram, R G; Hoogstraal, H; Wassef, H Y

    1982-02-01

    Hyalomma (Hyalommina) arabica sp. n. is described from 62 adults (29 males, 33 females) taken throughout the year from 23 goats and two sheep, mostly at 200 m altitude in the southern tihama foothills of Ta'izz Province, Yemen Arab Republic. One female from a goat at 2,300 m altitude in this Province may have attached to the host elsewhere and a male from Mecca, Saudi Arabia, was on a goat imported from an unknown source for the traditional religious pilgrimage feast. We postulate that the original host of adults was the Nubian ibex, Capra ibex nubiana F. Cuvier (Artiodactyla: Caprinae). This parasite is most closely related to H. (H.) kumari Sharif, which infests chiefly wild and domestic Caprinae from India to northwestern Iran and Tadzhik, SSR. It also shows relationships to H. (H.) punt Hoogstraal, Kaiser and Pedersen, which parasitizes gazelles and domestic mammals in Somalia and Ethiopia, but differs more widely from the third African-Arabian member of this subgenus, H. (H.) rhipicephaloides Neumann, which feeds on the Nubian ibex and gazelles in the Red Sea and Dead Sea areas. The Hyalomma subgenus Hyalommina now contains seven species, four confined to the Indian subcontinent (including Nepal, Burma, India, Sri Lanka, Pakistan, and Afghanistan) and Southwest Asia, and three in eastern Africa north of the equator and Arabia.

  13. Molecular analysis of Crimean-Congo hemorrhagic fever virus and Rickettsia in Hyalomma marginatum ticks removed from patients (Spain) and birds (Spain and Morocco), 2009-2015.

    Science.gov (United States)

    Palomar, Ana M; Portillo, Aránzazu; Mazuelas, David; Roncero, Lidia; Arizaga, Juan; Crespo, Ariñe; Gutiérrez, Óscar; Márquez, Francisco J; Cuadrado, Juan F; Eiros, José M; Oteo, José A

    2016-07-01

    Crimean-Congo hemorrhagic fever virus (CCHFV) was detected in Spain in 2010. The presence of CCHFV in Hyalomma marginatum ticks from migratory birds passing through Morocco during the spring migration strengthened the hypothesis of the arrival of infected ticks transported by birds to the Iberian Peninsula. Furthermore, Hyalomma species are vectors of bacterial infections such as spotted fever rickettsioses. CCHFV and Rickettsia were screened in Hyalomma ticks from Spain attached to patients (n=12) and birds (n=149). In addition, Rickettsia was investigated in 52 Hyalomma ticks from Morocco (previously reported as CCHFV-infected). No sample collected in Spain showed an infection with CCHFV. Two ticks removed from patients (16.7%), as well as 47 (31.5%) and 4 (7.7%) from birds, collected in Spain and Morocco respectively, were infected with Rickettsia aeschlimannii. Rickettsia sibirica subsp. mongolitimonae was also found in 2 ticks from birds collected in Spain (1.3%). The risk of CCHFV-infected ticks attached to migratory birds to reach the North of Spain is low. This study corroborates the presence of R. aeschlimannii in Spain and Morocco, and supports that H. marginatum can be a potential vector of R. sibirica subsp. mongolitimonae in the Iberian Peninsula.

  14. Verified and potential pathogens of predatory mites (Acari: Phytoseiidae)

    NARCIS (Netherlands)

    Schütte, C.; Dicke, M.

    2008-01-01

    Several species of phytoseiid mites (Acari: Phytoseiidae), including species of the genera Amblyseius, Galendromus, Metaseiulus, Neoseiulus, Phytoseiulus and Typhlodromus, are currently reared for biological control of various crop pests and/or as model organisms for the study of predator¿prey inter

  15. First record of Typhlodromus (Anthoseius transvaalensis (Acari: Phytoseiidae from Argentina

    Directory of Open Access Journals (Sweden)

    Claudia CÉDOLA

    2014-01-01

    Full Text Available Se cita por primera vez de la Argentina a Typhlodromus (Anthoseius transvaalensis Nesbitt (Acari: Phytoseiidae sobre Capsicum annuum L. y Lycopersicum esculentum L. (Solanaceae en la localidad de Concordia, Entre Ríos. Se proporcionan datos morfométricos de los ejemplares argentinos.

  16. HA03 as an Iranian Candidate Concealed Antigen for Vaccination against Hyalomma anatolicum anatolicum: Comparative Structural and In silico Studies

    Directory of Open Access Journals (Sweden)

    Mohammadi, A.

    2013-12-01

    Full Text Available In the last decades researchers had focused on developing a vaccine against tick based on protective antigen. Recombinant vaccines based on concealed antigen from Boophilus microplus have been developed in Australia and Cuba by the name of TICKGARD and GAVAC (De La Fuente and Kocan, 2006. Further studies on this antigen have shown some extent of protection against other species (De Vos et al., 2001. In Iran most important species is Hyalomma anatolicum and limited information about its control are available. This paper reports structural and polymorphic analysis of HA03 as an Iranian candidate concealed antigen of H. a. anatolicum deposited in Gen-Bank .(Aghaeipour et al. GQ228820. The comparison between this antigen and other mid gut concealed antigen that their characteristics are available in GenBank showed there are high rate of similarity between them. The HA03 amino acid sequence had a homology of around 89%, 64%, 56% with HA98, BM86, BM95 respectively. Potential of MHC class I and II binding region indicated a considerable variation between BM86 antigen and its efficiency against Iranian H. a. anatolicum. In addition, predicted major of hydrophobisity and similarity in N-glycosylation besides large amount of cystein and seven EGF like regions presented in protein structure revealed that value of HA03 as a new protective antigen and the necessity of the development, BM86 homolog of H. a. anatolicum HA03 based recombinant vaccine.

  17. The Midgut Bacterial Flora of Laboratory-Reared Hard Ticks, Haemaphysalis longicornis, Hyalomma asiaticum, and Rhipicephalus haemaphysaloides

    Institute of Scientific and Technical Information of China (English)

    LI Chun-hong; CAO Jie; ZHOU Yong-zhi; ZHANG Hou-shuang; GONG Hai-yan; ZHOU Jin-lin

    2014-01-01

    Ixodid ticks play an important role in the transmission of a variety of zoonoses of viral, bacterial and protozoan origin, and they also harbor a wealth of microorganisms. To gain more detailed insights into the potential interactions between bacterial lfora and tick-borne pathogens, we investigated the midgut bacterial lfora of laboratory-reared Haemaphysalis longicornis, Hyalomma asiaticum and Rhipicephalus haemaphysaloides. Based on morphological, biochemical, and 16S rDNA sequencing results, we identiifed 15 species belonging to 12 genera in the midgut of the three ticks. The bacterial communities were similar to those found in other studies of hematophagous arthropods. Kocuria sp. was the most frequently isolated species and its 16S rDNA gene sequence was very similar to Kocuria koreensis P31T. To our knowledge, this is the ifrst report of the bacterial lfora of tick midguts and the results show that there were many different bacterial species in each tick species. Among the most common genera, there may have been a novel species in the genus Kocuria. The results might be the ifrst step for looking for different aspects of the pathogen and tick interaction.

  18. Laboratory assessment of acaricidal activity of Cymbopogon winterianus, Vitex negundo and Withania somnifera extracts against deltamethrin resistant Hyalomma anatolicum.

    Science.gov (United States)

    Singh, Nirbhay Kumar; Jyoti; Vemu, Bhaskar; Nandi, Abhijit; Singh, Harkirat; Kumar, Rajender; Dumka, V K

    2014-07-01

    Larval packet test was used for detection of resistance levels against cypermethrin and deltamethrin, the most commonly used synthetic pyrethroids, in the multi-host tick Hyalomma anatolicum collected from district Moga, Punjab (India). Results indicated the presence of level I resistance against deltamethrin (RF = 2.81), whereas the tick isolate was susceptible to cypermethrin (RF = 0.2). The aqueous and ethanolic extracts of leaves of Cymbopogon winterianus, Vitex negundo and Withania somnifera along with roots of Vitex negundo were assessed for their acaricidal activity against the larvae of deltamethrin resistant H. anatolicum. The efficacy was assessed by measuring per cent larval mortality and determination of LC50 values. The various ethanolic extracts produced a concentration dependent increase in larval tick mortality, whereas the aqueous extracts exhibited a much lower mortality. The highest mortality (93.7 ± 0.66 %) was observed at the 5.0 % concentration of ethanolic extract of leaves of C. winterianus and the lowest LC50 value (0.011 %) was recorded for ethanolic extracts of leaves of V. negundo. The results indicated that these plant extracts have potential to be developed as herbal acaricides.

  19. First report of adult Hyalomma marginatum rufipes (vector of Crimean-Congo haemorrhagic fever virus on cattle under a continental climate in Hungary

    Directory of Open Access Journals (Sweden)

    Hornok Sándor

    2012-08-01

    Full Text Available Abstract Background South Hungary is being monitored for the northward spreading of thermophilic ixodid species, therefore ticks were collected from cattle and wild ruminants (red, fallow and roe deer in the autumn of 2011. Findings Besides indigenous species (1185 Dermacentor reticulatus and 976 Ixodes ricinus, two Hyalomma marginatum rufipes males were found on two cows, in September eight days apart. Conclusions This is the northernmost autochthonous infestation of the type host (cattle with H. m. rufipes, vector of Crimean-Congo haemorrhagic fever virus. The present findings are suggestive of the moulting success of this Afro-Mediterranean tick species in a continental climate in Central Europe.

  20. New records of water mites (Acari: Hydrachnidia, Halacaroidea) from Patagonia (Chile)

    NARCIS (Netherlands)

    Pešić, V.; Smit, H.; Datry, T.

    2010-01-01

    New records of water mite species (Acari: Hydrachnidia, Halacaroidea) from Patagonia (Southern Chile) are reported. Four species, Anisitsiellides australis Smit, 2002, Peregrinacarus falklandensis Bartsch, 2001, Lobohalacarus weberi (Romijn & Viets, 1924) and Soldanellonyx monardi Walter, 1919 are

  1. A new genus and species Mangalaus krishianusandhanus (Acari: Eriophyidae) from India

    Science.gov (United States)

    Mangalaus ikrishianusandhanus n. gen., n. sp., (Acari: Prostigmata: Eriophyoidea), collected from erineum on the underside of leaves of Cordia dichotoma (Boraginaceae) is described and illustrated from specimens collected at the Indian Agricultural Research Institute (IARI) in New Delhi, India....

  2. New records of water mites (Acari: Hydrachnidia) from Malaysia, with descriptions of three new species

    NARCIS (Netherlands)

    Pesic, V.; Smit, H.

    2010-01-01

    New records of water mites (Acari: Hydrachnidia) from Malaysia are presented. Three species new to science, Torrenticola haliki, Monatractides cameronensis and Atractides cameronensis are described; first records are given for Monatractides parviventris (K. Viets, 1935) and M. roseus (Lundblad, 1941

  3. Zoonotic pathogens associated with Hyalomma aegyptium in endangered tortoises: evidence for host-switching behaviour in ticks?

    Directory of Open Access Journals (Sweden)

    Paștiu Anamaria I

    2012-12-01

    Full Text Available Abstract Background Hyalomma aegyptium is a hard-tick with a typical three-host life cycle. The main hosts are Palearctic tortoises of genus Testudo. However, other hosts can be used by immature ticks for feeding in natural conditions. Given this complex ecology and multiple host use, the circulation of pathogens by H. aegyptium between various hosts can be important from epidemiological point of view. The aim of this study was to evaluate the role of H. aegyptium as natural carrier of four important zoonotic pathogens. Methods From 2008 to 2011, 448 H. aegyptium ticks were collected from 45 Spur-thighed tortoises, Testudo graeca in Romania. DNA was extracted individually from each tick using a commercial kit. DNA was examined for the presence of specific sequences of Borrelia burgdorferi s.l., Anaplasma phagocytophilum, Ehrlichia canis and Coxiella burnetii by PCR, according to previously described protocols. Results PCR analysis of H. aegyptium revealed the presence of A. phagocytophilum (18.8%, E. canis (14.1% and C. burnetii (10%. 32.4% of the ticks were infected with at least one pathogen and 9.8% had co-infections. The stages most frequently infected were nymphs (50% followed by males (33.9% and females (27%. The number of tortoises which harboured infected ticks was 27/45 examined (60%. From all tested T. graeca, 40% harboured ticks infected with A. phagocytophilum, 46.7% had ticks infected with E. canis and 33.3% had ticks with C. burnetii. This study reports for the first time the presence of A. phagocytophilum and E. canis in H. aegyptium. Conclusions The presence and relatively high prevalence of three important zoonotic pathogens in H. aegyptium raises the question of their epidemiologic importance in disease ecology. As tortoises are unlikely to be reservoir hosts for A. phagocytophilum and E. canis and both these pathogens are common in H. aegyptium, this is an important indication for (1 a possible increased host

  4. Influence of laboratory animal hosts on the life cycle of Hyalomma marginatum and implications for an in vivo transmission model for Crimean-Congo hemorrhagic fever virus

    Directory of Open Access Journals (Sweden)

    Aysen eGargili

    2013-08-01

    Full Text Available Crimean-Congo hemorrhagic fever virus (CCHFV is one of the most geographically widespread arboviruses and causes a severe hemorrhagic syndrome in humans. The virus circulates in nature in a vertebrate-tick cycle and ticks of the genus Hyalomma are the main vectors and reservoirs. Although the tick vector plays a central role in the maintenance and transmission of CCHFV in nature, comparatively little is known of CCHFV-tick interactions. This is mostly due to the fact that establishing tick colonies is laborious, and working with CCHFV requires a biosafety level 4 laboratory (BSL4 in many countries. Nonetheless, an in vivo transmission model is essential to understand the epidemiology of the transmission cycle of CCHFV. In addition, important parameters such as vectorial capacity of tick species, levels of infection in the host necessary to infect the tick, and aspects of virus transmission by tick bite including the influence of tick saliva, cannot be investigated any other way. Here, we evaluate the influence of different laboratory animal species as hosts supporting the life cycle of Hyalomma marginatum, a two-host tick. Rabbits were considered the host of choice for the maintenance of the uninfected colonies due to high larval attachment rates, shorter larval-nymphal feeding times, higher nymphal molting rates, high egg hatching rates and higher conversion efficiency index. Furthermore, we describe the successful establishment of an in vivo transmission model CCHFV in a BSL4 biocontainment setting using interferon knockout mice. This will give us a new tool to study the transmission and interaction of CCHFV with its tick vector.

  5. Influence of laboratory animal hosts on the life cycle of Hyalomma marginatum and implications for an in vivo transmission model for Crimean-Congo hemorrhagic fever virus.

    Science.gov (United States)

    Gargili, Aysen; Thangamani, Saravanan; Bente, Dennis

    2013-01-01

    Crimean-Congo hemorrhagic fever virus (CCHFV) is one of the most geographically widespread arboviruses and causes a severe hemorrhagic syndrome in humans. The virus circulates in nature in a vertebrate-tick cycle and ticks of the genus Hyalomma are the main vectors and reservoirs. Although the tick vector plays a central role in the maintenance and transmission of CCHFV in nature, comparatively little is known of CCHFV-tick interactions. This is mostly due to the fact that establishing tick colonies is laborious, and working with CCHFV requires a biosafety level 4 laboratory (BSL4) in many countries. Nonetheless, an in vivo transmission model is essential to understand the epidemiology of the transmission cycle of CCHFV. In addition, important parameters such as vectorial capacity of tick species, levels of infection in the host necessary to infect the tick, and aspects of virus transmission by tick bite including the influence of tick saliva, cannot be investigated any other way. Here, we evaluate the influence of different laboratory animal species as hosts supporting the life cycle of Hyalomma marginatum, a two-host tick. Rabbits were considered the host of choice for the maintenance of the uninfected colonies due to high larval attachment rates, shorter larval-nymphal feeding times, higher nymphal molting rates, high egg hatching rates, and higher conversion efficiency index (CEI). Furthermore, we describe the successful establishment of an in vivo transmission model for CCHFV in a BSL4 biocontainment setting using interferon knockout mice. This will give us a new tool to study the transmission and interaction of CCHFV with its tick vector.

  6. Ticks (Acari: Ixodidae infesting cattle and African buffaloes in the Tsavo conservation area, Kenya

    Directory of Open Access Journals (Sweden)

    Edward K. Kariuki

    2012-02-01

    Full Text Available Several ixodid tick species are shared between domestic cattle and African buffaloes (Syncerus caffer. So too, are a number of tick-borne diseases. The aim of the study was to compare the species composition of ticks that infest cattle and buffaloes utilising the same habitat within the Tsavo Conservation Area, Kenya. To this end, 25 cattle and 62 buffaloes were each opportunistically sampled for ticks on a single occasion in February 2010. Eight species, namely Amblyomma gemma, Amblyomma lepidum, Hyalomma albiparmatum, Hyalomma rufipes, Hyalomma truncatum, Rhipicephalus evertsi evertsi, Rhipicephalus pravus and Rhipicephalus pulchellus infested both cattle and buffaloes. Three species, Rhipicephalus (Boophilus sp., Rhipicephalus kochi, and Rhipicephalus muehlensi were collected only from cattle, and three species, Hyalomma impeltatum, Rhipicephalus humeralis and Rhipicephalus praetextatus were present only on buffaloes. The attachment sites of the various tick species were also recorded. New locality records for H. impeltatum and H. truncatum and the first confirmed locality record for Rhipicephalus praetextatus sensu stricto in Kenya were documented.

  7. Molecular Investigation of Francisella-Like Endosymbiont in Ticks and Francisella tularensis in Ixodid Ticks and Mosquitoes in Turkey.

    Science.gov (United States)

    Duzlu, Onder; Yildirim, Alparslan; Inci, Abdullah; Gumussoy, Kadir Semih; Ciloglu, Arif; Onder, Zuhal

    2016-01-01

    This study was carried out to investigate the molecular prevalence of Francisella-like endosymbionts (FLEs) and Francisella tularensis in ticks (Acari: Ixodidae) and mosquitoes in Turkey. Genomic DNA pools were constructed from a total of 1477 adult hard ticks of Rhipicephalus (Rh.) annulatus, Rh. turanicus, Rh. sanguineus, Rh. bursa, Haemaphysalis (Hae.) parva, Hae. sulcata, Hyalomma marginatum marginatum, H. anatolicum anatolicum, H. anatolicum excavatum, H. detritum detritum, H. dromedarii, Dermacentor marginatus, and Ixodes ricinus species, which were collected from several barns, cattle, and people. Genomic DNA was also extracted from pools consisting of 6203 adult female mosquito species belonging to Aedes vexans, Culex (Cx.) pipiens, Cx. hortensis, Cx. theileri, Culiseta annulata, and Anopheles maculipennis species. Conventional PCR and TaqMan probe-based real- time PCR targeting the 16S rRNA gene for FLEs and the lpnA gene for F. tularensis, respectively, were performed on the DNA isolates obtained. FLEs and F. tularensis were not found in any genomic DNA pools constructed from ixodid ticks and mosquitos. This study represents the first investigation of F. tularensis and FLEs in potential vector ticks and mosquitoes by molecular methods in Turkey. The present study provides useful insights into the molecular epidemiology of F. tularensis and FLEs. One of the major conclusions of the study is that tularemia outbreaks may be essentially due to direct transmission from the environment (especially from water) in Turkey and not to vector-borne transmission.

  8. Myrmecophilous pygmephoroid mites (Acari: Pygmephoroidea) associated with Lasius flavus (Hymenoptera: Formicidae) in Russia.

    Science.gov (United States)

    Khaustov, Alexander A

    2015-11-19

    Twenty four species of pygmephoroid mites (Acari: Pygmephoroidea: Neopygmephoridae, Scutacaridae, Microdispidae) are recorded from the ant Lasius flavus (Fabricius) or from its nests from Western Siberia and Crimea. Four of them of the genus Scutacarus Gros, 1845 (Acari: Scutacaridae), S. insolitus sp. nov., S. heterotrichus sp. nov., S. moseri sp. nov. and S. sibiriensis sp. nov. are described as new for science. Four species of scutacarid mites are recorded for the first time in Russia. The comparison of pygmephoroid mite communities associated with Lasius flavus from Crimean and West Siberian populations and notes on phoresy of pygmephoroid mites on ants are provided.

  9. Phytocystatins: Defense Proteins against Phytophagous Insects and Acari

    Science.gov (United States)

    Martinez, Manuel; Santamaria, Maria Estrella; Diaz-Mendoza, Mercedes; Arnaiz, Ana; Carrillo, Laura; Ortego, Felix; Diaz, Isabel

    2016-01-01

    This review deals with phytocystatins, focussing on their potential role as defence proteins against phytophagous arthropods. Information about the evolutionary, molecular and biochemical features and inhibitory properties of phytocystatins are presented. Cystatin ability to inhibit heterologous cysteine protease activities is commented on as well as some approaches of tailoring cystatin specificity to enhance their defence function towards pests. A general landscape on the digestive proteases of phytophagous insects and acari and the remarkable plasticity of their digestive physiology after feeding on cystatins are highlighted. Biotechnological approaches to produce recombinant cystatins to be added to artificial diets or to be sprayed as insecticide–acaricide compounds and the of use cystatins as transgenes are discussed. Multiple examples and applications are included to end with some conclusions and future perspectives. PMID:27775606

  10. Phytocystatins: Defense Proteins against Phytophagous Insects and Acari

    Directory of Open Access Journals (Sweden)

    Manuel Martinez

    2016-10-01

    Full Text Available This review deals with phytocystatins, focussing on their potential role as defence proteins against phytophagous arthropods. Information about the evolutionary, molecular and biochemical features and inhibitory properties of phytocystatins are presented. Cystatin ability to inhibit heterologous cysteine protease activities is commented on as well as some approaches of tailoring cystatin specificity to enhance their defence function towards pests. A general landscape on the digestive proteases of phytophagous insects and acari and the remarkable plasticity of their digestive physiology after feeding on cystatins are highlighted. Biotechnological approaches to produce recombinant cystatins to be added to artificial diets or to be sprayed as insecticide–acaricide compounds and the of use cystatins as transgenes are discussed. Multiple examples and applications are included to end with some conclusions and future perspectives.

  11. Phytocystatins: Defense Proteins against Phytophagous Insects and Acari.

    Science.gov (United States)

    Martinez, Manuel; Santamaria, Maria Estrella; Diaz-Mendoza, Mercedes; Arnaiz, Ana; Carrillo, Laura; Ortego, Felix; Diaz, Isabel

    2016-10-20

    This review deals with phytocystatins, focussing on their potential role as defence proteins against phytophagous arthropods. Information about the evolutionary, molecular and biochemical features and inhibitory properties of phytocystatins are presented. Cystatin ability to inhibit heterologous cysteine protease activities is commented on as well as some approaches of tailoring cystatin specificity to enhance their defence function towards pests. A general landscape on the digestive proteases of phytophagous insects and acari and the remarkable plasticity of their digestive physiology after feeding on cystatins are highlighted. Biotechnological approaches to produce recombinant cystatins to be added to artificial diets or to be sprayed as insecticide-acaricide compounds and the of use cystatins as transgenes are discussed. Multiple examples and applications are included to end with some conclusions and future perspectives.

  12. Second contribution to the knowledge of water mites from the Comoros, with the description of one new species (Acari: Hydrachnidia)

    NARCIS (Netherlands)

    Smit, H.; Pesic, V.; Mary-Sasal, N.

    2010-01-01

    New records of water mites (Acari: Hydrachnidia) from the Comoros are presented. One species new to science, Africasia comorosensis is described; first records are given for Torrenticola sp. and Atractides thoracatus Koenike, 1898.

  13. Screening for bacterial DNA in the hard tick Hyalomma marginatum (Ixodidae from Socotra Island (Yemen: detection of Francisella-like endosymbiont

    Directory of Open Access Journals (Sweden)

    M. Montagna

    2012-12-01

    Full Text Available Thirty-four adult ticks collected from livestock on Socotra Island (Yemen were identified as Hyalomma marginatum using traditional morphological characteristics. Morphological identification was confirmed for all the collected specimens using a molecular approach targeting a fragment of the mitochondrial gene 12S rRNA. All the specimens were examined for the presence of tick-borne pathogens and the tick endosymbiont Candidatus Midichloria mitochondrii using polymerase chain reaction. Three specimens out of the 34 analyzed tested positive to the presence of Francisella spp. leading to the first detection of these bacteria in H. marginatum on Socotra Island. The phylogenetic analyses conducted on a 660 bp fragment of the ribosomal gene 16S rRNA of Francisella spp. (including F. philomiragia as outgroup, the four subspecies of F. tularensis and the Francisella-like endosymbiont of ticks confirm that the newly detected Francisella strains cluster into the Francisella-like endosymbionts of ticks. Interestingly, the detected Francisella-like endosymbiont, shows a different genotype to that previously isolated from H. marginatum collected in Bulgaria. No specimen was positive for the presence of Rickettsia spp., Coxiella burnetii, Borrelia burgdorferi or M. mitochondrii.

  14. [Comparison of the ability to fertilize females by Hyalomma anatolicum anatolicum males irradiated with gamma radiation from caesium 137 with non-irradiated males].

    Science.gov (United States)

    Karaer, Zafer; Kar, Sirri; Düzgün, Ali; Güven, Esin; Cakmak, Ayşe; Emre, Zişan; Nalbantoğlu, Serpil; Saribaş, Taner; Akçay, Aytaç

    2009-01-01

    In this study, Hyalomma anatolicum anatolicum male ticks were subjected to gamma radiation with a dose of 10 Gy emitted by a gamma-ray source of Caesium 137. Female ticks were divided into 3 groups and placed in rabbit ears to feed. In the first group, the females fed with normal and irradiated males, in the second group females fed only with irradiated males and in last group females fed with normal males. Biological parameters such as the feeding period, weights, period of time from dropping until egg-laying began, the number of eggs and the number of larva hatching from eggs were recorded. With the results of statistical analysis it was found that the average egg laying period of females in the second group was clearly less (22.77 days) than other groups and the difference between these groups was statistically important (P < 0.05). After evaluation of numbers of larva, also there was a statistically important difference between the groups and the average number of larva was clearly higher (2519.30) in third group than other groups. In conclusion, in this study it was found that irradiated males could not compete with normal males in mating with females and because of this they couldn't affect the feeding and reproductivity of females.

  15. In vitro investigation of the toxic effects of extracts of Allium sativum bulbs on adults of Hyalomma marginatum rufipes and Rhipicephalus pulchellus

    Directory of Open Access Journals (Sweden)

    F. Nchu

    2005-06-01

    Full Text Available The toxic effects of the extracts of Allium sativum (Garlic were evaluated against adults of Hyalomma marginatum rufipes and Rhipicephalus pulchellus using three types (Types A, B and C of contact toxicity bioassays. A. sativum bulbs were extracted with acetone, ethanol and dichloromethane (DCM solvents. Among these three solvents, it is the DCM extract of A. sativum that appears to have anti-tick activity. In the Type A contact toxicity bioassay, DCM extracts of A. sativum demonstrated a high acaricidal bioactivity against H. m. rufipes with 100 % of ticks killed in less than an hour, and toxicity persisted to the second day. A weak acaricidal activity of aqueous extracts of A. sativum was observed in the Type B contact toxicity bioassay. In the Type C contact toxicity bioassay, a concentration of 24 % w/v of DCM extracts of garlic in sunflower oil (Helianthus annuus had killed 100% of H. m. rufipes (LC50= 5.9 % w/v and R. pulchellus (LC50 = 10.3 % w/v by 24 hours post-treatment of ticks. The results obtained from this study suggest that DCM extract of A. sativum is a potential source of novel acaricidal agents.

  16. Preparing soft-bodied arthropods for arthropods for microscope examination: Mites (Arachnida: Acari)

    Science.gov (United States)

    Proper identification of mites (Arachnida: Acari) require preparation of the specimen on a microscope slide. This training video provides visual instruction on how to prepare mite specimens on microscope slides for examination and identification. Steps ranging from collection, specimen clearing, use...

  17. Sexual selection and mating behavior in spider mites of the genus Tetranychus (Acari: Tetranychidae)

    NARCIS (Netherlands)

    Oku, K.

    2014-01-01

    As sexual selection is a coevolutionary process between males and females, various morphological and behavioral traits have evolved in each sex. In the tetranychid mites Tetranychus urticae Koch and T. kanzawai Kishida (Acari: Tetranychidae), males can mate repeatedly, whereas females normally

  18. Investigations of Gamasina mites in natural and man-affected soils in Latvia (Acari: Mesostigmata)

    NARCIS (Netherlands)

    Salmane, I.

    2003-01-01

    Investigations of Gamasina mites in natural and man-affected soils in Latvia (Acari: Mesostigmata) A short overview is presented on Gamasina material collected in 22 natural and man-disturbed habitats in Latvia. Species diversity, average density and species dominance were investigated. Altogether 1

  19. Role of excreta in predator avoidance by the Kanzawa spider mite, Tetranychus kanzawai (Acari: Tetranychidae)

    NARCIS (Netherlands)

    Oku, K.

    2008-01-01

    The Kanzawa spider mite, Tetranychus kanzawai (Acari: Tetranychidae) constructs webs over leaf surfaces and usually lives under these webs. T. kanzawai produces two types of excreta, black and yellow pellets, and uses its webs as a place for excretion. T. kanzawai also uses its webs as a refuge when

  20. Evaluation of four bed bug traps for surveillances of brown dog ticks (Acari: Ixodidae)

    Science.gov (United States)

    The brown dog tick can be a serious residential pest due to its unique ability, among ticks, to complete its lifecycle indoors. A single engorged and fertilized female tick can oviposit around 4,000 eggs, allowing indoor establishment to be rapid and easy to miss in early-stage infestations. Acari...

  1. Recovery of some of the missing wrappers of Berlese's Acari, Myriopoda et Scorpiones

    NARCIS (Netherlands)

    Hammen, van der L.

    1986-01-01

    Reproductions are given of the original wrappers of A. Berlese's Acari, Myriopoda et Scorpiones, fasc. II, IV, VI, VII and XIV. These wrappers (on some of which the first descriptions of new species are published) could not be included in the 1979 reprint edition of the work, as no extant copies of

  2. De corticole fauna van platanen: i. Arachniden (Arachnida: Araneae, Pseudoscorpiones, Acari)

    NARCIS (Netherlands)

    Noordijk, J.; Berg, M.P.

    2001-01-01

    The corticolous fauna of plane trees: I. Arachnids (Arachnida: Araneae, Pseudoscorpiones, Acari) From February until September 2000 an inventory was made of the bark-dwelling arthropod fauna of more than 400 plane trees (Platanus hybrida), all over the Netherlands. Arthropods were collected from bar

  3. Water mite species of the genus Hydrodroma Koch (Acari: Hydrachnidia, Hydrodromidae) from Australia. Part II.

    NARCIS (Netherlands)

    Pesic, V.; Smit, H.

    2007-01-01

    Abstract: Two new water mite species of the genus Hydrodroma Koch (Acari: Hydrachnidia, Hydrodromidae), characterized by single or absence of swimming setae on II-L-5, are reported from Australia: Hydrodroma wilesi sp. nov. and H. cooki sp. nov. New information is provided for H. tonapii Cook from I

  4. Sexual selection and mating behavior in spider mites of the genus Tetranychus (Acari: Tetranychidae)

    NARCIS (Netherlands)

    Oku, K.

    2014-01-01

    As sexual selection is a coevolutionary process between males and females, various morphological and behavioral traits have evolved in each sex. In the tetranychid mites Tetranychus urticae Koch and T. kanzawai Kishida (Acari: Tetranychidae), males can mate repeatedly, whereas females normally accep

  5. A new species of the genus Acarothrix (Acari: Halacaridae) from Brunei Darussalam and India

    Digital Repository Service at National Institute of Oceanography (India)

    Chatterjee, T.; Marshall, D.J.; Guru, B.C.; Ingole B.S.; Pesic V.

    ) in mangroves of Singapore. I. Description of three species. The Raffles Bulletin of Zoology, 54: 83-92. Proches S. 2002. New species of Copidognathinae (Acari: Halacaridae) from southern Africa. Journal of Natural History, 36: 999-1007. 6    Figure 1...

  6. Effects of radiation (Cobalt-60) on the elimination of Brevipalpus phoenicis (Acari: Tenuipalpidae) Cardinum endosymbiont

    Science.gov (United States)

    Brevipalpus phoenicis (Geijskes) (Acari: Tenuipalpidae) is a polyphagous mite with worldwide distribution and it is also a vector of several plant viruses. In citrus, B. phoenicis transmits Citrus leprosis virus (CiLV), the causal agent of leprosis, a disease that costs millions of dollars/year for ...

  7. In vitro assessment of the acaricidal activity of Piper longum, Piper nigrum, and Zingiber officinale extracts against Hyalomma anatolicum ticks.

    Science.gov (United States)

    Singh, Nirbhay K; Saini, S P S; Singh, Harkirat; Jyoti; Sharma, S K; Rath, S S

    2017-03-01

    Ticks and tick-borne diseases are a major constraint for the sustainable cattle industry in the tropical and subtropical regions including the Indian subcontinent. The development of resistance to most of the commonly used acaricides leads to an attempt to screen plant extracts and their combinations for their possible acaricidal activity to develop an eco-friendly tick control alternative. An alcoholic and various aqueous extracts of Piper longum, Piper nigrum and Zingiber officinale and their combinations were evaluated for acaricidal activity against the three-host ixodid tick, Hyalomma anatolicum by larval immersion test using 14-21 days old unfed larvae. The efficacy was assessed by measuring larval mortality (%) and the lethal concentrations for 50% (LC50) and 95% (LC95) with their 95% confidence limits (CL) values were estimated by applying regression equation analysis to the probit transformed data of mortality. A concentration-dependent mortality response was recorded in all extracts prepared from seeds of P. longum and P. nigrum and their combinations. The highest acaricidal property was exhibited by the alcoholic extract of P. longum seeds with the minimum LC50 and LC95 (95% CL) values of 0.071% (0.07-0.072) and 0.135% (0.13-0.14), respectively, followed by alcoholic combinations. Interestingly, no acaricidal activity was recorded in extracts prepared from the rhizome of Z. officinale. The results indicated that the ethanolic extracts of P. longum and P. nigrum and their combinations can be used effectively for tick control in an integrated format.

  8. New quill mites of the family Syringophilidae (Acari: Cheyletoidea).

    Science.gov (United States)

    Bochkov, A V; Fain, A; Skoracki, M

    2004-02-01

    Five new species and two new genera belonging to the family Syringophilidae (Acari: Cheyletoidea) are described from birds that died in the Antwerp Zoo during their quarantine: Charadriaulobia vanelli n. g., n. sp. from Vanellus chilensis (Charadriiformes: Charadriidae) in Brazil; Fritschisyringophilus lonchurae n. g., n. sp. from Lonchura punctulata (Passeriformes: Estrildidae) in India; Mironovia coturnae n. sp. from Coturnix coturnix (Galliformes: Phasianidae) in Europe; Syringophiloidus daberti n. sp. from Passerina ciris (Passeriformes: Emberizidae) in Mexico; and S. serini n. sp. from Serinus mozambicus (Passeriformes: Fringillidae) in Central Africa. Charadriaulobia n. g. differs from the closely related Aulobia Kethley, 1970, in both sexes, by the divergent epimeres I; in females, by the absence of protuberances on the hypostomal apex and by the situation of the bases of setae l4 distinctly anterior the bases of setae d4. Fritschisyringophilus n. g. differs from the closely related Syringophiloidus Kethley, 1972, in both sexes, by the presence of setae vs ' on legs II, the absence of setae dT on legs III and IV; in females, by the presence of median hypostomal protuberances and by short setae l1, l2 and l3. The relationships between the Syringophilidae and their hosts are briefly discussed. A list of all known syringophilid genera and their distribution on bird families is provided.

  9. New Wolbachia supergroups detected in quill mites (Acari: Syringophilidae).

    Science.gov (United States)

    Glowska, Eliza; Dragun-Damian, Anna; Dabert, Miroslawa; Gerth, Michael

    2015-03-01

    Wolbachia is the most abundant intracellular bacterial genus infecting a wide range of arthropods and filarial nematodes. Wolbachia have evolved parasitic, mutualistic and commensal relationships with their hosts but in arthropods generally act as reproductive parasites, inducing a wide range of phenotypic effects such as cytoplasmic incompatibility, parthenogenesis, feminization and male-killing. Up to now, the genus has been divided into 14 supergroups successively named A-O. Here, we describe two new Wolbachia supergroups from syringophilid mites (Acari: Cheyletoidea). These obligatory ectoparasites of birds inhabit the quills of feathers in many avian groups. The species of this family reproduce in a haplodiploid mode sensu arrhenotoky and are usually strongly female-biased. Based on the sequences of four protein-coding genes (ftsZ, gltA and groEL and coxA) and the 16S rRNA we identified strains of three Wolbachia supergroups (F and two distinct, yet undescribed ones) in five quill mite species. Our results suggest that in some cases the distribution of the bacteria can be better correlated with the mite's bird host rather than with mite taxonomy as such. The discovery of two new Wolbachia supergroups not only broadens the knowledge of the diversity of this bacterium but also raises questions about potential effects induced in quill mites and transmission mechanisms of the endosymbionts in this peculiar bacteria-quill mite-bird system.

  10. Rhipicephalus sanguineus (ACARI: IXODIDAE) BITING A HUMAN BEING IN PORTOALEGRE CITY, RIO GRANDE DO SUL, BRAZIL

    Science.gov (United States)

    MENTZ, Márcia Bohrer; TROMBKA, Marcelo; da SILVA, Guilherme Liberato; SILVA, Carlos Eugênio

    2016-01-01

    We report the finding of a female brown dog tick, Rhipicephalus sanguineus (Acari: Ixodidae) on the scalp of a male patient in Porto Alegre, Rio Grande do Sul, Brazil. Human parasitism by this tick is rare and has seldomly been reported in the literature, despite its recognized importance since it can act as a vector of Rickettsia rickettsii, the agent of spotted fever. PMID:27074329

  11. A large parasitengonid mite (Acari, Erythraeoidea from the Early Cretaceous Crato Formation of Brazil

    Directory of Open Access Journals (Sweden)

    J. A. Dunlop

    2007-08-01

    Full Text Available A new large, fossil mite (Arachnida: Acari, Pararainbowia martilli n. gen. n. sp., is described from the Early Cretaceous (Aptian Crato Formation from Ceará State, Brazil. It is assigned to the Cohort Parasitengona and the superfamily Erythraeoidea, some extant members of which can reach up to seven millimetres in body length. Given that doubts have been raised about the identity of putative Crato feather mite eggs, this new fossil represents the first unequivocal record of Acari from the Crato Formation, the first non-amber record of an erythraeoid mite and the oldest named example of this superfamily. Fossil erythraeoids from Mesozoic and Tertiary ambers are briefly reviewed – including a widely overlooked Late Cretaceous species – with comments on Mesozoic mites in general. Thirteen Baltic amber erythraeoids have been formally described, but much unstudied material from various amber sources remains. Ein neues großes Milbenfossil (Arachnida: Acari, Pararainbowia martilli n. gen. n. sp., wird aus der Crato Formation (Unterkreide, Aptium des Ceará Gebietes in Brasilien beschrieben. Es wird der Kohorte Parasitengona und der Überfamilie Erythraeoidea zugeordnet; die modernen Vertreter erreichen eine Körperlänge bis zu sieben mm. Weil die Identität von Federmilbeneiern aus der Crato Formation in Frage gestellt wurde, ist dieser Neufund der erste klare Hinweis von Acari aus der Crato Formation. Es ist die erste erythraeoide Milbe, die nicht aus dem Bernstein stammt sowie das älteste genannte Beispiel dieser Überfamilie. Fossile erythraeoide Milben aus dem Bernstein des Mesozoikum und des Tertiärs werden kurz zusammengefasst – u. a. eine weitgehend übersehene Art aus der Oberkreide – mit allgemeinen Anmerkungen zu den mesozoischen Milben. Dreizehn erythraeoide Milbenarten sind aus dem baltischen Bernstein genannt und beschrieben worden, aber weiteres unbearbeitetes Material von verschiedenen Bernstein-Fundpunkten liegt noch vor

  12. De corticole fauna van platanen: i. Arachniden (Arachnida: Araneae, Pseudoscorpiones, Acari)

    OpenAIRE

    Noordijk, J.; Berg, M.P.

    2001-01-01

    The corticolous fauna of plane trees: I. Arachnids (Arachnida: Araneae, Pseudoscorpiones, Acari) From February until September 2000 an inventory was made of the bark-dwelling arthropod fauna of more than 400 plane trees (Platanus hybrida), all over the Netherlands. Arthropods were collected from bark and under the ‘loose’ bark fragments at a height of 160-175 cm from the ground. Algae, mosses and fungi are important resources for the corticolous fauna. Crevices in the tree trunk and loose bar...

  13. Acaricide resistance in Tetranychus urticae (Acari: Tetranychidae) populations from Cyprus.

    Science.gov (United States)

    Vassiliou, Vassilis A; Kitsis, Pavlos

    2013-08-01

    Five field and greenhouse populations of the twospotted spider mite, Tetranychus urticae Koch (Acari: Tetranychidae), were collected from five different districts across the island of Cyprus, both in field and greenhouse crops, and tested to determine levels of resistance. Standard leaf-disk spray application bioassay procedures were used to determine the LC50s for five chemicals: abamectin, acrinathrin, fenazaquin, pirimiphos methyl, and bifenazate. Selection of these compounds was based on the widespread use by farmers as well as on the frequent control failures against T. urticae reported in the past. Resistance of T. urticae was detected to abamectin, acrinathrin, fenazaquin, and pirimiphos methyl. The resistance ratios were calculated relative to the German susceptible reference strain. The highest resistance ratios at LC50 value were recorded for abamectin in a greenhouse rose population (RR = 3822), followed by a field bean (RR = 1356) and field tomato population (RR = 1320). Significantly high resistance levels were also found for acrinathrin where the highest resistance ratios at LC50 were recorded in a field bean T. urticae population (RR = 903). For fenazaquin, the highest resistance levels were recorded in a field tomato population (RR = 310). Lower resistance levels were found for pirimiphos methyl (13.3 < RR < 77.4) in all populations. Low susceptibility of T. urticae was observed for bifenazate (2.7 < RR < 24.4) in all populations. These results suggest that at least the use of abamectin and acrinathrin should be avoided or minimized for the control of T. urticae populations in indoor and outdoor environments.

  14. A new species of Atractides Koch, 1837 (Acari: Hydrachnidia, Hygrobatidae from Ethiopia, with a discussion on the biodiversity of the genus Atractides in the Afrotropical region

    Directory of Open Access Journals (Sweden)

    Vladimir Pesic

    2011-03-01

    Full Text Available A new species of Atractides Koch, 1837 (Acari, Hydrachnidia is described from Ethiopia. The world number of Atractides now tallies 297 species. The diversity of the genus Atractides in the Afrotropical region is briefly discussed.

  15. The complete sequence of a West Nile virus lineage 2 strain detected in a Hyalomma marginatum marginatum tick collected from a song thrush (Turdus philomelos) in eastern Romania in 2013 revealed closest genetic relationship to strain Volgograd 2007.

    Science.gov (United States)

    Kolodziejek, Jolanta; Marinov, Mihai; Kiss, Botond J; Alexe, Vasile; Nowotny, Norbert

    2014-01-01

    In this study the first complete sequence of the West Nile virus (WNV) lineage 2 strain currently circulating in Romania was determined. The virus was detected in a Hyalomma marginatum marginatum tick collected from a juvenile song thrush (Turdus philomelos) in the Romanian Danube Delta close to the city of Tulcea, end of August 2013. Our finding emphasizes the role of ticks in introduction and maintenance of WNV infections. Sequence analyses revealed close genetic relationship of the Romanian WNV strain to strain Reb_Volgograd_07_H, which was isolated from human brain tissue during an outbreak of West Nile neuroinvasive disease (WNND) in Russia in 2007. In 2010 the Eastern European lineage 2 WNV caused an outbreak of human WNND in Romania. Partial sequences from subsequent years demonstrated that this WNV strain became endemic in Eastern Europe and has been causing outbreaks of varying sizes in southern Russia since 2007 and in Romania since 2010.

  16. Ticks (Acari: Ixodida) parasitizing humans in Corum and Yozgat provinces, Turkey.

    Science.gov (United States)

    Keskin, Adem; Keskin, Aysun; Bursali, Ahmet; Tekin, Saban

    2015-12-01

    In order to identify ticks infesting humans in Corum and Yozgat provinces in Turkey, a total of 2110 ticks representing 14 species were collected on humans, between June and September 2009. Of those, 1551 (687♂, 450♀, 407 nymphs, 7 larvae) were collected from Corum and 559 (330♂, 180♀, 49 nymphs) were collected from Yozgat. The majority of ticks (n = 1121, 53.1 %) was Hyalomma marginatum. Other common ticks infesting humans were Dermacentor marginatus (n = 209, 9.9 %) and Rhipicephalus turanicus sensu lato (n = 145, 6.9 %) in the study area. In addition, a total of 386 immature Hyalomma were found on humans in Corum (335 nymphs, 7 larvae) and Yozgat (44 nymphs). Ixodes laguri and Haemaphysalis erinacei taurica were recorded for the first time in Corum. To the best of our knowledge, this study is the first detailed investigation on ticks infesting humans in Corum and Yozgat, except individual or incidental records. The present study provides useful information for those concerned with ticks and tick-borne diseases in Turkey.

  17. Ticks (Acari: Ixodida) on wild carnivores in Brazil.

    Science.gov (United States)

    Labruna, Marcelo B; Jorge, Rodrigo S P; Sana, Dênis A; Jácomo, Anah Tereza A; Kashivakura, Cyntia K; Furtado, Mariana M; Ferro, Claudia; Perez, Samuel A; Silveira, Leandro; Santos, Tarcísio S; Marques, Samuel R; Morato, Ronaldo G; Nava, Alessandra; Adania, Cristina H; Teixeira, Rodrigo H F; Gomes, Albério A B; Conforti, Valéria A; Azevedo, Fernando C C; Prada, Cristiana S; Silva, Jean C R; Batista, Adriana F; Marvulo, Maria Fernanda V; Morato, Rose L G; Alho, Cleber J R; Pinter, Adriano; Ferreira, Patrícia M; Ferreira, Fernado; Barros-Battesti, Darci M

    2005-01-01

    The present study reports field data of ticks infesting wild carnivores captured from July 1998 to September 2004 in Brazil. Additional data were obtained from one tick collection and from previous published data of ticks on carnivores in Brazil. During field work, a total of 3437 ticks were collected from 89 Cerdocyon thous (crab-eating fox), 58 Chrysocyon brachyurus (maned wolf), 30 Puma concolor (puma), 26 Panthera onca (jaguar), 12 Procyon cancrivorus (crab-eating raccoon), 4 Speothos venaticus (bush dog), 6 Pseudalopex vetulus (hoary fox), 6 Nasua nasua (coati), 6 Leopardus pardalis (ocelot), 2 Leopardus tigrinus (oncilla), 1 Leopardus wiedii (margay), 1 Herpailurus yagouaroundi (jaguarundi), 1 Oncifelis colocolo (pampas cat), 1 Eira barbara (tayara), 1 Galictis vittata (grison), 1 Lontra longicaudis (neotropical otter), and 1 Potus flavus (kinkajou). Data obtained from the Acari Collection IBSP included a total of 381 tick specimens collected on 13 C. thous, 8 C. brachyurus, 3 P. concolor, 10 P. onca, 3 P. cancrivorus, 4 N. nasua, 1 L. pardalis, 1 L. wiedii, 4 H. yagouaroundi, 1 Galictis cuja (lesser grison), and 1 L. longicaudis. The only tick-infested carnivore species previously reported in Brazil, for which we do not present any field data are Pseudalopex gymnocercus (pampas fox), Conepatus chinga (Molina's hog-nosed skunk), and Conepatus semistriatus (striped hog-nosed skunk). We report the first tick records in Brazil on two Felidae species (O. colocolo, H. yagouaroundi), two Canidae species (P. vetulus, S. venaticus), one Procyonidae species (P. flavus) and one Mustelidae (E. barbara). Tick infestation remains unreported for 5 of the 26 Carnivora species native in Brazil: Oncifelis geoffroyi (Geoffroy's cat), Atelocynus microtis (short-eared dog), Pteronura brasiliensis (giant otter), Mustela africana (Amazon weasel), and Bassaricyon gabbii (olingo). Our field data comprise 16 tick species represented by the genera Amblyomma (12 species), Ixodes (1

  18. Effect of coconut palm proximities and Musa spp. germplasm resistance to colonization by Raoiella indica (Acari: Tenuipalpidae)

    Science.gov (United States)

    Although coconut (Cocos nucifera L.) is the predominant host for Raoiella indica Hirst (Acari: Tenuipalpidae), false spider mite infestations do occur on bananas and plantains (Musa spp. Colla). Since its introduction, the banana and plantain industries have been negatively impacted to different deg...

  19. The first record of the watermite Arrenurus beolinensis from the Netherlands, with the first description of the female (Acari: Hydrachnidia).

    NARCIS (Netherlands)

    Smit, H.; Didderen, K.; Wiggers, R.

    2007-01-01

    De watermijt Arrenurus berolinensis in Nederland, met de eerste beschrijving van het vrouwtje (Acari: Hydrachnidia) De zeer zeldzame watermijt Arrenurus berolinensis is in 2006 voor het eerst in Nederland gevonden, in een petgat in de Wieden (Overijssel). Tot nu toe was deze soort slechts twee keer

  20. Novel bacterial pathogen Acaricomes phytoseiuli causes severe disease symptoms and histopathological changes in the predatory mite Phytoseiulus persimilis (Acari, Phytoseiidae)

    NARCIS (Netherlands)

    Schütte, C.; Gols, R.; Kleespies, R.G.; Poitevin, O.J.L.; Dicke, M.

    2008-01-01

    Adult female Phytoseiulus persimilis Athias-Henriot (Acari, Phytoseiidae) of a laboratory population show a set of characteristic symptoms, designated as non-responding (NR) syndrome. Mature predators shrink, cease oviposition and die. They show a lower degree of attraction to herbivore-induced

  1. The presence of webbing affects the oviposition rate of two-spotted spider mites, Tetranychus urticae (Acari: Tetranychidae)

    NARCIS (Netherlands)

    Oku, K.; Magalhães, S.; Dicke, M.

    2009-01-01

    Several species of tetranychid mites including Tetranychus urticae Koch (Acari: Tetranychidae) construct complicated three-dimensional webs on plant leaves. These webs provide protection against biotic and abiotic stress. As producing web is likely to entail a cost, mites that arrive on a leaf with

  2. New Australian hygrobatids (Acari: Hydrachnidia: Hygrobatidae), with the description of two new genera and three new species

    NARCIS (Netherlands)

    Smit, H.

    2009-01-01

    Two new genera of the water mite family Hygrobatidae (Acari: Hydrachnidia) are described from Australia, Ioannibates gen. nov. and Pseudoaustraliobates gen. nov.. In addition, three new species are described, Ioannibates papillosus sp. nov., Pseudoaustraliobates flindersi sp. nov. and the second spe

  3. A rare finding of mites (Arachnida: Acari: Leeuwenhoekiidae) parasitising a whip spider (Arachnida: Amblypygi: Charinidae).

    Science.gov (United States)

    Gonçalves-Souza, Thiago; Giupponi, Alessandro P L; Hernandes, Fabio A

    2014-04-01

    Twelve larvae of unidentified species of Odontacarus Ewing, 1929 (Acari: Leeuwenhoekiidae) were found parasitising an adult male whip spider Charinus brasilianus Weygoldt (Charinidae) in Santa Teresa, mountainous region of Espirito Santo state, southeastern Brazil. These larvae occurred in the intersegmental membrane of prosoma and legs. This is the first report of ectoparasitic mites infecting a charinid whip spider and the first record of leeuwenhoekiid mites parasitising an invertebrate host. We suggest that future studies are essential to understand the reasons why these events of parasitism are so rare in the order Amblypygi.

  4. New and little known species of Halolaelaps (Acari: Mesostigmata: Halolaelapidae) from Ukraine.

    Science.gov (United States)

    Trach, Viacheslav A

    2016-08-23

    A new species of the family Halolaelapidae (Acari: Mesostigmata), Halolaelaps euxinus sp. nov. is described from Black Sea coast. Adult mites were found in seaweed, while deutonymphs were collected from the amphipod Talorchestia deshayesii and from seaweed. The adult female of Halolaelaps saproincisus Hirschmann & Götz, 1968 is recorded in new localities of Ukraine for the first time, in soil and bird faeces in chicken coops, and new morphological information is provided. The adult male (collected from chicken coops) and the deutonymph (collected from chicken coops and on dung-beetles) of H. saproincisus are described for the first time.

  5. Mites (Acari Associated with the Desert Seed Harvester Ant, Messor pergandei (Mayr

    Directory of Open Access Journals (Sweden)

    Kaitlin A. Uppstrom

    2011-01-01

    Full Text Available Mites (Acari associated with the seed harvester ant Messor pergandei were investigated in the Sonoran desert of Arizona. At least seven representatives of the mite genera Armacarus, Lemanniella, Petalomium, Forcellinia, Histiostoma, Unguidispus, and Cosmoglyphus are phoretically associated with M. pergandei. Most of these morphospecies show preference for specific phoretic attachment sites and primarily use female alates rather than male alates for dispersal. Five mite morphospecies were found in low numbers inhabiting the chaff piles: Tydeidae sp., Procaeculus sp., Anystidae sp., Bakerdania sp., and Tetranychidae sp. The phoretic Petalomium sp. was observed consuming fungus growing on a dead queen, but the roles of the other mite species remain mostly unresolved.

  6. Description of Lyrifissella gen. n. and Lyrifissellidae fam. n. (Acari, Oribatei

    Directory of Open Access Journals (Sweden)

    Adilson D. Paschoal

    1989-01-01

    Full Text Available Lyrifissella new genus and Lyrifissellidae new family (Acari, Oribatei are described. The type species, Pedrocortesella latoclava Hammer, 1966, from Milford, New Zealand, is fully redescribed from the holotype. The congeneric species, Pedrocortesella cryptonota Hammer, 1966, Lake Ratoitis, New Zealand, is compared with the type species and transferred to the new genus. Plateremaeus vestitus Tragardh, 1931, the species thought to be very close to Plateremaeus ornatissimus (Berlese, and which was erroneously used to characterize Plateremaeus and Plateremaeidae, causing them to be misunderstood for about five decades, is now placed in Lyrifissella.

  7. Phytoseiid mites of the Canary Islands (Acari, Phytoseiidae. II. Tenerife and La Gomera Islands

    Directory of Open Access Journals (Sweden)

    Ferragut, F.

    2007-12-01

    Full Text Available Phytoseiid mites (Acari, Phytoseiidae inhabiting plants in natural ecosystems from Tenerife and La Gomera islands (Canary Islands have been studied. Surveys were conducted from 1997 to 2002. Eleven species were collected, one of them being reported for the first time from the Canary Islands and six of them reported for the first time from Tenerife and La Gomera islands. Euseius machadoi n. sp. collected from woody plants in the Canarian laurisilva is proposed as a new species.

    En muestreos realizados desde 1997 hasta 2002 se ha estudiado la fauna de ácaros fitoseidos (Acari, Phytoseiidae asociada a plantas de ecosistemas naturales de las islas de Tenerife y La Gomera (Islas Canarias. Se han recolectado un total de 11 especies, siendo una de ellas citada por vez primera en las islas Canarias y seis de ellas citadas por primera vez en las islas de Tenerife y La Gomera. Euseius machadoi n. sp., recolectado en plantas leñosas de la laurisilva canaria, se propone como una nueva especie.

  8. Repellent efficacy of DEET, Icaridin, and EBAAP against Ixodes ricinus and Ixodes scapularis nymphs (Acari, Ixodidae).

    Science.gov (United States)

    Büchel, Kerstin; Bendin, Juliane; Gharbi, Amina; Rahlenbeck, Sibylle; Dautel, Hans

    2015-06-01

    Repellent efficacy of 10% EBAAP (3-[N-butyl-N-acetyl]-aminopropionic acid, ethyl ester) and 10% Icaridin ((2-(2-hydroxyethyl)-1-piperidinecarboxylic acid 1-methylpropyl ester)) were evaluated against 20% DEET (N,N-diethyl-3-methylbenzamide) in human subject trials against ticks. Responses of host-seeking nymphs of the European castor bean tick (Ixodes ricinus L.; Acari: Ixodidae) and the North American blacklegged tick (I. scapularis Say; Acari: Ixodidae) were compared. Tests were carried out according to the US-EPA standard protocol with ethanolic solutions of the active ingredients of repellents being applied to the forearm of 10 volunteers. The upward movement of ticks was monitored until repellent failure taking up to 12.5 h. Application of 20% DEET resulted in median complete protection times (CPT; Kaplan-Meier median) between 4 and 4.5 h, while 10% EBAAP yielded CPTs of 3.5-4h. No significant differences were found between the efficacies of two repellents nor between the two species tested. The median of the CPT of a 10% Icaridin solution was 5h in nymphs of I. scapularis, but 8h in those of I. ricinus (Prepellent activity against nymphs of the two Ixodes ticks with Icaridin demonstrating particularly promising results against I. ricinus. Future research should investigate whether similar results occur when adult Ixodes ticks or other tick species are tested.

  9. Reproductive parameters of Phytoseiulus macropilis (Banks fed with Tetranychus urticae Koch (Acari: Phytoseiidae, Tetranychidae in laboratory

    Directory of Open Access Journals (Sweden)

    G. C. Souza-Pimentel

    Full Text Available Abstract Predatory mites that belong to the Phytoseiidae family are one of the main natural enemies of phytophagous mites, thus allowing for their use as a biological control. Phytoseiulus macropilis (Banks, 1904 (Acari: Phytoseiidae is among the main species of predatory mites used for this purpose. Tetranychus urticae Koch, 1836 (Acari: Tetranychidae is considered to be one of the most important species of mite pests and has been described as attacking over 1,100 species of plants in 140 families with economic value. The objective of the present study was to investigate, in the laboratory, the reproductive parameters of the predatory mite P. macropilis when fed T. urticae. Experiments were conducted under laboratory conditions at 25 ± 2 °C of temperature, 70 ± 10% RH and 14 hours of photophase. In addition, biological aspects were evaluated and a fertility life table was established. The results of these experiments demonstrated that the longevity of adult female was 27.5 days and adult male was 29.0 days. The population was estimated to increase approximately 27 times (Ro in mean generation time (T, which was 17.7 days. Lastly, the mite population grew 1.2 times/day (λ and doubled every 3.7 days (TD.

  10. Beklemishevia hispaniola n. sp., nuevo representante de la Cohorte Palaeosomata (Acari, Oribatei en España

    Directory of Open Access Journals (Sweden)

    Pérez-Iñigo, C.

    1996-12-01

    Full Text Available A new species of oribatid mite (Acari, Oribatei belonging to the family Ctenacaridae (Cohors Palaeosomata is described; this species was recorded several times in Spain as Beklemishevia galeodula Zachvatkin, 1945. The new species is easily distinguishable from the mentioned one because of the presence of three claws in every leg, a noticeable pigidial neotrichy and the absence of short, almost spiniform, setae on the pygidium.Se describe una nueva especie de oribátido (Acari, Oribatei perteneciente a la familia Ctenacaridae (Cohorte Palaeosomata que habia sido citada varias veces en España como Beklemishevia galeodula Zachvatkin, 1945, y de la que se diferencia por presentar tres uñas en todas las patas, una acentuada neotriquia pigidial y carecer de setas cortas espiniformes en el pigidio.

  11. Prolixus (Acari: Trombidiformes: Tenuipalpidae) newly recorded from New Zealand: A new species from Cyperaceae and its ontogenetic patterns in chaetotaxy.

    Science.gov (United States)

    Xu, Yun; Zhang, Zhi-Qiang

    2014-12-19

    The genus Prolixus (Acari: Tenuipalpidae) was represented by two species from Australian sedges prior to this study. A new species, Prolixus meyerae sp. nov., is here described and illustrated from leaves of Gahnia (Cyperaceae) in Auckland, New Zealand. In this paper, we present the ontogenetic additions in idiosomal and leg chaetotaxy from larva to adult. A key to world species of Prolixus is also proposed.

  12. A new genus and species of Schizogyniidae (Acari: Mesostigmata) associated with carabid beetles (Coleoptera: Carabidae) from Ukraine.

    Science.gov (United States)

    Trach, Viacheslav A; Seeman, Owen D

    2014-04-29

    A new genus and species of Schizogyniidae (Acari: Mesostigmata: Celaenopsoidea), Euroschizogynium calvum gen. nov. and sp. nov., associated with Scarites terricola Bonelli, 1813 (Coleoptera: Carabidae) is described from Ukraine, representing the first record of the family from the Palaearctic. Fusura civica Valle & Fox, 1966 is moved out of the Schizogyniidae and placed into the Megacelaenopsidae. A new diagnosis for the family Schizogyniidae and a key to genera are provided.

  13. Chlorotic spots on Clerodendrum, a disease caused by a nuclear type of Brevipalpus (Acari:Tenuipalpidae) transmitted virus

    OpenAIRE

    Kitajima, Elliot Watanabe; Kubo,Karen Sumire; Ferreira,Paulo de Tarso Oliveira; Alcântara,Berenice Kussumoto; Boari,Alessandra de Jesus; Gomes,Renata Takassugi; Freitas-Astua,Juliana; Rezende,Jorge Alberto Marques; Morais,Gilberto José de; Salaroli,Renato Barbosa

    2008-01-01

    Chlorotic spots have been observed in plants of Clerodendrum x speciosum growing in residential gardens and parks in Piracicaba, SP, Brazil. Thin sections of diseased tissues revealed characteristic cytopathic effects of the nuclear type of the Brevipalpus (Acari: Tenuipalpidae) mite-transmitted viruses (BTrV). Brevipalpus mites, identified as B. phoenicis, infesting symptomatic C. x speciosum plants transmitted the pathogen to healthy C. x speciosum and to C. thomsonae, Gomphrena globosa, Hi...

  14. SELETIVIDADE DE CHLORFENAPYR E FENBUTATIN-OXIDE SOBRE DUAS ESPÉCIES DE ÁCAROS PREDADORES (ACARI: PHYTOSEIIDAE) EM CITROS

    OpenAIRE

    REIS PAULO REBELLES; SOUSA ÉLBER OLIVEIRA

    2001-01-01

    Com o uso de bioensaios, verificaram-se os efeitos residual de contato, ovicida e de persistência dos produtos chlorfenapyr e fenbutatin-oxide sobre duas espécies de ácaros predadores, Iphiseiodes zuluagai Denmark & Muma e Euseius alatus DeLeon (Acari: Phytoseiidae), associados ao ácaro da leprose-dos-citros Brevipalpus phoenicis (Geijskes) (Acari: Tenuipalpidae). O efeito total sobre os adultos foi estudado por meio do método residual de contato com pulverização em superfície de vidro, confo...

  15. The complete mitochondrial genome of the citrus red mite Panonychus citri (Acari: Tetranychidae): high genome rearrangement and extremely truncated tRNAs.

    Science.gov (United States)

    Yuan, Ming-Long; Wei, Dan-Dan; Wang, Bao-Jun; Dou, Wei; Wang, Jin-Jun

    2010-10-23

    The family Tetranychidae (Chelicerata: Acari) includes ~1200 species, many of which are of agronomic importance. To date, mitochondrial genomes of only two Tetranychidae species have been sequenced, and it has been found that these two mitochondrial genomes are characterized by many unusual features in genome organization and structure such as gene order and nucleotide frequency. The scarcity of available sequence data has greatly impeded evolutionary studies in Acari (mites and ticks). Information on Tetranychidae mitochondrial genomes is quite important for phylogenetic evaluation and population genetics, as well as the molecular evolution of functional genes such as acaricide-resistance genes. In this study, we sequenced the complete mitochondrial genome of Panonychus citri (Family Tetranychidae), a worldwide citrus pest, and provide a comparison to other Acari. The mitochondrial genome of P. citri is a typical circular molecule of 13,077 bp, and contains the complete set of 37 genes that are usually found in metazoans. This is the smallest mitochondrial genome within all sequenced Acari and other Chelicerata, primarily due to the significant size reduction of protein coding genes (PCGs), a large rRNA gene, and the A + T-rich region. The mitochondrial gene order for P. citri is the same as those for P. ulmi and Tetranychus urticae, but distinctly different from other Acari by a series of gene translocations and/or inversions. The majority of the P. citri mitochondrial genome has a high A + T content (85.28%), which is also reflected by AT-rich codons being used more frequently, but exhibits a positive GC-skew (0.03). The Acari mitochondrial nad1 exhibits a faster amino acid substitution rate than other genes, and the variation of nucleotide substitution patterns of PCGs is significantly correlated with the G + C content. Most tRNA genes of P. citri are extremely truncated and atypical (44-65, 54.1 ± 4.1 bp), lacking either the T- or D-arm, as found in P. ulmi

  16. The complete mitochondrial genome of the citrus red mite Panonychus citri (Acari: Tetranychidae: high genome rearrangement and extremely truncated tRNAs

    Directory of Open Access Journals (Sweden)

    Dou Wei

    2010-10-01

    Full Text Available Abstract Background The family Tetranychidae (Chelicerata: Acari includes ~1200 species, many of which are of agronomic importance. To date, mitochondrial genomes of only two Tetranychidae species have been sequenced, and it has been found that these two mitochondrial genomes are characterized by many unusual features in genome organization and structure such as gene order and nucleotide frequency. The scarcity of available sequence data has greatly impeded evolutionary studies in Acari (mites and ticks. Information on Tetranychidae mitochondrial genomes is quite important for phylogenetic evaluation and population genetics, as well as the molecular evolution of functional genes such as acaricide-resistance genes. In this study, we sequenced the complete mitochondrial genome of Panonychus citri (Family Tetranychidae, a worldwide citrus pest, and provide a comparison to other Acari. Results The mitochondrial genome of P. citri is a typical circular molecule of 13,077 bp, and contains the complete set of 37 genes that are usually found in metazoans. This is the smallest mitochondrial genome within all sequenced Acari and other Chelicerata, primarily due to the significant size reduction of protein coding genes (PCGs, a large rRNA gene, and the A + T-rich region. The mitochondrial gene order for P. citri is the same as those for P. ulmi and Tetranychus urticae, but distinctly different from other Acari by a series of gene translocations and/or inversions. The majority of the P. citri mitochondrial genome has a high A + T content (85.28%, which is also reflected by AT-rich codons being used more frequently, but exhibits a positive GC-skew (0.03. The Acari mitochondrial nad1 exhibits a faster amino acid substitution rate than other genes, and the variation of nucleotide substitution patterns of PCGs is significantly correlated with the G + C content. Most tRNA genes of P. citri are extremely truncated and atypical (44-65, 54.1 ± 4.1 bp, lacking

  17. New records of water mites (Acari: Hydrachnidia and Halacaroidea from Bosnia and Herzegovina, with description of a new species, Aturus gordani

    Directory of Open Access Journals (Sweden)

    Pešić Vladimir M.

    2003-01-01

    Full Text Available A presented faunistic catalogue of water mites (Acari: Hydrachnidia and Halacaroidea from Republic of Srpska (Bosnia and Herzegovina is based on all published data and numerous new records from the investigated area. Twenty two species were identified, 12 of which new to Bosnia and Herzegovina and one species Mideopsis roztoczensis was recorded for the first time in the Balkans. The species Aturus gordani was described as new to science; halacarid mites were recorded (Acari: Halacaroidea for the first time in the fauna of Bosnia and Herzegovina. The ecological significance of the new records was briefly discussed.

  18. Garrapatas (Acari: Ixodidae asociadas a perros en diferentes ambientes de la provincia de Corrientes, Argentina Ticks (Acari: Ixodidae of dogs in different environments of the Corrientes Province, Argentina

    Directory of Open Access Journals (Sweden)

    V.N. Debárbora

    2011-06-01

    Full Text Available Se estudiaron las garrapatas (Acari: Ixodidae de perros en ambientes urbanos, periurbanos y rurales de la provincia de Corrientes por medio de colecciones mensuales durante un año en siete sitios diferentes. De los 138 perros examinados, en 87 (63,04% se determinaron tres especies de garrapatas: Amblyomma tigrinum (n=35, Amblyomma ovale (n=2 y Rhipicephalus sanguineus sensu lato (n=523. Las mayores prevalencias para A. tigrinum y R. sanguineus s.l. fueron halladas en ambientes rurales. Especímenes de R. sanguineus s.l. fueron detectados a lo largo de todo el año, con picos de abundancia en primavera y verano, A. tigrinum fue encontrada en otoño, invierno y primavera con un pico en esta última estación, mientras que A. ovale fue colectada sólo en primavera. Rhipicephalus sanguineus s.l. y A. tigrinum fueron halladas en todos los ambientes muestreados, pero el primer taxón fue siempre el más abundante. Teniendo en cuenta que las especies del complejo R. sanguineus son potenciales vectores de microorganismos patógenos para los perros y humanos, y debido a la alta prevalencia registrada en este estudio, queda en evidencia la relevancia de aplicar métodos para su control en las áreas incluidas en este estudio.Ticks (Acari: Ixodidae of dogs in urban, peri-urban and rural areas from the Corrientes Province, Argentina, were studied. They were monthly collected during one year at 7 different sites. A total of 138 dogs were examined, and 87 (63.04% of them were infested; and three species were determined: Amblyomma tigrinum (n=35, Amblyomma ovale (n=2 and Rhipicephalus sanguineus sensu lato (n=523. Both A. tigrinum and R. sanguineus s.l. had the highest prevalence in rural areas. Specimens of R. sanguineus s.l. were collected in the four seasons, but the peaks of abundance were detected in spring and summer. Amblyomma tigrinum was found in autumn, winter and spring, with the peak of abundance in spring, and the two specimens of A. ovale were

  19. Quill mites of the subfamily Picobiinae (Acari: Syringophilidae) associated with woodpeckers (Aves: Piciformes: Picidae).

    Science.gov (United States)

    Skoracki, Maciej; Unsoeld, Markus; Kavetska, Katarzyna; Kaszewska, Katarzyna

    2014-03-01

    The paper contains a review of quill mites of the subfamily Picobiinae (Acari: Prostigmata: Syringophilidae) associated with woodpeckers (Aves: Piciformes: Picidae). Three new species are described: Picobia mentalis Skoracki et Unsoeld sp. nov. from Picus mentalis Temminck, Neopicobia ea Skoracki et Unsoeld sp. nov. from Celeus flavus (St. Mueller) (type host), C. elegans (St. Mueller), C. torquatus (Boddaert), and Neopicobia freya Skoracki et Unsoeld sp. nov. from Dryocopus galeatus (Temminck) (type host) and Piculus rubiginosus (Swainson). Additionally, six new host species for Picobia heeri Haller, 1878 and 12 new host species for Picobia dryobatis (Fritsch, 1956) are reported. A complete list of the picobiines parasitising birds of the family Picidae is presented in the tabular form.

  20. First Report of Raoiella indica (Hirst) (Acari: Tenuipalpide) in Southern Brazil.

    Science.gov (United States)

    Hata, F T; Silva, J E P; Ventura, M U; Pasini, A; Roggia, S

    2017-06-01

    The red palm mite (RPM), Raoiella indica (Hirst) (Acari: Tenuipalpidae), was found for the first time in the Paraná State, in southern Brazil. The first observations occurred in September 2015, on strawberry (Fragaria × ananassa Duch) leaves, which is not considered a typical host plant of RPM. It is probable that its occurrence on this plant was serendipitous. Visual surveys for RPM were carried out on four typical host plants (banana, coconut, foxtail palm, and real palm), in five cities of the Paraná State (Bela Vista do Paraíso, Londrina, Maringá, Marialva, and Sarandi). RPM was found on each of the four typical host plants, in each of the five cities. Our survey extends RPM occurrence to the southern region of Brazil and indicates that the pest could be widespread in the country.

  1. A review of the natural enemies of the red palm mite, Raoiella indica (Acari: Tenuipalpidae).

    Science.gov (United States)

    Carrillo, Daniel; Frank, J Howard; Rodrigues, Jose Carlos V; Peña, Jorge E

    2012-08-01

    A review of all the available information about the natural enemies reported in association with the red palm mite, Raoiella indica is presented. Twenty-eight species of predatory arthropods, including mites and insects, have been reported in association with R. indica in Asia, Africa and the Neotropics. In addition, pathogenic fungi associated with R. indica in the Caribbean have been reported. The available literature indicates that each site has a different natural enemy complex with only one predator species, Amblyseius largoensis (Acari: Phytoseiidae), present in all the geographical areas. The phytoseiids, Amblyseius caudatus Berlese, Amblyseius channabasavanni Gupta and A. largoensis, were regarded as important natural enemies of R. indica, and their predatory efficiency was studied in some detail. Among the predatory insects the coccinellids Stethorus keralicus Kapur and Telsimia ephippiger Chapin were reported as major predators of R. indica. The known distribution, abundance and relative importance of each species reported in association with R. indica are discussed.

  2. Brazilian distribution of Amblyomma varium Koch, 1844 (Acari: Ixodidae, a common parasite of sloths (Mammalia: Xenarthra

    Directory of Open Access Journals (Sweden)

    Marques Sandro

    2002-01-01

    Full Text Available Amblyomma varium, commonly known in Brazil as the "carrapato-gigante-da-preguiça" (sloth's giant tick is found from southern Central America to Argentina. The present study adds information on the geographical distribution of A. varium, as well as on their hosts, based on material deposited in the main Brazilian collections and on the available literature. Eighty-two vials, containing 191 adult specimens, deposited in five Acari collections between 1930 and 2001, were examined. These vials included data on the host and collection localities. The biology of A. varium is unknown. However it is known that, during the adult stage, the tick presents a high host specificity and is found almost exclusively on the sloths Bradypus tridactylus, B. variegatus, B.torquatus (Bradypodidae, Choloepus hoffmanni and C. didactylus (Megalonychidae. Based on the material examined, the states of Rondônia, Amazonas, Bahia and Alagoas are newly assigned to geographic distribution of A. varium in Brazil.

  3. Javanese species of the mite genus Macrocheles (Arachnida: Acari: Gamasina: Macrochelidae).

    Science.gov (United States)

    Hartini, Sri; Takaku, Gen

    2003-10-01

    Twelve mite species of the genus Macrocheles (Acari: Macrochelidae) were collected from the body surface of dung beetles in Java, Indonesia. Of these, three species, i.e., Macrocheles jabarensis, M. jonggolensis, and M. sukabumiensis, were described as new to science. Female of M. dispar was redescribed. Two species, i.e., M. baliensis and M. sukaramiensis, were recorded from Java for the first time. The occurrence of five species previously recorded from Java, i.e., M. hallidayi, M. kraepelini, M. limue, M. oigru, and M. merdarius, were reconfirmed. Taxonomic status of M. sp. aff. glaber was not settled in the present study, because we could not obtain the male and immatures which are indispensable for exact identification. In total 15 species of the genus Macrocheles, including 3 species already recorded but not collected in this research (M. crispa, M. krantzi, and M. subbadius), are known from Java up to date.

  4. Brazilian distribution of Amblyomma varium Koch, 1844 (Acari: Ixodidae), a common parasite of sloths (Mammalia: Xenarthra).

    Science.gov (United States)

    Marques, Sandro; Barros-Battesti, Darci Moraes; Faccini, João Luiz Horacio; Onofrio, Valeria Castilho

    2002-12-01

    Amblyomma varium, commonly known in Brazil as the "carrapato-gigante-da-pregui a" (sloth's giant tick) is found from southern Central America to Argentina. The present study adds information on the geographical distribution of A. varium, as well as on their hosts, based on material deposited in the main Brazilian collections and on the available literature. Eighty-two vials, containing 191 adult specimens, deposited in five Acari collections between 1930 and 2001, were examined. These vials included data on the host and collection localities. The biology of A. varium is unknown. However it is known that, during the adult stage, the tick presents a high host specificity and is found almost exclusively on the sloths Bradypus tridactylus, B. variegatus, B.torquatus (Bradypodidae), Choloepus hoffmanni and C. didactylus (Megalonychidae). Based on the material examined, the states of Rond nia, Amazonas, Bahia and Alagoas are newly assigned to geographic distribution of A. varium in Brazil.

  5. Benefits and risks of the subcutaneous immunotherapy with acari extracts in allergic rhinoconjunctivitis and bronchial asthma

    Directory of Open Access Journals (Sweden)

    Olimpio Rodríguez-Santos

    2014-12-01

    Full Text Available The records of patients from the Allergology Service in the Previsora Policlinic, Camagüey were revised to evaluate benefits and risks of the subcutaneous immunotherapy (ITSC with extracts of acari. The study was observational, analytic and retrospective of cases and controls in allergic rhinoconjunctivitis and bronchial asthma. A total of 160 subjects, older than 18 years old, were chosen. Eighty out of them had already received ITSC with dose increase during 13 weeks and maintenance with monthly injections during 18 months. A total of 80 patients who only received prevention measures and medications during the crises were paired. Questionnaires were applied for quality of rhinoconjunctivitis life and asthma, about the consumption of medications and the frequency of the crises. The adverse events were measured, as they were local and systemic to the cutaneous tests, to the ITSC and the different pharmacological treatments. There was a significant increase of the punctuation of life quality questionnaires, (p=0.011. The consumption of medications decreased in both the cases and the controls, without significant differences (p=0.083. The frequency of the rhinitis and asthma crises decrease in the group of ITSC (p=0.029. Slight local and systemic reactions were reported in both groups with Odds ratio (OR=2.029 in the ITSC group, with a 95% confidence interval of 1.114–3.967 (p=0.019. The results show that the subcutaneous immunotherapy with acari offers benefits and few risks to patients with allergic rhinoconjunctivitis and asthma.

  6. Potential of astigmatid mites (Acari: Astigmatina) as prey for rearing edaphic predatory mites of the families Laelapidae and Rhodacaridae (Acari: Mesostigmata).

    Science.gov (United States)

    Barbosa, Marina F C; de Moraes, Gilberto J

    2016-07-01

    Laelapidae and Rhodacaridae are important families of edaphic predatory mites and species of these families have been considered for use in biological control programs of soil pests. Mites of Cohort Astigmatina (Acari: Sarcoptiformes) have been largely used as factitious prey in the mass rearing of various edaphic or plant-inhabiting predatory mites. Stratiolaelaps scimitus (Womersley) (Mesostigmata: Laelapidae) (widely commercialized for the control of fungus gnats and thrips) and Protogamasellopsis zaheri Abo-Shnaf, Castilho and Moraes (Mesostigmata: Rhodacaridae) (not available commercially but promising for the control of thrips and nematodes) are known to be reared on Tyrophagus putrescentiae (Schrank) (Astigmatina: Acaridae), but the possibility to find a perhaps more efficient prey has not been evaluated. The objective of this paper was to evaluate different astigmatid species as prey for these predators. S. scimitus and P. zaheri oviposited on all evaluated astigmatids and the acarid mites T. putrescentiae and Aleuroglyphus ovatus (Tropeau) were the most suitable prey; to confirm the effect of prey on oviposition rates, pregnant females of the predators were kept under starvation conditions and oviposition was negligible or null. Survivorship was always higher than 78 % and was not influenced by prey species or starvation.

  7. Effect of various levels of dietary Jatropha curcas seed meal on rabbits infested by the adult ticks of Hyalomma marginatum marginatum I. Animal performance, anti-tick feeding and haemogram.

    Science.gov (United States)

    Abdel-Shafy, Sobhy; Nasr, Soad M; Abdel-Rahman, Hashem H; Habeeb, Salwa M

    2011-02-01

    The goal of this study was to investigate the use of Jatropha curcas seed meal (JCSM) in different levels as acaricide in diet of rabbits experimentally infested by Hyalomma marginatum marginatum then determining animal performance, anti-tick feeding and its effects on haemogram of rabbits. Thirty healthy mixed-breed rabbits were randomly divided into five equal groups. The first group was kept as a control fed soya bean meal (20%) as a source of protein. Groups from the second to the fifth fed diets contained 2.5%, 5%, 7.5% and 10% of JCSM instead of soya bean meal as a source of protein, respectively. Feeding and watering were given freely throughout the study. Animal performance for treatment groups were recorded from the 1st week up to the 6th week. Then each group divided into two subgroups, and the ticks were introduced to all of one subgroup and the other kept as control, following them until dropped at the end of the 8th week for all groups of the experiment. Feeding and reproductive performance of the adult tick females were determined. Blood samples were collected and analysed for haematological examination at the 0, 6th and 8th weeks post-treatment from all animals. Result revealed that rabbits received diets containing 5%, 7.5% and 10% had significantly (P Egg mass and reproductive index per female were marked increase (P drop in the group received 7.5% JCSM. Also, monocytosis was recorded in 7.5% and 10% JCSM groups. In conclusion, JCSM could be use in the treatment of ectoparasites at level less than 10% in diet. Further investigations should be done to detoxification the Jatropha seed meal to decrease the level of its toxicity.

  8. Crimean-Congo hemorrhagic fever:a molecular survey on hard ticks (Ixodidae) in Yazd province, Iran

    Institute of Scientific and Technical Information of China (English)

    Salim Abadi Yaser; Chinikar Sadegh; Telmadarraiy Zakkyeh; Vatandoost Hassan; Moradi Maryam; Oshaghi Mohammad Ali; Ghiasi Seyed Mojtaba

    2011-01-01

    Objective: To determine the rate of Crimean-Congo hemorrhagic fever virus (CCHFV) infection in hard ticks (Ixodidae) in Yazd province of Iran. Methods: A molecular survey on hard ticks(Ixodidae) was conducted in Yazd province during 2008 -2009. A total of 140 hard ticks (three genera and 7 species) were collected from randomly selected villages and were exanimate for presence of CCHFV reverse transcription-polymerase chain reaction (RT-PCR) method. Results:CCHFV genome was found in 5.71% of hard ticks. All positive ticks were from Hyalomma genus. Positive ticks including: Hyalomma dromedarii, Hyalomma marginatum, Hyalomma anatolicum,Hyalomma detritum, Hyalomma asiaticum . We were not able to find virus in in Rhipicephalus sanguineus and Dermacentor marginatus. Results exhibited that Hyalomma is the main vector in the study area. Conclusions: Due to the presence of virus in 24 provinces' out of 31, we recommend the use of acaricides and repellent to prevent disease transmission among humans. Greta care should be taken by the people who are working in slaughter houses.

  9. Marine water mites (Acari: Hydrachnidia: Pontarachnidae) from Taiwan, Korea and India, with the first description of the male of Pontarachna australis Smit, 2003

    Digital Repository Service at National Institute of Oceanography (India)

    Pesic, V.; Chatterjee, T.; Chan, B.K.K.; Ingole, B.S.

    –264. Lohmann, H. (1909) Marine Hydrachnidae und Halacaridae. In: Michaelsen, W. & Hartmeyer, R. (Eds), Die fauna Südwest-Australiens, Gustav Fischer, Jena, 2, 151–154. Smit, H. (2002) Two new species of the water mite family Pontarachnidae (Acari: Hydrachnidia...

  10. Ticks (Acari: Ixodidae) associated with wildlife and vegetation of Haller park along the Kenyan coastline.

    Science.gov (United States)

    Wanzala, W; Okanga, S

    2006-09-01

    This artcile describes the results obtained from a tick survey conducted in Haller park along the Kenyan coastline. The survey aimed at evaluating tick-host associations, assessing tick population density, and providing baseline information for planning future tick control and management in the park. Ticks (2,968) were collected by handpicking from eight species of wildlife and by dragging in 14 selected sites within the park. A considerable proportion of ticks were also collected from leaves, stems, and bark of most dominant trees, namely, Casuarina equisetifolia L. (Forst. and Forst.), Cocos nucifera L., Adansonia digitata L., Musa paradisiaca L., and Azadiracta indica Adr. Juss. Dragging was conducted in sites predominantly occupied by Cynodon dactylon L. (Pers.), Cenchrus ciliaris L., Stenotaphrum dimidiatum L. (Kuntze.) Brongn., and Brachiaria xantholeuca Hack. Ex Schinz Stapf. and Loudetia kagerensis K. Schum. Hutch. Eight tick species were identified, and the collection included Rhipicephalus pravus Dönitz 1910, Rhipicephalus pulchellus Gerstäcker 1873, Hyalomma marginatum rufipes Koch 1844, Amblyomma gemma Dönitz 1910, Amblyomma hebraeum Koch 1844, Amblyomma sparsum Neumann 1899, Amblyomma nuttalli Dönitz 1909, and Boophilus decoloratus Koch 1844. Given that the identified tick species are known to parasitize humans as well as livestock, there exist risks of emergence of zoonotic infections mediated by tick vectors. In the recreational environment of Haller park, where tick vectors share habitats with hosts, there is a need to develop sustainable and effective tick control and management strategies to minimize economic losses that tick infestation may cause.

  11. Laboratory Study on Biological Control of Ticks (Acari: Ixodidae by Entomopathogenic Indigenous Fungi (Beauveria bassiana

    Directory of Open Access Journals (Sweden)

    M Abdigoudarzi

    2009-12-01

    Full Text Available Background: Chemical control method using different acaricides as spray, dipping solution or pour-on is routinely used for controlling ticks. Biological control agents are favorable due to their safety for animals and environment. Entomopathogenic fungi such as Beauveria bassiana are well known for controlling ticks. In this study, two Iranian indigenous strains of B. bassiana (B. bassiana 5197 and B. bassiana Evin were selected and grown on specific me­dia. The pathogenic effects of these strains were evaluated on adult stages of two Iranian Ixodidae members (H. anatolicum anatolicum Koch 1844, and H. marginatum Koch 1844 by dipping method.Methods: Two Iranian strains of Beauveria bassiana (Beauveria bassiana 5197 and Beauveria bassiana Evin were selected and were grown successfully on specific media. The pathogenic effects of these strains were evaluated on adult stages of Iranian Ixodidae members such as, Hyalomma anatolicum anatolicum and H. marginatum by dipping method (these ticks were grown up at laboratory conditions during 2002 up to 2003 and still it is continued .Results: There was no effect of strain 5197 on mortality or fecundity rates for ticks. There was acute phase sign of paralysis in test group after dipping ticks in suspension made from Evin strain of B. bassiana. In addition, the test groups were totally died after four months, but the control groups survived for six months.Conclusion: High concentration of fungal spores is needed for inducing fungal infection. Additional study using different strains and fungi on Iranian ticks is proposed. 

  12. Parasites of domestic and wild animals in South Africa. XLIX. Ticks (Acari: Ixodidae infesting white and black rhinoceroses in southern Africa

    Directory of Open Access Journals (Sweden)

    Ivan G. Horak

    2017-01-01

    Full Text Available The objectives of the study were to determine the species composition of ticks infesting white and black rhinoceroses in southern Africa as well as the conservation status of those tick species that prefer rhinos as hosts. Ticks were collected opportunistically from rhinos that had been immobilised for management purposes, and 447 white rhinoceroses (Ceratotherium simum and 164 black rhinoceroses (Diceros bicornis were sampled in South Africa, 61 black rhinos in Namibia, 18 white and 12 black rhinos in Zimbabwe, and 24 black rhinos in Zambia. Nineteen tick species were recovered, of which two species, Amblyomma rhinocerotis and Dermacentor rhinocerinus, prefer rhinos as hosts. A. rhinocerotis was collected only in the northeastern KwaZulu-Natal reserves of South Africa and is endangered, while D. rhinocerinus is present in these reserves as well as in the Kruger National Park and surrounding conservancies. Eight of the tick species collected from the rhinos are ornate, and seven species are regularly collected from cattle. The species present on rhinos in the eastern, moister reserves of South Africa were amongst others Amblyomma hebraeum, A. rhinocerotis, D. rhinocerinus, Rhipicephalus maculatus, Rhipicephalus simus and Rhipicephalus zumpti, while those on rhinos in the Karoo and the drier western regions, including Namibia, were the drought-tolerant species, Hyalomma glabrum, Hyalomma rufipes, Hyalomma truncatum and Rhipicephalus gertrudae. The species composition of ticks on rhinoceroses in Zambia differed markedly from those of the other southern African countries in that Amblyomma sparsum, Amblyomma tholloni and Amblyomma variegatum accounted for the majority of infestations.

  13. New species and new records of mites of the genus Stigmaeus(Acari: Prostigmata: Stigmaeidae) from Crimea.

    Science.gov (United States)

    Khaustov, Alexander A

    2014-05-06

    Three new species of the genus Stigmaeus Koch, 1836 (Acari: Stigmaeidae) are described from various habitats in Crimea: Stigmaeus kuznetsovi sp. nov. from nests of Microtus socialis (Rodentia: Cricetidae); S. mitrofanovi sp. nov. from galleries of Pityogenes bistridentatus (Coleoptera: Curculionidae) under the bark of Pinus pallasiana, and S. silvestris sp. nov. from rotten log of Pinus pallasiana. Stigmaeus corticeus Kuznetsov and Wainstein, 1977 and S. maraghehiensis Bagheri and Ueckermann, 2012 are recorded for the first time in Crimea. A key to species of the genus Stigmaeus of Crimea is provided.

  14. First phylogenetic analysis of a Crimean-Congo hemorrhagic fever virus genome in naturally infected Rhipicephalus appendiculatus ticks (Acari: Ixodidae).

    Science.gov (United States)

    Fakoorziba, Mohammad Reza; Naddaf-Sani, Ali Asghar; Moemenbellah-Fard, Mohammad Djaefar; Azizi, Kourosh; Ahmadnia, Sara; Chinikar, Sadegh

    2015-05-01

    Crimean-Congo haemorrhagic fever (CCHF) is a potentially fatal systemic viral disease in many parts of the world, including Iran. The nationwide incidence of human CCHF in endemic areas was 870 confirmed cases with 126 deaths (case fatality rate, CFR = 17.6 %) in the decade leading to 2012. The detection of the CCHF virus (CCHFV) genome in tick vectors is of fundamental importance for identifying these ticks as potential reservoirs of CCHFV infection. From May to October 2013, following detection of four new clinical cases resulting in two deaths in the city of Mashhad (northeast Iran), hard ticks were recovered from infested livestock in 40 villages in Khorasan-Razavi province and examined by the microscopic method for species identification. About a quarter of the ticks were then subjected to reverse-transcription polymerase chain reaction (RT-PCR) to detect the CCHFV genome. The PCR products were then sequenced, and their phylogenetic lineages were determined. A total of 407 hard ticks were captured, representing seven different species in two distinct genera. Members of the genus Hyalomma were widely distributed in all but two of the villages studied, and this was also the most frequent (83.3 %) tick genus. Of 105 adult ticks subjected to RT-PCR, four (3.8 %) ticks were found positive for the CCHFV genome. One brown ear tick, Rhipicephalus appendiculatus, was found to be naturally infected for the first time anywhere in the world. Ticks of Hyalomma asiaticum, Hyalomma marginatum, and Rhipicephalus turanicus were also found to be naturally infected with CCHFV. CCHFV found in these four different tick species were clustered in the same lineage with the Matin and SR3 strains from Pakistan and some other strains from Iran, indicating that these tick species were naturally infected with genetically closely related CCHFV in the region. The presence of CCHFV infection in four different hard tick species was confirmed using RT-PCR in northeast Iran. Part of this

  15. Primeiro registro de Oligonychus yothersi (McGregor (Acari: Tetranychidae em Eucalyptus grandis Hill ex Maiden no Brasil First record of Oligonychus yothersi (McGregor (Acari: Tetranychidae on Eucalyptus grandis Hill ex Maiden in Brazil

    Directory of Open Access Journals (Sweden)

    Fabrício Fagundes Pereira

    2005-08-01

    Full Text Available Relata-se a infestação de um ácaro-vermelho em mudas clonais de Eucalyptus grandis Hill ex Maiden, mantidas em casa de vegetação no município de Martinho Campos, Minas Gerais. O ácaro foi observado na parte superior das folhas que exibiam sinais de sucção de seiva e bronzeamento. Essas injúrias causaram desenvolvimento anormal e morte de plantas. O ácaro foi identificado como Oligonychus yothersi (McGregor (Acari: Tetranychidae, e isso representa o primeiro registro dessa espécie em mudas clonais de E. grandis no Brasil.An infestation of the red spider mite was reported in clone seedlings of Eucalyptus grandis Hill ex Maiden under greenhouse conditions, in the municipality of Martinho Campos, Minas Gerais State. The spider mite was found on the leaf upper faces with signs of sap suction and bronzing. Such injuries caused abnormal development and plant death. The spider mite was identified as Oligonychus yothersi (McGregor (Acari: Tetranychidae. This is the first record of O. yothersi on E. grandis seedlings in Brazil.

  16. Preliminary assays for efficiency avaliation of neem oil for control of Oligonychus yothersi (Acari: Tetranychidae / Ensaios preliminares para avaliação da eficiência de óleo de neem no controle de Oligonychus yothersi (Acari: Tetranychidae

    Directory of Open Access Journals (Sweden)

    Renato C. Oliveira

    2003-05-01

    Full Text Available The effect of a commercial formulation of the neem oil (azadirachtina was evaluated in different stages of the biological cycle of the red mite of the paraguay tea Oligonychus yothersi (Acari: Tetranychidae. The formulation was shown efficient in the adults control, as well as it affected the fecundity of the females of the mite, however it didn’t inhabited oviposition, when the leaves were treated with the product.Avaliou-se o efeito de uma formulação comercial a base de neem (azadirachtina em diferentes etapas do ciclo biológico do ácaro vermelho da erva-mate Oligonychus yothersi (Acari: Tetranychidae. A formulação mostrou-se eficiente no controle de adultos, bem como afetou a fecundidade das fêmeas do ácaro, contudo não ocasionou inibição na oviposição, quando as folhas foram tratadas com o produto.

  17. Study of Acari and Collembola Populations in Four Cultivation Systems in Dourados - MS

    Directory of Open Access Journals (Sweden)

    Rosilda Mara Mussury

    2002-09-01

    Full Text Available The impact four cultivation systems on the soil fauna was studied, using Oribatida and Gamasida acarids as bioindicators and collembolan. The research was carried out in experimental fields, located in EMBRAPA - CPAO in Dourados, Centerwest of Brazil from July 1997 to December 1999. The constant pasture system presented smaller impact on the soil fauna followed by agricultural cattle rotation and a direct plantation system. In the conventional plantation series, the populational density of the mesofauna organisms was low, especially collembolan families.O impacto de quatro sistemas de cultivo sobre a fauna de solo foram estudados, utilizando-se como bioindicadores os acari Oribatida e Gamasida e os Collembola. A pesquisa foi conduzida em campos experimentais, localizados na EMBRAPA - CPAO no município de Dourados, MS, no período de julho de 1997 à dezembro de 1999. O sistema de pastagem contínua apresentou menor impacto sobre a fauna de solo seguido da rotação agricultura pecuária e do sistema de plantio direto. Nas sucessões do plantio convencional, a densidade populacional dos organismos da mesofauna foi baixa, em especial as famílias de colembolos.

  18. Comparing oxalic acid and sucrocide treatments for Varroa destructor (Acari: Varroidae) control under desert conditions.

    Science.gov (United States)

    Sammataro, D; Finley, J; Underwood, R

    2008-08-01

    The effectiveness of oxalic acid (OA) and Sucrocide (S) (AVA Chemical Ventures, L.L.C., Portsmouth, NH) in reducing populations of the varroa mite Varroa destructor Anderson & Trueman (Acari: Varroidae) in honey bee, Apis mellifera L. (Hymenoptera: Apidae) colonies was measured under the desert conditions of Arizona, USA. OA and S were applied three times 7 d apart. A 3.2% solution of OA was applied in sugar syrup via a large volume syringe, trickling 5 ml per space between frames in the colony. S was applied at a concentration of 0.625% (mixed with water), according to the label directions, using a compressed air Chapin sprayer at 20 psi to apply 59 ml per frame space. Varroa mites, collected on a sticky board before, during, and after the treatments, were counted to assess the effectiveness of the treatments. This study showed that a desert climate zone did not confer any positive or negative results on the acaricidal properties of OA. Even with brood present in colonies, significant varroa mite mortality occurred in the OA colonies. In contrast, we found that Sucrocide was not effective as a mite control technique. Despite its ability to increase mite mortality in the short-term, varroa mite populations measured posttreatment were not affected any more by Sucrocide than by no treatment at all.

  19. New Records of Ixodes affinis (Acari: Ixodidae) Parasitizing Avian Hosts in Southeastern Virginia.

    Science.gov (United States)

    Heller, Erin L; Wright, Chelsea L; Nadolny, Robyn M; Hynes, Wayne L; Gaff, Holly D; Walters, Eric L

    2016-03-01

    Ixodes affinis Neumann (Acari: Ixodidae) is a hard-bodied tick species distributed throughout much of the southeastern United States. Although I. affinis does not parasitize humans, it is a competent vector of Borrelia burgdorferi sensu stricto, the causative-agent of Lyme disease, and thus contributes to the enzootic maintenance of this pathogen. This study presents evidence of I. affinis parasitizing five new host passerine species. During 2012-2014, 1,888 birds were captured and examined for ticks, and 18 immature I. affinis were collected from 12 birds-six Carolina Wrens (Thyrothorus ludovicianus); two Brown Thrashers (Toxostoma rufum); and one American Robin (Turdus migratorius), Eastern Towhee (Pipilo erythrophthalmus), Northern Cardinal (Cardinalis cardinalis), and White-throated Sparrow (Zonotrichia albicollis). Of 15 larvae and 3 nymphs collected, one nymph tested positive for B. burgdorferi DNA. I. affinis was found co-feeding on birds with immature Amblyomma americanum (L.), Ixodes brunneus Koch, Ixodes dentatus Marx, Ixodes scapularis Say, and Haemaphysalis leporispalustris Packard. The results of this research provide a better understanding of I. affinis hosts and identify avian taxa that may play a role in the maintenance and dispersal of this tick species.

  20. Multiple resistance and biochemical mechanisms of pyridaben resistance in Tetranychus urticae (Acari: Tetranychidae).

    Science.gov (United States)

    Kim, Young-Joon; Park, Hyung-Man; Cho, Jum-Rae; Ahn, Young-Joon

    2006-06-01

    A field colony of Tetranychus urticae (Koch) (Acari: Tetranychidae) resistant to pyridaben was selected with pyridaben successively for 20 generations to produce the PR-20 strain. Resistance and multiple resistance levels of the PR-20 strain to 15 acaricides were determined using a spray bioassay. The PR-20 strain was extremely resistant to pyridaben (resistance ratio [RR] = 240]. The strain exhibited extremely strong resistance to fenpyroximate (RR=373) and acrinathrin (RR=329) and strong resistance to benzoximate (RR=84). An RR = 10-40 was observed with abamectin, fenazaquin, fenbutatin oxide, fenpropathrin, and tebufenpyrad. The PR-20 strain showed low levels of resistance (RR <10) to azocyclotin, bromopropylate, chlorfenapyr, dicofol, milbemectin, and propargite. Synergist experiments with different metabolic inhibitors revealed that piperonyl butoxide (PBO), a mixed function oxidase (MFO) inhibitor, had the greatest effect on pyridaben resistance. PBO significantly caused pyridaben resistance in the PR-20 strain to drop to the full susceptibility level of the susceptible (S) strain. However, there was no significant difference in MFO activities measured using a model substrate between the S and PR-20 strains. These results suggest that use of certain acaricides with little multiple resistance or PBO will be useful for the management of pyridaben resistance in the field.

  1. Sublethal effects of fenazaquin on life table parameters of the predatory mite Amblyseius swirskii (Acari: Phytoseiidae).

    Science.gov (United States)

    Alinejad, Marzieh; Kheradmand, Katayoon; Fathipour, Yaghoub

    2014-11-01

    Knowledge of the impact of acaricides on predatory mites is crucial for integrated pest management programs. The present study evaluated the sublethal effect of fenazaquin (Pride(®) 20 % SC, Behavar, Iran) on life table parameters of the subsequent generation of the predatory mite, Amblyseius swirskii Athias-Henriot (Acari: Phytoseiidae), fed on Tetranychus urticae Koch under laboratory conditions [26 ± 1 °C, 70 ± 3 % RH and 16:8 (L:D) h]. The sublethal concentrations including LC10, LC20 and LC30 were determined using a dose-effect assay. The total development time of both sexes enhanced with an increase in concentration. The oviposition period and total fecundity decreased in dose-dependent manner. The intrinsic rate of increase (r) and finite rate of increase (λ) significantly descended with concentration enhancing from LC10 to LC30, compared with the control. The net reproductive rate (R 0) ranged between 2.76 and 7.37 offspring. Overall, the results indicated that fenazaquin had negative effects on development and life table parameters of the subsequent generation of A. swirskii. In conclusion, fenazaquin is not a compatible acaricide with A. swirskii and should not be used with this predatory mite in integrated management of T. urticae.

  2. Acaricidal and repellent activities of essential oil of Eucalyptus globulus against Dermanyssus gallinae (Acari: Mesostigmata

    Directory of Open Access Journals (Sweden)

    Dehghani-Samani Amir

    2015-07-01

    Full Text Available Introduction: By considering an increase in drug resistance against red mites, finding the nonchemical herbal acaricide against Dermanyssus gallinae (De Geer (Acari: Mesostigmata is necessary to kill them and to reduce the chemical resistance against chemical acaricides in this specie. Dermanyssus gallinae is a potential vector of the causal agent of several viral diseases such as Equine encephalitis and St. Louis encephalitis. It can be a vector of bacteria such as Salmonella spp., Mycobacterium spp. and Erysipelothrix rhusiopathiae. It is also known to cause itching dermatosis in humans. In this study acaricidal and repellent activities of essential oil of Eucalyptus globulus against Dermanyssus gallinae were studied. Methods: After extracting the essential oil, different concentrations of the plant extract were prepared. Then, acaricidal effect of different concentrations was tested on poultry red mite, Dermanyssus gallinae, by dropping 3-4 drops of essential oil on mites. Repellent activity of essential oil was tested by Y-tube olfactometer bioassay. After the test, total number of killed and repellent mites reported. Results: Concentration of 1:2 or 50% had more acaricidal effect on mites. Also essential oil of Eucalyptus globulus had repellent activity against red mites. Conclusion: This study showed that essential oil of Eucalyptus globulus had acaricidal and repellent activities against red mites. Hence it might be used as a herbal acaricide against it to kill and to reduce the chemical resistance in this specie.

  3. Morphometric variations of laelapine mite (Acari: Mesostigmata populations infesting small mammals (Mammalia in Brazil

    Directory of Open Access Journals (Sweden)

    F. Martins-Hatano

    Full Text Available The goal of this study was to evaluate the morphometric variation of laelapine populations (Acari, Mesostigmata associated with neotropical oryzomyine rodents at different geographic localities in Brazil. Three nominal mite species were selected for study, all infesting the pelage of small mammals at different localities in Rio de Janeiro, Espírito Santo, Bahia, and the Federal District, Brazil. To analyse morphometric characteristics, thirty-seven morphological characters distributed across the whole body of each specimen were measured. We use the Analysis of Principal Components, extracting the three first axes and projecting each mite in these axes. Major species level changes in the taxonomy of the host mammals allows an independent examination of morphometric variation of mites infesting a set of distinctly different host species at different geographic localities. Gigantolaelaps vitzthumi and Laelaps differens are associated with oryzomyine rodents of the genus Cerradomys, and consistently showed a tendency to cluster by host phylogeny. Laelaps manguinhosi associated with Nectomys rattus in central Brazil is morphometrically distinct from mites infesting N. squamipes in the coastal restingas of Rio de Janeiro and Espírito Santo. The results obtained here indicate that laelapine mite populations can vary among geographic areas and among phylogenetically related host species. Clearly, the study of these mites at the population level can be an important tool for clarifying the taxonomy of both mites and hosts.

  4. Practical sampling plans for Varroa destructor (Acari: Varroidae) in Apis mellifera (Hymenoptera: Apidae) colonies and apiaries.

    Science.gov (United States)

    Lee, K V; Moon, R D; Burkness, E C; Hutchison, W D; Spivak, M

    2010-08-01

    The parasitic mite Varroa destructor Anderson & Trueman (Acari: Varroidae) is arguably the most detrimental pest of the European-derived honey bee, Apis mellifera L. Unfortunately, beekeepers lack a standardized sampling plan to make informed treatment decisions. Based on data from 31 commercial apiaries, we developed sampling plans for use by beekeepers and researchers to estimate the density of mites in individual colonies or whole apiaries. Beekeepers can estimate a colony's mite density with chosen level of precision by dislodging mites from approximately to 300 adult bees taken from one brood box frame in the colony, and they can extrapolate to mite density on a colony's adults and pupae combined by doubling the number of mites on adults. For sampling whole apiaries, beekeepers can repeat the process in each of n = 8 colonies, regardless of apiary size. Researchers desiring greater precision can estimate mite density in an individual colony by examining three, 300-bee sample units. Extrapolation to density on adults and pupae may require independent estimates of numbers of adults, of pupae, and of their respective mite densities. Researchers can estimate apiary-level mite density by taking one 300-bee sample unit per colony, but should do so from a variable number of colonies, depending on apiary size. These practical sampling plans will allow beekeepers and researchers to quantify mite infestation levels and enhance understanding and management of V. destructor.

  5. Desiccation tolerance in diapausing spider mites Tetranychus urticae and T. kanzawai (Acari: Tetranychidae).

    Science.gov (United States)

    Ghazy, Noureldin Abuelfadl; Suzuki, Takeshi

    2014-05-01

    We investigated the effects of changes in vapor pressure deficit (VPD) on the survival of diapausing (winter form) and non-diapausing (summer form) spider mites Tetranychus urticae Koch and Tetranychus kanzawai Kishida (Acari: Tetranychidae). Adult females of both species were kept without food at VPDs of 0.0, 0.4, 0.7, 1.5, 1.9, or 2.7 kPa for 3, 6, 9, 12, or 15 days at 25 °C. Diapausing females of both species kept at a VPD of ≥0.4 kPa for ≥6 days clearly tolerated desiccation. Under water-saturated conditions (VPD = 0.0 kPa), in which no desiccation occurred, diapausing females showed high starvation tolerance: 90 % survived for up to 15 days. No interspecific differences in tolerance to desiccation or starvation were observed under most conditions. These results indicate that diapause functions increase tolerance to desiccation and starvation. Such multiple tolerances to harsh environments might support winter survival in spider mites.

  6. Historical review of the genus Dermanyssus Dugès, 1834 (Acari: Mesostigmata: Dermanyssidae

    Directory of Open Access Journals (Sweden)

    Roy L.

    2007-06-01

    Full Text Available A synthetic review of the historical systematics of Dermanyssus Dugès, 1834 (Acari: Mesostigmata: Dermanyssidae is provided. The classification at the specific level in this early genus has not really been clarified during more than a century despite its economic impact, and the history of the genus is complex and includes various stages. Moreover, Dermanyssus currently includes 23 species, whereas the last review took only 18 species into account. Changes in the species status and position in the genus Dermanyssus from 1834 until today are presented. The evolution of the generic definition is explored and compared with other genera of the group. How the discrimination between the different species evolved in the genus is also examined. Some difficulties in the specific definitions are discussed. A current diagnosis of the genus Dermanyssus is given. A table of the species included in this genus since its first description along with their respective current positions, a list of the currently included species in Dermanyssus with their hosts, and a world map presenting their geographic distribution are provided.

  7. Identification of a dieldrin resistance-associated mutation in Rhipicephalus (Boophilus) microplus (Acari: Ixodidae).

    Science.gov (United States)

    Hope, Michelle; Menzies, Moira; Kemp, David

    2010-08-01

    The southern cattle tick, Rhipicephalus (Boophilus) microplus (Canestrini) (Acari: Ixodidae), is a major vector of tick fever organisms affecting cattle in many parts of the world, including Australia, Africa, and South America. Control of the southern cattle tick through acaricide use is an important approach in disease management. Resistance has emerged to many of the acaricides currently and previously used, including the cyclodienes. Although cyclodiene resistance mechanisms have been characterized in many insect species, this report is the first to identify mutations associated with dieldrin resistance in the cattle tick. A novel two base pair mutation in the GABA-gated chloride channel gene has been identified at position 868-9 and causes a codon change from threonine to leucine. Analysis of a small number of field-collected samples resistant to dieldrin shows this mutation has been maintained without selection pressure since the withdrawal of dieldrin in Australia > 20 yr ago. The mutation is not found in other laboratory-maintained strains of R. microplus that were subject to selection pressure with various acaricides.

  8. Laboratory Study on Biological Control of Ticks (Acari: Ixodidae by Entomopathogenic Indigenous Fungi (Beauveria bassiana

    Directory of Open Access Journals (Sweden)

    M Abdigoudarzi

    2009-12-01

    Full Text Available Background: Chemical control method using different acaricides as spray, dipping solution or pour-on is routinely used for controlling ticks. Biological control agents are favorable due to their safety for animals and environment. Entomopathogenic fungi such as Beauveria bassiana are well known for controlling ticks. In this study, two Iranian indigenous strains of B. bassiana (B. bassiana 5197 and B. bassiana Evin were selected and grown on specific me­dia. The pathogenic effects of these strains were evaluated on adult stages of two Iranian Ixodidae members (H. anatolicum anatolicum Koch 1844, and H. marginatum Koch 1844 by dipping method."nMethods: Two Iranian strains of Beauveria bassiana (Beauveria bassiana 5197 and Beauveria bassiana Evin were selected and were grown successfully on specific media. The pathogenic effects of these strains were evaluated on adult stages of Iranian Ixodidae members such as, Hyalomma anatolicum anatolicum and H. marginatum by dipping method (these ticks were grown up at laboratory conditions during 2002 up to 2003 and still it is continued ."nResults: There was no effect of strain 5197 on mortality or fecundity rates for ticks. There was acute phase sign of paralysis in test group after dipping ticks in suspension made from Evin strain of B. bassiana. In addition, the test groups were totally died after four months, but the control groups survived for six months."nConclusion: High concentration of fungal spores is needed for inducing fungal infection. Additional study using different strains and fungi on Iranian ticks is proposed.   Keywords: Biological control, fungi, Beauveria bassiana, ticks, Ixodidae, Iran

  9. Tick (Acari: Ixodidae) infestations in cattle along Geba River basin in Guinea-Bissau.

    Science.gov (United States)

    Zúquete, Sara Tudela; Coelho, João; Rosa, Fernanda; Vaz, Yolanda; Cassamá, Bernardo; Padre, Ludovina; Santos, Dulce; Basto, Afonso P; Leitão, Alexandre

    2017-01-01

    Tick infestations are a major problem for animal production in tropical areas where prevention and control remain deficient. The present study sought to assess the awareness of traditional cattle producers towards the importance of ticks and aimed at the identification of tick species infesting bovines within the Geba River basin, Guinea-Bissau. Interviews with producers revealed that the majority directly correlates the presence of ticks with the occurrence of diseases in cattle. However, insufficient or inadequate control approaches prevail. A total of 337 ticks were collected on bovines at 18 different villages (10 during dry season, and 8 during rainy season). The tick species collected during the dry season were Rhipicephalus (Boophilus) geigyi (56.5%), followed by Amblyomma variegatum (23.3%), Rhipicephalus (Boophilus) annulatus (17.6%) and Hyalomma truncatum (1%). In the rainy season A. variegatum was the most collected (88.9%), followed by R. (Boophilus) geigyi (4.2%), R. (Boophilus) annulatus (3.4%), Rhipicephalus sanguineus group (2.8%) and H. truncatum (0.7%). To support species identification, segments of both cytochrome c oxidase I (COI) and 12S ribosomal RNA (12S) genes were sequenced and the data gathered were analysed by maximum likelihood and parsimony. Morphological and genetic data of individual specimens gathered in this study provide relevant information for future studies on tick population dynamics in the region. In addition, it led to a deeper characterization of R. sulcatus and a R. sanguineus-like specimen, exploring their genetic relationship with other R. sanguineus, which supports their classification as distinct species within R. sanguineus group.

  10. [Transfer of exotic ticks (Acari: ixodida) on reptiles (Reptilia) imported to Poland].

    Science.gov (United States)

    2009-01-01

    In the of period 2003-2007, a total of 382 specimens of reptiles belonging to the following genera were investigated: Testudo, Iguana, Varanus, Gongylophis, Python, Spalerosophis, Psammophis. The material for the present study was a collection of reptiles owned by the "Animals" Ltd from Swietochłowice (Upper Silesia, Poland), specialising in import of exotic animals to Poland, as well as the reptile collections of private breeders. The reptiles that turned out to be the most heavily infected with ticks were the commonly bred terrarium reptiles: Varanus exanthematicus and Python regius and they were imported to Poland from Ghana, Africa. Exotic reptiles are also imported from Southern Europe, Asia and Central America. The presently reported study helped to confirm the fact of transfer of exotic ticks on reptiles to Poland. A total of 2104 tick specimens, representing all stages of development (males, females, nymphs, larvae), were collected. They represented species of the genera Amblyomma and Hyalomma. The following species were found: Amblyomma exornatum Koch, 1844, Amblyomma flavomaculatum (Lucas, 1846), Amblyomma latum Koch, 1844, Amblyomma nuttalli Dönitz, 1909, Amblyomma quadricavum Schulze, 1941, Amblyomma transversale (Lucas, 1844), Amblyomma varanense (Supino, 1897), Amblyomma spp. Koch, 1844, Hyalomma aegyptium (Linnaeus, 1758). All the species of ticks of genus Ambylomma revealed have been discovered in Poland for the first time. The overall prevalence of infection was 77.6%. The highest prevalence value (81.2%) was observed on pythons (Python regius) and (78.7%) on monitor lizards (Varanus exanthematicus). The highest number of ticks was collected from Python regius and Varanus exanthematicus. The mean infection intensity for V. exanthematicus was 7.6 ticks per host, while for P. regius the intensity reached 4.7 ticks. The most abundant tick transferred to Poland on a host was an African tick, Amblyomma latum. Fifty eight specimens of monitor lizards

  11. Two new families (Acari: Alicorhagiidae and Platyhelminthes: Prorhynchidae reported for the Hungarian fauna From leaf litter in the Bükk Mountains

    Directory of Open Access Journals (Sweden)

    Pfliegler, W.

    2016-06-01

    Full Text Available Two new members of the Hungarian fauna are reported, both of them were collected in beech forest leaf litter in the Bükk Mountains, North-East Hungary: Alicorhagia fragilis Berlese, 1910 (Arthropoda: Arachnida: Acari: Sarcoptiformes: Endeostigmata: Alicorhagiidae and Geocentrophora baltica (Kennel, 1883 (Platyhelminthes: Rhabditophora: Trepaxonemata: Amplimatricata: 'Lecithoepitheliata': Prorhynchida: Prorhynchidae. The families Alicorhagiidae and Prorhynchidae both represent new taxa in the fauna of the country.

  12. Secondary structure of expansion segment D1 in LSU rDNA from Arachnida and its phylogenetic application in Eriophyoid mites and in Acari.

    Science.gov (United States)

    Wang, Zheng-Hang; Zhao, Ya-E; Xu, Yang; Hu, Li; Chen, Yi-Meng

    2015-12-01

    An increasing number of researchers have applied secondary-structure based multiple alignments of rDNA genes in phylogeny. These studies mostly depended on a few valuable divergent domains in LSU and SSU rDNA. Yet other divergent domains, e.g. D1, were poorly investigated and rarely used. However, these domains might contain additional evolutionary data and play a vital role in DNA-based phylogenetic study. Here, we investigated all available D1 sequences of Arachnida taxa and predicted corresponding secondary structures to help identify homologous positions in the D1 region. Long insertions were found exclusive to Eriophyoidea and folded into three newly proposed helices. Non-Acari taxa were all GC rich. In Acari, most Trombidiformes and all Mesostigmata (Parasitiformes) taxa were AT rich and Ixodida (Parasitiformes) GC rich; however there was no consistent base bias in Sarcoptiformes sequences. For Eriophyoid mites, genera Cecidophyopsis and Aceria were both well supported in MP, NJ, ME and ML tress based on D1 sequences, and clusters of Cecidophyopsis species were identical with former study. This demonstrated that the D1 region could act as a valuable molecular marker in phylogenetic reconstruction of Eriophyoidea. Additionally, D1 has been proven suitable in phylogenetic analysis at the family and genus level in Acari, but not in Opiliones.

  13. Effects of Insecticides and Fungicides Commonly Used in Tomato Production on Phytoseiulus persimilis (Acari: Phtyoseiidae).

    Science.gov (United States)

    Ditillo, J L; Kennedy, G G; Walgenbach, J F

    2016-12-01

    The twospotted spider mite, Tetranychus urticae Koch (Acari: Tetranychidae), is an important pest of tomatoes in North Carolina. Resident populations of the predatory mite Phytoseiulus persimilis have recently been detected on field-grown tomatoes in central North Carolina, and potentially can be a useful biological control agent against T. urticae Laboratory bioassays were used to assess lethal and reproductive effects of 10 insecticides and five fungicides commonly used in commercial tomato production (chlorantraniliprole, spinetoram, permethrin, imidacloprid, dimethoate, dinotefuran, thiamethoxam, bifenthrin, fenpropathrin, lambda-cyhalothrin, azoxystrobin, chlorothalonil, boscalid, cyazofamid, and mancozeb) on P. persimilis adult females and eggs. Insecticides were tested using concentrations equivalent to 1×, 0.5×, and 0.1× of the recommended field rates. Fungicides were tested at the 1× rate only. Dimethoate strongly impacted P. persimilis with high adult mortality, reduced fecundity, and reduced hatch of eggs laid by treated adults, particularly at high concentrations. The pyrethroids lambda-cyhalothrin, bifenthrin, and fenpropathrin were associated with repellency and reproductive effects at high concentrations. Bifenthrin additionally caused increased mortality at high concentrations. Chlorantraniliprole, dinotefuran, and permethrin did not significantly affect mortality or reproduction. Imidacloprid significantly reduced fecundity and egg viability, but was not lethal to adult P. persimilis Thiamethoxam negatively impacted fecundity at the 1× rate. There were no negative effects associated with fungicide exposure with the exception of mancozeb, which impacted fecundity. Field trials were conducted to explore the in vivo impacts of screened insecticides on P. persimilis populations in the field. Field trials supported the incompatibility of dimethoate with P. persimilis populations. © The Authors 2016. Published by Oxford University Press on behalf

  14. Bacterial diversity in Amblyomma americanum (Acari: Ixodidae) with a focus on members of the genus Rickettsia.

    Science.gov (United States)

    Heise, Stephanie R; Elshahed, M S; Little, S E

    2010-03-01

    The lone star tick, Amblyomma americanum (Acari: Ixodidae), is commonly reported from people and animals throughout the eastern U.S. and is associated with transmission of a number of emerging diseases. To better define the microbial communities within lone star ticks, 16S rRNA gene based analysis using bacteria-wide primers, followed by sequencing of individual clones (n = 449) was used to identify the most common bacterial operational taxonomic units (OTUs) present within colony-reared and wild A. americanum. The colony-reared ticks contained primarily sequence affiliated with members of the genus Coxiella (89%; 81/91), common endosymbionts of ticks, and Brevibacterium (11%; 10/91). Similarly, analysis of clones from unfed wild lone star ticks revealed that 96.7% (89/92) of all the OTUs identified were affiliated with Coxiella-like endosymbionts, as compared with only 5.1-11.7% (5/98-9/77) of those identified from wild lone star ticks after feeding. In contrast, the proportion of OTUs identified as Rickettsia sp. in wild-caught ticks increased from 2.2% (2/92) before feeding to as high as 46.8% (36/77) after feeding, and all Rickettsia spp. sequences recovered were most similar to those described from the spotted fever group Rickettsia, specifically R. amblyommii and R. massiliae. Additional characterization of the Rickettsiales tick community by polymerase chain reaction, cloning, and sequencing of 17 kDa and gltA genes confirmed these initial findings and suggested that novel Rickettsia spp. are likely present in these ticks. These data provide insight into the overall, as well as the rickettsial community of wild lone star ticks and may ultimately aid in identification of novel pathogens transmitted by A. americanum.

  15. Pest management systems affect composition but not abundance of phytoseiid mites (Acari: Phytoseiidae) in apple orchards.

    Science.gov (United States)

    Szabó, Árpád; Pénzes, Béla; Sipos, Péter; Hegyi, Tamás; Hajdú, Zsuzsanna; Markó, Viktor

    2014-04-01

    We examined the faunal composition and abundance of phytoseiid mites (Acari: Phytoseiidae) in apple orchards under different pest management systems in Hungary. A total of 30 apple orchards were surveyed, including abandoned and organic orchards and orchards where integrated pest management (IPM) or broad spectrum insecticides (conventional pest management) were applied. A total of 18 phytoseiid species were found in the canopy of apple trees. Species richness was greatest in the organic orchards (mean: 3.3 species/400 leaves) and the least in the conventional orchards (1.4), with IPM (2.1) and abandoned (2.7) orchards showing intermediate values. The phytoseiid community's Rényi diversity displayed a similar pattern. However, the total phytoseiid abundance in the orchards with different pest management systems did not differ, with abundance varying between 1.8 and 2.6 phytoseiids/10 leaves. Amblyseius andersoni, Euseius finlandicus, and Typhlodromus pyri were the three most common species. The relative abundance of A. andersoni increased with the pesticide load of the orchards whereas the relative abundance of E. finlandicus decreased. The abundance of T. pyri did not change in the apple orchards under different pest management strategies; regardless of the type of applied treatment, they only displayed greater abundance in five of the orchards. The remaining 15 phytoseiid species only occurred in small numbers, mostly from the abandoned and organic orchards. We identified a negative correlation between the abundance of T. pyri and the other phytoseiids in the abandoned and organic orchards. However, we did not find any similar link between the abundance of A. andersoni and E. finlandicus.

  16. Effect of Pollen from Different Plant Species on Development of Typhlodromus pyri (Sheuten (Acari: Phytoseiidae Efecto del Polen de Diferentes Especies Vegetales sobre el Desarrollo de Typhlodromus pyri (Sheuten (Acari: Phytoseiidae

    Directory of Open Access Journals (Sweden)

    Paulina Bermúdez

    2010-09-01

    Full Text Available Typhlodromus pyri (Sheuten (Acari: Phytoseiidae is a phytoseiid mite with a high potential in controlling the false Chilean mite (Brevipalpus chilensis Baker; Acari: Tenuipalpidae. The purpose of this study was to determine the effect of different plant species pollen as a complementary food in the development of T. pyri when its prey is in low levels of availability. Mites were individually placed on black plastic boxes with pollen and maintained at a temperature of 26 ± 2 °C, 70 ± 5% relative humidity (RH, and a photoperiod of 16:8 h (L:D. Postembryonic development of T. pyri was studied in 11 pollen species, as well as in a mixed diet of Hirschfeldia incana (L. and B. chilensis. Results show that H. incana was the only pollen in which there was no mortality (P > 0.05 along with the control (Oxalis pes-caprae L.. Mean duration from egg to adult with H. incana was 8.70 ± 1.66 d, protonymph 3.27 ± 0.21 d, and deutonymph 2.90 ± 1.45 d (P > 0.05. The mix feeding of T. pyri did not show any significant differences neither in the mean time from egg to adult, nor in mortality by feeding only with B. chilensis. Survival curves of T. pyri fed only with H. incana pollen, combined with B. chilensis, and only with B. chilensis are higher in the first 14 d of life. The sex ratio was not significantly affected by being fed only with H. incana pollen, B. chilensis, or by a combination of both.Typhlodromus pyri (Sheuten (Acari: Phytoseiidae es un ácaro que presenta un alto potencial de uso para el control de la falsa arañita roja de la vid (Brevipalpus chilensis Baker; Acari: Tenuipalpidae. El objetivo de este estudio fue determinar el efecto del polen de diferentes especies vegetales como alimento complementario para T. pyri cuando escasea su presa. Los parámetros post-embrionarios de T. pyri se estudiaron en 11 especies de polen, en una dieta mixta de polen de Hirschfeldia incana (L. y B. chilensis. Los ácaros se colocaron individualmente sobre

  17. Acari; Tetranychidae

    African Journals Online (AJOL)

    do not specifically target T. urticae in terms of control but use insecticides at high dosages ... leaves were taken from the plants and sprayed with serial dilutions of the ... The LD50 values and slopes were determined using probit analysis and ...

  18. Primer registro del hongo Neozygites sp. (Zygomycota: Entomophthorales, patógeno de Tetranychus urticae (Acari: Tetranychidae en la República Argentina First record of Neozygites sp. (Zygomycota: Entomophthorales, pathogen of Tetranychus urticae (Acari: Tetranychidae in Argentina

    Directory of Open Access Journals (Sweden)

    Ana C. Scorsetti

    Full Text Available En el presente trabajo se cita por primera vez para la Argentina la presencia del hongo entomopatógeno Neozygites cf. floridana (Zygomycota: Zygomycetes: Entomophthorales como patógeno de la «arañuela roja», Tetranychus urticae (Acari: Tetranychidae, importante plaga de cultivos hortícolas en la región. Los muestreos fueron realizados en el cinturón hortícola del Gran La Plata sobre cultivos de tomate, pimiento, berenjena, y otras hortalizas. El material de herbario, como preparaciones microscópicas y ácaros infectados fue depositado en el Herbario del Instituto de Botánica C. Spegazzini y en el herbario micológico del CEPAVE. Este trabajo contribuye a ampliar la distribución y el espectro de hospedadores de Neozygites , así como ampliar la información de los hongos entomopatógenos en la Argentina.In this paper, the presence of the fungi Neozygites cf. floridana (Zygomycota: Zygomycetes: Entomophthorales, as pathogen of the mite Tetranychus urticae (Acari: Tetranychidae, is recorded for first time in Argentina. Samplings were carried out in La Plata , on tomato, pepper, egg-plant, and other horticultural crops. Microscopic slides and mites infected were placed in the Herbarium of the Institute of Botany C. Spegazzini and in the Herbarium of CEPAVE. This work contributes to further expand the distribution and the host range of Neozygites as well as the information of entomopathogenic fungi in Argentina.

  19. SELETIVIDADE DE INSETICIDAS A Neoseiulus californicus MCGREGOR (ACARI: PHYTOSEIIDAE EM MACIEIRA, NO RIO GRANDE DO SUL AGROCHEMICAL SELECTIVITY TO Neoseiulus californicus MCGREGOR (ACARI: PHYTOSEIIDAE ON APPLE IN RIO GRANDE DO SUL

    Directory of Open Access Journals (Sweden)

    LINO BITTENCOURT MONTEIRO

    2001-12-01

    Full Text Available Testes para determinar os efeitos de agroquímicos homologados para macieira foram realizados em laboratório sobre Neoseiulus californicus (Acari: Phytoseiidae. Os indivíduos testados foram coletados de um pomar comercial da Agriflor Ltda, em Vacaria, Rio Grande do Sul, após várias liberações inoculativas. Os inseticidas utilizados foram os tradicionalmente recomendados para o controle de pragas, principalmente mosca-das-frutas Anastrepha fraterculus (Diptera: Tephritidae. A oviposição e a mortalidade dos ácaros foram avaliadas 12; 24; 48 e 96 horas após a pulverização, cujos produtos foram classificados em quatro classes de toxicidade (IOBC/WPRS. Azinphos ethyl, deltametrina e fenthion provocaram 100% de mortalidade, sendo que dimethoate, fenitrotion, paration, phosmet e triclorfon foram levemente nocivos (classe 2. Malation foi considerado neutro para esta população.The side-effects of agrochemical to Neoseiulus californicus (Acari: Phytoseiidae were studied in laboratory. The mites were collected in commercial apple orchard of Agropastoril Rincão das Flores, in Vacaria, Rio Grande do Sul, Brazil, after successive inoculative releases. The insecticids used were recommended to control of same pest, as Anastrepha fraterculus (Diptera: Tephritidae. The reproduction effect and mortality were evalued 12, 24, 48 and 96 hours after pulverization, while the agrochemical were ranked in toxicity classes, according to IOBC/WPRS. Azinphos ethyl, deltametrina e fenthion were harmful with ca. 100% of mortality in 24 hours, dimethoate, fenitrotion, paration, phosmet e triclorfon were slightly harmful (class 2. Malation was harmless.

  20. TAMBO VIEJO: UN ASENTAMIENTO FORTIFICADO EN EL VALLE DE ACARÍ, PERÚ (Tambo Viejo: A Fortified Settlement in the Acari Valley, Peru

    Directory of Open Access Journals (Sweden)

    Lidio M. Valdez

    2013-10-01

    Full Text Available La aparición de los asentamientos fortificados y el origen del conflicto violento son temas poco discutidos en el contexto de la arqueología peruana. Considero que es oportuno investigar y determinar cuándo y por qué surgieron los primeros asentamientos fortificados. El propósito central de este artículo está precisamente orientado a responder tales interrogantes y discutir el tema del conflicto violento en el valle de Acarí y, por extensión, en la costa sur del Perú. Las evidencias arqueológicas disponibles señalan que, durante el periodo Intermedio Temprano, Tambo Viejo fue un asentamiento defendido por varias estructuras perimétricas. Otros sitios contemporáneos de Tambo Viejo en Acarí también fueron fortificados. Además, existe en el mismo valle evidencia tangible de violencia en la forma de prisioneros que posteriormente fueron decapitados. En contraste a la evidencia proveniente de Acarí, no existen asentamientos del periodo Intermedio Temprano identificables como fortificaciones, lo que hace de los sitios de Acarí los primeros asentamientos fortificados de toda la costa sur. ENGLISH: The emergence of violent conflict and of fortified settlements is a subject little studied within Peruvian archaeology. However, I consider it vital to investigate and determine the time and the reasons under which fortified settlements were first established. The central aim of this paper is to discuss when and why fortified settlements emerged first in the Acari Valley and, by extension, in the south coast of Peru. Available archaeological evidence indicates that during the Early Intermediate Period, Tambo Viejo was a fortified settlement protected by several massive walls. Other neighbouring sites in Acari were also fortified. Furthermore, in Acari there is conclusive evidence for violence in the form of decapitated individuals. In contrast to evidence coming from Acari, not a single Early Intermediate Period settlement from other

  1. Demodex castoris sp. nov. (Acari: Demodecidae) parasitizing Castor fiber (Rodentia), and other parasitic arthropods associated with Castor spp.

    Science.gov (United States)

    Izdebska, Joanna N; Fryderyk, Sławomira; Rolbiecki, Leszek

    2016-02-11

    A new species of demodecid mite, Demodex castoris sp. nov. (Acari: Prostigmata: Demodecidae), is described based on adult stages from the skin of the nasal region of the Eurasian beaver Castor fiber Linnaeus, 1758, collected in Poland. This is the first detection of a representative demodecid mite in rodents of the suborder Castorimorpha and also represents the first detection of a skin mite in Eurasian beavers. The new species is a small skin mite (average 173 µm in length) characterized by sexual dimorphism related to body proportions. D. castoris sp. nov. was observed in 4 out of 6 beavers examined (66.6%), with a mean intensity of 10.8 and an intensity range of 2-23 ind. host(-1). This paper also contains a checklist of parasitic arthropods known from Castor spp.

  2. Detection of naturally infected vector ticks (acari: ixodidae by different species of babesia and theileria agents from three different enzootic parts of iran.

    Directory of Open Access Journals (Sweden)

    Mohammad Abdigoudarzi

    2013-12-01

    Full Text Available Diagnostic study of vector ticks for different pathogens transmitted specifically have been done by Iranian old scientists working on the basis of biological transmission of pathogens. In this study we decided to confirm natural infection of different collected ticks from three different provinces of Iran.Ticks were collected from livestock (sheep, goats and cattle during favorable seasons (April to September 2007 and 2008. Slide preparations were stained by Giemsa and Feulgen and were studied searching for any trace of infection. Positive DNA from infected blood or tissue samples was provided and was used as positive control. First, PCR optimization for positive DNA was done, and then tick samples were subjected to specific PCR.Eleven pairs of primers were designed for detection of Theileria, Babesia and Anaplasma spp. Totally 21 tick samples were detected to be infected with protozoa. Hyalomma anatolicum anatolicum and Rhipicephalus turanicus from Fars Province were infected with T. lestoquardi at two different places. Hyalomma detritum was infected with T. lestoquardi in Lorestan Province and Rh. turanicus was infected to Ba. ovis from Fars Province.Totally 21 tick samples were detected to be infected with protozoa. Every sample is regarded with host-environment related factors. Since there are complex relations of vectors and their relevant protozoa, different procedures are presented for future studies.

  3. Chlorotic spots on Clerodendrum, a disease caused by a nuclear type of Brevipalpus (Acari:Tenuipalpidae) transmitted virus Mancha clorótica do Clerodendrum, uma enfermidade causada por um vírus do tipo nuclear, transmitido pelo ácaro Brevipalpus phoenicis (Acari:Tenuipalpidae)

    OpenAIRE

    Elliot Watanabe Kitajima; Karen Sumire Kubo; Paulo de Tarso de Oliveira Ferreira; Berenice Kussumoto de Alcântara; Alessandra de Jesus Boari; Renata Takassugi Gomes; Juliana Freitas-Astua; Jorge Alberto Marques Rezende; Gilberto José de Morais; Renato Barbosa Salaroli

    2008-01-01

    Chlorotic spots have been observed in plants of Clerodendrum x speciosum growing in residential gardens and parks in Piracicaba, SP, Brazil. Thin sections of diseased tissues revealed characteristic cytopathic effects of the nuclear type of the Brevipalpus (Acari: Tenuipalpidae) mite-transmitted viruses (BTrV). Brevipalpus mites, identified as B. phoenicis, infesting symptomatic C. x speciosum plants transmitted the pathogen to healthy C. x speciosum and to C. thomsonae, Gomphrena globosa, Hi...

  4. Comparative residual toxicities of pesticides to the predator Agistemus industani (Acari: Stigmaeidae) on citrus in Florida.

    Science.gov (United States)

    Childers, C C; Villanueva, R; Aguilar, H; Chewning, R; Michaud, J P

    2001-01-01

    Residual toxicities of registered and selected experimental pesticides used on citrus against Agistemus industani Gonzalez (Acari: Stigmaeidae) were compared. Pesticides considered highly toxic to A. industani were: abamectin 0.15 EC at 731 ml/ha + FC 435-66 petroleum oil at 46.8 l/ha, pyridaben 75 WP at 469 g/ha, ethion 4 EC at 7.01 l/ha + FC 435-66 petroleum oil at 46.8 l/ha, propargite 6.55 EC at 3.51 l/ha, chlorfenapyr 2 SC at 1.46 l/ha applied alone or in combination with FC 435-66 petroleum oil at 46.8 l/ha, sulphur 80 DF at 16.81 kg/ha. dicofol 4EC at 7.01 l/ha, fenbutatin oxide 50 WP at 2.24 kg/ha, benomyl 50 WP at 2.24 kg/ha, benomyl 50 WP at 1.68 kg/ha + ferbam 76 GF at 5.60 kg/ha, ferbam 76 GF at 11.21 kg/ha, neem oil 90 EC at 46.8 l/ha, and copper hydroxide DF (40% metallic copper) at 4.48 kg metallic copper/ha + FC 435-66 petroleum oil at 46.8 l/ha. Pesticides that were moderately to slightly toxic included: copper sulphate 98% at 4.48 kg metallic copper/ha + FC 435-66 petroleum oil at 46.8 l/ha, fenbuconazole 2 F at 280 ml/ha + FC 435-66 petroleum oil at 46.8 l/ha, FC 435-66 petroleum oil applied alone at 46.8 l/ha or 23.41/ha, and diflubenzuron 25 WP at 1.40 kg/ha. Pesticides that were non-toxic included: fenbuconazole 2 F at 585 ml/ha, malathion 57 EC at 5.85 l/ha, FC 435-66 petroleum oil at 46.8 l/ha, carbaryl 80 S at 3.36 kg/ha. chlorpyrifos 4 EC at 4.68 l/ha, and formetanate 92 SP at 1.12 kg/ha. Understanding the toxic effects of field weathered pesticides against key predacious mite species is important for effective IPM. The results of this study provide a comparison of direct and indirect toxic effects of various pesticides to A. industani under field conditions.

  5. Bazı bitkisel kökenli uçucu yağların Tetranychus cinnabarinus (Boisduval, 1867) (Acari: Tetranychidae) üzerine kontakt ve repellent etkileri

    OpenAIRE

    TOPUZ, Emine; MADANLAR, Nilgün

    2010-01-01

    In this study, contact and repellent effects of 5 different plant essential oils against Tetranychus cinnabarinus (Boisduval, 1867) (Acari: Tetranychidae) were investigated under laboratory conditions. Essential oils of aerial parts, leaves or seeds of Mentha pulegium Linnaeus (Labiatae), Foeniculum vulgare Miller (Umbellifera), Pistacia terebinthus Linnaeus (Anacardiaceae), Schinus molle Linnaeus (Anacardiaceae) and Vitex agnus-castus Linnaeus (Verbenaceae) plants, grown around Antalya regio...

  6. Determination of hard tick species (Acarina:Ixodidae) on sheep and cattle in Hamedan Province, Iran

    Institute of Scientific and Technical Information of China (English)

    Jamal Gharekhani; Abbas Gerami-Sadeghian; Zivar Sadeghi-Dehkordi; Mohammadreza Youssefi

    2015-01-01

    Objective: To determine the fauna and frequency of hard tick species on sheep and cattle in Hamedan Province, Western Iran. Methods: Tick sampling was performed on the whole body of 18000 sheep and 4200 cattle in 3 rural regions (mountain, plateau, and plain-mountainous zone) during the year of 2010 to 2011. The ticks were identified with appropriate identification keys. Results: A total of 1534 hard ticks (62.1% male and 37.9% female) were collected in animals. The infestation rate was found 2.4% in animals (4.2% in cattle and 2.0% in sheep). The ticks were classified into 3 genera and 7 species including: Hyalomma marginatum (34.1%), Hyalomma excavatum (29.7%), Rhipicephalus bursa (13.8%), Rhipicephalus sanguineus (7.5%), Hyalomma detritum (7.1%), Haemaphysalis punctata (5.1%) and Hyalomma dromedarii (2.7%). Conclusions: Current study is the first report of fauna and frequency of hard ticks in this region. The results showed that Hyalomma marginatum is the dominant hard tick species. Further studies are needed to determine the importance of Ixodidae ticks of veterinary and public health in this region of Iran.

  7. High infection of Anaplasma and Ehrlichia spp. among tick species collected from different geographical locations of Iran

    Directory of Open Access Journals (Sweden)

    Leila Tajedin

    2016-10-01

    Full Text Available Objective: To ascertain the prevalence of the Anaplasma/Ehrlichia infections in tick population within four provinces of Iran. Methods: A total of 384 tick specimens were collected from domestic animals inhabiting in four provinces (East Azerbaijan, Gilan, South Khorasan and Yazd. Specimens were identified based on morphological analysis. The detection of Anaplasma spp./Ehrlichia spp. within tick samples was carried out by nested PCR amplification of the 16S ribosomal RNA gene accompanied by DNA sequencing and analysis for verification. Results: A total of 10 tick species were identified as follows: Ornithodoros lahorensis (O. lahorensis (44.8%, Hyalomma dromedarii (15.6%, Dermacentor marginatus (13.5%, Hyalomma anatolicum (11.2%, Hyalomma asiaticum (5.7%, Hyalomma marginatum (4.9%, Rhipicephalus sanguineus (2.3%, Hyalomma detritum (1.0%, Dermacentor niveus (0.5% and Argas persicus (0.3%. The percentage distribution of Anaplasma/Ehrlichia was 55.5% (213 across 384 studied ticks. Conclusions: To the best of our knowledge, this is the first report of Anaplasma ovis infection in O. lahorensis in Iran. We also conjecture the prevalence of Ehrlichia spp. in Yazd Province based on sequencing results; also, it is suggested that O. lahorensis is a potential vector in the studied area. This survey highlights the importance of Argasidae family to verify and correlate their threat in causing anaplasmosis and other diseases in animals.

  8. A Preliminary Investigation on Ticks (Acari: Ixodidae) Infesting Birds in Kızılırmak Delta, Turkey.

    Science.gov (United States)

    Keskin, Adem; Erciyas-Yavuz, Kiraz

    2016-01-01

    Ticks are mandatory blood-feeding ectoparasites of mammals, birds, reptiles, and even amphibians. Turkey has a rich bird fauna and is located on the main migration route for many birds. However, information on ticks infesting birds is very limited. In the present study, we aimed to determine ticks infesting birds in Kızılırmak Delta, Turkey. In 2014 autumn bird migration season, a total of 7,452 birds belonging to 79 species, 52 genera, 35 families, and 14 orders were examined for tick infestation. In total, 287 (234 larvae, 47 nymphs, 6♀) ticks were collected from 54 passerine birds (prevalence = 0.72%) belonging to 12 species. Ticks were identified as Amblyomma sp., Dermacentor marginatus (Sulzer), Haemaphysalis concinna Koch, Haemaphysalis punctata Canestrini and Fanzago, Hyalomma sp., Ixodes frontalis (Panzer), and Ixodes ricinus (L). The most common tick species were I. frontalis (223 larvae, 23 nymphs, 6♀) followed by I. ricinus (3 larvae, 12 nymphs) and H. concinna (4 larvae, 6 nymphs). Based on our results, it can be said that Erithacus rubecula (L.) is the main host of immature I. frontalis, whereas Turdus merula L. is the most important carrier of immature stages of some ticks in Kızılırmak Delta, Turkey. To the best of our knowledge, most of the tick-host associations found in this study have never been documented in the literature.

  9. Detection of two Bartonella tamiae-like sequences in Amblyomma americanum (Acari: Ixodidae) using 16S-23S intergenic spacer region-specific primers.

    Science.gov (United States)

    Billeter, Sarah A; Miller, Melissa K; Breitschwerdt, Edward B; Levy, Michael G

    2008-01-01

    Four hundred and sixty-six questing Amblyomma americanum (L.) (Acari: Ixodidae) from Carolina County, VA, and 98 questing A. americanum from Chatham County, NC, were screened by polymerase chain reaction (PCR) for the Bartonella 16S-23S intergenic spacer region. Two amplicons, approximately 270-280 bp, were detected in two ticks from Virginia. Based upon PCR and sequencing, an adult male and adult female tick harbored DNA sequences closely related to Bartonella tamiae (DQ395180). Bartonella DNA was not detected in A. americanum from North Carolina. Potential transmission of Bartonella spp. by A. americanum should be the focus of future experimental studies.

  10. Avaliação de extratos vegetais no controle de Oligonychus ilicis (McGregor, 1917) (Acari: Tetranychidae) em laboratório

    OpenAIRE

    Carvalho, Thaiana Mansur Botelho de; EPAMIG-CTSM/EcoCentro; Reis, Paulo Rebelles; EPAMIG-CTSM/EcoCentro; Oliveira, Denilson Ferreira de; Universidade Federal de Lavras - UFLA; Carvalho, Geraldo Andrade; Universidade Federal de Lavras - UFLA; Carvalho, Douglas Antônio de; Universidade Federal de Lavras - UFLA

    2008-01-01

    Oligonychus ilicis (McGregor, 1917) (Acari: Tetranychidae) já foi referido como a segunda praga em importância para o cafeeiro Conillon, considerado mais sensível ao ácaro que o Arábica. A aplicação de pesticidas sintéticos no seu controle pode provocar impactos negativos ao ambiente e ao homem. Alternativamente ao uso de tais produtos, surgem outros menos impactantes, como por exemplo, extratos de plantas. Com o presente trabalho, teve-se por objetivo avaliar o efeito de extratos de plantas ...

  11. [The first report of Amblyomma fuscum Neumann, 1907 (Acari Ixodidae) on the lizard Tupinambis teguixin (L.) at the Municipality of Glorinha, State of Rio Grande do Sul, Brazil].

    Science.gov (United States)

    Martins, João R; Monticelli, Elida C; Onofrio, Valéria C; Barros-Battesti, Darcy M; Doyle, Rovaina L

    2007-01-01

    Amblyomma fuscum known only from Brazil has been described as a rare tick species with few reports of its occurrence in South and Southeast region. This is a new records this tick species (9 females) parasitizing lizard (Tupinambis teguixin) at the Municipality of Glorinha, State of Rio Grande do Sul. The females were deposited in the tick collection of Veterinary Research Institute Desiderio Finamor (7 specimens), Eldorado do Sul, RS and in the Acari collection from Instituto Butantan, São Paulo, State of São Paulo (2 specimens). The finding confirms establishment de A. fuscum in the South of Brazil.

  12. Otoacariasis due to Edentalges bradypus Fonseca 1954 (Acari; Psoroptidae) infestation in the brown-throated three-toed sloth Bradypus variegatus from Brazil.

    Science.gov (United States)

    de Souza, Clarissa Pimentel; Verocai, Guilherme Gomes; de Arruda, Julio Almeida Alencar Matos; Pires, Jeferson Rocha; Takitani, Andréa Yuri; Faccini, João Luiz Horacio

    2009-09-01

    The aim of this paper is to report the first description of gross pathological aspects of otoacariasis due to Edentalges bradypus Fonseca 1954 (Acari; Psoroptidae) infestation in the brown-throated three-toed sloth Bradypus variegatus Schinz, 1825 (Xenarthra; Bradypodidae) in Brazil. Mites were collected from massive skin crusts seen in both external ear canals and around both eyes of an extremely debilitated advanced-aged female sloth brought to the Wildlife Care Section of Universidade Estácio de Sá, Rio de Janeiro, Brazil.

  13. [Morphological adaptations of acariform mites (Acari: Acariformes) to permanent parasitism on mammals].

    Science.gov (United States)

    Bochkov, A V

    2007-01-01

    The external morphological adaptations to parasitism in acariform mites (Acari: Acariformes), permanently parasiting mammals, are briefly summated and analyzed. According to several external morphological criteria (structures of gnathosoma, idiosoma, setation, legs and life cycle), the following six morphoecotypes were established: skin mites (i)-- Cheyletidae, Chirorhynchobiidae, Lobalgidae, Myobiidae, Myocoptidae (the most part), Rhyncoptidae, Psoroptidae; fur mites (ii)--Atopomelidae, Clirodiscidae, Listrophoridae, Myocoptidae (Trichoecius only); skin burrowing mites (iii)--Sarcoptidae; intradermal mites (iv) - sorergatidae and Demodicidae; interstitial mites (v) - pimyodicidae; respiratory mites (vi) - reynetidae, Gastronyssidae, Lemurnyssidae, Pneumocoptidae. In the case of prostigmatic mites, the detailed reconstruction of the origin and evolution of "parasitic" morphoecotypes is possible due to the tentative phylogenetic hypotheses, which were proposed for the infraorder Eleutherengon, a, including the most part of the permanent mammalian parasites among prostigmatic mites (Kethley in Norton, 1993; Bochkov, 2002). The parasitism of Speleognathinae (Ereynetidae) in the mammalian respiratory tract arose independently of the other prostigmats. It is quite possible that these mites switched on mammals from birds, because they are more widely represented on these hosts than on mammals. The prostigmatic parasitism on mammalian skin seems to be originated independently in myobiids, in the five cheyletid tribes, Cheyletiellini, Niheliini, and Teinocheylini, Chelonotini, Cheyletini, and, probably, in a cheyletoid ansector of the sister families Psorergatidae-Demodicidae (Bochkov, Fain, 2001; Bochkov, 2002). Demodicids and psorergatids developed adaptations to parasitism in the skin gland ducts and directly in the epithelial level, respectively in the process of the subsequent specialization. Mites of the family Epimyodicidae belong to the phylogenetic line

  14. New Miticides for Integrated Pest Management of Varroa destructor (Acari: Varroidae) in Honey Bee Colonies on the Canadian Prairies.

    Science.gov (United States)

    Vandervalk, L P; Nasr, M E; Dosdall, L M

    2014-12-01

    Varroa destructor Anderson and Trueman 2000 (Acari: Varroidae) is an ectoparasitic mite of the honey bee, Apis mellifera L. (Hymenoptera: Apidae). Honey bee colonies require extensive management to prevent mortality caused by varroa mites and the viruses they vector. New miticides (Thymovar and HopGuard) to manage varroa mites were evaluated during the spring and fall treatment windows of the Canadian prairies to determine their effectiveness as part of an integrated management strategy. Thymovar and HopGuard were evaluated alongside the currently used industry standards: Apivar and formic acid. Results demonstrated that Apivar and formic acid remain effective V. destructor management options under spring and fall conditions. Applications of Thymovar during spring were associated with a reduction in brood area, and therefore should be limited to the fall season. The miticide HopGuard was not effective in managing V. destructor, and alteration of the current delivery system is necessary. This study demonstrates the potential for new effective treatment options to supplement currently used V. destructor integrated pest management systems.

  15. The role of the bacterial community in the nutritional ecology of the bulb mite Rhizoglyphus robini (Acari: Astigmata: Acaridae).

    Science.gov (United States)

    Zindel, Renate; Ofek, Maya; Minz, Dror; Palevsky, Eric; Zchori-Fein, Einat; Aebi, Alexandre

    2013-04-01

    The biology of many arthropods can only be understood when their associated microbiome is considered. The nutritional requirements of the bulb mite Rhizoglyphus robini Claparede (Acari: Astigmata: Acaridae) in the laboratory have been shown to be very easily satisfied, and in the field the mites prefer fungus-infected over uninfected plants. To test whether symbiotic bacteria facilitate the survival of R. robini on a temporarily nutritionally unbalanced diet, we investigated the composition of its microbiome. Using 454 pyrosequencing of 16S rRNA gene fragments, 3 genera were found to dominate the bacterial community: Myroides (41.4%), Serratia (11.4%), and Alcaligenes (4.5%); the latter 2 are known to include chitinase-producing species. Laboratory experiments demonstrated that mite fecundity is significantly higher (2 times) on fungus than on controls (sterilized potato dextrose agar and filter paper). Also, when mite homogenate was applied to a chitin layer, the halo produced through degradation was clearly visible, while the saline control did not produce a halo. We thus concluded that R. robini utilizes fungal chitin, at least to a certain extent, as a food source with the help of its associated bacteria. This information supports the general concept of multigenome organisms and the involvement of bacteria in the mite's nutritional ecology.

  16. Impact of ectohumus application in birch and pine nurseries on the presence of soil mites (Acari, Oribatida in particular

    Directory of Open Access Journals (Sweden)

    Klimek Andrzej

    2016-03-01

    Full Text Available Intensively used forest nurseries are characterised by degradation processes that lead to a drop in the quality of seedlings. The main reason of this problem is a decrease in biological soil diversity. Therefore, an attempt of nursery soil enrichment by introducing ectohumus – as compost and fresh litter – from the pine forest was carried out. The research was carried out in 2009–2011 in the Bielawy forest nursery near the city of Toruń, Poland. The objective of the study was to determine the impact of organic fertilisation (compost made up of forest humus and mulching using fresh ectohumus on the density and community composition of Acari mites and on species composition of oribatid mites (Oribatida in the nurseries of silver birch and Scots pine. Mites, especially oribatid mites, were treated as bioindicators of soil biological activity. Research has shown that mulching using fresh ectohumus caused a multiple increase in the density of mites, especially in saprophagous mites Oribatida. Oribatid mites were clearly more numerous in birch cultivation than in that of pine. Overall, 27 species of oribatid mites were found. Mulching resulted in a significant growth in species diversity in both cultivations. The most numerous oribatid mite in the area under the study was Oribatula tibialis. This species was present in all plots and showed clear preference for birch cultivation. Tectocepheus velatus and Oppiella nova, common and known to be present in a variety of environments, were slightly less numerous.

  17. Development and reproductive potential of Tyrophagus putrescentiae (Acari: Acaridae) on plant-parasitic nematodes and artificial diets.

    Science.gov (United States)

    Abou El-Atta, Doaa Abd El-Maksoud; Osman, Mohamed Ali

    2016-04-01

    This study investigated development, reproduction and life table parameters of the astigmatid mold mite Tyrophagus putrescentiae (Schrank) (Acari: Acaridae) feeding on egg-masses or adult females of the nematode Meloidogyne incognita, egg-masses of the nematode Rotylenchulus reniformis, ras cheese or yeast at 25 ± 1 °C, 70 ± 10 % RH in the dark. Immature developmental times were shorter when the mite was fed females of M. incognita followed by yeast. Different prey/diet types had no significant effect on longevity and lifespan of both males and females. Daily oviposition rate (eggs/female/day) was highest for mites fed yeast (20.8 ± 1.8 eggs) and lowest for mites fed females of M. incognita (6.6 ± 0.5). Intrinsic rate of natural increase (r m) was highest for mites fed yeast compared to other prey/diet; no significant differences in r m were observed among mites fed on non-yeast diets. This result may suggest a role of T. putrescentiae as biocontrol agent of plant-parasitic nematodes and the yeast may be used for mite mass-production purposes.

  18. Relative contribution of biotic and abiotic factors to the population density of the cassava green mite, Mononychellus tanajoa (Acari: Tetranychidae).

    Science.gov (United States)

    Rêgo, Adriano S; Teodoro, Adenir V; Maciel, Anilde G S; Sarmento, Renato A

    2013-08-01

    The cassava green mite, Mononychellus tanajoa, is a key pest of cassava, Manihot esculenta Crantz (Euphorbiaceae), and it may be kept in check by naturally occurring predatory mites of the family Phytoseiidae. In addition to predatory mites, abiotic factors may also contribute to regulate pest mite populations in the field. Here, we evaluated the population densities of both M. tanajoa and the generalist predatory mite Euseius ho DeLeon (Acari: Phytoseiidae) over the cultivation cycle (11 months) of cassava in four study sites located around the city of Miranda do Norte, Maranhão, Brazil. The abiotic variables rainfall, temperature and relative humidity were also recorded throughout the cultivation cycle of cassava. We determined the relative importance of biotic (density of E. ho) and abiotic (rainfall, temperature and relative humidity) factors to the density of M. tanajoa. The density of M. tanajoa increased whereas the density of E. ho remained constant throughout time. A hierarchical partitioning analysis revealed that most of the variance for the density of M. tanajoa was explained by rainfall and relative humidity followed by E. ho density and temperature. We conclude that abiotic factors, especially rainfall, were the main mechanisms driving M. tanajoa densities.

  19. THE EFFECT OF CATTLE LIQUID MANURE FERTILIZATION ON THE SOIL MITES (ACARI OF PERMANENT MEADOW IN POLAND

    Directory of Open Access Journals (Sweden)

    RADOMIR GRACZYK

    2009-06-01

    Full Text Available The effect of different doses of cattle liquid manure, with or without the VIT-TRA agent, on the mites of permanent meadow, with species analysis of oribatid mites (Acari, Oribatida was investigated. Samples were taken from 13 plots, fertilized with cattle liquid manure in doses 40, 60 and 80 m3· ha-1 and VIT-TRA agent. The dose 40 m3· ha-1 increased the abundance of mites, comparing to the control plot, while doses 60 and 80 m3· ha-1 decreased it. The fungicidal agent, with medium and high dose of fertilizer, signifi cantly decreased the density of Oribatida, Gamasida and Actinedida in relation to small dose of fertilizer with this agent. The mites reacted in a similar way to the bactericidal agent, but acting of virocidal agent was indistinct. The Oribatida dominated among the mites, while the Actinedida and Gamasida were less abundant. Among the Oribatida the most abundant were: Parachipteria bella, Liebstadia humerata, Achipteria coleoptrata and Scheloribates laevigatus. The Oribatida preferred the lower part of grasses, and their density distinctly decreased with the soil depth.

  20. SELECTION OF MODELS FOR SEQUENTIAL SAMPLING OF THE TAN-MITE Dichopelmus notus KEIFER (ACARI, ERIOPHYIDAE IN MATE-TEA

    Directory of Open Access Journals (Sweden)

    João Vieira Neto

    2007-09-01

    Full Text Available This research established models for the construction of plans of binomial sequential sampling for the tan-miteDichopelmus notus Keifer (Acari, Eriophyidae in mate-tea orchards. The study was carried out in a ten years old orchard, locatedin Chapecó, Santa Catarina state, Brazil. In three areas of approximately 2,500 m2, 30 plants had been selected randomly. Fortnightly,from January to December, 2004, infestation of D. notus in 18 mature leaves of ten plants in each area were evaluated. Theevaluations were executed directly in the orchard, using lenses (10x and 1 cm2 of fixed field. The lines of the sequential plans wereconstructed using the methodology based on the confidence interval of Iwao (1975, considering the models of Normal Approach withCorrection of Continuity, Normal Approach of Blyth (1986, Approach of Hall (1982 modified by Blyth (1986, Normal Approach ofMolenaar (1973, Normal Approach of Pratt (1968 and Leemis & Trivedi (1996 methodology. The models were evaluatedconsidering amplitude analysis of the confidence intervals. The results had evidenced that the Model of Normal Approach withCorrection of Continuity must preferentiably be used in the elaboration of plans of binomial sequential sampling for the tan-mite inmate-tea orchards.

  1. Transcriptome Analysis of the Carmine Spider Mite, Tetranychus cinnabarinus (Boisduval, 1867 (Acari: Tetranychidae, and Its Response to β-Sitosterol

    Directory of Open Access Journals (Sweden)

    Chunya Bu

    2015-01-01

    Full Text Available Tetranychus cinnabarinus (Acari: Tetranychidae is a worldwide polyphagous agricultural pest that has the title of resistance champion among arthropods. We reported previously the identification of the acaricidal compound β-sitosterol from Mentha piperita and Inula japonica. However, the acaricidal mechanism of β-sitosterol is unclear. Due to the limited genetic research carried out, we de novo assembled the transcriptome of T. cinnabarinus using Illumina sequencing and conducted a differential expression analysis of control and β-sitosterol-treated mites. In total, we obtained >5.4 G high-quality bases for each sample with unprecedented sequencing depth and assembled them into 22,941 unigenes. We identified 617 xenobiotic metabolism-related genes involved in detoxification, binding, and transporting of xenobiotics. A highly expanded xenobiotic metabolic system was found in mites. T. cinnabarinus detoxification genes—including carboxyl/cholinesterase and ABC transporter class C—were upregulated after β-sitosterol treatment. Defense-related proteins, such as Toll-like receptor, legumain, and serine proteases, were also activated. Furthermore, other important genes—such as the chloride channel protein, cytochrome b, carboxypeptidase, peritrophic membrane chitin binding protein, and calphostin—may also play important roles in mites’ response to β-sitosterol. Our results demonstrate that high-throughput-omics tool facilitates identification of xenobiotic metabolism-related genes and illustration of the acaricidal mechanisms of β-sitosterol.

  2. Effect of coconut palm proximities and Musa spp. germplasm resistance to colonization by Raoiella indica (Acari: Tenuipalpidae).

    Science.gov (United States)

    Rodrigues, Jose Carlos Verle; Irish, Brian M

    2012-08-01

    Although coconut (Cocos nucifera L.) is the predominant host for Raoiella indica Hirst (Acari: Tenuipalpidae), false spider mite infestations do occur on bananas and plantains (Musa spp. Colla). Since its introduction, the banana and plantain industries have been negatively impacted to different degrees by R. indica infestation throughout the Caribbean. Genetic resistance in the host and the proximity of natural sources of mite infestation has been suggested as two of the main factors affecting R. indica densities in Musa spp. plantations. Greenhouse experiments were established to try to determine what effect coconut palm proximities and planting densities had on R. indica populations infesting Musa spp. plants. Trials were carried out using potted Musa spp. and coconut palms plants at two different ratios. In addition, fourteen Musa spp. hybrid accessions were evaluated for their susceptibility/resistance to colonization by R. indica populations. Differences were observed for mite population buildup for both the density and germplasm accession evaluations. These results have potential implications on how this important pest can be managed on essential agricultural commodities such as bananas and plantains.

  3. Tick paralysis: first zoonosis record in Egypt.

    Science.gov (United States)

    Mosabah, Amira A Abd El-rahman; Morsy, Tosson A

    2012-04-01

    Tick paralysis caused by the secretion of toxin with saliva while taking a blood meal is an important veterinary disease, but is rare in humans. Although it has certain geographical proclivities, it exists worldwide. Tick paralysis was demonstrated for the first time in Egypt among four children living in rural area at Giza Governorate. The clinical pictures were confused with rabies; myasthensia gravis; botulism; diphtheritic polyneuropathy encountered in rural areas. The recovery of tick infesting the four little children and negative clinical and laboratory data of all diseases denoted tick paralysis. The encountered ticks infesting their animals were Rhipicephalus sanguineus on dogs, Hyalomma dromedarii on camels and Hyalomma anatolicum excavatum and Haemaphysalis sp. on goats. The case was recognized as first record of tick paralysis in Egypt.

  4. Life history of Neoseiulus californicus (McGregor, 1954) (Acari: Phytoseiidae) fed with castor bean (Ricinus communis L.) pollen in laboratory conditions.

    Science.gov (United States)

    Marafeli, P P; Reis, P R; Silveira, E C da; Souza-Pimentel, G C; de Toledo, M A

    2014-08-01

    The predatory mite, Neoseiulus californicus (McGregor, 1954) (Acari: Phytoseiidae) is one of the principal natural enemies of tetranychid mites in several countries, promoting efficient control of those mites in several food and ornamental crops. Pest attacks such as that of the spider mite, Tetranychus urticae Koch, 1836 (Acari: Tetranychidae), is one of the problems faced by farmers, especially in the greenhouse, due to the difficulty of its control with the use of chemicals because of the development of fast resistance making it hard to control it. The objective of this work was to study the life history of the predatory mite N. californicus as a contribution to its mass laboratory rearing, having castor bean plant [Ricinus communis L. (Euphorbiaceae)] pollen as food, for its subsequent use as a natural enemy of T. urticae on a cultivation of greenhouse rosebushes. The studies were carried out in the laboratory, at 25 ± 2°C of temperature, 70 ± 10% RH and a 14 hour photophase. The biological aspects and the fertility life table were appraised. Longevity of 32.9 days was verified for adult females and 40.4 days for males. The intrinsic rate of increase (rm) was 0.2 and the mean generation time (T) was 17.2 days. The population doubled every 4.1 days. The results obtained were similar to those in which the predatory mite N. californicus fed on T. urticae.

  5. Experimental infestation with the immatures of Amblyomma dissimile Koch, 1844 (Acari: Ixodidae on Tropidurus torquatus (Lacertilia: Iguanidae and Oryctolagus cuniculus Infestação experimental com as fases imaturas de Amblyomma dissimile Koch, 1844 (Acari: Ixodidae em Tropidurus torquatus (Lacertilia: Iguanidae e Oryctolagus cuniculus

    Directory of Open Access Journals (Sweden)

    L.H.T. Freitas

    2004-02-01

    Full Text Available Larvas provenientes de duas fêmeas de Amblyomma dissimile Koch, 1844 (Acari: Ixodidae, naturalmente ingurgitadas em uma iguana (Iguana iguana e provenientes do Estado do Mato Grosso, foram utilizadas na infestação experimental de lagartos da espécie Tropidurus torquatus e coelhos domésticos. As larvas alimentadas em ambos os hospedeiros realizaram ecdise para ninfas. As ninfas apenas ingurgitaram no lagarto e mudaram para machos e fêmeas. Este é o primeiro registro do parasitismo de larvas e ninfas de A. dissimile em T. torquatus e de larvas em coelhos.

  6. Seletividade de produtos fitossanitários sobre o ácaro predador Agistemus brasiliensis Matioli, Ueckermann & Oliveira (Acari: Stigmaeidae Selectivity ofthe pesticides tothe predaceous mite Agistemus brasiliensis Matioli,, Ueckermann & Oliveira (Acari: Stigmaeidae

    Directory of Open Access Journals (Sweden)

    Marcos Zatti da Silva

    2009-06-01

    Full Text Available Os ácaros predadores das famílias Phytoseiidae e Stigmaeidae constituem-se nos principais inimigos naturais de Brevipalpus phoenicis (Geijskes em citros. Este ácaro-praga causa sérios prejuízos na produção, devido à transmissão do vírus da leprose dos citros (CiLV. Apesar do grande volume de informações sobre a sensibilidade de ácaros Phytoseiidae a agrotóxicos, praticamente não existem informações sobre o efeito desses compostos em ácaros Stigmaeidae no Brasil. Sendo assim, o trabalho teve por objetivo avaliar o efeito dos principais agrotóxicos utilizados em citros sobre o ácaro predador Agistemus brasiliensis Matioli, Ueckermann & Oliveira (Acari: Stigmaeidae, em condições de laboratório. Arenas de folhas de citros da variedade Pera, contendo 25 fêmeas adultas de A. brasiliensis, foram pulverizadas em torre de Potter. Avaliaram-se as mortalidades dos ácaros 72 horas após a aplicação. O efeito dos produtos na reprodução do acarino e a viabilidade dos ovos também foram avaliados. Quanto à seletividade, conforme proposta da "Organização Internacional para o Controle Biológico" (IOBC, os produtos foram classificados como: classe 1 - inócuo (E99%, calda sulfocálcica, cyhexatin, flufenoxuron, hexythiazox, óxido de fenbutatin, propargite, pyridaben e spirodiclofen. Estudos conduzidos em condições de campo ainda são necessários para se compreender melhor o efeito desses agrotóxicos sobre o ácaro predador.The predaceous mites of the families Phytoseiidae and Stigmaeidae are the most important natural enemies of Brevipalpus phoenicis (Geijskes on citrus. This mite causes serious damages to the yield due to the transmission of Citrus leprosis virus (CiLV. Despite the considerable amount of information on susceptibility of phytoseiids to pesticides, the effect of these compounds is not very known for stigmaeid mites in Brazil. This work was carried out to evaluate the effect of the main pesticides used in

  7. Ocorrência do ácaro fitófago Catarhinus tricholaenae Keifer (Acari: Diptilomiopidae em cultivares de milho Bt Occurrence of the phytophagous mite Catarhinus tricholaenae Keifer (Acari: Diptilomiopidae on Bt corn cultivars

    Directory of Open Access Journals (Sweden)

    Marcos Antônio Matiello Fadini

    2012-09-01

    Full Text Available O objetivo deste trabalho foi avaliar a ocorrência do microácaro-da-face-inferior-das-folhas-de-milho Catarhinus tricholaenae Keifer (Acari: Diptilomiopidae em cultivares transgênicas de milho, contendo as proteínas Cry1F e Cry 1 A(b e milho não Bt. Durante o período de junho de 2010 a janeiro de 2011, foram coletadas, quinzenalmente, cinco amostras aleatórias de quatro folhas em talhões de milho Bt, contendo a proteína Cry 1F e Cry 1 A(b, e de milho não Bt em áreas experimentais da Embrapa Milho e Sorgo, em Sete Lagoas, MG. As amostras de folhas foram vistoriadas por 15 minutos na região da nervura central, em busca de adultos de C. tricholaenae. Foram registrados 2.930 indivíduos de C. tricholaenae, sendo que 1.114 no milho Bt Cry 1F, 753 em Cry 1 A(b e 1063 indivíduos em folhas das cultivares não Bt. As maiores abundâncias populacionais médias ocorreram nos meses de novembro e dezembro. Os fatores estágio fenológico das plantas e precipitação afetaram positivamente a abundância de C. tricholaenae. A abundância média do período de coleta de C. tricholaenae foi reduzida pela cultivar de milho contendo a proteína Cry 1 A(b. Esse é o primeiro registro de ácaros sobre cultivares de milho transgênico no Brasil.The objective of this study was to evaluate the occurrence of "microácaro-da-face-inferior-das-folhas-de-milho" Catarhinus tricholaenae Keifer (Acari: Diptilomiopidae on transgenic cultivars of corn containing proteins Cry1F and Cry 1 A (b and non-Bt corn. During the period from June 2010 to January 2011 were collected, every two weeks, five random samples of four leaves in plots of Bt corn containing the protein Cry 1F and Cry 1 A (b and non-Bt corn in the experimental area of Embrapa Corn and Sorghum, Sete Lagoas, MG. The leaf samples were examined for 15 minutes in the central region of leaf in search of adult C. tricholaenae. We recorded 2930 individuals of C. tricholaenae, 1114 on Bt Cry 1F, 752 on Cry 1 A

  8. Seletividade de agrotóxicos usados na cultura da macieira a Neoseiulus Californicus (McGregor (Acari: Phytoseiidae1 Pesticide selectivity used in apple crops Neoseiulus californicus (McGregor (Acari: Phytoseiidae

    Directory of Open Access Journals (Sweden)

    Geraldine de Andrade Meyer

    2009-06-01

    Full Text Available Objetivou-se avaliar os efeitos secundários dos principais agrotóxicos utilizados em macieira sobre adultos e imaturos de Neoseiulus californicus (McGregor (Acari: Phytoseiidae. Os testes foram conduzidos em laboratório, utilizando as doses dos produtos recomendadas para a cultura e o método de contato e residual com pulverização em superfície de folha. Foram testados tebufenozida, fosmete, metidationa, clorpirifós, abamectina, fenpiroximato, piridabem, captana, mancozebe (duas dosagens e ditianona. Para o cálculo do efeito total (E% sobre os adultos, avaliaram-se a mortalidade, a oviposição e a viabilidade dos ovos, e para os imaturos, somente a mortalidade. Os resultados do E% foram avaliados 96 horas após a pulverização. Os produtos foram classificados quanto ao efeito total (E% de toxicidade proposta pela IOBC/WPRS. Fosmete, tebufenozida e metidationa foram inócuos; abamectina, fenpiroximato, clorpirifós, captana, mancozebe (nas duas dosagens testadas e ditianona foram levemente nocivos, e piridabem foi moderadamente nocivo aos adultos de N. californicus. O fungicida mancozebe, na maior dosagem (320g,i.a./100L, foi o que mais afetou o ácaro predador. Quanto à seletividade dos agrotóxicos aos imaturos, constatouse que abamectina e piridabem foram moderadamente nocivos, e os demais foram inócuos. Nenhum produto foi classificado como nocivo, evidenciando a tolerância de N. californicus a estes agrotóxicos. Estes resultados permitem uma escolha e manejo mais adequado para os agrotóxicos utilizados nos pomares comerciais de macieira, de forma que a presença deste ácaro predador exerça pressão de controle do ácaro-vermelho.The objective of this study was to evaluate the side effects of the main pesticides used in adult and immature Neoseiulus californicus (McGregor (Acari: Phytoseiidae. The tests were carried out in the laboratory by using the contact and residual spraying method on the leaf surface. It was tested

  9. New records of water mites of the family Torrenticolidae (Acari, Hydrachnidia with descriptions of two new species from Nanshih River system in Taiwan and redescription of Torrenticola ussuriensis (Sokolow, 1940 from the Russian Far East

    Directory of Open Access Journals (Sweden)

    Vladimir Pesic

    2011-07-01

    Full Text Available New records of torrenticolid water mites (Acari: Hydrachnidia, Torrenticolidae from Nanshih River, Taiwan, are presented. Two new species are described: Torrenticola nanshihensis and T. taiwanicus; the latter species is compared with T. ussuriensis (Sokolow, 1940, a poorly known species which is re-described based on a new material from the Russian Far East; Monatractides cf. circuloides (Halík, 1930 is reported for the first time for Taiwan.

  10. Prevalence and Diversity of Tick-Borne Pathogens in Nymphal Ixodes scapularis (Acari: Ixodidae) in Eastern National Parks.

    Science.gov (United States)

    Johnson, Tammi L; Graham, Christine B; Boegler, Karen A; Cherry, Cara C; Maes, Sarah E; Pilgard, Mark A; Hojgaard, Andrias; Buttke, Danielle E; Eisen, Rebecca J

    2016-12-27

    Tick-borne pathogens transmitted by Ixodes scapularis Say (Acari: Ixodidae), also known as the deer tick or blacklegged tick, are increasing in incidence and geographic distribution in the United States. We examined the risk of tick-borne disease exposure in 9 national parks across six Northeastern and Mid-Atlantic States and the District of Columbia in 2014 and 2015. To assess the recreational risk to park visitors, we sampled for ticks along frequently used trails and calculated the density of I. scapularis nymphs (DON) and the density of infected nymphs (DIN). We determined the nymphal infection prevalence of I. scapularis with a suite of tick-borne pathogens including Borrelia burgdorferi, Borrelia miyamotoi, Anaplasma phagocytophilum, and Babesia microti Ixodes scapularis nymphs were found in all national park units; DON ranged from 0.40 to 13.73 nymphs per 100 m(2) Borrelia burgdorferi, the causative agent of Lyme disease, was found at all sites where I. scapularis was documented; DIN with B. burgdorferi ranged from 0.06 to 5.71 nymphs per 100 m(2) Borrelia miyamotoi and A. phagocytophilum were documented at 60% and 70% of the parks, respectively, while Ba. microti occurred at just 20% of the parks. Ixodes scapularis is well established across much of the Northeastern and Mid-Atlantic States, and our results are generally consistent with previous studies conducted near the areas we sampled. Newly established I. scapularis populations were documented in two locations: Washington, D.C. (Rock Creek Park) and Greene County, Virginia (Shenandoah National Park). This research demonstrates the potential risk of tick-borne pathogen exposure in national parks and can be used to educate park visitors about the importance of preventative actions to minimize tick exposure.

  11. Phylogeny and species delineation in European species of the genus Steganacarus (Acari, Oribatida) using mitochondrial and nuclear markers.

    Science.gov (United States)

    Kreipe, Victoria; Corral-Hernández, Elena; Scheu, Stefan; Schaefer, Ina; Maraun, Mark

    2015-06-01

    Species of the genus Steganacarus are soil-living oribatid mites (Acari, Phthiracaridae) with a ptychoid body. The phylogeny and species status of the species of Steganacarus are not resolved, some authors group all ten German species of Steganacarus within the genus Steganacarus whereas others split them into three subgenera, Steganacarus, Tropacarus and Atropacarus. Additionally, two species, S. magnus and T. carinatus, comprise morphotypes of questionable species status. We investigated the phylogeny and species status of ten European Steganacarus species, i.e. S. applicatus, S. herculeanus, S. magnus forma magna, S. magnus forma anomala, S. spinosus, Tropacarus brevipilus, T. carinatus forma carinata, T. carinatus forma pulcherrima, Atropacarus striculus and Rhacaplacarus ortizi. We used two molecular markers, a 251 bp fragment of the nuclear gene 28S rDNA (D3) and a 477 bp fragment of the mitochondrial COI region. The phylogeny based on a combined analysis of D3 and COI separated four subgenera (Steganacarus, Tropacarus and Atropacarus, Rhacaplacarus) indicating that they form monophyletic groups. The COI region separated all ten species of the genus Steganacarus and showed variation within some species often correlating with the geographic origin of the species. Resolution of the more conserved D3 region was limited, indicating that radiation events are rather recent. Overall, our results indicate that both genes alone cannot be used for phylogeny and barcoding since variation is too low in D3 and too high in COI. However, when used in combination these genes provide reliable insight into the phylogeny, radiation and species status of taxa of the genus Steganacarus.

  12. Distribution, hosts, 16S rDNA sequences and phylogenetic position of the Neotropical tick Amblyomma parvum (Acari: Ixodidae).

    Science.gov (United States)

    Nava, S; Szabó, M P J; Mangold, A J; Guglielmone, A A

    2008-07-01

    The hosts, distribution, intraspecific genetic variation and phylogenetic position of Amblyomma parvum (Acari: Ixodidae) have recently been re-assessed. Data on this tick's hosts and distribution were obtained not only from existing literature but also from unpublished records. Sequences of the ticks' mitochondrial 16S ribosomal DNA (rDNA) were used to evaluate genetic variation among specimens of A. parvum from different localities in Argentina and Brazil, and to explore the phylogenetic relationships between this tick and other Amblyomma species. Although several species of domestic and wild mammal act as hosts for adult A. parvum, most collected adults of this species have come from cattle and goats. Caviid rodents of the subfamily Caviinae appear to be the hosts for the immature stages. So far, A. parvum has been detected in 12 Neotropical biogeographical provinces (Chaco, Cerrado, Eastern Central America, Venezuelan Coast, Pantanal, Parana Forest, Caatinga, Chiapas, Venezuelan Llanos, Monte, Western Panamanian Isthmus, and Roraima) but the Chaco province has provided significantly more specimens than any other (P<0.0001). The 16S rDNA sequences showed just 0.0%-1.1% divergence among the Argentinean A. parvum investigated and no more than 0.2% divergence among the Brazilian specimens. The observed divergence between the Argentinean and Brazilian specimens was, however, greater (3.0%-3.7%). Although there is now molecular and morphological evidence to indicate that A. parvum, A. pseudoparvum, A. auricularium and A. pseudoconcolor are members of a natural group, previous subgeneric classifications do not reflect this grouping. The subgeneric status of these tick species therefore needs to be re-evaluated. The 16S-rDNA-based evaluation of divergence indicates that the gene flow between Argentinean and Brazilian 'A. parvum' is very limited and that the Argentinean 'A. parvum' may be a different species to the Brazilian.

  13. A novel spotted fever group Rickettsia infecting Amblyomma parvitarsum (Acari: Ixodidae) in highlands of Argentina and Chile.

    Science.gov (United States)

    Ogrzewalska, Maria; Nieri-Bastos, Fernanda A; Marcili, Arlei; Nava, Santiago; González-Acuña, Daniel; Muñoz-Leal, Sebastián; Ruiz-Arrondo, Ignacio; Venzal, José M; Mangold, Atilio; Labruna, Marcelo B

    2016-04-01

    The tick Amblyomma parvitarsum (Acari: Ixodidae) has established populations in Andean and Patagonic environments of South America. For the present study, adults of A. parvitarsum were collected in highland areas (elevation >3500 m) of Argentina and Chile during 2009-2013, and tested by PCR for rickettsial infection in the laboratory, and isolation of rickettsiae in Vero cell culture by the shell vial technique. Overall, 51 (62.2%) out of 82 A. parvitarsum adult ticks were infected by spotted fever group (SFG) rickettsiae, which generated DNA sequences 100% identical to each other, and when submitted to BLAST analysis, they were 99.3% identical to corresponding sequence of the ompA gene of Rickettsia sp. strain Atlantic rainforest. Rickettsiae were successfully isolated in Vero cell culture from two ticks, one from Argentina and one from Chile. DNA extracted from the third passage of the isolates of Argentina and Chile were processed by PCR, resulting in partial sequences for three rickettsial genes (gltA, ompB, ompA). These sequences were concatenated and aligned with rickettsial corresponding sequences available in GenBank. Phylogenetic analysis revealed that the A. pavitarsum rickettsial agent grouped under high bootstrap support in a clade composed by the SFG pathogens R. sibirica, R. africae, R. parkeri, Rickettsia sp. strain Atlantic rainforest, and two unnamed SFG agents of unknown pathogenicty, Rickettsia sp. strain NOD, and Rickettsia sp. strain ApPR. The pathogenic role of this A. parvitarsum rickettsia cannot be discarded, since several species of tick-borne rickettsiae that were considered nonpathogenic for decades are now associated with human infections.

  14. Resistance mechanisms to mitochondrial electron transport inhibitors in a field-collected strain of Tetranychus urticae Koch (Acari: Tetranychidae).

    Science.gov (United States)

    Van Pottelberge, S; Van Leeuwen, T; Nauen, R; Tirry, L

    2009-02-01

    A Belgian field strain (MR-VP) of Tetranychus urticae (Koch) (Acari: Tetranychidae) exhibits different levels of resistance to four frequently used METI (mitochondrial electron transport inhibitor)-acaricides, i.e. tebufenpyrad, fenpyroximate, pyridaben and fenazaquin. Resistance factors for these compounds were 184, 1547, 5971 and 35, respectively. A 23.5-fold increase in 7-ethoxy-4-trifluoromethylcoumarin O-deethylation activity suggested that metabolic resistance through elevated levels of cytochrome P450 dependent monooxygenase-activity is a possible resistance mechanism.However, synergism studies with different metabolic inhibitors revealed some contrasting resistance mechanisms between the METI-acaricides. Tebufenpyrad resistance could only be synergized after pre-treatment with the monooxygenase inhibitor piperonyl butoxide (PBO), whereas pyridaben resistance was strongly synergized both by PBO and the esterase inhibitor S,S,S-tributylphosphorotrithioate (DEF). Resistance levels to fenpyroximate could neither be suppressed by PBO nor by DEF. Although METI-acaricides are structurally related, these findings probably reflect a different role of esterases and mono-oxygenases in metabolic detoxification between these compounds. The overall lack of synergism by diethylmaleate (DEM) suggests that glutathione-S-transferases are not an important factor in resistance to METIs.Reciprocal crosses between susceptible females and resistant males showed no maternal effect, and resistance to METI-acaricides was inherited generally as a dominant trait. Backcrosses with F1 females revealed striking differences in the mode of inheritance. Although resistance to fenpyroximate and pyridaben was under monogenic control, resistance to tebufenpyrad was under control of more than one gene.

  15. Removal of drone brood from Apis mellifera (Hymenoptera: Apidae) colonies to control Varroa destructor (Acari: Varroidae) and retain adult drones.

    Science.gov (United States)

    Wantuch, Holly A; Tarpy, David R

    2009-12-01

    The parasitic mite Varroa destructor Anderson & Trueman (Acari: Varroidae) has plagued European honey bees, Apis mellifera L. (Hymenoptera: Apidae), in the Americas since its introduction in the 1980s. For many years, these mites were sufficiently controlled using synthetic acaricides. Recently, however, beekeepers have experienced increased resistance by mites to chemical pesticides, which are also known to leave residues in hive products such as wax and honey. Thus there has been increased emphasis on nonchemical integrated pest management control tactics for Varroa. Because mites preferentially reproduce in drone brood (pupal males), we developed a treatment strategy focusing on salvaging parasitized drones while removing mites from them. We removed drone brood from colonies in which there was no acaricidal application and banked them in separate "drone-brood receiving" colonies treated with pesticides to kill mites emerging with drones. We tested 20 colonies divided into three groups: 1) negative control (no mite treatment), 2) positive control (treatment with acaricides), and 3) drone-brood removal and placement into drone-brood receiving colonies. We found that drone-brood trapping significantly lowered mite numbers during the early months of the season, eliminating the need for additional control measures in the spring. However, mite levels in the drone-brood removal group increased later in the summer, suggesting that this benefit does not persist throughout the entire season. Our results suggest that this method of drone-brood trapping can be used as an element of an integrated control strategy to control varroa mites, eliminating a large portion of the Varroa population with limited chemical treatments while retaining the benefits of maintaining adult drones in the population.

  16. Laboratory evaluation of a native strain of Beauveria bassiana for controlling Dermanyssus gallinae (De Geer, 1778) (Acari: Dermanyssidae).

    Science.gov (United States)

    Immediato, Davide; Camarda, Antonio; Iatta, Roberta; Puttilli, Maria Rita; Ramos, Rafael Antonio Nascimento; Di Paola, Giancarlo; Giangaspero, Annunziata; Otranto, Domenico; Cafarchia, Claudia

    2015-09-15

    The poultry red mite, Dermanyssus gallinae (De Geer, 1778) (Acari: Dermanyssidae) is one of the most economically important ectoparasites of laying hens worldwide. Chemical control of this mite may result in environmental and food contamination, as well as the development of drug resistance. High virulence of Beauveria bassiana sensu lato strains isolated from naturally infected hosts or from their environment has been demonstrated toward many arthropod species, including ticks. However, a limited number of studies have assessed the use of B. bassiana for the control of D. gallinae s.l. and none of them have employed native strains. This study reports the pathogenicity of a native strain of B. bassiana (CD1123) against nymphs and adults of D. gallinae. Batches of nymph and adult mites (i.e., n=720 for each stage) for treated groups (TGs) were placed on paper soaked with a 0.1% tween 80 suspension of B. bassiana (CIS, 10(5), 10(7) and 10(9) conidia/ml), whilst 240 untreated control mites for each stage (CG) were exposed only to 0.1% tween 80. The mites in TG showed a higher mortality at all stages (p<0.01) when compared to CG, depending on the time of exposure and the conidial concentration. A 100% mortality rate was recorded using a CIS of 10(9) conidia/ml 12 days post infection (DPI) in adults and 14 DPI in nymphs. B. bassiana suspension containing 10(9) conidia/ml was highly virulent towards nymph and adult stages of D. gallinae, therefore representing a possible promising natural product to be used in alternative or in combination to other acaricidal compounds currently used for controlling the red mite.

  17. Primeiro relato de Amblyomma fuscum Neumann, 1907 (acari: ixodidae parasitando lagarto da espécie Tupinambis teguixin (L., no município de Glorinha, estado do Rio Grande do Sul, Brasil The first report of Amblyomma fuscum Neumann, 1907 (acari ixodidae on the lizard Tupinambis teguixin (L. at the municipality of Glorinha, state of Rio Grande do Sul, Brazil

    Directory of Open Access Journals (Sweden)

    João R Martins

    2007-12-01

    Full Text Available Amblyomma fuscum conhecida somente no Brasil, tem sido descrita como uma espécie rara de carrapato com relatos de sua ocorrência nas regiões sul e sudeste. Este é um novo registro desta espécie (9 fêmeas parasitando lagarto (Tupinambis teguixin, no Município de Glorinha, Estado do Rio Grande do Sul. As fêmeas foram depositadas na coleção do Instituto de Pesquisas Veterinárias Desidério Finamor (7 espécimes e na coleção de Acari do Instituto Butantan, Estado de São Paulo (2 espécimes. O achado confirma o estabelecimento de A. fuscum no Sul do Brasil.Amblyomma fuscum known only from Brazil has been described as a rare tick species with few reports of its occurrence in South and Southeast region. This is a new records this tick species (9 females parasitizing lizard (Tupinambis teguixin at the Municipality of Glorinha, State of Rio Grande do Sul. The females were deposited in the tick collection of Veterinary Research Institute Desiderio Finamor (7 specimens, Eldorado do Sul, RS and in the Acari collection from Instituto Butantan, São Paulo, State of São Paulo (2 specimens. The finding confirms establishment de A. fuscum in the South of Brazil.

  18. Overwintering survival and postdiapause fecundity in a population of the Kanzawa spider mite Tetranychus kanzawai (Acari: Tetranychidae) on Orixa japonica (Rutaceae).

    Science.gov (United States)

    Ito, Katsura

    2011-01-01

    In several adult-diapausing insects and mites, long duration of diapause decreases egg production after diapause termination. However, such nonlethal effects are much less studied than overwintering survival. In this study, lethal and nonlethal effects of different periods of diapause were investigated in an adult-diapausing spider mite, Tetranychus kanzawai Kishida (Acari: Tetranychidae), through field experiments. Diapausing females produced in the laboratory were kept in their natural habitat from October or November to the next April, and survival rate and postdiapause fecundity were compared between the months. The survival rate was lower, but not significantly, in the October treatment. Postdiapause fecundity was also not significantly different between the months. These results suggest that the effects of diapause on survival and reproduction are quite small after October, when diapausing mites are increasing in their natural habitat.

  19. Prevalence, mean intensity of infestation and host specificity of Spinturnicidae mites (Acari: Mesostigmata) on bats (Mammalia: Chiroptera) in the Pantanal, Brazil.

    Science.gov (United States)

    Silva, Camila de Lima; Graciolli, Gustavo

    2013-06-01

    Acari ectoparasites were collected from bats during 12 months in the Rio Negro farm (19°34'22″S and 56°14'36″W), Aquidauana, Mato Grosso do Sul. A total of 654 bats belonging to the families Phyllostomidae, Noctilionidae, Molossidae, Vespertilionidae and Emballonuridae were captured. Only 136 bats of nine genera and 11 species were parasitised. Periglischrus iheringi Oudemans was the most abundant mite species, and this prevalence may be related to the low degree of host specificity of this species and due to the broad geographical distribution of its hosts. The greatest mean intensity was found to Periglischrus torrealbai Machado-Allison on Phyllostomus discolor Wagner (Phyllostomidae) and Periglischrus tonatii Herrin and Tipton associated with Lophostoma silviculum d'Orbigny (Phyllostomidae), which also had the highest prevalence of infestation.

  20. Taxonomic value of morphological and morphometrical characters in the immature stages of four species of Kampimodromus Nesbitt (Acari: Phytoseiidae) from Italy and Croatia.

    Science.gov (United States)

    Cargnus, Elena; Zandigiacomo, Pietro

    2014-08-28

    The immature stages of four species of Kampimodromus Nesbitt (Acari: Phytoseiidae) from Italy and Croatia have been studied and identified both at stage and species level. Larval stages of Kampimodromus corylosus Kolodochka and all immature stages of Kampimodromus ericinus Ragusa di Chiara & Tsolakis and Kampimodromus langei Wainstein & Arutunjan are described for the first time. The relative length of the posterior dorsal setae Z4 make the larvae of Kampimodromus aberrans (Oudemans) easy to separate from those of the other three species. Nymphs of each species had similar diagnostics to the adults of the respective species. Ontogeny of the idiosomal and leg setation of the Kampimodromus immatures studied in comparison to the available data from immatures of other phytoseiid species is discussed. The length of seta Z4 in the K. aberrans larva, and the number of setae on leg IV of the deutonymphs of the four Kampimodromus species, are proposed as additional taxonomic traits for Phytoseiidae. 

  1. SELETIVIDADE DE CHLORFENAPYR E FENBUTATIN-OXIDE SOBRE DUAS ESPÉCIES DE ÁCAROS PREDADORES (ACARI: PHYTOSEIIDAE EM CITROS

    Directory of Open Access Journals (Sweden)

    REIS PAULO REBELLES

    2001-01-01

    Full Text Available Com o uso de bioensaios, verificaram-se os efeitos residual de contato, ovicida e de persistência dos produtos chlorfenapyr e fenbutatin-oxide sobre duas espécies de ácaros predadores, Iphiseiodes zuluagai Denmark & Muma e Euseius alatus DeLeon (Acari: Phytoseiidae, associados ao ácaro da leprose-dos-citros Brevipalpus phoenicis (Geijskes (Acari: Tenuipalpidae. O efeito total sobre os adultos foi estudado por meio do método residual de contato com pulverização em superfície de vidro, conforme metodologia da IOBC. O efeito ovicida foi avaliado por meio de pulverização direta sobre os ovos dos ácaros predadores, também em superfície de vidro. A persistência dos produtos foi avaliada em laboratório, em arenas confeccionadas com folhas de laranjeira pulverizadas no campo, aos 0; 5; 15 e 30 dias após a aplicação. Os resultados obtidos mostraram que chlorfenapyr foi nocivo ao I. zuluagai e E. alatus e o fenbutatin-oxide foi levemente nocivo a E. alatus e inócuo a I. zuluagai. Nenhum dos produtos apresentou efeito ovicida. Fenbutatin-oxide apresentou baixa persistência para ambas as espécies de ácaros predadores, e chlorfenapyr, na dosagem de 31,3 ml, foi de baixa persistência, enquanto, na dosagem de 62,5 ml, foi moderadamente persistente. O fenbutatin-oxide apresentou-se inócuo e levemente nocivo aos ácaros predadores I. zuluagai e E. alatus, respectivamente, e de baixa persistência para ambas as espécies

  2. Expression analysis of Drosophila doublesex, transformer-2, intersex, fruitless-like, and vitellogenin homologs in the parahaploid predator Metaseiulus occidentalis (Chelicerata: Acari: Phytoseiidae).

    Science.gov (United States)

    Pomerantz, Aaron F; Hoy, Marjorie A

    2015-01-01

    Characterization and expression analyses are essential to gain insight into sex-determination pathways in members of the Acari. Little is known about sex determination at the molecular level in the western orchard predatory mite Metaseiulus occidentalis (Arthropoda: Chelicerata: Arachnida: Acari: Phytoseiidae), a parahaploid species. In this study, eight genes previously identified as putative homologs to genes involved in the sex-determination pathway in Drosophila melanogaster were evaluated for sex-specific alternative splicing and sex-biased expression using reverse-transcriptase PCR and quantitative real-time PCR techniques, respectively. The homologs evaluated in M. occidentalis included two doublesex-like genes (Moccdsx1 and Moccdsx2), transformer-2 (Mocctra-2), intersex (Moccix), two fruitless-like genes (MoccBTB1 and MoccBTB2), as well as two vitellogenin-like genes (Moccvg1 and Moccvg2). Single transcripts of equal size were detected in males and females for Moccdsx1, Moccdsx2, Mocctra-2, Moccix, and MoccBTB2, suggesting that their pre-mRNAs do not undergo alternative splicing in a sex-specific manner. Three genes, Moccdsx1, Moccdsx2 and MoccBTB2, displayed male-biased expression relative to females. One gene, Moccix, displayed female-biased expression relative to males. Two genes, Mocctra-2 and MoccBTB1, did not display detectable differences in transcript abundance in males and females. Expression of Moccvg1 and Moccvg2 were detected in females only, and transcript levels were up-regulated in mated females relative to unmated females. To our knowledge, this represents the first attempt to elucidate expression patterns of putative sex-determination genes in an acarine. This study is an initial step towards understanding the sex-determination pathway in the parahaploid M. occidentalis.

  3. Review of cattle ticks (Acari, Ixodida) in Ivory Coast and geographic distribution of Rhipicephalus (Boophilus) microplus, an emerging tick in West Africa.

    Science.gov (United States)

    Boka, O M; Achi, L; Adakal, H; Azokou, A; Yao, P; Yapi, Y G; Kone, M; Dagnogo, K; Kaboret, Y Y

    2017-04-01

    The exotic tick Rhipicephalus (Boophilus) microplus was discovered in Ivory Coast in 2007 and then gradually in other countries in West Africa. It is known to induce significant losses in farming and to replace other species of the same genus. In order to contribute to improve health and productivity of cattle in Ivory Coast regarding the emergence of this dreaded tick, a study was conducted to determine the current geographic distribution of the tick R. (B.) microplus and review cattle ticks in general. To this end, 23,460 ticks were collected from 180 farms located throughout the country. Ten species of ticks belonging to the genus Rhipicephalus (including those of the subgenus Boophilus), Hyalomma and Ambyomma were identified. It was found that the exotic tick R. (B.) microplus has invaded the entire Ivorian territory and is now the main cattle tick (63.6% of ticks collected), followed by Amblyomma variegatum that remains still dominant in the North. The population of indigenous species of Rhipicephalus (Boophilus) is in drastic decline.

  4. Diversity and distribution of tick species (Acari: Ixodidae) associated with human otoacariasis and socio-ecological risk factors of tick infestations in Sri Lanka.

    Science.gov (United States)

    Ariyarathne, S; Apanaskevich, D A; Amarasinghe, P H; Rajakaruna, R S

    2016-09-01

    Tick infestation in humans is a major public health concern. The diversity and distribution of tick species associated with human otoacariasis was studied in five districts: Anuradhapura, Kandy, Kurunegala, Nuwara Eliya and Ratnapura in the main agro-climatic zones of Sri Lanka. Ticks from patients attending the ear, nose and throat clinics of the General Hospitals were collected during a 3 year period. In total 426 ticks were collected. Most human otoacariasis cases were reported from Kandy (33.8 %) and the fewest from Nuwara Eliya (8.2 %). Of the five tick species identified, nymphs of Dermacentor auratus constituted 90.6 % of the collection. Rhipicephalus sanguineus, Hyalomma isaaci, Haemaphysalis bispinosa and Otobius megnini were found rarely infesting humans possibly as an accidental host; H. bispinosa and O. megnini in the human ear canal were first time records in Sri Lanka. Females and children under 10 years were identified as risk groups of human otoacariasis. Subsequently, a field study was carried out to determine socio-ecological risk factors of human tick infestations in the five districts. Based on hospital data, eight villages with high prevalence of otoacariasis were selected from each district. A total 40 villages were visited and 1674 household members were interviewed. Involvement in outdoor activities, presence of wild animals around the house, location of the house in close proximity to a forest and occupation were identified as major risk factors.

  5. Ocorrência de Ornithonyssus bursa (Berlese, 1888 (Acari: Macronyssidae em filhotes de Megascops choliba (corujinha-do-mato e Pitangus sulphuratus (bem-te-vi, no Rio Grande do Sul, Brasil Ocurrence of Ornithonyssus bursa (Berlese, 1888 (Acari: Macronyssidae on Megascops choliba (tropical screech-owl and Pitangus sulphuratus (great kiskadee nestlings in the Rio Grande do Sul State, Brazil

    Directory of Open Access Journals (Sweden)

    Carolina S. Mascarenhas

    2009-12-01

    Full Text Available O Núcleo de Reabilitação da Fauna Silvestre e Centro de Triagem de Animais Silvestres da Universidade Federal de Pelotas - RS atendeu dois filhotes de Megascops choliba (corujinha-do-mato (Strigiformes - Strigidae e dois de Pitangus sulphuratus (bem-te-vi (Passeriformes - Tyrannidae intensamente parasitados por ácaros, em maio de 2005 e dezembro de 2006, respectivamente. Os filhotes e o ninho de P. sulphuratus foram recolhidos na zona urbana da cidade de Pelotas - RS após forte temporal. Os ácaros foram removidos, colocados em álcool 70% e levados ao laboratório de parasitologia para identificação. Os espécimes foram clarificados em lactofenol, montados em meio de Hoyer e identificados como Ornithonyssus bursa (Acari - Macronyssidae. Registra-se Megascops choliba e Pitangus sulphuratus como hospedeiros de Ornithonyssus bursa, no Rio Grande do Sul, Brasil.The Center for Rehabilitation of Wildlife and Center for Selection of Wild Animal of the Federal University of Pelotas has attended two nestlings of Megascops choliba (tropical screech-owl (Strigiformes - Strigidae and two of Pitangus sulphuratus (great kiskadee (Passeriformes - Tyrannidae heavily parasitized by mites, in May 2005 and December 2006, respectively. The nestlings and the nest of P. sulphuratus were collected in the Pelotas urban area after severe storms. The mites were removed, clarified in lactofenol, permanently mounted in Hoyer's medium and identified as Ornithonyssus bursa (Acari - Macronyssidae. Megascops choliba and Pitangus sulphuratus are reported as host of Ornithonyssus bursa in Rio Grande do Sul State, Brazil.

  6. Biological cycle of Tenuipalpus heveae Baker (Acari, Tenuipalpidae on leaflets of three rubber tree clones Ciclo de vida de Tenuipalpus heveae Baker (Acari, Tenuipalpidae em folíolos de três clones de seringueira

    Directory of Open Access Journals (Sweden)

    Reinaldo José Fazzio Feres

    2010-06-01

    Full Text Available Life cycle of Tenuipalpus heveae Baker (Acari, Tenuipalpidae on leaflets from three rubber tree clones. The biological cycle of Tenuipalpus heveae Baker, 1945 (Tenuipalpidae, a potential rubber tree pest mite, was studied by the observation of individuals reared on leaflets of the clones GT 1, PB 235 and RRIM 600, in controlled environmental conditions. Three daily observations were done of 60 eggs on leaflets from each clone in order to verify the development of immature stages and the female oviposition. The fertility life table was constructed based in the collected data. Mites reared on PB 235 had faster rate of development, requiring less time in days, to double its population in number (TD, and had the highest values for egg production, female longevity, net reproductive rate (Ro, intrinsic rate of natural increase (r m and finite rate of increase (λ. Lower reproductive values and the longest time necessary to reach adult stage were recorded for the mites on GT 1. In all studied clones, the deutonymphal phase had the highest viability, while the larval phase had the lowest, highlighted by the survivorship curve that indicated high mortality during this life stage. The clone PB 235 allowed the most suitable conditions for the development of T. heveae, followed by RRIM 600, while GT 1 was the less suitable substratum to rear this mite species.O ciclo de vida de Tenuipalpus heveae Baker, 1945 (Tenuipalpidae, um potencial ácaro-praga da seringueira, foi estudado a partir de indivíduos criados sobre folíolos destacados dos clones GT 1, PB 235 e RRIM 600, em condições controladas. Três observações diárias foram realizadas, acompanhando-se o desenvolvimento de 60 ovos e de sua prole em folíolos de cada um dos clones, para verificação da oviposição das fêmeas e dos estágios de desenvolvimento. A partir dos dados obtidos, foi elaborada uma tabela de vida de fertilidade. Os ácaros criados sobre folíolos de PB 235 apresentaram r

  7. Characterization of the complete mitochondrial genome of the storage mite pest Tyrophagus longior (Gervais) (Acari: Acaridae) and comparative mitogenomic analysis of four acarid mites.

    Science.gov (United States)

    Yang, Banghe; Li, Chaopin

    2016-02-01

    Mites of the genus Tyrophagus are economically important polyphagous pest commonly living on stored products and also responsible for allergic reactions to humans. Complete mitochondrial genomes (mitogenomes) and the gene features therein are widely used as molecular markers in the study of population genetics, phylogenetics as well as molecular evolution. However, scarcity on the sequence data has greatly impeded the studies in these areas pertaining to the Acari (mites and ticks). Information on the Tyrophagus mitogenomes is quite critical for phylogenetic evaluation and molecular evolution of the mitogenomes within Acariformes. Herein, we reported the complete mitogenome of the allergenic acarid storage mite Tyrophagus longior (Astigmata: Acaridae), an important member of stored food pests, and compared with those of other three acarid mites. The complete mitogenome of T. longior was a circular molecule of 13,271 bp. Unexpectedly, only 19 transfer RNA genes (tRNAs) were present, lacking trnF, trnS1 and trnQ. Furthermore, it also contained 13 protein-coding genes (PCGs) and 2 genes for rRNA (rrnS and rrnL) commonly detected in metazoans. The four mitogenomes displayed similar characteristics with respect to the gene content, nucleotide comparison, and codon usages. Yet, the gene order of T. longior was different from that in other Acari. The J-strands of the four mitogenomes possessed high A+T content (67.4-70.0%), and exhibited positive GC-skews and negative AT-skews. Most inferred tRNAs of T. longior were extremely truncated, lacking either a D- or T-arm, as found in other acarid mites. In T. longior mitogenome the A+T-rich region was just 50 bp in length and can be folded as a stable stem-loop structure, whereas in the region some structures of microsatellite-like (AT)n and palindromic sequences was not present. Besides, reconstructing of the phylogenetic relationship based on concatenated amino acid sequences of 13 PCGs supported that monophyly of the family

  8. Molecular characterization and evolutionary insights into potential sex-determination genes in the western orchard predatory mite Metaseiulus occidentalis (Chelicerata: Arachnida: Acari: Phytoseiidae).

    Science.gov (United States)

    Pomerantz, Aaron F; Hoy, Marjorie A; Kawahara, Akito Y

    2015-01-01

    Little is known about the process of sex determination at the molecular level in species belonging to the subclass Acari, a taxon of arachnids that contains mites and ticks. The recent sequencing of the transcriptome and genome of the western orchard predatory mite Metaseiulus occidentalis allows investigation of molecular mechanisms underlying the biological processes of sex determination in this predator of phytophagous pest mites. We identified four doublesex-and-mab-3-related transcription factor (dmrt) genes, one transformer-2 gene, one intersex gene, and two fruitless-like genes in M. occidentalis. Phylogenetic analyses were conducted to infer the molecular relationships to sequences from species of arthropods, including insects, crustaceans, acarines, and a centipede, using available genomic data. Comparative analyses revealed high sequence identity within functional domains and confirmed that the architecture for certain sex-determination genes is conserved in arthropods. This study provides a framework for identifying potential target genes that could be implicated in the process of sex determination in M. occidentalis and provides insight into the conservation and change of the molecular components of sex determination in arthropods.

  9. Acaricidal properties of vetiver essential oil from Chrysopogon zizanioides (Poaceae) against the tick species Amblyomma cajennense and Rhipicephalus (Boophilus) microplus (Acari: Ixodidae).

    Science.gov (United States)

    Campos, Roseane Nunes de Santana; Nascimento Lima, Cecília Beatriz; Passos Oliveira, Alexandre; Albano Araújo, Ana Paula; Fitzgerald Blank, Arie; Barreto Alves, Péricles; Nascimento Lima, Rafaely; Albano Araújo, Vinícius; Santana, Alisson Silva; Bacci, Leandro

    2015-09-15

    Ticks are arthropods widely distributed in tropical and subtropical regions, which can transmit infectious agents also responsible for zoonoses. Excessive use of conventional acaricides has resulted in the onset of drug resistance by these parasites, thus the need to use alternative methods for their control. This study evaluated the acaricidal activities of Chrysopogon zizanioides (vetiver) essential oils containing different zizanoic and khuzimol (high and low acidity) acid concentrations on Amblyomma cajennense and Rhipicephalus microplus (Acari: Ixodidae). To this aims, toxicity tests of different concentrations of examined essential oils were conducted on adult females and larval stages. Results showed that the essential oils of C. zizanioides with high and low acidity reduced oviposition of females, eggs hatch and larval survival, being more effective than some commercial products widely used to control these ectoparasites. These results indicate that the C. zizanoides essential oils are promising candidates as acaricidal agents and represent also an add value to vetiver oil with high acidity, which is commercially undervalued in the cosmetic industry.

  10. Syringophilid mites (Acari: Syringophilidae) associated with the rails (Aves: Rallidae) and a key to the species of the genus Rafapicobia Skoracki, 2011.

    Science.gov (United States)

    Skoracki, Maciej; Unsoeld, Markus; Skorupski, Maciej; Kavetska, Katarzyna

    2014-07-01

    The fauna of quill mites of the family Syringophilidae Lavoipierre, 1953 (Acari: Prostigmata Cheyletoidea) parasitising birds of the family Rallidae Vigors (Gruiformes) is updated. A new species, Rafapicobia melzeri n. sp. (subfamily Picobiinae), is described from four host species: Rallus aquaticus Linnaeus (type-host) from Germany, Pardirallus sanguinolentus (Swainson) from Chile, Porzana porzana (Linnaeus) from France and P. parva (Scopoli) from Kirghizia. The new species is most similar to R. lepidocolaptesi Skoracki & Solarczyk, 2012 but differs in the absence of agenital plates and the length ratios of setae ag2:g1 and vi:ve:si in females and in the punctate ornament on the hysteronotal and the pygidial shields in males. A key to the species of the genus Rafapicobia is proposed. This is the first record of a representative of the subfamily Picobiinae on gruiform birds. Additionally, new rallid hosts are reported for Charadriphilus ralli Skoracki & Bochkov, 2010 (subfamily Syringophilinae): Gallinula melanops (Vieillot) from Chile, Laterallus melanophaius (Vieillot) from Paraguay, and P. parva (Scopoli) from Kirghizia.

  11. Diversity of Quill Mites of the Family Syringophilidae (Acari: Prostigmata) Parasitizing Owls (Aves: Strigiformes) With Remarks on the Host-Parasite Relationships.

    Science.gov (United States)

    Skoracki, Maciej; Unsoeld, Markus; Marciniak, Natalia; Sikora, Bozena

    2016-07-01

    The quill mite fauna of the family Syringophilidae (Acari: Prostigmata: Cheyletoidea) associated with owls (Aves: Strigiformes) is reviewed. A new genus is proposed, Neobubophilus Skoracki & Unsoeld gen. nov. It differs from closely related Bubophilus (Bubophilus Philips and Norton, 1978) by the absence of leg setae vsII in the both sexes. In addition, four new species are described: (1) Neobubophilus cunicularius Skoracki & Unsoeld sp. nov. from Athene cunicularia (Molina, 1782) (Strigidae) from Paraguay; (2) Neobubophilus atheneus Skoracki & Unsoeld sp. nov. from Athene noctua (Scopoli, 1769) and Athene brama (Temminck, 1821) (Strigidae), both from India; (3) Bubophilus tytonus Skoracki & Unsoeld sp. nov. from Tyto alba affinis (Blyth, 1862) (Tytonidae) from Cameroon, and (4) Megasyringophilus dalmas Skoracki & Unsoeld sp. nov. from Megascops choliba (Vieillot, 1817) (Strigidae) from Venezuela. The following new host species are given: Bubo bubo (Linnaeus, 1758) (Strigidae) from Nepal for Bubophilus ascalaphus (Philips and Norton 1978) and Strix woodfordii (Smith, 1834) (Strigidae) from Tanzania for Bubophilus aluconis (aluconis Nattress and Skoracki 2009). A key for syringophilid genera and species associated with owls is constructed. The host-parasite relationships of syringophilid mites and owls are discussed. © The Authors 2016. Published by Oxford University Press on behalf of Entomological Society of America. All rights reserved. For Permissions, please email: journals.permissions@oup.com Version of Record, first published online May 24, 2016 with fixed content and layout in compliance with Art. 8.1.3.2 ICZN.

  12. Acaricidal activity of Annonaceae fractions against Tetranychus tumidus and Tetranychus urticae (Acari: Tetranychidae and the metabolite profile of Duguetia lanceolata (Annonaceae using GC-MS

    Directory of Open Access Journals (Sweden)

    Dejane Santos Alves

    2015-12-01

    Full Text Available Species of the Tetranychus genus feed on plant tissues, which reduces the rate of photosynthesis and can lead to the death of plant tissues. As a result, considerable production losses are caused by these arthropods. Thus, in order to aid in the development of new products for the control of Tetranychus tumidus Banks and Tetranychus urticae Koch (Acari: Tetranychidae, the initial objective of this study was to select Annonaceae derived fractions that were soluble in dichloromethane and have acaricidal activity. Then, an exploratory analysis of the metabolite profile of the most successful fraction was performed by gas chromatography-mass spectrometry (GC-MS. Among the dichloromethane soluble fractions derived from Annona cacans Warm., Annona coriacea Mart., Annona neolaurifolia H. Rainer, Annona sylvatica A.St.-Hil., Duguetia lanceolata A.St.-Hil., Guatteria australis A.St.-Hil., Xylopia brasiliensis Spreng., Xylopia emarginata Mart. and Xylopia sericea A.St.-Hil., only the fraction from D. lanceolata stem bark reduced the survival of T. tumidus females. However, ovicidal activity was not detected when D. lanceolata stem bark was evaluated against T. tumidus eggs. Further, we studied the effect of dichloromethane soluble fractions from D. lanceolata leaves, berry fruits and stem bark on T. urticae, and the stem bark was found to be the most active fraction against T. urticae. The metabolite profile analysis of D. lanceolata stem bark by GC-MS, suggested that the main constituents were 2,4,5-trimethoxystyrene and trans-asarone.

  13. Laboratory evaluation of aromatic essential oils from thirteen plant species as candidate repellents against Leptotrombidium chiggers (Acari: Trombiculidae), the vector of scrub typhus.

    Science.gov (United States)

    Eamsobhana, Praphathip; Yoolek, Adisak; Kongkaew, Wittaya; Lerdthusnee, Kriangkrai; Khlaimanee, Nittaya; Parsartvit, Anchana; Malainual, Nat; Yong, Hoi-Sen

    2009-03-01

    Scrub typhus, a rickettsial disease transmitted by several species of Leptotrombidium chiggers (larvae), is endemic in many areas of Asia. The disease is best prevented by the use of personal protective measures, including repellents. In this study commercially produced aromatic, essential oils of 13 plant species and ethanol (control) were tested in the laboratory for repellency against host-seeking chiggers of Leptotrombidium imphalum Vercammen-Grandjean and Langston (Acari: Trombiculidae). A rapid, simple and economic in vitro test method was used by exposing the chigger for up to 5 min. Repellency was based on relative percentages of chiggers attracted to test and control substances. Four of the 13 essential oils showed promise as effective repellent against L. imphalum chiggers. Syzygium aromaticum (clove) oil exhibited 100% repellency at 5% concentration (dilution with absolute ethanol), whereas Melaleuca alternifolia (tea tree) oil exhibited 100% repellency at 40% concentration. Undiluted oils of Zingiber cassamunar (plai) and Eucalyptus globules (blue gum) exhibited 100% repellency. Of the remaining nine essential oils, only 100% Pelargonium graveolens (geranium) exhibited >50% repellency (viz. 57%). Styrax torkinensis (benzoin) oil did not exhibit any repellency. These findings show that several aromatic, essential oils of plants may be useful as chigger repellent for the prevention of scrub typhus. Syzygium aromaticum oil may be safer and more economical to prevent chigger attacks than commercially available synthetic chemicals, such as DEET that may have harmful side effects.

  14. Dinâmica populacional de Calepitrimerus vitis (Nalepa (Acari: eriophyidae em cultivares de videira na região da campanha do Rio Grande do Sul

    Directory of Open Access Journals (Sweden)

    Paulo Ricardo Ebert Siqueira

    2013-06-01

    Full Text Available Na Região da Campanha do Rio Grande do Sul, o ácaro-da-ferrugem-da-videira, Calepitrimerus vitis (Nalepa (Acari: Eriophyidae, é encontrado com frequência em vinhedos de cultivares europeias, desde a safra de 2004/2005, causando bronzeamento nas folhas. A dinâmica populacional de C. vitis nas cultivares Chardonnay e Merlot foi avaliada em vinhedo comercial localizado no município de Dom Pedrito, na região da Campanha, durante os anos agrícolas de 2005/2006 e 2006/2007, por meio de amostragem realizada em folhas das posições basal, intermediária e apical de ramos de produção. O pico populacional de C. vitis ocorre entre o final de fevereiro e o início de março, sendo seguido de forte declínio populacional. A infestação variou de intensidade entre as cultivares de acordo com o ano, sendo a cultivar Chardonnay mais infestada no primeiro ano, e Merlot, no segundo. Folhas na posição basal, mediana e apical apresentam níveis similares de infestação. Uma correlação positiva foi encontrada entre o número de C. vitis na face abaxial das folhas e o percentual de folhas com infestação.

  15. Population structure and dynamics of the cassava green mite Mononychellus tanajoa (Bondar and the predator Euseius ho (DeLeon (Acari: Tetranychidae, Phytoseiidae

    Directory of Open Access Journals (Sweden)

    Evila C. Costa

    2012-06-01

    Full Text Available Population structure and dynamics of the cassava green mite Mononychellus tanajoa and the predator Euseius ho (Acari: Tetranychidae, Phytoseiidae. Cassava is attacked by several pests, among which the cassava green mite Mononychellus tanajoa. Predatory mites of the family Phytoseiidae are major natural enemies of pestmites and are naturally found inhabiting cassava plants in the field. We evaluated the temporal variation of the developmental stages of M. tanajoa and the most abundant predatory mite in cassava fields in the study region, the phytoseiid Euseius ho. Densities of all developmental stages of M. tanajoa were low during the rainy season, increasing over the cultivation cycle of cassava and peaking in the dry season. Overall, the larval stage of M. tanajoa presented the lowest densities throughout time. Densities of all developmental stages of E. ho were low and remained constant throughout the cultivation cycle of cassava. The number of eggs, nymphs and adults of M. tanajoa was higher in comparison to the larval stage whereas there were no differences in densities of the stages of E. ho. Densities of all developmental stages of M. tanajoa were negatively correlated with precipitation. Densities of the stages of egg, nymph and adult of M. tanajoa were positively related while the stage of larva was negatively related to temperature. We conclude that it is important to consider the population structure in studies of population dynamics of arthropods as each developmental stage experiences and responds uniquely to the local environment over time.

  16. Incidence and inheritance of resistance to METI-acaricides in European strains of the two-spotted spider mite (Tetranychus urticae) (Acari: Tetranychidae).

    Science.gov (United States)

    Devine, G J; Barber, M; Denholm, I

    2001-05-01

    A strain of Tetranychus urticae (Koch; Acari: Tetranychidae), collected from hops (Humulus humuli L; Cannabaceae) in England with a short history of tebufenpyrad use, exhibited resistance to four METI (mitochondrial electron transport inhibitor)-acaricides; tebufenpyrad, pyridaben, fenazaquin and fenpyroximate. Resistance factors for these compounds in a microimmersion assay were 46, 346, 168 and 77 respectively, and corresponded to those exhibited by a Japanese METI-acaricide-resistant reference strain. Levels of resistance remained stable without further selection, and selection with tebufenpyrad did not increase them. The UK strain was also resistant (c 6-fold) to bifenthrin. Crosses of homozygous, diploid females with hemizygous, haploid males showed that, in the UK strain, METI-acaricide resistance was paternally and maternally inherited, and was an incompletely dominant trait. Another tebufenpyrad-resistant strain from the UK, originating from a chrysanthemum nursery (Chrysanthemum foeniculaceum Giseke; Asteraceae) was collected eight months later at a site c 210 km distant from the first. These are the first published incidences of METI-acaricide resistance in Europe and implications for the future use of these compounds are discussed.

  17. Efficiency of the latex from Euphorbia splendens var. hislopii (N.E. Br. Ursch & Leandri, Euphorbiaceae, in the control of Rhipicephalus (Boophilus sanguineus (Latreille, 1806 (Acari: Ixodidae

    Directory of Open Access Journals (Sweden)

    Zeneida T. Pinto

    2011-06-01

    Full Text Available The aim of this study was to evaluate the effect of the latex from Euphorbia splendens var. hislopii (N.E. Br. Ursch & Leandri, Euphorbiaceae, on the eggs and engorged larvae of Rhipicephalus (B. sanguineus (Latreille, 1806 (Acari: Ixodidae. Six aqueous concentrations: 25, 50, 100, 125, 250 and 500 μL/L of the latex of this plant were tested. The control group was tested only with distilled water. The latex of E. splendens var. hislopii presented an LD50 of 18.031 μL/L and LD90 of 84.610 μL/L against the eggs of R. (B. sanguineus. The larvae of all the groups treated with the latex presented a low survival rate of 0% at 25 μL/L, 1% at 50 μL/L, 2% at 100 μL/L, 3% at 125 μL/L, 9% at 250 μL/L, 5% at 500 μL/L when compared with the control group (91%. On day 7 and 14 after the application the latex killed more efficiently the treated groups (25, 50, 100, 125, 250 and 500 μL/L. As from day 21 the latex became less effective for all treatments. Our results clearly show that the aqueous concentration of the latex have a strong effect on tick eggs and larvae suggesting that it could become an important acaricide.

  18. Differences between populations of Spinturnix myoti (Acari: Mesostigmata) in breeding and non-breeding colonies of Myotis myotis (Chiroptera) in central Europe: the effect of roost type.

    Science.gov (United States)

    Postawa, Tomasz; Szubert-Kruszyńska, Agnieszka; Ferenc, Hanna

    2014-12-01

    We studied variations in the abundance of parasitic spinturnicid mites in relation to the gender, age and body condition of bats living in different habitats. Populations of Spinturnix myoti Kolenati, 1856 (Acari: Spinturnicidae), an ectoparasite of the bat Myotis myotis (Borkhausen) (Mammalia: Chiroptera), were investigated in two types of roosts differing in microclimatic conditions: caves (low temperature and high humidity) and attics (high temperature and low humidity). Our data suggest that bats from cave nursery colonies harbour more parasites than those from attic colonies, irrespective of host sex or age. In underground colonies, adult females and their young differ in the mean abundance of parasites, whereas no such differences were found in attic colonies. Non-lactating females from underground roosts and lactating females from attic colonies had similar parasite loads, were lower than those of adult lactating females from caves. A negative correlation between the host body condition index and parasite load was found only in the most infected sex/age group of bats. In spite of significant differences in parasite load, the mean abundance of particular life stages of mites seems to be independent of the type of roost occupied by the host, its sex or age. However, in attic colonies the number of female deutonymphs was twice that of male deutonymphs, whereas in cave colonies the proportions of the sexes were similar. We suggest that the microclimate of the host's roosts may influence ectoparasite abundance through pressure on the sex ratio in the nymphal stages of mites.

  19. Hard ticks (Ixodidae and Crimean-Congo hemorrhagic fever virus in south west of Iran.

    Directory of Open Access Journals (Sweden)

    Narges Sharifinia

    2015-03-01

    Full Text Available Ticks are vectors of some important arthropod-borne diseases in both fields of veterinary and medicine, such as Lyme, tularemia, Rocky Mountain spotted fever, and some types of encephalitis as well as Crimean Congo hemorrhagic fever (CCHF. Iran is known as one of the main foci of CCHF in west of Asia. This study was conducted in DarrehShahr County because of the development of animal husbandry in this area to detect the fauna and viral infection of the hard ticks of livestock. A cross-sectional survey was conducted during 2011-2012 with random sampling in four villages. A sample of ticks was subjected to RT-PCR method for detection of viral infection. During the study period, 592 Ixodidae ticks were collected and identified as seven species of Hyalomma asiaticum, Hy. marginatum, Hy. anatolicum, Hy. dromedarii, Hy. detritum, Rhipicephalus bursa and Rh. sanguineus. More than 20% of these ticks were examined to detect the genome of CCHF virus while 6.6% were positive. All species of Hyalomma were found to be positive. A high rate of livestock was found to be infected with hard ticks, which can act as the vectors of the CCHF disease. Regarding infection of all five Hyalomma species captured in this area, this genus should be considered as the main vector of CCHF. Planning control program can be performed based on the obtained data on seasonal activity of Ixodidae to prevent animal infestation as well as to reduce the risk of CCHF transmission.

  20. Secondary structure prediction for complete rDNA sequences (18S, 5.8S, and 28S rDNA) of Demodex folliculorum, and comparison of divergent domains structures across Acari.

    Science.gov (United States)

    Zhao, Ya-E; Wang, Zheng-Hang; Xu, Yang; Wu, Li-Ping; Hu, Li

    2013-10-01

    According to base pairing, the rRNA folds into corresponding secondary structures, which contain additional phylogenetic information. On the basis of sequencing for complete rDNA sequences (18S, ITS1, 5.8S, ITS2 and 28S rDNA) of Demodex, we predicted the secondary structure of the complete rDNA sequence (18S, 5.8S, and 28S rDNA) of Demodex folliculorum, which was in concordance with that of the main arthropod lineages in past studies. And together with the sequence data from GenBank, we also predicted the secondary structures of divergent domains in SSU rRNA of 51 species and in LSU rRNA of 43 species from four superfamilies in Acari (Cheyletoidea, Tetranychoidea, Analgoidea and Ixodoidea). The multiple alignment among the four superfamilies in Acari showed that, insertions from Tetranychoidea SSU rRNA formed two newly proposed helixes, and helix c3-2b of LSU rRNA was absent in Demodex (Cheyletoidea) taxa. Generally speaking, LSU rRNA presented more remarkable differences than SSU rRNA did, mainly in D2, D3, D5, D7a, D7b, D8 and D10.

  1. Toxicidade diferencial de produtos à base de abamectina ao ácaro Brevipalpus phoenicis (Geijskes, 1939 (Acari: Tenuipalpidae em citros Differential toxicity of abamectin based products over Brevipalpus phoenicis (Geijskes, 1939 (Acari: Tenuipalpidae mite in citrus

    Directory of Open Access Journals (Sweden)

    Daniel Júnior de Andrade

    2010-03-01

    Full Text Available O ácaro Brevipalpus phoenicis é uma das principais pragas dos citros por ser vetor do "Citrus Leprosis Virus" (CiLV, agente causal da leprose, uma das mais graves doenças da citricultura. Objetivou-se avaliar o efeito tóxico de produtos à base de abamectina sobre o ácaro B. phoenicis. Foram realizados um experimento de ação direta e três de ação residual no Laboratório de Acarologia do Departamento de Proteção de Plantas (Fitossanidade da FCAV - UNESP, Jaboticabal-SP. O delineamento adotado nos bioensaios foi o inteiramente casualizado, onde 10 tratamentos foram repetidos 7 vezes, sendo cada repetição composta por um fruto de laranja. Os tratamentos estudados (mL p.c./100 L de água foram: Acaramik a 20; 30; 40 e 50 mL; Vertimec a 30 e 40 mL; Abamectin Nortox a 30 e 40 mL; Tricofol a 77 mL e uma testemunha sem aplicação. Utilizaram-se frutos com presença de verrugose, que foram lavados e parcialmente parafinados, deixando-se uma área sem parafina, que foi circundada com cola entomológica para contenção dos ácaros. Transferiram-se 20 ácaros adultos B. phoenicis para cada fruto. No bioensaio de ação direta, a transferência foi realizada antes das aplicações e, nos bioensaios de ação residual, aos 5; 10 e 15 dias após a aplicação dos produtos. A aplicação dos produtos sobre os frutos foi realizada em Torre de Potter. Os resultados obtidos nos bioensaios evidenciaram que os melhores tratamentos foram: Tricofol a 77 mL, Acaramik a 40 e 50 mL e Vertimec a 40 mL. De forma geral, os produtos testados podem ser utilizados no controle do ácaro B. phoenicis.The mite Brevipalpus phoenicis (Geijskes, 1939 (Acari: Tenuipalpidae is one of the most important pests in Brazil citrus plantation, because it is the virus "Citrus Leprosis Virus" (CiLV vector, one of the most serious citrus plantation diseases. The purpose of this experiment was to evaluate the toxical effect of abamectin in the mite B. phoenicis. It was performed

  2. Analysis of the Relative Expression of microRNA-10 in Different Developmental Stages and Various Tissues of Hyalomma asiaticum%亚洲璃眼蜱不同发育阶段及其组织中microRNA-10表达分析

    Institute of Scientific and Technical Information of China (English)

    袁小松; 罗金; 田占成; 谢俊仁; 王芳芳; 田美媛; 张以芳; 刘光远

    2014-01-01

    [Objective] MicroRNAs (miRNAs) are a conserved class of non-coding 20-22 nt small RNAs. miRNAs have been reported in many viruses, animals and plants such as Mareks diseased virus, fruit flies, zebra fish, humans and Arabidopsis so far. MiRNAs regulate gene expression by binding to mRNA at post-transcriptional levels, leading to mRNA inhibition or degradation. MiRNAs regulate a variety of biological processes, including cell proliferation, differentiation, metabolism and apoptosis. The purpose of this experiment is to understand the potential biological function of miR-10 in Hyalomma asiaticum. To obtain the precursor and mature of microRNA-10 (miR-10), its relative expression and the biologic significance in different developmental stages and various tissues from Hyalomma asiaticum were analyzed, which will be helpful for further study the relationship between the function of miR-10 and development of H. asiaticum. [Method] Total RNA of the different developmental stages and various tissues were extracted using Trizol Reagent, then transcripted to cDNA using SYBR ®Prime Script TM miRNA RT-PCR Kit( TaKaRa Code:RR716). To obtain the miR-10 precursor sequence from H. asiaticum, the specific primers were designed according to the miRBase database (Accession number:MI0012262). Then its homology was compared with the sequence from miRBas database by the MEGA4 software. The expression of miR-10 from different developmental stages and various tissues of H. asiaticum was assessed by qPCR. The biological function of miR-10 in H. asiaticum was presumed.[Result]A 73 bp gene was cloned by PCR, which was CUACAUCUACCCUGUAGAUCCGAAUUUGUUUGCCA CUAGACUACAAAUUCGGUUCUAGAGAGGCUUUGUGUGG. There was a relatively high genetic similarity among 16 varieties. The similarity between H. asiaticum and Ixodes scapularis was 95.9%, and 88.9%-91.7% compared with other arthropods. The miR-10 sequence was highly conserved in various species. The mature sequence of miR-10 was UACCCUGUAGAUCCGAAUUUGU

  3. Elenco y biogeografía de los ácaros acuáticos (Acari, Parasitengona, Hydrachnidia de Sudamérica

    Directory of Open Access Journals (Sweden)

    Rosso de Ferradás, B.

    2005-12-01

    Full Text Available Checklist and catalog publications demonstrate a clear connection between basic taxonomy and biodiversity issues. According to some estimates, only 10-30% of all global species have been named. As in other fields, catalogs provide an important source of information concerning species diversity in freshwater ecology.

    South America is a continent dominated by freshwater ecosystems. The tremendous habitat diversity created by this landscape supports a high number of arthropods, including water mites, which belong to the hyperdiverse group Acari. South America has a substantial task ahead in cataloging its biodiversity.

    Much has been published on water mites in South America. In fact, according to Besch, water mites were the most studied with the exception of Europe up until the 1960’s. Most of the collections were conducted by two acarologists (Lundblad and Karl Viets during the 1940’s. Today, the collection, identification and description process of water mites is slower. In the 1980’s, the north-american acarologist D. R. Cook produced two lengthy papers about neotropical water mites in four regions of South America. Recently, several Argentine acarologists have published papers on water mites from diverse habitats and regions in South America.

    The catalog presented here includes information regarding 6 superfamilies, including 23 families in 118 genera of true water mites (Hydrachnidia, Parasitengona, Acari. It also includes the references concerning the species, distribution in various regions of South America and –as far as known– habitat.

    At present, there are 916 species from several authors cataloged in 11 countries in South America. The degree of knowledge varies greatly from country to country, with numerous entries for Brazil and none for French Guiana.

    Las publicaciones de catálogos y listados de especies determinan una clara conexión entre taxonomía básica y temas

  4. Sampling method evaluation and empirical model fitting for count data to estimate densities of Oligonychus perseae (Acari: Tetranychidae) on 'Hass' avocado leaves in southern California.

    Science.gov (United States)

    Lara, Jesús R; Saremi, Naseem T; Castillo, Martin J; Hoddle, Mark S

    2016-04-01

    Oligonychus perseae (Acari: Tetranychidae) is an important foliar spider mite pest of 'Hass' avocados in several commercial production areas of the world. In California (USA), O. perseae densities in orchards can exceed more than 100 mites per leaf and this makes enumerative counting prohibitive for field sampling. In this study, partial enumerative mite counts along half a vein on an avocado leaf, an industry recommended practice known as the "half-vein method", was evaluated for accuracy using four data sets with a combined total of more than 485,913 motile O. perseae counted on 3849 leaves. Sampling simulations indicated that the half-vein method underestimated mite densities in a range of 15-60 %. This problem may adversely affect management of this pest in orchards and potentially compromise the results of field research requiring accurate mite density estimation. To address this limitation, four negative binomial regression models were fit to count data in an attempt to rescue the half-vein method for estimating mite densities. These models were incorporated into sampling plans and evaluated for their ability to estimate mite densities on whole leaves within 30-tree blocks of avocados. Model 3, a revised version of the original half-vein model, showed improvement in providing reliable estimates of O. perseae densities for making assessments of general leaf infestation densities across orchards in southern California. The implications of these results for customizing the revised half-vein method as a potential field sampling tool and for experimental research in avocado production in California are discussed.

  5. A review of the ticks (Acari, Ixodida of Brazil, their hosts and geographic distribution - 1. The State of Rio Grande do Sul, Southern Brazil

    Directory of Open Access Journals (Sweden)

    Evans DE

    2000-01-01

    Full Text Available A review of the ticks (Acari, Ixodida of the State of Rio Grande do Sul, southern Brazil, was completed as a step towards a definitive list (currently indicated as 12 of such species, their hosts and distribution. The ticks: Argas miniatus (poultry, Ixodes loricatus (opossums, Amblyomma aureolatum (dogs, A. calcaratum (anteaters, A. cooperi (capybaras, A. nodosum (anteaters, A. tigrinum (dogs (Neotropical and Rhipicephalus sanguineus (dogs (introduced, cosmopolitan, Afrotropical were confirmed as present, in addition to the predominant, Boophilus microplus (cattle (introduced, pan-tropical, Oriental. Of the further 18 species thus far reported in the literature as present in the state, but unavailable for examination: only Ornithodoros brasiliensis (humans and their habitations (Neotropical, Ixodes affinis (deer (Nearctic/Neotropical and I. auritulus (birds (Nearctic/Neotropical/Afrotropical/ Australasian are considered likely; 13 species would benefit from corroborative local data but the majority appear unlikely; reports of A. maculatum (Nearctic/Neotropical, but circum-Caribbean are considered erroneous; the validity of A. fuscum is in doubt. The very recent, first known report of the tropical Anocentor nitens (horses(Nearctic/Neotropical, but still apparent absence of the tropical A. cajennense (catholic (Nearctic/Neotropical and the sub-tropical/temperate Ixodes pararicinus (cattle (Neotropical in Rio Grande do Sul are important for considerations on their current biogeographical distribution and its dynamics in South America. The state has relatively long established, introduced ("exotic", Old World tick species (B. microplus, R. sanguineus that continue to represent significant pests and disease vectors to their traditional, introduced domestic animal hosts, cattle and urban dogs. There are also indigenous, New World ticks (A. miniatus, O. brasiliensis, A. aureolatum, A. nitens, as both long established and possibly newly locally

  6. Controle de Brevipalpus phoenicis (Geijskes, 1939 E Oligonychus ilicis (McGregor, 1917 (Acari: Tenuipalpidae, Tetranychidae em cafeeiro e o impacto sobre ácaros benéficos: I - abamectin e emamectin Control of Brevipalpus phoenicis (Geijskes, 1939 and Oligonychus ilicis (McGregor, 1917 (Acari: Tenuipalpidae, Tetranychidae in coffee plants and the impact on beneficial mites: I - Abamectin and emamectin

    Directory of Open Access Journals (Sweden)

    Paulo Rebelles Reis

    2004-04-01

    Full Text Available O ácaro Brevipalpus phoenicis (Geijskes, 1939 (Acari: Tenuipalpidae é importante em cafeeiro (Coffea spp., por ser o vetor do vírus da mancha-anular, responsável por queda de folhas e má qualidade da bebida do café, e o ácaro-vermelho, Oligonychus ilicis (McGregor, 1917 (Acari: Tetranychidae, por reduzir a área foliar de fotossíntese. Alguns ácaros da família Phytoseiidae são eficientes predadores associados aos ácaros-praga. Com este trabalho teve-se como objetivo estudar o controle dos ácaros-praga e o impacto do abamectin e emamectin sobre fitoseídeos. Em laboratório, foram estudados os efeitos ovicida, tópico, residual, tópico mais residual aos ácaros-praga e a seletividade fisiológica aos fitoseídeos. Em semicampo, foi estudada a persistência dos produtos no controle dos ácaros-praga. O efeito ovicida foi avaliado em ovos no início e fim de incubação; os efeitos residual, tópico e tópico mais residual foram avaliados pela mortalidade de larvas, ninfas e adultos após 48 horas da aplicação, enquanto a persistência foi avaliada pela mortalidade até 30 dias após a pulverização. A seletividade aos ácaros fitoseídeos foi avaliada pelo efeito total às fêmeas adultas, em teste residual em superfície de vidro. Pelos resultados, verificou-se que abamectin e emamectin não possuem ação ovicida, para ambas as espécies de ácaros-praga estudadas. Considerando o efeito tópico mais residual, o abamectin e emamectin foram altamente eficientes no controle de larvas, ninfas e adultos de B. phoenicis; apenas abamectin foi eficiente no controle de O. ilicis. Abamectin foi levemente a moderadamente nocivo e emamectin mostrou-se inócuo a levemente nocivo aos fitoseídeos. Devido à eficiência de controle e seletividade a fitoseídeos, conclui-se que abamectin e emamectin podem ser utilizados em programas de manejo integrado do ácaro B. phoenicis, e abamectin para o manejo de B. phoenicis e O. ilicis em cafeeiro

  7. Association of environmental traits with the geographic ranges of ticks (Acari: Ixodidae) of medical and veterinary importance in the western Palearctic. A digital data set.

    Science.gov (United States)

    Estrada-Peña, A; Farkas, Robert; Jaenson, Thomas G T; Koenen, Frank; Madder, Maxime; Pascucci, Ilaria; Salman, Mo; Tarrés-Call, Jordi; Jongejan, Frans

    2013-03-01

    We compiled information on the distribution of ticks in the western Palearctic (11°W, 45°E; 29°N, 71°N), published during 1970-2010. The literature search was filtered by the tick's species name and an unambiguous reference to the point of capture. Records from some curated collections were included. We focused on tick species of importance to human and animal health, in particular: Ixodes ricinus, Dermacentor marginatus, D. reticulatus, Haemaphysalis punctata, H. sulcata, Hyalomma marginatum, Hy. lusitanicum, Rhipicephalus annulatus, R. bursa, and the R. sanguineus group. A few records of other species (I. canisuga, I. hexagonus, Hy. impeltatum, Hy. anatolicum, Hy. excavatum, Hy. scupense) were also included. A total of 10,280 records was included in the data set. Almost 42 % of published references are not adequately referenced (and not included in the data set), host is reported for only 61 % of records and a reference to time of collection is missed for 84 % of published records. Ixodes ricinus accounted for 44.3 % of total records, with H. marginatum and D. marginatus accounting for 7.1 and 8.1 % of records, respectively. The lack of homogeneity of the references and potential pitfalls in the compilation were addressed to create a digital data set of the records of the ticks. We attached to every record a coherent set of quantitative descriptors for the site of reporting, namely gridded interpolated monthly climate and remotely sensed data on vegetation (NDVI). We also attached categorical descriptors of the habitat: a standard classification of land biomes and an ad hoc classification of the target territory from remotely sensed temperature and NDVI data. A descriptive analysis of the data revealed that a principal components reduction of the environmental (temperature and NDVI) variables described the distribution of the species in the target territory. However, categorical descriptors of the habitat were less effective. We stressed the importance of

  8. Prevalence, associated determinants, and in vivo chemotherapeutic control of hard ticks (Acari: Ixodidae) infesting domestic goats (Capra hircus) of lower Punjab, Pakistan.

    Science.gov (United States)

    Sajid, Muhammad Sohail; Iqbal, Zafar; Khan, Muhammad Nisar; Muhammad, Ghulam; Needham, Glen; Khan, Muhammad Kasib

    2011-03-01

    A total of 800 goats of various breeds, age, and sex were randomly selected from Muzaffargarh (M. garh) and Layyah districts of lower Punjab, Pakistan. The selected goats were visited twice a month to collect information about determinants influencing goat tick infestation prevalence. For acaricidal efficacy, 360 tick-infested adult goats were subjected to an acaricidal treatment and post-treatment quantitative assessment of tick burden. Quantification of adult tick detachment 24 h post-treatment and the duration of treatment efficacy were calculated. Overall prevalence of goat tick infestation in both study districts was 60.1% (481/800). The prevalence was higher in district M. garh than in district Layyah. Tehsil-wise prevalence in district Layyah was highest in tehsil Layyah followed in order by Chaubara and Karor. In district M. garh, highest prevalence was found in tehsil M. garh followed by Kot Addu, Alipur, and Jatoi. Hyalomma a. anatolicum (75.9%; 365/481) and Rhipicephalus sanguineus (24.1%; 116/481) were the predominant species in both the districts. The highest month-wise prevalence was 56.9% and 62.7% in Layyah and M. garh districts, respectively, during July 2008, and the minimum (0%) prevalence was reported in November and December, respectively. Regarding host determinants, female goats were more heavily infested (72.8%) than males (47.5%), and younger animals were (63.5%) more burdened than older ones (56.7%). Teddy goats were the most susceptible breeds followed in order by Beetal, cross-bred, Nachi, and Dera Din Pannah. The preferred sites of attachment were inside and outside of the ear. Both the ivermectin (IVM)- and cypermethrin (CYM)-treated groups resulted in significantly lower (P < 0.05) tick counts relative to controls on all post-treatment counting days. The lowest tick burden in the IVM-treated group was significantly higher (P < 0.05) as compared to the CYM-treated group, the latter being close to zero. Hence, the in vivo efficacy

  9. One-Humped Camels (Camelus dromedaries Hard Ticks Infestation in Qeshm Island, Iran

    Directory of Open Access Journals (Sweden)

    Saeed Nazifi

    2011-06-01

    Full Text Available The economic importance of tick infestation on camels are important as they are important meat and milk producer animals in the less vegetation area of Iran and their health and production are greatly affected by the high tick infestation. In this investigation, tick infestations on camels (Camelus dromedarius were determined in Qeshm Island, Iran. A total number of 912 adult ticks (472 males and 440 females were collected and identified. Hyalomma dromedarii was the predominant tick specie and accounted for 61.9% of the adult ticks. Other hard ticks were H. anatolicum excavatum (22 %, H. asiaticum asiaticum (14.2 %, H. marginatum (1.9 %, H. impeltatum (0.4 % and Ripicephalus bursa (0.4 %. In conclusion, The provision of tick control programs in the Qeshm Island would seem a prerequisite for improving camel meat and milk production.

  10. Primeiro relato de Amblyomma fuscum Neumann, 1907 (acari: ixodidae) parasitando lagarto da espécie Tupinambis teguixin (L.), no município de Glorinha, estado do Rio Grande do Sul, Brasil

    OpenAIRE

    João R Martins; Elida C. Monticelli; Onofrio,Valéria C.; Darcy M. Barros-Battesti; Rovaina L. Doyle

    2007-01-01

    Amblyomma fuscum conhecida somente no Brasil, tem sido descrita como uma espécie rara de carrapato com relatos de sua ocorrência nas regiões sul e sudeste. Este é um novo registro desta espécie (9 fêmeas) parasitando lagarto (Tupinambis teguixin), no Município de Glorinha, Estado do Rio Grande do Sul. As fêmeas foram depositadas na coleção do Instituto de Pesquisas Veterinárias Desidério Finamor (7 espécimes) e na coleção de Acari do Instituto Butantan, Estado de São Paulo (2 espécimes). O ac...

  11. Investigation of hemorrhagic fever viruses inside wild populations of ticks: One of the pioneer studies in Saudi Arabia

    Directory of Open Access Journals (Sweden)

    Rania Ali El Hadi Mohamed

    2017-05-01

    Full Text Available Objective: To screen hemorrhagic fever viruses inside wild populations of ticks collected from Riyadh, Saudi Arabia between January and March 2016. Methods: Ticks were identified depending on their morphological features using classical keys then grouped into pools. Ticks in each pool were processed separately using the sterile pestles and mortars. Viral RNA was extracted using Qiagen RNeasy Mini Kit and Qiagen RNAeasy Columns (Qiagen, Hilden, Germany according to the instructions of manufacturers. A total number of 1 282 hard ticks were collected, and 582 of them were precisely identified then screened for the presence of arboviruses using quantitative real-time PCR. The four species were screened for six viruses: Rift Valley fever virus (RVFV, Chikungunya virus (CHIKV, Crimean-Congo hemorrhagic fever virus (CCHFV, Alkhurma virus (INKV, Sindbis virus (SINV, and Pan Hanta virus (HANTA. CT value for the negative control (RNA free water was zero. Negative and positive controls were tested for each test to confirm the specificity of the selected primer pairs. SYBR Green One step RT-PCR Master Mix (KAPA Biosystems, Boston, MA was tested along with primers. Results: Ticks identification resulted into four species: Hyalomma schulzei, Hyalomma onatoli, Boophilus kdhlsi, and Hyalomm dromedarii. All the ticks’ species (except Boophilus kdhlsi were positive for the following viruses: SINV, RVFV, CHIKV, and CCHFV. While HANTA viruses have been detected in a single species (Hyalomm dromedarii. Conclusions: According to our knowledge this research may be one of the pioneer studies in Kingdom of Saudi Arabia. Incrimination of the above mentioned ticks species as well as their vectorial capacity are highly recommended for investigation in the upcoming researches.

  12. Hard Ticks on Domestic Ruminants and their SeasonalPopulation Dynamics in Yazd Province, Iran

    Directory of Open Access Journals (Sweden)

    Y Salim abadi

    2010-06-01

    Full Text Available Background: Ticks are the main vectors for transmission of different pathogens to human and animals. This survey was performed to find out distribution of ticks, which infested the domestic ruminants in Yazd Province, central Iran during year 2008-2009.Methods: A total number of 30 villages from both mountainous (20% and plateau (80% regions of the province were selected randomly. Ticks were colleted from the body of infested animals and transported to the laboratory of Medical Entomology, School of Public Health, Tehran University of Medical Sciences and then were identified to space level using valid identification key.Results: A total of 583 hard ticks were collected. The ticks were classified into three genera and 7 species including:  Hyalomma dromedarii (55.92%, Hy. marginatum (13.20%, Hy. anatolicum (9.78%, Hy. detritum (4.98%,  Hy. asiaticum (3.94%, Rhipicephalus sanguineus (11.84%, and Dermacentor marginatus (0.34%. The highest seasonal activities occurred in summer. The prevalence of the Ixodidae ticks was more evident in plateaus area in Yazd Province. Among the hosts including: cow, goat, sheep and camel, the ticks that collected from camel was more prevalent. The ratio of male was more than female ticks. Hyalomma. dromedarii was the predominant tick species and accounted for 55.92% of the ticks.Conclusion: Some of the collected ticks may play an important role for transmission of vector borne disease to human; therefore, the results of this study will provide a clue for vectors of tick-borne diseases in the region for local authorities for implementation of disease control.

  13. Eupalopsellidae and Stigmaeidae (Acari: Prostigmata) within citrus orchards in Florida: species distribution, relative and seasonal abundance within trees, associated vines, and ground cover plants.

    Science.gov (United States)

    Childers, Carl C; Ueckermann, Eduard A

    2014-10-01

    Seven citrus orchards on reduced- to no-pesticide spray programs were sampled for predacious mites in the families Eupalopsellidae and Stigmaeidae (Acari: Prostigmata) in central and south central Florida. Inner and outer canopy leaves, fruit, twigs, and trunk scrapings were sampled monthly between August 1994 and January 1996. Open flowers were sampled in March from five of the sites. Two species of eupalopsellid mites (Exothorhis caudata Summers and Saniosulus harteni (van-Dis and Ueckermann)) were identified from 252 specimens collected within citrus tree canopies within the seven citrus orchards of which 249 were E. caudata. Only two E. caudata were collected from ground cover plants within five of the seven orchards. Eight species of Stigmaeidae were identified from 5,637 specimens: Agistemus floridanus Gonzalez, A. terminalis Gonzalez, Eustigmaeus arcuata (Chandhri), E. sp. near arcuata, E. segnis (Koch), Mediostigmaeus citri (Rakha and McCoy), Stigmaeus seminudus Wood, and Zetzellia languida Gonzalez were collected from within citrus tree canopies from seven orchard sites. Agistemus floridanus was the only species in either family that was abundant with 5,483 collected from within citrus tree canopies compared with only 39 from vine or ground cover plants. A total of 431 samples from one or more of 82 vines and ground cover plants were sampled monthly between September 1994 and January 1996 in five of these orchards and one or more eupalopsellids or stigmaeids were collected from 19 of these plants. Richardia brasiliensis (Meg.) Gomez had nine A. floridanus from 5 of 25 samples collected from this plant. Solanum sp. had five A. floridanus from three samples taken. Both eupalopsellid and stigmaeid species numbers represented orchards were on full herbicide programs and ground cover plants were absent. Agistemus floridanus was more abundant in the citrus orchards with on-going or recent herbicide programs compared with orchards having well-developed ground

  14. Phytoseiidae (Acari: Mesostigmata) within citrus orchards in Florida: species distribution, relative and seasonal abundance within trees, associated vines and ground cover plants.

    Science.gov (United States)

    Childers, Carl C; Denmark, Harold A

    2011-08-01

    Seven citrus orchards on reduced- to no-pesticide spray programs were sampled for predacious mites in the family Phytoseiidae (Acari: Mesostigmata) in central and south central Florida. Inner and outer canopy leaves, open flowers, fruit, twigs, and trunk scrapings were sampled monthly between September 1994 and January 1996. Vines and ground cover plants were sampled monthly between September 1994 and January 1996 in five of these orchards. The two remaining orchards were on full herbicide programs and ground cover plants were absent. Thirty-three species of phytoseiid mites were identified from 35,405 specimens collected within citrus tree canopies within the seven citrus orchards, and 8,779 specimens from vines and ground cover plants within five of the seven orchards. The six most abundant phytoseiid species found within citrus tree canopies were: Euseius mesembrinus (Dean) (20,948), Typhlodromalus peregrinus (Muma) (8,628), Iphiseiodes quadripilis (Banks) (2,632), Typhlodromips dentilis (De Leon) (592), Typhlodromina subtropica Muma and Denmark (519), and Galendromus helveolus (Chant) (315). The six most abundant species found on vines or ground cover plants were: T. peregrinus (6,608), E. mesembrinus (788), T. dentilis (451), I. quadripilis (203), T. subtropica (90), and Proprioseiopsis asetus (Chant) (48). The remaining phytoseiids included: Amblyseius aerialis (Muma), A. herbicolus (Chant), A. largoensis (Chant), A. multidentatus (Chant), A. sp. near multidentatus, A. obtusus (Koch), Chelaseius vicinus (Muma), Euseius hibisci Chant, Galendromus gratus (Chant), Metaseiulus mcgregori (Chant), Neoseiulus mumai (Denmark), N. vagus (Denmark), Phytoscutus sexpilis (Muma), Phytoseiulus macropilis (Banks), Proprioseiopsis detritus (Muma), P. dorsatus (Muma), P. macrosetae (Banks), P. rotundus (Muma), P. solens (De Leon), Typhlodromips deleoni (Muma), T. dillus (De Leon), T. dimidiatus (De Leon), T. mastus Denmark and Muma, T. simplicissimus (De Leon), and T. sp

  15. Primera aproximacion a la Paleoentomología de los yacimientos de la Sierra de Atapuerca (Burgos, España: la fauna subfósil de Oribátidos (Acari, Oribatida

    Directory of Open Access Journals (Sweden)

    Arroyo, J.

    2007-06-01

    Full Text Available The Atapuerca Quaternarian sites are of worldwide interest due to the presence of human remains belonging to the last million years. The oribatid mites (Acari, Oribatida found in several archaeological samples extracted from the Atapuerca Quaternarian deposits, have been analyzed during the 2003 excavation campaign to study the Palaeoentomology of the site. The oribatid mite fauna consists of 7 individuals, 6 of which were obtained from Gran Dolina site (about 300.000 years old and belong to families Cosmochthoniidae, Scheloribatidae, Oribatulidae and Hemileiidae. Most of the taxa were identified to species level. The results obtained were used as a basis to reconstruct the paleo-environments of the site in correspondence with the biological and ecological preferences of the taxa.

    Los yacimientos cuaternarios de la Sierra de Atapuerca ofrecen interés mundial por haber hospedado varias especies de homínidos que vivieron en el último millón de años. En este contexto, durante la campaña de excavaciones de 2003 se realizó un muestreo puntual en algunos de sus yacimientos para obtener los primeros datos de restos de artrópodos que pudieran conservarse en los mismos. En este trabajo se presentan los resultados obtenidos de ácaros subfósiles pertenecientes al suborden de los oribátidos (Acari, Oribatida. Después de procesar los sedimentos, se obtuvieron un total de 7 individuos en el conjunto de los yacimientos muestreados, de los cuales 6 aparecieron en Gran Dolina en un nivel con datación en torno a los 300.000 años. Los ejemplares, identificados en su mayoría a nivel taxonómico de especie, pertenecen a las familias Cosmochthoniidae, Scheloribatidae, Oribatulidae y Hemileiidae. Dado el conocimiento que se dispone de la biología de los taxones encontrados, que pertenecen a géneros y especies presentes en la actualidad, se han realizado inferencias sobre los ambientes pretéritos en que los animales vivieron.

  16. Prevalence of tick infestation in dromedary camels (Camelus dromedarius) brought for slaughter in Mashhad abattoir, Iran.

    Science.gov (United States)

    Moshaverinia, Ali; Moghaddas, Elham

    2015-09-01

    This study was carried out to investigate the prevalence of tick infestation and identify tick species that parasitize dromedary camels. Since April 2012 through March 2013, a total of 400 camels that brought for slaughter in Mashhad abattoir were examined for tick infestation. Out of the total 400 camels examined, 237 were infested and annual prevalence of tick infestation 59.25 % (95 % CI 54-64) was calculated. The higher prevalence rates were found in the summer and spring, especially the summer that prevalence rate was the highest. A total of 1,122 ticks were collected from the infested camels and identified by stereomicroscopy. Hyalomma dromedarii was the predominant tick species and comprised 70.76 % of the collected ticks. The frequency of other species was as follows: H. excavatum (19.25 %), H. anatolicum (4.81 %), H. asiaticum (4.72 %), Rhipicephalus turanicus (0.17 %), H. detritum (0.09 %), H. impeltatum (0.09 %) and H. schulzei (0.09 %). Based on the results of present study, it is concluded that camels mostly harbor Hyalomma spp. The species of this genus are the most notorious ticks for transmission of human and animal diseases. Therefore, appropriate tick control measures need to be employed and pour-on method for acaricide application is suggested because this method is fast, easy and suitable for use by camel owners in deserts.

  17. Anaplasma infection of Bactrian camels (Camelus bactrianus) and ticks in Xinjiang, China.

    Science.gov (United States)

    Li, Youquan; Yang, Jifei; Chen, Ze; Qin, Gege; Li, Yaqiong; Li, Qian; Liu, Junlong; Liu, Zhijie; Guan, Guiquan; Yin, Hong; Luo, Jianxun; Zhang, Lin

    2015-06-10

    To date, anaplasmosis has been reported to be a subclinical disease in Indian and Arabian one-humped camels (Camelus dromedarius) and llamas (Lama glama). However, no information on Anaplasma infection in two-humped Bactrian camels (Camelus bactrianus) in China has been published to date. The aim of this study was to investigate the prevalence of Anaplasma spp. in domestic Bactrian camels and ticks in Xinjiang, China. A total of 382 ticks were collected from the Bactrian camels and from environmental sources. Of these, 84 were morphologically identified as belonging to the Rhipicephalus sanguineus group and genetically identified (12S rDNA, 16S rDNA and the cytochrome c oxidase 1 genes) as R. sanguineus group ticks (temporally designated as Rhipicephalus sp. Xinjiang). PCR testing showed that 7.2% (20/279) of the camels harbored Anaplasma platys DNA. However, microscopic examination revealed no A. platys inclusions in blood smears from the camels. The PCR prevalence of A. platys DNA was 9.5% (6/63) in Rhipicephalus sp. Xinjiang from the Bactrian camels and 14.3% (3/21) in Rhipicephalus sp. Xinjiang from the vegetation. A. platys DNA was not detected by PCR in other tick species (Hyalomma asiaticum, Dermacentor niveus and Hyalomma dromedarii), and no other Anaplasma species were detected in these samples. This is the first report of A. platys in Bactrian camels in Xinjiang, China. The moderate positivity observed indicates that these animals might be a natural host for this pathogen in China.

  18. Ticks (Acari: Ixodida: Argasidae, Ixodidae infesting humans in Northwestern Córdoba province, Argentina Garrapatas infestando humanos en el noroeste de la provincia de Córdoba, Argentina

    Directory of Open Access Journals (Sweden)

    Nava Santiago

    2006-06-01

    Full Text Available Ticks infesting humans were collected from September 2004 to August 2005 in Northwestern Córdoba in an area with a southern limit in the locality of Dean Funes (30°25´S 64°20´W and San José de las Salinas (30°00´S 64°37´W in the North. The collections consisted in ticks found attached on man obtained from three sources: 1 specimens fixed on two workers during two successive days per month of field work in the northern part of the area which belongs to Western Chaco district of the phytogeographical Chaco domain, 2 ticks attached to a man working in a farm close to Dean Funes in the Chaco Serrano district of the Chaco domain and, 3 ticks collected from a collaborator visiting daily a suburban property with dogsin the vicinities of Dean Funes. Most ticks collected were larvae, nymphs and adults of Amblyomma neumanni from the Chaco Serrano district where a nymph of Otobius megnini was also found on man. Adults of Amblyomma parvum and Amblyomma tigrinum were detected feeding on humans in the Western Chaco district and in the property close to Dean Funes, respectively. Amblyomma neumanni was absent on man from December to April while most specimens of A. parvum and A. tigrinum were collected during summer. Their role as potential vector of ticktransmitted diseases in the area is unknown.Se recolectaron garrapatas (Acari: Ixodida: Argasidae, Ixodidae infestando humanos entre septiembre de 2004 y agosto de 2005 en un área del noroeste de Córdoba cuyo límite al sur es la localidad Deán Funes (30º25´S 64°20´W y el límite al norte es la localidad de San José de las Salinas (30°00´S 64°37´W. Las colecciones consistieron en garrapatas fijadas a humanos obtenidas de tres fuentes: 1 garrapatas fijadas sobre dos trabajadores durante dos días sucesivos por mes de trabajo de campo en la parte norte del área, la cual pertenece al distrito chaqueño occidental del dominio fitogeográfico del Chaco, 2 garrapatas fijadas a un trabajador en

  19. Influence de l'âge de la feuille sur les paramètres biologiques et les populations de l'acarien vert du manioc Mononychellus tanajoa Bondar (Acari: tetranychidae

    Directory of Open Access Journals (Sweden)

    Badegana, AM.

    2002-01-01

    Full Text Available The Effect of Leaf Age on the Cassava Green Mite Mononychellus tanajoa Bondar (Acari: Tetranychidae Biological Parameters and Population Growth Rates. The study of cassava (Manihot esculenta Crantz leaf age effect on Mononychellus tanajoa Bondar biological parameters and population growth rates was studied in laboratory (T= 24-26 °C; RH= 70-90%. The local Dschang cultivar was used and the study concerned the 15, 40, 65, 90 and 115 days old leaves. The results obtained show that the egg incubation duration was the longest (6.4 days and that of the deutonymph stage the shortest one (1.9 days. The hatching rate was very high (98%. There was no significant difference (p= 0.05 between the developmental stages of M. tanajoa reared on the leaves of different ages. On the contrary fecundity whatever it is daily or total was high on young leaves and small on the old ones. The correlation coefficient between the leaf age and the intrinsic rate of increase (rm was -0.896 and that obtained between the net reproduction rate (Ro and the leaf age -0.966. These coefficients are negative and in absolute value near to one; which shows that the more the leaf is old, the more the M. tanajoa population growth is little. The M. tanajoa population growth is therefore fast on young leaves and slow on the old ones.

  20. (4E)-dehydrocitrals [(2E,4E)- and (2Z,4E )-3,7-dimethyl-2,4,6-octatrienals] from acarid mite Histiogaster sp. A096 (Acari: Acaridae).

    Science.gov (United States)

    Hiraoka, H; Mori, N; Nishida, R; Kuwahara, Y

    2001-12-01

    A mixture of two monoterpenes was obtained as the opisthonotal gland secretion from unidentified Histiogaster sp. A096 (Acari: Acaridae), and their structures were elucidated to be (4E)-dehydrocitrals [(2E,4E)- and (2Z,4E)-3,7-dimethyl-2,4,6-octatrienals] by GC/MS, GC/FT-IR, UV and 1H-NMR spectra. Both isomers of (4E)-dehydrocitral prepared by syntheses in 4 steps from 3-methyl-2-butenal with 34.2% yields (based on the ylide) were separated by column chromatography into the (2E,4E)- and (2Z,4E)-3,7-dimethyl-2,4,6-octatrienal. Mass spectra together with GC retention times of the purified natural (4E)-dehydrocitrals were identical with those of synthetic (2E,4E)-3,7-dimethyl-2,4,6-octatrienal and (2Z,4E)-3,7-dimethyl-2,4,6-octatrienal. The geometry at the 2-C position of both synthetic (4E)-dehydrocitrals was confirmed by NOESY analyses. This is the first identification of (4E)-dehydrocitrals from the animal kingdom.

  1. Sequencing for complete rDNA sequences (18S, ITS1, 5.8S, ITS2, and 28S rDNA) of Demodex and phylogenetic analysis of Acari based on 18S and 28S rDNA.

    Science.gov (United States)

    Zhao, Ya-E; Wu, Li-Ping; Hu, Li; Xu, Yang; Wang, Zheng-Hang; Liu, Wen-Yan

    2012-11-01

    Due to the difficulty of DNA extraction for Demodex, few studies dealt with the identification and the phyletic evolution of Demodex at molecular level. In this study, we amplified, sequenced, and analyzed a complete (Demodex folliculorum) and an almost complete (D12 missing) (Demodex brevis) ribosomal DNA (rDNA) sequence and also analyzed the primary sequences of divergent domains in small-subunit ribosomal RNA (rRNA) of 51 species and in large-subunit rRNA of 43 species from four superfamilies in Acari (Cheyletoidea, Tetranychoidea, Analgoidea, and Ixodoidea). The results revealed that 18S rDNA sequence was relatively conserved in rDNA-coding regions and was not evolving as rapidly as 28S rDNA sequence. The evolutionary rates of transcribed spacer regions were much higher than those of the coding regions. The maximum parsimony trees of 18S and 28S rDNA appeared to be almost identical, consistent with their morphological classification. Based on the fact that the resolution capability of sequence length and the divergence of the 13 segments (D1-D6, D7a, D7b, and D8-D12) of 28S rDNA were stronger than that of the nine variable regions (V1-V9) of 18S rDNA, we were able to identify Demodex (Cheyletoidea) by the indels occurring in D2, D6, and D8.

  2. Vectors of Crimean Congo Hemorrhagic Fever Virus in Iran

    Directory of Open Access Journals (Sweden)

    Zakkyeh Telmadarraiy

    2015-10-01

    Full Text Available Background: Ticks are important vectors and reservoirs of Crimean Congo Hemorrhagic Fever (CCHF virus. Human beings may be infected whenever the normal life cycle of the infected ticks on non- human vertebrate hosts is interrupted by the undesirable presence of humans in the cycle. A total of 26 species of Argasid and Ixodid ticks have been recorded in Iran; including nine Hyalomma, two Rhipicephalus, two Dermacentor, five Haemaphysalis, two Boophilus, one Ixodes and two Argas as well as three Ornithodoros species as blood sucking ectoparasites of livestock and poultries. The present paper reviews tick vectors of CCHF virus in Iran, focusing on the role of ticks in different provinces of Iran using reverse transcription polymerase chain reaction (RT-PCR assay.Methods: During ten years study, 1054 tick specimens; including two species of Argasidae and 17 species of Ixodidae were examined for their infection to CCHF virus genome. The output of all studies as well as related publications were discussed in the current paper.Results: The results show that Rhipicephalus sanguineus, Hyalomma marginatum, H. anatolicum, H. asiaticum and H. dromedarii were known as the most frequent species which were positive for CCHF virus.Conclusion: The status of ticks which were positive for CCHF virus revealed that unlike the most common idea that Hyalomma species are the most important vectors of CCHF virus, other ticks including Rhipicephalus,Haemaphysalis and Dermacentor can be reservoir of this virus; thus, considering geographical distribution, type of host and environmental conditions, different tick control measurements should be carried out in areas with high incidence of CCHF disease.

  3. Chlorotic spots on Clerodendrum, a disease caused by a nuclear type of Brevipalpus (Acari:Tenuipalpidae transmitted virus Mancha clorótica do Clerodendrum, uma enfermidade causada por um vírus do tipo nuclear, transmitido pelo ácaro Brevipalpus phoenicis (Acari:Tenuipalpidae

    Directory of Open Access Journals (Sweden)

    Elliot Watanabe Kitajima

    2008-02-01

    Full Text Available Chlorotic spots have been observed in plants of Clerodendrum x speciosum growing in residential gardens and parks in Piracicaba, SP, Brazil. Thin sections of diseased tissues revealed characteristic cytopathic effects of the nuclear type of the Brevipalpus (Acari: Tenuipalpidae mite-transmitted viruses (BTrV. Brevipalpus mites, identified as B. phoenicis, infesting symptomatic C. x speciosum plants transmitted the pathogen to healthy C. x speciosum and to C. thomsonae, Gomphrena globosa, Hibiscus cannabinus, H. coccineus, H. schizopetalus, Salvia leucantha, Spathiphyllum wallasi and Tetragonia expansa causing chlorotic spots on their leaves. Mechanical inoculation using leaf extracts from infected C. x speciosum resulted in chlorotic spots on inoculated C. x speciosum, Chenopodium quinoa, C. amaranticolor, G. globosa, H. cannabinus, H. coccineus and T. expansa leaves. C. amaranticolor and C. quinoa kept at 28 - 30°C became systemically infected. The same cytopathic effects caused by the nuclear type of BTrV were seen in tissues from all infected test plants by electron microscopy. The virus was purified from systemically infected leaves of C. amaranticolor and C. quinoa. A polyclonal antiserum obtained from an immunized rabbit presented a strong reaction with the homologous antigen in ELISA tests. The results suggest that this chlorotic spot disease of C. x speciosum is caused by a new species of the nuclear type of BTrV, tentatively named Clerodendrum chlorotic spot virus (ClCSV.Manchas cloróticas e necróticas foram observadas em folhas de várias plantas de coração-sangrento (Clerodendrum x speciosum cultivadas em parques e jardins em Piracicaba, SP, associadas à infestação pelo ácaro tenuipalpídeo Brevipalpus phoenicis. Exames preliminares de secções de tecido das manchas cloróticas ao microscópio eletrônico revelaram a ocorrência de efeitos citopáticos característicos dos induzidos pelos vírus do tipo nuclear, transmitido

  4. Nouvelle technique d'élevage de l'acarien phyllophage Tetranychus urticae Koch (Acari : Tetranychidae et son application à l'étude de l'efficacité de quelques acaricides sur pomme de terre (Solarium tuberosum L.

    Directory of Open Access Journals (Sweden)

    Badegana, AM.

    2000-01-01

    Full Text Available A New Rearing Technique of Phytophagous Mite Tetranychus urticae Koch (Acari : Tetranychida and its Application in the Study of the Efficacy of some Acaricides on Potato [Solanum tuberosum L.. A 5 cm diameter leaf disc of potato or another host plant (or four on 2.5 cm diameter was used in a Petri dish of 9 cm diameter for the rearing technique. This leaf disc, pierced in its centre, slides along a rustproof pin and floats on a 1 mm thick lamina of demineralized fresh water. Water is a "strong barrier" which confines the tetranychid mites on the leaf disc, even if this one does not corne from a host plant (tetranychid mites deprived of food. This rearing technique was used as a bioassay to test the effectiveness of acaricides (pyrimiphos-methyl, bromopropylate, fenpropathrin, dienochlor on the developmental stages of Tetranychus urticae. The ovicidal activity against the eggs of one, three, seven days old (the eggs incubation duration being 8.1 ±0.15 days was also studied. The results obtained show that bromopropylate, fenpropathrin and dienochlor have an ovicidal activity against the eggs of the different ages, but dienochlor has the highest efficiency (90 % mortality. Pyrimiphos-methyl is only active against the seven-day old eggs and bromopropylate has a high efficiency only on the one-day old eggs. Concerning the other developmental stages such as chrysalis (protochrysalis, deu-tochrysalis, teleiochrysalis and mobile stages (larva, protonymph, deutonymph and adult female, pyrimiphos-methyl has de highest efficiency (90 % mortality ; dienochlor also, except mobile stages. Bromopropylate has no activity against the chrysalis and mobile stages and fenpropathrin has a remarkable repulsive effect.

  5. Evolution journalière du sex-ratio dans une population de Mononychellus tanajoa Bondar (Acari: Tetranychidae en laboratoire, paramètres de la dynamique des populations

    Directory of Open Access Journals (Sweden)

    Badegana, AM.

    2003-01-01

    Full Text Available Sex-ratio Daily Evolution in a Population of Mononychellus tanajoa Bondar (Acari: Tetranychidae in the Laboratory, Population Dynamics Parameters. The sex-ratio (100.males/females of offsprings laid by fertilized female parents of Mononychellus tanajoa Bondar and its daily evolution was studied in the laboratory. The highest sex-ratio value 900 (90.0% male offsprings was obtained on the first day of the oviposition and the lowest value 7.2 (6.7% male offsprings on the 16th day of the oviposition period which lasted 38.1 ± 4.9 days (mean ± standard deviation. From a total number of 118.0 ± 10.9 offsprings, 94.0 ± 10.5 (on the average 79.7% were ''laid'' during the first half of the oviposition period. The results also show that from a total number of 88.0 ± 8.3 female offsprings, 74.0 ± 8.0 (84.1% were ''laid'' during the first half of the oviposition period whereas from a total number of 30.0 ± 2.7 male offsprings, 20.0 ± 2.5 (66.7% were ''laid'' within the same period. The sex-ratio of each fertilized female parent was 31.9 ± 1.7 (24.2% ± 1.0% male offsprings and the sex-ratio within the population was 34.0 ± 0.0 (25.4% ± 0.1% male offsprings. The intrinsic rate of increase, and the rate of multiplication in one generation were 0.1380 and 79.23 respectively.

  6. Sensibilité à Mononychellus tanajoa Bondar (Acari : Tetranychidae de quelques cultivars de manioc (Manihot esculenta Crantz et incidence des attaques sur le rendement, dans la région des hauts plateaux de l'Ouest Cameroun

    Directory of Open Access Journals (Sweden)

    Badegana, AM.

    2001-01-01

    Full Text Available Sensibility to Mononychellus tanajoa Bondar (Acari : Tetranychidae of some Cassava (Manihot esculenta Crantz, Cultivars and Effect of Damage on Yield Loss in the Cameroonian Western High-lands. The study of the sensibility towards the green mite Mononychellus tanajoa Bondar of some cassava (Manihot esculenta Crantz cultivars and the assessment of the effect of damage on the yield losses was carried out in the Western highlands of Cameroon. Four cassava cultivars were used : two local (Dschang and Njombe and two improved varieties (IITA 8017 and IITA 82516. The results obtained showed that the density (mites number/cm2 of leaf area was low during the rainy season and high during the dry season, which means that rains reduce the mite population by washing or lead the mites to death. The highest mean density (3.40 mites/cm2 of leaf area was obtained on the local Njombe cultivar which is consequently the most sensitive. On the contrary, the local Dschang cultivar, with the lowest mite density (1.40 mites/cm2 of leaf area was the most resistant followed by the IITA 8017 cultivar (1.74 mites/cm2. The IITA82516 cultivar had a mean density of2.65 mites/cm2. Yield losses ranged from 36.90 % for IITA 8017 (1.74 mites/cm2 and damages level of 2.75 to 58.70 % for local Dschang (3.40 mites/cm2 and damages level of 3.84. Local Dschang cultivar (1.40 mites/cm2 and damage level of 2.96 and IITA 82516 (2.65 mites/cm2 and damage level of 2.96 had a yield losse of38.10 % and 41.80 %. The results showed that higher the mite density and damage level are, higher is the yield loss, unless the cultivar is tolerant.

  7. In vitro activity of 3β-O-tigloylmelianol from Guarea kunthiana A. Juss (Meliaceae) on oogenesis and ecdysis of the cattle tick Rhipicephalus (Boophilus) microplus (Canestrini) (Acari: Ixodidae).

    Science.gov (United States)

    Barbosa, Carolina da Silva; Borges, Lígia Miranda Ferreira; Louly, Carla Cristina Braz; Rocha, Thiago Lopes; de Sabóia-Morais, Simone Maria Teixeira; Miguita, Carlos Henrique; Garcez, Walmir Silva; Garcez, Fernanda Rodriguez

    2016-05-01

    We evaluated the effects of 3β-O-tigloylmelianol from Guarea kunthiana A. Juss (Meliaceae) on oogenesis, as a larvicide and on ecdysis of the larvae and the nymphs of the cattle tick Rhipicephalus (Boophilus) microplus (Canestrini) (Acari: Ixodidae). On the oogenesis' test, 48 engorged females were divided into three groups, evaluated at 24, 48 and 72 h post-treatment. Half of the females were treated with 0.01% 3β-O-tigloylmelianol diluted in distilled water and 5% dimethyl sulfoxide (DMSO), while the other half (controls) were exposed to distilled water and 5% DMSO. After treatment, the ovaries were weighed in order to measure the gonadosomatic index (GSI) and were also subjected to standard histological technical tests. On the larvicide and ecdysis' tests, 3β-O-tigloylmelianol was tested at concentrations of 0.01, 0.005, 0.0025 and 0.00125%. Compared with the controls, there was a reduction of GSI of approximately 50% on the treated group, which started at 48 h post treatment. Overall, the protolimonoid 3β-O-tigloylmelianol has caused a significant reduction in the number of oocytes. It has also caused alteration of the cytoplasmic and germinal vesicle diameters. Morphological changes, such as vacuolization, chorion irregularity which has modified the oocytes' morphology as well as alterations on the yolk's granules were also observed. The compound was not larvicide, however, interfered in the ecdysis of the larvae and the nymphs. This study shows that the protolimonoid 3β-O-tigloylmelianol from G. kunthiana acts on oogenesis and ecdysis of R. (B.) microplus, but not as larvicide, indicating that it acts on the endocrine system of the tick.

  8. Molecular epidemiology of Crimean-Congo hemorrhagic fever virus detected from ticks of one humped camels (Camelus dromedarius) population in northeastern Iran.

    Science.gov (United States)

    Champour, Mohsen; Chinikar, Sadegh; Mohammadi, Gholamreza; Razmi, Gholamreza; Shah-Hosseini, Nariman; Khakifirouz, Sahar; Mostafavi, Ehsan; Jalali, Tahmineh

    2016-03-01

    A comprehensive study was conducted on camel ticks to assess the epidemiological aspects of the infection in camels. From May 2012 to January 2013, 11 cities and towns from the Khorasan provinces, northeastern Iran, were randomly selected as a "cluster" and at least 14 camels were sampled from each cluster. A total of 200 camels were examined in this study, reverse transcriptase polymerase chain reaction was used for the detection of the Crimean-Congo hemorrhagic fever virus (CCHFV) genome. Tick infestation was observed in 171 of the 200 camels, 480 ixodid ticks were collected, and one genus was identified as Hyalomma. Four species were reported to be the major tick species infesting camels. Among these, Hyalomma dromedarii was the most predominant tick species (90.7 %), followed by H. anatolicum (6 %), H. marginatum (2.9 %), and H. asiaticum (0.4 %). The genome of the CCHFV was detected in 49 (10.2 %) of the 480 ticks. The CCHFV RNA was detected in two of the four tick species, and the viral genome was detected from tick samples in three South Khorasan cities. The positivity rate of ticks was as follows: Boshroyeh, 25 out of 480 (5.2 %); Birjand, 17 out of 480 (3.5 %); and Nehbandan, 7 out of 480 (1.5 %). We recommend the use of acaricides to prevent disease transmission to humans and to reduce the tick population in camels. Care should be taken by abattoir workers and by those who work closely with camels.

  9. A comparative study of the dynamics of Wolbachia infection in different populations of Tetranychus urticae (Acari : Tetranychidae)%共生菌Wolbachia在中国二斑叶螨种群中的扩散规律

    Institute of Scientific and Technical Information of China (English)

    谢蓉蓉; 陈小琳; 孙荆涛; 洪晓月

    2013-01-01

    共生菌Wolbachia在中国二斑叶螨Tetranychus urticae Koch中分布广泛,所有的地理种群中均感染Wolbachia.以二斑叶螨湖南长沙(HN),辽宁兴城(LN)和江苏徐州(JS)3个地理种群为实验材料,经筛选获得100%感染和不感染Wolbachia的品系后,人工设置Wolbachia感染率为50%的品系,通过PCR技术检测二斑叶螨连续世代Wolbachia感染率动态变化,研究Wolbachia在二斑叶螨种群中的扩散规律.结果表明:3个地理种群的垂直传播效率都为100%;HN种群Wolbachia感染率上升速度最快,F7代达到100%感染;LN种群F12达到100%感染;而JS地理种群中Wolbachia感染率速度上升最慢,在F20代达到100%感染,其后感染率均能稳定在100%.LN种群Wolbachia通过诱导胞质不亲和的策略,JS种群的Wolbachia通过提高寄主适合度的策略,而HN种群Wolbachia则通过诱导胞质不亲和与提高寄主适合度两者相结合的策略,最终达到在二斑叶螨中维持感染状态并扩散传播的目的.本研究结果为今后利用Wolbachia的扩散规律控制有害生物及疾病传播提供了基础.%Maternally inherited Wolbachia bacteria are widely distributed in Chinese populations of the two-spotted spider mite Tetranychus urticae Koch (Acari; Tetranychidae). All populations were found to be infected with Wolbachia. Using the Hunan ( HN) , Liaoning ( LN ) and Jiangsu ( JS) populations of T. urticae as experimental subjects, 100% Wolbachia-infected and 100% uninfected spider mite lines were obtained by screening. This study investigated the dynamics of Wolbachia spread in the two-spotted spider mite. Infection frequencies of Wolbachia among the progenies of the artificial populations, initiated with 50% infected and 50% uninfected female adults, were monitored by PCR. The results show 100% maternal transmission in all three populations. The rate of spread was fastest in the HN population in which the infection rate reached 100% by the F7

  10. Detection of novel strains genetically related to Anaplasma platys in Tunisian one-humped camels (Camelus dromedarius).

    Science.gov (United States)

    Belkahia, Hanène; Ben Said, Mourad; Sayahi, Lotfi; Alberti, Alberto; Messadi, Lilia

    2015-10-29

    Little information is currently available regarding the presence of Anaplasma species in North African dromedaries. To fill this gap in knowledge, the prevalence, risk factors, and genetic diversity of Anaplasma species were investigated in Tunisian dromedary camels. A total of 226 camels from three different bioclimatic areas were sampled and tested for the presence of Anaplasma species by quantitative polymerase chain reaction (qPCR) and nested polymerase chain reaction (nPCR) assays. Detected Anaplasma strains were characterized by 16S rRNA sequence analysis. Overall infection rate of Anaplasma spp. was 17.7%, and was significantly higher in females. Notably, A. marginale, A. centrale, A. bovis, and A. phagocytophilum were not detected. Animals were severely infested by three tick species belonging to the genus Hyalomma (H. dromedarii, H. impeltatum, and H. excavatum). Alignment, similarity comparison, and phylogenetic analysis of the 16S rRNA sequence variants obtained in this study suggest that Tunisian dromedaries are infected by more than one novel Anaplasma strain genetically related to A. platys. This study reports the presence of novel Anaplasma sp. strains genetically related to A. platys in dromedaries from various bioclimatic areas of Tunisia. Findings raise new concerns about the specificity of the direct and indirect diagnostic tests routinely used to detect different Anaplasma species in ruminants and provide useful molecular information to elucidate the evolutionary history of bacterial species related to A. platys.

  11. Tick Infestation Rate of Sheep and Their Distribution in Abdanan County, Ilam Province, Iran, 2007-2008

    Directory of Open Access Journals (Sweden)

    MA Oshaghi

    2010-12-01

    Full Text Available "nAbstract "nBackground: Ticks are hematophagous arthropod belonging to the Class of Arachnids. Ticks are also one of the major vectors of pathogens to animal and human. This study was conducted to determine tick infestation rate of sheep in Abdanan during 2007–2008. "nMethods: Sampling was performed seasonally in 19 villages during spring 2007 until winter 2008. A total of 1095 sheep were selected and tested for tick infestation.  After collection, all ticks were transported to laboratory of Medi­cal Entomology and were identified with appropriate identification keys. "nResults: Totally, 864 hard ticks were collected. The ticks were classified into two genera and 5 species including: Hyalomma marginatum (44.67%, Hy. anatolicum (43.17%, Hy.asiaticum (6.37%, Hy. dromedarii (5.55%, Hea­maphysalis sulcata (0.24%. The highest seasonal activity was observed in spring (36.46 % and the lowest seasonal was in winter (11.57%. The rate of tick frequency in mountainous region was 48.15% and it was 51.85% in plateau regions. In this study, tick infestation of sheep was 11.41%. "nConclusion: Hy.marginatum has the more frequent density in the study area. "n  "nKeywords: Ticks, sheep, Iran

  12. Wassermilben (Acari: Hydrovolziidae et Hydrachnellae) aus Algerien

    NARCIS (Netherlands)

    Bader, Carl

    1989-01-01

    In the material collected from wells, hyporheic waters, and springs in western Algeria seven species of watermites have been found. Three of these are new to science: Acherontacarus tuberculalus nov. spec., Neumania (s. str.) algeriensis nov. spec., and the representative of a new genus Neoacheronta

  13. Ecology of Amblyomma neumanni (Acari: Ixodidae).

    Science.gov (United States)

    Nava, Santiago; Estrada-Peña, Agustín; Mangold, Atilio J; Guglielmone, Alberto A

    2009-09-01

    The life cycle of Amblyomma neumanni was described studying the seasonal distribution of free-living stages and parasitic phases during two consecutive years. Development periods of engorged ticks under different photoperiod conditions were recorded. Larvae of A. neumanni have the peak of abundance in autumn. Nymphs reach the peak in winter. Females were collected on cattle from autumn to late spring. The seasonal distribution pattern of females showed a bimodal curve, with a peak in autumn and other during early and middle spring. The engorged females exposed at shortest photoperiod regimen (10 h light-14 h dark) under both laboratory and field conditions undergo morphogenetic diapause, expressed as a delay in the oviposition. It is concluded that females of A. neumanni that feed and copulate in autumn undergo morphogenetic diapause, and they will lay eggs in spring, simultaneously with the females that feed and copulate in this season. Climate niche analysis shows that adequate suitability for A. neumanni depends mainly from temperature (mean, absolute maximum and minimum, and mean temperature in wettest and driest quarters) as well as from rainfall in warmest and coldest quarters. Sequences of 16S rDNA gene belonging to different populations of A. neumanni, showed no intraspecific genetic differentiation.

  14. Astigmatid mites (Acari: Sarcoptiformes) of forensic interest.

    Science.gov (United States)

    Oconnor, Barry M

    2009-10-01

    This paper reviews the occurrence of mites of the infraorder Astigmata in situations involving the legal system, particularly in the area of medicocriminal entomology. Species in the families Acaridae, Lardoglyphidae and Histiostomatidae are encountered in stored food products and in vertebrate carrion, including human remains. Some of these species are incidentals, whereas others are obligate necrophages. Phoretic associations between these mites and insects allows for rapid dispersal and colonization of such patchy resources.

  15. Wassermilben (Acari: Hydrovolziidae et Hydrachnellae) aus Algerien

    NARCIS (Netherlands)

    Bader, Carl

    1989-01-01

    In the material collected from wells, hyporheic waters, and springs in western Algeria seven species of watermites have been found. Three of these are new to science: Acherontacarus tuberculalus nov. spec., Neumania (s. str.) algeriensis nov. spec., and the representative of a new genus

  16. Hepatozoon kisrae n. sp. infecting the lizard Agama stellio is transmitted by the tick Hyalomma cf. aegyptium

    Directory of Open Access Journals (Sweden)

    Paperna I.

    2002-03-01

    Full Text Available Hepatozoon kisrae n. sp. was found infecting a starred lizard at a site in southeastern Samaria, Palestine. These lizards were also hosts to the ixodid tick Hyolomma cf. aegyptium, which was demonstrated to be the vector of this hemogregarine. Hepatozoon and tick infections occurred in lizards within a very restricted locality; at a second site, nearby, ticks occurred without Hepatozoon infection. Micro- and macromeronts occurred mainly in the lungs, while cyst-like merogonic stages, mainly dizoic, occurred in the liver. Mature intraerythrocytic gametocytes were stout and encapsulated. Development from oocysts to sporocysts took place in the tick hemocoel, and was examined by transmission electron microscopy. Lizards were successfully infected when fed on sporocyst-infected ticks or viscera of infected lizards. Ticks become infected when fed on infected lizards; sporogony was complete when the ticks reached adult stage, over 40 days after initial attachment.

  17. Caracterização de um vírus baciliforme isolado de Solanum violaefolium transmitido pelos ácaros Brevipalpus phoenicis e Brevipalpus obovatus (Acari: Tenuipalpidae Characterization of a bacilliform virus isolated from Solanum violaefolium transmitted by the tenuipalpid mites Brevipalpus phoenicis and Brevipalpus obovatus

    Directory of Open Access Journals (Sweden)

    Paulo de Tarso Oliveira Ferreira

    2007-09-01

    Full Text Available Solano-violeta (Solanum violaefolium é uma planta ornamental rasteira usada para cobrir solos de áreas sombreadas. Um vírus que induz manchas anelares nas folhas desta planta, tentativamente designado Solanum violaefolium ringspot virus - SvRSV, transmitido pelo ácaro Brevipalpus phoenicis (Acari: Tenuipalpidae foi encontrado em Piracicaba, SP. Trata-se de um vírus baciliforme que se assemelha a outros vírus do tipo citoplasmático transmitidos por Brevipalpus sp. Este trabalho teve como objetivo relatar propriedades biológicas e estabelecer uma caracterização molecular parcial do SvRSV. O vírus pode ser transmitido mecanicamente a várias outras espécies botânicas, causando lesões localizadas. Entre as espécies avaliadas, Datura stramonium mostrou-se a melhor hospedeira experimental. Observou-se também a manifestação de sintomas nestas plantas após infestação das mesmas por B. obovatus previamente alimentado em lesões de SvRSV, confirmando esta outra espécie de ácaro como vetor do vírus. Suas propriedades físicas in vitro foram: temperatura de inativação 40-45 ºC; ponto final de diluição 10-3-10-4; longevidade in vitro 12 dias. Em secções ultrafinas, as partículas do SvRSV mostraram-se levemente mais delgadas e mais longas que as de outros vírus do mesmo grupo. A partir do dsRNA do SvRSV foi construída uma biblioteca de cDNA e foram identificadas duas possíveis regiões codificadoras das proteínas de movimento e replicase viral. Baseado nestas regiões foram desenhados "primers" para amplificação do RNA do SvRSV por RT-PCR. Sondas baseadas nas seqüências obtidas hibridizaram com ss- e dsRNA de D. stramonium infectadas pelo vírus. Ensaios preliminares de RT-PCR e hibridização não resultaram em reação com o vírus da leprose dos citros, tipo citoplasmático (CiLV-C.Solanum violaefolium is an ornamental plant, with prostrate, trailing growth habit and is cultivated in shaded areas. A virus that causes

  18. Pode Euseius alatus DeLeon (Acari: Phytoseiidae) predar Aceria guerreronis Keifer (Acari: Eriophyidae) em coqueiro?

    OpenAIRE

    MELO, José W da S; DOMINGOS, Cleiton A; GONDIM JR, Manoel G C; de Moraes, Gilberto J.

    2009-01-01

    Ácaros do gênero Euseius são geralmente considerados especialistas na alimentação de pólen. Euseius alatus DeLeon é uma das seis espécies de ácaros fitoseídeos mais comumente encontrados em plantas de coqueiro no Nordeste do Brasil, associado com Aceria guerreronis Keifer. Apesar de a morfologia de E. alatus não favorecer a exploração da área meristemática do fruto habitada por A. guerreronis, o predador pode ter algum papel no controle do eriofídeo durante o processo de dispersão. O objetivo...

  19. Predatory behaviors of Neoseiulus californicus and Galendromus helveolus (Acari: Phytoseiidae) attacking Oligonychus perseae (Acari: Tetranychidae).

    Science.gov (United States)

    Takano-Lee, M; Hoddle, Mark

    2002-01-01

    Predatory behaviors of Neosieulus californicus (McGregor) and Galendromus helveolus (Chant) attacking Oligonychus perseae Tuttle, Baker and Abbatiello on avocado leaves were videotaped and analyzed. Behaviors were recorded for "fresh" predators that were used perseae only after invading webbed nests. Conversely. fresh and cold stored N. californicus employed three different modes of predatory attack: (1) intercepting and attacking migrant O. perseae outside of web nests: (2) attacking prey through nest webbing; or (3) invading and attacking O. perseae inside nests. Predatory efficacy of both N. californicus and G. helveolus was reduced following cold storage. as both species engaged in certain predatory behaviors less frequently in comparison to predators that were not stored at low temperatures. Our observed results for N. californicus and G. helveolus attacking O. perseae are interpreted in relation to the chaetotaxy hypothesis, which proposes that phytoseiid invasion efficiency and propensity of webbed nests is facilitated by dorsal setal lengths.

  20. New data regarding distribution of cattle ticks in the south-western Indian Ocean islands.

    Science.gov (United States)

    Stachurski, Frédéric; Tortosa, Pablo; Rahajarison, Patrick; Jacquet, Stéphanie; Yssouf, Amina; Huber, Karine

    2013-09-09

    Recent studies have produced new insight into the origin and distribution of some cattle ticks in the south-western Indian Ocean islands. Rhipicephalus appendiculatus, introduced from Tanzania in 2002, is now well established on Grande Comore but has not yet reached the other islands of the archipelago (Mohéli, Anjouan and Mayotte). Only one of the two clades identified in Africa has settled so far. Amblyomma variegatum, which was not supposed to be able to persist in the Antananarivo region (1300 m) nor in other Malagasy regions of high altitude without regular introductions of ticks by infested cattle, is now endemic as a general rule up to 1600 m although other regions of lower altitude (1400 m) are still free of the tick. This species remains confined in a small area of the west coast on La Reunion Island. On the contrary, Hyalomma dromedarii could not settle on Madagascar where it was introduced in 2008 and Rhipicephalus evertsi evertsi is not yet present in Grande Comore despite regular introductions by infested cattle from Tanzania. A phylogeographic approach has been carried out at an intra-specific level for A. variegatum. This study has led to the identification of two main lineages, one covering all species distribution and one restricted to East Africa and the Indian Ocean area. These two lineages are in sympatry in Madagascar where a high genetic diversity has been described, whereas a lower genetic diversity is observed on other islands. These results seem to agree with the historical data concerning the introduction of the tick in the Indian Ocean area.

  1. Molecular cloning and expression of a larval immunogenic protein from the cattle tick Boophilus annulatus.

    Science.gov (United States)

    Shahein, Yasser Ezzat

    2008-02-15

    A full-length cDNA of an immunogenic protein was cloned from a cDNA library of the local Egyptian cattle tick Boophilus annulatus. Antibodies raised against B. annulatus larval proteins were used to screen a cDNA expression library. A 936bp cloned fragment was sequenced and showed an open reading frame of 516bp encoding a protein of 171 amino acids. Comparison of the deduced amino acid sequence with protein data bank revealed that the sequence is related to a sequence isolated from the hard tick Haemaphysalis qinghaiensis (Hq05). Southern blot analysis of B. annulatus genomic DNA showed that the cloned cDNA hybridized to double bands per restriction digest, suggesting that the cloned cDNA is a double copy gene. Amino acid analysis of the cloned gene revealed the presence of two casein kinase II phosphorylation sites in the N-terminal domain suggesting that this molecule may be involved in the signal transduction or gene expression pathways. RT-PCR and northern blotting revealed the presence of two isoforms of the Ba05 gene in salivary glands and in the 3-day-old eggs. The cloned gene without the signal peptide, was expressed in Escherichia coli under T7 promotor of pET-30b vector, and purified under denaturation conditions. The purified protein appeared as a single band on 12% SDS-PAGE with a molecular weight around 22.8kDa including the histidine tag of the vector. Antibodies raised against the purified molecule were used to detect the B. annulatus homologue to the Hq05 gene in whole tick, larvae and gut protein extracts. Immunoblotting revealed the presence of this molecule Ba05 only in whole tick and larval protein extracts and not in the gut protein extract. Using the same antibodies, homologues to the Ba05 gene were detected in other tick species as Hyalomma dromedarii and Rhipicephalus sp. but not in Ornithodoros moubata.

  2. Molecular cloning, expression and characterization of a functional GSTmu class from the cattle tick Boophilus annulatus.

    Science.gov (United States)

    Shahein, Yasser Ezzat; El Sayed El-Hakim, Amr; Abouelella, Amira Mohamed Kamal; Hamed, Ragaa Reda; Allam, Shaimaa Abdul-Moez; Farid, Nevin Mahmoud

    2008-03-25

    A full-length cDNA of a glutathione S-transferase (GST) was cloned from a cDNA library of the local Egyptian cattle tick Boophilus annulatus. The 672 bp cloned fragment was sequenced and showed an open reading frame encoding a protein of 223 amino acids. Comparison of the deduced amino acid sequence with GSTs from other species revealed that the sequence is closely related to the mammalian mu-class GST. The cloned gene was expressed in E. coli under T7 promotor of pET-30b vector, and purified under native conditions. The purified enzyme appeared as a single band on 12% SDS-PAGE and has a molecular weight of 30.8 kDa including the histidine tag of the vector. The purified enzyme was assayed upon the chromogenic substrate 1-chloro-2,4-dinitrobenzene (CDNB) and the recombinant enzyme showed high level of activity even in the presence of the beta-galactosidase region on its 5' end and showed maximum activity at pH 7.5. The Km values for CDNB and GSH were 0.57 and 0.79 mM, respectively. The over expressed rBaGST showed high activity toward CDNB (121 units/mg protein) and less toward DCNB (29.3 units/mg protein). rBaGST exhibited peroxidatic activity on cumene hydroperoxide sharing this property with GSTs belonging to the GST alpha class. I50 values for cibacron blue and bromosulfophthalein were 0.22 and 8.45 microM, respectively, sharing this property with the mammalian GSTmu class. Immunoblotting revealed the presence of the GST molecule in B. annulatus protein extracts; whole tick, larvae, gut, salivary gland and ovary. Homologues to the GSTmu were also detected in other tick species as Hyalomma dromedarii and Rhipicephalus sp. while in Ornithodoros moubata, GSTmu homologue could not be detected.

  3. Seleções para resistência e suscetibilidade, detecção e monitoramento da resistência de Tetranychus urticae ao acaricida clorfenapir Selections for resistance and susceptibility, detection and monitoring of resistance to the acaricide chlorfenapyr in Tetranychus urticae koch (Acari: Tetranychidae

    Directory of Open Access Journals (Sweden)

    Mário Eidi Sato

    2007-01-01

    Full Text Available Problemas com resistência de ácaro-rajado, Tetranychus urticae Koch (Acari: Tetranychidae, a acaricidas têm sido registrados em diversos países, inclusive no Brasil. O estudo teve como objetivo caracterizar a resistência de T. urticae ao acaricida clorfenapir e avaliar a freqüência de resistência a esse composto em áreas comerciais de seis culturas no Estado de São Paulo. Seleções para resistência e suscetibilidade a clorfenapir foram realizadas em laboratório, utilizando-se uma população de T. urticae coletada em 2002 de um cultivo comercial de crisântemo em Holambra (SP. Após seis seleções para resistência e cinco seleções para suscetibilidade, foram obtidas as linhagens suscetível (S e resistente (R de T. urticae a clorfenapir. A razão de resistência (CL50 R/ CL50 S obtida alcançou valores de 571 vezes. Estabeleceu-se uma concentração discriminatória de 37,4 mg L-1 de ingrediente ativo (i.a. para o monitoramento da resistência de T. urticae a clorfenapir. O monitoramento foi realizado coletando-se 21 populações de ácaros em áreas comerciais de diferentes culturas (mamão, morango, feijão, tomate, crisântemo, rosa, em vários municípios do Estado de São Paulo. Arenas confeccionadas com folha de feijão foram infestadas com ácaros T. urticae e pulverizadas com clorfenapir, na sua concentração discriminatória, em torre de Potter. Os resultados indicaram grande variabilidade entre as populações com relação à suscetibilidade a clorfenapir. Foram observadas populações com freqüências de resistência entre 0,0 e 65,4%. As maiores freqüências de resistência foram observadas para populações coletadas de crisântemo em Holambra (SP.Problems associated with acaricide resistance in Tetranychus urticae Koch have been recorded in several countries including Brazil. The objective of this study was to characterize the resistance of T. urticae to the acaricide chlorfenapyr and to evaluate the resistance

  4. Hormonal Interference with Pheromone Systems in Parasitic Acarines, Especially Ixodid Ticks.

    Science.gov (United States)

    1982-05-01

    1) Precocity of molting as evidenced by stadium (larval, nymphal) deletion, (2) antigonadotrophic activity , (3) diapause induction, (4) ovicidal ...females. Studies to determine whether sex pheromone activity in D. variabilis can be affected by administration of ecdysteroids are being continued, but...Pheromone Activity in Hyalomm- dromedarii, With Evidence of the Existence of Ecdysteroids in H. dromedarii and Dermacentor variabilis

  5. 二斑叶螨两种群中Wolbachia诱导的胞质不亲和作用的影响因子比较研究%A comparative study of factors influencing the expression of Wolbachiainduced cytoplasmic incompatibility in two populations of the two-spotted spider mite, Tetranychus urticae Koch ( Acari: Tetranychidae)

    Institute of Scientific and Technical Information of China (English)

    陆明红; 谢蓉蓉; 赵臻君; 于明志; 薛晓峰; 洪晓月

    2011-01-01

    The cytoplasmic incompatibility (CI) is the most common effect of Wolbachia on the reproduction of its arthropod hosts, and the expression of CI differs greatly among different populations. Using the Jiangsu (JS) and Liaoning (LN) populations of the two-spotted spider mite, Tetranychus urticae Koch (Acari: Tetranychidae) , as experimental materials, 100% infected and uninfected Wolbachia lines were obtained by screening. The present study tried to evaluate some factors influencing the expression of CI in the spider mite by crossing experiment and Real-time quantitative PCR. These factors include age of host, temperature, host genes and Wolbachia density. The 1, 3, 5, 7-day-old virgin males were used to investigate the influence of host age on Wolbachia-induced CI. The results showed no effect of age on CI, suggesting that host age does not reduce the sperm modification induced by Wolbachia. The effect of temperatures (20℃, 25℃ and 30℃ ) on the CI induced by Wolbachia was also checked. Neither high nor low temperatures influenced the expression of CI. Wolbachia density in males of the JS population, as measured by quantitative PCR using the wsp (surface protein of Wolbachia) gene, was significantly higher than that in the LN population. In addition, in both the JS and LN populations, Wolbachia density increased with the age of male hosts. Wolbachia density also showed no effect on CI. We estimated the variability of CI expression between the JS and LN population of T. Urticae was due to the interaction between Wolbachia and host genotypes. The results might provide foundation for understanding the mechanisms of reproductive manipulation induced by Wolbachia.%Wolbachia诱导胞质不亲和(cytoplasmic incompatibility,CI)是对寄主的生殖调控中最常见的一种方式,在不同种群中CI表达的差异较大.以二斑叶螨Tetranychus urticae辽宁兴城(LN)和江苏徐州(JS)两个地理种群为实验材料,经筛选获得100%感染Wolbachia和不感

  6. Three eriophyoid mite species (Acari: Eriophyoidea: Eriophyidae) from Iran.

    Science.gov (United States)

    Xue, Xiao-Feng; Sadeghi, Hussein; Honarmand, Arash

    2016-01-01

    Three mite species of the family Eriophyidae from Iran are described and illustrated. They are: Tegolophus marrubiumer sp. nov. on Marrubium vulgare L. (Lamiaceae); Phyllocoptes sp. cf. balasi Farkas, 1962 on Sanguisorba minor Scop. subsp. minor (Rosaceae) and Aceria fasciculifolis sp. nov. on Astragalus fasciculifolius Boiss. (Fabaceae). Both new species described herein are vagrants on their respective host plants.

  7. Nieuwe vondsten van watermijten in Nederland (Acari: Hydrachnidia)

    NARCIS (Netherlands)

    Smit, H.; Hoek, van den T.H.; Wiggers, R.

    2006-01-01

    Sinds de publicatie van de atlas van de Nederlandse watermijten in 2000 is de interesse voor watermijten sterk toegenomen. Er worden regelmatig nieuwe en zeldzame soorten gevonden en de kennis over biotoopvoorkeuren en trends wordt steeds verder uitgebreid. In dit artikel worden enkele bijzondere ni

  8. Checklist of the Oribatid Mites of the Netherlands (Acari: Oribatida)

    NARCIS (Netherlands)

    Siepel, H.; Zaitsev, A.; Berg, M.

    2009-01-01

    More than fifty years ago Van der Hammen published the last checklist of oribatid mites (or moss mites) for the Netherlands. Since then the species number has almost doubled to 318 species, of which 100 are presented here for the first time. Brief data on occurence and nomenclature are provided for

  9. Some mossmites new for the Netherlands (Acari: Oribatida)

    NARCIS (Netherlands)

    Siepel, H.; Dimmers, W.J.

    2010-01-01

    Bestudering van materiaal uit enkele Alterra projecten leverde negen soorten mosmijten op die nog niet waren opgenomen in de recent gepubliceerde Nederlandse naamlijst. Het totaal aantal soorten voor Nederland komt hiermee op 327.

  10. Listado de oribátidos (Acari, Oribatida de Túnez

    Directory of Open Access Journals (Sweden)

    Subías, L. S.

    2015-12-01

    Full Text Available The oribatid mites of several Tunisian soil samples were studied. 113 species were obtained, 95 of which are recorded for the first time from Tunisia. A systematic check-list with the 136 species known up to now is included, and their geographical distribution is given. Most of them, 77 (56%, have a typical Mediterranean distribution and 16 are recorded for the first time from North Africa.Se han estudiado los ácaros oribátidos de una serie de muestras de suelo de Túnez y se han identificado 113 especies, 95 de las cuales se citan por primera vez en Túnez. Se ha elaborado un listado sistemático en el que se incluyen las 136 especies conocidas hasta el momento y su distribución geográfica. La mayoría, 77 (56 %, presentan características típicamente mediterráneas, y 16 se citan por primera vez en el norte de África.

  11. Oribatid mites from the Vohimana Reserve, Madagascar (Acari: Oribatida, II

    Directory of Open Access Journals (Sweden)

    Mahunka, S.

    2009-11-01

    Full Text Available Further studies on the oribatid species collected from the Vohimana Reserve (Madagascar are presented. Altogether 13 species are listed, of them two represent new genera (Rugocepheus gen. nov. and Madabelba gen. nov., furthermore seven species are new to science. The other six species were earlier mentioned from different regions of the island, they are however little known.

  12. Hypopi (Acari: Hypoderatidae) of the wood stork (Aves: Ciconiiformes: Ciconiidae)

    Science.gov (United States)

    Pence, Danny B.; Thomas, N.J.

    1995-01-01

    A new species is described and additional host records are presented for 2 other species of deutonymphs of the family Hypoderatidae from the subcutaneous adipose tissues of the wood stork, Mycteria americana L. Phalacrodectes (Phalacrodectes) mycteria n. sp. appears to share affinities with species from both pelicaniform and ciconiiform hosts, but it most closely resembles P. (P.) punctatissimus (Černý) Pence & Courtney from pelicans in idiosomal chaetotaxy, cutdcular sclerotization, and posteriorly divergent, widely separated genital openings. The new species differs from this and other species of the genus by its small size, the degree of separation of the genital openings with papillae, no secondary sclerotization in the perigenital area or surrounding the genital openings, and the long filiform setae s and w on genu III. There was a mixed infection of Neottialges kutzeri Fain and N. mycteriae Pence in all of 7 wood storks examined from Florida and Georgia; P. (P) mycteria was found in 4 of these hosts. This is the 7th species described as a deutonymph in the genus Phalacrodectes. The apparent close affinity of P. (P.) mycteria with P. (P.) punctatissimus and allied species from pelicaniform versus ciconiiform birds appears to be inconsistent with the established host-parasite relationships based on classical avian taxonomic relationships. However, this apparent affinity may be more reflective of the close relationships between the families of pelicans, ibises and spoonbills, and storks as recently proposed by DNA-DNA hybridization studies.

  13. Vectorial role of some dermanyssoid mites (Acari, Mesostigmata, Dermanyssoidea

    Directory of Open Access Journals (Sweden)

    Valiente Moro C.

    2005-06-01

    Full Text Available Among transmissible diseases, vectorial diseases represent a major problem for public health. In the group of acarina, while ticks are the most commonly implicated vectors, other arthropods and notably Dermanyssoidea are also involved in the transmission of pathogenic agents. Since the role of this superfamily is at present largely unknown, we have reviewed the vectorial role of these mites in the appearance, survival and propagation of pathogens. Various authors have shown that Dermanyssoidea are implicated in the transmission of both bacteria (Salmonella, Spirocheta, Rickettsia or Pasteurella and viruses (equine encephalitis viruses, West Nile virus, Fowl pox virus, the virus causing Newcastle disease and tick borne encephalitis viruses or hantaviruses. Finally, some authors have also shown their role in the transmission of some protozoa and filaria. As the vectorial character of such mites has been more clearly demonstrated (Dermanyssus gallinae, Ornithonyssus bacoti and Allodermanyssus sanguineus, it would be interesting to continue studies to better understand the role of this superfamily in the epidemiology of certain zoonoses.

  14. Development of Dermanyssus gallinae (Acari: Dermanyssidae) at different temperatures.

    Science.gov (United States)

    Tucci, E C; Prado, A P; Araújo, R P

    2008-08-01

    The development, viability, and life cycle parameters of Dermanyssus gallinae at five different temperatures (15, 20, 25, 30 and 35 degrees C), and at relative humidity 70-85% were evaluated. Life cycle duration was 690.75 h (28 days) at 15 degrees C, 263.12h (11 days) at 20 degrees C, 164.63 h (7 days) at 25 degrees C, 140.69 h (6 days) at 30 degrees C and 172.04 h (7 days) at 35 degrees C. The optimal development temperature for D. gallinae was 30 degrees C, with the greatest survival in all stages and the shortest development time. High mortality at 35 degrees C indicated that this temperature had adverse effects on development of D. gallinae, and that in field conditions D. gallinae populations may decrease or even disappear due to the negative impact of high temperature on development. There were no significant differences in the pre-oviposition period among the four temperatures 20-35 degrees C, indicating that temperature did not affect this part of the life cycle.

  15. Thermal requirements of Dermanyssus gallinae (De Geer, 1778 (Acari: Dermanyssidae

    Directory of Open Access Journals (Sweden)

    Edna Clara Tucci

    2008-06-01

    Full Text Available The thermal requirements for development of Dermanyssus gallinae were studied under laboratory conditions at 15, 20, 25, 30 and 35°C, a 12h photoperiod and 60-85% RH. The thermal requirements for D. gallinae were as follows. Preoviposition: base temperature 3.4ºC, thermal constant (k 562.85 degree-hours, determination coefficient (R² 0.59, regression equation: Y= -0.006035 + 0.001777 x. Egg: base temperature 10.60ºC, thermal constant (k 689.65 degree-hours, determination coefficient (R² 0.94, regression equation: Y= -0.015367 + 0.001450 x. Larva: base temperature 9.82ºC, thermal constant (k 464.91 degree-hours, determination coefficient R² 0.87, regression equation: Y= -0.021123+0.002151 x. Protonymph: base temperature 10.17ºC, thermal constant (k 504.49 degree-hours, determination coefficient (R² 0.90, regression equation: Y= -0.020152 + 0.001982 x. Deutonymph: base temperature 11.80ºC, thermal constant (k 501.11 degree-hours, determination coefficient (R² 0.99, regression equation: Y= -0.023555 + 0.001996 x. The results obtained showed that 15 to 42 generations of Dermanyssus gallinae may occur during the year in the State of São Paulo, as estimated based on isotherm charts. Dermanyssus gallinae may develop continually in the State of São Paulo, with a population decrease in the winter. There were differences between the developmental stages of D. gallinae in relation to thermal requirements.Experimentos de laboratório foram realizados visando estimar as exigências térmicas de Dermanyssus gallinae. Para isso, o desenvolvimento do ácaro foi estudado em condições de laboratório usando-se câmaras climatizadas reguladas a 15, 20, 25, 30 e 35°C, fotofase de 12h e UR de 6085%. As exigências térmicas determinadas para D. gallinae foram: Pré-oviposição: temperatura base de 3,4 ºC, constante térmica (k igual a 562,85 graus-hora, coeficiente de determinação (R² igual a 0,59, equação de regressão: Y= -0,006035 + 0,001777 x. Ovo. Temperatura base de 10,60 ºC, constante térmica (k igual a 689,65 graus-hora, coeficiente de determinação (R² igual a 0,94, equação de regressão: Y= -0,015367 + 0,001450 x. Larva. Temperatura base 9,82 ºC, constante térmica (k igual a 464,91 graus-hora, R² igual a 0,87, equação de regressão: Y= -0,021123+0,002151x. Protoninfa. Temperatura de 10,17 ºC, constante térmica (k igual a 504,49 graus-hora, coeficiente de determinação (R² igual a 0,90, equação de regressão: Y= -0,020152 + 0,001982 x. Deutoninfa. Temperatura de 11,80 ºC, constante (k térmica igual a 501,11 graus-hora, coeficiente de determinação (R² igual a 0,99, equação de regressão: Y= -0,023555 + 0,001996 x. Os resultados obtidos permitem concluir que no Estado de São Paulo podem ocorrem de 15 a 42 gerações/ano de D. gallinae, em estimativa baseada em isotermas. Dermanyssus gallinae pode se desenvolver continuamente no Estado de São Paulo, com diminuição da população no inverno. Existem diferenças entre os estágios de desenvolvimento de D. gallinae com relação às exigências térmicas.

  16. Thermal requirements of Dermanyssus gallinae (De Geer, 1778) (Acari: Dermanyssidae).

    Science.gov (United States)

    Tucci, Edna Clara; do Prado, Angelo P; de Araújo, Raquel Pires

    2008-01-01

    The thermal requirements for development of Dermanyssus gallinae were studied under laboratory conditions at 15, 20, 25, 30 and 35 degrees C, a 12h photoperiod and 60-85% RH. The thermal requirements for D. gallinae were as follows. Preoviposition: base temperature 3.4 degrees C, thermal constant (k) 562.85 degree-hours, determination coefficient (R(2)) 0.59, regression equation: Y= -0.006035 + 0.001777x. Egg: base temperature 10.60 degrees C, thermal constant (k) 689.65 degree-hours, determination coefficient (R(2)) 0.94, regression equation: Y= -0.015367 + 0.001450x. Larva: base temperature 9.82 degrees C, thermal constant (k) 464.91 degree-hours, determination coefficient (R(2)) 0.87, regression equation: Y= -0.021123 + 0.002151x. Protonymph: base temperature 10.17 degrees C, thermal constant (k) 504.49 degree-hours, determination coefficient (R(2)) 0.90, regression equation: Y= -0.020152 + 0.001982x. Deutonymph: base temperature 11.80 degrees C, thermal constant (k) 501.11 degree-hours, determination coefficient (R(2)) 0.99, regression equation: Y= -0.023555 + 0.001996x. The results obtained showed that 15 to 42 generations of Dermanyssus gallinae may occur during the year in the State of São Paulo, as estimated based on isotherm charts. Dermanyssus gallinae may develop continually in the State of São Paulo, with a population decrease in the winter. There were differences between the developmental stages of D. gallinae in relation to thermal requirements.

  17. The ticks (Acari: Ixodida: Argasidae, Ixodidae) of Paraguay.

    Science.gov (United States)

    Nava, S; Lareschi, M; Rebollo, C; Benítez Usher, C; Beati, L; Robbins, R G; Durden, L A; Mangold, A J; Guglielmone, A A

    2007-04-01

    The ticks reported in Paraguay, which are here reviewed, can be categorized as 'endemic or established' (Argas persicus or a sibling species, Ornithodoros hasei, O. rostratus, O. rudis, O. talaje/O. puertoricensis, Amblyomma aureolatum, Am. auricularium, Am. brasiliense, Am. cajennense, Am. calcaratum, Am. coelebs, Am. dissimile, Am. dubitatum, Am. incisum, Am. longirostre, Am. nodosum, Am. ovale, Am. pacae, Am. parvum, Am. pseudoconcolor, Am. rotundatum, Am. scutatum, Am. tigrinum, Am. triste, Dermacentor nitens, Haemaphysalis juxtakochi, H. leporispalustris, Ixodes loricatus, Rhipicephalus microplus, and Rh. sanguineus), 'probably endemic or established' (Ar. miniatus, Ar. monachus, Am. argentinae, Am. humerale, Am. naponense, Am. oblongoguttatum, Am. pseudoparvum, I. aragaoi/I. pararicinus, I. auritulus, I. luciae), or 'erroneously reported from Paraguay' (O. coriaceus, Am. americanum and Am. maculatum). Most Paraguayan tick collections have been made in the Chaco phyto-geographical domain, in the central part of the country. Argas persicus or a related species, Am. cajennense, D. nitens, Rh. microplus and Rh. sanguineus are important parasites of domestic animals. Ornithodoros rudis, Am. aureolatum, Am. brasiliense, Am. cajennense, Am. coelebs, Am. incisum, Am. ovale and Am. tigrinum have all been collected from humans. In terms of public health, the collections of Am. cajennense and Am. triste from humans may be particularly significant, as these species are potential vectors of Rickettsia rickettsii and Ri. parkeri, respectively.

  18. The ticks (Acari: Ixodida: Argasidae, Ixodidae) of Bolivia.

    Science.gov (United States)

    Mastropaolo, Mariano; Beltrán-Saavedra, L Fabián; Guglielmone, Alberto A

    2014-03-01

    The tick species reported in Bolivia are reviewed here as (1) endemic or established: Ornithodoros echimys, O. guaporensis, O. hasei, O. kohlsi, O. mimon, O. peropteryx, O. rostratus, Otobius megnini, Amblyomma auricularium, A. cajennense, A. calcaratum, A. coelebs, A. dubitatum, A. humerale, A. incisum, A. longirostre, A. naponense, A. nodosum, A. oblongoguttatum, A. ovale, A. parvitarsum, A. parvum, A. pecarium, A. pseudoconcolor, A. rotundatum, A. scalpturatum, A. tigrinum, A. triste, Dermacentor nitens, Haemaphysalis juxtakochi, H. leporispalustris, I. boliviensis, I. cooleyi, I. luciae, Rhipicephalus microplus, R. sanguineus, and (2) erroneously reported: Ornithodoros puertoricensis, O. talaje, O. turicata, Amblyomma americanum, A. maculatum, A. multipunctum, Ixodes ricinus, I. scapularis, Rhipicephalus annulatus. Many of these records are lacking locality and/or host, and some of them need new findings for confirmation. Some of the species recorded may represent a threat for human and animal health, therefore would be of great value to make a countrywide survey of ticks in order to update the information presented in this work. Copyright © 2013 Elsevier GmbH. All rights reserved.

  19. A revision of the Pheroliodidae, fam. n. (Acari: Oribatei

    Directory of Open Access Journals (Sweden)

    Adilson D. Paschoal

    1986-01-01

    Full Text Available The new family Pheroliodidae, herei nproposed, includes the following genera and species Pheroliodes Grandjean (in whose synonymy Pedrocortesia Hammer is placed, with the species: casa-branquensis, sp. n. (Brazil, São Paulo, Casa Branca, pellitus, sp. n. (Brazil, São Paulo, Piracicaba, nemoricultricis, sp. n. (Brazil, São Paulo, Piracicaba, wehnekei (Willmann (Guatemala, Venezuela, roblensis Covarrubias (Chile, mirabilis (Hammer, n. comb. (Argentina: Pedrocortesia elegans Hammer, P. intermedia Hammer, both from Peru, P. fissurata Balogh & Mahunka and P. inaequalis Balogh & Mahunka, both from Mongolia, P. franzi Balogh (Chad, P. africana Balogh (Kenya, P. vermicularis Balogh (New Guinea and P. sculptrata Aoki (Corea are considered incertae sedis; Lopholiodes, gen. n., includes the species micropunctinatum, sp. n., the type-species (Brazil, São Paulo, Anhumas and macropunctinatum, sp. n. (Brazil, São Paulo, Piracicaba: Octoliodes, gen n., includes the species leuteomarginatus (Hammer, n. comb., the type-species (New ealand and rotoruensis (Hammer, n. comb. (New Zealand: and Licnoliodes Grandjean, with the species: andrei Grandjean, type-species (Spain and Algeria, adminensis Grandjean, type-species (Spain and Algeria, adminensis Grandjean (Maroc, Algeria, Spain and apunctatus Mahunka (Greece.A nova família aqui descrita, Pheroliodidae, inclui os seguintes gêneros e espécies: Pheroliodes Grandjean (em cuja sinonímia vai incluído Pedrocortesia Hammer, com as seguintes espécies: casa-branquensis, sp. n. (Brasil, São Paulo, Casa Branca, pellitus, sp. n. (Brasil, São Paulo, Piracicaba, nemoricultricis, sp. n. (Brasil, São Paulo, Piracicaba, wehnekei (Willmann (Guatemala, Venezuela, roblensis Covarrubias (Chile, mirabilis (Hammer, n. comb. (Argentina: Pedrocortesia elegans Hammer, P. intermedia Hammer, ambas do Peru, P. fissurata Balogh & Mahunka (Mongólia, inaequalis Balogh & Mahunka (Mongólia, franzi Balogh (Chad, P. africana Balogh (Quênia, P. vermicularis Balogh (Nova Guiné e P. sculptrata Aoki (Coréia são consideradas incertae sedis: Lopholiodes, gen. n., inclui as espécies mícropunctatum, sp. n., espécie-tipo (Brasil, São Paulo, Anhumas e macropunctinatum. sp. n. (Brasil, São Paulo, Piracicaba: Octoliodes, gen. n., inclui as espécies luteomarginatus (Hammer, n. comb., a espécie-tipo (Nova elân da e rotoruensis (Hammer, n. comb. (Nova Zelândia: e Licnoliodes Grandjean, com as espécies: andrei Grandjean, espécie-tipo (Espanha e Argélia, adminensis Grandjean (Marrocos, Argélia, Espanha e apunctatus Mahunka (Grécia.

  20. Widespread Rickettsia spp. Infections in Ticks (Acari: Ixodoidea) in Taiwan.

    Science.gov (United States)

    Kuo, Chi-Chien; Shu, Pei-Yun; Mu, Jung-Jung; Lee, Pei-Lung; Wu, Yin-Wen; Chung, Chien-Kung; Wang, Hsi-Chieh

    2015-09-01

    Ticks are second to mosquitoes as the most important disease vectors, and recent decades have witnessed the emergence of many novel tick-borne rickettsial diseases, but systematic surveys of ticks and tick-borne rickettsioses are generally lacking in Asia. We collected and identified ticks from small mammal hosts between 2006 and 2010 in different parts of Taiwan. Rickettsia spp. infections in ticks were identified by targeting ompB and gltA genes with nested polymerase chain reaction. In total, 2,732 ticks were collected from 1,356 small mammals. Rhipicephalus haemaphysaloides Supino (51.8% of total ticks), Haemaphysalis bandicota Hoogstraal & Kohls (28.0%), and Ixodes granulatus Supino (20.0%) were the most common tick species, and Rattus losea Swinhoe (44.7% of total ticks) and Bandicota indica Bechstein (39.9%) were the primary hosts. The average Rickettsia infective rate in 329 assayed ticks was 31.9% and eight Rickettsia spp. or closely related species were identified. This study shows that rickettsiae-infected ticks are widespread in Taiwan, with a high diversity of Rickettsia spp. circulating in the ticks. Because notifiable rickettsial diseases in Taiwan only include mite-borne scrub typhus and flea-borne murine typhus, more studies are warranted for a better understanding of the real extent of human risks to rickettsioses in Taiwan.

  1. Die Euphthiracaridae Jacot, 1930, und Ihre Gattungen (Acari, Oribatei)

    NARCIS (Netherlands)

    Märkel, K.

    1964-01-01

    INHALT Einleitung.................... 4 Über den Körperbau der Euphthiracaridae........... 8 Die Gattungen der Euphthiracaridae............ 18 Oribotritia Jacot, 1924b................ 18 O. berlesei (Michael, 1898).............. 19 Indotritia Jacot, 1929................. 24 I. krakatauensis consimil

  2. Transmission of Hepatozoon americanum (Apicomplexa: Adeleorina) by ixodids (Acari: Ixodidae).

    Science.gov (United States)

    Ewing, S A; Mathew, J S; Panciera, R J

    2002-07-01

    American canine hepatozoonosis (ACH) caused by Hepatozoon americanum Vincent-Johnson, Macintire, Lindsay, Lenz, Baneth, and Shkap is an emerging, often fatal, tick-borne protozoal disease of dogs in the United States of America. Dogs acquire infection by ingesting ticks that contain oocysts. To understand the invertebrate (definitive) host range of H. americanum, experiments were carried out using four ixodids, Rhipicephalus sanguineus (Latreille), Dermacentor variabilis Say, Amblyomma americanum (L.), and Amblyomma maculatum Koch. Laboratory-reared nymphal ticks were fed on dogs that were either naturally or experimentally infected with H. americanum; when these ticks molted to the adult stage they were either fed to susceptible dogs or were dissected and examined for the presence of oocysts. Mature H. americanum oocysts were found in >90% of A. maculatum (both males and females), whereas oocysts were not found in any of the other three species. These results confirm that A. maculatum is an excellent host and vector for H. americanum and also suggest that this apicomplexan may have a narrow invertebrate host range, at least among ixodid ticks that are likely candidate vectors in the United States.

  3. Redefinition of the genus Triophtydeus Thor, 1932 (Acari: Actinedida)

    NARCIS (Netherlands)

    André, H.M.

    1985-01-01

    The genus Triophtydeus Thor, 1932 is redefined from the study of the type-species, T. triophthalmus (Oudemans, 1929). The genus Metatriophtydeus André, 1980 is a junior synonym of Triophtydeus. Species belonging or likely to belong to the genus Triophtydeus are listed and generic and specific

  4. Zetorchestes-Arten aus Neuguinea und Japan (Acari: Oribatida: Zetorchestidae)

    NARCIS (Netherlands)

    Krisper, G.

    1987-01-01

    A redescription of Zetorchestes saltator Oudemans, 1915 is given. In addition to that, two new Zetorchestes-species from New Guinea (Z. novaguineanus spec. nov., Z. vanderhammeni spec. nov.) and one new species from Japan (Z. aokii spec. nov.) are described in this paper. These four and some other s

  5. New species of water mites from the Comoros (Acari: Hydrachnidia)

    NARCIS (Netherlands)

    Smit, H.; Pesic, V.; Mary-Sasal, N.

    2009-01-01

    Three new species are described from the Comoros, an archipelago in the Indian Ocean: Teratothyasides scutulatus Smit & Pesic n. sp., Platymamersopsis comoros Smit & Pesic n. sp. and Atractides comorosensis Smit & Pesic n. sp. One species is reported new for the fauna of the Comoros, i.e. Monatracti

  6. Origins of asexuality in Bryobia mites (Acari: Tetranychidae

    Directory of Open Access Journals (Sweden)

    Menken Steph BJ

    2008-05-01

    Full Text Available Abstract Background Obligate asexual reproduction is rare in the animal kingdom. Generally, asexuals are considered evolutionary dead ends that are unable to radiate. The phytophagous mite genus Bryobia contains a large number of asexual species. In this study, we investigate the origin and evolution of asexuality using samples from 111 populations in Europe, South Africa and the United States, belonging to eleven Bryobia species. We also examine intraspecific clonal diversity for one species, B. kissophila, by genotyping individuals from 61 different populations. Knowledge on the origin of asexuality and on clonal diversity can contribute to our understanding of the paradox of sex. Results The majority (94% of 111 sampled populations reproduces asexually. Analysis of part of nuclear 28S rDNA shows that these asexuals do not form a monophyletic clade. Analysis of the mitochondrial COI region shows that intraspecific variation is extensive (up to 8.8%. Within B. kissophila, distinct clades are found, which are absent at the nuclear 28S rDNA level. Moreover, paraphyletic patterns are found at the mitochondrial DNA. Conclusion Asexuality is widespread in the genus Bryobia, signifying that some animal taxa do contain a high number of asexuals. We argue that asexuality originated multiple times within Bryobia. Wolbachia bacteria cause asexuality in at least two Bryobia species and may have infected different species independently. The high intraspecific clonal diversity and the patterns of paraphyly at the mitochondrial DNA in B. kissophila might be explained by a high mutation fixation rate and past hybridization events. Reproductive parasites like Wolbachia and Cardinium might influence these processes. We discuss the role these bacteria could play in the evolutionary success of asexual species.

  7. Can Euseius alatus DeLeon (Acari: Phytoseiidae) prey on Aceria guerreronis Keifer (Acari: Eriophyidae) in coconut palm?; Pode Euseius alatus DeLeon (Acari: Phytoseiidae) predar Aceria guerreronis Keifer (Acari: Eriophyidae) em coqueiro?

    Energy Technology Data Exchange (ETDEWEB)

    Melo, Jose W. da S.; Domingos, Cleiton A.; Gondim Junior, Manoel G.C. [Universidade Federal Rural de Pernambuco (UFRPE), Recife, PE (Brazil). Dept. de Agronomia. Area de Fitossanidade]. E-mail: mguedes@depa.ufrpe.br; Moraes, Gilberto J. de [Universidade de Sao Paulo (USP), Piracicaba, SP (Brazil). Escola Superior de Agricultura Luiz de Queiroz (ESALQ). Dept. de Entomologia, Fitopatologia e Zoologia Agricola]. E-mail: gjmoraes@carpa.ciagri.usp.br

    2009-01-15

    Mites of the genus Euseius are generally considered specialist as pollen feeders. Euseius alatus DeLeon is one of the six species of phytoseiid mites most commonly found on coconut plants in northeast Brazil associated with Aceria guerreronis Keifer. Although the morphology of E. alatus does not favor the exploitation of the meristematic area of the fruit inhabited by A. guerreronis, the predator may have some role in the control of this eriophyid during the dispersion process. The objective of this work was to evaluate the development and reproduction of E. alatus on the following diets: A. guerreronis, Ricinus communis pollen (Euphorbiaceae), and Tetranychus urticae Koch (Tetranychidae) + R. communis pollen + honey solution 10%. Euseius alatus developed slightly faster and had slightly higher oviposition rate when feeding on the diet composed of T. urticae + pollen + honey. However, life table parameters were very similar on all diets, suggesting that E. alatus may contribute in reducing the population of A. guerreronis in the field. (author)

  8. The ticks (Acari: Ixodida: Argasidae, Ixodidae) of Paraguay

    Science.gov (United States)

    2007-01-01

    Brazil, French Guiana, Surinam and Uruguay. Amblyomma rotundatum Koch. Although there have been no published reports of this reptile and amphibian ...Nicaragua, Surinam and the islands of the Greater and Lesser Antilles. Both species have been found in Colombia, Panama and Venezuela. IXODIDAE Murray...Guiana, Surinam and Uruguay (Guglielmone et al., 2003c). Amblyomma auricularium (Conil). Massi Pallarés and Benı́tez Usher (1982) reported this tick from

  9. Phytoseiid mites (Acari: Phytoseiidae) from Patagonia and Tierra del Fuego.

    Science.gov (United States)

    Ferragut, Francisco; Navia, Denise

    2015-07-28

    Predatory phytoseiid mites have been intensively studied and surveyed in the last decades because of their economic importance as biocontrol agents of agricultural pests. However, many regions of the world remain unexplored and the diversity of the family worldwide is still fragmentary. Up to date no phytoseiid species have been collected in the southernmost part of the Earth down to latitude 45º S. In this study Phytoseiidae were sampled from native vegetation in southern Argentina and Chile in the regions of Patagonia and Tierra del Fuego Island. Thirteen species were collected, five of which were previously described and eight, Chileseius australis n. sp., Neoseiulus mapuche n. sp., Typhlodromips valdivianus n. sp., T. fissuratus n. sp., Amblyseius grandiporus n. sp., A. caliginosus n. sp., Typhlodromus (Anthoseius) anomalos n. sp. and Metaseiulus parabrevicollis n. sp. are proposed as new to science and are described and diagnosed.

  10. Oribátidos (Acari, Oribatei de Fuerteventura (islas Canarias

    Directory of Open Access Journals (Sweden)

    Pérez-Iñigo, C.

    1995-12-01

    Full Text Available The oribatid fauna from Fuerteventura (Canary Islands is studied for the first time; 86 species are recorded, from which 18 are new to the Science and two are new subspecies. Two new genera are erected: Passalobates n. gen. (Family Passalozetidae and Fuerteventuria n. gen. (Family Protoribatidae. Two species belonging to Ethiopic genera are described: Scutoverticosus insperatus n. sp. and Ethiovertex elisae n. sp. These genera contained until now the type species only.

    Se estudian por primera vez los ácaros oribátidos de Fuerteventura, y se citan 86 especies de las que 18 son nuevas para la Ciencia y dos son nuevas subespecies, y se establecen dos géneros nuevos: Passalobates n. gen. (Familia Passalozetidae y Fuerteventuria n. gen. (Familia Protoribatidae. Se describen dos especies de géneros etiópicos: Scutoverticosus insperatus n. sp. y Ethiovertex elisae n. sp., géneros que, hasta ahora, solo contaban con la especie tipo.

  11. Artengliederung und Verbreitung der Gattung Zetorchestes in Europa (Acari, Oribatida)

    NARCIS (Netherlands)

    Krisper, G.

    1987-01-01

    This paper gives a description of Zetorchestes grandjeani spec. nov.; it is identical with those animals which are called "l'espèce de Pise" by Grandjean (1951). Ζ. grandjeani differs from Ζ. flabrarius Grandjean, 1951 and from Z. falzonii Coggi, 1898 in showing a reduction of hairs in the posterior

  12. Relative humidity and activity patterns of Ixodes scapularis (Acari: Ixodidae)

    Science.gov (United States)

    Berger, K.A.; Ginsberg, Howard S.; Gonzalez, L.; Mather, T.N.

    2014-01-01

    Laboratory studies have shown clear relationships between relative humidity (RH) and the activity and survival of Ixodes scapularis Say (blacklegged tick). However, field studies have produced conflicting results. We examined this relationship using weekly tick count totals and hourly RH observations at three field sites, stratified by latitude, within the state of Rhode Island. Records of nymphal tick abundance were compared with several RH-related variables (e.g., RH at time of sampling and mean weekly daytime RH). In total, 825 nymphs were sampled in 2009, a year of greater precipitation, with a weighted average leaf litter RH recorded at time of sampling of 85.22%. Alternatively, 649 nymphs were collected in 2010, a year of relatively low precipitation, and a weighted average RH recorded at time of sampling was 75.51%. Negative binomial regression analysis of tick count totals identified cumulative hours <82% RH threshold as a significant factor observed in both years (2009: P = 0.0037; 2010: P < 0.0001). Mean weekly daytime RH did not significantly predict tick activity in either year. However, mean weekly daytime RH recorded with 1-wk lag before sample date was a significant variable (P = 0.0016) in 2010. These results suggest a lag effect between moisture availability and patterns of tick activity and abundance. Differences in the relative importance of each RH variable between years may have been due to abnormally wet summer conditions in 2009.

  13. A supplementary description of Brevipalpus californicus (Acari: Trombidiformes: Tenuipalpidae

    Directory of Open Access Journals (Sweden)

    Mohammad Raissi Ardali

    2015-10-01

    Full Text Available The false spider mite Brevipalpus californicus from the family Tenuipalpidae was collected from Caucasian alnus, White willow, Persian raspberry and a wild Chrysanthemum bush in Mazandaran province. This species is reported as a new record to the false spider mites-fauna of Iran here. Reviewing literatures revealed that it was briefly described in the original paper without any measures. So, a completed description is presented based on the Iranian specimens and different body segments are drawn for B. californicus. In addition, the above plants are new host records for B. californicus.

  14. New records of the tribe Bryobiini berlsese (Acari: Tetranychidae: Bryobiinae) from Serbia, with notes about associated predators (Acari: Phytoseiidae)

    OpenAIRE

    Mladenović K.; Stojnić B.; Vidović B.; Radulović Z.

    2013-01-01

    This paper gives an overview of the present knowledge and some new faunistic and zoogeographic data of the insufficiently researched tribe Bryobiini in Serbia. In Serbia, this group of mites is represented by eight species, including four species new to Serbian fauna: Bryobia angustisetis Jakobashvili, B. lagodechiana Reck, B. ulmophila Reck and B. vasiljevi Reck. New data on host plant species and families have also been obtained - two new host plant species for B. angustisetis, two ho...

  15. Primer registro de Ixodes cookei (Acari: Ixodidae) para México First record of Ixodes cookei (Acari: Ixodidae) in Mexico

    OpenAIRE

    2007-01-01

    En este estudio se aportan los primeros datos de la garrapata Ixodes cookei Packard, 1869 en México. Un macho, 7 larvas y 15 ninfas se recolectaron en los estados de Nuevo León y Veracruz. Además, se registra al cacomixtle Bassariscus astutus como un nuevo huésped.The presence of Ixodes cookei Packard, 1869 is documented for the first time in Mexico, based on one male, 7 larvae and 15 nymphs collected in Veracruz and Nuevo Leon. Additionally, cacomixtle (Bassariscus astutus) is presented as a...

  16. Primer registro de Ixodes cookei (Acari: Ixodidae para México First record of Ixodes cookei (Acari: Ixodidae in Mexico

    Directory of Open Access Journals (Sweden)

    Griselda Montiel-Parra

    2007-06-01

    Full Text Available En este estudio se aportan los primeros datos de la garrapata Ixodes cookei Packard, 1869 en México. Un macho, 7 larvas y 15 ninfas se recolectaron en los estados de Nuevo León y Veracruz. Además, se registra al cacomixtle Bassariscus astutus como un nuevo huésped.The presence of Ixodes cookei Packard, 1869 is documented for the first time in Mexico, based on one male, 7 larvae and 15 nymphs collected in Veracruz and Nuevo Leon. Additionally, cacomixtle (Bassariscus astutus is presented as a new host record.

  17. Ocorrência de Brevipalpus phoenicis (Geijskes (Acari, Tenuipalpidae, Tetranychus urticae (Koch (Acari, Tetranychidae e Polyphagotarsonemus latus (Banks (Acari, Tarsonemidae sobre folhas de Ipomoea cairica (Linnaeus Sweet (Solanales, Convolvulaceae Occurrence of Brevipalpus phoenicis (Geijskes (Acari, Tenuipalpidae, Tetranychus urticae (Koch (Acari, Tetranychidae and Polyphagotarsonemus latus (Banks (Acari, Tarsonemidae on leaves of I. cairica (Linnaeus Sweet (Solanales, Convolvulaceae

    Directory of Open Access Journals (Sweden)

    Ozana M. de A. Maia

    2006-09-01

    Full Text Available A ocorrência de três espécies acarinas fitófagas é relatada pela primeira vez sobre folhas de Ipomoea cairica. As espécies Brevipalpus phoenicis (Geijskes, Tetranychus urticae (Koch e Polyphagotarsonemus latus (Banks, foram coletadas sobre folhas de I. cairica nas imediações da Universidade Federal do Paraná, Curitiba, Paraná, Brasil, em 20 de janeiro de 2005.The first occurrence of three phytophagus mites on Ipomoea cairica, is reported. The species Brevipalpus phoenicis (Geijskes, Tetranychus urticae (Koch and Polyphagotarsonemus latus (Banks were caught on leaves of I. cairica, around Universidade Federal do Paraná, Curitiba, Paraná, Brazil, in January 20th, 2005.

  18. Efficacy of larvicidal activity of green synthesized titanium dioxide nanoparticles using Mangifera indica extract against blood-feeding parasites.

    Science.gov (United States)

    Rajakumar, Govindasamy; Rahuman, Abdul Abdul; Roopan, Selvaraj Mohana; Chung, Ill-Min; Anbarasan, Karunanithi; Karthikeyan, Viswanathan

    2015-02-01

    Titanium dioxide nanoparticles (TiO2 NPs) are considered to be among the best photocatalytic materials due to their long-term thermodynamic stability, strong oxidizing power, and relative non-toxicity. Nano-preparations with TiO2 NPs are currently under investigation as novel treatments for acne vulgaris, recurrent condyloma acuminata, atopic dermatitis, hyperpigmented skin lesions, and other non-dermatologic diseases. The present study was to investigate the acaricidal and larvicidal activity of synthesized TiO2 NPs utilizing leaf aqueous extract of Mangifera indica L. (Anacardiaceae) against hematophagous parasites. The anti-parasitic activity of TiO2 NPs against the larvae of Rhipicephalus (Boophilus) microplus, Hyalomma anatolicum anatolicum and Haemaphysalis bispinosa (Acari: Ixodidae), fourth instar larvae of Anopheles subpictus, and Culex quinquefasciatus (Diptera: Culicidae) were assessed. The green synthesized TiO2 NPs were analyzed by UV-Vis, FTIR, X-ray diffraction (XRD), AFM, SEM, and TEM. The XRD analysis of synthesized TiO2 NPs revealed the dominant peak at 2θ value of 27.81 which matched the 110 crystallographic plane of the rutile structure indicating the crystal structure. The FTIR spectra exhibited a prominent peak at 3,448 cm(-1) and showed OH stretching due to the alcoholic group, and the OH group may act as a capping agent. The SEM images of TiO2 NPs displayed spherical, oval in shape, individual, and some in aggregates. Characterization of the synthesized TiO2 NPs using AFM offered three-dimensional visualization and uneven surface morphology. The TEM micrograph showed agglomerates, round and slight elongation with an average size of 30 ± 5 nm. The maximum efficacy was observed in synthesized TiO2 NPs against the larvae of R. microplus, Hyalomma anatolicum anatolicum, Haemaphysalis bispinosa, A. subpictus, and Culex quinquefasciatus with LC50 value of 28.56, 33.17, 23.81, 5.84, and 4.34 mg/L, respectively. In the present study, a novel

  19. Nuevos registros de ácaros oribátidos (Acari: Oribatida para la Argentina New records of oribatid mites (Acari: Oribatida for Argentina

    Directory of Open Access Journals (Sweden)

    Cecilia Accattoli

    2010-12-01

    Full Text Available Esta publicación constituye un aporte al conocimiento del elenco oribatológico en suelos de Argentina, basado en relevamientos realizados en un parque urbano de la ciudad de La Plata, Buenos Aires. Se informan dos nuevas citas de géneros, una de subgénero y siete de especies para el país. Además, cinco de las especies halladas serían nuevas para la ciencia. Se incorporan ocho géneros y siete especies a las registradas para la Provincia de Buenos Aires.This paper is a contribution to the knowledge of assemblages of oribatid mites in soils of Argentina. The study is based on samples from an urban forest in the city of La Plata, Buenos Aires. New records for the country are provided for two genera, one subgenus and seven species. Furthermore, five of the species found are possibly new to science. Eight genera and seven species are incorporated to the record of the Buenos Aires province.

  20. Selection of Entomopathogenic Fungi to Control Varroa destructor (Acari: Varroidae Selección de Hongos Entomopatógenos para el Control de Varroa destructor (Acari: Varroidae

    Directory of Open Access Journals (Sweden)

    Marta Rodríguez

    2009-12-01

    Full Text Available The aim of this work was select entomopathogenic fungi tolerant to temperatures inside the brood area of honey bees (Apis mellifera for to control Varroa destructor. For this purpose, 50 Beauveria bassiana (Balsamo Vuillemin and 48 Metarhizium anisopliae (Metschn. Sorokin isolates were evaluated at 30 and 35 ºC. For each isolate, colony discs of 5 mm with mycelium were placed in the center of a Petri dish with Sabouraud dextrose agar (SDA medium. The dishes were incubated at 30 and 35 °C, without light. Radial growth of each colony was measured daily. All the B. bassiana and M. anisopliae isolates presented a lineal growth rate at a temperature of 30 ºC. However, at 35 ºC, most of the isolates did not grow, except three B. bassiana and 14 M. anisopliae isolates (P El objetivo de este trabajo fue seleccionar hongos entomopatógenos tolerantes a las temperaturas del nido de cría de las abejas (Apis mellifera, para ser utilizados en el control de Varroa destructor. Se evaluaron 50 aislamientos de Beauveria bassiana (Balsamo Vuillemin y 48 de Metarhizium anisopliae (Metschn. Sorokin a temperaturas de 30 y 35 ºC. Discos de agar de 5 mm de diámetro con micelio de colonias de cada aislamiento, se depositaron en el centro de placas Petri con medio agar Sabouraud dextrosa (ASD. Las placas fueron incubadas a 30 y 35 °C y oscuridad y diariamente se midió el radio de cada colonia. Todos los aislamientos de B. bassiana y M. anisopliae var. anisopliae presentaron una tendencia lineal a través del tiempo a temperaturas de incubación de 30 °C. A 35 °C la mayoría de los aislamientos no crecieron, excepto tres aislamientos de B. bassiana y 14 de M. anisopliae (p < 0,001. Estos aislamientos fueron seleccionados para realizar pruebas de patogenicidad sobre V. destructor, aplicando una suspensión de 10(7 conidias mL-1. El aislamiento más efectivo fue Qu-M845 de M. anisopliae (p = 0,0033, produjo una mortalidad de 85%. La capacidad patogénica de este aislamiento en V. destructor y su tolerancia a las condiciones ambientales a las que sería expuesto, permite considerar esta cepa como una alternativa de control para esta plaga.

  1. Larvicidal potencial of Sapindus saponaria (Sapindaceae against Rhipicephalus sanguineus (Latreille, 1806 (Acari: Ixodidae Potencial larvicida de Sapindus saponaria (Sapindaceae sobre Rhipicephalus sanguineus (Latreille, 1806 (Acari: Ixodidae

    Directory of Open Access Journals (Sweden)

    F.F. Fernandes

    2007-02-01

    Full Text Available The larvicidal potential of the crude ethanolic extracts (CEE of the stem peel of Sapindus saponaria was evaluated against Rhipicephalus sanguineus. Lethal concentrations (LC, were calculated by preparing CEE solutions at different concentrations in distilled water. Larvae fasted for 14-21 days were utilized in the bioassays, after incubation of engorged females collected from infested environments frequented by dogs in several neighborhoods of Goiânia, GO. Bioassays were performed in a specially constructed biological chamber for testing botanical acaricides, acclimatized to 27±1ºC, RH>80%. The larvae were counted on filter paper envelopes impregnated with the solutions or distilled water and larval mortality observed after 48h. S. saponaria showed good larvicidal activity (LC50 and LC99 of 1994 and 3922ppm, respectively and the results demonstrated its potential as a botanical acaricide and an alternative control measure for R. sanguineus.Avaliou-se a potencialidade larvicida do extrato-bruto etanólico (EBE da casca do caule de Sapindus saponaria sobre Rhipicephalus sanguineus. Para o cálculo das concentrações letais (CL foram preparadas soluções com diferentes concentrações do EBE dissolvido em água destilada. Foram utilizadas larvas em jejum com 14 a 21 dias, obtidas pela incubação de teleóginas, coletadas em ambientes infestados, freqüentados por cães de vários bairros de Goiânia. Os bioensaios foram realizados em uma câmara biológica para testes com acaricidas botânicos, climatizada a 27±1ºC e UR>80%. As larvas foram contidas em envelopes de papel filtro impregnados com as soluções (grupo teste ou com água destilada (grupo-controle e a mortalidade larval foi observada após 48h. S. saponaria demonstrou atividade larvicida satisfatória (CL50 e CL99 respectivamente de 1994 e 3922ppm e os resultados demonstraram seu potencial como acaricida botânico e medida alternativa para o controle de R. sanguineus.

  2. A gallery of the key characters to ease identification of Dermanyssus gallinae (Acari: Gamasida: Dermanyssidae and allow differentiation from Ornithonyssus sylviarum (Acari: Gamasida: Macronyssidae

    Directory of Open Access Journals (Sweden)

    Di Palma Antonella

    2012-05-01

    Full Text Available Abstract Background Dermanyssus gallinae (poultry red mite is a major threat for the poultry industry and is of significant interest for public health. Identification of D. gallinae can be difficult for scientists not familiar with mite morphology and terminology especially when trying to use identification keys. Moreover, this species may easily be confused with another dermanyssoid mite, Ornithonyssus sylviarum (northern fowl mite, which often shares the same hosts and environment. Methods Specimens of D. gallinae were collected at poultry farms in the Puglia and performed for light and scanning electron microscopy observations, identification and micrographs. Moreover specimens of O. sylviarum were collected separately macerated and mounted on slides for light microscopy observations, identification and pictures. Results The micrographs used in this study, based on LM and SEM observations, highlight the following important identifying characters of D. gallinae: the prominent shoulders of the dorsal shield and the jagged edges of the shield reticulations, the position of setae j1, s1 and the epigynal pores, and the presence on tibia IV pl of one seta. Additional micrographs highlighting the shape of the dorsal (abruptly narrowed posteriorly and epigynal (narrowly rounded posteriorly shields and the chelicera (elongate, with distinct digits of O. sylviarum enable its differentiation from D.gallinae. Conclusion The photographic support provided here (both LM and SEM pictures can be considered a practical tool for scientists who are not well acquainted with the morphology of D.gallinae, and who are involved with classical and molecular systematics, veterinary and human health aspects of poultry red mites.

  3. Sobre el género Neocalonyx (Acari: Prostigmata: Hydryphantidae en las Yungas About the genus Neocalonyx (Acari: Prostigmata: Hydryphantidae in the Yungas

    Directory of Open Access Journals (Sweden)

    Beatriz Rosso de Ferradás

    2007-12-01

    Full Text Available Se tratan aquí dos especies conocidas del género Neocalonyx y se describe una nueva especie, N. diaguita sp. nov. de la provincia de Jujuy (Argentina. Se discuten los caracteres considerados en los tres subgéneros y los cuatro grupos de especies, reconocidos en uno de ellos.Two known species of Neocalonyx genus are dealt with in this paper, and one new species, N. diaguita sp. nov. from Jujuy province in Argentina is described.The characters considered in the three subgenera and the four species groups of one of them are discussed.

  4. Efeitos do nim sobre tetranychus urticae Koch (Acari: Tetranychidae e os predadores Phytoseiulus macropilis (Banks e Neoseiulus californicus (Mcgregor (Acari: Phytoseiidae

    Directory of Open Access Journals (Sweden)

    Daniele Cristine Hoffmann Schlesener

    2013-03-01

    Full Text Available O objetivo deste trabalho foi avaliar a eficiência de controle e os efeitos adversos de dois produtos à base de nim Azamax® (Azadiractina A/B 12g/L e Neemseto® (Azadiractina A/B, Nimbina e Salanina 2,389 g/L sobre o ácaro-rajado Tetranychus urticae e os predadores Phytoseiulus macropilis e Neoseiulus californicus em laboratório. Para o ácaro-rajado, foram consideradas as variáveis mortalidade, fecundidade, efeito ovicida e persistência biológica, enquanto para os fitoseídeos consideraram-se mortalidade e fecundidade. A mortalidade máxima observada para o ácaro-rajado foi de 89,7% e 91,5% para Azamax® e Neemseto®, respectivamente, na concentração de 0,5% após a reaplicação do produto no sétimo dia. Também foram observados efeitos adversos sobre a fecundidade e a viabilidade dos ovos quando tratados com os produtos comerciais (p.c.. A persistência biológica dos produtos foi de aproximadamente três dias após a pulverização. As formulações apresentaram seletividade em relação aos fitoseídeos, porém causaram redução da fecundidade dos mesmos.

  5. Hidracáridos (Acari, Hydrachnidia de la cuenca Andina del río Beni, Bolivia Hydracarids (Acari, Hydrachnidia from the Andean basin of Beni river, Bolivia

    Directory of Open Access Journals (Sweden)

    Beatriz Rosso de Ferradás

    2004-09-01

    Full Text Available Water mites from Andean part of the Bolivian Amazonian rivers were examined. A new species is described, Limnesia aymara. New records and redescription are made for Hygrobatella multiacetabulata Cook,1980, Atractides brasiliensis (Lundblad, 1937 and Krendowskia convexa (Ribaga, 1902. A new subgenus Schwoerbelobatella for hygrobatelids poliacetabulated is proposed and characterized. Ecological characteristics of the river area sampled and ecological preferences of the analyzed species are discussed.

  6. Life table parameters and capture success ratio studies of Typhlodromips swirskii (Acari: Phytoseiidae) to the factitious prey Suidasia medanensis (Acari: Suidasidae).

    Science.gov (United States)

    Midthassel, Audun; Leather, Simon R; Baxter, Ian H

    2013-09-01

    The predatory mite Typhlodromips swirskii (Athias-Henriot) is commonly used to suppress pest populations of thrips and whitefly in commercial greenhouses. Many generalist phytoseiid mites can be reared on astigmatid factitious prey. This study investigated the life table parameters of T. swirskii to the astigmatid mite Suidasia medanensis (Oudemans) and the capture success ratio of T. swirskii to different life stages of the prey. Juvenile development time and survival was 5.01 ± 0.10 days and 93 %, respectively. The intrinsic (r m ) and finite (λ) rates of increase were 0.222 and 1.249, respectively, with average oviposition rate of 1.71 ± 0.07 eggs/female/day. The capture success ratio of T. swirskii to S. medanensis was: eggs > freeze killed adults > nymphs > live adults. Typhlodromips swirskii was concluded to exhibit good population growth rates with S. medanensis as prey and, a prey population with predominance of eggs and nymphs to be advantageous to the predator due to an unidentified defence mechanism of adult prey.

  7. Acaricidal activity of the essential oils from Eucalyptus citriodora and Cymbopogon nardus on larvae of Amblyomma cajennense (Acari: Ixodidae) and Anocentor nitens (Acari: Ixodidae).

    Science.gov (United States)

    Clemente, Mateus Aparecido; de Oliveira Monteiro, Caio Márcio; Scoralik, Márcio Goldner; Gomes, Fernando Teixeira; de Azevedo Prata, Márcia Cristina; Daemon, Erik

    2010-09-01

    The present study evaluated the acaricidal activity of essential oils from Eucalyptus citriodora and Cymbopogon nardus on non-engorged larvae of Amblyomma cajennense and Anocentor nitens. In order to carry out the study, six groups were formed, each concentration being a treatment (6.25%, 12.5%, 25%, and 50%, respectively) and also with the creation of a control group (distilled water) and a positive control (Deltametrine). For each treatment, approximately 100 larvae of these ticks were placed onto filter papers (2 x 2 cm) impregnated with the concentrations used to test. Next, the envelopes were closed bearing inside the filter paper with measurements of 6 x 6 cm. For each group, six repetitions were performed, and after 24 h live and dead larvae were counted. This procedure was carried out for two essential oils on the two species of ticks. For A. cajennense, the acaricide efficacy of E. citriodora oil was of 10.8%, 35.3%, 34.5%, and 53.1%, whereas the efficacy of C. nardus was of 0.0%, 0.0%, 0.0%, and 61.1% at concentrations of 6.25%, 12.5%, 25.0%, and 50.0%, respectively. In relation to A. nitens, the acaricide efficacy of E. citriodora oil was of 20.1%, 84.5%, 89.2%, and 100.0%, whereas the efficacy of C. nardus was of 0.0%, 90.8%, 100.0%, and 100.0% at concentrations of 6.25%, 12.5%, 25.0%, and 50.0%, respectively. The results indicate that the essential oils tested showed a promising acaricidal activity mainly on A. nitens larvae.

  8. Suscetibilidade de Oligonychus yothersi (Acari: Tetranychidae ao fungo Beauveria bassiana Susceptibility of Oligonychus yothersi (Acari: Tetranychidae to the fungus Beauveria bassiana

    Directory of Open Access Journals (Sweden)

    Renato Cassol de Oliveira

    2002-03-01

    Full Text Available A cultura da erva-mate (Ilex paraguariensis é uma importante atividade econômica no Sul do Brasil. Com o aumento de consumo nos anos oitenta, cresceram também as áreas de monocultura, gerando condições favoráveis para o aumento populacional de insetos e ácaros fitófagos, entre eles o ácaro vermelho Oligonychus yothersi. Este estudo avaliou a suscetibilidade do ácaro vermelho O. yothersi a vários isolados do fungo Beauveria bassiana. O experimento foi conduzido em Cascavel, PR. Discos foliares de erva-mate (2,2 cm² foram previamente infestados com 20 fêmeas adultas. Alíquotas de 1 mL de cada suspensão de conídios dos diferentes isolados de B. bassiana, ajustadas na concentração de 1,0x10(8 conídios mL-1 foram pulverizadas, separadamente, sobre um conjunto de 5 discos. Os discos foliares foram mantidos flutuando em água destilada, em caixas plásticas (3 cm de diâmetro, sob condições controladas. Diariamente, os ácaros mortos foram transferidos para câmara úmida, para confirmação de mortalidade causada pelo fungo. A mortalidade total variou entre 77 e 98% (6 dias após a aplicação, não permitindo diferenciar os isolados quanto à virulência (P>0,05. Já a mortalidade confirmada variou entre 19 e 75%, permitindo diferenciá-los (PThe Paraguay tea (Ilex paraguariensis crop is an important economical activity in Southern Brazil. With the increase of tea consumption in the 80s, the number of monoculture crops also increased, creating favorable conditions for the development of phytophagous insect and mite populations, such as the red mite Oligonychus yothersi. The objective of this study was to evaluate the susceptibility of the red mite O. yothersi to the several strains of the Beauveria bassiana fungus. The experiments were carried out in Cascavel, PR, Brazil. Leaf disks of Paraguay tea (2.2 cm² were previously infested with 20 adult females. Five disks were inoculated with 1 mL of each conidial suspension of B. bassiana strains (1x10(8 conidia per mL. Disks were kept afloat on distilled water in plastic boxes (3 cm diameter, under controlled conditions. Dead mites were transferred to a humid chamber on a daily basis to confirm the mortalities rate by the fungus. All the strains were pathogenic, with total mortality varying from 77 to 98%, 6 days after application. It was not possible to differentiate virulence levels between strains (P<0.05 by total mortality. However, confirmed mortality varied from 19 to 75%, 8 days after application, allowing for a differentiation in virulence levels between strains (P<0.05. This study concluded that the O. yothersi red mite is susceptible, at different levels, to B. bassiana tested strains.

  9. Two new oribatid mites from the Republic of Rwanda. Plasmobates zarae sp. n. (Acari, Plasmobatidae) and Basilobelba spasmenosi sp. n. (Acari, Basilobelbidae)

    Science.gov (United States)

    Fernandez, Nestor; Theron, Pieter

    2016-01-01

    Abstract Two new species of oribatid mites, Plasmobates zarae sp. n. and Basilobelba spasmenosi sp. n. are described from the Republic of Rwanda. They can easily be differentiated from other species by a number of characters. Plasmobates zarae sp. n. is differentiated the following characters. four types of particular cerotegumental layers. Integument slightly foveate to smooth on prodorsum; foveate on notogaster; ventral region rugose to smooth.Large rostral setae inserted on protuberance, whip-shaped, with longitudinal pucker; interlamellar setae rod-shaped with triangular scales; interlamellar setae small. Medial band on prodorsum extending to anterior of central part, but not reaching rostrum. Bothridium horn-shaped; opening basally incised with rectilinear wall, internal bothridial rings dentate. Sensillus whip-like, with minute triangular scales. Variably distributed circumgastric macropores. Opisthosomal gland apophysis flat, triangular in lateral view and cylindrical in posterolateral view. Six pairs of notogastral setae, all situated posterior to opisthosomal gland level. Aggenital setae not detected; three pairs of adanal setae; two pairs of anal setae present. Nymphal scalps simple without anterior tuft or filaments, with dentate peripheral ridge. Larval scalp shaped like Chinese hat. Basilobelba spasmenosi sp. n. is characterized by the combination of the following characters: Cerotegument: thick basal layer with amorphous coat and cavities of different sizes, as well as structures resembling small cauliflowers. Setation: simple: notogastral, epimeral, genital, anal; simple long, basally barbate: le, ro setae; simple, whip-shaped: ex setae; medium length, sharpened tip with thorns on surface: in setae, leg setae; Flabellate: setae situated in ventral neotrichous zone. Thorn-like barbs and more or less parallel longitudinal grooves present on body surface of le, ro, in and leg setae. Prodorsum: rostrum finger-shaped, relative sizes of setae: le > ro > in > ex. Prodorsal cuticular surface smooth with shallow transversal furrow and two oblique furrows determining two triangular structures. Large humpbacked CSO situated anterior to and in medial line with in setal insertion, dorsal bothridial opening. Notogaster swollen, hemispheric; nine pairs of minute setae, only h1, h2, h3 easily identifiable, cuticular wart and dimple clearly visible. Humeral apophysis with longitudinal furrow dorsally. Elongate chelicera with cha, chb setae, behind them a series of scales directed dorsoventrally. Epimeral setation 3-1-3-3, adanal-aggenital neotrichy with between 8-10 setae. Nymphal scalps with very particular bean-shaped structure on either side of the decoupage zone, surrounding horn-like structure. Scalps with cuticular polyhedral reticulate to ovoid structure, often forming a cavity, either completely perforated or with a thin cuticular layer resembling an interior membrane. PMID:27408588

  10. Fitoseídeos (Acari: Phytoseiidae associados a cafezais e fragmentos florestais vizinhos Phytoseiids (Acari: Phytoseiidae associated to coffee plantations and adjacent forest fragments

    Directory of Open Access Journals (Sweden)

    Ester Azevedo Silva

    2010-10-01

    Full Text Available Existem poucas informações sobre a fauna de ácaros predadores (Phytoseiidae em ambientes naturais brasileiros adjacentes a agroecossistemas cafeeiros (Coffea spp. ou sobre a influência que essa vegetação exerce como reservatório de ácaros predadores. Neste estudo, objetivou-se avaliar a diversidade destes organismos em cafeeiros e fragmentos florestais adjacentes. Coletaram-se amostras das espécies Calyptranthes clusiifolia (Miq. O. Berg (Myrtaceae, Esenbeckia febrifuga (A. St.-Hil. A. Juss. ex Mart. (Rutaceae, Metrodorea stipularis Mart. (Rutaceae e Allophylus semidentatus (Miq. Radlk. (Sapindaceae, em oito fragmentos florestais, de 5 a 51 ha, e cafezais adjacentes, nos meses de junho (final período chuvoso e outubro (final período seco nos anos 2004 e 2005, na região Sul do Estado de Minas Gerais. Ácaros foram extraídos das folhas, utilizando o método de lavagem e, em seguida, montados em lâminas de microscopia em meio de Hoyer, para identificação específica. No total foram identificados 2.348 fitoseídeos, sendo 2.090 nos fragmentos florestais e 258 espécimes nos cafezais adjacentes, pertencentes a 38 espécies. Servindo-se de análise faunística, a espécie Iphiseiodes zuluagai Denmark & Muma, 1972 apresentou os melhores índices no agroecossistema cafeeiro, sendo muito frequente e constante nas épocas estudadas. Nos fragmentos florestais Amblyseius herbicolus Chant, 1959, Iphiseiodes affs. neonobilis Denmark & Muma, 1978, Leonseius regularis DeLeon, 1965 e Euseius alatus DeLeon, 1966 foram dominantes, muito abundantes, muito frequentes e constantes nas épocas estudadas. Podemos concluir que a vegetação nativa abriga ácaros predadores, inimigos naturais de ácaros-praga, que ocorrem na cultura cafeeira, possibilitando o desenvolvimento de programas de manejo ecológico com áreas de vegetação natural e agroecossistemas cafeeiros adjacentes.There is little information about the fauna of predatory mites (Phytoseiidae in Brazilian natural environments, adjacent to coffee agroecosystems (Coffea spp., or about the influence exerted by neighbor vegetation as a reservoir of predatory mites. The objective of this study was to evaluate the diversity of these organisms in coffee plantations and adjacent forest fragments. Samples of the species Calyptranthes clusiifolia (Miq. O. Berg (Myrtaceae, Esenbeckia febrifuga (A. St.-Hil. A. Juss. ex Mart., Metrodorea stipularis Mart. (Rutaceae and Allophylus semidentatus (Miq. Radlk. (Sapindaceae were collected in eight forest fragments, from 5 to 51ha, adjacent to coffee plantations, in June (end of the rainy season and October (end of the dry season in the years of 2004 and 2005, in the Southern region of State of Minas Gerais. Leaf mites were extracted using the wash method, mounted in microscopy slides with Hoyer's medium for identification. A total of 2.348 phytoseiids was collected, being 2.090 in the forest fragments and 258 in adjacent coffee plantations, belonging to 38 species. According to fauna analysis, Iphiseiodes zuluaguai Denmark & Muma, the year of 1972 presented the best indexes in the coffee agroecosystem, being very frequent and constant in those periods. In the forest fragments, Amblyseius herbicolus Chant, 1959, Iphiseiodes affs. neonobilis Denmark & Muma, 1978, Leonseius regularis DeLeon, 1965 and Euseius alatus DeLeon, 1966 were dominant, very abundant, very frequent and constant in those periods. One may conclude that the native vegetation shelters predator mite, natural enemies of mite-pests that still occur in coffee culture, making possible ecological management program development involving areas of natural vegetation and adjacent coffee agroecosystems.

  11. Garrapatas (Acari: Ixodidae) en perros de la ciudad de Concepción, Chile Ticks (Acari: Ixodidae) on dogs in Concepción city, Chile

    OpenAIRE

    Muñoz, L.; M. E. CASANUEVA

    2002-01-01

    Con la finalidad de determinar las especies de garrapatas que parasitan a los perros de la ciudad de Concepción, se extrajeron 137 garrapatas desde perros de ocho clínicas veterinarias de cuatro comunas de la ciudad de Concepción. Los ejemplares encontradas fueron observados mediante lupa estereoscópica y algunos fotografiados a microscopio electrónico. Como resultados se obtuvo que el 38.7% correspondían a Amblyomma tigrinum adultos y el 61.3% a Rhipicephalus sanguineus adultos e inmadurosA ...

  12. Nuevas citas de ácaros oribátidos (Acari: Oribatida para la Argentina New records of oribatids (Acari: Oribatida for Argentina

    Directory of Open Access Journals (Sweden)

    Ana Salazar Martínez

    2006-12-01

    Full Text Available En la presente nota se citan, por primera vez para la Argentina , cuatro especies de ácaros oribátidos: Epilohmannia pallida americana Balogh & Mahunka, 1981, Protoribates (Triangius praeoccupatus (Pérez-Iñigo & Baggio, 1980, Scheloribates curvialatus Hammer, 1961 y Galumna innexa Pérez-Iñigo & Baggio, 1986. Los ejemplares fueron hallados en muestras de suelo recolectadas en La Plata , Provincia de Buenos Aires (34º 54'S, 57º 55´ W, en ambientes sometidos a intervención antrópica: bosques urbanos, huertas orgánicas y pastizales.Four species of oribatid mites are recorded from Argentina for the first time: Epilohmannia pallida americana Balogh & Mahunka, 1981, Protoribates (Triangius praeoccupatus (Pérez-Iñigo & Baggio, 1980, Scheloribates curvialatus Hammer, 1961 and Galumna innexa Pérez-Iñigo & Baggio, 1986. The specimens were collected in soil samples in La Plata , Buenos Aires Province (34º 54' S, 57º 55´ W in sites exposed to different degrees of human intervention: urban forest, organic orchards and pastures.

  13. Rhipicephalus sanguineus (Acari: Ixodidae, the brown dog tick, parasitizing humans in Brazil Rhipicephalus sanguineus (Acari: Ixodidae, o carrapato vermelho do cão, parasitando humanos no Brasil

    Directory of Open Access Journals (Sweden)

    Filipe Dantas-Torres

    2006-02-01

    Full Text Available The objective of this paper is to describe four cases of human parasitism by Rhipicephalus sanguineus (Latrielle in Brazil. During an investigation regarding the species of ectoparasites of domestic dogs from the metropolitan region of Recife, Pernambuco state, four dog owners were found to be parasitized by ticks. The ticks were collected from these individuals and their dogs. All the ticks were identified as Rhipicephalus sanguineus . These are, to our knowledge, the first four cases of human parasitism by this tick species in Brazil. The possible implications of this finding are discussed here.O objetivo deste artigo é descrever quatro casos de parasitismo humano por Rhipicephalus sanguineus (Latrielle no Brasil. Durante uma investigação sobre as espécies de ectoparasitas de cães domésticos provenientes da Região Metropolitana de Recife, Pernambuco, quatro proprietários de cães foram encontrados parasitados por carrapatos. Foram coletados carrapatos dos indivíduos e de seus cães. Todos os carrapatos foram identificados como Rhipicephalus sanguineus, sendo, portanto, descritos os primeiros quatro casos de parasitismo humano por esta espécie de carrapato, no Brasil. Neste trabalho, são discutidas as possíveis implicações epidemiológicas deste achado.

  14. Distribuição espacial e plano de amostragem de Calacarus heveae (Acari em seringueira Spatial distribution and sampling plan for Calacarus heveae (Acari on rubber trees

    Directory of Open Access Journals (Sweden)

    Noeli Juarez Ferla

    2007-12-01

    Full Text Available Calacarus heveae Feres, 1992 é um eriofídeo descrito de espécimes coletados em plantas de seringueira (Hevea brasiliensis, Euphorbiaceae na região noroeste do Estado de São Paulo. Esse ácaro prefere a face adaxial dos folíolos e pode causar a perda do brilho, amarelecimento, bronzeamento dessa região e a subseqüente queda prematura das folhas. O objetivo deste trabalho foi analisar a distribuição de C. heveae em seringueira, selecionar a unidade de amostragem mais representativa e desenvolver um plano de amostragem para o estudo de sua flutuação populacional. O trabalho foi conduzido com os clones PB 260 e IAN 873, respectivamente nos municípios de Itiquira e de Pontes e Lacerda, ambos no Mato Grosso. Em Itiquira, diferenças significativas foram observadas em quatro ocasiões em relação ao número médio de ácaros por folha nos diferentes estratos das plantas. Nas amostragens realizadas em Pontes e Lacerda, nenhuma diferença significativa foi encontrada entre os estratos em relação àquele parâmetro. Apenas em Itiquira, em uma ocasião de amostragem, foi verificada diferença entre os três estratos, em relação à proporção de folhas infestadas. Nenhuma diferença significativa foi verificada em relação ao número médio de ácaros por folha e proporção de folhas infestadas por C. heveae a diferentes distâncias da periferia da copa. Calacarus heveae exibe distribuição agregada no campo. Para estimar a densidade de C. heveae, um plano numérico e um plano binomial de amostragem foram desenvolvidos.Calacarus heveae Feres, 1992 (Eriophyidae is a mite described from specimens collected on rubber tree (Hevea brasiliensis, Euphorbiaceae in the northwest region of the state of São Paulo. This mite prefers the adaxial face of the folioles which it can turn dry, yellowish and brownish; it can also cause leaf fall. The aim of this work was to analyze the distribution of C. heveae on rubber trees, to select the most representative sampling unit and to develop a sampling plan to determine the populational fluctuation. This study was conducted with clones PB 260 and IAN 873, in Itiquira and Pontes e Lacerda, respectively, both in the state of Mato Grosso. In Itiquira, significant differences were observed in four occasions in relation to the average number of mites per leaf in the different plant strata. In the samplings carried out in Pontes e Lacerda, no significant differences were observed between strata in relation to that parameter. Only in Itiquira, in one occasion, a significant difference between strata was verified in relation to the proportion of infested leaves. No significant differences were verified in relation to the average number of mites per leaf and proportion of leaves infested by C. heveae at different depths in the canopy. Calacarus heveae exhibits aggregated distribution in the field. To estimate the density of C. heveae, numeric and sampling plans were developed.

  15. Ticks (Ixodida) from the collection of the Natural History Department, Museum of Upper Silesia in Bytom, Poland - A contribution to knowledge on tick fauna and the first record of Hyalomma marginatum presence in Poland.

    Science.gov (United States)

    Cuber, Piotr Krzysztof

    2016-06-02

    There is no doubt that museum collections provide a wide variety of information on ticks. The tick collection at the Natural History Department of the Museum of Upper Silesia in Bytom consists only of 37 specimens as the department is focused mainly on building collections of insects and birds. However, this does not mean that such collection cannot contribute to our knowledge about these arthropods. The most valuable results of studies on the museum's tick collection concerned Polish fauna. There are specimens of I. ricinus dating back as far as 1930-1948, which are the first known records of the presence of this tick in the Upper Silesia. Two specimens collected in copula in 1941 might be the earliest record of the mating behaviour of this species in Poland. The most important result was the detection of 2 cases of H. marginatum presence in Poland, which by far are the oldest documented cases of its presence in this country.

  16. The Genus Ixodes (Acari: Ixodidae) in Mexico: Adult Identification Keys, Diagnoses, Hosts, and Distribution

    Science.gov (United States)

    2010-01-01

    1962. Monografía de los Ixodoidea de México. I Parte. Revista de la Sociedad Mexicana de Historia Natural 23:191-307. Hoffmann, A. 1969. Un caso de...geographic reference, 3rd ed., D. E. Wilson and D. M. Reeder (eds.). The Johns Hopkins University Press, Baltimore. p. 894-1531. Nuttall, G. H. F...337. Nuttall, G. H. F. and C. Warburton. 1911. A monograph of the Ixodoidea. Part II. Ixodidae. Cambridge at the University Press, London. p. i-xix

  17. Canis familiaris, UN NUEVO HOSPEDERO DE Ornithodoros (A. puertoricensis FOX, 1947 (ACARI: IXODIDA EN COLOMBIA

    Directory of Open Access Journals (Sweden)

    LUIS E. PATERNINA

    2009-01-01

    Full Text Available Las garrapatas revisten gran importancia en el campo biomédico por sus hábitos hematófagos y asociación con la transmisión de agentes patógenos a humanos y animales. El objetivo de esta investigación fue establecer las especies de garrapatas que parasitan perros en tres poblaciones del área rural del Caribe colombiano. Durante los meses de agosto y diciembre del año 2006 se realizó búsqueda activa de garrapatas sobre caninos domésticos de las localidades de El Campín, Sabanas del Potrero y Escobar Arriba, departamento de Sucre. Las garrapatas recolectadas fueron almacenadas en viales con etanol al 70% e identificadas empleando claves morfoló- gicas de referencia para cada familia. Para la determinación de especie en la familia Argasidae se realizaron estimaciones morfométricas de estructuras externas. Se reco- lectaron 420 garrapatas a partir de 50 caninos infestados, de un total de 134 perros examinados, que corresponde a una tasa de infestación del 37,3%. Las garrapatas fueron identificadas como Rhipicephalus sanguineus, Rhipicephalus (Boophilus microplus y Amblyomma ovale pertenecientes a la familia Ixodidae, y Ornithodoros (Alectorobius puertoricensis de la familia Argasidae. La especie predominante fue R. sanguineus (92,1% en los estados de larva, ninfa y adulto, seguida por larvas de O. puertoricensis, que fue- ron halladas en menor número sobre caninos de las tres localidades. Se registra, por primera vez en América, el parasitismo de O. puertoricensis sobre caninos domésticos y se confirma su presencia en Colombia.

  18. Preliminary survey of ticks (Acari: Ixodidae) parasitizing wild turkeys (Aves: Phasianidae) in eastern Kansas.

    Science.gov (United States)

    Mock, D E; Applegate, R D; Fox, L B

    2001-01-01

    During the spring and fall turkey hunting seasons of 1999, hunters and Kansas Department of Wildlife and Parks field personnel examined wild turkeys, Meleagris gallopavo L., for ticks and submitted them to us for identification. From springtime hunting, we received 113 ticks from 12 turkeys killed in nine counties, all in the eastern one-third of Kansas. Collectors reported examining three additional wild turkeys on which no ticks were found. All ticks were nymphal lone star ticks, Amblyomma americanum (L.). Of 11 wild turkeys examined in seven counties during October, one was parasitized by 30 A. americanum larvae. Data from this study and accounts from the published literature suggest that parasitism of wild turkeys by immature lone star ticks is commonplace wherever this host and ectoparasite are sympatric. Our study suggests that M. gallopavo may be an important host that supports lone star tick populations.

  19. The First Report of Eustigmaeus johnstoni (Acari: Stigmaeidae Parasitic Mite of Phlebotominae Sand Flies from Iran.

    Directory of Open Access Journals (Sweden)

    Mehdi Badakhshan

    2013-06-01

    Full Text Available Stigmaeids mites have been recorded only on Phlebotominae sand flies up to now. Five species of Eustigmaeus, and three of Stigmaeus were reported on infested sandflies in different country up to the present.Sand flies collection was done using CDC light trap and sticky paper. The mites were isolated from infested specimens, mounted in Puri's medium and identified using reliable keys.A mite infested Phlebotomus papatasi was observed during a study on sandflies of one of the southern provinces of Iran, near to the Persian Gulf. Several scars resulting from mite attachment were found on abdominal tergites of this female sand fly. The mites were identified as Eustigmaeus johnstoni.This parasitic mite is one of the eyeless species, which has a great distribution over the world, reported from Tunisia, Saudi Arabia, Pakistan, Yemen, Cyprus and Palestine. But, this is the first record of this species from Iran.

  20. Deltamethrin resistance in field populations of Rhipicephalus (Boophilus) microplus (Acari: Ixodidae) in Jammu and Kashmir, India.

    Science.gov (United States)

    Ahanger, R R; Godara, R; Katoch, R; Yadav, A; Bhutyal, A D S; Katoch, M; Singh, N K; Bader, M A

    2015-11-01

    Detection of resistance levels against deltamethrin in Rhipicephalus (Boophilus) microplus collected from six districts of Jammu and Kashmir (India) was carried out using the adult immersion test. The regression graphs of probit mortality of ticks plotted against log values of concentration of drug were utilised for the determination of slope of mortality, lethal concentration for 50% (LC50), 95% (LC95) and resistance factor (RF). On the basis of the data generated on mortality, egg mass weight, reproductive index and percentage inhibition of oviposition, the resistance level was categorised as I, II, III and IV. Out of these six districts, resistance to deltamethrin at level I was detected in one district (RF = 1.9), at level II in two districts (RF = 7.08-10.07) and at level IV in three districts (RF = 96.08-288.72). The data generated on deltamethrin resistance status will help in formulating tick control strategy in the region.

  1. Arrhenotoky and oedipal mating in the northern fowl mite (Ornithonyssus sylviarum (Acari: Gamasida: Macronyssidae

    Directory of Open Access Journals (Sweden)

    McCulloch John B

    2012-12-01

    Full Text Available Abstract Background The northern fowl mite (NFM; Ornithonyssus sylviarum is a blood-feeding ectoparasite of birds and a major pest of poultry in the United States. Mite populations spread rapidly in commercial flocks, reach peak burdens of >70,000 mites per bird and have developed resistance to many pesticides. Despite decades as a pest in the United States, the reproductive biology of NFM remains unclear. Based on karyotypes, the NFM has haplodiploid sex determination, which suggests unmated females could produce male offspring (arrhenotoky. Thus, unmated females could disseminate to a new host and initiate an infestation by producing and mating with sons (oedipal mating. Methods We used small capsules to isolate and recover NFM on host chickens. Mites in capsules could blood feed, develop and reproduce, but could not contact other mites. Individual larvae were matured in isolation to produce known, unmated females. We evaluated reproduction of (I previously mated females (i in isolation, or (ii paired with a male, and (II unmated (virgin females in isolation. In each treatment we recorded the number and sexes of offspring produced over time. Results Mated NFM produced female and male offspring in isolation, or when paired with a male. When paired with a male, females produced a female-biased sex ratio of the offspring (F:M ratio ~5:1. Unmated, female NFM produced exclusively male offspring when in isolation. When paired with their sons that had developed to maturity, the "virgin" females were able to mate and subsequently produce female offspring. Conclusions This study found that females with immediate access to sperm produced mostly female offspring. Virgin female NFM initially produced only male offspring and subsequently used oedipal mating to produce female offspring. Using this reproductive system NFM could successfully colonize new hosts as immature, or unmated females. The strong female-biased sex ratio of NFM populations suggests a large proportion of the parasite population is capable of disseminating to new hosts, which is essential for an obligate parasite to persist.

  2. Morphometric analyses reveal synonymy of two monotypic genera, Huangiella and Tumoris (Acari, Eriophyoidea, Eriophyidae

    Directory of Open Access Journals (Sweden)

    Kun-Wei Huang

    2011-06-01

    Full Text Available Morphological variation of Huangiella lanyuensis (Huang, 2001 and Tumoris sanasaii Huang, 2001 from Taiwan was analyzed using multivariate statistical methods. We show that these species are the same and propose to use the name Tumoris sanasaii. No significant differences between populations from Lanyu and Green Island (type localities for H. lanyuensis and T. sanasaii, respectively were found; however, mites from Yangmingshan (northern Taiwan differed substantially from these two groups. Synonymy resulted from our study is as follows: Huangiella Kammerer, 2006 is a junior synonym of Tumoris Huang, 2001; Absentia lanyuensis Huang, 2001 is a junior synonym of Tumoris sanasaii Huang, 2001. We also study the sexual variation of populations from Green Island. The result showed the females significantly larger than the males at 17 variables.

  3. Sociodemographic characteristics and risk factor analysis of Demodex infestation (Acari: Demodicidae)

    Institute of Scientific and Technical Information of China (English)

    Ya-e ZHAO; Na GUO; Meng XUN; Ji-ru XU; Mei WANG; Duo-lao WANG

    2011-01-01

    To identify sociodemographic characteristics and risk factor of Demodex infestation,756 students aged 13-22 years in Xi'an,China were sampled for the school-based cross-sectional study.Demodex was examined using the cellophane tape method (CTP).The results showed that the total detection rate of Demodex was 67.6%.Logistic regression analysis revealed that five variables (gender,residence,sharing sanitary ware,frequency of face-wash per day,and use of facial cleanser) were found to be uncorrelated with Demodex infestation,whereas three variables (age,skin type,and skin disease) were found to be independent correlates.Students aged over 18 years had 22.1 times higher odds of Demodex infestation compared to those under 16 years and students aged 16-18 years also had 2.1 times higher odds compared to those aged 13-15 years.Odds of having a Demodex infestation for oily or mixed skin were 2.1 times those for dry or neutral skin.Students with a facial skin disease had 3.0 times higher odds of being infested with Demodex compared to those without.The inception rate of students with facial dermatoses increased in parallel with increasing mite count.The inception rates were 21.3%,40.7%,59.2%,and 67.7% in the negative,mild,moderate,and severe infestation groups,respectively (X2=60.6,P<0.001).Specifically,the amount of infested mites and inception rate of acne vulgaris were positively correlated (R2=0.57,moderate infestation odds ratio (OR)=7.1,severe infestation OR=10.3).It was concluded that Demodex prevalence increases with age,and Demodex presents in nearly all adult human.Sebaceous hyperplasia with oily or mixed skin seems to favour Demodex proliferation.Demodex infestation could be associated with acne vulgaris.The CTP is a good sampling method for studies of Demodex prevalence.

  4. Polymorphism of Beauveria bassiana (Deuteromycota: Hyphomycetes) strains isolated from Ixodes ricinus (Acari: Ixodidae) in Moldova.

    Science.gov (United States)

    Mitina, G V; Tokarev, Y S; Movila, A A; Yli-Mattila, T

    2011-03-01

    Polymorphism of 10 Beauveria bassiana strains, isolated from Ixodes ricinus in Moldova, was evaluated using traditional (morphological and cultural properties) and molecular (RAPD patterns and ITS sequences) methods. The isolates differed greatly in morphological and cultural features, such as color, consistence, and growth rate. Four RAPD-PCR markers were used to evaluate genetic diversity of the strains. Phylogenetic neighbor-joining analysis of RAPD patterns divided strains into 3 major clades. The ITS sequences of 8 strains were identical to those of known B. bassiana strains. Two subsets (1 and 2) different by one nucleotide change were found in the ITS1 region. One strain of subset 1 was different from known B. bassiana strains by possessing 2 point mutations in the ITS region. RAPD-based clustering correlated to ITS sequence and colony morphology-based grouping of the strains.

  5. Molecular Diagnosis of Ehrlichia canis in Dogs and Ticks Rhipicephalus sanguineus (Acari: Ixodidae) in Yucatan, Mexico.

    Science.gov (United States)

    Pat-Nah, Henry; Rodriguez-Vivas, Roger Ivan; Bolio-Gonzalez, Manuel Emilio; Villegas-Perez, Sandra Luz; Reyes-Novelo, Enrique

    2015-01-01

    Ehrlichia canis is the etiological agent behind canine monocytic ehrlichiosis, and the tick Rhipicephalus sanguineus (Latreille) is its main vector. Blood smear and nested polymerase chain reaction (PCR) techniques were used to identify E. canis infection in dogs and R. sanguineus, and explore factors possibly associated with infection in dogs in Yucatan, Mexico. Blood samples were taken and ticks R. sanguineus collected from 50 dogs (10 house dogs and 40 in an animal control center). Data were collected on dog age, sex, body condition, and signs associated with platelet deficiencies (epistaxis). Blood smears were analyzed to identify E. canis morulae and generate platelet counts. Nested PCR analysis was done on blood samples and 200 ticks. A χ(2) test was done to identify factors associated with the E. canis infection in the tested dogs. The overall prevalence for infection, as determined by PCR, was 36% (18 out of 50). All positive dogs were from samples collected from the animal shelter, representing prevalence, for this sampling site, of 45% (18 out of 40). Morulae in monocytes were identified in only 4% of samples. Dog origin (i.e. animal control center) was the only variable associated with E. canis infection (P canis infection is present in both dogs and the brown dog ticks R. sanguineus in Yucatan, Mexico.

  6. Does Aponomma varanensis (Acari: Ixodida: Ixodidae) occur on the Taiwanese mainland?

    Science.gov (United States)

    Robbins, R G

    1996-08-01

    On 15 July 1976, teams from the U.S. Naval Medical Research Unit No. 2, Taipei, Taiwan, made 3 collections of ticks from beneath the dorsal scales of the Taiwan stink snake, Elaphe carinata, at Makung in the Penghu Islands, which lie astride the Tropic of Cancer in the Taiwan Strait between southern mainland China and Taiwan proper. These ticks were later determined to be Aponomma varanensis (Supino, 1897), but this discovery was never published, and no member of the genus Aponomma has heretofore been reported from Taiwan or any of its outlying islets. Because suitable hosts, including E. carinata, are abundant on Taiwan and because A. varanensis is widely distributed in tropical Asia, it is argued that this or a related species of Aponomma will one day be found on the Taiwanese mainland.

  7. Ticks (Acari: Ixodidae on wild animals from the Porto-Primavera Hydroelectric power station area, Brazil

    Directory of Open Access Journals (Sweden)

    Marcelo B Labruna

    2002-12-01

    Full Text Available From June 2000 to June 2001, a total of 741 ticks were collected from 51 free-living wild animals captured at the Porto-Primavera Hydroelectric power station area, located alongside an approximately 180 km course of the Paraná river, between the states of São Paulo and Mato Grosso do Sul, comprising 9 species of 3 genera: Ambly-omma (7 species, Boophilus (1 and Anocentor (1. A total of 421 immature Amblyomma ticks were reared in laboratory until the adult stage, allowing identification of the species. A. cajennense was the most frequent tick species (mostly immature stages collected on 9 host species: Myrmecophaga tridactyla, Tamandua tetradactyla,Cerdocyon thous, Puma concolor,Tayassu tajacu, Mazama gouazoubira,Hydrochaeris hydrochaeris,Alouatta caraya, Cebus apella. Other tick species were less common, generally restricted to certain host taxa.

  8. Efficacy of granular deltamethrin against Ixodes scapularis and Amblyomma americanum (Acari: Ixodidade) nymphs.

    Science.gov (United States)

    Schulze, T L; Jordan, R A; Hung, R W; Taylor, R C; Markowski, D; Chomsky, M S

    2001-03-01

    A single barrier application of granular deltamethrin to the woodland edges of a forested residential community in late spring significantly reduced the abundance of Ixodes scapularis Say nymphs. The application also suppressed the population of Amblyomma americanum (L.) nymphs, which recently became established in the study area. The efficacy of deltamethrin is compared with other commonly used acaricides.

  9. Analyses of hemolymph from Amblyomma cajennense (Acari: ixodidae) using neutron activation analysis (NAA)

    Energy Technology Data Exchange (ETDEWEB)

    Simons, Simone M.; Oliveira, Daniella G.L.; Chudzinski-Tavassi, Ana M., E-mail: daniellaoliveira@butantan.gov.b, E-mail: amchudzinki@butantan.gov.b [Instituto Butantan, Sao Paulo, SP (Brazil); Zamboni, Cibele B., E-mail: czamboni@ipen.b [Instituto de Pesquisas Energeticas e Nucleares (IPEN/CNEN-SP), Sao Paulo, SP (Brazil)

    2011-07-01

    Instrumental neutron activation analysis technique (INAA) was applied to determine the elemental composition of hemolymph from Amblyomma cajennense tick. This biological material came from Butantan Institute (Sao Paulo city, Brazil) and it was investigated using the IEA-R1 nuclear reactor (4MW, pool type) at IPEN/CNEN-SP - Brazil. The concentration values for: Br (0.0032 {+-} 0.0005gL{sup -1}), Ca (0.104 {+-} 0.029gL{sup -1}), Cl (4.41 {+-} 0.25gL{sup -1}), I (76 {+-} 27{mu}gL{sup -1}), K (0.38 {+-} 0.09gL{sup -1}), Mg (0.038 {+-} 0.011gL{sup -1}), Na (4.30 {+-} 0.26gL{sup -1}) and S (1.35 {+-} 0.37gL{sup -1}) were determined for the first time. These data were compared with the concentration values established for Americanum and Anatolicum Excavatum tick species to clarify the ion balance in this biological material (hemolymph). This comparison suggests that Na concentration, majority in these species, has a similar behavior. These data also contribute to the understanding of hemolymph composition complementing its characterization as well as for the understanding of several physiological processes, especially those related to salivary secretion. (author)

  10. Mites (Arachnida: Acari) inhabiting coffee domatia: a short review and recent findings from Costa Rica.

    Science.gov (United States)

    Six previously unreported domatia-inhabiting mites are reported from Coffea arabica accessions planted in Costa Rica. One of these is a new species of Asca found to be carrying fungal spores on its cuticle. A review of the literature on mites in coffee domatia is presented....

  11. A novel fluid-feeding mechanism for microbivory in the Acariformes (Arachnida: Acari).

    Science.gov (United States)

    Bolton, Samuel J; Bauchan, Gary R; Ochoa, Ronald; Klompen, Hans

    2015-07-01

    Low temperature scanning electron microscopy (LT-SEM) has revealed anatomical details suggesting that Osperalycus and Gordialycus (Acariformes: Nematalycidae) have an unusual feeding apparatus that is hypothesized to be specialized for feeding on the fluid contents of small microorganisms (diameter<5 μm). Both mite genera have a feeding strategy that appears to involve picking up small microorganisms and placing them onto the subcapitulum for puncturing. However, they have slightly different variants of the same basic rupturing mechanism. Whereas Gordialycus has evolved expansive and convergent rutella to hold the microorganisms in place while pushing chelicerae into them, Osperalycus has evolved a pouch into which a microorganism is inserted. The rutella reinforce this pouch while the chelicerae break up the microorganism. Both types of mouthpart apparatus seem to be adapted to minimize waste, an appropriate specialization given the organically impoverished habitats in which these mites live.

  12. Mitotic and meiotic chromosomes of a southern Brazilian population of Boophilus microplus (Acari, Ixodidae

    Directory of Open Access Journals (Sweden)

    Rosane Nunes Garcia

    Full Text Available Using conventional staining with acetic orcein and C-banding techniques it was investigated constitutive heterochromatin chromosomal polymorphisms and the mitotic and the meiotic behavior of male and female chromosomes of Boophilus microplus (Canestrini, 1887. Some differences were detected in the population of southern Brazil as compared to the data of other authors for populations in other latitudes. The differences being mainly concerned with the distribution of constitutive centromeric heterochromatin and variation in the length of heterochromatic blocks in the pericentromeric regions of some chromosome pairs.

  13. [Interrelatio of acari Ixodidae and hosts of Edentata of the Serra da Canastra, Minas Gerais, Brazil].

    Science.gov (United States)

    Botelho, J R; Linardi, P M; da Encarnação, C D

    1989-01-01

    We received for examination a small colection of ticks captured in the National Park of the Serra da Canastra (MG), between 1979 and 1980. The authors demonstrated the existence of a broad co-accomodation of Amblyomma pseudoconcolor on Edentata of the family Dasypodidae, being Dasypodini the tribe more adjusted to this infestation. In conformity to the Figs 1 and 2, Dasypodini are probably the real hosts of A. pseudoconcolor and also the oldest hosts. For the first time, A. pseudoconcolor is also recorded on Cabassous tatouay, C. unicinctus, Priodontes maximus and Euphractus sexcincuts. Also for the first time A. pseudoconcolor and Amblyomma calcaratum were recorded in the State of Minas Gerais. The ectoparasites are deposited in the "Departamento de Parasitologia da Universidade Federal de Minas Gerais, Brasil".

  14. Effects of agroforestry on phytoseiid mite communities (Acari: Phytoseiidae) in vineyards in the South of France.

    Science.gov (United States)

    Barbar, Ziad; Tixier, Marie-Stéphane; Cheval, Brigitte; Kreiter, Serge

    2006-01-01

    The abundance and diversity of phytoseiid mites were surveyed from April to September 2003 to 2005 in vineyards (Grenache and Syrah cultivars) co-planted with rows of Sorbus domestica or Pinus pinea and in monoculture plots of grapes in the South of France. Densities of phytoseiid mites were different on the two tree species, with P. pinea a more suitable host than S. domestica. Typhlodromus (Typhlodromus) exhilaratus was the dominant species occurring on grapes and on co-planted rows of S. domestica and P. pinea, whereas T. (T.) phialatus was the most abundant species in monoculture plots of both S. domestica and P. pinea. Factors determining the dominance of T. (T.) phialatus over T. (T.) exhilaratus in monoculture trees are discussed. In this study, agroforestry management did not affect phytoseiid diversity in vineyards, but did affect phytoseiid density, especially in 2005. The results obtained in 2003 and 2004 are not easy to discuss in this regard because of the low densities of mites observed during these 2 years (very dry climatic conditions and pesticide applications).

  15. Repellent activity of plant-derived compounds against Amblyomma cajennense (Acari: Ixodidae) nymphs.

    Science.gov (United States)

    Soares, Sara Fernandes; Borges, Lígia Miranda Ferreira; de Sousa Braga, Raquel; Ferreira, Lorena Lopes; Louly, Carla Cristina Braz; Tresvenzol, Leonice Manrique Faustino; de Paula, José Realino; Ferri, Pedro Henrique

    2010-01-20

    Repellence responses of Amblyomma cajennense nymphs to callicarpenal, intermedeol, Hyptis suaveolens essential oil, extract of Melia azedarach, Cymbopogon nardus, Spiranthera odoratissima, Chenopodium ambrosioides, Ageratum conyzoides, Mentha pulegium, Ruta graveolens, and Memora nodosa were studied. Among these the extract of C. nardus stood out because of the long-lasting repellence, maintaining, in the highest concentration, 35h of protection against 90% of the nymphs. The essential oil of H. suaveolens and the extracts of C. ambrosioides and A. conyzoides showed good repellence index (66%) when applied in high concentrations. However, greater protection could be obtained at higher concentrations but with a shorter repellence time. Callicarpenal, intermedeol, extract of M. Pulegium, and M. nodosa leaves showed moderate repellence in high concentrations. Extracts from M. azedarach, R. graveolens, S. odoratissima, and M. nodosa roots showed little or no repellent effect. These results show that some plant extracts may represent a promising alternative in the control of infestations by A. cajennense. Copyright 2009 Elsevier B.V. All rights reserved.

  16. New record, host and localities of bat mite of genusChirnyssoides (Acari, Sarcoptiformes, Sarcoptidae

    Directory of Open Access Journals (Sweden)

    Elizabete Captivo Lourenço

    Full Text Available Chirnyssoides parasitizes the anterior and posterior edges of bat wing membranes. Possibly due to a lack of studies, its distribution is believed to be restricted to a few countries of Central and South America, but its actual range is probably wider. The purpose of this paper is to report the presence of Chirnyssoides amazonae on the bat Carollia perspicillata in the state of Rio de Janeiro, Brazil, and to present a checklist of hosts and localities for Chirnyssoides. Eleven females and 22 egg clusters of C. amazonae were collected from 11 individuals of C. perspicillata captured in Tinguá Biological Reserve using mist nets. Our search of the literature came up with 69 records of Chirnyssoides. There are reports ofChirnyssoides caparti, Chirnyssoides amazonae, Chirnyssoides brasiliensis andChirnyssoides phyllostomus in Brazil. This paper reports the first record of Chirnyssoides amazonae in the state of Rio de Janeiro and the second in Brazil, indicating that their known distribution extends to the south. There are records of C. amazonae andC. surinamensis parasitizing C. perspicillata, but this is the first record of C. amazonae on C. perspicillata in Brazil.

  17. The First Report of Eustigmaeus Johnstoni (Acari: Stigmaeidae Parasitic Mite of Phlebotominae Sand Flies from Iran

    Directory of Open Access Journals (Sweden)

    Mehdi Badakhshan

    2013-03-01

    Full Text Available Background: Stigmaeids mites have been recorded only on Phlebotominae sand flies up to now. Five species of Eustigmaeus, and three of Stigmaeus were reported on infested sandflies in different country up to the present.Methods: Sand flies collection was done using CDC light trap and sticky paper. The mites were isolated from in­fested specimens, mounted in Puri’s medium and identified using reliable keys.Results: A mite infested Phlebotomus papatasi was observed during a study on sandflies of one of the southern provinces of Iran, near to the Persian Gulf. Several scars resulting from mite attachment were found on abdominal tergites of this female sand fly. The mites were identified as Eustigmaeus johnstoni.Conclusion: This parasitic mite is one of the eyeless species, which has a great distribution over the world, reported from Tunisia, Saudi Arabia, Pakistan, Yemen, Cyprus and Palestine. But, this is the first record of this species from Iran.

  18. Amblyomma auricularium (Acari: Ixodidae: underwater survival of the non-parasitic phase of feeding females

    Directory of Open Access Journals (Sweden)

    Iwine Joyce Barbosa de Sá-Hungaro

    Full Text Available To determine the effects of immersion in water on the biological parameters of engorged females of the tick species Amblyomma auricularium, 60 females were distributed in six groups, each comprising 10 individuals. The control group – G1 (not immersed was fixed dorsally in a Petri dish and incubated at 27 ± 1°C and 80% RH. The other groups were subjected to immersion periods of 24, 48, 72 and 96 hours, and the sixth group to continuous immersion. After the immersion period, the females were placed in Petri dishes to begin laying. Eggs were collected every 72 hours and kept in biological chambers. All the groups showed significant differences (p <0.05 during the pre-oviposition period. The laying period and the average weight of overall posture did not change. The egg incubation period also did not differ significantly, but the hatching rate in the group immersed for 96h showed a significant difference. Thus, immersion for up to 96 hours does not impair the survival of A. auricularium females, although it may delay egg laying and reduce the number of offspring.

  19. Diversity and population dynamics of Ascidae, Blattisociidae and Melicharidae (Acari: Mesostigmata) in tropical flowers in Brazil.

    Science.gov (United States)

    Britto, Erika Pessoa Japhyassu; Finotti, Amanda Silva; de Moraes, Gilberto José

    2015-06-01

    Cultivation of tropical flowers has expanded considerably in Brazil, justifying efforts to determine the arthropods associated with it. Heliconia species are some of the most important tropical flowers in Brazil. Mites of the families Ascidae, Blattisociidae and Melicharidae are commonly found on those plants. They disperse from flower to flower on hummingbirds. The objective of this study was to identify the diversity of mites of this group in tropical flowers, with emphasis on Heliconia species, in Brazil and to determine the fluctuation of the population of these mites in Piracicaba, Sao Paulo state. Specimens from Amazonas, Bahia, Pernambuco, Minas Gerais, Rio de Janeiro, Santa Catarina and São Paulo States were examined. Mites of the genera Asca and Iphidozercon (Ascidae), Cheiroseius and Lasioseius (Blattisociidae), and Proctolaelaps and Tropicoseius (Melicharidae) were collected in flowers of four plant families, with Lasioseius being the most diverse genus. Overall, most specimens found belonged to Tropicoseius, especially Tropicoseius venezuelensis Baker & Yunker; this was the dominant species on five of 13 Heliconia species/hybrids considered in this study. Samples of panicles of Heliconia rostrata Ruiz & Pavón were collected every 2 weeks, in Piracicaba. Six species of those mite families were found, among which Tropicoseius heliconiae Baker & Yunker and T. venezuelensis were the most numerous. The highest population levels of mites of those three families occurred at the beginning and at the end of the year, coinciding with the highest levels of rainfall, relative humidity and temperature, when plant flowers were most numerous and vigorous. Along each panicle, the highest mite densities were found in inflorescences of the three distal eighths of the panicles, where nectar and pollen were probably most abundant.

  20. Life cycle of Raoiella indica (Acari: Tenuipalpidae) on ornamental plants, mostly Arecaceae.

    Science.gov (United States)

    Vásquez, C; Colmenárez, Y; de Moraes, G J

    2015-02-01

    The red palm mite, Raoiella indica Hirst, has been primarily found associated with coconut and musaceous plants in the New World. However, it has also been recorded on several other palms, heliconiaceous and zingiberaceous species. This study was conducted to evaluate the suitability of different botanical families on which R. indica has been collected in the field and of arecaceous plants of the natural vegetation of the neotropics. In total, ten species of Arecaceae as well as Heliconia psittacorum [Heliconiaceae] and Alpinia purpurata [Zingiberacae] were evaluated, using coconut as a control. The study was carried out under controlled conditions (29 ± 0.5 °C, 60 ± 10% RH and photoperiod 12 h of light). Raoiella indica was able to complete immature development only on coconut, Adonidia merrillii, Ptychosperma macarthurii, H. psittacorum and A. purpurata. Duration of the immature phase (egg-adult) ranged between 21.5 days on coconut to 34.1 days on A. purpurata. Longevity was at least 50% greater and oviposition at least 38% higher on coconut than on other plants. Intrinsic rate of increase (rm) was higher on coconut (0.166) and A. merrillii (0.042), but negative on the other two plant species. Raoiella indica could not reach adulthood on any of the other ten arecaceous species considered in the study. The results suggested R. indica to be a threat to A. merrillii in addition to coconut, but not to other evaluated plants. However, complementary studies should be conducted to investigate whether the experimental procedures adopted in this study could not have prevented the mite from a better performance than it could have been under field conditions, especially in relation to Mauritia flexuosa, one of the dominant arecaceous plants in South America.

  1. Acquisition of Borrelia burgdorferi infection by larval Ixodes scapularis (Acari: Ixodidae) associated with engorgement measures

    Science.gov (United States)

    Couret, Janelle; Dyer, M.C.; Mather, T.N.; Han, S.; Tsao, J.I.; LeBrun, R.A.; Ginsberg, Howard

    2017-01-01

    Measuring rates of acquisition of the Lyme disease pathogen, Borrelia burgdorferi sensu lato Johnson, Schmid, Hyde, Steigerwalt & Brenner, by the larval stage of Ixodes scapularis Say is a useful tool for xenodiagnoses of B. burgdorferi in vertebrate hosts. In the nymphal and adult stages of I. scapularis, the duration of attachment to hosts has been shown to predict both body engorgement during blood feeding and the timing of infection with B. burgdorferi. However, these relationships have not been established for the larval stage of I. scapularis. We sought to establish the relationship between body size during engorgement of larval I. scapularis placed on B. burgdorferi-infected, white-footed mice (Peromyscus leucopus Rafinesque) and the presence or absence of infection in larvae sampled from hosts over time. Body size, time, and their interaction were the best predictors of larval infection with B. burgdorferi. We found that infected larvae showed significantly greater engorgement than uninfected larvae as early as 24 h after placement on a host. These findings may suggest that infection with B. burgdorferi affects the larval feeding process. Alternatively, larvae that engorge more rapidly on hosts may acquire infections faster. Knowledge of these relationships can be applied to improve effective xenodiagnosis of B. burgdorferi in white-footed mice. Further, these findings shed light on vector–pathogen–host interactions during an understudied part of the Lyme disease transmission cycle.

  2. Two new species of Neoribates (Neoribates Berlese, 1914 from China (Acari, Oribatida, Parakalummidae

    Directory of Open Access Journals (Sweden)

    Liang, W.Q.

    2013-06-01

    Full Text Available Two new oribatid mite species, Neoribates (N. cheni and Neoribates (N. particula spp. nov. are described from soil and litter of bamboo and under moss from China. Neoribates (N. cheni sp. nov. is morphologically most similar to Neoribates (N. spindleformis Ermilov, 2012 but differs from it in the number of leg claws and the position of epimeral setae. Neoribates (N. particula sp. nov. is morphologically most similar to Neoribates (N. gracilis Travé, 1972 but differs from it in the shape and size of rostral and lamellar setae, and the position of adanal setae ad3.

  3. Mite species of Mesostigmata order (Arachnida, Acari in industrial and postindustrial areas of Poland

    Directory of Open Access Journals (Sweden)

    Maciej Skorupski

    2013-03-01

    Full Text Available Industrial and postindustrial sites are effects of human activity that creates new habitats for many species. Among others, these sites are well occupied by mites of the order Mesostigmata. Because these animals have rather low tolerance to changes in soil environment, they are generally highly abundant, taxonomically and trophically diversified, they may potentially be used as powerful bioindicators and their presence or absence in the upper soil horizons may be a good base for describing changes of environmental conditions and ecosystem perturbations. In the paper we listed the most common mites from the order Mesostigmata (80 species found in Poland and we also described the environmental conditions they occupy. In Poland, most of these species were found by scientists from two research centers: University of Technology and Life Sciences with University of Kazimierz Wielki in Bydgoszcz and University of Silesia in Katowice. Most of the species found are very common, however some of them may be used to evaluate the effects of human influence on the environment, not only at the species level but also the zoocenosis level.

  4. Oribatid mites (Acari, Oribatida - bioindicators of forest soils pollution with heavy metals and fluorine

    Directory of Open Access Journals (Sweden)

    Otilia Ivan

    2009-12-01

    Full Text Available The present study analyzes the effects of pollution with heavy metals and fluorine on the oribatid mite communities populating the forest soils, on the basis of the researches carried on in three oak-type forests, situated at different distances from the Phosphoric Fertilizers Plant of Valea Călugărească (the Prahova county, Romania. In the forest strongly affected by pollution, the heavy metals concentrations were 2-9 times higher than the maximum allowable limits (MAL. In the perimeter with medium level of pollution, the content of Pb, Cr and Ni were over the MAL, while Co and Cd concentrations are closed to these limits. Two years after closing of this industrial unit, a decrease of soil loading with heavy metals was to be found, mostly in the surface sub-horizon. In the control perimeter, the oribatids constitute a complex community with a large specific diversity. The characteristic species for this zone (South-Eastern of Romania are frequent and/or abundant, having a high ecological significance. In the affected forests, the oribatid mites' densities are 6-476 times lower than in the control perimeter. Their communities are constituted of a small number of tolerant species (euryplastic, unspecific fauna, being characterized by a low specific diversity and a marked structural instability. The analysis of the oribatid species distribution in the control and polluted ecosystems has evidenced that certain elements can be considered bioindicators for this type of pollution. Our researches carried out two years after the production stopping, have not evidenced a favourable evolution of the oribatid mites communities. It is probably that the recovery of the decomposers' trophic chains requires a longer time.

  5. Three new species of eriophyoid mites (Acari, Eriophyoidea from Xinjiang Uygur Autonomous Region, China

    Directory of Open Access Journals (Sweden)

    Ji Li

    2015-06-01

    Full Text Available Three new species of eriophyoid mites from Xinjiang Uygur Autonomous Region, China, are described and illustrated. They are Paracolomerus gonglius sp. n. and Phyllocoptruta beggerianae sp. n. collected on Rosa beggeriana Schrenk ex Fisch. & C. A. Mey. (Rosaceae, and Rhyncaphytoptus fuyuniensis sp. n. collected on Cotoneaster ignavus E. L. Wolf (Rosaceae. All eriophyoid mites described here are vagrants on the undersurface of leaves and any apparent damage was not observed.

  6. Raillietia caprae (Acari: Raillietidae and Psoroptes ovis (Acari: Psoroptidae in the ears of goats in the state of Rio de Janeiro, Southeast Brazil Raillietia caprae (Acari: Raillietidae e Psoroptes ovis (Acari: Psoroptidae nos condutos auditivos de caprinos no Estado do Rio de Janeiro, Brasil

    Directory of Open Access Journals (Sweden)

    João Luiz H. Faccini

    2008-03-01

    Full Text Available Ear cannals of 145 domestic goats including the breeds Saanen, Toggenburg, Anglobian, Alpine, Moxoto (native and crossbred goats from 10 smallholder farms were examined by flushing for the presence of ear mites. Prevalence of Raillietia caprae Quintero, Bassols and Acevedo, 1980 was much more higher than Psoroptes ovis (Hering, 1838 in the studied area, respectively 62% ( 90/145 and 4% ( 6/145. The youngest animal parasitized was eight months old and the oldest was 10 years old. Subclinical otitis is a common feature of infestation by both species but increase of wax and the presence of pus were detected in the flushed material in approximately 10% of the goats examined.Os condutos auditivos de 145 caprinos das raças Saanen, Toggenburg, Anglobian, Alpine, Moxoto (native e mestiços provenientes de 10 pequenos criadores foram examinados pela técnica de lavagem para diagnosticar a infestação por ácaros. A prevalência de Raillietia caprae Quintero, Bassols and Acevedo, 1980 foi muito mais alta do que Psoroptes ovis (Hering, 1838 - 62% (90/145 e 4% (6/145, respectivamente. O animal parasitado mais jovem tinha oito meses de idade e o mais velho 10 anos. Otite subclínica é comum nas infestações por ambas espécies mas aumento de cerume e presença de pus foram diagnosticados no material da lavagem em aproximadamente 10% dos caprinos examinados.

  7. Two neuropeptides from synganglia of the hard tick,Ixodes sinensis (Acari:Ixodidae)

    Institute of Scientific and Technical Information of China (English)

    LI Jianxu; LIU Tongguang; YANG Hailong; XU Xueqing; LIU Zhigang; LAI Ren

    2006-01-01

    Two neuropeptides were isolated from synganglia (central nervous system) of the hard tick,Ixodes sinensis. Their primary sequences were established as Leu-VaI-VaI-Tyr-Pro-Trp-Thr-Lys and TrpGlu-Lys-Leu-Gly-Ser-Met-Glu-Thr-Leu. By hot plate bioassay, neuropeptide a displayed strong antinociceptive effect in mice by a dose-dependent behavior, while neuropeptide b had some relaxant effects on the isolated rat strip. These neuropeptides might be involved in down-regulating the host's defensive reaction.

  8. Pathogenicity of Metarhizium anisopliae (Deuteromycetes) and permethrin to Ixodes scapularis (Acari: Ixodidae) nymphs

    Science.gov (United States)

    Hornbostel, V.L.; Zhioua, Elyes; Benjamin, Michael A.; Ginsberg, Howard S.; Ostfeld, Richard S.

    2005-01-01

    Effectiveness of the entomopathogenic fungus Metarhizium anisopliae, for controlling nymphal Ixodes scapularis, was tested in laboratory and field trials. In the laboratory, M. anisopliae (Metschnikoff) Sorokin strain ESC1 was moderately pathogenic, with an LC50 of 107 spores/ml and induced 70% mortality at 109 spores/ml. In a field study, however, 109 spores/ml M. anisopliae did not effectively control questing I. scapularis nymphs, and significant differences were not detected in pre- and post-treatment densities. For nymphs collected and returned to the laboratory for observation, mortality was low in treatment groups, ranging from 20 to 36%. To assess whether a chemical acaricide would synergistically enhance pathogenicity of the fungus, we challenged unfed nymphal I. scapularis with combinations of M. anisopliae and permethrin, a relatively safe pyrethroid acaricide, in two separate bioassays. Significant interactions between M. anisopliae and permethrin were not observed, supporting neither synergism nor antagonism.

  9. Pathogenicity of entomopathogenic fungus Metarhizium anisopliae (Deuteromycetes) to Ixodes scapularis (Acari: Ixodidae)

    Science.gov (United States)

    Zhioua, E.; Browning, M.; Johnson, P.W.; Ginsberg, H.S.; LeBrun, R.A.

    1997-01-01

    The entomopathogenic fungus Metarhizium anisopliae is highly pathogenic to the black-legged tick, Ixodes scapularis. Spore concentrations of 108/ml for engorged larvae and 107/ml for engorged females resulted in 100% tick mortality, 2 wk post-infection. The LC50 value for engorged larvae (concentration to kill 50% of ticks) was 107 spores/ml. Metarhizium anisopliae shows considerable potential as a microbial control agent for the management of Ixodes scapularis.

  10. Resource availability as driving factor of the reproductive mode in soil microarthropods (Acari, Oribatida.

    Directory of Open Access Journals (Sweden)

    Katja Wehner

    Full Text Available The availability of high quality resources is an important factor driving community structure and reproductive mode of animals. Parthenogenetic reproduction prevails when resources are available in excess, whereas sexuality correlates with resource shortage. We investigated the effect of resource availability on the community structure of oribatid mites in a laboratory experiment. Availability of food resources was increased by addition of glucose to leaf litter and reduced by leaching of nutrients from leaf litter. Experimental systems were incubated at three different temperatures to establish different regimes of resource exploitation. Community structure of oribatids and numbers of eggs per female were measured over a period of ten months. We expected the density of oribatid mites to decline in the reduced litter quality treatment but to increase in the glucose treatment. Both effects were assumed to be more pronounced at higher temperatures. We hypothesized sexual species to be less affected than parthenogenetic species by reduced resource quality due to higher genetic diversity allowing more efficient exploitation of limited resources, but to be outnumbered by parthenogenetic species in case of resource addition due to faster reproduction. In contrast to our hypotheses, both sexual and parthenogenetic oribatid mite species responded similarly with their densities declining uniformly during incubation. The parthenogenetic Brachychthoniidae and Tectocepheus dominated early in the experiment but were replaced later by parthenogenetic Desmonomata and Rhysotritia. In parthenogenetic species the number of eggs per female increased during the experiment while the number of eggs in sexual females remained constant or decreased slightly; in general, egg numbers were higher in sexual than in parthenogenetic species. The results indicate that for sustaining oribatid mite populations other resources than litter and associated saprotrophic microorganisms are needed. They also indicate that there are two groups of parthenogenetically reproducing species: exploiters of easily available resources and consumers of leaf litter associated resources.

  11. Developmental biology of Argas neghmei Kohls & Hoogstraal (Acari: Argasidae) under laboratory conditions.

    Science.gov (United States)

    González-Acuña, Daniel; Vargas, Pamela; Ardiles, Karen; Parra, Luis; Guglielmone, Alberto

    2010-01-01

    In order to describe the developmental biology of the tick Argas neghmei Kohls & Hoogstraal under laboratory conditions, 40 females and 40 males were collected from chicken coops located in Calama (II Region, Chile). They were fed on chickens and maintained under two laboratory conditions: one group at 30 +/- 5 degrees C and 35 +/- 5 % RH and another at 27 +/- 5 degrees C and 80 +/- 5 % RH, both at 12: 12 h L:D photoperiod. The ticks were observed daily to determine larval feeding periods, preoviposition, oviposition, egg incubation as well as the frequency of egg laying, number of eggs laid, and percentage of larval hatching. Females did not lay eggs at 80 +/- 5% RH, and data on the biology of this tick was obtained only at 35 +/- 5% RH. The life cycle of A. neghmei lasted an average of 269 days. Feeding period of each nymphal stage as well as of adult females between oviposition events lasted less than a day. Females laid on average 1.8 egg batches and egg-laying period lasted on average 14 days, during which about 96 eggs were laid per female.

  12. An overview of Suctorian ciliates (Ciliophora, Suctorea) as epibionts of halacarid mites (Acari, Halacaridae)

    Digital Repository Service at National Institute of Oceanography (India)

    Dovgal, I.; Chatterjee, T.; Ingole, B.S.

    stream_size 29354 stream_content_type text/plain stream_name Zootaxa_1810_60.pdf.txt stream_source_info Zootaxa_1810_60.pdf.txt Content-Encoding UTF-8 Content-Type text/plain; charset=UTF-8 Accepted by A. Wright: 16 Apr... coast. Key words: Ciliophora, Suctorea, Halacaridae, epibionts Introduction Representatives of several groups of freshwater and marine aquatic mites have been identified as hosts of suc- torian ciliates (Suctorea) (Precht 1935; Matthes 1956; Matthes...

  13. Dissorhina cretensis n. sp. and some other remarkable oribatid mites (Acari: Oribatida from Crete, Greece

    Directory of Open Access Journals (Sweden)

    Mahunka, S.

    2008-12-01

    Full Text Available Newly collected and identified oribatids from Crete are studied and a list of the hitherto known species is provided. Altogether 37 species are enumerated from several sites of the island, among them 23 newly identified. One species new to science, Dissorhina cretensis n. sp., is described and three known, but rare species – Chamobates dentotutorii Shaldybina, 1969, Ocesobates boedvarssoni (Sellnick, 1974 and Humerobates rostrolamellatus Grandjean, 1936 – are described and/or commented and illustrated.

  14. The Evolving Medical and Veterinary Importance of the Gulf Coast tick (Acari: Ixodidae).

    Science.gov (United States)

    Paddock, Christopher D; Goddard, Jerome

    2015-03-01

    Amblyomma maculatum Koch (the Gulf Coast tick) is a three-host, ixodid tick that is distributed throughout much of the southeastern and south-central United States, as well as several countries throughout Central and South America. A considerable amount of scientific literature followed the original description of A. maculatum in 1844; nonetheless, the Gulf Coast tick was not recognized as a vector of any known pathogen of animals or humans for >150 years. It is now identified as the principal vector of Hepatozoon americanum, the agent responsible for American canine hepatozoonosis, and Rickettsia parkeri, the cause of an emerging, eschar-associated spotted fever group rickettsiosis identified throughout much of the Western Hemisphere. Coincident with these discoveries has been recognition that the geographical distribution of A. maculatum in the United States is far more extensive than described 70 yr ago, supporting the idea that range and abundance of certain tick species, particularly those with diverse host preferences, are not fixed in time or space, and may change over relatively short intervals. Renewed interest in the Gulf Coast tick reinforces the notion that the perceived importance of a particular tick species to human or animal health can be relatively fluid, and may shift dramatically with changes in the distribution and abundance of the arthropod, its vertebrate hosts, or the microbial agents that transit among these organisms. Published by Oxford University Press on behalf of Entomological Society of America 2015. This work is written by US Government employees and is in the public domain in the US.

  15. Wild birds as hosts of Amblyomma cajennense (Fabricius, 1787 (Acari: Ixodidae

    Directory of Open Access Journals (Sweden)

    Rosario Rojas

    1999-05-01

    Full Text Available We evaluated the prevalence, mean intensity and relative density of ticks in 467 wild birds of 67 species (12 families from forest and cerrado habitats at two protected areas of Minas Gerais, between March and September 1997. Ticks collected (n=177 were identified as larvae and nymphs of Amblyomma cajennense and four other species of Amblyomma. We report for the first time 28 bird species as hosts of the immature stages of A. cajennense, demonstrating the lack of host specificity of the larvae and nymphs. A. cajennense had 15% prevalence on birds, with a mean infestation intensity of 0.37 ticks per host sampled, and 2.5 ticks per infested bird. Prevalence varied in relation to host species, diet and between birds from forests at two successional stages. There were no differences in relation to host forest dependence, participation in mixed flocks of birds, and nest type constructed. A. cajennense is a species of medical and veterinary importance, occurring on domestic animals but is known little of its occurrence on wildlife.

  16. Survey of birds and lizards for ixodid ticks (Acari) and spirochetal infection in northern California.

    Science.gov (United States)

    Manweiler, S A; Lane, R S; Block, W M; Morrison, M L

    1990-11-01

    A total of 138 birds (24 species) was captured in an oak woodland between December 1988 and June 1989 at the University of California, Sierra Foothill Range Field Station, Yuba County, Calif. Ticks were not found on 71 birds captured between December 1988 and March 1989. Five subadult Ixodes pacificus Cooley & Kohls were removed from 3 of 67 birds caught between April and June 1989. These three birds, an orange-crowned warbler (Vermivora celata (Say], a lazuli bunting (Passerina amoena (Say], and a chipping sparrow (Spizella passerina (Bechstein], represent new host records for I. pacificus in California. Tissues from two ticks and thick blood films prepared from 126 birds tested negative for spirochetes by direct immunofluorescence (DI). A total of 172 larval and 197 nymphal I. pacificus was removed from 15 of 16 western fence lizards (Sceloporus occidentalis Baird & Girard) caught between April and June 1989 in the same location as were birds. Thick blood films prepared from all 16 lizards and tissue smears from 334 of the ticks (143 larvae and 191 nymphs) were DI test-negative for spirochetes. One (1.1%) of 93 adult I. pacificus collected at the bird-lizard capture site in February 1989 was infected with spirochetes that resembled B. burgdorferi.

  17. Spring migratory birds (Aves) extend the northern occurrence of blacklegged tick (Acari:Ixodidae).

    Science.gov (United States)

    Klich, M; Lankester, M W; Wu, K W

    1996-07-01

    Birds that had migrated northward across Lake Superior were captured upon reaching landfall at Thunder Cape (48 degrees 18' N, 88 degrees 56' W) at the southwestern tip of the Sibley Peninsula, northwestern Ontario, from 9 May to 9 June 1995. Twenty-one of 530 birds examined (6 of 55 species) had a total of 34 ticks; 1 blue jay, Cyanocitta cristata, had a northern fowl mite, Ornithonyssus sylviarum (Canestrini & Fanzago). Four blacklegged tick, Ixodes scapularis Say, larvae were found on an American robin, Turdus migratorius, and 2 on a chipping sparrow, Spizella passerina. This tick was not found on small mammals at Thunder Cape. Twenty-six larvae and a nymph of the rabbit tick, Haemaphysalis leporispalustris (Packard) were found on 1 American robin, 2 Swainson's thrushes, Catharus ustulatus, 1 white-throated sparrow, Zonotrichia albicollis, 1 common yellowthroat, Geothlypis trichas, 1 blue jay, and 12 chipping sparrows. A nymph of H. chordeilis (Packard) occurred on 1 chipping sparrow. Results demonstrate that northward migrating birds transport larvae of I. scapularis to areas of Ontario where the tick does not appear to have become established in small mammal populations. Spring migrants may be more involved in the dispersal of I. scapularis larvae than previously thought. Cooler temperatures and shorter seasons experienced in the more northerly, continental parts of the established distribution of this tick may extend the life cycle, resulting in a predominance of larvae rather than nymphs being acquired by northward-bound birds in early spring. Consequently, the role of spring migrating birds in the northward spread of I. scapularis and of borreliosis should be reevaluated.

  18. Morphologic features of Sancassania berlesei (Acari: Astigmata: Acaridae), a common mite of stored products in China.

    Science.gov (United States)

    Li, Chaopin; Jiang, Yuxin; Guo, Wei; Chen, Qi

    2015-04-01

    Objetivo: sancassania berlesei (S. berlesei) es el lider en la industria de cría amenaza mite eupolyphaga sinensis y la salud pública.Métodos: los especimenes vivos de S. berlesei fueron obtenidos a partir de la superficie de eupolyphaga sinensis y purificado con agua bidestilada.El huevo, larva, ninfa, hypopus, macho adulto y la hembra de S. berlesei fueron evaluados y elegidos bajo microscopio.Resultados: las variaciones morfológicas de S. berlesei, incluidas sus piernas, setas, genitales externos y accesorios, están claramente identificadas en la SEM.La larva tiene tres pares de patas, sin hojas como setas, pero su coxal Rod es desarrollada.Por la etapa de ninfa, cuatro pares de patas y el cuarto dorsal seta surgen, mientras que la zona genital se ve aún en desarrollo.En hypopus, las garras y tarsules aparecen bien construido, y la hoja como setas, setas de tibia y setas de Genu son vistos.La ventosa plato totalmente contiene nueve retoños y cuatro Shell como dimplings en que hay distribuciones simétricas con 1 par de mamones, 2 pares de lado anterior de ventosas y 1 par de tontos, respectivamente.Una pera como posterior ventosa está ubicado en la espalda de Sucker plato.Todos los tontos son suaves excepto anterior Sucker con franja radial.El órgano de sentido genital adultos exhibe con cordiforme aspecto externo y osificación típica textura; mientras que el macho es diferente con la hembra respecto a seta numero en el sentido de órganos genitales.Conclusión: descripción de la estructura morfologica en gran detalle para S. berlesei tiende a suministrar la información importante para la taxonomía y más estudio.

  19. Chlorfenapyr resistance in two-spotted spider mite (Acari: Tetranychidae) from Australian cotton.

    Science.gov (United States)

    Herron, G A; Rophail, J; Wilson, L J

    2004-01-01

    The responses of Tetranychus urticae Koch from Australian cotton to chlorfenapyr has been monitored since the 1997--1998 growing season. Resistance was first detected in the 2001--2002 season and then increased quickly in both level and proportion of resistant strains detected. In response, the resistance management strategy for chlorfenapyr use in cotton was altered and now recommends a further restriction of use from two to one spray per season. There was no evidence of negative cross-resistance to the pyrethroid bifenthrin, but chlorfenapyr was associated with an undefined negative cross-resistance.

  20. Efeitos do nim sobre tetranychus urticae Koch (Acari: Tetranychidae e os predadores Phytoseiulus macropilis (Banks e Neoseiulus californicus (Mcgregor (Acari: Phytoseiidae Effects of neem on tetranychus urticae Koch (Acari: Tetranychidae and the predators Phytoseiulus macropilis (Banks and Neoseiulus Californicus (Mcgregor (Acari: phytoseiidae

    Directory of Open Access Journals (Sweden)

    Daniele Cristine Hoffmann Schlesener

    2013-03-01

    Full Text Available O objetivo deste trabalho foi avaliar a eficiência de controle e os efeitos adversos de dois produtos à base de nim Azamax® (Azadiractina A/B 12g/L e Neemseto® (Azadiractina A/B, Nimbina e Salanina 2,389 g/L sobre o ácaro-rajado Tetranychus urticae e os predadores Phytoseiulus macropilis e Neoseiulus californicus em laboratório. Para o ácaro-rajado, foram consideradas as variáveis mortalidade, fecundidade, efeito ovicida e persistência biológica, enquanto para os fitoseídeos consideraram-se mortalidade e fecundidade. A mortalidade máxima observada para o ácaro-rajado foi de 89,7% e 91,5% para Azamax® e Neemseto®, respectivamente, na concentração de 0,5% após a reaplicação do produto no sétimo dia. Também foram observados efeitos adversos sobre a fecundidade e a viabilidade dos ovos quando tratados com os produtos comerciais (p.c.. A persistência biológica dos produtos foi de aproximadamente três dias após a pulverização. As formulações apresentaram seletividade em relação aos fitoseídeos, porém causaram redução da fecundidade dos mesmos.The aim of the present study was to evaluate the efficiency of control and adverse effects of two neem based products: Azamax TM (Azadirachtin A/B 12g/L and Neemseto TM (Azadirachtin A/B, Nimbin and Salanin 2,389 g/L over two-spotted spider mite Tetranychus urticae and the predators Phytoseiulus macropilis and Neoseiulus californicus in laboratory. Effects over the mortality, fecundity, eggs and biological persistence of the two-spotted spider mite when treated with neem based products were evaluated. For the phytoseiids the effects on mortality and fecundity were evaluated. The maximum mortality of two-spotted spider mites rates observed were 89.7% and 91.5% for Azamax TM and Neemseto TM respectively, on the 0.5% concentration after reapplying the product on the seventh day. Adverse effects were also observed over the fecundity and viability of the eggs when treated with commercial products (c.p.. The biological persistence of the products was of approximately three days after being pulverized. The formulations present selectivity in relation to the phytoseiids, however they caused fecundity reduction.

  1. Ecological preferences of exophilic and endophilic ticks (Acari: Ixodidae) parasitizing wild carnivores in the Iberian Peninsula.

    Science.gov (United States)

    Sobrino, Raquel; Millán, Javier; Oleaga, Alvaro; Gortázar, Christian; de la Fuente, José; Ruiz-Fons, Francisco

    2012-03-23

    Ticks parasitizing wild carnivores and the tick-borne pathogens (TBPs) that they transmit may affect domestic carnivores and humans. Thus, investigating the role of wild carnivores as tick hosts is of relevance for understanding the life cycle of ticks in natural foci and the epidemiology of TBPs shared with domestic animals and humans. Therefore, the main objective of this study was to determine the ixodid tick fauna of wild carnivores in Peninsular Spain and the environmental factors driving the risk of wild carnivores to be parasitized by ixodid ticks. We hypothesized that the adaptation of tick species to differing climatic conditions may be reflected in a similar parasitization risk of wild carnivores by ticks between bioclimatic regions in our study area. To test this, we surveyed ixodid ticks in wild carnivores in oceanic, continental-Mediterranean, and thermo-Mediterranean bioclimatic regions of Peninsular Spain. We analyzed the influence of environmental factors on the risk of wild carnivores to be parasitized by ticks by performing logistic regression models. Models were separately performed for exophilic and endophilic ticks under the expected differing influence of environmental conditions on their life cycle. We found differences in the composition of the tick community parasitizing wild carnivores from different bioclimatic regions. Modelling results partially confirmed our null hypothesis because bioclimatic region was not a relevant factor influencing the risk of wild carnivores to be parasitized by exophilic ticks. Bioclimatic region was however a factor driving the risk of wild carnivores to be parasitized by endophilic ticks. Spanish wild carnivores are hosts to a relevant number of tick species, some of them being potential vectors of pathogens causing serious animal and human diseases. Information provided herein can be of help to understand tick ecology in Spanish wildlife, the epidemiology of tick-borne diseases, and to prevent the risks of TBPs for wildlife, domestic animals, and humans.

  2. A new genus of syringophilid mites (Acari: Cheyletoidea: Syringophilidae) from cuculiform birds (Aves: Cuculiformes).

    Science.gov (United States)

    Skoracki, Maciej

    2008-06-01

    Cuculisyringophilus crotophaginus gen. n. et sp. n. is described from the guira cuckoo Guira guira (Gmelin) from Paraguay and also was collected from the groove-billed ani Crotophaga sulcirostris Swainson from Colombia and Mexico. This new genus is closely related to Neoaulobia Fain, Bochkov et Mironov, 2000 but is distinguished by the following characters: propodosomal setae sce are situated distinctly anterior to level of setae d1, leg setae vs'II are absent, apodemes I are divergent.

  3. First report of an hypopus (Acari: Hypoderatidae) from a jaeger (Aves: Charadriiformes: Stercorariidae)

    Science.gov (United States)

    Pence, Danny B.; Cole, R.A.

    1995-01-01

    Thalassornectes (Alcidectes) aukletae, originally described from two species of auklets (Charadriiformes: Alcidae) from maritime eastern Russia, is reported from a third species of pelagic charadriiform (Stercorariidae), the pomarine jaeger, Stercorarius poinarinus (Temminck), from Florida. The specimens from the jaeger are slightly smaller, the genital apodeme is more heavily sclerotized, paired setae gm are twice as long and there are other minor variations in the idiosomal and leg chaetotaxy. These differences are not considered sufficient to warrant taxonomic separation at the species or subspecies level from the nominate species T. (A.) aukletae. The same hypopus occurring across different families of birds is unusual in the Hypoderatidae. The diversity in hosts from several orders of birds, low intensities of infection in the two species from Africa, low prevalences in alcids from Russia, and rarity of these hypoderatids in all surveyed hosts leads us to speculate that the true host affinities of species in the genus Thalassornectes are unknown. The alternative consideration is that these are simply uncommon species that are very host specific.

  4. Two new oribatid mite species with auriculate pteromorphs from Southern Vietnam (Acari: Oribatida: Parakalummidae, Galumnidae

    Directory of Open Access Journals (Sweden)

    Ermilov, S.G.

    2012-12-01

    Full Text Available Two new oribatid mite species, Neoribates spindleformis sp. nov. and Globogalumna biporosa sp. nov. are described from soil and litter of pine and acacias artificial plantations of Dong Nai Culture and Nature Reserve (Southern Vietnam. First new species is differs from all other species of Neoribates by combination of the following characters; mor¬phology of sensilli, number of leg claws and genital setae. Second new species differs from type-species of Globogalumna by the body surface and number of notogastral porose areas. The genus Globogalumna is recorded for the first time from the Oriental region.

  5. Feather mites (Acari, Astigmata from Azorean passerines (Aves, Passeriformes: lower species richness compared to European mainland

    Directory of Open Access Journals (Sweden)

    Rodrigues Pedro

    2015-01-01

    Full Text Available Ten passerine species were examined on three islands of the Azores (North Atlantic during 2013 and 2014 in order to identify their feather mite assemblages. We recorded 19 feather mite species belonging to four families of the superfamily Analgoidea (Analgidae, Proctophyllodidae, Psoroptoididae and Trouessartiidae. A high prevalence of feather mite species was recorded on the majority of the examined host species. Only three passerine species (Sylvia atricapilla, Regulus regulus and Serinus canaria presented the same full complex of mite species as commonly occurs in the plumage of their closest relatives in continental Europe. Passer domesticus presented the same limited fauna of feather mites living in the plumage as do its co-specifics in continental Europe. Carduelis carduelis bears the same feather mite species as do most of its continental populations in Europe, but it lacks one mite species occurring on this host in Egypt. Turdus merula, Pyrrhula murina and Fringilla coelebs are missing several mite species common to their continental relatives. This diminution could be explained by the founder effect, whereby a limited number of colonizing individuals did not transport the full set of feather mite species, or by the extinction of some mite species after initially having reached the Azores. The only individual of Motacilla cinerea sampled in this study presented a new host record for the mite species Trouessartia jedliczkai.

  6. Human Infestation with Dermanyssus gallinae (Acari: Dermanyssidae in a Family Referred with Pruritus and Skin Lesions.

    Directory of Open Access Journals (Sweden)

    Mohammad Abdigoudarzi

    2014-06-01

    Full Text Available The poultry red mite, Dermanyssus gallinae is one of the most economically important ectoparasites in hens and some species of mammals worldwide. Cases of human infestation have been reported worldwide. In this study we report infestation in three members of a family referred with pruritus and allergic dermatitis rash. They have collected very small animals and carried them to the laboratory which later was confirmed as D. gallinae. They claimed that they had been bitten with this ectoparasite. This is the first case report of human infestation owing to D. gallinae from Iran.

  7. Human Infestation with Dermanyssus gallinae (Acari: Dermanyssidae) in a Family Referred with Pruritus and Skin Lesions.

    Science.gov (United States)

    Abdigoudarzi, Mohammad; Mirafzali, Mahmoud S; Belgheiszadeh, Hamid

    2014-01-01

    The poultry red mite, Dermanyssus gallinae is one of the most economically important ectoparasites in hens and some species of mammals worldwide. Cases of human infestation have been reported worldwide. In this study we report infestation in three members of a family referred with pruritus and allergic dermatitis rash. They have collected very small animals and carried them to the laboratory which later was confirmed as D. gallinae. They claimed that they had been bitten with this ectoparasite. This is the first case report of human infestation owing to D. gallinae from Iran.

  8. [Comparison of different sampling traps for Dermanyssus gallinae (Acari: Dermanyssidae) (de Geer, 1778)].

    Science.gov (United States)

    Cunha, Lucas M; Cunha, Mariana M; Leite, Romário C; Silva, Israel J; Oliveira, Paulo R de

    2009-01-01

    This work aims to compare the performance of corrugated paper and "taquaril" bamboo (Phyllostachys sp.) straw traps for collecting (in sampling) Dermanyssus gallinae in a metal cages battery laying hens. The presence of eggs in the two trap models were compared using a Qui-square test and a proportion confidence interval test. Total daily values of mobile instars gathered in each type of trap were compared using the Wilcoxon's test. The amount of traps containing eggs was not different in neither of the traps (p < 0,05). The number of mobile instars sampled at every two days per trap model was different (p

  9. Contact and fumigant toxicity of oriental medicinal plant extracts against Dermanyssus gallinae (Acari: Dermanyssidae).

    Science.gov (United States)

    Kim, Soon-Il; Na, Young-Eun; Yi, Ji-Hwan; Kim, Byung-Seok; Ahn, Young-Joon

    2007-04-30

    The acaricidal activity of methanolic extracts from 40 oriental medicinal plant species and a steam distillate of Cinnamomum camphora towards poultry house-collected adult Dermanyssus gallinae De Geer was examined using direct contact and vapour phase toxicity bioassays. Results were compared with those of 15 acaricides currently used. In filter paper contact toxicity bioassays using adult D. gallinae, C. camphora steam distillate (0.0051 mgcm(-2)) was the most toxic material, followed by extracts from Asarum sieboldii var. seoulens whole plant, Eugenia caryophyllata flower bud and Mentha arvensis var. piperascens whole plant (0.0063-0.0072 mgcm(-2)), based upon 24h LD(50) values. The acaricidal activity of these four plant preparations was almost comparable to that of profenofos (LD(50), 0.003 mgcm(-2)) but less effective than dichlorvos (LD(50), 0.0004 mgcm(-2)). The toxicity of Illicium verum fruit and Lysimachia davurica leaf extracts (0.09 mgcm(-2)) was almost comparable to that of benfuracarb, prothiofos, propoxur and fenthion (0.053-0.070mgcm(-2)). In vapour phase toxicity tests, these plant preparations were more effective in closed containers than in open ones, indicating that the mode of delivery of these plant extracts was largely a result of action in the vapour phase. Plants described herein merit further study as potential D. gallinae control agents.

  10. Human Infestation with Dermanyssus gallinae (Acari: Dermanyssidae) in a Family Referred with Pruritus and Skin Lesions.

    OpenAIRE

    Mohammad Abdigoudarzi; Mahmoud S Mirafzali; Hamid Belgheiszadeh

    2014-01-01

    The poultry red mite, Dermanyssus gallinae is one of the most economically important ectoparasites in hens and some species of mammals worldwide. Cases of human infestation have been reported worldwide. In this study we report infestation in three members of a family referred with pruritus and allergic dermatitis rash. They have collected very small animals and carried them to the laboratory which later was confirmed as D. gallinae. They claimed that they had been bitten with this ectoparasit...

  11. Ecology of the interaction between Ixodes loricatus (Acari: Ixodidae) and Akodon azarae (Rodentia: Criceridae).

    Science.gov (United States)

    Colombo, Valeria C; Nava, Santiago; Antoniazzi, Leandro R; Monje, Lucas D; Racca, Andrea L; Guglielmone, Alberto A; Beldomenico, Pablo M

    2015-10-01

    The present study explores associations of different factors (i.e. host parameters, presence of other ectoparasites and [mainly biotic] environmental factors) with burdens of Ixodes loricatus immature stages in one of its main hosts in Argentina, the rodent Akodon azarae. For 2 years, rodents were trapped and sampled monthly at 16 points located in four different sites in the Parana River Delta region. Data were analysed with generalized linear mixed models with a negative binomial response (counts of larvae or nymphs). The independent variables assessed were (a) environmental: trapping year, presence of cattle, type of vegetation, rodent abundance; (b) host parameters: body length, sex, body condition, blood cell counts, natural antibody titers and (c) co-infestation with other ectoparasites. Two-way interaction terms deemed a priori as relevant were also included in the analysis. Most of the associations investigated were found significant, but in general, the direction and magnitude of the associations were context-dependent. An exception was the presence of cattle, which was consistently negatively associated with both larvae and nymphs independently of all other variables considered and had the strongest effect on tick burdens. Mites, fleas and Amblyomma triste were also significantly associated (mostly positively) with larval and nymph burdens, and in many cases, they influenced associations with environmental or host factors. Our findings strongly support that raising cattle may have a substantial impact on the dynamics of I. loricatus and that interactions within the ectoparasite community may be an important-but generally ignored-driver of tick dynamics.

  12. Factors affecting patterns of Amblyomma triste (Acari: Ixodidae) parasitism in a rodent host.

    Science.gov (United States)

    Colombo, Valeria C; Nava, Santiago; Antoniazzi, Leandro R; Monje, Lucas D; Racca, Andrea L; Guglielmone, Alberto A; Beldomenico, Pablo M

    2015-07-30

    Here we offer a multivariable analysis that explores associations of different factors (i.e., environmental, host parameters, presence of other ectoparasites) with the interaction of Amblyomma triste immature stages and one of its main hosts in Argentina, the rodent Akodon azarae. Monthly and for two years, we captured and sampled rodents at 16 points located at 4 different sites in the Parana River Delta region. The analyses were conducted with Generalized Linear Mixed Models with a negative binomial response (counts of larvae or nymphs). The independent variables assessed were: (a) environmental: trapping year, season, presence of cattle; type of vegetation (natural grassland or implanted forest); rodent abundance; (b) host parameters: body length; sex; body condition; blood cell counts; natural antibody titres; and (c) co-infestation with other ectoparasites: other stage of A. triste; Ixodes loricatus; lice; mites; and fleas. Two-way interaction terms deemed a priori as relevant were also included in the analysis. Larvae were affected by all environmental variables assessed and by the presence of other ectoparasites (lice, fleas and other tick species). Host factors significantly associated with larval count were sex and levels of natural antibodies. Nymphs were associated with season, presence of cattle, body condition, body length and with burdens of I. loricatus. In most cases, the direction and magnitude of the associations were context-dependent (many interaction terms were significant). The findings of greater significance and implications of our study are two. Firstly, as burdens of A. triste larvae and nymphs were greater where cattle were present, and larval tick burdens were higher in implanted forests, silvopastoral practices developing in the region may affect the population dynamics of A. triste, and consequently the eco-epidemiology of Rickettsia parkeri. Secondly, strong associations and numerous interactions with other ectoparasites suggest that co-infestations may be more important for tick dynamics than has so far been appreciated.

  13. Site selection and growth of the larvae of Eylais discreta Koenike, 1897 (Acari, Hydrachnellae)

    NARCIS (Netherlands)

    Davids, C.; Nielsen, G.J.; Gehring, P.

    1977-01-01

    The distribution of the larvae of Eylais discreta on the abdominal tergites of the host species Sigara striata, S. falleni and Cymatia coleoptrata is examined. On S. striata and S. falleni the segments 3 and 4, on C. coleoptrata the segments 2 and 3 are successively preferred. There is but little in

  14. Effects of Ricinus communis oil esters on salivary glands of Rhipicephalus sanguineus (Latreille, 1806) (Acari: Ixodidae).

    Science.gov (United States)

    Arnosti, André; Brienza, Paula Desjardins; Furquim, Karim Christina Scopinho; Chierice, Gilberto Orivaldo; Neto, Salvador Claro; Bechara, Gervásio Henrique; Sampieri, Bruno Rodrigues; Camargo-Mathias, Maria Izabel

    2011-02-01

    This study showed the interference of esters extracted from Ricinus communis in the secretory cycle of salivary glands of Rhipicephalus sanguineus ticks, which consequently caused collateral effects on their feeding process. Ticks attached on hosts which were fed with commercial feed containing different concentrations of R. communis oil esters suffered damages such as cytoplasmic changes in their salivary glands, notably in the acinar cells, impairing the functioning of the acini and accelerating the organs degeneration as a whole. It was found that esters interfered with the activity of cellular secretion by changing the glycoprotein of salivary composition especially in acini II cells. It was also shown that the damages caused by esters in the salivary glands cells of these ectoparasites increased in higher concentrations of the product and degenerative glandular changes were more pronounced. Copyright © 2010 Elsevier Inc. All rights reserved.

  15. Amblyomma mixtum Koch, 1844 (Acari: Ixodidae): First record confirmation in Colombia using morphological and molecular analyses.

    Science.gov (United States)

    Rivera-Páez, Fredy A; Labruna, Marcelo B; Martins, Thiago F; Sampieri, Bruno Rodrigues; Camargo-Mathias, Maria I

    2016-07-01

    Up to some years ago, the taxon Amblyomma cajennense represented a single tick species in the New World, from southern United States to northern Argentina. Recent studies, based on genetic, reproductive and morphological data reorganized this taxon into a complex of the following 6 valid species: A. cajennense sensu stricto, Amblyomma mixtum, Amblyomma sculptum, Amblyomma interandinum, Amblyomma tonelliae, and Amblyomma patinoi. According to this classification, the A. cajennense complex is currently represented in Colombia by only one species, A. patinoi. Because the Colombian land is surrounded by confirmed records of A. mixtum in Panama and Ecuador, and by A. cajennense s.s. in Venezuela and the Brazilian Amazon, it is possible that these two species could also occur in Colombia. This study aimed to determine the occurrence of ticks of the A. cajennense complex in the Orinoquía region of Colombia. A total of 246 adult ticks of the Amblyomma genus were collected in three sampled regions: 71 females and 110 males in Arauca (Arauca Department), 27 females and 20 males in Nunchía (Casanare Department), and 10 females and 8 males in Yopal (Casanare Department). Based on morphological and molecular analyses, these ticks were identified as A. mixtum. Molecular analyses consisted of DNA sequences of two molecular markers, the nuclear second internal transcribed spacer (ITS2) and the mitochondrial cytochrome c oxidase subunit I gene (COI). The presence of A. mixtum in Colombia is of medical relevance, since this species is incriminated as a vector of Rickettsia rickettsii in Central America. Copyright © 2016. Published by Elsevier GmbH.

  16. Histopathological study of ovaries of Rhipicephalus sanguineus (Acari: Ixodidae) exposed to different thymol concentrations.

    Science.gov (United States)

    da Silva Matos, Renata; Daemon, Erik; Camargo-Mathias, Maria Izabel; Furquim, Karim Christina Scopinho; Sampieri, Bruno Rodrigues; Remédio, Rafael Neodini; Araújo, Laryssa Xavier; Novato, Tatiane Pinheiro Lopes

    2014-12-01

    Thymol is a monoterpene with proven acaricide action for several tick species. In addition to killing these ectoparasites, thymol can also reduce oviposition and egg hatch rate. However, the effects of thymol on the morphophysiology of tick ovaries are still unknown. Thus, the aim of this study was to evaluate the morphophysiological changes caused by this active principle in ovaries of Rhipicephalus sanguineus after a 6-day feeding period, through the application of morphohistochemical techniques. After the feeding period, a total of 50 females were divided into five groups and immersed in the following solutions: (I) distilled water (control), (II) 30% ethanol (control), (III) 1.25 mg/mL thymol, (IV) 2.5 mg/mL thymol, and (V) 5.0 mg/mL thymol. The experimental groups were kept in a climatic chamber (27 ± 1 °C; RH 80 ± 10%) for 5 days. After this period, morphological (hematoxylin/eosin) and histochemical (von Kossa) techniques were applied after remotion of the ovaries. The morphological results revealed large vacuoles in germ cells at different developmental stages and invaginations that represent deformations in the chorionic membrane. From the results obtained in this study, it was concluded that thymol interfered with the development of oocytes, which showed degeneration signs. The treatment containing 5.0 mg/mL thymol affected more accentuately the morphological development. Moreover, thymol also altered the calcium content of yolk granules, which generally showed an intense staining for this element.

  17. Rhipicephalus sanguineus (Acari: Ixodidae) female ticks exposed to castor oil (Ricinus communis): an ultrastructural overview.

    Science.gov (United States)

    Sampieri, B R; Furquim, K C S; Nunes, P H; Camargo-Mathias, M I

    2013-02-01

    Tick control has been accomplished through the use of synthetic acaricides, which has created resistant individuals, as well as contaminating the environment and nontarget organisms. Substances of plant origin, such as oils and extracts of eucalyptus and neem leaves, have been researched as an alternative to replace the synthetic acaricides. Ricinoleic acid esters from castor oil have recently been shown as a promising alternative in eliminating bacterial contamination during ethanol fermentation, by acting as an effective biocide. The same positive results have been observed when these esters are added to the food given to tick-infested rabbits. This study tested the effect of these substance on the reproductive system of Rhipicephalus sanguineus females, added to rabbit food, more specifically on oogenesis. For this, four groups were established: four control groups (CG1, CG2, CG3, and CG4) and four treatment groups (TG1, TG2, TG3, and TG4) with one rabbit in each (New Zealand White), used as hosts. After full 4 days feeding (semi-engorgement), the females were collected and had their ovaries extracted. In this study, it was observed that R. sanguineus females exposed to esters had their ovaries modified, which was demonstrated through transmission electron microscopy techniques. The addition of ricinoleic esters to the diet of tick-infested rabbits revealed how toxic such substances are for the cytoplasmic organelles of oocytes and pedicel cells. These compounds can change the morphophysiology of germ and somatic cells, consequently influencing their viability and, therefore, confirming that the ricinoleic acid esters from castor oil are a promising substance in the control of R. sanguineus.

  18. The Ixodes (Acari: Ixodidae) of Mexico: Parasite-Host and Host-Parasite Checklists

    Science.gov (United States)

    2007-08-20

    en Peligro de Extinción. Comisión Nacional para el Cono- cimiento y Uso de la Biodiversidad , Fondo de Cultura Económica, Instituto de Ecología, UNAM... Biodiversidad y Fondo de Cultura Económica, México, D. F. 981 pp. Chavarría, C.M. (1941) Garrapatas determinadas en México. Caracteres genéricos de las más...Campos, G. (2000) Biodiversidad de los ácaros en México. Fideicomiso Fondo para la Biodiver- sidad, México D. F., 230 pp. Hooker, W.A., Bishopp, F.C

  19. Taxonomic distribution of defensive alkaloids in Nearctic oribatid mites (Acari, Oribatida).

    Science.gov (United States)

    Saporito, Ralph A; Norton, Roy A; Garraffo, Martin H; Spande, Thomas F

    2015-11-01

    The opisthonotal (oil) glands of oribatid mites are the source of a wide diversity of taxon-specific defensive chemicals, and are likely the location for the more than 90 alkaloids recently identified in oribatids. Although originally recognized in temperate oribatid species, alkaloids have also been detected in related lineages of tropical oribatids. Many of these alkaloids are also present in a worldwide radiation of poison frogs, which are known to sequester these defensive chemicals from dietary arthropods, including oribatid mites. To date, most alkaloid records involve members of the superfamily Oripodoidea (Brachypylina), although few species have been examined and sampling of other taxonomic groups has been highly limited. Herein, we examined adults of more than 60 species of Nearctic oribatid mites, representing 46 genera and 33 families, for the presence of alkaloids. GC-MS analyses of whole body extracts led to the detection of 15 alkaloids, but collectively they occur only in members of the genera Scheloribates (Scheloribatidae) and Protokalumma (Parakalummidae). Most of these alkaloids have also been detected previously in the skin of poison frogs. All examined members of the oripodoid families Haplozetidae and Oribatulidae were alkaloid-free, and no mites outside the Oripodoidea contained alkaloids. Including previous studies, all sampled species of the cosmopolitan oripodoid families Scheloribatidae and Parakalummidae, and the related, mostly tropical families Mochlozetidae and Drymobatidae contain alkaloids. Our findings are consistent with a generalization that alkaloid presence is widespread, but not universal in Oripodoidea. Alkaloid presence in tropical, but not temperate members of some non-oripodoid taxa (in particular Galumnidae) deserves further study.

  20. A new genus and species in the mite family Eupodidae (Acari, Eupodoidea) from Crimea.

    Science.gov (United States)

    Khaustov, Alexander A

    2014-01-01

    A new genus Pseudoeupodes Khaustov, gen. n. and new species Pseudoeupodes porosus sp. n. are described from moss in Crimea. The taxonomy of the Eupodidae and some other families and genera of Eupodoidea is reviewed. The genus Turanopenthalodes Barilo, 1988 is transferred from Penthalodidae to Penthaleidae. The family Cocceupodidae Jesionowska, 2010 and the genus Filieupodes Jesionowska, 2010 are considered as junior synonyms of Eupodidae Koch, 1842 and Cocceupodes Thor, 1934, respectively. A key to genera of the family Eupodidae is provided.

  1. Abundance of adult ticks (Acari: Ixodidae) in the Chernobyl nuclear power plant exclusion zone.

    Science.gov (United States)

    Movila, A; Deriabina, T; Morozov, A; Sitnicova, N; Toderas, I; Uspenskaia, I; Alekhnovici, A

    2012-08-01

    The Chernobyl nuclear disaster resulted in contamination of vast areas in Europe. To date, there is little knowledge about the effects of radioactive contamination on tick species. We sampled ticks from vegetation and large-sized wild mammals belonging to orders Carnivora and Artiodactyla at sites with 0.76, 1.91, and 4.50 mSv/hr ionizing radiation background values in the Polesky State Radio-Ecological Reserve of the Chernobyl nuclear disaster zone in spring 2010. Altogether, 122 questing ticks were collected from vegetation. Among collected ticks, Dermacentor reticulatus (Fabricius) was, by far, the most abundant species (99.2%), followed by Ixodes ricnus (L.) (0.8%), which was collected only at the 0.76 mSv/hr site. The average sex ratio female∶male was 2.9∶1.0. In parallel with the present study, we examined 3 Sus scrofa (L.), 2 Nyctereutes procyonoides (Gray), and 1 Alces alces (L.) at the 4.50 mSv/hr site; 96 D. reticulatus ticks were found on 2 N. procyonoides specimens. The mean density and the intensity of infestation were 16 ticks per animal and 48 ticks per infested animal, respectively. Future investigations are warranted to further characterize the role of various tick vectors, vertebrate reservoirs, and diversity of tick-borne pathogens in the Chernobyl exclusion zone.

  2. Genetic Diversity of Salp15 in the Ixodes ricinus Complex (Acari: Ixodidae)

    OpenAIRE

    2014-01-01

    Salp15, a 15-kDa tick salivary gland protein, is both essential for ticks to successfully obtain host blood and also facilitates transmission of Lyme borreliosis. To determine whether the Salp15 gene is expressed in Ixodes persulcatus and Ixodes sinensis, principle vectors of Lyme borreliosis in China, we studied transcriptions of this gene in semi-engorged larvae, nymph and adults of these two species. A total of eight Salp15 homologues, five in I. persulcatus and three in I. sinensis, were ...

  3. Genetic diversity of Salp15 in the Ixodes ricinus complex (Acari: Ixodidae.

    Directory of Open Access Journals (Sweden)

    Xin Wang

    Full Text Available Salp15, a 15-kDa tick salivary gland protein, is both essential for ticks to successfully obtain host blood and also facilitates transmission of Lyme borreliosis. To determine whether the Salp15 gene is expressed in Ixodes persulcatus and Ixodes sinensis, principle vectors of Lyme borreliosis in China, we studied transcriptions of this gene in semi-engorged larvae, nymph and adults of these two species. A total of eight Salp15 homologues, five in I. persulcatus and three in I. sinensis, were identified by reverse transcriptase-polymerase chain reaction (RT-PCR. Interestingly, the intra-species similarity of Salp15 is approximately equal to its interspecies similarity and more than one Salp15 protein is expressed in a certain tick developmental stage. Comparison of DNA and proteins with other available tick Salp15 homologues suggests that the Salp15 superfamily is genetically conserved and diverse in the Ixodes ricinus complex. These findings indicate that Salp15 proteins in the I. ricinus complex may play an essential role in interacting with the host immune system and transmission of Borrelia genospecies.

  4. Cloning and characterization of a cDNA clone encoding calreticulin from Haemaphysalis qinghaiensis (Acari: Ixodidae).

    Science.gov (United States)

    Gao, Jinliang; Luo, Jianxun; Fan, Ruiquan; Fingerle, Volker; Guan, Guiquan; Liu, Zhijie; Li, Youquan; Zhao, Haiping; Ma, Miling; Liu, Junlong; Liu, Aihong; Ren, Qiaoyun; Dang, Zhisheng; Sugimoto, Chihiro; Yin, Hong

    2008-03-01

    The application of anti-tick vaccine has been shown to be the most promising alternative strategy compared to the current use of acaricides that suffer from a number of serious limitations. The success of this method is dependent upon identification and cloning of potential tick vaccine antigens. Previously, we have cloned 21 positive clones (named from Hq02 to Hq22) by immunoscreening complimentary DNA (cDNA) libraries of Haemaphysalis qinghaiensis; however, some of those clones did not contain open reading frames (ORF). In this study, we amplified the entire sequence of Hq07 by using rapid amplification of the cDNA ends. Hq07 contains an ORF of 1,233 bp that encodes for 410 amino acid residues with a coding capacity of 47 kDa. Search of the cloned sequences against GenBank revealed that Hq07 is a calreticulin (CRT)-similar clone and designated HqCRT. Expression analysis by reverse transcription-polymerase chain reaction showed that this gene is ubiquitously expressed at different developmental stages and in different tissues of H. qinghaiensis. The gene was expressed as glutathione S-transferase-fused proteins in a prokaryotic system. Western blot analysis revealed that native HqCRT was secreted into their hosts by ticks during blood sucking. Vaccination of sheep with rHqCRT conferred protective immunity against ticks, resulting in 54.3% mortality in adult ticks, compared to the 38.7% death rate in the control group. These results demonstrated that rHqCRT might be a useful vaccine candidate antigen for biological control of H. qinghaiensis.

  5. Potential nontarget effects of Metarhizium anisopliae (Deuteromycetes) used for biological control of ticks (Acari: Ixodidae)

    Science.gov (United States)

    Ginsberg, Howard S.; LeBrun, Roger A.; Heyer, Klaus; Zhioua, Elyes

    2002-01-01

    The potential for nontarget effects of the entomopathogenic fungus Metarhizium anisopliae (Metschnikoff) Sorokin, when used for biological control of ticks, was assessed in laboratory trials. Fungal pathogenicity was studied against convergent ladybird beetles, Hippodamia convergens Guérin-Méneville, house crickets, Acheta domesticus (L.), and the milkweed bugs Oncopeltus fasciatus (Dallas). Fungal spores applied with a spray tower produced significant mortality in H. convergens and A. domesticus, but effects on O. fasciatus were marginal. Placing treated insects with untreated individuals resulted in mortality from horizontal transmission to untreated beetles and crickets, but not milkweed bugs. Spread of fungal infection in the beetles resulted in mortality on days 4–10 after treatment, while in crickets mortality was on day 2 after treatment, suggesting different levels of pathogenicity and possibly different modes of transmission. Therefore, M. anisopliae varies in pathogenicity to different insects. Inundative applications can potentially affect nontarget species, but M. anisopliae is already widely distributed in North America, so applications for tick control generally would not introduce a novel pathogen into the environment. Pathogenicity in lab trials does not, by itself, demonstrate activity under natural conditions, so field trials are needed to confirm these results and to assess methods to minimize nontarget exposure.

  6. Cheylostigmaeus tarae sp. nov. and Stigmaeus delaramae sp. nov. (Acari: Stigmaeidae) from Kurdistan, Iran.

    Science.gov (United States)

    Khanjani, Mohammad; Nasrollahi, Siamak; Zamani, Ali Sina; Fayaz, Bahman Asali

    2014-07-28

    Two new species belonging to the family Stigmaeidae, Cheylostigmaeus tarae sp. nov. and Stigmaeus delaramae sp. nov., are described from specimens collected from soil and litter under pear trees, Pyrus communis L. (Rosaceae) in Iran. A key to all Iranian species of the genera Cheylostigmaeus (male) and Stigmaeus (female) are provided. 

  7. Two new Anoplocheylus species (Acari: Trombidiformes: Pseudocheylidae) from Kurdistan province of Iran.

    Science.gov (United States)

    Khanjani, Mohammad; Hoseini, Mohammad Ahmad; Amini, Fatemeh

    2014-09-12

    Two new species of the genus Anoplocheylus Berlese, 1910 are described: Anoplocheylus marivaniensis sp. nov. collected from soil and rotten leaves under oak trees and Anoplocheylus qorvehiensis sp. nov. from soil under Astragalus sp. bushes in Kurdistan province, Iran. A key to females of all known species of Anoplocheylus is provided, based on original descriptions and other literature.

  8. Complementary data on Haplozetes fusifer (Berlese, 1908 (Acari, Oribatida, Haplozetidae collected from Iran

    Directory of Open Access Journals (Sweden)

    Akrami, M. A.

    2013-12-01

    Full Text Available An oribatid mite of the family Haplozetidae, Haplozetes fusifer (Berlese, 1908 is redescribed on the basis of Iranian materials, including the first detailed descriptions of the gnathosoma and legs.Se redescribe un ácaro oribátido de la familia Haplozetidae, Haplozetes fusifer (Berlese, 1908, sobre la base de material iraní, incluyendo las primeras descripciones detalladas del gnatosoma y las patas.

  9. Evaluation of Gulf Coast Ticks (Acari: Ixodidae) for Ehrlichia and Anaplasma Species.

    Science.gov (United States)

    Allerdice, Michelle E J; Hecht, Joy A; Karpathy, Sandor E; Paddock, Christopher D

    2017-03-01

    Amblyomma maculatum Koch (the Gulf Coast tick) is an aggressive, human-biting ixodid tick distributed throughout much of the southeastern United States and is the primary vector for Rickettsia parkeri, an emerging human pathogen. Amblyomma maculatum has diverse host preferences that include white-tailed deer, a known reservoir for Ehrlichia and Anaplasma species, including the human pathogens E. ewingii and E. chaffeensis. To examine more closely the potential role of A. maculatum in the maintenance of various pathogenic Ehrlichia and Anaplasma species, we screened DNA samples from 493 questing adult A. maculatum collected from six U.S. states using broad-range Anaplasmataceae and Ehrlichia genus-specific PCR assays. Of the samples tested, four (0.8%) were positive for DNA of Ehrlichia ewingii, one (0.2%) was positive for Anaplasma platys, and one (0.2%) was positive for a previously unreported Ehrlichia species closely related to Ehrlichia muris and an uncultivated Ehrlichia species from Haemaphysalis longicornis ticks in Japan. No ticks contained DNA of Ehrlichia chaffeensis, Ehrlichia canis, the Panola Mountain Ehrlichia, or Anaplasma phagocytophilum. This is the first identification of E. ewingii, A. platys, and the novel Ehrlichia in questing Gulf Coast ticks; nonetheless the low prevalence of these agents suggests that A. maculatum is not likely an important vector of these zoonotic pathogens. Published by Oxford University Press on behalf of Entomological Society of America 2016. This work is written by US Government employees and is in the public domain in the US.

  10. Transovarial Transmission of Francisella-Like Endosymbionts and Anaplasma phagocytophilum Variants in Dermacentor albipictus (Acari: Ixodidae)

    Science.gov (United States)

    Dermacentor albipictus (Packard) is a North American Ixodid tick that parasitizes deer species but also infests livestock. It is a suspected vector of the agent of anaplasmosis in cattle herds, Anaplasma marginale, but its microbial flora and emerging pathogen vector potential remain under-evaluated...

  11. Prey-related odor preference of the predatory mites Typhlodromalus manihoti and Typhlodromalus aripo (Acari: Phytoseiidae)

    NARCIS (Netherlands)

    Gnanvossou, D.; Hanna, R.; Dicke, M.

    2002-01-01

    Typhlodromalus manihoti and Typhlodromalus aripo are exotic predators of the cassava green mite Mononychellus tanajoa in Africa. In an earlier paper, we showed that the two predators were attracted to odors from M. tanajoa-infested cassava leaves. In addition to the key prey species, M. tanajoa, two

  12. Infochemical-mediated niche use by the predatory mites Typhlodromalus manihoti and T. aripo (Acari: Phytoseiidae)

    NARCIS (Netherlands)

    Gnanvossou, D.; Hanna, R.; Dicke, M.

    2003-01-01

    In Africa, Typhlodromalus manihoti and T. aripo, two introduced predators of the cassava green mite Mononychellus tanajoa, occupy different parts of cassava foliage. In the present study, niche use by these two predators, as mediated by prey-induced infochemicals, was investigated. In response to pr

  13. Alternative control of Tetranychus evansi Baker & Pritchard (Acari: Tetranychidae) on tomato plants grown in greenhouses.

    Science.gov (United States)

    Soto, Alberto; Venzon, Madelaine; Oliveira, Rafael M; Oliveira, Hamilton G; Pallini, Angelo

    2010-01-01

    Tetranychus evansi Baker & Pritchard is an important pest of solanaceous plants, including tomatoes. This mite is characterized by a high reproductive rate, which leads to high population growth in a short period of time causing important economic damage. Control of T. evansi is mainly through synthetic acaricides. In searching for environmentally friendly control measures, we evaluated the efficiency of alternative products to control T. evansi on tomato plants under greenhouse conditions. The products tested were lime sulphur and neem based products. We first estimated the lethal concentration (LC) and instantaneous rate of increase (r i) of T. evansi exposed to different product concentrations in laboratory conditions, and later tested the efficacy of LC95 and the concentrations that restrained mite population growth (r i = 0) in greenhouse conditions. The following treatments were repeated three times: NeemPro (81.0 and 71.6 mg a.i./l), Natuneem (31.1 and 20.4 mg ai/l), Organic Neem (39.1 and 30.4 mg a.i./l), lime sulphur (1.0 and 0.6%) and water (control). For all products, control provided by LC95 was higher than provided for lower concentrations (r i = 0) one day after spraying. However, after five days, for both concentrations, the percentage of T. evansi population reduction was superior to 95% and increased over time. Only plants sprayed with Natuneem (31.1 mg a.i./l) showed symptoms of phytotoxicity. Lime sulphur and neem based products, applied in appropriate concentrations and formulations, bear out as a viable alternative to control T. evansi on tomato plants.

  14. Occurrence and transmission of mycovirus Cryphonectria hypovirus 1 from dejecta of Thyreophagus corticalis (Acari, Acaridae).

    Science.gov (United States)

    Bouneb, Mabrouk; Turchetti, Tullio; Nannelli, Roberto; Roversi, Pio Federico; Paoli, Francesco; Danti, Roberto; Simoni, Sauro

    2016-03-01

    The natural spread of virus-induced hypovirulence is highly involved in the recovery of blighted chestnut stands and orchards in Italy and in Europe. The potential role of corticolous mites as vectors of hypovirulence in blighted chestnut Castanea sativa (Mill.) stands was pointed out in previous reports. Here, by using RT-PCR, mycovirus Cryphonectria hypovirus (CHV1) was detected in Thyreophagus corticalis mites reared on a hypovirulent strain in monoxenic cultures and in their faecal pellets. Cryphonectria parasitica mycelium derived from mites' dejecta was able to transmit CHV1 to the virulent strain determining its conversion to hypovirulent one. This converted strain induced healing cankers on excised stems, differently from the un-converted virulent strain. Our findings prove the spread of CHV1 by corticolous mites that feed on virus-infected fungus and emphasize their potential role as vectors.

  15. Moss mites (Acari: Oribatida in soil revitalizing: a chance for practical application in silviculture

    Directory of Open Access Journals (Sweden)

    Klimek Andrzej

    2014-12-01

    Full Text Available The Oribatida (known as moss mites or beetle mites increase the breakdown of organic material in the soil. The paper analyses the dynamics of their abundance and number of species after various treatments enriching the soil in 4 study areas: afforested post-agricultural area in the Tuchola Forest, afforested degraded post-military training area in Bydgoszcz-Jachcice, and forest nurseries at Białe Błota and Bielawy. The results show that in post-agricultural and degraded soils at the initial stages of forest succession, the density and number of species of oribatid mites were low, even after phyto-land-improvement (afforestation and lupin as green manure. In the forest nurseries, however, we recorded a positive effect of soil revitalizing after mulching with forest ectohumus (i.e. organic surface layer of the soil. The inoculation of soils with forest mesofauna appeared more effective in nursery plantations of silver birch (Betula pendula and small-leaved lime (Tilia cordata, as compared with Scots pine (Pinus sylvestris. Thus to revitalize degraded soils effectively and to accelerate forest succession, apart from phytoland- improvement, it is advisable also to reintroduce mesofauna, e.g. with the use of forest ectohumus.

  16. First records of zerconid mites (Acari: Mesostigmata: Zerconidae from Albania, with description of three new species

    Directory of Open Access Journals (Sweden)

    Ujvári, Zs.

    2010-06-01

    Full Text Available Elaborating a material collected from different regions of Albania, eleven species of the genus Zercon(Zerconidae were identified, three of them, Z. albanicus sp. nov., Z. cavatus sp. nov. and Z. elongatus sp. nov., proved to be newto science. Short description of male and deutonymph of Z. villosus and morphological notes on Z. spatulatus are also provided.New occurrences of each species are depicted on maps as well.

  17. Three new species of Pergalumna (Acari: Oribatida: Galumnidae) from the tropical rainforest of Veracruz, Mexico.

    Science.gov (United States)

    Palacios-Vargas, José G; Villagomez, Fernando

    2017-03-09

    Three new species of oribatid mites of the genus Pergalumna from a tropical rain forest in Veracruz, Mexico are described. Pergalumna hypergranulosa sp. nov. differs from Pergalumna granulatus Balogh & Mahunka, 1967 by unilaterally barbulated bothridial setae, elongated notogastric porose areas, and also a more profuse granulation of the cerotegument. Pergalumna obsidiana sp. nov. differs from P. granulatus by the unilateral barbulation of bothridial setae and the presence of protuberances on the genital plates; from Pergalumna paralongisetosa Ermilov & Kalúz, 2012 by a diverging cerotegumental granulation on the notogaster. Pergalumna dactylaris sp. nov. differs from Pergalumna striata (Pérez-Íñigo & Baggio, 1980) by its bigger size and the presence of three notogastric porose areas instead of four and from Pergalumna decorata Balogh & Mahunka, 1977, also by the bigger size, a different position of setae lm and la and smaller but not minute interlamellar setae. These are the first Mexican species descriptions of this genus.

  18. Laboratory Study on Biological Control of Ticks (Acari: Ixodidae) by Entomopathogenic Indigenous Fungi (Beauveria bassiana)

    OpenAIRE

    M Abdigoudarzi; Esmaeilnia, K; Shariat, N

    2009-01-01

    Background: Chemical control method using different acaricides as spray, dipping solution or pour-on is routinely used for controlling ticks. Biological control agents are favorable due to their safety for animals and environment. Entomopathogenic fungi such as Beauveria bassiana are well known for controlling ticks. In this study, two Iranian indigenous strains of B. bassiana (B. bassiana 5197 and B. bassiana Evin) were selected and grown on specific me­dia. The pathogenic effects of the...

  19. Detection of Alpha and Gamma-Proteobacteria in Amblyomma triste (Acari: Ixodidae) from Uruguay.

    Science.gov (United States)

    Venzal, José Manuel; Estrada-Peña, Agustín; Portillo, Aránzazu; Mangold, Atilio J; Castro, Oscar; de Souza, Carlos G; Félix, María L; Pérez-Martínez, Laura; Santibánez, Sonia; Oteo, José A

    2008-01-01

    Amblyomma triste is the most prevalent tick species reported in human tick bites in Uruguay and has been found to be infected with Rickettsia parkeri, but no other microorganisms have been reported from this tick. A sample of 254 adults of A. triste was collected by flagging on vegetation in suburban areas in southern Uruguay. Pools of five ticks were assembled and a screening for the DNA from the resulting 51 pools was realized by PCR assays using primers for amplifying a fragment of 16S rRNA gene for members of Anaplasmataceae. Seventeen pools were positive (33%) and the sequenciation of the gene fragment amplified revealed the presence of a putative new Alpha-Proteobacterium (denominated Atri-uru). The phylogenetic analysis showed that this microorganism is closely related to the symbiont of I. ricinus denominated 'Candidatus Midichloria mitochondrii' and other associated organisms. This rickettsial symbiont of ticks is included in a recent new clade proposed for the Alpha subclass of the Proteobacteria. The discovery of this bacterium in A. triste is the first evidence of this group of Rickettsiales detected in the Genus Amblyomma, and the first record in South America. Also, in two of 17 positive samples a Gamma-Proteobacterium related to Francisella-like organisms was detected.

  20. Detection of Borrelia lonestari in Amblyomma americanum (Acari: Ixodidae) from Tennessee.

    Science.gov (United States)

    Stegall-Faulk, T; Clark, D C; Wright, S M

    2003-01-01

    Genetic sequences characteristic of Borrelia lonestari (Barbour et al. 1996) were detected in two pools of adult Amblyomma americanum (L.) from Tennessee, corresponding to an estimated minimum field infection rate of 8.4 infected ticks/1000 adults. DNA amplification was conducted using primers derived from the B. lonestari flagellin gene that would also amplify Borrelia burgdorferi (Johnson, Schmid, Hyde, Steigerwalt, and Brenner). Species-specific, internal probes were then used to differentiate between genetic sequences of the spirochetes. Subsequent nucleotide sequencing confirmed the presence of B. lonestari in A. americanum; B. burgdorferi was not detected. This represents the first report of B. lonestari from Tennessee, and suggests that Lyme-like illness may occur in Tennessee.

  1. Evidence of Borrelia lonestari DNA in Amblyomma americanum (Acari: Ixodidae) removed from humans.

    Science.gov (United States)

    Stromdahl, Ellen Y; Williamson, Phillip C; Kollars, Thomas M; Evans, Sandra R; Barry, Ryan K; Vince, Mary A; Dobbs, Nicole A

    2003-12-01

    We used a nested PCR with Borrelia flagellin gene (flaB) primers and DNA sequencing to determine if Borrelia lonestari was present in Amblyomma americanum ticks removed from military personnel and sent to the Tick-Borne Disease Laboratory of the U.S. Army Center for Health Promotion and Preventive Medicine. In our preliminary investigation, we detected Borrelia sequences in 19 of 510 A. americanum adults and nymphs from Ft. A. P. Hill, Va. During the 2001 tick season, the flaB primers were used to test all A. americanum samples as they were received, and 29 of 2,358 A. americanum samples tested individually or in small pools were positive. PCRs with 2,146 A. americanum samples in 2002 yielded 26 more Borrelia-positive samples. The positive ticks in 2001 and 2002 were from Arkansas, Delaware, Kansas, Kentucky, Maryland, New Jersey, North Carolina, Tennessee, and Virginia. The last positive sample of the 2001 season was a pool of larvae. To further investigate larval infection, we collected and tested questing A. americanum larvae from Aberdeen Proving Ground, Md.; 4 of 33 pools (40 larvae per pool) were positive. Infection of unfed larvae provides evidence of the maintenance of B. lonestari by means of transovarial transmission. Sequence analysis revealed that the amplicons were identical to sequences of the B. lonestari flaB gene in GenBank. Despite the low prevalence of infection, the risk of B. lonestari transmission may be magnified because A. americanum is often abundant and aggressive, and many tick bite victims receive multiple bites.

  2. Bacteria of the genus Rickettsia in ticks (Acari: Ixodidae) collected from birds in Costa Rica.

    Science.gov (United States)

    Ogrzewalska, Maria; Literák, Ivan; Capek, Miroslav; Sychra, Oldřich; Calderón, Víctor Álvarez; Rodríguez, Bernardo Calvo; Prudencio, Carlos; Martins, Thiago F; Labruna, Marcelo B

    2015-06-01

    The aim of this study was to document the presence of Rickettsia spp. in ticks parasitizing wild birds in Costa Rica. Birds were trapped at seven locations in Costa Rica during 2004, 2009, and 2010; then visually examined for the presence of ticks. Ticks were identified, and part of them was tested individually for the presence of Rickettsia spp. by polymerase chain reaction (PCR) using primers targeting fragments of the rickettsial genes gltA and ompA. PCR products were DNA-sequenced and analyzed in BLAST to determine similarities with previously reported rickettsial agents. A total of 1878 birds were examined, from which 163 birds (9%) were infested with 388 ticks of the genera Amblyomma and Ixodes. The following Amblyomma (in decreasing order of abundance) were found in immature stages (larvae and nymphs): Amblyomma longirostre, Amblyomma calcaratum, Amblyomma coelebs, Amblyomma sabanerae, Amblyomma varium, Amblyomma maculatum, and Amblyomma ovale. Ixodes ticks were represented by Ixodes minor and two unclassified species, designated here as Ixodes sp. genotype I, and Ixodes sp. genotype II. Twelve of 24 tested A. longirostre ticks were found to be infected with 'Candidatus Rickettsia amblyommii', and 2 of 4 A. sabanerae were found to be infected with Rickettsia bellii. Eight of 10 larval Ixodes minor were infected with an endosymbiont (a novel Rickettsia sp. agent) genetically related to the Ixodes scapularis endosymbiont. No rickettsial DNA was found in A. calcaratum, A. coelebs, A. maculatum, A. ovale, A. varium, Ixodes sp. I, and Ixodes sp. II. We report the occurrence of I. minor in Costa Rica for the first time and a number of new bird host-tick associations. Moreover, 'Candidatus R. amblyommii' and R. bellii were found in A. longirostre and A. sabanerae, respectively, in Costa Rica for the first time.

  3. Ehrlichia chaffeensis (Rickettsiales: Ehrlichieae) infection in Amblyomma americanum (Acari: Ixodidae) at Aberdeen Proving Ground, Maryland.

    Science.gov (United States)

    Stromdahl, E Y; Randolph, M P; O'Brien, J J; Gutierrez, A G

    2000-05-01

    Human monocytic ehrlichiosis (HME) is a sometimes fatal, emerging tick-borne disease caused by the bacterium Ehrlichia chaffeensis. It is frequently misdiagnosed because its symptoms mimic those of the flu. Current evidence indicates that Amblyomma americanum (L.), the lone star tick, is the major vector of HME. To determine if E. chaffeensis is present in ticks at Aberdeen Proving Ground, MD, questing A. americanum ticks were collected from 33 sites. Nucleic acid was extracted from 34 adult and 81 nymphal pools. Sequences diagnostic for E. chaffeensis from three different loci (16S rRNA, 120-kDa protein, and a variable-length polymerase chain reaction [PCR] target, or VLPT) were targeted for amplification by the PCR. Fifty-two percent of the collection sites yielded pools infected with E. chaffeensis, confirming the presence and widespread distribution of E. chaffeensis at Aberdeen Proving Ground. Analysis with the both the 120-kDa protein primers and the VLPT primers showed that genetic variance exists. A novel combination of variance for the two loci was detected in two tick pools. The pathogenic implications of genetic variation in E. chaffeensis are as yet unknown.

  4. Amblyomma cajennense (Fabricius, 1787) (Acari: Ixodidae), the Cayenne tick: phylogeography and evidence for allopatric speciation

    OpenAIRE

    Beati, Lorenza; Nava, Santiago; Burkman, Erica J; Barros-Battesti,Darci M; Labruna, Marcelo B.; Guglielmone, Alberto A; Cáceres, Abraham G; Guzmán-Cornejo, Carmen M; León, Renato; Durden, Lance A; Faccini, João L

    2013-01-01

    Abstract Background Amblyomma cajennense F. is one of the best known and studied ticks in the New World because of its very wide distribution, its economical importance as pest of domestic ungulates, and its association with a variety of animal and human pathogens. Recent observations, however, have challenged the taxonomic status of this tick and indicated that intraspecific cryptic speciation might be occurring. I...

  5. Isolation and characterization of microsatellite loci from the tick Amblyomma aureolatum (Acari: Ixodidae).

    Science.gov (United States)

    Ogrzewalska, M; Bajay, M M; Schwarcz, K; Bajay, S K; Telles, M P C; Pinheiro, J B; Zucchi, M I; Pinter, A; Labruna, M B

    2014-11-14

    Amblyomma aureolatum (Pallas) is the main vector of the bacterium Rickettsia rickettsii, the etiological agent of Brazilian spotted fever. This disease is the most lethal human spotted fever rickettsiosis in the world. Microsatellite loci were isolated from a dinucleotide-enriched library produced from A. aureolatum sampled in Southeastern Brazil. Eight polymorphic microsatellites were further characterized among 38 individuals sampled from São Paulo metropolitan region. The number of observed alleles ranged from 2 to 9, observed heterozygosity was 0.184-0.647, and expected heterozygosity was 0.251-0.747. Cross-species amplifications suggested that these loci will be useful for other Amblyomma species.

  6. First report of the male of Amblyomma rotundatum (Acari: Ixodidae) from a field-collected host.

    Science.gov (United States)

    Labruna, Marcelo B; Terrassini, Flávio A; Camargo, Luís Marcelo A

    2005-11-01

    An adult male of the tick Amblyomma rotundatum Koch was collected on a naturally infested lizard, Tropidurus sp. (Squamata: Tropiduridae), at Monte Negro, State of Rondonia, Brazil. The tick's identity was confirmed morphologically and by analysis of the second internal transcribed spacer of the ribosomal DNA. This is the third known male specimen of A. rotundatum, a species that has been shown to reproduce exclusively by parthenogenesis. The two previously reported male specimens seemed to be partially teratological or gynandromorphic, whereas the present specimen shows no visible genetic or developmental anomaly.

  7. Cross-mating experiments with geographically different populations of Amblyomma cajennense (Acari: Ixodidae).

    Science.gov (United States)

    Labruna, Marcelo B; Soares, João F; Martins, Thiago F; Soares, Herbert S; Cabrera, Ricardo R

    2011-05-01

    The present study evaluated the reproductive compatibility of the crosses between adult ticks of the following three geographically different populations of Amblyomma cajennense: State of São Paulo (SP), southeastern Brazil; State of Rondônia (RO), northern Brazil; and Colombia (CO). In addition, crosses between A. cajennense ticks from Argentina (AR) and SP ticks were also performed. The Argentinean population (AR) was compatible with SP because their crosses resulted in high % egg hatching (mean values ranging from 71.5 to 93.5%), similarly to all homologous (intrapopulational) crosses. In contrast, the tick populations SP, RO, and CO were shown to be incompatible with each other, since their heterologous (interpopulational) crosses always resulted in very low % egg hatching (range: 0-5%). The F(1) larval offspring derived from some of these females that yielded 5% egg hatching were reared until the F(1) adult stage. In all cases, only adult females molted from engorged nymphs. These F(1) females were likely to be a product of thelytokous parthenogenesis of the SP, RO, and CO females that were used in the heterologous crosses. Reproductive incompatibility is not expected to occur between different populations of a single species. Thus, our results suggest that the taxon A. cajennense might be represented by a complex of different species, whereas SP and AR ticks might represent a single species. Further populational genetic studies, coupled with extensive morphological analyses, are needed to clarify and determine a possible complex of valid species that might have been classified under the taxon A. cajennense.

  8. Infestations of the bont tick Amblyomma hebraeum (Acari: Ixodidae) on different breeds of cattle in Zimbabwe.

    Science.gov (United States)

    Norval, R A; Sutherst, R W; Kerr, J D

    1996-10-01

    Infestations of adults and nymphs of Amblyomma hebraeum were counted on Brahman (Br), Brahman x Simmental (BS), Sanga (Sa) and Hereford (He) steers exposed to infested pastures at Mbizi in southern Zimbabwe in 1986-1987. Herefords were always the most heavily infested, while the Sanga tended to carry the fewest ticks with the Brahman and Brahman x Simmental groups being in between. The ratios of the engorged females on the four breeds were 2.3:1.4:1.4:1.0 for He:Br:BS:Sa. The ratios of the standard nymphs were 2.2:1.4:1.7:1.0 for He:Br:BS:Sa. The results confirm earlier observations in Africa and support the view that there are genetic differences between breeds in the expression of resistance to this tick species.

  9. Electrophoretically detectable protein variation in natural populations of the lone star tick, Amblyomma americanum (Acari: Ixodidae).

    Science.gov (United States)

    Hilburn, L R; Sattler, P W

    1986-08-01

    Nine populations of Amblyomma americanum (L.) were examined electrophoretically for variation of 21 enzymes. Only three enzymes were not polymorphic and the average heterozygosity per individual (h) for the species was 0.085 with a range of 0.077 to 0.110, comparing well with values in other arthropods. The average Nei identity value for pairwise comparisons among the nine populations was high, 0.994 +/- 0.004 (I +/- SD). These high identity values and the absence of geographic structuring of the protein variation suggest that this species is genetically homogeneous. Normal levels of genic variability within and a lack of divergence between populations were not predicted by models developed to describe these genetic characteristics on the basis of the heterogeneities encountered by parasites in their environment. An analysis of data from several different species of ticks suggests host mobility and abundance, as well as tick abundance and selectivity in choosing a host, are important parameters in determining genetic variation in these ectoparasites.

  10. Characterization of Genetic Variability and Population Structure of the Tick Amblyomma aureolatum (Acari: Ixodidae).

    Science.gov (United States)

    Ogrzewalska, Maria; Schwarcz, Kaiser; Bajay, Miklos M; Bajay, Stephanie K; Pinheiro, José B; Zucchi, Maria I; Pinter, Adriano; Labruna, Marcelo B

    2016-07-01

    The hard tick Amblyomma aureolatum (Pallas) is a vector of the bacterium Rickettsia rickettsii, the etiologic agent of Brazilian spotted fever (BSF) in parts of Brazil. Despite its wide distribution in southeastern South America and its public health importance, there is no information about genetic variation of this species that might help to understand the epidemiology of BSF. Using data from eight microsatellite markers and ticks from six localities, we used a population genetics approach to test the hypothesis that tick populations from areas with the presence of R. rickettsii are genetically different from ticks from areas without R. rickettsii Contrary to expectations, we found low genetic structure between studied regions. Thus, the presence of R. rickettsii in the specific area is more likely correlated with ecological and the environmental conditions or due to unknown gene coding regions of A. aureolatum genome that would be related to R. rickettsii infection resistance.

  11. Hosts, distribution and genetic divergence (16S rDNA) of Amblyomma dubitatum (Acari: Ixodidae).

    Science.gov (United States)

    Nava, Santiago; Venzal, José M; Labruna, Marcelo B; Mastropaolo, Mariano; González, Enrique M; Mangold, Atilio J; Guglielmone, Alberto A

    2010-08-01

    We supply information about hosts and distribution of Amblyomma dubitatum. In addition, we carry out an analysis of genetic divergence among specimens of A. dubitatum from different localities and with respect to other Neotropical Amblyomma species, using sequences of 16S rDNA gene. Although specimens of A. dubitatum were collected on several mammal species as cattle horse, Tapirus terrestris, Mazama gouazoubira, Tayassu pecari, Sus scrofa, Cerdocyon thous, Myocastor coypus, Allouata caraya, Glossophaga soricina and man, most records of immature and adult stages of A. dubitatum were made on Hydrochoerus hydrochaeris, making this rodent the principal host for all parasitic stages of this ticks. Cricetidae rodents (Lundomys molitor, Scapteromys tumidus), opossums (Didelphis albiventris) and vizcacha (Lagostomus maximus) also were recorded as hosts for immature stages. All findings of A. dubitatum correspond to localities of Argentina, Brazil, Paraguay and Uruguay, and they were concentrated in the Biogeographical provinces of Pampa, Chaco, Cerrado, Brazilian Atlantic Forest, Parana Forest and Araucaria angustifolia Forest. The distribution of A. dubitatum is narrower than that of its principal host, therefore environmental variables rather than hosts determine the distributional ranges of this tick. The intraspecific genetic divergence among 16S rDNA sequences of A. dubitatum ticks collected in different localities from Argentina, Brazil and Uruguay was in all cases lower than 0.8%, whereas the differences with the remaining Amblyomma species included in the analysis were always bigger than 6.8%. Thus, the taxonomic status of A. dubitatum along its distribution appears to be certain at the specific level.

  12. Amblyomma parvum Aragão, 1908 (Acari: Ixodidae): Phylogeography and systematic considerations.

    Science.gov (United States)

    Lado, Paula; Nava, Santiago; Labruna, Marcelo B; Szabo, Matias P J; Durden, Lance A; Bermudez, Sergio; Montagna, Matteo; Sánchez Quirós, Ana C; Beati, Lorenza

    2016-07-01

    The geographical distribution of Amblyomma parvum Aragão 1908 in the New World is disjunct, with two main clusters separated from each other by the Amazon basin. The main objectives of this study were to further investigate the systematic relationships within A. parvum, to determine whether or not populations from different geographical areas might represent cryptic species, and to reconstruct the phylogeographical evolutionary history of the species. The genetic diversity of A. parvum collected throughout its distributional range was analyzed by using 6 molecular markers: 5 mitochondrial [the small and the large ribosomal subunits 12rDNA and 16SrDNA, the cytochrome oxidase I (COI) and II (COII) and the control region or d-loop (DL)], and one nuclear (ITS2, Inter transcribed spacer 2). Phylogenetic trees were inferred by using maximum parsimony and Bayesian analyses. In addition, node dating was attempted for the main lineages identified phylogenetically. Although mitochondrial and nuclear topologies were not totally congruent, they all identified at least two main supported clusters, a Central American lineage, and a Brazilian-Argentinian lineage. Clade support and divergence values strongly suggest that the two lineages correspond to different taxonomic entities. Node dating placed the split between the Central American and the Brazilian-Argentinian lineages at approximately 5.8-4.9 Mya, just after the progressive replacement of the dry areas that occupied the northern part of South America by the Amazon Basin in the early-mid Miocene. This event might be the cause of fragmentation and putative speciation within the ancestral relatively xerophilic A. parvum population.

  13. Patterns of cuticular hydrocarbon variation and genetic similarity between natural populations of Amblyomma cajennense (Acari: Ixodidae).

    Science.gov (United States)

    Estrada-Peña, A; Guglielmone, A A; Mangold, A J; Castellá, J

    1993-10-01

    Gas chromatography has been used to analyze the variation in cuticular hydrocarbon patterns between several populations of Amblyomma cajennense. 88 compounds were detected and these could be divided into 17 groups of hydrocarbons. Heterozygosis in the populations ranges from 0% to 25.84%. Isomers for pentacosane, heptacosane and nonatriacontane are the most variable, with 13, 10 and 11 variants, respectively. Nei's genetic identity and genetic distance show that populations may be considered as regional variants of only one species: the results do not indicate the presence of sibling species. However, a relatively high genetic distance has been observed between several Cuban and continental populations, suggesting a long reproductive isolation. Gas chromatography of cuticular hydrocarbons is a good alternative to isozyme analysis for population studies, when collecting conditions do not allow the use of live ticks and only alcohol-preserved collections are available. The high number of compounds available for genetic studies will provide excellent markers for evaluating the extent of gene flow and migration of tick species.

  14. Phylogeography and demographic history of Amblyomma variegatum (Fabricius) (Acari: Ixodidae), the tropical bont tick.

    Science.gov (United States)

    Beati, Lorenza; Patel, Jaymin; Lucas-Williams, Helene; Adakal, Hassane; Kanduma, Esther G; Tembo-Mwase, Enala; Krecek, Rosina; Mertins, James W; Alfred, Jeffery T; Kelly, Susyn; Kelly, Patrick

    2012-06-01

    The genetic diversity of Amblyomma variegatum (Fabricius) from four Caribbean islands and five African countries was compared by analyzing the sequences of three gene fragments, two mitochondrial (12SrDNA and D-Loop-DL), and one nuclear (intergenic transcribed spacer 2 [ITS2]). Genetic variability of the ITS2 DNA fragment consisted of only uninformative single nucleotide mutations, and therefore this gene was excluded from further analyses. Mitochondrial gene divergences among African populations and between Caribbean and African populations were very low. Nevertheless, the data suggest that A. variegatum is divided into distinct East and West African groups, the western group including all Caribbean samples. Phylogenetic analyses of the 12SrDNA and DL gene sequences showed that the West African A. variegatum clustered in a well-supported monophyletic clade, distinct from eastern paraphyletic lineages. Sequences of A. variegatum from the Caribbean were embedded in the West African clade, which supports the known West African historical origin for these ticks.

  15. Distribution and genetic variation of Amblyomma triste (Acari: Ixodidae) in Argentina.

    Science.gov (United States)

    Guglielmone, Alberto A; Nava, Santiago; Mastropaolo, Mariano; Mangold, Atilio J

    2013-09-01

    A study was conducted to investigate the distribution of Amblyomma triste in Argentina under the hypothesis that this tick prevails in riparian localities along the Paraná River and adjacent humid environments from 34° 30' S to 25° 20' S, approximately. Ticks were collected from mammals and vegetation in those environments from November 2008 to October 2012. Additionally, genetic variation was tested from Argentinean, Brazilian, Chilean, and Uruguayan populations of A. triste by comparing sequences of 16S rDNA mitochondrial gene. The hypothesis was not confirmed because A. triste were collected at 36° 16' S, well beyond the southern limit predicted, and the distribution along the banks of the Paraná River was not continuous. The northernmost population of A. triste within Argentina was found at 25° 42' S. Still undetermined abiotic factors and plant communities may play a role in modulating the abundance of A. triste because host availability does not appear to be a restriction factor. The genetic variation among A. triste populations from Argentina, Brazil, and Uruguay indicates that they belong to a unique taxon that is considered bona fide A. triste (type locality Montevideo, Uruguay) while it is unclear if the Chilean population of A. triste is conspecific with the other populations investigated in this study. It would be of importance to compare those genetically homogeneous populations with other populations of alleged A. triste, especially populations established in the Nearctic Zoogeographic Region in Mexico and USA.

  16. Phylogeography and Demographic History of Amblyomma variegatum (Fabricius) (Acari: Ixodidae), the Tropical Bont Tick

    OpenAIRE

    Beati, Lorenza; Patel, Jaymin; Lucas-Williams, Helene; Adakal, Hassane; Kanduma, Esther G.; Tembo-Mwase, Enala; Krecek, Rosina; Mertins, James W.; Alfred, Jeffery T.; Kelly, Susyn; Kelly, Patrick

    2012-01-01

    The genetic diversity of Amblyomma variegatum (Fabricius) from four Caribbean islands and five African countries was compared by analyzing the sequences of three gene fragments, two mitochondrial (12SrDNA and D-Loop-DL), and one nuclear (intergenic transcribed spacer 2 [ITS2]). Genetic variability of the ITS2 DNA fragment consisted of only uninformative single nucleotide mutations, and therefore this gene was excluded from further analyses. Mitochondrial gene divergences among African populat...

  17. Larval morphology of benthic and interstitial water mites (Acari: Hydrachnidia) from a Luxembourgian stream.

    Science.gov (United States)

    Martin, Peter

    2016-07-22

    During a project of the Luxembourg National Museum of Natural History the parasitism of water mites dwelling a small stream (Lurenzgriecht) in the southern part of the country (Gutland) was investigated. The first step of the project was to clarify the taxonomy of the larvae of all stream-dwelling species. For that reason emergence traps were installed in the stream during 2002 and emptied every 14 days to obtain parasitized hosts. Additionally, rearing experiments were implemented in the laboratory to produce larvae of well-defined species/mothers but only with partly success. The stream has a well-known water mite inventory of 22 species, almost equally composed of true benthic species and species strongly adapted to hyporheic interstitial. The larvae of five species (Torrenticola elliptica, Atractides pumilus, Feltria motasi, Ljania macilenta, Neoacarus hibernicus) were described here as new to science. Due to the poor quality and availability of former descriptions a re-description was made for another species living in the stream (Sperchon denticulatus-gr.) and, additionally, for Hygrobates fluviatilis, a common stream-dwelling species of the area. The larvae of nine species of the Lurenzgriecht had already been sufficiently described for identification purposes (Protzia eximia, Sperchonopsis verrucosa, Sperchon clupeifer, S. thienemanni, Lebertia glabra, Atractides fonticolus, Feltria rouxi, Ljania bipapillata, Aturus fontinalis). The larvae of some other species (Aturus crinitus, Kongsbergia spp., Stygohydracarus subterraneus, Arrenurus haplurus) could neither be reared in the lab nor attributed to species for taxonomic reasons. With the exception of Kongsbergia spp. (no known larva of the genus worldwide) and Aturus crinitus (a rare species in the Lurenzgriecht) an identification key was compiled for the larvae of all known species of the stream using the new descriptions and all available information on the other ones.

  18. Repellency of the oily extract of neem seeds (Azadirachta indica) against Varroa destructor (Acari: Varroidae).

    Science.gov (United States)

    González-Gómez, Rebeca; Otero-Colina, Gabriel; Villanueva-Jiménez, Juan A; Peña-Valdivia, Cecilia Beatriz; Santizo-Rincón, José Antonio

    2012-03-01

    A crude oil extract of neem seed (Azadirachta indica, Sapindales: Meliaceae) was evaluated for repellency on Varroa destructor Anderson and Trueman. Burgerjon's tower was used to spray worker bee pupae with 0.0, 0.3, 0.7, 1.3, 2.6, 5.3, 10.6 and 21.1% neem extract concentrations. Sprayed pupae were attached to observation arenas and incubated at 32 ± 2°C and 70 ± 10% RH. The ability of V. destructor to locate and feed on treated and untreated pupae was monitored from 30 min to 72 h after spray. Higher and more stable repellency was achieved with 2.6, 5.3, 10.6 and 21.1% neem extract. At the highest concentration, 98% of V. destructor were prevented to settle on bee pupae, resulting in 100% V. destructor mortality at 72 h.

  19. Detection of a novel Rickettsia sp. in soft ticks (Acari: Argasidae) in Algeria.

    Science.gov (United States)

    Lafri, Ismail; Leulmi, Hamza; Baziz-Neffah, Fadhila; Lalout, Reda; Mohamed, Chergui; Mohamed, Karakallah; Parola, Philippe; Bitam, Idir

    2015-01-01

    Argasid ticks are vectors of viral and bacterial agents that can infect humans and animals. In Africa, relapsing fever borreliae are neglected arthropod-borne pathogens that cause mild to deadly septicemia and miscarriage. It would be incredibly beneficial to be able to simultaneous detect and identify other pathogens transmitted by Argasid ticks. From 2012 to 2014, we conducted field surveys in 4 distinct areas of Algeria. We investigated the occurrence of soft ticks in rodent burrows and yellow-legged gull (Larus michahellis) nests in 10 study sites and collected 154 soft ticks. Molecular identification revealed the occurrence of two different soft tick genera and five species, including Carios capensis in yellow-legged gull nests and Ornithodoros occidentalis, Ornithodoros rupestris, Ornithodoros sonrai, Ornithodoros erraticus in rodent burrows. Rickettsial DNA was detected in 41/154, corresponding to a global detection rate of 26.6%. Sequences of the citrate synthase (gltA) gene suggest that this agent is a novel spotted fever group Rickettsia. For the first time in Algeria, we characterize a novel Rickettsia species by molecular means in soft ticks.

  20. Three new species of the genus Austrophthiracarus from New Zealand (Acari: Oribatida: Phthiracaridae).

    Science.gov (United States)

    Liu, Dong; Zhang, Zhi-Qiang

    2014-03-24

    Three new species of Austrophthiracarus (Oribatida: Phthiracaridae) from New Zealand are described: Austrophthiracarus matuku sp. nov. from the Bethells Matuku Reserve, Auckland, Austrophthiracarus notoporosus sp. nov. from the Tutoko Bench, Fiordland and Austrophthiracarus karioi sp. nov. from the Mt. Karioi, Waikato. Holotype specimens are deposited in the New Zealand Arthropod Collection, Landcare Research and paratypes are deposited in the Northeast Institute of Geography and Agroecology, Chinese Academy of Sciences.

  1. Gohieria fusca (Acari: Astigmata) found in the filter dusts of air conditioners in China.

    Science.gov (United States)

    Li, Chaopin; Zhan, Xiaodong; Zhao, Jinhong; Wei, Guo

    2014-10-06

    Objetivo: La Gohieria fusca (Oudemans, 1902) se reproduce en la harina de trigo, arroz, maíz, piensos, salvado de trigo y los medicamentos a base de hierbas, además de en otros productos almacenados; este ácaro puede tener una reactividad cruzada de leve a moderada con alérgenos de los ácaros del polvo domésticos, una importante fuente de alérgenos de interior asociada al asma y otras afecciones alérgicas. Los sistemas de aire acondicionado son indispensables en edificios públicos y civiles, y las pantallas de estos aparatos son los lugares donde más se acumula el polvo. Se realizó este estudio con el fin de investigar si la Gohieria fusca puede reproducirse en las pantallas de los acondicionadores de aire instalados en espacios públicos o viviendas en la ciudad de Wuhu, provincia de Anhui, China. Métodos: Se recogieron 430 muestras de polvo de los filtros de los sistemas de aire acondicionado en la cafeterías de centros educativos, mercados, hoteles y edificios civiles entre junio y septiembre de 2013, y se aisló la Gohieria fusca de dichas muestras. Resultados: Los resultados indicaron que la Gohieria fusca estaba presente en 98 de las 430 muestras (22,79%), y la tasa de reproducción fue significativa en los filtros del aire acondicionado de diferentes espacios (c2=18.294, P.

  2. A dispersal model for the range expansion of blacklegged tick (Acari: Ixodidae).

    Science.gov (United States)

    Madhav, Nita K; Brownstein, John S; Tsao, Jean I; Fish, Durland

    2004-09-01

    The blacklegged tick, Ixodes scapularis Say, a vector for the agents of Lyme borreliosis and other diseases, has expanded its range dramatically over the past 20 yr. However, the relative contributions of different vertebrate host species to this expansion have remained largely unexplored. To address this issue, we simulated the expansion of a theoretical tick population across a simple landscape by using a deterministic, spatially explicit, cellular automata model. The model incorporates the ecology of ticks and three vertebrate hosts: white-tailed deer, Odocoileus virginianus Zimmermann; white-footed mouse, Peromyscus leucopus Rafinesque; and American robin, Turdus migratorius L. Host contribution to tick dispersal is modeled as a function of tick burden, home range size, and population density. These parameters were determined using published and unpublished data. Our results suggest that 1) hosts with high tick burdens and large home ranges (e.g., deer) play a critical role in I. scapularis range expansion; 2) hosts with small home ranges (e.g., mice) can limit range expansion if they divert a sufficient number of ticks from feeding on more mobile hosts; and (3) birds that migrate annually (e.g., robins) can play a crucial role in tick range expansion.

  3. Recognition of the tick genus Anocentor Schulze, 1937 (Acari: Ixodidae) by numerical taxonomy.

    Science.gov (United States)

    Borges, L M; Labruna, M B; Linardi, P M; Ribeiro, M F

    1998-09-01

    We report on an evaluation of the systematic position of the tick Anocentor nitens (Neumann), examining particularly whether Anocentor should be regarded as a subgenus of Dermacentor or as a separate genus. Twelve species of Ixodidae were analyzed phenetically by using 24 characters of adult ticks. A phenogram indicated 3 clusters, with Anocentor more closely related to Rhipicephalus than to Dermacentor. The results of this study endorse the validity of the monotypic genus Anocentor.

  4. Three new species of the family Phthiracaridae (Acari, Oribatida) from Bolivia.

    Science.gov (United States)

    Niedbała, Wojciech; Starý, Josef

    2015-01-10

    Three new species of the family Phthiracaridae, Austrophthiracarus longisetosus sp. nov., Phthiracarus allocotos sp. nov., Protophthiracarus amboroensis sp. nov. from Bolivia are described and figured. A comparison of morphological similarities with the most closely related species is presented. Additional descriptions and taxonomical notes for three ptyctimous species: Acrotritia peruensis (Hammer, 1961), Acrotritia vestita (Berlese, 1913), and Steganacarus (Rhacaplacarus) sedecimus Niedbała, 2004 are added. A list of twenty six ptyctimous species from Bolivia is presented, ten of these species are new records for the fauna of Bolivia. A key to all species of ptyctimous mites of Bolivia is presented.

  5. Ticks (Acari: Ixodidae) and spirochetes (spirochaetaceae: spirochaetales) recovered from birds on a Georgia Barrier Island.

    Science.gov (United States)

    Durden, L A; Oliver, J H; Kinsey, A A

    2001-03-01

    From September 1997 through July 1999, 300 individuals and 46 species of birds were mist-netted and screened for ticks and spirochetes on St. Catherine's Island, Liberty County, GA. Seventy-six (25%) of the birds were parasitized by a meal intensity of 4.6 ticks. Seasonally, more birds were infested with ticks during the summer (50% in 1998, 34% in 1999) than in spring (15% in 1998, 11% in 1999) or fall (21% in 1997, 20% in 1998), mainly because of severe infestations on some birds by immature stages of the lone star tick, Amblyomma americanum (L.), during this season. Eight species ofticks were recovered from 14 species of birds during this study: A. americanum (74 nymphs, 168 larvae); the blacklegged tick, Ixodes scapularis Say (11 nymphs, 28 larvae), the Gulf Coast tick, Amblyomma maculatum Koch (two nymphs, 29 larvae); Ixodes minor Neumann (16 larvae); the rabbit tick. Haemaphysalis leporispalustris (Packard) (one nymph, 14 larvae); the bird tick Ixodes brunneus Koch (two larvae); the American dog tick, Dermacentor variabilis (Say) (one nymph); and Ixodes affinis Neumann (one larva). The Carolina wren was parasitized by more species of ticks (seven) than any other bird species, followed by the northern cardinal (five), white-throated sparrow (four) and painted bunting (three). Spirochetes were isolated in BSK II medium from one tick (a nymphal A. americanum) and from skin biopsies of 12 (4%) of the individual birds (three downy woodpeckers, three northern waterthrushes, two Carolina wrens, one American redstart, one pine warbler, one Swainson's thrush, and one white-eyed vireo) all in fall 1997. This concentrated phenology of spirochete isolations might reflect periodic amplification or recrudescence of spirochetes in reservoir avian hosts.

  6. Brevipalpus phoenicis (Geijskes) species complex – resurrection of E. W. Baker’s species (Acari: Tenuipalpidae)

    Science.gov (United States)

    Brevipalpus phoenicis sensu lato has been identified from countries all over the world and has been associated with many different host plant species. As a taxon, it shows a degree of morphological variation. A combination such as this often indicates that the taxon actually represents a complex o...

  7. Amblyomma cajennense (Fabricius, 1787) (Acari: Ixodidae), the Cayenne tick: phylogeography and evidence for allopatric speciation

    National Research Council Canada - National Science Library

    Beati, Lorenza; Nava, Santiago; Burkman, Erica J; Barros-Battesti, Darci M; Labruna, Marcelo B; Guglielmone, Alberto A; Caceres, Abraham G; Guzman-Cornejo, Carmen M; Leon, Renato; Durden, Lance A; Faccini, Joao LH

    2013-01-01

    Background: Amblyomma cajennense F. is one of the best known and studied ticks in the New World because of its very wide distribution, its economical importance as pest of domestic ungulates, and its association with a variety...

  8. First documentation of ivermectin resistance in Rhipicephalus sanguineus sensu lato (Acari: Ixodidae).

    Science.gov (United States)

    Rodriguez-Vivas, R I; Ojeda-Chi, M M; Trinidad-Martinez, I; Pérez de León, A A

    2017-01-15

    The brown dog tick, Rhipicephalus sanguineus sensu lato (Latreille, 1806), is an ectoparasite and disease vector of significant veterinary and public health importance that is distributed widely around the world. The intensive use of synthetic acaricides for tick control exerts a strong selective pressure for brown dog ticks to become resistant to them. Here, we investigated claims from the field regarding treatment failure associated with the use of veterinary products containing ivermectin (IVM) to control brown dog ticks infesting dogs in Yucatan state, Mexico. Dogs in six state municipalities were inspected to sample 15 R. sanguineus s.l. Interviews were conducted with dog owners to gather information on the history of dog treatment with conventional acaricides and IVM. The larval immersion test was used on the progeny of adult female ticks infesting dogs to test for susceptibility to IVM. Dose-mortality regressions, lethal concentrations (LC), their confidence intervals, and slope were estimated by probit analysis. Ten tick populations (66.7%) were classified as resistant compared with the most susceptible population. A high inter-population variation in the phenotypic level of IVM resistance was evident (resistance ratio at LC50% and LC99% ranged from 1.0 to 30.5, and from 1.0 to 458.8, respectively). Tick populations classified as resistant were collected from dogs known to have been treated with IVM. To our knowledge, this is the first report of IVM resistance in R. sanguineus s.l. worldwide. Veterinary and pet owner education on integrated tick management practices is required to avoid widespread resistance and increased treatment failure with products containing IVM and other macrocyclic lactones used to control endo- and ectoparasites affecting dogs. Integrated tick management will also help mitigate the burden of brown dog tick-borne diseases on human and animal populations. Copyright © 2016 Elsevier B.V. All rights reserved.

  9. Amblyomma cajennense (Fabricius, 1787) (Acari: Ixodidae), the Cayenne tick: phylogeography and evidence for allopatric speciation.

    Science.gov (United States)

    Beati, Lorenza; Nava, Santiago; Burkman, Erica J; Barros-Battesti, Darci M; Labruna, Marcelo B; Guglielmone, Alberto A; Cáceres, Abraham G; Guzmán-Cornejo, Carmen M; León, Renato; Durden, Lance A; Faccini, João L H

    2013-12-09

    Amblyomma cajennense F. is one of the best known and studied ticks in the New World because of its very wide distribution, its economical importance as pest of domestic ungulates, and its association with a variety of animal and human pathogens. Recent observations, however, have challenged the taxonomic status of this tick and indicated that intraspecific cryptic speciation might be occurring. In the present study, we investigate the evolutionary and demographic history of this tick and examine its genetic structure based on the analyses of three mitochondrial (12SrDNA, d-loop, and COII) and one nuclear (ITS2) genes. Because A. cajennense is characterized by a typical trans-Amazonian distribution, lineage divergence dating is also performed to establish whether genetic diversity can be linked to dated vicariant events which shaped the topology of the Neotropics. Total evidence analyses of the concatenated mtDNA and nuclear + mtDNA datasets resulted in well-resolved and fully congruent reconstructions of the relationships within A. cajennense. The phylogenetic analyses consistently found A. cajennense to be monophyletic and to be separated into six genetic units defined by mutually exclusive haplotype compositions and habitat associations. Also, genetic divergence values showed that these lineages are as distinct from each other as recognized separate species of the same genus. The six clades are deeply split and node dating indicates that they started diverging in the middle-late Miocene. Behavioral differences and the results of laboratory cross-breeding experiments had already indicated that A. cajennense might be a complex of distinct taxonomic units. The combined and congruent mitochondrial and nuclear genetic evidence from this study reveals that A. cajennense is an assembly of six distinct species which have evolved separately from each other since at least 13.2 million years ago (Mya) in the earliest and 3.3 Mya in the latest lineages. The temporal and spatial diversification modes of the six lineages overlap the phylogeographical history of other organisms with similar extant trans-Amazonian distributions and are consistent with the present prevailing hypothesis that Neotropical diversity often finds its origins in the Miocene, after the Andean uplift changed the topology and consequently the climate and ecology of the Neotropics.

  10. The brown dog tick, Rhipicephalus sanguineus (Latreille, 1806) (Acari: Ixodidae): from taxonomy to control.

    Science.gov (United States)

    Dantas-Torres, Filipe

    2008-04-15

    Rhipicephalus sanguineus, commonly known as the brown dog tick, is a three-host tick that feeds primarily on dogs and occasionally on other hosts, including humans. R. sanguineus ticks are widely distributed around the world and they are known vectors of pathogens, such as Babesia canis, Ehrlichia canis, and Rickettsia conorii. The increasing number of cases of human parasitism by R. sanguineus ticks reported in the literature indicates that the interaction between humans and R. sanguineus ticks may be more common than it is actually recognized. The indiscriminate use of acaricides is an emerging problem worldwide and has led to the selection of acaricide resistant tick strains. In this article, the medical and veterinary importance, taxonomy, biology, and ecology of R. sanguineus ticks around the world are reviewed. It also discusses the current strategies for the control of R. sanguineus, highlighting the potential risks associated to the improper use of acaricides, such as environmental pollution and toxicity to humans and other non-target organisms (e.g., tick predators).

  11. South African Acari. V. Some mites of the Kalahari Gemsbok National Park

    Directory of Open Access Journals (Sweden)

    Magdalena K.P. Smith Meyer

    1989-10-01

    Full Text Available A check list of phytophagous and predaceous mites collected from the Kalahari Gemsbok National Park is given. Data on the habitat and distribution of the 12 known species are presented. The following 10 species are described for the first time: Typhlodromus eremicus, Bryobia orycustodia, B. birivularis, B. deserticola, Aplonobia plinthi, Neopetrobia burchelliae, N. convolvuli, N. lerichei, Aegyptobia odontipilis and Abrolophus spiculosus.

  12. South African Acari. IV. Some Mites of the Addo Elephant National Park

    Directory of Open Access Journals (Sweden)

    E.A. Ueckermann

    1988-10-01

    Full Text Available Mites collected in the Addo Elephant National Park from 1968 to 1986 are given in a check list. Comments are made on the habitats and distribution of the 36 known species. The following species are described and illustrated: Tenuipalpus robustae Meyer, spec. nov., Tydeus schotiae Ueckermann spec. nov., Paralorryia grewiae Ueckermann, spec. nov. and Pronematulus pteroni Ueckermann, spec. nov.

  13. Precise identification of different stages of a tick, Ixodes granulatus Supino, 1897 (Acari: Ixodidae

    Directory of Open Access Journals (Sweden)

    Ernieenor Faraliana Che Lah

    2016-07-01

    Conclusions: These findings demonstrated for the first time the establishment of COI gene for identifying I. granulatus nymphal tick which is of paramount importance to the control of potential tick-borne infections in Malaysia. Moreover, this study provides evidence that a combination of morphology and molecular data was corroborated as an accurate tool for tick identification.

  14. Phytoseiid mites (Acari) associated with yerba mate in southern Brazil, with description of a new species.

    Science.gov (United States)

    Gonçalves, Dinarte; Da Silva, Guilherme Liberato; Ferla, Noeli Juarez

    2013-12-11

    Yerba mate is a plant of great socioeconomic importance in southern South America. Little has been published about the phytoseiid mite fauna of yerba mate. This paper presents information about the morphology and distribution of phytoseiid mites collected in yerba mate in the Ilópolis and Putinga counties of Brazil between 2002 and 2004. Four areas with of different forms of cultivation in every county were sampled. A list of the species recorded from that state, and a key for their identification are provided. Sixteen phytoseiid mites species were identified, belonging to 11 genera in the subfamilies Amblyseiinae (13 species) and Typhlodrominae (three species). The most abundant genus was Amblyseius with three species. Phytoscutus sexpilis Muma, 1961 and Typhloseiopsis dorsoreticulatus Lofego, Demite & Feres, 2011 are reported for the first time from Rio Grande do Sul state. This study also includes the description of a new species, Typhlodromips pallinii n. sp.

  15. Eriophyoid mites (Acari: Prostigmata: Eriophyoidea) from Turkey: description of five new species.

    Science.gov (United States)

    Kiedrowicz, Agnieszka; Denizhan, Evsel; Bromberek, Klaudia; Szydło, Wiktoria; Skoracka, Anna

    2016-01-15

    Five new eriophyoid mite species (Eriophyidae) from Turkey are described and illustrated in this paper: Aceria vanensis n. sp., Aceria onosmae n. sp., Aculus lydii n. sp., Aculus gebeliae n. sp. and Aculus spectabilis n. sp.. The descriptions are based on the morphology of females collected from weedy plants, respectively: Amaranthus retroflexus L. (Amaranthaceae), Onosma isauricum Boiss. et Heldr. (Boraginaceae), Hypericum lydium Boiss. (Hypericaceae), Lotus gebelia Vent. (Fabaceae) and Stachys spectabilis Choisy ex DC. (Lamiaceae). The new species were found to be vagrant on their host plants with no visible damage symptoms observed.

  16. Eriophyoid mites from Eastern India: description of three new species (Acari: Prostigmata: Eriophyoidea).

    Science.gov (United States)

    Debnath, Pranab; Karmakar, Krishna

    2016-01-11

    Three new eriophyoid mite species, namely Dichopelmus puncti n. sp. (Eriophyidae) from cogan grass, Imperata cylindrica (Poaceae); Calacarus kalyaniensis n. sp. (Eriophyidae) from Siam weed, Chromolaena odorata (Asteraceae) and Neorhynacus bidhanae n. sp. (Diptilomiopidae) from Croton caudatus (Euphorbiaceae), are described and illustrated from West Bengal, India. The new species are vagrants on the leaves of their respective host plants with no visible damage observed. Keys to the known species of Dichopelmus and Neorhynacus are provided along with a checklist of eriophyoid mites species present in West Bengal.

  17. Phytoseiid mites (Acari, Mesostigmata from the rest areas of Hungarian highways

    Directory of Open Access Journals (Sweden)

    Kontschán, Jenő

    2014-06-01

    Full Text Available The mesostigmatid mite family Phytoseiidae was surveyed in rest areas of Hungarian highways by examination of leaves collected from arboreal plants. All together 15 species, ca. 20 % of the Hungarian Phytoseiid fauna were recorded. Seven species were collected from the ring highway around Budapest (M0, ten species were found alongside the northwestern highway (M1, six-six species were recorded from the north-eastern and south-eastern highways (M3 and M5, and five species from the area of south-western highway (M7, finally two species were found on the newly built southern highway (M6. Euseius finlandicus (Oudemans, 1915 was present in most of the sampling sites, while other common species were Phytoseius macropilis (Banks, 1909; Kampimodromus aberrans (Oudemans, 1930; Neoseiulella aceri (Collyer, 1957 and Typhlodromus (Typhlodromus tiliae Oudemans, 1929. Typhloseiulus peculiaris (Kolodochka, 1980 was shown at the first time from Hungary in the framework of our study, thus a short description and new illustrations are given to this species.

  18. Genus Parichoronyssus (Acari: Macronyssidae) and a description of a new species from Mexico.

    Science.gov (United States)

    Morales-Malacara, J B

    1996-01-01

    The genus Parichoronyssus Radovsky (1966), is redefined, and Parichoronyssus lopezi Morales-Malacara is described as a new species from specimens collected from a bat, Dermanura azteca, taken in Tlaxcala, Mexico. A key to the 6 species of Parichoronyssus is provided.

  19. Detection of permethrin resistance and fipronil tolerance in Rhipicephalus sanguineus (Acari: Ixodidae) in the United States

    Science.gov (United States)

    Permethrin is a commonly used acaricide for tick control on domestic animals and in residential environments, while fipronil use is restricted to on-animal treatment. Following widespread reports of permethrin and fipronil application failures to control indoor infestations of Rhipicephalus sanguin...

  20. Chemical alarm and defence in the oribatid mite Collohmannia gigantea (Acari: Oribatida).

    Science.gov (United States)

    Raspotnig, Günther

    2006-01-01

    The multicomponent oil gland secretion of Collohmannia gigantea, a middle-derivative mixonomatan oribatid mite, is demonstrated to possess alarm pheromonal and allomonal properties. Four components of the secretion, namely the monoterpenes neryl formate, neral, geranial and the aromatic 2-hydroxy- 6-methyl-benzaldehyde (2,6-HMBD), showed moderate to strong alarm pheromonal activity in adult mites. Naturally elicited response is due to neral (about 50% of the secretion) and probably 2,6-HMBD (only 5% of the secretion, but strong alarm pheromonal activity). This is the second report of an alarm pheromone in Oribatida. Tridecane and pentadecane (=the hydrocarbon fraction of the secretion) did not evoke evident behavioural reactions, and most likely serve as solvents and spreading agents for the pheromonal-active components. Alarm reactions were characterized by a short recognition phase (waving movements with legs I), followed by shrinking back and panic escape from the scent source. In addition, all six components of the oil gland secretion, including the hydrocarbons, exhibited strong allomonal properties against a model oribatid predator, the scydmaenid beetle, Euconnus (Tetramelus) oblongus. Considering the widespread semiochemical properties of oil gland secretions in astigmatid mites (=a highly derivative oribatid group), these results furnish evidence for a phylogenetically early origin of defensive and communicative roles of oil gland secretions in oribatids. These roles include alarm communication, defence and the production of anti-fungal compounds.

  1. Reproduction, longevity and life table parameters of Tyrophagus neiswanderi (Acari: Acaridae) at constant temperatures.

    Science.gov (United States)

    Sánchez-Ramos, Ismael; Alvarez-Alfageme, Fernando; Castañera, Pedro

    2007-01-01

    The astigmatid mite Tyrophagus neiswanderi Johnston and Bruce is mainly considered a pest of ornamental and horticultural crops. However, this mite has been found infesting Cabrales cheese in Spain, though its population density is low compared to Acarus farris, the prevalent species of astigmatid mite encountered in Cabrales cheese maturing caves. One of the factors that might be influencing this differential abundance is temperature. In the present study the effect of temperature on reproductive parameters and longevity of T. neiswanderi was examined at six constant temperatures, ranging from 10 to 31 degrees C, and a relative humidity of 90 +/- 5%. Preoviposition period, fecundity and daily fecundity were adversely affected by extreme temperatures while the oviposition period increased as temperature was reduced. Male and female longevity increased as temperature decreased, but males showed significantly greater longevity than females. Additionally, this difference was greater as temperature decreased. The effect of temperature on the intrinsic rate of natural increase of T. neiswanderi populations was described by the non-linear Lactin model. The optimum temperature for development was predicted at 26.6 degrees C. At this temperature, the population doubling time is 2.8 days. The lower and upper thresholds for T. neiswanderi populations were calculated at 7.4 and 31.7 degrees C, respectively. According to these results, the influence of temperature on the low population density of this mite found in Cabrales maturing caves compared with A. farris is discussed.

  2. A method for both mass and individual rearing of fungivorous astigmatid mites (Acari).

    Science.gov (United States)

    Okabe, K; Oconnor, B M

    2001-01-01

    Several species of common fungi were assessed as food for fungivorous astigmatid mites. Hypocrea nigricans, Botrytis cinerea and Flammulina velutipes were generally good food sources for most mites examined. Fungal mycelia growing on PDA (potato dextrose agar) medium were not only nutritionally adequate but the system also maintained high humidity through the water-based agar medium. Among acarid mites, most species of Rhizoglyphinae could be reared easily with the method. Although filter-feeding histiostomatid mites do not feed directly on hyphae, some species were successfully maintained with the same method through multiple generations. Presumably, these mites obtained sufficient nutrition from the agar medium and fungal metabolites leaching into it. Most species ultimately produced dispersing heteromorphic deutonymphs on these media. Individual mites were also maintained in isolation within glass rings on fungal colonies. Using this technique, we were able to compare developmental periods, fecundity and survival periods of mites reared under different conditions.

  3. Ultrastructural morphology of the male and female genital tracts of Psoroptes spp. (Acari: Astigmata: Psoroptidae).

    Science.gov (United States)

    Lekimme, Mireille; Leclercq-Smekens, Michèle; Devignon, Chantal; Leclipteux, Thierry; Poumay, Yves; Losson, Bertrand

    2005-01-01

    The structure of the male and female genital systems of the astigmatid mite Psoroptes ovis (Hering) is described. The male genital system is composed of a paired testis, fused at its proximal part, two vasa deferentia, an ejaculatory duct, into which a single accessory gland opens, and a copulatory organ. The testis is characterized by a peripheric syncytial cell surrounding spermatogonia, spermatocytes, spermatids and spermatozoa which are distributed regularly in the gonad according to the sequence of spermatogenesis. The female genital system consists of a copulatory pore (the bursa copulatrix), a seminal receptacle, paired ovaries and oviducts, a glandular uterus and an ovipositor which leads to the oviporus. Ovaries are composed of somatic cells, germ cells and a central cell, with a multilobular nucleus, connected to oocytes by a stalk. Similarities with other astigmatic mites belonging to Psoroptidia and Acaridia are also discussed.

  4. Chemistry of the oil gland secretion of Collohmannia gigantea (Acari: Oribatida).

    Science.gov (United States)

    Raspotnig, G; Schuster, R; Krisper, G; Fauler, G; Leis, H J

    2001-01-01

    The chemistry of the lemon-scented oil gland secretion of Collohmannia gigantea, a middle-derivative mixonomatan oribatid mite, was investigated by gas chromatography - mass spectrometry. Gas chromatographic profiles of whole body extracts of C. gigantea revealed two distinct chromatographic zones, the first containing a set of six volatile compounds, comprising the lemon-scented monoterpene aldehydes neral and geranial, the scented monoterpene ester neryl formate, a distinctly scented aromatic aldehyde (2-hydroxy-6-methyl-benzaldehyde = 2,6-HMBD), and the two non-scented hydrocarbons, tridecane and pentadecane. All six components appeared to be present in steady relative proportions in scenting mites only, indicating their unity within the scented secretion. In contrast, the components of the second chromatographic zone were less volatile and found in both, scenting and nonscenting mites. Chemically, they represent a set of fatty acids of already known cuticular origin. The secretion bouquet of the first chromatographic zone was linked with oil glands by histochemical means: large amounts of aldehydes were present only in oil gland reservoirs, not in any other region of the mite body. While chemical profiles of oil gland secretions of several dozen astigmatid mites are known, only one other oribatid oil gland composition, from a desmonomatan species, has been elucidated, being almost the same as that of C. gigantea. Moreover, all components of these two secretions are widely distributed amongst astigmatid mite species and may also be common in a restricted set of middle-derivative oribatids. These findings are consistent with the idea of astigmatid mite origin from a mixonomatan-desmonomatan group.

  5. [Acari in housedust of the Brazilian capitals and Fernando de Noronha Island].

    Science.gov (United States)

    Galvão, A B; Guitton, N

    1986-01-01

    This paper deals with the geographical distribution of astigmatid mites related to human allergy and found in house dust samples collected in all states capitals in Brazil. Definitions and keys for the identification of the species of mites are presented.

  6. Four new records of mites (Acari: Astigmata phoretic on insects in Riyadh, Saudi Arabia

    Directory of Open Access Journals (Sweden)

    Mohamed W. Negm

    2011-06-01

    Full Text Available A survey was carried out to investigate astigmatid mites associated with four unrelated insect species, belonging to four families. The four insect species, Musca domestica (Linnaeus, 1785 (Diptera: Muscidae, Labidura riparia (Pallas, 1773 (Dermaptera: Labiduridae, Gryllus bimaculatus (DeGeer, 1773 (Orthoptera: Gryllidae, and Periplaneta americana (Linnaeus, 1758 (Blattaria: Blattidae, collected from different localities in Riyadh, were observed. Four astigmatid mites (Caloglyphus csibbii Eraky, Histiostoma camphori Eraky, Histiostoma pickaxei Eraky and Shoker, and Myianoetus lili Eraky belonging to two families, Acaridae and Histiostomatidae, were recorded on G. bimaculatus, L. riparia, P. americana, and M. domestica, respectively. All recorded mites are considered new to Saudi Arabian mite fauna. One individual of Copronomoia sphaerocerae (Vitzthum (Histiostomatidae mite, previously recorded in Saudi Arabia, was found on M. domestica. For each mite species found, notes on density and attachment sites are given. An identification key, based on deutonymphal stages, for the five mite species reported in this study and other phoretic astigmatid mites previously recorded on insects in Saudi Arabia is provided.

  7. Ontogenetic changes in the chemistry and morphology of oil glands in Hermannia convexa (Acari: Oribatida).

    Science.gov (United States)

    Raspotnig, Günther; Krisper, Günther; Schuster, Reinhart

    2005-01-01

    As a first example for the chemistry of oil gland secretions in the Hermannioidea (one of the three superfamilies of desmonomatan Oribatida), the oil gland secretion of Hermannia convexa was investigated by gas chromatography-mass spectrometry. Hexane extracts of all juvenile stages showed a multicomponent chromatographic pattern, mainly consisting of well-known oil gland secretion components such as neral, geranial, gamma-acaridial and the unsaturated C17-hydrocarbons, 6,9-heptadecadiene and 8-heptadecene. The secretion profiles of juveniles varied slightly between samples of two different collections, namely in the presence of gamma-acaridial and 8-heptadecene. Furthermore, a minor component, identified as 1,8-cineole (= eucalyptol) and hitherto not known from oil gland secretions of other species, was recorded in both juvenile and adult extracts. In adult profiles, 1,8-cineole, in low amounts, represented the only detectable component; thus, their profiles fundamentally differed from those of juveniles. A subsequent histological investigation revealed well developed oil glands in all juvenile stages, but degenerated oil glands in adults, consistent with the chemical data. So far, apart from H. convexa, degeneration of oil glands in the course of ontogenetic development is only known from a brachypylid species; on the other hand, chemical oil gland-polymorphism between juveniles and adults may occur in closely related Nothridae while it does not occur in oil glands of early- and middle-derivative Oribatida (Parhyposomata, Mixonomata, trhypochthoniid Desmonomata), nor in astigmatid mites.

  8. The Ticks (Acari: Ixodida: Argasidae, Ixodidae) of Taiwan: A Synonymic Checklist

    Science.gov (United States)

    2005-01-01

    Hoogstraal & Wassef, H. taiwana Sugimoto, H. yeni Toumanoff, Ixodes acutitarsus ( Karsch ), I. granulatus Supino, I. kuntzi Hoogstraal & Kohls, I...in the same five checklists. The senior synonym I. ovatus is listed only by Tseng Ixodes acutitarsus ( Karsch , 1880).8 (1978) and Hoogstraal (letter no

  9. Nuevas citas de ácaros oribátidos (Acari: Oribatida para la Argentina

    Directory of Open Access Journals (Sweden)

    Ana SALAZAR MARTÍNEZ

    2006-01-01

    Full Text Available En la presente nota se citan, por primera vez para la Argentina, cuatro especies de ácaros oribátidos: Epilohmannia pallida americana Balogh & Mahunka, 1981, Protoribates (Triangius praeoccupatus (Pérez-Iñigo & Baggio, 1980, Scheloribates curvialatus Hammer, 1961 y Galumna innexa Pérez-Iñigo & Baggio, 1986. Los ejemplares fueron hallados en muestras de suelo recolectadas en La Plata, Provincia de Buenos Aires (34º 54’S, 57º 55 ́ W, en ambientes sometidos a intervención antrópica: bosques urbanos, huertas orgánicas y pastizales.

  10. Primer registro de Ixodes cookei (Acari: Ixodidae) para México

    OpenAIRE

    2007-01-01

    En este estudio se aportan los primeros datos de la garrapata Ixodes cookei Packard, 1869 en México. Un macho, 7 larvas y 15 ninfas se recolectaron en los estados de Nuevo León y Veracruz. Además, se registra al cacomixtle Bassariscus astutus como un nuevo huésped.

  11. Convergent evolution of defense mechanisms in oribatid mites (Acari, Oribatida) shows no "ghosts of predation past".

    Science.gov (United States)

    Pachl, Patrick; Domes, Katja; Schulz, Garvin; Norton, Roy A; Scheu, Stefan; Schaefer, Ina; Maraun, Mark

    2012-11-01

    Oribatid mites are diverse and abundant terrestrial soil arthropods that are involved in decomposition of organic matter and nutrient cycling. As indicated by fossils starting from the Devonian, they evolved varied mechanisms and structures for defense from predators. We investigated four of these defensive structures (ptychoid body, hologastry, mineralization and opisthonotal glands) and used ancestral character state reconstruction to determine whether they evolved convergently and how many times this may have happened. Phylogenetic trees based on 18S rDNA were constructed for 42 oribatid mite species and two outgroup taxa using likelihood and Bayesian algorithms. The results suggest that at least three of the four defensive structures evolved convergently several times; for opisthonotal glands convergent evolution remains equivocal. This high level of convergence indicates that predation has been an important factor throughout the evolution of oribatid mites, contributing to morphological diversity and potentially also to species richness, as there are indications that some taxa radiated after the evolution of defense structures. Despite the ancientness of oribatid mites, defense structures seems to have been rarely lost, suggesting that they still are functional and necessary to reduce predation, rather than being 'ghosts of predation past'. Copyright © 2012 Elsevier Inc. All rights reserved.

  12. PCR-RFLP analysis for identification of Tetranychus spider mite species (Acari: Tetranychidae).

    Science.gov (United States)

    Arimoto, Makoto; Satoh, Masaru; Uesugi, Ryuji; Osakabe, Masahiro

    2013-04-01

    A polymerase chain reaction (PCR)-restriction fragment length polymorphism (PCR-restriction fragment-length polymorphism)-based method for species identification was applied to 14 Tetranychus spider mite species, which were dominant species intercepted at Japanese import plant quarantine. We sequenced the internal transcribed spacer (ITS) region of the nuclear ribosomal DNA (rDNA), which included the partial ends of the 18S and 28S ribosomal RNA genes, 5.8S ribosomal RNA gene, and two internal transcribed spacers (ITS1 and ITS2) for 15 populations of the 14 species. We analyzed the recognition sites of four restriction endonucleases, which had been proposed for discrimination of Japanese Tetranychus species, and constructed a scheme for Tetranychus species identification by PCR-restriction fragment-length polymorphism. We then applied the scheme to 245 individuals from 199 populations, most of them were from foreign countries. As a result, all 14 species were correctly identified using PCR-restriction fragment-length polymorphism. This demonstrates the usefulness of the PCR-restriction fragment-length polymorphism method for the worldwide identification of Tetranychus species.

  13. A new oribatid mite of the genus Peloribates Berlese, 1908 (Acari, Oribatida, Haplozetidae from Mongolia

    Directory of Open Access Journals (Sweden)

    Bayartogtokh, B.

    2000-12-01

    Full Text Available In the course of study on the species diversity and ecology of oribatid mites of Mongolia one interesting species belonging to the genus Peloribates was found and is described here as new to science. The new species, Peloribates angulatus differs from the closely related species by the relatively long and narrow head of sensillus, the different number of genital setae; the presence of distinct angular projection on the lateral margins of ventral plate, the presence of network consisting numerous striations and muscle sigillae on the anterolateral part of notogaster, the different arrangement of notogastral setae and the larger body size.Durante la realización de estudios sobre la diversidad y ecología de los ácaros oribátidos de Mongolia se encontró una interesante especie del género Peloribates que aquí se describe como nueva para la ciencia. La nueva especie, Peloribates angulatus, se diferencia de las especies próximas por la morfología de la cabeza del sensilo: relativamente larga y estrecha, el distinto número de setas genitales, la presencia de una marcada proyección angular en el margen lateral de la placa ventral, la existencia en el área anterolateral del notogáster de un retículo formado por múltiples estriaciones e impresiones musculares, la diferente disposición de las setas notogastrales y un mayor tamaño corporal.

  14. A new species of Separatoppia Mahunka, 1983 (Acari, Oribatida, Oppiidae from India

    Directory of Open Access Journals (Sweden)

    Ermilov, S. G.

    2013-12-01

    Full Text Available A new oribatid mite species of the family Oppiidae –Separatoppia indica n. sp.– is described from India. This species is morphologically most similar to Separatoppia concava Ermilov & Rybalov, 2013 (Ethiopia, but differs from the latter by length of interlamellar and notogastral setae and development of humeral processes. The genus Separatoppia Mahunka, 1983 is recorded for the first time from India and the Oriental region.Se redescribe una nueva especie de ácaro oribátido de la familia Oppiidae –Separatoppia indica n. sp.– de India. La nueva especie es muy similar morfológicamente a Separatoppia concava Ermilov & Rybalov de Etiopía, pero se diferencia de ella por la longitud de las setas interlamelares y notogastrales y el desarrollo del proceso humeral. Es la primera cira del género Separatoppia Mahunka, 1983 en India y en la región oriental.

  15. A new species of Ramusella Hammer, 1962 (Acari, Oppiidae, from Fars province, Iran

    Directory of Open Access Journals (Sweden)

    Behmanesh, M.

    2011-12-01

    Full Text Available A new species of oribatid mite of the family Oppiidae, Ramusella (Insculptoppia farsi sp. nov., is described from Fars province, southern Iran. The new species is characterized by the fusiform sensillus, with ten long ciliae on its head; smooth notogastral setae, presence of seta c2, and four pairs of genital setae.Se describe una nueva especie de ácaro oribátido de la familia Oppiidae, Ramusella (Insculptoppia farsi sp. nov., procedente de la provincia de Fars, sur de Irán. La nueva especie se caracteriza por el sensilo fusiforme con 10 largos cilios en su cabeza, setas notogastrales delgadas, presencia de seta c2 y cuatro pares de setas genitales.

  16. Habitat Suitability Model for the Distribution of Ixodes scapularis (Acari: Ixodidae) in Minnesota.

    Science.gov (United States)

    Johnson, T L; Bjork, J K H; Neitzel, D F; Dorr, F M; Schiffman, E K; Eisen, R J

    2016-05-01

    Ixodes scapularis Say, the black-legged tick, is the primary vector in the eastern United States of several pathogens causing human diseases including Lyme disease, anaplasmosis, and babesiosis. Over the past two decades, I. scapularis-borne diseases have increased in incidence as well as geographic distribution. Lyme disease exists in two major foci in the United States, one encompassing northeastern states and the other in the Upper Midwest. Minnesota represents a state with an appreciable increase in counties reporting I. scapularis-borne illnesses, suggesting geographic expansion of vector populations in recent years. Recent tick distribution records support this assumption. Here, we used those records to create a fine resolution, subcounty-level distribution model for I. scapularis using variable response curves in addition to tests of variable importance. The model identified 19% of Minnesota as potentially suitable for establishment of the tick and indicated with high accuracy (AUC = 0.863) that the distribution is driven by land cover type, summer precipitation, maximum summer temperatures, and annual temperature variation. We provide updated records of established populations near the northwestern species range limit and present a model that increases our understanding of the potential distribution of I. scapularis in Minnesota.

  17. Feather mites (Acari, Astigmata) associated with birds in an Atlantic Forest fragment in Northeastern Brazil.

    Science.gov (United States)

    Silva, H M; Hernandes, F A; Pichorim, M

    2015-08-01

    The present study reports associations between feather mites (Astigmata) and birds in an Atlantic Forest fragment in Rio Grande do Norte state, in Brazil. In the laboratory, mites were collected through visual examination of freshly killed birds. Overall, 172 individuals from 38 bird species were examined, between October 2011 and July 2012. The prevalence of feather mites was 80.8%, corresponding to 139 infested individuals distributed into 30 species and 15 families of hosts. Fifteen feather mite taxa could be identified to the species level, sixteen to the genus level and three to the subfamily level, distributed into the families Analgidae, Proctophyllodidae, Psoroptoididae, Pteronyssidae, Xolalgidae, Trouessartiidae, Falculiferidae and Gabuciniidae. Hitherto unknown associations between feather mites and birds were recorded for eleven taxa identified to the species level, and nine taxa were recorded for the first time in Brazil. The number of new geographic records, as well as the hitherto unknown mite-host associations, supports the high estimates of diversity for feather mites of Brazil and show the need for research to increase knowledge of plumicole mites in the Neotropical region.

  18. Irradiation as a phytosanitary treatment for mites of the specie Tyrophagus putrescentiae (Acari: Acaridae)

    Energy Technology Data Exchange (ETDEWEB)

    Arthur, Valter, E-mail: varthur@cena.usp.b [Centro de Energia Nuclear na Agricultura (CENA/USP), Piracicaba, SP (Brazil). Lab. de Radiobiologia e Ambiente; Mineiro, Jeferson L.C. [Instituto Biologico de Sao Paulo/APTA, Sao Paulo, SP (Brazil). Lab. de Entomologia Economico

    2009-07-01

    In great populations mites of the specie Tyrophagus putrescentiae can cause damages in stored products. The work had as objective to evaluate the effects of the gamma radiation of the Cobalt-60 to control the mites of the specie T. putrescentiae. The mites were irradiated with doses of 0 (control), 300, 400, 500, 600, 700, 800 Gy, in a source of Cobalt-60 type Gammacell-220, with a dose rate of 0.718 kGy/hour. Each treatment consisted of four repetitions containing 10 mites each, in a total of approximately 40 mites for treatment. The evaluations were daily, being counted the number of mites died, put eggs and emerged larvae. Based on the obtained results it was concluded that the dose sterilizing for the mites of this specie was of 300 Gy. Already the dose of 600 Gy induced the total mortality of the mites after 11 days of the irradiation process. (author)

  19. Molecular and morphological identification of a human biting tick, Amblyomma testudinarium (Acari: Ixodidae), in Taiwan.

    Science.gov (United States)

    Chao, Li-Lian; Lu, Chun-Wei; Lin, Ying-Fang; Shih, Chien-Ming

    2017-04-01

    Genetic identity and morphological features of a human biting tick, Amblyomma testudinarium, were determined for the first time in Taiwan. Morphological features of adult male and female ticks of Am. testudinarium were observed and photographed by a stereo- microscope. The genetic identity was analyzed by comparing the sequences of mitochondrial 16S ribosomal DNA gene obtained from 18 strains of ticks representing 10 species of Amblyomma, and four outgroup species of Dermacentor and Rhipicephalus ticks. Nine major clades could be easily distinguished by neighbour-joining analysis and were congruent by maximum-parsimony method. All these Am. testudinarium ticks collected from Taiwan and Japan were genetically affiliated to a monophyletic group with highly homogeneous sequence (99.8-100% similarity), and can be discriminated from other species of Amblyomma and other genera of ticks (Dermacentor and Rhipicephalus) with a sequence divergence ranging from 6.9 to 23.9%. Moreover, intra- and inter-species analysis based on the genetic distance (GD) values indicated a lower level (GD  0.108) of Amblyomma ticks, as well as outgroup (GD > 0.172) species. Our results provide the first distinguished features of adult Am. testudinarium ticks and the first genetic identification of Am. testudinarium ticks collected from humans in Taiwan. Seasonal prevalence, host range, and vectorial capacity of this tick species in Taiwan need to be further clarified.

  20. Molecular analysis of Rhipicephalus sanguineus (Acari: Ixodidae), an incriminated vector tick for Babesia vogeli in Taiwan.

    Science.gov (United States)

    Chao, Li-Lian; Shih, Chien-Ming

    2016-12-01

    The genetic identity of Rhipicephalus sanguineus tick was determined for the first time in Taiwan. The phylogenetic relationships were analyzed by comparing the sequences of mitochondrial 16S ribosomal DNA gene obtained from 32 strains of ticks representing six species of Rhipicephalus, two species of Dermacentor and two outgroup species (Haemaphysalis inermis and Ixodes ricinus). Seven major clades can be easily distinguished by neighbour-joining analysis and were congruent by maximum-parsimony method. All R. sanguineus ticks of Taiwan were genetically affiliated to the tropical lineage group of R. sanguineus sensu lato with highly homogeneous sequence (99.7-100% similarity), and can be discriminated from the temperate lineage group of Rhipicephalus sp. II and R. turanicus with a sequence divergence ranging from 1.7 to 5.2%. In contrast, the nucleotide variations among other Rhipicephalus spp. and other species/genus of ticks compared with the R. sanguineus ticks of Taiwan were measured from 10.6 to 25.5%. Moreover, intra- and inter-species analysis based on the genetic distance (GD) values indicated a lower level (GD  0.055) of Rhipicephalus, as well as other (GD > 0.129) and outgroup (GD > 0.236) species. Our results provide the first genetic identification of R. sanguineus ticks collected from Taiwan and demonstrate that all these R. sanguineus of Taiwan affiliated to the tropical lineage group of R. sanguineus sensu lato.

  1. Susceptibility of Boophilus microplus (Canestrini, 1887) (Acari: Ixodidae) to seven ixodicides in Nuevo Leon, Mexico

    OpenAIRE

    Jesús A. Esparza Rentería; Emily Lizett Esparza Sevilla

    2015-01-01

    This article reports the results of research only. Mention of a proprietary product does not constitute an endorsement or a recommendation by the FAUANL for its use Animal husbandry and meat industry in Mexico are one of the principal activities of the agricultural sector of the country, which are threatened by factors that affect the production of meat, skin and milk; among these, the damages caused by Boophilus microplus (Canestrini), the common tick of cattle, and the diseases it transm...

  2. Sociodemographic characteristics and risk factor analysis of Demodex infestation (Acari: Demodicidae).

    Science.gov (United States)

    Zhao, Ya-e; Guo, Na; Xun, Meng; Xu, Ji-ru; Wang, Mei; Wang, Duo-lao

    2011-12-01

    To identify sociodemographic characteristics and risk factor of Demodex infestation, 756 students aged 13-22 years in Xi'an, China were sampled for the school-based cross-sectional study. Demodex was examined using the cellophane tape method (CTP). The results showed that the total detection rate of Demodex was 67.6%. Logistic regression analysis revealed that five variables (gender, residence, sharing sanitary ware, frequency of face-wash per day, and use of facial cleanser) were found to be uncorrelated with Demodex infestation, whereas three variables (age, skin type, and skin disease) were found to be independent correlates. Students aged over 18 years had 22.1 times higher odds of Demodex infestation compared to those under 16 years and students aged 16-18 years also had 2.1 times higher odds compared to those aged 13-15 years. Odds of having a Demodex infestation for oily or mixed skin were 2.1 times those for dry or neutral skin. Students with a facial skin disease had 3.0 times higher odds of being infested with Demodex compared to those without. The inception rate of students with facial dermatoses increased in parallel with increasing mite count. The inception rates were 21.3%, 40.7%, 59.2%, and 67.7% in the negative, mild, moderate, and severe infestation groups, respectively (χ(2)=60.6, PDemodex prevalence increases with age, and Demodex presents in nearly all adult human. Sebaceous hyperplasia with oily or mixed skin seems to favour Demodex proliferation. Demodex infestation could be associated with acne vulgaris. The CTP is a good sampling method for studies of Demodex prevalence.

  3. RAPD-SCAR marker and genetic relationship analysis of three Demodex species (Acari: Demodicidae).

    Science.gov (United States)

    Zhao, Ya-E; Wu, Li-Ping

    2012-06-01

    For a long time, classification of Demodex mites has been mainly based on their hosts and phenotype characteristics. The study was the first to conduct molecular identification and genetic relationship analysis for six isolates of three Demodex species by random amplified polymorphic DNA (RAPD) and sequence-characterized amplified region (SCAR) marker. Totally, 239 DNA fragments were amplified from six Demodex isolates with 10 random primers in RAPD, of which 165 were polymorphic. Using a single primer, at least five fragments and at most 40 in the six isolates were amplified, whereas within a single isolate, a range of 35-49 fragments were amplified. DNA fingerprints of primers CZ 1-9 revealed intra- and interspecies difference in six Demodex isolates, whereas primer CZ 10 only revealed interspecies difference. The genetic distance and dendrogram showed the intraspecific genetic distances were closer than the interspecific genetic distances. The interspecific genetic distances of Demodex folliculorum and Demodex canis (0.7931-0.8140) were shorter than that of Demodex brevis and D. canis (0.8182-0.8987). The RAPD-SCAR marker displayed primer CZ 10 could be applied to identify the three Demodex species. The 479-bp fragment was specific for D. brevis, and the 261-bp fragment was specific for D. canis. The conclusion was that the RAPD-SCAR multi-marker was effective in molecular identification of three Demodex species. The genetic relationship between D. folliculorum and D. canis was nearer than that between D. folliculorum and D. brevis.

  4. Coffee ringspot virus vectored by Brevipalpus phoenicis (Acari: Tenuipalpidae) in coffee.

    Science.gov (United States)

    Chagas, C M; Kitajima, E W; Rodrigues, J C V

    2003-01-01

    Coffee ringspot is characterized by conspicuous ringspot symptoms on leaves, berries, and less frequently on twigs. It is caused by coffee ringspot virus (CoRSV), a short, bacilliform virus (40 nm x 100-110 nm). The virus is not seed borne and is transmitted by Brevipalpus phoenicis (Geijskes). Transovarial transmission within the mite does not occur. CoRSV has been mechanically transmitted to Chenopodium amaranticolor Coste and Reynaud, C. quinoa Wildenow, Beta vulgaris L., and Alternanthera tenella Colla resulting in local lesions. Systemic infection within both C. amaranticolor and C. quinoa occurs. Virions are found in the nucleus or cytoplasm of infected cells, commonly associated with membranes. Occasionally, membrane bounded particles are found within the cisternae of the endoplasmic reticulum. A characteristic electron lucent, nuclear inclusion is commonly found in many infected cells. These cytopathic effects place CoRSV among the nuclear type of Brevipalpus-borne viruses. The disease has been reported in several Brazilian states (São Paulo, Paraná, Minas Gerais, and Federal District) and recently found in Costa Rica. A similar disease is known in the Philippines, but no information exists about its relationship to CoRSV. Coffee ringspot had no economical significance until recently when a large scale infection was reported in Minas Gerais that resulted in yield loss.

  5. Genetic dissimilarity for resistance to Mononychellus tanajoa (bondar (Acari, Tetranychidae among domesticated and wild Manihot species

    Directory of Open Access Journals (Sweden)

    Verônica de Jesus Boaventura

    2015-10-01

    Full Text Available The aim of this study was to evaluate the genetic dissimilarity among wild and domesticated species of Manihot for resistance to cassava green mite during the insect life cycle. Nine accessions of wild Manihot species, M. esculenta ssp. flabellifolia, M. esculenta ssp. peruviana, and M. carthaginensis ssp. glaziovii, and two clones of M. esculenta (Cigana Preta and Sacaí were evaluated under laboratory conditions at 25 ± 1°C, 70 ± 10% RH, and a 12-h photophase. Daily observations during the mite life cycle stages (larva-adult were recorded. The data were subjected to an analysis of variance, a Scott-Knott test (5%, and Singh criterion, cluster, and principal component analyses. The larval-adult period ranged from 5.53 to 7.01 days: the longest period was observed on an M. glaziovii accession (GLA-19-DF and the shortest on an M. flabellifolia accession (FLA-025V. The UPGMA method allowed the division of the genotypes into six groups, with the greatest distance between the FLA-025V and GLA-19-DF accessions. The first two main components explained 77.50% of the total accumulated variation. The association of the longest cycle duration of M. tanajoa with the lowest larval-adult viability suggests that GLA-19-DF is less favorable to mite development compared to the other accessions. Significant variability among the genotypes was observed.

  6. Prey-related odor preference of the predatory mites Typhlodromalus manihoti and Typhlodromalus aripo (Acari: Phytoseiidae).

    Science.gov (United States)

    Gnanvossou, Désiré; Hanna, Rachid; Dicke, Marcel

    2002-01-01

    Typhlodromalus manihoti and Typhlodromalus aripo are exotic predators of the cassava green mite Mononychellus tanajoa in Africa. In an earlier paper, we showed that the two predators were attracted to odors from M. tanajoa-infested cassava leaves. In addition to the key prey species, M. tanajoa, two alternative prey mite species, Oligonychus gossypii and Tetranychus urticae also occur in the cassava agroecosystem. Here, we used a Y-tube olfactometer to determine the attraction of the predators to odors from O. gossypii- or T. urticae-infested cassava leaves and their prey-related odor preference. T. aripo but not T. manihoti was slightly attracted to odors from O. gossypii-infested leaves. Both predator species showed a stronger response to odors from cassava leaves infested by M. tanajoa over odors from cassava leaves infested by O. gossypii. Neither predator species was attracted to odors from T. urticae-infested leaves and the predators preferred the odors from M. tanajoa-infested leaves over those from T. urticae-infested leaves. When O. gossypii was present together with M. tanajoa on the same leaves or on different sets of leaves offered together as an odor source the two predators were attracted. In contrast, after mixing non-attractive odors from T. urticae-infested leaves with attractive odors from M. tanajoa-infested leaves, neither T. aripo nor T. manihoti was attracted. Ecological advantages and disadvantages of the predators' behavior and possible implications for biological control of M. tanajoa are discussed.

  7. Toxicity of neem oil to the cassava green mite Mononychellus tanajoa (Bondar (Acari: Tetranychidae

    Directory of Open Access Journals (Sweden)

    Amanda C.B Silva

    2013-09-01

    Full Text Available Neem (Azadirachta indica A. Juss.-derived pesticides have been used against a wide range of agricultural pests including tetranychid mites. Approaches combining lethal and sublethal toxicity studies of neem pesticides towards tetranychid mites are necessary to a comprehensive evaluation of such products. Here, we evaluated the lethal and sublethal toxicity of the neem oil Bioneem to the cassava green mite Mononychellus tanajoa (Bondar by integrating lethal concentration (LC with population growth and biological parameter studies. According to Probit analyses the concentration of neem oil Bioneem which kills 50% of the population (LC50 of M. tanajoa was 3.28 ¼L cm-2, which is roughly twice the field concentration recommended of this biopesticide to control pest mites (1.7 ¼L cm-2. The growth rate of the cassava green mite steadily decreased with dosages of neem oil. Furthermore, sublethal concentrations of the neem oil corresponding to the LC50 reduced the periods of the immature stages of M. tanajoa resulting in a shorter developmental time. Similarly, the number of eggs per day and the number of eggs per female per day, a proxy for fecundity, were drastically reduced in M. tanajoa females exposed to the LC50 of neem oil. Based on our comprehensive approach we conclude that the neem oil showed lethal as well as sublethal toxicity on growth rate and biological parameters such as duration of immature stages and fecundity of the cassava green mite M. tanajoa and it could be used as an ecological alternative for the management of this pest.

  8. A geographic distribution database of Mononychellus mites (Acari, Tetranychidae) on cassava (Manihot esculenta).

    Science.gov (United States)

    Vásquez-Ordóñez, Aymer Andrés; Parsa, Soroush

    2014-01-01

    The genus Mononychellus is represented by 28 herbivorous mites. Some of them are notorious pests of cassava (Manihot esculenta Crantz), a primary food crop in the tropics. With the exception of Mononychellus tanajoa (Bondar), their geographic distribution is not widely known. This article therefore reports observational and specimen-based occurrence data of Mononychellus species associated with cassava. The dataset consists of 1,513 distribution records documented by the International Center for Tropical Agriculture (CIAT) between 1975 and 2012. The specimens are held at CIAT's Arthropod Reference Collection (CIATARC). Most of the records are from the genus' native range in South America and were documented between 1980 and 2000. Approximately 61% of the records belong to M. tanajoa, 25% to M. caribbeanae (McGregor), 10% to M. mcgregori (Flechtmann and Baker) and 2% to M. planki (McGregor). The complete dataset is available in Darwin Core Archive format via the Global Biodiversity Information Facility (GBIF).

  9. Photosynthetic response of soybean to twospotted spider mite (Acari: Tetranychydae injury

    Directory of Open Access Journals (Sweden)

    Adeney de Freitas Bueno

    2009-08-01

    Full Text Available The twospotted spider mite Tetranychus urticae Koch is a common pest on soybean plants. To clarify plant-arthropod interaction on mite-soybean system, leaf fluorescence, photosynthetic responses to variable carbon dioxide levels, and chlorophyll content were evaluated. Significant photosynthetic rate reduction was observed due to stomatal limitation. Stomatal closure was the major plant physiological response. As a consequence, there was reduction in photosynthetic rates. Surprisingly, plants did not show chlorophyll content reduction associated with photosynthetic impairment. No differences in fluorescence data indicate that T. urticae injury did not impair the function of light harvesting and photoelectron transport. These results showed that T. urticae could be a serious pest of soybean even on lower infestation, at least when photosynthesis was determinant to yield.O ácaro-rajado, Tetranychus urticae Koch é uma praga comum em plantas de soja. Para elucidar a interação entre o artrópode e a planta no sistema soja-ácaro, a fluorescência, as respostas fotossintéticas em diferentes concentrações internas de CO2 e o conteúdo de clorofila foram avaliados. Observou-se redução na capacidade fotossintética das plantas infestadas e o fechamento dos estômatos foi a principal causa dessa redução. As plantas infestadas não mostraram redução no conteúdo de clorofila. Também, nenhuma diferença foi encontrada na leitura de fluorescência, o que mostra que a injúria causada pelo ácaro não prejudica a coleta de luz nem o transporte de elétrons. Estes resultados mostram que T. urticae pode ser uma praga séria na cultura da soja mesmo em baixas infestações, principalmente nas situações em que a fotossíntese é fator determinante na produção.

  10. Curative and Preventive Control of Aceria aloinis (Acari: Eriophyidae) in Southern California.

    Science.gov (United States)

    Villavicencio, L E; Bethke, J A; Dahlke, B; Vander Mey, B; Corkidi, L

    2014-12-01

    The aloe mite, Aceria aloinis Keifer, causes physiological and morphological alterations in species of Aloe L. We conducted three trials to evaluate the potential of various miticides for curative and preventive control of damage caused by A. aloinis. In the first trial, the efficacy of nine miticides against aloe mite damage was assessed without the removal of infected tissue in Aloe reitziiae Reynolds. Although significant reductions in the number of mites and eggs were found due to the treatments, miticide application did not reduce the amount of plant area damaged or damage severity. Once the plants are infected, the irreversible damage by aloe mite progresses. The second trial analyzed the effects of seven miticides on aloe mite damage on Aloe 'Goliath' plants in which the damaged tissue was removed. Reduced damage severity and mite number was observed in all treated plants. To determine if aloe mite damage could be prevented, the effects of six miticides with and without surfactant were tested on uninfected plants of Aloe spinosissima A. Berger in a third trial. Except for chlorfenapyr and fenazaquin, all treatments reduced plant damaged area, damage severity, and the number of mites 60 wk following three miticide applications. The severity index in the second and third trials suggested that all treated plants would be marketable. Our study demonstrated that there were miticides that were effective by contact (carbaryl), translaminar (spiromesifen), and systemic (spirotetramat) action, which can be used to cure and to prevent aloe mite plant damage alone or in combination with cultural practices. © 2014 Entomological Society of America.

  11. Fenpyroximate resistance in Tetranychus urticae (Acari: Tetranychidae): cross-resistance and biochemical resistance mechanisms.

    Science.gov (United States)

    Kim, Young-Joon; Lee, Si-Hyeock; Lee, Si-Woo; Ahn, Young-Joon

    2004-10-01

    A field colony of the Two-spotted spider mite, Tetranychus urticae (Koch), resistant to fenpyroximate was further selected with fenpyroximate 5SC for 20 generations at a selection pressure of 30-50% mortality (designated as FR-20 strain). Resistance and cross-resistance levels of the FR-20 strain to 18 acaricides were determined using a spray method. The FR-20 strain was extremely resistant to fenpyroximate [resistance ratio (RR) 252]. The strain exhibited extremely strong positive cross-resistance to acrinathrin (RR 196), and high levels of resistance to benzoximate (RR 55) and propargite (RR 64). Moderate levels of cross-resistance (RR 11-40) to abamectin, fenbutatin oxide, fenpropathrin, pyridaben, pyridaben + bifenthrin and tebufenpyrad were observed. The FR-20 strain showed low levels of resistance (RR fenazaquin and milbemectin. Synergist experiments with different metabolic inhibitors revealed that piperonyl butoxide had the greatest effect on the efficacy of fenpyroximate, followed by iprobenfos and triphenyl phosphate. In a comparative assay with detoxifying enzymes, the FR-20 strain showed 2.5-fold higher activity in p-nitroanisole-O-demethylation, and 2.5- and 2.2-fold higher activities in alpha- and beta-naphthyl acetate hydrolysis, respectively. These results suggested that enhanced activities of both mixed-function oxidases and esterases likely contribute to the fenpyroximate resistance of the FR-20 strain of T urticae.

  12. A human case of otoacariasis involving a histiostomatid mite (Acari: Histiostomatidae).

    Science.gov (United States)

    Al-Arfaj, Ahmed M; Mullen, Gary R; Rashad, Rafiaa; Abdel-Hameed, Ahmed; OConnor, Barry M; Alkhalife, Ibrahim S; Dute, Roland R

    2007-05-01

    A 31-year-old Saudi man was seen at an ear, nose, and throat clinic at Riyadh, Saudi Arabia, with bilateral itching in the external auditory canal. On otoscopic examination, the skin lining the ear canal was thickened with whitish sheets of sloughed cells and thick discharge. Large numbers of mites of an undescribed species closely related to members of the genus Loxanoetus (Histiostomatidae) were present. The patient underwent successive washings of the ear canal with saline and 70% ethanol at intervals of 2-3 months and was treated with antibiotics. Treatment with Eurax (crotamiton) ear drops for one week cleared the mite infestation. This represents the first reported case of human otoacariasis involving a histiostomatid mite. Based on the known biology of histiostomatid mites and the associated hosts of Loxanoetus and related genera, there is reason to speculate that the patient acquired the infestation while swimming in a lake or pond where this mite was present.

  13. Female performance towards offspring under starved conditions in four phytoseiid species (Acari, Phytoseiidae).

    Science.gov (United States)

    Zhang, Yanxuan; Ji, Jie; Lin, Jianzhen; Chen, Xia; Saito, Yutaka

    2015-01-01

    There is an important difference between cannibalism between unrelated individuals and between a mother and its offspring, because the former can be defined as a form of intraspecific competition, but the latter affects the inclusive fitness of individuals. Many examples of cannibalism have been reported in predacious phytoseiid mites. Furthermore, sib cannibalism avoidance is known in several species. However, whether females' actually prey upon their offspring under starved conditions has yet to be established. Here, female performance towards their offspring under no-prey-other-than-offspring, water-available and humidity-selectable conditions, was observed in four phytoseiid species, Amblyseius eharai, Amblyseius swirskii, Neoseiulus cucumeris and Typhlodromus bambusae. Typhlodromus bambusae females only survived for 4.14 ± 0.42 days and there was a significant difference in survival duration between T. bambusae and the other three species (all survived more than 8 days). Neoseiulus cucumeris females survived longer than A. eharai and A. swirskii females, whereas there was no difference between A. eharai and A. swirskii females. On the other hand, the offspring (immature stages from egg to larva or protonymph) of A. eharai, A. swirskii and N. cucumeris died earlier in mother-presence than in mother-absence (egg alone) experiments, suggesting that cannibalistic interactions occur between mother and offspring. The survivorship of T. bambusae offspring in the mother-presence condition did not differ from the mother-absence condition, indicating that kin cannibalism is rare in this species. This must be related to the phenomenon that mothers tend to die before their offspring. The short longevity of T. bambusae mothers is one of the reasons why there is no significant difference in immature survival between the mother-presence and mother-absence experiments. Lastly, the reason(s) behind such variation in female phytoseiid performance towards their offspring is addressed in relation to the diet-specialization hypothesis.

  14. An Initial Classification of Neotropical Water Mites (Acari: Hydrachnidia Based on Habitat Preferences

    Directory of Open Access Journals (Sweden)

    Hugo R. Fernández

    2011-01-01

    Full Text Available Existing classifications of benthic and interstitial freshwater invertebrates are described and discussed. A classification is proposed for southern neotropical (south of latitude S 15 water mites in relation to their life style and habitat preferences. The classification includes planktonic, superficial, benthic, thermal, and subterranean forms. The diversity of the Hydrachnidia family and genera (22 families, 97 genera, and 521 species is then analyzed using the new classification. Ubiquitous stygobites deserve special consideration because they move through ecotone zones and tolerate extreme conditions. Water mite communities from a north-western Argentinean stream were first described using a surber net and consequently considered as benthic. Nineteen Hydrachnidia species (from benthic to stygobite were collected and classified. The vertical distribution observed during the year confirmed the permanent presence of benthic Hydrachnidia, even during the first flood, which is of special importance in running waters. The functional classification we propose will facilitate comparison of fauna from different areas that have different faunistic composition but may have similar functional distribution.

  15. Laboratory evaluation of four commercial repellents against larval Leptotrombidium deliense (Acari: Trombiculidae).

    Science.gov (United States)

    Hanifah, Azima Laili; Ismail, Siti Hazar Awang; Ming, Ho Tze

    2010-09-01

    Four commercial repellents were evaluated in the laboratory against Leptotrombidium deliense chiggers. Both in vitro and in vivo methods were used to determine repellency of the compounds. The repellents were Kellis (containing citronella oil, jojoba oil and tea tree oil), Kaps (containing citronella oil), BioZ (containing citronella oil, geranium oil and lemon grass oil) and Off (containing DEET). The combination of three active ingredients: citronella oil, geranium oil, lemon grass oil gave the highest repellency (87%) followed by DEET (84%). In vitro repellencies ranged from 73% to 87%. There was no significant difference between the four products. All the repellents had 100% in vivo repellency compared to 41-57% for the controls.

  16. Highly variable acquisition rates of Ixodes scapularis (Acari: Ixodidae) by birds on an Atlantic barrier island.

    Science.gov (United States)

    Mitra, S S; Buckley, P A; Buckley, F G; Ginsberg, H S

    2010-11-01

    Acquisition of ticks by bird hosts is a central process in the transmission cycles of many tick-borne zoonoses, but tick recruitment by birds has received little direct study. We documented acquisition of Ixodes scapularis Say on birds at Fire Island, NY, by removing ticks from mist-netted birds, and recording the number of ticks on birds recaptured within 4 d of release. Eight bird species acquired at least 0.8 ticks bird(-1) day(-1) during the seasonal peak for at least one age class of I. scapularis. Gray Catbirds, Eastern Towhees, Common Yellowthroats, and Northern Waterthrushes collectively accounted for 83% of all tick acquisitions; and six individuals apportioned among Black-billed Cuckoo, Gray Catbird, Eastern Towhee, and Common Yellowthroat were simultaneously infested with both larvae and nymphs. Bird species with the highest acquisition rates were generally ground foragers, whereas birds that did not acquire ticks in our samples generally foraged above the ground. Tick acquisition by birds did not differ between deciduous and coniferous forests. Among the 15 bird species with the highest recruitment rates, acquisition of nymphs was not correlated with acquisition of larvae. Tick acquisition rates by individual bird species were not correlated with the reservoir competence of those species for Lyme borreliae. However, birds with high tick acquisition rates can contribute large numbers of infected ticks, and thus help maintain the enzootic cycle, even if their levels of reservoir competence are relatively low.

  17. Natural hosts of the larvae of Nuttalliella sp. (N. namaqua?) (Acari: Nuttalliellidae).

    Science.gov (United States)

    Horak, Ivan G; Lutermann, Heike; Medger, Katarina; Apanaskevich, Dmitry A; Matthee, Conrad A

    2012-02-02

    The first collection of unengorged and fully engorged larvae of Nuttalliella sp. (N. namaqua?) from the murid rodents Micaelamys namaquensis, Aethomys chrysophilus and Acomys spinosissimus in Limpopo Province and from M. namaquensis in the Northern Cape Province, South Africa, is documented. A total of nine larvae were collected from two M. namaquensis in the Soutpansberg mountain range in the Limpopo Province during April 2009. During the last week of September 2011, 221 larvae were collected from rodents at the same locality and 10 of 48 M. namaquensis, 6 of 12 Ae. chrysophilus and 3 of 14 Ac. spinosissimus were infested. One of the M. namaquensis harboured 53 larvae. Five larvae were collected from two M. namaquensis in the Northern Cape Province. Total genomic DNA was extracted from two larvae and a region of the 18S rRNA gene was sequenced for these. BLASTn searches revealed similarity between these specimens and the Nuttalliella sequences published on GenBank.

  18. Natural hosts of the larvae of Nuttalliella sp. (N. namaqua? (Acari: Nuttalliellidae

    Directory of Open Access Journals (Sweden)

    Ivan G. Horak

    2012-02-01

    Full Text Available The first collection of unengorged and fully engorged larvae of Nuttalliella sp. (N. namaqua? from the murid rodents Micaelamys namaquensis, Aethomys chrysophilus and Acomys spinosissimus in Limpopo Province and from M. namaquensis in the Northern Cape Province, South Africa, is documented. A total of nine larvae were collected from two M. namaquensis in the Soutpansberg mountain range in the Limpopo Province during April 2009. During the last week of September 2011, 221 larvae were collected from rodents at the same locality and 10 of 48 M. namaquensis, 6 of 12 Ae. chrysophilus and 3 of 14 Ac. spinosissimus were infested. One of the M. namaquensis harboured 53 larvae. Five larvae were collected from two M. namaquensis in the Northern Cape Province. Total genomic DNA was extracted from two larvae and a region of the 18S rRNA gene was sequenced for these. BLASTn searches revealed similarity between these specimens and the Nuttalliella sequences published on GenBank.

  19. Nymphs of the genus Amblyomma (Acari: Ixodidae) of Brazil: descriptions, redescriptions, and identification key.

    Science.gov (United States)

    Martins, Thiago F; Onofrio, Valeria C; Barros-Battesti, Darci M; Labruna, Marcelo B

    2010-06-01

    Together with the larval stage, the nymphal stage of ticks of the genus Amblyomma are the most aggressive ticks for humans entering areas inhabited by wildlife and some domestic animals in Brazil. However, due to the absence of morphological descriptions of the nymphal stage of most Brazilian Amblyomma species, plus the lack of an identification key, little or nothing is known about the life history of Amblyomma spp. nymphs in the country. In the present study, morphological description of the nymphal stage, illustrating important external characters through scanning electron microscopy, is provided for nymphs of 15 Amblyomma species that occur in Brazil, for which the nymphal stage had never been described: A. aureolatum, A. auricularium, A. calcaratum, A. coelebs, A. fuscum, A. humerale, A. incisum, A. latepunctatum, A. naponense, A. nodosum, A. ovale, A. pacae, A. pseudoconcolor, A. scalpturatum, A. varium. In addition, the nymphal stage of 12 Amblyomma species, which had been previously described, are redescribed: A. brasiliense, A. cajennense, A. dissimile, A. dubitatum, A. longirostre, A. oblongoguttatum, A. parkeri, A. parvum, A. romitii, A. rotundatum, A. tigrinum, A. triste. The descriptions and redescriptions totalized 27 species. Only 2 species (A. geayi, A. goeldii) out of the 29 Amblyomma species established in Brazil are not included in the present study. A dichotomous identification key is included to support taxonomic identification of the nymphal stage of 27 Amblyomma species established in Brazil.

  20. Canis familiaris, UN NUEVO HOSPEDERO DE Ornithodoros (A. puertoricensis FOX, 1947 (ACARI: IXODIDA EN COLOMBIA

    Directory of Open Access Journals (Sweden)

    BEJARANO EDUAR E. E.

    2009-04-01

    Full Text Available

    RESUMEN

    Las garrapatas revisten gran importancia en el campo biomédico por sus hábitos hematófagos y asociación con la transmisión de agentes patógenos a humanos y animales. El objetivo de esta investigación fue establecer las especies de garrapatas que parasitan perros en tres poblaciones del área rural del Caribe colombiano. Durante los meses de agosto y diciembre del año 2006 se realizó búsqueda activa de garrapatas sobre caninos domésticos de las localidades de El Campín, Sabanas del Potrero y Escobar Arriba, departamento de Sucre. Las garrapatas recolectadas fueron almacenadas en viales con etanol al 70% e identificadas empleando claves morfológicas de referencia para cada familia. Para la determinación de especie en la familia Argasidae se realizaron estimaciones morfométricas de estructuras externas. Se recolectaron 420 garrapatas a partir de 50 caninos infestados, de un total de 134 perros examinados, que corresponde a una tasa de infestación del 37,3%. Las garrapatas fueron identificadas como Rhipicephalus sanguineus, Rhipicephalus (Boophilus microplus y Amblyomma ovale pertenecientes a la familia Ixodidae, y Ornithodoros (Alectorobius puertoricensis de la familia Argasidae. La especie predominante fue R. sanguineus (92,1% en los estados de larva, ninfa y adulto, seguida por larvas de O. puertoricensis, que fueron halladas en menor número sobre caninos de las tres localidades. Se registra, por primera vez en América, el parasitismo de O. puertoricensis sobre caninos domésticos y se confirma su presencia en Colombia.

    Palabras clave: garrapatas, perros, Ornithodoros puertoricensis, Ixodida, Colombia.


    ABSTRACT

    Ticks are very important from the biomedical point of view, by their hematophagic activity and their role in the transmission of pathogenic microorganisms to man and animals. The main goal of this work was to establish the tick species parasiting dogs in three rural localities of the Colombian Caribbean. From August to December 2006, an active search of ticks on dogs was carried out in the localities of El Campín, Sabanas del Potrero and Escobar Arriba, department of Sucre. The collected ticks were preserved into eppendorf tubes with 70% ethanol, and identified using standard morphological keys for each family. Argasid species were determined by measuring external morphological characters. Of 134 examined dogs in the three localities, 50 were found infested by ticks, representing a infestation rate of 37,3%. A total of 420 ticks were collected from dogs and identified as Rhipicephalus sanguineus, Rhipicephalus (Boophilus microplus, and Amblyomma ovale of the Ixodidae family, and Ornithodoros puertoricensis of the Argasidae family. R. sanguineus was the predominant species (92,1% in the stages of larva, nymph and adult, following by O. puertoricensis larvae recorded in low numbers in the three regions sampled. The tick O. puertoricensis is recorded for the first time as ectoparasite of domestic dogs in America. Additionally, the presence of this tick species is confirmed in Colombia.

    Key words: Ticks, dogs, Ornithodoros puertoricensis, Ixodida, Colombia

  1. The impact of insecticides applied in apple orchards on the predatory mite Kampimodromus aberrans (Acari: Phytoseiidae).

    Science.gov (United States)

    Duso, Carlo; Ahmad, Shakeel; Tirello, Paola; Pozzebon, Alberto; Klaric, Virna; Baldessari, Mario; Malagnini, Valeria; Angeli, Gino

    2014-03-01

    Kampimodromus aberrans is an effective predatory mite in fruit orchards. The side-effects of insecticides on this species have been little studied. Field and laboratory experiments were conducted to evaluate the effects of insecticides on K. aberrans. Field experiments showed the detrimental effects of etofenprox, tau-fluvalinate and spinosad on predatory mites. Spider mite (Panonychus ulmi) populations reached higher densities on plots treated with etofenprox and tau-fluvalinate than in the other treatments. Single or multiple applications of neonicotinoids caused no detrimental effects on predatory mites. In the laboratory, spinosad and tau-fluvalinate caused 100 % mortality. Etofenprox caused a significant mortality and reduced fecundity. The remaining insecticides did not affect female survival except for imidacloprid. Thiamethoxam, clothianidin, thiacloprid, chlorpyrifos, lufenuron and methoxyfenozide were associated with a significant reduction in fecundity. No effect on fecundity was found for indoxacarb or acetamiprid. Escape rate of K. aberrans in laboratory was relatively high for etofenprox and spinosad, and to a lesser extent thiacloprid. The use of etofenprox, tau-fluvalinate and spinosad was detrimental for K. aberrans and the first two insecticides induced spider mite population increases. The remaining insecticides caused no negative effects on predatory mites in field trials. Some of them (reduced fecundity and repellence) should be considered with caution in integrated pest management programs.

  2. Reproductive performance of the generalist predator Hypoaspis aculeifer (Acari: Gamasida) when foraging on different invertebrate prey

    DEFF Research Database (Denmark)

    Heckmann, Lars-Henrik; Ruf, A.; Nienstedt, K. M.;

    2007-01-01

    In this study, we assessed the influence of prey quality and prey biomass during a standardized 3- week test on adult survival and reproductive output of the predatory mite Hypoaspis aculeifer when fed one of six different diets: springtails (Folsomia candida and F. fimetaria), a storage mite (Ca...

  3. Molecular Detection of Rickettsia Species Within Ticks (Acari: Ixodidae) Collected from Arkansas United States.

    Science.gov (United States)

    Trout Fryxell, R T; Steelman, C D; Szalanski, A L; Billingsley, P M; Williamson, P C

    2015-05-01

    Rocky Mountain spotted fever (RMSF), caused by the etiological agent Rickettsia rickettsii, is the most severe and frequently reported rickettsial illness in the United States, and is commonly diagnosed throughout the southeast. With the discoveries of Rickettsia parkeri and other spotted fever group rickettsiae (SFGR) in ticks, it remains inconclusive if the cases reported as RMSF are truly caused by R. rickettsii or other SFGR. Arkansas reports one of the highest incidence rates of RMSF in the country; consequently, to identify the rickettsiae in Arkansas, 1,731 ticks, 250 white-tailed deer, and 189 canines were screened by polymerase chain reaction (PCR) for the rickettsial genes gltA, rompB, and ompA. None of the white-tailed deer were positive, while two of the canines (1.1%) and 502 (29.0%) of the ticks were PCR positive. Five different tick species were PCR positive: 244 (37%) Amblyomma americanum L., 130 (38%) Ixodes scapularis Say, 65 (39%) Amblyomma maculatum (Koch), 30 (9%) Rhipicephalus sanguineus Latreille, 7 (4%) Dermacentor variabilis Say, and 26 (44%) unidentified Amblyomma ticks. None of the sequenced products were homologous to R. rickettsii. The most common Rickettsia via rompB amplification was Rickettsia montanensis and nonpathogenic Candidatus Rickettsia amblyommii, whereas with ompA amplification the most common Rickettsia was Ca. R. amblyommii. Many tick specimens collected in northwest Arkansas were PCR positive and these were commonly A. americanum harboring Ca. R. amblyommii, a currently nonpathogenic Rickettsia. Data reported here indicate that pathogenic R. rickettsii was absent from these ticks and suggest by extension that other SFGR are likely the causative agents for Arkansas diagnosed RMSF cases.

  4. Catalogue of genera and their type species in the mite Suborder Uropodina (Acari: Mesostigmata).

    Science.gov (United States)

    Halliday, R B

    2015-06-11

    This paper provides details of 300 genus-group names in the suborder Uropodina, including the superfamilies Microgynioidea, Thinozerconoidea, Uropodoidea, and Diarthrophalloidea. For each name, the information provided includes a reference to the original description of the genus, the type species and its method of designation, and details of nomenclatural and taxonomic anomalies where necessary. Twenty of these names are excluded from use because they are nomina nuda, junior homonyms, or objective junior synonyms. The remaining 280 available names appear to include a very high level of subjective synonymy, which will need to be resolved in a future comprehensive revision of the Uropodina.

  5. Mite (Arthropoda, Acari associates of palms (Arecaceae in Brazil I: present status and new records

    Directory of Open Access Journals (Sweden)

    Dalva L. Q. Santana

    1998-12-01

    Full Text Available This paper presents 72 new records and 10 records from literature on the distribuition of nine species of phytophagous mites and nine species of predatory mites from 13 species of palms in 13 Brazilian States.

  6. Reproductive performance of the generalist predator Hypoaspis aculeifer (Acari: Gamasida) when foraging on different invertebrate prey

    DEFF Research Database (Denmark)

    Heckmann, Lars-Henrik; Ruf, A.; Nienstedt, K. M.

    2007-01-01

    In this study, we assessed the influence of prey quality and prey biomass during a standardized 3- week test on adult survival and reproductive output of the predatory mite Hypoaspis aculeifer when fed one of six different diets: springtails (Folsomia candida and F. fimetaria), a storage mite...... (Caloglyphus cf. Michaeli), an oligochaete (Enchytraeus crypticus), a nematode (Turbatrix silusiae), and a 1:1:1 mix of F. candida : F. fimetaria : E. crypticus. Our results revealed that a single prey species may be nutritionally sufficient for a 3-week period, as H. aculeifer performed equally well......, or better, on a diet based on a 1:1:1 mix of F. candida : F. fimetaria : E. crypticus. However, when fed C. cf. michaeli, H. aculeifer had a poor reproductive output (prey prior to testing H. aculeifer...

  7. [Biology of Tetranychus mexicanus (McGregor) (Acari: Tetranychidae) on three species of Annonaceae].

    Science.gov (United States)

    de Sousa, Josilene M; Gondim, Manoel G C; Lofego, Antônio C

    2010-01-01

    The mite Tetranychus mexicanus (McGregor) is considered a pest of a variety of plant species in the Americas. Although this mite apparently causes economic damage to Annonaceae, little is known about its biology. Here we studied the biology of T. mexicanus on soursop (Annona muricata), sweetsop (Annona squamosa) and araticum (Annona coriaceae). The first two species are the most important economical Annonaceae species in northeast Brazil; araticum is commonly found in the region, but not commercially explored. The mites were collected in the field from leaves of A. muricata and maintained in the laboratory for six months on detached leaves of A. muricata, A. squamosa and A. coriaceae, respectively, before observations started. Tetranychus mexicanus developed more slowly on A. squamosa than on the two other hosts, but oviposition was considerably lower on A. coriaceae. As indicated by the calculated life table parameters, biotic potential was higher on A. muricata than on the other hosts. Despite the observed differences in the T. mexicanus biology on the different evaluated hosts, development and reproduction were satisfactory in all of the hosts used.

  8. In vitro activity of pineapple extracts (Ananas comosus, Bromeliaceae) on Rhipicephalus (Boophilus) microplus (Acari: Ixodidae).

    Science.gov (United States)

    Domingues, Luciana Ferreira; Giglioti, Rodrigo; Feitosa, Karina Alves; Fantatto, Rafaela Regina; Rabelo, Márcio Dias; Oliveira, Márcia Cristina de Sena; Oliveira, Gilson Pereira de; Bechara, Gervasio Henrique; Chagas, Ana Carolina de Souza

    2013-07-01

    Measures to control the cattle tick, Rhipicephalus (Boophilus) microplus, based only on chemical products are becoming unsustainable, mainly because of the development of resistance. The objective of this study was to test the effect of the aqueous extract of pineapple skin (AEPS) and bromelain extracted from the stem (Sigma-Aldrich®, B4882) on engorged females and larvae of R. (B.) microplus in vitro. These substances were diluted in water and evaluated at eight concentrations. Engorged females were collected and distributed in groups of 10, with three repetitions for each treatment. After immersion in the solutions, the females were placed in an incubator for observation of survival, oviposition and larval hatching. The larval packet method was used, also with three repetitions with about 100 larvae each. The packets were incubated and the readings were performed after 24 h. The estimated reproduction and efficacy of the solutions were calculated. The LC(50) and LC(90) were estimated using the Probit procedure of the SAS program. The eight concentrations were compared within each treatment by the Tukey test. For the experiment with engorged females, the most effective concentrations were 125, 250 and 500 mg/mL: 33%, 48% and 59% for the AEPS and 27%, 51% and 55% for the bromelain. The LC(50) and LC(90) values were, respectively, 276 and 8691 mg/mL for AEPS and 373 and 5172 mg/mL for bromelain. None of the dilutions tested was effective against the larvae of R. (B.) microplus. This is the first report of the action of pineapple extracts or their constituents on cattle ticks. The results demonstrate that further studies regarding composition of tick cuticle, with evaluation of other solvents and formulations, should be conducted seeking to enhance the effect of pineapple extracts and compounds against this ectoparasite.

  9. Tick pests and vectors (Acari: Ixodoidea) in European towns: Introduction, persistence and management.

    Science.gov (United States)

    Uspensky, Igor

    2014-02-01

    Ticks have always been a part of fauna in and around human settlements, and their significance changed concurrently with the enlargement of settlements and their transformation into towns. The increased rate of urbanization during the last decades has created a new reality for tick existence. Two groups of ticks are of major concern for modern towns: those living under natural conditions of urban surroundings and those well-adapted to urban conditions. During the process of urbanization, encroachment into forested and uncultivated areas as well as protection of existing green spaces create opportunities for ticks living in nature to also exist under urban and suburban conditions. Conditions of modern urban and especially suburban environment in developed European countries adequately meet tick requirements. Tick species having an advantage in urban areas are those that can use one and the same host at all parasitic stages, can starve for a prolonged time, can use either urban pests or domesticated animals as hosts, and can live in man-made buildings. The ticks of the Argas reflexus group (Argasidae) and the brown dog tick Rhipicephalus sanguineus (Ixodidae) comply with practically all conditions necessary for successful survival in urban areas. The ability of ticks to transmit numerous human and animal pathogens and the presence of many reservoir hosts in urban and suburban areas create persistent danger for human populations and domestic animals. Impact on urban ticks should be directed against the two major requirements of tick existence: reducing populations of potential tick hosts (feral pigeons, stray dogs and cats, and urban rodents), and changing other environmental conditions to make them less suitable for ticks. It is especially important that urban inhabitants be properly informed about the danger posed by ticks, the sites of possible tick attacks, and basic self-protection techniques.

  10. Ticks (Acari: Ixodidae) on wild animals from the Porto-Primavera Hydroelectric power station area, Brazil.

    Science.gov (United States)

    Labruna, Marcelo B; de Paula, Cátia D; Lima, Thiago F; Sana, Dênis A

    2002-12-01

    From June 2000 to June 2001, a total of 741 ticks were collected from 51 free-living wild animals captured at the Porto-Primavera Hydroelectric power station area, located alongside an approximately 180 km course of the Paran river, between the states of S o Paulo and Mato Grosso do Sul, comprising 9 species of 3 genera: Ambly-omma (7 species), Boophilus (1) and Anocentor (1). A total of 421 immature Amblyomma ticks were reared in laboratory until the adult stage, allowing identification of the species. A. cajennense was the most frequent tick species (mostly immature stages) collected on 9 host species: Myrmecophaga tridactyla, Tamandua tetradactyla,Cerdocyon thous, Puma concolor,Tayassu tajacu, Mazama gouazoubira,Hydrochaeris hydrochaeris,Alouatta caraya, Cebus apella. Other tick species were less common, generally restricted to certain host taxa.

  11. Acaricides and predatory mites against the begonia mite, Polyphagotarsonemus latus (Acari: Tarsonemidae), on Hedera helix.

    Science.gov (United States)

    Audenaert, Joachim; Vissers, Marc; Haleydt, Bart; Verhoeven, Ruth; Goossens, Frans; Gobin, Bruno

    2009-01-01

    In recent years, the begonia mite (Polyphagotarsonemus lotus) has become an important threat to different ornamental cultures in warm greenhouses. At present there are no professional plant protection products registered in Belgium for the control of mites of the Tarsonemidae family. In a screening trial, we evaluated the efficacy of a range of different acaricides: abamectin, milbemectin, pyridaben, spirodiclofen. Based on the results of the screening trial several products were selected for a full efficacy trial following EPPO guidelines. The best control results were obtained with two products from the avermectine group: abamectin and milbemectin. As growers currently have to rely solely on the use of natural enemies there is a strong need for practical evaluation of efficacies of the various predatory mite species (Amblyseius swirskii, A. cucumeris, A. andersoni) used in biological mite control. In a series of experiments, we screened the use of different species of predatory mites. The first efficacy trials on heavily infested plants at different rates of dosage and under different circumstances (temperature, dose rate, application technique) were started in May 2008. In these experiments Amblyseius swirskii showed good efficacy. But temperature was the limiting factor: the predatory mite needed a minimal temperature of 18 degrees C to obtain good results. Further research is necessary to search for predatory mites that can be used in winter conditions (lower temperatures, less light).

  12. Intraplant distribution of Acalitus essigi (Acari: Eriophyoidea) on blackberries (Rubus fruticosus agg.).

    Science.gov (United States)

    Davies, J T; Allen, G R; Williams, M A

    2001-01-01

    Specialised phytophagous arthropods often display high levels of specificity to particular sites on their host plant. In this paper we examine the occupation of microhabitats and aggregation patterns of the eriophyoid mite, Acalitus essigi (Hassan), on its host plant, European blackberry (Rubus fruticosus L. aggregate), a plant that undergoes significant seasonal changes in its morphology. A. essigi was found to be a refuge inhabiting species. It resided in bud and leaf axil microhabitats on both primocanes and fructocanes and also occupied berry and bract microhabitats on fructocanes. Population fluctuations within the different microhabitats were evident across seasons. From summer to winter, populations significantly declined in bract and leaf axil microhabitats, but significantly increased within bud microhabitats where overwintering took place as slowly reproducing colonies. Live fruit and young shoots were also identified as overwintering sites. A. essigi populations displayed an aggregated distribution both within and between individual blackberry canes. Within primocanes A. essigi were aggregated in the lower 20% of cane length. On fructocanes aggregation of A. essigi was in the lower 20% and especially in the upper 20% of cane length. In spring A. essigi was confirmed to emerge from bud overwintering sites and colonise shoots mainly in the lower third of the previous season's primocanes, suggesting limited dispersal away from overwintering sites. It is proposed that biotic factors such as tissue age, microhabitat morphology and limited ambulatory dispersal capabilities are responsible for the aggregation pattems of this mite.

  13. A new species of the genus Neogalumna (Acari, Oribatida, Galumnidae from China

    Directory of Open Access Journals (Sweden)

    Liang, Wenqin

    2014-06-01

    Full Text Available A new species of oribatid mites of the family Galumnidae, Neogalumna longiporosa sp. nov., is described from dark loamy soil collected under moss in North Eastern China. It is the first identified member of the genus Neogalumna recorded for China. An identification key to the known species of Neogalumna is also given.

  14. Influence of gamma radiation for controlling Brevipalpus phoenicis (Acari: Tenuipalpidae) (Geijskes, 1939) in oxygen atmosphere

    Energy Technology Data Exchange (ETDEWEB)

    Machi, Andre R., E-mail: rica_machi@hotmail.com [Instituto de Pesquisas Energeticas e Nucleares (IPEN/CNEN- SP), Sao Paulo, SP (Brazil); Arthur, Valter, E-mail: arthur@cena.usp.br [Centro de Energia na Agricultura (CENA/USP), Piracicaba, SP (Brazil)

    2013-07-01

    Brevipalpus phoenicis mite are controlled across of solutions acaricides, which are chemicals and leave residues in addition there is the difficulty of an effective pulverization due to the small size of the mite, the objective of this study was to evaluate of the influence of oxygen combined with gamma radiation on B.phoenicis as alternative control. Were used 70 mites per arena in 9 reps on 3 treatments at doses of 0 (control), 200 and 300 Gy. For irradiation, the leaves containing the mites, were cut and placed on bottles with bladder tied with ribbons and strings, before was put pure oxygen and the bottle was then sealed, these were taken to a gamma irradiator of Cobalt 60-type Gammacell 220, under a dose rate of 0.381 kGy/hour located in the CENA/USP. Was evaluated daily (eggs, nymphs and adults) of the mites observed viability, fertility and mortality across of the analysis of variance design with completely randomized design using the Statistical Analysis System (SAS) version 9.2® and by the Tukey test, the verification of means. After 22 days of irradiation the hatchability in 200 Gy dose was 41% after 3 days and 57% in control dose, this differed statistically of the other doses, where the nymphs arrived to the adult stage, which did not occurred in the 200 Gy dose and higher due to mutations, generated by the gamma radiation. In 300 Gy not was observed the presence of nymphs and eggs, being the sterilizing dose for all stages of the B.phoenicis. (author)

  15. Application of gamma radiation on longevity of some mites species (Acari: Tetranychidade)

    Energy Technology Data Exchange (ETDEWEB)

    Machi, Andre R., E-mail: rica_machi@hotmail.com [Instituto de Pesquisas Energeticas e Nucleares (IPEN/CNEN-SP), Sao Paulo, SP (Brazil); Arthur, Valter, E-mail: arthur@cena.usp.br [Centro de Energia Nuclear na Agricultura (CENA/USP), Piracicaba, SP (Brazil)

    2015-07-01

    Mites are pests agricultural found in various environments accessible to animal life: soil, aerial parts of the plants, host insects. In this research the effects of gamma irradiation on longevity of mite pests of the tetranychidae family have been studied. The mites were irradiated in a source of Cobalt-60, Gammacell-220 type, at a dose rate of 0.486 kGy located in the CENA/USP, in the doses of 0 (control), 100, 200, 300, and 400 Gy with sixteen replicates per dose. After the irradiation, the mites were placed in petri dishes totalizing 5 treatments in 32 repetitions. The analysis of variance design with completely randomized design using the Statistical Analysis System (SAS) and the Tukey test, the verification of means. Were evaluated daily the adult mortality and longevity of irradiated mites. After 25 days was observed a mean longevity of mites, for O.ilicis, 100 Gy was equal the control dose (18.3 days), but to T. desertorum and T. urticae the larger longevity was observed in the dose of 200 Gy (19.0 days) being that this dose, obtained the larger longevity in comparison to control dose (18.5 days), in general the longevity decreased in relation to increased doses. Thus, only the dose of 100 Gy and 200 Gy stimulated an increased the longevity in O. ilicis and T. desertorum and T. urticae respectively. The exact mechanism by which the mites are tolerant to avoid damage caused by radicals when exposed to ionizing radiation is not fully understood. (author)

  16. Phytoseiid mites from tropical fruit trees in Bahia State, Brazil (Acari, Phytoseiidae).

    Science.gov (United States)

    de Souza, Izabel Vieira; Sá Argolo, Poliane; Júnior, Manoel Guedes Correa Gondim; de Moraes, Gilberto José; Bittencourt, Maria Aparecida Leão; Oliveira, Anibal Ramadan

    2015-01-01

    The cultivation of tropical fruit trees has grown considerably in the state of Bahia, northeastern Brazil. Some of these have been severely attacked by phytophagous mites, which are usually controlled by the use of chemical pesticides. However, there is today a growing interest for the adoption of less aggressive measures of pest control, as for example the use of predatory mites. Most of the plant-inhabiting predatory mites belong to the family Phytoseiidae. The objective of this paper is to report the phytoseiid species found in an intensive survey conducted on cultivated tropical fruit trees in fifteen localities of the southern coast of Bahia. Measurements of relevant morphological characters are provided for each species, to complement the understanding of the morphological variation of these species. Twenty-nine species of sixteen genera were identified. A key was elaborated to assist in the separation of these species. Fifteen species are reported for the first time in the state, raising to sixty-six the number of species of this family now known from Bahia. Seventy-two percent of the species collected belong to Amblyseiinae, followed by Typhlodrominae (21%) and Phytoseiinae (7%). The most diverse genus was Amblyseius. Amblyseius operculatus De Leon was the most frequent and abundant species. Studies should be conducted to evaluate the possible role of the most common predators as control agents of the phytophagous mites co-occurring with them.

  17. Repellent effect of santalol from sandalwood oil against Tetranychus urticae (Acari: Tetranychidae).

    Science.gov (United States)

    Roh, Hyun Sik; Park, Kye Chung; Park, Chung Gyoo

    2012-04-01

    Thirty-four essential oils were screened for their repellent activities against the twospotted spider mite, Tetranychus urticae Koch (Acarina: Tetranychidae), at 0.1% concentration level using choice and no-choice laboratory bioassays. Of these, 20 essential oils showed significant repellencies against T. urticae in the choice tests. In subsequent no-choice tests using these 20 essential oils, only sandalwood oil showed significant repellency against T. urticae. Total number of eggs oviposited by T. urticae was significantly lower than controls in the choice tests when the kidney bean leaves were treated with 1 of 14 essential oils. The significant repellency of sandalwood oil against T. urticae lasted at least for 5 h at the 0.1% concentration level. Our GC-MS analysis indicated that the major components of the sandalwood oil were alpha-santalol (45.8%), beta-santalol (20.6%), beta-sinensal (9.4%), and epi-beta-santalol (3.3%). Santanol, a mixture of the two main components in the sandalwood oil, appears to be responsible for the repellency of sandalwood oil against T. urticae.

  18. Mechanisms of insecticide resistance in field populations of varroa mite (Acari: Mesostigmata: Varroidae)in Florida

    Science.gov (United States)

    The ectoparasitic mite Varroa destuctor is a serious threat to beekeeping and crops that rely on honey bee for pollination. The Varroa mite not only causes significant damage to honey bees by feeding on their haemolymph, but also serves as a vector of disease. In addition, the Varroa mite has develo...

  19. Temperature governs on-host distribution of the northern fowl mite, Ornithonyssus sylviarum (Acari: Macronyssidae).

    Science.gov (United States)

    De La Riva, Deborah G; Soto, Diane; Mullens, Bradley A

    2015-02-01

    The northern fowl mite, Ornithonyssus sylviarum (Canestri & Fanzago), is an ectoparasite of more than 70 species of North American wild birds, but it has a particularly significant impact on chickens, where it is a permanent resident of vent feathers. Improved control practices depend on a better understanding of host-mite relationships. ISA Brown hens were inoculated experimentally with northern fowl mite adults, and northern fowl mite populations developed naturally. Using a fast-response microprobe, temperatures of individual vent feathers (n = 15) were recorded at 5-mm increments along the length of the feather shaft. Immediately after temperatures were recorded, the individual feathers were quickly clipped at the skin surface and then flash-frozen between 2 small blocks of dry ice, freezing all northern fowl mite stages in situ. The feathers then were cut into 5-mm sections for careful mite enumeration by life stage. There were no overall differences among life stages in the distributions on the feather. Mite positions on feathers (distance from skin) varied distinctly with feather zone temperatures, as well as with ambient and average temperatures over the prior 24 hr. Ambient temperature at time of sampling affected the positions of the 2 mobile categories, adults and larvae/nymphs, but showed no statistical relationship with egg distribution. In contrast, ambient 24-hr temperature influenced the positions of all life stages. On-host feather temperatures reflected ambient temperatures. Feathers collected on hot days (ambient temperatures of 23-33 C) provided a narrow and quite warm range of temperature conditions for mites (often >30-36 C). Temperatures on cool days (ambient temperatures of <23 C) provided much wider on-host temperature ranges for mites to occupy (13-35 C). Mites were farther from the skin on warmer days. When mites had a broad range of temperatures, the feather temperature zone occupied by all life stages averaged 28-29 C. Mites move to occupy favorable temperature conditions on-host. When further out on feathers in warm weather, and under thermal stress, northern fowl mites either move off host or are dislodged. They then become a human pest, are noticed by farmers, and are more likely to disperse.

  20. Nanohystricidae n. fam., an unusual, plesiomorphic enarthronote mite family endemic to New Zealand (Acari, Oribatida).

    Science.gov (United States)

    Norton, Roy A; Fuangarworn, Marut

    2015-10-02

    Nanohystrix hammerae n. gen., n. sp.--proposed on the basis of numerous adults and a few juveniles--is a new oribatid mite of the infraorder Enarthronota that appears to be phylogenetically relictual and endemic to northern New Zealand, in habitats ranging from native shrublands to native and semi-native forests. With an adult body length of 1-1.2 mm, the species is the largest known enarthronote mite outside Lohmanniidae, and it has an unusual combination of plesiomorphic and apomorphic traits. Plesiomorphies include: a well-formed median (naso) eye and pigmented lateral eyes; a bothridial seta with a simple, straight base; a vertically-oriented gnathosoma; a peranal segment; adanal sclerites partially incorporated in notogaster (uncertain polarity); three genu I solenidia and a famulus on tarsus II. Autapomorphies include: five pairs of pale cuticular disks on the notogaster, with unknown function; six pairs of long, erectile notogastral setae, including pair h2 incorporated in the second transverse scissure along with the f-row, and pair h1 in a third scissure; chelicerae that are unusually broad, creating a flat-faced appearance; legs I that are inferred to have an unusually wide range of motion. Further, it is the only enarthronote species known to have an elongated ovipositor, and one of few to have glassy, luminous notogastral setae. The gastronotum of juveniles lacks transverse scissures, but has isolated sclerites supporting setae, including erectile setae. The large character gaps between N. hammerae and other enarthronote taxa justifies proposal of a monotypic new family--Nanohystricidae n. fam.--which is tentatively grouped with several other relictual families in the paraphyletic Heterochthonioidea. Small muscles appear to be involved in the operation of all erectile setae, but seem to be only depressors, with erection effected by hysterosomal distension. Based on gut contents, its food is primarily fungal hyphae and spores, though ingestion of small arthropods also occurs (perhaps by necrophagy). Collections were made by Berlese-funnel samples of litter, by sweeping low vegetation, and (mainly) by pitfall traps; the latter two suggest that adults are surface-active. Tritonymphs were collected by pitfall traps, but earlier juveniles were collected only by Berlese-funnels. Adults are frequently infected with a eugregarine parasite, which can entirely fill the digestive caeca; immature trophozoites were also seen in tritonymphs. Adults also can serve as hosts for dispersal of secondary capilliconidia of the fungal genus Basidiobolus.