WorldWideScience

Sample records for hv cross-polarized airsar

  1. The definition of cross polarization

    DEFF Research Database (Denmark)

    Ludwig, Arthur

    1973-01-01

    There are at least three different definitions of cross polarization used in the literature. The alternative definitions are discussed with respect to several applications, and the definition which corresponds to one standard measurement practice is proposed as the best choice....

  2. Log-periodic dipole antenna with low cross-polarization

    DEFF Research Database (Denmark)

    Pivnenko, Sergey

    2006-01-01

    In this work, log-periodic antennas with improved cross-polarization level were studied. It was found that some modifications of the traditional design lead to an essential improvement of the co-to-cross polarization ratio up to 40 dB. An improved design of a log-periodic dipole antenna with low...

  3. Coherent Backscattering in the Cross-Polarized Channel

    Science.gov (United States)

    Mischenko, Michael I.; Mackowski, Daniel W.

    2011-01-01

    We analyze the asymptotic behavior of the cross-polarized enhancement factor in the framework of the standard low-packing-density theory of coherent backscattering by discrete random media composed of spherically symmetric particles. It is shown that if the particles are strongly absorbing or if the smallest optical dimension of the particulate medium (i.e., the optical thickness of a plane-parallel slab or the optical diameter of a spherically symmetric volume) approaches zero, then the cross-polarized enhancement factor tends to its upper-limit value 2. This theoretical prediction is illustrated using direct computer solutions of the Maxwell equations for spherical volumes of discrete random medium.

  4. Rain-induced cross-polarization effects on satellite ...

    African Journals Online (AJOL)

    Rain-induced cross-polarization effects on satellite telecommunication in some tropical location. ... The PDF file you selected should load here if your Web browser has a PDF reader plug-in installed (for example, a recent version of Adobe Acrobat Reader). If you would like more information about how to print, save, and ...

  5. Relating multifrequency radar backscattering to forest biomass: Modeling and AIRSAR measurement

    Science.gov (United States)

    Sun, Guo-Qing; Ranson, K. Jon

    1992-01-01

    During the last several years, significant efforts in microwave remote sensing were devoted to relating forest parameters to radar backscattering coefficients. These and other studies showed that in most cases, the longer wavelength (i.e. P band) and cross-polarization (HV) backscattering had higher sensitivity and better correlation to forest biomass. This research examines this relationship in a northern forest area through both backscatter modeling and synthetic aperture radar (SAR) data analysis. The field measurements were used to estimate stand biomass from forest weight tables. The backscatter model described by Sun et al. was modified to simulate the backscattering coefficients with respect to stand biomass. The average number of trees per square meter or radar resolution cell, and the average tree height or diameter breast height (dbh) in the forest stand are the driving parameters of the model. The rest of the soil surface, orientation, and size distributions of leaves and branches, remain unchanged in the simulations.

  6. Internal magnetic turbulence measurement in plasma by cross polarization scattering

    Energy Technology Data Exchange (ETDEWEB)

    Zou, X L; Colas, L; Paume, M; Chareau, J M; Laurent, L; Devynck, P; Gresillon, D

    1994-09-01

    For the first time, the internal magnetic turbulence is measured by a new cross polarization scattering diagnostic in Tore Supra tokamak. The principle of this experiment is presented. It is based on the polarization change or mode conversion of the e.m. wave scattering by magnetic fluctuations. The role of different physical processes on the signal formation are investigated. From the Observation, a rough estimate for the relative magnetic fluctuations of about 10{sup -4} is obtained. A strong correlation of the measured signal with additional heating is observed. (author). 14 refs., 4 figs.

  7. Retrieval of pine forest biomass using JPL AIRSAR data

    Science.gov (United States)

    Beaudoin, A.; Letoan, T.; Zagolski, F.; Hsu, C. C.; Han, H. C.; Kong, J. A.

    1992-01-01

    The analysis of Jet Propulsion Laboratory (JPL) Airborne Synthetic Aperture Radar (AIRSAR) data over the Landes forest in South-West France revealed strong correlation between L- and especially P-band sigma degrees and the pine forest biomass. To explain the physical link of radar backscatter to biomass, a polarimetric backscattering model was developed and validated. Then the model was used in a simulation study to predict sigma degree sensitivity to undesired canopy and environmental parameters. Main results concerning the data analysis, modeling, and simulation at P-band are reported.

  8. Optically enhanced nuclear cross polarization in acridine-doped fluorene

    Energy Technology Data Exchange (ETDEWEB)

    Oshiro, C.M.

    1982-06-01

    The objective of this work has been to create large polarizations of the dilute /sup 13/C nuclei in the solid state. The idea was to create /sup 1/H polarizations larger than Boltzmann and to use the proton enhanced nuclear induction spectroscopy cross polarization technique to then transfer this large polarization to the /sup 13/C spin system. Optical Nuclear Polarization (ONP) of acridine-doped fluorene single crystals was studied. In addition, ONP of powdered samples of the acridine-doped fluorene was studied. In general, many compounds do not crystallize easily or do not form large crystals suitable for NMR experiments. Powdered, amorphous and randomly dispersed samples are generally far more readily available than single crystals. One objective of this work has been to (first) create large /sup 1/H polarizations. Although large optical proton polarizations in single crystals have been reported previously, optically generated polarizations in powdered samples have not been reported. For these reasons, ONP studies of powdered samples of the acridine-doped fluorene were also undertaken. Using ONP in combination with the proton enhanced nuclear induction spectroscopy experiment, large /sup 13/C polarizations have been created in fluorene single crystals. These large /sup 13/C polarizations have permitted the determination of the seven incongruent chemical shielding tensors of the fluorene molecule. Part 2 of this thesis describes the proton enhanced nuclear induction spectroscopy experiment. Part 3 describes the ONP experiment. Part 4 is a description of the experimental set-up. Part 5 describes the data analysis for the determination of the chemical shielding tensors. Part 6 presents the results of the ONP experiments performed in this work and the chemical shielding tensors determined.

  9. Optically enhanced nuclear cross polarization in acridine-doped fluorene

    International Nuclear Information System (INIS)

    Oshiro, C.M.

    1982-06-01

    The objective of this work has been to create large polarizations of the dilute 13 C nuclei in the solid state. The idea was to create 1 H polarizations larger than Boltzmann and to use the proton enhanced nuclear induction spectroscopy cross polarization technique to then transfer this large polarization to the 13 C spin system. Optical Nuclear Polarization (ONP) of acridine-doped fluorene single crystals was studied. In addition, ONP of powdered samples of the acridine-doped fluorene was studied. In general, many compounds do not crystallize easily or do not form large crystals suitable for NMR experiments. Powdered, amorphous and randomly dispersed samples are generally far more readily available than single crystals. One objective of this work has been to (first) create large 1 H polarizations. Although large optical proton polarizations in single crystals have been reported previously, optically generated polarizations in powdered samples have not been reported. For these reasons, ONP studies of powdered samples of the acridine-doped fluorene were also undertaken. Using ONP in combination with the proton enhanced nuclear induction spectroscopy experiment, large 13 C polarizations have been created in fluorene single crystals. These large 13 C polarizations have permitted the determination of the seven incongruent chemical shielding tensors of the fluorene molecule. Part 2 of this thesis describes the proton enhanced nuclear induction spectroscopy experiment. Part 3 describes the ONP experiment. Part 4 is a description of the experimental set-up. Part 5 describes the data analysis for the determination of the chemical shielding tensors. Part 6 presents the results of the ONP experiments performed in this work and the chemical shielding tensors determined

  10. Relating P-band AIRSAR backscatter to forest stand parameters

    Science.gov (United States)

    Wang, Yong; Melack, John M.; Davis, Frank W.; Kasischke, Eric S.; Christensen, Norman L., Jr.

    1993-01-01

    As part of research on forest ecosystems, the Jet Propulsion Laboratory (JPL) and collaborating research teams have conducted multi-season airborne synthetic aperture radar (AIRSAR) experiments in three forest ecosystems including temperate pine forest (Duke, Forest, North Carolina), boreal forest (Bonanza Creek Experimental Forest, Alaska), and northern mixed hardwood-conifer forest (Michigan Biological Station, Michigan). The major research goals were to improve understanding of the relationships between radar backscatter and phenological variables (e.g. stand density, tree size, etc.), to improve radar backscatter models of tree canopy properties, and to develop a radar-based scheme for monitoring forest phenological changes. In September 1989, AIRSAR backscatter data were acquired over the Duke Forest. As the aboveground biomass of the loblolly pine forest stands at Duke Forest increased, the SAR backscatter at C-, L-, and P-bands increased and saturated at different biomass levels for the C-band, L-band, and P-band data. We only use the P-band backscatter data and ground measurements here to study the relationships between the backscatter and stand density, the backscatter and mean trunk dbh (diameter at breast height) of trees in the stands, and the backscatter and stand basal area.

  11. BOREAS RSS-16 Level-3b DC-8 AIRSAR SY Images

    Data.gov (United States)

    National Aeronautics and Space Administration — Satellite and aircraft SAR data used in conjunction with various ground measurements to determine the moisture regime of the boreal forest. The NASA JPL AIRSAR is a...

  12. BOREAS RSS-16 Level-3b DC-8 AIRSAR CM Images

    Data.gov (United States)

    National Aeronautics and Space Administration — Satellite and aircraft SAR data used in conjunction with various ground measurements to determine the moisture regime of the boreal forest. The NASA JPL AIRSAR is a...

  13. Quantitative analysis of SMEX'02 AIRSAR data for soil moisture inversion

    Science.gov (United States)

    Zyl, J. J. van; Njoku, E.; Jackson, T.

    2003-01-01

    This paper discusses in detail the characteristics of the AIRSAR data acquired, and provides an initial quantitative assessment of the accuracy of the radar inversion algorithms under these vegetated conditions.

  14. AIRSAR South American deployment: Operation plan, version 3.0

    Science.gov (United States)

    Kobrick, M.

    1993-01-01

    The United States National Aeronautics and Space Administration (NASA) and the Brazilian Commission for Space Activities (COBAE) are undertaking a joint experiment involving NASA's DC-8 research aircraft and the Airborne Synthetic Aperture Radar (AIRSAR) system during late May and June 1993. The research areas motivating these activities are: (1) fundamental research in the role of soils, vegetation, and hydrology in the global carbon cycle; and (2) in cooperation with South American scientists, airborne remote sensing research for the upcoming NASA Spaceborne Imaging Radar (SIR)-C/X-SAR flights on the Space Shuttle. A flight schedule and plans for the deployment that were developed are included. Maps of the site locations and schematic indications of flight routes and dates, plots showing swath locations derived from the flight requests and generated by flight planning software, and, most importantly, a calendar showing which sites will be imaged each day are included.

  15. DUAL POLARIZATION ANTENNA ARRAY WITH VERY LOW CROSS POLARIZATION AND LOW SIDE LOBES

    DEFF Research Database (Denmark)

    1997-01-01

    The present invention relates to an antenna array adapted to radiate or receive electromagnetic waves of one or two polarizations with very low cross polarization and low side lobes. An antenna array comprising many antenna elements, e.g. more than ten antenna elements, is provided in which...... formation of grating lobes are inhibited in selected directions of the radiation and cross polarization within the main lobe is suppressed at least 30 dB below the main lobe peak value. According to a preferred embodiment of the invention, the antenna elements of the antenna array comprise probe-fed patches...

  16. Spin-locking and cross-polarization under magic-angle spinning of uniformly labeled solids.

    Science.gov (United States)

    Hung, Ivan; Gan, Zhehong

    2015-07-01

    Spin-locking and cross-polarization under magic-angle spinning are investigated for uniformly (13)C and (15)N labeled solids. In particular, the interferences from chemical shift anisotropy, and (1)H heteronuclear and (13)C homonuclear dipolar couplings are identified. The physical origin of these interferences provides guidelines for selecting the best (13)C and (15)N polarization transfer rf fields. Optimal settings for both the zero- and double-quantum cross-polarization transfer mechanisms are recommended. Copyright © 2015 Elsevier Inc. All rights reserved.

  17. Effects of using hallux valgus (HV splint, HV splint plus exercise or HV splint plus electrical stimulation (ES on treatment of flexible HV in Young Population

    Directory of Open Access Journals (Sweden)

    Abbas Rahimi

    2012-10-01

    Full Text Available Background and Aim: The dramatically increased incidence of hallux valgus (HV deformity is more related to the cultural rather than genetic parameters. Satisfaction rate following either conservative or surgical treatments are very low. The current study aimed to compare the effects of three commonly used conservative treatments including hallux valgus (HV splint, HV splint plus electrical stimulation (ES currents, or HV splint plus exercise to treat this deformity. Materials & Methods: Thirty-six university students with a mild to moderate HV deformity were recruited in this study. Before starting the study, anterior-posterior view radiographies were taken from their feet. HV angle (HVA less than 20º was considered as normal, between 21-25º as mild, between 26-40 º as moderate and higher than 40 degrees was considered as a sever HV deformity. Then, the subjects were divided into three groups (n=12 and were randomly placed into Splint, Splint plus Exercise, and Splint plus Exercise plus ES groups for 6 weeks. At the end of week six, the radiographies were repeated and the pre/post treatments HVA were compared. Results: The results of the current study showed a non-significant 4.7% reduction of HVA in Splint group (p=0.12. However, 15.4% reduction of HVA occurred in Splint plus Exercise group, which was significant (p=0.005.The subjects used Splint plus Electrical stimulation showed a significant 13.9% reduction in HVA (p=0.008. Furthermore, AOFAS scores of the subjects revealed no significant differences among treatment groups in terms of pain reduction.Conclusion: Although using a HV splint alone could not significantly reduce the HVA, mixing it with either exercise or ES could significantly expedite its corrective effects. It should be mentioned that correction of the deformity was not always associated with decreasing the subjects’ pain, which might be due to the immediate counter force of the splint. Repeating the study with a long

  18. Flow velocity measurement by using zero-crossing polarity cross correlation method

    International Nuclear Information System (INIS)

    Xu Chengji; Lu Jinming; Xia Hong

    1993-01-01

    Using the designed correlation metering system and a high accurate hot-wire anemometer as a calibration device, the experimental study of correlation method in a tunnel was carried out. The velocity measurement of gas flow by using zero-crossing polarity cross correlation method was realized and the experimental results has been analysed

  19. Retrieving hurricane wind speeds using cross-polarization C-band measurements

    NARCIS (Netherlands)

    Van Zadelhoff, G.J.; Stoffelen, A.; Vachon, P.W.; Wolfe, J.; Horstmann, J.; Belmonte Rivas, M.

    2014-01-01

    Hurricane-force wind speeds can have a large societal impact and in this paper microwave C-band cross-polarized (VH) signals are investigated to assess if they can be used to derive extreme wind-speed conditions. European satellite scatterometers have excellent hurricane penetration capability at

  20. Circularly Polarized Microwave Antenna Element with Very Low Off-Axis Cross-Polarization

    Science.gov (United States)

    Greem. David; DuToit, Cornelis

    2013-01-01

    The goal of this work was to improve off-axis cross-polarization performance and ease of assembly of a circularly polarized microwave antenna element. To ease assembly, the initial design requirement of Hexweb support for the internal circuit part, as well as the radiating disks, was eliminated. There is a need for different plating techniques to improve soldering. It was also desirable to change the design to eliminate soldering as well as the need to use the Hexweb support. Thus, a technique was developed to build the feed without using solder, solving the lathing and soldering issue. Internal parts were strengthened by adding curvature to eliminate Hexweb support, and in the process, the new geometries of the internal parts opened the way for improving the off-axis cross-polarization performance as well. The radiating disks curvatures were increased for increased strength, but it was found that this also improved crosspolarization. Optimization of the curvatures leads to very low off-axis cross-polarization. The feed circuit was curved into a cylinder for improved strength, eliminating Hexweb support. An aperture coupling feed mechanism eliminated the need for feed pins to the disks, which would have required soldering. The aperture coupling technique also improves cross-polarization performance by effectively exciting the radiating disks very close to the antenna s central axis of symmetry. Because of the shape of the parts, it allowed for an all-aluminum design bolted together and assembled with no solder needed. The advantage of a solderless design is that the reliability is higher, with no single-point failure (solder), and no need for special plating techniques in order to solder the unit together. The shapes (curved or round) make for a more robust build without extra support materials, as well as improved offaxis cross-polarization.

  1. Unidirectional cross polarization rotator with enhanced broadband transparency by cascading twisted nanobars

    International Nuclear Information System (INIS)

    Wang, Ying-Hua; Shao, Jian; Li, Jie; Zhu, Ming-Jie; Li, Jiaqi; Dong, Zheng-Gao

    2016-01-01

    We demonstrate the optical activity for linear polarization by twisting cascading multilayer nanobars, for which the x- (y-)polarized light is significantly transformed to a y- (x-)polarized one with enhanced transmittance in a unidirectional manner, and the bandwidth can be broadened by increasing the cascading number of layers. The polarization conversion rate reaches nearly 100% with a maximum cross-polarization transmission coefficient larger than 0.95. This phenomenon is attributed to the chiral structural arrangement and anisotropic resonance of nanobars, which consequently leads to different cross-polarization conversions between forward and backward incident lights, and thus the unidirectional transmission with an extinction ratio up to 10 3 . These characteristics show application potential in optical nano-devices. (paper)

  2. Advantages of cross-polarization endoscopic optical coherence tomography in diagnosis of bladder neoplasia

    Science.gov (United States)

    Gladkova, N. D.; Zagaynova, E. V.; Streltsova, O. S.; Kiseleva, E. B.; Karabut, M. M.; Snopova, L. B.; Yunusova, E. E.; Tararova, E.; Gelikonov, V. M.

    2010-02-01

    We consider the cross-polarization OCT (CP OCT) that is focused on comparison of images resulting from cross-polarization and co-polarization scattering simultaneously. This technique provides information about microstructural and biochemical alterations in depolarizing tissue components (collagen). We found that mature type I collagen gives a strong signal in orthogonal polarization. CP OCT images of benign inflammatory processes always feature signal in orthogonal polarization, with layers and borders persisting to be well defined. In the presence of precancerous alterations, signal in orthogonal polarization is available in the image but it is irregular, disappearing in some areas. A CP OCT image of bladder cancer in orthogonal polarization either shows no signal at all or a weak signal.

  3. Solid state nuclear magnetic resonance studies of cross polarization from quadrupolar nuclei

    Energy Technology Data Exchange (ETDEWEB)

    De Paul, Susan M. [Univ. of California, Berkeley, CA (United States)

    1997-08-01

    The development of solid-state Nuclear Magnetic Resonance (NMR) has, to a large extent, focused on using spin-1/2 nuclei as probes to investigate molecular structure and dynamics. For such nuclei, the technique of cross polarization is well-established as a method for sensitivity enhancement. However, over two-thirds of the nuclei in the periodic table have a spin-quantum number greater than one-half and are known as quadrupolar nuclei. Such nuclei are fundamental constituents of many inorganic materials including minerals, zeolites, glasses, and gels. It is, therefore, of interest to explore the extent to which polarization can be transferred from quadrupolar nuclei. In this dissertation, solid-state NMR experiments involving cross polarization from quadrupolar nuclei to spin-1/2 nuclei under magic-angle spinning (MAS) conditions are investigated in detail.

  4. Reduction of cross-polarized reflection to enhance dual-band absorption

    Science.gov (United States)

    Kundu, Debidas; Mohan, Akhilesh; Chakrabarty, Ajay

    2016-11-01

    In this paper, cross-polarized reflection from a periodic array of metal-dielectric-metal resonator units is reduced to improve its absorbing performance. Through this simple and typical example, it is shown that some reported absorbers are actually poor absorbers but efficient polarization converters, when the cross-polarized reflection is considered. Using a frequency selective surface, sandwiched between the top layer and the ground plane, the cross-polarized reflection is reduced by 7.2 dB at 5.672 GHz and 8.5 dB at 9.56 GHz, while negligibly affecting the co-polarized reflection reduction performance. The polarization conversion ratio is reduced from 90. 74% to 34.12% and 98.51% to 27.2% and total absorption is improved up to 80% from 26% and 21% around the two resonant frequencies. The reflection characteristics of the proposed absorber are quantitatively analyzed using interference theory, where the near field coupling of the resonant geometries and ground is taken into account. Measurement results show good agreement with both the numerically simulated and theoretical results.

  5. Clinical protection of goats against CpHV-1 induced genital disease with a BoHV-4-based vector expressing CpHV-1 gD.

    Directory of Open Access Journals (Sweden)

    Gaetano Donofrio

    Full Text Available Caprine herpesvirus type 1 (CpHV-1 is an alphaherpesvirus causing genital disease leading to abortion in adult pregnant goats and a systemic disease with high morbility and mortality in kids. Further, Caprine herpesvirus 1 infection represents a valuable large animal model for human herpesvirus induced genital disease, exploitable for pathogenic studies, new vaccines and antiviral molecules testing. Here, the bovine herpesvirus 4 (BoHV-4 based vector derived from an apathogenic isolate of BoHV-4 and expressing the immunodominant CpHV-1 glycoprotein D (BoHV-4-A-gD(cpgD(106ΔTK was constructed and its ability to protect goats against CpHV-1 induced genital disease evaluated. The subcutaneous route of recombinant BoHV-4 administration was first tested in vivo/ex vivo by in vivo image analysis and in vitro by goat skin primary cultures preparation and transduction. Next, an exploratory immunization and safety study in goats was performed with two recombinant BoHV4, BoHV-4-A-gD(cpgD(106ΔTK or BoHV-4-CMV-IgK-gE2gD-TM. In both cases no clinical signs were evident but a good titer of serum neutralizing antibodies was produced in all inoculated animals. When a challenge experiment was performed in a new group of animals using a highly pathogenic dose of CpHV-1, all the vaccinated goats with BoHV-4-A-gD(cpgD(106ΔTK were protected toward CpHV-1 induced genital disease respect to the unvaccinated control which showed typical vaginal lesions with a high grade of clinical score as well as a long lasting viral shedding. In summary, the data acquired in the present study validate BoHV-4-based vector as a safe and effective viral vector for goat vaccination against CpHV-1 induced genital disease and pave the way for further applications.

  6. Characterization of wetland, forest, and agricultural ecosystems in Belize with airborne radar (AIRSAR)

    Science.gov (United States)

    Pope, Kevin O.; Rey-Benayas, Jose Maria; Paris, Jack F.

    1992-01-01

    The Shuttle Imaging Radar-C/X-SAR (Synthetic Aperture Radar) Experiment includes the study of wetland dynamics in the seasonal tropics. In preparation for these wetland studies, airborne P, L, and C band radar (AIRSAR) data of Belize, Guatemala, and Mexico acquired by NASA and JPL in March 1990 were analyzed. The first phase of our study focuses on AIRSAR data from the Gallon Jug test site in northwestern Belize, for which ground data were also collected during the three days prior to the overflight. One of the main objectives of the Gallon Jug study is to develop a method for characterizing wetland vegetation types and their flooding status with multifrequency polarimetric radar data.

  7. Quantitative analysis of surface characteristics and morphology in Death Valley, California using AIRSAR data

    Science.gov (United States)

    Kierein-Young, K. S.; Kruse, F. A.; Lefkoff, A. B.

    1992-01-01

    The Jet Propulsion Laboratory Airborne Synthetic Aperture Radar (JPL-AIRSAR) is used to collect full polarimetric measurements at P-, L-, and C-bands. These data are analyzed using the radar analysis and visualization environment (RAVEN). The AIRSAR data are calibrated using in-scene corner reflectors to allow for quantitative analysis of the radar backscatter. RAVEN is used to extract surface characteristics. Inversion models are used to calculate quantitative surface roughness values and fractal dimensions. These values are used to generate synthetic surface plots that represent the small-scale surface structure of areas in Death Valley. These procedures are applied to a playa, smooth salt-pan, and alluvial fan surfaces in Death Valley. Field measurements of surface roughness are used to verify the accuracy.

  8. Aspects related to replacing HV lines by HV cables on resonant grid behavior

    NARCIS (Netherlands)

    Wu, L.; Wouters, P.A.A.F.; Steennis, E.F.

    2011-01-01

    At different places worldwide EHV/HV connections partly consist of sections with underground power cables. Presently in the west of the Netherlands 20 km (i.e. 240 km single phase in total) of power cables is planned in a new 380 kV connection (Randstad380 project) grid to ensure sufficient

  9. Simulation study on cross polarization scattering of ultrashort-pulse electromagnetic waves

    International Nuclear Information System (INIS)

    Katsuragawa, Naoki; Hojo, Hitoshi; Mase, Atushi

    1996-11-01

    Simulation study on cross polarization scattering of ultrashort-pulse electromagnetic waves due to magnetic fluctuations is presented. One-dimensional coupled wave equations for the ordinary and extraordinary modes are solved for incident unipolar sub-cycle pulses in an inhomogeneous magnetized plasma. It is shown that the peak frequencies in the frequency-spectral signals of the mode-converted reflected waves are determined from the Bragg resonance condition in the wave numbers of the ordinary mode, the extraordinary mode and the magnetic fluctuations for relatively short-wavelength localized magnetic fluctuations. (author)

  10. NONINVASIVE DIAGNOSIS OF BLADDER CANCER BY CROSS-POLARIZATION OPTICAL COHERENCE TOMOGRAPHY: A BLIND STATISTICAL STUDY

    Directory of Open Access Journals (Sweden)

    O. S. Streltsova

    2014-07-01

    Full Text Available Whether cross-polarization (CP optical coherence tomography (OCT could be used to detect early bladder cancer was ascertained; it was compared with traditional OCT within the framework of blind (closed clinical statistical studies. One hundred and sixteen patients with local nonexophytic (flat pathological processes of the bladder were examined; 360 CP OCT images were obtained and analyzed. The study used an OCT 1300-U CP optical coherence tomographer. CP OCT showed a high (94% sensitivity and a high (84% specificity in the identification of suspected nonexophytic areas in the urinary bladder.

  11. Dependence of the cross polar cap potential saturation on the type of solar wind streams

    OpenAIRE

    Nikolaeva, N. S.; Yermolaev, Yu. I.; Lodkina, I. G.

    2013-01-01

    We compare of the cross polar cap potential (CPCP) saturation during magnetic storms induced by various types of the solar wind drivers. By using the model of Siscoe-Hill \\citep{Hilletal1976,Siscoeetal2002a,Siscoeetal2002b,Siscoeetal2004,Siscoe2011} we evaluate criteria of the CPCP saturation during the main phases of 257 magnetic storms ($Dst_{min} \\le -50$ nT) induced by the following types of the solar wind streams: magnetic clouds (MC), Ejecta, the compress region Sheath before MC ($Sh_{M...

  12. Decay of correlations between cross-polarized electromagnetic waves in a two-dimensional random medium.

    Science.gov (United States)

    Gorodnichev, E E

    2018-04-01

    The problem of multiple scattering of polarized light in a two-dimensional medium composed of fiberlike inhomogeneities is studied. The attenuation lengths for the density matrix elements are calculated. For a highly absorbing medium it is found that, as the sample thickness increases, the intensity of waves polarized along the fibers decays faster than the other density matrix elements. With further increase in the sample thickness, the off-diagonal elements which are responsible for correlations between the cross-polarized waves disappear. In the asymptotic limit of very thick samples the scattered light proves to be polarized perpendicular to the fibers. The difference in the attenuation lengths between the density matrix elements results in a nonmonotonic depth dependence of the degree of polarization. In the opposite case of a weakly absorbing medium, the off-diagonal element of the density matrix and, correspondingly, the correlations between the cross-polarized fields are shown to decay faster than the intensity of waves polarized along and perpendicular to the fibers.

  13. Cross-polarization microwave radar return at severe wind conditions: laboratory model and geophysical model function.

    Science.gov (United States)

    Troitskaya, Yuliya; Abramov, Victor; Ermoshkin, Alexey; Zuikova, Emma; Kazakov, Vassily; Sergeev, Daniil; Kandaurov, Alexandr

    2014-05-01

    Satellite remote sensing is one of the main techniques of monitoring severe weather conditions over the ocean. The principal difficulty of the existing algorithms of retrieving wind based on dependence of microwave backscattering cross-section on wind speed (Geophysical Model Function, GMF) is due to its saturation at winds exceeding 25 - 30 m/s. Recently analysis of dual- and quad-polarization C-band radar return measured from satellite Radarsat-2 suggested that the cross-polarized radar return has much higher sensitivity to the wind speed than co-polarized back scattering [1] and conserved sensitivity to wind speed at hurricane conditions [2]. Since complete collocation of these data was not possible and time difference in flight legs and SAR images acquisition was up to 3 hours, these two sets of data were compared in [2] only statistically. The main purpose of this paper is investigation of the functional dependence of cross-polarized radar cross-section on the wind speed in laboratory experiment. Since cross-polarized radar return is formed due to scattering at small-scale structures of the air-sea interface (short-crested waves, foam, sprays, etc), which are well reproduced in laboratory conditions, then the approach based on laboratory experiment on radar scattering of microwaves at the water surface under hurricane wind looks feasible. The experiments were performed in the Wind-wave flume located on top of the Large Thermostratified Tank of the Institute of Applied Physics, where the airflow was produced in the flume with the straight working part of 10 m and operating cross section 0.40?0.40 sq. m, the axis velocity can be varied from 5 to 25 m/s. Microwave measurements were carried out by a coherent Doppler X-band (3.2 cm) scatterometer with the consequent receive of linear polarizations. Experiments confirmed higher sensitivity to the wind speed of the cross-polarized radar return. Simultaneously parameters of the air flow in the turbulent boundary layer

  14. Kinetic and thermodynamic properties of two barley thioredoxin h isozymes, HvTrxh1 and HvTrxh2

    DEFF Research Database (Denmark)

    Maeda, Kenji; Hägglund, Per; Björnberg, Olof

    2010-01-01

    -dependent fluorescence, and the barley isozymes, reaction kinetics and thermodynamic properties were readily determined. The reaction constants were 60% higher for HvTrxh1 than HvTrxh2, while their redox potentials were very similar. The primary nucleophile, Cys(N), of the active site Trp-Cys(N)-Gly-Pro-Cys......Barley thioredoxin h isozymes 1 (HvTrxh1) and barley thioredoxin h isozymes 2 (HvTrxh2) show distinct spatiotemporal distribution in germinating seeds. Using a novel approach involving measurement of bidirectional electron transfer rates between Escherichia coli thioredoxin, which exhibits redox...

  15. NONINVASIVE DIAGNOSIS OF URINARY BLADDER CANCER BY CROSS-POLARIZATION OPTICAL COHERENCE TOMOGRAPHY: CLINICAL RESULTS

    Directory of Open Access Journals (Sweden)

    O. S. Streltsova

    2014-07-01

    Full Text Available The investigation examined the feasibility of cross-polarization optical cohe-rence tomography (CP OCT to detect early urinary bladder cancer (UBC. Studies were performed in 376 patients; 5290 images were obtained using an OCT 133-U optical coherence tomograph. To acquire and compare intrared-light scattering images in baseline and orthogonal polarizations is the basis of CP OCT; their analysis makes it possible to judge from the state of the epithelium/connective tissue system and to obtain information on changes in tissue depolarizing components, collagen in particular. The authors elaborated criteria as determinants of the nature of CP OCT changes in direct and orthogonal polarizations in health, inflammatory changes, and UBC at its early stage - urothelial dysplasia and carcinoma in situ in flat suspected areas.

  16. Understanding sunscreen SPF performance using cross-polarized UVA reflectance photography.

    Science.gov (United States)

    Crowther, J M

    2018-04-01

    Objective methods for understanding sunscreen behaviour in vitro before they are applied to the skin have failed to keep pace with the ever-increasing demands for higher SPF scores where the products are absorbing more and more similar levels of UV. A novel method for visualizing the spreading and location of SPF ingredients based on cross-polarized UVA reflectance photography is described here which gives new insights into the formation of final film morphology and how it correlates with in vivo SPF efficacy for a set of test products. High-resolution UVA-based images of sunscreen films spread onto PMMA plates were captured using a modified commercial SLR camera in a custom imaging system. Visual grading and image analysis were used to describe the overall UVA absorbance and streakiness of the resultant films, and the data compared with both in vivo and calculated in vitro SPF scores for the products. Differences were observed between the products in terms of how they spread during application. A strong correlation was observed between the evenness of the resultant film as determined from the photographs and final in vivo SPF scores. Cross-polarized UVA reflectance photography has been demonstrated to be a valuable new method for assessing sunscreen distribution after spreading and to differentiate product based on film morphology, as well as strongly correlating with final in vivo behaviour. © 2017 Society of Cosmetic Scientists and the Société Française de Cosmétologie.

  17. Approaches to vegetation mapping and ecophysiological hypothesis testing using combined information from TIMS, AVIRIS, and AIRSAR

    Science.gov (United States)

    Oren, R.; Vane, G.; Zimmermann, R.; Carrere, V.; Realmuto, V.; Zebker, Howard A.; Schoeneberger, P.; Schoeneberger, M.

    1991-01-01

    The Tropical Rainforest Ecology Experiment (TREE) had two primary objectives: (1) to design a method for mapping vegetation in tropical regions using remote sensing and determine whether the result improves on available vegetation maps; and (2) to test a specific hypothesis on plant/water relations. Both objectives were thought achievable with the combined information from the Thermal Infrared Multispectral Scanner (TIMS), Airborne Visible/Infrared Imaging Spectrometer (AVIRIS), and Airborne Synthetic Aperture Radar (AIRSAR). Implicitly, two additional objectives were: (1) to ascertain that the range within each variable potentially measurable with the three instruments is large enough in the site, relative to the sensitivity of the instruments, so that differences between ecological groups may be detectable; and (2) to determine the ability of the three systems to quantify different variables and sensitivities. We found that the ranges in values of foliar nitrogen concentration, water availability, stand structure and species composition, and plant/water relations were large, even within the upland broadleaf vegetation type. The range was larger when other vegetation types were considered. Unfortunately, cloud cover and navigation errors compromised the utility of the TIMS and AVIRIS data. Nevertheless, the AIRSAR data alone appear to have improved on the available vegetation map for the study area. An example from an area converted to a farm is given to demonstrate how the combined information from AIRSAR, TIMS, and AVIRIS can uniquely identify distinct classes of land use. The example alludes to the potential utility of the three instruments for identifying vegetation at an ecological scale finer than vegetation types.

  18. Sensitivity enhancement by multiple-contact cross-polarization under magic-angle spinning.

    Science.gov (United States)

    Raya, J; Hirschinger, J

    2017-08-01

    Multiple-contact cross-polarization (MC-CP) is applied to powder samples of ferrocene and l-alanine under magic-angle spinning (MAS) conditions. The method is described analytically through the density matrix formalism. The combination of a two-step memory function approach and the Anderson-Weiss approximation is found to be particularly useful to derive approximate analytical solutions for single-contact Hartmann-Hahn CP (HHCP) and MC-CP dynamics under MAS. We show that the MC-CP sequence requiring no pulse-shape optimization yields higher polarizations at short contact times than optimized adiabatic passage through the HH condition CP (APHH-CP) when the MAS frequency is comparable to the heteronuclear dipolar coupling, i.e., when APHH-CP through a single sideband matching condition is impossible or difficult to perform. It is also shown that the MC-CP sideband HH conditions are generally much broader than for single-contact HHCP and that efficient polarization transfer at the centerband HH condition can be reintroduced by rotor-asynchronous multiple equilibrations-re-equilibrations with the proton spin bath. Boundary conditions for the successful use of the MC-CP experiment when relying on spin-lattice relaxation for repolarization are also examined. Copyright © 2017 Elsevier Inc. All rights reserved.

  19. Dental Shade Guide Variability for Hues B, C, and D Using Cross-Polarized Photography.

    Science.gov (United States)

    Sampaio, Camila S; Gurrea, Jon; Gurrea, Marta; Bruguera, August; Atria, Pablo J; Janal, Malvin; Bonfante, Estevam A; Coelho, Paulo G; Hirata, Ronaldo

    2018-04-20

    This study evaluated the color variability of hues B, C, and D between the VITA Classical shade guide (Vita Zahnfabrik) and four other VITA-coded ceramic shade guides using a digital camera (Canon EOS 60D) and computer software (Adobe Photoshop CC). A cross-polarizing filter was used to standardize external light sources influencing color match. A total of 275 pictures were taken, 5 per shade tab, for 11 shades (B1, B2, B3, B4, C1, C2, C3, C4, D2, D3, and D4), from the following shade guides: VITA Classical (control); IPS e.max Ceram (Ivoclar Vivadent); IPS d.SIGN (Ivoclar Vivadent); Initial ZI (GC); and Creation CC (Creation Willi Geller). Pictures were evaluated using Adobe Photoshop CC for standardization of hue, chroma, and value between shade tabs. The VITA-coded shade guides evaluated here showed an overall unmatched shade in all their tabs when compared to the control, suggesting that shade selection should be made with the corresponding manufacturer guide of the ceramic intended for the final restoration.

  20. Cross-polarization phenomena in the NMR of fast spinning solids subject to adiabatic sweeps

    Energy Technology Data Exchange (ETDEWEB)

    Wi, Sungsool, E-mail: sungsool@magnet.fsu.edu, E-mail: lucio.frydman@weizmann.ac.il; Gan, Zhehong [National High Magnetic Field Laboratory, Tallahassee, Florida 32304 (United States); Schurko, Robert [Department of Chemistry and Biochemistry, University of Windsor, 401 Sunset Avenue, Windsor N9B 3P4, Ontario (Canada); Frydman, Lucio, E-mail: sungsool@magnet.fsu.edu, E-mail: lucio.frydman@weizmann.ac.il [National High Magnetic Field Laboratory, Tallahassee, Florida 32304 (United States); Department of Chemical Physics, Weizmann Institute of Sciences, 76100 Rehovot (Israel)

    2015-02-14

    Cross-polarization magic-angle spinning (CPMAS) experiments employing frequency-swept pulses are explored within the context of obtaining broadband signal enhancements for rare spin S = 1/2 nuclei at very high magnetic fields. These experiments employ adiabatic inversion pulses on the S-channel ({sup 13}C) to cover a wide frequency offset range, while simultaneously applying conventional spin-locking pulse on the I-channel ({sup 1}H). Conditions are explored where the adiabatic frequency sweep width, Δν, is changed from selectively irradiating a single magic-angle-spinning (MAS) spinning centerband or sideband, to sweeping over multiple sidebands. A number of new physical features emerge upon assessing the swept-CP method under these conditions, including multiple zero- and double-quantum CP transfers happening in unison with MAS-driven rotary resonance phenomena. These were examined using an average Hamiltonian theory specifically designed to tackle these experiments, with extensive numerical simulations, and with experiments on model compounds. Ultrawide CP profiles spanning frequency ranges of nearly 6⋅γB{sub 1}{sup s} were predicted and observed utilizing this new approach. Potential extensions and applications of this extremely broadband transfer conditions are briefly discussed.

  1. Parallel and series FED microstrip array with high efficiency and low cross polarization

    Science.gov (United States)

    Huang, John (Inventor)

    1995-01-01

    A microstrip array antenna for vertically polarized fan beam (approximately 2 deg x 50 deg) for C-band SAR applications with a physical area of 1.7 m by 0.17 m comprises two rows of patch elements and employs a parallel feed to left- and right-half sections of the rows. Each section is divided into two segments that are fed in parallel with the elements in each segment fed in series through matched transmission lines for high efficiency. The inboard section has half the number of patch elements of the outboard section, and the outboard sections, which have tapered distribution with identical transmission line sections, terminated with half wavelength long open-circuit stubs so that the remaining energy is reflected and radiated in phase. The elements of the two inboard segments of the two left- and right-half sections are provided with tapered transmission lines from element to element for uniform power distribution over the central third of the entire array antenna. The two rows of array elements are excited at opposite patch feed locations with opposite (180 deg difference) phases for reduced cross-polarization.

  2. Heteronuclear cross-polarization in multinuclear multidimensional NMR: Prospects for triple-resonance CP

    Energy Technology Data Exchange (ETDEWEB)

    Majumdar, A.; Zuiderweg, E.R.P. [Univ. of Michigan, Ann Arbor, MI (United States)

    1994-12-01

    Heteronuclear multiple-pulse-based Cross Polarization (HECP) between scalar coupled spins is gaining an important role in high-resolution multidimensional NMR of isotopically labeled biomolecules, especially in experiments involving net magnetization transfer. It has generally been observed that in these situations, the performance of HECP is superior to that of INEPT-based sequences. In particular, HECP-based three-dimensional HCCH spectroscopy is more efficient than the INEPT version of the same experiment. Differences in sensitivity have been intuitively attributed to relaxation effects and technical factors such as radiofrequency (rf) inhomogeneity We present theoretical analyses and computer simulations to probe the effects of these factors. Relaxation effects were treated phenomenologically; we found that relaxation differences are relatively small (up to 25%) between pulsed-free-precession (INEPT) and HECP-although always in favor of HECP. We explored the rf effects by employing a Gaussian distribution of rf amplitude over sample volume. We found that inhomogeneity effects significantly favor HECP over INEPT, especially under conditions of {open_quotes}matched {close_quotes} inhomogeneity in the two rf coils. The differences in favor of HECP indicate that an extension of HECP to triple resonance experiments (TRCP) in I -> S -> Q net transfers might yield better results relative to analogous INEPT-based net transfers. We theoretically analyze the possibilities of TRCP and find that transfer functions are critically dependent on the ratio J{sub IS}/J{sub SQ}. When J{sub IS} equals J{sub SQ}, we find that 100% transfer is possible for truly simultaneous TRCP and this transfer is obtained in a time 1.41 /J. The TRCP time requirement compares favorably with optimally concatenated INEPT-transfers, where net transfer I -> S -> Q is complete at 1.5 /J.

  3. The Hv1 proton channel responds to mechanical stimuli.

    Science.gov (United States)

    Pathak, Medha M; Tran, Truc; Hong, Liang; Joós, Béla; Morris, Catherine E; Tombola, Francesco

    2016-11-01

    The voltage-gated proton channel, Hv1, is expressed in tissues throughout the body and plays important roles in pH homeostasis and regulation of NADPH oxidase. Hv1 operates in membrane compartments that experience strong mechanical forces under physiological or pathological conditions. In microglia, for example, Hv1 activity is potentiated by cell swelling and causes an increase in brain damage after stroke. The channel complex consists of two proton-permeable voltage-sensing domains (VSDs) linked by a cytoplasmic coiled-coil domain. Here, we report that these VSDs directly respond to mechanical stimuli. We find that membrane stretch facilitates Hv1 channel opening by increasing the rate of activation and shifting the steady-state activation curve to less depolarized potentials. In the presence of a transmembrane pH gradient, membrane stretch alone opens the channel without the need for strong depolarizations. The effect of membrane stretch persists for several minutes after the mechanical stimulus is turned off, suggesting that the channel switches to a "facilitated" mode in which opening occurs more readily and then slowly reverts to the normal mode observed in the absence of membrane stretch. Conductance simulations with a six-state model recapitulate all the features of the channel's response to mechanical stimulation. Hv1 mechanosensitivity thus provides a mechanistic link between channel activation in microglia and brain damage after stroke. © 2016 Pathak et al.

  4. Retrieval of Droplet size Density Distribution from Multiple field of view Cross polarized Lidar Signals: Theory and Experimental Validation

    Science.gov (United States)

    2016-06-02

    Retrieval of droplet-size density distribution from multiple-field-of-view cross-polarized lidar signals: theory and experimental validation...Gilles Roy, Luc Bissonnette, Christian Bastille, and Gilles Vallee Multiple-field-of-view (MFOV) secondary-polarization lidar signals are used to...use secondary polarization. A mathematical relation among the PSD, the lidar fields of view, the scattering angles, and the angular depolarization

  5. CyHV-3: the third cyprinid herpesvirus.

    Science.gov (United States)

    Gotesman, Michael; Kattlun, Julia; Bergmann, Sven M; El-Matbouli, Mansour

    2013-07-22

    Common carp (including ornamental koi carp) Cyprinus carpio L. are ecologically and economically important freshwater fish in Europe and Asia. C. carpio have recently been endangered by a third cyprinid herpesvirus, known as cyprinid herpesvirus-3 (CyHV-3), the etiological agent of koi herpesvirus disease (KHVD), which causes significant morbidity and mortality in koi and common carp. Clinical and pathological signs include epidermal abrasions, excess mucus production, necrosis of gill and internal organs, and lethargy. KHVD has decimated major carp populations in Israel, Indonesia, Taiwan, Japan, Germany, Canada, and the USA, and has been listed as a notifiable disease in Germany since 2005, and by the World Organisation for Animal Health since 2007. KHVD is exacerbated in aquaculture because of the relatively high host stocking density, and CyHV-3 may be concentrated by filter-feeding aquatic organisms. CyHV-3 is taxonomically grouped within the family Alloherpesviridae, can be propagated in a number of cell lines, and is active at a temperature range of 15 to 28°C. Three isolates originating from Japan (KHV-J), USA (KHV-U), and Israel (KHV-I) have been sequenced. CyHV-3 has a 295 kb genome with 156 unique open reading frames and replicates in the cell nucleus, and mature viral particles are 170 to 200 nm in diameter. CyHV-3 can be detected by multiple PCR-based methods and by enzyme-linked immunosorbent assay. Several modes of immunization have been developed for KHVD; however, fish immunized with either vaccine or wild-type virus may become carriers for CyHV-3. There is no current treatment for KHVD.

  6. Research of HF and HV circuit with Pspice

    International Nuclear Information System (INIS)

    Guo Jianjiang; Li Quanfeng; Zheng Shuxin; Li Wenjun; Tang Chuanxiang

    2005-01-01

    Transferring HF and HV pulse with 3 kinds of components is discussed. Terminal volt waves was got using the soft of Pspice when transmission line is matching of load in 3 kinds of condition. It is proved by experiments that the results got from Pspice have important values to improve experiment circuit. (authors)

  7. Role of bovine herpesvirus type 5 (BoHV-5) in diseases of cattle. Recent findings on BoHV-5 association with genital disease

    Science.gov (United States)

    Favier, P.A.; Marin, M.S.; Pérez, S.E.

    2012-01-01

    Bovine herpesvirus type 5 (BoHV-5) belongs to the family Herpesviridae, subfamily Alphaherpesvirinae, genus Varicellovirus. This virus is a major causative agent of non-suppurative meningoencephalitis in young cattle. It was first isolated in 1962 from a neurological disease outbreak in Australia. BoHV-5 is genetically and antigenically related to bovine herpesvirus type 1 (BoHV-1), a highly prevalent virus responsible for respiratory and genital disease in cattle. Initially, BoHV-5 was considered a subtype of BoHV-1 (BoHV-1.3). However, the exclusive presentation of outbreaks of neurological disease suggested that the virus was a new agent with characteristics of neuropathogenicity. Even though both are neurotropic viruses, only BoHV-5 is capable of replicating extensively in the central nervous system and inducing neurological disease. Occasionally, encephalitis caused by BoHV-1 has been reported. Like other alpha-herpesviruses, BoHV-5 can establish latency in nervous ganglia and, by stress factors or glucocorticoid treatment, latent virus can be reactivated. During episodes of reactivation, the virus is excreted in nasal, ocular and genital secretions and transmitted to other susceptible hosts. Recently, BoHV-5 has been associated with infection of the reproductive tract. The virus has been isolated and the presence of viral DNA has been demonstrated in semen samples from Brazil and Australia and natural transmission of the virus through contaminated semen has also been described. Embryos and oocytes are permissive for BoHV-5 infection and BoHV-5 DNA has been detected in the central nervous system of aborted fetuses. The objective of this review is to compile the limited information on the recent association between BoHV-5 and reproductive disorders in cattle. PMID:26623291

  8. Fusion of AIRSAR and TM Data for Parameter Classification and Estimation in Dense and Hilly Forests

    Science.gov (United States)

    Moghaddam, Mahta; Dungan, J. L.; Coughlan, J. C.

    2000-01-01

    The expanded remotely sensed data space consisting of coincident radar backscatter and optical reflectance data provides for a more complete description of the Earth surface. This is especially useful where many parameters are needed to describe a certain scene, such as in the presence of dense and complex-structured vegetation or where there is considerable underlying topography. The goal of this paper is to use a combination of radar and optical data to develop a methodology for parameter classification for dense and hilly forests, and further, class-specific parameter estimation. The area to be used in this study is the H. J. Andrews Forest in Oregon, one of the Long-Term Ecological Research (LTER) sites in the US. This area consists of various dense old-growth conifer stands, and contains significant topographic relief. The Andrews forest has been the subject of many ecological studies over several decades, resulting in an abundance of ground measurements. Recently, biomass and leaf-area index (LAI) values for approximately 30 reference stands have also become available which span a large range of those parameters. The remote sensing data types to be used are the C-, L-, and P-band polarimetric radar data from the JPL airborne SAR (AIRSAR), the C-band single-polarization data from the JPL topographic SAR (TOPSAR), and the Thematic Mapper (TM) data from Landsat, all acquired in late April 1998. The total number of useful independent data channels from the AIRSAR is 15 (three frequencies, each with three unique polarizations and amplitude and phase of the like-polarized correlation), from the TOPSAR is 2 (amplitude and phase of the interferometric correlation), and from the TM is 6 (the thermal band is not used). The range pixel spacing of the AIRSAR is 3.3m for C- and L-bands and 6.6m for P-band. The TOPSAR pixel spacing is 10m, and the TM pixel size is 30m. To achieve parameter classification, first a number of parameters are defined which are of interest to

  9. A method for automatic grain segmentation of multi-angle cross-polarized microscopic images of sandstone

    Science.gov (United States)

    Jiang, Feng; Gu, Qing; Hao, Huizhen; Li, Na; Wang, Bingqian; Hu, Xiumian

    2018-06-01

    Automatic grain segmentation of sandstone is to partition mineral grains into separate regions in the thin section, which is the first step for computer aided mineral identification and sandstone classification. The sandstone microscopic images contain a large number of mixed mineral grains where differences among adjacent grains, i.e., quartz, feldspar and lithic grains, are usually ambiguous, which make grain segmentation difficult. In this paper, we take advantage of multi-angle cross-polarized microscopic images and propose a method for grain segmentation with high accuracy. The method consists of two stages, in the first stage, we enhance the SLIC (Simple Linear Iterative Clustering) algorithm, named MSLIC, to make use of multi-angle images and segment the images as boundary adherent superpixels. In the second stage, we propose the region merging technique which combines the coarse merging and fine merging algorithms. The coarse merging merges the adjacent superpixels with less evident boundaries, and the fine merging merges the ambiguous superpixels using the spatial enhanced fuzzy clustering. Experiments are designed on 9 sets of multi-angle cross-polarized images taken from the three major types of sandstones. The results demonstrate both the effectiveness and potential of the proposed method, comparing to the available segmentation methods.

  10. Wind rotor power station BONI-ShHV

    International Nuclear Information System (INIS)

    Bolotov, A.V.

    1999-01-01

    Wind rotor power station (WRPS) BONI-ShHV has following advantages : the increase of installation stability by rise of wind velocity and rotation speed of rotor due to gyroscopic effect; the absence noise and vibration; the safety for birds and animals; ability of compact installation and creation of series of wind power dams with higher capacity; the simplicity and fast assembling and putting into operation. The price of 1 k W of installing capacity is lower about 2.5-3 times compare to usual WRPS due to simple kinematic scheme. WRPS has high specific output of electrical energy due to use of low and long existing wind velocity and due to short storms, giving greater power. It has ability to be replayed when average annual wind velocity is above 5.5 m/s in comparison with propeller WRPS, which are never repaying. WRPS BONI-ShHV are made on the plants of Republic of Kazakhstan, and tested in wind velocity range up 45 m/s, have experience of 3 years of operation, showing their reliability and effectiveness. The repayment period of individual WRPS BONI-0.5/6 ShHV is from 10 month to 1 year depending on average annual velocity

  11. Reliability 'H' scheme of HV/MV substations

    Directory of Open Access Journals (Sweden)

    Perić Dragoslav M.

    2015-01-01

    Full Text Available Substations (HV/MV connect transmission and distribution systems with consumers of electric energy. The selective search method was used for calculation of substation reliability, where all arrangement elements were grouped into blocks. Subject of the analysis was H-arrangements comprising air-insulated switchgears on the high voltage side of HV/MV substations with different number of feeder and transformer bays and diverse scope of the installed switching equipment. Failure rate and duration were used as main HV/MV substation equipment reliability indices. A large number of arrangements were classified into groups, and within a group the arrangements were ranked with the use of multiple criteria. It is shown that the reliability of the electricity transit depends on the equipment of field for the transit of electricity, which favors poorly equipped field. On the other hand, the reliability of transformation of the full power depends mostly on the equipment in coupling field. It is essential that in the coupling field, there are at least two disconnectors. Installation of the switch in the coupling field is meaningful only with appropriate protection, because it further improves reliability. Conclusions are drawn for phased construction and expansion of the single pole diagram with an additional field for the transmission line.

  12. Complete genome sequence and architecture of crucian carp Carassius auratus herpesvirus (CaHV).

    Science.gov (United States)

    Zeng, Xiao-Tao; Chen, Zhong-Yuan; Deng, Yuan-Sheng; Gui, Jian-Fang; Zhang, Qi-Ya

    2016-12-01

    Crucian carp Carassius auratus herpesvirus (CaHV) was isolated from diseased crucian carp with acute gill hemorrhages and high mortality. The CaHV genome was sequenced and analyzed. The data showed that it consists of 275,348 bp and contains 150 predicted ORFs. The architecture of the CaHV genome differs from those of four cyprinid herpesviruses (CyHV1, CyHV2, SY-C1, CyHV3), with insertions, deletions and the absence of a terminal direct repeat. Phylogenetic analysis of the DNA polymerase sequences of 17 strains of Herpesvirales members, and the concatenated 12 core ORFs from 10 strains of alloherpesviruses showed that CaHV clustered together with members of the genus Cyprinivirus, family Alloherpesviridae.

  13. Canis mtDNA HV1 database: a web-based tool for collecting and surveying Canis mtDNA HV1 haplotype in public database.

    Science.gov (United States)

    Thai, Quan Ke; Chung, Dung Anh; Tran, Hoang-Dung

    2017-06-26

    Canine and wolf mitochondrial DNA haplotypes, which can be used for forensic or phylogenetic analyses, have been defined in various schemes depending on the region analyzed. In recent studies, the 582 bp fragment of the HV1 region is most commonly used. 317 different canine HV1 haplotypes have been reported in the rapidly growing public database GenBank. These reported haplotypes contain several inconsistencies in their haplotype information. To overcome this issue, we have developed a Canis mtDNA HV1 database. This database collects data on the HV1 582 bp region in dog mitochondrial DNA from the GenBank to screen and correct the inconsistencies. It also supports users in detection of new novel mutation profiles and assignment of new haplotypes. The Canis mtDNA HV1 database (CHD) contains 5567 nucleotide entries originating from 15 subspecies in the species Canis lupus. Of these entries, 3646 were haplotypes and grouped into 804 distinct sequences. 319 sequences were recognized as previously assigned haplotypes, while the remaining 485 sequences had new mutation profiles and were marked as new haplotype candidates awaiting further analysis for haplotype assignment. Of the 3646 nucleotide entries, only 414 were annotated with correct haplotype information, while 3232 had insufficient or lacked haplotype information and were corrected or modified before storing in the CHD. The CHD can be accessed at http://chd.vnbiology.com . It provides sequences, haplotype information, and a web-based tool for mtDNA HV1 haplotyping. The CHD is updated monthly and supplies all data for download. The Canis mtDNA HV1 database contains information about canine mitochondrial DNA HV1 sequences with reconciled annotation. It serves as a tool for detection of inconsistencies in GenBank and helps identifying new HV1 haplotypes. Thus, it supports the scientific community in naming new HV1 haplotypes and to reconcile existing annotation of HV1 582 bp sequences.

  14. Dayside and nightside contributions to the cross polar cap potential: placing an upper limit on a viscous-like interaction

    Directory of Open Access Journals (Sweden)

    S. E. Milan

    2004-11-01

    Full Text Available Observations of changes in size of the ionospheric polar cap allow the dayside and nightside reconnection rates to be quantified. From these it is straightforward to estimate the rate of antisunward transport of magnetic flux across the polar regions, quantified by the cross polar cap potential ΦPC. When correlated with upstream measurements of the north-south component of the IMF, ΦPC is found to increase for more negative Bz, as expected. However, we also find that ΦPC does not, on average, decrease to zero, even for strongly northward IMF. In the past this has been interpreted as evidence for a viscous interaction between the magnetosheath flow and the outer boundaries of the magnetosphere. In contrast, we show that this is the consequence of flows excited by tail reconnection, which is inherently uncorrelated with IMF Bz.

  15. Scattering of a cross-polarized linear wave by a soliton at an optical event horizon in a birefringent nanophotonic waveguide.

    Science.gov (United States)

    Ciret, Charles; Gorza, Simon-Pierre

    2016-06-15

    The scattering of a linear wave on an optical event horizon, induced by a cross-polarized soliton, is experimentally and numerically investigated in integrated structures. The experiments are performed in a dispersion-engineered birefringent silicon nanophotonic waveguide. In stark contrast with copolarized waves, the large difference between the group velocity of the two cross-polarized waves enables a frequency conversion almost independent of the soliton wavelength. It is shown that the generated idler is only shifted by 10 nm around 1550 nm over a pump tuning range of 350 nm. Simulations using two coupled full vectorial nonlinear Schrödinger equations fully support the experimental results.

  16. Identification of an HV 1 voltage-gated proton channel in insects.

    Science.gov (United States)

    Chaves, Gustavo; Derst, Christian; Franzen, Arne; Mashimo, Yuta; Machida, Ryuichiro; Musset, Boris

    2016-04-01

    The voltage-gated proton channel 1 (HV 1) is an important component of the cellular proton extrusion machinery and is essential for charge compensation during the respiratory burst of phagocytes. HV 1 has been identified in a wide range of eukaryotes throughout the animal kingdom, with the exception of insects. Therefore, it has been proposed that insects do not possess an HV 1 channel. In the present study, we report the existence of an HV 1-type proton channel in insects. We searched insect transcriptome shotgun assembly (TSA) sequence databases and found putative HV 1 orthologues in various polyneopteran insects. To confirm that these putative HV 1 orthologues were functional channels, we studied the HV 1 channel of Nicoletia phytophila (NpHV 1), an insect of the Zygentoma order, in more detail. NpHV 1 comprises 239 amino acids and is 33% identical to the human voltage-gated proton channel 1. Patch clamp measurements in a heterologous expression system showed proton selectivity, as well as pH- and voltage-dependent gating. Interestingly, NpHV 1 shows slightly enhanced pH-dependent gating compared to the human channel. Mutations in the first transmembrane segment at position 66 (Asp66), the presumed selectivity filter, lead to a loss of proton-selective conduction, confirming the importance of this aspartate residue in voltage-gated proton channels. Nucleotide sequence data have been deposited in the GenBank database under accession number KT780722. © 2016 Federation of European Biochemical Societies.

  17. HV Switch Tube Development Program status report: April 28, 1978

    International Nuclear Information System (INIS)

    Winje, R.A.

    1978-01-01

    The HV Switch Tube Development Program encompassed development contracts to both Eimac (Division of Varian) and RCA. Both companies were required to develop a design for the tube and to build and test two tubes. The development program began in April, 1976. Currently, both companies have built tubes; Eimac has built one and RCA has built two. As initially built, both tubes exhibited unstable operation; however, RCA has implemented design changes which stabilized the tube operation. Eimac has a design modification which they believe will produce stable operation when the change is implemented. Both tubes have been tested to a limited degree and no other abnormal characteristics have been observed

  18. Edge-TCT measurements on irradiated HV CMOS sensors

    CERN Document Server

    Weisser, Constantin

    2014-01-01

    Passive $100 \\times 100 \\,\\mu$m test diodes in an unirradiated and an irradiated HV2FEI4v3 HV-CMOS silicon sensor were analysed using the edge TCT technique. To integrate the sensor into the setup a PCB was designed to extract the signals, a cooling mechanism was constructed and the system housed in a shielding box. The observed signal had fast and slow contributions, that were interpreted as drift and diffusion. The former peaked in a region, that was interpreted as the depletion region, while the latter peaked further in the bulk material. Raising the bias voltage increased the depth of the former region, while pushing the latter region further into the bulk. The irradiated sample lost signal strength mainly in its slow part compared to the unirradiated sample, while its quick signal remained largely unaffected. As only the signal interpreted as drift is fast enough to be useful in LHC operation the investigated sensors could be considered radiation hard for this purpose. This gives further promise to ...

  19. The relationship of rain-induced cross-polarization discrimination to attenuation for 10 to 30 GHz earth-space radio links

    Science.gov (United States)

    Stutzman, W. L.; Runyon, D. L.

    1984-01-01

    Rain depolarization is quantified through the cross-polarization discrimination (XPD) versus attenuation relationship. Such a relationship is derived by curve fitting to a rigorous theoretical model (the multiple scattering model) to determine the variation of the parameters involved. This simple isolation model (SIM) is compared to data from several earth-space link experiments and to three other models.

  20. Transient Overexpression of HvSERK2 Improves Barley Resistance to Powdery Mildew.

    Science.gov (United States)

    Li, Yingbo; Li, Qingwei; Guo, Guimei; He, Ting; Gao, Runhong; Faheem, Muhammad; Huang, Jianhua; Lu, Ruiju; Liu, Chenghong

    2018-04-18

    Somatic embryogenesis receptor-like kinases (SERKs) play an essential role in plant response to pathogen infection. Here we identified three SERK genes ( HvSERK1/2/3 ) from barley, and aimed to determine their implication in defense responses to barley powdery mildew ( Bgh ). Although HvSERK1/2/3 share the characteristic domains of the SERK family, only HvSERK2 was significantly induced in barley leaves during Bgh infection. The expression of HvSERK2 was rapidly induced by hydrogen peroxide (H₂O₂) treatment, but not by treatment with salicylic acid (SA), methyl jasmonate (MeJA), ethephon (ETH), or abscisic acid (ABA). Bioinformatics analysis of the cloned HvSERK2 promoter revealed that it contains several elements responsible for defense responses against pathogens. Promoter functional analysis showed that the HvSERK2 promoter was induced by Bgh and H₂O₂. Subcellular localization analysis of HvSERK2 indicated that it is mainly located on the plasma membrane. Transient overexpression of HvSERK2 in epidermal cells of the susceptible barley cultivar Hua 30 reduced the Bgh haustorium index from 58.6% to 43.2%. This study suggests that the HvSERK2 gene plays a positive role in the improvement of barley resistance to powdery mildew, and provides new insight into the function of SERK genes in the biotic stress response of plants.

  1. Regional mapping of forest canopy water content and biomass using AIRSAR images over BOREAS study area

    Science.gov (United States)

    Saatchi, Sasan; Rignot, Eric; Vanzyl, Jakob

    1995-01-01

    In recent years, monitoring vegetation biomass over various climate zones has become the primary focus of several studies interested in assessing the role of the ecosystem responses to climate change and human activities. Airborne and spaceborne Synthetic Aperture Radar (SAR) systems provide a useful tool to directly estimate biomass due to its sensitivity to structural and moisture characteristics of vegetation canopies. Even though the sensitivity of SAR data to total aboveground biomass has been successfully demonstrated in many controlled experiments over boreal forests and forest plantations, so far, no biomass estimation algorithm has been developed. This is mainly due to the fact that the SAR data, even at lowest frequency (P-band) saturates at biomass levels of about 200 tons/ha, and the structure and moisture information in the SAR signal forces the estimation algorithm to be forest type dependent. In this paper, we discuss the development of a hybrid forest biomass algorithm which uses a SAR derived land cover map in conjunction with a forest backscatter model and an inversion algorithm to estimate forest canopy water content. It is shown that unlike the direct biomass estimation from SAR data, the estimation of water content does not depend on the seasonal and/or environmental conditions. The total aboveground biomass can then be derived from canopy water content for each type of forest by incorporating other ecological information. Preliminary results from this technique over several boreal forest stands indicate that (1) the forest biomass can be estimated with reasonable accuracy, and (2) the saturation level of the SAR signal can be enhanced by separating the crown and trunk biomass in the inversion algorithm. We have used the JPL AIRSAR data over BOREAS southern study area to test the algorithm and to generate regional scale water content and biomass maps. The results are compared with ground data and the sources of errors are discussed. Several SAR

  2. A Labview Based Leakage Current Monitoring System For HV Insulators

    Directory of Open Access Journals (Sweden)

    N. Mavrikakis

    2015-10-01

    Full Text Available In this paper, a Labview based leakage current monitoring system for High Voltage insulators is described. The system uses a general purpose DAQ system with the addition of different current sensors. The DAQ system consists of a chassis and hot-swappable modules. Through the proper design of current sensors, low cost modules operating with a suitable input range can be employed. Fully customizable software can be developed using Labview, allowing on-demand changes and incorporation of upgrades. Such a system provides a low cost alternative to specially designed equipment with the added advantage of maximum flexibility. Further, it can be modified to satisfy the specifications (technical and economical set under different scenarios. In fact, the system described in this paper has already been installed in the HV Lab of the TEI of Crete whereas a variation of it is currently in use in TALOS High Voltage Test Station.

  3. Adiabatic-passage cross polarization in N-15 NMR spectroscopy of peptides weakly associated to phospholipids: Determination of large RDC

    International Nuclear Information System (INIS)

    Zandomeneghi, Giorgia; Meier, Beat H.

    2004-01-01

    Structural information can be extracted from one-bond residual dipolar couplings (RDC) measured in NMR spectra of systems in field-ordered media. RDC can be on the order of J-couplings if the anisotropy of alignment is ∼ 10 -2 , 10-fold stronger than that typically used for structural studies of water-soluble proteins. In such systems the performance of 1 H → 15 N polarization transfer methods of the INEPT type is not satisfactory. In this study we show the effectiveness of adiabatic-passage cross-polarization (APCP) in transferring the 1 H → 15 N polarization in the bicelle-associated peptide Leucine Enkephalin (Lenk). APCP is efficient both in static samples and in samples spun at the magic angle (MAS) or any other angle of the spinning axis to the magnetic field (variable-angle spinning, VAS). The anisotropic spectrum of an aligned static sample and the isotropic spectrum of the sample under MAS provide a set of possible values for the 1 H- 15 N RDC of phospholipid-associated Lenk. The unambiguous determination of the 1 H- 15 N RDC was accomplished by means of VAS experiments

  4. Broadband cross-polarization-based heteronuclear dipolar recoupling for structural and dynamic NMR studies of rigid and soft solids

    International Nuclear Information System (INIS)

    Kharkov, B. B.; Chizhik, V. I.; Dvinskikh, S. V.

    2016-01-01

    Dipolar recoupling is an essential part of current solid-state NMR methodology for probing atomic-resolution structure and dynamics in solids and soft matter. Recently described magic-echo amplitude- and phase-modulated cross-polarization heteronuclear recoupling strategy aims at efficient and robust recoupling in the entire range of coupling constants both in rigid and highly dynamic molecules. In the present study, the properties of this recoupling technique are investigated by theoretical analysis, spin-dynamics simulation, and experimentally. The resonance conditions and the efficiency of suppressing the rf field errors are examined and compared to those for other recoupling sequences based on similar principles. The experimental data obtained in a variety of rigid and soft solids illustrate the scope of the method and corroborate the results of analytical and numerical calculations. The technique benefits from the dipolar resolution over a wider range of coupling constants compared to that in other state-of-the-art methods and thus is advantageous in studies of complex solids with a broad range of dynamic processes and molecular mobility degrees

  5. Measurement of local, internal magnetic fluctuations via cross-polarization scattering in the DIII-D tokamak (invited)

    Energy Technology Data Exchange (ETDEWEB)

    Barada, K., E-mail: kshitish@ucla.edu; Rhodes, T. L.; Crocker, N. A.; Peebles, W. A. [University of California-Los Angeles, P.O. Box 957099, Los Angeles, California 90095 (United States)

    2016-11-15

    We present new measurements of internal magnetic fluctuations obtained with a novel eight channel cross polarization scattering (CPS) system installed on the DIII-D tokamak. Measurements of internal, localized magnetic fluctuations provide a window on an important physics quantity that we heretofore have had little information on. Importantly, these measurements provide a new ability to challenge and test linear and nonlinear simulations and basic theory. The CPS method, based upon the scattering of an incident microwave beam into the opposite polarization by magnetic fluctuations, has been significantly extended and improved over the method as originally developed on the Tore Supra tokamak. A new scattering geometry, provided by a unique probe beam, is utilized to improve the spatial localization and wavenumber range. Remotely controllable polarizer and mirror angles allow polarization matching and wavenumber selection for a range of plasma conditions. The quasi-optical system design, its advantages and challenges, as well as important physics validation tests are presented and discussed. Effect of plasma beta (ratio of kinetic to magnetic pressure) on both density and magnetic fluctuations is studied and it is observed that internal magnetic fluctuations increase with beta. During certain quiescent high confinement operational regimes, coherent low frequency modes not detected by magnetic probes are detected locally by CPS diagnostics.

  6. Voltage-Gated Proton Channels: Molecular Biology, Physiology, and Pathophysiology of the HV Family

    Science.gov (United States)

    2013-01-01

    Voltage-gated proton channels (HV) are unique, in part because the ion they conduct is unique. HV channels are perfectly selective for protons and have a very small unitary conductance, both arguably manifestations of the extremely low H+ concentration in physiological solutions. They open with membrane depolarization, but their voltage dependence is strongly regulated by the pH gradient across the membrane (ΔpH), with the result that in most species they normally conduct only outward current. The HV channel protein is strikingly similar to the voltage-sensing domain (VSD, the first four membrane-spanning segments) of voltage-gated K+ and Na+ channels. In higher species, HV channels exist as dimers in which each protomer has its own conduction pathway, yet gating is cooperative. HV channels are phylogenetically diverse, distributed from humans to unicellular marine life, and perhaps even plants. Correspondingly, HV functions vary widely as well, from promoting calcification in coccolithophores and triggering bioluminescent flashes in dinoflagellates to facilitating killing bacteria, airway pH regulation, basophil histamine release, sperm maturation, and B lymphocyte responses in humans. Recent evidence that hHV1 may exacerbate breast cancer metastasis and cerebral damage from ischemic stroke highlights the rapidly expanding recognition of the clinical importance of hHV1. PMID:23589829

  7. Further evidence of Chelonid herpesvirus 5 (ChHV5) latency

    DEFF Research Database (Denmark)

    Alfaro Nuñez, Luis Alonso; Bojesen, Anders Miki; Bertelsen, Mads Frost

    2016-01-01

    The Chelonid herpesvirus 5 (ChHV5) has been consistently associated with fibropapillomatosis (FP), a transmissible neoplastic disease of marine turtles. Whether ChHV5 plays a causal role remains debated, partly because while FP tumours have been clearly documented to contain high concentrations...

  8. Cross polarization with phase and amplitude modulation of radio frequency fields in NMR-experiments with sample rotation at magic angle

    International Nuclear Information System (INIS)

    Dvinskij, S.V.; Chizhik, V.I.

    2006-01-01

    One analyzes cross polarization of nuclei within a rotating system of coordinates as applied to the NMR-experiments with a specimen rotation under the magic angle. One worded a concept of simultaneous phase and amplitude modulation according to which the Hamiltonian form of the restored dipole interaction persisted if inversion of difference of radiofrequency field amplitudes occurred simultaneously with phase inversion. One presents a theoretical substantiation in terms of the average Hamiltonian theory. The concept is demonstrated both experimentally and by means of numerical analysis for a number of special cases. Phase periodic inversion in cross polarized experiments is shown to result into practically important advantage of suppression of interactions of chemical shift and influence of effects of coarse adjustment of radiofrequency field parameters [ru

  9. Near field of an oscillating electric dipole and cross-polarization of a collimated beam of light: Two sides of the same coin

    Science.gov (United States)

    Aiello, Andrea; Ornigotti, Marco

    2014-09-01

    We address the question of whether there exists a hidden relationship between the near-field distribution generated by an oscillating electric dipole and the so-called cross-polarization of a collimated beam of light. We find that the answer is affirmative by showing that the complex field distributions occurring in both cases have a common physical origin: the requirement that the electromagnetic fields must be transverse.

  10. Koi herpesvirus represents a third cyprinid herpesvirus (CyHV-3) in the family Herpesviridae.

    Science.gov (United States)

    Waltzek, Thomas B; Kelley, Garry O; Stone, David M; Way, Keith; Hanson, Larry; Fukuda, Hideo; Hirono, Ikuo; Aoki, Takashi; Davison, Andrew J; Hedrick, Ronald P

    2005-06-01

    The sequences of four complete genes were analysed in order to determine the relatedness of koi herpesvirus (KHV) to three fish viruses in the family Herpesviridae: carp pox herpesvirus (Cyprinid herpesvirus 1, CyHV-1), haematopoietic necrosis herpesvirus of goldfish (Cyprinid herpesvirus 2, CyHV-2) and channel catfish virus (Ictalurid herpesvirus 1, IcHV-1). The genes were predicted to encode a helicase, an intercapsomeric triplex protein, the DNA polymerase and the major capsid protein. The results showed that KHV is related closely to CyHV-1 and CyHV-2, and that the three cyprinid viruses are related, albeit more distantly, to IcHV-1. Twelve KHV isolates from four diverse geographical areas yielded identical sequences for a region of the DNA polymerase gene. These findings, with previously published morphological and biological data, indicate that KHV should join the group of related lower-vertebrate viruses in the family Herpesviridae under the formal designation Cyprinid herpesvirus 3 (CyHV-3).

  11. Erzherzog Ferdinand II., Astrologie und das Lustschloss Hvězda (Stern)

    Czech Academy of Sciences Publication Activity Database

    Purš, Ivo

    -, č. 14 (2014), s. 15-29 ISSN 1213-5372 Institutional support: RVO:68378033 Keywords : astrology * iconography * archduke Ferdinand of Tirol * Star (Hvězda) villa Subject RIV: AL - Art, Architecture, Cultural Heritage

  12. Identification and Characterization of Cyprinid Herpesvirus-3 (CyHV-3 Encoded MicroRNAs.

    Directory of Open Access Journals (Sweden)

    Owen H Donohoe

    Full Text Available MicroRNAs (miRNAs are a class of small non-coding RNAs involved in post-transcriptional gene regulation. Some viruses encode their own miRNAs and these are increasingly being recognized as important modulators of viral and host gene expression. Cyprinid herpesvirus 3 (CyHV-3 is a highly pathogenic agent that causes acute mass mortalities in carp (Cyprinus carpio carpio and koi (Cyprinus carpio koi worldwide. Here, bioinformatic analyses of the CyHV-3 genome suggested the presence of non-conserved precursor miRNA (pre-miRNA genes. Deep sequencing of small RNA fractions prepared from in vitro CyHV-3 infections led to the identification of potential miRNAs and miRNA-offset RNAs (moRNAs derived from some bioinformatically predicted pre-miRNAs. DNA microarray hybridization analysis, Northern blotting and stem-loop RT-qPCR were then used to definitively confirm that CyHV-3 expresses two pre-miRNAs during infection in vitro. The evidence also suggested the presence of an additional four high-probability and two putative viral pre-miRNAs. MiRNAs from the two confirmed pre-miRNAs were also detected in gill tissue from CyHV-3-infected carp. We also present evidence that one confirmed miRNA can regulate the expression of a putative CyHV-3-encoded dUTPase. Candidate homologues of some CyHV-3 pre-miRNAs were identified in CyHV-1 and CyHV-2. This is the first report of miRNA and moRNA genes encoded by members of the Alloherpesviridae family, a group distantly related to the Herpesviridae family. The discovery of these novel CyHV-3 genes may help further our understanding of the biology of this economically important virus and their encoded miRNAs may have potential as biomarkers for the diagnosis of latent CyHV-3.

  13. Identification and Characterization of Cyprinid Herpesvirus-3 (CyHV-3) Encoded MicroRNAs

    Science.gov (United States)

    Donohoe, Owen H.; Henshilwood, Kathy; Way, Keith; Hakimjavadi, Roya; Stone, David M.; Walls, Dermot

    2015-01-01

    MicroRNAs (miRNAs) are a class of small non-coding RNAs involved in post-transcriptional gene regulation. Some viruses encode their own miRNAs and these are increasingly being recognized as important modulators of viral and host gene expression. Cyprinid herpesvirus 3 (CyHV-3) is a highly pathogenic agent that causes acute mass mortalities in carp (Cyprinus carpio carpio) and koi (Cyprinus carpio koi) worldwide. Here, bioinformatic analyses of the CyHV-3 genome suggested the presence of non-conserved precursor miRNA (pre-miRNA) genes. Deep sequencing of small RNA fractions prepared from in vitro CyHV-3 infections led to the identification of potential miRNAs and miRNA–offset RNAs (moRNAs) derived from some bioinformatically predicted pre-miRNAs. DNA microarray hybridization analysis, Northern blotting and stem-loop RT-qPCR were then used to definitively confirm that CyHV-3 expresses two pre-miRNAs during infection in vitro. The evidence also suggested the presence of an additional four high-probability and two putative viral pre-miRNAs. MiRNAs from the two confirmed pre-miRNAs were also detected in gill tissue from CyHV-3-infected carp. We also present evidence that one confirmed miRNA can regulate the expression of a putative CyHV-3-encoded dUTPase. Candidate homologues of some CyHV-3 pre-miRNAs were identified in CyHV-1 and CyHV-2. This is the first report of miRNA and moRNA genes encoded by members of the Alloherpesviridae family, a group distantly related to the Herpesviridae family. The discovery of these novel CyHV-3 genes may help further our understanding of the biology of this economically important virus and their encoded miRNAs may have potential as biomarkers for the diagnosis of latent CyHV-3. PMID:25928140

  14. HvALMT1 from barley is involved in the transport of organic anions.

    Science.gov (United States)

    Gruber, Benjamin D; Ryan, Peter R; Richardson, Alan E; Tyerman, Stephen D; Ramesh, Sunita; Hebb, Diane M; Howitt, Susan M; Delhaize, Emmanuel

    2010-03-01

    Members of the ALMT gene family contribute to the Al(3+) resistance of several plant species by facilitating malate efflux from root cells. The first member of this family to be cloned and characterized, TaALMT1, is responsible for most of the natural variation of Al(3+) resistance in wheat. The current study describes the isolation and characterization of HvALMT1, the barley gene with the greatest sequence similarity to TaALMT1. HvALMT1 is located on chromosome 2H which has not been associated with Al(3+) resistance in barley. The relatively low levels of HvALMT1 expression detected in root and shoot tissues were independent of external aluminium or phosphorus supply. Transgenic barley plants transformed with the HvALMT1 promoter fused to the green fluorescent protein (GFP) indicated that expression of HvALMT1 was relatively high in stomatal guard cells and in root tissues containing expanding cells. GFP fused to the C-terminus of the full HvALMT1 protein localized to the plasma membrane and motile vesicles within the cytoplasm. HvALMT1 conferred both inward and outward currents when expressed in Xenopus laevis oocytes that were bathed in a range of anions including malate. Both malate uptake and efflux were confirmed in oocyte assays using [(14)C]malate as a radiotracer. It is suggested that HvALMT1 functions as an anion channel to facilitate organic anion transport in stomatal function and expanding cells.

  15. BoHV-4-based vector delivering Ebola virus surface glycoprotein

    Directory of Open Access Journals (Sweden)

    Alfonso Rosamilia

    2016-11-01

    Full Text Available Abstract Background Ebola virus (EBOV is a Category A pathogen that is a member of Filoviridae family that causes hemorrhagic fever in humans and non-human primates. Unpredictable and devastating outbreaks of disease have recently occurred in Africa and current immunoprophylaxis and therapies are limited. The main limitation of working with pathogens like EBOV is the need for costly containment. To potentiate further and wider opportunity for EBOV prophylactics and therapies development, innovative approaches are necessary. Methods In the present study, an antigen delivery platform based on a recombinant bovine herpesvirus 4 (BoHV-4, delivering a synthetic EBOV glycoprotein (GP gene sequence, BoHV-4-syEBOVgD106ΔTK, was generated. Results EBOV GP was abundantly expressed by BoHV-4-syEBOVgD106ΔTK transduced cells without decreasing viral replication. BoHV-4-syEBOVgD106ΔTK immunized goats produced high titers of anti-EBOV GP antibodies and conferred a long lasting (up to 6 months, detectable antibody response. Furthermore, no evidence of BoHV-4-syEBOVgD106ΔTK viremia and secondary localization was detected in any of the immunized animals. Conclusions The BoHV-4-based vector approach described here, represents: an alternative antigen delivery system for vaccination and a proof of principle study for anti-EBOV antibodies generation in goats for potential immunotherapy applications.

  16. ST5 Observations of the Imbalance of Region 1 and 2 Field-Aligned Currents and Its Implication to the Cross-Polar Cap Pedersen Currents

    Science.gov (United States)

    Le, Guan; Slavin, J. A.; Strangeway, Robert

    2011-01-01

    In this study, we use the in-situ magnetic field observations from Space Technology 5 mission to quantify the imbalance of Region 1 (R1) and Region 2 (R2) currents. During the three-month duration of the ST5 mission, geomagnetic conditions range from quiet to moderately active. We find that the R1 current intensity is consistently stronger than the R2 current intensity both for the dawnside and the duskside large-scale field-aligned current system. The net currents flowing into (out of) the ionosphere in the dawnside (duskside) are in the order of 5% of the total R1 currents. We also find that the net currents flowing into or out of the ionosphere are controlled by the solar wind-magnetosphere interaction in the same way as the field-aligned currents themselves are. Since the net currents due to the imbalance of the R1 and R2 currents require that their closure currents flow across the polar cap from dawn to dusk as Pedersen currents, our results indicate that the total amount of the cross-polar cap Pedersen currents is in the order of 0.1 MA. This study, although with a very limited dataset, is one of the first attempts to quantify the cross-polar cap Pedersen currents. Given the importance of the Joule heating due to Pedersen currents to the high-latitude ionospheric electrodynamics, quantifying the cross-polar cap Pedersen currents and associated Joule heating is needed for developing models of the magnetosphere-ionosphere coupling.

  17. Control of the Water Transport Activity of Barley HvTIP3;1 Specifically Expressed in Seeds.

    Science.gov (United States)

    Utsugi, Shigeko; Shibasaka, Mineo; Maekawa, Masahiko; Katsuhara, Maki

    2015-09-01

    Tonoplast intrinsic proteins (TIPs) are involved in the transport and storage of water, and control intracellular osmotic pressure by transporting material related to the water potential of cells. In the present study, we focused on HvTIP3;1 during the periods of seed development and desiccation in barley. HvTIP3;1 was specifically expressed in seeds. An immunochemical analysis showed that HvTIP3;1 strongly accumulated in the aleurone layers and outer layers of barley seeds. The water transport activities of HvTIP3;1 and HvTIP1;2, which also accumulated in seeds, were measured in the heterologous expression system of Xenopus oocytes. When they were expressed individually, HvTIP1;2 transported water, whereas HvTIP3;1 did not. However, HvTIP3;1 exhibited water transport activity when co-expressed with HvTIP1;2 in oocytes, and this activity was higher than when HvTIP1;2 was expressed alone. This is the first report to demonstrate that the water permeability of a TIP aquaporin was activated when co-expressed with another TIP. The split-yellow fluorescent protein (YFP) system in onion cells revealed that HvTIP3;1 interacted with HvTIP1;2 to form a heterotetramer in plants. These results suggest that HvTIP3;1 functions as an active water channel to regulate water movement through tissues during the periods of seed development and desiccation. © The Author 2015. Published by Oxford University Press on behalf of Japanese Society of Plant Physiologists. All rights reserved. For permissions, please email: journals.permissions@oup.com.

  18. Change in IgHV Mutational Status of CLL Suggests Origin From Multiple Clones.

    Science.gov (United States)

    Osman, Afaf; Gocke, Christopher D; Gladstone, Douglas E

    2017-02-01

    Fluorescence in situ hybridization and immunoglobulin (Ig) heavy-chain variable-region (IgHV) mutational status are used to predict outcome in chronic lymphocytic leukemia (CLL). Although DNA aberrations change over time, IgHV sequences and mutational status are considered stable. In a retrospective review, 409 CLL patients, between 2008 and 2015, had IgHV analysis: 56 patients had multiple analyses performed. Seven patients' IgHV results changed: 2 from unmutated to mutated and 5 from mutated to unmutated IgHV sequence. Three concurrently changed their variable heavy-chain sequence. Secondary to allelic exclusion, 2 of the new variable heavy chains produced were biologically nonplausible. The existence of these new nonplausible heavy-chain variable regions suggests either the CLL cancer stem-cell maintains the ability to rearrange a previously silenced IgH allele or more likely that the cancer stem-cell produced at least 2 subclones, suggesting that the CLL cancer stem cell exists before the process of allelic exclusion occurs. Copyright © 2016 Elsevier Inc. All rights reserved.

  19. Site characterization at Groningen gas field area through joint surface-borehole H/V analysis

    Science.gov (United States)

    Spica, Zack J.; Perton, Mathieu; Nakata, Nori; Liu, Xin; Beroza, Gregory C.

    2018-01-01

    A new interpretation of the horizontal to vertical (H/V) spectral ratio in terms of the Diffuse Field Assumption (DFA) has fuelled a resurgence of interest in that approach. The DFA links H/V measurements to Green's function retrieval through autocorrelation of the ambient seismic field. This naturally allows for estimation of layered velocity structure. In this contribution, we further explore the potential of H/V analysis. Our study is facilitated by a distributed array of surface and co-located borehole stations deployed at multiple depths, and by detailed prior information on velocity structure that is available due to development of the Groningen gas field. We use the vertical distribution of H/V spectra recorded at discrete depths inside boreholes to obtain shear wave velocity models of the shallow subsurface. We combine both joint H/V inversion and borehole interferometry to reduce the non-uniqueness of the problem and to allow faster convergence towards a reliable velocity model. The good agreement between our results and velocity models from an independent study validates the methodology, demonstrates the power of the method, but more importantly provides further constraints on the shallow velocity structure, which is an essential component of integrated hazard assessment in the area.

  20. A new method for simultaneous detection and discrimination of Bovine herpesvirus types 1 (BoHV-1) and 5 (BoHV-5) using real time PCR with high resolution melting (HRM) analysis.

    Science.gov (United States)

    Marin, M S; Quintana, S; Leunda, M R; Recavarren, M; Pagnuco, I; Späth, E; Pérez, S; Odeón, A

    2016-01-01

    Bovine herpesvirus types 1 (BoHV-1) and 5 (BoHV-5) are antigenically and genetically similar. The aim of this study was to develop a simple and reliable one-step real time PCR assay with high resolution melting (HRM) analysis for the simultaneous detection and differentiation of BoHV-1 and BoHV-5. Optimization of assay conditions was performed with DNA from reference strains. Then, DNA from field isolates, clinical samples and tissue samples of experimentally infected animals were studied by real time PCR-HRM. An efficient amplification of real time PCR products was obtained, and a clear melting curve and appropriate melting peaks for both viruses were achieved in the HRM curve analysis for BoHV type identification. BoHV was identified in all of the isolates and clinical samples, and BoHV types were properly differentiated. Furthermore, viral DNA was detected in 12/18 and 7/18 samples from BoHV-1- and BoHV-5-infected calves, respectively. Real time PCR-HRM achieved a higher sensitivity compared with virus isolation or conventional PCR. In this study, HRM was used as a novel procedure. This method provides rapid, sensitive, specific and simultaneous detection of bovine alpha-herpesviruses DNA. Thus, this technique is an excellent tool for diagnosis, research and epidemiological studies of these viruses in cattle. Copyright © 2015 Elsevier B.V. All rights reserved.

  1. Expression patterns of HvCKX genes indicate their role in growth and reproductive development of barley.

    Directory of Open Access Journals (Sweden)

    Wojciech Zalewski

    Full Text Available Cytokinin oxidase/dehydrogenase proteins (CKX are encoded by a multigene family of CKX genes with a varying number of members depending on species. For some of the genes, spectacular effects on grain production in selected cereals have been observed. Despite the fact that partial or full length sequences of most HvCKX genes in barley (Hordeum vulgare have already been published, in most cases their specific biological functions have not been reported. Detailed expression patterns for five HvCKX genes in different organs/tissues of developing barley plants coupled with analysis of RNAi silent for two genes are presented to test the hypothesis that these expression profiles might indicate their function. Elevated expression for four of them - HvCKX1, HvCKX9, HvCKX4, and HvCKX11 - was found in developing kernels of wild-type plants compared to other tissues. HvCKX5 was mainly expressed in leaf tissue. Lower expression was noted for HvCKX1 in seedling roots and for HvCKX9 in leaves. The documented effect of RNAi silencing of HvCKX1 and a trend for HvCKX9 was higher plant productivity, and the trait was inherited through four generations. Higher plant yield was determined by higher numbers of seeds and spikes. Increased productivity was significantly greater in HvCKX1 silenced plants showing higher relative expression of HvCKX1 in developing kernels of wild-type plants compared to the expression of HvCKX9. Both HvCKX1 silenced T1 seedlings of cv. Golden Promise and the newly transformed breeding line STH7308 showed greater root mass, but this trait was not inherited in the next generation. Similarly HvCKX9 silenced T1 seedlings exhibited greater plant height without inheritance in the next generation. It is suggested that these effects were not inherited because of compensation by other genes co-ordinately regulating reproductive development. One line with untypically changed, inherited phenotype, which was selected from several dozen silenced lines

  2. Prevalence of asinine herpesvirus type 5 (AsHV-5) infection in clinically normal Lipizzaner horses.

    Science.gov (United States)

    Rushton, James Oliver; Kolodziejek, Jolanta; Nell, Barbara; Nowotny, Norbert

    2014-04-01

    The aim of this study was to assess the extent of asinine herpesvirus (AsHV) type 5 infection in 'closed' populations of clinically normal Lipizzaner horses. Peripheral blood mononuclear cells plus nasal and conjunctival swabs were obtained on four occasions over an 18 month period from 266 animals as part of a health surveillance programme. Sequence analysis of samples that were positive by nested consensus herpesvirus PCR but negative using quantified equid herpesvirus (EHV) type 2 and 5 PCR, revealed a total of 51 samples from 39 horses positive for AsHV-5. No statistically significant association between animal age, gender or geographical location and infection status was identified. The findings suggest sub-clinical AsHV-5 infection may be encountered more frequently than previously reported. Copyright © 2013 Elsevier Ltd. All rights reserved.

  3. Energy Productivity of the High Velocity Algae Raceway Integrated Design (ARID-HV)

    Energy Technology Data Exchange (ETDEWEB)

    Attalah, Said; Waller, Peter M.; Khawam, George; Ryan, Randy D.; Huesemann, Michael H.

    2015-06-03

    The original Algae Raceway Integrated Design (ARID) raceway was an effective method to increase algae culture temperature in open raceways. However, the energy input was high and flow mixing was poor. Thus, the High Velocity Algae Raceway Integrated Design (ARID-HV) raceway was developed to reduce energy input requirements and improve flow mixing in a serpentine flow path. A prototype ARID-HV system was installed in Tucson, Arizona. Based on algae growth simulation and hydraulic analysis, an optimal ARID-HV raceway was designed, and the electrical energy input requirement (kWh ha-1 d-1) was calculated. An algae growth model was used to compare the productivity of ARIDHV and conventional raceways. The model uses a pond surface energy balance to calculate water temperature as a function of environmental parameters. Algae growth and biomass loss are calculated based on rate constants during day and night, respectively. A 10 year simulation of DOE strain 1412 (Chlorella sorokiniana) showed that the ARID-HV raceway had significantly higher production than a conventional raceway for all months of the year in Tucson, Arizona. It should be noted that this difference is species and climate specific and is not observed in other climates and with other algae species. The algae growth model results and electrical energy input evaluation were used to compare the energy productivity (algae production rate/energy input) of the ARID-HV and conventional raceways for Chlorella sorokiniana in Tucson, Arizona. The energy productivity of the ARID-HV raceway was significantly greater than the energy productivity of a conventional raceway for all months of the year.

  4. On the Computation of H/V and its Application to Microzonation and Seismic Design

    Science.gov (United States)

    Perton, M.; Martínez, J. A.; Lermo, J. F.; Sanchez-Sesma, F. J.

    2014-12-01

    The H/V ratio is the square root of the ratio of horizontal to vertical energies of ground motion. It has been observed that the frequency of the main peak is well suited for the characterization of site effects and had been widely used for micro-zonation and seismic structural design. Historically that ratio was made from the average of individual H/V ratios obtained from noise autocorrelations. Nevertheless, it has been recently pointed out that the H/V ratio should be calculated differently as the ratio of the average of H over the average of V. This calculation is based on the relation between the directional energies (the imaginary part of Green's function) and the noise autocorrelations. In general, the average of ratios is different from the ratio of averages. Although the frequency of the main response was correctly obtained, the associated amplification factor has generally been badly predicted, having little matching with the amplification observed during strong earthquakes. The unexpected decay behavior of such ratios at high frequency and the lack of stability and reproducibility of the H/V ratios are other problems that face the method. These problems are addressed here from the point of view of normalization of noise correlations. In fact, several normalization techniques have already been proposed in order to correctly retrieve the Green's function. Some of them are well suited for the retrieval of the surface wave contribution, while others are more appropriate for bulk wave incidence. Since the H/V ratio may be used for various purposes like surface wave tomography, micro-zonation or seismic design, different normalizations are discussed in functions of the objectives. The H/V obtained from local historical earthquakes on top or far away from the subduction zone are also discussed. ACKNOWLEDGEMENT This research has been partially supported by DGAPA-UNAM under Project IN104712 and the AXA Research Fund.

  5. Diagnostic validation of three test methods for detection of cyprinid herpesvirus 3 (CyHV-3).

    Science.gov (United States)

    Clouthier, Sharon C; McClure, Carol; Schroeder, Tamara; Desai, Megan; Hawley, Laura; Khatkar, Sunita; Lindsay, Melissa; Lowe, Geoff; Richard, Jon; Anderson, Eric D

    2017-03-06

    Cyprinid herpesvirus 3 (CyHV-3) is the aetiological agent of koi herpesvirus disease in koi and common carp. The disease is notifiable to the World Organisation for Animal Health. Three tests-quantitative polymerase chain reaction (qPCR), conventional PCR (cPCR) and virus isolation by cell culture (VI)-were validated to assess their fitness as diagnostic tools for detection of CyHV-3. Test performance metrics of diagnostic accuracy were sensitivity (DSe) and specificity (DSp). Repeatability and reproducibility were measured to assess diagnostic precision. Estimates of test accuracy, in the absence of a gold standard reference test, were generated using latent class models. Test samples originated from wild common carp naturally exposed to CyHV-3 or domesticated koi either virus free or experimentally infected with the virus. Three laboratories in Canada participated in the precision study. Moderate to high repeatability (81 to 99%) and reproducibility (72 to 97%) were observed for the qPCR and cPCR tests. The lack of agreement observed between some of the PCR test pair results was attributed to cross-contamination of samples with CyHV-3 nucleic acid. Accuracy estimates for the PCR tests were 99% for DSe and 93% for DSp. Poor precision was observed for the VI test (4 to 95%). Accuracy estimates for VI/qPCR were 90% for DSe and 88% for DSp. Collectively, the results show that the CyHV-3 qPCR test is a suitable tool for surveillance, presumptive diagnosis and certification of individuals or populations as CyHV-3 free.

  6. Susceptibility of Japanese Cyprininae fish species to cyprinid herpesvirus 2 (CyHV-2).

    Science.gov (United States)

    Ito, Takafumi; Maeno, Yukio

    2014-03-14

    Cyprinid herpesvirus 2 (CyHV-2) is known as the causative agent of herpesviral haematopoietic necrosis (HVHN) of goldfish (Carassius auratus). Recently, the virus has also been detected from Prussian carp (C. gibelio) and crucian carp (C. carassius) from European and Asian countries. To analyze the risk of spreading to new host species, the susceptibility of other fish species to the virus is essential. In this study experimental infections of indigenous Cyprininae species in Japan were performed by immersion in and intraperitoneal injection of a CyHV-2 isolate. Although Edonishiki, a variety of goldfish, immersed with the virus showed a cumulative mortality of 90%, no mortality was observed in ginbuna C. auratus langsdorfii, nagabuna C. auratus buergeri, nigorobuna C. auratus grandoculis and common carp Cyprinus carpio. Cumulative mortality was 100, 20 and 10% in intraperitoneally injected Edonishiki, ginbuna and nagabuna, respectively. Furthermore all Edonishiki immersed with the virus died. However, even after stimuli of sudden temperature changes, the immersed ginbuna and nagabuna did not die. Moreover no mortality was observed in co-reared Ranchu, another variety of goldfish, with immersed ginbuna and nagabuna although all three Ranchu co-reared with immersed Edonishiki died. CyHV-2 DNA was detected and the virus was re-isolated from all dead fish. Moreover CyHV-2 DNA was detected from some of the surviving Carassius spp. These results revealed that susceptibility of Japanese indigenous Cyprininae fish species to CyHV-2 is much lower than for goldfish. In addition, ability of replication of CyHV-2 might be different among Carassius fish species. Copyright © 2014 Elsevier B.V. All rights reserved.

  7. Use of AIRSAR to identify woody shrub invasion and other indicators of desertification in the Jornada LTER

    Science.gov (United States)

    Musick, H. Brad; Schaber, Gerald G.; Breed, Carol S.

    1995-01-01

    The replacement of semidesert grassland by woody shrubland is a widespread form of desertification. This change in physiognomy and species composition tends to sharply reduce the productivity of the land for grazing by domestic livestock, increase soil erosion and reduce soil fertility, and greatly alter many other aspects of ecosystem structure and functioning. Remote sensing methods are needed to assess and monitor shrubland encroachment. Detection of woody shrubs at low density would provide a particularly useful baseline on which to access changes, because an initially low shrub density often tends to increase even after cessation of the disturbance (e.g., overgrazing, drought, or fire suppression) responsible for triggering the initial stages of the invasion (Grover and Musick, 1990). Limited success has been achieved using optical remote sensing. In contrast to other forms of desertification, biomass does not consistently decrease with a shift from grassland to shrubland. Estimation of green vegetation amount (e.g., by NDVI) is thus of limited utility, unless the shrubs and herbaceous plants differ consistently in phenology and the area can be viewed during a season when only one of these is green. The objective of this study was to determine if the potential sensitivity of active microwave remote sensing to vegetation structure could be used to assess the degree of shrub invasion of grassland. Polarimetric Airborne Synthetic Aperture Radar (AIRSAR) data were acquired for a semiarid site containing varied mixtures of shrubs and herbaceous vegetation and compared with ground observations of vegetation type and other landsurface characteristics. In this preliminary report we examine the response of radar backscatter intensity to shrub density. The response of other multipolarization parameters will be examined in future work.

  8. A compact HV supply for field/PC based nuclear instrumentation

    International Nuclear Information System (INIS)

    Manna, A.; Nikhare, D.M.; Madhavi, V.; Bayala, A.K.; Mukhopadhyay, P.K.; Kataria, S.K.

    2001-01-01

    In the recent years, most of the nuclear instruments that were earlier based on NIM Bin standards, are becoming available as PC Add-on cards. This trend is due to the decreasing prices of desktop personal computers and the necessity for automation in radioactivity measurements. This paper describes the design and development of a HV supply module and its PC Add-on card version for field portable/ PC based nuclear instrumentation. The HV supply though being very compact in size meets all the stringent specifications required for detector biasing applications and it has been tested for use with NaI, BF 3 . (author)

  9. HvALMT1 from barley is involved in the transport of organic anions

    OpenAIRE

    Gruber, Benjamin D.; Ryan, Peter R.; Richardson, Alan E.; Tyerman, Stephen D.; Ramesh, Sunita; Hebb, Diane M.; Howitt, Susan M.; Delhaize, Emmanuel

    2010-01-01

    Members of the ALMT gene family contribute to the Al3+ resistance of several plant species by facilitating malate efflux from root cells. The first member of this family to be cloned and characterized, TaALMT1, is responsible for most of the natural variation of Al3+ resistance in wheat. The current study describes the isolation and characterization of HvALMT1, the barley gene with the greatest sequence similarity to TaALMT1. HvALMT1 is located on chromosome 2H which has not been associated w...

  10. Marine target detection in quad-pol synthetic aperture radar imagery based on the relative phase of cross-polarized channels

    Science.gov (United States)

    Wang, Yunhua; Li, Huimin; Zhang, Yanmin; Guo, Lixin

    2015-01-01

    A focus on marine target detection in noise corrupted fully polarimetric synthetic aperture radar (SAR) is presented. The property of the relative phase between two cross-polarized channels reveals that the relative phases evaluated within sea surface area or noise corrupted area are widely spread phase angle region [-π,π] due to decorrelation effect; however, the relative phases are concentrated to zero and ±π for real target and its first-order azimuth ambiguities (FOAAs), respectively. Exploiting this physical behavior, the reciprocal of the mean square value of the relative phase (RMSRP) is defined as a new parameter for target detection, and the experiments based on fully polarimetric Radarsat-2 SAR images show that the strong noise and the FOAAs can be effectively suppressed in RMSRP image. Meanwhile, validity of the new parameter for target detection is also verified by two typical Radarsat-2 SAR images, in which targets' ambiguities and strong noise are present.

  11. Investigation of the sensitivity of a cross-polarized light visualization system to detect subclinical erythema and dryness in women with vulvovaginitis.

    Science.gov (United States)

    Farage, Miranda A; Singh, Mukul; Ledger, William J

    2009-07-01

    An enhanced visualization technique using polarized light (Syris v600 enhanced visualization system; Syris Scientific LLC, Gray, ME) detects surface and subsurface ( approximately 1 mm depth) inflammation. We sought to compare the Syris v600 system with unaided visual inspection and colposcopy of the female genitalia. Erythema and dryness of the vulva, introitus, vagina, and cervix were visualized and scored by each method in patients with and without vulvitis. Subsurface visualization was more sensitive in detecting genital erythema and dryness at all sites whether or not symptoms were present. Subsurface inflammation of the introitus, vagina, and cervix only was detected uniquely in women with vulvar vestibulitis syndrome (VVS). A subset of women presenting with VVS exhibited subclinical inflammation of the vulva vestibule and vagina (designated VVS/lichen sclerosus subgroup). Enhanced visualization of the genital epithelial subsurface with cross-polarized light may assist in diagnosing subclinical inflammation in vulvar conditions heretofore characterized as sensory syndromes.

  12. Changes in forecasting of HV/MV transformer loading due to distributed generation

    NARCIS (Netherlands)

    Berende, M.J.C.; Ruiter, de A.; Morren, J.

    2013-01-01

    This paper describes how Enexis, one of the largest distribution network operators in the Netherlands, has adapted its load forecasting method for HV/MV-transformers to incorporate the influence of distributed generation. This new method involves the making of separate forecasts for demand and

  13. Engineering substrate promiscuity in halophilic alcohol dehydrogenase (HvADH2 by in silico design.

    Directory of Open Access Journals (Sweden)

    Jennifer Cassidy

    Full Text Available An alcohol dehydrogenase from the halophilic archaeon Haloferax volcanii (HvADH2 has been engineered by rational design to broaden its substrate scope towards the conversion of a range of aromatic substrates, including flurbiprofenol, that is an intermediate of the non-steroidal anti-inflammatory drug, flurbiprofen. Wild-type HvADH2 showed minimal activity with flurbiprofenol (11.1 mU/mg. A homology model of HvADH2 was built and docking experiments with this substrate revealed that the biphenyl rings of flurbiprofenol formed strong interactions with residues F85 and F108, preventing its optimal binding in the active site. Mutations at position 85 however did not increase activity. Site directed mutagenesis at position F108 allowed the identification of three variants showing a significant (up to 2.3-fold enhancement of activity towards flurbiprofenol, when compared to wild-type HvADH2. Interestingly, F108G variant did not show the classic inhibition in the presence of (R-enantiomer when tested with rac-1-phenylethanol, underling its potential in racemic resolution of secondary alcohols.

  14. Importation of CyHV-2-infected goldfish into the Netherlands

    NARCIS (Netherlands)

    Ito, Takafumi; Kurita, Jun; Haenen, Olga L.M.

    2017-01-01

    Cyprinid herpesvirus 2 (CyHV-2) is known as the causative agent of herpesviral haematopoietic necrosis in goldfish Carassius auratus auratus. However, the virus has also been detected in Prussian carp C. gibelio and crucian carp C. carassius from European and Asian countries. To prevent spread of

  15. Efficient alpha particle detection by CR-39 applying 50 Hz-HV electrochemical etching method

    International Nuclear Information System (INIS)

    Sohrabi, M.; Soltani, Z.

    2016-01-01

    Alpha particles can be detected by CR-39 by applying either chemical etching (CE), electrochemical etching (ECE), or combined pre-etching and ECE usually through a multi-step HF-HV ECE process at temperatures much higher than room temperature. By applying pre-etching, characteristics responses of fast-neutron-induced recoil tracks in CR-39 by HF-HV ECE versus KOH normality (N) have shown two high-sensitivity peaks around 5–6 and 15–16 N and a large-diameter peak with a minimum sensitivity around 10–11 N at 25°C. On the other hand, 50 Hz-HV ECE method recently advanced in our laboratory detects alpha particles with high efficiency and broad registration energy range with small ECE tracks in polycarbonate (PC) detectors. By taking advantage of the CR-39 sensitivity to alpha particles, efficacy of 50 Hz-HV ECE method and CR-39 exotic responses under different KOH normalities, detection characteristics of 0.8 MeV alpha particle tracks were studied in 500 μm CR-39 for different fluences, ECE duration and KOH normality. Alpha registration efficiency increased as ECE duration increased to 90 ± 2% after 6–8 h beyond which plateaus are reached. Alpha track density versus fluence is linear up to 10 6  tracks cm −2 . The efficiency and mean track diameter versus alpha fluence up to 10 6  alphas cm −2 decrease as the fluence increases. Background track density and minimum detection limit are linear functions of ECE duration and increase as normality increases. The CR-39 processed for the first time in this study by 50 Hz-HV ECE method proved to provide a simple, efficient and practical alpha detection method at room temperature. - Highlights: • Alpha particles of 0.8 MeV were detected in CR-39 by 50 Hz-HV ECE method. • Efficiency/track diameter was studied vs fluence and time for 3 KOH normality. • Background track density and minimum detection limit vs duration were studied. • A new simple, efficient and low-cost alpha detection method

  16. The voltage-gated proton channel Hv1 is expressed in pancreatic islet β-cells and regulates insulin secretion

    Energy Technology Data Exchange (ETDEWEB)

    Zhao, Qing [Department of Biophysics, School of Physics Science, The Key Laboratory of Bioactive Materials, Ministry of Education, Nankai University, Tianjin 300071 (China); Che, Yongzhe [School of Medicine, Nankai University, Tianjin 300071 (China); Li, Qiang; Zhang, Shangrong [Department of Biophysics, School of Physics Science, The Key Laboratory of Bioactive Materials, Ministry of Education, Nankai University, Tianjin 300071 (China); Gao, Ying-Tang [Key Laboratory of Artificial Cell, Third Central Clinical College of Tianjin Medical University, Tianjin 300170 (China); Wang, Yifan; Wang, Xudong; Xi, Wang; Zuo, Weiyan [Department of Biophysics, School of Physics Science, The Key Laboratory of Bioactive Materials, Ministry of Education, Nankai University, Tianjin 300071 (China); Li, Shu Jie, E-mail: shujieli@nankai.edu.cn [Department of Biophysics, School of Physics Science, The Key Laboratory of Bioactive Materials, Ministry of Education, Nankai University, Tianjin 300071 (China)

    2015-12-25

    The voltage-gated proton channel Hv1 is a potent acid extruder that participates in the extrusion of the intracellular acid. Here, we showed for the first time, Hv1 is highly expressed in mouse and human pancreatic islet β-cells, as well as β-cell lines. Imaging studies demonstrated that Hv1 resides in insulin-containing granules in β-cells. Knockdown of Hv1 with RNA interference significantly reduces glucose- and K{sup +}-induced insulin secretion in isolated islets and INS-1 (832/13) β-cells and has an impairment on glucose- and K{sup +}-induced intracellular Ca{sup 2+} homeostasis. Our data demonstrated that the expression of Hv1 in pancreatic islet β-cells regulates insulin secretion through regulating Ca{sup 2+} homeostasis.

  17. Structural modeling and molecular simulation analysis of HvAP2/EREBP from barley.

    Science.gov (United States)

    Pandey, Bharati; Sharma, Pradeep; Tyagi, Chetna; Goyal, Sukriti; Grover, Abhinav; Sharma, Indu

    2016-06-01

    AP2/ERF transcription factors play a critical role in plant development and stress adaptation. This study reports the three-dimensional ab initio-based model of AP2/EREBP protein of barley and its interaction with DNA. Full-length coding sequence of HvAP2/EREBP gene isolated from two Indian barley cultivars, RD 2503 and RD 31, was used to model the protein. Of five protein models obtained, the one with lowest C-score was chosen for further analysis. The N- and C-terminal regions of HvAP2 protein were found to be highly disordered. The dynamic properties of AP2/EREBP and its interaction with DNA were investigated by molecular dynamics simulation. Analysis of trajectories from simulation yielded the equilibrated conformation between 2-10ns for protein and 7-15ns for protein-DNA complex. We established relationship between DNA having GCC box and DNA-binding domain of HvAP2/EREBP was established by modeling 11-base-pair-long nucleotide sequence and HvAP2/EREBP protein using ab initio method. Analysis of protein-DNA interaction showed that a β-sheet motif constituting amino acid residues THR105, ARG100, ARG93, and ARG83 seems to play important role in stabilizing the complex as they form strong hydrogen bond interactions with the DNA motif. Taken together, this study provides first-hand comprehensive information detailing structural conformation and interactions of HvAP2/EREBP proteins in barley. The study intensifies the role of computational approaches for preliminary examination of unknown proteins in the absence of experimental information. It also provides molecular insight into protein-DNA binding for understanding and enhancing abiotic stress resistance for improving the water use efficiency in crop plants.

  18. The barley anion channel, HvALMT1, has multiple roles in guard cell physiology and grain metabolism.

    Science.gov (United States)

    Xu, Muyun; Gruber, Benjamin D; Delhaize, Emmanuel; White, Rosemary G; James, Richard A; You, Jiangfeng; Yang, Zhenming; Ryan, Peter R

    2015-01-01

    The barley (Hordeum vulgare) gene HvALMT1 encodes an anion channel in guard cells and in certain root tissues indicating that it may perform multiple roles. The protein localizes to the plasma membrane and facilitates malate efflux from cells when constitutively expressed in barley plants and Xenopus oocytes. This study investigated the function of HvALMT1 further by identifying its tissue-specific expression and by generating and characterizing RNAi lines with reduced HvALMT1 expression. We show that transgenic plants with 18-30% of wild-type HvALMT1 expression had impaired guard cell function. They maintained higher stomatal conductance in low light intensity and lost water more rapidly from excised leaves than the null segregant control plants. Tissue-specific expression of HvALMT1 was investigated in developing grain and during germination using transgenic barley lines expressing the green fluorescent protein (GFP) with the HvALMT1 promoter. We found that HvALMT1 is expressed in the nucellar projection, the aleurone layer and the scutellum of developing barley grain. Malate release measured from isolated aleurone layers prepared from imbibed grain was significantly lower in the RNAi barley plants compared with control plants. These data provide molecular and physiological evidence that HvALMT1 functions in guard cells, in grain development and during germination. We propose that HvALMT1 releases malate and perhaps other anions from guard cells to promote stomatal closure. The likely roles of HvALMT1 during seed development and grain germination are also discussed. © 2014 Scandinavian Plant Physiology Society.

  19. Linking stomatal traits and expression of slow anion channel genes HvSLAH1 2 HvSLAC1 with grain yield for increasing salinity tolerance in barley

    Directory of Open Access Journals (Sweden)

    Xiaohui eLiu

    2014-11-01

    Full Text Available Soil salinity is an environmental and agricultural problem in many parts of the world. One of the keys to breeding barley for adaptation to salinity lies in a better understanding of the genetic control of stomatal regulation. We have employed a range of physiological and molecular techniques (stomata assay, gas exchange, phylogenetic analysis, QTL analysis, and gene expression to investigate stomatal behaviour and genotypic variation in barley cultivars and a genetic population in four experimental trials. A set of relatively efficient and reliable methods were developed for the characterisation of stomatal behaviour of large numbers of varieties and genetic lines. Furthermore, we have found a large genetic variation of gas exchange and stomatal traits in barley in response to salinity stress. Salt-tolerant CM72 showed significantly larger stomatal aperture in 200 mM NaCl treatment than that of salt-sensitive Gairdner. Stomatal traits such as aperture width/length were found to significantly correlate with grain yield in salt treatment. Phenotypic characterisation and QTL analysis of a segregating double haploid population of the CM72/Gairdner resulted in the identification of significant stomatal traits-related QTLs for salt tolerance. Moreover, expression analysis of the slow anion channel genes HvSLAH1 and HvSLAC1 demonstrated that their up-regulation is linked to high barley grain yield in the field.

  20. A triple gene mutant of BoHV-1 administered intranasally in lambs replicates efficiently in the nasal epithelium and induces neutralizing antibody

    Science.gov (United States)

    Bovine herpes virus 1 (BoHV-1) causes respiratory infections and abortions in cattle, and is an important component of Bovine respiratory disease complex (BRDC). BoHV-1 has also been isolated from sheep with respiratory disorder. Experimentally, sheep and goats are infected productively with BoHV-1...

  1. [Bovine herpesvirus 4 (BoHV-4): general aspects of the biology and status in Argentina].

    Science.gov (United States)

    Morán, Pedro E; Pérez, Sandra E; Odeón, Anselmo C; Verna, Andrea E

    2015-01-01

    Bovine herpesvirus 4 (BoHV-4) has been isolated from cattle with respiratory infections, vulvovaginitis, mastitis, abortions, endometritis and from apparently healthy animals throughout the world. Although it has not yet been established as causal agent of a specific disease entity, it is primarily associated with reproductive disorders of cattle. This virus can infect a wide range of species, either in vivo or in vitro. Two groups of prototype strains were originated from the first isolates: the DN599-type strains (American group) and the Movar-type strains (European group). In Argentina, BoHV-4 was isolated and characterized in 2007 from vaginal discharge samples taken from cows that had aborted. So far, more than 40 isolates, mainly associated with aborting bovine females have been registered in our country. Copyright © 2014 Asociación Argentina de Microbiología. Publicado por Elsevier España, S.L.U. All rights reserved.

  2. The Hv NAC6 transcription factor: a positive regulator of penetration resistance in barley and Arabidopsis

    DEFF Research Database (Denmark)

    Jensen, Michael Krogh; Rung, Jesper Henrik; Gregersen, Per Langkjaer

    2007-01-01

    Pathogens induce the expression of many genes encoding plant transcription factors, though specific knowledge of the biological function of individual transcription factors remains scarce. NAC transcription factors are encoded in plants by a gene family with proposed functions in both abiotic...... and biotic stress adaptation, as well as in developmental processes. In this paper, we provide convincing evidence that a barley NAC transcription factor has a direct role in regulating basal defence. The gene transcript was isolated by differential display from barley leaves infected with the biotrophic...... powdery mildew fungus, Blumeria graminis f.sp. hordei (Bgh). The full-length cDNA clone was obtained using 5'-RACE and termed HvNAC6, due to its high similarity to the rice homologue, OsNAC6. Gene silencing of HvNAC6 during Bgh inoculation compromises penetration resistance in barley epidermal cells...

  3. The stability of H/V spectral ratios from noise measurements in Armutlu Peninsula (Turkey)

    Energy Technology Data Exchange (ETDEWEB)

    Livaoğlu, Hamdullah, E-mail: hamdullah.livaoglu@kocaeli.edu.tr; Irmak, T. Serkan; Caka, Deniz; Yavuz, Evrim; Tunç, B.; Baris, S. [Faculty of Engineering, Department of Geophysics, Kocaeli University, 41380, Kocaeli (Turkey); Lühr, B. G.; Woith, H. [GFZ, German Research Centre for Geoscience, Postsdam (Germany)

    2016-04-18

    The horizontal to vertical spectral ratio (H/V) method has been successfully using in order to estimate the fundamental resonance frequency of the sedimentary cover, its thickness and amplification factor since at least 3 decades. There are numerous studies have been carried out on the stability of the H/V spectral ratios. Almost all studies showed that fundamental frequency is stable even measurements are repeated at different times. From this point of view, the results will show us an approach whether the stations are suitable for accurate estimate of earthquake studies and engineering purposes or not. Also we want to see if any effects of the amplification factor changing on the seismograms for Armutlu Seismic Network (ARNET) even though seismic stations are established far away from cultural noise and located on hard rock sites. It has been selected one hour recorded data of all stations during the most stationary times. The amplification and resonant frequency variations of H/V ratio were calculated to investigate temporal stability in time. There is a total harmony in fundamental frequencies values and H/V spectral ratio values in time-lagged periods. Some stations shows secondary minor peaks in high frequency band due to a shallow formation effect or cultural noises around. In the east side of the area ILYS station shows amplitude peak in lower fundamental frequency band from expected. This could compose a high amplification in lower frequencies and so that yield less reliable results in local earthquakes studies. By the experimental results from ambient noise analysis, it could be worked up for relocation of one station.

  4. Simulation Of Substation HV/MV In DIGSILENT Power Factory Software

    International Nuclear Information System (INIS)

    Mladenovski, Ljubisha; Dimova, Iskra; Iliev, Atanas; Fushtikj, Vangel

    2003-01-01

    This paper presents a method for creating a model for substation high voltage/middle voltage (HV/MV) that supplies consumers at middle voltage side and capacitor battery that regulates the voltage at the middle voltage busbar. The results from the analyses are presented and discussed. The models of the transformer and the capacitor battery were made at the University of Rostock, Germany, in DYSIMAC (DYnaniic SImulation of the MACedonian power plants in a new technological and market environment) project. (Author)

  5. Testbeam results of irradiated ams H18 HV-CMOS pixel sensor prototypes

    Science.gov (United States)

    Benoit, M.; Braccini, S.; Casse, G.; Chen, H.; Chen, K.; Di Bello, F. A.; Ferrere, D.; Golling, T.; Gonzalez-Sevilla, S.; Iacobucci, G.; Kiehn, M.; Lanni, F.; Liu, H.; Meng, L.; Merlassino, C.; Miucci, A.; Muenstermann, D.; Nessi, M.; Okawa, H.; Perić, I.; Rimoldi, M.; Ristić, B.; Barrero Pinto, M. Vicente; Vossebeld, J.; Weber, M.; Weston, T.; Wu, W.; Xu, L.; Zaffaroni, E.

    2018-02-01

    HV-CMOS pixel sensors are a promising option for the tracker upgrade of the ATLAS experiment at the LHC, as well as for other future tracking applications in which large areas are to be instrumented with radiation-tolerant silicon pixel sensors. We present results of testbeam characterisations of the 4th generation of Capacitively Coupled Pixel Detectors (CCPDv4) produced with the ams H18 HV-CMOS process that have been irradiated with different particles (reactor neutrons and 18 MeV protons) to fluences between 1× 1014 and 5× 1015 1-MeV- neq. The sensors were glued to ATLAS FE-I4 pixel readout chips and measured at the CERN SPS H8 beamline using the FE-I4 beam telescope. Results for all fluences are very encouraging with all hit efficiencies being better than 97% for bias voltages of 85 V. The sample irradiated to a fluence of 1× 1015 neq—a relevant value for a large volume of the upgraded tracker—exhibited 99.7% average hit efficiency. The results give strong evidence for the radiation tolerance of HV-CMOS sensors and their suitability as sensors for the experimental HL-LHC upgrades and future large-area silicon-based tracking detectors in high-radiation environments.

  6. Broadband photonic single sideband frequency up-converter based on the cross polarization modulation effect in a semiconductor optical amplifier for radio-over-fiber systems.

    Science.gov (United States)

    Lee, Seung-Hun; Kim, Hyoung-Jun; Song, Jong-In

    2014-01-13

    A broadband photonic single sideband (SSB) frequency up-converter based on the cross polarization modulation (XPolM) effect in a semiconductor optical amplifier (SOA) is proposed and experimentally demonstrated. An optical radio frequency (RF) signal in the form of an optical single sideband (OSSB) is generated by the photonic SSB frequency up-converter to solve the power fading problem caused by fiber chromatic dispersion. The generated OSSB RF signal has almost identical optical carrier power and optical sideband power. This SSB frequency up-conversion scheme shows an almost flat electrical RF power response as a function of the RF frequency in a range from 31 GHz to 75 GHz after 40 km single mode fiber (SMF) transmission. The photonic SSB frequency up-conversion technique shows negligible phase noise degradation. The phase noise of the up-converted RF signal at 49 GHz for an offset of 10 kHz is -93.17 dBc/Hz. Linearity analysis shows that the photonic SSB frequency up-converter has a spurious free dynamic range (SFDR) value of 79.51 dB · Hz(2/3).

  7. Sensitivity enhancement for membrane proteins reconstituted in parallel and perpendicular oriented bicelles obtained by using repetitive cross-polarization and membrane-incorporated free radicals

    Energy Technology Data Exchange (ETDEWEB)

    Koroloff, Sophie N. [North Carolina State University, Department of Chemistry (United States); Tesch, Deanna M. [Shaw University (United States); Awosanya, Emmanuel O.; Nevzorov, Alexander A., E-mail: alex-nevzorov@ncsu.edu [North Carolina State University, Department of Chemistry (United States)

    2017-02-15

    Multidimensional separated local-field and spin-exchange experiments employed by oriented-sample solid-state NMR are essential for structure determination and spectroscopic assignment of membrane proteins reconstituted in macroscopically aligned lipid bilayers. However, these experiments typically require a large number of scans in order to establish interspin correlations. Here we have shown that a combination of optimized repetitive cross polarization (REP-CP) and membrane-embedded free radicals allows one to enhance the signal-to-noise ratio by factors 2.4-3.0 in the case of Pf1 coat protein reconstituted in magnetically aligned bicelles with their normals being either parallel or perpendicular to the main magnetic field. Notably, spectral resolution is not affected at the 2:1 radical-to-protein ratio. Spectroscopic assignment of Pf1 coat protein in the parallel bicelles has been established as an illustration of the method. The proposed methodology will advance applications of oriented-sample NMR technique when applied to samples containing smaller quantities of proteins and three-dimensional experiments.

  8. Establishment of a new cell line susceptible to Cyprinid herpesvirus 3 (CyHV-3) and possible latency of CyHV-3 by temperature shift in the cells.

    Science.gov (United States)

    Imajoh, M; Fujioka, H; Furusawa, K; Tamura, K; Yamasaki, K; Kurihara, S; Yamane, J; Kawai, K; Oshima, S

    2015-06-01

    A new cell line named CCF-K104 predominantly consisting of fibroblastic cells showed optimal growth at temperatures from 25 °C to 30 °C. Serial morphological changes in the cells induced by Cyprinid herpesvirus 3 (CyHV-3) included cytoplasmic vacuolar formation, cell rounding and detachment. Mature virions were purified from CyHV-3-infected CCF-K104 cells by sucrose gradient ultracentrifugation and had a typical herpesvirus structure on electron microscopy. Infectious CyHV-3 was produced stably in CCF-K104 cells over 30 viral passages. Our findings showed that CCF-K104 is a useful cell line for isolation and productive replication of CyHV-3. A temperature shift from 25 °C to 15 °C or 35 °C did not allow serial morphological changes as observed at 25 °C for 14 days. Under the same conditions, real-time PCR showed that CyHV-3 was present with low viral DNA loads, suggesting that CyHV-3 may establish latent infection in CCF-K104 cells. Amplification of the left and right terminal repeat sequences of the CyHV-3 genome arranged in a head-to-tail manner was detected by nested PCR following an upshift in temperature from 25 °C to 35 °C. The PCR results suggested that the circular genome may represent a latent form of CyHV-3. © 2014 John Wiley & Sons Ltd.

  9. HvZIP7 mediates zinc accumulation in barley (Hordeum vulgare) at moderately high zinc supply

    DEFF Research Database (Denmark)

    Tiong, Jingwen; Mcdonald, Glenn K.; Genc, Yusuf

    2014-01-01

    Summary: High expression of zinc (Zn)-regulated, iron-regulated transporter-like protein (ZIP) genes increases root Zn uptake in dicots, leading to high accumulation of Zn in shoots. However, none of the ZIP genes tested previously in monocots could enhance shoot Zn accumulation. In this report...... were also generated to further understand the functions of HvZIP7 in metal transport. HvZIP7 is strongly induced by Zn deficiency, primarily in vascular tissues of roots and leaves, and its protein was localized in the plasma membrane. These properties are similar to its closely related homologs...... in dicots. Overexpression of HvZIP7 in barley plants increased Zn uptake when moderately high concentrations of Zn were supplied. Significantly, there was a specific enhancement of shoot Zn accumulation, with no measurable increase in iron (Fe), manganese (Mn), copper (Cu) or cadmium (Cd). HvZIP7 displays...

  10. Radiation Hard GaNFET High Voltage Multiplexing (HV Mux) for the ATLAS Upgrade Silicon Strip Tracker

    CERN Document Server

    Lynn, David; The ATLAS collaboration

    2017-01-01

    The outer radii of the inner tracker (ITk) for the Phase-II Upgrade of the ATLAS experiment will consist of groups of silicon strip sensors mounted on common support structures. Lack of space creates a need to remotely disable a failing sensor from the common HV bus. We have developed circuitry consisting of a GaNFET transistor and a HV Multiplier circuit to disable a failed sensor. We will present two variants of the HV Mux circuitry and show irradiation results on individual components with an emphasis on the GaNFET results. We will also discuss the reliability of the HV Mux circuitry and show plans to ensure reliability during production.

  11. Identification of Chelonid herpesvirus 5 (ChHV5) in endangered green turtles (Chelonia mydas) with fibropapillomatosis in Asia

    Science.gov (United States)

    Li, Tsung-Hsien; Hsu, Wei-Li; Lan, Yu-Ching; Balazs, George H.; Work, Thierry M.; Tseng, Cheng-Tsung; Chang, Chao-Chin

    2017-01-01

    Fibropapillomatosis (FP), a debilitating tumor disease of sea turtles, was first identified in green turtles [Chelonia mydas (Linnaeus, 1758)] in Florida in 1938. In recent decades, FP has been observed globally and is an emerging panzootic disease in sea turtles. However, few reports of FP in Asia exist. Here, we provide the first evidence of Chelonid herpesvirus 5 (ChHV5) DNA associated with FP in endangered green turtles from Taiwan, through molecular characterization, phylogenetic analysis, and histopathological examination. In our study, ChHV5 was successfully detected by PCR in the FP tumor lesions of green turtles. The sequences were found to be consistent with those of tumor-inducing viruses shown to affect sea turtles in the other parts of the world. ChHV5 RNA from the FP tissues was further detected by RT-PCR, indicating active replication of the viruses inside FP tumors. In addition to the molecular evidence of ChHV5 in FP, epidermal intranuclear inclusions were identified in tumor lesions upon histopathological examination. This further suggests that ChHV5 should be in a transcriptionally active (i.e., non-latent) state in FP tumors of affected green turtles. The phylogenetic tree revealed that ChHV5 from the green turtles in Taiwan were closest to the ChHV5 from Hawaii, Puerto Rico, and Sao Tome. For conservation of endangered sea turtles, ChHV5 should be considered an emerging virus, which threatens sea turtles in marine waters in Asia.

  12. Prevalence of antibodies against Bubaline herpesvirus (BuHV-1) among Mediterranean water buffalo (Bubalus bubalis) with implications in buffalo trade.

    Science.gov (United States)

    Caruso, C; Prato, R; Ingravalle, F; Vecchio, D; Sciarra, A; Ternavasio, M; Ceccarelli, L; Martucciello, A; Galiero, G; De Carlo, E; Masoero, L

    2016-12-01

    Both Bovine herpesvirus (BoHV-1) and Bubaline herpesvirus (BuHV-1) have been reported to cross the species barrier. Antibody seroconversion in glycoprotein E (gE) blocking ELISA during BuHV-1 infection has been documented. Recent diagnostic efforts have focused on the development and application of discriminatory tests to distinguish between infections with BoHV-1 and BuHV-1. To evaluate the impact and distribution of these two infections in water buffalo farms in two regions (Piedmont (n = 3) and Campania (n = 10), Italy) where infectious bovine rhinotracheitis control programs have been implemented. Sampling was carried out on 13 buffalo farms comprising 1089 animals using specific gE-indirect ELISA's test able to discriminate among BoHV-1 and BuHV-1 infections. 59.0% of animals reacted positive to ELISA (irrespective of whether BoHV-1 or BuHV-1 antigen was used) and 86.4% of these were reactive to BuHV-1 only, whereas 11.8% showed absorbance values for both antigens and were classified as inconclusive. There was a statistically significant age-related difference in BuHV-1 infection rates but not in overall individual (47% vs. 58%) or herd prevalence (100% vs. 90%) of infection between the two regions. The low percentage of sera reactive to BoHV-1 (1.8%, 12/643) indicates that BuHV-1 may be the main circulating alphaherpesvirus infection in Mediterranean water buffalo in the two study areas. Since Bubalus bubalis is included in Directive 64/432/EEC on animal health problems affecting intra-community trade in bovine animals, diagnostic testing with nonspecific ELISA for BoHV-1 infection in buffalo may yield false-positive reactions. This scenario could lead to economic losses and hamper buffalo trade and movement, particularly for reproduction purposes.

  13. BoHV-4-Based Vector Single Heterologous Antigen Delivery Protects STAT1(-/- Mice from Monkeypoxvirus Lethal Challenge.

    Directory of Open Access Journals (Sweden)

    Valentina Franceschi

    2015-06-01

    Full Text Available Monkeypox virus (MPXV is the etiological agent of human (MPX. It is an emerging orthopoxvirus zoonosis in the tropical rain forest of Africa and is endemic in the Congo-basin and sporadic in West Africa; it remains a tropical neglected disease of persons in impoverished rural areas. Interaction of the human population with wildlife increases human infection with MPX virus (MPXV, and infection from human to human is possible. Smallpox vaccination provides good cross-protection against MPX; however, the vaccination campaign ended in Africa in 1980, meaning that a large proportion of the population is currently unprotected against MPXV infection. Disease control hinges on deterring zoonotic exposure to the virus and, barring that, interrupting person-to-person spread. However, there are no FDA-approved therapies against MPX, and current vaccines are limited due to safety concerns. For this reason, new studies on pathogenesis, prophylaxis and therapeutics are still of great interest, not only for the scientific community but also for the governments concerned that MPXV could be used as a bioterror agent. In the present study, a new vaccination strategy approach based on three recombinant bovine herpesvirus 4 (BoHV-4 vectors, each expressing different MPXV glycoproteins, A29L, M1R and B6R were investigated in terms of protection from a lethal MPXV challenge in STAT1 knockout mice. BoHV-4-A-CMV-A29LgD106ΔTK, BoHV-4-A-EF1α-M1RgD106ΔTK and BoHV-4-A-EF1α-B6RgD106ΔTK were successfully constructed by recombineering, and their capacity to express their transgene was demonstrated. A small challenge study was performed, and all three recombinant BoHV-4 appeared safe (no weight-loss or obvious adverse events following intraperitoneal administration. Further, BoHV-4-A-EF1α-M1RgD106ΔTK alone or in combination with BoHV-4-A-CMV-A29LgD106ΔTK and BoHV-4-A-EF1α-B6RgD106ΔTK, was shown to be able to protect, 100% alone and 80% in combination, STAT1(-/- mice

  14. Parameters for MDBK cell growth on microcarriers and BoHV-1 virus production

    Directory of Open Access Journals (Sweden)

    Ethel C. Freitas

    2017-09-01

    Full Text Available Bovine herpes virus 1 (BoHV-1 is an important veterinary agent , which causes infectious bovine rhinotra-cheitis. This disease affects the respiratory tract or genitals, causing weight loss, reduced milk production and abor-tion. Several vaccines against BoHV-1 have been developed. In this paper, we study the parameters for MDBK growth on microcarriers (Cytodex 1 and for BoHV-1 virus production. The cell culture attached to microcarriers is an effi-cient method to enlarge the surface of cell growth and for large-scale cell production. Our studies reveal that MDBK adhered to MCs in 30 minutes and that initial agitation of culture did not influence on the efficiency of adhesion or cell growth. In our experiments, we detected no relevant influence of agitation on initial cell adhesion of MDBK to MCs. The maximum cell yield was similar to all initial conditions of agitation studied. The maximum yield obtained in culture started with 15, 20 and 30 cells / MC, was respectively.8.7 x105, 9.3 x105 and 9.8 x105 cells / ml . The cellular distribution on the MCs at the beginning of the culture was more heterogeneous in higher initial densities. After three medium exchanges during MDBK cell culture, the increase in the final yield was 100% higher than that from culture performed without medium change (0.93 x 106 cells / mL. Replacing 50% of the culture medium with fresh medium after 24 hours of growth, the concentration of glucose (5 mM and glutamine (1.8 mM were almost completely res-tored. In these studies, BoHV-1 infections of MDBK were performed after 48, 72 and 86 hours with daily exchanges of 50% of the medium. The increase in viral titer was proportional to the number of viable cells present at the time of infection. The best result of BoHV-1 production was achieved when the infection was performed from 86 hours of cell culture, reaching about 3.7 x108 (TCID50/ml after 24-48 hours of infection, being on average four times higher when compared to the

  15. The calculation and simulation of the ECRH HV power supply for the HL-2A tokamak

    International Nuclear Information System (INIS)

    Mao Xiaohui; Li Qing; Xuan Weimin; Yao Lieying

    2006-01-01

    In order to satisfy the requirement of ECRH, the ECRH HV power supply (ECHV-HVPS) on the base of high voltage pulse modulation has been designed. The filter inductance in the ECHV-HVPS is much smaller than the voltage regulation power supply. Modulations are adopted in the power supply, so the short time of the leading edge and lagging edge of the pulse is achieved. The main circuit of the ECHV-HVPS is showed. The equivalent resistance and the transient response of the PS are calculated and analyzed using MATLAB, and experiment results are given. (authors)

  16. About SEEs in the HV Distributor System of the TileCal

    CERN Document Server

    Chadelas, R; Lambert, D

    2002-01-01

    SEE tests performed in october 2001 (27-28) on the HV distributor system of the Tile calorimeter gave us estimated numbers concerning soft and latch-up events. Even if the rates seen will not prevent the device from running, it is important to try to reduce them and to predict how the system will react in particular to latch-ups. This note describes the efforts developped to reduce SEE rates and to secure the behaviour of the system with respect to latch-ups.

  17. Improving zinc accumulation in cereal endosperm using HvMTP1, a transition metal transporter

    DEFF Research Database (Denmark)

    Menguer, Paloma K; Vincent, Thomas; Miller, Anthony J

    2018-01-01

    Zinc (Zn) is essential for all life forms, including humans. It is estimated that around two billion people are deficient in their Zn intake. Human dietary Zn intake relies heavily on plants, which in many developing countries consists mainly of cereals. The inner part of cereal grain......) vacuolar Zn transporter HvMTP1 was expressed under the control of the endosperm-specific D-hordein promoter. Transformed plants exhibited no significant change in growth but had higher total grain Zn concentration, as measured by ICP-OES, compared to parental controls. Compared with Zn, transformants had...

  18. Characterization of poly-hydroxybutyrate-hydroxyvalerate (PHB-HV)/corn starch blend films

    OpenAIRE

    Reis, Kelen Cristina dos

    2014-01-01

    Blendas de polihidroxibutirato-hidroxivalerato (PHB-HV) com amido de milho em diferentes concentrações foram preparadas pelo processo "casting" com clorofórmio. As propriedades mecânica, térmica, morfológica e físico-química das blendas foram investigadas usando as análises de textura, calorimetria diferencial de varredura, espectroscopia no infra-vermelho com transformada de Fourier, difração de raio-X, microscopia ótica, microscopia eletrônica de varredura e colorimetria. As propriedades me...

  19. Functional characterization of viral tumor necrosis factor receptors encoded by cyprinid herpesvirus 3 (CyHV3) genome.

    Science.gov (United States)

    Yi, Yang; Qi, Hemei; Yuan, Jimin; Wang, Rui; Weng, Shaoping; He, Jianguo; Dong, Chuanfu

    2015-08-01

    Cyprinid herpesvirus 3 (CyHV3) is a large double-stranded DNA virus of Alloherpesviridae family in the order Herpesvirales. It causes significant morbidity and mortality in common carp and its ornamental koi variety, and threatens the aquaculture industries worldwide. Mimicry of cytokines and cytokine receptors is a particular strategy for large DNA viruses in modulating the host immune response. Here, we report the identification and characterization of two novel viral homologues of tumor necrosis factor receptor (TNFR) encoded by CyHV3-ORF4 and -ORF12, respectively. CyHV3-ORF4 was identified as a homologue of HVEM and CyHV3-ORF12 as a homologue of TNFRSF1. Overexpression of ORF4 and ORF12 in zebrafish embryos results in embryonic lethality, morphological defects and increased apoptosis. Although we failed to identify any interaction between the two vTNFRs and their potential ligands in zebrafish TNF superfamily by yeast two-hybrid system, the expression of some genes in TNF superfamily or TNFR superfamily were mis-regulated in ORF4 or ORF12-overexpressing embryos, especially the death receptor zHDR and its cognate ligand DL1b. Further studies showed that the apoptosis induced by the both CyHV3 vTNFRs is mainly activated through the intrinsic apoptotic pathway and requires the crosstalk between the intrinsic and extrinsic apoptotic pathway. Additionally, using RT-qPCR and Western blot assays, the expression patterns of the both vTNFRs were also analyzed during CyHV3 productive infection. Collectively, this is the first functional study of two unique vTNFRs encoded by a herpesvirus infecting non-mammalian vertebrates, which may provide novel insights into viral immune regulation mechanism and the pathogenesis of CyHV3 infection. Copyright © 2015 Elsevier Ltd. All rights reserved.

  20. Characterisation of capacitively coupled HV/HR-CMOS sensor chips for the CLIC vertex detector

    Science.gov (United States)

    Kremastiotis, I.

    2017-12-01

    The capacitive coupling between an active sensor and a readout ASIC has been considered in the framework of the CLIC vertex detector study. The CLICpix Capacitively Coupled Pixel Detector (C3PD) is a High-Voltage CMOS sensor chip produced in a commercial 180 nm HV-CMOS process for this purpose. The sensor was designed to be connected to the CLICpix2 readout chip. It therefore matches the dimensions of the readout chip, featuring a matrix of 128×128 square pixels with 25μm pitch. The sensor chip has been produced with the standard value for the substrate resistivity (~20 Ωcm) and it has been characterised in standalone testing mode, before receiving and testing capacitively coupled assemblies. The standalone measurement results show a rise time of ~20 ns for a power consumption of 5μW/pixel. Production of the C3PD HV-CMOS sensor chip with higher substrate resistivity wafers (~20, 80, 200 and 1000 Ωcm) is foreseen. The expected benefits of the higher substrate resistivity will be studied using future assemblies with the readout chip.

  1. Characterisation of capacitively coupled HV/HR-CMOS sensor chips for the CLIC vertex detector

    CERN Document Server

    AUTHOR|(SzGeCERN)756402

    2017-01-01

    The capacitive coupling between an active sensor and a readout ASIC has been considered in the framework of the CLIC vertex detector study. The CLICpix Capacitively Coupled Pixel Detector (C3PD) is a High-Voltage CMOS sensor chip produced in a commercial 180 nm HV-CMOS process for this purpose. The sensor was designed to be connected to the CLICpix2 readout chip. It therefore matches the dimensions of the readout chip, featuring a matrix of 128 × 128 square pixels with 25 μm pitch. The sensor chip has been produced with the standard value for the substrate resistivity (∼ 20 Ωcm) and it has been characterised in standalone testing mode, before receiving and testing capacitively coupled assemblies. The standalone measurement results show a rise time of ∼ 20 ns for a power consumption of 5 μW/pixel. Production of the C3PD HV-CMOS sensor chip with higher substrate resistivity wafers (∼ 20, 80, 200 and 1000 Ωcm) is foreseen. The expected benefits of the higher substrate resistivity will be studied using...

  2. A source representation of microseisms constrained by HV spectral ratio observations

    Science.gov (United States)

    Dreger, D.; Rhie, J.

    2006-12-01

    The microseisms are generated by pressure variation on the sea floor caused by incident and reflected ocean waves, and dominant background noises at short periods. The observations of microseism wave fields in deep sedimentary basins (e.g., Santa Clara Valley) show that the maximum period of the horizontal to vertical (H/V) spectral ratio correlates with basin thickness. A similar correlation has been found in teleseismic arrival times and P-wave amplitude as well as local-earthquake S-wave relative amplification [Dolenc et al., 2005]. This observation infers that a study of microseism wave field, combined with other seismic data sets, can probably be used to invert for the velocity structures of the deep basins. To make this inversion possible, it is necessary to understand the excitation and propagation characteristics of microseisms. We will perform forward computations of microseism wave fields for source representations such as CLVDs and single-forces with the USGS 3D velocity model. Various spatial extensions as well as the frequency content of the source will be tested to match observed shifts in dominant H/V spectral ratio. The optimal source representation of the microseisms will be the first step to accomplish inversions for 3D seismic velocity structure in sedimentary basins using microseisms.

  3. A monolithic active pixel sensor for ionizing radiation using a 180 nm HV-SOI process

    Energy Technology Data Exchange (ETDEWEB)

    Hemperek, Tomasz; Kishishita, Tetsuichi; Krueger, Hans; Wermes, Norbert [Institute of Physics, University of Bonn, Bonn (Germany)

    2016-07-01

    An improved SOI-MAPS (Silicon On Insulator Monolithic Active Pixel Sensor) for ionizing radiation based on thick-180 nm High Voltage SOI technology (HV-SOI) has been developed. Similar to existing Fully Depleted SOI-based (FD-SOI) MAPS, a buried silicon oxide inter-dielectric (BOX) layer is used to separate the CMOS electronics from the handle wafer which is used as a depleted charge collection layer. Standard FD-SOI MAPS suffer from radiation damage such as transistor threshold voltage shifts due to trapped charge in the buried oxide layer and charged interface states created at the silicon oxide boundaries (back gate effect). The X-FAB 180 nm HV-SOI technology offers an additional isolation using a deep non-depleted implant between the BOX layer and the active circuitry which mitigates this problem. Therefore we see in this technology a high potential to implement radiation-tolerant MAPS with fast charge collection. The design and measurement results from first prototypes are presented including radiation tolerance to total ionizing dose and charge collection properties of neutron irradiated samples.

  4. A Monolithic Active Pixel Sensor for ionizing radiation using a 180 nm HV-SOI process

    Energy Technology Data Exchange (ETDEWEB)

    Hemperek, Tomasz, E-mail: hemperek@uni-bonn.de; Kishishita, Tetsuichi; Krüger, Hans; Wermes, Norbert

    2015-10-01

    An improved SOI-MAPS (Silicon On Insulator Monolithic Active Pixel Sensor) for ionizing radiation based on thick-film High Voltage SOI technology (HV-SOI) has been developed. Similar to existing Fully Depleted SOI-based (FD-SOI) MAPS, a buried silicon oxide inter-dielectric (BOX) layer is used to separate the CMOS electronics from the handle wafer which is used as a depleted charge collection layer. FD-SOI MAPS suffers from radiation damage such as transistor threshold voltage shifts due to charge traps in the oxide layers and charge states created at the silicon oxide boundaries (back gate effect). The X-FAB 180-nm HV-SOI technology offers an additional isolation by deep non-depleted implant between the BOX layer and the active circuitry which mitigates this problem. Therefore we see in this technology a high potential to implement radiation-tolerant MAPS with fast charge collection property. The design and measurement results from a first prototype are presented including charge collection in neutron irradiated samples.

  5. Barley plants over-expressing the NAC transcription factor gene HvNAC005 show stunting and delay in development combined with early senescence

    DEFF Research Database (Denmark)

    Christiansen, Michael W; Matthewman, Colette; Podzimska-Sroka, Dagmara

    2016-01-01

    -expressing plants showed up-regulation of genes involved with secondary metabolism, hormone metabolism, stress, signalling, development, and transport. Up-regulation of senescence markers and hormone metabolism and signalling genes supports a role of HvNAC005 in the cross field of different hormone and signalling......The plant-specific NAC transcription factors have attracted particular attention because of their involvement in stress responses, senescence, and nutrient remobilization. The HvNAC005 gene of barley encodes a protein belonging to subgroup NAC-a6 of the NAC family. This study shows that HvNAC005...... pathways. Binding of HvNAC005 to promoter sequences of putative target genes containing the T[G/A]CGT core motif was shown by direct protein-DNA interactions of HvNAC005 with promoters for two of the up-regulated genes. In conclusion, HvNAC005 was shown to be a strong positive regulator of senescence...

  6. Crystal structures of barley thioredoxin h isoforms HvTrxh1 and HvTrxh2 reveal features involved in protein recognition and possibly in discriminating the isoform specificity

    DEFF Research Database (Denmark)

    Maeda, Kenji; Hägglund, Per; Finnie, Christine

    2008-01-01

    segment of one HvTrxh1 molecule is positioned along a shallow hydrophobic groove at the primary nucleophile Cys40 of another HvTrxh1 molecule. The association mode can serve as a model for the target protein recognition by Trx, as it brings the Met82 C gamma atom (gamma position as a disulfide sulfur......) of the bound loop segment in the proximity of the Cys40 thiol. The interaction involves three characteristic backbone-backbone hydrogen bonds in an antiparallel beta-sheet-like arrangement, similar to the arrangement observed in the structure of an engineered, covalently bound complex between Trx...... and a substrate protein, as reported by Maeda et al. in an earlier paper. The occurrence of an intermolecular salt bridge between Glu80 of the bound loop segment and Arg101 near the hydrophobic groove suggests that charge complementarity plays a role in the specificity of Trx. In HvTrxh2, isoleucine corresponds...

  7. Specific expression of the human voltage-gated proton channel Hv1 in highly metastatic breast cancer cells, promotes tumor progression and metastasis

    International Nuclear Information System (INIS)

    Wang, Yifan; Li, Shu Jie; Pan, Juncheng; Che, Yongzhe; Yin, Jian; Zhao, Qing

    2011-01-01

    Highlights: → Hv1 is specifically expressed in highly metastatic human breast tumor tissues. → Hv1 regulates breast cancer cytosolic pH. → Hv1 acidifies extracellular milieu. → Hv1 exacerbates the migratory ability of metastatic cells. -- Abstract: The newly discovered human voltage-gated proton channel Hv1 is essential for proton transfer, which contains a voltage sensor domain (VSD) without a pore domain. We report here for the first time that Hv1 is specifically expressed in the highly metastatic human breast tumor tissues, but not in poorly metastatic breast cancer tissues, detected by immunohistochemistry. Meanwhile, real-time RT-PCR and immunocytochemistry showed that the expression levels of Hv1 have significant differences among breast cancer cell lines, MCF-7, MDA-MB-231, MDA-MB-468, MDA-MB-453, T-47D and SK-BR-3, in which Hv1 is expressed at a high level in highly metastatic human breast cancer cell line MDA-MB-231, but at a very low level in poorly metastatic human breast cancer cell line MCF-7. Inhibition of Hv1 expression in the highly metastatic MDA-MB-231 cells by small interfering RNA (siRNA) significantly decreases the invasion and migration of the cells. The intracellular pH of MDA-MB-231 cells down-regulated Hv1 expression by siRNA is obviously decreased compared with MDA-MB-231 with the scrambled siRNA. The expression of matrix metalloproteinase-2 and gelatinase activity in MDA-MB-231 cells suppressed Hv1 by siRNA were reduced. Our results strongly suggest that Hv1 regulates breast cancer intracellular pH and exacerbates the migratory ability of metastatic cells.

  8. Establishment of a novel and highly permissive cell line for the efficient replication of cyprinid herpesvirus 2 (CyHV-2).

    Science.gov (United States)

    Ma, Jie; Jiang, Nan; LaPatra, Scott E; Jin, Ling; Xu, Jin; Fan, Yuding; Zhou, Yong; Zeng, Lingbing

    2015-06-12

    Haematopoietic necrosis of gibel carp (Carassius auratus gibelio) is caused by cyprinid herpesvirus 2 (CyHV-2) and has caused huge economic losses in aquaculture worldwide. Currently the isolation and propagation of CyHV-2 in vitro is very difficult due to the lack of permissive cell lines. Studies on the pathogenesis of CyHV-2 have been hampered because the virus has not been extensively characterized. In this study, a novel cell line from the brain of gibel carp, denoted GiCB, has been established and characterized. Sustainable propagation of CyHV-2 in the GiCB cell line has been confirmed by virus infection and titration, PCR, transmission electron microscopy, immunofluorescence assay and fluorescence in situ hybridization. The GiCB cells showed typical cytopathic effect by day 6 post-infection with CyHV-2 including cell shrinkage, rounding, and cell fusion with cytoplasmic vacuolization. The virus titer reached 10(7.5 ± 0.37)TCID₅₀/ml and has been successfully passaged over 50 times in the GiCB cell line. Electron microscopy analysis revealed the complete replication of CyHV-2 in GiCB cells. CyHV-2-infected GiCB cells reacted strongly with polyclonal antibodies against CyHV-2 and CyHV-2 RNA in cells hybridized specifically with the virus RNA probes. Additionally, an experimental infection demonstrated that CyHV-2 produced in GiCB cells caused 100% mortality in gibel carp. All the results provide solid evidence that the GiCB cell line is highly permissive for the isolation and propagation of CyHV-2. This is a significant advancement that will promote additional research on CyHV-2 infection in fish in the future. Copyright © 2015 Elsevier B.V. All rights reserved.

  9. Development of hybrid micro circuit based multi-channel programmable HV supply for BARC-pelletron experimental facility

    International Nuclear Information System (INIS)

    Manna, A.; Thombare, S.; Moitra, S.; Kuswarkar, M.; Punna, M.; Nair, P.M.; Diwakar, M.P.; Pithawa, C.K.

    2013-01-01

    Electronics Division, BARC has developed a Multi channel programmable HV bias supply system for charge particle detector array for use in BARC-TIFR Pelletron-LINAC facility. The HV supplies are compact in size due to use of hybrid micro-circuits developed indigenously and are modular in construction to achieve versatility, scalability and serviceability. All programming operations and monitoring are performed remotely through PC over Ethernet. Each supply has a built-in over voltage, over current and thermal overload protections for safe operation and employs a Zero Voltage Switching (ZVS) technique to reduce thermal stress on the inverter switches. This article describes salient design aspects and performance of the HV supply system. (author)

  10. Barley HvPAPhy_a as transgene provides high and stable phytase activities in mature barley straw and in grains

    DEFF Research Database (Denmark)

    Holme, Inger; Dionisio, Giuseppe; Madsen, Claus Krogh

    2017-01-01

    The phytase purple acid phosphatase (HvPAPhy_a) expressed during barley seed development was evaluated as transgene for overexpression in barley. The phytase was expressed constitutively driven by the cauliflower mosaic virus 35S-promoter, and the phytase activity was measured in the mature grains......, the green leaves and in the dry mature vegetative plant parts left after harvest of the grains. The T2-generation of HvPAPhy_a transformed barley showed phytase activity increases up to 19-fold (29 000 phytase units (FTU) per kg in mature grains). Moreover, also in green leaves and mature dry straw, phytase...... activities were increased significantly by 110-fold (52 000 FTU/kg) and 57-fold (51 000 FTU/kg), respectively. The HvPAPhy_a-transformed barley plants with high phytase activities possess triple potential utilities for the improvement of phosphate bioavailability. First of all, the utilization of the mature...

  11. Comparison of nested PCR and qPCR for the detection and quantitation of BoHV6 DNA.

    Science.gov (United States)

    Kubiś, Piotr; Materniak, Magdalena; Kuźmak, Jacek

    2013-12-01

    Nested PCR and qPCR (quantitative PCR) tests based on glycoprotein B (gB) gene were designed for detecting Bovine herpesvirus 6 (BoHV6) in bovine whole blood samples and wild ruminant blood clots (deer and roe-deer). This virus, commonly known as BLHV (bovine lymphotropic herpesvirus) belongs to the Herpesviridae family, subfamily Gammaherpesvirinae and Macavirus genus. DNA isolated from 92 dairy cow blood samples and 69 wild ruminant clots were examined for the presence of BoHV6 using nested PCR and qPCR tests. Viral DNA was detected by using nested PCR in 59 out of 92 bovine blood samples (64.1%), and by qPCR in 68 out of 92 bovine blood samples (73.9%), but none out of 69 DNA samples isolated from wild ruminant blood clots, was positive in both assays. The specificity of nested PCR and qPCR was confirmed by using BoHV1, BoHV4, BoHV6, BFV, BIV, and BLV DNA. The sensitivity of nested PCR and qPCR was determined using a serially 10-fold diluted vector pCR2.1HgB (2 × 10(0)-2 × 10(6)copies/reaction). In this testing, qPCR was more sensitive than the nested PCR, detecting two copies of BoHV6 whilst the limit of detection for nested PCR was 20 copies. In all qPCR assays, the coefficients of determination (R(2)) ranged between 0.990 and 0.999, and the calculated amplification efficiencies (Eff%) within the range of 89.7-106.9. The intra- and inter-assay CV (coefficient of variation) values did not exceed 4%. Copyright © 2013 Elsevier B.V. All rights reserved.

  12. On/Off Power Supply of the Electron Beam Machine HV Automation by Using PCL-718 and PCLD-786

    International Nuclear Information System (INIS)

    Sudiyanto; Suyono, Djoko; Salam, Aminus; Ngatinu; Sudaryanto; Wiyana, Badi

    1996-01-01

    HV on/off power supply of the electron beam machine HV automation by using PCL-718 and PCLD-786 have been done. During the simulation experiments by using PCL-718 ADC-12 bit and PCLD-786 driver relay and Turbo-C software have been multiplexes 16 differential digital output channels which controlled on/off ac/dc relay of the electron beam machine power supply. Two PCLD-786 can be cascaded to expand the digital output channels which controlled 32 ac/dc relay

  13. The improved stability of an organic crystal in the Hitachi HV-1 high vacuum electron microscope

    International Nuclear Information System (INIS)

    Hartman, R.S.; Hartman, R.E.; Alsberg, H.; Nathan, R.

    1974-01-01

    A specimen of crystalline indanthrene olive T was placed in the HV-1, which was then pumped for 2 hours. The 25 A bright field fringe pattern was then observed on the TV monitor. Deterioration was noted very shortly, and the electron microscope was then pumped for three days, after which another field was subjected to the same level of irradiation by 50 KV electrons. It was found that there was little if any deterioration even after 20 minutes. It was concluded that it is possible to find conditions in a transmission EM where stability far exceeds that predicted by current theories of radiation damage or demonstrated by conventional electron microscopes. (R.L.)

  14. Recent results with HV-CMOS and planar sensors for the CLIC vertex detector

    CERN Document Server

    AUTHOR|(SzGeCERN)734627

    2017-01-01

    The physics aims for the future multi-TeV e+e- Compact Linear Collider (CLIC) impose high precision requirements on the vertex detector which has to match the experimental conditions, such as the time structure of the collisions and the presence of beam-induced backgrounds. The principal challenges are: a point resolution of 3μm, 10 ns time stamping capabilities, low mass (⇠0.2% X0 per layer), low power dissipation and pulsed power operation. Recent results of test beam measurements and GEANT4 simulations for assemblies with Timepix3 ASICs and thin active-edge sensors are presented. The 65 nm CLICpix readout ASIC with 25μm pitch was bump bonded to planar silicon sensors and also capacitively coupled through a thin layer of glue to active HV-CMOS sensors. Test beam results for these two hybridisation concepts are presented.

  15. Ontario Hydro's environmental monitoring program for HV [high voltage] transmission line projects

    International Nuclear Information System (INIS)

    Braekevelt, P.N.

    1991-01-01

    Responsible monitoring and control of environmental impacts is key to obtaining future needed approvals for new high voltage (HV) transmission line projects. Ontario Hydro's environmental monitoring program was developed as a highly structured, self-imposed monitoring system to relieve government agencies of the responsibility of developing a similar external program. The goal was to be self-policing. The historical development, program structure, standards, priority ratings, documentation, communication and computerization of the program is described. The most effective way to minimize environmental impacts is to avoid sensitive features at the route selection stage, well before any construction takes place. The environmental monitoring program is based on the following blueprint: each crew member is responsible for environmental protection; environmental problems are to be resolved at the lowest level possible; potential concerns should be resolved before they become problems; known problems should be dealt with quickly to minimize impacts; team members should work cooperatively; and formal and regular communication is emphasized

  16. The Hv-SGT1 gene from Haynaldia villosa contributes to resistances towards both biotrophic and hemi-biotrophic pathogens in common wheat (Triticum aestivum L..

    Directory of Open Access Journals (Sweden)

    Liping Xing

    Full Text Available The SGT1 protein is essential for R protein-mediated and PAMPs-triggered resistance in many plant species. Here we reported the isolation and characterization of the Hv-SGT1 gene from Haynaldiavillosa (2n = 14, VV. Analysis of the subcellular location of Hv-SGT1 by transient expression of a fusion to GFP indicated its presence in the cytoplasm and nucleus. Levels of Hv-SGT1 transcripts were increased by inoculation with either the biotrophic pathogen Blumeriagraminis DC. f. Sp. tritici (Bgt or the hemi-biotrophic pathogen Fusariumgraminearum (Fg. Levels of Hv-SGT1 showed substantial increase following treatment with H2O2 and methyl jasmonate (MeJA, only slightly induced following exposure to ethephon or abscisic acid, but not changed following exposure to salicylic acid. The demonstration that silencing of Hv-SGT1 substantially reduced resistance to Bgt indicated that Hv-SGT1 was an essential component of disease resistance in H. villosa. The over-expression of Hv-SGT1 in Yangmai 158 enhanced resistance to powdery mildew, and this correlated with increased levels of whole-cell reactive oxygen intermediates at the sites of penetration by the pathogens. Compared with wild-type plants, the expression levels of genes related to the H2O2 and JA signaling pathways were lower in the Hv-SGT1 silenced plants and higher in the Hv-SGT1 over-expressing plants. Therefore, the involvement of Hv-SGT1 in H2O2 production correlates with the hypersensitive response and jasmonic acid signaling. Our novel demonstration that wheat with over-expressed Hv-SGT1 showed enhanced resistance to both powdery mildew and FHB suggests that it could served as a transgenic genetic resource in wheat breeding for multiple disease resistance.

  17. Comparative Investigation of Pollution Accumulation and Natural Cleaning for Different HV Insulators

    Directory of Open Access Journals (Sweden)

    M. Dimitropoulou

    2015-04-01

    Full Text Available High Voltage insulators are scattered throughout any HV network and a single insulator fault may cause an excessive outage. Reliability is a key issue for electric power systems and fault-free performance of insulators greatly reflects on the reliability of the system. Environmental influence is rather important for the optimum selection of outdoor insulators and, therefore, field measurements provide valuable information. Utilities perform such measurements in order to decide upon the location/route of new HV installations (substations, lines etc and also to optimize the selection, maintenance and replacement of already installed insulators. A rather interesting case in Greek territory is the island of Crete, due to the coastal development of the network and the local weather conditions. The Greek utility has employed a variety of remedies to cope with the pollution problem. Following the positive feedback after the installation on certain tower in the past, a large project to replace all ceramic insulators with new polymer ones of hydrophobic surface is now in progress. Polymer coatings have also been extensively applied on substations and also on certain areas/towers of the transmission network in the past. In order to investigate the pollution accumulation and the impact of natural washing on different insulator types, a series of periodical ESDD and NSDD pollution measurements were conducted in HEDNO’s TALOS High Voltage Test Station for a 3-months period. Multiple measurements were performed on each insulator every month in order to collect additional data. Five different insulators were selected based on the types historically used in the Cretan Network. Along with the standard glass disc profile, two strings of glass fog profile (the one coated with RTV and two long-rod composite insulators of different shed profile and material were used. Results are presented and discussed in this paper.

  18. Mapping a Part of Neuquén Basin in Argentina by Global-phase H/V Spectral Ratio

    NARCIS (Netherlands)

    Nishitsuji, Yohei; Ruigrok, E.N.; Gomez, M.; Draganov, Deyan

    2015-01-01

    We investigated the applicability of global phases (epicentral distances of ≥ 120° and ≥ 150°) for the H/V spectral ratio to identify the fundamental resonance frequency. We applied the method to delineate a part of Neuquén basin in Argentina without the need for active seismic sources. We obtained

  19. Mapping a part of Neuquen Basin in Argentina by global-phase H/V spectral ratio

    NARCIS (Netherlands)

    Nishitsuji, Y.; Ruigrok, E.; Gomez, M.; Draganov, D.S.

    2015-01-01

    We investigated the applicability of global phases (epicentral distances of ? 120° and ? 150°) for the H/V spectral ratio to identify the fundamental resonance frequency. We applied the method to delineate a part of Neuquén basin in Argentina without the need for active seismic sources. We obtained

  20. Boron toxicity tolerance in barley through reduced expression of the multifunctional aquaporin HvNIP2;1.

    Science.gov (United States)

    Schnurbusch, Thorsten; Hayes, Julie; Hrmova, Maria; Baumann, Ute; Ramesh, Sunita A; Tyerman, Stephen D; Langridge, Peter; Sutton, Tim

    2010-08-01

    Boron (B) toxicity is a significant limitation to cereal crop production in a number of regions worldwide. Here we describe the cloning of a gene from barley (Hordeum vulgare), underlying the chromosome 6H B toxicity tolerance quantitative trait locus. It is the second B toxicity tolerance gene identified in barley. Previously, we identified the gene Bot1 that functions as an efflux transporter in B toxicity-tolerant barley to move B out of the plant. The gene identified in this work encodes HvNIP2;1, an aquaporin from the nodulin-26-like intrinsic protein (NIP) subfamily that was recently described as a silicon influx transporter in barley and rice (Oryza sativa). Here we show that a rice mutant for this gene also shows reduced B accumulation in leaf blades compared to wild type and that the mutant protein alters growth of yeast (Saccharomyces cerevisiae) under high B. HvNIP2;1 facilitates significant transport of B when expressed in Xenopus oocytes compared to controls and to another NIP (NOD26), and also in yeast plasma membranes that appear to have relatively high B permeability. We propose that tolerance to high soil B is mediated by reduced expression of HvNIP2;1 to limit B uptake, as well as by increased expression of Bot1 to remove B from roots and sensitive tissues. Together with Bot1, the multifunctional aquaporin HvNIP2;1 is an important determinant of B toxicity tolerance in barley.

  1. Radiation-hard Active Pixel Sensors for HL-LHC Detector Upgrades based on HV-CMOS Technology

    International Nuclear Information System (INIS)

    Miucci, A; Gonzalez-Sevilla, S; Ferrere, D; Iacobucci, G; Rosa, A La; Muenstermann, D; Gonella, L; Hemperek, T; Hügging, F; Krüger, H; Obermann, T; Wermes, N; Garcia-Sciveres, M; Backhaus, M; Capeans, M; Feigl, S; Nessi, M; Pernegger, H; Ristic, B; George, M

    2014-01-01

    Luminosity upgrades are discussed for the LHC (HL-LHC) which would make updates to the detectors necessary, requiring in particular new, even more radiation-hard and granular, sensors for the inner detector region. A proposal for the next generation of inner detectors is based on HV-CMOS: a new family of silicon sensors based on commercial high-voltage CMOS technology, which enables the fabrication of part of the pixel electronics inside the silicon substrate itself. The main advantages of this technology with respect to the standard silicon sensor technology are: low material budget, fast charge collection time, high radiation tolerance, low cost and operation at room temperature. A traditional readout chip is still needed to receive and organize the data from the active sensor and to handle high-level functionality such as trigger management. HV-CMOS has been designed to be compatible with both pixel and strip readout. In this paper an overview of HV2FEI4, a HV-CMOS prototype in 180 nm AMS technology, will be given. Preliminary results after neutron and X-ray irradiation are shown

  2. Evidence for functional diversity between the voltage-gated proton channel Hv1 and its closest related protein HVRP1.

    Directory of Open Access Journals (Sweden)

    Iris H Kim

    Full Text Available The Hv1 channel and voltage-sensitive phosphatases share with voltage-gated sodium, potassium, and calcium channels the ability to detect changes in membrane potential through voltage-sensing domains (VSDs. However, they lack the pore domain typical of these other channels. NaV, KV, and CaV proteins can be found in neurons and muscles, where they play important roles in electrical excitability. In contrast, VSD-containing proteins lacking a pore domain are found in non-excitable cells and are not involved in neuronal signaling. Here, we report the identification of HVRP1, a protein related to the Hv1 channel (from which the name Hv1 Related Protein 1 is derived, which we find to be expressed primarily in the central nervous system, and particularly in the cerebellum. Within the cerebellar tissue, HVRP1 is specifically expressed in granule neurons, as determined by in situ hybridization and immunohistochemistry. Analysis of subcellular distribution via electron microscopy and immunogold labeling reveals that the protein localizes on the post-synaptic side of contacts between glutamatergic mossy fibers and the granule cells. We also find that, despite the similarities in amino acid sequence and structural organization between Hv1 and HVRP1, the two proteins have distinct functional properties. The high conservation of HVRP1 in vertebrates and its cellular and subcellular localizations suggest an important function in the nervous system.

  3. Active Pixel Sensors in ams H18/H35 HV-CMOS Technology for the ATLAS HL-LHC Upgrade

    CERN Document Server

    Ristic, Branislav

    2016-09-21

    Deep sub micron HV-CMOS processes offer the opportunity for sensors built by industry standard techniques while being HV tolerant, making them good candidates for drift-based, fast collecting, thus radiation-hard pixel detectors. For the upgrade of the ATLAS Pixel Detector towards the HL-LHC requirements, active pixel sensors in HV-CMOS technology were investigated. These implement amplifier and discriminator stages directly in insulating deep n-wells, which also act as collecting electrodes. The deep n-wells allow for bias voltages up to 150V leading to a depletion depth of several 10um. Prototype sensors in the ams H18 180nm and H35 350nm HV-CMOS processes have been manufactured, acting as a potential drop-in replacement for the current ATLAS Pixel sensors, thus leaving higher level processing such as trigger handling to dedicated read-out chips. Sensors were thoroughly tested in lab measurements as well as in testbeam experiments. Irradiation with X-rays and protons revealed a tolerance to ionizing doses o...

  4. Rapid detection of Cyprinid herpesvirus-3 (CyHV-3) using a gold nanoparticle-based hybridization assay.

    Science.gov (United States)

    Saleh, Mona; El-Matbouli, Mansour

    2015-06-01

    Cyprinid herpesvirus-3 (CyHV-3) is a highly infectious pathogen that causes fatal disease in common and koi carp Cyprinus carpio L. CyHV-3 detection is usually based on virus propagation or amplification of the viral DNA using the PCR or LAMP techniques. However, due to the limited susceptibility of cells used for propagation, it is not always possible to successfully isolate CyHV-3 even from tissue samples that have high virus titres. All previously described detection methods including PCR-based assays are time consuming, laborious and require specialized equipment. To overcome these limitations, gold nanoparticles (AuNPs) have been explored for direct and sensitive detection of DNA. In this study, a label-free colorimetric nanodiagnostic method for direct detection of unamplified CyHV-3 DNA using gold nanoparticles is introduced. Under appropriate conditions, DNA probes hybridize with their complementary target sequences in the sample DNA, which results in aggregation of the gold nanoparticles and a concomitant colour change from red to blue, whereas test samples with non complementary DNA sequences remain red. In this study, gold nanoparticles were used to develop and evaluate a specific and sensitive hybridization assay for direct and rapid detection of the highly infectious pathogen termed Cyprinid herpesvirus-3. Copyright © 2015 Elsevier B.V. All rights reserved.

  5. Mutations in the C-terminal region affect subcellular localization of crucian carp herpesvirus (CaHV) GPCR.

    Science.gov (United States)

    Wang, Jun; Gui, Lang; Chen, Zong-Yan; Zhang, Qi-Ya

    2016-08-01

    G protein-coupled receptors (GPCRs) are known as seven transmembrane domain receptors and consequently can mediate diverse biological functions via regulation of their subcellular localization. Crucian carp herpesvirus (CaHV) was recently isolated from infected fish with acute gill hemorrhage. CaHV GPCR of 349 amino acids (aa) was identified based on amino acid identity. A series of variants with truncation/deletion/substitution mutation in the C-terminal (aa 315-349) were constructed and expressed in fathead minnow (FHM) cells. The roles of three key C-terminal regions in subcellular localization of CaHV GPCR were determined. Lysine-315 (K-315) directed the aggregation of the protein preferentially at the nuclear side. Predicted N-myristoylation site (GGGWTR, aa 335-340) was responsible for punctate distribution in periplasm or throughout the cytoplasm. Predicted phosphorylation site (SSR, aa 327-329) and GGGWTR together determined the punctate distribution in cytoplasm. Detection of organelles localization by specific markers showed that the protein retaining K-315 colocalized with the Golgi apparatus. These experiments provided first evidence that different mutations of CaHV GPCR C-terminals have different affects on the subcellular localization of fish herpesvirus-encoded GPCRs. The study provided valuable information and new insights into the precise interactions between herpesvirus and fish cells, and could also provide useful targets for antiviral agents in aquaculture.

  6. The role of the HvNAC6 transcription factor in response to biotic and abiotic stress in barley

    DEFF Research Database (Denmark)

    Chen, Yan-Jun

    -mediated transformation methods could be used to study stress responses at the whole-plant level. The abscisic acid (ABA) and salicylic acid (SA) levels were measured during Bgh infection to investigate the involvement of these hormones and TF in the basal resistance. HvNAC6 RNAi plants were also subjected to dehydration...

  7. Counting the dead to determine the source and transmission of the marine herpesvirus OsHV-1 in Crassostrea gigas.

    Science.gov (United States)

    Whittington, Richard J; Paul-Pont, Ika; Evans, Olivia; Hick, Paul; Dhand, Navneet K

    2018-04-10

    Marine herpesviruses are responsible for epizootics in economically, ecologically and culturally significant taxa. The recent emergence of microvariants of Ostreid herpesvirus 1 (OsHV-1) in Pacific oysters Crassostrea gigas has resulted in socioeconomic losses in Europe, New Zealand and Australia however, there is no information on their origin or mode of transmission. These factors need to be understood because they influence the way the disease may be prevented and controlled. Mortality data obtained from experimental populations of C. gigas during natural epizootics of OsHV-1 disease in Australia were analysed qualitatively. In addition we compared actual mortality data with those from a Reed-Frost model of direct transmission and analysed incubation periods using Sartwell's method to test for the type of epizootic, point source or propagating. We concluded that outbreaks were initiated from an unknown environmental source which is unlikely to be farmed oysters in the same estuary. While direct oyster-to-oyster transmission may occur in larger oysters if they are in close proximity (< 40 cm), it did not explain the observed epizootics, point source exposure and indirect transmission being more common and important. A conceptual model is proposed for OsHV-1 index case source and transmission, leading to endemicity with recurrent seasonal outbreaks. The findings suggest that prevention and control of OsHV-1 in C. gigas will require multiple interventions. OsHV-1 in C. gigas, which is a sedentary animal once beyond the larval stage, is an informative model when considering marine host-herpesvirus relationships.

  8. Frequency of antibodies against bovine herpesvirus type 1 (BoHV-1 in beef cattle not vaccinated

    Directory of Open Access Journals (Sweden)

    Ermilton Junio Pereira de Freitas

    2014-06-01

    Full Text Available Bovine herpesvirus type 1 (BoHV-1, is responsible for clinical manifestations such as infectious bovine rhinotracheitis, abortion, conjunctivitis, infectious pustular vulvovaginitis and balanoposthitis. This virus has been responsible for major losses in different productive and reproductive herds in the country. Thus, the objective of this study was to estimate the frequency of antibodies against BoHV-1 in beef heifers not vaccinated in Microregion of Imperatriz, Maranhao, and identify the age group most affected by the virus, as well as a study of factors associated with virus infection and to evaluate the indirect ELISA using the serum neutralization (SN as a reference standard. The study was conducted in 48 herds, cutting, distributed in 12 counties of Microregion of Imperatriz. The samples were collected from female cattle stratified into three age groups, ? 12 months, between 12 and 36 months and ? 36 months of age. The samples were subjected to two serological tests, ELISA and SN. In each herd, an epidemiological questionnaire was applied in order to obtain information on management and reproductive sanitary, for the study of risk factors. The frequency of antibodies against BoHV-1 in Microregion of Imperatriz was 63.23%, and the municipalities of Açailândia Buritirana showed the highest frequencies, both with 80.44%, the most affected age group, the Microregion, was animals aged ? 36 months (69.65%. Based on the results we can conclude that the frequency of antibodies against BoHV-1 is high, between the age groups most affected were the animals aged ? 36 months were considered risk factors for virus transmission, return to estrus (OR=1.874, recovery of animals from other states / region (OR=1.365 and the creation of goat / sheep associated with bovine (OR=1.348, the indirect ELISA technique showed moderate concordance when compared to SN technique, which is the gold standard technique for diagnosis of BoHV-1.

  9. Characterization of BoHV-5 field strains circulation and report of transient specific subtype of bovine herpesvirus 5 in Argentina

    Directory of Open Access Journals (Sweden)

    Thiry Julien

    2011-02-01

    Full Text Available Abstract Background Bovine herpesvirus 5 (BoHV-5 is a member of the subfamily Alphaherpesvirinae responsible for meningo-encephalitis in young cattle. The first case of bovine meningo-encephalitis associated with a herpesvirus infection was reported in Australia. The current geographical distribution of BoHV-5 infection is mainly restricted to South America, especially Brazil and Argentina. Outbreaks of BoHV-5 are regularly observed in Argentina suggesting the circulation of the virus in the bovine population. Results Seventeen field strains of BoHV-5 isolated from 1984 to now were confirmed by differential PCR and subjected to restriction endonuclease analysis (REA. Viral DNA was cleaved with BstEII which allows the differentiation among subtypes a, b and non a, non b. According to the REA with BstEII, only one field strain showed a pattern similar to the Argentinean A663 strain (prototype of BoHV-5b. All other isolates showed a clear pattern similar to the Australian N569 strain (prototype of BoHV-5a consistent with the subtypes observed in Brazil, the other South-American country where BoHV-5 is known to be prevalent. The genomic region of subtype b responsible for the distinct pattern was determined and amplified by PCR; specifically a point mutation was identified in glycoprotein B gene, on the BstEII restriction site, which generates the profile specific of BoHV-5b. Conclusions This is the first report of circulation of BoHV-5a in Argentina as the prevailing subtype. Therefore the circulation of BoHV-5b was restricted to a few years in Argentina, speculating that this subtype was not able to be maintained in the bovine population. The mutation in the gB gene is associated with the difference in the restriction patterns between subtypes "a" and "b".

  10. Studying the Genetics of Resistance to CyHV-3 Disease Using Introgression from Feral to Cultured Common Carp Strains

    Science.gov (United States)

    Tadmor-Levi, Roni; Asoulin, Efrat; Hulata, Gideon; David, Lior

    2017-01-01

    Sustainability and further development of aquaculture production are constantly challenged by outbreaks of fish diseases, which are difficult to prevent or control. Developing fish strains that are genetically resistant to a disease is a cost-effective and a sustainable solution to address this challenge. To do so, heritable genetic variation in disease resistance should be identified and combined together with other desirable production traits. Aquaculture of common carp has suffered substantial losses from the infectious disease caused by the cyprinid herpes virus type 3 (CyHV-3) virus and the global spread of outbreaks indicates that many cultured strains are susceptible. In this research, CyHV-3 resistance from the feral strain “Amur Sassan” was successfully introgressed into two susceptible cultured strains up to the first backcross (BC1) generation. Variation in resistance of families from F1 and BC1 generations was significantly greater compared to that among families of any of the susceptible parental lines, a good starting point for a family selection program. Considerable additive genetic variation was found for CyHV-3 resistance. This phenotype was transferable between generations with contributions to resistance from both the resistant feral and the susceptible cultured strains. Reduced scale coverage (mirror phenotype) is desirable and common in cultured strains, but so far, cultured mirror carp strains were found to be susceptible. Here, using BC1 families ranging from susceptible to resistant, no differences in resistance levels between fully scaled and mirror full-sib groups were found, indicating that CyHV-3 resistance was successfully combined with the desirable mirror phenotype. In addition, the CyHV-3 viral load in tissues throughout the infection of susceptible and resistant fish was followed. Although resistant fish get infected, viral loads in tissues of these fish are significantly lesser than in those of susceptible fish, allowing them

  11. Investigation of HV/HR-CMOS technology for the ATLAS Phase-II Strip Tracker Upgrade

    International Nuclear Information System (INIS)

    Fadeyev, V.; Galloway, Z.; Grabas, H.; Grillo, A.A.; Liang, Z.; Martinez-Mckinney, F.; Seiden, A.; Volk, J.; Affolder, A.; Buckland, M.; Meng, L.; Arndt, K.; Bortoletto, D.; Huffman, T.; John, J.; McMahon, S.; Nickerson, R.; Phillips, P.; Plackett, R.; Shipsey, I.

    2016-01-01

    ATLAS has formed strip CMOS project to study the use of CMOS MAPS devices as silicon strip sensors for the Phase-II Strip Tracker Upgrade. This choice of sensors promises several advantages over the conventional baseline design, such as better resolution, less material in the tracking volume, and faster construction speed. At the same time, many design features of the sensors are driven by the requirement of minimizing the impact on the rest of the detector. Hence the target devices feature long pixels which are grouped to form a virtual strip with binary-encoded z position. The key performance aspects are radiation hardness compatibility with HL-LHC environment, as well as extraction of the full hit position with full-reticle readout architecture. To date, several test chips have been submitted using two different CMOS technologies. The AMS 350 nm is a high voltage CMOS process (HV-CMOS), that features the sensor bias of up to 120 V. The TowerJazz 180 nm high resistivity CMOS process (HR-CMOS) uses a high resistivity epitaxial layer to provide the depletion region on top of the substrate. We have evaluated passive pixel performance, and charge collection projections. The results strongly support the radiation tolerance of these devices to radiation dose of the HL-LHC in the strip tracker region. We also describe design features for the next chip submission that are motivated by our technology evaluation.

  12. Investigation of HV/HR-CMOS technology for the ATLAS Phase-II Strip Tracker Upgrade

    Science.gov (United States)

    Fadeyev, V.; Galloway, Z.; Grabas, H.; Grillo, A. A.; Liang, Z.; Martinez-Mckinney, F.; Seiden, A.; Volk, J.; Affolder, A.; Buckland, M.; Meng, L.; Arndt, K.; Bortoletto, D.; Huffman, T.; John, J.; McMahon, S.; Nickerson, R.; Phillips, P.; Plackett, R.; Shipsey, I.; Vigani, L.; Bates, R.; Blue, A.; Buttar, C.; Kanisauskas, K.; Maneuski, D.; Benoit, M.; Di Bello, F.; Caragiulo, P.; Dragone, A.; Grenier, P.; Kenney, C.; Rubbo, F.; Segal, J.; Su, D.; Tamma, C.; Das, D.; Dopke, J.; Turchetta, R.; Wilson, F.; Worm, S.; Ehrler, F.; Peric, I.; Gregor, I. M.; Stanitzki, M.; Hoeferkamp, M.; Seidel, S.; Hommels, L. B. A.; Kramberger, G.; Mandić, I.; Mikuž, M.; Muenstermann, D.; Wang, R.; Zhang, J.; Warren, M.; Song, W.; Xiu, Q.; Zhu, H.

    2016-09-01

    ATLAS has formed strip CMOS project to study the use of CMOS MAPS devices as silicon strip sensors for the Phase-II Strip Tracker Upgrade. This choice of sensors promises several advantages over the conventional baseline design, such as better resolution, less material in the tracking volume, and faster construction speed. At the same time, many design features of the sensors are driven by the requirement of minimizing the impact on the rest of the detector. Hence the target devices feature long pixels which are grouped to form a virtual strip with binary-encoded z position. The key performance aspects are radiation hardness compatibility with HL-LHC environment, as well as extraction of the full hit position with full-reticle readout architecture. To date, several test chips have been submitted using two different CMOS technologies. The AMS 350 nm is a high voltage CMOS process (HV-CMOS), that features the sensor bias of up to 120 V. The TowerJazz 180 nm high resistivity CMOS process (HR-CMOS) uses a high resistivity epitaxial layer to provide the depletion region on top of the substrate. We have evaluated passive pixel performance, and charge collection projections. The results strongly support the radiation tolerance of these devices to radiation dose of the HL-LHC in the strip tracker region. We also describe design features for the next chip submission that are motivated by our technology evaluation.

  13. Investigation of HV/HR-CMOS technology for the ATLAS Phase-II Strip Tracker Upgrade

    Energy Technology Data Exchange (ETDEWEB)

    Fadeyev, V., E-mail: fadeyev@ucsc.edu [Santa Cruz Institute for Particle Physics, University of California, Santa Cruz, CA 95064 (United States); Galloway, Z.; Grabas, H.; Grillo, A.A.; Liang, Z.; Martinez-Mckinney, F.; Seiden, A.; Volk, J. [Santa Cruz Institute for Particle Physics, University of California, Santa Cruz, CA 95064 (United States); Affolder, A.; Buckland, M.; Meng, L. [Department of Physics, University of Liverpool, O. Lodge Laboratory, Oxford Street, Liverpool L69 7ZE (United Kingdom); Arndt, K.; Bortoletto, D.; Huffman, T.; John, J.; McMahon, S.; Nickerson, R.; Phillips, P.; Plackett, R.; Shipsey, I. [Department of Physics, Oxford University, Oxford (United Kingdom); and others

    2016-09-21

    ATLAS has formed strip CMOS project to study the use of CMOS MAPS devices as silicon strip sensors for the Phase-II Strip Tracker Upgrade. This choice of sensors promises several advantages over the conventional baseline design, such as better resolution, less material in the tracking volume, and faster construction speed. At the same time, many design features of the sensors are driven by the requirement of minimizing the impact on the rest of the detector. Hence the target devices feature long pixels which are grouped to form a virtual strip with binary-encoded z position. The key performance aspects are radiation hardness compatibility with HL-LHC environment, as well as extraction of the full hit position with full-reticle readout architecture. To date, several test chips have been submitted using two different CMOS technologies. The AMS 350 nm is a high voltage CMOS process (HV-CMOS), that features the sensor bias of up to 120 V. The TowerJazz 180 nm high resistivity CMOS process (HR-CMOS) uses a high resistivity epitaxial layer to provide the depletion region on top of the substrate. We have evaluated passive pixel performance, and charge collection projections. The results strongly support the radiation tolerance of these devices to radiation dose of the HL-LHC in the strip tracker region. We also describe design features for the next chip submission that are motivated by our technology evaluation.

  14. Observation of two distinct magnetic states in ZrZn2 via the dHvA effect under pressure

    International Nuclear Information System (INIS)

    Kimura, N.; Endo, M.; Isshiki, T.; Ochiai, A.; Aoki, H.; Terashima, T.; Uji, S.; Matsumoto, T.; Lonzarich, G.G.

    2005-01-01

    We have found an anomaly in magnetic field dependence of the de Haas-van Alphen (dHvA) frequency of ZrZn 2 . Pressure dependence of this anomaly suggests an existence of two distinct ferromagnetic states and then a 'nested' phase diagram similar to that of UGe 2 . The Stoner exchange parameter and the exchange splitting energy are 400 and 66meV, respectively, which are derived from comparing the field dependence of the dHvA frequency difference with the magnetization. The two parameters do not change in both the low and slightly higher average moment states, suggesting that the phase transition between these states is ascribed to the change in the difference of majority and minority spin carrier densities

  15. H/V spectral ratios technique application in the city of Bucharest: Can we get rid of source effect?

    International Nuclear Information System (INIS)

    Grecu, B.; Radulian, M.; Mandrescu, N.; Panza, G.F.

    2006-06-01

    The main issue of this paper is to show that, contrary to many examples of monitored strong earthquakes in different urban areas, the intensity and spectral characteristics of the strong ground motion induced in the Bucharest area, by Vrancea intermediate- depth earthquakes, is controlled by the coupled source-site properties rather than by the local site conditions alone. Our results have important implications on the strategy to follow when assessing the seismic microzoning for Bucharest city: we recommend the application of deterministic approaches rather than empirical techniques, like H/V spectral ratios. However, when applied to noise data, the H/V spectral technique succeeds in reproducing the predominant frequency response characteristic for the sedimentary cover beneath the city and the relatively uniform distribution of this structure over the city area. Our results strongly disagree with any strategy of extrapolation from small and moderate earthquakes to strong earthquakes for microzoning purposes. (author)

  16. Boron Toxicity Tolerance in Barley through Reduced Expression of the Multifunctional Aquaporin HvNIP2;11[W

    Science.gov (United States)

    Schnurbusch, Thorsten; Hayes, Julie; Hrmova, Maria; Baumann, Ute; Ramesh, Sunita A.; Tyerman, Stephen D.; Langridge, Peter; Sutton, Tim

    2010-01-01

    Boron (B) toxicity is a significant limitation to cereal crop production in a number of regions worldwide. Here we describe the cloning of a gene from barley (Hordeum vulgare), underlying the chromosome 6H B toxicity tolerance quantitative trait locus. It is the second B toxicity tolerance gene identified in barley. Previously, we identified the gene Bot1 that functions as an efflux transporter in B toxicity-tolerant barley to move B out of the plant. The gene identified in this work encodes HvNIP2;1, an aquaporin from the nodulin-26-like intrinsic protein (NIP) subfamily that was recently described as a silicon influx transporter in barley and rice (Oryza sativa). Here we show that a rice mutant for this gene also shows reduced B accumulation in leaf blades compared to wild type and that the mutant protein alters growth of yeast (Saccharomyces cerevisiae) under high B. HvNIP2;1 facilitates significant transport of B when expressed in Xenopus oocytes compared to controls and to another NIP (NOD26), and also in yeast plasma membranes that appear to have relatively high B permeability. We propose that tolerance to high soil B is mediated by reduced expression of HvNIP2;1 to limit B uptake, as well as by increased expression of Bot1 to remove B from roots and sensitive tissues. Together with Bot1, the multifunctional aquaporin HvNIP2;1 is an important determinant of B toxicity tolerance in barley. PMID:20581256

  17. Bio-plastic (P-3HB-co-3HV) from Bacillus circulans (MTCC 8167) and its biodegradation.

    Science.gov (United States)

    Phukon, Pinkee; Saikia, Jyoti Prasad; Konwar, Bolin Kumar

    2012-04-01

    Polyhydroxyalkanoates (PHAs) are naturally occurring polyesters synthesized by bacteria for carbon and energy storage and it has commercial potential as bioplastic. The bacterial species Bacillus circulans MTCC 8167, isolated from crude oil contaminated soil, can efficiently produce medium chain length polyhydroxyalkanoates (P-3HB-co-3HV) from cheap carbon sources like dextrose. The molecular mass of P-3HB-co-3HV was reported as 5.1×10(4)Da with polydispersity index of 1.21 by gel permeation chromatography. In the present investigation different bacteria and fungi species were used for testing the biodegradability of the extracted polymer. The FTIR spectra of the biodegraded PHBV film showed a decrease in the peak from 1735 cm(-1) (untreated film) to 1675 cm(-1), and disappearance of a peak present in the control at 2922 cm(-1) indicating the breakdown of ester (>C=O) or O-R group and -C=H bond, respectively. From biodegradability testing, the tested microorganisms were found to have decisive contribution to the biodegradation of P-3HB-co-3HV polymer. Copyright © 2011 Elsevier B.V. All rights reserved.

  18. Voltage-sensing domain of voltage-gated proton channel Hv1 shares mechanism of block with pore domains.

    Science.gov (United States)

    Hong, Liang; Pathak, Medha M; Kim, Iris H; Ta, Dennis; Tombola, Francesco

    2013-01-23

    Voltage-gated sodium, potassium, and calcium channels are made of a pore domain (PD) controlled by four voltage-sensing domains (VSDs). The PD contains the ion permeation pathway and the activation gate located on the intracellular side of the membrane. A large number of small molecules are known to inhibit the PD by acting as open channel blockers. The voltage-gated proton channel Hv1 is made of two VSDs and lacks the PD. The location of the activation gate in the VSD is unknown and open channel blockers for VSDs have not yet been identified. Here, we describe a class of small molecules which act as open channel blockers on the Hv1 VSD and find that a highly conserved phenylalanine in the charge transfer center of the VSD plays a key role in blocker binding. We then use one of the blockers to show that Hv1 contains two intracellular and allosterically coupled gates. Copyright © 2013 Elsevier Inc. All rights reserved.

  19. Overexpression of HvIcy6 in Barley Enhances Resistance against Tetranychus urticae and Entails Partial Transcriptomic Reprogramming

    Directory of Open Access Journals (Sweden)

    M. Estrella Santamaria

    2018-03-01

    Full Text Available Cystatins have been largely used for pest control against phytophagous species. However, cystatins have not been commonly overexpressed in its cognate plant species to test their pesticide capacity. Since the inhibitory role of barley HvCPI-6 cystatin against the phytophagous mite Tetranychus urticae has been previously demonstrated, the purpose of our study was to determine if barley transgenic lines overexpressing its own HvIcy6 gene were more resistant against this phytophagous infestation. Besides, a transcriptomic analysis was done to find differential expressed genes among wild-type and transformed barley plants. Barley plants overexpressing HvIcy6 cystatin gene remained less susceptible to T. urticae attack when compared to wild-type plants, with a significant lesser foliar damaged area and a lower presence of the mite. Transcriptomic analysis revealed a certain reprogramming of cellular metabolism and a lower expression of several genes related to photosynthetic activity. Therefore, although caution should be taken to discard potential deleterious pleiotropic effects, cystatins may be used as transgenes with impact on agricultural crops by conferring enhanced levels of resistance to phytophagous pests.

  20. Development of high voltage surge limiting resistor for protection of HV multiplier of 3 MeV DC accelerator

    International Nuclear Information System (INIS)

    Dewangan, S.; Sharma, D.K.; Bakhtsingh, R.I.

    2013-01-01

    A 3MeV, 10mA DC electron beam accelerator is in commissioning stages at EBC, Kharghar, Navi Mumbai. The accelerating potential of -3MV is generated by a Parallel Coupled Voltage Multiplier (PCVM) scheme using 74 stages of HV rectifier stacks in the 6 kg/cm 2 SF6 gas environment. The HV surges of order of 600kV, 42kA, 10ns is estimated across the rectifier stacks during sparking in the multiplier column. To limit the surge current and protect the rectifier diodes, a non inductive thick film surge limiting resistor (SLR) and protective spark gap is designed and developed. The rectifier stacks with surge limiting resistors at both the ends and protective spark gap in parallel has been successfully tested in simulated surge condition at an impulse voltage of 212kVp, 150ns FWHM and surge energy of 200J, 10ms, 20kV at 6kg/cm 2 SF6 gas environment and found satisfactorily. Subsequently the HV multiplier was installed with this surge protection scheme and is being tested at 1.2 MeV level. This paper describes the design features and test results of the non-inductive surge limiting resistor. (author)

  1. Co-infection of Acipenserid herpesvirus 2 (AciHV-2) and Streptococcus iniae in cultured white sturgeon Acipenser transmontanus.

    Science.gov (United States)

    Soto, Esteban; Richey, Christine; Stevens, Brittany; Yun, Susan; Kenelty, Kirsten; Reichley, Stephen; Griffin, Matt; Kurobe, Tomofumi; Camus, Al

    2017-03-30

    A mortality event in cultured white sturgeon Acipenser transmontanus (Richardson, 1836) sub-adults was investigated. After transfer between farms, high mortality was observed in fish, associated with back arching, abnormal swimming, and ulcerative skin lesions. Necropsy of moribund individuals revealed hemorrhagic ascites and petechial hemorrhages in the coelomic peritoneum and serosa of internal organs. Acipenserid herpesvirus 2 (AciHV-2) was isolated from external tissue samples, then identified and genotyped by sequencing of the terminase and polymerase genes. In addition, Streptococcus iniae was recovered from internal organs of affected fish. Histologic changes were limited to interstitial hematopoietic areas of the kidney and consisted of small foci of necrosis accompanied by fibrin deposition, minimal inflammatory response, and small numbers of bacterial cocci compatible with streptococci. Identity was confirmed by partial sequencing of the 16S rRNA, rpoB, and gyrB genes. Genetic fingerprinting demonstrated a genetic profile distinct from S. iniae isolates recovered from previous outbreaks in wild and cultured fish in North America, South America, and the Caribbean. Although the isolates were resistant to white sturgeon complement in serum killing assays, in vivo challenges failed to fulfill Koch's postulates. However, the clinical presentation, coupled with consistent recovery of S. iniae and AciHV-2 from moribund fish, suggests viral and bacterial co-infection were the proximate cause of death. To our knowledge, this represents the first report of AciHV-2 and S. iniae co-infection in cultured white sturgeon.

  2. Barley HvPAPhy_a as transgene provides high and stable phytase activities in mature barley straw and in grains.

    Science.gov (United States)

    Holme, Inger Baeksted; Dionisio, Giuseppe; Madsen, Claus Krogh; Brinch-Pedersen, Henrik

    2017-04-01

    The phytase purple acid phosphatase (HvPAPhy_a) expressed during barley seed development was evaluated as transgene for overexpression in barley. The phytase was expressed constitutively driven by the cauliflower mosaic virus 35S-promoter, and the phytase activity was measured in the mature grains, the green leaves and in the dry mature vegetative plant parts left after harvest of the grains. The T 2 -generation of HvPAPhy_a transformed barley showed phytase activity increases up to 19-fold (29 000 phytase units (FTU) per kg in mature grains). Moreover, also in green leaves and mature dry straw, phytase activities were increased significantly by 110-fold (52 000 FTU/kg) and 57-fold (51 000 FTU/kg), respectively. The HvPAPhy_a-transformed barley plants with high phytase activities possess triple potential utilities for the improvement of phosphate bioavailability. First of all, the utilization of the mature grains as feed to increase the release of bio-available phosphate and minerals bound to the phytate of the grains; secondly, the utilization of the powdered straw either directly or phytase extracted hereof as a supplement to high phytate feed or food; and finally, the use of the stubble to be ploughed into the soil for mobilizing phytate-bound phosphate for plant growth. © 2016 The Authors. Plant Biotechnology Journal published by Society for Experimental Biology and The Association of Applied Biologists and John Wiley & Sons Ltd.

  3. Design and construction of 5 kV HV and TAC

    International Nuclear Information System (INIS)

    Dang Lanh; Tran Tuan Anh; Vu Xuan Cach; Truong Van Dat; Nguyen An Son

    2007-01-01

    Energy spectroscopy system and Time spectroscopy one are the typical systems that used generally in nuclear physics. The measurement of time intervals plays an important role in basic nuclear physics research as well as in applications that involve the timing of events. Decay scheme and lifetime studies, coincidence experiments, single-photon counting, and positron annihilation studies are some of the experimental areas that require good timing capabilities. Most timing experiments involve either a precision measurement of the elapsed time between two events or the isolation of true coincidence events from a background of noncoincident data. The basic unit of most elapsed time measurement system is a time-to-amplitude converter (TAC). The instrument convert the time interval between a start pulse and a stop pulse into an output pulse with an amplitude precisely proportional to the time interval. Besides, an energy spectroscopy system can be either one detector or two detectors. The basic unit of the system furnishes an output high voltage for detector is the bias voltage unit (BV). Advancement in functional electronics design is a continuing study at NRI, Dalat. Obviously, the design and construction of the two aforementioned instruments is needed in the sub-project. Specifications of HV unit: Output high voltage range: 0-5 kV, Polarity: positive or negative, Output current: 1 mA, Linearity at output: ±1.2% for full range, Voltage stability < ±0.2%/h variation in output voltage with constant temperature and load and constant input voltages, Noise < 20 mV peak-peak from 50 Hz to 50 MHz. Basic characteristics of TAC unit: Single start-stop operation, time range is from 100 ns to 2 μs, DC-coupled to prevent counrate distortion, Coincidence or anti-coincidence gating, Biased amplifier to expand a region of interest, Output with variable delay and positive polarity for MCA compatibility. (author)

  4. HvCKX2 gene silencing by biolistic or Agrobacterium-mediated transformation in barley leads to different phenotypes.

    Science.gov (United States)

    Zalewski, Wojciech; Orczyk, Wacław; Gasparis, Sebastian; Nadolska-Orczyk, Anna

    2012-11-07

    CKX genes encode cytokinin dehydrogenase enzymes (CKX), which metabolize cytokinins in plants and influence developmental processes. The genes are expressed in different tissues and organs during development; however, their exact role in barley is poorly understood. It has already been proven that RNA interference (RNAi)-based silencing of HvCKX1 decreased the CKX level, especially in those organs which showed the highest expression, i.e. developing kernels and roots, leading to higher plant productivity and higher mass of the roots [1]. The same type of RNAi construct was applied to silence HvCKX2 and analyze the function of the gene. Two cultivars of barley were transformed with the same silencing and selection cassettes by two different methods: biolistic and via Agrobacterium. The mean Agrobacterium-mediated transformation efficiency of Golden Promise was 3.47% (±2.82). The transcript level of HvCKX2 in segregating progeny of T(1) lines was decreased to 34%. The reduction of the transcript in Agrobacterium-derived plants resulted in decreased CKX activity in the developing and developed leaves as well as in 7 DAP (days after pollination) spikes. The final phenotypic effect was increased productivity of T(0) plants and T(1) lines. Higher productivity was the result of the higher number of seeds and higher grain yield. It was also correlated with the higher 1000 grain weight, increased (by 7.5%) height of the plants and higher (from 0.5 to 2) numbers of spikes. The transformation efficiency of Golden Promise after biolistic transformation was more than twice as low compared to Agrobacterium. The transcript level in segregating progeny of T(1) lines was decreased to 24%. Otherwise, the enzyme activity found in the leaves of the lines after biolistic transformation, especially in cv. Golden Promise, was very high, exceeding the relative level of the control lines. These unbalanced ratios of the transcript level and the activity of the CKX enzyme negatively

  5. HV1 acts as a sodium sensor and promotes superoxide production in medullary thick ascending limb of Dahl salt-sensitive rats.

    Science.gov (United States)

    Jin, Chunhua; Sun, Jingping; Stilphen, Carly A; Smith, Susan M E; Ocasio, Hiram; Bermingham, Brent; Darji, Sandip; Guha, Avirup; Patel, Roshan; Geurts, Aron M; Jacob, Howard J; Lambert, Nevin A; O'Connor, Paul M

    2014-09-01

    We previously characterized a H(+) transport pathway in medullary thick ascending limb nephron segments that when activated stimulated the production of superoxide by nicotinamide adenine dinucleotide phosphate oxidase. Importantly, the activity of this pathway was greater in Dahl salt-sensitive rats than salt-resistant (SS.13(BN)) rats, and superoxide production was enhanced in low Na(+) media. The goal of this study was to determine the molecular identity of this pathway and its relationship to Na(+). We hypothesized that the voltage-gated proton channel, HV1, was the source of superoxide-stimulating H(+) currents. To test this hypothesis, we developed HV1(-/-) null mutant rats on the Dahl salt-sensitive rat genetic background using zinc-finger nuclease gene targeting. HV1 could be detected in medullary thick limb from wild-type rats. Intracellular acidification using an NH4Cl prepulse in 0 sodium/BaCl2 containing media resulted in superoxide production in thick limb from wild-type but not HV1(-/-) rats (Pthick limb and peritoneal macrophages only when HV1 was present. When fed a high-salt diet, blood pressure, outer medullary renal injury (tubular casts), and oxidative stress (4-hydroxynonenal staining) were significantly reduced in HV1(-/-) rats compared with wild-type Dahl salt-sensitive rats. We conclude that HV1 is expressed in medullary thick ascending limb and promotes superoxide production in this segment when intracellular Na(+) is low. HV1 contributes to the development of hypertension and renal disease in Dahl salt-sensitive rats. © 2014 American Heart Association, Inc.

  6. Estimation of the Ultimate Tensile Strength of Steel from Its HB and HV Hardness Numbers and Coercive Force

    Science.gov (United States)

    Sandomirskii, S. G.

    2017-11-01

    A formula is derived to accurately describe the tabulated relation between the Brinell ( HB) and Vickers ( HV) hardnesses of steel over the entire range of their possible variation. This formula and the formulas describing the relation between the HB hardness of chromium-molybdenum and chromium-nickel steels and their ultimate tensile strength σu are used to analyze the change in σu of 38KhNM steel upon quenching and tempering. The data that reveal a relation between σu of 38KhNM steel and its coercive force are obtained.

  7. Cyprinid herpesvirus-3 (CyHV-3) disturbs osmotic balance in carp (Cyprinus carpio L.)--A potential cause of mortality.

    Science.gov (United States)

    Negenborn, J; van der Marel, M C; Ganter, M; Steinhagen, D

    2015-06-12

    Cyprinid herpesvirus-3 (CyHV-3) causes a fatal disease in carp (Cyprinus carpio) and its ornamental koi varieties which seriously affects production and trade of this fish species globally. Up to now, the pathophysiology of this disease remains unclear. Affected individuals develop most prominent lesions in gills, skin and kidney, in tissues which are involved in the osmotic regulation of freshwater teleosts. Therefore, here serum and urine electrolyte levels were examined during the course of an experimental infection of carp with CyHV-3. In infected carp an interstitial nephritis with a progressive deterioration of nephric tubules developed, which was paralleled by elevated electrolyte losses, mainly Na(+) in the urine. The urine/plasma ratio for Na(+) increased from 0.03 in uninfected carp to 0.43-0.83 in carp under CyHV-3 infection, while concentration of divalent ions were not significantly changed. These electrolyte losses could not be compensated since plasma osmolality and Na(+) concentration dropped significantly in CyHV-3 infected carp. This was most probably caused by the progressive deterioration of the branchial epithelium, which in teleosts plays a prominent role in osmoregulation, and which was seen concomitantly with decreasing electrolyte levels in the serum of carp under CyHV-3 infection. Immediately after infection with CyHV-3, by day 2 post exposure, affected carp showed severe anaemia and prominent leucocytosis indicating the development of an acute inflammation, which could intensify the observed hydro-mineral imbalances. The data presented here show that an infection with CyHV-3 induces an acute inflammation and a severe dysfunction of osmoregulation in affected carp or koi, which may lead to death in particular in the case of acute disease progression. Copyright © 2015 Elsevier B.V. All rights reserved.

  8. Tests of a High Temperature Sample Conditioner for the Waste Treatment Plant LV-S2, LV-S3, HV-S3A and HV-S3B Exhaust Systems

    Energy Technology Data Exchange (ETDEWEB)

    Flaherty, Julia E. [Pacific Northwest National Lab. (PNNL), Richland, WA (United States); Glissmeyer, John A. [Pacific Northwest National Lab. (PNNL), Richland, WA (United States)

    2015-03-18

    Tests were performed to evaluate a sample conditioning unit for stack monitoring at Hanford Tank Waste Treatment and Immobilization Plant (WTP) exhaust stacks with elevated air temperatures. The LV-S2, LV-S3, HV-S3A and HV-S3B exhaust stacks are expected to have elevated air temperature and dew point. At these emission points, exhaust temperatures are too high to deliver the air sample directly to the required stack monitoring equipment. As a result, a sample conditioning system is considered to cool and dry the air prior to its delivery to the stack monitoring system. The method proposed for the sample conditioning is a dilution system that will introduce cooler, dry air to the air sample stream. This method of sample conditioning is meant to reduce the sample temperature while avoiding condensation of moisture in the sample stream. An additional constraint is that the ANSI/HPS N13.1-1999 standard states that at least 50% of the 10 μm aerodynamic diameter (AD) particles present in the stack free stream must be delivered to the sample collector. In other words, depositional loss of particles should be limited to 50% in the sampling, transport, and conditioning systems. Based on estimates of particle penetration through the LV-S3 sampling system, the diluter should perform with about 80% penetration or better to ensure that the total sampling system passes the 50% or greater penetration criterion.

  9. Induction of Barley Silicon Transporter HvLsi1 and HvLsi2, increased silicon concentration in the shoot and regulated Starch and ABA Homeostasis under Osmotic stress and Concomitant Potassium Deficiency

    Directory of Open Access Journals (Sweden)

    Seyed A. Hosseini

    2017-08-01

    Full Text Available Drought is one of the major stress factors reducing cereal production worldwide. There is ample evidence that the mineral nutrient status of plants plays a critical role in increasing plant tolerance to different biotic and abiotic stresses. In this regard, the important role of various nutrients e.g., potassium (K or silicon (Si in the mitigation of different stress factors, such as drought, heat or frost has been well documented. Si application has been reported to ameliorate plant nutrient deficiency. Here, we used K and Si either solely or in combination to investigate whether an additive positive effect on barley growth can be achieved under osmotic stress and which mechanisms contribute to a better tolerance to osmotic stress. To achieve this goal, barley plants were subjected to polyethylene glycol (PEG-induced osmotic stress under low or high K supply and two Si regimes. The results showed that barley silicon transporters HvLsi1 and HvLsi2 regulate the accumulation of Si in the shoot only when plant suffered from K deficiency. Si, in turn, increased the starch level under both osmotic stress and K deficiency and modulated the glycolytic and TCA pathways. Hormone profiling revealed that the beneficial effect of Si is most likely mediated also by ABA homeostasis and active cytokinin isopentenyl adenine (iP. We conclude that Si may effectively improve stress tolerance under K deficient condition in particular when additional stress like osmotic stress interferes.

  10. Molecular Characterization of the First Bovine Herpesvirus 4 (BoHV-4 Strains Isolated from In Vitro Bovine Embryos production in Argentina.

    Directory of Open Access Journals (Sweden)

    Erika González Altamiranda

    Full Text Available Bovine herpesvirus 4 (BoHV-4 is increasingly considered as responsible for various problems of the reproductive tract. The virus infects mainly blood mononuclear cells and displays specific tropism for vascular endothelia, reproductive and fetal tissues. Epidemiological studies suggest its impact on reproductive performance, and its presence in various sites in the reproductive tract highlights its potential transmission in transfer-stage embryos. This work describes the biological and genetic characterization of BoHV-4 strains isolated from an in vitro bovine embryo production system. BoHV-4 strains were isolated in 2011 and 2013 from granulosa cells and bovine oocytes from ovary batches collected at a local abattoir, used as "starting material" for in vitro production of bovine embryos. Compatible BoHV-4-CPE was observed in the co-culture of granulosa cells and oocytes with MDBK cells. The identity of the isolates was confirmed by PCR assays targeting three ORFs of the viral genome. The phylogenetic analyses of the strains suggest that they were evolutionary unlinked. Therefore it is possible that BoHV-4 ovary infections occurred regularly along the evolution of the virus, at least in Argentina, which can have implications in the systems of in vitro embryo production. Thus, although BoHV-4 does not appear to be a frequent risk factor for in vitro embryo production, data are still limited. This study reveals the potential of BoHV-4 transmission via embryo transfer. Moreover, the high variability among the BoHV-4 strains isolated from aborted cows in Argentina highlights the importance of further research on the role of this virus as an agent with the potential to cause reproductive disease in cattle. The genetic characterization of the isolated strains provides data to better understand the pathogenesis of BoHV-4 infections. Furthermore, it will lead to fundamental insights into the molecular aspects of the virus and the means by which these

  11. Research of operational properties of compound based on high viscosity styrene-butadiene rubber SSBR-2560 TDAE HV

    Directory of Open Access Journals (Sweden)

    M. I. Falyakhov

    2016-01-01

    Full Text Available The article consider the influence of replacement of SSBR-2560 TDAE batch production on high viscosity SSBR-2560-TDAE HV in the tread recipe on the tire performance properties. Obtained samples were highly viscosity styrene butadiene rubber did not differ in the microstructure of the SSBR-2560 TDAE batch production. Increasing the molecular weight possible to increase the Mooney viscosity of the rubber, however, is known to one of adverse factors is the deterioration of processability of rubber compounds based on polymers. In this connection, investigated the behavior in the step mixing compound based on high viscosity SSBR rubber. We chose recipes tread of the tire with a high content of organic silicon filler. It is established that the equivalent replacement of the polymer in the tread recipe does not lead to significant changes in the basic parameters of rubber mixing. We observed a slight increase in the energy consumption for the preparation of the rubber compounds, as well as the discharge temperature at each stage. It was shown to improve the distribution of the filler in the polymer matrix for the compound based on SSBR-2560 TDAE HV. The results showed that compound based on high viscosity SSBR improves rolling resistance and traction characteristics, while maintaining abrasion in comparison with the SSBR-2560-M27 batch production. Recommended use this brand in the production of rubber car tires.

  12. Bovine herpes virus-1 (BoHV-1 detection in dairy cattle with reproductive problems in Sudan

    Directory of Open Access Journals (Sweden)

    Amira Mohamed Elhassan

    2015-06-01

    Full Text Available The present work aimed to observe the infection pattern of Bovine herpes virus-1 (BoHV-1 in dairy cattle with reproductive problems in Sudan. A total of 140 samples comprising of vaginal swab (n=97, placenta (n=15, whole blood (n=19, uterine fluid (n=1, and serum (n=8 were collected from 16 dairy herds showing particularly high rate of abortion and infertility in Khartoum State. The samples were used for virus isolation, and were tested by Enzyme-Linked Immunosorbent Assay (ELISA and polymerase chain reaction (PCR. No virus could be isolated from the samples inoculated for isolation in cell culture. Out of 80 specimens tested by ELISA, 7 (8.75% were found to be positive, and one sample was doubtful. Using PCR, 11 (10.7% out of 103 samples were found to be positive. When comparing between two methods for DNA extraction, the DNA extracted by commercial kit was found to be better in quality as compared to the DNA extracted using phenol/chloroform/isoamyl-alcohol method. The study confirmed the presence of BoHV-1 in cattle farms with reproductive problems in Sudan.

  13. HvPap-1 C1A Protease Participates Differentially in the Barley Response to a Pathogen and an Herbivore

    Directory of Open Access Journals (Sweden)

    Mercedes Diaz-Mendoza

    2017-09-01

    Full Text Available Co-evolutionary processes in plant–pathogen/herbivore systems indicate that protease inhibitors have a particular value in biotic interactions. However, little is known about the defensive role of their targets, the plant proteases. C1A cysteine proteases are the most abundant enzymes responsible for the proteolytic activity during different processes like germination, development and senescence in plants. To identify and characterize C1A cysteine proteases of barley with a potential role in defense, mRNA and protein expression patterns were analyzed in response to biotics stresses. A barley cysteine protease, HvPap-1, previously related to abiotic stresses and grain germination, was particularly induced by flagellin or chitosan elicitation, and biotic stresses such as the phytopathogenic fungus Magnaporthe oryzae or the phytophagous mite Tetranychus urticae. To elucidate the in vivo participation of this enzyme in defense, transformed barley plants overexpressing or silencing HvPap-1 encoding gene were subjected to M. oryzae infection or T. urticae infestation. Whereas overexpressing plants were less susceptible to the fungus than silencing plants, the opposite behavior occurred to the mite. This unexpected result highlights the complexity of the regulatory events leading to the response to a particular biotic stress.

  14. The barley MATE gene, HvAACT1, increases citrate efflux and Al3+ tolerance when expressed in wheat and barley

    Science.gov (United States)

    Zhou, Gaofeng; Delhaize, Emmanuel; Zhou, Meixue; Ryan, Peter R.

    2013-01-01

    Background and Aims Aluminium is toxic in acid soils because the soluble Al3+ inhibits root growth. A mechanism of Al3+ tolerance discovered in many plant species involves the release of organic anions from root apices. The Al3+-activated release of citrate from the root apices of Al3+-tolerant genotypes of barley is controlled by a MATE gene named HvAACT1 that encodes a citrate transport protein located on the plasma membrane. The aim of this study was to investigate whether expressing HvAACT1 with a constitutive promoter in barley and wheat can increase citrate efflux and Al3+ tolerance of these important cereal species. Methods HvAACT1 was over-expressed in wheat (Triticum aestivum) and barley (Hordeum vulgare) using the maize ubiquitin promoter. Root apices of transgenic and control lines were analysed for HvAACT1 expression and organic acid efflux. The Al3+ tolerance of transgenic and control lines was assessed in both hydroponic solution and acid soil. Key Results and Conclusions Increased HvAACT1 expression in both cereal species was associated with increased citrate efflux from root apices and enhanced Al3+ tolerance, thus demonstrating that biotechnology can complement traditional breeding practices to increase the Al3+ tolerance of important crop plants. PMID:23798600

  15. Development and characterization of a PHB-HV-based 3D scaffold for a tissue engineering and cell-therapy combinatorial approach for spinal cord injury regeneration.

    Science.gov (United States)

    Ribeiro-Samy, Silvina; Silva, Nuno A; Correlo, Vitor M; Fraga, Joana S; Pinto, Luísa; Teixeira-Castro, Andreia; Leite-Almeida, Hugo; Almeida, Armando; Gimble, Jeffrey M; Sousa, Nuno; Salgado, António J; Reis, Rui L

    2013-11-01

    Spinal cord injury (SCI) leads to devastating neurological deficits. Several tissue engineering (TE)-based approaches have been investigated for repairing this condition. Poly (3-hydroxybutyrate-co-3-hydroxyvalerate) (PHB-HV) is found to be particularly attractive for TE applications due to its properties, such as biodegradability, biocompatibility, thermoplasticity and piezoelectricity. Hence, this report addresses the development and characterization of PHB-HV-based 3D scaffolds, produced by freeze-drying, aimed to SCI treatment. The obtained scaffolds reveal an anisotropic morphology with a fully interconnected network of pores. In vitro studies demonstrate a lack of cytotoxic effect of PHB-HV scaffolds. Direct contact assays also reveal their ability to support the culture of CNS-derived cells and mesenchymal-like stem cells from different sources. Finally, histocompatibility studies show that PHB-HV scaffolds are well tolerated by the host tissue, and do not negatively impact the left hindlimb locomotor function recovery. Therefore results herein presented suggest that PHB-HV scaffolds may be suitable for SCI treatment. © 2013 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim.

  16. Study of solid chemical evolution in torrefaction of different biomasses through solid-state "1"3C cross-polarization/magic angle spinning NMR (nuclear magnetic resonance) and TGA (thermogravimetric analysis)

    International Nuclear Information System (INIS)

    Rodriguez Alonso, Elvira; Dupont, Capucine; Heux, Laurent; Da Silva Perez, Denilson; Commandre, Jean-Michel; Gourdon, Christophe

    2016-01-01

    The objective of this work is to compare mass loss and chemical evolution of the solid phase, versus time, during dynamic torrefaction of different types of biomass. For this purpose, two experiments, ThermoGravimetric Analysis and solid-state "1"3C Cross-Polarization/Magic Angle Spinning Nuclear Magnetic Resonance, were run on four representative biomasses. Overall mass loss and chemical evolution of the solid phase were followed, respectively, as a function of temperature and time. Thanks to this coupled information, it was shown that the knowledge of both solid mass loss and chemical evolution is necessary to characterize torrefaction severity. Moreover, biomasses containing higher proportions of xylan lost mass faster than those containing lower proportions. Lignin showed a protecting role towards cellulose, which would lead to a faster degradation of non-woody biomasses in comparison with woody biomasses. Three parameters would have an influence on solid chemical evolution during torrefaction: xylan content in hemicellulose, lignin content in biomass, and cellulose crystallinity. - Highlights: • Torrefaction of four biomasses was studied with TGA and solid-state NMR. • Both solid mass loss and chemical evolution characterize torrefaction severity. • Biomasses containing a higher proportion of xylan lose mass faster. • Lignin shows a stronger protecting role in degradation of woody biomasses. • Xylan, lignin and crystalline cellulose values influence solid chemical evolution.

  17. Phylogenetic Variation of Chelonid Alphaherpesvirus 5 (ChHV5) in Populations of Green Turtles Chelonia mydas along the Queensland Coast, Australia.

    Science.gov (United States)

    Ariel, E; Nainu, F; Jones, K; Juntunen, K; Bell, I; Gaston, J; Scott, J; Trocini, S; Burgess, G W

    2017-09-01

    Sea turtle fibropapillomatosis (FP) is a disease marked by the proliferation of benign but debilitating cutaneous and occasional visceral tumors, likely to be caused by chelonid alphaherpesvirus 5 (ChHV5). This study presents a phylogeny of ChHV5 strains found on the east coast of Queensland, Australia, and a validation for previously unused primers. Two different primer sets (gB-1534 and gB-813) were designed to target a region including part of the UL27 glycoprotein B (gB) gene and part of UL28 of ChHV5. Sequences obtained from FP tumors found on juvenile green turtles Chelonia mydas (Queensland, and Queensland clusters. The clusters reflect the collection sites on the east coast of Queensland with a definitive north-south trend. Received October 22, 2016; accepted May 7, 2017.

  18. Transcriptome Comparative Profiling of Barley eibi1 Mutant Reveals Pleiotropic Effects of HvABCG31 Gene on Cuticle Biogenesis and Stress Responsive Pathways

    Directory of Open Access Journals (Sweden)

    Eviatar Nevo

    2013-10-01

    Full Text Available Wild barley eibi1 mutant with HvABCG31 gene mutation has low capacity to retain leaf water, a phenotype associated with reduced cutin deposition and a thin cuticle. To better understand how such a mutant plant survives, we performed a genome-wide gene expression analysis. The leaf transcriptomes between the near-isogenic lines eibi1 and the wild type were compared using the 22-k Barley1 Affymetrix microarray. We found that the pleiotropic effect of the single gene HvABCG31 mutation was linked to the co-regulation of metabolic processes and stress-related system. The cuticle development involved cytochrome P450 family members and fatty acid metabolism pathways were significantly up-regulated by the HvABCG31 mutation, which might be anticipated to reduce the levels of cutin monomers or wax and display conspicuous cuticle defects. The candidate genes for responses to stress were induced by eibi1 mutant through activating the jasmonate pathway. The down-regulation of co-expressed enzyme genes responsible for DNA methylation and histone deacetylation also suggested that HvABCG31 mutation may affect the epigenetic regulation for barley development. Comparison of transcriptomic profiling of barley under biotic and abiotic stresses revealed that the functions of HvABCG31 gene to high-water loss rate might be different from other osmotic stresses of gene mutations in barley. The transcriptional profiling of the HvABCG31 mutation provided candidate genes for further investigation of the physiological and developmental changes caused by the mutant.

  19. Construction and validation of a homology model of the human voltage-gated proton channel hHV1.

    Science.gov (United States)

    Kulleperuma, Kethika; Smith, Susan M E; Morgan, Deri; Musset, Boris; Holyoake, John; Chakrabarti, Nilmadhab; Cherny, Vladimir V; DeCoursey, Thomas E; Pomès, Régis

    2013-04-01

    The topological similarity of voltage-gated proton channels (H(V)1s) to the voltage-sensing domain (VSD) of other voltage-gated ion channels raises the central question of whether H(V)1s have a similar structure. We present the construction and validation of a homology model of the human H(V)1 (hH(V)1). Multiple structural alignment was used to construct structural models of the open (proton-conducting) state of hH(V)1 by exploiting the homology of hH(V)1 with VSDs of K(+) and Na(+) channels of known three-dimensional structure. The comparative assessment of structural stability of the homology models and their VSD templates was performed using massively repeated molecular dynamics simulations in which the proteins were allowed to relax from their initial conformation in an explicit membrane mimetic. The analysis of structural deviations from the initial conformation based on up to 125 repeats of 100-ns simulations for each system reveals structural features consistently retained in the homology models and leads to a consensus structural model for hH(V)1 in which well-defined external and internal salt-bridge networks stabilize the open state. The structural and electrostatic properties of this open-state model are compatible with proton translocation and offer an explanation for the reversal of charge selectivity in neutral mutants of Asp(112). Furthermore, these structural properties are consistent with experimental accessibility data, providing a valuable basis for further structural and functional studies of hH(V)1. Each Arg residue in the S4 helix of hH(V)1 was replaced by His to test accessibility using Zn(2+) as a probe. The two outermost Arg residues in S4 were accessible to external solution, whereas the innermost one was accessible only to the internal solution. Both modeling and experimental data indicate that in the open state, Arg(211), the third Arg residue in the S4 helix in hH(V)1, remains accessible to the internal solution and is located near the

  20. Solar light (hv) and H2O2/hv photo-disinfection of natural alkaline water (pH 8.6) in a compound parabolic collector at different day periods in Sahelian region.

    Science.gov (United States)

    Ndounla, J; Pulgarin, C

    2015-11-01

    The photo-disinfection of natural alkaline surface water (pH 8.6 ± 0.3) for drinking purposes was carried out under solar radiation treatments. The enteric bacteria studied were the wild total coliforms/Escherichia coli (10(4) CFU/ml) and Salmonella spp. (10(4) CFU/ml) naturally present in the water. The photo-disinfection of a 25-l water sample was carried out in a solar compound parabolic collector (CPC) in the absence and in the presence of hydrogen peroxide (H2O2). The addition of H2O2 (10 mg/L) to the sample water was sufficient to enhance the photo-disinfection and ensure an irreversible lethal action on the wild enteric bacteria contents of the sample. The inactivation kinetic of the system was significantly enhanced compared to the one carried out without H2O2 addition. The effect of the solar radiation parameters on the efficiency of the photo-disinfection were assessed. The pH has increased during the treatment in all the photo-disinfection processes (hv and H2O2/hv). The Salmonella spp strain has shown the best effective inactivate time in alkaline water than the one recorded under acidic or near-neutral conditions. The evolution of some physico-chemical parameters of the water (turbidity, NO2(-), NO3(-), NH4(+), HPO4(2-), and bicarbonate (HCO3(-))) was monitored during the treatment. Finally, the possible mechanistic process involved during the enteric bacteria inactivation was suggested.

  1. Genetic parameters of resistance to Vibrio aestuarianus, and OsHV-1 infections in the Pacific oyster, Crassostrea gigas, at three different life stages.

    Science.gov (United States)

    Azéma, Patrick; Lamy, Jean-Baptiste; Boudry, Pierre; Renault, Tristan; Travers, Marie-Agnès; Dégremont, Lionel

    2017-02-15

    In France, two main diseases threaten Pacific oyster production. Since 2008, Crassostrea gigas spat have suffered massive losses due to the ostreid herpesvirus OsHV-1, and since 2012, significant mortalities in commercial-size adults have been related to infection by the bacterium Vibrio aestuarianus. The genetic basis for resistance to V. aestuarianus and OsHV-1 and the nature of the genetic correlation between these two traits were investigated by using 20 half-sib sire families, each containing two full-sib families. For each disease, controlled infectious challenges were conducted using naïve oysters that were 3 to 26 months old. In addition, siblings were tested under field, pond and raceway conditions to determine whether laboratory trials reflected mortality events that occur in the oyster industry. First, we estimated the genetic basis of resistance to V. aestuarianus in C. gigas. Susceptibility to the infection was low for oysters in spat stage but increased with later life stages. Second, we confirmed a strong genetic basis of resistance to OsHV-1 infection at early stages and demonstrated that it was also strong at later stages. Most families had increased resistance to OsHV-1 infection from the spat to adult stages, while others consistently showed low or high mortality rates related to OsHV-1 infection, regardless of the life stage. Our third main finding was the absence of genetic correlations between resistance to OsHV-1 infection and resistance to V. aestuarianus infection. Selective breeding to enhance resistance to OsHV-1 infection could be achieved through selective breeding at early stages and would not affect resistance to V. aestuarianus infection. However, our results suggest that the potential to select for improved resistance to V. aestuarianus is lower. Selection for dual resistance to OsHV-1 and V. aestuarianus infection in C. gigas might reduce the impact of these two major diseases by selecting families that have the highest

  2. Proposal for the award of a blanket order contract for the supply of microprocessor-based protection and control devices for the CERN HV distribution network

    CERN Document Server

    2004-01-01

    This document concerns the award of a blanket contract for the supply of microprocessor-based protection and control devices for the CERN HV distribution network. The Finance Committee is invited to agree to the negotiation of a blanket order contract with SCHNEIDER ELECTRIC (PT), the lowest technically acceptable bidder after realignment, for the supply of microprocessor-based protection and control devices for the CERN HV distribution network for a total amount of 1 900 000 euros (2 924 128 Swiss francs), subject to revision for inflation after 1 January 2007. The rate of exchange used is that stipulated in the tender

  3. Design and standalone characterisation of a capacitively coupled HV-CMOS sensor chip for the CLIC vertex detector

    Science.gov (United States)

    Kremastiotis, I.; Ballabriga, R.; Campbell, M.; Dannheim, D.; Fiergolski, A.; Hynds, D.; Kulis, S.; Peric, I.

    2017-09-01

    The concept of capacitive coupling between sensors and readout chips is under study for the vertex detector at the proposed high-energy CLIC electron positron collider. The CLICpix Capacitively Coupled Pixel Detector (C3PD) is an active High-Voltage CMOS sensor, designed to be capacitively coupled to the CLICpix2 readout chip. The chip is implemented in a commercial 180 nm HV-CMOS process and contains a matrix of 128×128 square pixels with 25μm pitch. First prototypes have been produced with a standard resistivity of ~20 Ωcm for the substrate and tested in standalone mode. The results show a rise time of ~20 ns, charge gain of 190 mV/ke- and ~40 e- RMS noise for a power consumption of 4.8μW/pixel. The main design aspects, as well as standalone measurement results, are presented.

  4. Autophagy plays an important role in protecting Pacific oysters from OsHV-1 and Vibrio aestuarianus infections.

    Science.gov (United States)

    Moreau, Pierrick; Moreau, Kevin; Segarra, Amélie; Tourbiez, Delphine; Travers, Marie-Agnès; Rubinsztein, David C; Renault, Tristan

    2015-01-01

    Recent mass mortality outbreaks around the world in Pacific oysters, Crassostrea gigas, have seriously affected the aquaculture economy. Although the causes for these mortality outbreaks appear complex, infectious agents are involved. Two pathogens are associated with mass mortality outbreaks, the virus ostreid herpesvirus 1 (OsHV-1) and the bacterium Vibrio aestuarianus. Here we describe the interactions between these 2 pathogens and autophagy, a conserved intracellular pathway playing a key role in innate immunity. We show for the first time that autophagy pathway is present and functional in Pacific oysters and plays an important role to protect animals from infections. This study contributes to better understand the innate immune system of Pacific oysters.

  5. Integration of V2H/V2G Hybrid System for Demand Response in Distribution Network

    Energy Technology Data Exchange (ETDEWEB)

    Wang, Yubo; Sheikh, Omar; Hu, Boyang; Chu, Chi-Cheng; Gadh, Rajit

    2014-11-03

    Integration of Electrical Vehicles (EVs) with power grid not only brings new challenges for load management, but also opportunities for distributed storage and generation in distribution network. With the introduction of Vehicle-to-Home (V2H) and Vehicle-to-Grid (V2G), EVs can help stabilize the operation of power grid. This paper proposed and implemented a hybrid V2H/V2G system with commercialized EVs, which is able to support both islanded AC/DC load and the power grid with one single platform. Standard industrial communication protocols are implemented for a seamless respond to remote Demand Respond (DR) signals. Simulation and implementation are carried out to validate the proposed design. Simulation and implementation results showed that the hybrid system is capable of support critical islanded DC/AC load and quickly respond to the remote DR signal for V2G within 1.5kW of power range.

  6. Installation of a TCT set-up for characterization of novel HV-CMOS planar silicon sensors

    CERN Document Server

    Marx, Lisa

    2013-01-01

    For future upgrades of the LHC it is necessary to develop new tracking detectors: more radiation hard and cost efficient pixel detectors with high spacial resolution are required for the planned high luminosity version of the LHC (HL-LHC). For future tracking devices HV-CMOS active pixel sensors are great candidates since they fulfill all the demands mentioned above. First prototypes of these sensors are assembled on custom test boards and together with FE-I4 readout chips they make up the first test pixel detectors. One approach for testing these chips is through using lasers to induce electron-hole-pairs into the depletion zone of the sensor chip diodes to simulate an ionizing particle crossing through the bulk. Comparison measurements of irradiated/non-irradiated sensors are used to explore the radiation hardness of the sensors.

  7. Haemocytes from Crassostrea gigas and OsHV-1: A promising in vitro system to study host/virus interactions.

    Science.gov (United States)

    Morga, Benjamin; Faury, Nicole; Guesdon, Stéphane; Chollet, Bruno; Renault, Tristan

    2017-11-01

    Since 2008, mass mortality outbreaks associated with the detection of particular variants of OsHV-1 have been reported in Crassostrea gigas spat and juveniles in several countries. Recent studies have reported information on viral replication during experimental infection. Viral DNA and RNA were also detected in the haemolymph and haemocytes suggesting that the virus could circulate through the circulatory system. However, it is unknown if the virus is free in the haemolymph, passively associated at the surface of haemocytes, or able to infect and replicate inside these cells inducing (or not) virion production. In the present study, we collected haemocytes from the haemolymphatic sinus of the adductor muscle of healthy C. gigas spat and exposed them in vitro to a viral suspension. Results showed that viral RNAs were detectable one hour after contact and the number of virus transcripts increased over time in association with an increase of viral DNA detection. These results suggested that the virus is able to initiate replication rapidly inside haemocytes maintained in vitro. These in vitro trials were also used to carry out a dual transcriptomic study. We analyzed concomitantly the expression of some host immune genes and 15 viral genes. Results showed an up regulation of oyster genes currently studied during OsHV-1 infection. Additionally, transmission electron microscopy examination was carried out and did not allow the detection of viral particles. Moreover, All the results suggested that the in vitro model using haemocytes can be valuable for providing new perspective on virus-oyster interactions. Copyright © 2017 Elsevier Inc. All rights reserved.

  8. Fibroblasts express OvHV-2 capsid protein in vasculitis lesions of American bison (Bison bison) with experimental sheep-associated malignant catarrhal fever

    Science.gov (United States)

    Sheep-associated malignant catarrhal fever (SA-MCF) caused by ovine herpesvirus-2 (OvHV-2), a '-herpesvirus, is an often fatal disease characterized by lymphoproliferation, vasculitis, and mucosal ulceration in American bison (Bison bison), cattle (Bos taurus), and other clinically susceptible speci...

  9. Ostreid herpesvirus OsHV-1 μVar in Pacific oysters Crassostrea gigas (Thunberg 1793) of the Wadden Sea, a UNESCO world heritage site.

    Science.gov (United States)

    Gittenberger, A; Voorbergen-Laarman, M A; Engelsma, M Y

    2016-01-01

    The Wadden Sea is an extensive wetland area, recognized as UNESCO world heritage site of international importance. Since the mid-1990s, the invasive Pacific oyster Crassostrea gigas (Thunberg 1793) population in the area has grown exponentially, having a distinct impact on the ecosystem. The recent spread of the emerging oyster pathogen Ostreid herpesvirus OsHV-1 μVar worldwide and specifically in the oyster culture areas in the south of the Netherlands raised the question whether the virus may also be present in the Wadden Sea. In the summer of 2012 juvenile Pacific oysters were collected from five locations in the Dutch Wadden Sea. The virus was shown to be present in three of the five locations by real-time PCR and sequencing. It was concluded that OsHV-1 μVar has settled itself in Pacific oyster reefs in the Wadden Sea. These results and the recent discoveries of OsHV-1 microvariants in Australia and Korea indicate that OsHV-1 μVar and related variants might be more widespread than can be deduced from current literature. In particular in regions with no commercial oyster culture, similar to the Wadden Sea, the virus may go undetected as wild beds with mixed age classes hamper the detection of mortality among juvenile oysters. © 2015 John Wiley & Sons Ltd.

  10. Genetic variations of HvP5CS1 and their association with drought tolerance related traits in barley (Hordeum vulgare L.)

    Science.gov (United States)

    Delta-1-pyrroline-5-carboxylate synthase gene1 (P5CS1) is the key gene involved in the biosynthesis of proline and is significantly induced by drought stress. The exploration of genetic variation in HvP5CS1 may facilitate a better understanding of the mechanism of drought adaptation in barley. In th...

  11. Targeted genomic enrichment and sequencing of CyHV-3 from carp tissues confirms low nucleotide diversity and mixed genotype infections

    Directory of Open Access Journals (Sweden)

    Saliha Hammoumi

    2016-09-01

    Full Text Available Koi herpesvirus disease (KHVD is an emerging disease that causes mass mortality in koi and common carp, Cyprinus carpio L. Its causative agent is Cyprinid herpesvirus 3 (CyHV-3, also known as koi herpesvirus (KHV. Although data on the pathogenesis of this deadly virus is relatively abundant in the literature, still little is known about its genomic diversity and about the molecular mechanisms that lead to such a high virulence. In this context, we developed a new strategy for sequencing full-length CyHV-3 genomes directly from infected fish tissues. Total genomic DNA extracted from carp gill tissue was specifically enriched with CyHV-3 sequences through hybridization to a set of nearly 2 million overlapping probes designed to cover the entire genome length, using KHV-J sequence (GenBank accession number AP008984 as reference. Applied to 7 CyHV-3 specimens from Poland and Indonesia, this targeted genomic enrichment enabled recovery of the full genomes with >99.9% reference coverage. The enrichment rate was directly correlated to the estimated number of viral copies contained in the DNA extracts used for library preparation, which varied between ∼5000 and ∼2×107. The average sequencing depth was >200 for all samples, thus allowing the search for variants with high confidence. Sequence analyses highlighted a significant proportion of intra-specimen sequence heterogeneity, suggesting the presence of mixed infections in all investigated fish. They also showed that inter-specimen genetic diversity at the genome scale was very low (>99.95% of sequence identity. By enabling full genome comparisons directly from infected fish tissues, this new method will be valuable to trace outbreaks rapidly and at a reasonable cost, and in turn to understand the transmission routes of CyHV-3.

  12. Seismic microzonation and velocity models of El Ejido area (SE Spain) from the diffuse-field H/V method

    Science.gov (United States)

    García-Jerez, Antonio; Seivane, Helena; Navarro, Manuel; Piña-Flores, José; Luzón, Francisco; Vidal, Francisco; Posadas, Antonio M.; Aranda, Carolina

    2016-04-01

    El Ejido town is located in the Campo de Dalías coastal plain (Almería province, SE Spain), emplaced in one of the most seismically active regions of Spain. The municipality has 84000 inhabitants and presented a high growth rate during the last twenty years. The most recent intense seismic activity occurred close to this town was in 1993 and 1994, with events of Mb = 4.9 and Mb = 5.0, respectively. To provide a basis for site-specific hazard analysis, we first carried out a seismic microzonation of this town in terms of predominant periods and geotechnical properties. The predominant periods map was obtained from ambient noise observations on a grid of 250 x 250 m in the main urban area, and sparser measurements on the outskirts. These broad-band records, of about 20 minutes long each, were analyzed by using the horizontal-to-vertical spectral ratio technique (H/V). Dispersion curves obtained from two array measurements of ambient noise and borehole data provided additional geophysical information. All the surveyed points in the town were found to have relatively long predominant periods ranging from 0.8 to 2.3 s and growing towards the SE. Secondary high-frequency (> 2Hz) peaks were found at about the 10% of the points only. On the other hand, Vs30 values of 550 - 650 m/s were estimated from the array records, corresponding to cemented sediments and medium-hard rocks. The local S-wave velocity structure has been inverted from the H/V curves for a subset of the measurement sites. We used an innovative full-wavefield method based on the diffuse-wavefield approximation (Sánchez-Sesma et al., 2011) combined with the simulated annealing algorithm. Shallow seismic velocities and deep boreholes data were used as constraints. The results show that the low-frequency resonances are related with the impedance contrast between several hundred meters of medium-hard sedimentary rocks (marls and calcarenites) with the stiffer basement of the basin, which dips to the SE. These

  13. Radiation-hard Active Pixel Sensors for HL-LHC Detector Upgrades based on HV-CMOS Technology

    CERN Document Server

    Miucci, A; Hemperek, T.; Hügging, F.; Krüger, H.; Obermann, T.; Wermes, N.; Garcia-Sciveres, M.; Backhaus, M.; Capeans, M.; Feigl, S.; Nessi, M.; Pernegger, H.; Ristic, B.; Gonzalez-Sevilla, S.; Ferrere, D.; Iacobucci, G.; Rosa, A.La; Muenstermann, D.; George, M.; Grosse-Knetter, J.; Quadt, A.; Rieger, J.; Weingarten, J.; Bates, R.; Blue, A.; Buttar, C.; Hynds, D.; Kreidl, C.; Peric, I.; Breugnon, P.; Pangaud, P.; Godiot-Basolo, S.; Fougeron, D.; Bompard, F.; Clemens, J.C.; Liu, J; Barbero, M.; Rozanov, A

    2014-01-01

    Luminosity upgrades are discussed for the LHC (HL-LHC) which would make updates to the detectors necessary, requiring in particular new, even more radiation-hard and granular, sensors for the inner detector region. 1Corresponding author. c CERN 2014, published under the terms of the Creative Commons Attribution 3.0 License by IOP Publishing Ltd and Sissa Medialab srl. Any further distribution of this work must maintain attribution to the author(s) and the published article’s title, journal citation and DOI. doi:10.1088/1748-0221/9/05/C050642014 JINST 9 C05064 A proposal for the next generation of inner detectors is based on HV-CMOS: a new family of silicon sensors based on commercial high-voltage CMOS technology, which enables the fabrication of part of the pixel electronics inside the silicon substrate itself. The main advantages of this technology with respect to the standard silicon sensor technology are: low material budget, fast charge collection time, high radiation tolerance, low cost and operation a...

  14. Scattering Mechanism Extraction by a Modified Cloude-Pottier Decomposition for Dual Polarization SAR

    Directory of Open Access Journals (Sweden)

    Kefeng Ji

    2015-06-01

    Full Text Available Dual polarization is a typical operational mode of polarimetric synthetic aperture radar (SAR. However, few studies have considered the scattering mechanism extraction of dual-polarization SARs. A modified Cloude-Pottier decomposition is proposed to investigate the performance of the scattering mechanism extraction of dual-polarization SARs. It is theoretically demonstrated that only HH-VV SAR can discriminate the three canonical scattering mechanisms from an isotropic surface, horizontal dipole, and isotropic dihedral. Various experiments are conducted using 21 scenes from real datasets acquired by AIRSAR, Convair-580 SAR, EMISAR, E-SAR, Pi-SAR, and RADARSAT-2. Division of the dual-polarization H-α plane is experimentally obtained. The lack of cross-polarization induces the diffusion of scattering mechanisms and their overlap in the HH-VV H-α plane. However, the performance of HH-VV SAR for extracting scattering mechanisms is acceptable. Thus, HH-VV SAR is a suitable alternative to full-polarization SAR in certain cases. Meanwhile, the extraction performance of the other two dual-polarization SARs is badly degraded due to the lack of co-polarization. Therefore, HH-HV and HV-VV SARs cannot effectively extract the scattering mechanisms in the H-α plane.

  15. Performance of capacitively coupled active pixel sensors in 180 nm HV-CMOS technology after irradiation to HL-LHC fluences

    International Nuclear Information System (INIS)

    Feigl, S

    2014-01-01

    In this ATLAS upgrade R and D project, we explore the concept of using a deep-submicron HV-CMOS process to produce a drop-in replacement for traditional radiation-hard silicon sensors. Such active sensors contain simple circuits, e.g. amplifiers and discriminators, but still require a traditional (pixel or strip) readout chip. This approach yields most advantages of MAPS (improved resolution, reduced cost and material budget, etc.), without the complication of full integration on a single chip. After outlining the basic design of the HV2FEI4 test ASIC, results after irradiation with X-rays to 862 Mrad and neutrons up to 10 16 (1 MeV n eq )/cm 2 will be presented. Finally, a brief outlook on further development plans is given

  16. The barley HvNAC6 transcription factor affects ABA accumulation and promotes basal resistance against powdery mildew

    DEFF Research Database (Denmark)

    Chen, Yan-Jun; Perera, Venura; Wagner, Michael

    2013-01-01

    Barley HvNAC6 is a member of the plant-specific NAC (NAM, ATAF1,2, CUC2) transcription factor family and we have shown previously that it acts as a positive regulator of basal resistance in barley against the biotrophic pathogen Blumeria graminis f. sp. hordei (Bgh). In this study, we use a trans...

  17. Site Characterization in the Urban Area of Tijuana, B. C., Mexico by Means of: H/V Spectral Ratios, Spectral Analysis of Surface Waves, and Random Decrement Method

    Science.gov (United States)

    Tapia-Herrera, R.; Huerta-Lopez, C. I.; Martinez-Cruzado, J. A.

    2009-05-01

    Results of site characterization for an experimental site in the metropolitan area of Tijuana, B. C., Mexico are presented as part of the on-going research in which time series of earthquakes, ambient noise, and induced vibrations were processed with three different methods: H/V spectral ratios, Spectral Analysis of Surface Waves (SASW), and the Random Decrement Method, (RDM). Forward modeling using the wave propagation stiffness matrix method (Roësset and Kausel, 1981) was used to compute the theoretical SH/P, SV/P spectral ratios, and the experimental H/V spectral ratios were computed following the conventional concepts of Fourier analysis. The modeling/comparison between the theoretical and experimental H/V spectral ratios was carried out. For the SASW method the theoretical dispersion curves were also computed and compared with the experimental one, and finally the theoretical free vibration decay curve was compared with the experimental one obtained with the RDM. All three methods were tested with ambient noise, induced vibrations, and earthquake signals. Both experimental spectral ratios obtained with ambient noise as well as earthquake signals agree quite well with the theoretical spectral ratios, particularly at the fundamental vibration frequency of the recording site. Differences between the fundamental vibration frequencies are evident for sites located at alluvial fill (~0.6 Hz) and at sites located at conglomerate/sandstones fill (0.75 Hz). Shear wave velocities for the soft soil layers of the 4-layer discrete soil model ranges as low as 100 m/s and up to 280 m/s. The results with the SASW provided information that allows to identify low velocity layers, not seen before with the traditional seismic methods. The damping estimations obtained with the RDM are within the expected values, and the dominant frequency of the system also obtained with the RDM correlates within the range of plus-minus 20 % with the one obtained by means of the H/V spectral

  18. Commissioning and operation of 130 kV/130 A switched-mode HV power supplies with the upgraded JET neutral beam injectors

    International Nuclear Information System (INIS)

    Edwards, D.C.; Bigi, M.; Brown, D.P.D.; Ganuza, D.; Garcia, F.; Hudson, Z.; Jones, T.T.C.; Perez, A.

    2005-01-01

    The design features, on-site testing, commissioning and operation are described of two new 130 kV/130 A HV power supply units serving four upgraded 130 kV/60 A positive ion neutral injectors (PINIs) on JET. Both units were factory tested at full power and pulse length into dummy resistive load. Following on-site installation, the factory tests were repeated. The transition from dummy-load testing to PINI operation required full integration of the HVPS within the overall JET control system, and rigorous testing of the co-ordinated actions and protections of all PINI power supplies (filament and arc for plasma source and negative suppression grid). The implementation of these functions is described. Extensive use was made of parasitic integrated test pulses, where the other PINIs could be operated normally, with the HVPS energised under full remote control together with the corresponding PINI plasma sources, but with the HVPS connected to dummy load. The amount of NB operation time dedicated to commissioning was thereby minimised, yet gave a high degree of confidence of readiness for HV energisation of the PINI, and first beam operation followed less than 24 h from HV connection to the PINI. The routine operating experience and performance, including load protection characteristics of the new HVPS units are also described

  19. Detection of Herpesvirus anguillae (AngHV-1) in European eel Anguilla anguilla (L.) originating from northern Poland-assessment of suitability of selected diagnostic methods.

    Science.gov (United States)

    Nguyen, Tuan Thuc; Jin, Yeonhwa; Kiełpińska, Jolanta; Bergmann, Sven M; Lenk, Matthias; Panicz, Remigiusz

    2017-11-01

    The Community Action Plan requests EU member states to implement measures that ensure the recovery of the severely depleted European eel stocks. One of the main threats is posed by Anguillid herpesvirus 1 (AngHV-1) leading to increased mortality in both wild and farmed eels. Following recommendations of the OIE to minimize the risk of obtaining false-negative results, the main aim of the study was to optimize diagnostic methods for AngHV-1 detection using conventional PCR, nested PCR and in situ hybridization assay. While 53.3% of the individual organ samples were tested positive for AngHV-1 by PCR, the additional virus analysis via nested PCR revealed that the actual prevalence was 93.3%. In the cell cultivation passages, a cytopathic effect was hardly found in the first two rounds. In the third passage onto cell cultures, a lytic CPE was detected. The identification and confirmation of the viruses obtained from cell cultures as well as directly from the organ tissues were proceeded by PCR, nested PCR and sequencing of the PCR products. While no positive signal was detectable in the first round by PCR using samples from the third cell culture passages, the nested PCR provided weak but visible positive signals. © 2017 John Wiley & Sons Ltd.

  20. Context-invariant quasi hidden variable (qHV) modelling of all joint von Neumann measurements for an arbitrary Hilbert space

    International Nuclear Information System (INIS)

    Loubenets, Elena R.

    2015-01-01

    We prove the existence for each Hilbert space of the two new quasi hidden variable (qHV) models, statistically noncontextual and context-invariant, reproducing all the von Neumann joint probabilities via non-negative values of real-valued measures and all the quantum product expectations—via the qHV (classical-like) average of the product of the corresponding random variables. In a context-invariant model, a quantum observable X can be represented by a variety of random variables satisfying the functional condition required in quantum foundations but each of these random variables equivalently models X under all joint von Neumann measurements, regardless of their contexts. The proved existence of this model negates the general opinion that, in terms of random variables, the Hilbert space description of all the joint von Neumann measurements for dimH≥3 can be reproduced only contextually. The existence of a statistically noncontextual qHV model, in particular, implies that every N-partite quantum state admits a local quasi hidden variable model introduced in Loubenets [J. Math. Phys. 53, 022201 (2012)]. The new results of the present paper point also to the generality of the quasi-classical probability model proposed in Loubenets [J. Phys. A: Math. Theor. 45, 185306 (2012)

  1. Regional planning and plan approval procedures for development and modification of HV grids; Raumordnungs- und Planfeststellungsverfahren fuer den Aus- und Umbau der Hochspannungsnetze

    Energy Technology Data Exchange (ETDEWEB)

    Hennig, Jan; Luehmann, Tobias [Sozietaet Gleiss Lutz, Berlin (Germany)

    2012-07-01

    If renewable energy sources are to be integrated, HV grids in Germany must be expanded and upgraded massively. Plans for new ultrahigh voltage lines find a legal basis in the grid expansion acceleration act (NABEG) of 2011 while most of the plans for 110 kV HV lines are still based on the conventional regional planning procedures with public participation followed by a plan approval procedure. With the decentralisation of power supply, these distribution grids are rapidly developing into power collecting grids, which makes high demands in terms of adaptation and upgrading. The contribution presents the legal boundary conditions and practical challenges accompanying the planning of HV lines outside the scope of the NABEG. It outlines the limited options for priorisation of test points in the regional planning and subsequent plan approval procedures and shows how friction between these may be reduced. Buried cables as an alternative to overhead cables are given particular attention as these have come into focus with the energy turnaround legislation of 2011.

  2. A cathepsin F-like peptidase involved in barley grain protein mobilization, HvPap-1, is modulated by its own propeptide and by cystatins

    Science.gov (United States)

    Diaz, Isabel

    2012-01-01

    Among the C1A cysteine proteases, the plant cathepsin F-like group has been poorly studied. This paper describes the molecular and functional characterization of the HvPap-1 cathepsin F-like protein from barley. This peptidase is N-glycosylated and has to be processed to become active by its own propeptide being an important modulator of the peptidase activity. The expression pattern of its mRNA and protein suggest that it is involved in different proteolytic processes in the barley plant. HvPap-1 peptidase has been purified in Escherichia coli and the recombinant protein is able to degrade different substrates, including barley grain proteins (hordeins, albumins, and globulins) stored in the barley endosperm. It has been localized in protein bodies and vesicles of the embryo and it is induced in aleurones by gibberellin treatment. These three features support the implication of HvPap-1 in storage protein mobilization during grain germination. In addition, a complex regulation exerted by the barley cystatins, which are cysteine protease inhibitors, and by its own propeptide, is also described PMID:22791822

  3. Difference of Horizontal-to-Vertical (H/V) Spectral Ratios of Microtremors and Earthquake Motions: Theory and Observation

    Science.gov (United States)

    Kawase, H.; Nagashima, F.; Matsushima, S.; Sanchez-Sesma, F. J.

    2013-05-01

    Horizontal-to-vertical spectral ratios (HVRs) of microtremors have been traditionally interpreted theoretically as representing the Rayleigh wave ellipticity or just utilized a convenient tool to extract predominant periods of ground. However, based on the diffuse field theory (Sánchez-Sesma et al., 2011) the microtremor H/V spectral ratios (MHVRs) correspond to the square root of the ratio of the imaginary part of horizontal displacement for a horizontally applied unit harmonic load and the imaginary part of vertical displacement for a vertically applied unit load. The same diffuse field concept leads us to derive a simple formula for earthquake HVRs (EHVRs), that is, the ratio of the horizontal motion on the surface for a vertical incidence of S wave divided by the vertical motion on the surface for a vertical incidence of P wave with a fixed coefficient (Kawase et al., 2011). The difference for EHVRs comes from the fact that primary contribution of earthquake motions would be of plane body waves. Traditionally EHVRs are interpreted as the responses of inclined SV wave incidence only for their S wave portions. Without these compact theoretical solutions, EHVRs and MHVRs are either considered to be very similar/equivalent, or totally different in the previous studies. With these theoretical solutions we need to re-focus our attention on the difference of HVRs. Thus we have compared here HVRs at several dozens of strong motion stations in Japan. When we compared observed HVRs we found that EHVRs tend to be higher in general than the MHVRs, especially around their peaks. As previously reported, their general shapes share the common features. Especially their fundamental peak and trough frequencies show quite a good match to each other. However, peaks in EHVRs in the higher frequency range would not show up in MHVRs. When we calculated theoretical HVRs separately at these target sites, their basic characteristics correspond to these observed differences. At this

  4. HvDep1 Is a Positive Regulator of Culm Elongation and Grain Size in Barley and Impacts Yield in an Environment-Dependent Manner.

    Directory of Open Access Journals (Sweden)

    Toni Wendt

    Full Text Available Heterotrimeric G proteins are intracellular membrane-attached signal transducers involved in various cellular processes in both plants and animals. They consist of three subunits denoted as α, β and γ. The γ-subunits of the so-called AGG3 type, which comprise a transmembrane domain, are exclusively found in plants. In model species, these proteins have been shown to participate in the control of plant height, branching and seed size and could therefore impact the harvestable yield of various crop plants. Whether AGG3-type γ-subunits influence yield in temperate cereals like barley and wheat remains unknown. Using a transgenic complementation approach, we show here that the Scottish malting barley cultivar (cv. Golden Promise carries a loss-of-function mutation in HvDep1, an AGG3-type subunit encoding gene that positively regulates culm elongation and seed size in barley. Somewhat intriguingly, agronomic field data collected over a 12-year period reveals that the HvDep1 loss-of-function mutation in cv. Golden Promise has the potential to confer either a significant increase or decrease in harvestable yield depending on the environment. Our results confirm the role of AGG3-type subunit-encoding genes in shaping plant architecture, but interestingly also indicate that the impact HvDep1 has on yield in barley is both genotypically and environmentally sensitive. This may explain why widespread exploitation of variation in AGG3-type subunit-encoding genes has not occurred in temperate cereals while in rice the DEP1 locus is widely exploited to improve harvestable yield.

  5. Characterization of various Si-photodiode junction combinations and layout specialities in 0.18µm CMOS and HV-CMOS technologies

    Science.gov (United States)

    Jonak-Auer, I.; Synooka, O.; Kraxner, A.; Roger, F.

    2017-12-01

    With the ongoing miniaturization of CMOS technologies the need for integrated optical sensors on smaller scale CMOS nodes arises. In this paper we report on the development and implementation of different optical sensor concepts in high performance 0.18µm CMOS and high voltage (HV) CMOS technologies on three different substrate materials. The integration process is such that complete modularity of the CMOS processes remains untouched and no additional masks or ion implantation steps are necessary for the sensor integration. The investigated processes support 1.8V and 3V standard CMOS functionality as well as HV transistors capable of operating voltages of 20V and 50V. These processes intrinsically offer a wide variety of junction combinations, which can be exploited for optical sensing purposes. The availability of junction depths from submicron to several microns enables the selection of spectral range from blue to infrared wavelengths. By appropriate layout the contributions of photo-generated carriers outside the target spectral range can be kept to a minimum. Furthermore by making use of other features intrinsically available in 0.18µm CMOS and HV-CMOS processes dark current rates of optoelectronic devices can be minimized. We present TCAD simulations as well as spectral responsivity, dark current and capacitance data measured for various photodiode layouts and the influence of different EPI and Bulk substrate materials thereon. We show examples of spectral responsivity of junction combinations optimized for peak sensitivity in the ranges of 400-500nm, 550-650nm and 700-900nm. Appropriate junction combination enables good spectral resolution for colour sensing applications even without any additional filter implementation. We also show that by appropriate use of shallow trenches dark current values of photodiodes can further be reduced.

  6. Evaluation of the mature grain phytase candidate HvPAPhy_a gene in barley (Hordeum vulgare L.) using CRISPR/Cas9 and TALENs.

    Science.gov (United States)

    Holme, Inger B; Wendt, Toni; Gil-Humanes, Javier; Deleuran, Lise C; Starker, Colby G; Voytas, Daniel F; Brinch-Pedersen, Henrik

    2017-09-01

    In the present study, we utilized TALEN- and CRISPR/Cas9-induced mutations to analyze the promoter of the barley phytase gene HvPAPhy_a. The purpose of the study was dual, validation of the PAPhy_a enzyme as the main contributor of the mature grain phytase activity (MGPA), as well as validating the importance of a specific promoter region of the PAPhy_a gene which contains three overlapping cis-acting regulatory elements (GCN4, Skn1 and the RY-element) known to be involved in gene expression during grain filling. The results confirm that the barley PAPhy_a enzyme is the main contributor to the MGPA as grains of knock-out lines show very low MGPA. Additionally, the analysis of the HvPAPhy_a promoter region containing the GCN4/Skn1/RY motif highlights its importance for HvPAPhy_a expression as the MGPA in grains of plant lines with mutations within this motif is significantly reduced. Interestingly, lines with deletions located downstream of the motif show even lower MGPA levels, indicating that the GCN4/SKn1/RY motif is not the only element responsible for the level of PAPhy_a expression during grain maturation. Mutant grains with very low MPGA showed delayed germination as compared to grains of wild type barley. As grains with high levels of preformed phytases would provide more readily available phosphorous needed for a fast germination, this indicates that faster germination may be implicated in the positive selection of the ancient PAPhy gene duplication that lead to the creation of the PAPhy_a gene.

  7. Population History of the Red Sea. Genetic Exchanges Between the Arabian Peninsula and East Africa Signaled in the Mitochondrial DNA HV1 Haplogroup

    Czech Academy of Sciences Publication Activity Database

    Musilová, E.; Fernandes, V.; Silva, N. M.; Soares, P.; Alshamali, F.; Harich, N.; Cherni, L.; El Gaaied, A. B. A.; Al-Meeri, A.; Pereira, L.; Černý, Viktor

    2011-01-01

    Roč. 145, č. 4 (2011), s. 592-598 ISSN 0002-9483 R&D Projects: GA MŠk ME 917 Institutional research plan: CEZ:AV0Z80020508 Keywords : mtDNA genomes * HV1 haplogroup * Arabian Peninsula * East Africa Subject RIV: AC - Archeology, Anthropology, Ethnology Impact factor: 2.824, year: 2011 http://onlinelibrary.wiley.com/doi/10.1002/ajpa.21522/abstract;jsessionid=06420E45513D054B63DFDE068F111692.d03t01

  8. Investigation of the attenuation properties of the HV board grid of electric-powered vehicles; Untersuchung der Daempfungseigenschaften des Hochvoltbordnetzes in Elektrofahrzeugen

    Energy Technology Data Exchange (ETDEWEB)

    Obholz, Martin; Baerenfaenger, Joerg [EMC Test NRW GmbH, Dortmund (Germany); Maarleveld, Marc; Hirsch, Holger [Duisburg Univ. (Germany). Lehrstuhl fuer Energietransport und -speicherung

    2012-11-01

    Power electronics components with transient switching processes cause AC components in the HV on-board supply system, with current and voltage harmonics with frequencies in the two-digit MHz range. Depending on their length and design, the HV lines can act as effective antenna structures. It is already common to shield HV lines for better EMP but the shield should be continued also in the connected casings. Material characteristics must be considered for weight and cost optimisation. For this reason, shield attenuation dimensions are calculated for exemplary casings for the frequency ranges that are relevant in electromobility. Afater this, the intrinsic sheild attenuation values of three different materials are measured in the frequency range of 10 - 100 MHz, and their relevance for applications in electormobility is assessed. The coaxial HV lines differ from other coaxial lines in their system characteristics; coupling attenuation and transfer impedance are important characteristics. To measure these characteristics, measuring tools must be adapted to the concrete applications. The methodology and the identified characteristics are discussed in detail. [German] Baugruppen der Leistungselektronik mit transienten Schaltvorgaengen verursachen Wechselspannungsanteile im Hochvoltbordnetz, die Strom- und Spannungsoberschwingungen mit Frequenzauspraegungen bis in den zweistelligen MHz-Bereich zeigen. Die Hochvoltleitungen koennen dann abhaengig von Laenge und Ausfuehrung als effektive Antennenstrukturen agieren. Zur Einhaltung der elektromagnetischen Vertraeglichkeit, werden bereits Schirmungen der Hochvoltleitungen eingesetzt. Jedoch muss fuer eine effektive elektromagnetische Entkopplung die Schirmung auch in den angeschlossenen Gehaeusen konsequent weitergefuehrt werden. Hierbei sind materialspezifische Anforderungen zu beachten, die Gewichts- und Kostenoptimierungen unterliegen. Daher wird fuer die in der Elektromobilitaet relevanten Frequenzbereiche eine

  9. Study of built-in amplifier performance on HV-CMOS sensor for the ATLAS phase-II strip tracker upgrade

    Energy Technology Data Exchange (ETDEWEB)

    Liang, Z., E-mail: zhijun.liang@cern.ch [University of California Santa Cruz, Santa Cruz Institute for Particle Physics (SCIPP) (United States); Institute of High Energy Physics, Beijing (China); Affolder, A. [University of Liverpool (United Kingdom); Arndt, K. [University of Oxford (United Kingdom); Bates, R. [SUPA – School of Physics and Astronomy, University of Glasgow, Glasgow (United Kingdom); Benoit, M.; Di Bello, F. [University of Geneva (Switzerland); Blue, A. [SUPA – School of Physics and Astronomy, University of Glasgow, Glasgow (United Kingdom); Bortoletto, D. [University of Oxford (United Kingdom); Buckland, M. [University of Liverpool (United Kingdom); CERN, European Center for Nuclear Research (Switzerland); Buttar, C. [SUPA – School of Physics and Astronomy, University of Glasgow, Glasgow (United Kingdom); Caragiulo, P. [SLAC National Accelerator Laboratory (United States); Das, D.; Dopke, J. [Rutherford Appleton Laboratory, Didcot (United Kingdom); Dragone, A. [SLAC National Accelerator Laboratory (United States); Ehrler, F. [Karlsruhe Institute of Technology (Germany); Fadeyev, V.; Galloway, Z.; Grabas, H. [University of California Santa Cruz, Santa Cruz Institute for Particle Physics (SCIPP) (United States); Gregor, I.M. [Deutsches Elektronen-Synchrotron (Germany); Grenier, P. [SLAC National Accelerator Laboratory (United States); and others

    2016-09-21

    This paper focuses on the performance of analog readout electronics (built-in amplifier) integrated on the high-voltage (HV) CMOS silicon sensor chip, as well as its radiation hardness. Since the total collected charge from minimum ionizing particle (MIP) for the CMOS sensor is 10 times lower than for a conventional planar sensor, it is crucial to integrate a low noise built-in amplifier on the sensor chip to improve the signal to noise ratio of the system. As part of the investigation for the ATLAS strip detector upgrade, a test chip that comprises several pixel arrays with different geometries, as well as standalone built-in amplifiers and built-in amplifiers in pixel arrays has been fabricated in a 0.35 μm high-voltage CMOS process. Measurements of the gain and the noise of both the standalone amplifiers and built-in amplifiers in pixel arrays were performed before and after gamma radiation of up to 60 Mrad. Of special interest is the variation of the noise as a function of the sensor capacitance. We optimized the configuration of the amplifier for a fast rise time to adapt to the LHC bunch crossing period of 25 ns, and measured the timing characteristics including jitter. Our results indicate an adequate amplifier performance for monolithic structures used in HV-CMOS technology. The results have been incorporated in the next submission of a large-structure chip.

  10. Efficacy of a gE-deleted, bovine herpesvirus 1 (BoHV-1 inactivated vaccine Eficácia de uma vacina inativada, gE-deletada, contra o herpesvírus bovino tipo 1 (BoHV-1

    Directory of Open Access Journals (Sweden)

    Alessandra D. Silva

    2009-07-01

    Full Text Available Bovine herpesvirus type 1 (BoHV-1 is recognized as a major cause of economic losses in cattle. Vaccination has been widely applied to minimize losses induced by BoHV-1 infections. We have previously reported the development of a differential BoHV-1 vaccine, based on a recombinant glycoprotein E (gE-deleted virus (265gE-. In present paper the efficacy of such recombinant was evaluated as an inactivated vaccine. Five BoHV-1 seronegative calves were vaccinated intramuscularly on day 0 and boostered 30 days later with an inactivated, oil adjuvanted vaccine containing an antigenic mass equivalent to 10(7.0 fifty per cent cell culture infectious doses (CCID50 of 265gE-. Three calves were kept as non vaccinated controls. On day 60 post vaccination both vaccinated and controls were challenged with the virulent parental strain. No clinical signs or adverse effects were seen after or during vaccination. After challenge, 2/5 vaccinated calves showed mild clinical signs of infection, whereas all non vaccinated controls displayed intense rhinotracheitis and shed virus for longer and to higher titres than vaccinated calves. Serological responses were detected in all vaccinated animals after the second dose of vaccine, but not on control calves. Following corticosteroid administration in attempting to induce reactivation of the latent infection, no clinical signs were observed in vaccinated calves, whereas non vaccinated controls showed clinical signs of respiratory disease. In view of its immunogenicity and protective effect upon challenge with a virulent BoHV-1, the oil adjuvanted preparation with the inactivated 265gE- recombinant was shown to be suitable for use as a vaccine.O Herpesvírus bovino tipo 1 (BoHV-1 é reconhecido como um importante agente de perdas econômicas em bovinos. Vacinação tem sido amplamente empregada para minimizar as perdas conseqüentes a infecções com o BoHV-1. Reportamos previamente o desenvolvimento de uma vacina

  11. Evaluation of local site effect in the western side of the Suez Canal area by applying H/V and MASW techniques

    Science.gov (United States)

    Mohamed, Emad K.; Shokry, M. M. F.; Hassoup, Awad; Helal, A. M. A.

    2016-11-01

    The soft sediments are one of the most important factors responsible for the amplification of the seismic ground motion in an area of study. Three components, single-station microtremor measurements were performed at 61 sites along the Suez Canal to estimate the fundamental frequencies of the soil and corresponding H/V amplitude ratios by using the horizontal-to-vertical spectral ratio (HVSR) method. We have applied the investigations of the shear wave velocity for supplementing the existing seismic microzonation of the Suez Canal. The multichannel analysis of surface wave (MASW) tests were done along the Suez Canal in the three cities, Suez, Ismailia, and Port Said using 24 channels digital engineering seismograph with 4.5 Hz geophones from September 2014 to January 2015 to get the shear wave velocity VS30. The SeisImager/SW software was used for analyzing the data, and 1D-shear wave velocity model have achieved for each site. The HVSR curves show that the fundamental frequency values are ranging from 0.57 to 1.08 Hz, and H/V amplitude ratios are ranging from 4.05 to 6.46. The average values of VS30 are (548, 301), (241, 319), (194, 110, 238) for Suez, Ismailia, and Port Said respectively. The average of shear wave velocity up to 30 m depth is estimated and used for site classification based on the National Earthquake Hazard Reduction Program (NEHRP) classification. The majority of the sites was classified as Class D (stiff soil) except one site at Port Said city is classified as Class E (soft soils), and another site in the Suez city is classified as Class C (hard rock).

  12. Modifications induced by swift heavy ions on poly(hydroxybutyrate-hydroxyvalerate) (PHB/HV) and poly(ε-caprolactone) (PCL). Part 2. Radicals characterization

    International Nuclear Information System (INIS)

    Rouxhet, L.; Mestdagh, M.; Legras, R.

    2000-01-01

    Modifications induced by different energetic heavy ions ( 40 Ar 9+ , 80 Kr 15+ , 129 Xe 24+ , 208 Pb 53+ and 208 Pb 56+ ) on poly(ε-caprolactone) (PCL) and poly(hydroxybutyrate-hydroxyvalerate) (PHB/HV) have been investigated by electron spin resonance (ESR). Indeed, film irradiation by heavy ions leads to, among other phenomena, the formation of radicals in the ion tracks. Thanks to ESR, it is possible to detect these radicals and to identify them or at least to characterize them by following the evolution of the radical signal as a function of parameters, like temperature, or the kinetic of disappearance of the radical species at ambient temperature in vacuum or ambient atmosphere. This study confirmed the generation of radicals by the irradiation of PHB/HV samples with energetic heavy ions reported in the literature. The study on PCL was not pursued after a few preliminary studies, revealing the presence of an ESR signal in the non-irradiated sample. Electronic stopping power has a major influence on radical decrease at ambient temperature. The ion used for the irradiation did not modify very much the radical signal and the evolution of the radicalar signal intensity with temperature. Different reasoning and experiments revealed that the glass transition temperature is a key temperature above which irreversible recombinations of the most stable radicals take place. A simulation study indicated that the most stable radical produced was probably a tertiary radical formed by the stabilization of the secondary radical resulting from the abstraction of a highly mobile hydrogen adjacent to the carbonyl

  13. Field evaluation of safety during gestation and horizontal spread of a recombinant differential bovine herpesvirus 1 (BoHV-1 vaccine Avaliação a campo da segurança para vacas prenhes e capacidade de disseminação horizontal de uma vacina diferencial recombinante contra o Herpes-vírus Bovino tipo 1 (BoHV-1

    Directory of Open Access Journals (Sweden)

    Fernando R. Spilki

    2005-03-01

    Full Text Available Bovine herpesvirus type 1 (BoHV-1 is recognized as a major cause of respiratory, reproductive disease and abortion in cattle. Vaccination is widely applied to minimize losses induced by BoHV-1 infections; however, vaccination of dams during pregnancy with modified live virus (MLV vaccines has been occasionally associated to abortions. We have previously reported the development of a BoHV-1 recombinant virus, constructed with basis on a Brazilian BoHV-1 (Franco et al. 2002a from which the gene coding for glycoprotein E (gE was deleted (gE- by genetic manipulation. Such recombinant has been previously evaluated in its potential as a differential vaccine (gE- vaccine that allows differentiation between vaccinated and infected animals. Here, in the first part of the present study, the safety of the gE- vaccine during pregnancy was evaluated by the intramuscular inoculation of 10(7.4 tissue culture 50 % infective doses (TCID50 of the virus into 22 pregnant dams (14 BoHV-1 seronegative; 8 seropositive, at different stages of gestation. Other 15 pregnant dams were kept as non-vaccinated controls. No abortions, stillbirths or fetal abnormalities were seen after vaccination. Seroconversion was observed in both groups of previously seronegative vaccinated animals. In the second part of the study, the potential of the gE- vaccine virus to spread among beef cattle under field conditions was examined. Four heifers were inoculated intranasally with a larger amount (10(7,6 TCID50 of the gE- vaccine (to increase chances of transmission and mixed with other sixteen animals at the same age and body condition, in the same grazing area, at a population density equal to the average cattle farming density within the region (one cattle head per 10,000 m², for 180 days. All animals were monitored daily for clinical signs. Serum samples were collected on days 0, 30, 60 and 180 post-vaccination. Seroconversion was observed only in vaccinated heifers. These results

  14. Case note: HvJ EU (rolnr. C-131/12: Google Spain and Google Inc. tegen Agencia Española de Protección de Datos (AEPD) and Costeja González)

    NARCIS (Netherlands)

    van Hoboken, J.V.J.

    2014-01-01

    De uitspraak betreft de verplichtingen van aanbieders van zoekmachines op het internet met betrekking tot de verwerking van persoonsgegevens in zoekresultaten. Het HvJ EU beoordeelt deze vraag in het licht van het recht aangaande bescherming van persoonsgegevens, waarbij de door het EU Handvest

  15. Unraveling regulation of the small heat shock proteins by the heat shock factor HvHsfB2c in barley: its implications in drought stress response and seed development.

    Science.gov (United States)

    Reddy, Palakolanu Sudhakar; Kavi Kishor, Polavarapu B; Seiler, Christiane; Kuhlmann, Markus; Eschen-Lippold, Lennart; Lee, Justin; Reddy, Malireddy K; Sreenivasulu, Nese

    2014-01-01

    The rapid increase in heat shock proteins upon exposure to damaging stresses and during plant development related to desiccation events reveal their dual importance in plant development and stress tolerance. Genome-wide sequence survey identified 20 non-redundant small heat shock proteins (sHsp) and 22 heat shock factor (Hsf) genes in barley. While all three major classes (A, B, C) of Hsfs are localized in nucleus, the 20 sHsp gene family members are localized in different cell organelles like cytoplasm, mitochondria, plastid and peroxisomes. Hsf and sHsp members are differentially regulated during drought and at different seed developmental stages suggesting the importance of chaperone role under drought as well as seed development. In silico cis-regulatory motif analysis of Hsf promoters showed an enrichment with abscisic acid responsive cis-elements (ABRE), implying regulatory role of ABA in mediating transcriptional response of HvsHsf genes. Gene regulatory network analysis identified HvHsfB2c as potential central regulator of the seed-specific expression of several HvsHsps including 17.5CI sHsp. These results indicate that HvHsfB2c is co-expressed in the central hub of small Hsps and therefore it may be regulating the expression of several HvsHsp subclasses HvHsp16.88-CI, HvHsp17.5-CI and HvHsp17.7-CI. The in vivo relevance of binding specificity of HvHsfB2C transcription factor to HSE-element present in the promoter of HvSHP17.5-CI under heat stress exposure is confirmed by gel shift and LUC-reporter assays. Further, we isolated 477 bp cDNA from barley encoding a 17.5 sHsp polypeptide, which was predominantly upregulated under drought stress treatments and also preferentially expressed in developing seeds. Recombinant HvsHsp17.5-CI protein was expressed in E. coli and purified to homogeneity, which displayed in vitro chaperone activity. The predicted structural model of HvsHsp-17.5-CI protein suggests that the α-crystallin domain is evolutionarily highly

  16. Unraveling regulation of the small heat shock proteins by the heat shock factor HvHsfB2c in barley: its implications in drought stress response and seed development.

    Directory of Open Access Journals (Sweden)

    Palakolanu Sudhakar Reddy

    Full Text Available The rapid increase in heat shock proteins upon exposure to damaging stresses and during plant development related to desiccation events reveal their dual importance in plant development and stress tolerance. Genome-wide sequence survey identified 20 non-redundant small heat shock proteins (sHsp and 22 heat shock factor (Hsf genes in barley. While all three major classes (A, B, C of Hsfs are localized in nucleus, the 20 sHsp gene family members are localized in different cell organelles like cytoplasm, mitochondria, plastid and peroxisomes. Hsf and sHsp members are differentially regulated during drought and at different seed developmental stages suggesting the importance of chaperone role under drought as well as seed development. In silico cis-regulatory motif analysis of Hsf promoters showed an enrichment with abscisic acid responsive cis-elements (ABRE, implying regulatory role of ABA in mediating transcriptional response of HvsHsf genes. Gene regulatory network analysis identified HvHsfB2c as potential central regulator of the seed-specific expression of several HvsHsps including 17.5CI sHsp. These results indicate that HvHsfB2c is co-expressed in the central hub of small Hsps and therefore it may be regulating the expression of several HvsHsp subclasses HvHsp16.88-CI, HvHsp17.5-CI and HvHsp17.7-CI. The in vivo relevance of binding specificity of HvHsfB2C transcription factor to HSE-element present in the promoter of HvSHP17.5-CI under heat stress exposure is confirmed by gel shift and LUC-reporter assays. Further, we isolated 477 bp cDNA from barley encoding a 17.5 sHsp polypeptide, which was predominantly upregulated under drought stress treatments and also preferentially expressed in developing seeds. Recombinant HvsHsp17.5-CI protein was expressed in E. coli and purified to homogeneity, which displayed in vitro chaperone activity. The predicted structural model of HvsHsp-17.5-CI protein suggests that the α-crystallin domain is

  17. Validation of an indirect ELISA to detect antibodies against BoHV-1 in bovine and guinea-pig serum samples using ISO/IEC 17025 standards.

    Science.gov (United States)

    Parreño, Viviana; Romera, S Alejandra; Makek, Lucia; Rodriguez, Daniela; Malacari, Darío; Maidana, Silvina; Compaired, Diego; Combessies, Gustavo; Vena, María Marta; Garaicoechea, Lorena; Wigdorovitz, Andrés; Marangunich, Laura; Fernandez, Fernando

    2010-10-01

    Two ELISAs to quantify antibodies to BoHV-1 in the sera of cattle and immunized guinea pigs were developed and validated using ISO/IEC 17025 standards. The cut-off value of the assay was established at 20% positivity of a high positive control for screening of cattle. Using this threshold, the assay properly classified the OIE bovine reference sera EU1, EU2 and EU3. For vaccine potency testing, a cut-off of 40% was selected for both species. The reliability of the assays, given by their diagnostic sensitivity and specificity, using the threshold of 40% was 89.7% and 100%, respectively, for bovines and 94.9% and 100% for guinea pigs, respectively. There was almost perfect agreement between the ELISA and virus neutralization results. In addition, after vaccination, there was a good correlation between the neutralizing and ELISA antibody titers of the serum from the same bovine or guinea pig, sampled at 60 and 30 days post-vaccination, respectively (R(bovine)=0.88, R(guinea pig)=0.92; p<0.0001). A similar correlation was observed when analyzing the mean antibody titers of groups of vaccinated animals (R(bovine)=0.95 and R(guinea pig)=0.97; p<0.0001), indicating the relevance of the ELISAs for batch to batch vaccine potency testing in the target species and in the laboratory animal model. The intermediate precision of the assays expressed as the relative coefficient of variation (CV) of the positive control assayed over a 3-year period in the same laboratory was 22.2% for bovines and 23.1% for guinea pigs. The reproducibility of both techniques obtained in inter-laboratory assays was CV=12.4% for bovines and CV approximately 0 for guinea pigs, which met the requirements of the OIE (CV<30%). The validated ELISAs represent important methods for vaccine potency testing and for controlling BoHV-1 infections. Copyright (c) 2010 Elsevier B.V. All rights reserved.

  18. Using H/V Spectral Ratio Analysis to Map Sediment Thickness and to Explain Macroseismic Intensity Variation of a Low-Magnitude Seismic Swarm in Central Belgium

    Science.gov (United States)

    Van Noten, K.; Lecocq, T.; Camelbeeck, T.

    2013-12-01

    Between 2008 and 2010, the Royal Observatory of Belgium received numerous ';Did You Feel It'-reports related to a 2-year lasting earthquake swarm at Court-Saint-Etienne, a small town in a hilly area 20 km SE of Brussels, Belgium. These small-magnitude events (-0.7 ≤ ML ≤ 3.2, n = c. 300 events) were recorded both by the permanent seismometer network in Belgium and by a locally installed temporary seismic network deployed in the epicentral area. Relocation of the hypocenters revealed that the seismic swarm can be related to the reactivation of a NW-SE strike-slip fault at 3 to 6 km depth in the basement rocks of the Lower Palaeozoic London-Brabant Massif. This sequence caused a lot of emotion in the region because more than 60 events were felt by the local population. Given the small magnitudes of the seismic swarm, most events were more often heard than felt by the respondents, which is indicative of a local high-frequency earthquake source. At places where the bedrock is at the surface or where it is covered by thin alluvial sediments ( 30 m). In those river valleys that have a considerable alluvial sedimentary cover, macroseismic intensities are again lower. To explain this variation in macroseismic intensity we present a macroseismic analysis of all DYFI-reports related to the 2008-2010 seismic swarm and a pervasive H/V spectral ratio (HVSR) analysis of ambient noise measurements to model the thickness of sediments covering the London-Brabant Massif. The HVSR method is a very powerful tool to map the basement morphology, particularly in regions of unknown subsurface structure. By calculating the soil's fundamental frequency above boreholes, we calibrated the power-law relationship between the fundamental frequency, shear wave velocity and the thickness of sediments. This relationship is useful for places where the sediment thickness is unknown and where the fundamental frequency can be calculated by H/V spectral ratio analysis of ambient noise. In a

  19. arXiv Charge collection properties in an irradiated pixel sensor built in a thick-film HV-SOI process

    CERN Document Server

    INSPIRE-00541780; Cindro, V.; Gorišek, A.; Hemperek, T.; Kishishita, T.; Kramberger, G.; Krüger, H.; Mandić, I.; Mikuž, M.; Wermes, N.; Zavrtanik, M.

    2017-10-25

    Investigation of HV-CMOS sensors for use as a tracking detector in the ATLAS experiment at the upgraded LHC (HL-LHC) has recently been an active field of research. A potential candidate for a pixel detector built in Silicon-On-Insulator (SOI) technology has already been characterized in terms of radiation hardness to TID (Total Ionizing Dose) and charge collection after a moderate neutron irradiation. In this article we present results of an extensive irradiation hardness study with neutrons up to a fluence of 1x10e16 neq/cm2. Charge collection in a passive pixelated structure was measured by Edge Transient Current Technique (E-TCT). The evolution of the effective space charge concentration was found to be compliant with the acceptor removal model, with the minimum of the space charge concentration being reached after 5x10e14 neq/cm2. An investigation of the in-pixel uniformity of the detector response revealed parasitic charge collection by the epitaxial silicon layer characteristic for the SOI design. The r...

  20. Nonlinear spectral cleaning effect in cross-polarized wave generation

    Science.gov (United States)

    Yu, Linpeng; Xu, Yi; Wu, Fenxiang; Yang, Xiaojun; Zhang, Zongxin; Wu, Yuanfeng; Leng, Yuxin; Xu, Zhizhan

    2018-05-01

    Not Available Project supported by the National Natural Science Foundation of China (Grant Nos. 11127901, 61521093, and 61505234), the International S&T Cooperation of Program of China (Grant No. 2016YFE0119300), the Strategic Priority Research Program of the Chinese Academy of Sciences (Grant No. XDB160301), and the Youth Innovation Promotion Association, Chinese Academy of Sciences.

  1. TILLING in the two-rowed barley cultivar 'Barke' reveals preferred sites of functional diversity in the gene HvHox1

    Directory of Open Access Journals (Sweden)

    Komatsuda Takao

    2009-12-01

    Full Text Available Abstract Background The economic importance of cereals such as barley, and the demand for improved yield and quality require a better understanding of the genetic components that modulate biologically and commercially relevant traits. While Arabidopsis thaliana is the premiere model plant system, the spectrum of its traits cannot address all of the fundamental questions of crop plant development. Unlike Arabidopsis, barley is both a crop and a model system for scientific research, and it is increasingly being used for genetic and molecular investigations into the conserved biological processes of cereals. A common challenge in genetic studies in plants with large genomes arises from the very time-consuming work of associating mutant phenotypes with gene sequence information, especially if insertion mutagenesis is not routine, as in barley. Reverse genetics based on chemical mutagenesis represents the best solution to this obstacle. Findings In barley, we generated a new TILLING (Targeting Local Lesions IN Genomes resource comprising 10,279 M2 mutants in the two-rowed malting cultivar 'Barke,' which has been used in the generation of other genomic resources in barley (~150,000 ESTs, DH mapping population. The value of this new resource was tested using selected candidate genes. An average frequency of approximately one mutation per 0.5 Mb was determined by screening ten fragments of six different genes. The ethyl methanesulphonate (EMSmutagenesis efficiency was studied by recording and relating the mutagenesis-dependent effects found in the three mutant generations (M1-M3. A detailed analysis was performed for the homeodomain-leucine-zipper (HD-ZIP gene HvHox1. Thirty-one mutations were identified by screening a 1,270-bp fragment in 7,348 M2 lines. Three of the newly identified mutants exhibited either a six-rowed or an intermedium-spike phenotype, and one mutant displayed a significantly altered spikelet morphology compared to that of the 'Barke

  2. Site classification for National Strong Motion Observation Network System (NSMONS) stations in China using an empirical H/V spectral ratio method

    Science.gov (United States)

    Ji, Kun; Ren, Yefei; Wen, Ruizhi

    2017-10-01

    Reliable site classification of the stations of the China National Strong Motion Observation Network System (NSMONS) has not yet been assigned because of lacking borehole data. This study used an empirical horizontal-to-vertical (H/V) spectral ratio (hereafter, HVSR) site classification method to overcome this problem. First, according to their borehole data, stations selected from KiK-net in Japan were individually assigned a site class (CL-I, CL-II, or CL-III), which is defined in the Chinese seismic code. Then, the mean HVSR curve for each site class was computed using strong motion recordings captured during the period 1996-2012. These curves were compared with those proposed by Zhao et al. (2006a) for four types of site classes (SC-I, SC-II, SC-III, and SC-IV) defined in the Japanese seismic code (JRA, 1980). It was found that an approximate range of the predominant period Tg could be identified by the predominant peak of the HVSR curve for the CL-I and SC-I sites, CL-II and SC-II sites, and CL-III and SC-III + SC-IV sites. Second, an empirical site classification method was proposed based on comprehensive consideration of peak period, amplitude, and shape of the HVSR curve. The selected stations from KiK-net were classified using the proposed method. The results showed that the success rates of the proposed method in identifying CL-I, CL-II, and CL-III sites were 63%, 64%, and 58% respectively. Finally, the HVSRs of 178 NSMONS stations were computed based on recordings from 2007 to 2015 and the sites classified using the proposed method. The mean HVSR curves were re-calculated for three site classes and compared with those from KiK-net data. It was found that both the peak period and the amplitude were similar for the mean HVSR curves derived from NSMONS classification results and KiK-net borehole data, implying the effectiveness of the proposed method in identifying different site classes. The classification results have good agreement with site classes

  3. Creation of a bovine herpes virus 1 (BoHV-1) quantitative particle standard by transmission electron microscopy and comparison with established standards for use in real-time PCR.

    Science.gov (United States)

    Hoferer, Marc; Braun, Anne; Sting, Reinhard

    2017-07-01

    Standards are pivotal for pathogen quantification by real-time PCR (qPCR); however, the creation of a complete and universally applicable virus particle standard is challenging. In the present study a procedure based on purification of bovine herpes virus type 1 (BoHV-1) and subsequent quantification by transmission electron microscopy (TEM) is described. Accompanying quantitative quality controls of the TEM preparation procedure using qPCR yielded recovery rates of more than 95% of the BoHV-1 virus particles on the grid used for virus counting, which was attributed to pre-treatment of the grid with 5% bovine albumin. To compare the value of the new virus particle standard for use in qPCR, virus counter based quantification and established pure DNA standards represented by a plasmid and an oligonucleotide were included. It could be shown that the numbers of virus particles, plasmid and oligonucleotide equivalents were within one log10 range determined on the basis of standard curves indicating that different approaches provide comparable quantitative values. However, only virus particles represent a complete, universally applicable quantitative virus standard that meets the high requirements of an RNA and DNA virus gold standard. In contrast, standards based on pure DNA have to be considered as sub-standard due to limited applications. Copyright © 2017 International Alliance for Biological Standardization. Published by Elsevier Ltd. All rights reserved.

  4. The β-Ketoacyl-CoA Synthase HvKCS1, Encoded by Cer-zh, Plays a Key Role in Synthesis of Barley Leaf Wax and Germination of Barley Powdery Mildew.

    Science.gov (United States)

    Li, Chao; Haslam, Tegan M; Krüger, Anna; Schneider, Lizette M; Mishina, Kohei; Samuels, Lacey; Yang, Hongxing; Kunst, Ljerka; Schaffrath, Ulrich; Nawrath, Christiane; Chen, Guoxiong; Komatsuda, Takao; von Wettstein-Knowles, Penny

    2018-04-01

    The cuticle coats the primary aerial surfaces of land plants. It consists of cutin and waxes, which provide protection against desiccation, pathogens and herbivores. Acyl cuticular waxes are synthesized via elongase complexes that extend fatty acyl precursors up to 38 carbons for downstream modification pathways. The leaves of 21 barley eceriferum (cer) mutants appear to have less or no epicuticular wax crystals, making these mutants excellent tools for identifying elongase and modification pathway biosynthetic genes. Positional cloning of the gene mutated in cer-zh identified an elongase component, β-ketoacyl-CoA synthase (CER-ZH/HvKCS1) that is one of 34 homologous KCSs encoded by the barley genome. The biochemical function of CER-ZH was deduced from wax and cutin analyses and by heterologous expression in yeast. Combined, these experiments revealed that CER-ZH/HvKCS1 has a substrate specificity for C16-C20, especially unsaturated, acyl chains, thus playing a major role in total acyl chain elongation for wax biosynthesis. The contribution of CER-ZH to water barrier properties of the cuticle and its influence on the germination of barley powdery mildew fungus were also assessed.

  5. Modifications induced by swift heavy ions in poly(hydroxybutyrate-hydroxyvalerate) (PHB/HV) and poly(ε-caprolactone) (PCL) films. Part 1. Thermal behaviour and molecular mass modifications

    International Nuclear Information System (INIS)

    Rouxhet, L.; Legras, R.

    2000-01-01

    Modifications induced by different energetic heavy ions in poly(ε-caprolactone) (PCL) and poly(hydroxybutyrate-hydroxyvalerate) (PHB/HV) have been investigated by the differential scanning calorimetry (DSC) and steric exclusion chromatography (SEC). A certain dose of damages, depending mainly on the charge and mass of the ion and on the intensity of irradiation, has to be overcome in order to detect any effect on PHB/HV. Actually, at a given intensity of irradiation, superior to 10 10 ions/cm 2 , the level of damage intensity increased with the increase in charge and mass of the ion. Moreover, according to the SEC results, there seems to be a critical mass and/or charge threshold above which the dominant type of damages changes. As a matter of fact, high-density irradiation with Ar 9+ and Kr 15+ resulted mainly in chain scission whereas cross-linking was dominant when irradiating the polymer with Xe 24+ and Pb 56+ . The irradiation of PCL in the conditions studied did not modify significantly the values of the melting point, the crystallisation temperature and the molecular masses of the system studied. The main effect of the irradiation detected by the DSC is the cross-linking of the polymer chains

  6. A Reverse-Genetics Mutational Analysis of the Barley HvDWARF Gene Results in Identification of a Series of Alleles and Mutants with Short Stature of Various Degree and Disturbance in BR Biosynthesis Allowing a New Insight into the Process.

    Science.gov (United States)

    Gruszka, Damian; Gorniak, Malgorzata; Glodowska, Ewelina; Wierus, Ewa; Oklestkova, Jana; Janeczko, Anna; Maluszynski, Miroslaw; Szarejko, Iwona

    2016-04-22

    Brassinosteroids (BRs) are plant steroid hormones, regulating a broad range of physiological processes. The largest amount of data related with BR biosynthesis has been gathered in Arabidopsis thaliana, however understanding of this process is far less elucidated in monocot crops. Up to now, only four barley genes implicated in BR biosynthesis have been identified. Two of them, HvDWARF and HvBRD, encode BR-6-oxidases catalyzing biosynthesis of castasterone, but their relation is not yet understood. In the present study, the identification of the HvDWARF genomic sequence, its mutational and functional analysis and characterization of new mutants are reported. Various types of mutations located in different positions within functional domains were identified and characterized. Analysis of their impact on phenotype of the mutants was performed. The identified homozygous mutants show reduced height of various degree and disrupted skotomorphogenesis. Mutational analysis of the HvDWARF gene with the "reverse genetics" approach allowed for its detailed functional analysis at the level of protein functional domains. The HvDWARF gene function and mutants' phenotypes were also validated by measurement of endogenous BR concentration. These results allowed a new insight into the BR biosynthesis in barley.

  7. Verification and Improvement of the Three-Dimensional Basin Velocity Structure Model in the Osaka Sedimentary Basin, Japan Using Interstation Green's Functions and H/V Spectral Ratios of Microtremors

    Science.gov (United States)

    Asano, K.; Iwata, T.; Sekiguchi, H.; Somei, K.; Nishimura, T.; Miyakoshi, K.; Aoi, S.; Kunugi, T.

    2012-12-01

    as low as 350 m/s in 0.2-0.5 Hz. The second observation is a set of short-time (30~60 min) single-station microtremor observations to obtain H/V spectral ratios at sites. We observed microtremor at 100 strong motion stations of Osaka prefecture government, JMA, K-NET, KiK-net, and other institutes. The peak period of H/V ranges from about 1 to 7 s, and it depends on the bedrock depth at the observation site as previously pointed by Miyakoshi et al. (1997). Though the basin velocity model explains the characteristics of observed H/V spectral ratios at most sites, we found discrepancies between observed and predicted H/V peak periods at north part of Osaka bay area and hill area in southeastern part of the basin. By combining the observed constraints from the group velocities, waveform characteristics of interstation Green's functions, and H/V spectral ratios, we will improve the S-wave velocity structure model inside the Osaka basin.

  8. A novel method for observation by unaided eyes of nitrogen ion tracks and angular distribution in a plasma focus device using 50 Hz–HV electrochemically-etched polycarbonate detectors

    International Nuclear Information System (INIS)

    Sohrabi, M.; Habibi, M.; Roshani, G.H.; Ramezani, V.

    2012-01-01

    A novel ion detection method has been developed and studied in this paper for the first time to detect and observe tracks of nitrogen ions and their angular distribution by unaided eyes in the Amirkabir 4 kJ plasma focus device (PFD). The method is based on electrochemical etching (ECE) of nitrogen ion tracks in 1 mm thick large area polycarbonate (PC) detectors. The ECE method employed a specially designed and constructed large area ECE chamber by applying a 50 Hz–high voltage (HV) generator under optimized ECE conditions. The nitrogen ion tracks and angular distribution were efficiently (constructed for this study) amplified to a point observable by the unaided eyes. The beam profile and angular distribution of nitrogen ion tracks in the central axes of the beam and two- and three-dimensional iso-ion track density distributions showing micro-beam spots were determined. The distribution of ion track density along the central axes versus angular position shows double humps around a dip at the 0° angular positions. The method introduced in this paper proved to be quite efficient for ion beam profile and characteristic studies in PFDs with potential for ion detection studies and other relevant dosimetry applications.

  9. AIRSAR Automated Web-based Data Processing and Distribution System

    Science.gov (United States)

    Chu, Anhua; vanZyl, Jakob; Kim, Yunjin; Lou, Yunling; Imel, David; Tung, Wayne; Chapman, Bruce; Durden, Stephen

    2005-01-01

    In this paper, we present an integrated, end-to-end synthetic aperture radar (SAR) processing system that accepts data processing requests, submits processing jobs, performs quality analysis, delivers and archives processed data. This fully automated SAR processing system utilizes database and internet/intranet web technologies to allow external users to browse and submit data processing requests and receive processed data. It is a cost-effective way to manage a robust SAR processing and archival system. The integration of these functions has reduced operator errors and increased processor throughput dramatically.

  10. DATEP: 120 channel PM HV regulator

    International Nuclear Information System (INIS)

    Centro, S.; Giorgi, M. de

    1981-01-01

    DATEP (Distributore Alta Tensione Programmabile) has been designed to distribute high voltage to some 1500 PM's for the gamma detectors (part C) of EHS. Each unit has its own microprocessor controller which performs continuous checking of the 120 channels and allows operator interaction. Channel regulators are based on a specially developed thick film hybrid circuit that allows to get on overall temperature coefficient better than 50 ppm/ 0 C. (orig.)

  11. Zrozeni z hvězd

    Czech Academy of Sciences Publication Activity Database

    Borovička, Jan

    2014-01-01

    Roč. 27, [2.8.2014] (2014), s. 21-21 ISSN 0862-5921 Institutional support: RVO:67985831 Keywords : chemistry * geochemistry * cosmochemistry * chemical elements * Sun * universe * Earth Subject RIV: DD - Geochemistry

  12. 新媒体在科技期刊广告经营中的运用——以《暖通空调》为例%Application of new media in the advertising operation of sci-tech journals: taking Journal of HV & AC as a case

    Institute of Scientific and Technical Information of China (English)

    姜燕梅; 郭晓芳; 王曙明; 刘承军; 陈鑫

    2012-01-01

    Based on the advertising operation experience of Journal of HV & AC, this paper presents in detail the application of new media such as mobile phone messages, websites, microblogs and so on in the advertising operation of sci-tech journals.%以《暖通空调》为例,结合广告经营实践经验,介绍手机短信、网站、微博等新媒体形式在科技期刊广告经营中的运用。

  13. Atividade antiviral e virucida de extratos hidroalcoólicos de própolis marrom, verde e de abelhas Jataí (Tetragonisca angustula frente ao herpersvírus bovino tipo 1 (BoHV-1 e ao vírus da diarreia viral bovina (BVDV

    Directory of Open Access Journals (Sweden)

    Cristina Mendes Peter

    Full Text Available RESUMO: Dentre as propriedades biológicas da própolis, a atividade antimicrobiana tem merecido destacada atenção. No presente trabalho, descreve-se a ação antiviral e virucida de três extratos hidroalcoólicos de própolis (marrom, verde e de abelhas jataí (Tetragonisca angustula, frente ao Herpesvírus Bovino tipo (BoHV-1 e ao Vírus da Diarreia Viral Bovina (BVDV. Os três extratos hidroalcoólicos foram obtidos de extração etanólica e são oriundos do sul do Brasil. A composição química dos extratos de própolis foi determinada pela cromatografia líquida de alta eficiência acoplada a espectrômetro de massas (UFLC-PDA-ESI-TOF/MS que identificou e quantificou compostos como: ácido cafeico e ácido p-cumárico, ácido clorogênico, ácido ferúlico, além de flavonoides como a rutina. A toxicidade celular bem como a atividade antiviral dos extratos de própolis em monocamadas de células MDBK (Madin-Darby Bovine Kidney foi avaliada através de observação microscópica e quantificada pelo teste de MTT (3-(4,5 dimetiltiazol-2yl-2-5-difenil-2H tetrazolato de bromo. O extrato de própolis de abelhas jataí demonstrou ser menos citotóxico (1,57μg/mL, quando comparado aos extratos verde (0,78μg/mL e marrom (0,39μg/mL. Quanto a atividade antiviral, a própolis verde demostrou maior eficácia em ambos os tratamentos celulares (pós e pré-exposição frente ao BoHV-1 em relação aos outros extratos, ou seja, houve maior viabilidade celular quando comparada aos controles de células e vírus. Já a de jataí apresentou atividade frente aos dois vírus (BoHV-1 e BVDV no método pré-infecção, enquanto a própolis marrom demonstrou ação apenas frente ao BoHV-1 também no método pré-infecção. Para determinação da atividade virucida foram utilizadas diferentes diluições dos vírus, bem como temperaturas e tempos distintos de incubação. A própolis verde a 37°C propiciou a maior redução no título viral (4,33log em

  14. CROSS-POLARIZED ANGULAR EMISSION PATTERNS FROM LENS-COUPLED TERAHERTZ ANTENNAS. (R827122)

    Science.gov (United States)

    The perspectives, information and conclusions conveyed in research project abstracts, progress reports, final reports, journal abstracts and journal publications convey the viewpoints of the principal investigator and may not represent the views and policies of ORD and EPA. Concl...

  15. Evaluation of Dental Shade Guide Variability Using Cross-Polarized Photography.

    Science.gov (United States)

    Gurrea, Jon; Gurrea, Marta; Bruguera, August; Sampaio, Camila S; Janal, Malvin; Bonfante, Estevam; Coelho, Paulo G; Hirata, Ronaldo

    2016-01-01

    This study evaluated color variability in the A hue between the VITA Classical (VITA Zahnfabrik) shade guide and four other VITA-coded ceramic shade guides using a Canon EOS 60D camera and software (Photoshop CC, Adobe). A total of 125 photographs were taken, 5 per shade tab for each of 5 shades (A1 to A4) from the following shade guides: VITA Classical (control), IPS e.max Ceram (Ivoclar Vivadent), IPS d.SIGN (Ivoclar Vivadent), Initial ZI (GC), and Creation CC (Creation Willi Geller). Photos were processed with Adobe Photoshop CC to allow standardized evaluation of hue, chroma, and value between shade tabs. None of the VITA-coded shade tabs fully matched the VITA Classical shade tab for hue, chroma, or value. The VITA-coded shade guides evaluated herein showed an overall unmatched shade in all tabs when compared with the control, suggesting that shade selection should be made using the guide produced by the manufacturer of the ceramic intended for the final restoration.

  16. GPS Low Cross-polarization Antenna Array for Orbit Determination beyond Geostationary Earth Orbits

    Data.gov (United States)

    National Aeronautics and Space Administration — This work will expand on the recent successes of Navigator on MMS, opening new and unforeseen possibilities for the use of GPS for very high-altitude applications up...

  17. Identification of Dynamic Cover Types in Wetlands by using Multitemporal Cross-polarized Sentinel-1 Images

    DEFF Research Database (Denmark)

    Muro, Javier; Canty, Morton; Conradsen, Knut

    , and the Lagoon of Fuente de Piedra, a small wetland in Southern Spain. For that we use a multitemporal change detection procedure for polarimetric SAR imagery based on the Complex Wishart distribution developed recently by Conradsen et al (2015), (to be published) and an innovative open source software...

  18. Electric axle. HV components and system; Elektrische Achse. HV-Komponenten und System

    Energy Technology Data Exchange (ETDEWEB)

    Schermann, Markus [Magna Powertrain, Oberwaltersdorf (Austria). Elektrische Antriebssysteme

    2013-03-15

    Magna Powertrain introduces the system of an electric rear axle drive. The system consists of an electric machine integrated into the gearbox and an appropriate inverter. The system is used to apply power to the rear axle while a conventional combustion engine drives the front axle. This kind of parallel hybrid approach is called ''through-the-road-hybrid'' because the total power of both combustion engine and electric motor is applied through the road at different axles. With this approach, the all-wheel drive functionality is covered as well.

  19. HvWRKY10, HvWRKY19, and HvWRKY28 positively regulate Mla-triggered immunity and basal defense to barley powdery mildew

    Science.gov (United States)

    WRKY proteins represent a large family of transcription factors (TFs), involved in plant development and defense responses. So far, fifty-five unique barley TFs have been annotated that contain the WRKY domain; twenty-six of these are present on the Barley1 GeneChip. We analyzed time-course expres...

  20. Integration of HV components. Requirements on the next generation of HV components; Integration von Hochvoltkomponenten. Anforderungen an die naechste Generation von HV-Komponenten

    Energy Technology Data Exchange (ETDEWEB)

    Hauck, Uwe; Ginsberg, Thomas; Brand, Robert [Tyco Electronics AMP GmbH, Bensheim/Berlin (Germany)

    2010-07-01

    The distribution of electrical power plays a significant role in alternative drive systems. Driven by higher voltage and current values, a new generation of automotive connector and power distribution technologies have evolved with new safety requirements such as touch protection, interlock circuitry, and shielding. Connectors have to be compliant with these new safety requirements as well as fulfill the general mechanical, environmental and ergonomic design requirements (such as packaging, mating/ unmating force, sealing, etc.). Fuse and relay boxes with high voltage/current classification not only switch and distribute electrical power, but they also protect components from overvoltage. Depending upon the application, such boxes may include a current sensor and have some digital signal processing capability to achieve this protection. Since relatively moderate volumes and flat ramp up curves can be expected for the next years, standardization and cross-ORM applicability of components and subsystems are the keys to success in this market. (orig.)

  1. Quality assurance for CMS Tracker LV and HV Power Supplies

    CERN Document Server

    Costa, Marco; Sertoli, M; Trapani, P; Periale, L; Isabella, L; Landi, C; Lucchesi, A

    2007-01-01

    This work describes the quality assurance measurements that have been carried out on about 2000 Power Supply Units produced in CAEN technology for the CMS Silicon Tracker Detector. The automate procedure and the characteristics of the dedicated Test Fixture developed for this activity are described in details. Magnetic field tolerance and radiation hardness of Tracker power supply units is also discussed at length.

  2. Hv 1 Proton Channels in Dinoflagellates: Not Just for Bioluminescence?

    Science.gov (United States)

    Kigundu, Gabriel; Cooper, Jennifer L; Smith, Susan M E

    2018-04-26

    Bioluminescence in dinoflagellates is controlled by H V 1 proton channels. Database searches of dinoflagellate transcriptomes and genomes yielded hits with sequence features diagnostic of all confirmed H V 1, and show that H V 1 is widely distributed in the dinoflagellate phylogeny including the basal species Oxyrrhis marina. Multiple sequence alignments followed by phylogenetic analysis revealed three major subfamilies of H V 1 that do not correlate with presence of theca, autotrophy, geographic location, or bioluminescence. These data suggest that most dinoflagellates express a H V 1 which has a function separate from bioluminescence. Sequence evidence also suggests that dinoflagellates can contain more than one H V 1 gene. This article is protected by copyright. All rights reserved. This article is protected by copyright. All rights reserved.

  3. Improved characteristics of HV pulse modulators for technological accelerators

    International Nuclear Information System (INIS)

    Dolgov, A.; Kildisheva, O.

    2004-01-01

    The new modulator series intended to provide a pulse power supply of MI-451, MI-456 microwave magnetrons is described. The main feature of this modulator series, as compared with the existing national counterparts, is the storage charging power supply. The offered modulators with improved charging power supplies have the substantially better efficiency and high operation stability and reliability

  4. Double Layered Sheath in Accurate HV XLPE Cable Modeling

    DEFF Research Database (Denmark)

    Gudmundsdottir, Unnur Stella; Silva, J. De; Bak, Claus Leth

    2010-01-01

    This paper discusses modelling of high voltage AC underground cables. For long cables, when crossbonding points are present, not only the coaxial mode of propagation is excited during transient phenomena, but also the intersheath mode. This causes inaccurate simulation results for high frequency...

  5. EHV/HV Underground Cable Systems for Power Transmission

    DEFF Research Database (Denmark)

    Bak, Claus Leth

    of the transmission system must be re‐thought in order to accommodate the transmission needs for the future. New lines have to be constructed. Transmission lines are usually laid out as overhead lines, which are large structures, i.e. a 400 kV power pylon is 50 meters high. According to public opinion, such power...

  6. BOREAS RSS-16 Level-3b DC-8 AIRSAR SY Images

    Data.gov (United States)

    National Aeronautics and Space Administration — ABSTRACT: Satellite and aircraft SAR data used in conjunction with various ground measurements to determine the moisture regime of the boreal forest. The NASA JPL...

  7. BOREAS RSS-16 Level-3b DC-8 AIRSAR CM Images

    Data.gov (United States)

    National Aeronautics and Space Administration — ABSTRACT: Satellite and aircraft SAR data used in conjunction with various ground measurements to determine the moisture regime of the boreal forest. The NASA JPL...

  8. Tunable 13C/1H dual channel matching circuit for dynamic nuclear polarization system with cross-polarization

    DEFF Research Database (Denmark)

    Rybalko, Oleksandr; Bowen, Sean; Zhurbenko, Vitaliy

    2016-01-01

    In this paper we report initial results of design and practical implementation of tuning and matching circuit to estimate a performance of Dynamic Nuclear Polarization (DNP) at a magnetic field of 6.7 T. It is shown that developed circuit for signal observation is compact, easy to make and provides....... Measurement results with a tuning and matching circuit prototype are presented including obtained spectra (13C and 1H) and estimation of the signal-to-noise ratio....

  9. Understanding the Balance of Dayside and Nightside Reconnection Contributions to the Cross Polar Cap Potential During Solar Wind Disturbances

    Science.gov (United States)

    2014-05-15

    3.1 Event 1: 10 January 1998 The first event occurred during the recovery phase of a geomagnetic storm on January 10, 1997. The top four panels of...Mapping ionospheric substorm response, Adv. Space Res., 20, No 4/5, pp. 895-905. Lockwood, M. (1991), On flow reversal boundaries and transpolar voltage...2001), Geomagnetic Storm Simulation With a Coupled Magnetosphere-Ionosphere-Thermosphere Model, in: Space Weather: Progress and Challenges in

  10. Development of Efficient and Robust Heteronuclear Cross-Polarization Techniques for Biological Solid-State Nuclear Magnetic Resonance Spectroscopy

    DEFF Research Database (Denmark)

    Jain, Sheetal Kumar

    2014-01-01

    →13C and 1H→14N polarization transfers. The deuterium experiments were performed on deuterated glutamine and outer membrane protein G samples, while the nitrogen experiments were carried out on ammonium nitrate and alanine samples. Moreover, experiments with low power on the 2H channel are presented......→13C polarization transfer to facilitate 2-dimensional experiments detecting 14N in the indirect dimension are shown. Finally, to test the polarization transfer efficiency with very large chemical shift anisotropies, 19F→13C polarization transfer experiments for Poly Tetra Fluoro Ethylene (PTFE...

  11. A wideband (3 to 5 GHz) wide-scan connected array of dipoles with low cross polarization

    NARCIS (Netherlands)

    Cavallo, D.; Neto, A.; Gerini, G.

    2012-01-01

    A wideband, wide-scan prototype phased array of connected dipoles has been manufactured and tested from 3 to 5 GHz. The array comprises 7 × 7 elements, each fed by a loop-shaped transformer to avoid common-mode resonances. Such resonances typically affect this type of arrays, with consequent

  12. Standardisation of HV systems. A power electronics perspective; Standardisierung von HV-Bordnetzen aus Sicht der Leistungselektronik

    Energy Technology Data Exchange (ETDEWEB)

    Doncker, Rik W. de; Kowal, Maurice; Biskoping, Matthias [RWTH Aachen (DE). Inst. fuer Stromrichtertechnik und Elektrische Antriebe (ISEA)

    2012-04-15

    With regard to the first generations of plug-in hybrid and electric vehicles, the following opinion has triggered controversy: components and systems must not be standardised too early. Some contend that this would suppress a necessary climate of competition and creativity. others maintain that this would intensify cost pressures and delay a market breakthrough; they propose how costs could be reduced by means of standards and alternatives. Moreover, the often criticised safety issues can be improved. Some proposals following this direction stem from, among others, the Institute for Power Electronics and Electrical Drives (ISEA) at RWTH Aachen University. (orig.)

  13. Episodes of cross-polar transport in the Arctic troposphere during July 2008 as seen from models, satellite, and aircraft observations

    Directory of Open Access Journals (Sweden)

    H. Sodemann

    2011-04-01

    Full Text Available During the POLARCAT summer campaign in 2008, two episodes (2–5 July and 7–10 July 2008 occurred where low-pressure systems traveled from Siberia across the Arctic Ocean towards the North Pole. The two cyclones had extensive smoke plumes from Siberian forest fires and anthropogenic sources in East Asia embedded in their associated air masses, creating an excellent opportunity to use satellite and aircraft observations to validate the performance of atmospheric transport models in the Arctic, which is a challenging model domain due to numerical and other complications.

    Here we compare transport simulations of carbon monoxide (CO from the Lagrangian transport model FLEXPART and the Eulerian chemical transport model TOMCAT with retrievals of total column CO from the IASI passive infrared sensor onboard the MetOp-A satellite. The main aspect of the comparison is how realistic horizontal and vertical structures are represented in the model simulations. Analysis of CALIPSO lidar curtains and in situ aircraft measurements provide further independent reference points to assess how reliable the model simulations are and what the main limitations are.

    The horizontal structure of mid-latitude pollution plumes agrees well between the IASI total column CO and the model simulations. However, finer-scale structures are too quickly diffused in the Eulerian model. Applying the IASI averaging kernels to the model data is essential for a meaningful comparison. Using aircraft data as a reference suggests that the satellite data are biased high, while TOMCAT is biased low. FLEXPART fits the aircraft data rather well, but due to added background concentrations the simulation is not independent from observations. The multi-data, multi-model approach allows separating the influences of meteorological fields, model realisation, and grid type on the plume structure. In addition to the very good agreement between simulated and observed total column CO fields, the results also highlight the difficulty to identify a data set that most realistically represents the actual pollution state of the Arctic atmosphere.

  14. Optimising the measurement of bruises in children across conventional and cross polarized images using segmentation analysis techniques in Image J, Photoshop and circle diameter measurements.

    Science.gov (United States)

    Harris, C; Alcock, A; Trefan, L; Nuttall, D; Evans, S T; Maguire, S; Kemp, A M

    2018-02-01

    Bruising is a common abusive injury in children, and it is standard practice to image and measure them, yet there is no current standard for measuring bruise size consistently. We aim to identify the optimal method of measuring photographic images of bruises, including computerised measurement techniques. 24 children aged Photoshop 'ruler' software (Photoshop diameter)). Inter and intra-observer effects were determined by two individuals repeating 11 electronic measurements, and relevant Intraclass Correlation Coefficient's (ICC's) were used to establish reliability. Spearman's rank correlation was used to compare in vivo with computerised measurements; a comparison of measurement techniques across imaging modalities was conducted using Kolmogorov-Smirnov tests. Significance was set at p 0.5 for all techniques, with maximum Feret diameter and maximum Photoshop diameter on conventional images having the strongest correlation with in vivo measurements. There were significant differences between in vivo and computer-aided measurements, but none between different computer-aided measurement techniques. Overall, computer aided measurements appeared larger than in vivo. Inter- and intra-observer agreement was high for all maximum diameter measurements (ICC's > 0.7). Whilst there are minimal differences between measurements of images obtained, the most consistent results were obtained when conventional images, segmented by Image J Software, were measured with a Feret diameter. This is therefore proposed as a standard for future research, and forensic practice, with the proviso that all computer aided measurements appear larger than in vivo. Copyright © 2018 Elsevier Ltd and Faculty of Forensic and Legal Medicine. All rights reserved.

  15. Frequency dependence of polarization phase difference

    International Nuclear Information System (INIS)

    Rao, K.S.; Rao, Y.S.; Wang, J.R.

    1993-09-01

    Polarimetric AIRSAR data of July 13, 1990 acquired over Mahatango watershed area was processed for the identification of corn fields an forested areas. Polarization Phase Difference (PPD) values were computed for the corn fields at P-, L- and C- bands and studied as a function of frequency. The results compare well with the model calculations at 24 deg. incidence angle where as the locations of corn fields were computed to be at 35 deg. incidence angle. The discrepancy is attributed to lack of accurate ground truth and the undulating topography of the corn fields. Another study reported here deals with the usefulness of Polarization Index (PI) for the study of vegetation. PI was found to be dependent on frequency for corn fields where as for forest trees no such dependence was noticed. PI HH,HV is more useful parameter compared to PI HH,VV even for the study of corn fields. (author). 19 refs, 7 figs

  16. Mapping biomass for a northern forest ecosystem using multi-frequency SAR data

    Science.gov (United States)

    Ranson, K. J.; Sun, Guoqing

    1992-01-01

    Image processing methods for mapping standing biomass for a forest in Maine, using NASA/JPL airborne synthetic aperture radar (AIRSAR) polarimeter data, are presented. By examining the dependence of backscattering on standing biomass, it is determined that the ratio of HV backscattering from a longer wavelength (P- or L-band) to a shorter wavelength (C) is a good combination for mapping total biomass. This ratio enhances the correlation of the image signature to the standing biomass and compensates for a major part of the variations in backscattering attributed to radar incidence angle. The image processing methods used include image calibration, ratioing, filtering, and segmentation. The image segmentation algorithm uses both means and variances of the image, and it is combined with the image filtering process. Preliminary assessment of the resultant biomass maps suggests that this is a promising method.

  17. H.V. support structure of 3MVDC generator and its protection from HV discharges in vacuum and SF6 gas for DC electron accelerator

    International Nuclear Information System (INIS)

    Sharma, D.K.; Rajan, R.N.; Srivastava, S.K.; Dewangan, S.; Jayaprakash, D.; Bakhtsingh, R.I.; Acharya, S.; Gantayet, L.M.

    2014-01-01

    Accelerator and Pulse Power Division of BARC has developed a DC electron accelerator for cross linking of polymers, medical sterilisation, preservation of food. The demonstration of stack-gas cleanup for green power generation has been demonstrated successfully. The support structure of the 3MVDC voltage generator is made of Perspex for high dielectric strength, easy availability of raw material, excellent radiation resistance and long term dimensional stability. This paper describes the salient design features of the High voltage support structure in brief. (author)

  18. H.V. support structure of 3MVDC generator and its protection from HV discharges in vacuum and SF6 gas for DC electron accelerator

    Energy Technology Data Exchange (ETDEWEB)

    Sharma, D.K.; Rajan, R.N.; Srivastava, S.K.; Dewangan, S.; Jayaprakash, D.; Bakhtsingh, R.I.; Acharya, S.; Gantayet, L.M., E-mail: dksharma@barc.gov.in [Accelerator and Pulse Power Division, Bhabha Atomic Research Centre, Mumbai (India)

    2014-07-01

    Accelerator and Pulse Power Division of BARC has developed a DC electron accelerator for cross linking of polymers, medical sterilisation, preservation of food. The demonstration of stack-gas cleanup for green power generation has been demonstrated successfully. The support structure of the 3MVDC voltage generator is made of Perspex for high dielectric strength, easy availability of raw material, excellent radiation resistance and long term dimensional stability. This paper describes the salient design features of the High voltage support structure in brief. (author)

  19. Time domain analysis of the lightning current distribution at the HV tower with GSM system

    NARCIS (Netherlands)

    Grcev, L.; Deursen, van A.P.J.; Waes, van J.B.M.

    2003-01-01

    GSM base stations are often placed in the poles of power transmission lines. Such base stations are usually powered from the low-voltage network through an isolating transformer to separate the high- and low-voltage networks. The isolating transformer serves to ensure security at other customers'

  20. HV Test of the CTS Edgeless Silicon Detector in Vacuum and Close to a Grounded Plate

    CERN Document Server

    Eremin, Vladimir; Ruggiero, Gennaro

    2007-01-01

    The TOTEM Roman Pot Silicon sensors will be operated in vacuum to minimise the mechanical stress of the thin metal window which separates the detector package from the ultra high vacuum of the beam. To approach the beam axis as close as possible the detectors will be mounted with their edge at a distance of the order 100 - 200 um from the thin metal window. As the detectors will be run in overdepletion mode to allow the full charge collection within the shaping time of the readout electronics, there will be a potential drop of more than 100 V across their edge. Moreover this potential drop might need to be further increased with the accumulated radiation dose. The main goals of the tests described in this note are: - Characterisation of the voltage-current characteristics when the detector edge is in the direct vicinity of a grounded metal plate which simulates the above mentioned vacuum window; - Demonstration of the detector operation in vacuum at different pressures.

  1. Poselství Galileova dalekohledu. Medicejské hvězdy

    Czech Academy of Sciences Publication Activity Database

    Hadravová, Alena; Hadrava, Petr

    2009-01-01

    Roč. 88, č. 1 (2009), s. 16-17 ISSN 0042-4544 Institutional research plan: CEZ:AV0Z80630520; CEZ:AV0Z10030501 Keywords : history of astronomy * Galileo Galilei * first telescopic observations Subject RIV: AB - History

  2. Hvězdářství krále Jana

    Science.gov (United States)

    Černá, Alena M.; Hadrava, Petr; Hadravová, Alena; Stluka, Martin

    The critical edition of the collection "King John's Astronomy" is based on the Old Czech manuscript written at the beginning of the 15th century which is preserved at the Library of the National Museum in Prague (ms. II F 14). The collection consists of several separate parts - first of all it contains astronomical and astrological treatises refering to Ptolemy's works. Explanations on the impact of the seven planets and twelve zodiacal signs on the fate of man, who was born under their influence, prevail in the texts. The texts which are connected with Hippocrates and Galenos' doctrines about humoral physiology and humoral pathology are another subject. They are supplemented by a treatise on blood-letting and by pharmaceutical instructions on different weight units. Another treatise deals with God, God's acts and with human fate. The manuscript also contains calendar tools for the calculation of Easter and other feasts during the year. The origin of this Old Czech text coincides with the period of the development of national languages as languages of science. Vocabulary contained in the manuscript is rich. It yields evidence about the formation of terminological systems in various fields involved in the collection. The Old Czech language of this literary monument exhibits unexpectedly archaic features. The present edition is a result of interdisciplinary collaboration of researchers from the fields of diachronic Bohemistics, classical philology, and astronomy. The publication is completed with the critical apparatus, indices, vocabulary, by a list of the chosen literature and other related supplements.

  3. Simple DCM or CRM analog peak current controller for HV capacitor charge-discharge applications

    DEFF Research Database (Denmark)

    Trintis, Ionut; Dimopoulos, Emmanouil; Munk-Nielsen, Stig

    2013-01-01

    This paper presents a simple analog current controller suitable for buck and boost converter topologies. The controller operates in DCM or CRM, depending on the setup. The experimental results are presented to validate the proposed controller functionality for a high voltage capacitor charge...

  4. Voltage and pH sensing by the voltage-gated proton channel, HV1.

    Science.gov (United States)

    DeCoursey, Thomas E

    2018-04-01

    Voltage-gated proton channels are unique ion channels, membrane proteins that allow protons but no other ions to cross cell membranes. They are found in diverse species, from unicellular marine life to humans. In all cells, their function requires that they open and conduct current only under certain conditions, typically when the electrochemical gradient for protons is outwards. Consequently, these proteins behave like rectifiers, conducting protons out of cells. Their activity has electrical consequences and also changes the pH on both sides of the membrane. Here we summarize what is known about the way these proteins sense the membrane potential and the pH inside and outside the cell. Currently, it is hypothesized that membrane potential is sensed by permanently charged arginines (with very high p K a ) within the protein, which results in parts of the protein moving to produce a conduction pathway. The mechanism of pH sensing appears to involve titratable side chains of particular amino acids. For this purpose their p K a needs to be within the operational pH range. We propose a 'counter-charge' model for pH sensing in which electrostatic interactions within the protein are selectively disrupted by protonation of internally or externally accessible groups. © 2018 The Author.

  5. HV discharge acceleration by sequences of UV laser filaments with visible and near-infrared pulses

    Science.gov (United States)

    Schubert, Elise; Rastegari, Ali; Feng, Chengyong; Mongin, Denis; Kamer, Brian; Kasparian, Jérôme; Wolf, Jean-Pierre; Arissian, Ladan; Diels, Jean-Claude

    2017-12-01

    We investigate the triggering and guiding of DC high-voltage discharges over a distance of 37 cm by filaments produced by ultraviolet (266 nm) laser pulses of 200 ps duration. The latter reduce the breakdown electric field by half and allow up to 80% discharge probability in an electric field of 920 kV m–1. This high efficiency is not further increased by adding nanosecond pulses in the Joule range at 532 and at 1064 nm. However, the latter statistically increases the guiding length, thereby accelerating the discharge by a factor of 2. This effect is due both to photodetachment and to the heating of the plasma channel, that increases the efficiency of avalanche ionization and reduces electron attachment and recombination.

  6. Initial commissioning of the HV electrostatic generator for the Vivitron project

    International Nuclear Information System (INIS)

    Helleboid, J.M.

    1993-01-01

    Soon after the complete assembly of the Vivitron as an electrostatic generator at the end of October 1990, initial commissioning began. Voltage tests were carried out at 7 bar SF 6 from December 1990 to March 1991. An intermediate level of 17.6 MV was reached but with high parasitic currents from the rollers in the dead sections and with flashovers along the column and related damage to the insulating plates. A high level of humidity, which was diagnosed at a later stage, was the cause of those difficulties. In addition, major problems connected with the gas handling system stopped the tests for the rest of the year and up to the end of March 1992 when the generator was made ready for tests after carrying out repairs and cleaning which were completed by the end of January and then implementing some improvements and reassembly. A very encouraging level of 18.9 MV at 4 bar half pressure was reached in April, but this has not been reproduced since then due to various problems and damage from sparking. (orig.)

  7. Initial commissioning of the H.V. electrostatic generator for the Vivitron project

    International Nuclear Information System (INIS)

    Helleboid, J.M.

    1992-06-01

    Early after complete assembly of the Vivitron as an electrostatic generator by the end of October 1990, the initial commissioning began. Voltage tests were done at 7 bars of SF6 from December 1990 to March 1991. An intermediate level of 17.6 MV was reached but with high parasitic currents from the rollers in the dead sections and with flashovers along the column and related damage to the insulating plates. A high level of humidity which has been put in sight later, was the cause of those difficulties. In addition, major problems connected with the gas handling system stopped the tests from the rest of the year up to the end of March 1992 when the generator was made ready for tests after achieving repair and cleaning by the end of January and then implementing some improvements and reassembly. A very encouraging level of 18.9 MV at 4 bars half pressure was reached in April but could not be reproduced up to now due to various problems and damage from sparking

  8. Classification of PD sources in HV cables using neural networks and the LN-FDTD method

    Energy Technology Data Exchange (ETDEWEB)

    Barros, W.H.; Oliveira, R.M.; Sobrinho, C.L.; Leite, R.C. [Univ. Federal do Para, Para (Brazil). Dept. of Computational and Electrical Engineering

    2008-07-01

    Partial discharges can be generated by the presence of several defects, and are often the cause of failures in electrical equipment insulators. In this study, a local non-orthogonal finite difference time-domain method (LN-FDTD) was used to simulate the sources of partial discharges in a high voltage coaxial cable model. The artificial neural network (ANN) technique used a Marquandt-Levenberg training algorithm to detect and classify cable PD sources. A set of harmonics obtained from the difference between the registered signals in the time domain was used as part of the training procedure. A failure was inserted on an electrical cable in each simulation in order to obtain the correlated data. Input signals were injected using a voltage pulse represented by a Gaussian function. A total of 90 simulations were conducted to generate 360 data groups in order to consider 6 different types of failures. Results of the study showed that the method can be used to detect and classify partial discharges in cables. 12 refs., 21 figs.

  9. Relation between film character and wafer alignment: critical alignment issues on HV device for VLSI manufacturing

    Science.gov (United States)

    Lo, Yi-Chuan; Lee, Chih-Hsiung; Lin, Hsun-Peng; Peng, Chiou-Shian

    1998-06-01

    Several continuous splits for wafer alignment target topography conditions to improve epitaxy film alignment were applied. The alignment evaluation among former layer pad oxide thickness (250 angstrom - 500 angstrom), drive oxide thickness (6000 angstrom - 10000 angstrom), nitride film thickness (600 angstrom - 1500 angstrom), initial oxide etch (fully wet etch, fully dry etch and dry plus wet etch) will be split to this experiment. Also various epitaxy deposition recipe such as: epitaxy source (SiHCl2 or SiCHCl3) and growth rate (1.3 micrometer/min approximately 2.0 micrometer/min) will be used to optimize the process window for alignment issue. All the reflectance signal and cross section photography of alignment target during NIKON stepper alignment process will be examined. Experimental results show epitaxy recipe plays an important role to wafer alignment. Low growth rate with good performance conformity epitaxy lead to alignment target avoid washout, pattern shift and distortion. All the results (signal monitor and film character) combined with NIKON's stepper standard laser scanning alignment system will be discussed in this paper.

  10. Alternative Solder Bond Packaging Approach for High-Voltage (HV) Pulsed Power Devices

    Science.gov (United States)

    2016-09-01

    triggered into the ON-state with a fiber - optic transmitter once the capacitor has been charged up to the desired voltage of choice with a power supply...substrate, which results in a much higher conductivity compared to highly doped p-type substrates in SiC (Fig. 1). The anode layer was etched using...reactive ion etch and then the mesa of the device was etched for total isolation. The gate contact implant was followed using nitrogen in a box

  11. Unsupervised Learning Through Randomized Algorithms for High-Volume High-Velocity Data (ULTRA-HV).

    Energy Technology Data Exchange (ETDEWEB)

    Pinar, Ali [Sandia National Lab. (SNL-NM), Albuquerque, NM (United States); Kolda, Tamara G. [Sandia National Lab. (SNL-NM), Albuquerque, NM (United States); Carlberg, Kevin Thomas [Wake Forest Univ., Winston-Salem, MA (United States); Ballard, Grey [Sandia National Lab. (SNL-NM), Albuquerque, NM (United States); Mahoney, Michael [Univ. of California, Berkeley, CA (United States)

    2018-01-01

    Through long-term investments in computing, algorithms, facilities, and instrumentation, DOE is an established leader in massive-scale, high-fidelity simulations, as well as science-leading experimentation. In both cases, DOE is generating more data than it can analyze and the problem is intensifying quickly. The need for advanced algorithms that can automatically convert the abundance of data into a wealth of useful information by discovering hidden structures is well recognized. Such efforts however, are hindered by the massive volume of the data and its high velocity. Here, the challenge is developing unsupervised learning methods to discover hidden structure in high-volume, high-velocity data.

  12. Analysis and simulation of HV-CMOS assemblies for the CLIC vertex detector

    CERN Document Server

    Buckland, Matthew Daniel

    2017-01-01

    One of the design concepts currently under study for the vertex detector at the proposed Compact Linear Collider is a High-Voltage CMOS sensor, fabricated in a commercial 180 nm technology, capacitively coupled to a hybrid readout chip. Tests of the assemblies were carried out at the CERN SPS using 120 GeV/c pions, covering incident angles ranging from 0$^\\circ$ to 80$^\\circ$. The measurements have shown an excellent tracking performance with an efficiency above 99.7% and a spatial resolution of 5–7 $\\mu$m over the tested angular range. These results were then compared to TCAD simulations carried out using simulations, showing a good agreement for the current-voltage, breakdown and charge collection properties. The simulations have also been used to optimise future sensor design.

  13. Ikke alt, der hvæser, hos børn er astma

    DEFF Research Database (Denmark)

    Hermann, Christian

    2000-01-01

    Med udgangspunkt i projektet "Opsporing af astma i 5 års alderen i almen praksis" beskrives asthma i barnealderen som en folkesygdom, der fylder meget i praksis. Det vigtige i tidlig diagnosticering understreges, da man i dag har effektiv medicin og viden om forebyggelse, der om ikke kurerer...... sygdommen så forbedrer trivselen betydeligt. Sygdomsbilledet i almen praksis ligger i grænseområdet til banalt luftvejsbesvær, hvorved det adskiller sig betydeligt fra astma sygdomsbilledet, som det optræder i hospitalssektoren og er beskrevet i lærebøgerne, hvilket er baggrunden for ovennævnte projekt...

  14. Application of H/V technique on different soils using ambient vibration measurements and earthquakes

    International Nuclear Information System (INIS)

    Schmidt-Diaz, Victor

    2016-01-01

    Four techniques to identify the fundamental frequency (f0) for 26 different sites were applied. These techniques correspond to spectral ratios based on the recording of: ambient vibration using an accelerograph (denominated VAA), ambient vibration using a seismograph (VAS), total seismic records (ST) and a time window of 5 s staring at S waves arrives in the seismic records (SOS). Better results were achieved when VAA was applied during the day (at 8 am and 3 pm). When VAA at 3 pm was compared to VAS at day time, it was observed that in the 58% of the analyzed cases the shapes and amplitudes of the spectral ratios were different, which means that VAA is not an appropriated technique to identify f0 based on that the results from VAS are the correct ones. It is affirmed based on its similarity to ST and SOS techniques in a 75% of the studied cases. These last two techniques are better justified in both mathematical and physical fundaments. (author) [es

  15. Study of the degradation of the insulation of HV cables with PVC insulation

    International Nuclear Information System (INIS)

    Quennehen, Pierre

    2014-01-01

    The observed decrease in the resistivity of the PVC insulation of some high voltage unipolar cables led to question their ability to perform their function. Provide answers concerning in particular the origin of the variation in resistivity and the impact on the dielectric strength were the objectives of this study. The characterizations were carried on cables withdrawn from service whose properties had changed during their use. Physico-chemical characterization (IR microscopy, UV spectroscopy, SEM - EDX and coulometry) showed that aging of the cable resulted from a mechanism of dehydro-chlorination. The presence of two modes of electric conduction in the material was observed: electronic conduction at a low temperature (≤ -10 C) and ionic conduction at room temperature and beyond. The presence of these two modes of conduction is consistent with the mechanism of dehydro-chlorination. In contrast to an Arrhenius law, artificial aging showed a threshold effect in the thermal activation of the mechanism at the origin of the resistivity drop. The dielectric strength of the cable has been confirmed by tests at voltages or temperatures well beyond the nominal values. Measurements of differential scanning calorimetry (DSC) showed occasional more or less pronounced over-heatings that correlate with the resistivity drops, and can therefore be considered as being at the origin of the observed evolutions. (author)

  16. Design and construction of double-Blumlein HV pulse power supply

    Indian Academy of Sciences (India)

    Springer Verlag Heidelberg #4 2048 1996 Dec 15 10:16:45

    A double Blumlein pulse generator is constructed using a coaxial cable. ... studying the streamer corona discharge and fast breakdown processes in air, it can also be used as a ... description of spark gap and water load is presented here.

  17. Noot bij: HvJ EG zaak C-60/00 (2002-07-11)

    NARCIS (Netherlands)

    Oosterom-Staples, H.

    2003-01-01

    In het arrest Carpenter beslist het Hof van Justitie EG dat echtgenoten van grensoverschrijdende dienstverleners uit hoofde van het gemeenschapsrecht een verblijfsrecht in het land van nationaliteit van de EG-onderdaan echtgenoot kunnen hebben. Hiermee beperkt het Hof de bevoegdheden van de

  18. A surface acoustic wave electric field strength meter for environmental studies of HV transmission lines

    International Nuclear Information System (INIS)

    Grandolfo, M.; Ranghiasci, C.; Verona, E.

    1988-01-01

    In recent years, there has been a significant increase in concern over the health and safety aspects of high voltage transmission lines (HVTL). The majority of research has focused on effects directly or indirectly involved with the central nervous system, including physiological, ultrastructural, and biochemical alterations, changes in blood composition, behaviour, reproduction, and development. Several recent epidemiological reports have presented preliminary data suggesting an increase in the incidence of cancer among children and adults exposed to magnetic fields through living close to various types of electrical power lines or devices. With the increase in environmental concerns there has been a concomitant consideration of biological effects and health implications related to presently existing HVTL and those planned in the future. It was concluded that the electric and magnetic field strengths and the electrical discharges are the most important electrophysical factors. Thus, it has been deemed necessary to develop measuring means to determine the field strengths in areas surrounding electric installations, in particular at ground level. In the present paper an electric field meter, based on the use of a surface acoustic wave (SAW) delay line, is presented and the experimental results obtained are discussed

  19. Partial Discharge Measurements in HV Rotating Machines in Dependence on Pressure of Coolant

    Directory of Open Access Journals (Sweden)

    I. Kršňák

    2002-01-01

    Full Text Available The influence of the pressure of the coolant used in high voltage rotating machines on partial discharges occurring in stator insulation is discussed in this paper. The first part deals with a theoretical analysis of the topic. The second part deals with the results obtained on a real generator in industrial conditions. Finally, theoretical assumptions and obtained results are compared.

  20. Voltage and pH sensing by the voltage-gated proton channel, HV1

    Science.gov (United States)

    2018-01-01

    Voltage-gated proton channels are unique ion channels, membrane proteins that allow protons but no other ions to cross cell membranes. They are found in diverse species, from unicellular marine life to humans. In all cells, their function requires that they open and conduct current only under certain conditions, typically when the electrochemical gradient for protons is outwards. Consequently, these proteins behave like rectifiers, conducting protons out of cells. Their activity has electrical consequences and also changes the pH on both sides of the membrane. Here we summarize what is known about the way these proteins sense the membrane potential and the pH inside and outside the cell. Currently, it is hypothesized that membrane potential is sensed by permanently charged arginines (with very high pKa) within the protein, which results in parts of the protein moving to produce a conduction pathway. The mechanism of pH sensing appears to involve titratable side chains of particular amino acids. For this purpose their pKa needs to be within the operational pH range. We propose a ‘counter-charge’ model for pH sensing in which electrostatic interactions within the protein are selectively disrupted by protonation of internally or externally accessible groups. PMID:29643227

  1. Design optimization of the 100 kV HV bushing for ITER-DNB

    Energy Technology Data Exchange (ETDEWEB)

    Shah, Sejal, E-mail: sshah@iter-india.org [ITER-India, Institute for Plasma Research, Gandhinagar 382025, Gujarat (India); Rajesh, S. [ITER-India, Institute for Plasma Research, Gandhinagar 382025, Gujarat (India); Microelectronics and Materials Physics Laboratories, P.O. Box 4500, FIN-90014 University of Oulu (Finland); Srusti, B. [DesignTech Systems Ltd, Banjara Hills, Hyderabad, Andhra Pradesh 500034 (India); Bandyopadhyay, M.; Rotti, C.; Singh, M.J.; Roopesh, G.; Chakraborty, A.K. [ITER-India, Institute for Plasma Research, Gandhinagar 382025, Gujarat (India); Schunke, B.; Hemsworth, R.; Chareyre, J. [ITER Organization, Route de Vinon sur Verdon, 13115 St. Paul lez Durance (France)

    2011-10-15

    The 100 kV bushing of the Diagnostic Neutral Beam (DNB) injector is a cylindrical feedthrough which forms the interface between the gas insulated transmission line and the torus primary vacuum and provides all necessary services to the beam source. All conventions for safety, voltage holding requirement, vacuum compatibility and the choice of materials have been addressed in the design. Finite Element Analyses (FEAs) for the electrostatic and the structural configuration is carried out to validate the design of the High Voltage Bushing (HVB). Several iterations and optimizations of the stress shields are carried out to meet electrostatic criteria, especially at the triple point (the ceramic, metal and vacuum joint), which is critical for good voltage holding. Structural analyses is carried out to assess the stress distribution in the fiber reinforced plastic insulator, the alumina insulator and the integrated HVB for different load cases like operational orientation (horizontal), normal operation and accidental case. Design is further validated for seismic conditions for Seismic Loading-2 (SL-2).

  2. Design optimization of the 100 kV HV bushing for ITER-DNB

    International Nuclear Information System (INIS)

    Shah, Sejal; Rajesh, S.; Srusti, B.; Bandyopadhyay, M.; Rotti, C.; Singh, M.J.; Roopesh, G.; Chakraborty, A.K.; Schunke, B.; Hemsworth, R.; Chareyre, J.

    2011-01-01

    The 100 kV bushing of the Diagnostic Neutral Beam (DNB) injector is a cylindrical feedthrough which forms the interface between the gas insulated transmission line and the torus primary vacuum and provides all necessary services to the beam source. All conventions for safety, voltage holding requirement, vacuum compatibility and the choice of materials have been addressed in the design. Finite Element Analyses (FEAs) for the electrostatic and the structural configuration is carried out to validate the design of the High Voltage Bushing (HVB). Several iterations and optimizations of the stress shields are carried out to meet electrostatic criteria, especially at the triple point (the ceramic, metal and vacuum joint), which is critical for good voltage holding. Structural analyses is carried out to assess the stress distribution in the fiber reinforced plastic insulator, the alumina insulator and the integrated HVB for different load cases like operational orientation (horizontal), normal operation and accidental case. Design is further validated for seismic conditions for Seismic Loading-2 (SL-2).

  3. Investigating the lignocellulosic composition during delignification using confocal raman spectroscopy, cross-polarization magic angle spinning carbon 13 - nuclear magnetic resonance (CP/MAS 13C- NMR) spectroscopy and atomic force microscopy

    CSIR Research Space (South Africa)

    Chunilall, Viren

    2012-03-01

    Full Text Available , extractives and hemicelluloses supporting bundles of tightly packed cellulose fibrils.1 Cellulose, the major component of the cell wall, is a polysaccharide made up of (1-4)-?-D-glucopyranose units. After cellulose, hemicelluloses constitute the most... abundant group of carbohydrates in the wood cell walls. Hemicelluloses are branched polymers made up of several monosaccharides. Lignin, the second most abundant polymer in wood, consists of phenyl propane units and plays an important supporting role...

  4. Higher capacity, lower carbon dioxide emissions. Idle power compensation in HV lines; Mehr Kapazitaet, weniger Kohlendioxid. Blindleistungskompensation bei Hochspannungsleitungen

    Energy Technology Data Exchange (ETDEWEB)

    Auer, Jan-Hendrik von [Alstom Grid GmbH, Berlin (Germany). Team Leistungselektronik und Kompensationsanlagen

    2012-07-01

    Even today, many HP lines have reached their limits. It is therefore highly urgent to find measures for optimum utilization of the available overhead transmssion capacities, e.g. by idle power compensation. Together with a filter for harmonics reduction, this will ensure higher grid stability and enhance transport capacities while reducing transport losses, thus saving money and reducing CO{sub 2} emissions. (orig./AKB)

  5. Nálezy a ztráty jihomoravských slanisk - hvězdnice sivá

    Czech Academy of Sciences Publication Activity Database

    Danihelka, Jiří

    2009-01-01

    Roč. 57, č. 3 (2009), s. 107-109 ISSN 0044-4812 R&D Projects: GA MŠk LC06073 Institutional research plan: CEZ:AV0Z60050516 Keywords : Aster canus * phytogeography * Central Europe Subject RIV: EF - Bot anics

  6. Rad-hard vertical JFET switch for the HV-MUX system of the ATLAS upgrade Inner Tracker

    CERN Document Server

    Fernandez-Martinez, Pablo; Flores, David; Hidalgo, Salvador; Quirion, David; Lynn, David

    2016-01-01

    This work presents a new silicon vertical JFET (V-JFET) device, based on the trenched 3D-detector technology developed at IMB-CNM, to be used as switches for the High-Voltage powering scheme of the ATLAS upgrade Inner Tracker. The optimization of the device characteristics is performed by 2D and 3D TCAD simulations. Special attention has been paid to the on-resistance and the switch-off and breakdown voltages to meet the specific requirements of the system. In addition, a set of parameter values has been extracted from the simulated curves to implement a SPICE model of the proposed V-JFET transistor. As these devices are expected to operate under very high radiation conditions during the whole experiment life-time, a study of the radiation damage effects and the expected degradation on the device performance is also presented at the end of the paper.

  7. Case note: HvJ EG (nr. C-562/07: Spaanse vermogenswinstbelasting in strijd met EU-recht)

    NARCIS (Netherlands)

    Monteiro, W.W.

    2009-01-01

    Op grond van de tot 31 december 2006 geldende Spaanse belastingwetgeving werd over de vermogenswinst van niet-ingezetenen belasting met een tarief van 35% geheven, terwijl voor die van de ingezetenen een progressief tarief gold indien de vermogensbestanddelen minder dan een jaar in hun bezit bleven,

  8. A Study on the Dependable and Secure Relaying Scheme under High Resistance Earth Faults on HV, EHV Line

    Energy Technology Data Exchange (ETDEWEB)

    Kim, I.D.; Han, K.N. [Korea Electric Power Research Institute, Taejeon (Korea, Republic of)

    1997-12-31

    This report contains following items for the purpose of investigating and analyzing characteristics of high impedance ground faults. - Reason and characteristics identification of HIF - Modeling of power system - Testing of protective relays using RTD(Real Time Digital Simulator) - Staged ground faults test - Development of new algorithm to detect HIF - Protective coordination schemes between different types of relays - HIF monitoring and relaying scheme and H/W prototyping. (author). 22 refs., 28 figs., 21 tabs.

  9. Targeted expression of HvHMA2 increases the mineral content of the inner endosperm in barley

    DEFF Research Database (Denmark)

    Noeparvar, Shahin; Darbani, Behrooz; Tauris, Birgitte

    2018-01-01

    Cereals are a major source of dietary energy and protein but are nutritionally poor in micronutrients. Zinc (Zn) biofortification of staple crops has been proposed as a promising strategy to combat the global challenge of human Zn-deficiency. The aim of this study was to improve the Zn content in...

  10. The electron gun for high power high HV accelerator; Wyrzutnia elektronow do akceleratora wysokiego napiecia duzej mocy

    Energy Technology Data Exchange (ETDEWEB)

    Drabik, W.; Kielsznia, R.; Kapla, P.; Stras, W. [Soltan Inst. for Nuclear Studies, Otwock-Swierk (Poland)

    1994-12-31

    Application of electron accelerators, for purification of flue gases from SO{sub 2} and NO{sub x} in industrial mode requires electron accelerators with 200 - 300 kW power. The electron source in such accelerators has to generate the current 200 - 300 mA for long time. In this report the technical project of d.c. electron gun with parameters 250 mA, 5 kW is presented. The construction of the gun is described, it consist of cathode made of LaB{sub 6} and heater made of pyrolytic graphite. For investigation of gun characteristics the test stand was build and the result of parameters measurements are also presented. The good agreement between assumed and measured parameters has been obtained. (author). 13 refs, 20 figs.

  11. Case note: HvJ EG (C-40/08: Asturcom Telecomunicaciones SL v. Cristina Rodríguez Nogueira)

    NARCIS (Netherlands)

    Mak, C.

    2010-01-01

    On those grounds, the Court (First Chamber) hereby rules: Council Directive 93/13/EEC of 5 April 1993 on unfair terms in consumer contracts must be interpreted as meaning that a national court or tribunal hearing an action for enforcement of an arbitration award which has become final and was made

  12. Optimization of the shape of the HV electrode of the electrostatic deflectors for the Milan superconducting cyclotron

    International Nuclear Information System (INIS)

    De Martinis, C.; Ferrari, A.

    1987-01-01

    The electrostatic deflectors for the extraction of the beam from the Milan Superconducting Cyclotron are presently under development. The early tests showed that major troubles arise from the modifications induced in the discharge mechanism by the presence of the magnetic field, resulting in a drastic reduction of the deflector performances. Therefore a detailed analysis of the electric field configuration of the deflector has been carried out in order to improve its performances. In this paper the results so far obtained in the optimization of the shape of the electrode and insulator fixing are reported

  13. Development of microcontroller based remote control system for HV power supply of ECR ion source for ADSS project

    International Nuclear Information System (INIS)

    Srivastava, S.; Misra, A.; Thakur, S.K.; Pandey, H.K.; Pandit, V.S.

    2009-01-01

    In this paper we will describe the design and development of the microcontroller based interface card used to control and monitor the operation of High Voltage Power supply 120kV/50mA (HVPS). This power supply is deployed for the extraction of proton beam from the microwave ion source in the ADSS project. (author)

  14. Hvězdy barokní opery budou pro posluchače dobrodružstvím

    Czech Academy of Sciences Publication Activity Database

    Kapsa, Václav; Luks, Václav

    2013-01-01

    Roč. 21, č. 10 (2013), s. 6-8 ISSN 1210-8081 Institutional support: RVO:68378076 Keywords : interview * music * interpretation Subject RIV: AL - Art, Architecture, Cultural Heritage http://www.muzikus.cz/klasicka-hudba- jazz -clanky/Hvezdy-barokni-opery-Budou-pro-posluchace-dobrodruzstvim~03~zari~2013/

  15. PRELIMINARY RESULTS OF ESTIMATING SOIL MOISTURE OVER BARE SOIL USING FULL-POLARIMETRIC ALOS-2 DATA

    Directory of Open Access Journals (Sweden)

    A. Sekertekin

    2016-10-01

    Full Text Available Synthetic Aperture Radar (SAR imaging system is one of the most effective way for Earth observation. The aim of this study is to present the preliminary results about estimating soil moisture using L-band Synthetic Aperture Radar (SAR data. Full-polarimetric (HH, HV, VV, VH ALOS-2 data, acquired on 22.04.2016 with the incidence angle of 30.4o, were used in the study. Simultaneously with the SAR acquisition, in-situ soil moisture samples over bare agricultural lands were collected and evaluated using gravimetric method. Backscattering coefficients for all polarizations were obtained and linear regression analysis was carried out with in situ moisture measurements. The best correlation coefficient was observed with VV polarization. Cross-polarized backscattering coefficients were not so sensitive to soil moisture content. In the study, it was observed that soil moisture maps can be retrieved with the accuracy about 14% (RMSE.

  16. Forest biomass, canopy structure, and species composition relationships with multipolarization L-band synthetic aperture radar data

    Science.gov (United States)

    Sader, Steven A.

    1987-01-01

    The effect of forest biomass, canopy structure, and species composition on L-band synthetic aperature radar data at 44 southern Mississippi bottomland hardwood and pine-hardwood forest sites was investigated. Cross-polarization mean digital values for pine forests were significantly correlated with green weight biomass and stand structure. Multiple linear regression with five forest structure variables provided a better integrated measure of canopy roughness and produced highly significant correlation coefficients for hardwood forests using HV/VV ratio only. Differences in biomass levels and canopy structure, including branching patterns and vertical canopy stratification, were important sources of volume scatter affecting multipolarization radar data. Standardized correction techniques and calibration of aircraft data, in addition to development of canopy models, are recommended for future investigations of forest biomass and structure using synthetic aperture radar.

  17. Research on Full-polarization Bistatic Scattering Characteristics of Aircraft

    Directory of Open Access Journals (Sweden)

    Ai Xiaofeng

    2016-12-01

    Full Text Available Whole space polarimetric bistatic scattering data of full-size aircraft targets were calculated via the mature electromagnetic calculation software. The fluctuation statistics characteristic of the polarimetric bistatic Radar Cross-Section (RCS was carried out. It was found that the statistical properties of the four polarimetric types (HH, HV, VH, VV of polarimetric bistatic RCSs are nearly the same, while the monostatic main and cross polarization RCSs statistical properties were quite different from each other. The characteristics of the distribution statistic for the monostatic and bistatic polarization ratio were carried out. Moreover, it was found that the cross-main polarization ratios were quite different, while the main polarization ratios were similar. The statistical results provide a theoretical reference for fully polarimetric bistatic radar aircraft target detection experiments.

  18. Fish skin provides invisibility in open ocean (image 11)

    National Science Foundation

    2017-02-10

    Full Text Available Skin preparation from fish shows birefringence under cross polarization microscopy Skin preparation from fish shows birefringence under cross polarization microscopySkin preparation from fish shows birefringence under cross polarization microscopy Skin pr

  19. Marsh dieback, loss, and recovery mapped with satellite optical, airborne polarimetric radar, and field data

    Science.gov (United States)

    Ramsey, Elijah W.; Rangoonwala, Amina; Chi, Zhaohui; Jones, Cathleen E.; Bannister, Terri

    2014-01-01

    Landsat Thematic Mapper and Satellite Pour l'Observation de la Terre (SPOT) satellite based optical sensors, NASA Uninhabited Aerial Vehicle synthetic aperture radar (UAVSAR) polarimetric SAR (PolSAR), and field data captured the occurrence and the recovery of an undetected dieback that occurred between the summers of 2010, 2011, and 2012 in the Spartina alterniflora marshes of coastal Louisiana. Field measurements recorded the dramatic biomass decrease from 2010 to 2011 and a biomass recovery in 2012 dominated by a decrease of live biomass, and the loss of marsh as part of the dieback event. Based on an established relationship, the near-infrared/red vegetation index (VI) and site-specific measurements delineated a contiguous expanse of marsh dieback encompassing 6649.9 ha of 18,292.3 ha of S. alterniflora marshes within the study region. PolSAR data were transformed to variables used in biophysical mapping, and of this variable suite, the cross-polarization HV (horizontal send and vertical receive) backscatter was the best single indicator of marsh dieback and recovery. HV backscatter exhibited substantial and significant changes over the dieback and recovery period, tracked measured biomass changes, and significantly correlated with the live/dead biomass ratio. Within the context of regional trends, both HV and VI indicators started higher in pre-dieback marshes and exhibited substantially and statistically higher variability from year to year than that exhibited in the non-dieback marshes. That distinct difference allowed the capturing of the S. alterniflora marsh dieback and recovery; however, these changes were incorporated in a regional trend exhibiting similar but more subtle biomass composition changes.

  20. Development of HV power transmission technology. Electric power supply until first world war; Entwicklung der Hochspannungsuebertragungstechnik. Die Elektroenergieversorgung bis zum Ersten Weltkrieg

    Energy Technology Data Exchange (ETDEWEB)

    Dittmann, Frank [Deutsches Museum, Muenchen (Germany)

    2009-11-02

    Story of power supply from 1880 to 1935 in Germany starting first with light centers, first public plants for power utilization followed by steam power plants and erection of overhead power lines. (GL)

  1. Studies of aging and HV break down problems during development and operation of MSGC and GEM detectors for the inner tracking system of HERA-B

    International Nuclear Information System (INIS)

    Bagaturia, Y.; Baruth, O.; Dreis, H.B.; Eisele, F.; Gorbunov, I.; Gradl, S.; Gradl, W.; Hausmann, S.; Hildebrandt, M.; Hott, T.; Keller, S.; Krauss, C.; Lomonosov, B.; Negodaev, M.; Richter, C.; Robmann, P.; Schmidt, B.; Straumann, U.; Truoel, P.; Visbeck, S.; Walter, T.; Werner, C.; Werthenbach, U.; Zech, G.; Zeuner, T.; Ziegler, M.

    2002-01-01

    The results of 5 years of development of the inner tracking system of the HERA-B experiment and first experience from the data taking period of the year 2000 are reported. The system contains 184 chambers, covering a sensitive area of about (20x20) cm 2 each. The detector is based on microstrip gas counters (MSGCs) with diamond-like coated (DLC) glass wafers and gas electron multipliers (GEMs). The main problems in the development phase were gas discharges in intense hadron beams and aging in a high radiation dose environment. The observation of gas discharges which damage the electrode structure of the MSGC led to the addition of the GEM as a first amplification step. Spurious sparking at the GEM cannot be avoided completely. It does not affect the GEM itself but can produce secondary damage of the MSGC if the electric field between the GEM and the MSGC is above a threshold depending on the operation conditions. We observed that aging does not only depend on the dose but also on the spot size of the irradiated area. Ar-DME mixtures had to be abandoned whereas a mixture of 70% Ar and 30% CO 2 showed no serious aging effects up to about 40 mC/cm deposited charge on the anodes. X-ray measurements indicate that the DLC of the MSGC is deteriorated by the gas amplification process. As a consequence, long-term gain variations are expected. The Inner Tracker has successfully participated in the data taking at HERA-B during summer 2000

  2. Studies of aging and HV break down problems during development and operation of MSGC and GEM detectors for the inner tracking system of HERA-B

    Energy Technology Data Exchange (ETDEWEB)

    Bagaturia, Y.; Baruth, O.; Dreis, H.B.; Eisele, F.; Gorbunov, I.; Gradl, S.; Gradl, W.; Hausmann, S.; Hildebrandt, M.; Hott, T.; Keller, S.; Krauss, C.; Lomonosov, B.; Negodaev, M.; Richter, C.; Robmann, P.; Schmidt, B.; Straumann, U.; Truoel, P.; Visbeck, S.; Walter, T.; Werner, C.; Werthenbach, U.; Zech, G. E-mail: zech@physik.uni-siegen.de; Zeuner, T.; Ziegler, M

    2002-09-01

    The results of 5 years of development of the inner tracking system of the HERA-B experiment and first experience from the data taking period of the year 2000 are reported. The system contains 184 chambers, covering a sensitive area of about (20x20) cm{sup 2} each. The detector is based on microstrip gas counters (MSGCs) with diamond-like coated (DLC) glass wafers and gas electron multipliers (GEMs). The main problems in the development phase were gas discharges in intense hadron beams and aging in a high radiation dose environment. The observation of gas discharges which damage the electrode structure of the MSGC led to the addition of the GEM as a first amplification step. Spurious sparking at the GEM cannot be avoided completely. It does not affect the GEM itself but can produce secondary damage of the MSGC if the electric field between the GEM and the MSGC is above a threshold depending on the operation conditions. We observed that aging does not only depend on the dose but also on the spot size of the irradiated area. Ar-DME mixtures had to be abandoned whereas a mixture of 70% Ar and 30% CO{sub 2} showed no serious aging effects up to about 40 mC/cm deposited charge on the anodes. X-ray measurements indicate that the DLC of the MSGC is deteriorated by the gas amplification process. As a consequence, long-term gain variations are expected. The Inner Tracker has successfully participated in the data taking at HERA-B during summer 2000.

  3. Case note: HvJ EU (zaaknr. C-446/09, C-495/09, LJN BU7493: Philips/Nokia)

    NARCIS (Netherlands)

    Hugenholtz, P.B.

    2013-01-01

    Verzoeken om een prejudiciële beslissing ingediend door de Rechtbank van eerste aanleg te Antwerpen en de Court of Appeal, England and Wales, (Civil Division) bij beslissingen van 4 respectievelijk 26 november 2009. Bestrijding van binnenbrengen in de Unie van namaakgoederen en door piraterij

  4. Mitochondrial DNA (mtDNA) variants in the European haplogroups HV, JT, and U do not have a major role in schizophrenia.

    Science.gov (United States)

    Torrell, Helena; Salas, Antonio; Abasolo, Nerea; Morén, Constanza; Garrabou, Glòria; Valero, Joaquín; Alonso, Yolanda; Vilella, Elisabet; Costas, Javier; Martorell, Lourdes

    2014-10-01

    It has been reported that certain genetic factors involved in schizophrenia could be located in the mitochondrial DNA (mtDNA). Therefore, we hypothesized that mtDNA mutations and/or variants would be present in schizophrenia patients and may be related to schizophrenia characteristics and mitochondrial function. This study was performed in three steps: (1) identification of pathogenic mutations and variants in 14 schizophrenia patients with an apparent maternal inheritance of the disease by sequencing the entire mtDNA; (2) case-control association study of 23 variants identified in step 1 (16 missense, 3 rRNA, and 4 tRNA variants) in 495 patients and 615 controls, and (3) analyses of the associated variants according to the clinical, psychopathological, and neuropsychological characteristics and according to the oxidative and enzymatic activities of the mitochondrial respiratory chain. We did not identify pathogenic mtDNA mutations in the 14 sequenced patients. Two known variants were nominally associated with schizophrenia and were further studied. The MT-RNR2 1811A > G variant likely does not play a major role in schizophrenia, as it was not associated with clinical, psychopathological, or neuropsychological variables, and the MT-ATP6 9110T > C p.Ile195Thr variant did not result in differences in the oxidative and enzymatic functions of the mitochondrial respiratory chain. The patients with apparent maternal inheritance of schizophrenia did not exhibit any mutations in their mtDNA. The variants nominally associated with schizophrenia in the present study were not related either to phenotypic characteristics or to mitochondrial function. We did not find evidence pointing to a role for mtDNA sequence variation in schizophrenia. © 2014 Wiley Periodicals, Inc.

  5. Subpixel mapping and test beam studies with a HV2FEI4v2 CMOS-Sensor-Hybrid Module for the ATLAS inner detector upgrade

    Science.gov (United States)

    Bisanz, T.; Große-Knetter, J.; Quadt, A.; Rieger, J.; Weingarten, J.

    2017-08-01

    The upgrade to the High Luminosity Large Hadron Collider will increase the instantaneous luminosity by more than a factor of 5, thus creating significant challenges to the tracking systems of all experiments. Recent advancement of active pixel detectors designed in CMOS processes provide attractive alternatives to the well-established hybrid design using passive sensors since they allow for smaller pixel sizes and cost effective production. This article presents studies of a high-voltage CMOS active pixel sensor designed for the ATLAS tracker upgrade. The sensor is glued to the read-out chip of the Insertable B-Layer, forming a capacitively coupled pixel detector. The pixel pitch of the device under test is 33× 125 μm2, while the pixels of the read-out chip have a pitch of 50× 250 μm2. Three pixels of the CMOS device are connected to one read-out pixel, the information of which of these subpixels is hit is encoded in the amplitude of the output signal (subpixel encoding). Test beam measurements are presented that demonstrate the usability of this subpixel encoding scheme.

  6. Ostreid herpesvirus OsHV-1 μVar in Pacific oysters Crassostrea gigas (Thunberg 1793) of the Wadden Sea, a UNESCO world heritage site

    NARCIS (Netherlands)

    Gittenberger, A.; Voorbergen-Laarman, M.A.; Engelsma, M.Y.

    2016-01-01

    The Wadden Sea is an extensive wetland area, recognized as UNESCO world heritage site of international importance. Since the mid-1990s, the invasive Pacific oyster Crassostrea gigas (Thunberg 1793) population in the area has grown exponentially, having a distinct impact on the ecosystem. The

  7. Potential performance analysis and future trend prediction of electric vehicle with V2G/V2H/V2B capability

    Directory of Open Access Journals (Sweden)

    Dalong Guo

    2016-03-01

    Full Text Available Due to the intermittent nature, renewable energy sources (RES has brought new challenges on load balancing and energy dispatching to the Smart Grid. Potentially served as distributed energy storage, Electric Vehicle’s (EV battery can be used as a way to help mitigate the pressure of fluctuation brought by RES and reinforce the stability of power systems. This paper gives a comprehensive review of the current situation of EV technology and mainly emphasizing three EV discharging operations which are Vehicle to Grid (V2G, Vehicle to Home (V2H, and Vehicle to Building (V2B, respectively. When needed, EV’s battery can discharge and send its surplus energy back to power grid, residential homes, or buildings. Based on our data analysis, we argue that V2G with the largest transmission power losses is potentially less efficient compared with the other two modes. We show that the residential users have the incentive to schedule the charging, V2G, and V2H according to the real-time price (RTP and the market sell-back price. In addition, we discuss some challenges and potential risks resulting from EVs’ fast growth. Finally we propose some suggestions on future power systems and also argue that some incentives or rewards need to be provided to motivate EV owners to behave in the best interests of the overall power systems.

  8. Breakdown Voltage of CF3CHCl2 gas an Alternative to SF6 Gas using HV Test and Bonding Energy Methods

    Science.gov (United States)

    Juliandhy, Tedy; Haryono, T.; Suharyanto; Perdana, Indra

    2018-04-01

    For more than two decades of Sulphur Hexafluoride (SF6) gases is used as a gas insulation in high voltage equipment especially in substations. In addition to getting an advantage as an insulating gas. SF6 gas is recognized as one of the greenhouse effect gases that cause global warming. Under the Kyoto Protocol, SF6 gas is one of those gases whose use is restricted and gradually reduced to the presence of a replacement gas for SF6 gas. One of the alternative gas alternatives which have the potential of replacing SF6 gas as an insulating gas in Gas Insulated Switchgear (GIS) equipment in the substation is Dichlorotrifluoroethane (CF3CHCl2) gas. The purpose of this paper is to enable a comparison of breakdown voltage with high voltage test and method of calculating Bonding energy to Dichlorotrifluoroethane gas as substitute gas for SF6 gas. At 0.1 bar gas pressure obtained an average breakdown voltage of 18.68 kV / mm at 25oC chamber temperature and has the highest breakdown voltage at 50oC with a breakdown voltage of 19.56 kV / mm. The CF3CHCl2 gas has great potential as an insulating gas because it has more insulation ability high of SF6 gas, and is part of the gas recommended under the Kyoto Protocol. Gas CF3CHCl2 has the capacity to double the value of electronegativity greater than SF6 gas as a major requirement of gas isolation and has a value of Global Warming Potential (GWP) and Ozone Depleting lower than from SF6 gas.

  9. Závislost fotometrických parametrů hvězd na orbitálních parametrech exoplanet

    Czech Academy of Sciences Publication Activity Database

    Pintr, Pavel

    2012-01-01

    Roč. 57, 11-12 (2012), s. 317-320 ISSN 0447-6441. [OaM 2012 International Conference on Optics and Measurement. Liberec, 16.10.2012-18.10.2012] Institutional research plan: CEZ:AV0Z20430508 Keywords : Exoplanets * regression analyse * stellar luminosity * stellar irradiance * effective temperature * orbital parameters Subject RIV: BH - Optics, Masers, Lasers

  10. Onderzoek naar viswering en visgeleiding bij 7 gemalen in Nederland (met bijdragen van M.C.M. Bruijs en H.V. Winter)

    NARCIS (Netherlands)

    Kroes, M.J.; Boer, de M.B.E.; Bruijs, M.C.M.; Winter, H.V.

    2013-01-01

    Gemalen vormen een barrière voor vismigratie van met name schieraal. De vraag is in welke mate schade en sterfte optreedt onder vis die pogingen onderneemt om het opvoerwerk te passeren of juist onvrijwillig door poimpen wordt ingezogen. In opdracht van STOWA is een grootschalig onderzoek uitgevoerd

  11. Antiviral activities of 2,6-diaminopurine-based acyclic nucleoside phosphonates against herpesviruses: In vitro study results with pseudorabies virus (PrV, SuHV-1)

    Czech Academy of Sciences Publication Activity Database

    Zouharová, D.; Lipenská, I.; Fojtiková, M.; Kulich, P.; Neca, J.; Slaný, M.; Kovařčík, K.; Turanek-Knotigová, P.; Hubatka, F.; Celechovská, H.; Mašek, J.; Koudelka, Š.; Procházka, L.; Eyer, L.; Plocková, J.; Bartheldyová, E.; Miller, A. D.; Růžek, Daniel; Raška, M.; Janeba, Zlatko; Turánek, J.

    2016-01-01

    Roč. 184, FEB 29 (2016), s. 84-93 ISSN 0378-1135 Institutional support: RVO:60077344 ; RVO:61388963 Keywords : Pseudorabies * Acyclic nucleoside phosphonates * DNA viruses * Cidofovir * Antiviral drugs * DNA polymerase Subject RIV: EE - Microbiology, Virology; CC - Organic Chemistry (UOCHB-X) Impact factor: 2.628, year: 2016

  12. Study of HV Dielectrics for High Frequency Operation in Linear & Nonlinear Transmission Lines & Simulation & Development of Hybrid Nonlinear Lines for RF Generation

    Science.gov (United States)

    2015-08-27

    As shown in [4], [5], the capacitors based on PZT (lead-zirconate- titanate) and BT dielectrics have dielectric BD strength of the order of 50 kV/cm...results. Depending on the nonlinearity properties of the capacitor dielectric , input pulse rise time, output pulse sharpening and or RF soliton... capacitors in a frequency range up to 2 MHz, below the resonant frequency of the both dielectrics . As seen in Fig. 1, PZTs have better performance than

  13. Study of HV Dielectrics for High Frequency Operation in Linear and Nonlinear Transmission Lines (NLTLs) and Simulation and Development of Hybrid Nonlinear Lines for RF Generation

    Science.gov (United States)

    2016-01-27

    Microwave & Optolectronics Conf. (IMOC), Rio de Janeiro , RJ, 2013, pp. 1-5. 7) L.P. Silva Neto, J.O. Rossi, J.J. Barroso, A.R. Silva. “Characterization of...Proc. of the SBMO/IEEE MTT-S International Microwave and Optoelectronics Conference, Rio de Janeiro , Brazil, Aug. 2013, pp. 1-5. 11) L.P. Silva Neto...transmission lines,” Proc. of the SBMO/IEEE MTT-S International Microwave and Optoelectronics Conference, Rio de Janeiro , Brazil, Aug. 2013, pp. 1-5

  14. Barley HvHMA1 is a heavy metal pump involved in mobilizing organellar Zn and Cu and plays a role in metal loading into grains

    DEFF Research Database (Denmark)

    Mikkelsen, Maria Dalgaard; Pedas, Pai; Schiller, Michaela

    2012-01-01

    Heavy metal transporters belonging to the P1B-ATPase subfamily of P-type ATPases are key players in cellular heavy metal homeostasis. Heavy metal transporters belonging to the P1B-ATPase subfamily of P-type ATPases are key players in cellular heavy metal homeostasis. In this study we investigated...

  15. Circuit design and simulation of a HV-supply controlling the power of 140 GHz 1 MW gyrotrons for ECRH on W7-X

    International Nuclear Information System (INIS)

    Brand, P.; Mueller, G.A.

    2003-01-01

    For plasma heating by ECR in the Stellarator W7-X under construction, 140 GHz gyrotrons with 1 MW cw output power are under development. These tubes have a voltage depressed collector for electron energy recovery. Each gyrotron is fed by two high-voltage sources: a high-power supply for driving the electron beam and a precision low-power supply for beam acceleration. In addition, a protection system with a thyratron crowbar for fast power removal in case of gyrotron arcing is installed. The low-power high-voltage source for beam acceleration is realized by a high-voltage servo-amplifier driving the depression voltage such that the influence of the voltage noise of the main high-power supply on the acceleration voltage is suppressed by feed-back control of the amplifier. Design and simulation of the servo-amplifier by PSpice is presented

  16. Čtyři nové proměnné hvězdy v Kasiopei objevené pomocí DSLR

    Czech Academy of Sciences Publication Activity Database

    Pintr, Pavel; Vápenka, David; Mašek, M.

    2017-01-01

    Roč. 62, č. 1 (2017), s. 22-25 ISSN 0447-6441 R&D Projects: GA MŠk(CZ) LO1206 Institutional support: RVO:61389021 Keywords : variable stars * light curve * HALZ telescope * period analysis Subject RIV: BH - Optics, Masers, Lasers OBOR OECD: Optics (including laser optics and quantum optics)

  17. Mangrove vegetation structure in Southeast Brazil from phased array L-band synthetic aperture radar data

    Science.gov (United States)

    de Souza Pereira, Francisca Rocha; Kampel, Milton; Cunha-Lignon, Marilia

    2016-07-01

    The potential use of phased array type L-band synthetic aperture radar (PALSAR) data for discriminating distinct physiographic mangrove types with different forest structure developments in a subtropical mangrove forest located in Cananéia on the Southern coast of São Paulo, Brazil, is investigated. The basin and fringe physiographic types and the structural development of mangrove vegetation were identified with the application of the Kruskal-Wallis statistical test to the SAR backscatter values of 10 incoherent attributes. The best results to separate basin to fringe types were obtained using copolarized HH, cross-polarized HV, and the biomass index (BMI). Mangrove structural parameters were also estimated using multiple linear regressions. BMI and canopy structure index were used as explanatory variables for canopy height, mean height, and mean diameter at breast height regression models, with significant R2=0.69, 0.73, and 0.67, respectively. The current study indicates that SAR L-band images can be used as a tool to discriminate physiographic types and to characterize mangrove forests. The results are relevant considering the crescent availability of freely distributed SAR images that can be more utilized for analysis, monitoring, and conservation of the mangrove ecosystem.

  18. New Methods for Landslide Identification and Mapping Using SAR Polarimetry Obtained During the PacRim 2000 Mission in Taiwan

    National Research Council Canada - National Science Library

    Czuchlewski, Kristina R; Weissel, Jeffrey K; Lee, Jong-Sen

    2005-01-01

    We reanalyze PacRim 2000 L-band AIRSAR polarimetry collected over the western foothills of central Taiwan a year after the September 20, 1999 ChiChi earthquake, which produced more than 10,000 landslide...

  19. Synergy of optical and polarimetric microwave data for forest resource assessment

    International Nuclear Information System (INIS)

    Miguel-Ayanz, J.S.

    1997-01-01

    Data acquired during the Mac-Europe 91 campaign over the Black Forest ( Germany) are used to study the synergy of optical imaging spectrometer data ( AVIRIS) and polarimetric microwave data ( AIRSAR) for forest resource assessment. Original and new derived bands from AIRSAR and AVIRIS data are used to predict age and biomass. The best predictors ( bands) are selected through a multivariate stepwise regression analysis of each of the datasets separately. Then the joint AIRSAR-AVIRIS dataset is analysed. This study shows how the synergistic use of AIRSAR and AVIRIS data improves significantly the predictions obtained from the individual datasets for both age and biomass over the test site. In the analysis of AVIRIS data a new approach for processing large datasets as those provided by imaging spectrometers is presented, so that maximum likelihood classification of these datasets becomes feasible. (author)

  20. High-resolution threshold photoelectron-photoion coincidence experiments performed on beamline 9.0.2.2: Kinetic energy release study of the process SF{sub 6} + hv {yields} SF{sub 5}{sup +} F + e{sup -}

    Energy Technology Data Exchange (ETDEWEB)

    Evans, M.; Ng, C.Y. [Ames Lab., IA (United States); Hsu, C.W.; Heimann, P. [Lawrence Berkeley National Lab., CA (United States)

    1997-04-01

    Vacuum ultraviolet (VUV) photoionization mass spectrometry has been used extensively to determine the energetics of neutral radicals and radical cations, as well as to study the dynamics of the dissociative photoionization process. Very often these measurements are concerned with determining the appearance energy (AE) for a dissociative ionization process, as well as determining the heats of formation of the species involved. One such photoionization mass spectrometric technique employed on End Station 2 of the Chemical Dynamics Beamline (9.0.2.2) at the Advanced Light Source is the threshold photoelectron-photoion coincidence (TPEPICO) method. TPEPICO involves measuring the time-of-flight (TOF) mass spectrum of a given cation in coincidence with threshold photoelectrons at a known photoionization energy.

  1. Hvězdnice sivá (Aster canus), Christian Ferdinand Hochstetter a dva málo známé prameny ke květeně Moravy

    Czech Academy of Sciences Publication Activity Database

    Danihelka, Jiří

    2008-01-01

    Roč. 43, č. 1 (2008), s. 1-16 ISSN 1211-5258 R&D Projects: GA MŠk(CZ) LC06073 Institutional research plan: CEZ:AV0Z60050516 Keywords : history of botany * halophytes * exsiccate series Subject RIV: EF - Botanics

  2. Case note: HvJ EU (rolnummer C-160/14: João Filipe Ferreira da Silva e Brito e.a. tegen Estado português)

    NARCIS (Netherlands)

    Beltzer, R.M.

    2015-01-01

    AIA, een Portugese luchtvaartmaatschappij, is ontbonden en de werknemers zijn ontslagen. TAP, de hoofdaandeelhouder van AIA, is gedurende een half jaar een deel van de vluchten van AIA gaan uitvoeren, waaronder chartervluchten. Op deze markt was TAP nog niet actief. De Portugese rechter vraagt in

  3. Calculation of Loss Factors for Metal Sheath and Armour of HV Cables%高压电缆金属护套及铠装结构的损耗计算

    Institute of Scientific and Technical Information of China (English)

    刘英

    2013-01-01

    在确定电力电缆额定载流量时,必须精确计算金属护套、铠装等结构的损耗因数,尤其对于金属护套采取两端直接互联接地的高压单芯电缆线路,如大长度海底电缆.简单对称敷设情况下护套和磁性铠装结构的损耗因数可以根据IEC 60287中推荐的公式进行计算;若铠装采用非磁性材料,可按照标准中推荐的处理方法获得总的损耗因数,再按两者并联的方式进行分配,获得各自的损耗因数.其它非磁性金属结构按照类似方法处理.当然,也可从基本的等效电路出发,求解电缆金属护套、加强层、铠装层等结构中流过的环流,从而获得损耗因数,这种方法可应用于更复杂或一般性的电缆结构和敷设情况.两种计算方法各有优缺点,可根据需要选用.

  4. The barley (Hordeum vulgare) cellulose synthase-like D2 gene (HvCslD2) mediates penetration resistance to host-adapted and nonhost isolates of the powdery mildew fungus

    NARCIS (Netherlands)

    Douchkov, Dimitar; Lueck, Stefanie; Hensel, Goetz; Kumlehn, Jochen; Rajaraman, Jeyaraman; Johrde, Annika; Doblin, Monika S.; Beahan, Cherie T.; Kopischke, Michaela; Fuchs, René; Lipka, Volker; Niks, Rients E.; Bulone, Vincent; Chowdhury, Jamil; Little, Alan; Burton, Rachel A.; Bacic, Antony; Fincher, Geoffrey B.; Schweizer, Patrick

    2016-01-01

    Cell walls and cellular turgor pressure shape and suspend the bodies of all vascular plants. In response to attack by fungal and oomycete pathogens, which usually breach their host's cell walls by mechanical force or by secreting lytic enzymes, plants often form local cell wall appositions

  5. Objev nové ELL proměnné hvězdy v souhvězdí Kentaura a možnost detekce nových exoplanet pomocí dalekohledu FRAM

    Czech Academy of Sciences Publication Activity Database

    Pintr, Pavel; Vápenka, David; Mašek, M.

    2015-01-01

    Roč. 60, č. 2 (2015), s. 65-68 ISSN 0447-6441 R&D Projects: GA MŠk(CZ) LO1206; GA ČR GA13-10365S Institutional support: RVO:61389021 Keywords : variable star * light curve * FRAM * period analysis * exoplanet transit Subject RIV: BN - Astronomy, Celestial Mechanics, Astrophysics http://jmo.fzu.cz/

  6. Malý zámeček s šesti cípy do tvaru hvězdy. Rozhovor se Sylvou Dobalovou, Blankou Kubíkovou a Ivanem P. Muchkou nejen o neobvyklém půdorysu letohrádku Hvězda, ale také o jeho výzdobě a poslání

    Czech Academy of Sciences Publication Activity Database

    Dobalová, Sylva; Kubíková, B.; Muchka, Ivan; Bůžek, V.

    2017-01-01

    Roč. 39, č. 7 (2017), s. 23-25 ISSN 0418-5129 Institutional support: RVO:68378033 Keywords : Archduke Ferdinand II of Tyrol * summer palace * Prague Subject RIV: AL - Art, Architecture, Cultural Heritage

  7. Schur spaces and weighted spaces of type H

    African Journals Online (AJOL)

    We extend some results related to composition operators on Hv(G) to arbitrary linear operators on Hv0 (G) and Hv(G). We also give examples of rank-one operators on Hv(G) which cannot be approximated by composition operators. Keywords: Weighted Banach spaces of holomorphic functions, Schur spaces, weakly ...

  8. Cy5 maleimide labelling for sensitive detection of free thiols in native protein extracts: identification of seed proteins targeted by barley thioredoxin h isoforms

    DEFF Research Database (Denmark)

    Maeda, K.; Finnie, Christine; Svensson, Birte

    2004-01-01

    search. HvTrxh1 and HvTrxh2 were shown to have similar target specificity. Barley alpha-amylase/subtilisin inhibitor, previously demonstrated to be reduced by both HvTrxh1 and HvTrxh2, was among the identified target proteins, confirming the suitability of the method. Several alpha-amylase...

  9. The degree of horizontal violence in RNs practicing in New York State.

    Science.gov (United States)

    Sellers, Kathleen F; Millenbach, Linda; Ward, Kathy; Scribani, Melissa

    2012-10-01

    This study examined the degree of horizontal violence (HV) among RNs practicing in New York State (NYS). The objective was to determine the knowledge of HV and the degree of being a victim among practicing RNs. A descriptive survey using Briles' Sabotage Savvy Questionnaire, measuring occurrences of HV and nurses' knowledge of HV, was conducted among 2659 RNs in NYS hospitals. Findings demonstrate a significantly greater (P leadership, and individual interventions to address HV helps create a culture of safety.

  10. Comparative Genomics of Carp Herpesviruses

    Science.gov (United States)

    Kurobe, Tomofumi; Gatherer, Derek; Cunningham, Charles; Korf, Ian; Fukuda, Hideo; Hedrick, Ronald P.; Waltzek, Thomas B.

    2013-01-01

    Three alloherpesviruses are known to cause disease in cyprinid fish: cyprinid herpesviruses 1 and 3 (CyHV1 and CyHV3) in common carp and koi and cyprinid herpesvirus 2 (CyHV2) in goldfish. We have determined the genome sequences of CyHV1 and CyHV2 and compared them with the published CyHV3 sequence. The CyHV1 and CyHV2 genomes are 291,144 and 290,304 bp, respectively, in size, and thus the CyHV3 genome, at 295,146 bp, remains the largest recorded among the herpesviruses. Each of the three genomes consists of a unique region flanked at each terminus by a sizeable direct repeat. The CyHV1, CyHV2, and CyHV3 genomes are predicted to contain 137, 150, and 155 unique, functional protein-coding genes, respectively, of which six, four, and eight, respectively, are duplicated in the terminal repeat. The three viruses share 120 orthologous genes in a largely colinear arrangement, of which up to 55 are also conserved in the other member of the genus Cyprinivirus, anguillid herpesvirus 1. Twelve genes are conserved convincingly in all sequenced alloherpesviruses, and two others are conserved marginally. The reference CyHV3 strain has been reported to contain five fragmented genes that are presumably nonfunctional. The CyHV2 strain has two fragmented genes, and the CyHV1 strain has none. CyHV1, CyHV2, and CyHV3 have five, six, and five families of paralogous genes, respectively. One family unique to CyHV1 is related to cellular JUNB, which encodes a transcription factor involved in oncogenesis. To our knowledge, this is the first time that JUNB-related sequences have been reported in a herpesvirus. PMID:23269803

  11. Characteristics Associated with Hallux Valgus in a Population-Based Study of Older Adults: The Framingham Foot Study

    Science.gov (United States)

    Dufour, Alyssa B.; Casey, Virginia A.; Golightly, Yvonne M.; Hannan, Marian T.

    2015-01-01

    Objective Hallux valgus (HV) is common in older adults, but limited studies of risk factors have reported conflicting results. This cross-sectional analysis examined the association of HV with foot pain and other characteristics in older adults. Methods HV, foot pain, foot structure (planus, rectus, cavus), current and past high heel use, age, and body mass index were assessed in the population-based Framingham Foot Study. Sex-specific logistic and multinomial logistic regression examined the association of HV and HV with pain with study variables. Results Of 1352 men and 1725 women (mean age 66 ± 10.5 years), 22% of men and 44% of women had HV and 3% of men and 11% of women had HV with pain. Foot pain increased odds of HV in both sexes (p 30 kg/m2 decreased odds of HV by 33% in men and 45% in women (p<0.05). In women only, odds of Pain & HV vs. No Pain & No HV were greater with older age and planus foot structure. Conclusions Our work showed different associations in participants who had HV with pain compared to those without foot pain. In both men and women, strong relations were observed between HV and foot pain and inversely with BMI. Older age was associated with HV in women only, as were protective associations with cavus foot structure. PMID:24965070

  12. Whole-genome sequence of a novel Chinese cyprinid herpesvirus 3 isolate reveals the existence of a distinct European genotype in East Asia.

    Science.gov (United States)

    Li, Wei; Lee, Xuezhu; Weng, Shaoping; He, Jianguo; Dong, Chuanfu

    2015-02-25

    Cyprinid herpesvirus 3 (CyHV3), also known as koi herpesvirus (KHV), can be subdivided primarily into European and Asian genotypes, which are represented by CyHV3-U or CyHV3-I and CyHV3-J, respectively. In this study, the whole genome sequence of a novel Chinese CyHV3 isolate (GZ11) was determined and annotated. CyHV3-GZ11 genome was found to contain 295,119 nucleotides with 52.9% G/C content, which is highly similar to those of published CyHV3-U, CyHV3-I, and CyHV3-J strains. With reference to CyHV3-U, CyHV3-I, and CyHV3-J, CyHV3-GZ11 was also classified into 164 open reading frames (ORF), which include eight repeated ORFs. On the basis of the 12 alloherpeviruses core genes, results from phylogenetic analysis showed that CyHV3-GZ11 had closer evolutionary relationships with CyHV3-U and CyHV3-I than with CyHV3/KHV-J, which were also supported by genome wide-based single nucleotide substitution analysis and the use of a series of developed molecular markers. This study was the first to reveal the presence of a distinct European CyHV3 genotype in East and Southeast Asia at a whole genome level, which will evoke new insights on exploring the origin, evolution, and epidemiology of the virus. Copyright © 2014 Elsevier B.V. All rights reserved.

  13. Revealing the dark side of Portlandite Clusters in cement paste by circular polarization microscopy

    NARCIS (Netherlands)

    Copuroglu, O.

    2016-01-01

    Plane and crossed polarization are the two standard light modes in polarized light microscopy that are widely used to characterize crystalline and amorphous phases in cement-based materials. However, the use of the crossed polarized light mode has been found to be restrictive for studying

  14. Biophysical Forest Type Characterization in the Colombian Amazon by Airborne Polarimetric SAR

    NARCIS (Netherlands)

    Hoekman, D.H.; Quiñones, M.J.

    2002-01-01

    Fully polarimetric C-, L-, and P-band data were collected by NASA's AirSAR system in May 1993 at the Araracuara test site, a well-surveyed forest reserve in the center of the Colombian Amazon. The area is characterized by a high diversity of forest types, soil types, and flooding conditions. In this

  15. Integrating Radar Image Data with Google Maps

    Science.gov (United States)

    Chapman, Bruce D.; Gibas, Sarah

    2010-01-01

    A public Web site has been developed as a method for displaying the multitude of radar imagery collected by NASA s Airborne Synthetic Aperture Radar (AIRSAR) instrument during its 16-year mission. Utilizing NASA s internal AIRSAR site, the new Web site features more sophisticated visualization tools that enable the general public to have access to these images. The site was originally maintained at NASA on six computers: one that held the Oracle database, two that took care of the software for the interactive map, and three that were for the Web site itself. Several tasks were involved in moving this complicated setup to just one computer. First, the AIRSAR database was migrated from Oracle to MySQL. Then the back-end of the AIRSAR Web site was updated in order to access the MySQL database. To do this, a few of the scripts needed to be modified; specifically three Perl scripts that query that database. The database connections were then updated from Oracle to MySQL, numerous syntax errors were corrected, and a query was implemented that replaced one of the stored Oracle procedures. Lastly, the interactive map was designed, implemented, and tested so that users could easily browse and access the radar imagery through the Google Maps interface.

  16. Factors Related to Prevalence of Hallux Valgus in Female University Students: A Cross-Sectional Study

    Science.gov (United States)

    Okuda, Hiroto; Juman, Sachiko; Ueda, Ai; Miki, Tomohiro; Shima, Masayuki

    2014-01-01

    Background We investigated the prevalence of hallux valgus (HV) and examined its association with various factors in a cross-sectional study of Japanese female university students. Methods A questionnaire survey of foot symptoms, lifestyle, and body mass index (BMI) was administered to 343 women who provided informed consent at a women’s university. Footprints were obtained and bone density was measured. Associations of HV with various factors were analyzed by logistic regression analysis. Results Big toe pain was reported in 26.5% of the women. HV (HV angle, ≥15°) was present in the left foot in 22.4%, the right foot in 20.7%, and unilaterally or bilaterally in 29.7% of women. Mild HV (HV angle, ≥15° to <20°) was noted in the left foot and right foot in 13.4% and 13.1% of women, respectively; no severe HV (HV angle, ≥40°) was observed. HV was associated with big toe pain (adjusted OR: 3.56, 95% CI: 2.01–6.32), history of HV in the mother or maternal grandmother (adjusted OR: 2.45, 95% CI: 1.19–5.02), and history of HV in other family members (adjusted OR: 3.09, 95% CI: 1.35–7.06). Moderate HV was associated with big toe pain (adjusted OR: 4.58, 95% CI: 2.17–9.66) and history of HV in the mother or maternal grandmother (adjusted OR: 3.36, 95% CI: 1.40–8.07). The proportion of women with big toe pain increased significantly with HV severity. Conclusions HV was present in about 30% of female university students. Young women with big toe pain or a family history of HV should be evaluated for HV. PMID:24705646

  17. Development of a quantitative PCR assay for measurement of trichechid herpesvirus 1 load in the Florida manatee ( Trichechus manatus latirostris).

    Science.gov (United States)

    Ferrante, Jason A; Cortés-Hinojosa, Galaxia; Archer, Linda L; Wellehan, James F X

    2017-07-01

    Trichechid herpesvirus 1 (TrHV-1) is currently the only known herpesvirus in any sirenian. We hypothesized that stress may lead to recrudescence of TrHV-1 in manatees, thus making TrHV-1 a potential biomarker of stress. We optimized and validated a TrHV-1 real-time quantitative probe hybridization PCR (qPCR) assay that was used to quantify TrHV-1 in manatee peripheral blood mononuclear cells (PBMCs). Average baseline TrHV-1 loads in a clinically healthy wild Florida manatee ( Trichechus manatus latirostris) population ( n = 42) were 40.9 ± SD 21.2 copies/100 ng DNA; 19 of 42 manatees were positive. TrHV-1 loads were significantly different between the 2 field seasons ( p < 0.025). This optimized and validated qPCR assay may be used as a tool for further research into TrHV-1 in Florida manatees.

  18. Construction and growth properties of bovine herpesvirus type 5 recombinants defective in the glycoprotein E or thymidine kinase gene or both

    Directory of Open Access Journals (Sweden)

    M.C.S. Brum

    2010-02-01

    Full Text Available Bovine herpesvirus type 5 (BoHV-5 is an important pathogen of cattle in South America. We describe here the construction and characterization of deletion mutants defective in the glycoprotein E (gE or thymidine kinase (TK gene or both (gE/TK from a highly neurovirulent and well-characterized Brazilian BoHV-5 strain (SV507/99. A gE-deleted recombinant virus (BoHV-5 gE∆ was first generated in which the entire gE open reading frame was replaced with a chimeric green fluorescent protein gene. A TK-deleted recombinant virus (BoHV-5 TK∆ was then generated in which most of the TK open reading frame sequences were deleted and replaced with a chimeric β-galactosidase gene. Subsequently, using the BoHV-5 gE∆ virus as backbone, a double gene-deleted (TK plus gE BoHV-5 recombinant (BoHV-5 gE/TK∆ was generated. The deletion of the gE and TK genes was confirmed by immunoblotting and PCR, respectively. In Madin Darby bovine kidney (MDBK cells, the mutants lacking gE (BoHV-5 gE∆ and TK + gE (BoHV-5 gE/TK∆ produced small plaques while the TK-deleted BoHV-5 produced wild-type-sized plaques. The growth kinetics and virus yields in MDBK cells for all three recombinants (BoHV-5 gE∆, BoHV-5 TK∆ and BoHV-5 gE/TK∆ were similar to those of the parental virus. It is our belief that the dual gene-deleted recombinant (BoHV-5 gE/TK∆ produced on the background of a highly neurovirulent Brazilian BoHV-5 strain may have potential application in a vaccine against BoHV-5.

  19. Isolation and serological differentiation of a herpesvirus from bobwhite quail (Colinus virginianus, L. 1758).

    Science.gov (United States)

    Kaleta, E F; Marschall, H J; Glünder, G; Stiburek, B

    1980-01-01

    An infectious agent was isolated from the liver of bobwhite quails (Colinus virginianus, L. 1758). The agent was sensitive to chloroform and its multiplication was inhibited by 5-iodine-2-deoxy-uridine. It passed filters with a pore diameter of 220 nm and more but not 100 nm filters. Electron microscopic examination revealed numerous nucleocapsids with hollow capsomeres and few enveloped particles in the supernatant fluids of infected cultures. The nucleocapsids were calculated to have 162 capsomeres on their surface. Using the plaque reduction method for neutralization tests no serological cross reactions could be detected between the quail isolate and sera against Marek's disease virus, turkey herpes-virus (HV), duck enteritis HV, infectious laryngotracheitis HV, amazon parrot HV, great horned owl HV, eagle owl HV, snowy owl HV, falcon HV, pigeon HV, Lake Victoria Cormorant HV, and stork HV. The isolate from bobwhite quail did only cross-react with antiserum against crane HV. It is concluded that the isolated virus is a member of the avian herpesvirus group and it is proposed to tentatively term it herpesvirus colinum (from Colinus virginianus = bobwhite quail).

  20. Validation of a serum neutralization test for detection of antibodies specific to cyprinid herpesvirus 3 in infected common and koi carp (Cyprinus carpio)

    DEFF Research Database (Denmark)

    Cabon, J.; Louboutin, L.; Castric, J.

    2017-01-01

    healthy and naturally or experimentally CyHV-3-infected carp. French CyHV-3 isolate 07/108b was neutralized efficiently by sera from carp infected with European, American and Taiwanese CyHV-3 isolates, but no neutralization was observed using sera specific to other aquatic herpesviruses. Diagnostic...

  1. Modular High Voltage Pulse Converter for Short Rise and Decay Times

    NARCIS (Netherlands)

    Mao, S.

    2018-01-01

    This thesis explores a modular HV pulse converter technology with short rise and decay times. A systematic methodology to derive and classify HV architectures based on a modularization level of power building blocks of the HV pulse converter is developed to summarize existing architectures and

  2. Virtual-Instrument-Based Online Monitoring System for Hands-on Laboratory Experiment of Partial Discharges

    Science.gov (United States)

    Karmakar, Subrata

    2017-01-01

    Online monitoring of high-voltage (HV) equipment is a vital tool for early detection of insulation failure. Most insulation failures are caused by partial discharges (PDs) inside the HV equipment. Because of the very high cost of establishing HV equipment facility and the limitations of electromagnetic interference-screened laboratories, only a…

  3. A theoretical and numerical study of polarimetric scattering and emission from random rough surfaces with anisotropic directional spectrum

    Science.gov (United States)

    Yueh, S. H.; Kwok, R.

    1993-01-01

    In this paper, theoretical and numerical results of the polarimetric scattering and emission from random rough surfaces with anisotropic directional spectrum are presented for the remote sensing of ocean and soil surfaces. The polarimetric scattered field for rough dielectric surfaces is derived to the second order by the small perturbation method (SPM). It is found that the second-order scattered field is coherent in nature, and its coefficients for different polarizations present the lowest-order corrections to the Fresnel reflection coefficients of the surfaces. In addition, the cross-polarized (HV and VH) components of the coherent fields are reciprocal and not zero for surfaces with anisotropic directional spectrum when the azimuth angle of the incident direction is not aligned with the symmetry directions of surfaces. In order to verify the energy conservation condition of the theoretical results, which is important if the theory is to be applied to the passive polarimetry of rough surfaces, a Monte Carlo simulation is performed to numerically calculate the polarimetric reflectivities of one-dimensional random rough surfaces which are generated with a prescribed power-law spectrum in the spectral domain and transformed to the spatial domain by the FFT. The surfaces simulated by this approach are periodic with the period corresponding to the low-wavenumber cutoff. To calculate the scattering from periodic dielectric surfaces, the authors present a new numerical technique which applies the Floquet theorem to reduce the problem to one period and does not require the evaluation of one-dimensional periodic Green's function used in the conventional method of moment formulation. Once the scattering coefficients are obtained, the polarimetric Stokes vectors for the emission from the random surfaces are then calculated according to the Kirchhoff's law and are illustrated as functions of relative azimuth observation and row directions. The second-order SPM is also

  4. Monitoring flooding and vegetation on seasonally inundated floodplains with multifrequency polarimetric synthetic aperture radar

    Science.gov (United States)

    Hess, Laura Lorraine

    The ability of synthetic aperture radar to detect flooding and vegetation structure was evaluated for three seasonally inundated floodplain sites supporting a broad variety of wetland and upland vegetation types: two reaches of the Solimoes floodplain in the central Amazon, and the Magela Creek floodplain in Northern Territory, Australia. For each site, C- and L-band polarimetric Shuttle Imaging Radar-C (SIR-C) data was obtained at both high- and low-water stages. Inundation status and vegetation structure were documented simultaneous with the SIR-C acquisitions using low-altitude videography and ground measurements. SIR-C images were classified into cover states defined by vegetation physiognomy and presence of standing water, using a decision-tree model with backscattering coefficients at HH, VV, and HV polarizations as input variables. Classification accuracy was assessed using user's accuracy, producer's accuracy, and kappa coefficient for a test population of pixels. At all sites, both C- and L-band were necessary to accurately classify cover types with two dates. HH polarization was most. useful for distinguishing flooded from non-flooded vegetation (C-HH for macrophyte versus pasture, L-HH for flooded versus non-flooded forest), and cross-polarized L-band data provided the best separation between woody and non-woody vegetation. Increases in L-HH backscattering due to flooding were on the order of 3--4 dB for closed-canopy varzea and igapo forest, and 4--7 dB, for open Melaleuca woodland. The broad range of physiognomies and stand structures found in both herbaceous and woody wetland communities, combined with the variation in the amount of emergent canopy caused by water level fluctuations and phenologic changes, resulted in a large range in backscattering characteristics of wetland communities both within and between sites. High accuracies cannot be achieved for these communities using single-date, single-band, single-polarization data, particularly in the

  5. Strategy for recruitment and factors associated with motivation and satisfaction in a randomized trial with 210 healthy volunteers without financial compensation.

    Science.gov (United States)

    Luzurier, Quentin; Damm, Cédric; Lion, Fabien; Daniel, Carine; Pellerin, Lucille; Tavolacci, Marie-Pierre

    2015-01-05

    The aim was to describe a strategy for recruitment of healthy volunteers (HV) to a randomized trial that assessed the efficacy of different telephone techniques to assist HV in performing cardiac massage for vital emergency. Participation in the randomized trial was not financially compensated, however HV were offered emergency first-aid training. We also studied factors associated with HV motivation and satisfaction regarding participation in the trial. Strategy for recruitment of 210 HV aged 18 to 60 years was based on: (1) the updated records of all telephone number since January 2000 of HV registered in the Rouen Clinical Investigation Centre HV database, (2) a communication campaign for the general public focussing on posters and media advertisements. Data on the recruitment, socio-demographics, motivation and satisfaction of the 210 HV were collected by anonymous self-administered questionnaire. Of the 210 HV included, 63.3% (n = 133) were recruited from the HV database and 36.7% (n = 77) by the communication campaign. On the one hand, the HV database enabled screening of 1315 HV, 54.8% (n = 721) of whom were reached by phone, 55.2% (n = 398) of these latter accepted to participate in the study and 10.1% of the initial screening (n = 133) were finally included. One the other hand, for the 77 HV not recruited from the HV database, word-of-mouth (56.1%) was the main means of recruitment. The male/female ratio of the 210 HV was 0.5 and mean age 43.5 years (Standard Deviation = 12.4). The main motivations given for participating in the trial were to support research (87.6%) and receive emergency first-aid training (85.7%). Overall satisfaction with the welcome process was significantly higher for older HV (46-60 years) (adjusted odds ratio (AOR): 3.44; 95% confidence interval (95% CI): 1.48-7.99), and for HV in management jobs (AOR: 4.26; 95% CI: 1.22-14.87). Satisfaction with protocol management was higher for women (AOR: 2.33; 95% CI: 1

  6. Clinical protection against caprine herpesvirus 1 genital infection by intranasal administration of a live attenuated glycoprotein E negative bovine herpesvirus 1 vaccine

    Directory of Open Access Journals (Sweden)

    Meurens François

    2007-12-01

    Full Text Available Abstract Background Caprine herpesvirus 1 (CpHV-1 is responsible of systemic diseases in kids and genital diseases leading to abortions in goats. CpHV-1 is widespread and especially in Mediterranean countries as Greece, Italy and Spain. CpHV-1 is antigenically and genetically closely related to bovine herpesvirus 1 (BoHV-1. Taking into account the biological properties shared by these two viruses, we decided in the current study to assess the protection of a live attenuated glycoprotein E (gE negative BoHV-1 vaccine against a genital CpHV-1 infection in goats. Results The vaccine was inoculated intranasally twice three weeks apart followed by a subsequent CpHV-1 intravaginal challenge which is the natural route of infection in three goats. To analyse the safety and the efficacy of this marker vaccine, two groups of three goats served as controls: one immunised with a virulent CpHV-1 and one uninoculated until the challenge. Goats were clinically monitored and all sampling procedures were carried out in a blind manner. The vaccine did not induce any undesirable local or systemic reaction and goats did not excrete gE-negative BoHV-1. After challenge, a significant reduction in disease severity was observed in immunised goats. Moreover, goats immunised with either gE-negative BoHV-1 or CpHV-1 exhibited a significant reduction in the length and the peak of viral excretion. Antibodies neutralising both BoHV-1 and CpHV-1 were raised in immunised goats. Conclusion Intranasal application of a live attenuated gE-negative BoHV-1 vaccine is able to afford a clinical protection and a reduction of virus excretion in goats challenged by a CpHV-1 genital infection.

  7. Ozone Synthesis Efficiency Upgrading in the Pulsed Point-to-Plane Gas Discharge

    International Nuclear Information System (INIS)

    Golota, V.I.; Zavada, L.M.; Kotyukov, O.V.; Polyakov, A.V.; Pugach, S.G.

    2006-01-01

    Results are reported from the studies into electrodynamic characteristics of the barrierless point-to-plane gas discharge as a HV pulse of positive polarity is applied to the point electrode. The efficiency of ozone synthesis has been determined as a function of the length and repetition frequency of the HV pulse. It has been demonstrated that the electrodynamic characteristics of the discharge and the efficiency of ozone synthesis in oxygen-containing gas mixtures essentially depend on the parameters of HV power supply. The HV switch HTS-300 (BEHLKE Electronic GmbH) was used for HV pulse shaping

  8. Intraspecific bovine herpesvirus 1 recombinants carrying glycoprotein E deletion as a vaccine marker are virulent in cattle.

    Science.gov (United States)

    Muylkens, Benoît; Meurens, François; Schynts, Frédéric; Farnir, Frédéric; Pourchet, Aldo; Bardiau, Marjorie; Gogev, Sacha; Thiry, Julien; Cuisenaire, Adeline; Vanderplasschen, Alain; Thiry, Etienne

    2006-08-01

    Vaccines used in control programmes of Bovine herpesvirus 1 (BoHV-1) utilize highly attenuated BoHV-1 strains marked by a deletion of the glycoprotein E (gE) gene. Since BoHV-1 recombinants are obtained at high frequency in experimentally coinfected cattle, the consequences of recombination on the virulence of gE-negative BoHV-1 were investigated. Thus, gE-negative BoHV-1 recombinants were generated in vitro from several virulent BoHV-1 and one mutant BoHV-1 deleted in the gC and gE genes. Four gE-negative recombinants were tested in the natural host. All the recombinants were more virulent than the gE-negative BoHV-1 vaccine and the gC- and gE-negative parental BoHV-1. The gE-negative recombinant isolated from a BoHV-1 field strain induced the highest severe clinical score. Latency and reactivation studies showed that three of the recombinants were reexcreted. Recombination can therefore restore virulence of gE-negative BoHV-1 by introducing the gE deletion into a different virulence background.

  9. A Reverse-Genetics Mutational Analysis of the Barley HvDWARF Gene Results in Identification of a Series of Alleles and Mutants with Short Stature of Various Degree and Disturbance in BR Biosynthesis Allowing a New Insight into the Process

    Czech Academy of Sciences Publication Activity Database

    Gruszka, D.; Gorniak, M.; Glodowska, E.; Wierus, E.; Oklešťková, Jana; Janeczko, A.; Maluszynski, M.; Szarejko, I.

    2016-01-01

    Roč. 17, č. 4 (2016), s. 600 E-ISSN 1422-0067 R&D Projects: GA MŠk(CZ) LO1204 Institutional support: RVO:61389030 Keywords : barley * biosynthesis * brassinosteroids Subject RIV: EB - Genetics ; Molecular Biology Impact factor: 3.226, year: 2016

  10. Expression of Nudix hydrolase genes in barley under UV irradiation

    Science.gov (United States)

    Tanaka, Sayuri; Sugimoto, Manabu; Kihara, Makoto

    Seed storage and cultivation should be necessary to self-supply foods when astronauts would stay and investigate during long-term space travel and habitation in the bases on the Moon and Mars. Thought the sunlight is the most importance to plants, both as the ultimate energy source and as an environmental signal regulating growth and development, UV presenting the sunlight can damage many aspects of plant processes at the physiological and DNA level. Especially UV-C, which is eliminated by the stratospheric ozone layer, is suspected to be extremely harmful and give a deadly injury to plants in space. However, the defense mechanism against UV-C irradiation damage in plant cells has not been clear. In this study, we investigated the expression of Nudix hydrolases, which defense plants from biotic / abiotic stress, in barley under UV irradiation. The genes encoding the amino acid sequences, which show homology to those of 28 kinds of Nudix hydrolases in Arabidopsis thaliana, were identified in the barley full-length cDNA library. BLAST analysis showed 14 kinds of barley genes (HvNUDX1-14), which encode the Nudix motif sequence. A phylogenetic tree showed that HvNUDX1, HvNUDX7, HvNUDX9 and HvNUDX11 belonged to the ADP-ribose pyrophosphohydrolase, ADP-sugar pyrophosphohydrolase, NAD(P)H pyrophosphohydrolase and FAD pyrophosphohydrolase subfamilies, respectively, HvNUDX3, HvNUDX6, and HvNUDX8 belonged to the Ap _{n}A pyrophosphohydrolase subfamilies, HvNUDX5 and HvNUDX14 belonged to the coenzyme A pyrophosphohydrolase subfamilies, HvNUDX12 and HvNUDX13 belonged to the Ap _{4}A pyrophosphohydrolase subfamilies. Induction of HvNUDX genes by UV-A (340nm), UV-B (312nm), and UV-C (260nm) were analyzed by quantitative RT-PCR. The results showed that HvNUDX4 was induced by UV-A and UV-B, HvNUDX6 was induced by UV-B and UV-C, and HvNUDX7 and HvNUDX14 were induced by UV-C, significantly. Our results suggest that the response of HvNUDXs to UV irradiation is different by UV

  11. Analysis of Radar Images of Angkor, Cambodia

    Science.gov (United States)

    Freeman, Anthony; Hensley, Scott; Moore, Elizabeth

    2000-01-01

    During the 1996 AIRSAR Pacific Rim Deployment, data were collected over Angkor in Cambodia. The temples of Angkor date the succession of cities to the 9th-13th century AD, but little is known of its prehistoric habitation. A related area of archaeological debate has been the origin, spiritual meaning and use of the hydraulic constructions in the urban zone. The high resolution, multi-channel capability of AIRSAR, together with the unprecedentedly accurate topography provided by TOPSAR, offer identification and delineation of these features. Examples include previously unrecorded circular earthworks around circular village sites, detection of unrecorded earthwork dykes, reservoirs and canal features, and of temple sites located some distance from the main temple complex at Angkor.

  12. Differential Infection Patterns and Recent Evolutionary Origins of Equine Hepaciviruses in Donkeys

    Science.gov (United States)

    Walter, Stephanie; Rasche, Andrea; Moreira-Soto, Andrés; Pfaender, Stephanie; Bletsa, Magda; Corman, Victor Max; Aguilar-Setien, Alvaro; García-Lacy, Fernando; Hans, Aymeric; Todt, Daniel; Schuler, Gerhard; Shnaiderman-Torban, Anat; Steinman, Amir; Roncoroni, Cristina; Veneziano, Vincenzo; Rusenova, Nikolina; Sandev, Nikolay; Rusenov, Anton; Zapryanova, Dimitrinka; García-Bocanegra, Ignacio; Jores, Joerg; Carluccio, Augusto; Veronesi, Maria Cristina; Cavalleri, Jessika M. V.; Drosten, Christian; Lemey, Philippe

    2016-01-01

    ABSTRACT The hepatitis C virus (HCV) is a major human pathogen. Genetically related viruses in animals suggest a zoonotic origin of HCV. The closest relative of HCV is found in horses (termed equine hepacivirus [EqHV]). However, low EqHV genetic diversity implies relatively recent acquisition of EqHV by horses, making a derivation of HCV from EqHV unlikely. To unravel the EqHV evolutionary history within equid sister species, we analyzed 829 donkeys and 53 mules sampled in nine European, Asian, African, and American countries by molecular and serologic tools for EqHV infection. Antibodies were found in 278 animals (31.5%), and viral RNA was found in 3 animals (0.3%), all of which were simultaneously seropositive. A low RNA prevalence in spite of high seroprevalence suggests a predominance of acute infection, a possible difference from the mostly chronic hepacivirus infection pattern seen in horses and humans. Limitation of transmission due to short courses of infection may explain the existence of entirely seronegative groups of animals. Donkey and horse EqHV strains were paraphyletic and 97.5 to 98.2% identical in their translated polyprotein sequences, making virus/host cospeciation unlikely. Evolutionary reconstructions supported host switches of EqHV between horses and donkeys without the involvement of adaptive evolution. Global admixture of donkey and horse hepaciviruses was compatible with anthropogenic alterations of EqHV ecology. In summary, our findings do not support EqHV as the origin of the significantly more diversified HCV. Identification of a host system with predominantly acute hepacivirus infection may enable new insights into the chronic infection pattern associated with HCV. IMPORTANCE The evolutionary origins of the human hepatitis C virus (HCV) are unclear. The closest animal-associated relative of HCV occurs in horses (equine hepacivirus [EqHV]). The low EqHV genetic diversity implies a relatively recent acquisition of EqHV by horses

  13. Differential Infection Patterns and Recent Evolutionary Origins of Equine Hepaciviruses in Donkeys.

    Science.gov (United States)

    Walter, Stephanie; Rasche, Andrea; Moreira-Soto, Andrés; Pfaender, Stephanie; Bletsa, Magda; Corman, Victor Max; Aguilar-Setien, Alvaro; García-Lacy, Fernando; Hans, Aymeric; Todt, Daniel; Schuler, Gerhard; Shnaiderman-Torban, Anat; Steinman, Amir; Roncoroni, Cristina; Veneziano, Vincenzo; Rusenova, Nikolina; Sandev, Nikolay; Rusenov, Anton; Zapryanova, Dimitrinka; García-Bocanegra, Ignacio; Jores, Joerg; Carluccio, Augusto; Veronesi, Maria Cristina; Cavalleri, Jessika M V; Drosten, Christian; Lemey, Philippe; Steinmann, Eike; Drexler, Jan Felix

    2017-01-01

    The hepatitis C virus (HCV) is a major human pathogen. Genetically related viruses in animals suggest a zoonotic origin of HCV. The closest relative of HCV is found in horses (termed equine hepacivirus [EqHV]). However, low EqHV genetic diversity implies relatively recent acquisition of EqHV by horses, making a derivation of HCV from EqHV unlikely. To unravel the EqHV evolutionary history within equid sister species, we analyzed 829 donkeys and 53 mules sampled in nine European, Asian, African, and American countries by molecular and serologic tools for EqHV infection. Antibodies were found in 278 animals (31.5%), and viral RNA was found in 3 animals (0.3%), all of which were simultaneously seropositive. A low RNA prevalence in spite of high seroprevalence suggests a predominance of acute infection, a possible difference from the mostly chronic hepacivirus infection pattern seen in horses and humans. Limitation of transmission due to short courses of infection may explain the existence of entirely seronegative groups of animals. Donkey and horse EqHV strains were paraphyletic and 97.5 to 98.2% identical in their translated polyprotein sequences, making virus/host cospeciation unlikely. Evolutionary reconstructions supported host switches of EqHV between horses and donkeys without the involvement of adaptive evolution. Global admixture of donkey and horse hepaciviruses was compatible with anthropogenic alterations of EqHV ecology. In summary, our findings do not support EqHV as the origin of the significantly more diversified HCV. Identification of a host system with predominantly acute hepacivirus infection may enable new insights into the chronic infection pattern associated with HCV. The evolutionary origins of the human hepatitis C virus (HCV) are unclear. The closest animal-associated relative of HCV occurs in horses (equine hepacivirus [EqHV]). The low EqHV genetic diversity implies a relatively recent acquisition of EqHV by horses, limiting the time span for

  14. Coordinated and sequential transcription of the cyprinid herpesvirus-3 annotated genes.

    Science.gov (United States)

    Ilouze, Maya; Dishon, Arnon; Kotler, Moshe

    2012-10-01

    Cyprinid herpesvirus-3 (CyHV-3) is the cause of a fatal disease in carp and koi fish. The disease is seasonal and appears when water temperatures range from 18 to 28°C. CyHV-3 is a member of the Alloherpesviridae, a family in the Herpesvirales order that encompasses mammalian, avian and reptilian viruses. CyHV-3 is a large double-stranded DNA (dsDNA) herpesvirus with a genome of approximately 295kbp, divergent from other mammalian, avian and reptilian herpesviruses, but bearing several genes similar to cyprinid herpesvirus-1 (CyHV-1), CyHV-2, anguillid herpesvirus-1 (AngHV-1), ictalurid herpesvirus-1 (IcHV-1) and ranid herpes virus-1 (RaHV-1). Here we show that viral DNA synthesis commences 4-8h post-infection (p.i.), and is completely inhibited by pre-treatment with cytosine β-d-arabinofuranoside (Ara-C). Transcription of CyHV-3 genes initiates after infection as early as 1-2h p.i., and precedes viral DNA synthesis. All 156 annotated open reading frames (ORFs) of the CyHV-3 genome are transcribed into RNAs, most of which can be classified into immediate early (IE or α), early (E or β) and late (L or γ) classes, similar to all other herpesviruses. Several ORFs belonging to these groups are clustered along the viral genome. Copyright © 2012 Elsevier B.V. All rights reserved.

  15. Genome and Transcriptome Sequencing of the Ostreid herpesvirus 1 From Tomales Bay, California

    Science.gov (United States)

    Burge, C. A.; Langevin, S.; Closek, C. J.; Roberts, S. B.; Friedman, C. S.

    2016-02-01

    Mass mortalities of larval and seed bivalve molluscs attributed to the Ostreid herpesvirus 1 (OsHV-1) occur globally. OsHV-1 was fully sequenced and characterized as a member of the Family Malacoherpesviridae. Multiple strains of OsHV-1 exist and may vary in virulence, i.e. OsHV-1 µvar. For most global variants of OsHV-1, sequence data is limited to PCR-based sequencing of segments, including two recent genomes. In the United States, OsHV-1 is limited to detection in adjacent embayments in California, Tomales and Drakes bays. Limited DNA sequence data of OsHV-1 infecting oysters in Tomales Bay indicates the virus detected in Tomales Bay is similar but not identical to any one global variant of OsHV-1. In order to better understand both strain variation and virulence of OsHV-1 infecting oysters in Tomales Bay, we used genomic and transcriptomic sequencing. Meta-genomic sequencing (Illumina MiSeq) was conducted from infected oysters (n=4 per year) collected in 2003, 2007, and 2014, where full OsHV-1 genome sequences and low overall microbial diversity were achieved from highly infected oysters. Increased microbial diversity was detected in three of four samples sequenced from 2003, where qPCR based genome copy numbers of OsHV-1 were lower. Expression analysis (SOLiD RNA sequencing) of OsHV-1 genes expressed in oyster larvae at 24 hours post exposure revealed a nearly complete transcriptome, with several highly expressed genes, which are similar to recent transcriptomic analyses of other OsHV-1 variants. Taken together, our results indicate that genome and transcriptome sequencing may be powerful tools in understanding both strain variation and virulence of non-culturable marine viruses.

  16. Sequence analysis of the 5′ third of glycoprotein C gene of South American bovine herpesviruses 1 and 5

    Energy Technology Data Exchange (ETDEWEB)

    Traesel, C.K.; Bernardes, L.M. [Setor de Virologia, Departamento de Medicina Veterinária Preventiva, Universidade Federal de Santa Maria, Santa Maria, RS (Brazil); Spilki, F.R. [Laboratório de Microbiologia Molecular, Universidade Feevale, Novo Hamburgo, RS (Brazil); Weiblen, R.; Flores, E.F. [Setor de Virologia, Departamento de Medicina Veterinária Preventiva, Universidade Federal de Santa Maria, Santa Maria, RS (Brazil)

    2015-03-06

    Bovine herpesviruses 1 (BoHV-1) and 5 (BoHV-5) share high genetic and antigenic similarities, but exhibit marked differences in tissue tropism and neurovirulence. The amino-terminal region of glycoprotein C (gC), which is markedly different in each of the viruses, is involved in virus binding to cellular receptors and in interactions with the immune system. This study investigated the genetic and antigenic differences of the 5′ region of the gC (5′ gC) gene (amino-terminal) of South American BoHV-1 (n=19) and BoHV-5 (n=25) isolates. Sequence alignments of 374 nucleotides (104 amino acids) revealed mean similarity levels of 97.3 and 94.2% among BoHV-1 gC (gC1), respectively, 96.8 and 95.6% among BoHV-5 gC (gC5), and 62 and 53.3% between gC1 and gC5. Differences included the absence of 40 amino acid residues (27 encompassing predicted linear epitopes) scattered throughout 5′ gC1 compared to 5′ gC5. Virus neutralizing assays testing BoHV-1 and BoHV-5 antisera against each isolate revealed a high degree of cross-neutralization between the viruses, yet some isolates were neutralized at very low titers by heterologous sera, and a few BoHV-5 isolates reacted weakly with either sera. The virus neutralization differences observed within the same viral species, and more pronounced between BoHV-1 and BoHV-5, likely reflect sequence differences in neutralizing epitopes. These results demonstrate that the 5′ gC region is well conserved within each viral species but is divergent between BoHV-1 and BoHV-5, likely contributing to their biological and antigenic differences.

  17. Development of a 130-mA, 75-kV high voltage column for high-intensity dc proton injectors

    International Nuclear Information System (INIS)

    Sherman, J.; Arvin, A.; Hansborough, L.; Hodgkins, D.; Meyer, E.; Schneider, J.D.; Stevens, R.R. Jr.; Zaugg, T.

    1997-01-01

    A reliable high-voltage (HV) column has been developed for dc proton injectors with applications to high-intensity cw linacs. The HV column is coupled with a microwave-driven plasma generator to produce a 75-keV, 110-mA dc proton beam. Typical proton fraction from this source is 85--90%, requiring the HV column and accelerating electrodes to operate with a 130-mA hydrogen-ion beam current. A glow-discharge, which was caused by the ion source axial magnetic field, was initially observed in the HV column. This problem was solved by scaling the electron production processes, the magnetic field, and the HV column pressure into a favorable regime. A subsequent 168 hour reliability run on the 75-keV injector showed that the ion source (plasma generator and HV column) has >98% beam availability

  18. High voltage processing of the SLC polarized electron gun

    International Nuclear Information System (INIS)

    Saez, P.; Clendenin, J.; Garden, C.; Hoyt, E.; Klaisner, L.; Prescott, C.; Schultz, D.; Tang, H.

    1993-04-01

    The SLC polarized electron gun operates at 120 kV with very low dark current to maintain the ultra high vacuum (UHV). This strict requirement protects the extremely sensitive photocathode from contaminants caused by high voltage (HV) activity. Thorough HV processing is thus required x-ray sensitive photographic film, a nanoammeter in series with gun power supply, a radiation meter, a sensitive residual gas analyzer and surface x-ray spectrometry were used to study areas in the gun where HV activity occurred. By reducing the electric field gradients, carefully preparing the HV surfaces and adhering to very strict clean assembly procedures, we found it possible to process the gun so as to reduce both the dark current at operating voltage and the probability of HV discharge. These HV preparation and processing techniques are described

  19. Investigation of latent infections caused by cyprinid herpesvirus 3 in koi ( Cyprinus carpio) in southern China.

    Science.gov (United States)

    Zheng, Shucheng; Wang, Qing; Bergmann, Sven M; Li, Yingying; Zeng, Weiwei; Wang, Yingying; Liu, Chun; Shi, Cunbin

    2017-05-01

    Although herpesviruses such as cyprinid herpesvirus 3 (CyHV-3) can establish lifelong latent infections, little is known about latency conditions in farmed koi populations in China. We used nested polymerase chain reaction targeting the TK gene and an indirect antibody ELISA to screen asymptomatic fish obtained from southern China for evidence of CyHV-3 infection. CyHV-3 DNA could be detected either in peripheral blood leukocytes or from gills of asymptomatic koi. Most koi sera did not contain anti-CyHV-3 antibodies; however, 5 samples were ELISA positive, providing evidence of prior CyHV-3 infections. These findings suggest that koi may survive CyHV-3 infections and become virus carriers.

  20. Psittacid herpesvirus 3 infection in the eclectus parrot (Eclectus roratus) in Australia.

    Science.gov (United States)

    Gabor, M; Gabor, L J; Peacock, L; Srivastava, M; Rosenwax, A; Phalen, D

    2013-11-01

    Psittacid herpesvirus 3 (PsHV-3) has recently been implicated as the cause of a severe respiratory disease in Bourke's parrots (Neopsephotus bourkii) in the United States. In this report, the clinical manifestations and gross and microscopic lesions of PsHV-3 infection in 2 eclectus parrots (Eclectus roratus) in Australia are described. The presence of a PsHV-3 infection was confirmed by polymerase chain reaction amplification and sequencing of PsHV-3 DNA using degenerate and PsHV-3 primers. Electron microscopy of infected cells demonstrated the assembly of herpesvirus virions as well as intranuclear tubular structures. The detection of PsHV-3 in Australia in 2 eclectus parrots broadens the list of known affected species and confirms the presence of this virus in Australia.

  1. The prevalence of ovine herpesvirus-2 in 4 sheep breeds from different regions in South Africa

    Directory of Open Access Journals (Sweden)

    C.W. Bremer

    2010-05-01

    Full Text Available About 90% of bovine malignant catarrhal fever (BMCF PCR-positive cases in South Africa are caused by alcelaphine herpesvirus-1 (AlHV-1 and the other 10 % by ovine herpesvirus-2 (OvHV-2. The prevalence of OvHV-2 in different sheep breeds in South Africa was determined in order to investigate whether the lower incidence of BMCF caused by OvHV-2 in comparison with AlHV-1 can be ascribed to a low incidence of the virus in sheep. A single-tube hemi-nested PCR was developed, evaluated and applied to detect OvHV-2 DNA. The prevalence of the virus in 4 sheep breeds from various regions in South Africa was shown to be 77 %. No statistically significant difference was found amongst the sheep breeds tested.

  2. INFECÇÃO EXPERIMENTAL DE BEZERROS COM RECOMBINANTES DO HERPESVÍRUS BOVINO TIPO 5 COM DELEÇÕES NOS GENES DA GLICOPROTEÍNA E, TIMIDINA QUINASE E AMBOS

    OpenAIRE

    Cyndia Mara Bezerra dos Santos

    2010-01-01

    O herpesvírus bovino tipo 5 (BoHV-5) é o agente de doença neurológica grave em bovinos. A utilização de vacinas recombinantes tem sido preconizada para o controle da infecção pelo BoHV-5. O objetivo do presente trabalho foi investigar a patogenia, em bezerros, de três recombinantes do BoHV-5, com deleções nos genes da glicoproteína E (BoHV-5gEΔ), da enzima timidina quinase (BoHV-5TKΔ) ou ambos (BoHV-5gETKΔ) para uso potencial em vacinas. Para isso, quatro grupos de bezerros com...

  3. Planar channeled relativistic electrons and positrons in the field of resonant hypersonic wave

    International Nuclear Information System (INIS)

    Grigoryan, L.Sh.; Mkrtchyan, A.H.; Khachatryan, H.F.; Tonoyan, V.U.; Wagner, W.

    2003-01-01

    The wave function of a planar channeled relativistic particle (electron, positron) in a single crystal excited by longitudinal hypersonic vibrations (HVs) is determined. The obtained expression is valid for periodic (not necessarily harmonic) HV of desired profile and single crystals with an arbitrary periodic continuous potential. A revised formula for the wave number of HV that exert resonance influence on the state of a channeled particle was deduced to allow for non-linear effects due to the influence of HV

  4. Genetic characterization of complete open reading frame of glycoprotein C gene of bovine herpesvirus 1

    Directory of Open Access Journals (Sweden)

    Saurabh Majumder

    2013-10-01

    Full Text Available Aim: To characterize one of the major glycoprotein genes viz., glycoprotein C (gC; UL44, unique long region 44 of bovineherpesvirus 1(BoHV1 of Indian origin at genetic and phylogenetic level.Materials and Methods: A bovine herpesvirus 1 isolate viz., (BoHV1/IBR 216 II/ 1976/ India maintained at Division ofVirology, IVRI, Mukteswar was used for the current study. The DNA was extracted using commercial kit and the completeORF of gC gene was amplified, cloned, and sequenced by conventional Sanger sequencing method. The sequence wasgenetically and phylogenetically analysed using various bioinformatic tools. The sequence was submitted in the Genbankwith accession number Kc756965.Results: The complete ORF of gC gene was amplified and sequenced. It showed 100% sequence homology with referencecooper strain of BoHV1 and divergence varied from 0% to 2.7% with other isolates of BoHV1. The isolate under study haddivergence of 9.2%, 13%, 26.6%, and 9.2% with BoHV5 (Bovine herpesvirus 5, CvHV1 (Cervid herpesvirus 1, CpHV1(Caprine herpesvirus 1, and BuHV1 (Bubaline herpesvirus 1, respectively.Conclusion: This is the first genetic characterization of complete open reading frame (ORF of glycoprotein C gene (UL44 ofIndian isolate of BoHV1. The gC gene of BoHV1 is highly conserved among all BoHV1 isolates and it can be used as a targetfor designing diagnostic primers for the specific detection of BoHV1.

  5. A caprine herpesvirus 1 vaccine adjuvanted with MF59™ protects against vaginal infection and interferes with the establishment of latency in goats.

    Directory of Open Access Journals (Sweden)

    Mariarosaria Marinaro

    Full Text Available The immunogenicity and the efficacy of a beta-propiolactone-inactivated caprine herpesvirus 1 (CpHV-1 vaccine adjuvanted with MF59™ were tested in goats. Following two subcutaneous immunizations, goats developed high titers of CpHV-1-specific serum and vaginal IgG and high serum virus neutralization (VN titers. Peripheral blood mononuclear cells (PBMC stimulated in vitro with inactivated CpHV-1 produced high levels of soluble IFN-gamma and exhibited high frequencies of IFN-gamma producing cells while soluble IL-4 was undetectable. On the other hand, control goats receiving the inactivated CpHV-1 vaccine without adjuvant produced only low serum antibody responses. A vaginal challenge with virulent CpHV-1 was performed in all vaccinated goats and in naïve goats to assess the efficacy of the two vaccines. Vaginal disease was not detected in goats vaccinated with inactivated CpHV-1 plus MF59™ and these animals had undetectable levels of infectious challenge virus in their vaginal washes. Goats vaccinated with inactivated CpHV-1 in the absence of adjuvant exhibited a less severe disease when compared to naïve goats but shed titers of challenge virus that were similar to those of naïve goats. Detection and quantitation of latent CpHV-1 DNA in sacral ganglia in challenged goats revealed that the inactivated CpHV-1 plus MF59™ vaccine was able to significantly reduce the latent viral load when compared either to the naïve goats or to the goats vaccinated with inactivated CpHV-1 in the absence of adjuvant. Thus, a vaccine composed of inactivated CpHV-1 plus MF59™ as adjuvant was strongly immunogenic and induced effective immunity against vaginal CpHV-1 infection in goats.

  6. Numerical Analysis of the Photo-Dissociation/Radical Oxidation of Formaldehyde by Ultraviolet Light in a Photolytic Reactor

    Science.gov (United States)

    1993-12-01

    airstream. For example, the photolytic reactor may not provide any additional benefit in a pollution control device which treats specific emissions ...Atomic Hydrogen Reactions (H*): HHO ~hv -H*+HC0* ),nm 1.30E-Ss -1 [PlA] Atkinson H2O2+hv -.H*+HO2* Xnm 0, (4b - 0) [PSC] Atkinson H202+hv

  7. A Caprine Herpesvirus 1 Vaccine Adjuvanted with MF59™ Protects against Vaginal Infection and Interferes with the Establishment of Latency in Goats

    Science.gov (United States)

    Marinaro, Mariarosaria; Rezza, Giovanni; Del Giudice, Giuseppe; Colao, Valeriana; Tarsitano, Elvira; Camero, Michele; Losurdo, Michele; Buonavoglia, Canio; Tempesta, Maria

    2012-01-01

    The immunogenicity and the efficacy of a beta-propiolactone-inactivated caprine herpesvirus 1 (CpHV-1) vaccine adjuvanted with MF59™ were tested in goats. Following two subcutaneous immunizations, goats developed high titers of CpHV-1-specific serum and vaginal IgG and high serum virus neutralization (VN) titers. Peripheral blood mononuclear cells (PBMC) stimulated in vitro with inactivated CpHV-1 produced high levels of soluble IFN-gamma and exhibited high frequencies of IFN-gamma producing cells while soluble IL-4 was undetectable. On the other hand, control goats receiving the inactivated CpHV-1 vaccine without adjuvant produced only low serum antibody responses. A vaginal challenge with virulent CpHV-1 was performed in all vaccinated goats and in naïve goats to assess the efficacy of the two vaccines. Vaginal disease was not detected in goats vaccinated with inactivated CpHV-1 plus MF59™ and these animals had undetectable levels of infectious challenge virus in their vaginal washes. Goats vaccinated with inactivated CpHV-1 in the absence of adjuvant exhibited a less severe disease when compared to naïve goats but shed titers of challenge virus that were similar to those of naïve goats. Detection and quantitation of latent CpHV-1 DNA in sacral ganglia in challenged goats revealed that the inactivated CpHV-1 plus MF59™ vaccine was able to significantly reduce the latent viral load when compared either to the naïve goats or to the goats vaccinated with inactivated CpHV-1 in the absence of adjuvant. Thus, a vaccine composed of inactivated CpHV-1 plus MF59™ as adjuvant was strongly immunogenic and induced effective immunity against vaginal CpHV-1 infection in goats. PMID:22511971

  8. Hyperintense vessels on FLAIR: A useful non-invasive method for assessing intracerebral collaterals

    International Nuclear Information System (INIS)

    Liu Wenhua; Xu Gelin; Yue Xuanye; Wang Xiaoliang; Ma Minmin; Zhang Renliang; Wang Handong; Zhou Changsheng; Liu Xinfeng

    2011-01-01

    Objective: This study was aimed to evaluate relationship between hyperintense vessels (HV) on fluid-attenuated inversion recovery (FLAIR) and artery steno-occlusion related intracerebral collaterals. Materials and methods: A total of 233 patients with 260 atherosclerotic lesions in the M1 segment of the middle cerebral artery (MCA) were examined with FLAIR and digital subtraction angiography (DSA). HV were graded as 0, 1, 2 and 3 by its distributions in the MCA territory. Grade 0 indicated no HV; Grade 1 indicated the HV limited in Sylvian fissure; Grade 2 indicated the HV limited in Sylvian fissure and the temporal-occipital junction; Grade 3 indicated the HV extended to frontal-parietal lobes. Collateral blood flows were classified by DSA results. The relationship between HV grades and patterns of collateral flows was analyzed. Results: HV were observed in 76 out of 260 hemispheres. For patients with Grade 1 HV, most of their collateral flows (80.8%) were antegrade; for patients with Grade 2, the retrograde leptomeningeal flows were commonly manifested as anterior cerebral artery to MCA (75%); for patients with Grade 3 HV, most of the retrograde leptomeningeal flows were manifested as posterior cerebral artery to MCA (81.8%). As the grade HV increased, the frequency of retrograde leptomeningeal collateral from ACA to MCA decreased (100% to 75% and to 18.2%), and increased (0% to 25% and to 81.8%) for the retrograde leptomeningeal collateral via PCA to MCA (P < 0.001). Conclusions: The HV could assess non-invasively intracerebral collaterals in patients with steno-occlusive lesions of M1 segment of MCA.

  9. Genomic sequence of Heliothis virescens ascovirus 3g isolated from Spodoptera exigua.

    Science.gov (United States)

    Huang, Guo-Hua; Wang, Yun-Sheng; Wang, Xing; Garretson, Tyler A; Dai, Liang-Ying; Zhang, Chuan-Xi; Cheng, Xiao-Wen

    2012-11-01

    Heliothis virescens ascovirus 3a (HvAV-3a), a member of the family Ascoviridae, has the highest diversity among ascovirus species that have been reported in Australia, Indonesia, China, and the United States. To understand the diversity and origin of this important ascovirus, the complete genome of the HvAV Indonesia strain (HvAV-3g), isolated from Spodoptera exigua, was determined to be 199,721 bp, with a G+C content of 45.9%. Therefore, HvAV-3g has the largest genome among the reported ascovirus genomes to date. There are 194 predicted open reading frames (ORFs) encoding proteins of 50 or more amino acid residues. In comparison to HvAV-3e reported from Australia, HvAV-3g has all the ORFs in HvAV-3e with 6 additional ORFs unique to HvAV-3g, including 1 peptidase C26 gene with the highest identity to Drosophila spp. and 2 gas vesicle protein U (GvpU) genes with identities to Bacillus megaterium. The five unique homologous regions (hrs) and 25 baculovirus repeat ORFs (bro) of HvAV-3g are highly variable.

  10. A mitochondrial DNA SNP multiplex assigning Caucasians into 36 haplo- and subhaplogroups

    DEFF Research Database (Denmark)

    Mikkelsen, Martin; Rockenbauer, Eszter; Sørensen, Erik

    2008-01-01

    Mitochondrial DNA (mtDNA) is maternally inherited without recombination events and has a high copy number, which makes mtDNA analysis feasible even when genomic DNA is sparse or degraded. Here, we present a SNP typing assay with 33 previously described mtDNA coding region SNPs for haplogroup...... previously typed by sequencing of the mitochondrial HV1 and HV2 regions. Haplogroup assignments based on mtDNA coding region SNPs and sequencing of HV1 and HV2 regions gave identical results for 27% of the samples, and except for one sample, differences in haplogroup assignments were at the subhaplogroup...

  11. The high-voltage system for the LHCb RICH hybrid photon detectors

    International Nuclear Information System (INIS)

    Arnaboldi, C.; Bellunato, T.; De Lucia, A.; Fanchini, E.; Perego, D.L.; Pessina, G.

    2009-01-01

    We describe the characterization of the high-voltage (HV) distribution system designed and produced for the pixel hybrid photon detectors of the ring imaging Cherenkov counters of the LHCb experiment. The HV system consists of a series of printed circuit boards with a specific layout designed to prevent any discharge arising from high electric fields. The system has dedicated monitoring and control features to supervise HV set-up during data taking. The full production of the HV system has been now completed and all the boards have been fully characterized and installed in the detector, which is currently being commissioned.

  12. Concomitant infection of Neospora caninum and Bovine Herpesvirus type 5 in spontaneous bovine abortions

    Directory of Open Access Journals (Sweden)

    Maia S. Marin

    2013-11-01

    Full Text Available Bovine Herpesvirus type 5 (BoHV-5 has not been conclusively demonstrated to cause bovine abortion. Brain lesions produced by Neospora caninum and Bovine Herpesvirus type 1 (BoHV-1 exhibit common features. Therefore, careful microscopic evaluation and additional diagnostic procedures are required to achieve an accurate final etiological diagnosis. The aim of the present work was to investigate the occurrence of infections due to BoHV-1, BoHV-5 and N. caninum in 68 cases of spontaneous bovine abortions which showed microscopic lesions in the fetal central nervous system. This study allowed the identification of 4 (5.9% fetuses with dual infection by BoHV-5 and N. caninum and 33 (48.5% cases in which N. caninum was the sole pathogen identified. All cases were negative to BoHV-1. The results of this study provide evidence that dual infection by BoHV-5 and N. caninum occur during pregnancy in cattle; however, the role of BoHV-5 as a primary cause of bovine abortion needs further research. Molecular diagnosis of BoHV-5 and N. caninum confirmed the importance of applying complementary assays to improve the sensitivity of diagnosing bovine abortion.

  13. Pronación del dedo gordo en el hallux valgus

    OpenAIRE

    Gómez Galván, Mercedes

    2015-01-01

    La pronación del dedo gordo en el hallux valgus (HV) es difícil de estudiar y cuantificar. Objetivos: evaluar la pronación del dedo gordo en el HV. Material y métodos: estudio prospectivo de 132 pacientes con HV que estaban en lista de espera quirúrgica y grupo control de 30 pacientes sin HV. Se realizó un estudio experimental con 6 falanges proximales creando un sistema de calibrado que permitía controlar su pronación a 0º, 10º, 20º, 30º, 40º, 50º y 60º. El paciente se coloca...

  14. Ultrastructural and histopathologic findings after pars plana vitrectomy with a new hypersonic vitrector system. Qualitative preliminary assessment.

    Directory of Open Access Journals (Sweden)

    Salvador Pastor-Idoate

    Full Text Available Preliminary assessment of a new prototype ultrasound-based hypersonic vitrector (HV by qualitatively examining the histopathological changes in the retina and vitreous body after pars plana vitrectomy (PPV and its ability to fragment vitreous collagen.Fourteen porcine cadaveric eyes, 20 eyes in live swine and six human cadaveric eyes underwent PPV using the HV or a pneumatic guillotine vitrector (GV. An additional 4 porcine crystalline lenses were touched with either the HV or GV for 1 minute. Following PPV, human vitreous was removed and processed for electron microscopy (EM. Eyes and lenses were fixed and sectioned for light microscopy (LM.There were no macroscopic retinal or optic nerve defects associated with either HV or GV PPVs. Cadaveric retinal specimens showed separation of the inner limiting membrane (ILM and vacuolization and fragmentation at the nerve fiber layer (NFL and the ganglion cell layer (GCL. ILM fragmentation and separation were found after PPV in live swine with both vitrectors. Small disruptions of the posterior capsule or structural lens defects were found after HV touch. The EM analysis revealed more fragmentation of human vitreous collagen fibrils after HV compared to GV PPV.LM and EM analysis of retina, vitreous, and crystalline lens after PPV showed similar morphological changes using the HV or the GV. Vitreous fragmentation appeared more effective with the HV. Overall this study suggests that the HV may be a promising new technology. More work is needed to quantitatively assess its safety and efficacy.

  15. Congenital abnormalities associated with hemivertebrae in relation to hemivertebrae location.

    Science.gov (United States)

    Bollini, Gerard; Launay, Franck; Docquier, Pierre-Louis; Viehweger, Elke; Jouve, Jean-Luc

    2010-01-01

    Numerous congenital abnormalities have been reported in association with hemivertebrae (HV). No data exist about their incidence depending on the location of the HV. From 1980 to 2003, 75 patients with 80 HV responsible for evolutive congenital scoliosis were managed by HV resection using a double approach and short anterior and posterior convex fusion. The associated abnormalities were evaluated with MRI, echocardiography and renal ultrasound. Associated genitourinary abnormalities were found in 24% of patients, cardiac abnormalities in 8% and intrathecal abnormalities in 15%. Medullar abnormalities were more frequent in case of vertebral malformations at lumbosacral level.

  16. Epigenetic chromatin modifiers in barley: IV. The study of barley Polycomb group (PcG genes during seed development and in response to external ABA

    Directory of Open Access Journals (Sweden)

    Stanca Michele A

    2010-04-01

    Full Text Available Abstract Background Epigenetic phenomena have been associated with the regulation of active and silent chromatin states achieved by modifications of chromatin structure through DNA methylation, and histone post-translational modifications. The latter is accomplished, in part, through the action of PcG (Polycomb group protein complexes which methylate nucleosomal histone tails at specific sites, ultimately leading to chromatin compaction and gene silencing. Different PcG complex variants operating during different developmental stages have been described in plants. In particular, the so-called FIE/MEA/FIS2 complex governs the expression of genes important in embryo and endosperm development in Arabidopsis. In our effort to understand the epigenetic mechanisms regulating seed development in barley (Hordeum vulgare, an agronomically important monocot plant cultivated for its endosperm, we set out to characterize the genes encoding barley PcG proteins. Results Four barley PcG gene homologues, named HvFIE, HvE(Z, HvSu(z12a, and HvSu(z12b were identified and structurally and phylogenetically characterized. The corresponding genes HvFIE, HvE(Z, HvSu(z12a, and HvSu(z12b were mapped onto barley chromosomes 7H, 4H, 2H and 5H, respectively. Expression analysis of the PcG genes revealed significant differences in gene expression among tissues and seed developmental stages and between barley cultivars with varying seed size. Furthermore, HvFIE and HvE(Z gene expression was responsive to the abiotic stress-related hormone abscisic acid (ABA known to be involved in seed maturation, dormancy and germination. Conclusion This study reports the first characterization of the PcG homologues, HvFIE, HvE(Z, HvSu(z12a and HvSu(z12b in barley. All genes co-localized with known chromosomal regions responsible for malting quality related traits, suggesting that they might be used for developing molecular markers to be applied in marker assisted selection. The Pc

  17. High-voltage test and measuring techniques

    CERN Document Server

    Hauschild, Wolfgang

    2014-01-01

    It is the intent of this book to combine high-voltage (HV) engineering with HV testing technique and HV measuring technique. Based on long-term experience gained by the authors as lecturer and researcher as well as member in international organizations, such as IEC and CIGRE, the book will reflect the state of the art as well as the future trends in testing and diagnostics of HV equipment to ensure a reliable generation, transmission and distribution of electrical energy. The book is intended not only for experts but also for students in electrical engineering and high-voltage engineering.

  18. Decreased hyperintense vessels on FLAIR images after endovascular recanalization of symptomatic internal carotid artery occlusion

    International Nuclear Information System (INIS)

    Liu Wenhua; Yin Qin; Yao Lingling; Zhu Shuanggen; Xu Gelin; Zhang Renliang; Ke Kaifu; Liu Xinfeng

    2012-01-01

    Background and purpose: Hyperintense vessels (HV) on fluid-attenuated inversion recovery (FLAIR) images were assumed to be explained by slow antegrade or retrograde leptomeningeal collateral flow related to extracranial or intracranial artery steno-occlusion. The aim of this study was to investigate the effect of recanalization after endovascular therapy of symptomatic internal carotid artery (ICA) occlusion on the presence of HV. Methods: Eleven patients with symptomatic ICA occlusion were retrospectively enrolled. Changes in the HV on FLAIR images were examined in affected hemisphere of each patient after successful treatment with endovascular recanalization (angioplasty, n = 3; stent-assisted angioplasty, n = 8). The relationship between postoperative changes in the HV and Thrombolysis In Cerebral Ischemia (TICI) scale (I-III) was assessed. Results: After operation, HV of the 11 affected hemispheres were showed to be decreased (n = 3) or disappeared (n = 8) in treated side. The median interval between pre- and postoperative MRI examinations was 97.0 h (range, from 69. to 48.7 h). Of the 8 patients with disappeared HV, 7 achieved high TICI grade flow (III) and 1 had relatively low TICI grade flow (IIc) in treated side. However, all the 3 patients with decreased HV were found to be relatively low TICI grade flow (IIc). Conclusion: Our data indicate that endovascular recanalization of ICA occlusion was effective for decreasing HV. Postoperative decrease in HV can be considered as a marker for hemodynamic improvement.

  19. Initial Detection and Molecular Characterization of Namaycush Herpesvirus (Salmonid Herpesvirus 5) in Lake Trout.

    Science.gov (United States)

    Glenney, Gavin W; Barbash, Patricia A; Coll, John A

    2016-03-01

    A novel herpesvirus was found by molecular methods in samples of Lake Trout Salvelinus namaycush from Lake Erie, Pennsylvania, and Lake Ontario, Keuka Lake, and Lake Otsego, New York. Based on PCR amplification and partial sequencing of polymerase, terminase, and glycoprotein genes, a number of isolates were identified as a novel virus, which we have named Namaycush herpesvirus (NamHV) salmonid herpesvirus 5 (SalHV5). Phylogenetic analyses of three NamHV genes indicated strong clustering with other members of the genus Salmonivirus, placing these isolates into family Alloherpesviridae. The NamHV isolates were identical in the three partially sequenced genes; however, they varied from other salmonid herpesviruses in nucleotide sequence identity. In all three of the genes sequenced, NamHV shared the highest sequence identity with Atlantic Salmon papillomatosis virus (ASPV; SalHV4) isolated from Atlantic Salmon Salmo salar in northern Europe, including northwestern Russia. These results lead one to believe that NamHV and ASPV have a common ancestor that may have made a relatively recent host jump from Atlantic Salmon to Lake Trout or vice versa. Partial nucleotide sequence comparisons between NamHV and ASPV for the polymerase and glycoprotein genes differ by >5% and >10%, respectively. Additional nucleotide sequence comparisons between NamHV and epizootic epitheliotropic disease virus (EEDV/SalHV3) in the terminase, glycoprotein, and polymerase genes differ by >5%, >20%, and >10%, respectively. Thus, NamHV and EEDV may be occupying discrete ecological niches in Lake Trout. Even though NamHV shared the highest genetic identity with ASPV, each of these viruses has a separate host species, which also implies speciation. Additionally, NamHV has been detected over the last 4 years in four separate water bodies across two states, which suggests that NamHV is a distinct, naturally replicating lineage. This, in combination with a divergence in nucleotide sequence from EEDV

  20. Final report on RMO Vickers key comparison COOMET M.H-K1

    Science.gov (United States)

    Aslanyan, E.; Menelao, F.; Herrmann, K.; Aslanyan, A.; Pivovarov, V.; Galat, E.; Dovzhenko, Y.; Zhamanbalin, M.

    2013-01-01

    This report describes a COOMET key comparison on Vickers hardness scales involving five National Metrology Institutes: PTB (Germany), BelGIM (Belarus), NSC IM (Ukraine), KazInMetr (Kazakhstan) and VNIIFTRI (Russia). The pilot laboratory was VNIIFTRI, and PTB acted as the linking institute to key comparisons CCM.H-K1.b and CCM.H-K1.c conducted for the Vickers hardness scales HV1 and HV30, respectively. The comparison was also conducted for the HV5 Vickers hardness scale, since this scale is most frequently used in practice in Russia and CIS countries that work according to GOST standards. In the key comparison, two sets of hardness reference blocks for the Vickers hardness scales HV1, HV5 and HV30 consisting each of three hardness reference blocks with hardness levels of 450 HV and 750 HV were used. The measurement results and uncertainty assessments for HV1 and HV30 hardness scales, as announced by BelGIM, NSC IM, KazInMetr and VNIIFTRI, are in good agreement with the key comparison reference values of CCM.H-K1.b and CCM.H-K1.c. The comparison results for the HV5 hardness scale are viewed as additional information, since up to today no CCM key comparisons on this scale have yet been carried out. Main text. To reach the main text of this paper, click on Final Report. Note that this text is that which appears in Appendix B of the BIPM key comparison database kcdb.bipm.org/. The final report has been peer-reviewed and approved for publication by the CCM, according to the provisions of the CIPM Mutual Recognition Arrangement (CIPM MRA).

  1. Methyl vitamins contribute to obesogenic effects of a high multivitamin gestational diet and epigenetic alterations in hypothalamic feeding pathways in Wistar rat offspring.

    Science.gov (United States)

    Cho, Clara E; Pannia, Emanuela; Huot, Pedro S P; Sánchez-Hernández, Diana; Kubant, Ruslan; Dodington, David W; Ward, Wendy E; Bazinet, Richard P; Anderson, G Harvey

    2015-03-01

    High multivitamin (HV, tenfold AIN-93G) gestational diets fed to Wistar rats increase food intake, obesity, and characteristics of metabolic syndrome in the offspring. We hypothesized that methyl vitamins, and specifically folate, in the HV gestational diet contribute to the obesogenic phenotypes consistent with their epigenetic effects on hypothalamic food intake regulatory mechanisms. Male offspring of dams fed the AIN-93G diet with high methyl vitamins (HMethyl; tenfold folate, vitamins B12, and B6) (Study 1) and HV with recommended folate (HVRF) (Study 2) were compared with those from HV and recommended vitamin (RV) fed dams. All offspring were weaned to a high fat diet for 8 wks. HMethyl diet, similar to HV, and compared to RV, resulted in higher food intake, body weight, and metabolic disturbances. Removing folate additions to the HV diet in HVRF offspring normalized the obesogenic phenotype. Methyl vitamins, and folate in HV diets, altered hypothalamic gene expression toward increased food intake concurrent with DNA methylation and leptin and insulin receptor signaling dysfunction. Methyl vitamins in HV gestational diets contribute to obesogenic phenotypes and epigenetic alterations in the hypothalamic feeding pathways in the offspring. Folate alone accounts for many of these effects. © 2014 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim.

  2. Modélisation de la rugosité et de la dureté de surface par la ...

    African Journals Online (AJOL)

    The turning surface roughness about 2.5 μm was decreased to 0.15 μm after burnishing, while the hardness about 176 HV was increased to 226 HV. Statistically based on experimental design (response surface methodology) using central composite second-order rotatable design was used to establish a mathematical ...

  3. Microhardness studies on nonlinear optical L-alanine single crystals

    Indian Academy of Sciences (India)

    evaporation technique over a load range of 10–50 g on selected broad (2 0 3) plane. Vickers (Hv) ... Meyer's index number (n) calculated from Hv shows that the material belongs to the soft material .... where Hk is Knoop microhardness value at a particular load, ... Chenthamarai S, Jayaraman D, Ushasree P M, Meera K,.

  4. Mechanism of the re-buildup phenomenon in moyamoya disease; Analysis of local cerebral hemodynamics with intra-arterial digital subtraction angiography

    Energy Technology Data Exchange (ETDEWEB)

    Touho, Hajime; Karasawa, Jun; Shishido, Hisashi; Morisako, Toshitaka; Yamada, Keisuke; Nagai, Shigeki; Shibamoto, Kenji [Osaka Neurological Institute, Osaka (Japan)

    1990-10-01

    The authors investigated the mechanism of the re-buildup phenomenon on electroencephalogram in 14 patients of moyamoya disease with superficial temporal artery-middle cerebral artery anastomosis. Visualization of the lateral view of the common carotid angiography was performed with intra-arterial digital subtraction angiography (IA-DSA), using a 4/sec x 3 sec + 2/sec x 5 sec + 1/sec x 5 sec film sequence. The catheter tip was inserted into C5/6 level and 250 mgl/ml of iopamidol was used as the contrast agent; 6 ml in total was injected over 1.5 seconds. Circulation times of the common carotid artery (C{sub 3} portion)-ascending parietal vein ({delta}TTP{sub s}) and common carotid artery-internal cerebral vein ({delta}TTP{sub D}) were measured before hyperventilation (HV), immediately after HV, and 3 minutes after HV during pre- and postoperative periods. {delta}TTP{sub D} in the preoperative period was prolonged by HV and was normalized at 3 minutes after HV but {delta}TTP{sub S} were prolonged immediately after and 3 minutes after HV. In the postoperative period, however, these values did not change significantly immediately after and 3 minutes after HV. These findings indicate that delayed cerebral blood flow response to HV is a pathogenetic factor of the re-buildup phenomenon in moyamoya disease. (author).

  5. The vaccines for Bovine Herpesvirus Type 1: A review | Zhao ...

    African Journals Online (AJOL)

    Bovine herpesvirus type 1 (BoHV-1) is the pathogen of Infectious Bovine Rhinothracheitis (IBR) disease, causing great economic losses in the livestock industry. Vaccine is a powerful means to control the virus. Here, the review described the currently available knowledge regarding to the advance in the field of BoHV-1 ...

  6. Structure of the starch-debranching enzyme barley limit dextrinase reveals homology of the N-terminal domain to CBM21

    DEFF Research Database (Denmark)

    Møller, Marie Sofie; Abou Hachem, Maher; Svensson, Birte

    2012-01-01

    Barley limit dextrinase (HvLD) is a debranching enzyme from glycoside hydrolase family 13 subfamily 13 (GH13_13) that hydrolyses α-1,6-glucosidic linkages in limit dextrins derived from amylopectin. The structure of HvLD was solved and refined to 1.9 Å resolution. The structure has a glycerol...

  7. Ultrasound evaluation of intrinsic plantar muscles and fascia in hallux valgus: A case-control study.

    Science.gov (United States)

    Lobo, César Calvo; Marín, Alejandro Garrido; Sanz, David Rodríguez; López, Daniel López; López, Patricia Palomo; Morales, Carlos Romero; Corbalán, Irene Sanz

    2016-11-01

    A cross-sectional area (CSA) and thickness reduction of the abductor hallucis (AbH) is shown in subjects with hallux valgus (HV). To date, other soft-tissue structures have not been researched in relation with HV. The aim of this study was to compare the CSA and thickness of the intrinsic plantar muscles and fascia (PF) between feet with and without HV. Therefore, a cross-sectional and case-control study was performed using B-mode with an iU22 Philips ultrasound system and a 5 to 17-MHz transducer. The CSA and thickness were measured for the AbH, flexor digitorum brevis (FDB) and flexor hallucis brevis (FHB), and also the thickness for the anterior, middle, and posterior PF portions. A convenience sample of 40 feet, 20 with HV and 20 without HV, was recruited from a clinical and research center. A multivariate regression analysis using linear regression was performed to evaluate the ultrasound imaging measurements (α = 0.05). Consequently, statistically significant differences were observed between the groups (P plantar fascia thickness increase in favor of the HV group. On the contrary, the FDB thickness and CSA did not show statistically significant differences (P ≥ 0.05). In conclusion, the CSA and thickness of the AbH and FHB intrinsic plantar muscles are reduced, whereas the thickness of the anterior, middle, and posterior PF portions are increased, in subjects with HV compared with those without HV.

  8. High copy number of ovine gammaherpesvirus 2 DNA associated with malignant catarrhal fever-like syndrome in a lamb

    Science.gov (United States)

    Domestic and wild sheep are the natural reservoirs for ovine gammaherpesvirus 2 (OvHV-2), the causative agent of sheep-associated malignant catarrhal fever (SA-MCF). Virtually all domestic sheep are infected with OvHV-2 and infection is normally subclinical. MCF-like clinical signs and typical histo...

  9. A redox-dependent dimerization switch regulates activity and tolerance for reactive oxygen species of barley seed glutathione peroxidase

    DEFF Research Database (Denmark)

    Navrot, Nicolas; Skjoldager, Nicklas; Bunkenborg, Jakob

    2015-01-01

    Monomeric and dimeric forms of recombinant barley (Hordeum vulgare subsp. vulgare) glutathione peroxidase 2 (HvGpx2) are demonstrated to display distinctly different functional properties in vitro. Monomeric HvGpx2 thus has five fold higher catalytic efficiency than the dimer towards tert-butyl h...

  10. Genetic differentiation across North America in the generalist moth Heliothis virescens and the specialist H. subflexa

    NARCIS (Netherlands)

    Groot, A.T.; Classen, A.; Inglis, O.; Blanco, C.A.; López Jr., J.; Vargas, A.T.; Schal, C.; Heckel, D.G.; Schöfl, G.

    2011-01-01

    The two moth species Heliothis virescens (Hv) and H. subflexa (Hs) are closely related, but have vastly different feeding habits. Hv is a generalist and an important pest in many crops in the USA, while Hs is a specialist feeding only on plants in the genus Physalis. In this study, we conducted a

  11. Massively parallel pyrosequencing of the mitochondrial genome with the 454 methodology in forensic genetics

    DEFF Research Database (Denmark)

    Mikkelsen, Martin; Frank-Hansen, Rune; Hansen, Anders Johannes

    2014-01-01

    RESULTS: of sequencing of whole mitochondrial genome, HV1 and HV2 DNA with the second generation system (SGS) Roche 454 GS Junior were compared with results of Sanger sequencing and SNP typing with SNaPshot single base extension detected with MALDI-TOF and capillary electrophoresis. We investigated...

  12. Bovine herpesvirus 1 interferes with TAP-dependent peptide transport and intracellular trafficking of MHC class I molecules in human cells

    NARCIS (Netherlands)

    Koppers-Lalic, D.; Rychlowski, M.; Leeuwen, D.; Rijsewijk, F.A.M.; Ressing, M.E.; Neefjes, J.J.; Bienkowska-Szewczyk, K.; Wiertz, E.

    2003-01-01

    Bovine herpesvirus 1 (BoHV-1), the cause of infectious bovine rhinotracheitis and infectious pustular vulvovaginitis in cattle, establishes a lifelong infection, despite the presence of antiviral immunity in the host. BoHV-1 has been shown to elude the host immune system, but the viral gene products

  13. A tuneable switch for controlling environmental degradation of bioplastics: addition of isothiazolinone to polyhydroxyalkanoates.

    Science.gov (United States)

    Woolnough, Catherine Anne; Yee, Lachlan Hartley; Charlton, Timothy Stuart; Foster, Leslie John Ray

    2013-01-01

    Controlling the environmental degradation of polyhydroxybutyrate (PHB) and polyhydroxyvalerate (P(HB-co-HV)) bioplastics would expand the range of their potential applications. Combining PHB and P(HB-co-HV) films with the anti-fouling agent 4,5-dichloro-2-n-octyl-4-isothiazolin-3-one (DCOI, bioplastics increases their potential use in biodegradable applications.

  14. Detection of novel strains of cyprinid herpesvirus closely related to koi herpesvirus

    NARCIS (Netherlands)

    Engelsma, M.Y.; Way, K.; Dodge, M.J.; Voorbergen-Laarman, H.A.; Panzarin, V.M.; Abbadi, M.; El-Matbouli, M.; Skall, H.F.; Kahns, S.; Stone, D.M.

    2013-01-01

    Cyprinid herpesvirus 3 (CyHV-3) or koi herpesvirus (KHV) is a devastating virus of carp. Using generic primers for the DNA polymerase and the major capsid protein genes of cyprinid herpesviruses, nucleotide sequences divergent from previously described CyHV-3 were obtained. At least 3 novel groups

  15. Detection of novel strains of cyprinid herpesvirus closely related to koi herpesvirus

    DEFF Research Database (Denmark)

    Engelsma, Marc Y.; Way, Keith; Dodge, Melanie J.

    2013-01-01

    Cyprinid herpesvirus 3 (CyHV-3) or koi herpesvirus (KHV) is a devastating virus of carp. Using generic primers for the DNA polymerase and the major capsid protein genes of cyprinid herpesviruses, nucleotide sequences divergent from previously described CyHV-3 were obtained. At least 3 novel groups...

  16. Proteomic characterization of murid herpesvirus 4 extracellular virions.

    Directory of Open Access Journals (Sweden)

    Sarah Vidick

    Full Text Available Gammaherpesvirinae, such as the human Epstein-Barr virus (EBV and the Kaposi's sarcoma associated herpesvirus (KSHV are highly prevalent pathogens that have been associated with several neoplastic diseases. As EBV and KSHV are host-range specific and replicate poorly in vitro, animal counterparts such as Murid herpesvirus-4 (MuHV-4 have been widely used as models. In this study, we used MuHV-4 in order to improve the knowledge about proteins that compose gammaherpesviruses virions. To this end, MuHV-4 extracellular virions were isolated and structural proteins were identified using liquid chromatography tandem mass spectrometry-based proteomic approaches. These analyses allowed the identification of 31 structural proteins encoded by the MuHV-4 genome which were classified as capsid (8, envelope (9, tegument (13 and unclassified (1 structural proteins. In addition, we estimated the relative abundance of the identified proteins in MuHV-4 virions by using exponentially modified protein abundance index analyses. In parallel, several host proteins were found in purified MuHV-4 virions including Annexin A2. Although Annexin A2 has previously been detected in different virions from various families, its role in the virion remains controversial. Interestingly, despite its relatively high abundance in virions, Annexin A2 was not essential for the growth of MuHV-4 in vitro. Altogether, these results extend previous work aimed at determining the composition of gammaherpesvirus virions and provide novel insights for understanding MuHV-4 biology.

  17. Increasing Weldability of Service-Aged Reformer Tubes by Partial Solution Annealing

    Science.gov (United States)

    Mostafaei, M.; Shamanian, M.; Purmohamad, H.; Amini, M.

    2016-04-01

    A dissimilar joint of 25Cr-35Ni/30Cr-48Ni (HP/HV) heat-resistant steels was evaluated. The investigations indicated that the as-cast HP alloy contained M7C3, M23C6, and NbC carbides and HV alloy with 5 wt.% tungsten, contained M23C6 and M6C carbides embedded in an austenitic matrix. After 8 years of ex-service aging at 1050 °C, the ductility of HP/HV reformer tubes was decreased dramatically, and thus, the repair welding of the aged HP/HV dissimilar joint was at a risk. In order to repair the aged reformer tubes and increase weldability properties, a new partial solution annealing treatment was designed. Mechanical testing results showed that partial solution annealing at 1200 °C for 6 h increased the elongation and toughness of the aged HP and HV alloys drastically. Also, a mechanism for constitutional liquation cracking in the heat-affected zones (HAZ) of the HP/HV dissimilar joint was proposed. In the HAZ of the aged HP/HV welded joint, the cracks around the locally melted carbides were initiated and propagated during carbides solidification at the cooling cycle of welding associated with the decrease in the ductility of the aged HP and HV alloys. In addition, Varestraint weldability test showed that the susceptibility to hot cracking was decreased with partial solution annealing.

  18. Preventing Perinatal Depression through Home Visiting: The Mothers and Babies Course

    Science.gov (United States)

    Perry, Deborah F.; Tandon, S. Darius; Edwards, Karen; Mendelson, Tamar

    2014-01-01

    Home visiting (HV) programs serve women at high risk for developing postpartum depression because of factors such as poverty and low social support. Depression poses serious threats not only to mother-child attachment and healthy infant development but also to women's ability to engage with HV services and supports. The Mothers and Babies (MB)…

  19. Cloning of Bovine herpesvirus type 1 and type 5 as infectious bacterial artifical chromosomes

    Directory of Open Access Journals (Sweden)

    Ackermann Mathias

    2009-10-01

    Full Text Available Abstract Background Bovine herpesviruses type 1 (BoHV1 and type 5 (BoHV5 are two closely related pathogens of cattle. The identity of the two viruses on the amino acid level averages 82%. Despite their high antigenetic similarities the two pathogens induce distinctive clinical signs. BoHV1 causes respiratory and genital tract infections while BoHV5 leads to severe encephalitis in calves. Findings The viral genomes of BoHV1 and BoHV5 were cloned as infectious bacterial artificial chromosomes (BACs. First, recombinant viruses carrying the genetic elements for propagation in bacteria were generated. Second, DNA from these recombinant viruses were transferred into prokaryotic cells. Third, DNA from these bacteria were transferred into eukaryotic cells. Progeny viruses from BAC transfections showed similar kinetics as their corresponding wild types. Conclusion The two viral genomes of BoHV1 and BoHV5 cloned as BACs are accessible to the tools of bacterial genetics. The ability to easily manipulate the viral genomes on a molecular level in future experiments will lead to a better understanding of the difference in pathogenesis induced by these two closely related bovine herpesviruses.

  20. ISOLATION AND CHARACTERIZATION OF COML, A TRANSCRIPTION UNIT INVOLVED IN COMPETENCE DEVELOPMENT OF BACILLUS-SUBTILIS

    NARCIS (Netherlands)

    VANSINDEREN, D; WITHOFF, S; BOELS, H; VENEMA, G

    1990-01-01

    Using the transformation-deficient mutant M465, which was previously isolated by means of insertional mutagenesis with plasmid pHV60, a transcription unit comL required for genetic competence of Bacillus subtilis was identified. A chromosomal DNA fragment flanking the inserted pHV60 was isolated and

  1. Transient Delivery of Adenosine as a Novel Therapy to Prevent Epileptogenesis

    Science.gov (United States)

    2015-10-01

    Chemother 6:98–101. Bukoski RD, Sparks HV, and Mela -Riker LM (1986) A role for mitochondria in myocardial adenosine production. Adv Exp Med Biol 194:157–167...Bukoski RD, Sparks HV, and Mela LM (1983) Rat heart mitochondria release adenosine. Biochem Biophys Res Commun 113:990–995. Burnstock G, Fredholm BB

  2. Isolation of innate immune response genes, expression analysis, polymorphism identification and development of genetic marker for linkage analysis in common carp (Cyprinus carpio)

    Science.gov (United States)

    Common carp are economically important foodfish worldwide. Over the past few years, carp aquaculture has suffered from enormous losses to a disease caused by cyprinid herpesvirus 3 (CyHV-3). A recent study reported that common carp strains/crossbreds have differential resistance to CyHV-3, suggest...

  3. Antibody screening identifies 78 putative host proteins involved in Cyprinid herpesvirus 3 infection or propagation in common carp, Cyprinus carpio L.

    Science.gov (United States)

    Gotesman, M; Soliman, H; El-Matbouli, M

    2014-01-01

    Cyprinid herpesvirus 3 (CyHV-3) is the aetiological agent of a serious and notifiable disease afflicting common and koi carp, Cyprinus carpio L., termed koi herpesvirus disease (KHVD). Significant progress has been achieved in the last 15 years, since the initial reports surfaced from Germany, USA and Israel of the CyHV-3 virus, in terms of pathology and detection. However, relatively few studies have been carried out in understanding viral replication and propagation. Antibody-based affinity has been used for detection of CyHV-3 in enzyme-linked immunosorbent assay and PCR-based techniques, and immunohistological assays have been used to describe a CyHV-3 membrane protein, termed ORF81. In this study, monoclonal antibodies linked to N-hydroxysuccinimide (NHS)-activated spin columns were used to purify CyHV-3 and host proteins from tissue samples originating in either CyHV-3 symptomatic or asymptomatic fish. The samples were next analysed either by polyacrylamide gel electrophoresis (PAGE) and subsequently by electrospray ionization coupled to mass spectrometry (ESI-MS) or by ESI-MS analysis directly after purification. A total of 78 host proteins and five CyHV-3 proteins were identified in the two analyses. These data can be used to develop novel control methods for CyHV-3, based on pathways or proteins identified in this study. PMID:23347276

  4. Evolution of the Fermi surface of the strongly correlated f electron system under hydrostatic and uniaxial pressures

    CERN Document Server

    Aoki, H; Endo, M; Nakayama, M; Takei, H; Kimura, N; Kunii, S; Terashima, T; Uji, S; Matsumoto, T

    2002-01-01

    We report our recent developments of experimental systems for measuring the de Haas-van Alphen (dHvA) effect under hydrostatic and uniaxial pressures. The dHvA effect of CeB sub 6 has been studied under both hydrostatic and uniaxial pressures and the effects of the pressures on the electronic structure are discussed.

  5. Pulse electrodeposition and corrosion properties of Ni–Si3N4 ...

    Indian Academy of Sciences (India)

    Administrator

    Smooth composite deposits containing well-distributed silicon nitride particles were ... The micro hardness of the composite coatings (720 HV) was higher than that of pure nickel. (310 HV) due to ... compared to pure metal or alloy (Jeon et al 2008). Nano- ... Among these factors, the type of applied cu- rrent is one of the most ...

  6. Dicty_cDB: SSK522 [Dicty_cDB

    Lifescience Database Archive (English)

    Full Text Available SAMPLING. 914 0.0 3 AF307748 |AF307748.1 Tn10 delivery vector pHV1249 transposas...i str. ATCC ... 296 1e-78 AF307748_1( AF307748 |pid:none) Tn10 delivery vector pHV1249 trans... 296 1e-78 AC

  7. The High-Voltage System of Calet Apparatus

    Directory of Open Access Journals (Sweden)

    Petroni Francesco

    2017-01-01

    This paper presents the experience gained in the implementation of the CALET HV system: the system design requirements and the technical solutions adopted, the two system sections block schemes and the main characteristics of the DC/DC converters that guarantee the CALET HV system technical performance.

  8. Polarization properties of linearly polarized parabolic scaling Bessel beams

    Energy Technology Data Exchange (ETDEWEB)

    Guo, Mengwen; Zhao, Daomu, E-mail: zhaodaomu@yahoo.com

    2016-10-07

    The intensity profiles for the dominant polarization, cross polarization, and longitudinal components of modified parabolic scaling Bessel beams with linear polarization are investigated theoretically. The transverse intensity distributions of the three electric components are intimately connected to the topological charge. In particular, the intensity patterns of the cross polarization and longitudinal components near the apodization plane reflect the sign of the topological charge. - Highlights: • We investigated the polarization properties of modified parabolic scaling Bessel beams with linear polarization. • We studied the evolution of transverse intensity profiles for the three components of these beams. • The intensity patterns of the cross polarization and longitudinal components can reflect the sign of the topological charge.

  9. An Ultra-wideband and Polarization-independent Metasurface for RCS Reduction.

    Science.gov (United States)

    Su, Pei; Zhao, Yongjiu; Jia, Shengli; Shi, Wenwen; Wang, Hongli

    2016-02-11

    In this paper, an ultra-wideband and polarization-independent metasurface for radar cross section (RCS) reduction is proposed. The unit cell of the metasurface operates in a linear cross-polarization scheme in a broad band. The phase and amplitude of cross-polarized reflection can be separately controlled by its geometry and rotation angle. Based on the diffuse reflection theory, a 3-bit coding metasurface is designed to reduce the RCS in an ultra-wide band. The wideband property of the metasurface benefits from the wideband cross polarization conversion and flexible phase modulation. In addition, the polarization-independent feature of the metasurface is achieved by tailoring the rotation angle of each element. Both the simulated and measured results demonstrate that the proposed metasurface can reduce the RCS significantly in an ultra-wide frequency band for both normal and oblique incidences, which makes it promising in the applications such as electromagnetic cloaking.

  10. Isolation and characterisation of a ruminant alphaherpesvirus closely related to bovine herpesvirus 1 in a free-ranging red deer

    Directory of Open Access Journals (Sweden)

    Belák Sándor

    2007-09-01

    Full Text Available Abstract Background The genus Varicellovirus of the Herpesviridae subfamily Alphaherpesvirinae includes a cluster of viruses antigenically and genetically related to bovine herpesvirus 1 (BoHV-1: namely bovine herpesvirus 5 (BoHV-5, bubaline herpesvirus 1 (BuHV-1, caprine herpesvirus 1 (CpHV-1, cervid herpesviruses 1 (CvHV-1 and 2 (CvHV-2 and elk herpesvirus 1 (ElkHV-1. Considering the serological relationship between these ruminant alphaherpesviruses, several surveys have studied the occurrence of BoHV-1 related virus infection in wild and domestic ruminant species. In this way, a recent investigation has indicated, in Belgium, a high increase in the serological prevalence of BoHV-1 related virus infection in free-ranging red deer population. In this context, it has been decided to investigate the presence of an alphaherpesvirus spreading in the Belgian free-ranging red deer population. Results The current study reports the first isolation in a free-ranging red deer of a BoHV-1 closely related virus. The isolate was antigenically, genomically and genetically characterised by comparison with several ruminant alphaherpesvirus. Immunofluorescence assays revealed the isolate was antigenically distinct from bovine and caprine alphaherpesviruses. Similarly, BamHI and BstEII restriction analyses demonstrated the genomic difference between the isolate and the other ruminant alphaherpesviruses. Next, the sequencing of selected parts of UL27 and US8 genes showed a high degree of homologies between each BoHV-1 related ruminant alphaherpesvirus and the isolate. Besides the close relationship between all ruminant alphaherpesviruses, the phylogenetic analysis revealed that the isolate clustered with CvHV-1. Conclusion The first isolation of a virus closely related to BoHV-1 in a free-ranging red deer is reported. Data demonstrate that a CvHV-1 strain, named Anlier, circulates in wild red deer in continental Europe. Anlier strain show consistent differences

  11. Accumulation of a poly(hydroxyalkanoate) copolymer containing primarily 3-hydroxyvalerate from simple carbohydrate substrates by Rhodococcus sp. NCIMB 40126.

    Science.gov (United States)

    Haywood, G W; Anderson, A J; Williams, D R; Dawes, E A; Ewing, D F

    1991-04-01

    A number of taxonomically-related bacteria have been identified which accumulate poly(hydroxyalkanoate) (PHA) copolymers containing primarily 3-hydroxyvalerate (3HV) monomer units from a range of unrelated single carbon sources. One of these, Rhodococcus sp. NCIMB 40126, was further investigated and shown to produce a copolymer containing 75 mol% 3HV and 25 mol% 3-hydroxybutyrate (3HB) from glucose as sole carbon source. Polyesters containing both 3HV and 3HB monomer units, together with 4-hydroxybutyrate (4HB), 5-hydroxyvalerate (5HV) or 3-hydroxyhexanoate (3HHx), were also produced by this organism from certain accumulation substrates. With valeric acid as substrate, almost pure (99 mol% 3HV) poly(3-hydroxyvalerate) was produced. N.m.r. analysis confirmed the composition of these polyesters. The thermal properties and molecular weight of the copolymer produced from glucose were comparable to those of PHB produced by Alcaligenes eutrophus.

  12. Thioredoxin reductase from barley: Structure, recognition of thioredoxin, protein engineering and catalytic mechanism

    DEFF Research Database (Denmark)

    Kirkensgaard, Kristine Groth

    eukaryotes but appears to be absent in most prokaryotes. The crystal structure of HvTrxh2 covalently bound to the barley α‐amylase/subtilisin inhibitor (BASI, Maeda et al., 2006a), allowed comparison of the molecular features involved in the interactions between HvTrxh2 and its electron donor (NTR...... of HvNTR2 and HvTrxh2 was built, using the structure of Escherichia coli NTR covalently bound to Trx (EcNTR:EcTrx) as a template (Lennon et al., 2000). The model provides new insight into how eukaryotic LMW NTRs in general bind Trx and suggests major differences in the NTR:Trx binding interface of Hv...

  13. A bovine herpesvirus 5 recombinant defective in the thymidine kinase (TK gene and a double mutant lacking TK and the glycoprotein E gene are fully attenuated for rabbits

    Directory of Open Access Journals (Sweden)

    S.C. Silva

    2010-02-01

    Full Text Available Bovine herpesvirus 5 (BoHV-5, the agent of herpetic meningoencephalitis in cattle, is an important pathogen of cattle in South America and several efforts have been made to produce safer and more effective vaccines. In the present study, we investigated in rabbits the virulence of three recombinant viruses constructed from a neurovirulent Brazilian BoHV-5 strain (SV507/99. The recombinants are defective in glycoprotein E (BoHV-5gEΔ, thymidine kinase (BoHV-5TKΔ and both proteins (BoHV-5gEΔTKΔ. Rabbits inoculated with the parental virus (N = 8 developed neurological disease and died or were euthanized in extremis between days 7 and 13 post-infection (pi. Infectivity was detected in several areas of their brains. Three of 8 rabbits inoculated with the recombinant BoHV-5gEΔ developed neurological signs between days 10 and 15 pi and were also euthanized. A more restricted virus distribution was detected in the brain of these animals. Rabbits inoculated with the recombinants BoHV-5TKΔ (N = 8 or BoHV-5gEΔTKΔ (N = 8 remained healthy throughout the experiment in spite of variable levels of virus replication in the nose. Dexamethasone (Dx administration to rabbits inoculated with the three recombinants at day 42 pi did not result in viral reactivation, as demonstrated by absence of virus shedding and/or increase in virus neutralizing titers. Nevertheless, viral DNA was detected in the trigeminal ganglia or olfactory bulbs of all animals at day 28 post-Dx, demonstrating they were latently infected. These results show that recombinants BoHV-5TKΔ and BoHV-5gEΔTKΔ are attenuated for rabbits and constitute potential vaccine candidates upon the confirmation of this phenotype in cattle.

  14. Functional characterisation of an intron retaining K+ transporter of barley reveals intron-mediated alternate splicing

    KAUST Repository

    Shahzad, K.

    2015-01-01

    Intron retention in transcripts and the presence of 5 and 3 splice sites within these introns mediate alternate splicing, which is widely observed in animals and plants. Here, functional characterisation of the K+ transporter, HvHKT2;1, with stably retained introns from barley (Hordeum vulgare) in yeast (Saccharomyces cerevisiae), and transcript profiling in yeast and transgenic tobacco (Nicotiana tabacum) is presented. Expression of intron-retaining HvHKT2;1 cDNA (HvHKT2;1-i) in trk1, trk2 yeast strain defective in K+ uptake restored growth in medium containing hygromycin in the presence of different concentrations of K+ and mediated hypersensitivity to Na+. HvHKT2;1-i produces multiple transcripts via alternate splicing of two regular introns and three exons in different compositions. HKT isoforms with retained introns and exon skipping variants were detected in relative expression analysis of (i) HvHKT2;1-i in barley under native conditions, (ii) in transgenic tobacco plants constitutively expressing HvHKT2;1-i, and (iii) in trk1, trk2 yeast expressing HvHKT2;1-i under control of an inducible promoter. Mixed proportions of three HKT transcripts: HvHKT2;1-e (first exon region), HvHKT2;1-i1 (first intron) and HvHKT2;1-i2 (second intron) were observed. The variation in transcript accumulation in response to changing K+ and Na+ concentrations was observed in both heterologous and plant systems. These findings suggest a link between intron-retaining transcripts and different splice variants to ion homeostasis, and their possible role in salt stress.

  15. Association Between Treatment at High-Volume Facilities and Improved Overall Survival in Soft Tissue Sarcomas.

    Science.gov (United States)

    Venigalla, Sriram; Nead, Kevin T; Sebro, Ronnie; Guttmann, David M; Sharma, Sonam; Simone, Charles B; Levin, William P; Wilson, Robert J; Weber, Kristy L; Shabason, Jacob E

    2018-03-15

    Soft tissue sarcomas (STS) are rare malignancies that require complex multidisciplinary management. Therefore, facilities with high sarcoma case volume may demonstrate superior outcomes. We hypothesized that STS treatment at high-volume (HV) facilities would be associated with improved overall survival (OS). Patients aged ≥18 years with nonmetastatic STS treated with surgery and radiation therapy at a single facility from 2004 through 2013 were identified from the National Cancer Database. Facilities were dichotomized into HV and low-volume (LV) cohorts based on total case volume over the study period. OS was assessed using multivariable Cox regression with propensity score-matching. Patterns of care were assessed using multivariable logistic regression analysis. Of 9025 total patients, 1578 (17%) and 7447 (83%) were treated at HV and LV facilities, respectively. On multivariable analysis, high educational attainment, larger tumor size, higher grade, and negative surgical margins were statistically significantly associated with treatment at HV facilities; conversely, black race and non-metropolitan residence were negative predictors of treatment at HV facilities. On propensity score-matched multivariable analysis, treatment at HV facilities versus LV facilities was associated with improved OS (hazard ratio, 0.87, 95% confidence interval, 0.80-0.95; P = .001). Older age, lack of insurance, greater comorbidity, larger tumor size, higher tumor grade, and positive surgical margins were associated with statistically significantly worse OS. In this observational cohort study using the National Cancer Database, receipt of surgery and radiation therapy at HV facilities was associated with improved OS in patients with STS. Potential sociodemographic disparities limit access to care at HV facilities for certain populations. Our findings highlight the importance of receipt of care at HV facilities for patients with STS and warrant further study into improving access to

  16. Compact U-Slotted Antenna for Broadband Radar Applications

    Directory of Open Access Journals (Sweden)

    S. Costanzo

    2013-01-01

    Full Text Available The original U-shaped patch antenna is properly modified in this work to provide a compact and broadband antenna configuration with reduced cross-polar effects, well suitable for modern radar applications. The proposed antenna layout is applied to design, realize, and test two different prototypes working at P-band and C-band, typically adopted for ground-penetrating radar. The experimental results successfully demonstrate a large operating bandwidth between 15% and 20%, a significant reduction of size (about half of the standard configuration, and a low cross-polarization level within the operating frequency range.

  17. The Use of Orthogonal Polarizations in Microwave Imagery of Isolated Canine Kidney

    Science.gov (United States)

    Larsen, L. E.; Jacobi, J. H.

    1980-06-01

    A method of imaging biological targets using microwave radiation at a frequency of 4 GHz is presented. Linearly polarized radiation is transmitted through an isolated canine kidney and received with co-polarized and cross-polarized antennas. Images are displayed as the spatial variation of the magnitude of the transmission scattering parameter S21 for each mode of polarization. The relationship between the spatial variation of the magnitude of S21 and canine renal anatomy is discussed. It is shown that within the kidney the cross-polarized image tends to emphasize linear or piecewise linear structures, whereas the co-polarized image balances renal cortical lobulations.

  18. Geologic mapping of the Hekla volcano (Iceland) using integrated data sets from optic and radar sensors

    Science.gov (United States)

    Wever, Tobias; Loercher, Gerhard

    1994-12-01

    During the MAC-Europe campaign in June/July 1991 different airborne data sets (AIRSAR, TMS and AVIRIS) were collected over Iceland. One test site is situated around the Hekla-volcano in South Iceland. This area is characterised by a sequence of lava flows of different ages together with tuffs and ashes. This case study shall contribute to demonstrate the potential of MAC-Europe data for geological mapping. The optical- and the SAR data was analysed separately to elaborate the preferences of the different sensors. An approach was carried out to process an image representing the advantages of the respective sensors in only one presentation. The synergetic approach improves the separation of geological units clearly by combination of two completely different data sets due to the utilisation of spectral bands in the visible and infrared region on one side and on the other side in the microwave region. Beside the petrographical information extracted from optical data using spectral signatures the combination includes physical information like roughness and dielectricity of a target. The geologic setting of the test area is characterised by a very uniform petrography hence the spectral signatures are showing only little variations. Due to this fact, the differentiation of geological units using optical data is limited. The additional use of SAR data establishes the new dimension of the surface roughness which improves the discrimination clearly. This additional parameter presents a new information tool about the state of weathering, age and sequence of the different lava flows. The NASA/JPL AIRSAR system is very suitable for this kind of investigation due to its multifrequency and polarimetric capabilities. The three SAR frequencies (C-, L- and P-Band) enable the detection of a broad range of roughness differences. These results can be enhanced by comprising the full scattering matrix of the polarimetric AIRSAR data.

  19. Radar Image with Color as Height, Sman Teng, Temple, Cambodia

    Science.gov (United States)

    2002-01-01

    This image of Cambodia's Angkor region, taken by NASA's Airborne Synthetic Aperture Radar (AIRSAR), reveals a temple (upper-right) not depicted on early 19th Century French archeological survey maps and American topographic maps. The temple, known as 'Sman Teng,' was known to the local Khmer people, but had remained unknown to historians due to the remoteness of its location. The temple is thought to date to the 11th Century: the heyday of Angkor. It is an important indicator of the strategic and natural resource contributions of the area northwest of the capitol, to the urban center of Angkor. Sman Teng, the name designating one of the many types of rice enjoyed by the Khmer, was 'discovered' by a scientist at NASA's Jet Propulsion Laboratory, Pasadena, Calif., working in collaboration with an archaeological expert on the Angkor region. Analysis of this remote area was a true collaboration of archaeology and technology. Locating the temple of Sman Teng required the skills of scientists trained to spot the types of topographic anomalies that only radar can reveal.This image, with a pixel spacing of 5 meters (16.4 feet), depicts an area of approximately 5 by 4.7 kilometers (3.1 by 2.9 miles). North is at top. Image brightness is from the P-band (68 centimeters, or 26.8 inches) wavelength radar backscatter, a measure of how much energy the surface reflects back toward the radar. Color is used to represent elevation contours. One cycle of color represents 25 meters (82 feet) of elevation change, so going from blue to red to yellow to green and back to blue again corresponds to 25 meters (82 feet) of elevation change.AIRSAR flies aboard a NASA DC-8 based at NASA's Dryden Flight Research Center, Edwards, Calif. In the TOPSAR mode, AIRSAR collects radar interferometry data from two spatially separated antennas (2.6 meters, or 8.5 feet). Information from the two antennas is used to form radar backscatter imagery and to generate highly accurate elevation data. Built

  20. Despeckling Polsar Images Based on Relative Total Variation Model

    Science.gov (United States)

    Jiang, C.; He, X. F.; Yang, L. J.; Jiang, J.; Wang, D. Y.; Yuan, Y.

    2018-04-01

    Relatively total variation (RTV) algorithm, which can effectively decompose structure information and texture in image, is employed in extracting main structures of the image. However, applying the RTV directly to polarimetric SAR (PolSAR) image filtering will not preserve polarimetric information. A new RTV approach based on the complex Wishart distribution is proposed considering the polarimetric properties of PolSAR. The proposed polarization RTV (PolRTV) algorithm can be used for PolSAR image filtering. The L-band Airborne SAR (AIRSAR) San Francisco data is used to demonstrate the effectiveness of the proposed algorithm in speckle suppression, structural information preservation, and polarimetric property preservation.

  1. Forest Modeling of Jack Pine Trees for BOREAS

    Science.gov (United States)

    Moghhadam, Mahta; Saatchi, Sasan

    1994-01-01

    As a part of the intensive field campaign for the Boreal forest ecosystem-atmosphere research (BOREAS) project in August 1993, the NASA/JPL AIRSAR covered an area of about 100 km by 100 km near the Prince Albert National Park in Saskatchewan, Canada. At the same time, ground-truth measurements were made in several stands which have been selected as the primary study sites, as well as in some auxiliary sites. This paper focuses on an area including Jack Pine stands in the Nipawin area near the park.

  2. Synergistic use of active and passive microwave in soil moisture estimation

    Science.gov (United States)

    O'Neill, P.; Chauhan, N.; Jackson, T.; Saatchi, S.

    1992-01-01

    Data gathered during the MACHYDRO experiment in central Pennsylvania in July 1990 have been utilized to study the synergistic use of active and passive microwave systems for estimating soil moisture. These data sets were obtained during an eleven-day period with NASA's Airborne Synthetic Aperture Radar (AIRSAR) and Push-Broom Microwave Radiometer (PBMR) over an instrumented watershed which included agricultural fields with a number of different crop covers. Simultaneous ground truth measurements were also made in order to characterize the state of vegetation and soil moisture under a variety of meteorological conditions. A combination algorithm is presented as applied to a representative corn field in the MACHYDRO watershed.

  3. On the potential of long wavelength imaging radars for mapping vegetation types and woody biomass in tropical rain forests

    Science.gov (United States)

    Rignot, Eric J.; Zimmermann, Reiner; Oren, Ram

    1995-01-01

    In the tropical rain forests of Manu, in Peru, where forest biomass ranges from 4 kg/sq m in young forest succession up to 100 kg/sq m in old, undisturbed floodplain stands, the P-band polarimetric radar data gathered in June of 1993 by the AIRSAR (Airborne Synthetic Aperture Radar) instrument separate most major vegetation formations and also perform better than expected in estimating woody biomass. The worldwide need for large scale, updated biomass estimates, achieved with a uniformly applied method, as well as reliable maps of land cover, justifies a more in-depth exploration of long wavelength imaging radar applications for tropical forests inventories.

  4. Obstruction of hepatic vein or inferior vena cava after liver transplantation: the diagnosis and interventional treatment

    International Nuclear Information System (INIS)

    Zhu Kangshun; Qian Jiesheng; Meng Xiaochun; Yi Shuhong; Pang Pengfei; He Keke; Jiang Zaibo; Lu Minqiang; Shan Hong

    2010-01-01

    Objective: To investigate the diagnosis and interventional therapeutic technology for the obstruction of hepatic vein (HV) or inferior vena cava (IVC) after liver transplantation. Methods: In the 831 patients who received orthotopic liver transplantation (OLT) and 26 patients who received living donor liver transplantation (LDLT), 11 cases were confirmed with HV or IVC obstruction by venography and received interventional treatment from 2 to 111 days after liver transplantation. Of the 11 patients, five had the obstruction of HV anastomosis, five had the obstruction of IVC anastomosis, and one had the obstruction of HV and IVC anastomosis. In the eleven patients, five patients underwent OLT, four patients underwent LDLT, and two pediatric patients underwent reduced-size OLT. Before interventional treatment, 9 patients function tests, clinical sympatom, and monitoring of HV or IVC flow. Pressure gradients before and after therapeutic technology of 11 cases were retrospectively analyzed. Results: In all 11 patients, CT or MRI could clearly show congested areas of the liver, and the location and degree of HV or IVC obstruction. Of the 11 patients, four with HV obstruction and five with IVC obstruction were treated with stent placement, one with HV obstruction was treated with percutaneous transluminal angioplasty (PTA), one with HV and IVC obstruction was treated with HV PTA and IVC stent placement. Interventional technical success was achieved in all patients. The venous pressure gradient across obstruction was significantly reduced from (16.5 ± 4.1) mm Hg (1 mm Hg =0.133 kPa) before the procedure to (2.9 ± 1.7) mm Hg after the procedure (t=11.5, P<0.01). Clinical improvement was noted in 10 patients except one pediatric patient who died of multiple-organs failure at the 9 th day after the treatment. During the follow-up period of 9 to 672 days, two patients with PTA treatment had recurrent HV stenosis within one month after treatment, no patient with stent

  5. Comparison between DNA Detection in Trigeminal Nerve Ganglia and Serology to Detect Cattle Infected with Bovine Herpesviruses Types 1 and 5.

    Directory of Open Access Journals (Sweden)

    Rodrigo Puentes

    Full Text Available Bovine herpesviruses (BoHVs types 1 (BoHV-1 and 5 (BoHV-5 are alphaherpesviruses of major importance to the bovine production chain. Such viruses are capable of establishing latent infections in neuronal tissues. Infected animals tend to develop a serological response to infection; however, such response-usually investigated by antibody assays in serum-may eventually not be detected in laboratory assays. Nevertheless, serological tests such as virus neutralization (VN and various enzyme-linked immunosorbent assays (ELISAs are widely employed to check individual or herd status of BoHV infections. The correlation between detection of antibodies and the presence of viral nucleic acids as indicatives of infection in infected cattle has not been deeply examined. In order to investigate such correlation, 248 bovine serum samples were tested by VN to BoHV-1 and BoHV-5, as well as in a widely employed (though not type-differential gB ELISA (IDEXX IBR gB X2 Ab Test in search for antibodies to BoHVs. Immediately after blood withdrawal, cattle were slaughtered and trigeminal ganglia (TG excised for DNA extraction and viral nucleic acid detection (NAD by nested PCR. Neutralizing antibodies to BoHV-1 and/or BoHV-5 were detected in 44.8% (111/248 of sera, whereas the gB ELISA detected antibodies in 51.2% (127/248 of the samples. However, genomes of either BoHV-1, BoHV-5, or both, were detected in TGs of 85.9% (213/248 of the animals. These findings reveal that the assays designed to detect antibodies to BoHV-1 and/or BoHV-5 employed here may fail to detect a significant number of latently infected animals (in this study, 35.7%. From such data, it is clear that antibody assays are poorly correlated with detection of viral genomes in BoHV-1 and BoHV-5-infected animals.

  6. Detecção molecular de herpesvírus bovino 1 e 5 em amostras de encéfalo conservadas em formol e emblocadas em parafina provenientes de bovinos com doença neurológica Molecular detection of bovine herpesvirus 1 and 5 in formalin-fixed, paraffin-embedded samples from cattle with neurological disease

    Directory of Open Access Journals (Sweden)

    Laura P. Arruda

    2010-08-01

    Full Text Available A infecção por herpesvírus bovino (BoHV é uma das principais causas de doença neurológica em bovinos na região Centro-Oeste do Brasil. O uso de técnicas moleculares de diagnóstico representa uma contribuição importante para o estudo dessa doença. Este trabalho descreve o uso de uma técnica específica de PCR multiplex para identificar BoHV-5 e BoHV-1 em 76 amostras de encéfalo de bovinos fixadas em formol e incluídas em parafina. Com base nas alterações histológicas, as amostras foram separadas em 2 grupos: o Grupo 1 era composto de 40 amostras de bovinos com meningoencefalite necrosante característica da infecção por BoHV; no Grupo 2 estavam 36 amostras de casos com encefalite não-supurativa inespecífica. Identificação de BoHV-5 foi constatada em 40% das amostras do grupo 1 e em 33% das amostras do grupo 2. Não houve amplificação de DNA de BoHV-1 em nenhuma amostra.Bovine herpesvirus (BoHV is an important cause of neurological disease in cattle in the Midwest Brazil. The application of molecular diagnostic techniques represents an important contribution for the study of BoHV. This paper describes the detection of BoHV-5 and BoHV-1 by a specific multiplex PCR assay in 76 paraffin-embedded samples from central nervous system (CNS of cattle with neurological disorders. The samples were divided into 2 groups according to the histological features: Group 1 was composed of 40 cases of necrotizing meningoencephalitis (characteristic of BoHV infection, and Group 2 was composed of 36 cases of nonspecific nonsuppurative meningoencephalitis. Positive results for BoHV-5 accounted for 40% of the samples in the group 1 and 33% in the group 2. No detection of BoHV-1 was recorded.

  7. Potential Noncutaneous Sites of Chelonid Herpesvirus 5 Persistence and Shedding in Green Sea Turtles Chelonia mydas.

    Science.gov (United States)

    Page-Karjian, Annie; Gottdenker, Nicole L; Whitfield, Jordyn; Herbst, Lawrence; Norton, Terry M; Ritchie, Branson

    2017-09-01

    Chelonid herpesvirus 5 (ChHV5), the likely etiologic agent of sea turtle fibropapillomatosis (FP), is predicted to be unevenly distributed within an infected turtle, in which productive virus replication and virion shedding occurs in cutaneous tumor keratinocytes. In this study, we measured and compared ChHV5 DNA quantities in tumors, skin, urine, major organs, and nervous tissue samples from green turtles Chelonia mydas. These samples were taken from the carcasses of 10 juvenile green turtles with and without clinical signs of FP that stranded in Florida during 2014. Quantitative PCR for ChHV5 UL30 was used to identify ChHV5 DNA in tumors, skin, heart, kidney, nerves, and urine sampled from five out of five FP-positive and three out of five FP-free turtles. The most frequently co-occurring sites were cutaneous tumor and kidney (n = 4). Novel data presented here include the identification of ChHV5 DNA in kidney, heart, and nerve samples from three FP-free turtles. These data support candidate nontumored anatomic sites of ChHV5 DNA localization and mobilization during two different disease states that may be involved in the ChHV5 infection cycle. Received September 8, 2016; accepted April 17, 2017.

  8. Burkholderia sacchari DSM 17165: A source of compositionally-tunable block-copolymeric short-chain poly(hydroxyalkanoates) from xylose and levulinic acid.

    Science.gov (United States)

    Ashby, Richard D; Solaiman, Daniel K Y; Nuñez, Alberto; Strahan, Gary D; Johnston, David B

    2018-04-01

    Burkholderia sacchari was used to produce poly-3-hydroxybutyrate-co-3-hydroxyvalerate block copolymers from xylose and levulinic acid. Levulinic acid was the preferred substrate resulting in 3-hydroxyvalerate (3HV) contents as high as 95 mol% at 24 h. The 3HB:3HV ratios were controlled by the initial levulinic acid media concentration and fermentation length. Higher levulinic acid concentrations and longer durations, resulted in polymers with two glass transition temperatures, each approximating those associated with poly-3HB and poly-3HV. 13 C NMR confirmed the presence of high concentrations of 3HB-3HB and 3HV-3HV homopolymeric dyads, while mass spectrometry of the partial hydrolysis products did not conform to Bernoullian statistics for randomness, confirming block sequences. MS/MS analysis of specific oligomers showed the mass-loss of 86 amu (a 3HB unit) and 100 amu (a 3HV unit) attesting to some randomness within the polymers. This study verifies the potential for producing Poly-3HB-block-3HV copolymers from inexpensive biorenewable feedstocks without sequential addition of carbon sources. Published by Elsevier Ltd.

  9. An investigation of age and yield of fresh fruit bunches of oil palm based on ALOS PALSAR 2

    Science.gov (United States)

    Darmawan, S.; Takeuchi, W.; Haryati, A.; M, R. Najib A.; Na'aim, M.

    2016-06-01

    The objective on this study is to investigate age and yield of FFB of oil palms based on ALOS PALSAR 2. Study areas in oil palm plantations areas of Jerantut, Pahang Malaysia. Methodology consists collecting of ALOS PALSAR 2 and tabular data on the study area, processing of ALOS PALSAR 2 including of converting digital numbers to normalize radar cross sections (NRCS), topography correction and filtering, making of regions of interest according to areas of age and yield of FFB of oil palms and making of relationship analysis between backscatter value of HH, HV and age and yield of FFB of oil palm. The results have showed relationship between HH, HV and age of oil palm which R2 of 0.63 for HH and 0.42 for HV that indicated increasing of age of oil palm as increasing of HH and HV value. Also relationship between HH, HV and yield of FFB of oil palm which R2 of 0.26 for HH and 0.15 for HV, that indicated increasing of yield of FFB as decreasing of HH and HV value.

  10. Artificial intelligence based modeling and optimization of poly(3-hydroxybutyrate-co-3-hydroxyvalerate) production process by using Azohydromonas lata MTCC 2311 from cane molasses supplemented with volatile fatty acids: a genetic algorithm paradigm.

    Science.gov (United States)

    Zafar, Mohd; Kumar, Shashi; Kumar, Surendra; Dhiman, Amit K

    2012-01-01

    The present work describes the optimization of medium variables for the production of poly(3-hydroxybutyrate-co-3-hydroxyvalerate) [P(3HB-co-3HV)] by Azohydromonas lata MTCC 2311 using cane molasses supplemented with propionic acid. Genetic algorithm (GA) has been used for the optimization of P(3HB-co-3HV) production through the simulation of artificial neural network (ANN) and response surface methodology (RSM). The predictions by ANN are better than those of RSM and in good agreement with experimental findings. The highest P(3HB-co-3HV) concentration and 3HV content have been reported as 7.35 g/l and 16.84 mol%, respectively by hybrid ANN-GA. Upon validation, 7.20 g/l and 16.30 mol% of P(3HB-co-3HV) concentration and 3HV content have been found in the shake flask, whereas 6.70 g/l and 16.35 mol%, have been observed in a 3 l bioreactor, respectively. The specific growth rate and P(3HB-co-3HV) accumulation rate of 0.29 per h and 0.16 g/lh determined with cane molasses are comparable to those observed on pure substrates. Copyright © 2011 Elsevier Ltd. All rights reserved.

  11. Electrocardiogram: his bundle potentials can be recorded noninvasively beat by beat on surface electrocardiogram.

    Science.gov (United States)

    Wang, Gaopin; Liu, Renguang; Chang, Qinghua; Xu, Zhaolong; Zhang, Yingjie; Pan, Dianzhu

    2017-03-15

    The micro waveform of His bundle potential can't be recorded beat-to-beat on surface electrocardiogram yet. We have found that the micro-wavelets before QRS complex may be related to atrioventricular conduction system potentials. This study is to explore the possibility of His bundle potential can be noninvasively recorded on surface electrocardiogram. We randomized 65 patients undergoing radiofrequency catheter ablation of paroxysmal superventricular tachycardia (exclude overt Wolff-Parkinson-White syndrome) to receive "conventional electrocardiogram" and "new electrocardiogram" before the procedure. His bundle electrogram was collected during the procedure. Comparative analysis of PA s (PA interval recorded on surface electrocardiogram), AH s (AH interval recorded on surface electrocardiogram) and HV s (HV interval recorded on surface electrocardiogram) interval recorded on surface "new electrocardiogram" and PA, AH, HV interval recorded on His bundle electrogram was investigated. There was no difference (P > 0.05) between groups in HV s interval (49.63 ± 6.19 ms) and HV interval (49.35 ± 6.49 ms). Results of correlational analysis found that HV S interval was significantly positively associated with HV interval (r = 0.929; P electrocardiogram. Noninvasive His bundle potential tracing might represent a new method for locating the site of atrioventricular block and identifying the origin of a wide QRS complex.

  12. Validation of a serum neutralization test for detection of antibodies specific to cyprinid herpesvirus 3 in infected common and koi carp (Cyprinus carpio).

    Science.gov (United States)

    Cabon, J; Louboutin, L; Castric, J; Bergmann, S; Bovo, G; Matras, M; Haenen, O; Olesen, N J; Morin, T

    2017-05-01

    Cyprinid herpesvirus 3 (CyHV-3) is the aetiological agent of a serious infective, notifiable disease affecting common carp and varieties. In survivors, infection is generally characterized by a subclinical latency phase with restricted viral replication. The CyHV-3 genome is difficult to detect in such carrier fish that represent a potential source of dissemination if viral reactivation occurs. In this study, the analytical and diagnostic performance of an alternative serum neutralization (SN) method based on the detection of CyHV-3-specific antibodies was assessed using 151 serum or plasma samples from healthy and naturally or experimentally CyHV-3-infected carp. French CyHV-3 isolate 07/108b was neutralized efficiently by sera from carp infected with European, American and Taiwanese CyHV-3 isolates, but no neutralization was observed using sera specific to other aquatic herpesviruses. Diagnostic sensitivity, diagnostic specificity and repeatability of 95.9%, 99.0% and 99.3%, respectively, were obtained, as well as a compliance rate of 89.9% in reproducibility testing. Neutralizing antibodies were steadily detected in infected carp subjected to restrictive or permissive temperature variations over more than 25 months post-infection. The results suggest that this non-lethal diagnostic test could be used in the future to improve the epidemiological surveillance and control of CyHV-3 disease. © 2016 John Wiley & Sons Ltd.

  13. Development of a PCR assay to detect cyprinid herpesvirus 1 in koi and common carp.

    Science.gov (United States)

    Viadanna, Pedro H O; Miller-Morgan, Tim; Peterson, Trace; Way, Keith; Stone, David M; Marty, Gary D; Pilarski, Fabiana; Hedrick, Ronald P; Waltzek, Thomas B

    2017-02-08

    Cyprinid herpesvirus 1 (CyHV1) infects all scaled and color varieties of common carp Cyprinus carpio, including koi. While it is most often associated with unsightly growths known as 'carp pox,' the underlying lesion (epidermal hyperplasia) can arise from a variety of disease processes. CyHV1-induced epidermal hyperplasia may occur transiently in response to water temperature, and thus histopathology cannot be used in isolation to assess CyHV1 infection status. To address this problem, here we describe a PCR assay targeted to the putative thymidine kinase gene of CyHV1. The PCR assay generates a 141 bp amplicon and reliably detects down to 10 copies of control plasmid DNA sequence (analytic sensitivity). The PCR does not cross-detect genomic DNA from cyprinid herpesvirus 2 and 3 (analytic specificity). The CyHV1 PCR effectively detected viral DNA in koi and common carp sampled from various locations in the UK, USA, Brazil, and Japan. Viral DNA was detected in both normal appearing and grossly affected epidermal tissues from koi experiencing natural epizootics. The new CyHV1 PCR provides an additional approach to histopathology for the rapid detection of CyHV1. Analysis of the thymidine kinase gene sequences determined for 7 PCR-positive carp originating from disparate geographical regions identified 3 sequence types, with 1 type occurring in both koi and common carp.

  14. [Application of multiple polymorphism genetic markers in determination of half sibling sharing a same mother].

    Science.gov (United States)

    Que, Ting-zhi; Zhao, Shu-min; Li, Cheng-tao

    2010-08-01

    Determination strategies for half sibling sharing a same mother were investigated through the detection of autosomal and X-chromosomal STR (X-STR) loci and polymorphisms on hypervariable (HV) region of mitochondrial DNA (mtDNA). Genomic DNA were extracted from blood stain samples of the 3 full siblings and one dubious half sibling sharing the same mother with them. Fifteen autosomal STR loci were genotyped by Sinofiler kit, and 19 X-STR loci were genotyped by Mentype Argus X-8 kit and 16 plex in-house system. Polymorphisms of mtDNA HV-I and HV-II were also detected with sequencing technology. Full sibling relationship between the dubious half sibling and each of the 3 full siblings were excluded based on the results of autosomal STR genotyping and calculation of full sibling index (FSI) and half sibling index (HIS). Results of sequencing for mtDNA HV-I and HV-II showed that all of the 4 samples came from a same maternal line. X-STR genotyping results determined that the dubious half sibling shared a same mother with the 3 full siblings. It is reliable to combine three different genotyping technologies including autosomal STR, X-STR and sequencing of mtDNA HV-I and HV-II for determination of half sibling sharing a same mother.

  15. Nationwide Cyprinid herpesvirus 3 contamination in natural rivers of Japan.

    Science.gov (United States)

    Minamoto, Toshifumi; Honjo, Mie N; Yamanaka, Hiroki; Uchii, Kimiko; Kawabata, Zen'ichiro

    2012-08-01

    Cyprinid herpesvirus 3 (CyHV-3) disease is a significant threat for common and koi carp cultivators and for freshwater ecosystems. To determine the prevalence of CyHV-3 in Japanese rivers, a nationwide survey of all national class-A rivers was undertaken in the Summer of 2008. The virus was concentrated from river water samples using the cation-coated filter method. CyHV-3 DNA was detected in 90 rivers, representing 90% of 103 successfully analysed rivers. More than 100,000 copies of CyHV-3 DNA per litre of sample were detected in four rivers, higher than that reported during the Yura River outbreak in 2007. For CyHV-3-positive rivers, the log CyHV-3 density was negatively correlated with the water temperature on the sampling date and positively correlated with the suspended solids and dissolved oxygen, which are annually averaged for each river. Our results demonstrate that virus detection using molecular biology techniques is a powerful tool for monitoring the presence of CyHV-3 in natural environments. Copyright © 2011 Elsevier Ltd. All rights reserved.

  16. Quality of Life Impact Related to Foot Health in a Sample of Older People with Hallux Valgus

    Science.gov (United States)

    López, Daniel López; Callejo González, Lucía; Iglesias, Marta Elena Losa; Canosa, Jesús Luis Saleta; Sanz, David Rodríguez; Lobo, Cesar Calvo; de Bengoa Vallejo, Ricardo Becerro

    2016-01-01

    Hallux Valgus (HV) is a highly prevalent forefoot deformity in older people associated with progressive subluxation and osteoarthritis of the first metatarsophalangeal (MTP) joint and it is believed to be associated with varying degrees of HV effect on the quality of life related to foot health. The aim of this study is to compare the impact of varying degrees of HV on foot health in a sample of older people. The sample consisted of 115 participants, mean age 76.7 ± 9.1, who attended an outpatient center where self-report data were recorded. The degree of HV deformity was determined in both feet using the Manchester Scale (MS) from stage 1 (mild) to 4 (very severe). Scores obtained on the Foot Health Status Questionnaire (FHSQ) were compared. This has 13 questions that assess 4 health domains of the feet, namely pain, function, general health and footwear. The stage 4 of HV shown lower scores for the footwear domain (11.23 ± 15.6); general foot health (27.62 ± 19.1); foot pain (44.65 ± 24.5); foot function (53.04 ± 27.2); vigour (42.19 ± 16.8); social capacity (44.46 ± 28.1); and general health (41.15 ± 25.5) compared with stage 1 of HV (Phallux valgus deformity which appears to be associated with the presence of greater degree of HV, regardless of gender. PMID:26816663

  17. Kennedy, the early sixties, and visitation by the angel of death.

    Science.gov (United States)

    O'Toole, D; Chase, C C L; Miller, M M; Campen, H Van

    2014-11-01

    The inaugural issue of Pathologia Veterinaria in 1964 contained the first detailed account of lesions in aborted fetuses following natural, experimental, and postvaccinal infection with bovine herpesvirus 1 (BoHV-1). The article, written by pathologists Kennedy and Richards, described diagnostic gross and histologic features in 13 bovine fetuses. The authors provided clinical and epidemiologic features of 1 postvaccination outbreak, including the absence of clinical signs in infected dams and the propensity for abortions to occur after 6 months' gestation. Subsequent field and experimental studies corroborated and expanded these observations. As a result of this and later reports, veterinarians became alert to the association between infectious bovine rhinotracheitis and abortion, including the risks of exposing pregnant cattle to live vaccinal BoHV-1. Methods were developed to corroborate a morphologic diagnosis of herpetic abortion in cattle, including immunofluorescence, immunohistochemistry, and polymerase chain reaction methods. Outbreaks of postvaccinal BoHV-1 abortion in the United States began to be reported with apparently increased frequency in the early 2000s. This coincided with licensure in 2003 of modified live BoHV-1 vaccines intended for use in pregnant cattle, which are now sold by 3 manufacturers. Ten recent herd episodes of postvaccinal BoHV-1 abortion are reported. All 10 BoHV-1 isolates had single-nucleotide polymorphism (SNPs) profiles previously identified in a group of BoHV-1 isolates that contains vaccine strains, based on a BoHV-1 SNP classification system. They lacked SNP features typical of those in characterized field-type strains of BoHV-1. © The Author(s) 2014.

  18. Isolation and purification of Gallid herpesvirus 2 strains currently distributed in Japan.

    Science.gov (United States)

    Machida, Yuka; Murata, Shiro; Matsuyama-Kato, Ayumi; Isezaki, Masayoshi; Taneno, Akira; Sakai, Eishi; Konnai, Satoru; Ohashi, Kazuhiko

    2017-01-20

    Gallid herpesvirus 2 (GaHV-2) causes malignant lymphomas in chickens (Marek's disease, MD). Although MD is controlled through vaccination efforts, field isolates of GaHV-2 have increased in virulence worldwide and even cause MD in vaccinated chickens. GaHV-2 strains are classified into four categories (mild, virulent, very virulent and very virulent +) based on the virulence exhibited in experimental infection in unvaccinated or MD-vaccinated susceptible chickens. Although MD cases are sporadically reported in Japan, the recent field strains of GaHV-2 in Japan have not been characterized. During isolation of recent field strains by using primary chicken kidney cell cultures, a method classically used for GaHV-2 isolation, vaccine strains were simultaneously isolated. Therefore, it is necessary to separate vaccine strains to characterize the virulence and pathogenicity of the GaHV-2 strains currently distributed in Japan. In this study, we prepared cell suspensions from the spleens of MD-symptomatic chickens, inoculated day-old-chicks and isolated GaHV-2 strains by primary chicken kidney cell cultures at 2-3 weeks post inoculation. The isolated strains were passaged several times on chicken embryo fibroblast cells, and PCR analysis revealed that the isolated strains were not contaminated with vaccine strains. Moreover, the contaminant vaccine strains were completely removed by the purification of plaques observed in chicken kidney cells. These procedures are necessary to isolate GaHV-2 field strains from vaccine strains in order to carry out future studies to characterize these strains and glean insights into GaHV-2 virulence and pathogenicity.

  19. Foot pain and functional limitation in healthy adults with hallux valgus: a cross-sectional study

    Directory of Open Access Journals (Sweden)

    Nix Sheree E

    2012-10-01

    Full Text Available Abstract Background Hallux valgus (HV is a very common deformity of the first metatarsophalangeal joint that often requires surgical correction. However, the association between structural HV deformity and related foot pain and disability is unclear. Furthermore, no previous studies have investigated concerns about appearance and difficulty with footwear in a population with HV not seeking surgical correction. The aim of this cross-sectional study was to investigate foot pain, functional limitation, concern about appearance and difficulty with footwear in otherwise healthy adults with HV compared to controls. Methods Thirty volunteers with HV (radiographic HV angle >15 degrees and 30 matched controls were recruited for this study (50 women, 10 men; mean age 44.4 years, range 20 to 76 years. Differences between groups were examined for self-reported foot pain and disability, satisfaction with appearance, footwear difficulty, and pressure-pain threshold at the first metatarsophalangeal joint. Functional measures included balance tests, walking performance, and hallux muscle strength (abduction and plantarflexion. Mean differences (MD and 95% confidence intervals (CI were calculated. Results All self-report measures showed that HV was associated with higher levels of foot pain and disability and significant concerns about appearance and footwear (p Conclusions These findings show that HV negatively impacts on self-reported foot pain and function, and concerns about foot appearance and footwear in otherwise healthy adults. There was also evidence of impaired hallux muscle strength and increased postural sway in HV subjects compared to controls, although general physical functioning and participation in physical activity were not adversely affected.

  20. Hallux valgus and plantar pressure loading: the Framingham foot study

    Science.gov (United States)

    2013-01-01

    Background Hallux valgus (HV), a common structural foot deformity, can cause foot pain and lead to limited mobility. The purpose of this study was to evaluate differences in plantar pressure and force during gait by HV status in a large population-based cohort of men and women. Methods A trained examiner performed a validated physical examination on participants’ feet and recorded the presence of hallux valgus and other specific foot disorders. Each foot was classified into one of four mutually exclusive groups based on the foot examination. Foot groups were: (i) HV only, (ii) HV and at least one additional foot disorder (FD), (iii) no HV but at least one other FD, and (iv) neither HV nor FD (referent). Biomechanical data for both feet were collected using Tekscan Matscan. Foot posture during quiet standing, using modified arch index (MAI), and foot function during gait, using center of pressure excursion index (CPEI), were calculated per foot. Further, walking scans were masked into eight sub-regions using Novel Automask, and peak pressure and maximum force exerted in each region were calculated. Results There were 3205 participants, contributing 6393 feet with complete foot exam data and valid biomechanical measurements. Participants with HV had lower hallucal loading and higher forces at lesser toes as well as higher MAI and lower CPEI values compared to the referent. Participants with HV and other FDs were also noted to have aberrant rearfoot forces and pressures. Conclusions These results suggest that HV alters foot loading patterns and pressure profiles. Future work should investigate how these changes affect the risk of other foot and lower extremity ailments. PMID:24138804

  1. Diversity in boron toxicity tolerance of Australian barley (Hordeum vulgare L.) genotypes.

    Science.gov (United States)

    Hayes, Julie E; Pallotta, Margaret; Garcia, Melissa; Öz, Mehmet Tufan; Rongala, Jay; Sutton, Tim

    2015-09-26

    Boron (B) is an important micronutrient for plant growth, but is toxic when levels are too high. This commonly occurs in environments with alkaline soils and relatively low rainfall, including many of the cereal growing regions of southern Australia. Four major genetic loci controlling tolerance to high soil B have been identified in the landrace barley, Sahara 3771. Genes underlying two of the loci encode the B transporters HvBot1 and HvNIP2;1. We investigated sequence and expression level diversity in HvBot1 and HvNIP2;1 across barley germplasm, and identified five novel coding sequence alleles for HvBot1. Lines were identified containing either single or multiple copies of the Sahara HvBot1 allele. We established that only the tandemly duplicated Sahara allele conferred B tolerance, and this duplicated allele was found only in a set of nine lines accessioned in Australian collections as Sahara 3763-3771. HvNIP2;1 coding sequences were highly conserved across barley germplasm. We identified the likely causative SNP in the 5'UTR of Sahara HvNIP2;1, and propose that the creation of a small upstream open reading frame interferes with HvNIP2;1 translation in Sahara 3771. Similar to HvBot1, the tolerant HvNIP2;1 allele was unique to the Sahara barley accessions. We identified a new source of the 2H B tolerance allele controlling leaf symptom development, in the landrace Ethiopia 756. Ethiopia 756, as well as the cultivar Sloop Vic which carries both the 2H and HvBot1 B tolerance alleles derived from Sahara 3771, may be valuable as alternative parents in breeding programs targeted to high soil B environments. There is significant diversity in B toxicity tolerance among contemporary Australian barley varieties but this is not related to variation at any of the four known B tolerance loci, indicating that novel, as yet undiscovered, sources of tolerance exist.

  2. Major immunogenic proteins of phocid herpes-viruses and their relationships to proteins of canine and feline herpesviruses.

    Science.gov (United States)

    Harder, T C; Harder, M; de Swart, R L; Osterhaus, A D; Liess, B

    1998-04-01

    The immunogenic proteins of cells infected with the alpha- or the gamma-herpesvirus of seals, phocid herpesvirus-1 and -2 (PhHV-1, -2), were examined in radioimmunoprecipitation assays as a further step towards the development of a PhHV-1 vaccine. With sera obtained from convalescent seals of different species or murine monoclonal antibodies (Mabs), at least seven virus-induced glycoproteins were detected in lysates of PhHV-1-infected CrFK cells. A presumably disulphide-linked complex composed of glycoproteins of 59, 67 and 113/120 kDa, expressed on the surface of infected cells, was characterized as a major immunogenic infected cell protein of PhHV-1. This glycoprotein complex has previously been identified as the proteolytically cleavable glycoprotein B homologue of PhHV-1 (14). At least three distinct neutralization-relevant epitopes were operationally mapped, by using Mabs, on the glycoprotein B of PhHV-1. Among the infected cell proteins of the antigenically closely related feline and canine herpesvirus, the glycoprotein B equivalent proved to be the most highly conserved glycoprotein. Sera obtained from different seal species from Arctic, Antarctic, and European habitats did not precipitate uniform patterns of infected cell proteins from PhHV-1-infected cell lysates although similar titres of neutralizing antibodies were displayed. Thus, antigenic differences among the alphaherpesvirus species prevalent in the different pinniped populations cannot be excluded. PhHV-2 displayed a different pattern of infected cell proteins and only limited cross-reactivity to PhHV-1 at the protein level was detected, which is in line with its previous classification as a distinct species, based on nucleotide sequence analysis, of the gammaherpesvirus linenge. A Mab raised against PhHV-2 and specific for a major glycoprotein of 117 kDa, cross reacted with the glycoprotein B of PhHV-1. The 117-kDa glycoprotein could represent the uncleaved PhHV-2 glycoprotein B homologue.

  3. DsRNA-free transmissible hypovirulence associated with formation of intra-hyphal hyphae in Botrytis cinerea.

    Science.gov (United States)

    Cao, Jian Bo; Zhou, Yu; Zhang, Lei; Zhang, Jing; Yang, Long; Qin, Li Hong; Jiang, Dao Hong; Li, Guo Qing; Huang, Hung-Chang

    2011-07-01

    A spontaneous mutant CanBc-3HV and its parental strain CanBc-3 of Botrytis cinerea were investigated in terms of pathogenicity, colony morphology, hypovirulence transmissibility, presence of double-stranded RNA (dsRNA), and formation of intra-hyphal hyphae (IH). Results showed that inoculation of CanBc-3HV on detached leaves of Brassica napus did not produce any visible necrotic lesions (20°C, 72h), whereas inoculation of CanBc-3 caused necrotic leaf lesions. Compared to CanBc-3, CanBc-3HV grew slowly, formed numerous mycelial sectors, sporulated sporadically and failed to produce sclerotia on potato dextrose agar (PDA) (20°C, 15d). Hypovirulence and the abnormal cultural characteristics of CanBc-3HV were transmissible from CanBc-3HV to CanBc-3 in pair cultures on PDA. However, the transmission was unsuccessful from CanBc-3HV to another virulent strain CanBc-2 of B. cinerea. These results suggest that transmission of the hypovirulence and the abnormal cultural characteristics of CanBc-3HV are strain-specific. No dsRNA was detected in mycelia of either CanBc-3HV or CanBc-3, implying that the hypovirulence of CanBc-3HV is caused by a transmissible element (TE) of non-RNA mycoviral origin. Formation of IH through self-infection was observed in CanBc-3HV, CanBc-3T1 (a hypovirulent derivative of CanBc-3 trans-infected by TE in CanBc-3HV), but was not observed in CanBc-3, suggesting that IH formation is associated with the hypovirulence of CanBc-3HV. To our knowledge, this is the first report of dsRNA-free transmissible hypovirulence associated with IH formation in B. cinerea. Copyright © 2011 The British Mycological Society. Published by Elsevier Ltd. All rights reserved.

  4. Digital Control of a High Voltage (2.5 kV) Bidirectional Flyback DC-DC Converter for Driving a Capacitive Incremental Actuator

    DEFF Research Database (Denmark)

    Thummala, Prasanth; Maksimovic, Dragan; Zhang, Zhe

    2016-01-01

    This paper presents a digital control technique to achieve valley switching in a bidirectional flyback converter used to drive a dielectric electro-active polymer based capacitive incremental actuator. The paper also provides the design of a low input voltage (24 V) and variable high output voltage...... on the output high-voltage (HV) side. Experimental results verifying the bidirectional operation of a high voltage flyback converter are presented, using a 3 kV polypropylene film capacitor as the load. The energy loss distributions of the converter when 4 kV and 4.5 kV HV MOSFETs are used on HV side...

  5. Identification and characterization of barley RNA-directed RNA polymerases

    DEFF Research Database (Denmark)

    Madsen, Christian Toft; Stephens, Jennifer; Hornyik, Csaba

    2009-01-01

    in dicot species. In this report, we identi!ed and characterized HvRDR1, HvRDR2 and HvRDR6 genes in the monocot plant barley (Hordeum vulgare). We analysed their expression under various biotic and abiotic stresses including fungal and viral infections, salicylic acid treatment as well as during plant...... development. The different classes and subclasses of barley RDRs displayed contrasting expression patterns during pathogen challenge and development suggesting their involvement in speci!c regulatory pathways. Their response to heat and salicylic acid treatment suggests a conserved pattern of expression...

  6. Erosion of heat-treated AISI 4140 steel

    Energy Technology Data Exchange (ETDEWEB)

    Goretta, K.C. (Materials and Components Tech. Div., Argonne National Lab., IL (United States)); Thompson, A.C. (Materials and Components Tech. Div., Argonne National Lab., IL (United States)); Routbort, J.L. (Materials Science Div., Argonne National Lab., IL (United States))

    1993-03-15

    Solid-particle erosion was studied on AISI 4140 steel heat treated to have a Vickers hardness (Hv) of 288-650 kg mm[sup -2]. The experiments were conducted in vacuum with 143 [mu]m Al[sub 2]O[sub 3] abrasive impacting at 50-100 m s[sup -1] at an angle of 30 or 90 . Erosion rates were nearly independent of hardness for Hv[<=]365 kg mm[sup -2], but increased with hardness for Hv>365 kg mm[sup -2]. The improved erosion resistances of the softer alloys were attributed to increased ductilities. (orig.). Letter-to-the-editor

  7. Fermi surface measurements in actinide metals and compounds

    International Nuclear Information System (INIS)

    Arko, A.J.; Schirber, J.E.

    1978-01-01

    The various techniques of measuring Fermi Surface parameters are briefly discussed in terms f application to actinide systems. Particular emphasis is given the dHvA effect. Some general results found in the dHvA studies of actinide compounds are given. The dHvA effect has been measured in α-U and is presented in detail. None of the observed frequencies corresponds to closed surfaces. Results are compared to the calculations of Freeman, Koelling and Watson-Yang where qualitative agreement is observed

  8. Hydroa Vacciniforme-Like T-Cell Lymphoma: A Further Brazilian Case.

    Science.gov (United States)

    Miranda, Mario Fernando Ribeiro de; Santos, Josie Eiras Bisi Dos; Müller, Silvia Ferreira Rodrigues; Bittencourt, Maraya de Jesus Semblano; Brito, Arival Cardoso de; Barros Junior, Jorge Nazareno da Silva; Xerfan, Ellen Maria Sampaio

    2018-03-01

    Hydroa vacciniforme (HV)-like lymphoma is a rare, usually fatal Epstein-Barr virus-driven lymphoproliferative disease affecting children from Asia, Mexico, and South America. Cutaneous manifestations imitate HV, a benign photodermatosis in which systemic symptoms are not observed, and spontaneous regression occurs later in adolescence or young adulthood. We report a case of HV-like lymphoma in a 12-year-old girl, descendent from an ancient Amazon indigenous tribe that, as far as we know, represents the second Brazilian case ever reported in the medical literature.

  9. Metallurgical and acoustical characterization of a hydroformed, 304 stainless steel, Caribbean-style musical pan

    International Nuclear Information System (INIS)

    Murr, L.E.; Gaytan, S.M.; Lopez, M.I.; Bujanda, D.E.; Martinez, E.Y.; Whitmyre, G.; Price, H.

    2008-01-01

    We report herein the metallurgical and acoustical characterization of hydroformed 304 stainless steel, Caribbean pans. These pans were fully tuned to chromatic tones and compared to a manufactured, low-carbon, Caribbean steel pan standard. Hydroformed platforms had a Vickers microindentation hardness of HV 345, which was reduced by annealing during pan fabrication to HV 270. Skirts welded to the hydroformed head had a microindentation hardness of HV 440. Microstructural characterization by light optical metallography and transmission electron microscopy illustrated microstructures (including grain structures) characteristic of these pan microindentation hardnesses

  10. The germinlike protein GLP4 exhibits superoxide dismutase activity and is an important component of quantitative resistance in wheat and barley

    DEFF Research Database (Denmark)

    Christensen, Anders Bentsen; Thordal-Christensen, Hans; Zimmermann, Grit

    2004-01-01

    Germinlike proteins (GLP) are encoded in plants by a gene family with proposed functions in plant development and defense. Genes of GLP subfamily 4 of barley (HvGLP4, formerly referred to as HvOxOLP) and the wheat orthologue TaGLP4 (formerly referred to as TaGLP2a) were previously found...... overexpression of TaGLP4 and HvGLP4 enhanced resistance against B. graminis in wheat and barley, whereas transient silencing by RNA interference reduced basal resistance in both cereals. The effect of GLP4 overexpression or silencing was strongly influenced by the genotype of the plant. The data suggest...

  11. A novel twist on molecular interactions between thioredoxin and nicotinamide adenine dinucleotide phosphate-dependent thioredoxin reductase

    DEFF Research Database (Denmark)

    Kirkensgaard, Kristine Groth; Hägglund, Per; Shahpiri, Azar

    2013-01-01

    The ubiquitous disulfide reductase thioredoxin (Trx) regulates several important biological processes such as seed germination in plants. Oxidized cytosolic Trx is regenerated by nicotinamide adenine dinucleotide phosphate (NADPH)-dependent thioredoxin reductase (NTR) in a multistep transfer...... dinucleotide (FAD)-binding domain of HvNTR2 to strongly affect the interaction with Trx. In particular, Trp42 and Met43 play key roles for recognition of the endogenous HvTrxh2. Trx from Arabidopsis thaliana is also efficiently recycled by HvNTR2 but turnover in this case appears to be less dependent...

  12. Miscibility and specific interactions in blends of poly(n-vinyl-2-pyrrolidone) and acid functional polyester resins.

    NARCIS (Netherlands)

    Senatore, D.; Berix, M.J.A.; Laven, J.; Benthem, van R.A.T.M.; With, de G.; Mezari, B.; Magusin, P.C.M.M.

    2008-01-01

    Miscibility and intermol. interactions of novel blends of poly(N-vinyl-2-pyrrolidone) (PVP) and acid functional polyester resins (APE) were studied by use of Differential Scanning Calorimetry (DSC), Attenuated Total Reflectance Fourier Transform IR (ATR-FTIR), Cross-Polarization Magic Angle Spinning

  13. Temporally uncorrelated photon-pair generation by dual-pump four-wave mixing

    DEFF Research Database (Denmark)

    Christensen, Jesper Bjerge; McKinstrie, C. J.; Rottwitt, Karsten

    2016-01-01

    We study the preparation of heralded single-photon states using dual-pump spontaneous four-wave mixing. The dual-pump configuration, which in our case employs cross-polarized pumps, allows for a gradual variation of the nonlinear interaction strength enabled by a birefringence-induced walk...

  14. Microwave-gated dynamic nuclear polarization

    DEFF Research Database (Denmark)

    Bornet, Aurélien; Pinon, Arthur; Jhajharia, Aditya

    2016-01-01

    Dissolution dynamic nuclear polarization (D-DNP) has become a method of choice to enhance signals in nuclear magnetic resonance (NMR). Recently, we have proposed to combine cross-polarization (CP) with D-DNP to provide high polarization P((13)C) in short build-up times. In this paper, we show...

  15. GEOLOGY AND ENVIRONMENTAL IMPACT ASSESSMENT AND ...

    African Journals Online (AJOL)

    Dr Osondu

    Plagioclase granular structure is as a result of slow cooling during the formation of the rock. Under plane polarize light, quartz, plagioclase, orthoclase and muscovite are colorless, while under cross polar quartz color vary from grey to cream, plagioclase yellow, hornblend blue, orthoclase white and muscovite green.

  16. A new approach to the silica gel surface : characterization of different surface regions by 29Si magic angle spinning NMR relaxation parameters and consequences for quantification of silica gels by NMR: characterization of different surface regions by silicon-29 magic angle spinning NMR relaxation parameters and consequences for quantification of silica gels by NMR

    NARCIS (Netherlands)

    Pfleiderer, B.; Albert, K.; Bayer, E.; Ven, van de L.J.M.; Haan, de J.W.; Cramers, C.A.M.G.

    1990-01-01

    Native and some monofunctionally derivatized silica gels have been investigated by 29Si CP MAS NMR spectroscopy with pulse and with cross-polarization (CP) excitation. Contact time variation experiments for some native materials yield results for the siloxane (Q4)g roups which cannot be described

  17. External polarimetric calibration of the Danish polarimetric C-band SAR

    DEFF Research Database (Denmark)

    Skriver, Henning; Dall, Jørgen; Madsen, Søren Nørvang

    1994-01-01

    on a masking procedure using the cross-correlation between co- and cross-polarized returns. The cross-talk estimated for the EMISAR data is low (below -30 dB), virtually independent of range, and stable between different acquisitions-within a mission and between missions. The cross-talk is reduced by 8 d...

  18. 75 FR 1285 - Vehicle-Mounted Earth Stations (VMES)

    Science.gov (United States)

    2010-01-11

    ... the Consumer & Governmental Affairs Bureau at (202)418-0530 (voice), (202) 418-0432 (TTY). Synopsis As... earth station antenna in the direction of the plane of the GSO; the co-polarized EIRP in the elevation plane, that is, the plane perpendicular to the plane of the GSO; and cross- polarized EIRP. Each table...

  19. Localized excitons in quantum wells show spin relaxation without coherence loss

    DEFF Research Database (Denmark)

    Zimmermann, R.; Langbein, W.; Runge, E.

    2001-01-01

    The coherence in the secondary emission from quantum well excitons is studied using the speckle method. Analysing the different polarization channels allows to conclude that (i) no coherence loss occurs in the cross-polarized emission, favouring spin beating instead of spin dephasing, and that (i...

  20. Active patch antennas for transponder applications

    Energy Technology Data Exchange (ETDEWEB)

    Biffi Gentili, G; Avitabile, G; Bonifacio, F; Salvador, C [Florence Univ. (Italy). Dip. di Ingegneria Elettronica

    1996-01-01

    The paper deals with two patch antenna structures that are mainly taught for short range link and non-contact identification system (RFID). The proposed antennas were developed by starting from an original concept of cross-polarization usefully applicable, in compliance with european for transponder applications are described and experimental results are reported.

  1. Room-temperature near-field reflection spectrocopy of semiconductor nanostructures

    DEFF Research Database (Denmark)

    Langbein, Wolfgang; Hvam, Jørn Märcher; Madsen, Steen

    1999-01-01

    We investigate the properties of near-field reflection spectroscopy in different polarization and detection modes using uncoated fiber probes. The results show, that cross-polarized detection suppresses to a large extent far-field contributions. Using the fiber dithering as a modulation source fo...

  2. Fast Response PDFLC Displays

    International Nuclear Information System (INIS)

    Karapinar, R.

    2004-01-01

    Polymer dispersed ferroelectric liquid crystal (PDFLC) samples were prepared by the polymerization induced phase separation method. The PDFLC films were uniaxially aligned by a shear deformation during ultraviolet curing. Switching was obtained by a voltage dependent optical retardation with the films placed between crossed polarizers. The electro-optical switching of the PDFLC films was studied

  3. Understanding the unusual reorganization of the nanostructure of a dark conglomerate phase

    NARCIS (Netherlands)

    Nagaraj, M.; Jones, J. C.; Panov, V. P.; Liu, H.; Portale, G.; Bras, W.; Gleeson, H. F.

    2015-01-01

    The dark conglomerate (DC) phase exhibited by a bent-core liquid crystal shows remarkable properties including an electric-field tunable chiral domain structure and a large (0.045) reduction of refractive index, while maintaining an optically dark texture when observed under crossed polarizers. A

  4. Lectures on pulsed NMR

    International Nuclear Information System (INIS)

    Pines, A.

    1988-08-01

    These lectures discuss some recent developments in pulsed NMR, emphasizing fundamental principles with selected illustrative applications. Major topics covered include multiple-quantum spectroscopy, spin decoupling, the interaction of spins with a quantized field, adiabatic rapid passage, spin temperature and statistics of cross-polarization, coherent averaging, and zero field NMR. 32 refs., 56 figs

  5. Lectures on pulsed NMR

    International Nuclear Information System (INIS)

    Pines, A.

    1986-09-01

    These lectures discuss some recent developments in pulsed NMR, emphasizing fundamental principles with selected illustrative applications. Major topics covered include multiple-quantum spectroscopy, spin decoupling, the interaction of spins with a quantized field, adiabatic rapid passage, spin temperature and statistics of cross-polarization, coherent averaging, and zero field NMR. 55 figs

  6. Biopolymer nanocomposite films reinforced with nanocellulose whiskers

    Science.gov (United States)

    Amit Saxena; Marcus Foston; Mohamad Kassaee; Thomas J. Elder; Arthur J. Ragauskas

    2011-01-01

    A xylan nanocomposite film with improved strength and barrier properties was prepared by a solution casting using nanocellulose whiskers as a reinforcing agent. The 13C cross-polarization magic angle spinning (CP/MAS) nuclear magnetic resonance (NMR) analysis of the spectral data obtained for the NCW/xylan nanocomposite films indicated the signal intensity originating...

  7. Irrigation, fertilization and initial substrate quality effects on decomposing Loblolly pine litter chemistry

    Science.gov (United States)

    Felipe G. Sanchez

    2004-01-01

    Changes in carbon chemistry (i.e., carbon compound classes such as aromatics, phenolics, etc.) of loblolly pine (Pinus taeda L.) litter were examined during three years of decomposition under factorial combinations of irrigation and fertilization treatments. Cross polarization magic angle spinning 13C nuclear magnetic resonance...

  8. Untitled

    Indian Academy of Sciences (India)

    ... field directions respectively (Shamburov et al. 1970). - -. ZnS transparency in Uv region enables their effective usage for overfrequency. — 4 - 2 O 2 4. V (kw). Figure 9. Light transmission curve for transverse electro-optic effect in ZnScrystal (111) cut when crossed polarizers. The curve looks like a “butterfly" hysteresis loop ...

  9. Near-infrared spectroscopic tissue imaging for medical applications

    Science.gov (United States)

    Demos, Stavros [Livermore, CA; Staggs, Michael C [Tracy, CA

    2006-12-12

    Near infrared imaging using elastic light scattering and tissue autofluorescence are explored for medical applications. The approach involves imaging using cross-polarized elastic light scattering and tissue autofluorescence in the Near Infra-Red (NIR) coupled with image processing and inter-image operations to differentiate human tissue components.

  10. Detection of Ostreid herpesvirus-1 microvariants in healthy Crassostrea gigas following disease events and their possible role as reservoirs of infection.

    Science.gov (United States)

    Evans, Olivia; Hick, Paul; Whittington, Richard J

    2017-09-01

    Ostreid herpesvirus-1 microvariants (OsHV-1) cause severe mortalities in farmed Crassostrea gigas in Europe, New Zealand and Australia. Outbreaks are seasonal, recurring in the warmer months of the year in endemic estuaries. The reference genotype and microvariant genotypes of OsHV-1 have been previously detected in the tissues of apparently healthy adult oysters naturally exposed to OsHV-1 in the field. However, the role of such oysters as reservoirs of infection for subsequent mortality outbreaks remains unclear. The aims of this study were: (1) to identify the optimal sample type to use for the detection of OsHV-1 DNA in apparently healthy C. gigas; and (2) to assess whether live C. gigas maintained on-farm after an OsHV-1 related mortality event remain infected and could act as a reservoir host for subsequent outbreaks. OsHV-1 DNA was detected in the hemolymph, gill, mantle, adductor muscle, gonad and digestive gland of apparently healthy adult oysters. The likelihood of detecting OsHV-1 DNA in hemolymph was equivalent to that in gill and mantle, but the odds of detecting OsHV-1 DNA in hemolymph and gill were more than 8 times that of adductor muscle. Gill had the highest viral loads. Compared to testing whole gill homogenates, testing snippets of the gill improved the detection of OsHV-1 DNA by about four fold. The prevalence of OsHV-1 in gill and mantle was highest after the first season of OsHV-1 exposure; it then declined to low or negligible levels in the same cohorts in subsequent seasons, despite repeated seasonal exposure in monitoring lasting up to 4years. The hemolymph of individually identified oysters was repeatedly sampled over 15months, and OsHV-1 prevalence declined over that time frame in the youngest cohort, which had been exposed to OsHV-1 for the first time at the start of that season. In contrast, the prevalence in two cohorts of older oysters, which had been exposed to OsHV-1 in prior seasons, was consistently low (<10%). Viral loads were

  11. Retrieving forest stand parameters from SAR backscatter data using a neural network trained by a canopy backscatter model

    International Nuclear Information System (INIS)

    Wang, Y.; Dong, D.

    1997-01-01

    It was possible to retrieve the stand mean dbh (tree trunk diameter at breast height) and stand density from the Jet Propulsion Laboratory (JPL) Airborne Synthetic Aperture Radar (AIRSAR) backscatter data by using threelayered perceptron neural networks (NNs). Two sets of NNs were trained by the Santa Barbara microwave canopy backscatter model. One set of the trained NNs was used to retrieve the stand mean dbh, and the other to retrieve the stand density. Each set of the NNs consisted of seven individual NNs for all possible combinations of one, two, and three radar wavelengths. Ground and multiple wavelength AIRSAR backscatter data from two ponderosa pine forest stands near Mt. Shasta, California (U.S.A.) were used to evaluate the accuracy of the retrievals. The r.m.s. and relative errors of the retrieval for stand mean dbh were 6.1 cm and 15.6 per cent for one stand (St2), and 3.1 cm and 6.7 per cent for the other stand (St11). The r.m.s. and relative errors of the retrieval for stand density were 71.2 treesha-1 and 23.0 per cent for St2, and 49.7 treesha-1 and 21.3 per cent for St11. (author)

  12. Improved techniques to utilize remotely sensed data from multi-frequency imaging radar polarimeter; Tashuha tahenha SAR data no riyoho no kenkyu

    Energy Technology Data Exchange (ETDEWEB)

    Okada, K [Sumitomo Metal Mining Co. Ltd., Osaka (Japan); Maruyama, Y [Earth Remote Sensing Data Analysis Center, Tokyo (Japan); Tapley, I

    1997-05-27

    It was intended to serve for establishing specifications for a next generation SAR such as PALSAR through studying methods for evaluating and utilizing the multi-frequency, multi-polarized wave SAR data. Placing an emphasis on utilization of the NASA`s AIRSAR, identification was made on backscatter amount recorded on the SAR data, terrestrial constitutional substances, patterns of the ground surface, micro-topography and such terrestrial conditions as vegetation and land utilization. Their mutual relationships were also analyzed. A noise reduction method usable on multi-band data can be applied to the AIRSAR data, and can reduce noise effectively. Images with more volume of information can be acquired from multi-band images with the same polarization wave than from multi-polarization wave images with the same band. As a result of estimating terrestrial permitivity by using the method invented by Dubois and van Zyl, most of the subject area is judged to have terrestrial substances dried at the time of having acquired the images. A colluvium rich with exposed rock regions and gravels was identified as an area having higher permitivity than the former area. Images of terrestrial roughness were divided largely into smooth flat lands, sand and gravel distributed regions, exposed rock regions, and plant distributed regions along river basins. 3 refs., 2 figs., 1 tab.

  13. Understanding the Future Market for NovaSAR-S Flood Mapping Products Using Data Mining and Simulation

    Science.gov (United States)

    Lavender, Samantha; Haria, Kajal; Cooksley, Geraint; Farman, Alex; Beaton, Thomas

    2016-08-01

    The aim was to understand a future market for NovaSAR-S, with a particular focus on flood mapping, through developing a simple Synthetic Aperture Radar (SAR) simulator that can be used in advance of NovaSAR-S data becoming available.The return signal was determined from a combination of a terrain or elevation model, Envisat S-Band Radar Altimeter (RA)-2, Landsat and CORINE land cover information; allowing for a simulation of a SAR image that's influenced by both the geometry and surface type. The test sites correspond to data from the 2014 AirSAR campaign, and validation is performed by using AirSAR together with Envisat Advanced (ASAR) and Advanced Land Observing Satellite "Daichi" (ALOS) Phased Array type L-Band Synthetic Aperture Radar (PALSAR) data.It's envisaged that the resulting simulated data, and the simulator, will not only aid early understanding of NovaSAR-S, but will also aid the development of flood mapping applications.

  14. High voltage multiplexing for the ATLAS Tracker Upgrade

    International Nuclear Information System (INIS)

    Villani, E G; Phillips, P; Matheson, J; Lynn, D; Hommels, L B A; Gregor, I; Bessner, M; Tackmann, K; Newcomer, F M; Spencer, E; Greenall, A

    2014-01-01

    The increased luminosity of the HL-LHC will require more channels in the upgraded ATLAS Tracker, as a result of the finer detector segmentation, stemming from the otherwise too high occupancy. Among the many technological challenges facing the ATLAS Tracker Upgrade there is more an efficient power distribution and HV biasing of the sensors. The solution adopted in the current ATLAS detector uses one HV conductor for each sensor, which makes it easy to disable malfunctioning sensors without affecting the others, but space constraints and material budget considerations renders this approach impractical for the Upgraded detector. A number of approaches, including the use of the same HV line to bias several sensors and suitable HV switches, along with their control circuitry, are currently being investigated for this purpose. The proposed solutions along with latest test results and measurements will be described

  15. Backward causation, hidden variables and the meaning of ...

    Indian Academy of Sciences (India)

    relation to the issue as to whether quantum mechanics provides a complete ..... The moral of this discussion for HV approaches — especially for those .... should simply recognise that they are different, and get on with the business of exploring.

  16. Download this PDF file

    African Journals Online (AJOL)

    biological importance and the person would be immune to the HV. Therefore, an effective ... Bioethics, limperial College, London, UK, 21 - 24 September 2000,. RESUME .... powerful secret weapon of the HIV with which it frus- trates and ...

  17. Epistemiske strategier i studieaktivitetsmodellen 09/2015 – 12/2016

    DEFF Research Database (Denmark)

    Vestbo, Michelle; Steenfeldt, Vibeke Østergaard; Helms, Niels Henrik

    2017-01-01

    Afrapportering af projektet Epistemiske strategier i studieaktivitetsmodellen. Rapporten er en afrapportering af projektet Epistemiske strategier i studieaktivitetsmodellen, som har udfoldet sig gennem en vifte bestående af seks delprojekter inden for to overordnede tematikker: de studerendes hv...

  18. S¯adhan¯a Vol. 26, 2001 Subject Index

    Indian Academy of Sciences (India)

    R. Narasimhan (Krishtel eMaging) 1461 1996 Oct 15 13:05:22

    . Acoustic emission ... approach. 251. Blumlein-spark gap. Design and construction of double-Blumlein. HV pulse power ... A note on critical flow section in collector channels. 439 ... system for Langmuir-blodgett film deposition set-up. 213.

  19. The vaccines for Bovine Herpesvirus Type 1: A review

    African Journals Online (AJOL)

    Administrator

    2011-09-05

    Sep 5, 2011 ... disease, causing great economic losses in the livestock industry. Vaccine is a ... virus vaccines. Key words: BoHV-1, vaccine, DIVA, recombinant virus. ... may cause latent infection and immune suppression. (Yates, 1982).

  20. Functional and structural characterization of plastidic starch phosphorylase during barley endosperm development

    DEFF Research Database (Denmark)

    Cuesta-Seijo, Jose A.; Ruzanski, Christian; Krucewicz, Katarzyna

    2017-01-01

    The production of starch is essential for human nutrition and represents a major metabolic flux in the biosphere. The biosynthesis of starch in storage organs like barley endosperm operates via two main pathways using different substrates: starch synthases use ADP-glucose to produce amylose......,4-glucans using HvPho1 from G1P as the sole substrate. The structural properties of HvPho1 provide insights into the low affinity of HvPho1 for large polysaccharides like starch or amylopectin. Our results suggest that HvPho1 may play a role during the initiation of starch biosynthesis in barley....... and amylopectin, the two major components of starch, whereas starch phosphorylase (Pho1) uses glucose-1-phosphate (G1P), a precursor for ADP-glucose production, to produce α-1,4 glucans. The significance of the Pho1 pathway in starch biosynthesis has remained unclear. To elucidate the importance of barley Pho1...

  1. Is wave-particle objectivity compatible with determinism and locality?

    Science.gov (United States)

    Ionicioiu, Radu; Jennewein, Thomas; Mann, Robert B; Terno, Daniel R

    2014-09-26

    Wave-particle duality, superposition and entanglement are among the most counterintuitive features of quantum theory. Their clash with our classical expectations motivated hidden-variable (HV) theories. With the emergence of quantum technologies, we can test experimentally the predictions of quantum theory versus HV theories and put strong restrictions on their key assumptions. Here, we study an entanglement-assisted version of the quantum delayed-choice experiment and show that the extension of HV to the controlling devices only exacerbates the contradiction. We compare HV theories that satisfy the conditions of objectivity (a property of photons being either particles or waves, but not both), determinism and local independence of hidden variables with quantum mechanics. Any two of the above conditions are compatible with it. The conflict becomes manifest when all three conditions are imposed and persists for any non-zero value of entanglement. We propose an experiment to test our conclusions.

  2. Is wave–particle objectivity compatible with determinism and locality?

    Science.gov (United States)

    Ionicioiu, Radu; Jennewein, Thomas; Mann, Robert B.; Terno, Daniel R.

    2014-01-01

    Wave–particle duality, superposition and entanglement are among the most counterintuitive features of quantum theory. Their clash with our classical expectations motivated hidden-variable (HV) theories. With the emergence of quantum technologies, we can test experimentally the predictions of quantum theory versus HV theories and put strong restrictions on their key assumptions. Here, we study an entanglement-assisted version of the quantum delayed-choice experiment and show that the extension of HV to the controlling devices only exacerbates the contradiction. We compare HV theories that satisfy the conditions of objectivity (a property of photons being either particles or waves, but not both), determinism and local independence of hidden variables with quantum mechanics. Any two of the above conditions are compatible with it. The conflict becomes manifest when all three conditions are imposed and persists for any non-zero value of entanglement. We propose an experiment to test our conclusions. PMID:25256419

  3. Development of 2D and 3D transient electro-thermal computational models to predict the radiation failures in SiC-based Schottky diodes and power field-effect transistors (FETs)

    Data.gov (United States)

    National Aeronautics and Space Administration — High voltage (HV) power devices based on silicon carbide (SiC) semiconductor material may offer revolutionary transformations for future NASA space missions, due to...

  4. Feline herpesvirus.

    Science.gov (United States)

    Gaskell, Rosalind; Dawson, Susan; Radford, Alan; Thiry, Etienne

    2007-01-01

    Feline herpesvirus (FHV-1; felid herpesvirus 1 (FeHV-1)) is an alphaherpesvirus of cats closely related to canine herpesvirus-1 and phocine herpesvirus-1. There is only one serotype of the virus and it is relatively homogenous genetically. FeHV-1 is an important cause of acute upper respiratory tract and ocular disease in cats. In addition, its role in more chronic ocular disease and skin lesions is increasingly being recognised. Epidemiologically, FeHV-1 behaves as a typical alphaherpesvirus whereby clinically recovered cats become latently infected carriers which undergo periodic episodes of virus reactivation, particularly after a stress. The primary site of latency is the trigeminal ganglion. Conventional inactivated and modified-live vaccines are available and protect reasonably well against disease but not infection, although viral shedding may be reduced. Genetically engineered vaccines have also been developed, both for FeHV-1 and as vector vaccines for other pathogens, but none is as yet marketed.

  5. Dicty_cDB: VSF173 [Dicty_cDB

    Lifescience Database Archive (English)

    Full Text Available TT ATTTCAGGAAAAGCACTTGCATTTTCA sequence update 2001. 3.22 Translated Amino Acid sequence ---*tskkwdmilkql*vf...vasyflapvpkyim* k*r*ffk*krni*rywvifnrsiyxiwicnsxdfspfryyfrkstcif Frame B: ---*tskkwdmilkql*vflahlqlvyylif*hv

  6. Cyprinid herpesvirus 3: an interesting virus for applied and fundamental research

    Science.gov (United States)

    2013-01-01

    Cyprinid herpesvirus 3 (CyHV-3), a member of the family Alloherpesviridae is the causative agent of a lethal, highly contagious and notifiable disease in common and koi carp. The economic importance of common and koi carp industries together with the rapid spread of CyHV-3 worldwide, explain why this virus became soon after its isolation in the 1990s a subject of applied research. In addition to its economic importance, an increasing number of fundamental studies demonstrated that CyHV-3 is an original and interesting subject for fundamental research. In this review, we summarized recent advances in CyHV-3 research with a special interest for studies related to host-virus interactions. PMID:24073814

  7. DNA microarray revealed and RNAi plants confirmed key genes conferring low Cd accumulation in barley grains

    DEFF Research Database (Denmark)

    Sun, Hongyan; Chen, Zhong-Hua; Chen, Fei

    2015-01-01

    Background Understanding the mechanism of low Cd accumulation in crops is crucial for sustainable safe food production in Cd-contaminated soils. Results Confocal microscopy, atomic absorption spectrometry, gas exchange and chlorophyll fluorescence analyses revealed a distinct difference in Cd...... with a substantial difference between the two genotypes. Cd stress led to higher expression of genes involved in transport, carbohydrate metabolism and signal transduction in the low-grain-Cd-accumulating genotype. Novel transporter genes such as zinc transporter genes were identified as being associated with low Cd...... accumulation. Quantitative RT-PCR confirmed our microarray data. Furthermore, suppression of the zinc transporter genes HvZIP3 and HvZIP8 by RNAi silencing showed increased Cd accumulation and reduced Zn and Mn concentrations in barley grains. Thus, HvZIP3 and HvZIP8 could be candidate genes related to low...

  8. Mechanical properties of 3D printed warped membranes

    Science.gov (United States)

    Kosmrlj, Andrej; Xiao, Kechao; Weaver, James C.; Vlassak, Joost J.; Nelson, David R.

    2015-03-01

    We explore how a frozen background metric affects the mechanical properties of solid planar membranes. Our focus is a special class of ``warped membranes'' with a preferred random height profile characterized by random Gaussian variables h (q) in Fourier space with zero mean and variance q-m . It has been shown theoretically that in the linear response regime, this quenched random disorder increases the effective bending rigidity, while the Young's and shear moduli are reduced. Compared to flat plates of the same thickness t, the bending rigidity of warped membranes is increased by a factor hv / t while the in-plane elastic moduli are reduced by t /hv , where hv =√{ } describes the frozen height fluctuations. Interestingly, hv is system size dependent for warped membranes characterized with m > 2 . We present experimental tests of these predictions, using warped membranes prepared via high resolution 3D printing.

  9. Crohn's disease intestinal CD4+ T cells have impaired interleukin-10 productionwhich is not restored by probiotic bacteria

    DEFF Research Database (Denmark)

    Hvas, Christian L; Kelsen, Jens; Agnholt, Jørgen

    2007-01-01

    OBJECTIVE: Crohn's disease (CD) has been associated with low mucosal interleukin (IL)-10 production, but the mechanism behind this deficiency remains unclear. The aim of this study was to investigate IL-10 and interferon (IFN)-gamma production in intestinal CD4+ T cells from CD patients and healthy...... volunteers (HV) and to examine how this was affected by bacterial products and the presence or absence of autologous dendritic cells. MATERIAL AND METHODS: We cultured intestinal CD4+ T cells from CD patients (n=9) and HV (n=6) and differentiated dendritic cells from their peripheral monocytes. Intestinal T...... this imbalance in CD, but tended to do so in HV. When there were no dendritic cells, CD intestinal T cells responded to autologous bacteria with an increased IFN-gamma production (2.3+/-1.3 ng/ml) compared with HV intestinal T cells (0.3+/-0.2 ng/ml). CONCLUSIONS: Crohn's disease intestinal CD4+ T cells display...

  10. ELECTRICITY PRICING IN LESS DEVELOPED COUNTRIES ...

    African Journals Online (AJOL)

    ES Obe

    This paper presents the use of expected system load duration curve (LDC) and power plant input-output ..... upgrade) some transmission and distribution facilities for ... associated with service drop lines, meter, .... voltage level: LV, MH, and HV.

  11. Compact Digital High Voltage Charger

    CERN Document Server

    Li, Ge

    2005-01-01

    The operation of classical resonant circuit developed for the pulse energizing is investigated. The HV pulse or generator is very compact by a soft switching circuit made up of IGBT working at over 30 kHZ. The frequencies of macro pulses andμpulses can be arbitrarily tuned below resonant frequency to digitalize the HV pulse power. Theμpulses can also be connected by filter circuit to get the HVDC power. The circuit topology is given and its novel control logic is analyzed by flowchart. The circuit is part of a system consisting of a AC or DC LV power supply, a pulse transformer, the pulse generator implemented by LV capacitor and leakage inductance of the transformer, a HV DC or pulse power supply and the charged HV capacitor of the modulators.

  12. Costly cables; Lange Leitung

    Energy Technology Data Exchange (ETDEWEB)

    Hautmann, Daniel

    2012-08-15

    Connection of offshore wind turbines to the onshore power supply grid requires costly cables for HV DC power transmission. The technology is mature enough to enable low-loss power transmission, but construction times may last several years.

  13. Hyperventilation, cerebral perfusion, and syncope

    DEFF Research Database (Denmark)

    Immink, R V; Pott, F C; Secher, N H

    2014-01-01

    dioxide (PaCO2) and oxygen (PaO2) partial pressures so that hypercapnia/hypoxia increases and hypocapnia/hyperoxia reduces global cerebral blood flow. Cerebral hypoperfusion and TLOC have been associated with hypocapnia related to HV. Notwithstanding pronounced cerebrovascular effects of PaCO2...... the contribution of a low PaCO2 to the early postural reduction in middle cerebral artery blood velocity is transient. HV together with postural stress does not reduce cerebral perfusion to such an extent that TLOC develops. However when HV is combined with cardiovascular stressors like cold immersion or reduced...... cardiac output brain perfusion becomes jeopardized. Whether, in patients with cardiovascular disease and/or defect, cerebral blood flow cerebral control HV-induced hypocapnia elicits cerebral hypoperfusion, leading to TLOC, remains to be established....

  14. Photoacoustic Monitoring of Internal Plastification in Poly(3-hydroxybutyrate-co-3-hydroxyvalerate Copolymers: Measurements of Thermal Parameters

    Directory of Open Access Journals (Sweden)

    Sanchez Ruben R.

    1999-01-01

    Full Text Available Basic data on thermophysical properties of poly(3-hydroxybutyrate-co-3-hydroxyvalerate copolymers poly(3HB-co-3HV were investigated with the aim of understanding the role of 3-hydroxyvalerate monomeric units (3HV incorporated during random copolymerization. The results show strong evidence that internal plastification is produced by the introduction of 3HV units in the copolymer. It was observed that copolymer thermal conductivity increased approximately linearly with the 3HV content. On the other hand, thermal diffusivity was very sensitive to the change in the copolymer composition showing a sudden rise that attained a saturation plateau. Amplitude-frequency plots indicate that a thermoelastic bending mechanism is operating. In this paper a new photoacoustic arrangement for the measurement of thermal effusivity is presented.

  15. Functional CT imaging: load-dependent visualization of the subchondral mineralization by means of CT osteoabsorptionmetry (CT-OAM)

    International Nuclear Information System (INIS)

    Linsenmaier, U.; Schlichtenhorst, K.; Pfeifer, K.J.; Reiser, M.; Kersting, S.; Putz, R.; Mueller-Gerbl, M.

    2003-01-01

    Purpose: Functional computed tomography for visualization and quantification of subchondral bone mineralization using CT osteoabsorptiometry (CT-OAM). Materials and Methods: Tarsometatarsal (TMT) and metatarsophalangeal (MTP) joints of 46 human hallux valgus (HV) specimens were examined (sagittal 1/1/1 mm) on a single slice CT scanner SCT (Somatom Plus 4, Siemens AG). Subchondral bone pixels were segmented and assigned to 10 density value groups (triangle 100 HU, range 200 - 1200 HU) the pixels using volume rendering technique (VRT). The data analysis considered the severity of HV as determined by the radiographically measured HV-angle (a.p. projection). Results: CT-OAM could generate reproducible densitograms of the distribution pattern of the subchondral bone density for all four joint surfaces (TMT and MTP joints). The bone density localization enables the assignment to different groups, showing a characteristic HV-angle-dependent distribution of the maximum bone mineralization of the load-dependent densitogram (p [de

  16. On the origin of the mixed alkali effect on indentation in silicate glasses

    DEFF Research Database (Denmark)

    Kjeldsen, Jonas; Smedskjær, Morten Mattrup; Mauro, J. C.

    2014-01-01

    The compositional scaling of Vickers hardness (Hv) in mixed alkali oxide glasses manifests itself as a positive deviation from linearity as a function of the network modifier/modifier ratio, with a maximum deviation at the ratio of 1:1. In this work, we investigate the link between the indentation...... deformation processes (elastic deformation, plastic deformation, and densification) and Hv in two mixed sodium–potassium silicate glass series. We show that the mixed alkali effect in Hv originates from the nonlinear scaling of the resistance to plastic deformation. We thus confirm a direct relation between...... the resistance to plastic flow and Hv in mixed modifier glasses. Furthermore, we find that the mixed alkali effect also manifests itself as a positive deviation from linearity in the compositional scaling of density for glasses with high alumina content. This trend could be linked to a compaction of the network...

  17. Supra-chondritic Nb/Ta ratios and other exotic geochemical signatures in rejuvinated Hawaiian magmas as fingerprints of carbonatitic auto-metasomatism in parts of the Hawaiian mantle plume

    OpenAIRE

    A. Rocholl; K. P. Jochum; D. Rhede; B. Stoll; U. Weis

    2014-01-01

    The rejuvenated Honolulu Volcanics (HV), Oahu, Hawaii, comprise small-volume magmas ranging from alkali basalt through basanite and nephelinite to melilite. Their origin is enigmatic and debated, because the magmas are highly enriched in incompatible trace elements but isotopically depleted and erupted some 1.3 Myrs after the Koolau shield building phase had ceased. We have analysed 26 HV basanitic to melilitic tuffs from Salt Lake Crater at Honolu...

  18. Composição química e resistência mecânica da base de braquetes "Straight-Wire" Superficial hardness and the metallographic characteristics of straight-wire base brackets

    Directory of Open Access Journals (Sweden)

    Luciana de Paula Gontijo

    2004-08-01

    Full Text Available Esse trabalho objetivou comparar as durezas superficiais e as características metalográficas das bases de braquetes "straight-wire" de quatro marcas comerciais: Morelli, Abzil Lancer, Unitek e A-Company. As durezas superficiais foram avaliadas por meio de um teste de dureza realizado com o auxílio de um microdurômetro. Os resultados indicaram diferenças entre as marcas comerciais testadas onde os braquetes da A-Company apresentaram os valores mais altos de dureza (314 HV, seguidos da Unitek (325 HV, Abzil (230 HV e Morelli (192 HV. As características metalográficas das bases de braquetes foram avaliadas por meio de um espectrômetro, onde observou-se a presença de elementos de liga como o cromo, o níquel, o silício, o cobre, o alumínio, o enxofre e o nióbio. A quantidade de cada elemento de liga variou entre as marcas, provavelmente devido ao processo de fabricação industrial, mas sem interferir na qualidade final da liga.The objective of this study was to compare the superficial hardness and the metallographic characteristics of the bases of straight-wire brackets. Brackets from four different manufactures were utilized: Morelli, Abzil Lancer, Unitek and A-Company. The superficial hardness test revealed that the A-Company bracket base had the highest value (314 HV followed by Unitek (325 HV, Abzil (230 HV and Morelli (192 HV. The presence of variable amounts of chrome, nickel, silicon, copper, aluminum, sulfur and niobium was detected by the spectrometer. The quantity of each element varied according to the brand tested and did not interfere with the quality of the alloy. This variance was most likely due to differences in the process of the fabrication of each manufactures.

  19. Compulsive Sexual Behavior: Prefrontal and Limbic Volume and Interactions

    DEFF Research Database (Denmark)

    Schmidt, Casper; Morris, Laurel S.; Kvamme, Timo L.

    2017-01-01

    with matched healthy volunteers (HV). Methods: Structural MRI (MPRAGE) data were collected in 92 subjects (23 CSB males and 69 age-matched male HV) and analyzed using voxel-based morphometry. Resting state functional MRI data using multi-echo planar sequence and independent components analysis (ME-ICA) were...... prefrontal cortex (whole brain, cluster corrected FWE P motivational salience and emotion processing, and impaired functional connectivity between prefrontal control regulatory and limbic regions...

  20. PTFE Graft as a "Bridge" to Communicating Veins Maturation in the Treatment of an Intrahepatic Cholangiocarcinoma Involving the 3 Hepatic Veins. The Minor-but-Complex Liver Resection.

    Science.gov (United States)

    Urbani, Lucio; Balestri, Riccardo; Sidoti, Francesco; Bernardini, Juri Riccardo; Arces, Francesco; Licitra, Gabriella; Leoni, Chiara; Forfori, Francesco; Colombatto, Piero; Boraschi, Piero; Castagna, Maura; Buccianti, Piero

    2016-12-01

    Parenchyma-sparing liver surgery allows resecting hepatic veins (HV) at the hepatocaval confluence with minor (PTFE graft can be used as a bridge to communicating-veins maturation to ensure the correct outflow of the spared liver. We present a video of an intrahepatic cholangiocarcinoma (IC) involving the three HV at the hepatocaval confluence treated with this approach. In a 50-year old obese (BMI 44.8) male a 6-cm IC involving the hepatocaval confluence was identified during the follow-up for a kidney malignancy. At the preoperative CT scan the left HV was not detectable, the middle HV was incorporated within the tumor, and right HV had a 3-cm contact with the tumor. No communicating veins were evident at preoperative imaging. After a J-shape thoracophrenolaparotomy, the resection of segments II-III-IVa was partially extended to segment VIII-VII and I. The right HV was detached from the tumor, and the middle HV was reconstructed with a 7-mm ringed-armed PTFE graft anastomosed to V8. Surgery lasted 20 h and 55 min with an estimated blood loss of 3500 ml, but the postoperative course was uneventful and the patient was discharged on the 14th postoperative day. One month later the CT scan showed a patent PTFE graft with the maturation of communicating-veins. One year later a complete thrombosis of the PTFE graft was observed with normal liver perfusion and function, and the patient was disease-free. PTFE-based parenchyma-sparing liver resection is a new tool to treat tumors located at the hepatocaval confluence exploiting the maturation of intrahepatic communicating-veins between main HV.