WorldWideScience

Sample records for hunters drew important

  1. The Piniariarneq Project: Inughuit hunters map their important hunting areas

    DEFF Research Database (Denmark)

    Johansen, Kasper Lambert; Flora, Janne; Oberborbeck Andersen, Astrid

    industrialisation of the High Arctic in the near future. Mapping of important resource areas of local, human communities have also been conducted on numerous occasions, but has generally received much less attention, and often results from such efforts are difficult to integrate with biological data. Here, we...

  2. Drew Goodman, Earthbound Farm

    OpenAIRE

    Rabkin, Sarah

    2010-01-01

    Drew Goodman is CEO and co-founder, with his wife, Myra, of Earthbound Farm, based in San Juan Bautista, California. Two years after its 1984 inception on 2.5 Carmel Valley acres, Earthbound became the first successful purveyor of pre-washed salads bagged for retail sale. The company now produces more than 100 varieties of certified organic salads, fruits, and vegetables on a total of about 33,000 acres, with individual farms ranging from five to 680 acres in California, Arizona, Washington, ...

  3. Explicit versus implicit motivations: Clarifying how experiences affect turkey hunter satisfaction using revised importance-performance, importance grid, and penalty-reward-contrast analyses

    Science.gov (United States)

    Schroeder, Susan A.; Cornicelli, Louis; Fulton, David C.; Merchant, Steven S.

    2018-01-01

    Although research has advanced methods for clarifying factors that relate to customer satisfaction, they have not been embraced by leisure researchers. Using results from a survey of wild turkey hunters, we applied traditional and revised importance-performance (IPA/RIPA), importance-grid analysis (IGA), and penalty-reward-contrast analysis (PRCA) to examine how activity-specific factors influenced satisfaction. Results suggested differences between the explicit and implicit importance of factors related to turkey hunting. Opportunities to kill turkeys were explicitly rated as less important than seeing, hearing, or calling in turkeys, but opportunities for harvest had relatively higher levels of implicit importance. PRCA identified “calling turkeys in” and “hearing gobbling” as minimum requirements that cause dissatisfaction if not fulfilled, but do not provide satisfaction, whereas “seeing turkeys” and an “opportunity to kill a turkey” related to both satisfaction and dissatisfaction. RIPA, IGA, and PRCA could provide valuable insights about factors that may improve satisfaction for leisure participants.

  4. Vulnerable Hunter

    OpenAIRE

    Md.Asha Begum; Y.VishnuPriya; V.ManoranjanBabu; ,O.Srinivasu

    2016-01-01

    This project "VULNERABLE HUNTER" application main aim is to detect risk in our mobile applications. This application contains modules like Fetch Application, Generate Score, Uninstall and Display Graph. Through this application it detects risk so that this application is very useful to smart phone users Now-a-days so many people are using smart phones and people are crazy about new apps. But by installing all the applications into our mobile may reduce its performance. Some apps c...

  5. Teaching Hunter Responsibility.

    Science.gov (United States)

    Crume, Charles T.; Lang, George M.

    This guide provides volunteer hunter-education instructors with background information on subjects related to hunter education. A major goal of hunter education is to develop an environmental ethic among outdoorsmen, based on a deeper understanding of the natural world. Chapter 1 clarifies terms frequently used within the broad context of outdoor…

  6. Hunters' motivations and values:

    DEFF Research Database (Denmark)

    Radder, Laetitia; Bech-Larsen, Tino

    2008-01-01

    This article examines the values and motivations of South African biltong hunters. A hierarchical value map of associations between attributes, consequences and values resulted from laddering interviews with 34 hunters. The Means-End Chain approach proved useful in identifying: (a) personal value...

  7. HISTORICAL NOTE JOHN HUNTER (SURGEON) John Hunter FRS ...

    African Journals Online (AJOL)

    JOHN HUNTER (SURGEON). John Hunter FRS (13 February 1728-16 October 1793) was a Scottish surgeon, one of the most distinguished scientists and surgeons of his day. He was an early advocate of careful observation and scientific method in medicine. He was the husband of Anne Hunter, a teacher, friend and ...

  8. The Higgs hunter's guide

    CERN Document Server

    Gunion, John F; Haber, Howard E; Kane, Gordon L

    1989-01-01

    The Higgs Hunter's Guide is a definitive and comprehensive guide to the physics of Higgs bosons. In particular, it discusses the extended Higgs sectors required by those recent theoretical approaches that go beyond the Standard Model, including supersymmetry and superstring-inspired models.

  9. Motivations of female Black Hills deer hunters

    Science.gov (United States)

    Gigliotti, Larry M.; Covelli Metcalf, Elizabeth

    2016-01-01

    State fish and wildlife agencies are particularly interested in attracting female participation because of the potential to offset declining participation in hunting. Understanding female hunters’ motivations will be critical for designing effective recruitment and retention programs for women hunters. Although female participation in hunting is increasing, males still outnumber females by about tenfold. Gender differences in deer hunters were explored by comparing ratings of eight motivations (social, nature, excitement, meat, challenge, trophy, extra hunting opportunity, and solitude). Hunter types were defined by hunters’ selection of the most important motivation for why they like Black Hills deer hunting. Overall, females and males were relatively similar in their ratings of the eight motivations, and we found 85% gender similarity in the selection of the most important motivation. Women were slightly more motivated by the food aspect of the hunt while men placed slightly more value on the hunt as a sporting activity.

  10. Hunters in the New Millennium

    DEFF Research Database (Denmark)

    Hansen, Hans Peter

    that hunting is a common source of conflict between different interests, only very few studies has been made to produce knowledge about people hunting for leisure. The survey “Hunters in the new millennium” is an attempt to contribute to a better understanding of hunters and hunting in an increasing urbanized...

  11. Neurogenic bladder in Hunter's syndrome.

    Science.gov (United States)

    Koyama, K; Moda, Y; Sone, A; Tanaka, H; Hino, Y

    1994-01-01

    We encountered a rare patient with Hunter's syndrome who exhibited urinary retention as a result of a neurogenic bladder, uninhibited detrusor contractions, and detrusor-sphincter dyssynergia. Neurological findings were consistent with cervical myelopathy and cervical MR imaging showed very narrow segments at the cord level C2-4. We speculate that this Hunter's syndrome patient has cervical myelopathy and that this neurological dysfunction causes the neurogenic bladder. PMID:8014981

  12. Planet Hunters: Kepler by Eye

    Science.gov (United States)

    Schwamb, Megan E.; Lintott, C.; Fischer, D.; Smith, A. M.; Boyajian, T. S.; Brewer, J. M.; Giguere, M. J.; Lynn, S.; Parrish, M.; Schawinski, K.; Schmitt, J.; Simpson, R.; Wang, J.

    2014-01-01

    Planet Hunters (http://www.planethunters.org), part of the Zooniverse's (http://www.zooniverse.org) collection of online citizen science projects, uses the World Wide Web to enlist the general public to identify transits in the pubic Kepler light curves. Planet Hunters utilizes human pattern recognition to identify planet transits that may be missed by automated detection algorithms looking for periodic events. Referred to as ‘crowdsourcing’ or ‘citizen science’, the combined assessment of many non-expert human classifiers with minimal training can often equal or best that of a trained expert and in many cases outperform the best machine-learning algorithm. Visitors to the Planet Hunters' website are presented with a randomly selected ~30-day light curve segment from one of Kepler’s ~160,000 target stars and are asked to draw boxes to mark the locations of visible transits in the web interface. 5-10 classifiers review each 30-day light curve segment. Since December 2010, more than 260,000 volunteers world wide have participated, contributing over 20 million classifications. We have demonstrated the success of a citizen science approach with the project’s more than 20 planet candidates, the discovery of PH1b, a transiting circumbinary planet in a quadruple star system, and the discovery of PH2-b, a confirmed Jupiter-sized planet in the habitable zone of a Sun-like star. I will provide an overview of Planet Hunters, highlighting several of project's most recent exoplanet and astrophysical discoveries. Acknowledgements: MES was supported in part by a NSF AAPF under award AST-1003258 and a American Philosophical Society Franklin Grant. We acknowledge support from NASA ADAP12-0172 grant to PI Fischer.

  13. Danes - The keen bargain hunters

    DEFF Research Database (Denmark)

    Jensen, Birger Boutrup

    2008-01-01

    New research proves that Danes are keen bargain hunters, and that they do specific price checks before selecting a product.......New research proves that Danes are keen bargain hunters, and that they do specific price checks before selecting a product....

  14. Influence of Age and Educational Level on the Behavior of Hunters in Vojvodina Province (Serbia

    Directory of Open Access Journals (Sweden)

    Vladimir Marković

    2011-07-01

    Full Text Available Education as an important factor in the development of economy has a major impact on the development of hunting and hunting tourism. In this research, it has conducted a survey of hunters from the territory of Vojvodina Province regarding their attitude and motives for hunting, importance of education, importance of GIS in hunting, poaching as well as their level of hunting ethics. Using SPSS program, it was cross-referenced the individual responses in relation to age category and level of education. The results show that the youngest hunters (18 to 35 years compared to middle age hunters (35-59 years and old hunters (over 60 visit hunting events more, they are the most informed about GIS and they are most willing to learn about these technologies. The number of hunters that took part in the poaching is proportional with their level of education, so that most hunters that participate in poaching hold a university degree. However, hunters holding a university degree in the highest percentage believe that GIS can contribute to the development of hunting largely, and are willing to participate in training.

  15. Fecundity and longevity of Bactrocera carambolae Drew & Hancock (Diptera: Tephritidae

    Directory of Open Access Journals (Sweden)

    Cristiane Ramos Jesus-Barros

    2017-12-01

    Full Text Available Bactrocera carambolae Drew & Hancock is an exotic species considered a quarantine pest in Brazil, with distribution limited to the states of Amapá and Roraima. Knowledge of its biology under Brazilian conditions is still limited. The objective of this work was to determine the fecundity and longevity of B. carambolae females, reared on artificial diet, under laboratory conditions. The experiment was carried out at Embrapa Amapá, where 20 newly emerged B. carambolae couples were selected (F3 generation. Each couple was placed in a plastic cage containing feed, distilled water and an artificial oviposition device and stored in an air-conditioned room (26 ± 1°C, 60 ± 10% R. H. and 12-hour photoperiod. The eggs deposited on each device were counted daily. Mean survival was 90.70 ± 9.97 days and the maximum longevity was 150 days. The mean duration of the pre-oviposition period was 25.15 ± 3.54 days and the oviposition period was 62.73 ± 7.84 days. Fecundity was variable over time, with an oviposition peak on the 28th day. The mean number of eggs per female was 1,088.26 ± 167.82. These results suggest that B. carambolae uses high fecundity and longevity as a reproductive strategy.

  16. Evaluation of PHI Hunter in Natural Language Processing Research.

    Science.gov (United States)

    Redd, Andrew; Pickard, Steve; Meystre, Stephane; Scehnet, Jeffrey; Bolton, Dan; Heavirland, Julia; Weaver, Allison Lynn; Hope, Carol; Garvin, Jennifer Hornung

    2015-01-01

    We introduce and evaluate a new, easily accessible tool using a common statistical analysis and business analytics software suite, SAS, which can be programmed to remove specific protected health information (PHI) from a text document. Removal of PHI is important because the quantity of text documents used for research with natural language processing (NLP) is increasing. When using existing data for research, an investigator must remove all PHI not needed for the research to comply with human subjects' right to privacy. This process is similar, but not identical, to de-identification of a given set of documents. PHI Hunter removes PHI from free-form text. It is a set of rules to identify and remove patterns in text. PHI Hunter was applied to 473 Department of Veterans Affairs (VA) text documents randomly drawn from a research corpus stored as unstructured text in VA files. PHI Hunter performed well with PHI in the form of identification numbers such as Social Security numbers, phone numbers, and medical record numbers. The most commonly missed PHI items were names and locations. Incorrect removal of information occurred with text that looked like identification numbers. PHI Hunter fills a niche role that is related to but not equal to the role of de-identification tools. It gives research staff a tool to reasonably increase patient privacy. It performs well for highly sensitive PHI categories that are rarely used in research, but still shows possible areas for improvement. More development for patterns of text and linked demographic tables from electronic health records (EHRs) would improve the program so that more precise identifiable information can be removed. PHI Hunter is an accessible tool that can flexibly remove PHI not needed for research. If it can be tailored to the specific data set via linked demographic tables, its performance will improve in each new document set.

  17. The hunter a scientific novel

    CERN Document Server

    Genta, Giancarlo

    2013-01-01

    The 24th century: humankind has become a spacefaring civilization, colonizing the solar system and beyond. While no alien forms of life have yet been encountered in this expansion into space, colonists suddenly encounter machines of alien origin - huge robots able to reproduce themselves.  Called replicators by the colonists, they seem to have but a single goal: to destroy all organic life they come in contact with. Since the colonial governments have no means to fight this menace directly, they instead promise huge rewards to whoever destroys a replicator. As a result, the frontier attracts a new kind of adventurers, the Hunters, who work to find and destroy the replicators. Mike Edwards, a skilled young maintenance technician and robotics expert at a faraway outpost, will not only become one of them - but be the very first one to unlock the secret behind the replicators’ origin and mission.   The scientific and technical aspects underlying the plot - in particular space travel, robotics and self-replica...

  18. Honey, Hadza, hunter-gatherers, and human evolution.

    Science.gov (United States)

    Marlowe, Frank W; Berbesque, J Colette; Wood, Brian; Crittenden, Alyssa; Porter, Claire; Mabulla, Audax

    2014-06-01

    Honey is the most energy dense food in nature. It is therefore not surprising that, where it exists, honey is an important food for almost all hunter-gatherers. Here we describe and analyze widespread honey collecting among foragers and show that where it is absent, in arctic and subarctic habitats, honey bees are also rare to absent. Second, we focus on one hunter-gatherer society, the Hadza of Tanzania. Hadza men and women both rank honey as their favorite food. Hadza acquire seven types of honey. Hadza women usually acquire honey that is close to the ground while men often climb tall baobab trees to raid the largest bee hives with stinging bees. Honey accounts for a substantial proportion of the kilocalories in the Hadza diet, especially that of Hadza men. Cross-cultural forager data reveal that in most hunter-gatherers, men acquire more honey than women but often, as with the Hadza, women do acquire some. Virtually all warm-climate foragers consume honey. Our closest living relatives, the great apes, take honey when they can. We suggest that honey has been part of the diet of our ancestors dating back to at least the earliest hominins. The earliest hominins, however, would have surely been less capable of acquiring as much honey as more recent, fully modern human hunter-gatherers. We discuss reasons for thinking our early ancestors would have acquired less honey than foragers ethnographically described, yet still significantly more than our great ape relatives. Copyright © 2014 Elsevier Ltd. All rights reserved.

  19. Hunter College Dance Therapy Masters Program.

    Science.gov (United States)

    Schmais, Claire; White, Elissa Q.

    Described is development of the Hunter College dance therapy 18-month 30-credit masters program involving 33 adult students, (in two classes beginning in 1971 and 1972), an educational model, internship in psychiatric institutions, and preparation of instructional materials. The dance therapist is said to incorporate the psychiatric patient's…

  20. "The Deer Hunter": Rhetoric of the Warrior.

    Science.gov (United States)

    Rushing, Janice Hocker; Frentz, Thomas S.

    A psychological/ritual model of criticism is used to examine the movie "The Deer Hunter" as a rhetorical event in which males undergo psychological change through their war and postwar experiences. The critical model depends on understanding a Jungian interpretation of the human psyche, the form and function of initiation rituals, and…

  1. PALEOLITHIC HUNTER-GATHERERS' DIETARY PATTERNS ...

    African Journals Online (AJOL)

    Dr. Al-Domi

    the main aspects of Paleolithic hunter-gatherers' dietary patterns and its main long-term ... Hence, people in developing countries have been exposed to certain ... as food habits, which prompted possible negative impacts on health status leading to ... costs [5, 7]. .... Agricultural revolution with efficient production of grains,.

  2. Anterior Hypopituitarism and Treatment Response in Hunter Syndrome: A Comparison of Two Patients

    Directory of Open Access Journals (Sweden)

    Munier A. Nour

    2016-01-01

    Full Text Available Hypopituitarism is a clinically important diagnosis and has not previously been reported in Hunter syndrome. We contrast two cases with anatomic pituitary anomalies: one with anterior panhypopituitarism and the other with intact pituitary function. Patient 1, a 10-year-old boy with Hunter syndrome, was evaluated for poor growth and an ectopic posterior pituitary gland. Endocrine testing revealed growth hormone (GH deficiency, secondary adrenal insufficiency, and tertiary hypothyroidism. An improvement in growth velocity with hormone replacement (GH, thyroxine, and corticosteroid was seen; however, final adult height remained compromised. Patient 2, a 13-year-old male with Hunter syndrome, was evaluated for growth failure. He had a large empty sella turcica with posteriorly displaced pituitary. Functional endocrine testing was normal and a trial of GH-treatment yielded no significant effect. Panhypopituitarism associated with pituitary anomalies has not been previously reported in Hunter syndrome and was an incidental finding of significant clinical importance. In the setting of documented anterior hypopituitarism, while hormone replacement improved growth velocity, final height remained impaired. In patient 2 with equivocal GH-testing results, treatment had no effect on linear growth. These cases highlight the importance of careful clinical assessment in Hunter syndrome and that judicious hormone replacement may be indicated in individual cases.

  3. Targeting hunter distribution based on host resource selection and kill sites to manage disease risk.

    Science.gov (United States)

    Dugal, Cherie J; van Beest, Floris M; Vander Wal, Eric; Brook, Ryan K

    2013-10-01

    Endemic and emerging diseases are rarely uniform in their spatial distribution or prevalence among cohorts of wildlife. Spatial models that quantify risk-driven differences in resource selection and hunter mortality of animals at fine spatial scales can assist disease management by identifying high-risk areas and individuals. We used resource selection functions (RSFs) and selection ratios (SRs) to quantify sex- and age-specific resource selection patterns of collared (n = 67) and hunter-killed (n = 796) nonmigratory elk (Cervus canadensis manitobensis) during the hunting season between 2002 and 2012, in southwestern Manitoba, Canada. Distance to protected area was the most important covariate influencing resource selection and hunter-kill sites of elk (AICw = 1.00). Collared adult males (which are most likely to be infected with bovine tuberculosis (Mycobacterium bovis) and chronic wasting disease) rarely selected for sites outside of parks during the hunting season in contrast to adult females and juvenile males. The RSFs showed selection by adult females and juvenile males to be negatively associated with landscape-level forest cover, high road density, and water cover, whereas hunter-kill sites of these cohorts were positively associated with landscape-level forest cover and increasing distance to streams and negatively associated with high road density. Local-level forest was positively associated with collared animal locations and hunter-kill sites; however, selection was stronger for collared juvenile males and hunter-killed adult females. In instances where disease infects a metapopulation and eradication is infeasible, a principle goal of management is to limit the spread of disease among infected animals. We map high-risk areas that are regularly used by potentially infectious hosts but currently underrepresented in the distribution of kill sites. We present a novel application of widely available data to target hunter distribution based on host resource

  4. Traditional Bulgarian Hunter's Cuisine (Hunter's Cooking Book (1939 [In Bulgarian

    Directory of Open Access Journals (Sweden)

    A. Petrushev

    2012-09-01

    Full Text Available This very rare book was published in Belogradchik in 1939. The publisher is Stamen Kamenov. Stamen Kamenov owned a printing press, where several books of local and national importance were printed. This is a cookbook with recipes for cooking wild game. The book is relevant to modern man because it shows what has been the cuisine of old Bulgarians.

  5. Comparing Road-Kill Datasets from Hunters and Citizen Scientists in a Landscape Context

    Directory of Open Access Journals (Sweden)

    Florian Heigl

    2016-10-01

    Full Text Available Road traffic has severe effects on animals, especially when road-kills are involved. In many countries, official road-kill data are provided by hunters or police; there are also road-kill observations reported by citizen scientists. The aim of the current study was to test whether road-kill reports by hunters stem from similar landscapes than those reported by citizen scientists. We analysed the surrounding landscapes of 712 road-kill reportings of European hares in the province of Lower Austria. Our data showed that road-killed hares reported both by hunters and citizens are predominantly surrounded by arable land. No difference of hedges and solitary trees could be found between the two datasets. However, significant differences in landcover classes and surrounding road networks indicate that hunters’ and citizen scientists’ data are different. Hunters reported hares from landscapes with significantly higher percentages of arable land, and greater lengths of secondary roads. In contrast, citizens reported hares from landscapes with significantly higher percentages of urban or industrial areas and greater lengths of motorways, primary roads, and residential roads. From this we argue that hunters tend to report data mainly from their hunting areas, whereas citizens report data during their daily routine on the way to/from work. We conclude that a citizen science approach is an important source for road-kill data when used in addition to official data with the aim of obtaining an overview of road-kill events on a landscape scale.

  6. Reducing Lead on the Landscape: Anticipating Hunter Behavior in Absence of a Free Nonlead Ammunition Program.

    Directory of Open Access Journals (Sweden)

    Loren Chase

    Full Text Available Lead is a neurotoxin that has been documented to affect many forms of wildlife, and has been identified as a limiting factor in a population of California Condors in Northern Arizona. The Arizona Game and Fish Department provides vouchers for free nonlead ammunition to hunters selected to hunt within the distribution of California Condors, with the intention of having fewer lead-laden offal piles available to California Condors. Although wildlife agencies may reasonably assume voucher programs motivate hunters into choosing nonlead ammunition, the lead reduction efforts attributable to the voucher program has not been empirically quantified. Our intention was to compare a control group of hunters to a treatment group of hunters within California Condor occupied areas. Both groups received educational materials regarding the deleterious effects of lead, but the treatment group also received a voucher for a free initial box of ammunition. About half of the control group used nonlead ammunition, compared to about three-fourths of the treatment group. Prominent barriers to adoption of nonlead ammunition included a general difficulty of obtaining it, obtaining it in the desired caliber, and its costliness. Frequently mentioned motivations for using nonlead was the exhortation to use it by the Department, and the desire to aid California Condor recovery by hunters. The disparate compliance rates found herein confirm and quantify the success of nonlead ammunition voucher programs, but underscore the importance of working to increase the supply of nonlead ammunition with the end of facilitating its procurement and reducing its cost.

  7. Radium issues at Hunters Point Annex

    International Nuclear Information System (INIS)

    Dean, S.M.

    1994-01-01

    Radium was a common source of illumination used in numerous instruments and gauges for military equipment prior to 1970. As a result of its many military applications radium 226 is now a principle radionuclide of concern at military base closures sites throughout the United States. This is an overview of the site characterization strategy employed and a potential site remediation technology being considered at a radium contaminated landfill at Hunters Point Annex, a former U.S. Navy shipyard in San Francisco, California

  8. Injury and Illness Among Deer Hunters

    OpenAIRE

    McRae, Shelagh M.

    1989-01-01

    General practice and out-patient emergency records for a five-year period were reviewed for injuries and illnesses that occurred during the week of deer rifle hunting on Manitoulin Island. Of 65 hunters who were identified, most had lacerations secondary to knife injuries. There were two deaths (one shooting and one in a motor vehicle accident), and 19 persons required hospitalization. More than half of these serious accidents occurred on the weekends immediately preceding or following the hu...

  9. Hunter-gatherer energetics and human obesity.

    Science.gov (United States)

    Pontzer, Herman; Raichlen, David A; Wood, Brian M; Mabulla, Audax Z P; Racette, Susan B; Marlowe, Frank W

    2012-01-01

    Western lifestyles differ markedly from those of our hunter-gatherer ancestors, and these differences in diet and activity level are often implicated in the global obesity pandemic. However, few physiological data for hunter-gatherer populations are available to test these models of obesity. In this study, we used the doubly-labeled water method to measure total daily energy expenditure (kCal/day) in Hadza hunter-gatherers to test whether foragers expend more energy each day than their Western counterparts. As expected, physical activity level, PAL, was greater among Hadza foragers than among Westerners. Nonetheless, average daily energy expenditure of traditional Hadza foragers was no different than that of Westerners after controlling for body size. The metabolic cost of walking (kcal kg(-1) m(-1)) and resting (kcal kg(-1) s(-1)) were also similar among Hadza and Western groups. The similarity in metabolic rates across a broad range of cultures challenges current models of obesity suggesting that Western lifestyles lead to decreased energy expenditure. We hypothesize that human daily energy expenditure may be an evolved physiological trait largely independent of cultural differences.

  10. Hunter-gatherer energetics and human obesity.

    Directory of Open Access Journals (Sweden)

    Herman Pontzer

    Full Text Available Western lifestyles differ markedly from those of our hunter-gatherer ancestors, and these differences in diet and activity level are often implicated in the global obesity pandemic. However, few physiological data for hunter-gatherer populations are available to test these models of obesity. In this study, we used the doubly-labeled water method to measure total daily energy expenditure (kCal/day in Hadza hunter-gatherers to test whether foragers expend more energy each day than their Western counterparts. As expected, physical activity level, PAL, was greater among Hadza foragers than among Westerners. Nonetheless, average daily energy expenditure of traditional Hadza foragers was no different than that of Westerners after controlling for body size. The metabolic cost of walking (kcal kg(-1 m(-1 and resting (kcal kg(-1 s(-1 were also similar among Hadza and Western groups. The similarity in metabolic rates across a broad range of cultures challenges current models of obesity suggesting that Western lifestyles lead to decreased energy expenditure. We hypothesize that human daily energy expenditure may be an evolved physiological trait largely independent of cultural differences.

  11. Landscape and Social Values in Popular Children's Literature: Nancy Drew Mysteries.

    Science.gov (United States)

    Brooker-Gross, Susan R.

    1981-01-01

    Examines the covert lessons in moral social geography found in a set of popular juvenile fiction published between 1924 and 1978--the Nancy Drew mystery stories. Topics discussed include landscape symbolism, urban environments, uses of geographical elements in the stories, rural settings, wilderness settings, social stereotypes, and landscape…

  12. Core Hunter 3: flexible core subset selection.

    Science.gov (United States)

    De Beukelaer, Herman; Davenport, Guy F; Fack, Veerle

    2018-05-31

    Core collections provide genebank curators and plant breeders a way to reduce size of their collections and populations, while minimizing impact on genetic diversity and allele frequency. Many methods have been proposed to generate core collections, often using distance metrics to quantify the similarity of two accessions, based on genetic marker data or phenotypic traits. Core Hunter is a multi-purpose core subset selection tool that uses local search algorithms to generate subsets relying on one or more metrics, including several distance metrics and allelic richness. In version 3 of Core Hunter (CH3) we have incorporated two new, improved methods for summarizing distances to quantify diversity or representativeness of the core collection. A comparison of CH3 and Core Hunter 2 (CH2) showed that these new metrics can be effectively optimized with less complex algorithms, as compared to those used in CH2. CH3 is more effective at maximizing the improved diversity metric than CH2, still ensures a high average and minimum distance, and is faster for large datasets. Using CH3, a simple stochastic hill-climber is able to find highly diverse core collections, and the more advanced parallel tempering algorithm further increases the quality of the core and further reduces variability across independent samples. We also evaluate the ability of CH3 to simultaneously maximize diversity, and either representativeness or allelic richness, and compare the results with those of the GDOpt and SimEli methods. CH3 can sample equally representative cores as GDOpt, which was specifically designed for this purpose, and is able to construct cores that are simultaneously more diverse, and either are more representative or have higher allelic richness, than those obtained by SimEli. In version 3, Core Hunter has been updated to include two new core subset selection metrics that construct cores for representativeness or diversity, with improved performance. It combines and outperforms the

  13. Factors impacting hunter access to private lands in southeast Minnesota

    Science.gov (United States)

    Walberg, Eric; Cornicelli, Louis; Fulton, David C.

    2018-01-01

    White-tailed deer (Odocoileus virginianus) have important socioeconomic and ecological impacts in the United States. Hunting is considered to be important for the effective management of deer and relies on access to privately owned lands. In 2013, we surveyed nonindustrial private landowners in southeast Minnesota and created two logit models to examine factors that impact landowners’ decision to (a) allow public hunting access and (b) post private property. Parcel characteristics were found to impact landowner decisions to allow hunting access, particularly the size of the property and whether it was posted. Hunting access to small properties was more likely to be restricted to family, friends, and neighbors (83%) compared to medium (74%) or large properties (60%). Hunter concerns (e.g., liability) and knowledge about deer management was significant in both models, suggesting there are opportunities to educate landowners about the importance of allowing public hunting access and available liability protections.

  14. Hunters syndrom og hørenedsaettelse

    DEFF Research Database (Denmark)

    Kiaer, Eva Kirkegaard; Møller, Troels Reinholdt; Wetke, Randi

    2010-01-01

    A 30 month-old boy with delayed language development was referred to the Department of Audiology in Aarhus. At the time of referral he had had 19 cases of acute otitis media and had been tubulated four times. Furthermore, the boy had not developed according to age in several respects: his motor...... functions and language were delayed, and he made audible respiratory sounds and was obviously nasally congested. The boy was referred for further investigations at the Department of Paediatrics. The tests showed that the boy suffered from Hunter Syndrome (MPSII) and he underwent relevant treatment....

  15. Undergraduate Planet Hunters: Tools and Results

    Science.gov (United States)

    Buzasi, Derek L.; Carboneau, Lindsey; Ferrell, Laura; Green, Gilbert; Kaiser, Maya; Kreke, Kira; Lundy, Samantha; Merritt, William; Passino, Matlin; Paxton, Harrison; Podaril, Alexandria; Stansfield, Alexis

    2018-06-01

    One student "Honors Experience" option at Florida Gulf Coast University is a research experience, and we have developed a "Planet Hunters" course to provide an astronomical research track that satisfies that requirement. Students spend the first semester learning astronomical background and exoplanet detection techniques, while the second semester is primarily devoted to planet searches in K2 data using student-oriented software tools developed specifically for the task. In this poster, we illustrate those tools and show results obtained by class participants during this years experience.

  16. Low-frequency electromagnetic measurements at the NPE and Hunter`s Trophy: A comparison

    Energy Technology Data Exchange (ETDEWEB)

    Sweeney, J.J. [Lawrence Livermore National Lab., CA (United States)

    1994-12-31

    Sensors and recorders were deployed for both the Non-Proliferative Experiment (NPE) and Hunter`s Trophy to measure low-frequency (1-30 Hz) electric and magnetic fields accompanying the detonation. Two stations were used for each event, located at a slant range of about 500 m, with measurements of orthogonal horizontal electric field and orthogonal horizontal and vertical magnetic field. Signals were recorded digitally with at 200 Hz sampling rate. Separate magnetic and electric signals were recorded which can be related both to the detonation and the arrival of the shock wave. The detonation time signal from the nuclear explosion is a relatively short pulse occurring with no detectable delay (within 0.5 ms) ranging from 11-19 ms after the detonation time. The cause of the initial electromagnetic signal for both chemical and nuclear explosions is unknown; the differences between the NPE and Hunter`s Trophy results may be related to the different mechanisms involved with plasma generation between nuclear and chemical explosions.

  17. Radioactive caesium in hunters and their families

    Energy Technology Data Exchange (ETDEWEB)

    Aagren, G; Bergman, R [Natonal Defence Research Establishment, Umeaa (Sweden); Drottz-Sjoeberg, B M [Center for Risk Research, Stockholm (Sweden); Enander, A [National Defence Research Establishment, Karlstad (Sweden); Johansson, K J [Swedish Univ. of Agricultural Sciences, Uppsala (Sweden)

    1995-12-01

    We have measured the whole-body content of radiocesium in men and women in households, where at least one member is a hunter. Hunter families live to a great extent on forest products, such as mushrooms, berries and meat from game. Measurements were performed in two areas in northern Sweden and in three areas in the middle part of Sweden with deposition levels between 7 to 80 kBq/m{sup 2}. The average whole body content of {sup 137}Cs varied between 0.3 to 1.9 kBq for women and 0.6 to 4.7 kBq for men, depending on the deposition level. Each individual in the measured group was also asked to fill in questionnaire and a food diary to provide complementary information of, e.g., food intake and other life conditions. The single dietary factor most clearly related to whole-body content in these groups is the intake of meat from moose. The best regression model with variables from the questionnaire explained 60% of the variance in the whole-body content of {sup 137}Cs in the measurement group. Some of the variables in this model were deposition level, sex, rate of intake and estimated consumption of moose meat and estimated amount of bilberries in the fridge. 6 refs, 5 figs, 14 tabs.

  18. Radioactive caesium in hunters and their families

    International Nuclear Information System (INIS)

    Aagren, G.; Bergman, R.; Drottz-Sjoeberg, B.M.; Enander, A.; Johansson, K.J.

    1995-12-01

    We have measured the whole-body content of radiocesium in men and women in households, where at least one member is a hunter. Hunter families live to a great extent on forest products, such as mushrooms, berries and meat from game. Measurements were performed in two areas in northern Sweden and in three areas in the middle part of Sweden with deposition levels between 7 to 80 kBq/m 2 . The average whole body content of 137 Cs varied between 0.3 to 1.9 kBq for women and 0.6 to 4.7 kBq for men, depending on the deposition level. Each individual in the measured group was also asked to fill in questionnaire and a food diary to provide complementary information of, e.g., food intake and other life conditions. The single dietary factor most clearly related to whole-body content in these groups is the intake of meat from moose. The best regression model with variables from the questionnaire explained 60% of the variance in the whole-body content of 137 Cs in the measurement group. Some of the variables in this model were deposition level, sex, rate of intake and estimated consumption of moose meat and estimated amount of bilberries in the fridge. 6 refs, 5 figs, 14 tabs

  19. Wildlife value orientations among hunters, landowners and the general public

    DEFF Research Database (Denmark)

    Gamborg, Christian; Jensen, Frank Søndergaard

    2016-01-01

    This article examined wildlife value orientations among hunters (n = 1,130) and landowners (n = 1,207) in comparison to the general public (n = 1,001 adults) in Denmark, a highly urbanized European country. Respondents were categorized into four value types based on their responses to 19 statements....... Significant differences in wildlife value orientations were found. Mutualists and distanced dominated in the public; most landowners and hunters were utilitarian followed by pluralist. Male hunters were more utilitarian than female. More active hunters were more utilitarian; hunters belonging to a hunting...... association were more utilitarian than those who did not belong to associations. Full-time farmers were more utilitarian than part-time farmers, and conventional farmers were more utilitarian than organic farmers. No significant difference with regard to residence for all three groups was found. Future...

  20. Contrasts in livelihoods and protein intake between commercial and subsistence bushmeat hunters in two villages on Bioko Island, Equatorial Guinea.

    Science.gov (United States)

    Vega, María Grande; Carpinetti, Bruno; Duarte, Jesús; Fa, John E

    2013-06-01

    Across West and Central Africa, wildlife provides a source of food and income. We investigated the relation between bushmeat hunting and household wealth and protein consumption in 2 rural communities in Bioko Island, Equatorial Guinea. One village was dedicated to commercial hunting, the other trapped game primarily for food. We tested whether commercial-hunter households were nutritionally advantaged over subsistence-hunter households due to their higher income from the bushmeat trade and greater access to wild-animal protein. We conducted bushmeat-offtake surveys in both villages (captures by hunters and carcasses arriving to each village). Mammals (including threatened primates: black colobus [Colobus satanas], Preussi's guenon [Allochrocebus preussi], and russet-eared guenon [Cercopithecus erythrotis]), birds, and reptiles were hunted. The blue duiker (Philantomba monticola), giant pouched rat (Cricetomys emini), and brush-tailed porcupine (Atherurus africanus) contributed almost all the animal biomass hunted, consumed, or sold in both villages. Monkeys and Ogilbyi's duikers (Cephalophus ogilbyi) were hunted only by commercial hunters. Commercial hunters generated a mean of US$2000/year from bushmeat sales. Households with commercial hunters were on average wealthier, generated more income, spent more money on nonessential goods, and bought more products they did not grow. By contrast, households with subsistence hunters spent less on market items, spent more on essential products, and grew more of their own food. Despite these differences, average consumption of vegetable protein and domestic meat and bushmeat protein did not differ between villages. Our results highlight the importance of understanding the socioeconomic and nutritional context of commercial and subsistence bushmeat hunting to correctly interpret ways of reducing their effects on threatened species and to enable the sustainable offtake of more productive taxa. © 2013 Society for Conservation

  1. Hide Tanning and Its Use in Taiga: The Case of the Orochen-Evenki Reindeer Herders and Hunters of Zabaikalye (East Siberia

    Directory of Open Access Journals (Sweden)

    Donatas Brandišauskas

    2011-05-01

    Full Text Available This article documents the way in which the Orochen-Evenki hunters and herders in northern part of Zabaikalye tan hides and produce gear in the post-Soviet era. Here, I wish to present the argument that it is difficult to understand the reviving of hide tanning in remote villages and the taiga without understanding how hunters and herders in this region adapt to the unstable post-Soviet environment. I suggest that hunters and herders aim to maintain their autonomy from goods and resources imported from cities, and, in spending little effort connecting with state powers in this way, securing their lives from socio-economic constraints.

  2. Hide Tanning and Its Use in Taiga: The Case of the Orochen-Evenki Reindeer Herders and Hunters of Zabaikalye (East Siberia

    Directory of Open Access Journals (Sweden)

    Donatas Brandišauskas

    2010-12-01

    Full Text Available This article documents the way in which the Orochen-Evenki hunters and herders in northern part of Zabaikalye tan hides and produce gear in the post-Soviet era. Here, I wish to present the argument that it is difficult to understand the reviving of hide tanning in remote villages and the taiga without understanding how hunters and herders in this region adapt to the unstable post-Soviet environment. I suggest that hunters and herders aim to maintain their autonomy from goods and resources imported from cities, and, in spending little effort connecting with state powers in this way, securing their lives from socio-economic constraints.

  3. Discrete choice modeling of season choice for Minnesota turkey hunters

    Science.gov (United States)

    Schroeder, Susan A.; Fulton, David C.; Cornicelli, Louis; Merchant, Steven S.

    2018-01-01

    Recreational turkey hunting exemplifies the interdisciplinary nature of modern wildlife management. Turkey populations in Minnesota have reached social or biological carrying capacities in many areas, and changes to turkey hunting regulations have been proposed by stakeholders and wildlife managers. This study employed discrete stated choice modeling to enhance understanding of turkey hunter preferences about regulatory alternatives. We distributed mail surveys to 2,500 resident turkey hunters. Results suggest that, compared to season structure and lotteries, additional permits and level of potential interference from other hunters most influenced hunter preferences for regulatory alternatives. Low hunter interference was preferred to moderate or high interference. A second permit issued only to unsuccessful hunters was preferred to no second permit or permits for all hunters. Results suggest that utility is not strictly defined by harvest or an individual's material gain but can involve preference for other outcomes that on the surface do not materially benefit an individual. Discrete stated choice modeling offers wildlife managers an effective way to assess constituent preferences related to new regulations before implementing them. 

  4. Linking Hunter Knowledge with Forest Change to Understand Changing Deer Harvest Opportunities in Intensively Logged Landscapes

    Directory of Open Access Journals (Sweden)

    Todd J. Brinkman

    2009-06-01

    Full Text Available The effects of landscape changes caused by intensive logging on the availability of wild game are important when the harvest of wild game is a critical cultural practice, food source, and recreational activity. We assessed the influence of extensive industrial logging on the availability of wild game by drawing on local knowledge and ecological science to evaluate the relationship between forest change and opportunities to harvest Sitka black-tailed deer (Odocoileus hemionus sitkensis on Prince of Wales Island, Alaska. We used data collected through interviews with local deer hunters and GIS analysis of land cover to determine relationships among landscape change, hunter access, and habitat for deer hunting over the last 50 yr. We then used these relationships to predict how harvest opportunities may change in the future. Intensive logging from 1950 into the 1990s provided better access to deer and habitat that facilitated deer hunting. However, successional changes in intensively logged forests in combination with a decline in current logging activity have reduced access to deer and increased undesirable habitat for deer hunting. In this new landscape, harvest opportunities in previously logged landscapes have declined, and hunters identify second-growth forest as one of the least popular habitats for hunting. Given the current state of the logging industry in Alaska, it is unlikely that the logging of the remaining old-growth forests or intensive management of second-growth forests will cause hunter opportunities to rebound to historic levels. Instead, hunter opportunities may continue to decline for at least another human generation, even if the long-term impacts of logging activity and deer harvest on deer numbers are minimal. Adapting hunting strategies to focus on naturally open habitats such as alpine and muskeg that are less influenced by external market forces may require considerably more hunting effort but provide the best option for

  5. Effect of Piper chaba Hunter, Piper sarmentosum Roxb. and Piper interruptum Opiz. on natural killer cell activity and lymphocyte proliferation.

    Science.gov (United States)

    Panthong, Sumalee; Itharat, Arunporn

    2014-08-01

    Immune system is the most important system ofhuman body. Thaifolk doctors have used some medicinal plants as an adaptogenic drug or immunomodulatory agent. Piper chaba Hunter, Piper sarmentosum Roxb. and Piper interruptum Opiz. are used by folk doctors to activate immune response in cancer patients. To investigate the effect on natural killer cell activity and on lymphocyte proliferation activity of water extract of P chaba Hunter P. sarmentosum Roxb. and P interruptum Opiz. MATERIAL ANDMETHOD: Plant materials were extracted by decoction method. All extracts were testedfor an immunomodulatory effect using PBMCs from twelve healthy donors by chromium release assay. Lymphocyte proliferation was also determined by 3H-thymidine uptake assay. The degree of activation was expressed as the stimulation index. The water extract of P chaba Hunter significantly increased lymphocyte proliferation at concentrations ofl ng/ml, 10 ng/ml, 1 μg/ml, 5 μg/ml, 10 μg/ml and 100 μg/ml. P sarmentosum Roxb., and P interruptum Opiz. extracts at those concentrations significantly stimulated lymphocyteproliferation. P sarmentosum Roxb. extractsignificantly increased natural killer (NK) cell activity at a concentration of 100 μg/ml but P chaba Hunter and P interruptum Opiz. extracts did not significantly stimulate natural killer cell activity. P chaba Hunter, P interruptum Opiz. andP sarmentosum Roxb. have an immunomodulatory effect especially for P sarmentosum Roxb. extract which can activate both lymphocyte proliferation and NK cell activity.

  6. Improvements to the Hunter Dose tracking system

    Energy Technology Data Exchange (ETDEWEB)

    Whiteside, T. S. [Savannah River Site (SRS), Aiken, SC (United States). Savannah River National Lab. (SRNL); Aucott, T. J. [Savannah River Site (SRS), Aiken, SC (United States). Savannah River National Lab. (SRNL); Brand, A. D. [Savannah River Site (SRS), Aiken, SC (United States). Savannah River National Lab. (SRNL); Diprete, D. P. [Savannah River Site (SRS), Aiken, SC (United States). Savannah River National Lab. (SRNL)

    2017-07-01

    Since 1965, the Savannah River Site (SRS) has conducted deer hunts which are open to the general public. SRS performs field monitoring for cesium-137 (Cs-137) of each harvested animal to determine whether the animal may be released to the hunter. A new field system for measuring Cs-137 in the harvested animals has been developed. The system incorporates numerous enhancements compared to the original system. The original system was composed of two Ludlum Measurements scalar-driven 2 inch x 2 inch sodium iodide counters, while the new system is based on a single Ametek Ortec Digibase-driven 2 inch x 4 inch x 16 inch sodium iodide gamma spectrometer. The new system includes a series of easy-to-assemble stainless steel encapsulated lead shields. The combination of the larger detector size and lead shielding improved the detection limit of the new system by a factor of approximately three compared to the original system. This lower detection limit allows for a larger number of measurements to be directly compared to the laboratory results, in cases where animal portions have been sampled. The results from developing and using this system are presented as well as recommendations on improvements to the overall field monitoring of the SRS hunts.

  7. Hunter-gatherers have less famine than agriculturalists.

    Science.gov (United States)

    Berbesque, J Colette; Marlowe, Frank W; Shaw, Peter; Thompson, Peter

    2014-01-01

    The idea that hunter-gatherer societies experience more frequent famine than societies with other modes of subsistence is pervasive in the literature on human evolution. This idea underpins, for example, the 'thrifty genotype hypothesis'. This hypothesis proposes that our hunter-gatherer ancestors were adapted to frequent famines, and that these once adaptive 'thrifty genotypes' are now responsible for the current obesity epidemic. The suggestion that hunter-gatherers are more prone to famine also underlies the widespread assumption that these societies live in marginal habitats. Despite the ubiquity of references to 'feast and famine' in the literature describing our hunter-gatherer ancestors, it has rarely been tested whether hunter-gatherers suffer from more famine than other societies. Here, we analyse famine frequency and severity in a large cross-cultural database, in order to explore relationships between subsistence and famine risk. This is the first study to report that, if we control for habitat quality, hunter-gatherers actually had significantly less--not more--famine than other subsistence modes. This finding challenges some of the assumptions underlying for models of the evolution of the human diet, as well as our understanding of the recent epidemic of obesity and type 2 diabetes mellitus.

  8. Social networks and cooperation in hunter-gatherers.

    Science.gov (United States)

    Apicella, Coren L; Marlowe, Frank W; Fowler, James H; Christakis, Nicholas A

    2012-01-25

    Social networks show striking structural regularities, and both theory and evidence suggest that networks may have facilitated the development of large-scale cooperation in humans. Here, we characterize the social networks of the Hadza, a population of hunter-gatherers in Tanzania. We show that Hadza networks have important properties also seen in modernized social networks, including a skewed degree distribution, degree assortativity, transitivity, reciprocity, geographic decay and homophily. We demonstrate that Hadza camps exhibit high between-group and low within-group variation in public goods game donations. Network ties are also more likely between people who give the same amount, and the similarity in cooperative behaviour extends up to two degrees of separation. Social distance appears to be as important as genetic relatedness and physical proximity in explaining assortativity in cooperation. Our results suggest that certain elements of social network structure may have been present at an early point in human history. Also, early humans may have formed ties with both kin and non-kin, based in part on their tendency to cooperate. Social networks may thus have contributed to the emergence of cooperation.

  9. Beyond the Cut Hunter: A Historical Epidemiology of HIV Beginnings in Central Africa.

    Science.gov (United States)

    Rupp, Stephanie; Ambata, Philippe; Narat, Victor; Giles-Vernick, Tamara

    2016-12-01

    In the absence of direct evidence, an imagined "cut hunter" stands in for the index patient of pandemic HIV/AIDS. During the early years of colonial rule, this explanation goes, a hunter was cut or injured from hunting or butchering a chimpanzee infected with simian immunodeficiency virus, resulting in the first sustained human infection with the virus that would emerge as HIV-1M. We argue here that the "cut hunter" relies on a historical misunderstanding and ecological oversimplification of human-chimpanzee (Pan Troglodytes troglodytes) interactions that facilitated pathogenic transmission. This initial host shift cannot explain the beginnings of the HIV/AIDS pandemic. Instead, we must understand the processes by which the virus became transmissible, possibly between Sangha basin inhabitants and ultimately reached Kinshasa. A historical epidemiology of the late nineteenth and twentieth centuries, provides a much-needed corrective to the major shortcomings of the cut hunter. Based on 62 oral historical interviews conducted in southeastern Cameroon and archival research, we show that HIV emerged from ecological, economic, and socio-political transformations of the late nineteenth and twentieth centuries. The gradual imposition of colonial rule built on and reoriented ecologies and economies, and altered older patterns of mobility and sociality. Certain changes may have contributed to the initial viral host shift, but more importantly, facilitated the adaptation of HIV-1M to human-to-human transmission. Our evidence suggests that the most critical changes occurred after 1920. This argument has important implications for public health policy, underscoring recent work emphasizing alternative pathways for zoonotic spillovers into human beings.

  10. Síndrome de Hunter-Hurler

    Directory of Open Access Journals (Sweden)

    Antonio B. Lefèvre

    1954-03-01

    Full Text Available Les deux cas de gargoylisme présentés ont appelé l'attention des auteurs et ont mérité leur publication vue la rareté de la maladie en question. Le diagnostic repose en un certain nombre de signes cliniques, lesquels, cependant, n'ont pas besoin d'être au complet pour que l'on puisse affermir le diagnostic du syndrome de Hunter-Hurler. C'est ce qui arrive, d'ailleurs, avec la majorité des maladies de caractère génétique, dans les-quelles il est possible de verifier la transmission de quelques traits seule-ment de Pensemble clinique, insuffisants pour caractériser la maladie sous tous ses aspects, mais suffisants pour permettre un diagnostic très sûr. Cas nº 1: les auteurs font ressortir la face caractéristique de la maladie, la petite taille, les doigts en griffe, les alterations très caractéristiques de forme des vertèbres lombaires et le retard psycho-moteur considérable; comme antécédents familiaux, il a été constaté qu'une cousine-germaine du côté paternel de la malade est morte à 1'âge de 12 ans d'une maladie semblable. Cas nº 2: ici ressortent la face caractéristique, la petite taille, le développement retardé, les altérations des vertèbres lombaires et, à l'examen oculaire, un aspect suggestif de l'opacité cornéenne considérée comme pathognomonique du gargoylisme. Aucun traitement a été tenté dans les deux cas.

  11. Intergroup aggression in chimpanzees and war in nomadic hunter-gatherers: evaluating the chimpanzee model.

    Science.gov (United States)

    Wrangham, Richard W; Glowacki, Luke

    2012-03-01

    Chimpanzee and hunter-gatherer intergroup aggression differ in important ways, including humans having the ability to form peaceful relationships and alliances among groups. This paper nevertheless evaluates the hypothesis that intergroup aggression evolved according to the same functional principles in the two species-selection favoring a tendency to kill members of neighboring groups when killing could be carried out safely. According to this idea chimpanzees and humans are equally risk-averse when fighting. When self-sacrificial war practices are found in humans, therefore, they result from cultural systems of reward, punishment, and coercion rather than evolved adaptations to greater risk-taking. To test this "chimpanzee model," we review intergroup fighting in chimpanzees and nomadic hunter-gatherers living with other nomadic hunter-gatherers as neighbors. Whether humans have evolved specific psychological adaptations for war is unknown, but current evidence suggests that the chimpanzee model is an appropriate starting point for analyzing the biological and cultural evolution of warfare.

  12. Profile of idursulfase for the treatment of Hunter syndrome

    Directory of Open Access Journals (Sweden)

    Sestito S

    2015-07-01

    Full Text Available Simona Sestito, Ferdinando Ceravolo, Michele Grisolia, Elisa Pascale, Licia Pensabene, Daniela Concolino Department of Pediatrics, University Magna Graecia of Catanzaro, Catanzaro, Italy Abstract: Mucopolysaccharidosis type II (MPS II; Hunter syndrome is a rare X-linked lysosomal storage disorder caused by deficiency of the enzyme iduronate-2-sulfatase (IDS. Enzyme replacement therapy (ERT with recombinant human IDS, available since 2005, is currently the most appropriate treatment for this progressive, multisystemic, chronic, and life-threatening disease. Efficacy and safety of therapy with idursulfase have been assessed in several clinical trials, and confirmed in many clinical reports. Long-term follow-up of patients receiving ERT has demonstrated the importance of an early onset of treatment with idursulfase, before irreversible pathological changes occur. Intravenously administered idursulfase is not able to cross the blood–brain barrier, so neurological signs and symptoms cannot benefit from ERT, still remaining a major challenge in the treatment of MPS II. Keywords: MPS II, glycosaminoglycans, enzyme replacement therapy, ERT

  13. Host plants of Carambola fruit fly, Bactrocera carambolae Drew & Hancock(Diptera:Tephritidae);and provisional list of suitable host plants of Carambola fruit fly,(Bactrocera(Bactrocera) carambolae Drew & Hancock(Diptera:Tep

    Science.gov (United States)

    Bactrocera carambolae Drew & Hancock (Diptera: Tephritidae), commonly known as the carambola fruit fly, is native to Southeast Asia, but has extended its geographic range to several countries in South America. As with other tephritid fruit fly species, establishment of B.carambolae in areas where it...

  14. Wealth Transmission and Inequality Among Hunter-Gatherers

    Science.gov (United States)

    Hill, Kim; Marlowe, Frank; Nolin, David; Wiessner, Polly; Gurven, Michael; Bowles, Samuel; Mulder, Monique Borgerhoff; Hertz, Tom; Bell, Adrian

    2010-01-01

    We report quantitative estimates of intergenerational transmission and population-wide inequality for wealth measures in a set of hunter-gatherer populations. Wealth is defined broadly as factors that contribute to individual or household well-being, ranging from embodied forms such as weight and hunting success to material forms such household goods, as well as relational wealth in exchange partners. Intergenerational wealth transmission is low to moderate in these populations, but is still expected to have measurable influence on an individual’s life chances. Wealth inequality (measured with Gini coefficients) is moderate for most wealth types, matching what qualitative ethnographic research has generally indicated (if not the stereotype of hunter-gatherers as extreme egalitarians). We discuss some plausible mechanisms for these patterns, and suggest ways in which future research could resolve questions about the role of wealth in hunter-gatherer social and economic life. PMID:21151711

  15. Process-based coastal erosion modeling for Drew Point (North Slope, Alaska)

    Science.gov (United States)

    Ravens, Thomas M.; Jones, Benjamin M.; Zhang, Jinlin; Arp, Christopher D.; Schmutz, Joel A.

    2012-01-01

    A predictive, coastal erosion/shoreline change model has been developed for a small coastal segment near Drew Point, Beaufort Sea, Alaska. This coastal setting has experienced a dramatic increase in erosion since the early 2000’s. The bluffs at this site are 3-4 m tall and consist of ice-wedge bounded blocks of fine-grained sediments cemented by ice-rich permafrost and capped with a thin organic layer. The bluffs are typically fronted by a narrow (∼ 5  m wide) beach or none at all. During a storm surge, the sea contacts the base of the bluff and a niche is formed through thermal and mechanical erosion. The niche grows both vertically and laterally and eventually undermines the bluff, leading to block failure or collapse. The fallen block is then eroded both thermally and mechanically by waves and currents, which must occur before a new niche forming episode may begin. The erosion model explicitly accounts for and integrates a number of these processes including: (1) storm surge generation resulting from wind and atmospheric forcing, (2) erosional niche growth resulting from wave-induced turbulent heat transfer and sediment transport (using the Kobayashi niche erosion model), and (3) thermal and mechanical erosion of the fallen block. The model was calibrated with historic shoreline change data for one time period (1979-2002), and validated with a later time period (2002-2007).

  16. Methyl eugenol aromatherapy enhances the mating competitiveness of male Bactrocera carambolae Drew & Hancock (Diptera: Tephritidae).

    Science.gov (United States)

    Haq, Ihsan; Vreysen, Marc J B; Cacéres, Carlos; Shelly, Todd E; Hendrichs, Jorge

    2014-09-01

    Males of Bactrocera carambolae Drew & Hancock (Diptera: Tephritidae) are strongly attracted to methyl eugenol (ME) (1,2-dimethoxy-4-(2-propenyl)benzene), a natural compound occurring in variety of plant species. ME-feeding is known to enhance male B. carambolae mating competitiveness 3 days after feeding. Enhanced male mating competitiveness due to ME-feeding can increase the effectiveness of sterile insect technique (SIT) manifolds. However, the common methods for emergence and holding fruit flies prior to field releases do not allow the inclusion of any ME feeding treatment after fly emergence. Therefore this study was planned to assess the effects of ME-aromatherapy in comparison with ME feeding on male B. carambolae mating competitiveness as aromatherapy is pragmatic for fruit flies emergence and holding facilities. Effects of ME application by feeding or by aromatherapy for enhanced mating competitiveness were evaluated 3d after treatments in field cages. ME feeding and ME aromatherapy enhanced male mating competitiveness as compared to untreated males. Males treated with ME either by feeding or by aromatherapy showed similar mating success but mating success was significantly higher than that of untreated males. The results are discussed in the context of application of ME by aromatherapy as a pragmatic approach in a mass-rearing facility and its implications for effectiveness of SIT. Copyright © 2014 The Authors. Published by Elsevier Ltd.. All rights reserved.

  17. The Mysterious Case of the Detective as Child Hero: Sherlock Holmes, Encyclopedia Brown and Nancy Drew as Role Models?

    Science.gov (United States)

    Sugarman, Sally

    In the mystery genre, the one characteristic that the enduring figures of Sherlock Holmes, Nancy Drew, and Encyclopedia Brown have in common is a rational mind. The source of their strength is their ability to think and think well. A study examined some typical examples of the mystery genre in young adult literature and surveyed children and…

  18. Molecular and biometric assessment of Myzodium mimulicola (Drew & Sampson) (Hemiptera, Aphididae), new synonymy, host, and distributional data

    Science.gov (United States)

    Molecular and biometric assessment and subsequent redescription of Myzodium mimulicola (Drew & Sampson) is provided. New host and distributional data for North America are presented, including the first record from Alaska. The current study determined that Myzodium knowltoni (Smith & Robinson) is a ...

  19. 75 FR 32877 - Financial Assistance: Wildlife Restoration, Sport Fish Restoration, Hunter Education and Safety

    Science.gov (United States)

    2010-06-10

    ... resources, aquatic-life forms, and sport fishing; and (e) develop responsible attitudes and ethics toward..., Sport Fish Restoration, Hunter Education and Safety AGENCY: Fish and Wildlife Service, Interior. ACTION... governing the Wildlife Restoration, Sport Fish Restoration, and Hunter Education and Safety (Enhanced Hunter...

  20. Hot subduction: Magmatism along the Hunter Ridge, SW Pacific

    International Nuclear Information System (INIS)

    Crawford, A.J.; Verbeeten, A.; Danyushevsky, L.V.; Sigurdsson, I.A.; Maillet, P.; Monzier, M.

    1997-01-01

    The Hunter 'fracture zone' is generally regarded as a transform plate boundary linking the oppositely dipping Tongan and Vanuatu subduction systems. Dredging along the Hunter Ridge and sampling of its northernmost extent, exposed as the island of Kadavu in Fiji, has yielded a diversity of magmatic suites, including arc tholeiites and high-Ca boninites, high-Mg lavas with some affinities to boninites and some affinities to adakites, and true adakitic lavas associated with remarkable low-Fe, high-Na basalts with 8-16 ppm Nb (herein high-Nb basalts). Lavas which show clear evidence of slab melt involvement in their petrogenesis occur at either end of the Hunter Ridge, whereas the arc tholeiites and high-Ca boninites appear to be restricted to the south central part of the ridge. Mineralogical and whole rock geochemical data for each of these suites are summarized, and a tectono-magmatic model for their genesis and distribution is suggested. Trace element features and radiogenic isotope data for the Hunter Ridge lavas indicate compositions analogue to Pacific MORB-like mantle

  1. Planet Hunters 2 in the K2 Era

    Science.gov (United States)

    Schwamb, Megan E.; Fischer, Debra; Boyajian, Tabetha S.; Giguere, Matthew J.; Ishikawa, Sascha; Lintott, Chris; Lynn, Stuart; Schmitt, Joseph; Snyder, Chris; Wang, Ji; Barclay, Thomas

    2015-01-01

    Planet Hunters (http://www.planethunters.org) is an online citizen science project enlisting hundreds of thousands of people to search for planet transits in the publicly released Kepler data. Volunteers mark the locations of visible transits in a web interface, with multiple independent classifiers reviewing a randomly selected ~30-day light curve segment. In September 2014, Planet Hunters entered a new phase. The project was relaunched with a brand new online classification interface and discussion tool built using the Zooniverse's (http://www.zooniverse.org) latest technology and web platform. The website has been optimized for the rapid discovery and identification of planet candidates in the light curves from K2, the two-wheeled ecliptic plane Kepler mission. We will give an overview of the new Planet Hunters classification interface and Round 2 review system in context of the K2 data. We will present the first results from the Planet Hunters 2 search of K2 Campaigns 0 and 1 including a summary of new planet candidates.

  2. perceptions and adaptations of beekeepers and honey hunters

    African Journals Online (AJOL)

    Prof. Adipala Ekwamu

    honey sector (i.e. honey hunters) to climate change are, however, not adequately explored. The objective of .... The statistical software SPSS Version 16 was used for this purpose. ... content analysis is an effort of interpretation, that balances ... FORM. Discontinue. N o = 0 ; Yes = 1. ±. Creditavability. CRED. Discontinue. N.

  3. Maxwell Fry and Jane Drew Partners : The Contributions of British Architects to Built Environment in Colonial Nigeria, 1946-1959

    Directory of Open Access Journals (Sweden)

    Abiodun Akeem Oladiti

    2016-06-01

    Full Text Available This paper examines the contributions of two British architects, Maxwell Fry and Jane Drew in the development of built environment in Nigeria after World War II. It analyses the historical development of the built environment in Nigeria’s public space with respect to modernize infrastructures such as banks, schools, teachers training colleges and the university needed in support of the colonial administration in Nigeria. The agitation of the nationalists and postwar reconstruction facilitated and encouraged the British Empire to develop the edifice or structures that would be suitable for the environment. This, to a large extent, influenced the Nigerian architecture and built environment. Their design principles yielded functional institutional spaces and a hybrid aesthetics that signifies modernist construction and colonial influence. The paper concludes that the designs of both Fry and Drew represent a milestone and significant contribution to the development of built environment in colonial Nigeria.

  4. Avian influenza prevalence among hunter-harvested birds in a remote Canadian First Nation community.

    Science.gov (United States)

    Liberda, Eric N; Meldrum, Richard; Charania, Nadia A; Davey, Robert; Tsuji, Leonard Js

    2017-01-01

    Avian influenza virus (AIV) prevalence has been associated with wild game and other bird species. The contamination of these birds may pose a greater risk to those who regularly hunt and consumed infected species. Due to resident concerns communicated by local Band Council, hunter-harvested birds from a remote First Nation community in subArctic Ontario, Canada were assessed for AIV. Hunters, and especially those who live a subsistence lifestyle, are at higher risk of AIV exposure due to their increased contact with wild birds, which represent an important part of their diet. Cloacal swabs from 304 harvested game birds representing several species of wild birds commonly hunted and consumed in this First Nation community were analyzed for AIV using real-time reverse transcription polymerase chain reaction. Subtyping was performed using reverse transcription polymerase chain reaction. Sequences were assembled using Lasergene, and the sequences were compared to Genbank. In total, 16 of the 304 cloacal swab samples were positive for AIV. Of the 16 positive samples, 12 were found in mallard ducks, 3 were found in snow geese (wavies), and 1 positive sample was found in partridge. The AIV samples were subtyped, when possible, and found to be positive for the low pathogenic avian influenza virus subtypes H3 and H4. No samples were positive for subtypes of human concern, namely H5 and H7. This work represents the first AIV monitoring program results of hunter-harvested birds in a remote subsistence First Nation community. Community-level surveillance of AIV in remote subsistence hunting communities may help to identify future risks, while educating those who may have the highest exposure about proper handling of hunted birds. Ultimately, only low pathogenic strains of AIV were found, but monitoring should be continued and expanded to safeguard those with the highest exposure risk to AIV.

  5. Salinity and resource management in the Hunter Valley

    Energy Technology Data Exchange (ETDEWEB)

    Creelman, R.A.; Cooke, R.; Simons, M. [RA Creelman & Associates (Australia)

    1995-08-01

    If excess water salinity is to be managed in the Hunter Valley, its causes and behaviour must be understood. Although Hunter Valley hydrology, hydrogeology and hydrogeochemistry require further study, there is now enough information available to begin the development of both temporal and spatial models as valley management tools. Currently the Department of Water Resources is developing a model known as Integrated Water Quality and Quantity Model (IQQM). IQQM which includes a salinity module is essentially a surface water simulation model. It wll enable testing of alternate management and operation policies such as the salinity property rights trading scheme recently introduced by the EPA to manage salt release from coal mines and power stations. An overview is presented of the progress made to date on the salinity module for IQQM, and an outline is given of the geological and hydrogeochemical concepts that have been assembled to support the salinity module of IQQM. 17 refs., 3 figs., 1 tab.

  6. Hunter-Gatherers and the Origins of Religion.

    Science.gov (United States)

    Peoples, Hervey C; Duda, Pavel; Marlowe, Frank W

    2016-09-01

    Recent studies of the evolution of religion have revealed the cognitive underpinnings of belief in supernatural agents, the role of ritual in promoting cooperation, and the contribution of morally punishing high gods to the growth and stabilization of human society. The universality of religion across human society points to a deep evolutionary past. However, specific traits of nascent religiosity, and the sequence in which they emerged, have remained unknown. Here we reconstruct the evolution of religious beliefs and behaviors in early modern humans using a global sample of hunter-gatherers and seven traits describing hunter-gatherer religiosity: animism, belief in an afterlife, shamanism, ancestor worship, high gods, and worship of ancestors or high gods who are active in human affairs. We reconstruct ancestral character states using a time-calibrated supertree based on published phylogenetic trees and linguistic classification and then test for correlated evolution between the characters and for the direction of cultural change. Results indicate that the oldest trait of religion, present in the most recent common ancestor of present-day hunter-gatherers, was animism, in agreement with long-standing beliefs about the fundamental role of this trait. Belief in an afterlife emerged, followed by shamanism and ancestor worship. Ancestor spirits or high gods who are active in human affairs were absent in early humans, suggesting a deep history for the egalitarian nature of hunter-gatherer societies. There is a significant positive relationship between most characters investigated, but the trait "high gods" stands apart, suggesting that belief in a single creator deity can emerge in a society regardless of other aspects of its religion.

  7. HiggsHunters - a citizen science project for ATLAS

    CERN Document Server

    Haas, Andrew; The ATLAS collaboration

    2016-01-01

    Since the launch of HiggsHunters.org in November 2014, citizen science volunteers have classified more than a million points of interest in images from the ATLAS experiment at the LHC. Volunteers have been looking for displaced vertices and unusual features in images recorded during LHC Run-1. We discuss the design of the project, its impact on the public, and the surprising results of how the human volunteers performed relative to the computer algorithms in identifying displaced secondary vertices.

  8. Sacrificing Steve: How I Killed the Crocodile Hunter

    Directory of Open Access Journals (Sweden)

    Luke Carman

    2010-09-01

    Full Text Available Bob Hodge and Vijay Mishra argue that the complex issues of illegitimacy at the core of Australian identity are repressed through a continual process of cyclical silencing, where traces of a shameful past are exorcised by a focus on images of a mythologised ‘legend’, embodied in characters such as 'The Man from Snowy River'. This article explores such a 'schizophrenic' cycle in relation to the life, death and resurrection of Steve 'Crocodile Hunter' Irwin.

  9. Cooperation and the evolution of hunter-gatherer storytelling.

    Science.gov (United States)

    Smith, Daniel; Schlaepfer, Philip; Major, Katie; Dyble, Mark; Page, Abigail E; Thompson, James; Chaudhary, Nikhil; Salali, Gul Deniz; Mace, Ruth; Astete, Leonora; Ngales, Marilyn; Vinicius, Lucio; Migliano, Andrea Bamberg

    2017-12-05

    Storytelling is a human universal. From gathering around the camp-fire telling tales of ancestors to watching the latest television box-set, humans are inveterate producers and consumers of stories. Despite its ubiquity, little attention has been given to understanding the function and evolution of storytelling. Here we explore the impact of storytelling on hunter-gatherer cooperative behaviour and the individual-level fitness benefits to being a skilled storyteller. Stories told by the Agta, a Filipino hunter-gatherer population, convey messages relevant to coordinating behaviour in a foraging ecology, such as cooperation, sex equality and egalitarianism. These themes are present in narratives from other foraging societies. We also show that the presence of good storytellers is associated with increased cooperation. In return, skilled storytellers are preferred social partners and have greater reproductive success, providing a pathway by which group-beneficial behaviours, such as storytelling, can evolve via individual-level selection. We conclude that one of the adaptive functions of storytelling among hunter gatherers may be to organise cooperation.

  10. Does Lateral Transmission Obscure Inheritance in Hunter-Gatherer Languages?

    Science.gov (United States)

    Bowern, Claire; Epps, Patience; Gray, Russell; Hill, Jane; Hunley, Keith; McConvell, Patrick; Zentz, Jason

    2011-01-01

    In recent years, linguists have begun to increasingly rely on quantitative phylogenetic approaches to examine language evolution. Some linguists have questioned the suitability of phylogenetic approaches on the grounds that linguistic evolution is largely reticulate due to extensive lateral transmission, or borrowing, among languages. The problem may be particularly pronounced in hunter-gatherer languages, where the conventional wisdom among many linguists is that lexical borrowing rates are so high that tree building approaches cannot provide meaningful insights into evolutionary processes. However, this claim has never been systematically evaluated, in large part because suitable data were unavailable. In addition, little is known about the subsistence, demographic, ecological, and social factors that might mediate variation in rates of borrowing among languages. Here, we evaluate these claims with a large sample of hunter-gatherer languages from three regions around the world. In this study, a list of 204 basic vocabulary items was collected for 122 hunter-gatherer and small-scale cultivator languages from three ecologically diverse case study areas: northern Australia, northwest Amazonia, and California and the Great Basin. Words were rigorously coded for etymological (inheritance) status, and loan rates were calculated. Loan rate variability was examined with respect to language area, subsistence mode, and population size, density, and mobility; these results were then compared to the sample of 41 primarily agriculturalist languages in [1]. Though loan levels varied both within and among regions, they were generally low in all regions (mean 5.06%, median 2.49%, and SD 7.56), despite substantial demographic, ecological, and social variation. Amazonian levels were uniformly very low, with no language exhibiting more than 4%. Rates were low but more variable in the other two study regions, in part because of several outlier languages where rates of borrowing were

  11. The Enchanted Hunters in Nabokov’s Lolita

    Directory of Open Access Journals (Sweden)

    Justine Shu- Ting Kao

    2017-06-01

    Full Text Available In Nabokov’s Lolita, Humbert Humbert’s The Enchanted Hunters, as a quest for love, aims to reconstruct a felicitous world or integrate various fragmentary details into an organic unity that revives a lost love, experiencing it on the basis of irony, and revealing a simulation of the desire, violence, and despondency which have been expressed in myths of nymphs and Persephone. The protagonist never reaches this unity, but his narrative of erotic and romantic love reveals him as a pathetic addict engaged in mechanical reproduction related to the phenomena of desire, seduction, violence, and sex. His The Enchanted Hunters does not simulate what he expects of his childhood love with Annabel; rather, it simulates the erotic imagination suggested in Mary D. Sheriff’s term “nymphomania,” in which artists fall degenerately to a model of tragedy. Keywords: simulation, nymph, nymphomania, The Enchanted Hunters The Enchanted Hunters in Nabokov’s Lolita refers to the name of a hotel and the title of a play. This seeming coincidence is actually not coincidental: Nabokov weaves a story concerning a pedophile’s seduction of a prepubescent child into a “story within a story,” in which the girl is imagined as a seducer who bewitches a number of hunters. Just as the girl in the play is a figment of a poet’s imagination, so Lolita in the novel Lolita is an imaginary production of a middle-aged pedophile. Yet Lolita is not so much a novel revealing guilt and mental disorder, but a mélange of art and reality, or more specifically, it is about a coinage in which the author fabricates art and myth in real life. Parallel to the protagonist who simulates what he expects of his childhood love, Annabel, in the form of the nymphet, Lolita, Nabokov replicates the beauty of butterflies in the pursuit of beauty and immortality, and develops the world of art with a pathetic tone whereby we gradually perceive a simulation of the desire, violence, and

  12. Learning from the mistakes of others: How female elk (Cervus elaphus) adjust behaviour with age to avoid hunters.

    Science.gov (United States)

    Thurfjell, Henrik; Ciuti, Simone; Boyce, Mark S

    2017-01-01

    In animal behaviour, there is a dichotomy between innate behaviours (e.g., temperament or personality traits) versus those behaviours shaped by learning. Innate personality traits are supposedly less evident in animals when confounded by learning acquired with experience through time. Learning might play a key role in the development and adoption of successful anti-predator strategies, and the related adaptation has the potential to make animals that are more experienced less vulnerable to predation. We carried out a study in a system involving a large herbivorous mammal, female elk, Cervus elaphus, and their primary predator, i.e., human hunters. Using fine-scale satellite telemetry relocations, we tested whether differences in behaviour depending on age were due solely to selection pressure imposed by human hunters, meaning that females that were more cautious were more likely to survive and become older. Or whether learning also was involved, meaning that females adjusted their behaviour as they aged. Our results indicated that both human selection and learning contributed to the adoption of more cautious behavioural strategies in older females. Whereas human selection of behavioural traits has been shown in our previous research, we here provide evidence of additive learning processes being responsible for shaping the behaviour of individuals in this population. Female elk are indeed almost invulnerable to human hunters when older than 9-10 y.o., confirming that experience contributes to their survival. Female elk monitored in our study showed individually changing behaviours and clear adaptation as they aged, such as reduced movement rates (decreased likelihood of encountering human hunters), and increased use of secure areas (forest and steeper terrain), especially when close to roads. We also found that elk adjusted behaviours depending on the type of threat (bow and arrow vs. rifle hunters). This fine-tuning by elk to avoid hunters, rather than just

  13. Learning from the mistakes of others: How female elk (Cervus elaphus adjust behaviour with age to avoid hunters.

    Directory of Open Access Journals (Sweden)

    Henrik Thurfjell

    Full Text Available In animal behaviour, there is a dichotomy between innate behaviours (e.g., temperament or personality traits versus those behaviours shaped by learning. Innate personality traits are supposedly less evident in animals when confounded by learning acquired with experience through time. Learning might play a key role in the development and adoption of successful anti-predator strategies, and the related adaptation has the potential to make animals that are more experienced less vulnerable to predation. We carried out a study in a system involving a large herbivorous mammal, female elk, Cervus elaphus, and their primary predator, i.e., human hunters. Using fine-scale satellite telemetry relocations, we tested whether differences in behaviour depending on age were due solely to selection pressure imposed by human hunters, meaning that females that were more cautious were more likely to survive and become older. Or whether learning also was involved, meaning that females adjusted their behaviour as they aged. Our results indicated that both human selection and learning contributed to the adoption of more cautious behavioural strategies in older females. Whereas human selection of behavioural traits has been shown in our previous research, we here provide evidence of additive learning processes being responsible for shaping the behaviour of individuals in this population. Female elk are indeed almost invulnerable to human hunters when older than 9-10 y.o., confirming that experience contributes to their survival. Female elk monitored in our study showed individually changing behaviours and clear adaptation as they aged, such as reduced movement rates (decreased likelihood of encountering human hunters, and increased use of secure areas (forest and steeper terrain, especially when close to roads. We also found that elk adjusted behaviours depending on the type of threat (bow and arrow vs. rifle hunters. This fine-tuning by elk to avoid hunters, rather

  14. Molecular characterization of Histoplasma capsulatum isolated from an outbreak in treasure hunters Histoplasma capsulatum in treasure hunters

    Directory of Open Access Journals (Sweden)

    Muñoz Bertha

    2010-09-01

    Full Text Available Abstract Background In Mexico, primary pulmonary histoplasmosis is the most relevant clinical form of the disease. The geographical distribution of specific strains of Histoplasma capsulatum circulating in Mexico has not been fully established. Outbreaks must be reported in order to have current, updated information on this disease, identifying new endemic areas, manner of exposure to the fungi, and molecular characterization of the causative agents. We report a recent outbreak of histoplasmosis in treasure hunters and the molecular characterization of two isolates obtained from these patients. Methods Six patients admitted to the National Institute of Respiratory Diseases (INER in Mexico City presented severe respiratory symptoms suggestive of histoplasmosis. They acquired the infection in the Veracruz (VZ endemic zone. Diagnosis was made by X-ray and Computed tomography (CT, liver function, immunological techniques, and culture. Identification of H. capsulatum isolates was confirmed by using Polymerase chain reaction (PCR was conducted with a probe from the M antigen, and the isolates were characterized by means of Random amplification of polymorphic DNA (RAPD-PCR employed the 1253 oligonucleotide and a mixture of oligonucleotides 1281 and 1283. These were compared to eight reference strain isolates from neighboring areas. Results X-ray and CT revealed disseminated micronodular images throughout lung parenchyma, as well as bilateral retrocaval, prevascular, subcarinal, and hilar adenopathies, hepatosplenomegaly, and altered liver function tests. Five of the six patients developed disseminated histoplasmosis. Two H. capsulatum strains were isolated. The same band profile was detected in both strains, indicating that both isolates corresponded to the sole H. capsulatum strain. Molecular characterization of the isolates was similar in 100% with the EH-53 Hidalgo human (HG strain (reference strain integrated into the LAm A clade described for

  15. Representações da Guerra Fria no discurso jornalístico norte-americano de Drew Pearson (1950-1960 = Representations of the Cold War in the north american journalistic discourse of Drew Pearson (1950-1960

    Directory of Open Access Journals (Sweden)

    Portela, Leonice

    2014-01-01

    Full Text Available O presente artigo pretende realizar uma análise nas páginas da revista O Cruzeiro no período de 1950 a 1960, na coluna Carrossel do Mundo escrita pelo jornalista norte-americano Drew Person. Nesta pesquisa evidenciaremos o cruzamento da história com a imprensa e as representações que esta fazia do contexto dos anos de 1950 a 1960. Além de utilizarmos a revistas O Cruzeiro como fonte de pesquisa, está também será nosso objeto de estudo na medida em que se pretende analisar a revista nos seus intrincados bastidores e relações com o poder. A revista é fonte de sua própria história e das mais diversas situações, encontramos dados sobre a sociedade, costumes, informando sobre questões políticas e econômicas inseridas em suas representações através de suas palavras e imagens. Realizaremos um panorama dos artigos de Drew Pearson no período de 1950 a 1960, sendo classificadas em três Eixos Temáticos que se destacam como: a Articulações Políticas dos Estados Unidos nas relações internas e externas; b As ameaças do Comunismo; c Guerra Fria na sua perspectiva de “guerra de nervos”

  16. Black Hole Hunters Set New Distance Record

    Science.gov (United States)

    2010-01-01

    billion times as much as the Sun. So far, around 20 stellar-mass black holes have been found. [2] In astronomy, heavy chemical elements, or "metals", are any chemical elements heavier than helium. [3] Predicted by Einstein's theory of general relativity, gravitational waves are ripples in the fabric of space and time. Significant gravitational waves are generated whenever there are extreme variations of strong gravitational fields with time, such as during the merger of two black holes. The detection of gravitational waves, never directly observed to date, is one of the major challenges for the next few decades. [4] The LIGO and Virgo experiments have the goal of detecting gravitational waves using sensitive interferometers in Italy and the United States. More information This research was presented in a letter to appear in the Monthly Notices of the Royal Astronomical Society (NGC 300 X-1 is a Wolf-Rayet/Black Hole binary, P.A. Crowther et al.). The team is composed of Paul Crowther and Vik Dhillon (University of Sheffield, UK), Robin Barnard and Simon Clark (The Open University, UK), and Stefania Carpano and Andy Pollock (ESAC, Madrid, Spain). ESO, the European Southern Observatory, is the foremost intergovernmental astronomy organisation in Europe and the world's most productive astronomical observatory. It is supported by 14 countries: Austria, Belgium, the Czech Republic, Denmark, France, Finland, Germany, Italy, the Netherlands, Portugal, Spain, Sweden, Switzerland and the United Kingdom. ESO carries out an ambitious programme focused on the design, construction and operation of powerful ground-based observing facilities enabling astronomers to make important scientific discoveries. ESO also plays a leading role in promoting and organising cooperation in astronomical research. ESO operates three unique world-class observing sites in Chile: La Silla, Paranal and Chajnantor. At Paranal, ESO operates the Very Large Telescope, the world's most advanced visible

  17. HiggsHunters - a citizen science project for ATLAS

    CERN Document Server

    AUTHOR|(INSPIRE)INSPIRE-00053405; The ATLAS collaboration

    2017-01-01

    Since the launch of HiggsHunters.org in November 2014, citizen science volunteers have classified more than a million points of interest in images from the ATLAS experiment at the LHC. Volunteers have been looking for displaced vertices and unusual features in images recorded during LHC Run-1. We discuss the design of the project, its impact on the public, and the results of how the human volunteers performed relative to the computer algorithms in identifying displaced secondary vertices. People were better than existing algorithms at identifying displaced vertices for some masses and lifetimes, and showed good ability to recognize unexpected new features in the data.

  18. Medicinal and ethnoveterinary remedies of hunters in Trinidad

    Directory of Open Access Journals (Sweden)

    Georges Karla

    2001-11-01

    Full Text Available Abstract Background Ethnomedicines are used by hunters for themselves and their hunting dogs in Trinidad. Plants are used for snakebites, scorpion stings, for injuries and mange of dogs and to facilitate hunting success. Results Plants used include Piper hispidum, Pithecelobium unguis-cati, Bauhinia excisa, Bauhinia cumanensis, Cecropia peltata, Aframomum melegueta, Aristolochia rugosa, Aristolochia trilobata, Jatropha curcas, Jatropha gossypifolia, Nicotiana tabacum, Vernonia scorpioides, Petiveria alliacea, Renealmia alpinia, Justicia secunda, Phyllanthus urinaria,Phyllanthus niruri,Momordica charantia, Xiphidium caeruleum, Ottonia ovata, Lepianthes peltata, Capsicum frutescens, Costus scaber, Dendropanax arboreus, Siparuma guianensis, Syngonium podophyllum, Monstera dubia, Solanum species, Eclipta prostrata, Spiranthes acaulis, Croton gossypifolius, Barleria lupulina, Cola nitida, Acrocomia ierensis (tentative ID. Conclusion Plant use is based on odour, and plant morphological characteristics and is embedded in a complex cultural context based on indigenous Amerindian beliefs. It is suggested that the medicinal plants exerted a physiological action on the hunter or his dog. Some of the plants mentioned contain chemicals that may explain the ethnomedicinal and ethnoveterinary use. For instance some of the plants influence the immune system or are effective against internal and external parasites. Plant baths may contribute to the health and well being of the hunting dogs.

  19. Energy expenditure and activity among Hadza hunter-gatherers.

    Science.gov (United States)

    Pontzer, Herman; Raichlen, David A; Wood, Brian M; Emery Thompson, Melissa; Racette, Susan B; Mabulla, Audax Z P; Marlowe, Frank W

    2015-01-01

    Studies of total energy expenditure, (TEE; kcal/day) among traditional populations have challenged current models relating habitual physical activity to daily energy requirements. Here, we examine the relationship between physical activity and TEE among traditional Hadza hunter-gatherers living in northern Tanzania. Hadza adults were studied at two camps, with minimal intervention so as to monitor energy expenditure and activity during normal daily life. We measured daily walking distance and walking speed using wearable GPS units for 41 adults. For a subset of 30 adults, we measured TEE using doubly labeled water, three indices of work load (foraging return rate, maternal status, and number of dependent children), and urinary biomarkers of metabolic activity and stress (8-hydroxydeoxyguanosine, cortisol, and testosterone). Fat-free mass was the single strongest predictor of TEE among Hadza adults (r(2)  = 0.66, P < 0.001). Hadza men used greater daily walking distances and faster walking speeds compared with that of Hadza women, but neither sex nor any measure of physical activity or work load were correlated with TEE in analyses controlling for fat-free mass. Compared with developed, industrial populations, Hadza adults had similar TEE but elevated levels of metabolic stress as measured by 8-hydroxydeoxyguanosine. Our results indicate that daily physical activity may not predict TEE within traditional hunter-gatherer populations like the Hadza. Instead, adults with high levels of habitual physical activity may adapt by reducing energy allocation to other physiological activity. © 2015 Wiley Periodicals, Inc.

  20. Medicinal and ethnoveterinary remedies of hunters in Trinidad.

    Science.gov (United States)

    Lans, C; Harper, T; Georges, K; Bridgewater, E

    2001-01-01

    Ethnomedicines are used by hunters for themselves and their hunting dogs in Trinidad. Plants are used for snakebites, scorpion stings, for injuries and mange of dogs and to facilitate hunting success. Plants used include Piper hispidum, Pithecelobium unguis-cati, Bauhinia excisa, Bauhinia cumanensis, Cecropia peltata, Aframomum melegueta, Aristolochia rugosa, Aristolochia trilobata, Jatropha curcas, Jatropha gossypifolia, Nicotiana tabacum, Vernonia scorpioides, Petiveria alliacea, Renealmia alpinia, Justicia secunda, Phyllanthus urinaria,Phyllanthus niruri,Momordica charantia, Xiphidium caeruleum, Ottonia ovata, Lepianthes peltata, Capsicum frutescens, Costus scaber, Dendropanax arboreus, Siparuma guianensis, Syngonium podophyllum, Monstera dubia, Solanum species, Eclipta prostrata, Spiranthes acaulis, Croton gossypifolius, Barleria lupulina, Cola nitida, Acrocomia ierensis (tentative ID). Plant use is based on odour, and plant morphological characteristics and is embedded in a complex cultural context based on indigenous Amerindian beliefs. It is suggested that the medicinal plants exerted a physiological action on the hunter or his dog. Some of the plants mentioned contain chemicals that may explain the ethnomedicinal and ethnoveterinary use. For instance some of the plants influence the immune system or are effective against internal and external parasites. Plant baths may contribute to the health and well being of the hunting dogs.

  1. Legitimization of regulatory norms: Waterfowl hunter acceptance of changing duck bag limits

    Science.gov (United States)

    Schroeder, Susan A.; Fulton, David C.; Lawrence, Jeffrey S.; Cordts, Steven D.

    2014-01-01

    Few studies have examined response to regulatory change over time, or addressed hunter attitudes about changes in hunting bag limits. This article explores Minnesota waterfowl hunters’ attitudes about duck bag limits, examining attitudes about two state duck bag limits that were initially more restrictive than the maximum set by the U.S. Fish and Wildlife Service (USFWS), but then increased to match federal limits. Results are from four mail surveys that examined attitudes about bag limits over time. Following two bag limit increases, a greater proportion of hunters rated the new bag limit “too high” and a smaller proportion rated it “too low.” Several years following the first bag limit increase, the proportion of hunters who indicated that the limit was “too high” had declined, suggesting hunter acceptance of the new regulation. Results suggest that waterfowl bag limits may represent legal norms that influence hunter attitudes and gain legitimacy over time.

  2. Predicting hunter behavior of indigenous communities in the Ecuadorian Amazon: insights from a household production model

    Directory of Open Access Journals (Sweden)

    Enrique de la Montaña

    2015-12-01

    Full Text Available Many indigenous communities living in the Amazon rely on hunting and fishing to meet the majority of their protein needs. Despite the importance of these practices, few studies from the region have analyzed the socioeconomic drivers of hunting and fishing at the household level. We propose a household production model to assess the effect of key economic parameters on hunting and fishing in small indigenous communities located in the Ecuadorian Amazon, whose principal source of protein is derived from hunting and fishing. The model was validated using empirical data from two communities that reflect different levels of market integration and forest conservation. Demand and supply functions were generated from household data gathered over 19 months. Elasticities were derived to determine the sensitivity of the decision to engage in hunting to exogenous parameters such as off-farm wages, hunting costs, bushmeat price, penalties for the illegal sale of bushmeat, and biological characteristics of the game species. After calibrating the model, we simulated changes in the key economic parameters. The parameter that most directly affected hunting activity in both communities was off-farm wages. Simulating a 10% wage increase resulted in a 16-20% reduction in harvested biomass, while a 50% increase diminished harvested biomass by > 50%. Model simulations revealed that bushmeat price and penalties for illegal trade also had important effects on hunter behavior in terms of amount of bushmeat sold, but not in terms of total harvest. As a tool for understanding hunters' economic decision-making, the model provides a basis for developing strategies that promote sustainable hunting and wildlife conservation while protecting indigenous livelihoods.

  3. Gut microbiome of the Hadza hunter-gatherers.

    Science.gov (United States)

    Schnorr, Stephanie L; Candela, Marco; Rampelli, Simone; Centanni, Manuela; Consolandi, Clarissa; Basaglia, Giulia; Turroni, Silvia; Biagi, Elena; Peano, Clelia; Severgnini, Marco; Fiori, Jessica; Gotti, Roberto; De Bellis, Gianluca; Luiselli, Donata; Brigidi, Patrizia; Mabulla, Audax; Marlowe, Frank; Henry, Amanda G; Crittenden, Alyssa N

    2014-04-15

    Human gut microbiota directly influences health and provides an extra means of adaptive potential to different lifestyles. To explore variation in gut microbiota and to understand how these bacteria may have co-evolved with humans, here we investigate the phylogenetic diversity and metabolite production of the gut microbiota from a community of human hunter-gatherers, the Hadza of Tanzania. We show that the Hadza have higher levels of microbial richness and biodiversity than Italian urban controls. Further comparisons with two rural farming African groups illustrate other features unique to Hadza that can be linked to a foraging lifestyle. These include absence of Bifidobacterium and differences in microbial composition between the sexes that probably reflect sexual division of labour. Furthermore, enrichment in Prevotella, Treponema and unclassified Bacteroidetes, as well as a peculiar arrangement of Clostridiales taxa, may enhance the Hadza's ability to digest and extract valuable nutrition from fibrous plant foods.

  4. Food Sharing among Hadza Hunter-Gatherer Children.

    Science.gov (United States)

    Crittenden, Alyssa N; Zes, David A

    2015-01-01

    Human prosociality is one of the defining characteristics of our species, yet the ontogeny of altruistic behavior remains poorly understood. The evolution of widespread food sharing in humans helped shape cooperation, family formation, life history, language, and the development of economies of scale. While the behavioral and ecological correlates of food sharing among adults are widely studied, very little is known about food sharing among children. Here, in the first study to analyze the food sharing patterns of hunter-gatherer children, we show that while sharing may be biased towards kin, reciprocity characterizes the majority of all sharing dyads, both related and unrelated. These data lend support to the recent claim that discrimination among kin might be linked with reciprocal altruism theory. Furthermore, we show that age positively correlates with an increase in sharing, both in frequency and amount, supporting recent suggestions that prosocial behaviors and egalitarianism develop strongly in middle childhood when children acquire the normative rules of their society.

  5. Evidence for early hunters beneath the Great Lakes.

    Science.gov (United States)

    O'Shea, John M; Meadows, Guy A

    2009-06-23

    Scholars have hypothesized that the poorly understood and rarely encountered archaeological sites from the terminal Paleoindian and Archaic periods associated with the Lake Stanley low water stage (10,000-7,500 BP) are lost beneath the modern Great Lakes. Acoustic and video survey on the Alpena-Amberley ridge, a feature that would have been a dry land corridor crossing the Lake Huron basin during this time period, reveals the presence of a series of stone features that match, in form and location, structures used for caribou hunting in both prehistoric and ethnographic times. These results present evidence for early hunters on the Alpena-Amberley corridor, and raise the possibility that intact settlements and ancient landscapes are preserved beneath Lake Huron.

  6. Energy drew up 2008

    International Nuclear Information System (INIS)

    2008-01-01

    This article is about the following topics: energy analysis, production and use, supply and demand, consumption, energy sources, petroleum products for energy production, energy demand by economic sector and final consumption.

  7. The formation of fire residues associated with hunter-gatherers in humid tropical environments: A geo-ethnoarchaeological perspective

    Science.gov (United States)

    Friesem, David E.; Lavi, Noa; Madella, Marco; Boaretto, Elisabetta; Ajithparsad, P.; French, Charles

    2017-09-01

    Tropical forests have been an important human habitat and played a significant role in early human dispersal and evolution. Likewise, the use of fire, besides being one of the exceptional characteristics of humans, serves as a marker for human evolution. While the use of fire by prehistoric hunter-gatherers is relatively well documented in arid and temperate environments, the archaeological evidence in humid tropical environment is to date very limited. We first review the archaeological evidence for hunter-gatherer use of fire in humid tropical environments and suggest that better understanding of formation processes is required. We present a geo-ethnoarchaeological study from South India, involving ethnography, excavations and laboratory-based analyses in order to build a new framework to study fire residues in humid tropical forests associated with hunter-gatherer's use of fire. Ethnographic observations point to a dynamic and ephemeral use of hearths. Hearths location were dictated by the social and ever-changing social dynamics of the site. The hearths deposited small amount of residues which were later swept on a daily basis, re-depositing ash and charcoal in waste areas and leaving only a microscopic signal in the original location. Particular acidic conditions and intensive biological activity within tropical sediments result in the complete dissolution of ash and bones while favouring the preservation of charcoal and phytoliths. Consequently, the identification of fire residues in humid tropical forests and the reconstruction of the human use of fire must involve multi-proxy microscopic analysis to detect its micro-signatures.

  8. Slow Earthquake Hunters: A New Citizen Science Project to Identify and Catalog Slow Slip Events in Geodetic Data

    Science.gov (United States)

    Bartlow, N. M.

    2017-12-01

    Slow Earthquake Hunters is a new citizen science project to detect, catalog, and monitor slow slip events. Slow slip events, also called "slow earthquakes", occur when faults slip too slowly to generate significant seismic radiation. They typically take between a few days and over a year to occur, and are most often found on subduction zone plate interfaces. While not dangerous in and of themselves, recent evidence suggests that monitoring slow slip events is important for earthquake hazards, as slow slip events have been known to trigger damaging "regular" earthquakes. Slow slip events, because they do not radiate seismically, are detected with a variety of methods, most commonly continuous geodetic Global Positioning System (GPS) stations. There is now a wealth of GPS data in some regions that experience slow slip events, but a reliable automated method to detect them in GPS data remains elusive. This project aims to recruit human users to view GPS time series data, with some post-processing to highlight slow slip signals, and flag slow slip events for further analysis by the scientific team. Slow Earthquake Hunters will begin with data from the Cascadia subduction zone, where geodetically detectable slow slip events with a duration of at least a few days recur at regular intervals. The project will then expand to other areas with slow slip events or other transient geodetic signals, including other subduction zones, and areas with strike-slip faults. This project has not yet rolled out to the public, and is in a beta testing phase. This presentation will show results from an initial pilot group of student participants at the University of Missouri, and solicit feedback for the future of Slow Earthquake Hunters.

  9. The Teacher's Role in Quality Classroom Interactions: Q&A with Dr. Drew Gitomer. REL Mid-Atlantic Teacher Effectiveness Webinar Series

    Science.gov (United States)

    Regional Educational Laboratory Mid-Atlantic, 2013

    2013-01-01

    In this webinar, Dr. Drew Gitomer, professor at Rutgers University, shared results from recent studies of classroom observations that helped participants understand both general findings about the qualities of classroom interactions and also the challenges to carrying out valid and reliable observations. This Q&A addressed the questions…

  10. Project CHECO Southeast Asia Report. OV-1/AC-119 Hunter-Killer Team

    National Research Council Canada - National Science Library

    Sexton, Richard R; Hodgson, William M

    1972-01-01

    Hunter-Killer operations were but a logical extension of the resourceful thinking behind the development of gunships as a solution to some of the tactical problems of the unique war in Southeast Asia...

  11. Mental health perspectives of Hunter syndrome: Case reports of two biological siblings

    Directory of Open Access Journals (Sweden)

    Kabir Garg

    2016-01-01

    Full Text Available Hunter syndrome is a rare X-linked recessive disorder caused by deficiency of the lysosomal enzyme iduronate-2-sulphatase, leading to progressive accumulation of a substance called glycosaminoglycans in nearly all cell types, tissues, and organs. Hunter syndrome presents with facial dysmorphism, airway diseases, skeletal defects, cardiomyopathies, and neuropsychiatric manifestations. Mental subnormality is a cardinal feature in Hunter syndrome. This is a progressive cognitive decline that is not amenable to enzyme replacement therapy. Due to progressive cognitive decline, training the children to improve the adaptive functioning is a challenge that creates immense stress for the caregivers. Patients with Hunter syndrome should undergo serial assessment of intellectual ability and may be trained accordingly.

  12. Cadmium, lead, and chromium in large game: a local-scale exposure assessment for hunters consuming meat and liver of wild boar.

    Science.gov (United States)

    Danieli, P P; Serrani, F; Primi, R; Ponzetta, M P; Ronchi, B; Amici, A

    2012-11-01

    Heavy metals are ubiquitous in soil, water, and air. Their entrance into the food chain is an important environmental issue that entails risks to humans. Several reports indicate that game meat can be an important source of heavy metals, particularly because of the increasing consumption of game meat, mainly by hunters. We performed an exposure assessment of hunters and members of their households, both adults and children, who consumed wild boar (WB) meat and offal. We estimated the amount of cadmium, lead, and chromium in the tissues of WB hunted in six areas within Viterbo Province (Italy) and gathered data on WB meat and offal consumption by conducting specific diet surveys in the same areas. The exposure to cadmium, lead, and chromium was simulated with specifically developed Monte Carlo simulation models. Cadmium and lead levels in WB liver and meat harvested in Viterbo Province (Italy) were similar to or lower than the values reported in other studies. However, some samples contained these metals at levels greater then the EU limits set for domestic animals. The chromium content of meat or liver cannot be evaluated against any regulatory limit, but our results suggest that the amounts of this metal found in WB products may reflect a moderate environmental load. Our survey of the hunter population confirmed that their consumption of WB meat and liver was greater than that of the general Italian population. This level of consumption was comparable with other European studies. Consumption of WB products contributes significantly to cadmium and lead exposure of both adults and children. More specifically, consumption of the WB liver contributed significantly to total cadmium and lead exposure of members of the households of WB hunters. As a general rule, liver consumption should be kept to a minimum, especially for children living in these hunter households. The exposure to chromium estimated for this population of hunters may be considered to be safe. However

  13. Fiber-optic displacement sensors on the Hunters Trophy UGT impulse gauge experiments

    Energy Technology Data Exchange (ETDEWEB)

    Green, R.E.L.; Poutiatine, A.I.

    1995-03-01

    As part of a program to develop gauges for measurement of various mechanical properties in hostile environments, the authors fielded purely optical displacement sensors at the ends of long fiber-optic cables as supplements to the regular displacement sensors of four impulse gauges fielded as part of a materials study on the Hunters Trophy underground effects test at the Nevada Test Site. These fiber-optic sensor systems and their performance on the Hunters Trophy test are described in this report.

  14. Lead shot pellets dispersed by hunters: ingested by ducks

    Energy Technology Data Exchange (ETDEWEB)

    Danell, K [Univ. of Umea, Sweden; Andersson, A; Marcstrom, V

    1977-01-01

    Many of the lead pellets shot by waterfowl hunters over shores and waters fall on the feeding grounds of ducks and geese. These pellets, picked up and ingested by the birds, can remain in the gizzard where they are eroded by mechanical and chemical action. In some cases the bird absorbs enough lead to cause lead poisoning. This report describes the incidence of ingested lead shot pellets found in 928 ducks collected in Sweden during hunting season. Pellets were found in both dabbling and diving ducks and were present in birds from six of the eight localities sampled. Usually one or two pellets were found but some ducks contained up to 62 pellets. As the incidence of ingested pellets in the present study is approximately the same as that found in North America, where the annual duck loss due to lead poisoning is estimated to be 2 to 3 percent of the population, it may be assumed that lead poisoning is a mortality factor for Swedish ducks also.

  15. Rabbit hunter uveitis: case report of tularemia uveitis.

    Science.gov (United States)

    Terrada, Céline; Azza, Said; Bodaghi, Bahram; Le Hoang, Phuc; Drancourt, Michel

    2016-09-01

    Literature reports on ophthalmological manifestations related to tularemia, a zoonose caused by the bacterium Francisella tularensis, largely refer to Parinaud's oculoglandular syndrome, which consists of the association of conjunctivitis with preauricular lymphadenitis. In this paper, we report a case of intraocular inflammation during tularemia infection. A 52-year-old Caucasian man was diagnosed with unilateral uveitis. The uveitis was posterior, with a 2+ vitritis and a large yellowish lesion involving the macula with an overlying sub-retinal detachment, extending inferiorly, and subretinal hemorrhages. Fluorescein angiography showed a late hyperfluorescence with focal vascular leakage. Ultrasound biomicroscopy confirmed the presence of a 3.8 mm parietal granuloma with a few calcifications in the left eye. While extensive work-up eliminated any other infectious and non-infectious etiology, tularemia was diagnosed by advanced serology consisting of two-dimensional Western-immunoblotting. The patient, a hunter, recalled having killed rabbits in the days before the symptoms appeared. Uveitis was rapidly controlled following treatment with doxycycline, yet three years after initiation of the treatment, the patient still complained of loss of vision in the left eye with a central scotoma. Posterior uveitis may be an infrequent manifestation of tularemia infection, and therefore this infection should be considered in the differential diagnosis of intraocular inflammation in areas where F. tularensis is endemic.

  16. Portrait of a Geothermal Spring, Hunter's Hot Springs, Oregon.

    Science.gov (United States)

    Castenholz, Richard W

    2015-01-27

    Although alkaline Hunter's Hot Springs in southeastern Oregon has been studied extensively for over 40 years, most of these studies and the subsequent publications were before the advent of molecular methods. However, there are many field observations and laboratory experiments that reveal the major aspects of the phototrophic species composition within various physical and chemical gradients of these springs. Relatively constant temperature boundaries demark the upper boundary of the unicellular cyanobacterium, Synechococcus at 73-74 °C (the world-wide upper limit for photosynthesis), and 68-70 °C the upper limit for Chloroflexus. The upper limit for the cover of the filamentous cyanobacterium, Geitlerinema (Oscillatoria) is at 54-55 °C, and the in situ lower limit at 47-48 °C for all three of these phototrophs due to the upper temperature limit for the grazing ostracod, Thermopsis. The in situ upper limit for the cyanobacteria Pleurocapsa and Calothrix is at ~47-48 °C, which are more grazer-resistant and grazer dependent. All of these demarcations are easily visible in the field. In addition, there is a biosulfide production in some sections of the springs that have a large impact on the microbiology. Most of the temperature and chemical limits have been explained by field and laboratory experiments.

  17. Food Sharing among Hadza Hunter-Gatherer Children.

    Directory of Open Access Journals (Sweden)

    Alyssa N Crittenden

    Full Text Available Human prosociality is one of the defining characteristics of our species, yet the ontogeny of altruistic behavior remains poorly understood. The evolution of widespread food sharing in humans helped shape cooperation, family formation, life history, language, and the development of economies of scale. While the behavioral and ecological correlates of food sharing among adults are widely studied, very little is known about food sharing among children. Here, in the first study to analyze the food sharing patterns of hunter-gatherer children, we show that while sharing may be biased towards kin, reciprocity characterizes the majority of all sharing dyads, both related and unrelated. These data lend support to the recent claim that discrimination among kin might be linked with reciprocal altruism theory. Furthermore, we show that age positively correlates with an increase in sharing, both in frequency and amount, supporting recent suggestions that prosocial behaviors and egalitarianism develop strongly in middle childhood when children acquire the normative rules of their society.

  18. Parental experience of enzyme replacement therapy for Hunter syndrome.

    Science.gov (United States)

    Buraczewska, M; O'Leary, D; Walsh, O; Monavari, A; Crushell, E

    2013-04-01

    We aimed to establish the profile of Irish patients with Hunter Syndrome (Mucopolysaccharidosis type II, MPS II) receiving weekly intravenous Enzyme Replacement Therapy (ERT) with recombinant iduronate-2-sulfatase and to assess the social impact and parental opinion of ERT through the use of a parental questionnaire. Nine patients aged 3.5- 14 years have received a mean of 2 (range 0.5-3.5) years of ERT. Treatment was associated with clinical improvements from baseline in hepatosplenomegaly in 6/7 (85%) respiratory manifestations in 4/6 (67%) and a mean reduction in urinary glycosaminoglycan excretion of 62%. Changes noted by parents included increased energy 3/9 (33%) and softening of skin, hair and facial features 8/9 (89%). Parents report that seven hours weekly were spent on hospitalizations for ERT. Parental employment was adversely affected in 8 (89%) families. One day of school/preschool (20%) was lost every week for 8 (89%) children. All parents believed the benefits of ERT out-weigh the difficulties involved. All families would welcome the introduction of home based therapy. In conclusion the social and educational burden of hospital-based ERT on these children and their families is significant. The introduction of home-based therapy is likely to improve overall quality of life for MPSII patients and their families.

  19. Blood, guts and knife cuts: reducing the risk of swine brucellosis in feral pig hunters in north-west New South Wales, Australia.

    Science.gov (United States)

    Massey, P D; Polkinghorne, B G; Durrheim, D N; Lower, T; Speare, R

    2011-01-01

    Humans who have close contact with livestock, wild or feral animals can risk acquiring zoonotic infections such as brucellosis, Q fever, and leptospirosis. Human infection with Brucella suis (swine brucellosis) usually follows occupational or recreational exposure to infected animals. Worldwide, many cases of human infection follow contact with infected feral pigs. In Australia there is a growing market for the export of 'wild boar' and a considerable number of people are involved in feral pig hunting. However, feral pig hunters are often hard to reach with health strategies. According to Australian authorities the most important means of preventing disease in humans includes covering cuts; wearing gloves; washing hands; and avoiding blood when coming into contact with feral pigs. There has not been an evaluation of the acceptability of these recommended risk-reduction strategies in the settings where feral pig hunting and evisceration occurs. Semi-structured interviews and small focus groups were conducted with feral pig hunters in north-west New South Wales (NSW), Australia, to explore their hunting experiences and views on the brucellosis prevention strategies. Interview and focus group notes were thematically analysed. There was a range of experiences of feral pig hunting, from a very professional approach to a purely recreational approach. The main domains that emerged from participants' experiences during their most recent feral pig hunting activity and their reflections on current swine brucellosis risk reduction strategies were: 'you've gotta be tough to be a feral pig hunter'; 'most of the suggested strategies won't work as they are'; 'reducing risk in the scrub'; and 'how to let pig hunters know'. The recreational nature and prevailing macho perspective of participants demand a pragmatic approach to risk reduction if it is going to prove acceptable to feral pig hunters. The 'you've gotta be tough to be a feral pig hunter' context of the activity and the

  20. Humans as predators: an overview of predation strategies of hunters with contrasting motivational drivers

    Directory of Open Access Journals (Sweden)

    Fredrik Dalerum

    2018-01-01

    Full Text Available Predator-prey theory suggests that generalist predators are linked to demographic stability of prey whereas specialists are destabilizing. We overview the demographic consequences of different predation strategies and hypothesize that subsistence hunting occurs opportunistically, persecution hunters behave like specialist predators, and recreational hunters behave like generalist predators. Under this hypothesis, persecution hunting would have destabilizing effects, whereas the effects of subsistence and recreational hunting would be neutral or stabilizing. We found poor empirical support for this hypothesis, but there was scarce empirical data. Recreational hunters mainly hunted opportunistically and hunting as managed persecution followed a type III functional response, i.e. with low hunting intensity at low game abundances and a switch to an increased intensity at some level of abundance. We suggest that recreational hunters have limited destabilizing effects on game populations and that hunting may be an ineffective way of complete the removal of invasive species. We urge for further studies quantifying the responses of hunters to game abundances, in particular studies evaluating the responses of subsistence hunters and illegal persecution.

  1. Morphological and histological damage on reproduction organ of radio-sterilized male fruit flies bactrocera carambolae (drew & hancock) (diptera; tephritidae)

    International Nuclear Information System (INIS)

    Achmad Nasroh Kuswadi

    2011-01-01

    It is known that gamma irradiation of 90 Gy on pupae of Bactrocera carambolae (Drew & Hancock) fruit fly induced sterility on the adults, however limited data on the cause of sterility is available. To obtain such information, morphological and histological damages on the reproduction organ of male adult flies emerged from irradiated pupae were observed. Pupae of 9 day-old were irradiated with 90 Gy gamma, and the male adults of 7 and 14 day-old emerged from the pupae were dissected to obtained the testis. Morphology and size of the testis of irradiated and unirradiated flies were observed under the microscopes, each in 10 replicates. Preparate of the testis were also made and observed under the microscopes of 400 magnification. The results showed that significant damages were found on testis of the irradiated B. carambolae flies due to irradiation, so that the growth of the organ disturbed as shown by the smallers size of the irradiated testis as compare to the normal one. On the irradiated 7 day-old flies, the length and width of testis were 25.9 and 30.2 % smaller, while on those of 14 day-old the testis were 39.20 and 44.42 % smaller, than the normal. Besides smaller in size, dead germinal cells on the testis preparate were also observed. It is concluded that sterility on the male flies was due to the damage on the germinal cells so that abnormal spermatogenesis process happened. The smaller in size of the testis, is also differentiate between of the irradiated from the normal flies of B. carambolae. (author)

  2. Irradiation of Eggs and Larvae of Bactrocera Carambolae (Drew and Hancock) Fruit Fly to Produce Irradiation Host for Its Parasitoids

    International Nuclear Information System (INIS)

    Achmad Nasroh Kuswadi; Murni lndarwatmi; Nasution, Indah Arastuti

    2004-01-01

    Bactrocera carambolae (Drew and Hancock) fruit fly, a major pests of commercial fruits in Indonesia, is attacked by several species of parasitoids in the field, such as by Biosteres sp. that attacks on early instar larvae and Opius sp. on late instar larvae. In order to produce irradiated host in mass rearing of both species, several dosage of gamma were tested on both eggs and larvae. Egg masses of 0.5 ml were irradiated with 0, 10, 20, 30, 40 and 50 Gy and then inoculated into artificial diet. Viability of the eggs, the larval period and the number of pupae produced were observed. About 200 third instar larvae irradiated with 0, 10, 30, 50,70 dan 90 Gy and the number and quality of the pupae developed were then observed. The results showed that the eggs irradiated with tested dosage did not reduce its viability however it reduced the survival of larvae emerged. Number of pupae produced from 0.5 ml irradiated eggs were reduced from 2740 pupae to 407, 167, 113, 53 and 44 pupae, besides the pupation delayed up to three days. Irradiation on third instars larvae did not reduce its pupation, since pupae were developed from > 85 % of irradiated larvae. However, irradiation did reduced the fly emergence from the pupae. Irradiated hosts for Biosteres sp and Opius sp can be produced by irradiating eggs however it should be evaluated since the survival rate of the larvae reduced. Irradiation of third instar larvae may produce irradiated host for Opius sp So, the use of irradiated eggs or irradiated larvae as host in the colonization of the parasitoids will insure no hosts emerged as adult. However it remain to be proved whether irradiated hosts are prefered and able to support the life of parasitoid. (author)

  3. Irradiation as a quarantine treatment against the invader fruit fly (Bactrocera Invadens, Drew) in mangoes (Mangifera Indica L,)

    International Nuclear Information System (INIS)

    Odai, B.T.

    2010-06-01

    The detection of the African invader fly, Bactrocera invadens Drew, Tsuruta and White, in Ghana has led to limitations in the export of mango fruits from Ghana to other countries. The limitations ranging from increased control costs to outright rejection of exports has necessitated a study in the area of quarantine treatment. A study was conducted to ascertain the effectiveness of gamma radiation for control of Bactrocera invadens in fruit destined for export. Pupae were obtained from the incubation of mango fruits collected from various locations. Adults were reared and infestation levels were determined after fruits were exposed to 5, 10, 20 females in different cages. Late instar larvae in fruits were irradiated at 15, 25, 35, 45, 50, 60 and 75 Gy to determine an effective dose for B. invadens. The mortality of the fly was determined at the various doses to obtain a probit 9 figure of 68.06 Gy (rounded to 70 Gy). The confirmatory test for 3050 larvae endorsed the effective dose as the probit 9 dose. Non-infested mature green export grade mango fruits were irradiated with 0, 70 and 150 Gy to determine its effect on ascorbic acid and total acidity content, sweetness, colour, juiciness, sourness, aroma and firmness of the mango fruits. Ascorbic acid and total acidity were not irradiation dependent. Varietal differences (p 0.05) by irradiation. Varietal differences did not affect the acceptability of the sweetness, sourness and colour of the fruits (p>0.05). Storage days significantly affected (p<0.05) the acceptability of all the sensory attributes. (au)

  4. Ride, shoot, and call: wildlife use among contemporary urban hunters in Três Fronteiras, Brazilian Amazon

    Directory of Open Access Journals (Sweden)

    Nathalie van Vliet

    2015-09-01

    Full Text Available Most bushmeat studies in the Amazon region focus on hunting patterns of indigenous populations in rural settings. Our study describes the existence of urban hunters in medium-sized towns. Using a variety of data collection methods, we describe the main socioeconomic characteristics of urban hunters in Benjamin Constant and Atalaia do Norte, Brazil. We analyze the patterns and motivations of urban hunters as well as the type of prey harvested and quantities traded. All interviewed hunters are caboclos, people of mixed Brazilian indigenous and European origins from rural areas who now live in urban and peri-urban areas. Living in these more populated spaces allows these hunters better market options for their harvest and allows them to alternate hunting with other economic activities. Only 29% of the interviewed hunters relied solely on hunting. In total, 11.6 tons of bushmeat were harvested (of which 97% was traded by four hunters during the monitoring period (60 days. The most hunted species were terecay (Podocnemis unifilis, curassow (Crax sp., paca (Cuniculus paca, and tapir (Tapirus terrestris. The ratio of bushmeat sold to that consumed, as well as the level of participation in the bushmeat market chain, allowed us to differentiate between specialized and diversified hunters. Specialized hunters sell 81% of the bushmeat caught to known wholesalers in the city. Diversified hunters sell 21% of their total catch to families, neighbors, or friends directly as fresh meat, avoiding intermediaries. For all hunters, hunting localities are associated with peri-urban roadways that are easily reached by motorbike or bicycle from the hunters' houses in the urban areas or city fringes. Our results show that urban hunters in medium-sized towns exemplify how traditional hunting systems can be adapted in the face of globalization, by living close to the market, at relatively manageable distances from hunting grounds, and using modern methods of

  5. Near-source surface seismic measurements for the NPE, NPE Calibration, Hunter`s Trophy, and Mineral Quarry

    Energy Technology Data Exchange (ETDEWEB)

    Reinke, R.E.; Leverette, J.A. [Field Command Defense Nuclear Agency, Kirtland AFB, NM (United States); Stump, B.W. [Los Alamos National Laboratory, NM (United States)] [and others

    1994-12-31

    An extensive seismic network was deployed on the surface of Rainier Mesa for both the Non-Proliferation Experiment (NPE) Calibration shot as well as the full scale NPE event. This network was very similar to previous deployments for the nuclear events MISTY ECHO, MINERAL QUARRY, and HUNTERS TROPHY. For the full scale NPE event three-component accelerometers and seismometers were fielded at 32 sites across the mesa. A slightly smaller network with 28 stations was in operation for the 300 pound NPE calibration event. The mesa top array included both accelerometers and seismometers. The accelerometers were used to obtain data from the main NPE event while the seismometers with their higher sensitivity were used to record the 300 pound cal shot and several hundred after events from the NPE. Large spatial variations in ground motion are evident in both the full mesa data set as well as a small (80 m on a side) aperture, 9-element triangular array. This paper summarizes the data and discusses wave propagation effects. A companion paper presents a comparative source analysis.

  6. The night of the hunter: children & adults in the secret

    Directory of Open Access Journals (Sweden)

    Terry caesar

    2010-04-01

    Full Text Available Night of the Hunter is  the 1956 Charles Laughton’s film considered  one of the best discussions about childhood. In this film, the story revolves around the fate of John and Pearl, two orphaned siblings whose father was hanged for stealing. The father had given the children the money, and they hid the money inside the girl’s doll. When the Preacher Powell enters their lives , both John and Pearl are in danger. The siblings have to keep a secret which is both where they put the money, and the fact that, for children, money is simply paper.

  7. Transsulfuration pathway thiols and methylated arginines: the Hunter Community Study.

    Directory of Open Access Journals (Sweden)

    Arduino A Mangoni

    Full Text Available Serum homocysteine, when studied singly, has been reported to be positively associated both with the endogenous nitric oxide synthase inhibitor asymmetric dimethylarginine [ADMA, via inhibition of dimethylarginine dimethylaminohydrolase (DDAH activity] and with symmetric dimethylarginine (SDMA. We investigated combined associations between transsulfuration pathway thiols, including homocysteine, and serum ADMA and SDMA concentrations at population level.Data on clinical and demographic characteristics, medication exposure, C-reactive protein, serum ADMA and SDMA (LC-MS/MS, and thiols (homocysteine, cysteine, taurine, glutamylcysteine, total glutathione, and cysteinylglycine; capillary electrophoresis were collected from a sample of the Hunter Community Study on human ageing [n = 498, median age (IQR = 64 (60-70 years].REGRESSION ANALYSIS SHOWED THAT: a age (P = 0.001, gender (P = 0.03, lower estimated glomerular filtration rate (eGFR, P = 0.08, body mass index (P = 0.008, treatment with beta-blockers (P = 0.03, homocysteine (P = 0.02, and glutamylcysteine (P = 0.003 were independently associated with higher ADMA concentrations; and b age (P = 0.001, absence of diabetes (P = 0.001, lower body mass index (P = 0.01, lower eGFR (P<0.001, cysteine (P = 0.007, and glutamylcysteine (P < 0.001 were independently associated with higher SDMA concentrations. No significant associations were observed between methylated arginines and either glutathione or taurine concentrations.After adjusting for clinical, demographic, biochemical, and pharmacological confounders the combined assessment of transsulfuration pathway thiols shows that glutamylcysteine has the strongest and positive independent associations with ADMA and SDMA. Whether this reflects a direct effect of glutamylcysteine on DDAH activity (for ADMA and/or cationic amino acid transport requires further investigations.

  8. Drivers of change in hunter offtake and hunting strategies in Sendje, Equatorial Guinea.

    Science.gov (United States)

    Gill, David J C; Fa, John E; Rowcliffe, J Marcus; Kümpel, Noëlle F

    2012-12-01

    Economic development in Africa is expected to increase levels of bushmeat hunting through rising demand for meat and improved transport infrastructure. However, few studies have tracked long-term changes in hunter behavior as a means of testing this prediction. We evaluated changes in hunter behavior in a rural community in Equatorial Guinea over a period of rapid national economic growth, during which time road access to the regional capital greatly improved. We conducted offtake surveys (Supporting Information) over 3 7-week periods at the same time of year in 1998, 2003, and 2010 and conducted hunter and household interviews (Supporting Information) in 2003 and 2010. We tested whether relations existed among catch, hunting effort, hunting strategy, and income earned through hunting and other livelihoods in 2003 and 2010. Although village offtake increased from 1775 kg in 1998 to 4172 kg in 2003, it decreased in 2010 to 1361 kg. Aggregate catch per unit effort (i.e., number of carcasses caught per hunter and per trap) decreased from 2003 to 2010, and the majority of hunters reported a decrease in abundance of local fauna. Although these results are indicative of unsustainable hunting, cumulative changes in offtake and catch per unit effort were driven by a contraction in the total area hunted following an out-migration of 29 of the village's hunters, most of whom left to gain employment in the construction industry, after 2003. Hunters operating in both 2003 and 2010 hunted closer to the village because an increased abundance of elephants posed a danger and because they desired to earn income through other activities. Our study provides an example of national economic development contributing to a reduction in the intensity and extent of hunting. ©2012 Society for Conservation Biology.

  9. Preferences for symmetry in human faces in two cultures: data from the UK and the Hadza, an isolated group of hunter-gatherers.

    Science.gov (United States)

    Little, Anthony C; Apicella, Coren L; Marlowe, Frank W

    2007-12-22

    Many studies show agreement within and between cultures for general judgements of facial attractiveness. Few studies, however, have examined the attractiveness of specific traits and few have examined preferences in hunter-gatherers. The current study examined preferences for symmetry in both the UK and the Hadza, a hunter-gatherer society of Tanzania. We found that symmetry was more attractive than asymmetry across both the cultures and was more strongly preferred by the Hadza than in the UK. The different ecological conditions may play a role in generating this difference. Such variation in preference may be adaptive if it reflects adaptation to local conditions. Symmetry is thought to indicate genetic quality, which may be more important among the Hadza with much higher mortality rates from birth onwards. Hadza men who were more often named as good hunters placed a greater value on symmetry in female faces. These results suggest that high quality Hadza men are more discriminating in their choice of faces. Hadza women had increased preferences for symmetry in men's faces when they were pregnant or nursing, perhaps due to their increased discrimination and sensitivity to foods and disease harmful to a foetus or nursing infant. These results imply that symmetry is an evolutionarily relevant trait and that variation in symmetry preference appears strategic both between cultures and within individuals of a single culture.

  10. Evidence of Levy walk foraging patterns in human hunter-gatherers.

    Science.gov (United States)

    Raichlen, David A; Wood, Brian M; Gordon, Adam D; Mabulla, Audax Z P; Marlowe, Frank W; Pontzer, Herman

    2014-01-14

    When searching for food, many organisms adopt a superdiffusive, scale-free movement pattern called a Lévy walk, which is considered optimal when foraging for heterogeneously located resources with little prior knowledge of distribution patterns [Viswanathan GM, da Luz MGE, Raposo EP, Stanley HE (2011) The Physics of Foraging: An Introduction to Random Searches and Biological Encounters]. Although memory of food locations and higher cognition may limit the benefits of random walk strategies, no studies to date have fully explored search patterns in human foraging. Here, we show that human hunter-gatherers, the Hadza of northern Tanzania, perform Lévy walks in nearly one-half of all foraging bouts. Lévy walks occur when searching for a wide variety of foods from animal prey to underground tubers, suggesting that, even in the most cognitively complex forager on Earth, such patterns are essential to understanding elementary foraging mechanisms. This movement pattern may be fundamental to how humans experience and interact with the world across a wide range of ecological contexts, and it may be adaptive to food distribution patterns on the landscape, which previous studies suggested for organisms with more limited cognition. Additionally, Lévy walks may have become common early in our genus when hunting and gathering arose as a major foraging strategy, playing an important role in the evolution of human mobility.

  11. Resource scarcity drives lethal aggression among prehistoric hunter-gatherers in central California.

    Science.gov (United States)

    Allen, Mark W; Bettinger, Robert Lawrence; Codding, Brian F; Jones, Terry L; Schwitalla, Al W

    2016-10-25

    The origin of human violence and warfare is controversial, and some scholars contend that intergroup conflict was rare until the emergence of sedentary foraging and complex sociopolitical organization, whereas others assert that violence was common and of considerable antiquity among small-scale societies. Here we consider two alternative explanations for the evolution of human violence: (i) individuals resort to violence when benefits outweigh potential costs, which is likely in resource poor environments, or (ii) participation in violence increases when there is coercion from leaders in complex societies leading to group level benefits. To test these hypotheses, we evaluate the relative importance of resource scarcity vs. sociopolitical complexity by evaluating spatial variation in three macro datasets from central California: (i) an extensive bioarchaeological record dating from 1,530 to 230 cal BP recording rates of blunt and sharp force skeletal trauma on thousands of burials, (ii) quantitative scores of sociopolitical complexity recorded ethnographically, and (iii) mean net primary productivity (NPP) from a remotely sensed global dataset. Results reveal that sharp force trauma, the most common form of violence in the record, is better predicted by resource scarcity than relative sociopolitical complexity. Blunt force cranial trauma shows no correlation with NPP or political complexity and may reflect a different form of close contact violence. This study provides no support for the position that violence originated with the development of more complex hunter-gatherer adaptations in the fairly recent past. Instead, findings show that individuals are prone to violence in times and places of resource scarcity.

  12. Hunter-gatherer genomic diversity suggests a southern African origin for modern humans.

    Science.gov (United States)

    Henn, Brenna M; Gignoux, Christopher R; Jobin, Matthew; Granka, Julie M; Macpherson, J M; Kidd, Jeffrey M; Rodríguez-Botigué, Laura; Ramachandran, Sohini; Hon, Lawrence; Brisbin, Abra; Lin, Alice A; Underhill, Peter A; Comas, David; Kidd, Kenneth K; Norman, Paul J; Parham, Peter; Bustamante, Carlos D; Mountain, Joanna L; Feldman, Marcus W

    2011-03-29

    Africa is inferred to be the continent of origin for all modern human populations, but the details of human prehistory and evolution in Africa remain largely obscure owing to the complex histories of hundreds of distinct populations. We present data for more than 580,000 SNPs for several hunter-gatherer populations: the Hadza and Sandawe of Tanzania, and the ≠Khomani Bushmen of South Africa, including speakers of the nearly extinct N|u language. We find that African hunter-gatherer populations today remain highly differentiated, encompassing major components of variation that are not found in other African populations. Hunter-gatherer populations also tend to have the lowest levels of genome-wide linkage disequilibrium among 27 African populations. We analyzed geographic patterns of linkage disequilibrium and population differentiation, as measured by F(ST), in Africa. The observed patterns are consistent with an origin of modern humans in southern Africa rather than eastern Africa, as is generally assumed. Additionally, genetic variation in African hunter-gatherer populations has been significantly affected by interaction with farmers and herders over the past 5,000 y, through both severe population bottlenecks and sex-biased migration. However, African hunter-gatherer populations continue to maintain the highest levels of genetic diversity in the world.

  13. Future Discounting in Congo Basin Hunter-Gatherers Declines with Socio-Economic Transitions.

    Directory of Open Access Journals (Sweden)

    Gul Deniz Salali

    Full Text Available Humans have a tendency to discount the future; that is we value small, short-term rewards over larger, long-term rewards. The degree of future discounting, however, changes in response to socio-ecological factors. Here, we study Mbendjele BaYaka hunter-gatherers of northern Congo and their farmer neighbours to investigate adaptations in inter-temporal preferences in humans. We argue that in immediate-return systems, where food storage is absent and egalitarianism is enforced through levelling mechanisms, future discounting is an adaptive strategy to prevent wealth accumulation and the emergence of hierarchies. This ensures food sharing and allows for survival in unpredictable environments where there is risk of an energy shortfall. On the other hand, when food storage is made possible by the emergence of agriculture or as seen in some delayed-return hunter-gatherer populations, wealth accumulation, hierarchies and lower discount rates become the adaptive strategy. Therefore, individuals in immediate-return, egalitarian societies will discount the future more than those in non-egalitarian, delayed-return societies. Consistent with the predictions we found that market integration and socio-economic transitions decrease the future discounting in Mbendjele hunter-gatherers. Our measures of socio-economic differences marked this transition in hunter-gatherers living in a logging town. The degree of future-discounting was the same between more market-integrated hunter-gatherers and their farmer neighbours.

  14. PLANET HUNTERS: ASSESSING THE KEPLER INVENTORY OF SHORT-PERIOD PLANETS

    International Nuclear Information System (INIS)

    Schwamb, Megan E.; Lintott, Chris J.; Lynn, Stuart; Smith, Arfon M.; Simpson, Robert J.; Fischer, Debra A.; Giguere, Matthew J.; Brewer, John M.; Parrish, Michael; Schawinski, Kevin

    2012-01-01

    We present the results from a search of data from the first 33.5 days of the Kepler science mission (Quarter 1) for exoplanet transits by the Planet Hunters citizen science project. Planet Hunters enlists members of the general public to visually identify transits in the publicly released Kepler light curves via the World Wide Web. Over 24,000 volunteers reviewed the Kepler Quarter 1 data set. We examine the abundance of ≥2 R ⊕ planets on short-period ( ⊕ Planet Hunters ≥85% efficient at identifying transit signals for planets with periods less than 15 days for the Kepler sample of target stars. Our high efficiency rate for simulated transits along with recovery of the majority of Kepler ≥4 R ⊕ planets suggests that the Kepler inventory of ≥4 R ⊕ short-period planets is nearly complete.

  15. Targeting hunter distribution based on host resource selection and kill sites to manage disease risk

    DEFF Research Database (Denmark)

    Dugal, Cherie; van Beest, Floris; Vander Wal, Eric

    2013-01-01

    Endemic and emerging diseases are rarely uniform in their spatial distribution or prevalence among cohorts of wildlife. Spatial models that quantify risk-driven differences in resource selection and hunter mortality of animals at fine spatial scales can assist disease management by identifying high-risk...... areas and individuals. We used resource selection functions (RSFs) and selection ratios (SRs) to quantify sex- and age-specific resource selection patterns of collared (n = 67) and hunter-killed (n = 796) nonmigratory elk (Cervus canadensis manitobensis) during the hunting season between 2002 and 2012...... juvenile males and hunter-killed adult females. In instances where disease infects a metapopulation and eradication is infeasible, a principle goal of management is to limit the spread of disease among infected animals. We map high-risk areas that are regularly used by potentially infectious hosts...

  16. Clarifying beliefs underlying hunter intentions to support a ban on lead shot

    Science.gov (United States)

    Schroeder, Susan A.; Fulton, David C.; Doncarlos, Kathy

    2016-01-01

    Shot from hunting adds toxic lead to environments worldwide. Existing lead shot regulations have been instituted with little understanding of hunter beliefs and attitudes. This study applied the Theory of Reasoned Action, using a multilevel, multivariate approach, to clarify how positive and negative beliefs relate to attitudes about a ban on lead shot. Structure coefficients and commonality analysis were employed to further examine relationships between beliefs and attitudes. Results suggest that while both positive and negative outcomes influence attitudes, positive outcomes were more influential for supporters and negative beliefs for opposers. Management may need to focus on the results from hunters who indicated that they would be unlikely to support a ban, as these hunters include those who may actively oppose additional efforts to regulate lead.

  17. Fairy tales? Marion Jones, C.J. Hunter and the framing of doping in American newspapers

    DEFF Research Database (Denmark)

    Pfister, Gertrud Ursula; Gems, Gerald

    2015-01-01

    This article deals with the images, metaphors and narratives in the media coverage of doping in the United States. It presents a case study with a focus on Marion Jones, the most celebrated track athlete of the turn of the millennium, and her husband, C.J. Hunter, a shot put world champion...... under suspicion. At the same time, the 2000 Olympics can be considered a watershed in American anti-doping policy. The media portrayed Jones and Hunter as the Beauty and the Beast or Svengali and his victim, using a famous fairy tale and a well-known novel to capture attention, label the protagonists...

  18. Comparing Road-Kill Datasets from Hunters and Citizen Scientists in a Landscape Context

    OpenAIRE

    Florian Heigl; Carina R. Stretz; Wolfgang Steiner; Franz Suppan; Thomas Bauer; Gregor Laaha; Johann G. Zaller

    2016-01-01

    Road traffic has severe effects on animals, especially when road-kills are involved. In many countries, official road-kill data are provided by hunters or police; there are also road-kill observations reported by citizen scientists. The aim of the current study was to test whether road-kill reports by hunters stem from similar landscapes than those reported by citizen scientists. We analysed the surrounding landscapes of 712 road-kill reportings of European hares in the province of Lower Aust...

  19. Project CHECO Southeast Asia Report. OV-1/AC-119 Hunter-Killer Team

    Science.gov (United States)

    1972-10-10

    between Phan Rang, Phu Cat , and Danang in order to provide best coverage of the Vietnamese conflict. -- On 16 February 1970, three AC -ll9Ks and 70...SOUTHEAST ASIA D D DDiv AY/XDOSQA I OV-1/ AC -119 " i IWB I HUNTER-KILLER TEAM 19’.1’ CONTINUING REPORT CLASSIFIED Ey 7AFIDOOC DOWNGRADE TjU SECRET...xamination of C urrent, 0 per’tions I~ I fF!lr T I TII TIIII I OV=1/ AC -119 HUNTER-KILLER TEAMI 1 10 OCTOBER 1972 HQ PACAF Directorate of Operations

  20. Fundación Book Hunters: Atrévete a experimentar con la lectura

    OpenAIRE

    Cruz Mejía, Fernanda

    2017-01-01

    La fundación Book Hunters es una organización sin ánimo de lucro que busca fortalecer la relación de la lectura en los niños desde temprana edad, involucrando a la comunidad y promoviendo el entendimiento del entorno que rodea hoy en día la infancia. El equipo considera que, para lograr los objetivos es necesario transformar el significado ha perseguido a la lectura durante años, es decir, para Book Hunters leer va más allá de tomar un libro e involucrarse en la historia, en cambio, el si...

  1. Ethical acceptability of recreational hunting - does the motive of the hunter matter?

    DEFF Research Database (Denmark)

    Gamborg, Christian; Jensen, Frank Søndergaard; Sandøe, Peter

    2016-01-01

    Recreational hunting can be a way of taking responsibility for acquiring one’s own meat. However, many recreational hunters focus instead on hunting as a hobby or sport. This distinction, between two rather different motives for hunting, is relevant to the activity’s moral justifiability. The pub......Recreational hunting can be a way of taking responsibility for acquiring one’s own meat. However, many recreational hunters focus instead on hunting as a hobby or sport. This distinction, between two rather different motives for hunting, is relevant to the activity’s moral justifiability...

  2. Indice de Indices en la Biblioteca de Hunter College para el Estudiante Hispano.

    Science.gov (United States)

    Talero Bielsa, Alberto; And Others

    Designed for Spanish-speaking students of Hunter College of the City University of New York, this guide explains the use of 70 English-language indexes found in the college library. The explanations are given in Spanish in order to simplify the process of library research for students who are not completely comfortable with English. Each index is…

  3. The seed hunter in het spoor van Vavilov (interview met C. Kik)

    NARCIS (Netherlands)

    Zanderink, R.; Kik, C.

    2013-01-01

    Er moet voor een veredelaar een grote variatie aan plantmateriaal aanwezig zijn om uit te kunnen putten zodat onze gewassen, die vaak bestaan uit monoculturen, voor de toekomst veiliggesteld worden. Het vinden van die variatie is het werk van seed hunters of zadenverzamelaars. Eén van die seed

  4. Teaching Experientially with the Madeline Hunter Method: An Application in a Marketing Research Course

    Science.gov (United States)

    Burns, Alvin C.

    2006-01-01

    Due to concerns about the disparity of learning and the high nonresponse rates encountered by student marketing research teams working with sponsors, the author adopted the Hunter Method to restructure his course. This method requires the use of a model onto which students can map their learning via guided practice as well as independent practice.…

  5. Big game hunting practices, meanings, motivations and constraints: a survey of Oregon big game hunters

    Science.gov (United States)

    Suresh K. Shrestha; Robert C. Burns

    2012-01-01

    We conducted a self-administered mail survey in September 2009 with randomly selected Oregon hunters who had purchased big game hunting licenses/tags for the 2008 hunting season. Survey questions explored hunting practices, the meanings of and motivations for big game hunting, the constraints to big game hunting participation, and the effects of age, years of hunting...

  6. 76 FR 46149 - Financial Assistance: Wildlife Restoration, Sport Fish Restoration, Hunter Education and Safety

    Science.gov (United States)

    2011-08-01

    ... these regulations on June 10, 2010, to address changes in law, regulation, policy, technology, and... Service 50 CFR Part 80 Financial Assistance: Wildlife Restoration, Sport Fish Restoration, Hunter... 80 [Docket No. FWS-R9-WSR-2009-0088; 91400-5110-POLI-7B; 91400-9410-POLI- 7B] RIN 1018-AW65 Financial...

  7. Deer hunting and television: are tv shows creating expectations among deer hunters?

    Science.gov (United States)

    Joshua D. Agee; Craig A. Miller

    2009-01-01

    Throughout the past two decades new media outlets emphasizing trophy deer hunting have come to dominate hunting culture. Using data collected through a mail survey of Illinois deer hunters (n = 2,683, 78.5-percent response), we tested two hypotheses to determine factors that contribute to preference for hunting trophy deer. In particular, we examined the relationship...

  8. Period Determination of Binary Asteroid Targets Observed at Hunters Hill Observatory: May-September 2009

    Science.gov (United States)

    Higgins, David; Oey, Julian; Pravec, Petr

    2011-01-01

    Lightcurves for seven confirmed or possible binary asteroids were obtained at the Hunters Hill Observatory (HHO) and Leura Observatory from 2009 May through 2010 September: 1453 Fennia, 2501 Lohja, 3076 Garbor, 4029 Bridges, 5325 Silver, 6244 Okamoto, and (6265) 1985 TW3.

  9. High adult mortality among Hiwi hunter-gatherers: implications for human evolution.

    Science.gov (United States)

    Hill, Kim; Hurtado, A M; Walker, R S

    2007-04-01

    Extant apes experience early sexual maturity and short life spans relative to modern humans. Both of these traits and others are linked by life-history theory to mortality rates experienced at different ages by our hominin ancestors. However, currently there is a great deal of debate concerning hominin mortality profiles at different periods of evolutionary history. Observed rates and causes of mortality in modern hunter-gatherers may provide information about Upper Paleolithic mortality that can be compared to indirect evidence from the fossil record, yet little is published about causes and rates of mortality in foraging societies around the world. To our knowledge, interview-based life tables for recent hunter-gatherers are published for only four societies (Ache, Agta, Hadza, and Ju/'hoansi). Here, we present mortality data for a fifth group, the Hiwi hunter-gatherers of Venezuela. The results show comparatively high death rates among the Hiwi and highlight differences in mortality rates among hunter-gatherer societies. The high levels of conspecific violence and adult mortality in the Hiwi may better represent Paleolithic human demographics than do the lower, disease-based death rates reported in the most frequently cited forager studies.

  10. Levels and sources of forest fire prevention knowledge of California hunters

    Science.gov (United States)

    William S. Folkman

    1963-01-01

    Males 30-50 years of age from the smaller urban centers (under 25,000 population) make up the bulk of the California hunter population. They are mainly from the skilled-semiskilled and professional-managerial occupations. Their level of knowledge about forest fire prevention is generally high, but their knowledge is weak in some pertinent areas. Most frequently...

  11. A Biocultural Investigation of Gender Differences in Tobacco Use in an Egalitarian Hunter-Gatherer Population.

    Science.gov (United States)

    Roulette, Casey J; Hagen, Edward; Hewlett, Barry S

    2016-06-01

    In the developing world, the dramatic male bias in tobacco use is usually ascribed to pronounced gender disparities in social, political, or economic power. This bias might also reflect under-reporting by woman and/or over-reporting by men. To test the role of gender inequality on gender differences in tobacco use we investigated tobacco use among the Aka, a Congo Basin foraging population noted for its exceptionally high degree of gender equality. We also tested a sexual selection hypothesis-that Aka men's tobacco use is related to risk taking. Tobacco use, income, tobacco purchases, tobacco sharing, reasons for using tobacco, risk taking, and other variables were measured using structured surveys and peer reports. Tobacco use was verified by testing for salivary cotinine, a nicotine metabolite. Contrary to expectations, we found a very large male bias in tobacco use. Low levels of use among females appeared to be explained by aversions to tobacco, concerns over its negative effects on fetal health, and a desire to attract husbands, who prefer nonsmoking wives. High male use appeared to be related to a desire to enhance hunting abilities and attract and/or retain wives, who prefer husbands that smoke. We conclude that low levels of smoking by Aka women are better explained by the hypothesis that women evolved to avoid plant toxins to protect their fetuses and nursing infants. High male use might be better explained by sexual selection. We also highlight the important role that recreational drugs appear to play in hunter-gatherer sharing relationships.

  12. Knowledge-Sharing Networks in Hunter-Gatherers and the Evolution of Cumulative Culture.

    Science.gov (United States)

    Salali, Gul Deniz; Chaudhary, Nikhil; Thompson, James; Grace, Olwen Megan; van der Burgt, Xander M; Dyble, Mark; Page, Abigail E; Smith, Daniel; Lewis, Jerome; Mace, Ruth; Vinicius, Lucio; Migliano, Andrea Bamberg

    2016-09-26

    Humans possess the unique ability for cumulative culture [1, 2]. It has been argued that hunter-gatherer's complex social structure [3-9] has facilitated the evolution of cumulative culture by allowing information exchange among large pools of individuals [10-13]. However, empirical evidence for the interaction between social structure and cultural transmission is scant [14]. Here we examine the reported co-occurrence of plant uses between individuals in dyads (which we define as their "shared knowledge" of plant uses) in BaYaka Pygmies from Congo. We studied reported uses of 33 plants of 219 individuals from four camps. We show that (1) plant uses by BaYaka fall into three main domains: medicinal, foraging, and social norms/beliefs; (2) most medicinal plants have known bioactive properties, and some are positively associated with children's BMI, suggesting that their use is adaptive; (3) knowledge of medicinal plants is mainly shared between spouses and biological and affinal kin; and (4) knowledge of plant uses associated with foraging and social norms is shared more widely among campmates, regardless of relatedness, and is important for camp-wide activities that require cooperation. Our results show the interdependence between social structure and knowledge sharing. We propose that long-term pair bonds, affinal kin recognition, exogamy, and multi-locality create ties between unrelated families, facilitating the transmission of medicinal knowledge and its fitness implications. Additionally, multi-family camps with low inter-relatedness between camp members provide a framework for the exchange of functional information related to cooperative activities beyond the family unit, such as foraging and regulation of social life. Copyright © 2016 Elsevier Ltd. All rights reserved.

  13. Establishment of native and exotic grasses on mine overburden and topsoil in the Hunter Valley, New South Wales

    Energy Technology Data Exchange (ETDEWEB)

    Huxtable, C.H.A.; Koen, T.B.; Waterhouse, D. [DNR, Dangar, NSW (Australia)

    2005-07-01

    Current recommendations for rehabilitation of open-cut coal mines in the Hunter Valley involve the sowing of exotic pasture species to reinstate mined land to Class IV and V under the Rural Land Capability System. Despite the importance of native grasses in the pre-mined landscape, they are currently not widely included in mine rehabilitation. To address this issue a project was conducted between 1994 and 2000 to research the use of native grasses for rehabilitation of open-cut coal mines in the Hunter Valley. This paper reports on 2 mine site experiments that aimed to assess establishment and persistence of a broad range of native and exotic grass species from an autumn sowing in both topsoil and raw spoil over a period of 61 months. The most promising natives in terms of early establishment, persistence and spread over time, included six C-3 accessions (five Austrodanthonia spp. and Austrostipa bigeniculata) and one C-4 accession (Cynodon dactylon). Persistence of these accessions was better in raw spoil than topsoil, despite initial low numbers, due to a lack of weed competition and their ability to spread by self-seeding. In topsoil, and in the absence of any biomass reduction, native species were mostly out-competed by vigorous exotic perennial grasses which were sown in these experiments and from seed influx from adjacent rehabilitation areas or from the soil seed bank. The effects of climatic conditions and differences in soil physical, chemical and seed bank characteristics at the 2 mine sites are also discussed.

  14. Hunter-gatherers in southeast Asia: from prehistory to the present.

    Science.gov (United States)

    Higham, Charles

    2013-01-01

    Anatomically modern hunter-gatherers expanded from Africa into Southeast Asia at least 50,000 years ago, where they probably encountered and interacted with populations of Homo erectus and Homo floresiensis and the recently discovered Denisovans. Simulation studies suggest that these hunter-gatherers may well have followed a coastal route that ultimately led to the settlement of Sahul, while archaeology confirms that they also crossed significant seas and explored well into the interior. They also adapted to marked environmental changes that alternated between relatively cool and dry conditions and warmer, wetter interludes. During the former, the sea fell by up to 120 m below its present level, which opened up a vast low-lying area known as Sundaland. Three principal alignments can be identified: the first involved the occupation of rock shelters in upland regions, the second has identified settlement on broad riverine floodplains, and the last concentrated on the raised beaches formed from about five millennia ago when the sea level was elevated above its present position. This cultural sequence was dislocated about 4 kya when rice and millet farmers infiltrated the lowlands of Southeast Asia ultimately from the Yangtze River valley. It is suggested that this led to two forms of interaction. In the first, the indigenous hunter-gatherers integrated with intrusive Neolithic communities and, while losing their cultural identity, contributed their genes to the present population of Southeast Asia. In the second, hunter-gatherers withdrew to rainforest refugia and, through selective pressures inherent in such an environment, survived as the small-bodied, dark-skinned humans found to this day in the Philippines, Peninsular Malaysia and Thailand, and the Andaman Islands. Beyond the impact of expansive rice farmers in Melanesia and Australia, hunter-gatherers continued to dominate until they encountered European settlement. Copyright © 2013 Wayne State University Press

  15. Nutrition, modernity and the archaeological record: coastal resources and nutrition among Middle Stone Age hunter-gatherers on the Western Cape coast of South Africa.

    Science.gov (United States)

    Kyriacou, Katharine; Parkington, John E; Marais, Adrian D; Braun, David R

    2014-12-01

    In this paper, we assess the nutritional value of some marine and terrestrial food resources available to Middle Stone Age hunter-gatherers in the Western Cape of South Africa with respect to an important macronutrient (protein) and an essential micronutrient (iron) and introduce a framework for assessing the relative utility of marine and terrestrial resources. Whilst the ability to extract nutrients from the environment has always been a lynchpin in archaeologists' reconstructions of human evolution, a recent paradigm shift has recognized the role of marine resources in encephalization. Nutritional research indicates that marine ecosystems are the best source for long chain polyunsaturated fatty acids essential for proper brain development, and excavations at securely dated archaeological sites in South Africa provide firm evidence for the exploitation of marine resources by Middle Stone Age hunter-gatherers from at least Marine Isotope Stage 5 (130 ka), and possibly even earlier. Because marine molluscs are abundant, predictably located and easily harvested, they would have been readily available to all members of the community, in contrast to terrestrial resources. The improving archaeological record gives important clues to resource choice, but many more nutritional observations are needed to determine the extent to which marine resources could have met the nutrient requirements of prehistoric people. Our observations indicate that marine and terrestrial fauna are both excellent sources of protein, and that marine molluscs have higher iron concentrations than we expected for invertebrate fauna. We calculate the number of individual food items from a selection of marine and terrestrial species needed to provide the protein and iron requirements of a hypothetical group of hunter-gatherers, identify contrasts in peoples' requirements for and access to nutrients and resources, and discuss the implications for prehistoric subsistence strategies and human evolution

  16. Hunter versus CIE color measurement systems for analysis of milk-based beverages.

    Science.gov (United States)

    Cheng, Ni; Barbano, David M; Drake, Mary Anne

    2018-06-01

    The objective of our work was to determine the differences in sensitivity of Hunter and International Commission on Illumination (CIE) methods at 2 different viewer angles (2 and 10°) for measurement of whiteness, red/green, and blue/yellow color of milk-based beverages over a range of composition. Sixty combinations of milk-based beverages were formulated (2 replicates) with a range of fat level from 0.2 to 2%, true protein level from 3 to 5%, and casein as a percent of true protein from 5 to 80% to provide a wide range of milk-based beverage color. In addition, commercial skim, 1 and 2% fat high-temperature, short-time pasteurized fluid milks were analyzed. All beverage formulations were HTST pasteurized and cooled to 4°C before analysis. Color measurement viewer angle (2 vs. 10°) had very little effect on objective color measures of milk-based beverages with a wide range of composition for either the Hunter or CIE color measurement system. Temperature (4, 20, and 50°C) of color measurement had a large effect on the results of color measurement in both the Hunter and CIE measurement systems. The effect of milk beverage temperature on color measurement results was the largest for skim milk and the least for 2% fat milk. This highlights the need for proper control of beverage serving temperature for sensory panel analysis of milk-based beverages with very low fat content and for control of milk temperature when doing objective color analysis for quality control in manufacture of milk-based beverages. The Hunter system of color measurement was more sensitive to differences in whiteness among milk-based beverages than the CIE system, whereas the CIE system was much more sensitive to differences in yellowness among milk-based beverages. There was little difference between the Hunter and CIE system in sensitivity to green/red color of milk-based beverages. In defining milk-based beverage product specifications for objective color measures for dairy product

  17. Human behavior. Sex equality can explain the unique social structure of hunter-gatherer bands.

    Science.gov (United States)

    Dyble, M; Salali, G D; Chaudhary, N; Page, A; Smith, D; Thompson, J; Vinicius, L; Mace, R; Migliano, A B

    2015-05-15

    The social organization of mobile hunter-gatherers has several derived features, including low within-camp relatedness and fluid meta-groups. Although these features have been proposed to have provided the selective context for the evolution of human hypercooperation and cumulative culture, how such a distinctive social system may have emerged remains unclear. We present an agent-based model suggesting that, even if all individuals in a community seek to live with as many kin as possible, within-camp relatedness is reduced if men and women have equal influence in selecting camp members. Our model closely approximates observed patterns of co-residence among Agta and Mbendjele BaYaka hunter-gatherers. Our results suggest that pair-bonding and increased sex egalitarianism in human evolutionary history may have had a transformative effect on human social organization. Copyright © 2015, American Association for the Advancement of Science.

  18. Co-residence patterns in hunter-gatherer societies show unique human social structure.

    Science.gov (United States)

    Hill, Kim R; Walker, Robert S; Bozicević, Miran; Eder, James; Headland, Thomas; Hewlett, Barry; Hurtado, A Magdalena; Marlowe, Frank; Wiessner, Polly; Wood, Brian

    2011-03-11

    Contemporary humans exhibit spectacular biological success derived from cumulative culture and cooperation. The origins of these traits may be related to our ancestral group structure. Because humans lived as foragers for 95% of our species' history, we analyzed co-residence patterns among 32 present-day foraging societies (total n = 5067 individuals, mean experienced band size = 28.2 adults). We found that hunter-gatherers display a unique social structure where (i) either sex may disperse or remain in their natal group, (ii) adult brothers and sisters often co-reside, and (iii) most individuals in residential groups are genetically unrelated. These patterns produce large interaction networks of unrelated adults and suggest that inclusive fitness cannot explain extensive cooperation in hunter-gatherer bands. However, large social networks may help to explain why humans evolved capacities for social learning that resulted in cumulative culture.

  19. Sex differences in Nintendo Wii performance as expected from hunter-gatherer selection.

    Science.gov (United States)

    Cherney, Isabelle D; Poss, Jordan L

    2008-06-01

    To test the hunter-gatherer theory of cognitive sex differences, men and women each played four video games on a Wii console: two games simulating skills necessary for hunting (navigation and shooting) and two games simulating skills necessary for gathering (fine motor and visual search). Men outperformed women on the two hunting games, whereas there were no sex differences on the gathering skill games. The findings are discussed in terms of evolutionary psychology theory.

  20. Coccidioidomycosis in armadillo hunters from the state of Ceará, Brazil

    OpenAIRE

    Brillhante, Raimunda Sâmia Nogueira; Moreira Filho, Renato Evando; Rocha, Marcos Fábio Gadelha; Castelo-Branco, Débora de Souza Collares Maia; Fechine, Maria Auxiliadora Bezerra; Lima, Rita Amanda Chaves de; Picanço, Yuri Vieira Cunha; Cordeiro, Rossana de Aguiar; Camargo, Zoilo Pires de; Queiroz, José Ajax Nogueira; Araujo, Roberto Wagner Bezerra de; Mesquita, Jacó Ricarte Lima de; Sidrim, José Júlio Costa

    2012-01-01

    Coccidioidomycosis is a systemic mycosis with a variable clinical presentation. Misdiagnosis of coccidioidomycosis as bacterial pneumopathy leads to inappropriate prescription of antibiotics and delayed diagnosis. This report describes an outbreak among armadillo hunters in northeastern Brazil in which an initial diagnosis of bacterial pneumonia was later confirmed as coccidioidomycosis caused by Coccidioides posadasii. Thus, this mycosis should be considered as an alternative diagnosis in pa...

  1. Favorable ecological circumstances promote life expectancy in chimpanzees similar to that of human hunter-gatherers.

    Science.gov (United States)

    Wood, Brian M; Watts, David P; Mitani, John C; Langergraber, Kevin E

    2017-04-01

    Demographic data on wild chimpanzees are crucial for understanding the evolution of chimpanzee and hominin life histories, but most data come from populations affected by disease outbreaks and anthropogenic disturbance. We present survivorship data from a relatively undisturbed and exceptionally large community of eastern chimpanzees (Pan troglodytes schweinfurthii) at Ngogo, Kibale National Park, Uganda. We monitored births, deaths, immigrations, and emigrations in the community between 1995 and 2016. Using known and estimated ages, we calculated survivorship curves for the whole community, for males and females separately, and for individuals ≤2 years old when identified. We used a novel method to address age estimation error by calculating stochastic survivorship curves. We compared Ngogo life expectancy, survivorship, and mortality rates to those from other chimpanzee communities and human hunter-gatherers. Life expectancy at birth for both sexes combined was 32.8 years, far exceeding estimates of chimpanzee life expectancy in other communities, and falling within the range of human hunter-gatherers (i.e., 27-37 years). Overall, the pattern of survivorship at Ngogo was more similar to that of human hunter-gatherers than to other chimpanzee communities. Maximum lifespan for the Ngogo chimpanzees, however, was similar to that reported at other chimpanzee research sites and was less than that of human-hunter gatherers. The absence of predation by large carnivores may contribute to some of the higher survivorship at Ngogo, but this cannot explain the much higher survivorship at Ngogo than at Kanyawara, another chimpanzee community in the same forest, which also lacks large carnivores. Higher survivorship at Ngogo appears to be an adaptive response to a food supply that is more abundant and varies less than that of Kanyawara. Future analyses of hominin life history evolution should take these results into account. Copyright © 2017 Elsevier Ltd. All rights

  2. Ancient DNA reveals lack of continuity between neolithic hunter-gatherers and contemporary Scandinavians

    DEFF Research Database (Denmark)

    Malmström, Helena; Gilbert, M Thomas P; Thomas, Mark G

    2009-01-01

    of the two cultures in Scandinavia has been cited as an argument against population replacement between the Mesolithic and the present [7, 8]. Through analysis of DNA extracted from ancient Scandinavian human remains, we show that people of the Pitted Ware culture were not the direct ancestors of modern......]. Furthermore, our data are consistent with the view that the eastern Baltic represents a genetic refugia for some of the European hunter-gatherer populations....

  3. JEFX 10 demonstration of Cooperative Hunter Killer UAS and upstream data fusion

    Science.gov (United States)

    Funk, Brian K.; Castelli, Jonathan C.; Watkins, Adam S.; McCubbin, Christopher B.; Marshall, Steven J.; Barton, Jeffrey D.; Newman, Andrew J.; Peterson, Cammy K.; DeSena, Jonathan T.; Dutrow, Daniel A.; Rodriguez, Pedro A.

    2011-05-01

    The Johns Hopkins University Applied Physics Laboratory deployed and demonstrated a prototype Cooperative Hunter Killer (CHK) Unmanned Aerial System (UAS) capability and a prototype Upstream Data Fusion (UDF) capability as participants in the Joint Expeditionary Force Experiment 2010 in April 2010. The CHK capability was deployed at the Nevada Test and Training Range to prosecute a convoy protection operational thread. It used mission-level autonomy (MLA) software applied to a networked swarm of three Raven hunter UAS and a Procerus Miracle surrogate killer UAS, all equipped with full motion video (FMV). The MLA software provides the capability for the hunter-killer swarm to autonomously search an area or road network, divide the search area, deconflict flight paths, and maintain line of sight communications with mobile ground stations. It also provides an interface for an operator to designate a threat and initiate automatic engagement of the target by the killer UAS. The UDF prototype was deployed at the Maritime Operations Center at Commander Second Fleet, Naval Station Norfolk to provide intelligence analysts and the ISR commander with a common fused track picture from the available FMV sources. It consisted of a video exploitation component that automatically detected moving objects, a multiple hypothesis tracker that fused all of the detection data to produce a common track picture, and a display and user interface component that visualized the common track picture along with appropriate geospatial information such as maps and terrain as well as target coordinates and the source video.

  4. Guidelines for diagnosis and treatment of Hunter Syndrome for clinicians in Latin America

    Directory of Open Access Journals (Sweden)

    Roberto Giugliani

    2014-06-01

    Full Text Available This review aims to provide clinicians in Latin America with the most current information on the clinical aspects, diagnosis, and management of Hunter syndrome, a serious and progressive disease for which specific treatment is available. Hunter syndrome is a genetic disorder where iduronate-2-sulfatase (I2S, an enzyme that degrades glycosaminoglycans, is absent or deficient. Clinical manifestations vary widely in severity and involve multiple organs and tissues. An attenuated and a severe phenotype are recognized depending on the degree of cognitive impairment. Early diagnosis is vital for disease management. Clinical signs common to children with Hunter syndrome include inguinal hernia, frequent ear and respiratory infections, facial dysmorphisms, macrocephaly, bone dysplasia, short stature, sleep apnea, and behavior problems. Diagnosis is based on screening urinary glycosaminoglycans and confirmation by measuring I2S activity and analyzing I2S gene mutations. Idursulfase (recombinant I2S (Elaprase®, Shire enzyme replacement therapy (ERT, designed to address the underlying enzyme deficiency, is approved treatment and improves walking capacity and respiratory function, and reduces spleen and liver size and urinary glycosaminoglycan levels. Additional measures, responding to the multi-organ manifestations, such as abdominal/inguinal hernia repair, carpal tunnel surgery, and cardiac valve replacement, should also be considered. Investigational treatment options such as intrathecal ERT are active areas of research, and bone marrow transplantation is in clinical practice. Communication among care providers, social workers, patients and families is essential to inform and guide their decisions, establish realistic expectations, and assess patients' responses.

  5. Wild-harvested venison yields and sharing by Michigan deer hunters

    Science.gov (United States)

    Goguen, Amber D.; Riley, Shawn J.; Organ, John F.; Rudolph, Brent A.

    2018-01-01

    An increased societal focus on wildlife as food and recent policy deliberations regarding legal markets for wild-harvested meat are encouraging wildlife managers and researchers to examine the amount, use, and distribution of meat yielded through recreational hunting. We used responses to questions on the Michigan Deer Harvest Study to estimate the maximum yield of edible venison and assess hunters’ sharing behaviors. We estimated 11,402–14,473 metric tons of edible venison were procured during the 2013 hunting season. Of hunters who harvested a deer, 85% shared their venison. Hunters who shared did so with an average of 5.6 people (SD = 4.5). Sharing occurred most frequently within tight social networks: members of hunters’ households (69%), relatives (52%), and friends, neighbors, or coworkers (50%). In the absence of legal markets, venison is distributed widely by hunters and greatly amplifies the number of people benefiting from hunting. Nonetheless, we also identified the potential breadth of exposure to disease or contaminants from wild-harvested meat.

  6. Estimating the mercury exposure dose in a population of migratory bird hunters in the St. Lawrence River region, Quebec, Canada

    International Nuclear Information System (INIS)

    Duchesne, J.-F.; Levesque, B.; Gauvin, Denis; Braune, Birgit; Gingras, Suzanne; Dewailly, E.

    2004-01-01

    St. Lawrence River hunters (Quebec, Canada) are exposed to the pollutants, especially mercury, that contaminate birds and fish. However, the health risks of this have remained unclear because of a lack of information about the hunters' duck, geese, and sportfish consumption habits. A nutritional survey was set up to characterize waterfowl and sportfish consumption in St. Lawrence River duck hunters and to estimate their daily exposure to mercury. During the winter of 2000, 512 hunters selected from the Canadian Wildlife Service database completed a self-administered questionnaire. Daily exposure to contaminants was measured using data from the Canadian Wildlife Service (waterfowl) and available data on St. Lawrence River sportfish. The annual average consumption was 7.5 meals of ducks and geese and 8.7 meals of sportfish. The daily exposure to mercury related to waterfowl consumption was below the Canadian tolerable daily intake (TDI) of 0.47 μg/kg body wt/day for all participants. The daily mercury intake associated with fish consumption was greater than the TDI in 2 duck hunters. The daily exposure to mercury was higher than the TDI in 4 participants when both waterfowl and fish consumption were combined. Our results suggest that fish consumption (especially freshwater fish) represents the main source of exposure to pollutants in duck hunters

  7. Sex Differences in Food Preferences of Hadza Hunter-Gatherers

    OpenAIRE

    Julia Colette Berbesque; Frank W. Marlowe

    2009-01-01

    Food preferences are important for understanding foraging choices. In studying human foragers rather than other animals, we have the advantage of being able to ask them which foods they prefer. Yet surprisingly, no studies of systematically collected data exist on human forager food preferences. The Hadza of Tanzania are full-time foragers in an area where the hominin record extends back to 3-4 million years ago, so their diet is very relevant for understanding the paleo-diet. Here, we report...

  8. Sex Differences in Food Preferences of Hadza Hunter-Gatherers

    Directory of Open Access Journals (Sweden)

    Julia Colette Berbesque

    2009-10-01

    Full Text Available Food preferences are important for understanding foraging choices. In studying human foragers rather than other animals, we have the advantage of being able to ask them which foods they prefer. Yet surprisingly, no studies of systematically collected data exist on human forager food preferences. The Hadza of Tanzania are full-time foragers in an area where the hominin record extends back to 3-4 million years ago, so their diet is very relevant for understanding the paleo-diet. Here, we report on their food preferences, elicited with photographs of species within the five major food categories in their diet: honey, meat, berries, baobab, and tubers. There were sex differences in the ranks of two food categories: meat and berries. While male and female ranks agreed on the other three food categories, females ranked berries second and meat fourth, whereas males ranked meat second and berries fourth. Theses similarities and differences are interesting in light of the fact that the sexes target different foods. We discuss the implications of Hadza food preferences for the origin of the uniquely human sexual division of foraging labor.

  9. Hunter-gatherer postcranial robusticity relative to patterns of mobility, climatic adaptation, and selection for tissue economy.

    Science.gov (United States)

    Stock, J T

    2006-10-01

    Human skeletal robusticity is influenced by a number of factors, including habitual behavior, climate, and physique. Conflicting evidence as to the relative importance of these factors complicates our ability to interpret variation in robusticity in the past. It remains unclear how the pattern of robusticity in the skeleton relates to adaptive constraints on skeletal morphology. This study investigates variation in robusticity in claviculae, humeri, ulnae, femora, and tibiae among human foragers, relative to climate and habitual behavior. Cross-sectional geometric properties of the diaphyses are compared among hunter-gatherers from southern Africa (n = 83), the Andaman Islands (n = 32), Tierra del Fuego (n = 34), and the Great Lakes region (n = 15). The robusticity of both proximal and distal limb segments correlates negatively with climate and positively with patterns of terrestrial and marine mobility among these groups. However, the relative correspondence between robusticity and these factors varies throughout the body. In the lower limb, partial correlations between polar second moment of area (J(0.73)) and climate decrease from proximal to distal section locations, while this relationship increases from proximal to distal in the upper limb. Patterns of correlation between robusticity and mobility, either terrestrial or marine, generally increase from proximal to distal in the lower and upper limbs, respectively. This suggests that there may be a stronger relationship between observed patterns of diaphyseal hypertrophy and behavioral differences between populations in distal elements. Despite this trend, strength circularity indices at the femoral midshaft show the strongest correspondence with terrestrial mobility, particularly among males.

  10. Using obsidian transfer distances to explore social network maintenance in late Pleistocene hunter-gatherers.

    Science.gov (United States)

    Pearce, Eiluned; Moutsiou, Theodora

    2014-12-01

    Social behaviour is notoriously difficult to study archaeologically and it is unclear how large the networks of prehistoric humans were, or how they remained connected. Maintaining social cohesion was crucial for early humans because social networks facilitate cooperation and are imperative for survival and reproduction. Recent hunter-gatherer social organisation typically comprises a number of nested layers, ranging from the nuclear family through to the ~1500-strong ethnolinguistic tribe. Here we compare maximum obsidian transfer distances from the late Pleistocene with ethnographic data on the size of the geographic areas associated with each of these social grouping layers in recent hunter-gatherers. The closest match between the two is taken to indicate the maximum social layer within which contact could be sustained by Pleistocene hominins. Within both the (sub)tropical African and Subarctic biomes, the maximum obsidian transfer distances for Pleistocene modern humans (~200km and ~400km respectively) correspond to the geographic ranges of the outermost tribal layer in recent hunter-gatherers. This suggests that modern humans could potentially sustain the cohesion of their entire tribe at all latitudes, even though networks are more dispersed nearer the poles. Neanderthal obsidian transfer distances (300km) indicate that although Neanderthal home ranges are larger than those of low latitude hominins, Neanderthals travelled shorter distances than modern humans living at the same high latitudes. We argue that, like modern humans, Neanderthals could have maintained tribal cohesion, but that their tribes were substantially smaller than those of contemporary modern humans living in similar environments. The greater time taken to traverse the larger modern human tribal ranges may have limited the frequency of their face-to-face interactions and thus necessitated additional mechanisms to ensure network connectivity, such as the exchange of symbolic artefacts

  11. Settlement-Size Scaling among Prehistoric Hunter-Gatherer Settlement Systems in the New World.

    Directory of Open Access Journals (Sweden)

    W Randall Haas

    Full Text Available Settlement size predicts extreme variation in the rates and magnitudes of many social and ecological processes in human societies. Yet, the factors that drive human settlement-size variation remain poorly understood. Size variation among economically integrated settlements tends to be heavy tailed such that the smallest settlements are extremely common and the largest settlements extremely large and rare. The upper tail of this size distribution is often formalized mathematically as a power-law function. Explanations for this scaling structure in human settlement systems tend to emphasize complex socioeconomic processes including agriculture, manufacturing, and warfare-behaviors that tend to differentially nucleate and disperse populations hierarchically among settlements. But, the degree to which heavy-tailed settlement-size variation requires such complex behaviors remains unclear. By examining the settlement patterns of eight prehistoric New World hunter-gatherer settlement systems spanning three distinct environmental contexts, this analysis explores the degree to which heavy-tailed settlement-size scaling depends on the aforementioned socioeconomic complexities. Surprisingly, the analysis finds that power-law models offer plausible and parsimonious statistical descriptions of prehistoric hunter-gatherer settlement-size variation. This finding reveals that incipient forms of hierarchical settlement structure may have preceded socioeconomic complexity in human societies and points to a need for additional research to explicate how mobile foragers came to exhibit settlement patterns that are more commonly associated with hierarchical organization. We propose that hunter-gatherer mobility with preferential attachment to previously occupied locations may account for the observed structure in site-size variation.

  12. Game meat consumption by hunters and their relatives: A probabilistic approach.

    Science.gov (United States)

    Sevillano Morales, Jesus; Moreno-Ortega, Alicia; Amaro Lopez, Manual Angel; Arenas Casas, Antonio; Cámara-Martos, Fernando; Moreno-Rojas, Rafael

    2018-06-18

    This study aimed to estimate the consumption of meat and products derived from hunting by the consumer population and, specifically, by hunters and their relatives. For this purpose, a survey was conducted on the frequency of consuming meat from the four most representative game species in Spain, two of big game, wild boar (Sus scrofa) and red deer (Cervus elaphus) and two of small game, rabbit (Oryctolagus cunulucus) and red partridge (Alectoris rufa), as well as of processed meat products (salami-type sausage) made from those big game species. The survey was carried out on 337 habitual consumers of these types of products (hunters and their relatives). The total mean game meat consumption, per capita in this population group, is 6.87 kg/person/year of meat and 8.57 kg/person/year if the processed meat products are also considered. Consumption of rabbit, red partridge, red deer and wild boar, individually, was 1.85, 0.82, 2.28 and 1.92 kg/person/year, respectively. It was observed that hunters generally registered a larger intake of game meat, this being statistically significant in the case of rabbit meat consumption. Using probabilistic methods, the meat consumption frequency distributions for each hunting species studied were estimated, as well as the products made from big game species and the total consumption both of meat by itself and that including the products made from it. The consumption frequency distributions were adjusted to exponential ones, verified by the test suitable for it according to Akaike Information Criterion, Bayesian Information Criterion, the Chi-Squared and Kolmogorov-Smirnov statistics. In addition, the consumption percentiles of the different distributions were obtained. The latter could be a good tool when making nutrition or contaminant studies since they permit the assessment of exposure to the compound in question.

  13. Mortality, fertility, and the OY ratio in a model hunter-gatherer system.

    Science.gov (United States)

    White, Andrew A

    2014-06-01

    An agent-based model (ABM) is used to explore how the ratio of old to young adults (the OY ratio) in a sample of dead individuals is related to aspects of mortality, fertility, and longevity experienced by the living population from which the sample was drawn. The ABM features representations of rules, behaviors, and constraints that affect person- and household-level decisions about marriage, reproduction, and infant mortality in hunter-gatherer systems. The demographic characteristics of the larger model system emerge through human-level interactions playing out in the context of "global" parameters that can be adjusted to produce a range of mortality and fertility conditions. Model data show a relationship between the OY ratios of living populations (the living OY ratio) and assemblages of dead individuals drawn from those populations (the dead OY ratio) that is consistent with that from empirically known ethnographic hunter-gatherer cases. The dead OY ratio is clearly related to the mean ages, mean adult mortality rates, and mean total fertility rates experienced by living populations in the model. Sample size exerts a strong effect on the accuracy with which the calculated dead OY ratio reflects the actual dead OY ratio of the complete assemblage. These results demonstrate that the dead OY ratio is a potentially useful metric for paleodemographic analysis of changes in mortality and mean age, and suggest that, in general, hunter-gatherer populations with higher mortality, higher fertility, and lower mean ages are characterized by lower dead OY ratios. Copyright © 2014 Wiley Periodicals, Inc.

  14. Mollie Lentaigne, the nurse who drew McIndoe's Guinea pigs: Exploring the role of a medical artist at the Queen Victoria Hospital, 1940-1945.

    Science.gov (United States)

    Baldwin, Alexander J

    2018-04-16

    Mollie Lentaigne was a medical artist who worked at the Queen Victoria Hospital in East Grinstead during the Second World War alongside Archibald McIndoe and his dedicated team. She drew hundreds of medical illustrations for McIndoe and his fellow surgeons during the years between 1940 and 1945. Her illustrations depict the plastic surgery that was carried out in that hospital on the badly burnt RAF servicemen injured during the war that took place in the skies over Europe, which included many aircrew injured during the Battle of Britain. This project looks at the career of Lentaigne and her role within the surgical team in East Grinstead during that era and explores a number of Lentaigne's illustrations whilst providing context as to the procedures and patients depicted. An examination of Lentaigne's story, using an interview conducted by the author with the artist offers an alternative perspective with which to observe the events that unfolded in East Grinstead during that conflict. An analysis of these images shows the ability of this artist to portray relatively complex operations with a series of simple pencil or ink diagrams whilst also skilfully engaging the observer's sense of touch. The ability of a medical artist to be selective with her illustrations allowed them to provide clearer, less cluttered images that were preferred by McIndoe when recording the specific surgical procedures for use in the patient's medical records. Copyright © 2018 British Association of Plastic, Reconstructive and Aesthetic Surgeons. Published by Elsevier Ltd. All rights reserved.

  15. Environmental injustice and air pollution in coal affected communities, Hunter Valley, Australia

    Energy Technology Data Exchange (ETDEWEB)

    Higginbotham, N.; Freeman, S.; Connor, L.; Albrecht, G. [University of Newcastle, Callaghan, NSW (Australia). School of Medicine & Public Health

    2010-03-15

    The authors describe environmental injustice from air pollution in the Upper Hunter, Australia, and analyse the inaction of state authorities in addressing residents' health concerns. Obstacles blocking a public-requested health study and air monitoring include: the interdependence of state government and corporations in reaping the economic benefits of coal production; lack of political will, regulatory inertia and procedural injustice; and study design and measurement issues. We analyse mining- and coal-related air pollution in a contested socio-political arena, where residents, civil society and local government groups struggle with corporations and state government over the burden of imposed health risk caused by air pollution.

  16. Coccidioidomycosis in armadillo hunters from the state of Ceará, Brazil.

    Science.gov (United States)

    Brillhante, Raimunda Sâmia Nogueira; Moreira Filho, Renato Evando; Rocha, Marcos Fábio Gadelha; Castelo-Branco, Débora de Souza Collares Maia; Fechine, Maria Auxiliadora Bezerra; Lima, Rita Amanda Chaves de; Picanço, Yuri Vieira Cunha; Cordeiro, Rossana de Aguiar; Camargo, Zoilo Pires de; Queiroz, José Ajax Nogueira; Araujo, Roberto Wagner Bezerra de; Mesquita, Jacó Ricarte Lima de; Sidrim, José Júlio Costa

    2012-09-01

    Coccidioidomycosis is a systemic mycosis with a variable clinical presentation. Misdiagnosis of coccidioidomycosis as bacterial pneumopathy leads to inappropriate prescription of antibiotics and delayed diagnosis. This report describes an outbreak among armadillo hunters in northeastern Brazil in which an initial diagnosis of bacterial pneumonia was later confirmed as coccidioidomycosis caused by Coccidioides posadasii. Thus, this mycosis should be considered as an alternative diagnosis in patients reporting symptoms of pneumonia, even if these symptoms are only presented for a short period, who are from areas considered endemic for this disease.

  17. Coccidioidomycosis in armadillo hunters from the state of Ceará, Brazil

    Directory of Open Access Journals (Sweden)

    Raimunda Sâmia Nogueira Brillhante

    2012-09-01

    Full Text Available Coccidioidomycosis is a systemic mycosis with a variable clinical presentation. Misdiagnosis of coccidioidomycosis as bacterial pneumopathy leads to inappropriate prescription of antibiotics and delayed diagnosis. This report describes an outbreak among armadillo hunters in northeastern Brazil in which an initial diagnosis of bacterial pneumonia was later confirmed as coccidioidomycosis caused by Coccidioides posadasii. Thus, this mycosis should be considered as an alternative diagnosis in patients reporting symptoms of pneumonia, even if these symptoms are only presented for a short period, who are from areas considered endemic for this disease.

  18. Period Determination of Asteroid Targets Observed at Hunters Hill Observatory: May 2009 - September 2010

    Science.gov (United States)

    Higgins, David

    2011-01-01

    Lightcurves for 27 asteroids were obtained at the Hunters Hill Observatory (HHO) from 2009 May through 2010 September: 308 Polyxo, 326 Tamara, 369 Aeria, 504 Cora, 822 Lalage, 1164 Kobolda, 1619 Ueta, 1625 The NORC, 1685 Toro, 2189 Zaragoza, 2287 Kalmykia, 2639 Planman, 3695 Fiaia, 4786 Tatianina, 5333 Kanaya, (5452) 1937 NN, 6170 Levasseur, 7741 Fedoseev, 14815 Rutberg, 15724 Zille, 16525 Shumarinaiko, (21996) 1993 XP31, (29729) 1999 BY1, (35404) 1997 YV5, (39087) 2000 VN50, (66146) 1998 TU3, and (101769) 1999 FF52.

  19. MRI findings in the mild type of mucopolysaccharidosis II (Hunter's syndrome)

    International Nuclear Information System (INIS)

    Shimoda-Matsubayashi, S.; Ito, T.; Hattori, N.; Okuma, Y.; Mizuno, Y.; Kuru, Y.; Sumie, H.

    1990-01-01

    Neuroradiological findings in a 44-year-old male with the typical mild type of Hunter's disease are reported. Cranial MRI revealed patchy areas of increased and decreased signals in T1- and T2-weighted images in the thalamus and the basal ganglia giving rise to a honey comb-like appearance as a whole. The deep white matter showed high signals in the T2-weighted image. To our knowledge, the honey comb-like appearance has never been reported in this disorder. Deposition of mucopolysaccharides and/or glycolipids and increase in fluid content seem to be responsible for these changes. (orig.)

  20. Making a Home in the Taiga: Movements, Paths and Signs among Orochen-Evenki Hunters and Herders of Zabaikal Krai (South East Siberia

    Directory of Open Access Journals (Sweden)

    Donatas Brandišauskas

    2012-06-01

    Full Text Available In this article, I will explore interrelations between place making, movement, use of paths and signs among the Orochen of Zabaikal Krai (Province. Although under the Russian Tsars Orochen-Evenki hunters and herders were referred to negatively as wanderers; today my ethnography demonstrates how movements of animals and humans are crucial for the success of their subsistence, place making and worldview. Hence, walking in the taiga is an important skill that is essential to hunting and herding activities when humans strive to identify animals' 'living places' (Orochen bikit by reading their tracks and movements. Humans also leave their own tracks and paths as well as signs communicating with each other while subsisting in remote areas, in this way creating their own living places. Thereby, I show how movements and the use of paths is an important dimension of Orochen-Evenki wellbeing as well as their moral code.

  1. Hunter Syndrome

    Science.gov (United States)

    ... type and severity of the disease. Complications can affect the lungs, heart, joints, connective tissue, and brain and nervous system. Respiratory complications An enlarged tongue, thickened gums, and ...

  2. Diagnosis of Hunter's syndrome carriers; radioactive sulphate incorporation into fibroblasts in the presence of fructose 1-phosphate

    International Nuclear Information System (INIS)

    Toennesen, T.; Lykkelund, C.; Guettler, F.

    1982-01-01

    Mutual correction of co-cultivated fibroblasts from patients with Hunter's and Hurler's syndrome could be inhibited by either fructose 1-phosphate or mannose 6-phosphate. In the presence of fructose 1-phosphate a 50% mixture of fibroblasts from a patient with Hunter's syndrome and a normal homozygous individual showed an increased 35 S-sulphate incorporation into acid mucopolysaccharides. When fibroblast cultures from one obligate and two possible carriers of Hunter's syndrome were tested for 35 S-sulphate incorporation, the cultures showed either twice the normal 35 S-sulphate incorporation into acid mucopolysaccharides in the presence of fructose 1-phosphate or an abnormally high incorporation in the presence as well as in the absence of the sugar phosphate. (orig.)

  3. Seasonal and Long-term Variations in 137Cs Among Adults from Swedish Hunter Families

    International Nuclear Information System (INIS)

    Agren, G.

    2001-01-01

    To study seasonal variations in 137 Cs, whole-body content measurements of adults from Swedish hunter families have been performed in autumn 1997 and spring 1998. Measurements were performed in three locations, By, Harbo and Gavle, geographically close (within 100 km of each other) but with large differences in ground deposition levels. The hunter families at these three locations were previously measured in 1994. The measured persons were also asked for their frequency of intake of moose, roe-deer, freshwater fish, mushrooms and berries. A statistically significant lower frequency of intake of mushrooms and berries in By, moose, roe-deer and mushrooms in Harbo, and moose in Gavle was found in springtime compared to autumn. In one of the locations, there was a statistically significant lower average 137 Cs whole-body content in spring 1998 than in autumn 1997 while in the other two locations no such effects could be seen. The 137 Cs whole-body content has decreased by 37% from 1994 and to 1998 (including physical decay) correlated to an effective ecological half time of 6 years. (author)

  4. High frequency of lactose intolerance in a prehistoric hunter-gatherer population in northern Europe

    Directory of Open Access Journals (Sweden)

    Holmlund Gunilla

    2010-03-01

    Full Text Available Abstract Background Genes and culture are believed to interact, but it has been difficult to find direct evidence for the process. One candidate example that has been put forward is lactase persistence in adulthood, i.e. the ability to continue digesting the milk sugar lactose after childhood, facilitating the consumption of raw milk. This genetic trait is believed to have evolved within a short time period and to be related with the emergence of sedentary agriculture. Results Here we investigate the frequency of an allele (-13910*T associated with lactase persistence in a Neolithic Scandinavian population. From the 14 individuals originally examined, 10 yielded reliable results. We find that the T allele frequency was very low (5% in this Middle Neolithic hunter-gatherer population, and that the frequency is dramatically different from the extant Swedish population (74%. Conclusions We conclude that this difference in frequency could not have arisen by genetic drift and is either due to selection or, more likely, replacement of hunter-gatherer populations by sedentary agriculturalists.

  5. Preliminary assessment of channel stability and bed-material transport along Hunter Creek, southwestern Oregon

    Science.gov (United States)

    Jones, Krista L.; Wallick, J. Rose; O'Connor, Jim E.; Keith, Mackenzie K.; Mangano, Joseph F.; Risley, John C.

    2011-01-01

    This preliminary assessment of (1) bed-material transport in the Hunter Creek basin, (2) historical changes in channel condition, and (3) supplementary data needed to inform permitting decisions regarding instream gravel extraction revealed the following: Along the lower 12.4 km (kilometers) of Hunter Creek from its confluence with the Little South Fork Hunter Creek to its mouth, the river has confined and unconfined segments and is predominately alluvial in its lowermost 11 km. This 12.4-km stretch of river can be divided into two geomorphically distinct study reaches based primarily on valley physiography. In the Upper Study Reach (river kilometer [RKM] 12.4-6), the active channel comprises a mixed bed of bedrock, boulders, and smaller grains. The stream is confined in the upper 1.4 km of the reach by a bedrock canyon and in the lower 2.4 km by its valley. In the Lower Study Reach (RKM 6-0), where the area of gravel bars historically was largest, the stream flows over bed material that is predominately alluvial sediments. The channel alternates between confined and unconfined segments. The primary human activities that likely have affected bed-material transport and the extent and area of gravel bars are (1) historical and ongoing aggregate extraction from gravel bars in the study area and (2) timber harvest and associated road construction throughout the basin. These anthropogenic activities likely have varying effects on sediment transport and deposition throughout the study area and over time. Although assessing the relative effects of these anthropogenic activities on sediment dynamics would be challenging, the Hunter Creek basin may serve as a case study for such an assessment because it is mostly free of other alterations to hydrologic and geomorphic processes such as flow regulation, dredging, and other navigation improvements that are common in many Oregon coastal basins. Several datasets are available that may support a more detailed physical assessment

  6. How Do Hunter-Gatherer Children Learn Subsistence Skills? : A Meta-Ethnographic Review.

    Science.gov (United States)

    Lew-Levy, Sheina; Reckin, Rachel; Lavi, Noa; Cristóbal-Azkarate, Jurgi; Ellis-Davies, Kate

    2017-12-01

    Hunting and gathering is, evolutionarily, the defining subsistence strategy of our species. Studying how children learn foraging skills can, therefore, provide us with key data to test theories about the evolution of human life history, cognition, and social behavior. Modern foragers, with their vast cultural and environmental diversity, have mostly been studied individually. However, cross-cultural studies allow us to extrapolate forager-wide trends in how, when, and from whom hunter-gatherer children learn their subsistence skills. We perform a meta-ethnography, which allows us to systematically extract, summarize, and compare both quantitative and qualitative literature. We found 58 publications focusing on learning subsistence skills. Learning begins early in infancy, when parents take children on foraging expeditions and give them toy versions of tools. In early and middle childhood, children transition into the multi-age playgroup, where they learn skills through play, observation, and participation. By the end of middle childhood, most children are proficient food collectors. However, it is not until adolescence that adults (not necessarily parents) begin directly teaching children complex skills such as hunting and complex tool manufacture. Adolescents seek to learn innovations from adults, but they themselves do not innovate. These findings support predictive models that find social learning should occur before individual learning. Furthermore, these results show that teaching does indeed exist in hunter-gatherer societies. And, finally, though children are competent foragers by late childhood, learning to extract more complex resources, such as hunting large game, takes a lifetime.

  7. The coexistence of Baird's tapir (Tapirus bairdii) and indigenous hunters in northeastern Honduras.

    Science.gov (United States)

    Dunn, Marc; Estrada, Nereyda; Smith, Derek A

    2012-12-01

    The Baird's tapir (Tapirus bairdii) is a popular game species throughout Central America, particularly among indigenous populations, and is currently endangered. Research on Miskitu hunting was conducted over 4 months in a remote region in northeastern Honduras that overlaps with the Río Plátano Biosphere Reserve. The hunting zone was mapped together with hunters and interviews were conducted with elders and other community members about tapir hunting. Results show that tapir harvesting is targeted toward specific habitats at specific times of year. Harvest rates for one year suggest that tapir hunting in the area exceeds estimates of maximum sustainable production. Nevertheless, field surveys reveal the presence of tapir within 1 km of the community, and its harvest tends to be nearby, in both forested and agricultural landscapes, suggesting that the animal has not been depleted in the area. It appears that the existence of forest areas adjacent to the hunting zone that do not experience hunting, together with the anthropogenic habitats created through shifting cultivation, are factors that help explain the presence of tapirs in the area. The article concludes with a discussion regarding the potential positive role of indigenous hunters in tapir conservation throughout its distribution range. © 2012 Wiley Publishing Asia Pty Ltd, ISZS and IOZ/CAS.

  8. Firewood, food and human niche construction: the potential role of Mesolithic hunter-gatherers in actively structuring Scotland's woodlands

    Science.gov (United States)

    Bishop, Rosie R.; Church, Mike J.; Rowley-Conwy, Peter A.

    2015-01-01

    Over the past few decades the potential role of Mesolithic hunter-gatherers in actively constructing their own niches, through the management of wild plants, has frequently been discussed. It is probable that Mesolithic hunter-gatherers systematically exploited specific woodland resources for food and fuel and influenced the 'natural' abundance or distribution of particular species within Mesolithic environments. Though there has been considerable discussion of the pollen evidence for potential small-scale human-woodland manipulation in Mesolithic Scotland, the archaeobotanical evidence for anthropogenic firewood and food selection has not been discussed in this context. This paper assesses the evidence for the active role of Mesolithic hunter-gatherer communities in systematically exploiting and managing woodlands for food and fuel in Scotland. While taphonomic factors may have impacted on the frequency of specific species in archaeobotanical assemblages, it is suggested that hunter-gatherers in Mesolithic Scotland were systematically using woodland plants, and in particular hazel and oak, for food and fuel. It is argued that the pollen evidence for woodland management is equivocal, but hints at the role of hunter-gatherers in shaping the structure of their environments, through the maintenance or creation of woodland clearings for settlement or as part of vegetation management strategies. It is proposed that Mesolithic hunter-gatherers may have actively contributed to niche construction and that the systematic use of hazel and oak as a fuel may reflect the deliberate pruning of hazel trees to increase nut-yields and the inadvertent - or perhaps deliberate - coppicing of hazel and oak during greenwood collection.

  9. Beyond the drip-line: a high-resolution open-air Holocene hunter-gatherer sequence from highland Lesotho

    CSIR Research Space (South Africa)

    Mitchell, P

    2011-03-01

    Full Text Available the drip-line: a high-resolution open-air Holocene hunter-gatherer sequence from highland Lesotho Peter Mitchell1, Ina Plug2, Geoff Bailey3, Ruth Charles4, Amanda Esterhuysen5, Julia Lee Thorp6, Adrian Parker7 & Stephan Woodborne8 The activities...

  10. The Catalyst Scholarship Program at Hunter College. A Partnership among Earth Science, Physics, Computer Science and Mathematics

    Science.gov (United States)

    Salmun, Haydee; Buonaiuto, Frank

    2016-01-01

    The Catalyst Scholarship Program at Hunter College of The City University of New York (CUNY) was established with a four-year award from the National Science Foundation (NSF) to fund scholarships to 40 academically talented but financially disadvantaged students majoring in four disciplines of science, technology, engineering and mathematics…

  11. Effect of different doses of aerobic exercise on total white blood cell (WBC and WBC subfraction number in postmenopausal women: results from DREW.

    Directory of Open Access Journals (Sweden)

    Neil M Johannsen

    Full Text Available BACKGROUND: Elevated total white blood cell (WBC count is associated with an increased risk of coronary heart disease and death. Aerobic exercise is associated with lower total WBC, neutrophil, and monocyte counts. However, no studies have evaluated the effect of the amount of aerobic exercise (dose on total WBC and WBC subfraction counts. PURPOSE: To examine the effects of 3 different doses of aerobic exercise on changes in total WBC and WBC subfraction counts and independent effects of changes in fitness, adiposity, markers of inflammation (IL-6, TNF-α, C-reactive protein, fasting glucose metabolism, and adiponectin. METHODS: Data from 390 sedentary, overweight/obese postmenopausal women from the DREW study were used in these analyses. Women were randomized to a non-exercise control group or one of 3 exercise groups: energy expenditure of 4, 8, or 12 kcal kg(-1⋅week(-1 (KKW for 6 months at an intensity of 50% VO2peak. RESULTS: A dose-dependent decrease in total WBC counts (trend P = 0.002 was observed with a significant decrease in the 12KKW group (-163.1±140.0 cells/µL; mean±95%CI compared with the control (138.6±144.7 cells/µL. A similar response was seen in the neutrophil subfraction (trend P = 0.001 with a significant decrease in the 12KKW group (-152.6±115.1 cells/µL compared with both the control and 4KKW groups (96.4±119.0 and 21.9±95.3 cells/µL, respectively and in the 8KKW group (-102.4±125.0 cells/µL compared with the control. When divided into high/low baseline WBC categories (median split, a dose-dependent decrease in both total WBCs (P = 0.003 and neutrophils (P<0.001 was observed in women with high baseline WBC counts. The effects of exercise dose on total WBC and neutrophil counts persisted after accounting for significant independent effects of change in waist circumference and IL-6. CONCLUSION: Aerobic exercise training reduces total WBC and neutrophil counts, in a dose-dependent manner, in

  12. Statistical Validation of Calibrated Wind Data Collected From NOAA's Hurricane Hunter Aircraft

    Science.gov (United States)

    Graham, K.; Sears, I. T.; Holmes, M.; Henning, R. G.; Damiano, A. B.; Parrish, J. R.; Flaherty, P. T.

    2015-12-01

    Obtaining accurate in situ meteorological measurements from the NOAA G-IV Hurricane Hunter Aircraft currently requires annual wind calibration flights. This project attempts to demonstrate whether an alternate method to wind calibration flights can be implemented using data collected from many previous hurricane, winter storm, and surveying flights. Wind derivations require using airplane attack and slip angles, airplane pitch, pressure differentials, dynamic pressures, ground speeds, true air speeds, and several other variables measured by instruments on the aircraft. Through the use of linear regression models, future wind measurements may be fit to past statistical models. This method of wind calibration could replace the need for annual wind calibration flights, decreasing NOAA expenses and providing more accurate data. This would help to ensure all data users have reliable data and ultimately contribute to NOAA's goal of building of a Weather Ready Nation.

  13. Origin of HTLV-1 in hunters of nonhuman primates in Central Africa.

    Science.gov (United States)

    Kazanji, Mirdad; Mouinga-Ondémé, Augustin; Lekana-Douki-Etenna, Sonia; Caron, Mélanie; Makuwa, Maria; Mahieux, Renaud; Gessain, Antoine

    2015-02-01

    Of 78 Gabonese individuals who had received bites from nonhuman primates (NHPs) while hunting, 7 were infected with human T lymphotropic virus (HTLV-1). Five had been bitten by gorillas and were infected with subtype B strains; however, a 12-year-old girl who was severely bitten by a Cercopithecus nictitans was infected with a subtype D strain that was closely related to the simian T lymphotropic virus (STLV-1) that infects this monkey species. Her mother was infected with a subtype B strain. These data confirm that hunters in Africa can be infected by HTLV-1 that is closely related to the strains circulating among local NHP game. Our findings strongly suggest that a severe bite represent a risk factor for STLV-1 acquisition. © The Author 2014. Published by Oxford University Press on behalf of the Infectious Diseases Society of America. All rights reserved. For Permissions, please e-mail: journals.permissions@oup.com.

  14. Results of the radiological survey at West Hunter Avenue Firehall, Maywood, New Jersey (MJ027)

    International Nuclear Information System (INIS)

    Foley, R.D.; Floyd, L.M.

    1990-03-01

    Maywood Chemical Works (MCW) of Maywood, New Jersey, generated process wastes and residues associated with the production and refining of thorium and thorium compounds from monazite ores from 1916 to 1956. At the request of the US Department of Energy (DOE), a group from Oak Ridge National Laboratory conducts investigative radiological surveys of properties in the vicinity of MCW to determine whether a property is contaminated with radioactive residues, principally 232 Th, derived from the MCW site. The survey typically includes direct measurement of gamma radiation levels and soil sampling for radionuclide analyses. The survey of this site, West Hunter Avenue Firehall, Maywood, New Jersey (MJ027), was conducted during 1987. 4 refs., 3 tabs

  15. Una valigia caduta in mare: Jaume Serra Hunter e la "Scuola di Barcellona"

    Directory of Open Access Journals (Sweden)

    Nazzareno Fioraso

    2014-12-01

    Full Text Available Nella storiografia filosofica spagnola non esiste, probabilmente, una definizione ambigua e problematica come quella che riguarda la cosiddetta "Scuola di Barcellona". La tesi principale di questo articolo è che tale scuola non giunse mai a nascere, ma ne esistette soltanto una forma embrionale che non poté maturare perché, in conseguenza della situazione politica venutasi a creare con la guerra civile (1936-1939, i suoi componenti si dispersero nell'esilio. Ciò nonostante, è possibile riconoscere alcuni tratti comuni, seppur labili e (forse non sostanziali, nella diaspora degli intellettuali catalani che rendono possibile definirla, con le dovute cautele, "Scuola di Barcellona". Tali caratteristiche comuni si possono far risalire a colui che, in un certo senso, fu il fondatore della scuola, essendo il principale maestro delle nuove leve filosofiche della Catalogna all'inizio del XX secolo: Jaume Serra Hunter.

  16. General medicine advanced training: lessons from the John Hunter training programme.

    Science.gov (United States)

    Jackel, D; Attia, J; Pickles, R

    2014-03-01

    Recent years have seen a rapid growth in the number of advanced trainees pursuing general medicine as a specialty. This reflects an awareness of the need for broader training experiences to equip future consultant physicians with the skills to manage the healthcare challenges arising from the demographic trends of ageing and increasing comorbidity. The John Hunter Hospital training programme in general medicine has several characteristics that have led to the success in producing general physicians prepared for these challenges. These include support from a core group of committed general physicians, an appropriate and sustainable funding model, flexibility with a focus on genuine training and developing awareness of a systems approach, and strong links with rural practice. © 2014 The Authors; Internal Medicine Journal © 2014 Royal Australasian College of Physicians.

  17. Did warfare among ancestral hunter-gatherers affect the evolution of human social behaviors?

    Science.gov (United States)

    Bowles, Samuel

    2009-06-05

    Since Darwin, intergroup hostilities have figured prominently in explanations of the evolution of human social behavior. Yet whether ancestral humans were largely "peaceful" or "warlike" remains controversial. I ask a more precise question: If more cooperative groups were more likely to prevail in conflicts with other groups, was the level of intergroup violence sufficient to influence the evolution of human social behavior? Using a model of the evolutionary impact of between-group competition and a new data set that combines archaeological evidence on causes of death during the Late Pleistocene and early Holocene with ethnographic and historical reports on hunter-gatherer populations, I find that the estimated level of mortality in intergroup conflicts would have had substantial effects, allowing the proliferation of group-beneficial behaviors that were quite costly to the individual altruist.

  18. Genomic insights into the origin and diversification of late maritime hunter-gatherers from the Chilean Patagonia.

    Science.gov (United States)

    de la Fuente, Constanza; Ávila-Arcos, María C; Galimany, Jacqueline; Carpenter, Meredith L; Homburger, Julian R; Blanco, Alejandro; Contreras, Paloma; Cruz Dávalos, Diana; Reyes, Omar; San Roman, Manuel; Moreno-Estrada, Andrés; Campos, Paula F; Eng, Celeste; Huntsman, Scott; Burchard, Esteban G; Malaspinas, Anna-Sapfo; Bustamante, Carlos D; Willerslev, Eske; Llop, Elena; Verdugo, Ricardo A; Moraga, Mauricio

    2018-04-24

    Patagonia was the last region of the Americas reached by humans who entered the continent from Siberia ∼15,000-20,000 y ago. Despite recent genomic approaches to reconstruct the continental evolutionary history, regional characterization of ancient and modern genomes remains understudied. Exploring the genomic diversity within Patagonia is not just a valuable strategy to gain a better understanding of the history and diversification of human populations in the southernmost tip of the Americas, but it would also improve the representation of Native American diversity in global databases of human variation. Here, we present genome data from four modern populations from Central Southern Chile and Patagonia ( n = 61) and four ancient maritime individuals from Patagonia (∼1,000 y old). Both the modern and ancient individuals studied in this work have a greater genetic affinity with other modern Native Americans than to any non-American population, showing within South America a clear structure between major geographical regions. Native Patagonian Kawéskar and Yámana showed the highest genetic affinity with the ancient individuals, indicating genetic continuity in the region during the past 1,000 y before present, together with an important agreement between the ethnic affiliation and historical distribution of both groups. Lastly, the ancient maritime individuals were genetically equidistant to a ∼200-y-old terrestrial hunter-gatherer from Tierra del Fuego, which supports a model with an initial separation of a common ancestral group to both maritime populations from a terrestrial population, with a later diversification of the maritime groups.

  19. Measured elemental transfer factors for boreal hunter/gatherer scenarios: fish, game and berries

    International Nuclear Information System (INIS)

    Sheppard, S.C.; Long, J.M.; Sanipelli, B.

    2010-01-01

    The environmental assessment of long-term nuclear waste management requires data to estimate food chain transfers for radionuclides in various environmental settings. For key elements such as iodine (I) and chlorine (Cl), there is a paucity of transfer factor data, particularly outside of agricultural food chains. This study dealt with transfers of I, Cl and 28 other elements to foods that would be typical of boreal hunter/gatherer lifestyles, as well as being common foods for modern recreational and subsistence hunters. Food/substrate concentration ratios (CRs) and related transfer factors for eight species of widely distributed fish, whitetail deer (Odocoileus virginianus), Canada geese (Branta canadensis) and wild blueberries (Vaccinium myrtilloides) were measured and compared to the literature. Limited data were obtained for caribou (Rangifer tarandus), elk (Cervus elaphus) and moose (Alces americanus). Freshwater sediment Kd values and CRs for a ubiquitous freshwater macrophyte were also obtained. The CRs for I in fish were 29 L kg -1 in edible muscle (fillets) of large-bodied species and 85 L kg -1 for whole, small-bodied fish. The log CRs for fish and macrophytes were correlated across elements. For several elements, the Kds for sediments in deep water were ∼4-fold higher than for littoral samples. The elemental transfers to wild animals for some elements were notably different than the literature indicates for domestic animals. It is argued that the transfer data obtained using indigenous elements from real environmental settings, as opposed to contaminant elements in experimental or impacted environments, are especially relevant to assessment of long-term impacts.

  20. Measured elemental transfer factors for boreal hunter/gatherer scenarios: fish, game and berries

    Energy Technology Data Exchange (ETDEWEB)

    Sheppard, S.C., E-mail: sheppards@ecomatters.co [ECOMatters Inc., WB Lewis Business Centre, 24 Aberdeen Avenue, Pinawa, Manitoba R0E 1L0 (Canada); Long, J.M.; Sanipelli, B. [ECOMatters Inc., WB Lewis Business Centre, 24 Aberdeen Avenue, Pinawa, Manitoba R0E 1L0 (Canada)

    2010-11-15

    The environmental assessment of long-term nuclear waste management requires data to estimate food chain transfers for radionuclides in various environmental settings. For key elements such as iodine (I) and chlorine (Cl), there is a paucity of transfer factor data, particularly outside of agricultural food chains. This study dealt with transfers of I, Cl and 28 other elements to foods that would be typical of boreal hunter/gatherer lifestyles, as well as being common foods for modern recreational and subsistence hunters. Food/substrate concentration ratios (CRs) and related transfer factors for eight species of widely distributed fish, whitetail deer (Odocoileus virginianus), Canada geese (Branta canadensis) and wild blueberries (Vaccinium myrtilloides) were measured and compared to the literature. Limited data were obtained for caribou (Rangifer tarandus), elk (Cervus elaphus) and moose (Alces americanus). Freshwater sediment Kd values and CRs for a ubiquitous freshwater macrophyte were also obtained. The CRs for I in fish were 29 L kg{sup -1} in edible muscle (fillets) of large-bodied species and 85 L kg{sup -1} for whole, small-bodied fish. The log CRs for fish and macrophytes were correlated across elements. For several elements, the Kds for sediments in deep water were {approx}4-fold higher than for littoral samples. The elemental transfers to wild animals for some elements were notably different than the literature indicates for domestic animals. It is argued that the transfer data obtained using indigenous elements from real environmental settings, as opposed to contaminant elements in experimental or impacted environments, are especially relevant to assessment of long-term impacts.

  1. A família Drew de Walworth: um século após a avaliação inicial finalmente o diagnóstico doença de Machado-Joseph The Drew family of Walworth: one century from the first evaluation until the final diagnosis, Machado-Joseph disease

    Directory of Open Access Journals (Sweden)

    Hélio A. Ghizoni Teive

    2004-03-01

    Full Text Available As enfermidades heredo-degenerativas, entre elas as ataxias cerebelares autossômicas dominantes, agora conhecidas como ataxias espinocerebelares (AEC, correspondem a extenso grupo de s com grande heterogeneidade genética. Algumas formas de AEC, em especial a de Machado-Joseph (DMJ, caracteriza-se por acentuada variabilidade de expressão fenotípica intra e inter-familial. Em 1895, na Grã-Bretanha, foi descrita uma família com uma forma autossômica dominante de AEC que viria a ser conhecida como a família Drew de Walworth. Desde sua descrição inicial até 1995, quando do diagnóstico genético final de DMJ, vários membros e gerações desta família foram examinados e seus achados descritos na literatura por famosos neurologistas como Gowers, Stewart, Collier, Kinnier-Wilson, Turner, Worster-Drought, Ferguson, Critchley e Anita Harding. Neste artigo, os autores descrevem a trajetória histórica tortuosa e as discussões sobre os diagnósticos nosológicos propostos no decorrer de um século, com o propósito de mostrar a impressionante e atraente complexidade que envolve este grupo de s neurodegenerativas.Autosomal dominant spinocerebellar ataxia (SCA is an heterogeneous group of neurodegenerative diseases involving cerebellum and its connections. Several forms have already been described, and it seems the most common form of SCA observed among the many series of families described worldwide is SCA3 (Machado-Joseph disease. SCA3 is characterized by a marked phenotypic expression with a wide spectrum of clinical findings including cerebellar ataxia, pyramidal and extrapyramidal (e.g. dystonia, parkinsonism, lower motor neuron syndrome and peripheral neuropathy. The Drew family of Walworth, England, has several affected members seen and described by famous neurologists including Gowers, Stewart, Collier, Kinnier-Wilson, Turner, Worster-Drought, Ferguson, Critchley, and Anita Harding from 1895 to our days. In fact, the final genetic

  2. Hide Tanning and Its Use in Taiga: The Case of the Orochen-Evenki Reindeer Herders and Hunters of Zabaikalye (East Siberia)

    OpenAIRE

    Donatas Brandišauskas

    2010-01-01

    This article documents the way in which the Orochen-Evenki hunters and herders in northern part of Zabaikalye tan hides and produce gear in the post-Soviet era. Here, I wish to present the argument that it is difficult to understand the reviving of hide tanning in remote villages and the taiga without understanding how hunters and herders in this region adapt to the unstable post-Soviet environment. I suggest that hunters and herders aim to maintain their autonomy from goods and resources imp...

  3. Macrophysical climate models and Holocene hunter-gatherer subsistence shifts in Central Texas, USA

    Science.gov (United States)

    Mauldin, R. P.; Munoz, C.

    2013-12-01

    We use stable carbon isotopic values from bone collagen, as well as carbon values from carbonate extracted from bone apatite from 69 prehistoric human skeletal samples to investigate past resource use and climate relationships over the Middle and Late Holocene in Central Texas. Bone samples come from seven archaeological sites and samples date from 6,900 BP to the close of the prehistoric sequence at about 350 BP. Carbon isotopes from these samples suggest four broad dietary trends. From 6,900 through about 3,800 BP, carbon isotopes suggest a gradual increase in the consumption of resources that ultimately use a C3 photosynthetic pathway. A decline in δ13C in both collagen and carbonate values follows, suggesting a decrease in C3 resource use through roughly 2,900 BP. A variable, but once again increasing pattern on C3 resource use by prehistoric hunter-gatherers is indicated in bone isotopes through about 1,000 BP. After that date, a decrease in C3 resource dependence, with hints at greater subsistence diversity, is suggested through the close of the sequence at 350 BP. To assess the impact of climate shifts on this isotopic pattern, we developed a series of macrophysical climate models (MCM) for several locations in Central Texas focusing on fall, winter, and early spring precipitation. This fall-spring rainfall should closely determine C3 production. If subsistence shifts are responding to climate-induced changes in resource availability, then the measured hunter-gatherer carbon isotope trends summarized above should pattern with C3 production as monitored by the modeled fall-spring precipitation values. For the Middle Holocene portion of the sequence, the precipitation models suggest increasing C3 production, consistent with increasing C3 dependence shown in the isotopic data. A decline in C3 production between 3,900 and 3,000 BP in the models is also consistent with the isotopic decline at that point. After 3,000 BP, however, the coupling between fall

  4. From Head-hunter to Organ-thief: Verisimilitude, Doubt and Plausible Worlds in Indonesia and Beyond

    DEFF Research Database (Denmark)

    Bubandt, Nils Ole

    2017-01-01

    their victims and using the human heads in construction rituals as they used to do, head-hunters are now allegedly harvesting the victims’ organs for sale on the international organ market. Based on a comparison of ethnographic material from North Maluku, a province in the eastern part of Indonesia, and news...... reports I trace the shift from head-hunting to organ theft and suggest that this plasticity is not merely a symbolic representation of changing political and economic realities. Rather, I argue, the organ-stealing head-hunters are part of a global travelling package that includes and entangles organ...... trafficking practices, media accounts, political imaginaries, and social anxieties within the same field of reality and possibility, a field of verisimilitude in which fiction and fact, rumour and reality, are fundamentally blurred. The article proposes a ‘more-than-representational’ approach to the organ...

  5. AllerHunter: a SVM-pairwise system for assessment of allergenicity and allergic cross-reactivity in proteins.

    Directory of Open Access Journals (Sweden)

    Hon Cheng Muh

    Full Text Available Allergy is a major health problem in industrialized countries. The number of transgenic food crops is growing rapidly creating the need for allergenicity assessment before they are introduced into human food chain. While existing bioinformatic methods have achieved good accuracies for highly conserved sequences, the discrimination of allergens and non-allergens from allergen-like non-allergen sequences remains difficult. We describe AllerHunter, a web-based computational system for the assessment of potential allergenicity and allergic cross-reactivity in proteins. It combines an iterative pairwise sequence similarity encoding scheme with SVM as the discriminating engine. The pairwise vectorization framework allows the system to model essential features in allergens that are involved in cross-reactivity, but not limited to distinct sets of physicochemical properties. The system was rigorously trained and tested using 1,356 known allergen and 13,449 putative non-allergen sequences. Extensive testing was performed for validation of the prediction models. The system is effective for distinguishing allergens and non-allergens from allergen-like non-allergen sequences. Testing results showed that AllerHunter, with a sensitivity of 83.4% and specificity of 96.4% (accuracy = 95.3%, area under the receiver operating characteristic curve AROC = 0.928+/-0.004 and Matthew's correlation coefficient MCC = 0.738, performs significantly better than a number of existing methods using an independent dataset of 1443 protein sequences. AllerHunter is available at (http://tiger.dbs.nus.edu.sg/AllerHunter.

  6. Inferring the demographic history of African farmers and pygmy hunter-gatherers using a multilocus resequencing data set.

    Directory of Open Access Journals (Sweden)

    Etienne Patin

    2009-04-01

    Full Text Available The transition from hunting and gathering to farming involved a major cultural innovation that has spread rapidly over most of the globe in the last ten millennia. In sub-Saharan Africa, hunter-gatherers have begun to shift toward an agriculture-based lifestyle over the last 5,000 years. Only a few populations still base their mode of subsistence on hunting and gathering. The Pygmies are considered to be the largest group of mobile hunter-gatherers of Africa. They dwell in equatorial rainforests and are characterized by their short mean stature. However, little is known about the chronology of the demographic events-size changes, population splits, and gene flow--ultimately giving rise to contemporary Pygmy (Western and Eastern groups and neighboring agricultural populations. We studied the branching history of Pygmy hunter-gatherers and agricultural populations from Africa and estimated separation times and gene flow between these populations. We resequenced 24 independent noncoding regions across the genome, corresponding to a total of approximately 33 kb per individual, in 236 samples from seven Pygmy and five agricultural populations dispersed over the African continent. We used simulation-based inference to identify the historical model best fitting our data. The model identified included the early divergence of the ancestors of Pygmy hunter-gatherers and farming populations approximately 60,000 years ago, followed by a split of the Pygmies' ancestors into the Western and Eastern Pygmy groups approximately 20,000 years ago. Our findings increase knowledge of the history of the peopling of the African continent in a region lacking archaeological data. An appreciation of the demographic and adaptive history of African populations with different modes of subsistence should improve our understanding of the influence of human lifestyles on genome diversity.

  7. Origin and diet of the prehistoric hunter-gatherers on the mediterranean island of Favignana (Ègadi Islands, Sicily.

    Directory of Open Access Journals (Sweden)

    Marcello A Mannino

    Full Text Available Hunter-gatherers living in Europe during the transition from the late Pleistocene to the Holocene intensified food acquisition by broadening the range of resources exploited to include marine taxa. However, little is known on the nature of this dietary change in the Mediterranean Basin. A key area to investigate this issue is the archipelago of the Ègadi Islands, most of which were connected to Sicily until the early Holocene. The site of Grotta d'Oriente, on the present-day island of Favignana, was occupied by hunter-gatherers when Postglacial environmental changes were taking place (14,000-7,500 cal BP. Here we present the results of AMS radiocarbon dating, palaeogenetic and isotopic analyses undertaken on skeletal remains of the humans buried at Grotta d'Oriente. Analyses of the mitochondrial hypervariable first region of individual Oriente B, which belongs to the HV-1 haplogroup, suggest for the first time on genetic grounds that humans living in Sicily during the early Holocene could have originated from groups that migrated from the Italian Peninsula around the Last Glacial Maximum. Carbon and nitrogen isotope analyses show that the Upper Palaeolithic and Mesolithic hunter-gatherers of Favignana consumed almost exclusively protein from terrestrial game and that there was only a slight increase in marine food consumption from the late Pleistocene to the early Holocene. This dietary change was similar in scale to that at sites on mainland Sicily and in the rest of the Mediterranean, suggesting that the hunter-gatherers of Grotta d'Oriente did not modify their subsistence strategies specifically to adapt to the progressive isolation of Favignana. The limited development of technologies for intensively exploiting marine resources was probably a consequence both of Mediterranean oligotrophy and of the small effective population size of these increasingly isolated human groups, which made innovation less likely and prevented transmission of

  8. Origin and Diet of the Prehistoric Hunter-Gatherers on the Mediterranean Island of Favignana (Ègadi Islands, Sicily)

    Science.gov (United States)

    Mannino, Marcello A.; Catalano, Giulio; Talamo, Sahra; Mannino, Giovanni; Di Salvo, Rosaria; Schimmenti, Vittoria; Lalueza-Fox, Carles; Messina, Andrea; Petruso, Daria; Caramelli, David; Richards, Michael P.; Sineo, Luca

    2012-01-01

    Hunter-gatherers living in Europe during the transition from the late Pleistocene to the Holocene intensified food acquisition by broadening the range of resources exploited to include marine taxa. However, little is known on the nature of this dietary change in the Mediterranean Basin. A key area to investigate this issue is the archipelago of the Ègadi Islands, most of which were connected to Sicily until the early Holocene. The site of Grotta d’Oriente, on the present-day island of Favignana, was occupied by hunter-gatherers when Postglacial environmental changes were taking place (14,000-7,500 cal BP). Here we present the results of AMS radiocarbon dating, palaeogenetic and isotopic analyses undertaken on skeletal remains of the humans buried at Grotta d’Oriente. Analyses of the mitochondrial hypervariable first region of individual Oriente B, which belongs to the HV-1 haplogroup, suggest for the first time on genetic grounds that humans living in Sicily during the early Holocene could have originated from groups that migrated from the Italian Peninsula around the Last Glacial Maximum. Carbon and nitrogen isotope analyses show that the Upper Palaeolithic and Mesolithic hunter-gatherers of Favignana consumed almost exclusively protein from terrestrial game and that there was only a slight increase in marine food consumption from the late Pleistocene to the early Holocene. This dietary change was similar in scale to that at sites on mainland Sicily and in the rest of the Mediterranean, suggesting that the hunter-gatherers of Grotta d’Oriente did not modify their subsistence strategies specifically to adapt to the progressive isolation of Favignana. The limited development of technologies for intensively exploiting marine resources was probably a consequence both of Mediterranean oligotrophy and of the small effective population size of these increasingly isolated human groups, which made innovation less likely and prevented transmission of fitness

  9. Vessel guardians: sculpture and graphics related to the ceramics of NorthEastern European hunter-gatherers

    Directory of Open Access Journals (Sweden)

    Ekaterina Aleksandrovna Kashina

    2015-12-01

    Full Text Available North-Eastern European hunter-gatherer ceramic sculptures, relief sculptures and graphic images on vessels are discussed. Five groups of finds are distinguished according to their chronology (4000–2500 BC cal and represented subject (birds, human head, human figure, mammal head etc.. Their production believes to be a female craft, their making had ritual aims and their emerging was independent from any influences of pastoral/agricultural societies.

  10. Assessment of risk to aquatic biota from elevated salinity -- a case study from the Hunter River, Australia.

    Science.gov (United States)

    Muschal, Monika

    2006-05-01

    An ecological risk assessment was performed on salinity levels of the Hunter River and its tributaries to respond to concerns that high salinity may be damaging aquatic ecosystems. Probabilistic techniques were used to assess likelihood and consequence, and hence the risk to aquatic biota from salinity. Continuous electrical conductivity distributions were used to describe the likelihood that high salinity would occur (exposure dataset) and toxicity values were compiled from the limited literature sources available to describe the consequence of high salinity (effects dataset). The assessment was preliminary in the sense that it modelled risk on the basis of existing data and did not undertake site-specific toxicity testing. Some sections of the Hunter River catchment have geologies that are saline because of their marine origins. Catchment development has increased the liberation rates of salts into surface-waters. Such modifying activities include coal-mining, power generation and land clearing. The aquatic biota of tributaries had a greater risk of impairment from high salinity than that of the Hunter River. High salinities in the tributaries were attributed to the combined factors of naturally saline geologies, increased liberation of salts due to modification of the landscape, and reduced dilution by flushing flows. A salinity guideline trigger value of 1100 mg L(-1) was recommended.

  11. Surface evolution and carbon sequestration in disturbed and undisturbed wetland soils of the Hunter estuary, southeast Australia

    Science.gov (United States)

    Howe, A. J.; Rodríguez, J. F.; Saco, P. M.

    2009-08-01

    The aim of this work was to quantify the soil carbon storage and sequestration rates of undisturbed natural wetlands and disturbed wetlands subject to restriction of tidal flow and subsequent rehabilitation in an Australian estuary. Disturbed and undisturbed estuarine wetlands of the Hunter estuary, New South Wales, Australia were selected as the study sites for this research. Vertical accretion rates of estuarine substrates were combined with soil carbon concentrations and bulk densities to determine the carbon store and carbon sequestration rates of the substrates tested. Relationships between estuary water level, soil evolution and vertical accretion were also examined. The carbon sequestration rate of undisturbed wetlands was lower (15% for mangrove and 55% for saltmarsh) than disturbed wetlands, but the carbon store was higher (65% for mangrove and 60% for saltmarsh). The increased carbon sequestration rate of the disturbed wetlands was driven by substantially higher rates of vertical accretion (95% for mangrove and 345% for saltmarsh). Estuarine wetland carbon stores were estimated at 700-1000 Gg C for the Hunter estuary and 3900-5600 Gg C for New South Wales. Vertical accretion and carbon sequestration rates of estuarine wetlands in the Hunter are at the lower end of the range reported in the literature. The comparatively high carbon sequestration rates reported for the disturbed wetlands in this study indicate that wetland rehabilitation has positive benefits for regulation of atmospheric carbon concentrations, in addition to more broadly accepted ecosystem services.

  12. Robert Plant (1818–1858: A Victorian plant hunter in Natal, Zululand, Mauritius and the Seychelles

    Directory of Open Access Journals (Sweden)

    Donal P. McCracken

    2011-03-01

    Full Text Available In the 1850s Robert William Plant collected plants and other natural specimens in what is now KwaZulu-Natal. This one-time Englishman compiled a dictionary for gardeners before emigrating to Natal in 1850. There he worked as the agent for Samuel Stevens, the London dealer in ‘curiosities of natural history’. Though Plant collected mainly plants, he also sent consignments of beetles, butterflies, bird skins and shells back to Britain. He published the first scientific paper on Zululand and was requested by the Royal Botanic Gardens at Kew to write the first Flora natalensis. It was while collecting for this never-to-be-completed treatise that Plant contracted malaria in Maputaland. He died in St Lucia in 1858 and in doing so became South Africa’s martyr to botany. What emerges from this study is a picture of the difficulties faced by plant hunters in mid-19th-century South Africa, the sort of plants they collected and the necessity for them sometimes to diversify into other natural history products to survive.

  13. Schooling, Local Knowledge and Working Memory: A Study among Three Contemporary Hunter-Gatherer Societies.

    Science.gov (United States)

    Reyes-García, Victoria; Pyhälä, Aili; Díaz-Reviriego, Isabel; Duda, Romain; Fernández-Llamazares, Álvaro; Gallois, Sandrine; Guèze, Maximilien; Napitupulu, Lucentezza

    2016-01-01

    Researchers have analysed whether school and local knowledge complement or substitute each other, but have paid less attention to whether those two learning models use different cognitive strategies. In this study, we use data collected among three contemporary hunter-gatherer societies with relatively low levels of exposure to schooling yet with high levels of local ecological knowledge to test the association between i) schooling and ii) local ecological knowledge and verbal working memory. Participants include 94 people (24 Baka, 25 Punan, and 45 Tsimane') from whom we collected information on 1) schooling and school related skills (i.e., literacy and numeracy), 2) local knowledge and skills related to hunting and medicinal plants, and 3) working memory. To assess working memory, we applied a multi-trial free recall using words relevant to each cultural setting. People with and without schooling have similar levels of accurate and inaccurate recall, although they differ in their strategies to organize recall: people with schooling have higher results for serial clustering, suggesting better learning with repetition, whereas people without schooling have higher results for semantic clustering, suggesting they organize recall around semantically meaningful categories. Individual levels of local ecological knowledge are not related to accurate recall or organization recall, arguably due to overall high levels of local ecological knowledge. While schooling seems to favour some organization strategies this might come at the expense of some other organization strategies.

  14. Schooling, Local Knowledge and Working Memory: A Study among Three Contemporary Hunter-Gatherer Societies.

    Directory of Open Access Journals (Sweden)

    Victoria Reyes-García

    Full Text Available Researchers have analysed whether school and local knowledge complement or substitute each other, but have paid less attention to whether those two learning models use different cognitive strategies. In this study, we use data collected among three contemporary hunter-gatherer societies with relatively low levels of exposure to schooling yet with high levels of local ecological knowledge to test the association between i schooling and ii local ecological knowledge and verbal working memory. Participants include 94 people (24 Baka, 25 Punan, and 45 Tsimane' from whom we collected information on 1 schooling and school related skills (i.e., literacy and numeracy, 2 local knowledge and skills related to hunting and medicinal plants, and 3 working memory. To assess working memory, we applied a multi-trial free recall using words relevant to each cultural setting. People with and without schooling have similar levels of accurate and inaccurate recall, although they differ in their strategies to organize recall: people with schooling have higher results for serial clustering, suggesting better learning with repetition, whereas people without schooling have higher results for semantic clustering, suggesting they organize recall around semantically meaningful categories. Individual levels of local ecological knowledge are not related to accurate recall or organization recall, arguably due to overall high levels of local ecological knowledge. While schooling seems to favour some organization strategies this might come at the expense of some other organization strategies.

  15. Heart Failure Hospitalisations in the Hunter New England Area Over 10 years. A Changing Trend.

    Science.gov (United States)

    Al-Omary, Mohammed S; Davies, Allan J; Khan, Arshad A; McGee, Michael; Bastian, Bruce; Leitch, James; Attia, John; Fletcher, Peter J; Boyle, Andrew J

    2017-06-01

    Heart failure carries a major burden on our health system, mainly related to the high rate of hospital admission. An understanding of the recent trends in heart failure hospitalisation is essential to the future allocation of health resources. Our aim is to analyse the temporal trends in heart failure hospitalisation. We extracted all separations in the Hunter New England Local Health District between 2005-2014 (n=40,119) with an ICD 10 code for heart failure (I-50) in the first four diagnoses on discharge. The numbers of hospitalisations were age-standardised to the 2001 Australian population and compared based on gender and remoteness. There was a decline in the age-standardised hospitalisation. However, there was a clear inflection point between 2009-2010, after which the decline levelled off. The absolute number of hospitalisations increased between 2010 and 2014. Heart failure hospitalisation was higher in males compared to females and rural compared to metropolitan inhabitants. The gains in heart failure treatment noted in recent years seem to have come to an end. Patients aged 75 years and older are contributing the majority of age-standardised hospitalisations. Copyright © 2016 Australian and New Zealand Society of Cardiac and Thoracic Surgeons (ANZSCTS) and the Cardiac Society of Australia and New Zealand (CSANZ). Published by Elsevier B.V. All rights reserved.

  16. Paraoxonases: ancient substrate hunters and their evolving role in ischemic heart disease.

    Science.gov (United States)

    Martinelli, Nicola; Consoli, Letizia; Girelli, Domenico; Grison, Elisa; Corrocher, Roberto; Olivieri, Oliviero

    2013-01-01

    Interest in the role of paraoxonases (PON) in cardiovascular research has increased substantially over the past two decades. These multifaceted and pleiotropic enzymes are encoded by three highly conserved genes (PON1, PON2, and PON3) located on chromosome 7q21.3-22.1. Phylogenetic analysis suggests that PON2 is the ancient gene from which PON1 and PON3 arose via gene duplication. Although PON are primarily lactonases with overlapping, but distinct specificities, their physiologic substrates remain poorly characterized. The most interesting characteristic of PON, however, is their multifunctional roles in various biochemical pathways. These include protection against oxidative damage and lipid peroxidation, contribution to innate immunity, detoxification of reactive molecules, bioactivation of drugs, modulation of endoplasmic reticulum stress, and regulation of cell proliferation/apoptosis. In general, PON appear as "hunters" of old and new substrates often involved in athero- and thrombogenesis. Although reduced PON activity appears associated with increased cardiovascular risk, the correlation between PON genotype and ischemic heart disease remains controversial. In this review, we examine the biochemical pathways impacted by these unique enzymes and investigate the potential use of PON as diagnostic tools and their impact on development of future therapeutic strategies.

  17. Results of the radiological survey at 110 E Hunter Avenue, Maywood, New Jersey (MJ022)

    International Nuclear Information System (INIS)

    Foley, R.D.; Carrier, R.F.; Floyd, L.M.; Crutcher, J.W.

    1989-09-01

    Maywood Chemical Works (MCW) of Maywood, New Jersey, generated process wastes and residues associated with the production and refining of thorium and thorium compounds from monazite ores from 1916 to 1956. MCW supplied rare earth metals and thorium compounds to the Atomic Energy Commission and various other government agencies from the late 1940s to the mid-1950s. Area residents used the sandlike waste from this thorium extraction process mixed with tea and cocoa leaves as mulch in their yards. Some of these contaminated wastes also eroded from the site into Lodi Brook. At the request of the US Department of Energy (DOE), a group from Oak Ridge National Laboratory conducts investigative radiological surveys of properties in the vicinity of MCW to determine whether a property is contaminated with radioactive residues, principally 232 Th, derived from the MCW site. The survey typically includes direct measurement of gamma radiation levels and soil sampling for radionuclide analyses. The survey of this site, 110 E. Hunter Avenue, Maywood, New Jersey (MJ022), was conducted during 1987. Following the removal of a small chunk of material showing elevated gamma exposure rates, all radionuclide concentrations and measurements conformed to DOE remedial action criteria. The slightly elevated radionuclide concentrations found in other soil samples were the result of naturally enhances radioactivity characteristic of some environmental materials such as coal ash and were unrelated to operations at the MCW site. The survey data demonstrate that the property requires no further action on the part of DOE. 4 refs., 2 figs., 3 tabs

  18. Jaguar conservation in southern Belize: Conflicts, perceptions, and prospects among mayan hunters

    Directory of Open Access Journals (Sweden)

    Michael K Steinberg

    2016-01-01

    Full Text Available Belize has emerged as an international leader in jaguar conservation through the creation of numerous protected areas that contain prime cat habitat and by strengthening conservation laws. For example, in 1984, Belize created the Cockscomb Basin Jaguar Preserve, the first special jaguar protection area in the Americas. In 1995, the government expanded Cockscomb by creating the adjacent Chiquibul National Park. In 2010, the government continued this commitment to jaguar conservation by creating the Labouring Creek Jaguar Corridor Wildlife Sanctuary in central Belize. As a result of these protected areas, Belize has been rightfully lauded as a leader in nature-based tourism and protected areas creation in Central America. However, outside national parks and communities that directly benefit from ecotourism, it is less clear how supportive rural residents are of cat conservation. It is also not clear if jaguars persist outside protected areas in locations such as southern Belize, where the environment has been significantly altered by human activities. Through interviews with Mayan hunters, this paper investigates the attitudes towards jaguars, human-jaguar conflicts, and potential community-based jaguar conservation in two Mayan villages in the Toledo District in southern Belize. Also, using indirect methods, the paper documents the presence/absence and other temporal/spatial aspects of jaguars in a heavily altered landscape in southern Belize.

  19. The Implications of Victimhood Identity: The Case of ‘Persecution’ of Swedish Hunters

    Directory of Open Access Journals (Sweden)

    Erica von Essen

    2017-06-01

    Full Text Available This ethnographically based study examines Swedish hunters’ claims to victimhood through appeal to the term ‘persecution’. Perceiving disenfranchisement, injustice and discrimination on the basis of wolf conservation policy, we present hunters’ self-styled predicament as victimhood-claimants of persecution at the hands of a state that has been co-opted by a conservationist, pro-wolf agenda that systematically disenfranchises rural and hunting interests and lifestyles. Through the phenomenological accounts of hunter respondents, our paper takes seriously the hunters’ perception of persecution and, likewise, considers the opposite case made by conservationists: that wolves have been, and continue to be, the real victims of persecution in the conflict. Nonetheless, we show that the persecution language as it is applied from opposing parties in the conflict is problematic inasmuch as it is focused around creating a moral panic and confusion among the Swedish public who are ultimately responsible, as a democratic body-politic, for assessing the legitimacy of claims to moral wrong-doing and legal redress for the wronged. Our case study joins scholarship that explores the pathologies of claims to victimization

  20. The neutrino hunters the chase for the ghost particle and the secrets of the universe

    CERN Document Server

    Jayawardhana, Ray

    2014-01-01

    In Neutrino Hunters, the renowned astrophysicist and award-winning writer Ray Jayawardhana takes us on a thrilling journey into the shadowy world of neutrinos and the colorful lives of those who seek them. Demystifying particle science along the way, Jayawardhana tells a detective story with cosmic implications—interweaving tales of the sharp-witted theorist Wolfgang Pauli; the troubled genius Ettore Majorana; the harbinger of the atomic age Enrico Fermi; the notorious Cold War defector Bruno Pontecorvo; and the dynamic dream team of Marie and Pierre Curie. Then there are the scientists of today who have caught the neutrino bug, and whose experimental investigations stretch from a working nickel mine in Ontario to a long tunnel through a mountain in central Italy, from a nuclear waste site in New Mexico to a bay on the South China Sea, and from Olympic-size pools deep underground to a gigantic cube of Antarctic ice—called, naturally, IceCube. As Jayawardhana recounts a captivating saga of scientific disc...

  1. Proving communal warfare among hunter-gatherers: The Quasi-Rousseauan error.

    Science.gov (United States)

    Gat, Azar

    2015-01-01

    Was human fighting always there, as old as our species? Or is it a late cultural invention, emerging after the transition to agriculture and the rise of the state, which began, respectively, only around ten thousand and five thousand years ago? Viewed against the life span of our species, Homo sapiens, stretching back 150,000-200,000 years, let alone the roughly two million years of our genus Homo, this is the tip of the iceberg. We now have a temporal frame and plenty of empirical evidence for the "state of nature" that Thomas Hobbes and Jean-Jacque Rousseau discussed in the abstract and described in diametrically opposed terms. All human populations during the Pleistocene, until about 12,000 years ago, were hunter-gatherers, or foragers, of the simple, mobile sort that lacked accumulated resources. Studying such human populations that survived until recently or still survive in remote corners of the world, anthropology should have been uniquely positioned to answer the question of aboriginal human fighting or lack thereof. Yet access to, and the interpretation of, that information has been intrinsically problematic. The main problem has been the "contact paradox." Prestate societies have no written records of their own. Therefore, documenting them requires contact with literate state societies that necessarily affects the former and potentially changes their behavior, including fighting. © 2015 Wiley Periodicals, Inc.

  2. Macronutrient contributions of insects to the diets of hunter-gatherers: a geometric analysis.

    Science.gov (United States)

    Raubenheimer, David; Rothman, Jessica M; Pontzer, Herman; Simpson, Stephen J

    2014-06-01

    We present a geometric model for examining the macronutrient contributions of insects in the diets of pre-agricultural humans, and relate the findings to some contemporary societies that regularly eat insects. The model integrates published data on the macronutrient composition of insects and other foods in the diets of humans, recommended human macronutrient intakes, and estimated macronutrient intakes to examine the assumption that insects provided to pre-agricultural humans an invertebrate equivalent of vertebrate-derived meats, serving primarily as a source of protein. Our analysis suggests that insects vary more widely in their macronutrient content than is likely to be the case for most wild vertebrate meats, spanning a broad range of protein, fat and carbohydrate concentrations. Potentially, therefore, in terms of their proportional macronutrient composition, insects could serve as equivalents not only of wild meat, but of a range of other foods including some shellfish, nuts, pulses, vegetables and even fruits. Furthermore, humans might systematically manipulate the composition of edible insects to meet specific needs through pre-ingestive processing, such as cooking and selective removal of body parts. We present data suggesting that in modern societies for which protein is the more limiting macronutrient, pre-ingestive processing of edible insects might serve to concentrate protein. It is likely, however, that the dietary significance of insects was different for Paleolithic hunter-gatherers who were more limited in non-protein energy. Our conclusions are constrained by available data, but highlight the need for further studies, and suggest that our model provides an integrative framework for conceiving these studies. Copyright © 2014 Elsevier Ltd. All rights reserved.

  3. Hadza hunter-gatherer men do not have more masculine digit ratios (2D:4D).

    Science.gov (United States)

    Apicella, Coren L; Tobolsky, Victoria A; Marlowe, Frank W; Miller, Kathleen W

    2016-02-01

    The ratio between the length of the second and the length of the fourth digit (2D:4D) is sexually dimorphic such that males of many species possess a lower ratio than females, particularly in the right hand. Still, men and women often exhibit overlapping 2D:4D ranges and the ratio is highly variable between populations. In order to further explore populational variability, we chose to analyze 2D:4D in the Hadza, a population of hunter-gatherers living in Tanzania. Data were collected separately by two researchers over the course of three years (1998, 2001, 2006) from 152 adult participants (male: n = 76, female: n = 76). Independent samples t-tests were used to explore sex differences, paired samples t-tests were used to explore directional effects within each sex, and linear regression and one-way ANOVA were used to test possible age effects. In none of the years, or pooled (n = 152), did we find evidence that adult men have a lower 2D:4D than adult women. If anything, the data suggest that women in this population have a significantly lower right hand 2D:4D than men (P < 0.001, d = 0.57). In contrast, left hand 2D:4D did not exhibit a sex difference (P = 0.862, d = 0.03). These findings challenge the current view that lower 2D:4D in men is a uniform characteristic of our species. Cross-populational variance in 2D:4D may be related to known patterns of hormonal variation resulting from both genetic and environmental mechanisms, though this relationship merits further investigation. © 2015 Wiley Periodicals, Inc.

  4. PLANET HUNTERS. VIII. CHARACTERIZATION OF 41 LONG-PERIOD EXOPLANET CANDIDATES FROM KEPLER ARCHIVAL DATA

    International Nuclear Information System (INIS)

    Wang, Ji; Fischer, Debra A.; Picard, Alyssa; Schmitt, Joseph R.; Boyajian, Tabetha S.; Barclay, Thomas; Ma, Bo; Bowler, Brendan P.; Riddle, Reed; Jek, Kian J.; LaCourse, Daryll; Simister, Dean Joseph; Grégoire, Boscher; Babin, Sean P.; Poile, Trevor; Jacobs, Thomas Lee; Baranec, Christoph; Law, Nicholas M.; Lintott, Chris; Schawinski, Kevin

    2015-01-01

    The census of exoplanets is incomplete for orbital distances larger than 1 AU. Here, we present 41 long-period planet candidates in 38 systems identified by Planet Hunters based on Kepler archival data (Q0–Q17). Among them, 17 exhibit only one transit, 14 have two visible transits, and 10 have more than three visible transits. For planet candidates with only one visible transit, we estimate their orbital periods based on transit duration and host star properties. The majority of the planet candidates in this work (75%) have orbital periods that correspond to distances of 1–3 AU from their host stars. We conduct follow-up imaging and spectroscopic observations to validate and characterize planet host stars. In total, we obtain adaptive optics images for 33 stars to search for possible blending sources. Six stars have stellar companions within 4″. We obtain high-resolution spectra for 6 stars to determine their physical properties. Stellar properties for other stars are obtained from the NASA Exoplanet Archive and the Kepler Stellar Catalog by Huber et al. We validate 7 planet candidates that have planet confidence over 0.997 (3σ level). These validated planets include 3 single-transit planets (KIC-3558849b, KIC-5951458b, and KIC-8540376c), 3 planets with double transits (KIC-8540376b, KIC-9663113b, and KIC-10525077b), and 1 planet with four transits (KIC-5437945b). This work provides assessment regarding the existence of planets at wide separations and the associated false positive rate for transiting observation (17%–33%). More than half of the long-period planets with at least three transits in this paper exhibit transit timing variations up to 41 hr, which suggest additional components that dynamically interact with the transiting planet candidates. The nature of these components can be determined by follow-up radial velocity and transit observations

  5. Frequency and developmental timing of linear enamel hypoplasia defects in Early Archaic Texan hunter-gatherers

    Directory of Open Access Journals (Sweden)

    J. Colette Berbesque

    2018-02-01

    Full Text Available Digital photographs taken under controlled conditions were used to examine the incidence of linear enamel hypoplasia defects (LEHs in burials from the Buckeye Knoll archaeological site (41VT98 Victoria county, Texas, which spans the Early to Late Archaic Period (ca. 2,500–6,500 BP uncorrected radiocarbon. The majority (68 of 74 burials date to the Texas Early Archaic, including one extremely early burial dated to 8,500 BP. The photogrammetric data collection method also results in an archive for Buckeye Knoll, a significant rare Archaic period collection that has been repatriated and reinterred. We analyzed the incidence and developmental timing of LEHs in permanent canines. Fifty-nine percent of permanent canines (n = 54 had at least one defect. There were no significant differences in LEH frequency between the maxillary and mandibular canines (U = 640.5, n1 = 37, n2 = 43, p = .110. The sample studied (n = 92 permanent canines had an overall mean of 0.93 LEH defect per tooth, with a median of one defect, and a mode of zero defects. Average age at first insult was 3.92 (median = 4.00, range = 2.5–5.4 and the mean age of all insults per individual was 4.18 years old (range = 2.5–5.67. Age at first insult is consistent with onset of weaning stress—the weaning age range for hunter-gatherer societies is 1–4.5. Having an earlier age of first insult was associated with having more LEHs (n = 54, rho = −0.381, p = 0.005.

  6. PLANET HUNTERS. VIII. CHARACTERIZATION OF 41 LONG-PERIOD EXOPLANET CANDIDATES FROM KEPLER ARCHIVAL DATA

    Energy Technology Data Exchange (ETDEWEB)

    Wang, Ji; Fischer, Debra A.; Picard, Alyssa; Schmitt, Joseph R.; Boyajian, Tabetha S. [Department of Astronomy, Yale University, New Haven, CT 06511 (United States); Barclay, Thomas [NASA Ames Research Center, M/S 244-30, Moffett Field, CA 94035 (United States); Ma, Bo [Department of Astronomy, University of Florida, 211 Bryant Space Science Center, Gainesville, FL 32611-2055 (United States); Bowler, Brendan P.; Riddle, Reed [California Institute of Technology, 1200 East California Boulevard, Pasadena, CA 91101 (United States); Jek, Kian J.; LaCourse, Daryll; Simister, Dean Joseph; Grégoire, Boscher; Babin, Sean P.; Poile, Trevor; Jacobs, Thomas Lee; Baranec, Christoph [Institute for Astronomy, University of Hawai‘i at Mānoa, Hilo, HI 96720-2700 (United States); Law, Nicholas M. [Department of Physics and Astronomy, University of North Carolina at Chapel Hill, Chapel Hill, NC 27599-3255 (United States); Lintott, Chris [Oxford Astrophysics, Denys Wilkinson Building, Keble Road, Oxford OX1 3RH (United Kingdom); Schawinski, Kevin [Institute for Astronomy, Department of Physics, ETH Zurich, Wolfgang-Pauli-Strasse 27, CH-8093 Zurich (Switzerland); and others

    2015-12-20

    The census of exoplanets is incomplete for orbital distances larger than 1 AU. Here, we present 41 long-period planet candidates in 38 systems identified by Planet Hunters based on Kepler archival data (Q0–Q17). Among them, 17 exhibit only one transit, 14 have two visible transits, and 10 have more than three visible transits. For planet candidates with only one visible transit, we estimate their orbital periods based on transit duration and host star properties. The majority of the planet candidates in this work (75%) have orbital periods that correspond to distances of 1–3 AU from their host stars. We conduct follow-up imaging and spectroscopic observations to validate and characterize planet host stars. In total, we obtain adaptive optics images for 33 stars to search for possible blending sources. Six stars have stellar companions within 4″. We obtain high-resolution spectra for 6 stars to determine their physical properties. Stellar properties for other stars are obtained from the NASA Exoplanet Archive and the Kepler Stellar Catalog by Huber et al. We validate 7 planet candidates that have planet confidence over 0.997 (3σ level). These validated planets include 3 single-transit planets (KIC-3558849b, KIC-5951458b, and KIC-8540376c), 3 planets with double transits (KIC-8540376b, KIC-9663113b, and KIC-10525077b), and 1 planet with four transits (KIC-5437945b). This work provides assessment regarding the existence of planets at wide separations and the associated false positive rate for transiting observation (17%–33%). More than half of the long-period planets with at least three transits in this paper exhibit transit timing variations up to 41 hr, which suggest additional components that dynamically interact with the transiting planet candidates. The nature of these components can be determined by follow-up radial velocity and transit observations.

  7. Barley (Hordeum vulgare) in the Okhotsk culture (5th-10th century AD) of northern Japan and the role of cultivated plants in hunter-gatherer economies.

    Science.gov (United States)

    Leipe, Christian; Sergusheva, Elena A; Müller, Stefanie; Spengler, Robert N; Goslar, Tomasz; Kato, Hirofumi; Wagner, Mayke; Weber, Andrzej W; Tarasov, Pavel E

    2017-01-01

    existed ca. 600-1000 cal yr AD across the island region. Despite a large body of studies and numerous theoretical and conceptual debates, the question of how to differentiate between hunter-gatherer and farming economies persists reflecting the wide range of dynamic subsistence strategies used by humans through the Holocene. Our current study contributes to the ongoing discussion of this important issue.

  8. Barley (Hordeum vulgare in the Okhotsk culture (5th-10th century AD of northern Japan and the role of cultivated plants in hunter-gatherer economies.

    Directory of Open Access Journals (Sweden)

    Christian Leipe

    domains possibly existed ca. 600-1000 cal yr AD across the island region. Despite a large body of studies and numerous theoretical and conceptual debates, the question of how to differentiate between hunter-gatherer and farming economies persists reflecting the wide range of dynamic subsistence strategies used by humans through the Holocene. Our current study contributes to the ongoing discussion of this important issue.

  9. Importance measures

    International Nuclear Information System (INIS)

    Gomez Cobo, A.

    1997-01-01

    The presentation discusses the following: general concepts of importance measures; example fault tree, used to illustrate importance measures; Birnbaum's structural importance; criticality importance; Fussel-Vesely importance; upgrading function; risk achievement worth; risk reduction worth

  10. A comparison of antemortem tooth loss in human hunter-gatherers and non-human catarrhines: implications for the identification of behavioral evolution in the human fossil record.

    Science.gov (United States)

    Gilmore, Cassandra C

    2013-06-01

    Middle and Late Pleistocene fossil hominin specimens with severe antemortem tooth loss are often regarded as evidence for the precocious evolution of human-like behaviors, such as conspecific care or cooking, in ancient hominin species. The goal of this project was to ask whether the theoretical association between antemortem tooth loss and uniquely human behaviors is supported empirically in a large skeletal sample of human hunter-gatherers, chimpanzees, orangutans, and baboons. Binomial regression modeling in a Bayesian framework allows for the investigation of the effects of tooth class, genus, age, and sex on the likelihood of tooth loss. The results strongly suggest that modern humans experience more antemortem tooth loss than non-human primates and identify age in years as an important predictor. Once age is accounted for, the difference between the humans and the closest non-human genus (chimpanzees) is less pronounced; humans are still more likely on average to experience antemortem tooth loss though 95% uncertainty envelopes around the average prediction for each genus show some overlap. These analyses support theoretical links between antemortem tooth loss and modern human characteristics; humans' significantly longer life history and a positive correlation between age and antemortem tooth loss explain, in part, the reason why humans are more likely to experience tooth loss than non-human primates, but the results do not exclude behavioral differences as a contributing factor. Copyright © 2013 Wiley Periodicals, Inc.

  11. Their grass is greener but ours is sweeter - thoroughbred breeding and water management in the Upper Hunter region of New South Wales, Australia

    Energy Technology Data Exchange (ETDEWEB)

    McManus, P. [University of Sydney, Sydney, NSW (Australia). School for Geoscience

    2008-05-15

    The Upper Hunter region (in New South Wales (NSW) around Scone is reputed to be the second most significant thoroughbred breeding region in the world after the Bluegrass region of Kentucky. This article identifies the importance and cultural constructions of grass, and hence water, in the thoroughbred breeding industry in this region. Thoroughbred stud managers attempt to produce environments attractive to potential horse purchasers and owners with mares to be mated. These environments are constructed from perceptions of how a thoroughbred stud should appear, and from the physical conditions of specific locations. One perception is that the grass should be green. There are differing opinions in the thoroughbred breeding industry about the nutritional value of irrigated grasses, the role of these grasses in horse development and the associated access to, cost of and efficacy of water used for this purpose. The paper concludes that effective water management in this industry is only possible if various cultures of nature are understood, where necessary challenged, and subsequently included in policy and planning.

  12. Estimation of the tourism climate in the Hunter Region, Australia, in the early twenty-first century

    Science.gov (United States)

    Shiue, Ivy; Matzarakis, Andreas

    2011-07-01

    Existing tourism-related climate information and evaluation are typically based on mean monthly conditions of air temperature and precipitation and do not include thermal perception and other climate parameters relevant for tourists. Here, we quantify climate based on the climate facets relevant to tourism (thermal, physical, aesthetical), and apply the results to the Climate-Tourism-Information-Scheme (CTIS). This paper presents bioclimatic and tourism climatological conditions in the Hunter Region—one of Australia's most popular tourist destinations. In the Hunter Region, generally, temperatures below 15°C occur from April through October, temperatures less than 25°C are expected throughout the whole year, while humidity sits around 50%. As expected, large differences between air temperature and physiologically equivalent temperature (PET) were clearly identified. The widest differences were seen in summer time rather than in the winter period. In addition, cold stress was observed less than 10% of the time in winter while around 40-60% of heat stress was observed in summer time. This correlates with the highest numbers of international visitors, who usually seek a warmer weather, at the beginning of summer time (November and December) and also to the number of domestic visitors, who tend to seek cooler places for recreation and leisure, in late summer (January-March). It was concluded that thermal bioclimate assessment such as PET and CTIS can be applied in the Hunter region, and that local governments and the tourism industry should take an integrated approach to providing more relevant weather and climate information for both domestic and international tourists in the near future.

  13. Hunter color dimensions, sugar content and volatile compounds in pasteurized yellow passion fruit juice (Passiflora edulis var. flavicarpa during storage

    Directory of Open Access Journals (Sweden)

    Delcio Sandi

    2004-06-01

    Full Text Available Changes in Hunter L, a and b values, glucose, fructose and sucrose contents, concentration of four volatile compounds (ethyl butirate, ethyl caproate, hexyl butirate and hexyl caproate and furfural, were studied in yellow passion fruit juice (Passiflora edulis var. flavicarpa pasteurized at 75ºC/60s, 80ºC/41s or 85ºC/27s, during storage at room temperature (25±5ºC and refrigeration (5±1ºC for 120 days. While the sucrose content decreased, the glucose and fructose contents increased significantly over storage time. The Hunter L and b values behaved similarly, with a tendency to decrease over time, inversely to Hunter a value. Volatile compound concentrations also decreased over time, inversely to the furfural content. Pasteurization at 85ºC/27s resulted minimum changes in the studied passion fruit characteristics, while that at 75ºC/60s was the most harmful. Storage under refrigeration tended to keep the best quality characteristics of the juice.Foi estudada a variação dos valores "L", "a" e "b" do sistema de Hunter, dos teores de glucose, frutose e sacarose, e da concentração de quatro compostos voláteis (butirato de etila, caproato de etila, butirato de hexila e caproato de hexila e furfural, em suco de maracujá-amarelo (Passiflora edulis var. flavicarpa submetido à pasteurização (75ºC/60 s, 80ºC/41 s e 85ºC/27 s, durante o armazenamento a temperatura ambiente (25±5ºC e refrigerada (5±1ºC por 120 dias. Enquanto os teores de sacarose diminuíram, aqueles de glucose e frutose aumentaram significativamente. Os valores "L" e "b" apresentaram comportamento semelhante, com tendência a diminuir ao longo do tempo, inversamente ao valor "a". As concentrações dos compostos voláteis também diminuíram, exceto para o furfural. A pasteurização a 85ºC/27 s proporcionou as menores alterações nas características estudadas, enquanto aquela à 75ºC/60 s foi a mais prejudicial. O armazenamento sob refrigeração apresentou

  14. Ceramics among Eurasian hunter-gatherers: 32 000 years of ceramic technology use and the perception of containment

    Directory of Open Access Journals (Sweden)

    Mihael Budja

    2016-12-01

    Full Text Available We present two parallel and 32 000 years long trajectories of episodic ceramic technology use in Eurasian pre-Neolithic hunter-gatherer societies. In eastern, Asian trajectory the pottery was produced from the beginning. Ceramic figurines mark the western, European trajectory. The western predates the eastern for about eleven millennia. While ceramic cones and figurines first appeared in Central Europe at c. 31 000 cal BC the earliest vessels in eastern Asia was dated at c. 20 000 cal BC. We discuss women’s agency, perception of containment, ‘cross-craft interactions’, and evolution of private property that that may influenced the inventions of ceramic (pyrotechnology.

  15. OPERATION ODESSA: THE FLIGHT OF NAZI WAR CRIMINALS TO LATIN AMERICA AFTER WORLD WAR II AND THE NAZI HUNTERS

    Directory of Open Access Journals (Sweden)

    Marcos Eduardo Meinerz

    2013-06-01

    Full Text Available This article aims to analyze why Latin America, especially Argentina, was the region of the world that harbored the most Nazi war criminals—for example, Josef Mengele, Adolf Eichmann and Klaus Barbie—after World War II. It also aims to analyze how this fact has set the tone for the appearance of literary works about the fantastic adventures of “Nazi hunters” seeking the whereabouts of those individuals. For this purpose, in the first part of the article we will address Nazis’ escape to Latin America. Next, we analyze some literary works by authors who called themselves Nazi hunters.

  16. Isolation And Identification Of Antioxidant Compounds Leaf Betel Seating (Piper sarmentosum Roxb. Ex Hunter

    Directory of Open Access Journals (Sweden)

    Hartiwi Diastutia

    2012-02-01

    Full Text Available Sirih duduk or Piper sarmentosum Roxb. ex Hunter have been long used the people in Indonesia for traditional medicine to cure various diseases. This research was aimed to isolate and identify antioxidant compounds from P. sarmentosum leaves. The isolation bioactive compounds of P. sarmentosum leaves was performed by extraction the powder of P. sarmentosum leaves using methanol. The methanol extract was fractionated using n-hexane and ethylacetate in their various composition.  The fractions respectively was examined their antioxidant activity. The most active extract was fractionated again performed by coloumn chromatography Identification of the bioactive compounds was carried out using ultraviolet-visible (UV-Vis spectrometry, infra red (IR spectrometry and gas chromatography-mass spectrometry (GCMS. The result showed that the methanol extract of  P. sarmentosum leaves have antioxidant activity. The fractionation was performed by coloumn chromatography using n-hexane-ethylacetate (4:6 eluent, a bioactive compound of sinamic acid derivative was 4-ethoxy-2-hidroxy-3,5-dimethoxy sinamic acid could be purely isolated. Keywords: Piper sarmentosum, antioxidant, sinamic acid derivative. Normal 0 false false false EN-US X-NONE X-NONE st1\\:*{behavior:url(#ieooui } /* Style Definitions */ table.MsoNormalTable {mso-style-name:"Table Normal"; mso-tstyle-rowband-size:0; mso-tstyle-colband-size:0; mso-style-noshow:yes; mso-style-priority:99; mso-style-qformat:yes; mso-style-parent:""; mso-padding-alt:0in 5.4pt 0in 5.4pt; mso-para-margin-top:0in; mso-para-margin-right:0in; mso-para-margin-bottom:10.0pt; mso-para-margin-left:0in; line-height:115%; mso-pagination:widow-orphan; font-size:11.0pt; font-family:"Calibri","sans-serif"; mso-ascii-font-family:Calibri; mso-ascii-theme-font:minor-latin; mso-fareast-font-family:"Times New Roman"; mso-fareast-theme-font:minor-fareast; mso-hansi-font-family:Calibri; mso-hansi-theme-font:minor-latin; mso

  17. Analysis of PFAAs in American alligators part 2: Potential dietary exposure of South Carolina hunters from recreationally harvested alligator meat.

    Science.gov (United States)

    Tipton, Jessica J; Guillette, Louis J; Lovelace, Susan; Parrott, Benjamin B; Rainwater, Thomas R; Reiner, Jessica L

    2017-11-01

    Exposure to perfluorinated alkyl acids (PFAAs) has been linked to many harmful health effects including reproductive disorders, developmental delays, and altered liver and kidney function. Most human exposure to environmental contaminants, including PFAAs, occurs through consumption of contaminated food or drinking water. This study uses PFAA data from meat samples collected from recreationally harvested American alligators (Alligator mississippiensis) in South Carolina to assess potential dietary exposure of hunters and their families to PFAAs. Consumption patterns were investigated using intercept surveys of 23 hunters at a wild game meat processor. An exposure scenario using the average consumption frequency, portion size, and median perfluorooctane sulfonic acid (PFOS) concentration in alligator meat from all hunt units found the daily dietary exposure to be 2.11ng/kg body weight per day for an adult human. Dietary PFOS exposure scenarios based on location of harvest suggested the highest daily exposure occurs with alligator meat from the Middle Coastal hunt unit in South Carolina. Although no samples were found to exceed the recommended threshold for no consumption of PFOS found in Minnesota state guidelines, exposure to a mixture of PFAAs found in alligator meat and site-specific exposures based on harvest location should be considered in determining an appropriate guideline for vulnerable populations potentially exposed to PFAAs through consumption of wild alligator meat. Copyright © 2017. Published by Elsevier B.V.

  18. Hunter-gatherer adaptations and environmental change in the southern Great Basin: The evidence from Pahute and Rainier mesas

    Energy Technology Data Exchange (ETDEWEB)

    Pippin, L.C.

    1998-06-01

    This paper reviews the evidence for fluctuations in past environments in the southern Great Basin and examines how these changes may have affected the strategies followed by past hunter and gatherers in their utilization of the resources available on a highland in this region. The evidence used to reconstruct past environments for the region include botanical remains from packrat middens, pollen spectra from lake and spring deposits, faunal remains recovered from archaeological and geologic contexts, tree-ring indices from trees located in sensitive (tree-line) environments, and eolian, alluvial and fluvial sediments deposited in a variety of contexts. Interpretations of past hunter and gatherer adaptive strategies are based on a sample of 1,311 archaeological sites recorded during preconstruction surveys on Pahute and Rainier mesas in advance of the US Department of Energy`s nuclear weapons testing program. Projectile point chronologies and available tree-ring, radiocarbon, thermoluminescence and obsidian hydration dates were used to assign these archaeological sites to specific periods of use.

  19. An improved assay for iduronate 2-sulphate sulphatase in serum and its use in the detection of carriers of the Hunter syndrome

    International Nuclear Information System (INIS)

    Archer, I.M.; Harper, P.S.; Wusteman, F.S.

    1981-01-01

    A more sensitive assay procedure has been developed for the enzyme iduronate 2-sulphate sulphatase which is deficient in the Hunter syndrome. The substrate is O-(α-L-idopyranosyluronic acid 2-sulphate)-(1 → 4)-2,5 anhydro-D-[ 3 H-1)mannitol 6-sulphate, which, after incubation, is separated from the product by ion-exchange chromatography on a micro-columnn of Dowex 1 X 2 (Cl - ). Serum analyses can be used to supplement those on hair roots in the detection of carriers of the Hunter syndrome. (Auth.)

  20. Do individual differences in use of cover habitat affect red deer`s (Cervus elaphus) probability of being shot by hunters?

    OpenAIRE

    Stamnes, Inga

    2014-01-01

    The purpose of this study was to test if red deer (Cervus elaphus) habitat use affects their risk of being shot by hunters. I compared habitat use of 20 GPS-marked red deer that survived the hunting season with 20 individuals that were shot. I predicted that shot red deer used open areas within forested habitats with a better visibility for hunters than surviving red deer. I also predicted that the use of less risky habitat is costly in terms of foraging opportunity, with shot animals using b...

  1. Autoradiographical detection of cholecystokinin-A receptors in primate brain using 125I-Bolton Hunter CCK-8 and 3H-MK-329

    International Nuclear Information System (INIS)

    Hill, D.R.; Shaw, T.M.; Graham, W.; Woodruff, G.N.

    1990-01-01

    In vitro autoradiography was performed in order to visualize cholecystokinin-A (CCK-A) receptors in sections of Cynomolgus monkey brain. CCK-A receptors were defined as those which displayed high affinity for the selective non-peptide antagonist MK-329 (L-364,718) and were detected in several regions by selective inhibition of 125I-Bolton Hunter CCK using MK-329 or direct labeling with 3H-MK-329. In the caudal medulla, high densities of CCK-A sites were present in the nucleus tractus solitarius, especially the caudal and medial aspects, and also the dorsal motor nucleus of the vagus. CCK-A sites were localized to a number of hypothalamic nuclei such as the supraoptic and paraventricular nuclei, the dorsomedial and infundibular nuclei as well as the neurohypophysis. The mammillary bodies and supramammillary nuclei also contained CCK-A receptor sites. High concentrations of CCK-A receptors were present in the substantia nigra zona compacta and also the ventral tegmental area and may be associated with dopamine cell bodies. Binding of 3H-MK-329 was also detected in parts of the caudate nucleus and ventral putamen. The detection, by autoradiographical means, of CCK-A receptors throughout the Cynomolgus monkey brain contrasts with similar studies performed using rodents and suggests differences in the density and, perhaps, the importance of CCK-A receptors in the primate as opposed to the rodent. The data suggest the possibility that CCK-A receptors may be involved in a number of important brain functions as diverse as the processing of sensory information from the gut, the regulation of hormone secretion, and the activity of dopamine cell activity

  2. Occurrence and prevalence of selected zoonotic agents: Echinococcus multilocularis, Trichinella spiralis and hepatitis E virus (HEV) in the population of Polish hunters--results of the study conducted in 2010-2012.

    Science.gov (United States)

    Sadkowska-Todys, Małgorzata; Baumann-Popczyk, Anna; Wnukowska, Natalia; Popczyk, Bartłomiej; Kucharczyk, Bożena; Gołąb, Elżbieta

    2015-01-01

    In Poland the development of the knowledge concerning zoonotic pathogens, of which free-living animals are the reservoir of is gaining in importance both in epidemiological aspect as well as in the context of prevention for improving public health. Dietary habits such as the consumption of forest undergrowth products and wild game meat, and the way of those products being prepared (in the process of barbequing) pose a risk factors of infection with the foodborne pathogens such as Echinococcus multilocularis, Trichinella spp., and HEV. The aim of this study is to estimate the prevalence of infections caused by Trichinella spp., Echinococcus multilocularis, and HEV in the population of Polish hunters, describing their geographical distribution in Poland, and to try to define basic factors, which may contribute to their occurrence. In 2010-2012 a cross-sectional study was carried out among Polish hunters. A blood samples were collected as well as a survey of 1027 participants recruited in the 16 provinces was also carried out. Serological tests were performed for the presence of specific antibodies against Echinococcus multilocularis, Trichinella spp. and HEV using commercial or "in home" ELISA tests. In case of positive result for Echinococcus, an Em2plus ELISA or/and western blot test were carried out, and for positive results for IgM for HEV a recomLine HEV IgM test was carried out. In the studied population a total number of 2 cases of Echinococcus multilocularis infection were found. Moreover in 47 (4,6%) participants presence of antibodies against Trichinella spp. were found, including 17 positive and 30 borderline results. In 206 persons (25%) IgG anti-HEV antibodies were found (by ELISA test). Geographical diversity in prevalence of both, the Trichinella spp. and HEV cases was observed. The study confirmed presence of zoonotic infections such as Echinococcus multilocularis, Trichinella spp., and hepatitis E (HEV) among Polish hunters. In the case of

  3. Pavlovian hunters on the margin - archaeozoological analysis of the animal remains discovered at the Pavlov II site (1966-67 excavations)

    Czech Academy of Sciences Publication Activity Database

    Wilczyński, J.; Wojtal, P.; Svoboda, Jiří

    2017-01-01

    Roč. 73, 3-4 (2017), s. 322-331 ISSN 2533-4050 Institutional support: RVO:68081758 Keywords : Gravettian * hunters-gatherers * southern Moravia * subsistence strategies Subject RIV: AC - Archeology, Anthropology, Ethnology OBOR OECD: Archaeology http://fi.nm.cz/wp-content/uploads/2017/12/06_Wilczynski_et-al_2017.pdf

  4. Seasonal variation in Eurasian Wigeon Anas penelope sex and age ratios from hunter-based surveys

    DEFF Research Database (Denmark)

    Clausen, Kevin Kuhlmann; Dalby, Lars; Sunde, Peter

    2013-01-01

    dominated by adult males, and juvenile proportions were highest in November and significantly lower before and after this peak. Nationwide field assessments undertaken in January 2012 showed no significant differences from sex and age ratios in the wing survey data from that particular hunting season (2011...... schemes. This study found consistent seasonal variation in Eurasian Wigeon Anas penelope sex and age ratios among Danish hunter-based wing surveys, and describes how accounting for this variation might explain reported discrepancies between this and other monitoring methods. Early season flocks were....../2012), indicating that this survey is a good predictor of Wigeon demography. These results highlight the need to account for consistent temporal variation in such demographic time series when using the results to model population parameters....

  5. Perceptions of on-site hunters: Environmental concerns, future land use, and cleanup options at the Savannah River Site

    International Nuclear Information System (INIS)

    Burger, J.; Sanchez, J.

    1999-01-01

    The Department of Energy owns land in 34 states, and most of these lands have been off limits to the public for over 50 years. Although some parts of each site are contaminated, most of many sites are not. With the ending of the Cold War, the department is considering alternative land uses. In this article, the perceptions of hunters and fishermen allowed on site for a limited time were examined, about environmental concerns, future land use, and cleanup options. Although loss of jobs was the foremost concern, preserving parts of the site had more support as a future land use than continuing the nuclear mission, and nearly three-quarters of the sample supported cleanup, regardless of cost. On-site employment was a significant indicator of lower concern about safety and environmental issues, less support for designating the site for research, and more concern for maintaining jobs

  6. Effect of resource spatial correlation and hunter-fisher-gatherer mobility on social cooperation in Tierra del Fuego.

    Directory of Open Access Journals (Sweden)

    José Ignacio Santos

    Full Text Available This article presents an agent-based model designed to explore the development of cooperation in hunter-fisher-gatherer societies that face a dilemma of sharing an unpredictable resource that is randomly distributed in space. The model is a stylised abstraction of the Yamana society, which inhabited the channels and islands of the southernmost part of Tierra del Fuego (Argentina-Chile. According to ethnographic sources, the Yamana developed cooperative behaviour supported by an indirect reciprocity mechanism: whenever someone found an extraordinary confluence of resources, such as a beached whale, they would use smoke signals to announce their find, bringing people together to share food and exchange different types of social capital. The model provides insight on how the spatial concentration of beachings and agents' movements in the space can influence cooperation. We conclude that the emergence of informal and dynamic communities that operate as a vigilance network preserves cooperation and makes defection very costly.

  7. How does a carnivore guild utilise a substantial but unpredictable anthropogenic food source? Scavenging on hunter-shot ungulate carcasses by wild dogs/dingoes, red foxes and feral cats in south-eastern Australia revealed by camera traps.

    Directory of Open Access Journals (Sweden)

    David M Forsyth

    Full Text Available There is much interest in understanding how anthropogenic food resources subsidise carnivore populations. Carcasses of hunter-shot ungulates are a potentially substantial food source for mammalian carnivores. The sambar deer (Rusa unicolor is a large (≥ 150 kg exotic ungulate that can be hunted throughout the year in south-eastern Australia, and hunters are not required to remove or bury carcasses. We investigated how wild dogs/dingoes and their hybrids (Canis lupus familiaris/dingo, red foxes (Vulpes vulpes and feral cats (Felis catus utilised sambar deer carcasses during the peak hunting seasons (i.e. winter and spring. We placed carcasses at 1-km intervals along each of six transects that extended 4-km into forest from farm boundaries. Visits to carcasses were monitored using camera traps, and the rate of change in edible biomass estimated at ∼ 14-day intervals. Wild dogs and foxes fed on 70% and 60% of 30 carcasses, respectively, but feral cats seldom (10% fed on carcasses. Spatial and temporal patterns of visits to carcasses were consistent with the hypothesis that foxes avoid wild dogs. Wild dog activity peaked at carcasses 2 and 3 km from farms, a likely legacy of wild dog control, whereas fox activity peaked at carcasses 0 and 4 km from farms. Wild dog activity peaked at dawn and dusk, whereas nearly all fox activity occurred after dusk and before dawn. Neither wild dogs nor foxes remained at carcasses for long periods and the amount of feeding activity by either species was a less important predictor of the loss of edible biomass than season. Reasons for the low impacts of wild dogs and foxes on sambar deer carcass biomass include the spatially and temporally unpredictable distribution of carcasses in the landscape, the rapid rate of edible biomass decomposition in warm periods, low wild dog densities and the availability of alternative food resources.

  8. How does a carnivore guild utilise a substantial but unpredictable anthropogenic food source? Scavenging on hunter-shot ungulate carcasses by wild dogs/dingoes, red foxes and feral cats in south-eastern Australia revealed by camera traps.

    Science.gov (United States)

    Forsyth, David M; Woodford, Luke; Moloney, Paul D; Hampton, Jordan O; Woolnough, Andrew P; Tucker, Mark

    2014-01-01

    There is much interest in understanding how anthropogenic food resources subsidise carnivore populations. Carcasses of hunter-shot ungulates are a potentially substantial food source for mammalian carnivores. The sambar deer (Rusa unicolor) is a large (≥ 150 kg) exotic ungulate that can be hunted throughout the year in south-eastern Australia, and hunters are not required to remove or bury carcasses. We investigated how wild dogs/dingoes and their hybrids (Canis lupus familiaris/dingo), red foxes (Vulpes vulpes) and feral cats (Felis catus) utilised sambar deer carcasses during the peak hunting seasons (i.e. winter and spring). We placed carcasses at 1-km intervals along each of six transects that extended 4-km into forest from farm boundaries. Visits to carcasses were monitored using camera traps, and the rate of change in edible biomass estimated at ∼ 14-day intervals. Wild dogs and foxes fed on 70% and 60% of 30 carcasses, respectively, but feral cats seldom (10%) fed on carcasses. Spatial and temporal patterns of visits to carcasses were consistent with the hypothesis that foxes avoid wild dogs. Wild dog activity peaked at carcasses 2 and 3 km from farms, a likely legacy of wild dog control, whereas fox activity peaked at carcasses 0 and 4 km from farms. Wild dog activity peaked at dawn and dusk, whereas nearly all fox activity occurred after dusk and before dawn. Neither wild dogs nor foxes remained at carcasses for long periods and the amount of feeding activity by either species was a less important predictor of the loss of edible biomass than season. Reasons for the low impacts of wild dogs and foxes on sambar deer carcass biomass include the spatially and temporally unpredictable distribution of carcasses in the landscape, the rapid rate of edible biomass decomposition in warm periods, low wild dog densities and the availability of alternative food resources.

  9. How Does a Carnivore Guild Utilise a Substantial but Unpredictable Anthropogenic Food Source? Scavenging on Hunter-Shot Ungulate Carcasses by Wild Dogs/Dingoes, Red Foxes and Feral Cats in South-Eastern Australia Revealed by Camera Traps

    Science.gov (United States)

    Forsyth, David M.; Woodford, Luke; Moloney, Paul D.; Hampton, Jordan O.; Woolnough, Andrew P.; Tucker, Mark

    2014-01-01

    There is much interest in understanding how anthropogenic food resources subsidise carnivore populations. Carcasses of hunter-shot ungulates are a potentially substantial food source for mammalian carnivores. The sambar deer (Rusa unicolor) is a large (≥150 kg) exotic ungulate that can be hunted throughout the year in south-eastern Australia, and hunters are not required to remove or bury carcasses. We investigated how wild dogs/dingoes and their hybrids (Canis lupus familiaris/dingo), red foxes (Vulpes vulpes) and feral cats (Felis catus) utilised sambar deer carcasses during the peak hunting seasons (i.e. winter and spring). We placed carcasses at 1-km intervals along each of six transects that extended 4-km into forest from farm boundaries. Visits to carcasses were monitored using camera traps, and the rate of change in edible biomass estimated at ∼14-day intervals. Wild dogs and foxes fed on 70% and 60% of 30 carcasses, respectively, but feral cats seldom (10%) fed on carcasses. Spatial and temporal patterns of visits to carcasses were consistent with the hypothesis that foxes avoid wild dogs. Wild dog activity peaked at carcasses 2 and 3 km from farms, a likely legacy of wild dog control, whereas fox activity peaked at carcasses 0 and 4 km from farms. Wild dog activity peaked at dawn and dusk, whereas nearly all fox activity occurred after dusk and before dawn. Neither wild dogs nor foxes remained at carcasses for long periods and the amount of feeding activity by either species was a less important predictor of the loss of edible biomass than season. Reasons for the low impacts of wild dogs and foxes on sambar deer carcass biomass include the spatially and temporally unpredictable distribution of carcasses in the landscape, the rapid rate of edible biomass decomposition in warm periods, low wild dog densities and the availability of alternative food resources. PMID:24918425

  10. Networks of Food Sharing Reveal the Functional Significance of Multilevel Sociality in Two Hunter-Gatherer Groups.

    Science.gov (United States)

    Dyble, Mark; Thompson, James; Smith, Daniel; Salali, Gul Deniz; Chaudhary, Nikhil; Page, Abigail E; Vinicuis, Lucio; Mace, Ruth; Migliano, Andrea Bamberg

    2016-08-08

    Like many other mammalian and primate societies [1-4], humans are said to live in multilevel social groups, with individuals situated in a series of hierarchically structured sub-groups [5, 6]. Although this multilevel social organization has been described among contemporary hunter-gatherers [5], questions remain as to the benefits that individuals derive from living in such groups. Here, we show that food sharing among two populations of contemporary hunter-gatherers-the Palanan Agta (Philippines) and Mbendjele BaYaka (Republic of Congo)-reveals similar multilevel social structures, with individuals situated in households, within sharing clusters of 3-4 households, within the wider residential camps, which vary in size. We suggest that these groupings serve to facilitate inter-sexual provisioning, kin provisioning, and risk reduction reciprocity, three levels of cooperation argued to be fundamental in human societies [7, 8]. Humans have a suite of derived life history characteristics including a long childhood and short inter-birth intervals that make offspring energetically demanding [9] and have moved to a dietary niche that often involves the exploitation of difficult to acquire foods with highly variable return rates [10-12]. This means that human foragers face both day-to-day and more long-term energetic deficits that conspire to make humans energetically interdependent. We suggest that a multilevel social organization allows individuals access to both the food sharing partners required to buffer themselves against energetic shortfalls and the cooperative partners required for skill-based tasks such as cooperative foraging. Copyright © 2016 Elsevier Ltd. All rights reserved.

  11. Prey items and predation behavior of killer whales (Orcinus orca) in Nunavut, Canada based on Inuit hunter interviews

    Science.gov (United States)

    2012-01-01

    Background Killer whales (Orcinus orca) are the most widely distributed cetacean, occurring in all oceans worldwide, and within ocean regions different ecotypes are defined based on prey preferences. Prey items are largely unknown in the eastern Canadian Arctic and therefore we conducted a survey of Inuit Traditional Ecological Knowledge (TEK) to provide information on the feeding ecology of killer whales. We compiled Inuit observations on killer whales and their prey items via 105 semi-directed interviews conducted in 11 eastern Nunavut communities (Kivalliq and Qikiqtaaluk regions) from 2007-2010. Results Results detail local knowledge of killer whale prey items, hunting behaviour, prey responses, distribution of predation events, and prey capture techniques. Inuit TEK and published literature agree that killer whales at times eat only certain parts of prey, particularly of large whales, that attacks on large whales entail relatively small groups of killer whales, and that they hunt cooperatively. Inuit observations suggest that there is little prey specialization beyond marine mammals and there are no definitive observations of fish in the diet. Inuit hunters and elders also documented the use of sea ice and shallow water as prey refugia. Conclusions By combining TEK and scientific approaches we provide a more holistic view of killer whale predation in the eastern Canadian Arctic relevant to management and policy. Continuing the long-term relationship between scientists and hunters will provide for successful knowledge integration and has resulted in considerable improvement in understanding of killer whale ecology relevant to management of prey species. Combining scientists and Inuit knowledge will assist in northerners adapting to the restructuring of the Arctic marine ecosystem associated with warming and loss of sea ice. PMID:22520955

  12. Diagnosis of tuberculosis in the wild boar (Sus scrofa: a comparison of methods applicable to hunter-harvested animals.

    Directory of Open Access Journals (Sweden)

    Nuno Santos

    Full Text Available BACKGROUND: To obtain robust epidemiological information regarding tuberculosis (TB in wildlife species, appropriate diagnostic methods need to be used. Wild boar (Sus scrofa recently emerged as a major maintenance host for TB in some European countries. Nevertheless, no data is available to evaluate TB post-mortem diagnostic methods in hunter-harvested wild boar. METHODOLOGY/PRINCIPAL FINDINGS: Six different diagnostic methods for TB were evaluated in parallel in 167 hunter-harvested wild boar. Compared to bacteriological culture, estimates of sensitivity of histopathology was 77.8%, gross pathology 72.2%, PCR for the MPB70 gene 66.7%, detection of acid-fast bacilli (AFB in tissue contact smears 55.6% and in histopathology slides 16.7% (estimated specificity was 96.7%, 100%, 100%, 94.4% and 100%, respectively. Combining gross pathology with stained smears in parallel increased estimated sensitivity to 94.4% (94.4% specificity. Four probable bacteriological culture false-negative animals were identified by Discriminant Function Analysis. Recalculating the parameters considering these animals as infected generated estimated values for sensitivity of bacteriology and histopathology of 81.8%, gross pathology 72.7%, PCR for the MPB70 gene 63.6%, detection of AFB in tissue contact smears 54.5% and in histopathology slides 13.6% (estimated specificity was 100% for gross pathology, PCR, bacteriology and detection of AFB in histopathology slides, 96.7% for histopathology and 94.4% for stained smears. CONCLUSIONS/SIGNIFICANCE: These results show that surveys for TB in wild boar based exclusively on gross pathology considerably underestimate prevalence, while combination of tests in parallel much improves sensitivity and negative predictive values. This finding should thus be considered when planning future surveys and game meat inspection schemes. Although bacteriological culture is the reference test for TB diagnosis, it can generate false

  13. "Founder crops" v. wild plants: Assessing the plant-based diet of the last hunter-gatherers in southwest Asia

    Science.gov (United States)

    Arranz-Otaegui, Amaia; González Carretero, Lara; Roe, Joe; Richter, Tobias

    2018-04-01

    The Natufian culture (c. 14.6-11.5 ka cal. BP) represents the last hunter-gatherer society that inhabited southwest Asia before the development of plant food production. It has long been suggested that Natufians based their economy on the exploitation of the wild ancestors of the Neolithic "founder crops", and that these hunter-gatherers were therefore on the "threshold to agriculture". In this work we review the available data on Natufian plant exploitation and we report new archaeobotanical evidence from Shubayqa 1, a Natufian site located in northeastern Jordan (14.6-11.5 ka cal. BP). Shubayqa 1 has produced an exceptionally large plant assemblage, including direct evidence for the continuous exploitation of club-rush tubers (often regarded as "missing foods") and other wild plants, which were probably used as food, fuel and building materials. Taking together this data we evaluate the composition of archaeobotanical assemblages (plant macroremains) from the Natufian to the Early Pre-Pottery Neolithic B (EPPNB). Natufian assemblages comprise large proportions of non-founder plant species (>90% on average), amongst which sedges, small-seeded grasses and legumes, and fruits and nuts predominate. During the Pre-Pottery Neolithic, in particular the EPPNB, the presence of "founder crops" increases dramatically and constitute up to c. 42% of the archaeobotanical assemblages on average. Our results suggest that plant exploitation strategies during the Natufian were very different from those attested during subsequent Neolithic periods. We argue that historically driven interpretations of the archaeological record have over-emphasized the role of the wild ancestors of domesticated crops previous to the emergence of agriculture.

  14. DCS Terrain Submission for Drew AR

    Data.gov (United States)

    Federal Emergency Management Agency, Department of Homeland Security — Terrain data, as defined in FEMA Guidelines and Specifications, Appendix N: Data Capture Standards, describes the digital topographic data that was used to create...

  15. "And first he drew a line"

    DEFF Research Database (Denmark)

    Graham, Brian Russell

    At the end of “Night the Seventh” of Blake’s The Four Zoas, Blake’s Los, against a background of “furious war”, takes a stance and then performs an act which might seem powerless and quaint against such a backdrop: he draws a line, beginning work consisting of lines which Enitharmon, his companion......, tinctures, as it emerges. Placing this moment in the context of the poem’s epic struggle, this paper explores the reasons for Blake’s choice of image at this juncture in the “history”, thereby making a contribution to our understanding of the opposition between form and formlessness in the narrative....

  16. Shooting history and presence of high-frequency hearing impairment in swedish hunters: A cross-sectional internet-based observational study.

    Science.gov (United States)

    Honeth, Louise; Ström, Peter; Ploner, Alexander; Bagger-Sjöbäck, Dan; Rosenhall, Ulf; Nyrén, Olof

    2015-01-01

    The aim of this cross-sectional study among Swedish hunters was to examine the association between shooting history and presence of high-frequency hearing impairment (HFHI). All hunters registered with an e-mail address in the membership roster of the Swedish Hunters' Association were invited via e-mail to a secure website with a questionnaire and an Internet-based audiometry test. Associations, expressed as prevalence ratio (PR), were multivariately modelled using Poisson regression. The questionnaire was answered by 1771 hunters (age 11-91 years), and 202 of them also completed the audiometry test. Subjective severe hearing loss was reported by 195/1771 (11%), while 23/202 (11%) exhibited HFHI upon testing with Internet-based audiometry. As many as 328/1771 (19%) had never used hearing protection during hunting. In the preceding 5 years, 785/1771 (45%), had fired >6 unprotected gunshots with hunting rifle calibers. The adjusted PR of HFHI when reporting 1-6 such shots, relative to 0, was 1.5 [95% confidence interval (CI) 1.1-2.1; P = 0.02]. We could not verify any excessive HFHI prevalence among 89 hunters reporting unprotected exposure to such gunshot noise >6 times. Nor did the total number of reported rifle shots seem to matter. These findings support the notion of a wide variation in individual susceptibility to impulse noise; that significant sound energy, corresponding to unprotected noise from hunting rifle calibers, seems to be required; that susceptible individuals may sustain irreversible damage to the inner ear from just one or a few shots; and that use of hearing protection should be encouraged from the first shot with such weapons.

  17. IMPORTANT NOTIFICATION

    CERN Multimedia

    HR Department

    2009-01-01

    Green plates, removals and importation of personal effects Please note that, as from 1 April 2009, formalities relating to K and CD special series French vehicle plates (green plates), removals and importation of personal effects into France and Switzerland will be dealt with by GS Department (Building 73/3-014, tel. 73683/74407). Importation and purchase of tax-free vehicles in Switzerland, as well as diplomatic privileges, will continue to be dealt with by the Installation Service of HR Department (Building 33/1-011, tel. 73962). HR and GS Departments

  18. Hunter disease eClinic: interactive, computer-assisted, problem-based approach to independent learning about a rare genetic disease

    Directory of Open Access Journals (Sweden)

    Moldovan Laura

    2010-10-01

    Full Text Available Abstract Background Computer-based teaching (CBT is a well-known educational device, but it has never been applied systematically to the teaching of a complex, rare, genetic disease, such as Hunter disease (MPS II. Aim To develop interactive teaching software functioning as a virtual clinic for the management of MPS II. Implementation and Results The Hunter disease eClinic, a self-training, user-friendly educational software program, available at the Lysosomal Storage Research Group (http://www.lysosomalstorageresearch.ca, was developed using the Adobe Flash multimedia platform. It was designed to function both to provide a realistic, interactive virtual clinic and instantaneous access to supporting literature on Hunter disease. The Hunter disease eClinic consists of an eBook and an eClinic. The eClinic is the interactive virtual clinic component of the software. Within an environment resembling a real clinic, the trainee is instructed to perform a medical history, to examine the patient, and to order appropriate investigation. The program provides clinical data derived from the management of actual patients with Hunter disease. The eBook provides instantaneous, electronic access to a vast collection of reference information to provide detailed background clinical and basic science, including relevant biochemistry, physiology, and genetics. In the eClinic, the trainee is presented with quizzes designed to provide immediate feedback on both trainee effectiveness and efficiency. User feedback on the merits of the program was collected at several seminars and formal clinical rounds at several medical centres, primarily in Canada. In addition, online usage statistics were documented for a 2-year period. Feedback was consistently positive and confirmed the practical benefit of the program. The online English-language version is accessed daily by users from all over the world; a Japanese translation of the program is also available. Conclusions The

  19. Hunter disease eClinic: interactive, computer-assisted, problem-based approach to independent learning about a rare genetic disease.

    Science.gov (United States)

    Al-Jasmi, Fatma; Moldovan, Laura; Clarke, Joe T R

    2010-10-25

    Computer-based teaching (CBT) is a well-known educational device, but it has never been applied systematically to the teaching of a complex, rare, genetic disease, such as Hunter disease (MPS II). To develop interactive teaching software functioning as a virtual clinic for the management of MPS II. The Hunter disease eClinic, a self-training, user-friendly educational software program, available at the Lysosomal Storage Research Group (http://www.lysosomalstorageresearch.ca), was developed using the Adobe Flash multimedia platform. It was designed to function both to provide a realistic, interactive virtual clinic and instantaneous access to supporting literature on Hunter disease. The Hunter disease eClinic consists of an eBook and an eClinic. The eClinic is the interactive virtual clinic component of the software. Within an environment resembling a real clinic, the trainee is instructed to perform a medical history, to examine the patient, and to order appropriate investigation. The program provides clinical data derived from the management of actual patients with Hunter disease. The eBook provides instantaneous, electronic access to a vast collection of reference information to provide detailed background clinical and basic science, including relevant biochemistry, physiology, and genetics. In the eClinic, the trainee is presented with quizzes designed to provide immediate feedback on both trainee effectiveness and efficiency. User feedback on the merits of the program was collected at several seminars and formal clinical rounds at several medical centres, primarily in Canada. In addition, online usage statistics were documented for a 2-year period. Feedback was consistently positive and confirmed the practical benefit of the program. The online English-language version is accessed daily by users from all over the world; a Japanese translation of the program is also available. The Hunter disease eClinic employs a CBT model providing the trainee with realistic

  20. City Life in the Midst of the Forest: a Punan Hunter-Gatherer's Vision of Conservation and Development

    Directory of Open Access Journals (Sweden)

    Patrice Levang

    2007-06-01

    Full Text Available The Punan Tubu, a group of hunter-gatherers in East-Kalimantan, Indonesia, are used to illustrate the very real trade-offs that are made between conservation and development. This group has undergone various forms of resettlement in the 20th century, to the point that some are now settled close to the city of Malinau whereas others remain in remote locations in the upper Tubu catchment. This study is based on several years of ethnographic and household analysis. The Punan clearly favor both conservation and development. In the city, the Punan benefit from all positive effects of development. Child and infant mortality rates are very low, and illiteracy has been eradicated among the younger generation. However, the Punan complain that nothing in town is free. The older generation, in particular, resents the loss of Punan culture. Because of frustration and unemployment, young people often succumb to alcoholism and drug addiction. The Punan do not want to choose between conservation and development, between forest life and city life. They want to benefit from the advantages of both locations, to enjoy both free forest products and the positive aspects of modern life, to go wild boar hunting in the morning and watch television in the evening. In short, they want to enjoy city life in the midst of the forest. The same kind of contradiction has led to identity problems. They want to uphold the traditional life of the hunter-gatherer, but at the same time they reject marginalization and seek integration into the larger society. In short, they want integration without loss of identity. The settlement of Sule-Pipa illustrates how some groups have dealt with the contradiction more successfully. Thanks to good organization and charitable donations, they have secured educational facilities and basic health care, and marketing costs are reduced by collectively organized road and river transportation. The economy of the village is thriving, mainly because of

  1. 1500-year Record of trans-Pacific Dust Flux collected from the Denali Ice Core, Mt. Hunter, Alaska

    Science.gov (United States)

    Saylor, P. L.; Osterberg, E. C.; Koffman, B. G.; Winski, D.; Ferris, D. G.; Kreutz, K. J.; Wake, C. P.; Handley, M.; Campbell, S. W.

    2016-12-01

    Mineral dust aerosols are a critical component of the climate system through their influence on atmospheric radiative forcing, ocean productivity, and surface albedo. Dust aerosols derived from Asian deserts are known to reach as far as Europe through efficient transport in the upper tropospheric westerlies. While centennially-to-millennially resolved Asian dust records exist over the late Holocene from North Pacific marine sediment cores and Asian loess deposits, a high-resolution (sub-annual to decadal) record of trans-Pacific dust flux will significantly improve our understanding of North Pacific dust-climate interactions and provide paleoclimatological context for 20th century dust activity. Here we present an annually resolved 1500-year record of trans-Pacific dust transport based on chemical and physical dust measurements in parallel Alaskan ice cores (208 m to bedrock) collected from the summit plateau of Mt. Hunter in Denali National Park. The cores were sampled at high resolution using a continuous melter system with discrete analyses for major ions (Dionex ion chromatograph), trace elements (Element2 inductively coupled plasma mass spectrometer), and stable water isotope ratios (Picarro laser ringdown spectroscopy), and continuous flow analysis for dust concentration and size distribution (Klotz Abakus). We compare the ice core dust record to instrumental aerosol stations, satellite observations, and dust model data from the instrumental period, and evaluate climatic controls on dust emission and trans-Pacific transport using climate reanalysis data, to inform dust-climate relationships over the past 1500 years. Physical particulate and chemical data demonstrate remarkable fidelity at sub-annual resolution, with both displaying a strong springtime peak consistent with periods of high dust activity over Asian desert source regions. Preliminary results suggest volumetric mode typically ranges from 4.5 - 6.5 um, with a mean value of 5.5 um. Preliminary

  2. Importance classification

    International Nuclear Information System (INIS)

    Mizumachi, Wataru; Kobayashi, Masahide

    2008-01-01

    Conventionally, the design of a nuclear reactor has been performed from a viewpoint of a safety function and the importance on earthquake-proof on the basis of not giving off the mainly included radioactivity outside. In this Niigataken-Chuetsuoki earthquake, there is almost no damage to the system, components and structure on safe also in the earthquake beyond assumption, and the validity of the design was checked. But, the situation peculiar to a big earthquake was also generated. The emergency plan room which should serve as a connection center with the exterior was not able to open a door and use at the beginning. Fire-extinguishing system piping fractured and self-defense fire fighting was not made. And so on. Discussion from the following three viewpoints was performed. 1st: The importance from a viewpoint which should maintain a function also with the disaster in case of an earthquake like an emergency plan room etc. 2nd: In the earthquake, since the safe system and un-safe system was influenced, the importance from a viewpoint which may have influence safely inquired when the un-safe system broke down. 3rd: Although it was not directly related safely, discussion from a viewpoint which influences fear of insecurity, such as taking out smoke, for example, was performed (author)

  3. Operations Charioteer, Musketeer, Touchstone, Cornerstone, Aqueduct, Sculpin and Julin. Tests Mill Yard, Diamond Beech, Mighty Oak, Middle Note Mission Ghost, Mission Cyber, Misty Echo, Disko Elm, Mineral Quarry, Distant Zenith, Diamond Fortune, and Hunters Trophy

    National Research Council Canada - National Science Library

    Schoengold, Carole

    1999-01-01

    ...; Tests MILL YARD, DIAMOND BEECH, MIGHTY OAK, MIDDLE NOTE, MISSION GHOST, MISSION CYBER, MISTY ECHO, DISKO ELM, MINERAL QUARRY, DISTANT ZENITH, DIAMOND FORTUNE, and HUNTERS TROPHY, 9 October 1985 to 18 September 1992...

  4. Clinical response to long term enzyme replacement treatment in children, adolescent and adult patients with Hunter syndrome.

    Science.gov (United States)

    Dalmau Serra, Jaime; Vitoria Miñana, Isidro; Calderón Fernández, Rafael; Cortell Aznar, Isidoro

    2015-11-06

    Since enzyme replacement treatment (ERT) with idursulfase is available for Hunter syndrome (HS; mucopolysaccharidosis type II), for the first time, disease progression can be limited and organ damage reduced or prevented. We described retrospectively the clinical evolution of eight HS males, treated with ERT and followed in routine clinical practice in Hospital Infantil La Fe (Valencia, Spain). We studied three children, three adolescents and two adults. Time from diagnosis to ERT ranged from 13.7 to 0.2 years, and duration of ERT ranged from 24 to 77.1 months. From the start of ERT, weight and height increased in children and adolescents and remained stable in adults. Glycosaminoglycans (GAG) decreased in all patients; in patient 5 (aged 23 years), we observed the highest reduction (86%) with recovery of carpal tunnel syndrome, splenomegaly and a decrease in nocturnal oxygen dependence. Our results show that ERT improve respiratory impairment and organomegalies and decrease GAGs levels in all patients including children, adolescent and adults. While cardiac manifestations and facial features stabilized, responses in other parameters were heterogeneous. Copyright © 2015 Elsevier España, S.L.U. All rights reserved.

  5. Poachers and Poverty: Assessing Objective and Subjective Measures of Poverty among Illegal Hunters Outside Ruaha National Park, Tanzania

    Directory of Open Access Journals (Sweden)

    Eli J Knapp

    2017-01-01

    Full Text Available Illegal hunters in Africa may be making rational decisions about the hunting activities they partake in. These decisions could be linked to their socioeconomic status and the livelihood opportunities available to them. In particular, poverty is widely considered the leading driver that causes a household's inhabitants to take up poaching in protected areas. Programs aiming to protect vulnerable wildlife populations by mitigating poaching have historically relied upon income-based poverty metrics in efforts to reduce regional poverty and incentivise local inhabitants to discontinue poaching activities. Because such data sets that deal with poachers directly are rare, assumptions about the role of poverty, and the extent of poverty, that drives poaching have been hard to test. This study uses a unique sample of 173 self-admitted poachers living in villages adjacent to Ruaha National Park in Tanzania to explore the influence of poverty on poaching. Results indicated high demographic and household economy heterogeneity among poaching households. Capability deprivation examined more subjective measures of poverty and revealed that poachers are strongly motivated by the need to improve their incomes, but are not necessarily the poorest of the poor.

  6. Planet hunters. VI. An independent characterization of KOI-351 and several long period planet candidates from the Kepler archival data

    International Nuclear Information System (INIS)

    Schmitt, Joseph R.; Wang, Ji; Fischer, Debra A.; Moriarty, John C.; Boyajian, Tabetha S.; Jek, Kian J.; LaCourse, Daryll; Omohundro, Mark R.; Winarski, Troy; Goodman, Samuel Jon; Jebson, Tony; Schwengeler, Hans Martin; Paterson, David A.; Schwamb, Megan E.; Lintott, Chris; Simpson, Robert; Lynn, Stuart; Smith, Arfon M.; Parrish, Michael; Schawinski, Kevin

    2014-01-01

    We report the discovery of 14 new transiting planet candidates in the Kepler field from the Planet Hunters citizen science program. None of these candidates overlapped with Kepler Objects of Interest (KOIs) at the time of submission. We report the discovery of one more addition to the six planet candidate system around KOI-351, making it the only seven planet candidate system from Kepler. Additionally, KOI-351 bears some resemblance to our own solar system, with the inner five planets ranging from Earth to mini-Neptune radii and the outer planets being gas giants; however, this system is very compact, with all seven planet candidates orbiting ≲ 1 AU from their host star. A Hill stability test and an orbital integration of the system shows that the system is stable. Furthermore, we significantly add to the population of long period transiting planets; periods range from 124 to 904 days, eight of them more than one Earth year long. Seven of these 14 candidates reside in their host star's habitable zone.

  7. Access to Electric Light Is Associated with Shorter Sleep Duration in a Traditionally Hunter-Gatherer Community.

    Science.gov (United States)

    de la Iglesia, Horacio O; Fernández-Duque, Eduardo; Golombek, Diego A; Lanza, Norberto; Duffy, Jeanne F; Czeisler, Charles A; Valeggia, Claudia R

    2015-08-01

    Access to electric light might have shifted the ancestral timing and duration of human sleep. To test this hypothesis, we studied two communities of the historically hunter-gatherer indigenous Toba/Qom in the Argentinean Chaco. These communities share the same ethnic and sociocultural background, but one has free access to electricity while the other relies exclusively on natural light. We fitted participants in each community with wrist activity data loggers to assess their sleep-wake cycles during one week in the summer and one week in the winter. During the summer, participants with access to electricity had a tendency to a shorter daily sleep bout (43 ± 21 min) than those living under natural light conditions. This difference was due to a later daily bedtime and sleep onset in the community with electricity, but a similar sleep offset and rise time in both communities. In the winter, participants without access to electricity slept longer (56 ± 17 min) than those with access to electricity, and this was also related to earlier bedtimes and sleep onsets than participants in the community with electricity. In both communities, daily sleep duration was longer during the winter than during the summer. Our field study supports the notion that access to inexpensive sources of artificial light and the ability to create artificially lit environments must have been key factors in reducing sleep in industrialized human societies. © 2015 The Author(s).

  8. If Hunters End Up in the Emergency Room: A Retrospective Analysis of Hunting Injuries in a Swiss Emergency Department

    Directory of Open Access Journals (Sweden)

    Valentina Bestetti

    2015-01-01

    Full Text Available Aim. to characterize the mechanisms, patterns, and outcomes of nonfatal hunting-related injuries in patients presenting to Bern University Hospital, Switzerland, and compare these to reports of hunting injuries worldwide. Methods. patients presenting with hunting-related injuries to the Emergency Department at Bern University hospital from 2000 to 2014 were identified by retrospectively searching the department database using the keyword “hunt.” Each case was analyzed in terms of the patient age and gender, the mechanism and pattern of injury, and management and patient follow-up. Results. 19 patients were identified. 16 were male with a mean age of 50 years (range: 16–74. Mechanisms of injury included firearm-related injuries, falls, and knife wounds. The most common patterns of injury were head injuries (7, followed by injuries to the upper (5 or lower limb (5 and trunk (2. Over half of the patients were admitted, and nine required emergency surgery. Conclusion. Nonfatal hunting accidents in Bern, Switzerland, are largely caused by firearms and falls and tend to occur in male hunters with a mean age of 50 years. The most common patterns of injury are orthopedic and head injuries, often requiring surgery. These findings are consistent with international studies of nonfatal hunting accidents.

  9. ISOLASI DAN IDENTIFIKASI SENYAWA KIMIA SERTA UJI AKTIVITAS ANTICANDIDAISIS SERBUK DAUN SIRIH DUDUK (Piper sarmentosum Roxb. Ex Hunter

    Directory of Open Access Journals (Sweden)

    Suwandri Suwandri

    2006-11-01

    Full Text Available Sirih duduk or Piper sarmentosum Roxb. ex Hunter have been long used the people in Indonesia for traditional medicine to cure various diseases. One of them was used to treat fungoid diseases. This research was aimed to examine the anticandidaisis activity from extract of P. sarmentosum leaves and to isolate and identify the anticandidaisis compounds from P. sarmentosum leaves. The isolation bioactive compounds of P. sarmentosumleaves was performed by extraction the powder of P. sarmentosum leaves using methanol and the bioactivity tests were performed against Candida albicans. The methanol extracts was then fractionated using organic solvents such as n-hexane, benzene, chloroform, and ethyl acetate. Identification of the bioactive compounds was carried out using ultraviolet-visible spectrometry, fourier transform infra red spectrometry and gas chromatography-mass spectrometry. The result showed that the chloroform fraction of methanol extract of P. sarmentosum leaves have activity against C. albicans. The fractionation was performed by coloumn chromatography using n-hexane-ethyl acetate(1:1 eluent. A bioactive compound of sinamic acid derivative was 4-ethoxy-2-hidroxy-3,5-dimethoxy sinamic acid could be purely isolated.

  10. ISOLASI DAN IDENTIFIKASI SENYAWA KIMIA SERTA UJI AKTIVITAS ANTICANDIDAISIS SERBUK DAUN SIRIH DUDUK (Piper sarmentosum Roxb. Ex Hunter

    Directory of Open Access Journals (Sweden)

    Suwandri

    2006-11-01

    Full Text Available Sirih duduk or Piper sarmentosum Roxb. ex Hunter have been long used the people in Indonesia for traditional medicine to cure various diseases. One of them was used to treat fungoid diseases. This research was aimed to examine the anticandidaisis activity from extract of P. sarmentosum leaves and to isolate and identify the anticandidaisis compounds from P. sarmentosum leaves. The isolation bioactive compounds of P. sarmentosum leaves was performed by extraction the powder of P. sarmentosum leaves using methanol and the bioactivity tests were performed against Candida albicans. The methanol extracts was then fractionated using organic solvents such as n-hexane, benzene, chloroform, and ethyl acetate. Identification of the bioactive compounds was carried out using ultraviolet-visible spectrometry, fourier transform infra red spectrometry and gas chromatography-mass spectrometry. The result showed that the chloroform fraction of methanol extract of P. sarmentosum leaves have activity against C. albicans. The fractionation was performed by coloumn chromatography using n-hexane-ethyl acetate(1:1 eluent. A bioactive compound of sinamic acid derivative was 4-ethoxy-2-hidroxy-3,5-dimethoxy sinamic acid could be purely isolated.

  11. Preliminary assessment report for Army Aviation Support Facility No. 3, Installation 13307, Hunter Army Airfield, Savannah, Georgia

    International Nuclear Information System (INIS)

    Kolpa, R.; Smith, K.

    1993-07-01

    This report presents the results of the preliminary assessment (PA) conducted by Argonne National Laboratory at the Georgia Army National Guard property located on Hunter Army Airfield (HAA) near Savannah, Georgia, known as Army Aviation Support Facility (AASF) No. 3. Preliminary assessments of federal facilities are being conducted to compile the information necessary for completing preremedial activities and to provide a basis for establishing corrective actions in response to releases of hazardous substances. The principal objective of the PA is to characterize the site accurately and determine the need for further action by examining site activities, types and quantities of hazardous substances utilized, the nature and amounts of wastes generated or stored at the facility, and potential pathways by which contamination could affect public health and the environment. This PA satisfies, for the AASF No. 3 property, requirements of the Department of Defense Installation Restoration Program (IRP). The scope of this assessment is limited to the facilities and past activities contained within the area now occupied by AASF No. 3. However, this assessment report is intended to be read in conjunction with a previous IRP assessment of HAA completed in 1992 (USATHAMA 1992) and to provide comprehensive information on AASF No. 3 for incorporation with information contained in that previous assessment for the entirety of HAA

  12. Quantitative autoradiographic localization of cholecystokinin receptors in rat and guinea pig brain using 125I-Bolton-Hunter-CCK8

    International Nuclear Information System (INIS)

    Niehoff, D.L.

    1989-01-01

    The autoradiographic localization of receptors for the brain-gut peptide cholecystokinin (CCK) has shown differences in receptor distribution between rat and guinea pig brain. However the full anatomical extent of the differences has not been determined quantitatively. In the present study, 125 I-Bolton-Hunter-CCK8 ( 125 I-BH-CCK8) was employed in a comparative quantitative autoradiographic analysis of the distribution of CCK receptors in these two species. The pharmacological profile of 125 I-BH-CCK8 binding in guinea pig forebrain sections was comparable to those previously reported for rat and human. Statistically significant differences in receptor binding between rat and guinea pig occurred in olfactory bulb, caudate-putamen, amygdala, several cortical areas, ventromedial hypothalamus, cerebellum, and a number of midbrain and brainstem nuclei. The results of this study confirm the presence of extensive species-specific variation in the distribution of CCK receptors, suggesting possible differences in the physiological roles of this peptide in different mammalian species

  13. Preliminary assessment report for Army Aviation Support Facility No. 3, Installation 13307, Hunter Army Airfield, Savannah, Georgia. Installation Restoration Program

    Energy Technology Data Exchange (ETDEWEB)

    Kolpa, R.; Smith, K.

    1993-07-01

    This report presents the results of the preliminary assessment (PA) conducted by Argonne National Laboratory at the Georgia Army National Guard property located on Hunter Army Airfield (HAA) near Savannah, Georgia, known as Army Aviation Support Facility (AASF) No. 3. Preliminary assessments of federal facilities are being conducted to compile the information necessary for completing preremedial activities and to provide a basis for establishing corrective actions in response to releases of hazardous substances. The principal objective of the PA is to characterize the site accurately and determine the need for further action by examining site activities, types and quantities of hazardous substances utilized, the nature and amounts of wastes generated or stored at the facility, and potential pathways by which contamination could affect public health and the environment. This PA satisfies, for the AASF No. 3 property, requirements of the Department of Defense Installation Restoration Program (IRP). The scope of this assessment is limited to the facilities and past activities contained within the area now occupied by AASF No. 3. However, this assessment report is intended to be read in conjunction with a previous IRP assessment of HAA completed in 1992 (USATHAMA 1992) and to provide comprehensive information on AASF No. 3 for incorporation with information contained in that previous assessment for the entirety of HAA.

  14. Unconventional imports

    International Nuclear Information System (INIS)

    Yamaguchi, N.D.

    2001-01-01

    This article focuses on bitumens and bitumen products from Canadian oil sands and explores how they will affect the Canadian oil industry and the US refining industry. The falling production of crude, the growing demand for it, and the stagnating refining capacity in the US are reported, and Canadian and Mexican exports to the US, the definition of bitumens and bitumen quality, and the position of Canada as world leader in bitumen resources are considered. Bitumen production techniques, sales of bitumens and synthetic crude, the production outlook, and the quality and refining of bitumen and synthetic crude are examined. Plots illustrating North American crude refining capacity, production and demand for 1980-2000; US crude imports from Canada and Mexico (1981-2000), world proven oil reserves (2001), world bitumen resources, and Canadian oil production (1998-2000) are provided. Details of the composition of crudes and bitumens, and recent synthetic crude production are tabulated

  15. Linking hunter knowledge with forest change to understand changing deer harvest opportunities in intensively logged landscapes

    Science.gov (United States)

    Tidd J. Brinkman; Terry Chapin; Gary Kofinas; David K. Person

    2009-01-01

    The effects of landscape changes caused by intensive logging on the availability of wild game are important when the harvest of wild game is a critical cultural practice, food source, and recreational activity. We assessed the influence of extensive industrial logging on the availability of wild game by drawing on local knowledge and ecological science to evaluate the...

  16. An examination of gender bias on the eighth-grade MEAP science test as it relates to the Hunter Gatherer Theory of Spatial Sex Differences

    Science.gov (United States)

    Armstrong-Hall, Judy Gail

    The purpose of this study was to apply the Hunter-Gatherer Theory of sex spatial skills to responses to individual questions by eighth grade students on the Science component of the Michigan Educational Assessment Program (MEAP) to determine if sex bias was inherent in the test. The Hunter-Gatherer Theory on Spatial Sex Differences, an original theory, that suggested a spatial dimorphism concept with female spatial skill of pattern recall of unconnected items and male spatial skills requiring mental movement. This is the first attempt to apply the Hunter-Gatherer Theory on Spatial Sex Differences to a standardized test. An overall hypothesis suggested that the Hunter-Gatherer Theory of Spatial Sex Differences could predict that males would perform better on problems involving mental movement and females would do better on problems involving the pattern recall of unconnected items. Responses to questions on the 1994-95 MEAP requiring the use of male spatial skills and female spatial skills were analyzed for 5,155 eighth grade students. A panel composed of five educators and a theory developer determined which test items involved the use of male and female spatial skills. A MANOVA, using a random sample of 20% of the 5,155 students to compare male and female correct scores, was statistically significant, with males having higher scores on male spatial skills items and females having higher scores on female spatial skills items. Pearson product moment correlation analyses produced a positive correlation for both male and female performance on both types of spatial skills. The Hunter-Gatherer Theory of Spatial Sex Differences appears to be able to predict that males could perform better on the problems involving mental movement and females could perform better on problems involving the pattern recall of unconnected items. Recommendations for further research included: examination of male/female spatial skill differences at early elementary and high school levels to

  17. Multi-scalar insights into hunter-gatherer-farmer-fisher subsistence and diet

    DEFF Research Database (Denmark)

    Philippsen, Bente

    . Establishing the relative importance of these varied resources in the diets of PWC people, however, is challenged by poor preservation of bone assemblages, poor chronological resolution and the diversity of subsistence strategies on the different sites. As part of the multidisciplinary project “CONTACT...... residues, respectively. We focus our discussion on the site Kainsbakke on Djursland, Denmark. Furthermore, we present isotope data from a series of other sites around the Kattegat. Our integrated data provide a sound baseline for calculating human diets from isotope ratios of human bones. Furthermore...

  18. Pottery use by early Holocene hunter-gatherers of the Korean peninsula closely linked with the exploitation of marine resources

    Science.gov (United States)

    Shoda, Shinya; Lucquin, Alexandre; Ahn, Jae-ho; Hwang, Chul-joo; Craig, Oliver E.

    2017-08-01

    The earliest pottery on the Korean peninsula dates to the early Holocene, notably later than other regions of East Asia, such as Japan, the Russian Far East and Southern China. To shed light on the function of such early Korean pottery and to understand the motivations for its adoption, organic residue analysis was conducted on pottery sherds and adhered surface deposit on the wall of pottery vessels (foodcrusts) excavated from the Sejuk shell midden (7.7-6.8ka calBP) on the southeastern coast and the Jukbyeon-ri site (7.9-6.9ka calBP) on the eastern coast of the Korean peninsula, that represents the earliest pottery assemblages with reliable radiocarbon dates. Through chemical and isotopic residue analysis, we conclude that the use of pottery at these sites was oriented towards marine resources, supported by lipid biomarkers typical of aquatic organisms and stable carbon isotope values that matched authentic marine reference fats. The findings contrast with other archaeological evidence, which shows that a wider range of available food resources were exploited. Therefore, we conclude pottery was used selectively for processing aquatic organisms perhaps including the rendering of aquatic oils for storage. Early pottery use in Korea is broadly similar to other prehistoric temperate hunter-gatherers, such as in Japan, northern Europe and northern America. However, it is also notable that elaborately decorated red burnished pottery excavated from isolated location at the Jukbyeon-ri site had a different usage pattern, which indicates that division of pottery use by vessel form was established even at this early stage.

  19. Metabolic and physiologic effects from consuming a hunter-gatherer (Paleolithic)-type diet in type 2 diabetes.

    Science.gov (United States)

    Masharani, U; Sherchan, P; Schloetter, M; Stratford, S; Xiao, A; Sebastian, A; Nolte Kennedy, M; Frassetto, L

    2015-08-01

    The contemporary American diet figures centrally in the pathogenesis of numerous chronic diseases--'diseases of civilization'--such as obesity and diabetes. We investigated in type 2 diabetes whether a diet similar to that consumed by our pre-agricultural hunter-gatherer ancestors ('Paleolithic' type diet) confers health benefits. We performed an outpatient, metabolically controlled diet study in type 2 diabetes patients. We compared the findings in 14 participants consuming a Paleo diet comprising lean meat, fruits, vegetables and nuts, and excluding added salt, and non-Paleolithic-type foods comprising cereal grains, dairy or legumes, with 10 participants on a diet based on recommendations by the American Diabetes Association (ADA) containing moderate salt intake, low-fat dairy, whole grains and legumes. There were three ramp-up diets for 7 days, then 14 days of the test diet. Outcomes included the following: mean arterial blood pressure; 24-h urine electrolytes; hemoglobin A1c and fructosamine levels; insulin resistance by euglycemic hyperinsulinemic clamp and lipid levels. Both groups had improvements in metabolic measures, but the Paleo diet group had greater benefits on glucose control and lipid profiles. Also, on the Paleo diet, the most insulin-resistant subjects had a significant improvement in insulin sensitivity (r = 0.40, P = 0.02), but no such effect was seen in the most insulin-resistant subjects on the ADA diet (r = 0.39, P = 0.3). Even short-term consumption of a Paleolithic-type diet improved glucose control and lipid profiles in people with type 2 diabetes compared with a conventional diet containing moderate salt intake, low-fat dairy, whole grains and legumes.

  20. Hunter-gatherer dental pathology: Do historic accounts of Aboriginal Australians correspond to the archeological record of dental disease?

    Science.gov (United States)

    Littleton, Judith

    2018-03-01

    Studies of hunter-gatherer oral pathology, particularly in Australia, often focus upon dental wear and caries or assume that historic studies of Aboriginal people reflect the precontact past. Consequently the range of population variation has been underestimated. In this paper dental pathology from human remains from Roonka are compared with a model of dental pathology derived from historic studies. The aim is to identify aspects of dental pathology indicative of regional or intra-population diversity. Adult dentitions (n = 115) dating from the mid to late Holocene were recorded for the following conditions: dental wear, caries, periapical voids, calculus, periodontal disease and antemortem tooth loss. Statistical analysis was used to identify patterns of dental pathology and to identify causal relationships between conditions. Dental wear is marked while dental caries rates are extremely low. Other indications of dental pathology are uncommon (<7% of teeth affected). Temporal heterogeneity is apparent: there are 3 young adults with caries who died in the postcontact period. There is also a small group of middle age to old adults with disproportionate abscessing and pulp exposure who may represent temporal variation or heterogeneity in individual frailty. The results confirm dental wear as the major cause of dental pathology in this group and that, at a general level, historic accounts do correspond with this archeological sample. However, intra-sample heterogeneity is apparent while 2 dental conditions, calculus and periodontal disease, along with the pattern of sex differences deviate from expectation, demonstrating that to identify regional variation attention needs to be paid to the dentoalveolar complex as a whole. © 2017 Wiley Periodicals, Inc.

  1. The resilience of postglacial hunter-gatherers to abrupt climate change.

    Science.gov (United States)

    Blockley, Simon; Candy, Ian; Matthews, Ian; Langdon, Pete; Langdon, Cath; Palmer, Adrian; Lincoln, Paul; Abrook, Ashley; Taylor, Barry; Conneller, Chantal; Bayliss, Alex; MacLeod, Alison; Deeprose, Laura; Darvill, Chris; Kearney, Rebecca; Beavan, Nancy; Staff, Richard; Bamforth, Michael; Taylor, Maisie; Milner, Nicky

    2018-05-01

    Understanding the resilience of early societies to climate change is an essential part of exploring the environmental sensitivity of human populations. There is significant interest in the role of abrupt climate events as a driver of early Holocene human activity, but there are very few well-dated records directly compared with local climate archives. Here, we present evidence from the internationally important Mesolithic site of Star Carr showing occupation during the early Holocene, which is directly compared with a high-resolution palaeoclimate record from neighbouring lake beds. We show that-once established-there was intensive human activity at the site for several hundred years when the community was subject to multiple, severe, abrupt climate events that impacted air temperatures, the landscape and the ecosystem of the region. However, these results show that occupation and activity at the site persisted regardless of the environmental stresses experienced by this society. The Star Carr population displayed a high level of resilience to climate change, suggesting that postglacial populations were not necessarily held hostage to the flickering switch of climate change. Instead, we show that local, intrinsic changes in the wetland environment were more significant in determining human activity than the large-scale abrupt early Holocene climate events.

  2. Measuring local depletion of terrestrial game vertebrates by central-place hunters in rural Amazonia.

    Directory of Open Access Journals (Sweden)

    Mark I Abrahams

    Full Text Available The degree to which terrestrial vertebrate populations are depleted in tropical forests occupied by human communities has been the subject of an intense polarising debate that has important conservation implications. Conservation ecologists and practitioners are divided over the extent to which community-based subsistence offtake is compatible with ecologically functional populations of tropical forest game species. To quantify depletion envelopes of forest vertebrates around human communities, we deployed a total of 383 camera trap stations and 78 quantitative interviews to survey the peri-community areas controlled by 60 semi-subsistence communities over a combined area of over 3.2 million hectares in the Médio Juruá and Uatumã regions of Central-Western Brazilian Amazonia. Our results largely conform with prior evidence that hunting large-bodied vertebrates reduces wildlife populations near settlements, such that they are only found at a distance to settlements where they are hunted less frequently. Camera trap data suggest that a select few harvest-sensitive species, including lowland tapir, are either repelled or depleted by human communities. Nocturnal and cathemeral species were detected relatively more frequently in disturbed areas close to communities, but individual species did not necessarily shift their activity patterns. Group biomass of all species was depressed in the wider neighbourhood of urban areas rather than communities. Interview data suggest that species traits, especially group size and body mass, mediate these relationships. Large-bodied, large-group-living species are detected farther from communities as reported by experienced informants. Long-established communities in our study regions have not "emptied" the surrounding forest. Low human population density and low hunting offtake due to abundant sources of alternative aquatic protein, suggest that these communities represent a best-case scenario for sustainable

  3. Measuring local depletion of terrestrial game vertebrates by central-place hunters in rural Amazonia

    Science.gov (United States)

    Peres, Carlos A.; Costa, Hugo C. M.

    2017-01-01

    The degree to which terrestrial vertebrate populations are depleted in tropical forests occupied by human communities has been the subject of an intense polarising debate that has important conservation implications. Conservation ecologists and practitioners are divided over the extent to which community-based subsistence offtake is compatible with ecologically functional populations of tropical forest game species. To quantify depletion envelopes of forest vertebrates around human communities, we deployed a total of 383 camera trap stations and 78 quantitative interviews to survey the peri-community areas controlled by 60 semi-subsistence communities over a combined area of over 3.2 million hectares in the Médio Juruá and Uatumã regions of Central-Western Brazilian Amazonia. Our results largely conform with prior evidence that hunting large-bodied vertebrates reduces wildlife populations near settlements, such that they are only found at a distance to settlements where they are hunted less frequently. Camera trap data suggest that a select few harvest-sensitive species, including lowland tapir, are either repelled or depleted by human communities. Nocturnal and cathemeral species were detected relatively more frequently in disturbed areas close to communities, but individual species did not necessarily shift their activity patterns. Group biomass of all species was depressed in the wider neighbourhood of urban areas rather than communities. Interview data suggest that species traits, especially group size and body mass, mediate these relationships. Large-bodied, large-group-living species are detected farther from communities as reported by experienced informants. Long-established communities in our study regions have not “emptied” the surrounding forest. Low human population density and low hunting offtake due to abundant sources of alternative aquatic protein, suggest that these communities represent a best-case scenario for sustainable hunting of

  4. Ethnobotanical Study of Medicinal Plants Used as Anti-Obesity Remedies in the Nomad and Hunter Communities of Burkina Faso

    Directory of Open Access Journals (Sweden)

    Dramane Pare

    2016-04-01

    Full Text Available Background: Obesity is a global epidemic that affects both developed and developing countries. According to World Health Organization (WHO, in 2014, over 1.9 billion adults were overweight. Burkina Faso, like other countries, faces the problem of obesity, with a prevalence of 7.3%. The main cause is excessive intake of caloric foods combined with low physical activity, although genetic, endocrine and environmental influences (pollution can sometimes be predisposing factors. This metabolic imbalance often leads to multiple pathologies (heart failure, Type II diabetes, cancers, etc.. Drugs have been developed for the treatment of these diseases; but in addition to having many side effects, locally these products are not economically accessible to the majority of the population. Burkina Faso, like the other countries bordering the Sahara, has often been confronted in the past with periods of famine during which populations have generally used anorectic plants to regulate their food needs. This traditional ethnobotanical knowledge has not been previously investigated. An ethnobotanical survey was conducted in Burkina Faso in the provinces of Seno (North and Nayala (Northwest to list the plants used by local people as an anorectic and/or fort weight loss. Methods: The survey, conducted in the two provinces concerned traditional healers, herbalists, hunters, nomads and resourceful people with knowledge of plants. It was conducted over a period of two months and data were collected following a structured interview with the respondents. The approach was based on dialogue in the language of choice of the respondent and the use of a questionnaire. The data have been structured and then statistically analyzed. Results: The fifty-five (55 respondents of the survey were aged between 40 and 80 years. Sixty-one (61 plant species, belonging to thirty-one (31 families were listed as appetite suppressants and/or for their anti-obesity properties. The main

  5. Development of idursulfase therapy for mucopolysaccharidosis type II (Hunter syndrome: the past, the present and the future

    Directory of Open Access Journals (Sweden)

    Whiteman DAH

    2017-08-01

    Full Text Available David AH Whiteman,* Alan Kimura* Research & Development, Shire Human Genetic Therapies, Inc., Lexington, MA, USA *These authors contributed equally to this work Abstract: Mucopolysaccharidosis type II (MPS II; Hunter syndrome; OMIM 309900 is a rare, multisystemic, progressive lysosomal storage disease caused by deficient activity of the iduronate-2-sulfatase (I2S enzyme. Accumulation of the glycosaminoglycans dermatan sulfate and heparan sulfate results in a broad range of disease manifestations that are highly variable in presentation and severity; notably, approximately two-thirds of individuals are affected by progressive central nervous system involvement. Historically, management of this disease was palliative; however, during the 1990s, I2S was purified to homogeneity for the first time, leading to cloning of the corresponding gene and offering a means of addressing the underlying cause of MPS II using enzyme replacement therapy (ERT. Recombinant I2S (idursulfase was produced for ERT using a human cell line and was shown to be indistinguishable from endogenous I2S. Preclinical studies utilizing the intravenous route of administration provided valuable insights that informed the design of the subsequent clinical studies. The pivotal Phase II/III clinical trial of intravenous idursulfase (Elaprase®; Shire, Lexington, MA, USA demonstrated improvements in a range of clinical parameters; based on these findings, intravenous idursulfase was approved for use in patients with MPS II in the USA in 2006 and in Europe and Japan in 2007. Evidence gained from post-approval programs has helped to improve our knowledge and understanding of management of patients with the disease; as a result, idursulfase is now available to young pediatric patients, and in some countries patients have the option to receive their infusions at home. Although ERT with idursulfase has been shown to improve somatic signs and symptoms of MPS II, the drug does not cross the

  6. THE HUNTER OF MAN

    African Journals Online (AJOL)

    as 1755, in which year the British Government, licking their wounds after an ... were adept at sniping from behind rocks and any .... ing rifles in the world, incredibly had no effective .... awarded third prize for the above contribution to the Military.

  7. Colegio Hunter. Nueva York

    Directory of Open Access Journals (Sweden)

    Breuer, Marcel

    1960-12-01

    Full Text Available En marcado contraste con las edificaciones existentes del Colegio, han sido construidos dos nuevos elementos independientes, pero enlazados entre sí, destinados, respectivamente, a biblioteca y a clases. El estilo gótico tradicional, grave y estrecho que muestran los pabellones primitivos y la línea escueta, simplista, limpia de los dos prismas nuevos, juegan una brillante y notable armonía por contraste, cuyo éxito se debe a un cuidado estudio general y a una composición esmerada, en cuanto a masas, línea y materiales se refiere. Estos últimos, con sus colores característicos; son los mismos que predominan en las fachadas del Colegio: piedra caliza, piedra natural y ladrillo tostado.

  8. Guerrilla Hunter Killer Smartbook

    Science.gov (United States)

    2009-07-04

    down the Host Nation Government vs . GH/K views by opposing sides. Observing the model becomes convoluted unless the relationship between these two...be measured only by land ownership , but by area of influence to where human needs can be marked by spheres of influence. Concentration inside of... franchisement amongst the populace if the efforts of external advisors and civil organizations (Coalition Forces), the Host Nation Government, or even the

  9. Middle and Late Holocene hunter-gatherers in East Central Europe: changing paradigms of the ‘non-Neolithic’ way of life

    Directory of Open Access Journals (Sweden)

    Marek Nowak

    2007-12-01

    Full Text Available According to traditional views, the main reason for ‘demesolithisation’ in East Central Europe was the spread of the Neolithic oecumene, particularly from c. 4000 BC. Simultaneously, the disintegrated Late Mesolithic world gradually underwent typological unification, and finally reached the stage that is sometimes described as pre-Neolithic. However, we definitely have to bear in mind that as a matter of fact we deal only with the ‘history’ of archaeological artefacts that are treated as typical attributes of hunter-gatherers. The analyses of chronological, technological, settlement, economic, and social data referring to foragers of East Central Europe demonstrate that the quantitative decrease and changes of their archaeological attributes in the fifth, fourth, and third millennia were not connected with a profound reorientation of their spatial and ideological existence. It was rather a continuation of previous patterns, even though territories settled by farming societies were steadily growing in size. The final disappearance of Central European hunter-gatherers – but only in a strictly typological dimension – took place in the Late Neolithic and Early Bronze Age.

  10. Silicone infusion tubing instead of Hunter rods for two-stage zone 2 flexor tendon reconstruction in a resource-limited surgical environment.

    Science.gov (United States)

    Kibadi, K; Moutet, F

    2017-10-01

    The authors describe their experience using silicone infusion tubing in place of Hunter rods for two-stage zone 2 flexor tendon reconstruction in a resource-limited surgical environment. This case report features a 47-year-old, right-handed man who had no active PIP and DIP joint flexion in four fingers of the right hand 5 months after an injury. During the first repair stage, the A2 and A4 pulleys were reconstructed using an extensor retinaculum graft. An infusion tube was inserted instead of Hunter rods. During the second stage, formation of a digital neo-canal around the infusion tubing was observed. The infusion tubing was removed and replaced with a palmaris longus tendon graft according to the conventional technique. Physiotherapy and rehabilitation followed surgery. At 6 months, very significant progress had been made with complete recovery of PIP and DIP flexion in the four fingers. Copyright © 2017 SFCM. Published by Elsevier Masson SAS. All rights reserved.

  11. Mitigating the health impacts of a natural disaster--the June 2007 long-weekend storm in the Hunter region of New South Wales.

    Science.gov (United States)

    Cretikos, Michelle A; Merritt, Tony D; Main, Kelly; Eastwood, Keith; Winn, Linda; Moran, Lucille; Durrheim, David N

    A severe storm that began on Thursday, 7 June 2007 brought heavy rains and gale-force winds to Newcastle, Gosford, Wyong, Sydney, and the Hunter Valley region of New South Wales. The storm caused widespread flooding and damage to houses, businesses, schools and health care facilities, and damaged critical infrastructure. Ten people died as a result of the storm, and approximately 6000 residents were evacuated. A natural disaster was declared in 19 local government areas, with damage expected to reach $1.5 billion. Additional demands were made on clinical health services, and interruption of the electricity supply to over 200,000 homes and businesses, interruption of water and gas supplies, and sewerage system pump failures presented substantial public health threats. A public health emergency operations centre was established by the Hunter New England Area Health Service to coordinate surveillance activities, respond to acute public health issues and prevent disease outbreaks. Public health activities focused on providing advice, cooperating with emergency service agencies, monitoring water quality and availability, preventing illness from sewage-contaminated flood water, assessing environmental health risks, coordinating the local government public health response, and surveillance for storm-related illness and disease outbreaks, including gastroenteritis. The local ABC (Australian Broadcasting Corporation) radio station played a key role in disseminating public health advice. A household survey conducted within a fortnight of the storm established that household preparedness and storm warning systems could be improved.

  12. Hepatitis E virus antibody prevalence in hunters from a district in Central Germany, 2013: a cross-sectional study providing evidence for the benefit of protective gloves during disembowelling of wild boars.

    Science.gov (United States)

    Schielke, A; Ibrahim, V; Czogiel, I; Faber, M; Schrader, C; Dremsek, P; Ulrich, R G; Johne, R

    2015-10-22

    In Germany, 17% of the general human population have antibodies to hepatitis E virus (HEV) (recomLine HEV-IgG/IgM immunoassay [Mikrogen GmbH]). Wild boars represent an animal reservoir for HEV genotype 3, which is the common genotype in Germany. We estimated the seroprevalence among hunters with contact to wild boars to identify factors that may be associated with past or present HEV infection. In 2013, the local veterinarian authority in a district in Central Germany attended meetings of hunters who provided blood specimens and completed a questionnaire collecting information on age, sex, hunting-related activities and consumption of wild boar meat. Specimens of wild boars were taken during drive hunts in this district during the season 2012/2013. All specimens were tested for HEV RNA and anti-HEV IgM and IgG antibodies. Log-binomial regression was used to estimate prevalence ratios (PR) for the hunters. Of 126 hunters (median age 55; 94% male) 21% tested positive for anti-HEV IgG antibodies (95% confidence interval [CI] 13-28%) (recomWell HEV IgG assay [Mikrogen GmbH]). Anti-HEV prevalence was highest in the age group of the 70-79-year-olds (67%; 95% CI 39-95%). Wild boars showed an average anti-HEV prevalence of 41%. HEV RNA was detected in 4/22 (18%) liver specimens and in 1/22 (4.5%) muscle specimens. Most wild boars were tested positive for HEV RNA (3/10; 30%) and HEV-specific antibodies (7/15; 47%) in the southwestern part of the district. Hunters preferring this hunting ground had a lower anti-HEV prevalence when gloves were frequently used during disembowelling of wild boars compared to hunters using gloves never or infrequently (age-adjusted PR 0.12; 95% CI 0.02-0.86). Hunters may benefit from wearing gloves when in contact with blood or body fluids of HEV animal reservoirs. Anti-HEV prevalence among the hunters of this study did not significantly differ from that of the general population suggesting that other factors play a major role in the

  13. Rudimentary functions:Important reminders of history and relationship

    Directory of Open Access Journals (Sweden)

    Natalia Y. Collings

    2018-03-01

    Full Text Available Background. When Vygotsky suggested the term rudimentary functions for psychological phenomena, he drew a parallel with organismic rudiments that existed and continue to exist in a number of biological species. These rudiments used to play an important role in the life of an organism and allow us to study that life in the process of its development. Vygotsky originally gave three explicit examples of psychological rudimentary functions: 1 attributing an important decision to the result of a solitaire card game, 2 tying a knot in a handkerchief in order to remember and do something later, and 3 counting on one’s fingers. Objective. The purpose of this article is to offer a contemporary overview and paths for development of L.S. Vygotsky’s notion of rudimentary function. Design. This paper, in the genre of a theoretical article, drew on existing research and theoretical literature to advance a theory. I analyzed Vygotsky’s original example of a solitaire game and similar actions (for example, flipping a coin, arguing that these actions represent key events mediating choice and exercising human will over affect. I then focused on three more psychological functions that fit Vygotsky’s definition of rudiments: 1 photographic memory and déjà vu as instances of historically primitive eidetic memory, 2 talking to oneself aloud as a rudiment of a key event forming the self-regulatory mechanism of inner speech in childhood, and 3 fantasizing, which could remind us of our young age, when imagination readily created what was lacking in external world. Results. This analysis allowed me to vividly illustrate the historical and relational focus of Vygotsky’s theories. Conclusions. Rudimentary functions, often perceived as mysterious, in their simplicity can be powerful reminders that historically primitive functions do not disappear, but enter complex relationships with other psychological functions, and that many relationships are possible within

  14. Ancient DNA from hunter-gatherer and farmer groups from Northern Spain supports a random dispersion model for the Neolithic expansion into Europe.

    Directory of Open Access Journals (Sweden)

    Montserrat Hervella

    Full Text Available BACKGROUND/PRINCIPAL FINDINGS: The phenomenon of Neolithisation refers to the transition of prehistoric populations from a hunter-gatherer to an agro-pastoralist lifestyle. Traditionally, the spread of an agro-pastoralist economy into Europe has been framed within a dichotomy based either on an acculturation phenomenon or on a demic diffusion. However, the nature and speed of this transition is a matter of continuing scientific debate in archaeology, anthropology, and human population genetics. In the present study, we have analyzed the mitochondrial DNA diversity in hunter-gatherers and first farmers from Northern Spain, in relation to the debate surrounding the phenomenon of Neolithisation in Europe. METHODOLOGY/SIGNIFICANCE: Analysis of mitochondrial DNA was carried out on 54 individuals from Upper Paleolithic and Early Neolithic, which were recovered from nine archaeological sites from Northern Spain (Basque Country, Navarre and Cantabria. In addition, to take all necessary precautions to avoid contamination, different authentication criteria were applied in this study, including: DNA quantification, cloning, duplication (51% of the samples and replication of the results (43% of the samples by two independent laboratories. Statistical and multivariate analyses of the mitochondrial variability suggest that the genetic influence of Neolithisation did not spread uniformly throughout Europe, producing heterogeneous genetic consequences in different geographical regions, rejecting the traditional models that explain the Neolithisation in Europe. CONCLUSION: The differences detected in the mitochondrial DNA lineages of Neolithic groups studied so far (including these ones of this study suggest different genetic impact of Neolithic in Central Europe, Mediterranean Europe and the Cantabrian fringe. The genetic data obtained in this study provide support for a random dispersion model for Neolithic farmers. This random dispersion had a different

  15. Re-evaluating the resource potential of lomas fog oasis environments for Preceramic hunter-gatherers under past ENSO modes on the south coast of Peru

    Science.gov (United States)

    Beresford-Jones, David; Pullen, Alexander G.; Whaley, Oliver Q.; Moat, Justin; Chauca, George; Cadwallader, Lauren; Arce, Susana; Orellana, Alfonso; Alarcón, Carmela; Gorriti, Manuel; Maita, Patricia K.; Sturt, Fraser; Dupeyron, Agathe; Huaman, Oliver; Lane, Kevin J.; French, Charles

    2015-12-01

    Lomas - ephemeral seasonal oases sustained by ocean fogs - were critical to ancient human ecology on the desert Pacific coast of Peru: one of humanity's few independent hearths of agriculture and "pristine" civilisation. The role of climate change since the Late Pleistocene in determining productivity and extent of past lomas ecosystems has been much debated. Here we reassess the resource potential of the poorly studied lomas of the south coast of Peru during the long Middle Pre-ceramic period (c. 8000-4500 BP): a period critical in the transition to agriculture, the onset of modern El Niño Southern Oscillation ('ENSO') conditions, and eustatic sea-level rise and stabilisation and beach progradation. Our method combines vegetation survey and herbarium collection with archaeological survey and excavation to make inferences about both Preceramic hunter-gatherer ecology and the changed palaeoenvironments in which it took place. Our analysis of newly discovered archaeological sites - and their resource context - show how lomas formations defined human ecology until the end of the Middle Preceramic Period, thereby corroborating recent reconstructions of ENSO history based on other data. Together, these suggest that a five millennia period of significantly colder seas on the south coast induced conditions of abundance and seasonal predictability in lomas and maritime ecosystems, that enabled Middle Preceramic hunter-gatherers to reduce mobility by settling in strategic locations at the confluence of multiple eco-zones at the river estuaries. Here the foundations of agriculture lay in a Broad Spectrum Revolution that unfolded, not through population pressure in deteriorating environments, but rather as an outcome of resource abundance.

  16. A study on the revision of nuclear safety act to build the foundation of nuclear export and import control system in Korea

    International Nuclear Information System (INIS)

    Yang, Seung Hyo; Choi, Sun Do

    2012-01-01

    Nuclear related items require export and import control beyond the multilateral export control system according to Safeguard Agreement, Additional Protocol and bilateral agreements. Besides Korea as a nuclear supplier is needed to actively cope with its export control system, which is being reinforced internationally. In regard to this trend, this study drew the revision plan of present Nuclear Safety Act to found the nuclear export and import control system in Korea by examining the related legislations and analyzing the implementation status of nuclear export and import control

  17. A study on the revision of nuclear safety act to build the foundation of nuclear export and import control system in Korea

    Energy Technology Data Exchange (ETDEWEB)

    Yang, Seung Hyo; Choi, Sun Do [Korea Institute of Nuclear Nonproliferation and Control, Daejeon (Korea, Republic of)

    2012-10-15

    Nuclear related items require export and import control beyond the multilateral export control system according to Safeguard Agreement, Additional Protocol and bilateral agreements. Besides Korea as a nuclear supplier is needed to actively cope with its export control system, which is being reinforced internationally. In regard to this trend, this study drew the revision plan of present Nuclear Safety Act to found the nuclear export and import control system in Korea by examining the related legislations and analyzing the implementation status of nuclear export and import control.

  18. Balinese Y-chromosome perspective on the peopling of Indonesia: genetic contributions from pre-neolithic hunter-gatherers, Austronesian farmers, and Indian traders.

    Science.gov (United States)

    Karafet, Tatiana M; Lansing, J S; Redd, Alan J; Reznikova, Svetlana; Watkins, Joseph C; Surata, S P K; Arthawiguna, W A; Mayer, Laura; Bamshad, Michael; Jorde, Lynn B; Hammer, Michael F

    2005-02-01

    The island of Bali lies near the center of the southern chain of islands in the Indonesian archipelago, which served as a stepping-stone for early migrations of hunter-gatherers to Melanesia and Australia and for more recent migrations of Austronesian farmers from mainland Southeast Asia to the Pacific. Bali is the only Indonesian island with a population that currently practices the Hindu religion and preserves various other Indian cultural, linguistic, and artistic traditions (Lansing 1983). Here, we examine genetic variation on the Y chromosomes of 551 Balinese men to investigate the relative contributions of Austronesian farmers and pre-Neolithic hunter-gatherers to the contemporary Balinese paternal gene pool and to test the hypothesis of recent paternal gene flow from the Indian subcontinent. Seventy-one Y-chromosome binary polymorphisms (single nucleotide polymorphisms, SNPs) and 10 Y-chromosome-linked short tandem repeats (STRs) were genotyped on a sample of 1,989 Y chromosomes from 20 populations representing Indonesia (including Bali), southern China, Southeast Asia, South Asia, the Near East, and Oceania. SNP genotyping revealed 22 Balinese lineages, 3 of which (O-M95, O-M119, and O-M122) account for nearly 83.7% of Balinese Y chromosomes. Phylogeographic analyses suggest that all three major Y-chromosome haplogroups migrated to Bali with the arrival of Austronesian speakers; however, STR diversity patterns associated with these haplogroups are complex and may be explained by multiple waves of Austronesian expansion to Indonesia by different routes. Approximately 2.2% of contemporary Balinese Y chromosomes (i.e., K-M9*, K-M230, and M lineages) may represent the pre-Neolithic component of the Indonesian paternal gene pool. In contrast, eight other haplogroups (e.g., within H, J, L, and R), making up approximately 12% of the Balinese paternal gene pool, appear to have migrated to Bali from India. These results indicate that the Austronesian expansion had a

  19. CONDICIÓN FÍSICA Y HÁBITOS DE PRÁCTICA FÍSICO-DEPORTIVA DE LOS CAZADORES EXTREMEÑOS [Physical condition and habits of practice exercise of hunters extremeños

    Directory of Open Access Journals (Sweden)

    José Martín Gamonales Puerto

    2016-12-01

    Present study analyses the physical condition and the physical-sportive exercise in a random sample of hunters (n=144 in the Extremadura (Spain. Hunting is recognized as a sportive modality by the Board of the CDS (Spanish High Sports Council. In order to know the physical condition levels in hunters group, were used a selection of Eurofit and AFISAL-INEFC tests for adult. Final results show the relation which exist between physical condition and sociodemographic differences, as well as the influence that hunting can have in a healthy lifestyle. Attending to the results, there are differences in the physical condition according to the age of the individuals. Moreover, it shows a relation between the sociodemographic characteristics of the sample and the additional physical-sportive exercises of the different modalities of hunting.

  20. Development of a local baiting system for the control of the Africa invader fly, (Bactrocera invadens) Drew, Tsuruta and White (Diptera: Tephritidae) in mango orchards at Somanya, Eastern Ghana

    International Nuclear Information System (INIS)

    Yeboah, S.

    2012-01-01

    Fruit production plays an important role in Africa's economy. In Ghana, mango is targeted as one of the next non-traditional export crop that is expected to fetch the highest foreign exchange for the country and replace cocoa. Ghana's current production is said to have increased from 6,800 tonnes in 2007 to about 7000 tonnes in 2010. However, the African invader fruit fly, Bactrocera invadens, is causing high yield losses as an important quarantine pest and has brought some setback in the mango trade between Ghana and their exporting destinations. Imported commercial protein hydrolysate bait for controlling the flies constitutes the highest cost component of the control programme, excluding cost of labour. The baits are exhorbitant for local farmers and seldom available. This setback has called for the need to design and implement efficient and cost-effective control regimes for managing this pest. The objective of the study was to explore the development of locally produced, cheap and efficient baiting system using brewery yeast wastes and coloured cylinder traps to attract and control this quarantine pest. A 1 ha study area was selected within DORMEHSCO FARM, a mango orchard at Somanya in the Eastern region of Ghana with the Keith mango variety for the study. Local sources of Guiness, Beer and Pito yeast wastes were collected into Winchester bottles and subjected to pasteurisation. Papain enzyme was added to maximize yeast cell autolysis at 70 degrees celcius for 9 hours. The Micro-Kjeldahl apparatus was used to determine the percentage protein in each waste. Transparent cylinder traps with three different colours of lids (red, yellow and green) and three 3cm diameter round holes referred to as coloured traps were used to dispense the baits. The traps were labelled according to the type of bait and trap colour combination. The trials were conducted in two successive peak fruiting seasons fron October to November, 2011 (minor season and then from April to June

  1. A synergistic effort among geoscience, physics, computer science and mathematics at Hunter College of CUNY as a Catalyst for educating Earth scientists.

    Science.gov (United States)

    Salmun, H.; Buonaiuto, F. S.

    2016-12-01

    The Catalyst Scholarship Program at Hunter College of The City University of New York (CUNY) was established with a four-year award from the National Science Foundation (NSF) to fund scholarships for academically talented but financially disadvantaged students majoring in four disciplines of science, technology, engineering and mathematics (STEM). Led by Earth scientists the Program awarded scholarships to students in their junior or senior years majoring in computer science, geosciences, mathematics and physics to create two cohorts of students that spent a total of four semesters in an interdisciplinary community. The program included mentoring of undergraduate students by faculty and graduate students (peer-mentoring), a sequence of three semesters of a one-credit seminar course and opportunities to engage in research activities, research seminars and other enriching academic experiences. Faculty and peer-mentoring were integrated into all parts of the scholarship activities. The one-credit seminar course, although designed to expose scholars to the diversity STEM disciplines and to highlight research options and careers in these disciplines, was thematically focused on geoscience, specifically on ocean and atmospheric science. The program resulted in increased retention rates relative to institutional averages. In this presentation we will discuss the process of establishing the program, from the original plans to its implementation, as well as the impact of this multidisciplinary approach to geoscience education at our institution and beyond. An overview of accomplishments, lessons learned and potential for best practices will be presented.

  2. Climate-driven environmental changes around 8,200 years ago favoured increases in cetacean strandings and Mediterranean hunter-gatherers exploited them.

    Science.gov (United States)

    Mannino, Marcello A; Talamo, Sahra; Tagliacozzo, Antonio; Fiore, Ivana; Nehlich, Olaf; Piperno, Marcello; Tusa, Sebastiano; Collina, Carmine; Di Salvo, Rosaria; Schimmenti, Vittoria; Richards, Michael P

    2015-11-17

    Cetacean mass strandings occur regularly worldwide, yet the compounded effects of natural and anthropogenic factors often complicate our understanding of these phenomena. Evidence of past stranding episodes may, thus, be essential to establish the potential influence of climate change. Investigations on bones from the site of Grotta dell'Uzzo in North West Sicily (Italy) show that the rapid climate change around 8,200 years ago coincided with increased strandings in the Mediterranean Sea. Stable isotope analyses on collagen from a large sample of remains recovered at this cave indicate that Mesolithic hunter-gatherers relied little on marine resources. A human and a red fox dating to the 8.2-kyr-BP climatic event, however, acquired at least one third of their protein from cetaceans. Numerous carcasses should have been available annually, for at least a decade, to obtain these proportions of meat. Our findings imply that climate-driven environmental changes, caused by global warming, may represent a serious threat to cetaceans in the near future.

  3. Hunter syndrome in an 11-year old girl on enzyme replacement therapy with idursulfase: brain magnetic resonance imaging features and evolution.

    Science.gov (United States)

    Manara, Renzo; Rampazzo, Angelica; Cananzi, Mara; Salviati, Leonardo; Mardari, Rodica; Drigo, Paola; Tomanin, Rosella; Gasparotto, Nicoletta; Priante, Elena; Scarpa, Maurizio

    2010-12-01

    Mucopolysaccharidosis type II (MPS-II, Hunter disease) is a X-linked recessive disorder. Affected females are extremely rare, mostly due to skewed X chromosome inactivation. A few papers outline MPS-II brain magnetic resonance imaging (MRI) "gestalt" in males, but neuroradiological reports on females are still lacking. We present an 11-year-old girl affected by the severe form of MPS-II who was followed up over a time span of 8 years, focusing on clinical and brain MRI evolution. In the last 2.5 years, the patient has been treated with enzyme replacement therapy (ERT) with idursulfase (Elaprase™, Shire Human Genetic Therapies AB, Sweden). On brain and cervical MRI examination, abnormalities in our patient did not differ from those detected in male patients: J-shaped pituitary sella, enlargement of perivascular spaces, brain atrophy, mild T2-hyperintensity in the paratrigonal white matter, diffuse platyspondylia, and mild odontoid dysplasia with odontoid cup. Brain atrophy progressed despite ERT introduction, whereas perivascular space enlargement did not change significantly before and after ERT. Cognitive impairment worsened independently from the course of white matter abnormality. Despite a profound knowledge of genetic and biochemical aspects in MPS-II, neuroradiology is still poorly characterized, especially in female patients. Spinal and brain involvement and its natural course and evolution after ERT introduction still need to be clarified.

  4. Quantitative autoradiographic localization of cholecystokinin receptors in rat and guinea pig brain using sup 125 I-Bolton-Hunter-CCK8

    Energy Technology Data Exchange (ETDEWEB)

    Niehoff, D.L. (Abbott Laboratories, Abbott Park, IL (USA))

    1989-03-01

    The autoradiographic localization of receptors for the brain-gut peptide cholecystokinin (CCK) has shown differences in receptor distribution between rat and guinea pig brain. However the full anatomical extent of the differences has not been determined quantitatively. In the present study, {sup 125}I-Bolton-Hunter-CCK8 ({sup 125}I-BH-CCK8) was employed in a comparative quantitative autoradiographic analysis of the distribution of CCK receptors in these two species. The pharmacological profile of {sup 125}I-BH-CCK8 binding in guinea pig forebrain sections was comparable to those previously reported for rat and human. Statistically significant differences in receptor binding between rat and guinea pig occurred in olfactory bulb, caudate-putamen, amygdala, several cortical areas, ventromedial hypothalamus, cerebellum, and a number of midbrain and brainstem nuclei. The results of this study confirm the presence of extensive species-specific variation in the distribution of CCK receptors, suggesting possible differences in the physiological roles of this peptide in different mammalian species.

  5. Man the fat hunter: the demise of Homo erectus and the emergence of a new hominin lineage in the Middle Pleistocene (ca. 400 kyr Levant.

    Directory of Open Access Journals (Sweden)

    Miki Ben-Dor

    Full Text Available The worldwide association of H. erectus with elephants is well documented and so is the preference of humans for fat as a source of energy. We show that rather than a matter of preference, H. erectus in the Levant was dependent on both elephants and fat for his survival. The disappearance of elephants from the Levant some 400 kyr ago coincides with the appearance of a new and innovative local cultural complex--the Levantine Acheulo-Yabrudian and, as is evident from teeth recently found in the Acheulo-Yabrudian 400-200 kyr site of Qesem Cave, the replacement of H. erectus by a new hominin. We employ a bio-energetic model to present a hypothesis that the disappearance of the elephants, which created a need to hunt an increased number of smaller and faster animals while maintaining an adequate fat content in the diet, was the evolutionary drive behind the emergence of the lighter, more agile, and cognitively capable hominins. Qesem Cave thus provides a rare opportunity to study the mechanisms that underlie the emergence of our post-erectus ancestors, the fat hunters.

  6. [125I]Bolton-Hunter neuropeptide-Y-binding sites on folliculo-stellate cells of the pars intermedia of Xenopus laevis: A combined autoradiographic and immunocytochemical study

    International Nuclear Information System (INIS)

    De Rijk, E.P.; Cruijsen, P.M.; Jenks, B.G.; Roubos, E.W.

    1991-01-01

    It has previously been established that neuropeptide-Y (NPY) is a potent inhibitor of alpha MSH release from the pars intermedia of the amphibian Xenopus laevis. The location of binding sites for NPY in the pars intermedia of the pituitary has now been studied with light microscopic autoradiography, using a dispersed cell labeling method with the specific NPY receptor ligand [ 125 I]Bolton-Hunter NPY. The majority of radioactive labeling was associated with folliculo-stellate cells; the percentage of labeling as well as the mean number of grains were approximately 5 times higher for folliculo-stellate cells than for melanotropes. An excess of nonlabeled NPY drastically reduced radiolabeling of folliculo-stellate cells, but had no effect on the degree of labeling of melanotropes. These results show that folliculo-stellate cells of X. laevis possess specific binding sites for NPY and indicate that NPY exerts its inhibitory action on the release of alpha MSH in an indirect fashion, by acting on the folliculo-stellate cells

  7. Ancient lipids document continuity in the use of early hunter-gatherer pottery through 9,000 years of Japanese prehistory.

    Science.gov (United States)

    Lucquin, Alexandre; Gibbs, Kevin; Uchiyama, Junzo; Saul, Hayley; Ajimoto, Mayumi; Eley, Yvette; Radini, Anita; Heron, Carl P; Shoda, Shinya; Nishida, Yastami; Lundy, Jasmine; Jordan, Peter; Isaksson, Sven; Craig, Oliver E

    2016-04-12

    The earliest pots in the world are from East Asia and date to the Late Pleistocene. However, ceramic vessels were only produced in large numbers during the warmer and more stable climatic conditions of the Holocene. It has long been assumed that the expansion of pottery was linked with increased sedentism and exploitation of new resources that became available with the ameliorated climate, but this hypothesis has never been tested. Through chemical analysis of their contents, we herein investigate the use of pottery across an exceptionally long 9,000-y sequence from the Jōmon site of Torihama in western Japan, intermittently occupied from the Late Pleistocene to the mid-Holocene. Molecular and isotopic analyses of lipids from 143 vessels provides clear evidence that pottery across this sequence was predominantly used for cooking marine and freshwater resources, with evidence for diversification in the range of aquatic products processed during the Holocene. Conversely, there is little indication that ruminant animals or plants were processed in pottery, although it is evident from the faunal and macrobotanical remains that these foods were heavily exploited. Supported by other residue analysis data from Japan, our results show that the link between pottery and fishing was established in the Late Paleolithic and lasted well into the Holocene, despite environmental and socio-economic change. Cooking aquatic products in pottery represents an enduring social aspect of East Asian hunter-gatherers, a tradition based on a dependable technology for exploiting a sustainable resource in an uncertain and changing world.

  8. Utilizing hunter harvest effort to survey for wildlife disease: a case study of West Nile virus in greater sage-grouse

    Science.gov (United States)

    Dusek, Robert J.; Hagen, Christian A.; Franson, J. Christian; Budeau, David A.; Hofmeister, Erik K.

    2014-01-01

    Greater sage-grouse (Centrocercus urophasianus; sage-grouse) are highly susceptible to infection with West Nile virus (WNV), with substantial mortality reported in wild populations and in experimentally infected birds. Although sage-grouse are hunted throughout much of their range, they have also recently been considered for protection under the Endangered Species Act. We used blood samples collected on filter-paper strips during the 2006–2010 Oregon, USA, annual sage-grouse hunt to survey for specific WNV-neutralizing antibodies that indicate a previous infection with WNV. During this period, hunters submitted 1,880 blood samples from sage-grouse they harvested. Samples obtained were proportional for all 12 Oregon sage-grouse hunting units. Laboratory testing of 1,839 samples by the WNV epitope-blocking enzyme-linked immunosorbent assay (bELISA) followed by plaque reduction neutralization test on bELISA-positive samples yielded 19 (1%) and 1 (0.05%) positive samples, respectively. These data provided early baseline information for future comparisons regarding the prevalence of WNV-specific neutralizing antibodies in sage-grouse in Oregon. This methodology may provide other states where sage-grouse (or other species) populations are hunted and where WNV constitutes a species conservation concern with a viable option to track the relative prevalence of the virus in populations.

  9. Permutation importance: a corrected feature importance measure.

    Science.gov (United States)

    Altmann, André; Toloşi, Laura; Sander, Oliver; Lengauer, Thomas

    2010-05-15

    In life sciences, interpretability of machine learning models is as important as their prediction accuracy. Linear models are probably the most frequently used methods for assessing feature relevance, despite their relative inflexibility. However, in the past years effective estimators of feature relevance have been derived for highly complex or non-parametric models such as support vector machines and RandomForest (RF) models. Recently, it has been observed that RF models are biased in such a way that categorical variables with a large number of categories are preferred. In this work, we introduce a heuristic for normalizing feature importance measures that can correct the feature importance bias. The method is based on repeated permutations of the outcome vector for estimating the distribution of measured importance for each variable in a non-informative setting. The P-value of the observed importance provides a corrected measure of feature importance. We apply our method to simulated data and demonstrate that (i) non-informative predictors do not receive significant P-values, (ii) informative variables can successfully be recovered among non-informative variables and (iii) P-values computed with permutation importance (PIMP) are very helpful for deciding the significance of variables, and therefore improve model interpretability. Furthermore, PIMP was used to correct RF-based importance measures for two real-world case studies. We propose an improved RF model that uses the significant variables with respect to the PIMP measure and show that its prediction accuracy is superior to that of other existing models. R code for the method presented in this article is available at http://www.mpi-inf.mpg.de/ approximately altmann/download/PIMP.R CONTACT: altmann@mpi-inf.mpg.de, laura.tolosi@mpi-inf.mpg.de Supplementary data are available at Bioinformatics online.

  10. Structure, Stiffness and Substates of the Dickerson-Drew Dodecamer

    Czech Academy of Sciences Publication Activity Database

    Dršata, Tomáš; Pérez, A.; Orozco, M.; Morozov, A. V.; Šponer, Jiří; Lankaš, Filip

    2013-01-01

    Roč. 9, č. 1 (2013), s. 707-721 ISSN 1549-9618 R&D Projects: GA ČR(CZ) GAP208/11/1822 Grant - others:CEITEC(XE) CZ.1.05/1.1.00/02.0068 Institutional support: RVO:61388963 ; RVO:68081707 Keywords : DNA * mechanical properties * molecular dynamics Subject RIV: CF - Physical ; Theoretical Chemistry Impact factor: 5.310, year: 2013

  11. Long-timescale dynamics of the Drew-Dickerson dodecamer

    Czech Academy of Sciences Publication Activity Database

    Dans, P. D.; Danilane, L.; Ivani, I.; Dršata, Tomáš; Lankaš, Filip; Hospital, A.; Walther, J.; Pujagut, R. I.; Battistini, F.; Gelpí, J. L.; Lavery, R.; Orozco, M.

    2016-01-01

    Roč. 44, č. 9 (2016), s. 4052-4066 ISSN 0305-1048 R&D Projects: GA ČR(CZ) GA14-21893S Institutional support: RVO:61388963 Keywords : microsecond molecular dynamics * B-DNA dodecamer * analyzing ion distributions Subject RIV: CE - Biochemistry Impact factor: 10.162, year: 2016 http://nar.oxfordjournals.org/content/44/9/4052.full

  12. Estimating the unknown components of nutrient mass balances for forestry plantations in mine rehabilitation, upper Hunter Valley, New South Wales, Australia.

    Science.gov (United States)

    Mercuri, A M; Duggin, J A; Daniel, H; Lockwood, P V; Grant, C D

    2006-04-01

    Commercial forestry plantations as a postmining land use in the Upper Hunter Valley of New South Wales, Australia are restricted by both the poor nutrient availability of mining substrates and low regional rainfall. An experiment was conducted to investigate whether municipal waste products and saline groundwater from coal mining operations could improve early tree growth without impacting on the environment through salt accumulation and/or nutrient enrichment and changes in groundwater quality. Potential impacts were investigated by quantifying the nutrient cycling dynamics within the plantation using an input-output mass balance approach for exchangeable calcium (Ca(2+)), exchangeable magnesium (Mg(2+)), exchangeable potassium (K(+)), exchangeable sodium (Na(+)), nitrogen (N), and phosphorus (P). Measured inputs to and outputs from the available nutrient pool in the 0-30 cm of the overburden subsystem were used to estimate the net effect of unmeasured inputs and outputs (termed "residuals"). Residual values in the mass balance of the irrigated treatments demonstrated large leaching losses of exchangeable Ca, Mg, K, and Na. Between 96% and 103% of Na applied in saline mine-water irrigation was leached below the 0-30-cm soil profile zone. The fate of these salts beyond 30 cm is unknown, but results suggest that irrigation with saline mine water had minimal impact on the substrate to 30 cm over the first 2 years since plantation establishment. Accumulations of N and P were detected for the substrate amendments, suggesting that organic amendments (particularly compost) retained the applied nutrients with very little associated losses, particularly through leaching.

  13. Hydrogeologic characteristics and water quality of a confined sand unit in the surficial aquifer system, Hunter Army Airfield, Chatham County, Georgia

    Science.gov (United States)

    Gonthier, Gerard

    2012-01-01

    An 80-foot-deep well (36Q397, U.S. Geological Survey site identification 320146081073701) was constructed at Hunter Army Airfield to assess the potential of using the surficial aquifer system as a water source to irrigate a ballfield complex. A 300-foot-deep test hole was drilled beneath the ballfield complex to characterize the lithology and water-bearing characteristics of sediments above the Upper Floridan aquifer. The test hole was then completed as well 36Q397 open to a 19-foot-thick shallow, confined sand unit contained within the surficial aquifer system. A single-well, 24-hour aquifer test was performed by pumping well 36Q397 at a rate of 50 gallons per minute during July 13-14, 2011, to characterize the hydrologic properties of the shallow, confined sand unit. Two pumping events prior to the aquifer test affected water levels. Drawdown during all three pumping events and residual drawdown during recovery periods were simulated using the Theis formula on multiple changes in discharge rate. Simulated drawdown and residual drawdown match well with measured drawdown and residual drawdown using values of horizontal hydraulic conductivity and specific storage, which are typical for a confined sand aquifer. Based on the hydrologic parameters used to match simulated drawdown and residual drawdown to measured drawdown and residual drawdown, the transmissivity of the sand was determined to be about 400 feet squared per day. The horizontal hydraulic conductivity of the sand was determined to be about 20 feet per day. Analysis of a water-quality sample indicated that the water is suitable for irrigation. Sample analysis indicated a calcium-carbonate type water having a total dissolved solids concentration of 39 milligrams per liter. Specific conductance and concentrations of all analyzed constituents were below those that would be a concern for irrigation, and were below primary and secondary water-quality criteria levels.

  14. Sediment tracing in the upper Hunter catchment using elemental and mineralogical compositions: Implications for catchment-scale suspended sediment (dis)connectivity and management

    Science.gov (United States)

    Fryirs, Kirstie; Gore, Damian

    2013-07-01

    River bed colmation layers clog the interstices of gravel-bed rivers, impeding the vertical exchange of water and nutrients that drives ecosystem function in the hyporheic zone. In catchments where fine-grained sediment supply has increased since human disturbance, understanding sediment provenance and the (dis)connectivity of supply allows practitioners to target sediment source problems and treat them within catchment management plans. Release of alluvial fine-grained sediment from channel bank erosion since European settlement has resulted in the formation of a colmation layer along the upper Hunter River at Muswellbrook, eastern Australia. X-ray fluorescence spectrometry (XRF) and X-ray diffractometry (XRD) are used to determine the elemental and mineralogical signatures of colmation layer and floodplain sediment sources across this 4480 km2 catchment. This sediment tracing technique is used to construct a picture of how suspended sediment supply and (dis)connectivity operates in this catchment. In this system, the primary source areas are subcatchments in which sediments are stored largely in partly confined floodplain pockets, but from which sediment supply is unimpeded and directly connected to the receiving reach. Subcatchments in which alluvial sediment storage is significant — and which contain large, laterally unconfined valleys — are essentially 'switched off' or disconnected from the receiving reach. This is because large sediment sinks act to trap fine-grained sediment before it reaches the receiving reach, forming a buffer along the sediment conveyor belt. Given the age structure of floodplains in the receiving reach, this pattern of source area contributions and (dis)connectivity must have occurred throughout the Holocene.

  15. O pós-humano, cyborgs e a (reevolução do corpo em Mega Man Maverick Hunter X

    Directory of Open Access Journals (Sweden)

    Simão Cireneu Milani Addôr Nunes da Silva

    2017-07-01

    Full Text Available Este trabalho propõe a análise da conformação híbrida do robô X (humano e máquina, personagem principal do game Mega Man Maverick Hunter X, lançado em 2005, que é um remake do jogo Megaman X, produzido pela Capcom para a plataforma Super Nintendo em 1993. No universo narrativo do game, X é único robô a possuir a capacidade de ter sentimentos, sendo seu projeto o ponto de partida para a criação dos reploids (cyborgs com a capacidade de livre arbítrio, que, como ele,demonstram empatia por todos os seres, sejam humanos ou robóticos. Apesar de X ter o que é considerada a maior “fraqueza” dos humanos: sentimentos, ele é o personagem mais poderoso da série, justamente pela percepção de que esse potencial o torna ilimitado como os humanos; pois enquanto os humanos são capazes de evoluir física e intelectualmente, os robôs estarão permanentemente atrelados à função para a qual foram criados. Para analisar a constituição de X como uma possibilidade de discussão da perspectiva do pós-humano, utilizamos teorias desenvolvidas por Paula Sibilia (2002 em O homem pós-orgânico, e Lucia Santaella, em Culturas e artes do pós-humano (2003.

  16. Study of stability of the ceramic Ba{sub 2}NiWO{sub 6} in crude petroleum drew back from state - Brazil oil wells; Microestrutura e propriedades mecanicas da ceramica Ba{sub 2}NiWO{sub 6} apos imersao em petroleo cru retirado de pocos de prtroleo do estado de Sergipe - Brasil

    Energy Technology Data Exchange (ETDEWEB)

    Yadava, Y.P.; Bezerra, L.P.; Diniz, M.J.L.; Ferreira, R.A.S. [Universidade Federal de Pernambuco (DEM/UFPE), Recife, PE (Brazil). Dept. de Engenharia Mecanica], e-mail: yadava@ufpe.br

    2008-07-01

    The necessity of developing technologies which make practical the oil-well exploration is notorious. Knowing that those are hostile places is necessary to find materials which are capable to resist to the inclemency caused by those environments. Pondering that the ceramics show the required characteristics to this purpose the present assignment views the elaboration of complex perovskite ceramic Ba{sub 2}NiWO{sub 6} to produce ceramics components parts of temperature sensors to oil-well. To this purpose we studied the ceramic stability when they are vulnerable to the attack of the crude petroleum drew back from ocean and earth's oil-wells of Sergipe state-Brazil. The ceramics were submersed in the mentioned petroleum during thirty days and then they were analyzed by X-ray diffraction, optics microscopy and microhardness Vickers to verify if changes happened in the structure, microstructure and mechanics proprieties characteristics. These results are showed and discussed in this assignment. (author)

  17. Governator vs. Hunter and Aggregator: A simulation of party competition with vote-seeking and office-seeking rules.

    Science.gov (United States)

    Lehrer, Roni; Schumacher, Gijs

    2018-01-01

    The policy positions parties choose are central to both attracting voters and forming coalition governments. How then should parties choose positions to best represent voters? Laver and Sergenti show that in an agent-based model with boundedly rational actors a decision rule (Aggregator) that takes the mean policy position of its supporters is the best rule to achieve high congruence between voter preferences and party positions. But this result only pertains to representation by the legislature, not representation by the government. To evaluate this we add a coalition formation procedure with boundedly rational parties to the Laver and Sergenti model of party competition. We also add two new decision rules that are sensitive to government formation outcomes rather than voter positions. We develop two simulations: a single-rule one in which parties with the same rule compete and an evolutionary simulation in which parties with different rules compete. In these simulations we analyze party behavior under a large number of different parameters that describe real-world variance in political parties' motives and party system characteristics. Our most important conclusion is that Aggregators also produce the best match between government policy and voter preferences. Moreover, even though citizens often frown upon politicians' interest in the prestige and rents that come with winning political office (office pay-offs), we find that citizens actually receive better representation by the government if politicians are motivated by these office pay-offs in contrast to politicians with ideological motivations (policy pay-offs). Finally, we show that while more parties are linked to better political representation, how parties choose policy positions affects political representation as well. Overall, we conclude that to understand variation in the quality of political representation scholars should look beyond electoral systems and take into account variation in party

  18. Recent Discoveries of the Paijanense in The Upper Chicama, Moche and Virú Valleys, Northern Perú: New Perspectives on the First Hunter-Gatherers in the Andes of South America

    OpenAIRE

    Briceño, Jesús

    2014-01-01

    We present newly-registered Paiján sites in the interior and upper parts of the Chicama, Moche and Virú valleys, with strong tiesto the highland region. The research indicates that Paiján hunter-gatherers were not only a coastal group whose subsistence was basedon marine resources. They also occupied diverse ecological environments preferring springs with high mobility across the Andes and exploiting diverse resources, such as white-tail deer (Odocoileus virginianus) and raw materials for pro...

  19. The importance of coughs

    African Journals Online (AJOL)

    2012-03-14

    Mar 14, 2012 ... how important it can be. It is at best ... e. rise of intrathoracic pressure up to 200mm Hg., f. glottic opening and ... The differential diagnosis may be reviewed from knowledge .... cigarette smoking is an important example. 3.

  20. Stellar recipes for axion hunters

    Energy Technology Data Exchange (ETDEWEB)

    Giannotti, Maurizio [Physical Sciences, Barry University, 11300 NE 2nd Ave., Miami Shores, FL 33161 (United States); Irastorza, Igor G.; Redondo, Javier [Departamento de Física Teórica, Universidad de Zaragoza, Pedro Cerbuna 12, E-50009, Zaragoza (Spain); Ringwald, Andreas; Saikawa, Ken' ichi, E-mail: mgiannotti@barry.edu, E-mail: igor.irastorza@cern.ch, E-mail: jredondo@unizar.es, E-mail: andreas.ringwald@desy.de, E-mail: kenichi.saikawa@desy.de [Theory Group, Deutsches Elektronen-Synchrotron DESY, Notkestraße 85, D-22607 Hamburg (Germany)

    2017-10-01

    There are a number of observational hints from astrophysics which point to the existence of stellar energy losses beyond the ones accounted for by neutrino emission. These excessive energy losses may be explained by the existence of a new sub-keV mass pseudoscalar Nambu-Goldstone boson with tiny couplings to photons, electrons, and nucleons. An attractive possibility is to identify this particle with the axion—the hypothetical pseudo Nambu-Goldstone boson predicted by the Peccei-Quinn solution to the strong CP problem. We explore this possibility in terms of a DFSZ-type axion and of a KSVZ-type axion/majoron, respectively. Both models allow a good global fit to the data, prefering an axion mass around 10 meV. We show that future axion experiments—the fifth force experiment ARIADNE and the helioscope IAXO—can attack the preferred mass range from the lower and higher end, respectively. An axion in this mass range can also be the main constituent of dark matter.

  1. Stellar recipes for axion hunters

    Energy Technology Data Exchange (ETDEWEB)

    Giannotti, Maurizio [Barry Univ., Miami Shores, FL (United States). Physical Sciences; Irastorza, Igor G. [Zaragoza Univ. (Spain). Dept. de Fisica Teorica; Redondo, Javier [Zaragoza Univ. (Spain). Dept. de Fisica Teorica; Max-Planck-Institut fuer Physik, Muenchen (Germany); Ringwald, Andreas; Saikawa, Ken' ichi [DESY, Hamburg (Germany). Theory Group

    2017-08-15

    There are a number of observational hints from astrophysics which point to the existence of stellar energy losses beyond the ones accounted for by neutrino emission. These excessive energy losses may be explained by the existence of a new sub-keV mass pseudoscalar Nambu-Goldstone boson with tiny couplings to photons, electrons, and nucleons. An attractive possibility is to identify this particle with the axion - the hypothetical pseudo Nambu-Goldstone boson predicted by the Peccei-Quinn solution to the strong CP problem. We explore this possibility in terms of a DFSZ-type axion and of a KSVZ-type axion/majoron, respectively. Both models allow a good global fit to the data, prefering an axion mass around 10 meV. We show that future axion experiments - the fifth force experiment ARIADNE and the helioscope IAXO - can attack the preferred mass range from the lower and higher end, respectively. An axion in this mass range can also be the main constituent of dark matter.

  2. Stellar recipes for axion hunters

    International Nuclear Information System (INIS)

    Giannotti, Maurizio; Ringwald, Andreas; Saikawa, Ken'ichi

    2017-08-01

    There are a number of observational hints from astrophysics which point to the existence of stellar energy losses beyond the ones accounted for by neutrino emission. These excessive energy losses may be explained by the existence of a new sub-keV mass pseudoscalar Nambu-Goldstone boson with tiny couplings to photons, electrons, and nucleons. An attractive possibility is to identify this particle with the axion - the hypothetical pseudo Nambu-Goldstone boson predicted by the Peccei-Quinn solution to the strong CP problem. We explore this possibility in terms of a DFSZ-type axion and of a KSVZ-type axion/majoron, respectively. Both models allow a good global fit to the data, prefering an axion mass around 10 meV. We show that future axion experiments - the fifth force experiment ARIADNE and the helioscope IAXO - can attack the preferred mass range from the lower and higher end, respectively. An axion in this mass range can also be the main constituent of dark matter.

  3. Border Hunter Research Technical Report

    Science.gov (United States)

    2010-07-31

    paintballs) keep everybody on their toes . • Specific actions on contact, force on force to implement tactics • None - good job!! • All...suspect or keep them in jail. For this event, the terrain becomes a little bit easier – hard sand and rock, sandy dunes with plants – so that intricate...the toe -first primary impact point and uneven stride, and increasing pressure of one of the tracks, you surmise that one of the party is injured

  4. CONFLICTS BETWEEN TOURISTS AND HUNTERS

    Directory of Open Access Journals (Sweden)

    Ionica Soare

    2015-05-01

    Full Text Available Tourism recreational outdoors bring revenue for the major economies of many states, for example communities should contribute with more than 800 billion dollars annually on U.S. economy, where three out of four Americans participate actively in the open air at recreation each year, as well as as well as hiking, biking, camping, wildlife generates an enormous economic power and a multiplier effect in major sectors of the economy. Empirical Research reveals a ambiguity of the feelings and attitudes concerning the relationship and potential for real conflicts between hunting recreational-sports and leisure and other activities of tourism recreational outdoors. Quantitative methods of analysis have revealed many common items, the reasons for and the environment, which are shared by both classes. An investigation carried out by means of interviews and questionnaires revealed three key elements which offers the potential of conflict: group characteristics, behavior and use of weapons for killing of animals.

  5. Hydrology, water quality, and water-supply potential of ponds at Hunter Army Airfield, Chatham County, Georgia, November 2008-July 2009

    Science.gov (United States)

    Clarke, John S.; Painter, Jaime A.

    2010-01-01

    The hydrology, water quality, and water-supply potential of four ponds constructed to capture stormwater runoff at Hunter Army Airfield, Chatham County, Georgia, were evaluated as potential sources of supplemental irrigation supply. The ponds are, Oglethorpe Lake, Halstrum Pond, Wilson Gate Pond, and golf course pond. During the dry season, when irrigation demand is highest, ponds maintain water levels primarily from groundwater seepage. The availability of water from ponds during dry periods is controlled by the permeability of surficial deposits, precipitation and evaporation, and the volume of water stored in the pond. Net groundwater seepage (Gnet) was estimated using a water-budget approach that used onsite and nearby climatic and hydrologic data collected during November-December 2008 including precipitation, evaporation, pond stage, and discharge. Gnet was estimated at three of the four sites?Oglethorpe Lake, Halstrum Pond, and Wilson Gate Pond?during November-December 2008. Pond storage volume in the three ponds ranged from 5.34 to 12.8 million gallons. During November-December 2008, cumulative Gnet ranged from -5.74 gallons per minute (gal/min), indicating a net loss in pond volume, to 19 gal/min, indicating a net gain in pond volume. During several periods of stage recovery, daily Gnet rates were higher than the 2-month cumulative amount, with the highest rates of 178 to 424 gal/min following major rainfall events during limited periods. These high rates may include some contribution from stormwater runoff; more typical recovery rates were from 23 to 223 gal/min. A conservative estimate of the volume of water available for irrigation supply from three of the ponds was provided by computing the rate of depletion of pond volume for a variety of withdrawal rates based on long-term average July precipitation and evaporation and the lowest estimated Gnet rate at each pond. Withdrawal rates of 1,000, 500, and 250 gal/min were applied during an 8-hour daily

  6. Optimising import phytosanitary inspection

    NARCIS (Netherlands)

    Surkov, I.

    2007-01-01

    Keywords: quarantine pest, plant health policy, optimization, import phytosanitary inspection, ‘reduced checks’, optimal allocation of resources, multinomial logistic regression, the Netherlands World trade is a major vector of spread of quarantine plant pests. Border phytosanitary inspection

  7. Optimal coal import strategy

    International Nuclear Information System (INIS)

    Chen, C.Y.; Shih, L.H.

    1992-01-01

    Recently, the main power company in Taiwan has shifted the primary energy resource from oil to coal and tried to diversify the coal supply from various sources. The company wants to have the imported coal meet the environmental standards and operation requirements as well as to have high heating value. In order to achieve these objectives, establishment of a coal blending system for Taiwan is necessary. A mathematical model using mixed integer programming technique is used to model the import strategy and the blending system. 6 refs., 1 tab

  8. Propagandes, films et guerre du Vietnam : histoires d’hommes et de femmes ou propagande du « genre » de The Deer Hunter (1978 à Path to War (2002 Vietnam War and Films: Men and Women’s Stories or Gender Propaganda? From The DeerHunter (1978 to Path to War (2002

    Directory of Open Access Journals (Sweden)

    Alexandra Boudet-Brugal

    2009-06-01

    Full Text Available Drawing from a selection of movies (and a documentary, I propose to study some images of men and women in the context of the Vietnam War, taking a closer look at women’s. To some extent, they contribute to revealing how the “field of battle” has become a “field of gender” and what is at stake. The film as a medium is involved in what we may call “war propaganda”: in the movies, there are elements that are part and parcel of what makes the traditional image of men and women in wartime. It is mostly about defining men as visible acting characters on stage and women as secondary characters (Path to War, playing the part of the apolitical and maternal Other (Heaven and Earth. Indeed, their historical identity mainly defines them as “those who do not make war” (The Deer Hunter. Sometimes, the female image is ambivalent. But the portraits of those who betray their gender, the women warriors (Full Metal Jacket and the unfaithful (Coming Home, though proposing new facets, do integrate into gender war propaganda. Occasionally the images showed also reveal new voices and paths (Regret to Inform, In Country, Heaven and Earth. It is true that overall we encounter no heroines but “super-hero soldiers” who rescue women (Heaven and Earth, Coming Home; however the representations offer a new space, emancipated from historical and social expectations. But do these stories suggest that women’s stories may be war stories and be part of history?

  9. [Diagnosing imported helminthiasis].

    Science.gov (United States)

    Pardo, Javier; Pérez-Arellano, José Luis; Galindo, Inmaculada; Belhassen, Moncef; Cordero, Miguel; Muro, Antonio

    2007-05-01

    In recent years, there has been an increase in cases of imported helminthiasis in Spain because of two complementary causes: immigration and international travel. Although the prevalence of helminthiasis is high in the immigrant population, the risk of transmission to the Spanish population is low. In this review, we provide clues to aid in the diagnosis of the helminthiasis, highlighting the geographic characteristics, clinical findings and analytical results of the most frequent types. The low sensitivity of the classic parasitological diagnostic test, mainly in tissue helminthiasis, is described. In addition, the advantages and limitations of the common serological methods for detecting related circulating antigens and antibodies are presented. Certain molecular methods used in the diagnosis of imported helminthiasis and the best strategies for screening of this condition are discussed.

  10. Risk communication importance

    Energy Technology Data Exchange (ETDEWEB)

    Cunha, Raquel Dalledone Siqueira da; Andrade, Delvonei Alves de, E-mail: raqueldalledonesiqueira@gmail.com, E-mail: delvonei@ipen.br [Instituto de Pesquisas Energeticas e Nucleares (IPEN/CNEN-SP), Sao Paulo, SP (Brazil)

    2013-07-01

    Risk Communication has shown its importance in the elaboration of emergency plans in the Chemical industry. In the 90's, the UNEP developed the APELL (Awareness and Preparedness for Emergency at Local Level) plan, a risk management methodology used by dangerous chemical facilities. The methodology comprises the commitment of both Government and the community located in the risk area in the development of the emergency plan. In the nuclear sector, there is no similar methodology developed so far. However, establishing a communication channel between the nuclear segment and the community is essential. In Brazil, the construction of Angra 3 and the RMB (Multi Purpose Reactor) project stand as nuclear initiatives that improve the importance of a good communication to the public. Security issues of these projects are natural sources of concernment to the public, which is aggravated by events such as the Fukushima disaster. Without an effective communication about what means the presence of nuclear plants and reactors in a specific area, the interested public will only have an alarmist vision of the subject, given by those against these facilities. (author)

  11. Risk communication importance

    International Nuclear Information System (INIS)

    Cunha, Raquel Dalledone Siqueira da; Andrade, Delvonei Alves de

    2013-01-01

    Risk Communication has shown its importance in the elaboration of emergency plans in the Chemical industry. In the 90's, the UNEP developed the APELL (Awareness and Preparedness for Emergency at Local Level) plan, a risk management methodology used by dangerous chemical facilities. The methodology comprises the commitment of both Government and the community located in the risk area in the development of the emergency plan. In the nuclear sector, there is no similar methodology developed so far. However, establishing a communication channel between the nuclear segment and the community is essential. In Brazil, the construction of Angra 3 and the RMB (Multi Purpose Reactor) project stand as nuclear initiatives that improve the importance of a good communication to the public. Security issues of these projects are natural sources of concernment to the public, which is aggravated by events such as the Fukushima disaster. Without an effective communication about what means the presence of nuclear plants and reactors in a specific area, the interested public will only have an alarmist vision of the subject, given by those against these facilities. (author)

  12. Most important human aluminoses

    Energy Technology Data Exchange (ETDEWEB)

    Avtsyn, A P

    1986-01-01

    Aluminoses are widespread forms of trace element deficiency of various severity. The organism is protected against a possible pathogenic influence of aluminum by a number of physiological mechanisms the most important among which is a regular urine excretion. A complex of pathological symptoms develops if serious homeostasis disturbances take place e. g. when renal deficiency or direct penetration of the trace element occur. The following forms of aluminosis should be distinguished: 1) simple accumulation in central nervous system which occurs in persons over 65 years; 2) aluminum accumulation in Alzheimer disease, in severe form of presenile and senile dementia; 3) dialysis aluminum encephalopathy; 4) non-dialysis infantile encephalopathy; 5) aluminum encephalopathy in total parenteral nutrition; 6) iatrogenic dialysis aluminum osteodystrophy; 7) jatrogenic peritoneal aluminosis; 8) aluminum pneumoconiosis of an occupational origin; 9) bronchospastic syndrome in aluminum smelter workers.

  13. Mexico: Imports or exports?

    International Nuclear Information System (INIS)

    Estrada, J.

    2002-01-01

    This presentation provides an overview of Mexico's energy sector. Proven oil reserves place Mexico in ninth position in the world and fourth largest in natural gas reserves. Energy is one of the most important economic activities of the country, representing 3 per cent of Gross Domestic Product (GDP). Oil exports represent 8.4 per cent of total exports. Approximately 40 per cent of total public investment is earmarked for energy projects. The author discusses energy resources and energy sector limitations. The energy sector plan for the period 2001-2006 is discussed. Its goals are to ensure energy supply, to develop the energy sector, to stimulate participation of Mexican enterprises, to promote renewable energy sources, and to strengthen international energy cooperation. The regulatory framework is being adapted to increase private investment. Some graphs are presented, displaying the primary energy production and primary energy consumption. Energy sector reforms are reviewed, as are electricity and natural gas reforms. The energy sector demand for 2000-2010 and investment requirements are reviewed, as well as fuel consumption for power generation. The author discusses the National Pipeline System (SNG) and the bottlenecks caused by pressure efficiency in the northeast, flow restriction on several pipeline segments, variability of the Petroleos Mexicanos (PEMEX) own use, and pressure drop on central regions. The entire prospect for natural gas in the country is reviewed, along with the Strategic Gas Program (PEG) consisting of 20 projects, including 4 non-associated natural gas, 9 exploration and 7 optimization. A section dealing with multiple service contracts is included in the presentation. The authors conclude by stating that the priority is a national energy policy to address Mexico's energy security requirements, to increase natural gas production while promoting the diversification of imports, and a regulatory framework to be updated in light of current

  14. Bone transplantation and tissue engineering, part I. Mythology, miracles and fantasy: from Chimera to the Miracle of the Black Leg of Saints Cosmas and Damian and the cock of John Hunter.

    Science.gov (United States)

    Hernigou, Philippe

    2014-12-01

    The replacement of diseased organs and tissues by the healthy ones of others has been a unique milestone in modern medicine. However, even though cloning, member transplantation and regenerative therapies with stem cells are available in the twentieth and twenty-first centuries, one should remember that all these techniques were in the imagination more than 2,000 years ago. For centuries, transplantation remained a theme of mythology, miracle or fantasy and was found only in literature and arts. This first paper explains the concept of tissue transplantation from the period when it was relegated to the imagination to the work of the Scottish surgeon and anatomist, John Hunter, who demonstrated the viability of bone allograft.

  15. Imported coenurosis in sheep

    International Nuclear Information System (INIS)

    Schweizer, G.; Grünenfelder, F.; Sydler, T.; Rademacher, N.; Braun, U.; Deplazes, P.

    2006-01-01

    Thirteen sheep from a milk producing farm in the Canton of Grisons that presented chronic coenurosis were examined and subjected to treatment trials at the veterinary hospital in Zurich. Symptoms were first observed around two months after the import of two dogs from Italy (Abruzza) of which one was infected with Taenia multiceps and Echinococcus granulosus. The most frequently observed clinical symptoms of the sheep were reduced general condition, circling, reduced menace reflex, apathy, unsteady gait and head tilt. Analyses of cerebrospinal fluid revealed an increased leucocyte count in 3 sheep and eosinophilia in 4 sheep. In 4 animals that underwent computertomography, one or more hypodense, definable lesions were found in the brain. In 2 sheep surgical treatment and in 10 animals medical treatment with either Praziquantel (n=8) or Oxfendazol (n=2) was attempted. Only one animal treated with Praziquantel needed not to be euthanized. At necropsy, one or two coenurus cysts could be found either in a side ventricle (n=2), in the cerebellum (n=3) or in the cerebrum (n=7). The locations corresponded with the clinical findings. Despite Praziquantel or Oxfendazol treatment, living protoscoleces could be found in the parasite cysts [de

  16. AND/OR Importance Sampling

    OpenAIRE

    Gogate, Vibhav; Dechter, Rina

    2012-01-01

    The paper introduces AND/OR importance sampling for probabilistic graphical models. In contrast to importance sampling, AND/OR importance sampling caches samples in the AND/OR space and then extracts a new sample mean from the stored samples. We prove that AND/OR importance sampling may have lower variance than importance sampling; thereby providing a theoretical justification for preferring it over importance sampling. Our empirical evaluation demonstrates that AND/OR importance sampling is ...

  17. How important is importance for prospective memory? A review

    OpenAIRE

    Walter, Stefan; Meier, Beat

    2014-01-01

    Forgetting to carry out an intention as planned can have serious consequences in everyday life. People sometimes even forget intentions that they consider as very important. Here, we review the literature on the impact of importance on prospective memory performance. We highlight different methods used to manipulate the importance of a prospective memory task such as providing rewards, importance relative to other ongoing activities, absolute importance, and providing social motives. Moreover...

  18. How important is importance for prospective memory? A review

    Directory of Open Access Journals (Sweden)

    Stefan eWalter

    2014-06-01

    Full Text Available Forgetting to carry out an intention as planned can have serious consequences in everyday life. People sometimes even forget intentions that they consider as very important. Here, we review the literature on the impact of importance on prospective memory performance. We highlight different methods used to manipulate the importance of a prospective memory task such as providing rewards, importance relative to other ongoing activities, absolute importance, and providing social motives. Moreover, we address the relationship between importance and other factors known to affect prospective memory and ongoing task performance such as type of prospective memory task (time-, event- or activity-based, cognitive loads, and cue focality. Finally, we provide a connection to motivation, we summarize the effects of task importance and we identify important venues for future research.

  19. How important is importance for prospective memory? A review

    Science.gov (United States)

    Walter, Stefan; Meier, Beat

    2014-01-01

    Forgetting to carry out an intention as planned can have serious consequences in everyday life. People sometimes even forget intentions that they consider as very important. Here, we review the literature on the impact of importance on prospective memory performance. We highlight different methods used to manipulate the importance of a prospective memory task such as providing rewards, importance relative to other ongoing activities, absolute importance, and providing social motives. Moreover, we address the relationship between importance and other factors known to affect prospective memory and ongoing task performance such as type of prospective memory task (time-, event-, or activity-based), cognitive loads, and processing overlaps. Finally, we provide a connection to motivation, we summarize the effects of task importance and we identify important venues for future research. PMID:25018743

  20. Development of a wild game meat supply chain: assessment of the food safety of large wild ungulates’ meat by interviews with hunters

    Directory of Open Access Journals (Sweden)

    Maria Elena Marescotti

    2016-06-01

    Our findings provide important inputs for the development of a real market for this type of meat. Therefore, the research seems to be relevant at both scientific and practical level. It proposes a new conceptual and practical option for a more sustainable development of Italian (and others mountain areas.

  1. Importance measures and resource allocation

    International Nuclear Information System (INIS)

    Guey, C.N.; Morgan, T.; Hughes, E.A.

    1987-01-01

    This paper discusses various importance measures and their practical relevance to allocating resources. The characteristics of importance measures are illustrated through simple examples. Important factors associated with effectively allocating resources to improve plant system performance or to prevent system degradation are discussed. It is concluded that importance measures are only indicative of and not equal to the risk significance of a component, system, or event. A decision framework is suggested to provide a comprehensive basis for resource allocation

  2. Import-Export Business Plan

    OpenAIRE

    Asad, Muhammad

    2014-01-01

    Import export businesses, also known as international trading, are one of the hottest commercial trends of this decade. Since the owner of an import export enterprise, can work as a distributor by focusing on exporting and importing goods and services that cannot be obtained on national soil. With a rapidly growing population of about 150 million, Pakistan is a major country, recognized by the international community, and is one of the most important actors in the Islamic world. Based on its ...

  3. Website Policies / Important Links | DOepatents

    Science.gov (United States)

    Links Website Policies / Important Links Javascript Not Enabled OSTI Security Website Policies and first) Publication Date (oldest first) Close Clear All Find DOepatents Website Policies / Important Important Links Some links on this page may take you to non-federal websites. Their policies may differ from

  4. Adaptive Importance Sampling with a Rapidly Varying Importance Function

    International Nuclear Information System (INIS)

    Booth, Thomas E.

    2000-01-01

    It is known well that zero-variance Monte Carlo solutions are possible if an exact importance function is available to bias the random walks. Monte Carlo can be used to estimate the importance function. This estimated importance function then can be used to bias a subsequent Monte Carlo calculation that estimates an even better importance function; this iterative process is called adaptive importance sampling.To obtain the importance function, one can expand the importance function in a basis such as the Legendre polynomials and make Monte Carlo estimates of the expansion coefficients. For simple problems, Legendre expansions of order 10 to 15 are able to represent the importance function well enough to reduce the error geometrically by ten orders of magnitude or more. The more complicated problems are addressed in which the importance function cannot be represented well by Legendre expansions of order 10 to 15. In particular, a problem with a cross-section notch and a problem with a discontinuous cross section are considered

  5. Importance analysis for reconfigurable systems

    International Nuclear Information System (INIS)

    Si, Shubin; Levitin, Gregory; Dui, Hongyan; Sun, Shudong

    2014-01-01

    Importance measures are used in reliability engineering to rank the system components according to their contributions to proper functioning of the entire system and to find the most effective ways of reliability enhancement. Traditionally, the importance measures do not consider the possible change of system structure with the improvement of specific component reliability. However, if a component's reliability changes, the optimal system structure/configuration may also change and the importance of the corresponding component will depend on the chosen structure. When the most promising component reliability improvement is determined, the component importance should be taken into account with respect to the possible structure changes. This paper studies the component reliability importance indices with respect to the changes of the optimal component sequencing. This importance measure indicates the critical components in providing the system reliability enhancement by both enhancing the component's reliability and reconfiguring the system. Examples of linear consecutive-k-out-of-n: F and G systems are considered to demonstrate the change of the component Birnbaum importance with the optimal system reconfiguration. The results show that the change of the importance index corresponds to the change of the system optimal configuration and the importance index can change not monotonically with the variation of the component reliability

  6. De Las Vegas a Marina D'or. O como llegar desde el New Jornalism norteamericano de Hunter S. Thompson hasta la nueva narrativa española de Robert Juan-Cantavella

    Directory of Open Access Journals (Sweden)

    María Angulo Egea

    2011-12-01

    Full Text Available The north-american trend called 'New Journalism' born in the 60's, was a revolution for the USA traditional Journalism, for its use of literary elements with other ones that belong to the journalistic research. Hunter S. Thompson, author of Fear and loathing in Las Vegas (1971, with his gonzo style, was going to shed new light on the New Journalism proposals, improving the immersión process using drugs until he gets implied personally in his reports and taking all his narrative influences from the 50's beat movement. Almost 35 years later, in El Dorado, Juan-Cantavella makes a paralellism between Las Vegas and the holiday city in the mediterranean coast, Marina D'Or and he develops in this space a novel, where his alter ego, the punk journalist Escargot, plays the lead. Novel, journalism, gonzo, fiction, story, punk, essay, report, 'aportaje', discursive fragmentation, dialogs, internal monologues, descriptions, memorandums, telegrams, emails, press releases, radio news, songs, slogans, all fits to reenact genres, to re-read journalistic and literary traditions and to build something new. This work analyses this process, that goes from the gonzo journalism of Fear and loathing in Las Vegas to the current Spanish narrative of El Dorado. It tries to distinguish the literary resources that the gonzo journalist uses to build his reports and the journalistic tools that nourish Juan-Cantavella's 'punk narrative'. A particular example of literary-journalistic symbiosisLa corriente norteamericana llamada 'Nuevo periodismo', nacida en los años sesenta, supuso para la Periodística tradicional de Estados Unidos toda una revolución por la combinación de elementos literarios con otros propios de la investigación periodística. Hunter S. Thompson, autor de Miedo y asco en las Vegas (1971, con su periodismo gonzo, le iba a dar una vuelta más a la propuesta del New Journalism, llevando al extremo el proceso de inmersión, hasta implicarse personalmente

  7. A Study on Narrative Perspectives in The Heart is a Lonely Hunter%论《心是孤独的猎手》中的叙事视角

    Institute of Scientific and Technical Information of China (English)

    陈博

    2012-01-01

    The theme of loneliness in McCullers" works has always been the focus of which the connotations of feminism, poetic traits as well as cultural background of criticism have been circles, out explored to the fullest extent over the past few years. McCullers" genius is not only embodied in her keen and deep insight; but also in her unique and exquisite narrative skill. This thesis attempts to elaborate on the narrative strategies of McCullers" The Heart is a Lonely Hunter, of which the narrative perspective is of variety. That is mainly embodied in the applications of third person external perspective, zero perspective and internal perspective. These three kinds of perspective are switched back and forth tactfully, reflecting the unique creative concept of the author.%麦卡勒斯作品的孤独主题一直占据评论界的中心,其引申出的女性主义、诗性特征以及文化背景义涵都得到了充分的拓展。麦卡勒斯的天才不仅体现在其敏锐深刻的洞察力上,也体现在其独特精致的叙事技巧上。麦卡勒斯作品《心是孤独的猎手》的叙事视角具有多变性特征,主要表现在第三人称外视角的应用,零视角的应用,以及内视角的应用等方面。三种视角巧妙地来回切换,体现了作者独具匠心的创作理念。

  8. PARALLEL IMPORT: REALITY FOR RUSSIA

    Directory of Open Access Journals (Sweden)

    Т. А. Сухопарова

    2014-01-01

    Full Text Available Problem of parallel import is urgent question at now. Parallel import legalization in Russia is expedient. Such statement based on opposite experts opinion analysis. At the same time it’s necessary to negative consequences consider of this decision and to apply remedies to its minimization.Purchase on Elibrary.ru > Buy now

  9. What's important to a game?

    DEFF Research Database (Denmark)

    Debus, Michael S.; Grabarczyk, Pawel

    2017-01-01

    , as well as visual representation, of the model suggests an equal importance of these three dimensions. We claim that such symmetry is unattainable. Through the exploration of the three dimensions relationships to one another, we will show that the mechanical system has a higher importance to games than...

  10. Enhancing importance-performance analysis

    DEFF Research Database (Denmark)

    Eskildsen, Jacob Kjær; Kristensen, Kai

    2006-01-01

    Purpose: The interpretation of the importance/performance map is based on an assumption of independence between importance and performance but many studies question the validity of this assumption. The aim of this research is to develop a new typology for job satisfaction attributes as well...... as a new importance/performance map that can be an aid for organizations when they prioritize their improvement actions based on a job satisfaction study. Design/methodology/approach: A typology for possible relationships between importance and performance in job satisfaction studies is developed based...... on theoretical considerations. This typology is then applied and validated on approximately 10,000 responses from the European Employee Index 2002. Ultimately a new importance/performance map for priority setting in job satisfaction studies is developed based on the new typology for possible relationships...

  11. Some of SAWTRI's important research findings on mohair

    CSIR Research Space (South Africa)

    Turpie, DWF

    1985-06-01

    Full Text Available Part I: Long, Mediumand Short Good to Average Style Kids, Young Goats and Adults, SA WTRI Tech. Rep. 488 (November, 1981). 21. Robinson, G.A., Hunter, L.. & Tavlor. H.. Spinning and Weaving of DREF ~ a ' m s having specialit; Fibreson the &&e, S....2%). Vegetablecontamination was fairly low (from O,1 to 1,7%), largely due to the superior style of the hair selected for the study. The suint was found to be acidic with pH values ranging from 3,3 to 6,2. STAPLE LENGTH AND STRENGTH: Traditionally, staple length...

  12. The ontogeny of visual-motor memory and its importance in handwriting and reading: a developing construct.

    Science.gov (United States)

    Waterman, Amanda H; Havelka, Jelena; Culmer, Peter R; Hill, Liam J B; Mon-Williams, Mark

    2015-01-07

    Humans have evolved a remarkable ability to remember visual shapes and use these representations to generate motor activity (from Palaeolithic cave drawings through Jiahu symbols to cursive handwriting). The term visual-motor memory (VMM) describes this psychological ability, which must have conveyed an evolutionary advantage and remains critically important to humans (e.g. when learning to write). Surprisingly, little empirical investigation of this unique human ability exists--almost certainly because of the technological difficulties involved in measuring VMM. We deployed a novel technique for measuring this construct in 87 children (6-11 years old, 44 females). Children drew novel shapes presented briefly on a tablet laptop screen, drawing their responses from memory on the screen using a digitizer stylus. Sophisticated algorithms (using point-registration techniques) objectively quantified the accuracy of the children's reproductions. VMM improved with age and performance decreased with shape complexity, indicating that the measure captured meaningful developmental changes. The relationship between VMM and scores on nationally standardized writing assessments were explored with the results showing a clear relationship between these measures, even after controlling for age. Moreover, a relationship between VMM and the nationally standardized reading test was mediated via writing ability, suggesting VMM's wider importance within language development. © 2014 The Author(s) Published by the Royal Society. All rights reserved.

  13. Uses of risk importance measures

    International Nuclear Information System (INIS)

    Mankamo, T.; Poern, K.; Holmberg, J.

    1991-05-01

    Risk importance measures provide an understandable and practical way of presenting probabilistic safety analysis results which too often tend to remain abstract numbers without real insight into the content. The report clarifies the definitions, relationships and interpretations of the three most basic measures: Risk increase factor, risk decrease factor, and fractional contribution. The above three measures already cover the main types of risk importance measures. Many other importance measures presented in literature are close variants to some of these three measures. They are related in many cases so that, for a technical system considered, the two other measures can be derived from the one calculated first. However, the practical interpretations are different, and hence each three measures have their own uses and rights to existence. The fundamental aspect of importance measures is, that they express some specific influence of a basic event on the total risk. The basic failure or error events are the elements from which the reliability and risk models are constituted. The importance measures are relative, which is an advantage compared to absolute risk numbers, due to insensitivity with respect to quantification uncertainties. Therefore they are particularly adapted to give first hand guidance where to focus main interest from the system's risk and reliability point of view and wherefrom to continue the analysis with more sophisticated methods requiring more effort

  14. Dynamically consistent oil import tariffs

    International Nuclear Information System (INIS)

    Karp, L.; Newbery, D.M.

    1992-01-01

    The standard theory of optimal tariffs considers tariffs on perishable goods produced abroad under static conditions, in which tariffs affect prices only in that period. Oil and other exhaustable resources do not fit this model, for current tariffs affect the amount of oil imported, which will affect the remaining stock and hence its future price. The problem of choosing a dynamically consistent oil import tariff when suppliers are competitive but importers have market power is considered. The open-loop Nash tariff is solved for the standard competitive case in which the oil price is arbitraged, and it was found that the resulting tariff rises at the rate of interest. This tariff was found to have an equilibrium that in general is dynamically inconsistent. Nevertheless, it is shown that necessary and sufficient conditions exist under which the tariff satisfies the weaker condition of time consistency. A dynamically consistent tariff is obtained by assuming that all agents condition their current decisions on the remaining stock of the resource, in contrast to open-loop strategies. For the natural case in which all agents choose their actions simultaneously in each period, the dynamically consistent tariff was characterized, and found to differ markedly from the time-inconsistent open-loop tariff. It was shown that if importers do not have overwhelming market power, then the time path of the world price is insensitive to the ability to commit, as is the level of wealth achieved by the importer. 26 refs., 4 figs

  15. The Signal Importance of Noise

    Science.gov (United States)

    Macy, Michael; Tsvetkova, Milena

    2015-01-01

    Noise is widely regarded as a residual category--the unexplained variance in a linear model or the random disturbance of a predictable pattern. Accordingly, formal models often impose the simplifying assumption that the world is noise-free and social dynamics are deterministic. Where noise is assigned causal importance, it is often assumed to be a…

  16. Observing Two Important Teaching Variables.

    Science.gov (United States)

    Gustafson, John A.

    1986-01-01

    Two behaviors essential to good teaching, teacher expectation and teacher flexibility, have been incorporated into the observation system used in the student teacher program at the University of New Mexico. The importance of these behaviors in teaching and in evaluating student teachers is discussed. (MT)

  17. The importance of board independence

    NARCIS (Netherlands)

    Zijl, N.J.M.

    2012-01-01

    Although the attributed importance of board independence is high, a clear definition of independence does not exist. Furthermore, the aim and consequences of independence are the subject of discussion and empirical evidence about the impact of independence is weak and disputable. Despite this lack

  18. Hydrogen peroxide: importance and determination

    OpenAIRE

    Mattos, Ivanildo Luiz de; Shiraishi, Karina Antonelli; Braz, Alexandre Delphini; Fernandes, João Roberto

    2003-01-01

    A brief discussion about the hydrogen peroxide importance and its determination is presented. It was emphasized some consideration of the H2O2 as reagent (separated or combined), uses and methods of analysis (techniques, detection limits, linear response intervals, sensor specifications). Moreover, it was presented several applications, such as in environmental, pharmaceutical, medicine and food samples.

  19. The Importance of Prior Knowledge.

    Science.gov (United States)

    Cleary, Linda Miller

    1989-01-01

    Recounts a college English teacher's experience of reading and rereading Noam Chomsky, building up a greater store of prior knowledge. Argues that Frank Smith provides a theory for the importance of prior knowledge and Chomsky's work provided a personal example with which to interpret and integrate that theory. (RS)

  20. Important projects of the Division

    International Nuclear Information System (INIS)

    2008-01-01

    In this chapter important projects of the Division for Radiation Safety, NPP Decommissioning and Radwaste Management of the VUJE, a. s. are presented. Division for Radiation Safety, NPP Decommissioning and Radwaste Management has successfully carried out variety of significant projects. The most significant projects that were realised, are implemented and possible future projects are introduced in the following part of presentation.

  1. Import market penetration in services

    OpenAIRE

    Langhammer, Rolf J.

    1991-01-01

    The EC-1992 programme foresees the complete liberalization of trade in services among member countries. To what extent has import market penetration in the Community already begun in selected service industries? Which EC member countries have been the forerunners to date? The following paper uses a new data base released recently by EUROSTAT in an attempt to answer these and other related questions.

  2. The Strategic Importance of Balochistan

    Science.gov (United States)

    2011-06-01

    projects require augmentation from skilled Punjabi labor. Militarily, it is important from a logistical standpoint as it provides a...Balochistan to a newly independent Greater Balochistan, but also their Pashtun regions need to join Afghanistan, leaving the Punjabi and Sindhi regions to

  3. A new uncertainty importance measure

    International Nuclear Information System (INIS)

    Borgonovo, E.

    2007-01-01

    Uncertainty in parameters is present in many risk assessment problems and leads to uncertainty in model predictions. In this work, we introduce a global sensitivity indicator which looks at the influence of input uncertainty on the entire output distribution without reference to a specific moment of the output (moment independence) and which can be defined also in the presence of correlations among the parameters. We discuss its mathematical properties and highlight the differences between the present indicator, variance-based uncertainty importance measures and a moment independent sensitivity indicator previously introduced in the literature. Numerical results are discussed with application to the probabilistic risk assessment model on which Iman [A matrix-based approach to uncertainty and sensitivity analysis for fault trees. Risk Anal 1987;7(1):22-33] first introduced uncertainty importance measures

  4. Are All Pixels Equally Important?

    CERN Multimedia

    CERN. Geneva

    2015-01-01

    When we look at our environment, we primarily pay attention to visually distinctive objects. We refer to these objects as visually important or salient. For efficient visual processing, the human visual system identifies salients objects and dedicates most of its processing resources to them. An analogous resource allocation can be performed by salient-object detection algorithms, which identify objects of interest in an image. Consequently, thanks to salient-object detection, complex visual computing operations can focus on the important parts of the visual data and can save time and resources. About the speaker Dr. Gokhan Yildirim is a research assistant in the School of Computer and Communication Sciences (IC) at the École Polytechnique Fédérale de Lausanne (EPFL). His research interests include image understanding, multimedia, pattern recognition, machine learning, salient-object detection on images & videos and its applications on image proces...

  5. Importing HOL Light into Coq

    OpenAIRE

    Keller , Chantal; Werner , Benjamin

    2010-01-01

    International audience; We present a new scheme to translate mathematical developments from HOL Light to Coq, where they can be re-used and re-checked. By relying on a carefully chosen embedding of Higher-Order Logic into Type Theory, we try to avoid some pitfalls of inter-operation between proof systems. In particular, our translation keeps the mathematical statements intelligible. This translation has been implemented and allows the importation of the HOL Light basic library into Coq.

  6. ECOPHARMACOVIGILANCE: ITS IMPORTANCE AND CHALLENGES

    OpenAIRE

    Dr. Bhavana Srivastava

    2014-01-01

    Active pharmaceutical ingredients represent a group of emerging environmental contamination. Even in trace amounts, they are of great concern due to then continuous introduction into the environment, their impact an ecosystem and human and vetenery health is of great importance. This has given birth to the science of Ecopharmacovigilance (EPV). It aims to ensure that significant environmental issues associated with pharmaceuticals in the environment are identified and managed appropriately. ...

  7. Importance Profiles for Water Vapor

    Science.gov (United States)

    Mapes, Brian; Chandra, Arunchandra S.; Kuang, Zhiming; Zuidema, Paquita

    2017-11-01

    Motivated by the scientific desire to align observations with quantities of physical interest, we survey how scalar importance functions depend on vertically resolved water vapor. Definitions of importance begin from familiar examples of water mass I m and TOA clear-sky outgoing longwave flux I OLR, in order to establish notation and illustrate graphically how the sensitivity profile or "kernel" depends on whether specific humidity S, relative humidity R, or ln( R) are used as measures of vapor. Then, new results on the sensitivity of convective activity I con to vapor (with implied knock-on effects such as weather prediction skill) are presented. In radiative-convective equilibrium, organized (line-like) convection is much more sensitive to moisture than scattered isotropic convection, but it exists in a drier mean state. The lesson for natural convection may be that organized convection is less susceptible to dryness and can survive and propagate into regions unfavorable for disorganized convection. This counterintuitive interpretive conclusion, with respect to the narrow numerical result behind it, highlights the importance of clarity about what is held constant at what values in sensitivity or susceptibility kernels. Finally, the sensitivities of observable radiance signals I sig for passive remote sensing are considered. While the accuracy of R in the lower free troposphere is crucial for the physical importance scalars, this layer is unfortunately the most difficult to isolate with passive remote sensing: In high emissivity channels, water vapor signals come from too high in the atmosphere (for satellites) or too low (for surface radiometers), while low emissivity channels have poor altitude discrimination and (in the case of satellites) are contaminated by surface emissions. For these reasons, active ranging (LiDAR) is the preferred observing strategy.

  8. The Importance of Why: An Intelligence Approach for a Multi-Polar World

    Science.gov (United States)

    2016-04-04

    code breakers drew information from 1 Sun Tzu , The Art of War. Translated by Samuel B...document_conversions/17/20110525.pdf (accessed December 29, 2015) Tzu , Sun . The Art of War. Translated by Samuel B. Griffith. New York: Oxford...Systems, and Game Theory..................................................... 63 Bibliography

  9. Importance of Engineering History Education

    Science.gov (United States)

    Arakawa, Fumio

    It is needless to cite the importance of education for succeed of engineering. IEEJ called for the establishment of ICEE in 1994, where the education is thought highly of, though its discussion has not been well working. Generally speaking, education has been one of the most important national strategies particularly at a time of its political and economical development. The science and technology education is, of course, not the exemption. But in these days around 2000 it seems that the public pays little attention on the science and technology, as they are quite day to day matters. As the results, for instance, such engineering as power systems and electric heavy machines are referred to as “endangered”. So fur, many engineers have tried not to be involved in social issues. But currently they can not help facing with risks of social issues like patent rights, troubles and accidents due to application of high technology, information security in the use of computers and engineering ethics. One of the most appropriate ways for the risk management is to learn lessons in the past, that is, history, so that the idea suggested in it could be made full use for the risk management. The author cited the global importance of education, particularly of engineering history education for engineering ethics, in the ICEE 2010 held in Bussan, Korea, as the 16th anniversary.

  10. Important plasma problems in astrophysics

    International Nuclear Information System (INIS)

    Kulsrud, R.M.

    1995-01-01

    In astrophysics, plasmas occur under very extreme conditions. For example, there are ultrastrong magnetic fields in neutron stars, relativistic plasmas around black holes and in jets, extremely energetic particles such as cosmic rays in the interstellar medium, extremely dense plasmas in accretion disks, and extremely large magnetic Reynolds numbers in the interstellar medium. These extreme limits for astrophysical plasmas make plasma phenomena much simpler to analyze in astrophysics than in the laboratory. An understanding of such phenomena often results in an interesting way, by simply taking the extreme limiting case of a known plasma theory. The author will describe one of the more exciting examples and will attempt to convey the excitement he felt when he was first exposed to it. However, not all plasma astrophysical phenomena are so simple. There are certain important plasma phenomena in astrophysics that have not been so easily resolved. In fact, a resolution of them is blocking significant progress in astrophysical research. They have not yet yielded to attacks by theoretical astrophysicists nor to extensive numerical simulation. The author will attempt to describe one of the more important of these plasma--astrophysical problems, and discuss why its resolution is so important to astrophysics. This significant example is fast, magnetic reconnection. Another significant example is the large-magnetic-Reynolds number magnetohydrodynamics (MHD) dynamos

  11. Clinical Presentation of Mucopolysaccharidosis Type II (Hunter's ...

    African Journals Online (AJOL)

    This report is of a 7-year-old boy who presented to the children outpatient through a referral with a history of inability to grasp objects, inability to express self, and coarse skin, which started 5 years ago. On examination, he was short statured, with a big head, protruding abdomen, coarse skin, swollen wrist joints, and ...

  12. Portrait of a Hunter and His Dog.

    Science.gov (United States)

    Tolbert, Peggy Manulikow

    1985-01-01

    Instructional strategies based on a portrait painting of Jean-Baptiste Oudry familiarize intermediate grade students with the techniques of portraiture and introduce the characteristics of eighteenth-century French rococo painting. (RM)

  13. ESPRESSO: The next European exoplanet hunter

    Science.gov (United States)

    Pepe, F.; Molaro, P.; Cristiani, S.; Rebolo, R.; Santos, N. C.; Dekker, H.; Mégevand, D.; Zerbi, F. M.; Cabral, A.; Di Marcantonio, P.; Abreu, M.; Affolter, M.; Aliverti, M.; Allende Prieto, C.; Amate, M.; Avila, G.; Baldini, V.; Bristow, P.; Broeg, C.; Cirami, R.; Coelho, J.; Conconi, P.; Coretti, I.; Cupani, G.; D'Odorico, V.; De Caprio, V.; Delabre, B.; Dorn, R.; Figueira, P.; Fragoso, A.; Galeotta, S.; Genolet, L.; Gomes, R.; González Hernández, J. I.; Hughes, I.; Iwert, O.; Kerber, F.; Landoni, M.; Lizon, J.-L.; Lovis, C.; Maire, C.; Mannetta, M.; Martins, C.; Monteiro, M.; Oliveira, A.; Poretti, E.; Rasilla, J. L.; Riva, M.; Santana Tschudi, S.; Santos, P.; Sosnowska, D.; Sousa, S.; Spanó, P.; Tenegi, F.; Toso, G.; Vanzella, E.; Viel, M.; Zapatero Osorio, M. R.

    2014-01-01

    The acronym ESPRESSO stems for Echelle SPectrograph for Rocky Exoplanets and Stable Spectroscopic Observations; this instrument will be the next VLT high resolution spectrograph. The spectrograph will be installed at the Combined-Coudé Laboratory of the VLT and linked to the four 8.2 m Unit Telescopes (UT) through four optical Coudé trains. ESPRESSO will combine efficiency and extreme spectroscopic precision. ESPRESSO is foreseen to achieve a gain of two magnitudes with respect to its predecessor HARPS, and to improve the instrumental radial-velocity precision to reach the 10 cm s-1 level. It can be operated either with a single UT or with up to four UTs, enabling an additional gain in the latter mode. The incoherent combination of four telescopes and the extreme precision requirements called for many innovative design solutions while ensuring the technical heritage of the successful HARPS experience. ESPRESSO will allow to explore new frontiers in most domains of astrophysics that require precision and sensitivity. The main scientific drivers are the search and characterization of rocky exoplanets in the habitable zone of quiet, nearby G to M-dwarfs and the analysis of the variability of fundamental physical constants. The project passed the final design review in May 2013 and entered the manufacturing phase. ESPRESSO will be installed at the Paranal Observatory in 2016 and its operation is planned to start by the end of the same year.

  14. PALEOLITHIC HUNTER-GATHERERS' DIETARY PATTERNS ...

    African Journals Online (AJOL)

    Dr. Al-Domi

    This has displaced local and traditional food items as well ... genes, which could be attributed to a possible failure in the natural selection process to .... Over the last 50 years, the rapid rise of convenience and take away fast foods among.

  15. Pulmonary coccidioidomycosis in a armadillo hunter

    OpenAIRE

    COSTA, FABRÍCIO ANDRÉ MARTINS DA; REIS, RICARDO COELHO; BENEVIDES, FÁBIO; TOMÉ, GERALDO DE SOUSA; HOLANDA, MARCELO ALCÂNTARA

    2001-01-01

    A coccidioidomicose, uma doença fúngica adquirida através da inalação do agente Coccidioides immitis sob forma de artroconídio, vem sendo descrita desde 1892. Restringe-se principalmente a áreas de clima árido, solo alcalino e regiões de baixo índice pluviométrico. Não por acaso, a maioria dos casos descritos no Brasil ocorreu na região Nordeste. Relata-se o caso de um homem de 19 anos, imunocompetente, com queixa de dor pleural bilateral, febre, adinamia e tosse seca havia dois meses. A radi...

  16. The leptoquark hunter's guide: pair production

    Science.gov (United States)

    Diaz, Bastian; Schmaltz, Martin; Zhong, Yi-Ming

    2017-10-01

    Leptoquarks occur in many new physics scenarios and could be the next big discovery at the LHC. The purpose of this paper is to point out that a model-independent search strategy covering all possible leptoquarks is possible and has not yet been fully exploited. To be systematic we organize the possible leptoquark final states according to a leptoquark matrix with entries corresponding to nine experimentally distinguishable leptoquark decays: any of {light-jet, b-jet, top} with any of {neutrino, e/ μ, τ}. The 9 possibilities can be explored in a largely model-independent fashion with pair-production of leptoquarks at the LHC. We review the status of experimental searches for the 9 components of the leptoquark matrix, pointing out which 3 have not been adequately covered. We plead that experimenters publish bounds on leptoquark cross sections as functions of mass for as wide a range of leptoquark masses as possible. Such bounds are essential for reliable recasts to general leptoquark models. To demonstrate the utility of the leptoquark matrix approach we collect and summarize searches with the same final states as leptoquark pair production and use them to derive bounds on a complete set of Minimal Leptoquark models which span all possible flavor and gauge representations for scalar and vector leptoquarks.

  17. Clinical Presentation of Mucopolysaccharidosis Type II (Hunter's ...

    African Journals Online (AJOL)

    hanumantp

    MPS is a group of metabolic disorders caused by absence or malfunctioning of the lysosomal enzymes needed to break down molecules called glycosaminoglycans (GAGs).[1]. Children with MPs either do not produce enough of one of the two enzymes required to break down the sugar chains into proteins and simpler ...

  18. Importance of Grid Center Arrangement

    Science.gov (United States)

    Pasaogullari, O.; Usul, N.

    2012-12-01

    In Digital Elevation Modeling, grid size is accepted to be the most important parameter. Despite the point density and/or scale of the source data, it is freely decided by the user. Most of the time, arrangement of the grid centers are ignored, even most GIS packages omit the choice of grid center coordinate selection. In our study; importance of the arrangement of grid centers is investigated. Using the analogy between "Raster Grid DEM" and "Bitmap Image", importance of placement of grid centers in DEMs are measured. The study has been conducted on four different grid DEMs obtained from a half ellipsoid. These grid DEMs are obtained in such a way that they are half grid size apart from each other. Resulting grid DEMs are investigated through similarity measures. Image processing scientists use different measures to investigate the dis/similarity between the images and the amount of different information they carry. Grid DEMs are projected to a finer grid in order to co-center. Similarity measures are then applied to each grid DEM pairs. These similarity measures are adapted to DEM with band reduction and real number operation. One of the measures gives function graph and the others give measure matrices. Application of similarity measures to six grid DEM pairs shows interesting results. These four different grid DEMs are created with the same method for the same area, surprisingly; thirteen out of 14 measures state that, the half grid size apart grid DEMs are different from each other. The results indicated that although grid DEMs carry mutual information, they have also additional individual information. In other words, half grid size apart constructed grid DEMs have non-redundant information.; Joint Probability Distributions Function Graphs

  19. The Importance of Pilot Studies

    OpenAIRE

    Van Teijlingen, Edwin; Hundley, Vanora

    2001-01-01

    The term 'pilot studies' refers to mini versions of a full-scale study (also called 'feasibility' studies), as well as the specific pre-testing of a particular research instrument such as a questionnaire or interview schedule. \\ud Pilot studies are a crucial element of a good study design. Conducting a pilot study does not guarantee success in the main study, but it does increase the likelihood. \\ud Pilot studies fulfil a range of important functions and can provide valuable insights for othe...

  20. Exercise: A vitally important prescription.

    Science.gov (United States)

    Hechanova, Rachel L; Wegler, Jennifer L; Forest, Christopher P

    2017-04-01

    Sedentary lifestyles and low physical activity have led to rising health concerns and increasing mortality risks. With the growing concern of the inactivity of adult Americans, it is important that physical activity be promoted to prevent disease and reduce health risks. This article reviews the benefits of physical activity and the steps that primary care providers should take to evaluate physical activity as the fifth vital sign in every patient encounter. The 5A's (assess, advise, agree, assist, and arrange) should be applied in order to implement an exercise prescription into the practice of medicine.

  1. PFGE: importance in food quality.

    Science.gov (United States)

    Vernile, Anna; Giammanco, Giovanni; Massa, Salvatore

    2009-11-01

    In late 19 century, great interest has arisen for food quality. This is referred as absence of pathogens in food (safety for consumers) and as nutritional quality of food (organoleptic characteristics). Pulsed-field gel electrophoresis (PFGE) is, among the molecular techniques developed in the last years, one of the most reliable, discriminative and reproducible technique. It can be used in clinical field for the identification of pathogens and the origin of outbreaks, and in food microbiology for the identification of pathogens (food borne disease surveillance) or of microorganisms responsible for the organoleptic characteristics of food. The present article shows some useful patents related to PFGE and importance in food quality.

  2. Radioactive contamination in imported foods

    International Nuclear Information System (INIS)

    Kan, Kimiko; Maki, Toshio; Nagayama, Toshihiro; Hashimoto, Hideki; Kawai, Yuka; Kobayashi, Maki; Shioda, Hiroko; Nishima, Taichiro

    1990-01-01

    On April 26, 1986, explosion occurred in Chernobyl nuclear power station in USSR, and radioactivity contamination was brought about in almost all countries in the world. In European countries, crops were contaminated directly with radioactive fallout to high concentration. Also in Japan, after one week the radioactivity higher than usual was detected in environment, and also in vegetables, milk, tea leaves and others. Thereafter, in order to cope with the import of contaminated foods, inspection and watch system was strengthened by deciding the interim limit of radioactive concentration. However the cases of exceeding the interim limit were often reported. In order to remove the harmful foods due to radioactive contamination and to meet the fear of consumers, the authors measured the radioactive concentration in foods distributed in Tokyo and investigated the actual state of contamination. The samples were 920 imported foods. The experimental method, the preparation of samples, the method of analysis and the results are reported. The samples in which the radioactive concentration exceeding 50 Bq/kg was detected were 25 cases. The food having the high frequency of detection was flavors. (K.I.)

  3. When is protein binding important?

    Science.gov (United States)

    Heuberger, Jules; Schmidt, Stephan; Derendorf, Hartmut

    2013-09-01

    The present paper is an ode to a classic citation by Benet and Hoener (2002. Clin Pharm Ther 71(3):115-121). The now classic paper had a huge impact on drug development and the way the issue of protein binding is perceived and interpreted. Although the authors very clearly pointed out the limitations and underlying assumptions for their delineations, these are too often overlooked and the classic paper's message is misinterpreted by broadening to cases that were not intended. Some members of the scientific community concluded from the paper that protein binding is not important. This was clearly not intended by the authors, as they finished their paper with a paragraph entitled: "When is protein binding important?" Misinterpretation of the underlying assumptions in the classic work can result in major pitfalls in drug development. Therefore, we revisit the topic of protein binding with the intention of clarifying when clinically relevant changes should be considered during drug development. Copyright © 2013 Wiley Periodicals, Inc.

  4. The importance of least restrictive care: the clinical implications of a recent High Court decision on negligence.

    Science.gov (United States)

    Ryan, Christopher James; Callaghan, Sascha; Large, Matthew

    2015-08-01

    This paper aims to explain the meaning and implications for practice of the High Court of Australia's finding in the negligence case, Hunter and New England Local Health District v McKenna [2014] HCA 44. The facts of the case and the law of negligence are reviewed before reporting the Court's decision. The High Court found that the obligation upon doctors to provide the least restrictive option for care that was imposed by the, then applicable, Mental Health Act 1990 (NSW) was inconsistent with an obligation that might otherwise be imposed by a common law duty to have regard to the interests of those with whom a psychiatric patient may come into contact if not detained. The Court's finding underlines the importance of clinicians documenting their clinical reasoning around why their negotiated management plan was the option least restrictive of the patient's freedom and most protective of his or her human rights. © The Royal Australian and New Zealand College of Psychiatrists 2015.

  5. Buying Local or Imported Goods?

    DEFF Research Database (Denmark)

    Ayob, Abu H.; Hussain, Wan Mohd Hirwani Wan

    2016-01-01

    ’ purchasing decisions. Data was collected on 296 university students in Malaysia and analyzed through probit regression analysis. The findings reveal that foreign products from advanced countries are preferred by male students because of the superior quality and brand image. On the other hand, family members......This study attempts to profile non-income consumers by examining their decisions to buy local or imported products. Hypotheses were drawn from discussions on the comparative advantages of advanced and developing countries, as well as the effects of a product’s country-of-origin on customers...... encourage students to buy local products because they are perceived as being less expensive. Also, students who receive scholarships are more likely to buy local products than self-sponsored students. This research offers insights into ex-ante purchasing behavior in developing countries particularly among...

  6. The Most Important Maglev Applications

    Directory of Open Access Journals (Sweden)

    Hamid Yaghoubi

    2013-01-01

    Full Text Available The name maglev is derived from magnetic levitation. Magnetic levitation is a highly advanced technology. It has various uses. The common point in all applications is the lack of contact and thus no wear and friction. This increases efficiency, reduces maintenance costs, and increases the useful life of the system. The magnetic levitation technology can be used as an efficient technology in the various industries. There are already many countries that are attracted to maglev systems. Many systems have been proposed in different parts of the worlds. This paper tries to study the most important uses of magnetic levitation technology. The results clearly reflect that the maglev can be conveniently considered as a solution for the future engineering needs of the world.

  7. The importance of contact quality

    DEFF Research Database (Denmark)

    van Bakel, Marian; Gerritsen, Marinel; van Oudenhoven, Jan Pieter

    Establishing contact between expatriates and a local host has been found to reap benefits with regard to Interaction Adjustment, Host National Social Support, Open-mindedness, and Social Initiative. This longitudinal study examines the role of the quality of contact for these four aspects....... Expatriates in the Netherlands were randomly divided into an experimental group (n = 33) of which 21 developed high-quality contact with their host, and a control group (n = 32) without host. The results show that contact quality plays an important role and suggest that the higher the quality of the contact......, the more benefit the expatriate experienced. Moreover, expatriates with low-quality contact did not experience a detrimental effect....

  8. Terminology, the importance of defining.

    Science.gov (United States)

    van Mil, J W Foppe; Henman, Martin

    2016-06-01

    Multiple terms and definitions exist to describe specific aspects of pharmacy practice and service provision. This commentary explores the reasons for different interpretations of words and concepts in pharmaceutical care and pharmacy practice research. Reasons for this variation can be found in language, culture, profession and may also depend on developments over time. A list of words is provided where the authors think that currently multiple interpretations are possible. To make sure that the reader understands the essence, it seems imperative that authors include a definition of the topics that they actually study in their papers, and that they clearly cite existing definitions or refer to collections of definitions such as existing glossaries. It is important that presenters, authors and reviewers of pharmacy practice papers pay more attention to this aspect of describing studies.

  9. Conflict management: importance and implications.

    Science.gov (United States)

    McKibben, Laurie

    2017-01-26

    Conflict is a consistent and unavoidable issue within healthcare teams. Despite training of nurse leaders and managers around areas of conflict resolution, the problem of staff relations, stress, sickness and retention remain. Conflict arises from issues with interpersonal relationships, change and poor leadership. New members of staff entering an already established healthcare team should be supported and integrated, to encourage mutual role respect between all team members and establish positive working relationships, in order to maximise patient care. This paper explores the concept of conflict, the importance of addressing causes of conflict, effective management, and the relevance of positive approaches to conflict resolution. Good leadership, nurturing positive team dynamics and communication, encourages shared problem solving and acceptance of change. Furthermore mutual respect fosters a more positive working environment for those in healthcare teams. As conflict has direct implications for patients, positive resolution is essential, to promote safe and effective delivery of care, whilst encouraging therapeutic relationships between colleagues and managers.

  10. Five important advances in hematopathology.

    Science.gov (United States)

    Shi, Min; Xiao, Ruobing; Woda, Bruce A; Yu, Hongbo

    2014-03-01

    Hematopathology is a dynamic field that has always been on the frontier of clinical research within the scope of pathology. Several recent developments in hematopathology will likely affect its practice clinically. To review 5 important recent advances in hematopathology: (1) detection and prognostic implication of MYC in diffuse large B-cell lymphomas, (2) determining origin and prognosis through immunoglobulin gene usage in mature B-cell neoplasms, (3)detecting minimal residual disease in multiple myeloma, (4) using genome-wide analysis in myelodysplastic syndromes, and (5) employing whole-genome sequencing in acute myeloid leukemias. Literature review and the authors' experiences in an academic center. These advances will bring hematopathology into a new molecular era and help us to better understand the molecular, pathologic mechanisms of lymphomas, leukemias, myelomas, and myelodysplastic syndromes. They will help us to identify diagnostic and prognostic markers and eventually provide new therapeutic targets and treatments for these diseases.

  11. Clinical importance of electromagnetic fields

    International Nuclear Information System (INIS)

    Ruppe, I.

    1993-01-01

    The clinical importance of most of the electromagnetic fields is not highly. Mostly they only have thermal effects, produced by energy-absorption. About 1 C increase of whole-body-temperature is valid for tolerable limit. For measuring is used the SAR-Value (Specific Absorption Rate) in W/kg body mass. SAR = 0,8W/kg for the whole body is valid to be safety. For the evaluation of possible other effects of electromagnetic fields the scientific knowledges are till now not sufficient to allow a final statement. That could be impacts of electromagnetic fields to conduction or switch processes in the nerves or brains, in the framwork of cellular regulations, in the genetic reactions are occurig is little, but if is necessary to find it out in scinentific investigations. (orig.) [de

  12. The importance of being informed

    Science.gov (United States)

    Draganova, Tamara

    2013-04-01

    "Science needs a lot of inspiration and that is why it is very important to draw the students` inspiration because it is the inspiration that is the future of science." For 10 years on students, teachers, parents and citizens harmonize knowledge and skills, competencies and energy, renewable ideas and shared experience on the topic "Climate change" at our High School of Humanitarian "St. st. Cyril and Methodius". During the last 3 years we have been doing our utmost to encourage the students from our school to participate actively in different eco projects such as: 8 workshops and 2 conferences, 63 multimedia lessons in ecology, geography, world and personality; 15 interactive art lessons through the Forum-theatre, 7 photo exhibitions and 29 exhibitions on the topic "The Archives of the Planet Speak", 5 roundtable workshops, 19 eco-races, 7 scenarios of decision taking, 12 open lessons, 26 discussions, 5 scientific lectures given by professors from V. Tarnovo University, Department Geography, 9 questionnaires, 17 practical lessons and experiments held in the classroom, 13 training and 11 ecological campaigns named - "It depends on You", "Striped Rug - Colourful Beans", "Let`s Plant Life", "Saving Energy between Nations", "Save Today to Have Tomorrow", "Grey Is Not Fashionable" etc. Numerous meetings were held with representatives of NGOs, the Regional Inspectorate of Education, the Regional Inspectorate of Environment and Water Safety, V. Tarnovo University, Department Geography, V. Tarnovo Municipality and other communities. Students and university students were organized around the core activity of renewable energy sources, presenting scientific and creative activities such as models, presentations, poems, essays, drawing posters and more. Students under the guidance of a teacher in geography studied history, current treatment processes and phenomena, the signs of expression, the similarities and differences between different parts of the country and other parts

  13. Toxoplasmosis: An Important Protozoan Zoonosis

    Directory of Open Access Journals (Sweden)

    Sonar S. S. and Brahmbhatt M.N.

    Full Text Available Toxoplasmosis is an important infection caused by single celled parasite Toxoplasma gondii which is one of the world's most common parasites. Toxoplasmosis is considered to be the third leading cause of death attributed to food-borne illness in the United States. Most people affected never develop signs and symptoms. But for infants born to infected mothers and for people with compromised immune systems, toxoplasmosis can cause extremely serious complications. Toxoplasmosis was first described in 1908 from a small rodent. The parasite infects almost all worm blooded animals and serological evidence indicates that it is one of the most common of humans’ infections throughout the world. The disease is transmitted mainly by ingestion of infective stage of the parasite, organ transplant as well as blood transfusion in addition to the transplacental transmission which is very common. Toxoplasmosis can be presented in various forms of clinical manifestations depending on the immune status of the patient causing life threatening disease in AIDS patient. Pregnant women, cat owners, veterinarians, abattoir workers, children, cooks, butchers are considered as high risk group. Timely treatment of man and animals with proper antibiotic, hygienic measures, proper disinfection, mass education and vaccination are the measures to curtail the disease. [Veterinary World 2010; 3(9.000: 436-439

  14. Reinsurance: Substance, range and importance

    Directory of Open Access Journals (Sweden)

    Petrović-Tomić Nataša

    2015-01-01

    Full Text Available Reinsurance - at least in Serbian law - represents one of the institutes of Insurance Law of whom a little is known. It should not be surprising as the contract of reinsurance traditionally is not regulated in civil codes or laws on contract of insurance. Questionable are all features of the contract of reinsurance: from the definition through the essentialia negotii to the principle of utmost good faith. That is why the paper is structured so that firstly gives definition of contract of reinsurance and explains position of reinsurance in the system of insurance. It is high­lighted that the contract of reinsurance builds on the contract of insurance; which enables the further transfer of risk. It is business-to-business contract (B-2-B, concluded between insurance law experts; frequently of international character; mostly contract of adhesion, aleatory and synallagmatic contract, contract with subsequent execution, etc. The importance of reinsurance in the system of insurance is divided on three components: increase of capacity of insurance market, guarantee of acomplishment of obligations of insurer and regulatory effect on insurance. The author concludes that the contract of reinsurance is a specific business insurance contract, concluded by the insurance law experts and that represents community of interests of reinsurer and reinsured. The mentioned contract may perform its function only if the contracting parties act in a responsible manner, lege artis and respecting the principle of utmost good faith.

  15. IMPORTANT PROTOZOAN PARASITES IN INDONESIA

    Directory of Open Access Journals (Sweden)

    Srisasi Gandahusada

    2012-09-01

    Full Text Available The most important protozoan parasites in Indonesia are the malaria parasites, Toxoplasma gondii and Entamoeba histolytica. After the second world war the residual insecticides and effective antimalarial drugs were used in the control of malaria. After development of resistance among mosquitoes to insecticides, the Malaria Control Programme was switched over to the Malaria Eradication Programme. Malaria incidence dropped heavily. However, due to the quick development of vector resistance and financial limitations, malaria came back and so did the Malaria Control Programme. P. falciparum and P.vivax are the most common species in Indonesia. Important vectors are An. sundaicus, An. aconitus, An. maculatus, An. hyrcanus group, An. balabacensis, An. farauti etc. An. sundaicus and An. aconitus have developed resistance to DDT and Dieldrin in Java. In 1959 the Malaria Eradication Programme was started in Java, Bali and Lampung. In 1965 the API dropped to 0,15 per thousand. From 1966 onwards malaria transmission was on the increase, because spraying activities were slowed down, but dropped again from 1974 onwards by occasional residual house spraying with DDT or Fenitrothion, malaria surveillance and treatment of malaria cases, resulting in an API of 0.18 per thousand in 1987. At present malaria is not transmitted in Jakarta and in capitals of the provinces and kabupatens, except in Irian Jaya, Nusa Tenggara Timur and one or two other provinces, but it still exists in rural areas. The distribution of chloroquine resistant P.falciparum is patchy. Resistance is at the RI, RII and RUT levels. The main problems of malaria control are : the increasing development of resistance of the vector to insecticides, the change of An.aconitus from zoophili to anthropophili and from indoor to outdoor biting, the increasing resistance of P.falciparum to chloroquine, the shortage of skilled manpower and limitation of budget. In Indonesia many newborns with congenital

  16. Zirconium - an imported mineral commodity

    International Nuclear Information System (INIS)

    1983-10-01

    This report examines Canada's position in regard to the principal zirconium materials: zircon; fusion-cast zirconium-bearing refractory products; zirconium-bearing chemicals; and zirconium metal, master alloys, and alloys. None of these is produced in Canada except fused alumina-zirconia and certain magnesium-zirconium alloys and zirconium-bearing steels. Most of the 3 000-4 000 tonnes of the various forms of zircon believed to be consumed in Canada each year is for foundry applications. Other minerals, notably chromite, olivine and silica sand are also used for these purposes and, if necessary, could be substituted for zircon. Zirconium's key role in Canada is in CANDU nuclear power reactors, where zirconium alloys are essential in the cladding for fuel bundles and in capital equipment such as pressure tubes, calandria tubes and reactivity control mechanisms. If zirconium alloys were to become unavailable, the Canadian nuclear power industry would collapse. As a contingency measure, Ontario Hydro maintains at least nine months' stocks of nuclear fuel bundles. Canada's vulnerability to short-term disruptions to supplies of nuclear fuel is diminished further by the availability of more expensive electricity from non-nuclear sources and, given time, from mothballed thermal plants. Zirconium minerals are present in many countries, notably Australia, the Republic of South Africa and the United States. Australia is Canada's principal source of zircon imports; South Africa is its sole source of baddeleyite. At this time, there are no shortages of either material. Canada has untapped zirconium resources in the Athabasca Oil Sands (zircon) and at Strange Lake along the ill-defined border between Quebec and Newfoundland (gittinsite). Adequate metal and alloy production facilities exist in France, Japan and the United States. No action by the federal government in regard to zirconium supplies is called for at this time

  17. [Mycoviruses and importance in mycology].

    Science.gov (United States)

    Keçeli, Sema Aşkın

    2017-10-01

    extracellular way, and then the binding of mycovirus to target fungus by genetic modifications is aimed. The second scenario is about the use of mycovirus as a vector for genetic transformation. In fact, this method is applied by using toxins in fungal diseases of plants. In addition, the production of lethal antibodies or peptides derived from antibodies obtained from toxin-coding cytoplasmic dsRNA mycovirus toxins may be a new therapeutic approach. It has been claimed that these derivatives may be used as parentheral therapeutic agents against human pathogenic fungi including Candida albicans. In this review article, the importance of mycoviruses in mycology has been discussed.

  18. [Breastfeeding: the importance of intervening].

    Science.gov (United States)

    Aguiar, Hélder; Silva, Ana Isabel

    2011-12-01

    Breast milk is considered by the WHO the ideal food for the first months of life. Although health professionals are aware of recommendations, high rates of drop-outs have been identified in Portugal. A false notion of hypogalactia is the major factor for early termination, which is allied to the technical difficulties of the feeding. Health professionals, often lacking training in the area, may have difficulty in reassuring mothers in these situations. In Portugal, at the 3rd month, most mothers stop breastfeeding by indication of their medical assistant. Gather evidence about the advantages of breast-feeding compared to artificial milk, and establish useful strategies in clinical practice to avoid early withdrawal. A survey was conducted for articles from the last six years in the major sites of evidence-based medicine and reference sites (Pubmed, Cochrane, National Guideline Clearinghouse, Tripdatabase, WHO). Breast-feeding is clearly associated with benefits to the infant, including significant protective effects for gastrointestinal infections (64%), middle ear (23- 50%), severe respiratory infections (73%) and for acute lymphocytic leukemia (19%) and sudden death syndrome in infants (36%). We also found long-term benefits, such as for obesity (7-24%) and other cardiovascular risk factors in adulthood. The mother also benefits from its protective effect for cancers of the breast and ovary, and diabetes mellitus type 2 as also, proportionate to the duration of breastfeeding. Health professionals have an important role in the initiation and continuation of breastfeeding. The notion of its advantages, the communication prior to delivery, accessibility support and training in technical aspects of correct picks are the proven strategies for evidence explored in the article. Breast milk contains several unique and exclusive elements, orchestrators of its health benefits. Postnatal period is critical to the development of neuro--hypothalamic circuits involved in

  19. Postradiation sarcomas: importance of surgery

    International Nuclear Information System (INIS)

    Lagrange, J.L.; Ramaioli, A.; Chateau, M.C.; Pignol, J.P.; Marchal, C.; Resbeut, M.; Richaud, P.; Rambert, P.; Tortechaux, J.; Seng, S.H.; La Fontan, B. de; Reme-Saumon, M.; Roullet, B.; Bof, J.; Coindre, J.M.

    1997-01-01

    ) and 31 mo for Surgery+chemotherapy. The differences of survival for the 3 groups are highly significant (p=0,0001, Mantel-Cox). There was no difference between Surgery or Surgery + Chemotherapy (p=0.56). The quality of surgery is known for 57 patients (complete 44p, partial 13 p). The survival was 43 mo VS 16 mo (p=0.08, Mantle-Cox, p=0.036, Breslow) Conclusion. This series confirmed the poor prognosis of post radiation sarcomas even though some have long survived for long periods but Surgery play a very important role in the survival of the patients

  20. DREW-UCLA Breast Cancer Research and Training Program: Molecular/Cellular Pathogenesis Model

    Science.gov (United States)

    2007-03-01

    RHS1764-9209568) were designed corresponding to nucleotides 575 to 595 of the coding region (gccctggccgtgctagacaat) of Homo sapiens ERBB2 transcript...variant 1, mRNA sequence (NM_004448, NCBI database), and 2896 to 2917 of the coding region (gctgaactggtgtatgcagatt) of Homo sapiens ERBB2, transcript...responsible for alanine transport. Springer Apoptosis (2007) 12:593–612 599 * T ra n sp o rt V el o ci ty (n m o l/m g p ro te in /m in ) 0.0 0.5 1.0

  1. A US Air Force Strategy for Africa (Drew Paper, Number 7)

    Science.gov (United States)

    2009-08-01

    of the French empire. In 1935 the French war minister “insisted that sparse French military resources— mechanized weaponry, field artillery...elsewhere might receive them.”3 The common argument against such broad-ranging consideration of consequences is that it engen - ders “analysis

  2. Amy and Drew: Two Children Who Helped Determine What Free Appropriate Public Education Means

    Science.gov (United States)

    Hammel, Alice M.

    2018-01-01

    Two Supreme Court cases have served to frame our legal rights and responsibilities regarding a Free Appropriate Public Education for students in our music classrooms and ensembles. This article serves as record of the two cases and their merits, according to the Supreme Court, as well as the actions recommended based on the court decisions.

  3. Population Dynamic Observation And Mass Trapping Of Fruit Fly Bactrocera Carambolae (Drew and Hancock)

    International Nuclear Information System (INIS)

    Kuswadi, Achmad Nasroh; Indarwatmi, Murni; Nasution, Indah A.; Darwani; Himawan, Toto

    2000-01-01

    In connection with the control of B. carambolae, major pest of mango fruit in Indonesia using sterile insect technique, population monitoring with methyl eugenol attractant baited traps, absolute population measurement with release and recapture techniques, and mass trapping to reduce population of the pest in mango orchards were conducted. Based on the number of the male fly trapped it was know that the fly population was always low when no mature mango fruit found on the orchard, and it strated to increase in October, the middle time, of mango harvest until some time after the end of harvesting time. In August, when the population was low, about 4000 flies/hectare or 600 flies/hectare were found in the extensive and intensive culture orchards respectively. Mass trapping with 4 trapps per hectare was able to kill about 620 and 240 male flies per hectare of the extensive and intensive culture orchards respectively

  4. Zolpidem and traffic safety - the importance of treatment compliance.

    Science.gov (United States)

    Verster, Joris C; Volkerts, Edmund R; Olivier, Berend; Johnson, William; Liddicoat, Laura

    2007-09-01

    Zolpidem is among the most frequently prescribed hypnotic drugs for those who suffer from insomnia. Recent media reports drew attention to driving impairment after zolpidem misuse. This review summarizes the available data on the effects of recommended use and misuse of zolpidem on driving ability and traffic safety. Both experimental studies and roadside evidence were taken into account. From these studies it must be concluded that patients should fully comply with the prescription instructions of zolpidem, i.e. to take the medication just prior to a full 8 hours of uninterrupted sleep. If this strategy is adopted, zolpidem is a safe alternative to benzodiazpine hypnotics and zopiclone who do show significant driving impairment the morning following bedtime administration. However, to ensure traffic safety higher dosages than recommended (10 mg) or allowing less than 8 hours between zolpidem intake and actual operation of a motor vehicle should be avoided.

  5. 9 CFR 94.19 - Restrictions on importation from BSE minimal-risk regions of meat and edible products from...

    Science.gov (United States)

    2010-01-01

    ... OF ANIMALS (INCLUDING POULTRY) AND ANIMAL PRODUCTS RINDERPEST, FOOT-AND-MOUTH DISEASE, EXOTIC... encephalopathy. (e) Meat or dressed carcasses of hunter-harvested wild sheep, goats, or other ruminants other than cervids. The meat or dressed carcass (eviscerated and the head is removed) is derived from a wild...

  6. Website Policies / Important Links | Data Explorer

    Science.gov (United States)

    Website Policies / Important Links Javascript Not Enabled OSTI Security Website Policies and Important ) Publication Date (oldest first) Close Clear All Find DOE Data Explorer Website Policies / Important Links Science | Office of Scientific and Technical Information Website Policies / Important Links * Site Map

  7. 50 CFR 20.61 - Importation limits.

    Science.gov (United States)

    2010-10-01

    ... PLANTS (CONTINUED) MIGRATORY BIRD HUNTING Importations § 20.61 Importation limits. No person shall import migratory game birds in excess of the following importation limits: (a) Doves and pigeons. (1) From any foreign country except Mexico, during any one calendar week beginning on Sunday, not to exceed 25 doves...

  8. Protein import into isolated pea root leucoplasts

    OpenAIRE

    Chu, Chiung-Chih; Li, Hsou-min

    2015-01-01

    Leucoplasts are important organelles for the synthesis and storage of starch, lipids and proteins. However, molecular mechanism of protein import into leucoplasts and how it differs from that of import into chloroplasts remain unknown. We used pea seedlings for both chloroplast and leucoplast isolations to compare within the same species. We further optimized the isolation and import conditions to improve import efficiency and to permit a quantitative comparison between the two plastid types....

  9. Inland Ertebølle Culture: the importance of aquatic resources and the freshwater reservoir effect in radiocarbon dates from pottery food crusts

    Directory of Open Access Journals (Sweden)

    Bente Philippsen

    2014-11-01

    Full Text Available The Ertebølle culture is a late Mesolithic hunter-gatherer-fisher culture in southern Scandinavia, northern Germany and Poland. Archaeological finds as well as scientific analyses of humans and their artefacts indicate the great importance of aquatic resources, both marine and freshwater, to Ertebølle subsistence. In northern Germany, modern freshwater fish samples can have very high apparent radiocarbon ages (up to 3000 years. If such dramatic 'freshwater reservoir effects' also existed during the late Mesolithic, they could lead to artificially old radiocarbon dates for the bones of Ertebølle humans and domestic dogs, and for carbonised food crusts on cooking pots. Conversely, if we can demonstrate radiocarbon age 'offsets' in such samples, we can often attribute them to the exploitation of freshwater food resources. This article discusses methods of identifying freshwater resources in prehistoric pottery, including radiocarbon reservoir effects. We consider the results of radiocarbon, stable isotope and elemental analyses of food crusts on prehistoric pottery from four sites in the Alster and Trave valleys: Kayhude, Schlamersdorf, Bebensee and Seedorf.

  10. Peroxisome protein import: a complex journey.

    Science.gov (United States)

    Baker, Alison; Lanyon-Hogg, Thomas; Warriner, Stuart L

    2016-06-15

    The import of proteins into peroxisomes possesses many unusual features such as the ability to import folded proteins, and a surprising diversity of targeting signals with differing affinities that can be recognized by the same receptor. As understanding of the structure and function of many components of the protein import machinery has grown, an increasingly complex network of factors affecting each step of the import pathway has emerged. Structural studies have revealed the presence of additional interactions between cargo proteins and the PEX5 receptor that affect import potential, with a subtle network of cargo-induced conformational changes in PEX5 being involved in the import process. Biochemical studies have also indicated an interdependence of receptor-cargo import with release of unloaded receptor from the peroxisome. Here, we provide an update on recent literature concerning mechanisms of protein import into peroxisomes. © 2016 The Author(s).

  11. Predicting the importance of current papers.

    Energy Technology Data Exchange (ETDEWEB)

    Klavans, Richard (SciTech Strategies, Inc., Berwyn, PA); Boyack, Kevin W.

    2005-01-01

    This article examines how well one can predict the importance of a current paper (a paper that is recently published in the literature). We look at three factors--journal importance, reference importance and author reputation. Citation-based measures of importance are used for all variables. We find that journal importance is the best predictor (explaining 22.3% out of a potential 29.1% of the variance in the data), and that this correlation value varies significantly by discipline. Journal importance is a better predictor of citation in Computer Science than in any other discipline. While the finding supports the present policy of using journal impact statistics as a surrogate for the importance of current papers, it calls into question the present policy of equally weighting current documents in text-based analyses. We suggest that future researchers take into account the expected importance of a document when attempting to describe the cognitive structure of a field.

  12. Why Physical Activity Is Important (for Girls)

    Science.gov (United States)

    ... Home Fitness Why physical activity is important Why physical activity is important You may wonder if being physically ... you are to be around. That's partly because physical activity gets your brain to make "feel-good" chemicals ...

  13. Evaluations and utilizations of risk importances

    International Nuclear Information System (INIS)

    Vesely, W.E.; Davis, T.C.

    1985-08-01

    This report presents approaches for utilizing Probabilistic Risk Analyses (PRA's) to determine risk importances. Risk importances are determined for design features, plant operations, and other factors that can affect risk. PRA's can be used to identify the importances of risk contributors or proposed changes to designs or operations. The objective of this report is to serve as a handbook and guide in evaluating and applying risk importances. The utilization of both qualitative risk importances and quantitative risk importances is described in this report. Qualitative risk importances are based on the logic models in the PRA, while quantitative risk importances are based on the quantitative results of the PRA. Both types of importances are among the most robust and meaningful information a PRA can provide. A wide variety of risk importance evaluations are described including evaluations of the importances of design changes, testing, maintenance, degrading environments, and aging. Specific utilizations are described in inspection and in reliability assurance programs, however the general approaches have widespread applicability. The role of personal computers and decision support programs in applying risk importance evaluations is also described

  14. 77 FR 70714 - Electronic Import Inspection Application and Certification of Imported Products and Foreign...

    Science.gov (United States)

    2012-11-27

    ... Import Inspection Application and Certification of Imported Products and Foreign Establishments..., the egg products import regulations provide for foreign country (not establishment) certification to... imported egg products at this time. The Agency will propose foreign establishment certification in a...

  15. THE IMPACT OF REFORMING WHEAT IMPORTING STATE-TRADING ENTERPRISES ON THE QUALITY OF WHEAT IMPORTED

    OpenAIRE

    Lavoie, Nathalie

    2003-01-01

    Recent surveys of wheat importers indicate that countries that import wheat via a state trader are less sensitive to quality issues in import decision making than countries that import wheat through private traders. This study examines conceptually and empirically the impact of the deregulation of wheat imports on the quality and source of wheat imports.

  16. Measures of risk importance and their applications

    International Nuclear Information System (INIS)

    Vesely, W.E.; Davis, T.C.; Denning, R.S.; Saltos, N.

    1983-07-01

    This work is part of a project being conducted for the Division of Risk Analysis (DRA) of the Nuclear Regulatory Commission (NRC). The objectives of the project are to evaluate the importances of containment, the different safety functions, and other various contributers as assessed in probabilistic risk analyses and to identify generic conclusions regarding the importances. Effective display of the importances is an important part of these objectives. To address these objectives, measures of risk importance need to be first identified and then they need to be evaluated for the different risk analyses which have been performed. This report describes the risk importance measures that were defined and were applied to the risk analyses which were performed as part of the Reactor Safety Study Methodology Applications Program (RSSMAP). The risk importance measures defined in this report measure the importance of features not only with regard to risk reduction but also with regard to reliability assurance, or risk maintenance. The goal of this report is not to identify new mathematical formulas for risk importance but to show how importance measures can be interpreted and can be applied

  17. Protein import into isolated pea root leucoplasts

    Directory of Open Access Journals (Sweden)

    Chiung-Chih eChu

    2015-09-01

    Full Text Available Leucoplasts are important organelles for the synthesis and storage of starch, lipids and proteins. However, molecular mechanism of protein import into leucoplasts and how it differs from that of import into chloroplasts remain unknown. We used pea seedlings for both chloroplast and leucoplast isolations to compare within the same species. We further optimized the isolation and import conditions to improve import efficiency and to permit a quantitative comparison between the two plastid types. The authenticity of the import was verified using a mitochondrial precursor protein. Our results show that, when normalized to Toc75, most translocon proteins are less abundant in leucoplasts than in chloroplasts. A precursor shown to prefer the receptor Toc132 indeed had relatively more similar import efficiencies between chloroplasts and leucoplasts compared to precursors that preferred Toc159. Furthermore we found two precursors that exhibited very high import efficiency into leucoplasts. Their transit peptides may be candidates for delivering transgenic proteins into leucoplasts and for analyzing motifs important for leucoplast import.

  18. Direct Importance Estimation with Gaussian Mixture Models

    Science.gov (United States)

    Yamada, Makoto; Sugiyama, Masashi

    The ratio of two probability densities is called the importance and its estimation has gathered a great deal of attention these days since the importance can be used for various data processing purposes. In this paper, we propose a new importance estimation method using Gaussian mixture models (GMMs). Our method is an extention of the Kullback-Leibler importance estimation procedure (KLIEP), an importance estimation method using linear or kernel models. An advantage of GMMs is that covariance matrices can also be learned through an expectation-maximization procedure, so the proposed method — which we call the Gaussian mixture KLIEP (GM-KLIEP) — is expected to work well when the true importance function has high correlation. Through experiments, we show the validity of the proposed approach.

  19. Investigating important factors influencing purchasing from chains

    Directory of Open Access Journals (Sweden)

    Naser Azad

    2012-04-01

    Full Text Available In this paper, we survey important factors, influencing customers to buy more from one of well known food market operating in capital city of Iran named Shahrvand. The survey studies the effects of six factors including customer's perception, persuasive factors, brand, customers' expectations, product's characteristics and special features of store on attracting more customers. We have distributed questionnaire among 196 customers who regularly visit stores and analyzed details of the data. The results indicate that customers' perception is the most important item, which includes eight components. Years of experience is the most important item in our survey followed by impact of color and working hours. Diversity of services is another factor, which plays the most important role followed by quality of services. Next, fidelity and brand are other most important factors and the name of store and risk are in lower degree of importance.

  20. A comparison of RAM importance measures

    International Nuclear Information System (INIS)

    Atwood, C.L.; Wolford, A.J.; Wright, R.E.

    1989-01-01

    In this paper measures of importance of components and cut sets of a system are reviewed. The measures considered are based on reliability, availability, and maintainability, the three elements of the acronym RAM. They follow the approaches of Fussell and Vesely and of Birnbaum. A new Birnbaum-type unmaintainability importance measure is proposed. The measures are compared in a simple example, and the appropriate use of unmaintainability importance is discussed

  1. Characterizing Density and Complexity of Imported Cargos

    Energy Technology Data Exchange (ETDEWEB)

    Birrer, Nathaniel [Lawrence Livermore National Lab. (LLNL), Livermore, CA (United States); Divin, Charles [Lawrence Livermore National Lab. (LLNL), Livermore, CA (United States); Glenn, Steven [Lawrence Livermore National Lab. (LLNL), Livermore, CA (United States); Martz, Harry [Lawrence Livermore National Lab. (LLNL), Livermore, CA (United States)

    2017-08-01

    X-ray inspection systems are used to detect radiological and nuclear threats in imported cargo. In order to better understand performance of these systems, system imaging capabilities and the characteristics of imported cargo need to be determined. This project involved calculation of the modulation transfer function as a metric of system imaging performance and a study of the density and inhomogeneity of imported cargos, which have been shown to correlate with human analysts, threat detection performance.

  2. Nuclear exportation and importation - the Brazilian situation

    International Nuclear Information System (INIS)

    Lavos Coimbra, G.

    1986-01-01

    The author proposes to set up a working group which should be responsible for the compilation of laws, procedures, and national policies for the nuclear importation and exportation in the supplying and receiving countries. Shared international views would simplify the flow of imports and exports between the countries. The author describes the different phases of exportation and importation of nuclear material are processed in her country, Brazil. (CW) [de

  3. IMPORTANCE OF FINANCING THE SOCIAL ECONOMY PROJECTS

    OpenAIRE

    Victor NICOL‚ESCU; Corina CACE; Sorin CACE

    2012-01-01

    The re-emergence of the social economy sector as important agent for occupation, economic growth, social solidarity, associationism and social services, coincided with a higher importance of running program and project- based activities in all European countries, irrespective whether they are member states of candidate states. Within the context of the benefits specific to the social economy projects it is important to debate and analyse the subject of continuing the activities of this form o...

  4. Seed Potato Production and Its Importance

    OpenAIRE

    Erdoğan ÖZTÜRK; Taşkın POLAT

    2017-01-01

    Our country has different agricultural regions showed different ecological properties in terms of climate and soil characteristics increase the plant variety. Within this variety the potato is one of the most important plants for agriculture and economic of our country, also it is an important food source for human. It is important to use productive and quality seed for healthy agricultural production. With the using of good quality seed, can be obtained about 20% increase in yield. Certified...

  5. Reliability importance measures and their calculation

    International Nuclear Information System (INIS)

    Andsten, R.; Vaurio, J.K.

    1989-01-01

    The importance of a component to the system reliability or availability and to the system failure rate can be measured by a number of importance measures. Such measures can be used to guide the system design improvement actions as well as the diagnostic and repair actions. This report develops relationships between several importance measures, illustrates their meaning with interpretations and applications, and describes the computer program called IMPO that calculates importance measures when the system minimum cat sets and component parameters are given. A user's manual is included with illustrative examples

  6. Attitude Importance and the False Consensus Effect.

    Science.gov (United States)

    Fabrigar, Leandre R.; Krosnick, Jon A.

    1995-01-01

    Explores the possibility that importance may regulate the magnitude of the false consensus effect. Analysis revealed a strong false consensus effect but no reliable relation between its magnitude and attitude importance. Results contradict assumptions that the false consensus effect arises from attitudes that directly or indirectly influence…

  7. Chief Business Officers' Functions: Responsibilities and Importance.

    Science.gov (United States)

    Calver, Richard A.; Vogler, Daniel E.

    1985-01-01

    Reports on a survey of 177 chief business officers of public community colleges regarding their responsibilities and the importance they assigned to various role functions. Highlights findings concerning the perceived importance of fiscal/financial duties; endowments as a job function; role in shared planning; and personal attention given to…

  8. 9 CFR 93.807 - Other importations.

    Science.gov (United States)

    2010-01-01

    ... CONVEYANCE AND SHIPPING CONTAINERS Elephants, Hippopotami, Rhinoceroses, and Tapirs § 93.807 Other importations. (a) Elephants, hippopotami, rhinoceroses, and tapirs are exempt from the regulations in this part... or bedding materials with any elephant, hippopotamus, rhinoceros, or tapir imported into Canada...

  9. 9 CFR 93.802 - Import permit.

    Science.gov (United States)

    2010-01-01

    ... CONVEYANCE AND SHIPPING CONTAINERS Elephants, Hippopotami, Rhinoceroses, and Tapirs § 93.802 Import permit. (a) An elephant, hippopotamus, rhinoceros, or tapir shall not be imported into the United States... export an elephant, hippopotamus, rhinoceros, or tapir to the United States; (2) The name and address of...

  10. 47 CFR 2.1204 - Import conditions.

    Science.gov (United States)

    2010-10-01

    ... 47 Telecommunication 1 2010-10-01 2010-10-01 false Import conditions. 2.1204 Section 2.1204 Telecommunication FEDERAL COMMUNICATIONS COMMISSION GENERAL FREQUENCY ALLOCATIONS AND RADIO TREATY MATTERS; GENERAL... frequency device is being imported in limited quantities for demonstration at industry trade shows and the...

  11. Development and application of group importance measures

    International Nuclear Information System (INIS)

    Haskin, F.E.; Huang, Min; Sasser, M.K.; Stack, D.W.

    1992-01-01

    As part of a complete Level I probabilistic safety analysis of the K Production Reactor, three traditional importance measures-risk reduction, partial derivative, and variance reduction-have been extended to permit analyses of the relative importance of groups of basic and initiating events. None of the group importance measures require Monte Carlo sampling for their quantification. The group importance measures are quantified for the overall fuel damage equation and for dominant accident sequences using the following event groups: initiating events, electrical failures, instrumentation failures, common-cause failures, human errors, and nonrecovery events. Additional analyses are presented using other event groups. Collectively, these applications indicate both the utility and the versatility of the group importance measures

  12. [Imported diseases in Switzerland: development and perspectives].

    Science.gov (United States)

    Degrémont, A; Lorenz, N

    1990-10-01

    During the last years, imported diseases have become more frequent in Switzerland. This is easily explained by the enormous increase of tourism to tropical and subtropical countries. Immigration from these countries has equally seen an important augmentation. The principal imported diseases are still malaria and gastrointestinal infections. Viral infections are rarely diagnosed, with the exception of hepatitis and HIV infection. The prevalence of sexually transmitted diseases is most certainly underestimated. The differential diagnosis of imported skin diseases is still difficult. Rare tropical diseases will probably become more frequent in the coming years as travellers leave more and more the traditional tourist paths. Practitioners have to look out for such problems, and continuous training programmes for them will have to take these new problems into account. Referral centres of infectious diseases should be established in all regions of Switzerland. High priority should be given to the prevention of imported diseases.

  13. ANÁLISIS FUNCIONALES EN ARTEFACTOS LÍTICOS DE GRUPOS CAZADORES-RECOLECTORES EN REGIONES TROPICALES DURANTE LA TRANSICIÓN PLEISTOCENO FINAL-HOLOCENO TEMPRANO: EL ABRIGO SANTA MARTA, CHIAPAS, MÉXICO (Functional Analysis of Lithic Artifacts of Hunter-Gatherer Groups in Tropical Regions During the Late Pleistocene-Early Holocene Transition: Santa Marta's Shelter, Chiapas, Mexico

    Directory of Open Access Journals (Sweden)

    Patricia Pérez Martínez

    2018-03-01

    Full Text Available Los análisis funcionales vieron la luz en la década de los sesenta con la publicación de la Tecnología Prehistórica de Semenov (1964, desde entonces se ha realizado un gran número de investigaciones para dilucidar actividades de subsistencia a partir de la funcionalidad de los artefactos. Desafortunadamente, en México pocos han sido los trabajos enfocados a este tipo de análisis (Elizalde y Mandujano 2000; Lewenstein 1990; Mirambell 1964. En el presente estudio se analizaron microscópicamente 36 artefactos líticos con el objetivo de caracterizar los micropulidos e inferir la funcionalidad de estos conjuntos asociados a grupos cazadores-recolectores procedentes de contextos de la transición Pleistoceno-Holoceno (13130-12671 cal. AP. ENGLISH: Use-wear studies began in the 1960s with Semenov’s publication entitled Prehistoric Technology (1964. Since then, a great number of investigations have been carried out to elucidate subsistence activities based on the functionality of the artifacts. Unfortunately, in Mexico few studies have focused on this type of analysis (Elizalde & Mandujano 2000; Lewenstein 1990; Mirambell 1964. In the present study, 36 lithic artifacts associated with hunter-gatherer groups from Pleistocene-Holocene transition contexts (13130–12671 cal. AP were analyzed microscopically with the aim of characterizing micropolishes and inferring functionality.

  14. The elusive importance effect: more failure for the Jamesian perspective on the importance of importance in shaping self-esteem.

    Science.gov (United States)

    Marsh, Herbert W

    2008-10-01

    Following William James (1890/1963), many leading self-esteem researchers continue to support the Individual-importance hypothesis-that the relation between specific facets of self-concept and global self-esteem depends on the importance an individual places on each specific facet. However, empirical support for the hypothesis is surprisingly elusive, whether evaluated in terms of an importance-weighted average model, a generalized multiple regression approach for testing self-concept-by-importance interactions, or idiographic approaches. How can actual empirical support for such an intuitively appealing and widely cited psychological principle be so elusive? Hardy and Moriarty (2006), acknowledging this previous failure of the Individual-importance hypothesis, claim to have solved the conundrum, demonstrating an innovative idiographic approach that provides clear support for it. However, a critical evaluation of their new approach, coupled with a reanalysis of their data, undermines their claims. Indeed, their data provide compelling support against the Individual-importance hypothesis, which remains as elusive as ever.

  15. Economics of power generation from imported biomass

    International Nuclear Information System (INIS)

    Lako, P.; Van Rooijen, S.N.M.

    1998-02-01

    Attention is paid to the economics of import of biomass to the Netherlands, and subsequent utilisation for power generation, as a means to reduce dependence on (imported) fossil fuels and to reduce CO2 emission. Import of wood to the extent of 40 PJ or more from Baltic and South American states seems to be readily achievable. Import of biomass has various advantages, not only for the European Union (reduced CO2 emissions) but also for the countries of origin (employment creation). However, possible disadvantages or risks should be taken into account. With that in mind, import of biomass from Baltic states seems very interesting, although it should be noted that in some of those countries the alternative of fuel-switching to biomass seems to be more cost-effective than import of biomass from those countries. Given the expected increase in inland biomass consumption in the Baltic countries and the potential substantial future demand for biomass in other Western European countries it is expected that the biomass supply from Baltic countries will not be sufficient to fulfill the demand. An early focus on import from other countries seems advisable. Several power generation options are available with short to medium term potential and long term potential. The margin between costs of biomass-fuelled power and of coal fired power will be smaller, due to substantial improvements in power generating efficiency and reductions of investment costs of options for power generation from biomass, notably Biomass Gasification Combined Cycle. 18 refs

  16. Ministerial Importance and Survival in Government

    DEFF Research Database (Denmark)

    Bright, Jonathan; Döring, Holger; Little, Conor

    2015-01-01

    less important ministerial positions. Age, prior government experience and the size of the party to which the minister belongs are also associated with consistently significant effects. Further, the study explores the determinants of survival for two types of risk – exiting government with one’s party...... and exiting without it – showing that the effects of ministerial importance and other covariates are markedly different for these two types of exit. The findings have important implications for the understanding of ministerial and governmental stability....

  17. Radiological control of food importation products

    International Nuclear Information System (INIS)

    Aguirre G, J.

    2003-01-01

    Nowadays exists the possibility of marketing products possibly polluted with radioactive isotopes, by that some countries like Mexico, they have been given to the task of creating legal bases and the necessary infrastructure with the end of carrying out the radiological surveillance of nutritious import products. In this work the legal bases that our country has established for the radiological control are presented besides the results of this radiological control carried out through the gamma spectroscopy analysis of nutritious import products sent to our country through diverse companies that import foods produced mainly in European countries. (Author)

  18. On the Importance of Well-Being

    DEFF Research Database (Denmark)

    Rodogno, Raffaele

    2008-01-01

    central theories in normative ethics. I will focus on Scanlon’s discussion in particular because it affords us with two criteria for the assessment of the importance for a person of a value-concept such as well-being. I will claim that much of Scanlon’s case rests on the idea that well......Many among philosophers and non-philosophers would claim that well-being is important in moral theory because it is important to the individual whose well-being it is. The exact meaning of this claim, however, is in need of clarification. Having provided that, I will present a charge against it...

  19. German radionuclide exports and imports 1990

    International Nuclear Information System (INIS)

    Anon.

    1991-01-01

    The statistics compiled by the German Federal Office for Trade and Industry (Bundesamt fuer Wirtschaft) for the Federal Ministry for the Environment, Conservation of Nature, and Reactor Protection of imports and exports of radionuclides, irradiation samples and sealed emitters above 1850 GBq show a slight decline by 11.8%, on the basis of activity, in imports and a somewhat higher rise by 21.6% in exports in 1990. Imports returned to the level of 1988 after having experienced an extraordinary rise in 1989. Exports were slightly better than in the previous year, but still considerably below the average of the past five years. (orig.) [de

  20. The economic importance of migrant entrepreneurship: An ...

    African Journals Online (AJOL)

    The economic importance of migrant entrepreneurship: An application of data ... as an interesting focus for the city's Small and Medium Enterprise (SME) policy. ... and provide a positive stimulus for creative business-making in modern cities.

  1. Why Is Oral Health Important for Women?

    Science.gov (United States)

    ... 2018 About | Contact InfoBites Quick Reference Learn more Oral Health and Overal Health Gum Disease and Cardiovascular Health ... delivered directly to your desktop! more... Why Is Oral Health Important for Women? Article Chapters Why Is Oral ...

  2. A new importance measure for sensitivity analysis

    International Nuclear Information System (INIS)

    Liu, Qiao; Homma, Toshimitsu

    2010-01-01

    Uncertainty is an integral part of risk assessment of complex engineering systems, such as nuclear power plants and space crafts. The aim of sensitivity analysis is to identify the contribution of the uncertainty in model inputs to the uncertainty in the model output. In this study, a new importance measure that characterizes the influence of the entire input distribution on the entire output distribution was proposed. It represents the expected deviation of the cumulative distribution function (CDF) of the model output that would be obtained when one input parameter of interest were known. The applicability of this importance measure was tested with two models, a nonlinear nonmonotonic mathematical model and a risk model. In addition, a comparison of this new importance measure with several other importance measures was carried out and the differences between these measures were explained. (author)

  3. Colorectal Cancer: The Importance of Early Detection

    Science.gov (United States)

    ... of this page please turn JavaScript on. Feature: Colorectal Cancer The Importance of Early Detection Past Issues / Summer ... Cancer of the colon or rectum is called colorectal cancer. The colon and the rectum are part of ...

  4. Information-theoretic approach to uncertainty importance

    International Nuclear Information System (INIS)

    Park, C.K.; Bari, R.A.

    1985-01-01

    A method is presented for importance analysis in probabilistic risk assessments (PRA) for which the results of interest are characterized by full uncertainty distributions and not just point estimates. The method is based on information theory in which entropy is a measure of uncertainty of a probability density function. We define the relative uncertainty importance between two events as the ratio of the two exponents of the entropies. For the log-normal and log-uniform distributions the importance measure is comprised of the median (central tendency) and of the logarithm of the error factor (uncertainty). Thus, if accident sequences are ranked this way, and the error factors are not all equal, then a different rank order would result than if the sequences were ranked by the central tendency measure alone. As an illustration, the relative importance of internal events and in-plant fires was computed on the basis of existing PRA results

  5. Importance of Grammar in English Teaching

    Institute of Scientific and Technical Information of China (English)

    赵天毓

    2011-01-01

    Grammar teaching is one of the most difficult and important points in the middle school. However, there exist some problems with present grammar teaching, such as students' poor knowledge of grammar, improper teaching methods and the ignorance of grammar

  6. 1986 imports and exports of radionuclides

    International Nuclear Information System (INIS)

    Anon.

    1987-01-01

    The statistics compiled by the German Federal Office for Industry (Bundesamt fuer Wirtschaft), on behalf of the Federal Ministry for the Environment, Protection of Nature, and Reactor Safety, of the imports and exports of radionuclides, irradiation samples, and sealed emitters of more than 1850 GBq show an enormous increase by 152.7% of imports (on the basis of activity) and a decline by 19.5% of exports. In the category of imports, some 98% of the total activity were made up of the H-3, Co-60, Mo-99, and Ir-192 nuclides. In the category of sealed emitters, the imports of Co-60 have trebled. In the exports category, more than 95% of the total activity were made up of the H-3, Mo-99, and Ir-192 nuclides. In the category of sealed emitters, exports of Cs-137 experienced a fourfold increase over the level of the previous year. (orig.) [de

  7. Important complications of chronic kidney disease

    African Journals Online (AJOL)

    A raised parathyroid hormone level (secondary hyperparathyroidism) is also a major risk factor for cardiovascular .... Evaluation of the iron deficit and correct iron supply is important ... growth factor 23 which, in turn, inhibits the hydroxylation of.

  8. Food and Agricultural Imports from China

    National Research Council Canada - National Science Library

    Becker, Geoffrey S

    2007-01-01

    U.S. food and agricultural imports have increased significantly in recent years. A series of recent incidents have raised safety concerns about the many foods, medicines, and other products from China in particular. U.S...

  9. 7 CFR 1219.58 - Importer associations.

    Science.gov (United States)

    2010-01-01

    ... may be composed of importers as well as representatives of foreign avocado exporting industries. An... AGREEMENTS AND ORDERS; MISCELLANEOUS COMMODITIES), DEPARTMENT OF AGRICULTURE HASS AVOCADO PROMOTION, RESEARCH, AND INFORMATION Hass Avocado Promotion, Research, and Information Order Budgets, Expenses, and...

  10. The importance of materiality in audit

    OpenAIRE

    Maria MORARU; Franca DUMITRU

    2012-01-01

    In the context of globalization the need of information becomes more and more important. The information dominate the economical life of entities, the access to information being an absolute necessary condition for the business success. The auditors issue a kind of warranty certificate concerning the information contained in the financial or non/financial statements. The work makes a study of the determination method of materiality, of its importance in the audit process, it presents the rela...

  11. History And Importance Of Graphic Design

    OpenAIRE

    Lyallya, Kirill

    2016-01-01

    This thesis is about history and importance of graphic design in different periods, from ancient times until today. The features inherent in different countries are considered. The techniques, basic methods for creating projects and computer software that designers have used are mentioned. In order to understand the importance of graphic design in our lives, it is considered from the side of ordinary people, how it manifests itself in daily lives and how it affects business. The thesis provid...

  12. Motivation and its importance in learning English

    OpenAIRE

    Нетесова, Мария Витальевна

    2015-01-01

    The principal objective of this paper is to pay our attention to such a significant problem as motivation in the process of learning a foreign language. The paper is devoted to the very important problem concerning educational process. For most purposes in today, motivation has different reasons why we act in a certain way. We may indeed be motivated by influences as basic as pain and pleasure. The key to understanding motivation is, to some, understanding why it is important to an individual...

  13. Importance sampling the Rayleigh phase function

    DEFF Research Database (Denmark)

    Frisvad, Jeppe Revall

    2011-01-01

    Rayleigh scattering is used frequently in Monte Carlo simulation of multiple scattering. The Rayleigh phase function is quite simple, and one might expect that it should be simple to importance sample it efficiently. However, there seems to be no one good way of sampling it in the literature....... This paper provides the details of several different techniques for importance sampling the Rayleigh phase function, and it includes a comparison of their performance as well as hints toward efficient implementation....

  14. Ticks imported to Europe with exotic reptiles.

    Science.gov (United States)

    Mihalca, Andrei Daniel

    2015-09-30

    It is known that traded exotic animals carry with them an immense number of associated symbionts, including parasites. Reptiles are no exception. Most of the imported reptiles originate from tropical countries and their possibility to carry potentially dangerous pathogens is high. According to CITES, Europe is currently the main reptile importer in the world. Despite this, there is no review or analysis available for the risk related to the importation of tick-borne diseases with traded reptile to the EU. The main aim of the manuscript is to provide a review on the available literature on ticks introduced to and exchanged between European countries via the live reptile trade. So far, the published reports of ticks imported on reptiles are limited to few European countries: Italy, Poland, Spain, Netherlands, Belgium, Slovenia and UK. The following species have been reported: Hyalomma aegyptium, Amblyomma dissimile, Amblyomma exornatum, Amblyomma flavomaculatum, Amblyomma fuscolineatum, Amblyomma latum, Amblyomma quadricavum, Amblyomma marmoreum, Amblyomma nuttalli, Amblyomma sparsum, Amblyomma sphenodonti, Amblyomma transversale and Amblyomma varanense. The majority of species are of African origin, followed by American and Asian species. All groups of reptiles (chelonians, snakes, lizards, crocodiles, tuataras) were involved. However, it seems that certain groups (i.e. tortoises of genus Testudo, monitor lizards of genus Varanus, snakes of genus Python) are more important as host for imported ticks, but this may be related to higher levels of international trade. Even fewer are the reports of tick-borne pathogens associated with imported reptile ticks. Despite the diversity of tick species reported on imported reptiles, the situations of truly invasive species are atypical and are limited in natural environments to maximum two cases where H. aegyptium was involved. Otherwise, the risk associated with reptile trade for introduction of invasive tick to Europe is low

  15. ECONOMIC AND SOCIAL IMPORTANCE OF TOURISM

    OpenAIRE

    Ștefan-Dragoș CÎRSTEA; Andreea CÎRSTEA

    2015-01-01

    Tourism is a sector with a significant share in the economies of many countries. There are nations whose GDP consists of 40% of the total contribution of tourism to this indicator. One such segment requires permanent research of its economic, social and sustainability dimensions and their importance. This study outlines an overview of the main aspects related to economic and social importance of tourism and how tourism relates to the concept of sustainable development. The total contribution ...

  16. IMPORTANCE OF KNOWLEDGE MANAGEMENT FOR COMPANIES

    OpenAIRE

    Vivian Toledo Santos Gambarato; Pâmela Gimenez Mateus; Renato Luiz Gambarato

    2015-01-01

    This work addressed the importance of knowledge management as a strategy for the survival of companies in the market. It have been shown the talent retention concepts, people management, intellectual capital and technologies related to knowledge management, in the view of several authors, in order to prove the importance of these issues can provide organizations. A survey of companies was performed, which showed part of your reality with respect to talent retention practice and...

  17. Import-push or Export-pull?

    DEFF Research Database (Denmark)

    Jäkel, Ina Charlotte

    2014-01-01

    predictions regarding the export market and the role of product differentiation. Empirical results for a sample of Danish manufacturing industries confirm the import- "push" hypothesis as well as the export- "pull" hypothesis, but also reveal differences across industries. The selection effect of trade...... is mainly driven by the "import-push" if product differentiation is high, whereas it is driven by the "export-pull" if goods are homogeneous....

  18. Import-push or Export-pull?

    DEFF Research Database (Denmark)

    Jäkel, Ina Charlotte

    predictions regarding the export market and the role of product differentiation. Empirical results for a sample of Danish manufacturing industries confirm the import-"push" hypothesis as well as the export-"pull" hypothesis, but also reveal differences across industries. The selection effect of trade...... is mainly driven by the "import-push" if product differentiation is high, whereas it is driven by the "export-pull" if goods are homogeneous....

  19. Imported emissions. The world trade stowaway

    International Nuclear Information System (INIS)

    Fink, Meike; Gautier, Celia

    2013-05-01

    This study first gives an overview of existing tools and methodological challenges to account emissions included in consumed products fabricated elsewhere. It notably discusses the passage from a methodology based on a production principle to a methodology based on a consumption principle, outlines the different methodologies associated with the different analysis levels, and the importance of uncertainty sources. The second part proposes a view on emission flows included in exports and imports. It addresses the following issues: the international level, increasing importance of emissions transferred via world trade, emissions related to consumption per capita and per social class, carbon and energy intensity of products at the origin of emissions, composition of imported and exported products and intensity of their emissions, impact of a methodological change on greenhouse gas emissions by France, extent of emissions imported in France, and Germany as the first trade partner and emission importer of France. The third part discusses the political implications of an accounting of emissions related to consumption and to world trade

  20. Quality characteristics of rice inoculated with Inonotus obliquus ...

    African Journals Online (AJOL)

    latif

    2013-08-14

    Aug 14, 2013 ... scavenging activity, Hunter`s color values, free amino acid content, and mineral content were investigated. ... important foods in the human diet and one of the most extended cereal crops ...... Gluten-Free Cereal Products and.

  1. Import of electric power increased by 19 %

    International Nuclear Information System (INIS)

    Anon.

    2000-01-01

    The import of electric power increased by 19% in 1999. Due to the decrease in the electric power export the net import of electric power increased even more. Electric power import from Sweden was 6000 GWh, import from Russia 5200 GWh and import from Norway 100 GWh. The electric power export in 1999 was only 200 GWh. The generation of nuclear power increased 5% and the consumption of wood-based fuels by 3%. The increase in nuclear power generation is based on increment of the power output capacities of the power plants. The consumption of peat decreased by 12% and the production of hydroelectric power by 15%. The decrement of the peat consumption is based on the changes in energy taxation. The production of hydroelectric power decreased to the normal level after the rainy year 1998. Oil consumption remained nearly the same as in 1998 even though the national product increased in 1999 by 3.5%. The wind power generation was doubled in 1999. The share of it is still only about 0.01% of the total energy consumption. Carbon dioxide emissions from coal and peat, decreased by 1.0 million tons, down to 56 million tons. The present emissions are now only about 2 million tons higher than during the reference year 1990. The emissions have decreased by 5 million tons since 1996 when they were at their highest

  2. Electrochemical Behavior of Biologically Important Indole Derivatives

    Directory of Open Access Journals (Sweden)

    Cigdem Karaaslan

    2011-01-01

    Full Text Available Voltammetric techniques are most suitable to investigate the redox properties of a new drug. Use of electrochemistry is an important approach in drug discovery and research as well as quality control, drug stability, and determination of physiological activity. The indole nucleus is an essential element of a number of natural and synthetic products with significant biological activity. Indole derivatives are the well-known electroactive compounds that are readily oxidized at carbon-based electrodes, and thus analytical procedures, such as electrochemical detection and voltammetry, have been developed for the determination of biologically important indoles. This paper explains some of the relevant and recent achievements in the electrochemistry processes and parameters mainly related to biologically important indole derivatives in view of drug discovery and analysis.

  3. Responsiveness and minimal clinically important change

    DEFF Research Database (Denmark)

    Christiansen, David Høyrup; Frost, Poul; Falla, Deborah

    2015-01-01

    Study Design A prospective cohort study nested in a randomized controlled trial. Objectives To determine and compare responsiveness and minimal clinically important change of the modified Constant score (CS) and the Oxford Shoulder Score (OSS). Background The OSS and the CS are commonly used...... to assess shoulder outcomes. However, few studies have evaluated the measurement properties of the OSS and CS in terms of responsiveness and minimal clinically important change. Methods The study included 126 patients who reported having difficulty returning to usual activities 8 to 12 weeks after...... were observed for the CS and the OSS. Minimal clinically important change ROC values were 6 points for the OSS and 11 points for the CS, with upper 95% cutoff limits of 12 and 22 points, respectively. Conclusion The CS and the OSS were both suitable for assessing improvement after decompression surgery....

  4. German nuclear fuel exports and imports 1991

    International Nuclear Information System (INIS)

    Anon.

    1993-01-01

    The statistics compiled by the German Federal Office for Trade and Industry (Bundesamt fuer Wirtschaft) for the Federal Ministry for the Environment, Conservation of Nature, and Reactor Safety of imports and exports of nuclear fuels and source materials in 1991 show a major drop by 33.8% in imports and a pronounced rise by 191.5% in exports, compared to the levels in the previous year. Source material for the purposes of these statistics refers only to uranium concentrate. Quantitatively, the biggest import items are source materials, depleted uranium, and uranium enriched up to 3%. Exports of unirradiated material quantitatively comprise mainly depleted uranium, source material, and uranium enriched up to 10%. (orig.) [de

  5. Important Issues in Ecotoxicological Investigations Using Earthworms.

    Science.gov (United States)

    Velki, Mirna; Ečimović, Sandra

    The importance and beneficial effects of earthworms on soil structure and quality is well-established. In addition, earthworms have proved to be important model organisms for investigation of pollutant effects on soil ecosystems. In ecotoxicological investigations effects of various pollutants on earthworms were assessed. But some important issues regarding the effects of pollutants on earthworms still need to be comprehensively addressed. In this review several issues relevant to soil ecotoxicological investigations using earthworms are emphasized and guidelines that should be adopted in ecotoxicological investigations using earthworms are given. The inclusion of these guidelines in ecotoxicological studies will contribute to the better quantification of impacts of pollutants and will allow more accurate prediction of the real field effects of pollutants to earthworms.

  6. Optimization of importance factors in inverse planning

    International Nuclear Information System (INIS)

    Xing, L.

    1999-01-01

    Inverse treatment planning starts with a treatment objective and obtains the solution by optimizing an objective function. The clinical objectives are usually multifaceted and potentially incompatible with one another. A set of importance factors is often incorporated in the objective function to parametrize trade-off strategies and to prioritize the dose conformality in different anatomical structures. Whereas the general formalism remains the same, different sets of importance factors characterize plans of obviously different flavour and thus critically determine the final plan. Up to now, the determination of these parameters has been a 'guessing' game based on empirical knowledge because the final dose distribution depends on the parameters in a complex and implicit way. The influence of these parameters is not known until the plan optimization is completed. In order to compromise properly the conflicting requirements of the target and sensitive structures, the parameters are usually adjusted through a trial-and-error process. In this paper, a method to estimate these parameters computationally is proposed and an iterative computer algorithm is described to determine these parameters numerically. The treatment plan selection is done in two steps. First, a set of importance factors are chosen and the corresponding beam parameters (e.g. beam profiles) are optimized under the guidance of a quadratic objective function using an iterative algorithm reported earlier. The 'optimal' plan is then evaluated by an additional scoring function. The importance factors in the objective function are accordingly adjusted to improve the ranking of the plan. For every change in the importance factors, the beam parameters need to be re-optimized. This process continues in an iterative fashion until the scoring function is saturated. The algorithm was applied to two clinical cases and the results demonstrated that it has the potential to improve significantly the existing method of

  7. Phenomena and parameters important to burnup credit

    International Nuclear Information System (INIS)

    Parks, C.V.; Dehart, M.D.; Wagner, J.C.

    2001-01-01

    Since the mid-1980s, a significant number of studies have been directed at understanding the phenomena and parameters important to implementation of burnup credit in out-of-reactor applications involving pressurized-water- reactor (PWR) spent fuel. The efforts directed at burnup credit involving boiling-water-reactor (BWR) spent fuel have been more limited. This paper reviews the knowledge and experience gained from work performed in the United States and other countries in the study of burnup credit. Relevant physics and analysis phenomenon are identified, and an assessment of their importance to burnup credit implementation for transport and dry cask storage is given. (author)

  8. The cognitive import of the narrative schema

    DEFF Research Database (Denmark)

    Bundgaard, Peer

    2007-01-01

    principle of intelligibility. This is the reason why the narrative schema is by no means confined to the domain of the literary work of art. It is rather a major principle for the combination of partial significations in many other domains. The paper explores the role traditionally assigned to the narrative...... schema within continental semiotics, and through an interpretation of Heider & Simmel’s study on apparent behavior it establishes the cognitive import of the narrative schema and its origin in visual perception; finally it gives examples of the meaning organizing import of the narrative schema....

  9. [Import and local transmission of Haemophilus ducreyi].

    Science.gov (United States)

    Knudsen, Troels Bygum; Sand, Carsten; Jensen, Jørgen Skov

    2010-07-26

    Chancroid is a sexually transmitted disease characterized by painful ulcers with a soft margin, necrotic base and purulent exudate. Previously, only sporadic, imported cases have been reported in Denmark. The bacterium is difficult to culture and novel polymerase chain reaction (PCR)-based methods for direct demonstration of bacterial DNA have facilitated rapid verification of the clinical diagnosis. We report two cases which demonstrate import and subsequent local transmission in Denmark. In both cases, the clinical diagnosis was rapidly verified by a combined PCR testing for multiple causes of venereal ulcers.

  10. Importance Sampling for Stochastic Timed Automata

    DEFF Research Database (Denmark)

    Jegourel, Cyrille; Larsen, Kim Guldstrand; Legay, Axel

    2016-01-01

    We present an importance sampling framework that combines symbolic analysis and simulation to estimate the probability of rare reachability properties in stochastic timed automata. By means of symbolic exploration, our framework first identifies states that cannot reach the goal. A state-wise cha......We present an importance sampling framework that combines symbolic analysis and simulation to estimate the probability of rare reachability properties in stochastic timed automata. By means of symbolic exploration, our framework first identifies states that cannot reach the goal. A state...

  11. THE IMPORTANCE OF EDUCATIONAL TECHNOLOGY IN TEACHING

    Directory of Open Access Journals (Sweden)

    Lazar Stošić

    2015-06-01

    Full Text Available Today, more than ever, the role of educational technology in teaching is of great importance because of the use of information and communication technologies. With the help of various applications for distance education, the Internet, teachers, and students themselves, they see the advantage of educational technology. The question is whether schools and teachers themselves are ready for the use of technology in education and whether they are aware of its benefits? In this paper, we try to give an overview of the importance and use of educational technology in the classroom.

  12. Novel relativistic effect important in accelerators

    International Nuclear Information System (INIS)

    Talman, R.

    1986-01-01

    It is shown that a bunch of charged particles following a curved path in a magnetic field is subject to a force due to its own electro-magnetic field. One aspect of this is a ''centrifugal'' force acting on individual particles in the bunch. A resonance mechanism, capable of disrupting the beam at modest currents, is given as an example of the importance of this force. The theory is tested with observations from the Cornell Electron Storage Ring. This force will cause important modifications to existing theories of accelerator stability

  13. Importance theory for lumped-parameter systems

    International Nuclear Information System (INIS)

    Cady, K.B.; Kenton, M.A.; Ward, J.C.; Piepho, M.G.

    1981-01-01

    A general sensitivity theory has been developed for nonlinear lumped parameter system simulations. The point of departure is general perturbation theory for nonlinear systems. Importance theory as developed here allows the calculation of the sensitivity of a response function to any physical or design parameter; importance of any equation or term or physical effect in the system model on the response function; variance of the response function caused by the variances and covariances of all physical parameters; and approximate effect on the response function of missing physical phenomena or incorrect parameters

  14. Solubility limits of importance to leaching

    International Nuclear Information System (INIS)

    Ogard, A.; Bentley, G.; Bryant, E.; Duffy, C.; Grisham, J.; Norris, E.; Orth, C.; Thomas, K.

    1981-01-01

    The solubilities of some radionuclides, especially rare earths and actinides, may be an important and controlling factor in leaching of waste forms. These solubilities should be measured accurately as a function of pH and not as a part of a multicomponent system. Individual solubilities should be measured as a function of temperature to determine if a kinetic effect is being observed in the data. A negative temperature coefficient of solubility for actinides and rare earths in water would have important consequences for nuclear reactor safety and for the management of nuclear wastes

  15. On Importance of Rows for Decision Tables

    KAUST Repository

    AbouEisha, Hassan M.; Azad, Mohammad; Moshkov, Mikhail

    2017-01-01

    In this paper, we propose a method for the evaluation of importance of rows for decision tables. It is based on indirect information about changes in the set of reducts after removing the considered row from the table. We also discuss results of computer experiments with decision tables from UCI Machine Learning Repository.

  16. Pollution concentration estimates in ecologically important zones

    Energy Technology Data Exchange (ETDEWEB)

    Skiba, Y.N. [Mexico City Univ. (Mexico). Center for Atmospheric Sciences

    1995-12-31

    Method based on using the pollutant transport equation and the adjoint technique is described here for estimating the pollutant concentration level in ecologically important zones. The method directly relates the pollution level in such zones with the power of the pollution sources and the initial pollution field. Assuming that the wind or current velocities are known (from climatic data or dynamic model), the main and adjoint pollutant transport equations can be considered in a limited area to solve such theoretically and practically important problems as: (1) optimal location of new industries in a given region with the aim to minimize the pollution concentration in certain ecologically important zones, (2) optimization of emissions from operating industries, (3) detection of the plants violating sanitary regulations, (4) analysis of the emissions coming from the vehicle traffic (such emissions can be included in the model by means of the linear pollution sources located along the main roadways), (5) estimation of the oil pollution in various ecologically important oceanic (sea) zones in case of accident with the oil tanker, (6) evaluation of the sea water desalination level in estuary regions, and others. These equations considered in a spherical shell domain can also be applied to the problems of transporting the pollutants from a huge industrial complex, or from the zone of an ecological catastrophe similar to the Chernobyl one

  17. The Educational Importance of Deep Wonder

    Science.gov (United States)

    Schinkel, Anders

    2017-01-01

    That wonder is educationally important will strike many people as obvious. And in a way it is obvious, because being capable of experiencing wonder implies an openness to (novel) experience and seems naturally allied to intrinsic educational motivation, an eagerness to inquire, a desire to understand, and also to a willingness to suspend judgement…

  18. Radioactive contamination in imported foods (II)

    International Nuclear Information System (INIS)

    Kan, Kimiko; Maki, Toshio; Hashimoto, Hideki; Kawai, Yuka; Nagayama, Toshihiro; Kobayashi, Maki; Shioda, Hiroko; Nishima, Taichiro

    1991-01-01

    Five years have elapsed since the Chernobyl accident, but the effect of radioactivity contamination to foods has continued. Also in Japan, the imported foods which were ordered by the Ministry of Health and Welfare to be sent back due to radioactivity contamination do not cease. In fiscal year 1990, three cases occurred: tea from Albania, mushrooms from Yugoslavia and spices from france. If those are not checked at quarantines, it is feared that such foods are distributed in Japan. Among the foods which were ordered to be sent back in the past, there were those from Brazil and Hong Kong where the effect of the Chernobyl accident is little, and the foods contaminated with radioactivity spread worldwide through import and export. Therefore, attention must be paid to the foods from the countries where radioactivity contamination is little. Also it is feared that Japanese foods may be contaminated by being cultivated with imported feed, soil and fertilizer, for which there is no regulation. In this report, the radioactivity contamination of imported foods in fiscal year 1990 is described, and the experimental method and the results are reported. (K.I.)

  19. The Educational Importance of Self-Esteem

    Science.gov (United States)

    Ferkany, Matt

    2008-01-01

    Some philosophers of education have recently argued that educators can more or less ignore children's global self-esteem without failing them educationally in any important way. This paper draws on an attachment theoretic account of self-esteem to argue that this view is mistaken. I argue that understanding self-esteem's origins in attachment…

  20. Importance of exercise immunology in health promotion.

    Science.gov (United States)

    Neto, J C Rosa; Lira, F S; de Mello, M T; Santos, Ronaldo Vagner T

    2011-11-01

    Chronic physical exercise with adequate intensity and volume associated with sufficient recovery promotes adaptations in several physiological systems. While intense and exhaustive exercise is considered an important immunosuppressor agent and increases the incidence of upper respiratory tract infections (URTI), moderate regular exercise has been associated with significant disease protection and is a complementary treatment of many chronic diseases. The effects of chronic exercise occur because physical training can induce several physiological, biochemical and psychological adaptations. More recently, the effect of acute exercise and training on the immunological system has been discussed, and many studies suggest the importance of the immune system in prevention and partial recovery in pathophysiological situations. Currently, there are two important hypotheses that may explain the effects of exercise and training on the immune system. These hypotheses including (1) the effect of exercise upon hormones and cytokines (2) because exercise can modulate glutamine concentration. In this review, we discuss the hypothesis that exercise may modulate immune functions and the importance of exercise immunology in respect to chronic illnesses, chronic heart failure, malnutrition and inflammation.

  1. Importance of soil physical characteristics for petroleum ...

    African Journals Online (AJOL)

    Public PCs

    interaction between the soil, plant and organisms (Zhang et al., 2010). .... only the diversity and abundance of the clay, minerals is an important ..... the main supplier of the essential water for plant growth. Soil water ... This also leads to inhibition of roots to ..... contaminated soil with pentachlorophenol and cadmium. Int. J.

  2. Leervondsten uit Midlaren: import of eigen fabricaat?

    NARCIS (Netherlands)

    van Driel-Murray, C.; Nicolay, J.A.W.

    2008-01-01

    Leather finds from Midlaren: imported or local products? A few scraps of leather were present in two wells and one of the graves. A single cowhide offcut is suggestive of the presence of a leatherworker in the settlement, but the remaining fragments of goatskin are uninformative. Since vegetable

  3. The importance of music to adolescents.

    Science.gov (United States)

    North, A C; Hargreaves, D J; O'Neill, S A

    2000-06-01

    The study aims to determine the importance of music to adolescents in England, and investigates why they listen to and perform music. A total of 2465 adolescents (1149 males; 1266 females; 50 participants did not state their sex) between 13 and 14 years of age who were attending Year 9 at one of 22 secondary schools in the North Staffordshire region of England. A questionnaire asked participants (a) about their degree of involvement with musical activities; (b) to rate the importance of music relative to other activities; and (c) to rate the importance of several factors that might determine why they and other people of their age and sex might listen to/perform pop and classical music. Responses indicated that i) over 50% of respondents either played an instrument currently or had played regularly before giving up, and the sample listened to music for an average of 2.45 hours per day; ii) listening to music was preferred to other indoor activities but not to outdoor activities; iii) listening to/playing pop music has different perceived benefits to listening to/playing classical music; iv) responses to suggested reasons for listening to music could be grouped into three factors; and v) responses to suggested reasons for playing music could be grouped into four factors. These results indicate that music is important to adolescents, and that this is because it allows them to (a) portray an 'image' to the outside world and (b) satisfy their emotional needs.

  4. Thailand: gas import review takes on urgency

    International Nuclear Information System (INIS)

    Hayes, D.

    1992-01-01

    The potential market for natural gas imports in Thailand as a result of the downgrading of gas reserves in the Nan Phong field is examined. Proposed pipelines, plans for gas-fired power plants, and the effects that the downgrading has had on Thailand's long-term plans for the development of gas utilisation are discussed. (UK)

  5. Growth of a Functionally Important Lexicon.

    Science.gov (United States)

    Zechmeister, Eugene B.; And Others

    1995-01-01

    Uses a dictionary-sampling method and multiple-choice testing of word knowledge to estimate the lexicon size of junior-high students, college students, and older adults. Suggests that there may yet be a role for direct instruction in affecting lexicon size of functionally important words. (SR)

  6. Weeds as important vegetables for farmers

    NARCIS (Netherlands)

    Cruz Garcia, G.S.; Price, L.L.

    2012-01-01

    The objective of this study was to investigate the multiple uses and cognitive importance of edible weeds in Northeast Thailand. Research methods included focus group discussions and freelistings. A total of 43 weeds consumed as vegetable were reported, including economic, naturalized, agricultural

  7. Fundamental Movement Skills: An Important Focus

    Science.gov (United States)

    Barnett, Lisa M.; Stodden, David; Cohen, Kristen E.; Smith, Jordan J.; Lubans, David Revalds; Lenoir, Matthieu; Iivonen, Susanna; Miller, Andrew D.; Laukkanen, Arto; Dudley, Dean; Lander, Natalie J.; Brown, Helen; Morgan, Philip J.

    2016-01-01

    Purpose: Recent international conference presentations have critiqued the promotion of fundamental movement skills (FMS) as a primary pedagogical focus. Presenters have called for a debate about the importance of, and rationale for teaching FMS, and this letter is a response to that call. The authors of this letter are academics who actively…

  8. 27 CFR 478.116 - Conditional importation.

    Science.gov (United States)

    2010-04-01

    ... bringing in the firearm, firearm barrel, ammunition, or ammunition feeding device must agree to either... imported or brought in under this part. A firearm, firearm barrel, ammunition, or ammunition feeding device... bringing into the United States or any possession thereof of any firearm, firearm barrel, ammunition, or...

  9. Puidu import Venemaalt valmistab raskusi / Ketlin Priilinn

    Index Scriptorium Estoniae

    Priilinn, Ketlin, 1982-

    2007-01-01

    Ilmunud ka: Delovõje Vedomosti 21. nov. lk. 16. Eesti puiduettevõtetele valmistab raskusi puidu import Venemaalt, sest raudteed pidi enam vedada ei saa ning maanteetransport on häiritud. Küsimustele vastab Venemaa Stora Enso Foresti logistikajuht Jevgeni Popov. Kommenteerib Kunda sadama direktor Alaksander Nikolajev. Diagrammid: Eesti Raudtee puiduveomaht; Puiduveomahud Kunda sadama kaudu

  10. Considerations on Accounting Intelligent Systems Importance

    Directory of Open Access Journals (Sweden)

    2007-01-01

    Full Text Available Managers begin to realize the importance of artificial intelligence technologies for their organizations. Knowledge is today seen as the main organizational resource and that is what intelligent systems are about: manipulating knowledge. In this paper we highlight the main reasons that an accountant can bring to his managers to emphasize this idea: intelligent systems are really needful in modern accounting.

  11. On Importance of Rows for Decision Tables

    KAUST Repository

    AbouEisha, Hassan M.

    2017-06-21

    In this paper, we propose a method for the evaluation of importance of rows for decision tables. It is based on indirect information about changes in the set of reducts after removing the considered row from the table. We also discuss results of computer experiments with decision tables from UCI Machine Learning Repository.

  12. 7 CFR 1209.8 - Importer.

    Science.gov (United States)

    2010-01-01

    ... 7 Agriculture 10 2010-01-01 2010-01-01 false Importer. 1209.8 Section 1209.8 Agriculture Regulations of the Department of Agriculture (Continued) AGRICULTURAL MARKETING SERVICE (MARKETING AGREEMENTS... CONSUMER INFORMATION ORDER Mushroom Promotion, Research, and Consumer Information Order Definitions § 1209...

  13. Petrogenetic importance of Cr - spinel metaperidotite

    International Nuclear Information System (INIS)

    Snarska, B.

    2010-01-01

    The research is ultramafic body Komarovce the site, which represents the spinel metaperidotit. In recent works dealing with the problems of genesis and tectonic ultramafic rocks placement consideration, Cr - spinel, which is considered an important petrogenetic indicator. Based on its chemical composition can further characterize the origin of peridotite.

  14. Ranking Music Data by Relevance and Importance

    DEFF Research Database (Denmark)

    Ruxanda, Maria Magdalena; Nanopoulos, Alexandros; Jensen, Christian Søndergaard

    2008-01-01

    Due to the rapidly increasing availability of audio files on the Web, it is relevant to augment search engines with advanced audio search functionality. In this context, the ranking of the retrieved music is an important issue. This paper proposes a music ranking method capable of flexibly fusing...

  15. Adaptability: An Important Capacity for Effective Teachers

    Science.gov (United States)

    Collie, Rebecca J.; Martin, Andrew J.

    2016-01-01

    A defining feature of teaching work is that it involves novelty, change, and uncertainty on a daily basis. Being able to respond effectively to this change is known as adaptability. In this article, we discuss the importance of adaptability for teachers and their healthy and effective functioning in the workplace. We discuss approaches for…

  16. The importance of places and place branding

    NARCIS (Netherlands)

    Kovács, Z.; Musterd, S.; Musterd, S.; Kovács, Z.

    2013-01-01

    In the analytical part of this study, we highlight that, despite globalisation and growing uniformity, there is still an important role for place itself in the location decisions of economic players. Part III of this volume deals with this. Even though city-regions across the world have become

  17. The Importance of Proving the Null

    Science.gov (United States)

    Gallistel, C. R.

    2009-01-01

    Null hypotheses are simple, precise, and theoretically important. Conventional statistical analysis cannot support them; Bayesian analysis can. The challenge in a Bayesian analysis is to formulate a suitably vague alternative, because the vaguer the alternative is (the more it spreads out the unit mass of prior probability), the more the null is…

  18. The Importance of Simulation in Nursing Education

    Science.gov (United States)

    Eyikara, Evrim; Baykara, Zehra Gocmen

    2017-01-01

    Nursing education involves a practice-oriented curriculum in which emphasis is placed on both theoretical knowledge and psychomotor skills. In skill-based education, where learning through practice occupies a central role, it is important to ensure the integration of theoretical knowledge into practice. In this context, simulations represent an…

  19. 7 CFR 996.6 - Importation.

    Science.gov (United States)

    2010-01-01

    ... 7 Agriculture 8 2010-01-01 2010-01-01 false Importation. 996.6 Section 996.6 Agriculture Regulations of the Department of Agriculture (Continued) AGRICULTURAL MARKETING SERVICE (Marketing Agreements... peanuts into channels of commerce of the United States. ...

  20. Isoeugenol is an important contact allergen

    DEFF Research Database (Denmark)

    White, I R; Johansen, J D; Gimenéz-Arnau, Elena

    1999-01-01

    The prevalence of contact allergy to the fragrance mix in individuals with eczema is up to 10%. Within the mix, isoeugenol (CAS 97-54-1) is an important individual allergen. Until May 1998, the IFRA (International Fragrance Association) guidelines suggested that isoeugenol could safely be used at...

  1. Learning by Exporting, Importing or Both?

    DEFF Research Database (Denmark)

    Smeets, Valérie; Warzynski, Frederic

    In this paper, we analyze the relationship between exporting/importing status and firm productivity. We use a rich product-firm-level dataset providing both revenue and quantities of all products for a large panel of Danish manufacturing firms over the period 1998-2005 and link it to another...

  2. The educational importance of deep wonder

    NARCIS (Netherlands)

    Schinkel, Anders

    2017-01-01

    That wonder is educationally important will strike many people as obvious. And in a way it is obvious, because being capable of experiencing wonder implies an openness to (novel) experience and seems naturally allied to intrinsic educational motivation, an eagerness to inquire, a desire to

  3. Importance of individual events in temporal networks

    International Nuclear Information System (INIS)

    Takaguchi, Taro; Masuda, Naoki; Sato, Nobuo; Yano, Kazuo

    2012-01-01

    Records of time-stamped social interactions between pairs of individuals (e.g. face-to-face conversations, e-mail exchanges and phone calls) constitute a so-called temporal network. A remarkable difference between temporal networks and conventional static networks is that time-stamped events rather than links are the unit elements generating the collective behavior of nodes. We propose an importance measure for single interaction events. By generalizing the concept of the advance of events proposed by Kossinets et al (2008 Proc. 14th ACM SIGKDD Int. Conf. on Knowledge Discovery and Data Mining p 435), we propose that an event is central when it carries new information about others to the two nodes involved in the event. We find that the proposed measure properly quantifies the importance of events in connecting nodes along time-ordered paths. Because of strong heterogeneity in the importance of events present in real data, a small fraction of highly important events is necessary and sufficient to sustain the connectivity of temporal networks. Nevertheless, in contrast to the behavior of scale-free networks against link removal, this property mainly results from bursty activity patterns and not heterogeneous degree distributions. (paper)

  4. Pollution concentration estimates in ecologically important zones

    Energy Technology Data Exchange (ETDEWEB)

    Skiba, Y N [Mexico City Univ. (Mexico). Center for Atmospheric Sciences

    1996-12-31

    Method based on using the pollutant transport equation and the adjoint technique is described here for estimating the pollutant concentration level in ecologically important zones. The method directly relates the pollution level in such zones with the power of the pollution sources and the initial pollution field. Assuming that the wind or current velocities are known (from climatic data or dynamic model), the main and adjoint pollutant transport equations can be considered in a limited area to solve such theoretically and practically important problems as: (1) optimal location of new industries in a given region with the aim to minimize the pollution concentration in certain ecologically important zones, (2) optimization of emissions from operating industries, (3) detection of the plants violating sanitary regulations, (4) analysis of the emissions coming from the vehicle traffic (such emissions can be included in the model by means of the linear pollution sources located along the main roadways), (5) estimation of the oil pollution in various ecologically important oceanic (sea) zones in case of accident with the oil tanker, (6) evaluation of the sea water desalination level in estuary regions, and others. These equations considered in a spherical shell domain can also be applied to the problems of transporting the pollutants from a huge industrial complex, or from the zone of an ecological catastrophe similar to the Chernobyl one

  5. Marine cargo imports and forest pest introductions

    Science.gov (United States)

    Frank H. Koch

    2009-01-01

    A major pathway for the introduction of nonindigenous forest pests is accidental transport on cargo imported from overseas. Diseases may be brought into the United States via commercial trade of nursery stock or other live plant material, as has been suggested for Phytophthora ramorum, the pathogen that causes sudden oak death (Ivors and others 2006). Insects may...

  6. Is it necessary to import biofuels?

    International Nuclear Information System (INIS)

    Jensen, V.

    1997-01-01

    This conference paper discusses whether it is necessary to import biofuels into Denmark. As far as resources and capacities are concerned, the answer is no. From a commercial point of view the answer is yes. The electricity utilities and the district heating companies have established import as an alternative to domestic production of biomass. This is because agreements among suppliers had led to the absence of competition on price. This tendency to form cartels are seen for straw and chips. With pellets the situation is different; the market is controlled by the supply of shavings and filings from the furniture industry. This means that the market is very sensitive to changes in the export of furniture to Germany. Importing pellets has been difficult because of transportation problems. The prices of biofuels have been slightly falling. From 2005 the need for bioenergy will increase beyond the domestic resources of straw and chips. To secure that the Danish prices will not exceed those on the world market, in spite of the governmentally planned choice of fuels, some import of biomass will be required. 5 figs

  7. 19 CFR 12.107 - Importations permitted.

    Science.gov (United States)

    2010-04-01

    ... TREASURY SPECIAL CLASSES OF MERCHANDISE Pre-Columbian Monumental and Architectural Sculpture and Murals § 12.107 Importations permitted. Pre-Columbian monumental or architectural sculpture or mural for which... sculpture or mural, in a form acceptable to the Secretary, certifying that such exportation was not in...

  8. 76 FR 65976 - Controlled Import Permits

    Science.gov (United States)

    2011-10-25

    ..., regulated articles may be imported under conditions ``modified to be less stringent'' than those contained... under 7 CFR part 330, genetically engineered plant material regulated under 7 CFR part 340, noxious... plants, noxious weed seeds, soil, living organisms such as parasitic plants, pathogens, insects, snails...

  9. Earth's Most Important Producers: Meet the Phytoplankton!

    Science.gov (United States)

    Marrero, Meghan E.; Stevens, Nicole

    2011-01-01

    The ocean is home to some of Earth's most important producers. Single-celled organisms in the ocean are responsible for more than half of Earth's productivity, as well as most of its oxygen. Phytoplankton are single-celled, plantlike organisms. That is, they have chloroplasts and perform photosynthesis, but are not true plants, which are typically…

  10. Decision importance as a cue for deferral

    NARCIS (Netherlands)

    Krijnen, Job; Zeelenberg, Marcel; Breugelmans, Seger

    2015-01-01

    A series of 7 experiments found that people defer important decisions more than unimportant decisions, and that this is independent of choice set composition. This finding persists even when deferral does not provide more flexibility (Experiment 2), when deferral has potential disadvantages

  11. 19 CFR 10.846 - Imported directly.

    Science.gov (United States)

    2010-04-01

    ... they: (i) Remained under the control of the customs authority in the intermediate country; (ii) Did not... 19 Customs Duties 1 2010-04-01 2010-04-01 false Imported directly. 10.846 Section 10.846 Customs Duties U.S. CUSTOMS AND BORDER PROTECTION, DEPARTMENT OF HOMELAND SECURITY; DEPARTMENT OF THE TREASURY...

  12. 19 CFR 10.193 - Imported directly.

    Science.gov (United States)

    2010-04-01

    ... control of the customs authority of the intermediate country; (2) Did not enter into the commerce of the... 19 Customs Duties 1 2010-04-01 2010-04-01 false Imported directly. 10.193 Section 10.193 Customs Duties U.S. CUSTOMS AND BORDER PROTECTION, DEPARTMENT OF HOMELAND SECURITY; DEPARTMENT OF THE TREASURY...

  13. 19 CFR 10.204 - Imported directly.

    Science.gov (United States)

    2010-04-01

    ... customs authority in the intermediate country; (2) Did not enter into the commerce of the intermediate... 19 Customs Duties 1 2010-04-01 2010-04-01 false Imported directly. 10.204 Section 10.204 Customs Duties U.S. CUSTOMS AND BORDER PROTECTION, DEPARTMENT OF HOMELAND SECURITY; DEPARTMENT OF THE TREASURY...

  14. Child abuse. Important findings in radiology

    International Nuclear Information System (INIS)

    Troeger, J.; Stegen, P.

    1995-01-01

    Important clinical signs are hematoma at different ages and in uncommon locations. The principle imaging signs are subdural hematoma, brain contusion and multiple skeletal injuries sometimes at different ages. The parents or the persons responsible for care often neglect mentioning an injury. The principle signs are shown and a diagnostic flow chart is presented. (orig./MG) [de

  15. Consumer Views: Importance of Fuel Economy

    Energy Technology Data Exchange (ETDEWEB)

    Singer, Mark [National Renewable Energy Lab. (NREL), Golden, CO (United States)

    2017-04-11

    This presentation includes data captured by the National Renewable Energy Laboratory (NREL) to support the U.S. Department of Energy's Vehicle Technologies Office (VTO) research efforts. The data capture consumer views on the importance of fuel economy amongst other vehicle attributes and views on which alternative fuel types would be the best and worst replacements for gasoline.

  16. Copepoda parasites in economically important fish, Mugilidae ...

    African Journals Online (AJOL)

    FUNMILAYO

    of economically important fish, both from the wild and fish farms, thus making them difficult to market. In this study ... Sakiti, 1997; Gbankoto et al., 2003) but no work has been carried out on ... digital weighing balance and recorded. ..... Life Sci. J. 9(3):733-737. Paperna I, Lahav M (1971). New records and further data on fish.

  17. Chirality plays important roles in radiopharmaceuticals

    International Nuclear Information System (INIS)

    Shen Yumei

    2006-01-01

    The paper introduces the basic concept of chirality, target specific selectivity and their relationship in radiopharmaceuticals. If the ligands labeled by radionuclides have chiral center, the enantiomers must be separated, or the target specific selectivity will not be good. Chirality is one of the most important factors which must be considered in the study of the structure-activity relationship of radiopharmaceuticals. (authors)

  18. Review Article: Hazards of Chaotic Importation, Certification ...

    African Journals Online (AJOL)

    Review Article: Hazards of Chaotic Importation, Certification, Distribution and Marketing of Medical Laboratory Consumables in Nigeria. BC Nlemadim. Abstract. No abstract. Journal of Medical Laboratory Science Vol.12(2) 2003: 25 - 27. Full Text: EMAIL FULL TEXT EMAIL FULL TEXT · DOWNLOAD FULL TEXT ...

  19. Adaptive Importance Sampling Simulation of Queueing Networks

    NARCIS (Netherlands)

    de Boer, Pieter-Tjerk; Nicola, V.F.; Rubinstein, N.; Rubinstein, Reuven Y.

    2000-01-01

    In this paper, a method is presented for the efficient estimation of rare-event (overflow) probabilities in Jackson queueing networks using importance sampling. The method differs in two ways from methods discussed in most earlier literature: the change of measure is state-dependent, i.e., it is a

  20. The Relative Importance of the European Languages

    DEFF Research Database (Denmark)

    Hjorth-Andersen, Christian

    the relevant measure GNP rather than the population measure usually preferred by linguists and politicians. The results are quite dramatic as English can be shown to be completely dominant. In the second part of the paper, I look at the relative importance of the European languages in Europe. In order to put...