Vulnerable Hunter

OpenAIRE

Md.Asha Begum; Y.VishnuPriya; V.ManoranjanBabu; ,O.Srinivasu

2016-01-01

This project "VULNERABLE HUNTER" application main aim is to detect risk in our mobile applications. This application contains modules like Fetch Application, Generate Score, Uninstall and Display Graph. Through this application it detects risk so that this application is very useful to smart phone users Now-a-days so many people are using smart phones and people are crazy about new apps. But by installing all the applications into our mobile may reduce its performance. Some apps c...

Hunter-gatherer energetics and human obesity.

Science.gov (United States)

Pontzer, Herman; Raichlen, David A; Wood, Brian M; Mabulla, Audax Z P; Racette, Susan B; Marlowe, Frank W

2012-01-01

Western lifestyles differ markedly from those of our hunter-gatherer ancestors, and these differences in diet and activity level are often implicated in the global obesity pandemic. However, few physiological data for hunter-gatherer populations are available to test these models of obesity. In this study, we used the doubly-labeled water method to measure total daily energy expenditure (kCal/day) in Hadza hunter-gatherers to test whether foragers expend more energy each day than their Western counterparts. As expected, physical activity level, PAL, was greater among Hadza foragers than among Westerners. Nonetheless, average daily energy expenditure of traditional Hadza foragers was no different than that of Westerners after controlling for body size. The metabolic cost of walking (kcal kg(-1) m(-1)) and resting (kcal kg(-1) s(-1)) were also similar among Hadza and Western groups. The similarity in metabolic rates across a broad range of cultures challenges current models of obesity suggesting that Western lifestyles lead to decreased energy expenditure. We hypothesize that human daily energy expenditure may be an evolved physiological trait largely independent of cultural differences.

The Higgs hunter's guide

CERN Document Server

Gunion, John F; Haber, Howard E; Kane, Gordon L

1989-01-01

The Higgs Hunter's Guide is a definitive and comprehensive guide to the physics of Higgs bosons. In particular, it discusses the extended Higgs sectors required by those recent theoretical approaches that go beyond the Standard Model, including supersymmetry and superstring-inspired models.

Beyond the Cut Hunter: A Historical Epidemiology of HIV Beginnings in Central Africa.

Science.gov (United States)

Rupp, Stephanie; Ambata, Philippe; Narat, Victor; Giles-Vernick, Tamara

2016-12-01

In the absence of direct evidence, an imagined "cut hunter" stands in for the index patient of pandemic HIV/AIDS. During the early years of colonial rule, this explanation goes, a hunter was cut or injured from hunting or butchering a chimpanzee infected with simian immunodeficiency virus, resulting in the first sustained human infection with the virus that would emerge as HIV-1M. We argue here that the "cut hunter" relies on a historical misunderstanding and ecological oversimplification of human-chimpanzee (Pan Troglodytes troglodytes) interactions that facilitated pathogenic transmission. This initial host shift cannot explain the beginnings of the HIV/AIDS pandemic. Instead, we must understand the processes by which the virus became transmissible, possibly between Sangha basin inhabitants and ultimately reached Kinshasa. A historical epidemiology of the late nineteenth and twentieth centuries, provides a much-needed corrective to the major shortcomings of the cut hunter. Based on 62 oral historical interviews conducted in southeastern Cameroon and archival research, we show that HIV emerged from ecological, economic, and socio-political transformations of the late nineteenth and twentieth centuries. The gradual imposition of colonial rule built on and reoriented ecologies and economies, and altered older patterns of mobility and sociality. Certain changes may have contributed to the initial viral host shift, but more importantly, facilitated the adaptation of HIV-1M to human-to-human transmission. Our evidence suggests that the most critical changes occurred after 1920. This argument has important implications for public health policy, underscoring recent work emphasizing alternative pathways for zoonotic spillovers into human beings.

Wealth Transmission and Inequality Among Hunter-Gatherers

Science.gov (United States)

Hill, Kim; Marlowe, Frank; Nolin, David; Wiessner, Polly; Gurven, Michael; Bowles, Samuel; Mulder, Monique Borgerhoff; Hertz, Tom; Bell, Adrian

2010-01-01

We report quantitative estimates of intergenerational transmission and population-wide inequality for wealth measures in a set of hunter-gatherer populations. Wealth is defined broadly as factors that contribute to individual or household well-being, ranging from embodied forms such as weight and hunting success to material forms such household goods, as well as relational wealth in exchange partners. Intergenerational wealth transmission is low to moderate in these populations, but is still expected to have measurable influence on an individual’s life chances. Wealth inequality (measured with Gini coefficients) is moderate for most wealth types, matching what qualitative ethnographic research has generally indicated (if not the stereotype of hunter-gatherers as extreme egalitarians). We discuss some plausible mechanisms for these patterns, and suggest ways in which future research could resolve questions about the role of wealth in hunter-gatherer social and economic life. PMID:21151711

Hunter-gatherer energetics and human obesity.

Directory of Open Access Journals (Sweden)

Herman Pontzer

Full Text Available Western lifestyles differ markedly from those of our hunter-gatherer ancestors, and these differences in diet and activity level are often implicated in the global obesity pandemic. However, few physiological data for hunter-gatherer populations are available to test these models of obesity. In this study, we used the doubly-labeled water method to measure total daily energy expenditure (kCal/day in Hadza hunter-gatherers to test whether foragers expend more energy each day than their Western counterparts. As expected, physical activity level, PAL, was greater among Hadza foragers than among Westerners. Nonetheless, average daily energy expenditure of traditional Hadza foragers was no different than that of Westerners after controlling for body size. The metabolic cost of walking (kcal kg(-1 m(-1 and resting (kcal kg(-1 s(-1 were also similar among Hadza and Western groups. The similarity in metabolic rates across a broad range of cultures challenges current models of obesity suggesting that Western lifestyles lead to decreased energy expenditure. We hypothesize that human daily energy expenditure may be an evolved physiological trait largely independent of cultural differences.

Linking Hunter Knowledge with Forest Change to Understand Changing Deer Harvest Opportunities in Intensively Logged Landscapes

Directory of Open Access Journals (Sweden)

Todd J. Brinkman

2009-06-01

Full Text Available The effects of landscape changes caused by intensive logging on the availability of wild game are important when the harvest of wild game is a critical cultural practice, food source, and recreational activity. We assessed the influence of extensive industrial logging on the availability of wild game by drawing on local knowledge and ecological science to evaluate the relationship between forest change and opportunities to harvest Sitka black-tailed deer (Odocoileus hemionus sitkensis on Prince of Wales Island, Alaska. We used data collected through interviews with local deer hunters and GIS analysis of land cover to determine relationships among landscape change, hunter access, and habitat for deer hunting over the last 50 yr. We then used these relationships to predict how harvest opportunities may change in the future. Intensive logging from 1950 into the 1990s provided better access to deer and habitat that facilitated deer hunting. However, successional changes in intensively logged forests in combination with a decline in current logging activity have reduced access to deer and increased undesirable habitat for deer hunting. In this new landscape, harvest opportunities in previously logged landscapes have declined, and hunters identify second-growth forest as one of the least popular habitats for hunting. Given the current state of the logging industry in Alaska, it is unlikely that the logging of the remaining old-growth forests or intensive management of second-growth forests will cause hunter opportunities to rebound to historic levels. Instead, hunter opportunities may continue to decline for at least another human generation, even if the long-term impacts of logging activity and deer harvest on deer numbers are minimal. Adapting hunting strategies to focus on naturally open habitats such as alpine and muskeg that are less influenced by external market forces may require considerably more hunting effort but provide the best option for

Hot subduction: Magmatism along the Hunter Ridge, SW Pacific

International Nuclear Information System (INIS)

Crawford, A.J.; Verbeeten, A.; Danyushevsky, L.V.; Sigurdsson, I.A.; Maillet, P.; Monzier, M.

1997-01-01

The Hunter 'fracture zone' is generally regarded as a transform plate boundary linking the oppositely dipping Tongan and Vanuatu subduction systems. Dredging along the Hunter Ridge and sampling of its northernmost extent, exposed as the island of Kadavu in Fiji, has yielded a diversity of magmatic suites, including arc tholeiites and high-Ca boninites, high-Mg lavas with some affinities to boninites and some affinities to adakites, and true adakitic lavas associated with remarkable low-Fe, high-Na basalts with 8-16 ppm Nb (herein high-Nb basalts). Lavas which show clear evidence of slab melt involvement in their petrogenesis occur at either end of the Hunter Ridge, whereas the arc tholeiites and high-Ca boninites appear to be restricted to the south central part of the ridge. Mineralogical and whole rock geochemical data for each of these suites are summarized, and a tectono-magmatic model for their genesis and distribution is suggested. Trace element features and radiogenic isotope data for the Hunter Ridge lavas indicate compositions analogue to Pacific MORB-like mantle

Intergroup aggression in chimpanzees and war in nomadic hunter-gatherers: evaluating the chimpanzee model.

Science.gov (United States)

Wrangham, Richard W; Glowacki, Luke

2012-03-01

Chimpanzee and hunter-gatherer intergroup aggression differ in important ways, including humans having the ability to form peaceful relationships and alliances among groups. This paper nevertheless evaluates the hypothesis that intergroup aggression evolved according to the same functional principles in the two species-selection favoring a tendency to kill members of neighboring groups when killing could be carried out safely. According to this idea chimpanzees and humans are equally risk-averse when fighting. When self-sacrificial war practices are found in humans, therefore, they result from cultural systems of reward, punishment, and coercion rather than evolved adaptations to greater risk-taking. To test this "chimpanzee model," we review intergroup fighting in chimpanzees and nomadic hunter-gatherers living with other nomadic hunter-gatherers as neighbors. Whether humans have evolved specific psychological adaptations for war is unknown, but current evidence suggests that the chimpanzee model is an appropriate starting point for analyzing the biological and cultural evolution of warfare.

Targeting hunter distribution based on host resource selection and kill sites to manage disease risk.

Science.gov (United States)

Dugal, Cherie J; van Beest, Floris M; Vander Wal, Eric; Brook, Ryan K

2013-10-01

Endemic and emerging diseases are rarely uniform in their spatial distribution or prevalence among cohorts of wildlife. Spatial models that quantify risk-driven differences in resource selection and hunter mortality of animals at fine spatial scales can assist disease management by identifying high-risk areas and individuals. We used resource selection functions (RSFs) and selection ratios (SRs) to quantify sex- and age-specific resource selection patterns of collared (n = 67) and hunter-killed (n = 796) nonmigratory elk (Cervus canadensis manitobensis) during the hunting season between 2002 and 2012, in southwestern Manitoba, Canada. Distance to protected area was the most important covariate influencing resource selection and hunter-kill sites of elk (AICw = 1.00). Collared adult males (which are most likely to be infected with bovine tuberculosis (Mycobacterium bovis) and chronic wasting disease) rarely selected for sites outside of parks during the hunting season in contrast to adult females and juvenile males. The RSFs showed selection by adult females and juvenile males to be negatively associated with landscape-level forest cover, high road density, and water cover, whereas hunter-kill sites of these cohorts were positively associated with landscape-level forest cover and increasing distance to streams and negatively associated with high road density. Local-level forest was positively associated with collared animal locations and hunter-kill sites; however, selection was stronger for collared juvenile males and hunter-killed adult females. In instances where disease infects a metapopulation and eradication is infeasible, a principle goal of management is to limit the spread of disease among infected animals. We map high-risk areas that are regularly used by potentially infectious hosts but currently underrepresented in the distribution of kill sites. We present a novel application of widely available data to target hunter distribution based on host resource

Legitimization of regulatory norms: Waterfowl hunter acceptance of changing duck bag limits

Science.gov (United States)

Schroeder, Susan A.; Fulton, David C.; Lawrence, Jeffrey S.; Cordts, Steven D.

2014-01-01

Few studies have examined response to regulatory change over time, or addressed hunter attitudes about changes in hunting bag limits. This article explores Minnesota waterfowl hunters’ attitudes about duck bag limits, examining attitudes about two state duck bag limits that were initially more restrictive than the maximum set by the U.S. Fish and Wildlife Service (USFWS), but then increased to match federal limits. Results are from four mail surveys that examined attitudes about bag limits over time. Following two bag limit increases, a greater proportion of hunters rated the new bag limit “too high” and a smaller proportion rated it “too low.” Several years following the first bag limit increase, the proportion of hunters who indicated that the limit was “too high” had declined, suggesting hunter acceptance of the new regulation. Results suggest that waterfowl bag limits may represent legal norms that influence hunter attitudes and gain legitimacy over time.

Mental health perspectives of Hunter syndrome: Case reports of two biological siblings

Directory of Open Access Journals (Sweden)

Kabir Garg

2016-01-01

Full Text Available Hunter syndrome is a rare X-linked recessive disorder caused by deficiency of the lysosomal enzyme iduronate-2-sulphatase, leading to progressive accumulation of a substance called glycosaminoglycans in nearly all cell types, tissues, and organs. Hunter syndrome presents with facial dysmorphism, airway diseases, skeletal defects, cardiomyopathies, and neuropsychiatric manifestations. Mental subnormality is a cardinal feature in Hunter syndrome. This is a progressive cognitive decline that is not amenable to enzyme replacement therapy. Due to progressive cognitive decline, training the children to improve the adaptive functioning is a challenge that creates immense stress for the caregivers. Patients with Hunter syndrome should undergo serial assessment of intellectual ability and may be trained accordingly.

75 FR 32877 - Financial Assistance: Wildlife Restoration, Sport Fish Restoration, Hunter Education and Safety

Science.gov (United States)

2010-06-10

... resources, aquatic-life forms, and sport fishing; and (e) develop responsible attitudes and ethics toward..., Sport Fish Restoration, Hunter Education and Safety AGENCY: Fish and Wildlife Service, Interior. ACTION... governing the Wildlife Restoration, Sport Fish Restoration, and Hunter Education and Safety (Enhanced Hunter...

Core Hunter 3: flexible core subset selection.

Science.gov (United States)

De Beukelaer, Herman; Davenport, Guy F; Fack, Veerle

2018-05-31

Core collections provide genebank curators and plant breeders a way to reduce size of their collections and populations, while minimizing impact on genetic diversity and allele frequency. Many methods have been proposed to generate core collections, often using distance metrics to quantify the similarity of two accessions, based on genetic marker data or phenotypic traits. Core Hunter is a multi-purpose core subset selection tool that uses local search algorithms to generate subsets relying on one or more metrics, including several distance metrics and allelic richness. In version 3 of Core Hunter (CH3) we have incorporated two new, improved methods for summarizing distances to quantify diversity or representativeness of the core collection. A comparison of CH3 and Core Hunter 2 (CH2) showed that these new metrics can be effectively optimized with less complex algorithms, as compared to those used in CH2. CH3 is more effective at maximizing the improved diversity metric than CH2, still ensures a high average and minimum distance, and is faster for large datasets. Using CH3, a simple stochastic hill-climber is able to find highly diverse core collections, and the more advanced parallel tempering algorithm further increases the quality of the core and further reduces variability across independent samples. We also evaluate the ability of CH3 to simultaneously maximize diversity, and either representativeness or allelic richness, and compare the results with those of the GDOpt and SimEli methods. CH3 can sample equally representative cores as GDOpt, which was specifically designed for this purpose, and is able to construct cores that are simultaneously more diverse, and either are more representative or have higher allelic richness, than those obtained by SimEli. In version 3, Core Hunter has been updated to include two new core subset selection metrics that construct cores for representativeness or diversity, with improved performance. It combines and outperforms the

Hunter-Gatherers and the Origins of Religion.

Science.gov (United States)

Peoples, Hervey C; Duda, Pavel; Marlowe, Frank W

2016-09-01

Recent studies of the evolution of religion have revealed the cognitive underpinnings of belief in supernatural agents, the role of ritual in promoting cooperation, and the contribution of morally punishing high gods to the growth and stabilization of human society. The universality of religion across human society points to a deep evolutionary past. However, specific traits of nascent religiosity, and the sequence in which they emerged, have remained unknown. Here we reconstruct the evolution of religious beliefs and behaviors in early modern humans using a global sample of hunter-gatherers and seven traits describing hunter-gatherer religiosity: animism, belief in an afterlife, shamanism, ancestor worship, high gods, and worship of ancestors or high gods who are active in human affairs. We reconstruct ancestral character states using a time-calibrated supertree based on published phylogenetic trees and linguistic classification and then test for correlated evolution between the characters and for the direction of cultural change. Results indicate that the oldest trait of religion, present in the most recent common ancestor of present-day hunter-gatherers, was animism, in agreement with long-standing beliefs about the fundamental role of this trait. Belief in an afterlife emerged, followed by shamanism and ancestor worship. Ancestor spirits or high gods who are active in human affairs were absent in early humans, suggesting a deep history for the egalitarian nature of hunter-gatherer societies. There is a significant positive relationship between most characters investigated, but the trait "high gods" stands apart, suggesting that belief in a single creator deity can emerge in a society regardless of other aspects of its religion.

PALEOLITHIC HUNTER-GATHERERS' DIETARY PATTERNS ...

African Journals Online (AJOL)

Dr. Al-Domi

the main aspects of Paleolithic hunter-gatherers' dietary patterns and its main long-term ... Hence, people in developing countries have been exposed to certain ... as food habits, which prompted possible negative impacts on health status leading to ... costs [5, 7]. .... Agricultural revolution with efficient production of grains,.

Ride, shoot, and call: wildlife use among contemporary urban hunters in Três Fronteiras, Brazilian Amazon

Directory of Open Access Journals (Sweden)

Nathalie van Vliet

2015-09-01

Full Text Available Most bushmeat studies in the Amazon region focus on hunting patterns of indigenous populations in rural settings. Our study describes the existence of urban hunters in medium-sized towns. Using a variety of data collection methods, we describe the main socioeconomic characteristics of urban hunters in Benjamin Constant and Atalaia do Norte, Brazil. We analyze the patterns and motivations of urban hunters as well as the type of prey harvested and quantities traded. All interviewed hunters are caboclos, people of mixed Brazilian indigenous and European origins from rural areas who now live in urban and peri-urban areas. Living in these more populated spaces allows these hunters better market options for their harvest and allows them to alternate hunting with other economic activities. Only 29% of the interviewed hunters relied solely on hunting. In total, 11.6 tons of bushmeat were harvested (of which 97% was traded by four hunters during the monitoring period (60 days. The most hunted species were terecay (Podocnemis unifilis, curassow (Crax sp., paca (Cuniculus paca, and tapir (Tapirus terrestris. The ratio of bushmeat sold to that consumed, as well as the level of participation in the bushmeat market chain, allowed us to differentiate between specialized and diversified hunters. Specialized hunters sell 81% of the bushmeat caught to known wholesalers in the city. Diversified hunters sell 21% of their total catch to families, neighbors, or friends directly as fresh meat, avoiding intermediaries. For all hunters, hunting localities are associated with peri-urban roadways that are easily reached by motorbike or bicycle from the hunters' houses in the urban areas or city fringes. Our results show that urban hunters in medium-sized towns exemplify how traditional hunting systems can be adapted in the face of globalization, by living close to the market, at relatively manageable distances from hunting grounds, and using modern methods of

Landscape and Social Values in Popular Children's Literature: Nancy Drew Mysteries.

Science.gov (United States)

Brooker-Gross, Susan R.

1981-01-01

Examines the covert lessons in moral social geography found in a set of popular juvenile fiction published between 1924 and 1978--the Nancy Drew mystery stories. Topics discussed include landscape symbolism, urban environments, uses of geographical elements in the stories, rural settings, wilderness settings, social stereotypes, and landscape…

Cooperation and the evolution of hunter-gatherer storytelling.

Science.gov (United States)

Smith, Daniel; Schlaepfer, Philip; Major, Katie; Dyble, Mark; Page, Abigail E; Thompson, James; Chaudhary, Nikhil; Salali, Gul Deniz; Mace, Ruth; Astete, Leonora; Ngales, Marilyn; Vinicius, Lucio; Migliano, Andrea Bamberg

2017-12-05

Storytelling is a human universal. From gathering around the camp-fire telling tales of ancestors to watching the latest television box-set, humans are inveterate producers and consumers of stories. Despite its ubiquity, little attention has been given to understanding the function and evolution of storytelling. Here we explore the impact of storytelling on hunter-gatherer cooperative behaviour and the individual-level fitness benefits to being a skilled storyteller. Stories told by the Agta, a Filipino hunter-gatherer population, convey messages relevant to coordinating behaviour in a foraging ecology, such as cooperation, sex equality and egalitarianism. These themes are present in narratives from other foraging societies. We also show that the presence of good storytellers is associated with increased cooperation. In return, skilled storytellers are preferred social partners and have greater reproductive success, providing a pathway by which group-beneficial behaviours, such as storytelling, can evolve via individual-level selection. We conclude that one of the adaptive functions of storytelling among hunter gatherers may be to organise cooperation.

Humans as predators: an overview of predation strategies of hunters with contrasting motivational drivers

Directory of Open Access Journals (Sweden)

Fredrik Dalerum

2018-01-01

Full Text Available Predator-prey theory suggests that generalist predators are linked to demographic stability of prey whereas specialists are destabilizing. We overview the demographic consequences of different predation strategies and hypothesize that subsistence hunting occurs opportunistically, persecution hunters behave like specialist predators, and recreational hunters behave like generalist predators. Under this hypothesis, persecution hunting would have destabilizing effects, whereas the effects of subsistence and recreational hunting would be neutral or stabilizing. We found poor empirical support for this hypothesis, but there was scarce empirical data. Recreational hunters mainly hunted opportunistically and hunting as managed persecution followed a type III functional response, i.e. with low hunting intensity at low game abundances and a switch to an increased intensity at some level of abundance. We suggest that recreational hunters have limited destabilizing effects on game populations and that hunting may be an ineffective way of complete the removal of invasive species. We urge for further studies quantifying the responses of hunters to game abundances, in particular studies evaluating the responses of subsistence hunters and illegal persecution.

Reducing Lead on the Landscape: Anticipating Hunter Behavior in Absence of a Free Nonlead Ammunition Program.

Directory of Open Access Journals (Sweden)

Loren Chase

Full Text Available Lead is a neurotoxin that has been documented to affect many forms of wildlife, and has been identified as a limiting factor in a population of California Condors in Northern Arizona. The Arizona Game and Fish Department provides vouchers for free nonlead ammunition to hunters selected to hunt within the distribution of California Condors, with the intention of having fewer lead-laden offal piles available to California Condors. Although wildlife agencies may reasonably assume voucher programs motivate hunters into choosing nonlead ammunition, the lead reduction efforts attributable to the voucher program has not been empirically quantified. Our intention was to compare a control group of hunters to a treatment group of hunters within California Condor occupied areas. Both groups received educational materials regarding the deleterious effects of lead, but the treatment group also received a voucher for a free initial box of ammunition. About half of the control group used nonlead ammunition, compared to about three-fourths of the treatment group. Prominent barriers to adoption of nonlead ammunition included a general difficulty of obtaining it, obtaining it in the desired caliber, and its costliness. Frequently mentioned motivations for using nonlead was the exhortation to use it by the Department, and the desire to aid California Condor recovery by hunters. The disparate compliance rates found herein confirm and quantify the success of nonlead ammunition voucher programs, but underscore the importance of working to increase the supply of nonlead ammunition with the end of facilitating its procurement and reducing its cost.

Hide Tanning and Its Use in Taiga: The Case of the Orochen-Evenki Reindeer Herders and Hunters of Zabaikalye (East Siberia

Directory of Open Access Journals (Sweden)

Donatas Brandišauskas

2011-05-01

Full Text Available This article documents the way in which the Orochen-Evenki hunters and herders in northern part of Zabaikalye tan hides and produce gear in the post-Soviet era. Here, I wish to present the argument that it is difficult to understand the reviving of hide tanning in remote villages and the taiga without understanding how hunters and herders in this region adapt to the unstable post-Soviet environment. I suggest that hunters and herders aim to maintain their autonomy from goods and resources imported from cities, and, in spending little effort connecting with state powers in this way, securing their lives from socio-economic constraints.

Hide Tanning and Its Use in Taiga: The Case of the Orochen-Evenki Reindeer Herders and Hunters of Zabaikalye (East Siberia

Directory of Open Access Journals (Sweden)

Donatas Brandišauskas

2010-12-01

Full Text Available This article documents the way in which the Orochen-Evenki hunters and herders in northern part of Zabaikalye tan hides and produce gear in the post-Soviet era. Here, I wish to present the argument that it is difficult to understand the reviving of hide tanning in remote villages and the taiga without understanding how hunters and herders in this region adapt to the unstable post-Soviet environment. I suggest that hunters and herders aim to maintain their autonomy from goods and resources imported from cities, and, in spending little effort connecting with state powers in this way, securing their lives from socio-economic constraints.

The Enchanted Hunters in Nabokov’s Lolita

Directory of Open Access Journals (Sweden)

Justine Shu- Ting Kao

2017-06-01

Full Text Available In Nabokov’s Lolita, Humbert Humbert’s The Enchanted Hunters, as a quest for love, aims to reconstruct a felicitous world or integrate various fragmentary details into an organic unity that revives a lost love, experiencing it on the basis of irony, and revealing a simulation of the desire, violence, and despondency which have been expressed in myths of nymphs and Persephone. The protagonist never reaches this unity, but his narrative of erotic and romantic love reveals him as a pathetic addict engaged in mechanical reproduction related to the phenomena of desire, seduction, violence, and sex. His The Enchanted Hunters does not simulate what he expects of his childhood love with Annabel; rather, it simulates the erotic imagination suggested in Mary D. Sheriff’s term “nymphomania,” in which artists fall degenerately to a model of tragedy. Keywords: simulation, nymph, nymphomania, The Enchanted Hunters The Enchanted Hunters in Nabokov’s Lolita refers to the name of a hotel and the title of a play. This seeming coincidence is actually not coincidental: Nabokov weaves a story concerning a pedophile’s seduction of a prepubescent child into a “story within a story,” in which the girl is imagined as a seducer who bewitches a number of hunters. Just as the girl in the play is a figment of a poet’s imagination, so Lolita in the novel Lolita is an imaginary production of a middle-aged pedophile. Yet Lolita is not so much a novel revealing guilt and mental disorder, but a mélange of art and reality, or more specifically, it is about a coinage in which the author fabricates art and myth in real life. Parallel to the protagonist who simulates what he expects of his childhood love, Annabel, in the form of the nymphet, Lolita, Nabokov replicates the beauty of butterflies in the pursuit of beauty and immortality, and develops the world of art with a pathetic tone whereby we gradually perceive a simulation of the desire, violence, and

Hunter-gatherer genomic diversity suggests a southern African origin for modern humans.

Science.gov (United States)

Henn, Brenna M; Gignoux, Christopher R; Jobin, Matthew; Granka, Julie M; Macpherson, J M; Kidd, Jeffrey M; Rodríguez-Botigué, Laura; Ramachandran, Sohini; Hon, Lawrence; Brisbin, Abra; Lin, Alice A; Underhill, Peter A; Comas, David; Kidd, Kenneth K; Norman, Paul J; Parham, Peter; Bustamante, Carlos D; Mountain, Joanna L; Feldman, Marcus W

2011-03-29

Africa is inferred to be the continent of origin for all modern human populations, but the details of human prehistory and evolution in Africa remain largely obscure owing to the complex histories of hundreds of distinct populations. We present data for more than 580,000 SNPs for several hunter-gatherer populations: the Hadza and Sandawe of Tanzania, and the ≠Khomani Bushmen of South Africa, including speakers of the nearly extinct N|u language. We find that African hunter-gatherer populations today remain highly differentiated, encompassing major components of variation that are not found in other African populations. Hunter-gatherer populations also tend to have the lowest levels of genome-wide linkage disequilibrium among 27 African populations. We analyzed geographic patterns of linkage disequilibrium and population differentiation, as measured by F(ST), in Africa. The observed patterns are consistent with an origin of modern humans in southern Africa rather than eastern Africa, as is generally assumed. Additionally, genetic variation in African hunter-gatherer populations has been significantly affected by interaction with farmers and herders over the past 5,000 y, through both severe population bottlenecks and sex-biased migration. However, African hunter-gatherer populations continue to maintain the highest levels of genetic diversity in the world.

PLANET HUNTERS: ASSESSING THE KEPLER INVENTORY OF SHORT-PERIOD PLANETS

International Nuclear Information System (INIS)

Schwamb, Megan E.; Lintott, Chris J.; Lynn, Stuart; Smith, Arfon M.; Simpson, Robert J.; Fischer, Debra A.; Giguere, Matthew J.; Brewer, John M.; Parrish, Michael; Schawinski, Kevin

2012-01-01

We present the results from a search of data from the first 33.5 days of the Kepler science mission (Quarter 1) for exoplanet transits by the Planet Hunters citizen science project. Planet Hunters enlists members of the general public to visually identify transits in the publicly released Kepler light curves via the World Wide Web. Over 24,000 volunteers reviewed the Kepler Quarter 1 data set. We examine the abundance of ≥2 R ⊕ planets on short-period ( ⊕ Planet Hunters ≥85% efficient at identifying transit signals for planets with periods less than 15 days for the Kepler sample of target stars. Our high efficiency rate for simulated transits along with recovery of the majority of Kepler ≥4 R ⊕ planets suggests that the Kepler inventory of ≥4 R ⊕ short-period planets is nearly complete.

Contrasts in livelihoods and protein intake between commercial and subsistence bushmeat hunters in two villages on Bioko Island, Equatorial Guinea.

Science.gov (United States)

Vega, María Grande; Carpinetti, Bruno; Duarte, Jesús; Fa, John E

2013-06-01

Across West and Central Africa, wildlife provides a source of food and income. We investigated the relation between bushmeat hunting and household wealth and protein consumption in 2 rural communities in Bioko Island, Equatorial Guinea. One village was dedicated to commercial hunting, the other trapped game primarily for food. We tested whether commercial-hunter households were nutritionally advantaged over subsistence-hunter households due to their higher income from the bushmeat trade and greater access to wild-animal protein. We conducted bushmeat-offtake surveys in both villages (captures by hunters and carcasses arriving to each village). Mammals (including threatened primates: black colobus [Colobus satanas], Preussi's guenon [Allochrocebus preussi], and russet-eared guenon [Cercopithecus erythrotis]), birds, and reptiles were hunted. The blue duiker (Philantomba monticola), giant pouched rat (Cricetomys emini), and brush-tailed porcupine (Atherurus africanus) contributed almost all the animal biomass hunted, consumed, or sold in both villages. Monkeys and Ogilbyi's duikers (Cephalophus ogilbyi) were hunted only by commercial hunters. Commercial hunters generated a mean of US$2000/year from bushmeat sales. Households with commercial hunters were on average wealthier, generated more income, spent more money on nonessential goods, and bought more products they did not grow. By contrast, households with subsistence hunters spent less on market items, spent more on essential products, and grew more of their own food. Despite these differences, average consumption of vegetable protein and domestic meat and bushmeat protein did not differ between villages. Our results highlight the importance of understanding the socioeconomic and nutritional context of commercial and subsistence bushmeat hunting to correctly interpret ways of reducing their effects on threatened species and to enable the sustainable offtake of more productive taxa. © 2013 Society for Conservation

Drivers of change in hunter offtake and hunting strategies in Sendje, Equatorial Guinea.

Science.gov (United States)

Gill, David J C; Fa, John E; Rowcliffe, J Marcus; Kümpel, Noëlle F

2012-12-01

Economic development in Africa is expected to increase levels of bushmeat hunting through rising demand for meat and improved transport infrastructure. However, few studies have tracked long-term changes in hunter behavior as a means of testing this prediction. We evaluated changes in hunter behavior in a rural community in Equatorial Guinea over a period of rapid national economic growth, during which time road access to the regional capital greatly improved. We conducted offtake surveys (Supporting Information) over 3 7-week periods at the same time of year in 1998, 2003, and 2010 and conducted hunter and household interviews (Supporting Information) in 2003 and 2010. We tested whether relations existed among catch, hunting effort, hunting strategy, and income earned through hunting and other livelihoods in 2003 and 2010. Although village offtake increased from 1775 kg in 1998 to 4172 kg in 2003, it decreased in 2010 to 1361 kg. Aggregate catch per unit effort (i.e., number of carcasses caught per hunter and per trap) decreased from 2003 to 2010, and the majority of hunters reported a decrease in abundance of local fauna. Although these results are indicative of unsustainable hunting, cumulative changes in offtake and catch per unit effort were driven by a contraction in the total area hunted following an out-migration of 29 of the village's hunters, most of whom left to gain employment in the construction industry, after 2003. Hunters operating in both 2003 and 2010 hunted closer to the village because an increased abundance of elephants posed a danger and because they desired to earn income through other activities. Our study provides an example of national economic development contributing to a reduction in the intensity and extent of hunting. ©2012 Society for Conservation Biology.

High adult mortality among Hiwi hunter-gatherers: implications for human evolution.

Science.gov (United States)

Hill, Kim; Hurtado, A M; Walker, R S

2007-04-01

Extant apes experience early sexual maturity and short life spans relative to modern humans. Both of these traits and others are linked by life-history theory to mortality rates experienced at different ages by our hominin ancestors. However, currently there is a great deal of debate concerning hominin mortality profiles at different periods of evolutionary history. Observed rates and causes of mortality in modern hunter-gatherers may provide information about Upper Paleolithic mortality that can be compared to indirect evidence from the fossil record, yet little is published about causes and rates of mortality in foraging societies around the world. To our knowledge, interview-based life tables for recent hunter-gatherers are published for only four societies (Ache, Agta, Hadza, and Ju/'hoansi). Here, we present mortality data for a fifth group, the Hiwi hunter-gatherers of Venezuela. The results show comparatively high death rates among the Hiwi and highlight differences in mortality rates among hunter-gatherer societies. The high levels of conspecific violence and adult mortality in the Hiwi may better represent Paleolithic human demographics than do the lower, disease-based death rates reported in the most frequently cited forager studies.

Hunter-gatherers in southeast Asia: from prehistory to the present.

Science.gov (United States)

Higham, Charles

2013-01-01

Anatomically modern hunter-gatherers expanded from Africa into Southeast Asia at least 50,000 years ago, where they probably encountered and interacted with populations of Homo erectus and Homo floresiensis and the recently discovered Denisovans. Simulation studies suggest that these hunter-gatherers may well have followed a coastal route that ultimately led to the settlement of Sahul, while archaeology confirms that they also crossed significant seas and explored well into the interior. They also adapted to marked environmental changes that alternated between relatively cool and dry conditions and warmer, wetter interludes. During the former, the sea fell by up to 120 m below its present level, which opened up a vast low-lying area known as Sundaland. Three principal alignments can be identified: the first involved the occupation of rock shelters in upland regions, the second has identified settlement on broad riverine floodplains, and the last concentrated on the raised beaches formed from about five millennia ago when the sea level was elevated above its present position. This cultural sequence was dislocated about 4 kya when rice and millet farmers infiltrated the lowlands of Southeast Asia ultimately from the Yangtze River valley. It is suggested that this led to two forms of interaction. In the first, the indigenous hunter-gatherers integrated with intrusive Neolithic communities and, while losing their cultural identity, contributed their genes to the present population of Southeast Asia. In the second, hunter-gatherers withdrew to rainforest refugia and, through selective pressures inherent in such an environment, survived as the small-bodied, dark-skinned humans found to this day in the Philippines, Peninsular Malaysia and Thailand, and the Andaman Islands. Beyond the impact of expansive rice farmers in Melanesia and Australia, hunter-gatherers continued to dominate until they encountered European settlement. Copyright © 2013 Wayne State University Press

Future Discounting in Congo Basin Hunter-Gatherers Declines with Socio-Economic Transitions.

Directory of Open Access Journals (Sweden)

Gul Deniz Salali

Full Text Available Humans have a tendency to discount the future; that is we value small, short-term rewards over larger, long-term rewards. The degree of future discounting, however, changes in response to socio-ecological factors. Here, we study Mbendjele BaYaka hunter-gatherers of northern Congo and their farmer neighbours to investigate adaptations in inter-temporal preferences in humans. We argue that in immediate-return systems, where food storage is absent and egalitarianism is enforced through levelling mechanisms, future discounting is an adaptive strategy to prevent wealth accumulation and the emergence of hierarchies. This ensures food sharing and allows for survival in unpredictable environments where there is risk of an energy shortfall. On the other hand, when food storage is made possible by the emergence of agriculture or as seen in some delayed-return hunter-gatherer populations, wealth accumulation, hierarchies and lower discount rates become the adaptive strategy. Therefore, individuals in immediate-return, egalitarian societies will discount the future more than those in non-egalitarian, delayed-return societies. Consistent with the predictions we found that market integration and socio-economic transitions decrease the future discounting in Mbendjele hunter-gatherers. Our measures of socio-economic differences marked this transition in hunter-gatherers living in a logging town. The degree of future-discounting was the same between more market-integrated hunter-gatherers and their farmer neighbours.

Hunter College Dance Therapy Masters Program.

Science.gov (United States)

Schmais, Claire; White, Elissa Q.

Described is development of the Hunter College dance therapy 18-month 30-credit masters program involving 33 adult students, (in two classes beginning in 1971 and 1972), an educational model, internship in psychiatric institutions, and preparation of instructional materials. The dance therapist is said to incorporate the psychiatric patient's…

Host plants of Carambola fruit fly, Bactrocera carambolae Drew & Hancock(Diptera:Tephritidae);and provisional list of suitable host plants of Carambola fruit fly,(Bactrocera(Bactrocera) carambolae Drew & Hancock(Diptera:Tep

Science.gov (United States)

Bactrocera carambolae Drew & Hancock (Diptera: Tephritidae), commonly known as the carambola fruit fly, is native to Southeast Asia, but has extended its geographic range to several countries in South America. As with other tephritid fruit fly species, establishment of B.carambolae in areas where it...

Wild-harvested venison yields and sharing by Michigan deer hunters

Science.gov (United States)

Goguen, Amber D.; Riley, Shawn J.; Organ, John F.; Rudolph, Brent A.

2018-01-01

An increased societal focus on wildlife as food and recent policy deliberations regarding legal markets for wild-harvested meat are encouraging wildlife managers and researchers to examine the amount, use, and distribution of meat yielded through recreational hunting. We used responses to questions on the Michigan Deer Harvest Study to estimate the maximum yield of edible venison and assess hunters’ sharing behaviors. We estimated 11,402–14,473 metric tons of edible venison were procured during the 2013 hunting season. Of hunters who harvested a deer, 85% shared their venison. Hunters who shared did so with an average of 5.6 people (SD = 4.5). Sharing occurred most frequently within tight social networks: members of hunters’ households (69%), relatives (52%), and friends, neighbors, or coworkers (50%). In the absence of legal markets, venison is distributed widely by hunters and greatly amplifies the number of people benefiting from hunting. Nonetheless, we also identified the potential breadth of exposure to disease or contaminants from wild-harvested meat.

Cadmium, lead, and chromium in large game: a local-scale exposure assessment for hunters consuming meat and liver of wild boar.

Science.gov (United States)

Danieli, P P; Serrani, F; Primi, R; Ponzetta, M P; Ronchi, B; Amici, A

2012-11-01

Heavy metals are ubiquitous in soil, water, and air. Their entrance into the food chain is an important environmental issue that entails risks to humans. Several reports indicate that game meat can be an important source of heavy metals, particularly because of the increasing consumption of game meat, mainly by hunters. We performed an exposure assessment of hunters and members of their households, both adults and children, who consumed wild boar (WB) meat and offal. We estimated the amount of cadmium, lead, and chromium in the tissues of WB hunted in six areas within Viterbo Province (Italy) and gathered data on WB meat and offal consumption by conducting specific diet surveys in the same areas. The exposure to cadmium, lead, and chromium was simulated with specifically developed Monte Carlo simulation models. Cadmium and lead levels in WB liver and meat harvested in Viterbo Province (Italy) were similar to or lower than the values reported in other studies. However, some samples contained these metals at levels greater then the EU limits set for domestic animals. The chromium content of meat or liver cannot be evaluated against any regulatory limit, but our results suggest that the amounts of this metal found in WB products may reflect a moderate environmental load. Our survey of the hunter population confirmed that their consumption of WB meat and liver was greater than that of the general Italian population. This level of consumption was comparable with other European studies. Consumption of WB products contributes significantly to cadmium and lead exposure of both adults and children. More specifically, consumption of the WB liver contributed significantly to total cadmium and lead exposure of members of the households of WB hunters. As a general rule, liver consumption should be kept to a minimum, especially for children living in these hunter households. The exposure to chromium estimated for this population of hunters may be considered to be safe. However

Clarifying beliefs underlying hunter intentions to support a ban on lead shot

Science.gov (United States)

Schroeder, Susan A.; Fulton, David C.; Doncarlos, Kathy

2016-01-01

Shot from hunting adds toxic lead to environments worldwide. Existing lead shot regulations have been instituted with little understanding of hunter beliefs and attitudes. This study applied the Theory of Reasoned Action, using a multilevel, multivariate approach, to clarify how positive and negative beliefs relate to attitudes about a ban on lead shot. Structure coefficients and commonality analysis were employed to further examine relationships between beliefs and attitudes. Results suggest that while both positive and negative outcomes influence attitudes, positive outcomes were more influential for supporters and negative beliefs for opposers. Management may need to focus on the results from hunters who indicated that they would be unlikely to support a ban, as these hunters include those who may actively oppose additional efforts to regulate lead.

Effect of Piper chaba Hunter, Piper sarmentosum Roxb. and Piper interruptum Opiz. on natural killer cell activity and lymphocyte proliferation.

Science.gov (United States)

Panthong, Sumalee; Itharat, Arunporn

2014-08-01

Immune system is the most important system ofhuman body. Thaifolk doctors have used some medicinal plants as an adaptogenic drug or immunomodulatory agent. Piper chaba Hunter, Piper sarmentosum Roxb. and Piper interruptum Opiz. are used by folk doctors to activate immune response in cancer patients. To investigate the effect on natural killer cell activity and on lymphocyte proliferation activity of water extract of P chaba Hunter P. sarmentosum Roxb. and P interruptum Opiz. MATERIAL ANDMETHOD: Plant materials were extracted by decoction method. All extracts were testedfor an immunomodulatory effect using PBMCs from twelve healthy donors by chromium release assay. Lymphocyte proliferation was also determined by 3H-thymidine uptake assay. The degree of activation was expressed as the stimulation index. The water extract of P chaba Hunter significantly increased lymphocyte proliferation at concentrations ofl ng/ml, 10 ng/ml, 1 μg/ml, 5 μg/ml, 10 μg/ml and 100 μg/ml. P sarmentosum Roxb., and P interruptum Opiz. extracts at those concentrations significantly stimulated lymphocyteproliferation. P sarmentosum Roxb. extractsignificantly increased natural killer (NK) cell activity at a concentration of 100 μg/ml but P chaba Hunter and P interruptum Opiz. extracts did not significantly stimulate natural killer cell activity. P chaba Hunter, P interruptum Opiz. andP sarmentosum Roxb. have an immunomodulatory effect especially for P sarmentosum Roxb. extract which can activate both lymphocyte proliferation and NK cell activity.

Does Lateral Transmission Obscure Inheritance in Hunter-Gatherer Languages?

Science.gov (United States)

Bowern, Claire; Epps, Patience; Gray, Russell; Hill, Jane; Hunley, Keith; McConvell, Patrick; Zentz, Jason

2011-01-01

In recent years, linguists have begun to increasingly rely on quantitative phylogenetic approaches to examine language evolution. Some linguists have questioned the suitability of phylogenetic approaches on the grounds that linguistic evolution is largely reticulate due to extensive lateral transmission, or borrowing, among languages. The problem may be particularly pronounced in hunter-gatherer languages, where the conventional wisdom among many linguists is that lexical borrowing rates are so high that tree building approaches cannot provide meaningful insights into evolutionary processes. However, this claim has never been systematically evaluated, in large part because suitable data were unavailable. In addition, little is known about the subsistence, demographic, ecological, and social factors that might mediate variation in rates of borrowing among languages. Here, we evaluate these claims with a large sample of hunter-gatherer languages from three regions around the world. In this study, a list of 204 basic vocabulary items was collected for 122 hunter-gatherer and small-scale cultivator languages from three ecologically diverse case study areas: northern Australia, northwest Amazonia, and California and the Great Basin. Words were rigorously coded for etymological (inheritance) status, and loan rates were calculated. Loan rate variability was examined with respect to language area, subsistence mode, and population size, density, and mobility; these results were then compared to the sample of 41 primarily agriculturalist languages in [1]. Though loan levels varied both within and among regions, they were generally low in all regions (mean 5.06%, median 2.49%, and SD 7.56), despite substantial demographic, ecological, and social variation. Amazonian levels were uniformly very low, with no language exhibiting more than 4%. Rates were low but more variable in the other two study regions, in part because of several outlier languages where rates of borrowing were

"The Deer Hunter": Rhetoric of the Warrior.

Science.gov (United States)

Rushing, Janice Hocker; Frentz, Thomas S.

A psychological/ritual model of criticism is used to examine the movie "The Deer Hunter" as a rhetorical event in which males undergo psychological change through their war and postwar experiences. The critical model depends on understanding a Jungian interpretation of the human psyche, the form and function of initiation rituals, and…

Hunter versus CIE color measurement systems for analysis of milk-based beverages.

Science.gov (United States)

Cheng, Ni; Barbano, David M; Drake, Mary Anne

2018-06-01

The objective of our work was to determine the differences in sensitivity of Hunter and International Commission on Illumination (CIE) methods at 2 different viewer angles (2 and 10°) for measurement of whiteness, red/green, and blue/yellow color of milk-based beverages over a range of composition. Sixty combinations of milk-based beverages were formulated (2 replicates) with a range of fat level from 0.2 to 2%, true protein level from 3 to 5%, and casein as a percent of true protein from 5 to 80% to provide a wide range of milk-based beverage color. In addition, commercial skim, 1 and 2% fat high-temperature, short-time pasteurized fluid milks were analyzed. All beverage formulations were HTST pasteurized and cooled to 4°C before analysis. Color measurement viewer angle (2 vs. 10°) had very little effect on objective color measures of milk-based beverages with a wide range of composition for either the Hunter or CIE color measurement system. Temperature (4, 20, and 50°C) of color measurement had a large effect on the results of color measurement in both the Hunter and CIE measurement systems. The effect of milk beverage temperature on color measurement results was the largest for skim milk and the least for 2% fat milk. This highlights the need for proper control of beverage serving temperature for sensory panel analysis of milk-based beverages with very low fat content and for control of milk temperature when doing objective color analysis for quality control in manufacture of milk-based beverages. The Hunter system of color measurement was more sensitive to differences in whiteness among milk-based beverages than the CIE system, whereas the CIE system was much more sensitive to differences in yellowness among milk-based beverages. There was little difference between the Hunter and CIE system in sensitivity to green/red color of milk-based beverages. In defining milk-based beverage product specifications for objective color measures for dairy product

Learning from the mistakes of others: How female elk (Cervus elaphus) adjust behaviour with age to avoid hunters.

Science.gov (United States)

Thurfjell, Henrik; Ciuti, Simone; Boyce, Mark S

2017-01-01

In animal behaviour, there is a dichotomy between innate behaviours (e.g., temperament or personality traits) versus those behaviours shaped by learning. Innate personality traits are supposedly less evident in animals when confounded by learning acquired with experience through time. Learning might play a key role in the development and adoption of successful anti-predator strategies, and the related adaptation has the potential to make animals that are more experienced less vulnerable to predation. We carried out a study in a system involving a large herbivorous mammal, female elk, Cervus elaphus, and their primary predator, i.e., human hunters. Using fine-scale satellite telemetry relocations, we tested whether differences in behaviour depending on age were due solely to selection pressure imposed by human hunters, meaning that females that were more cautious were more likely to survive and become older. Or whether learning also was involved, meaning that females adjusted their behaviour as they aged. Our results indicated that both human selection and learning contributed to the adoption of more cautious behavioural strategies in older females. Whereas human selection of behavioural traits has been shown in our previous research, we here provide evidence of additive learning processes being responsible for shaping the behaviour of individuals in this population. Female elk are indeed almost invulnerable to human hunters when older than 9-10 y.o., confirming that experience contributes to their survival. Female elk monitored in our study showed individually changing behaviours and clear adaptation as they aged, such as reduced movement rates (decreased likelihood of encountering human hunters), and increased use of secure areas (forest and steeper terrain), especially when close to roads. We also found that elk adjusted behaviours depending on the type of threat (bow and arrow vs. rifle hunters). This fine-tuning by elk to avoid hunters, rather than just

Learning from the mistakes of others: How female elk (Cervus elaphus adjust behaviour with age to avoid hunters.

Directory of Open Access Journals (Sweden)

Henrik Thurfjell

Full Text Available In animal behaviour, there is a dichotomy between innate behaviours (e.g., temperament or personality traits versus those behaviours shaped by learning. Innate personality traits are supposedly less evident in animals when confounded by learning acquired with experience through time. Learning might play a key role in the development and adoption of successful anti-predator strategies, and the related adaptation has the potential to make animals that are more experienced less vulnerable to predation. We carried out a study in a system involving a large herbivorous mammal, female elk, Cervus elaphus, and their primary predator, i.e., human hunters. Using fine-scale satellite telemetry relocations, we tested whether differences in behaviour depending on age were due solely to selection pressure imposed by human hunters, meaning that females that were more cautious were more likely to survive and become older. Or whether learning also was involved, meaning that females adjusted their behaviour as they aged. Our results indicated that both human selection and learning contributed to the adoption of more cautious behavioural strategies in older females. Whereas human selection of behavioural traits has been shown in our previous research, we here provide evidence of additive learning processes being responsible for shaping the behaviour of individuals in this population. Female elk are indeed almost invulnerable to human hunters when older than 9-10 y.o., confirming that experience contributes to their survival. Female elk monitored in our study showed individually changing behaviours and clear adaptation as they aged, such as reduced movement rates (decreased likelihood of encountering human hunters, and increased use of secure areas (forest and steeper terrain, especially when close to roads. We also found that elk adjusted behaviours depending on the type of threat (bow and arrow vs. rifle hunters. This fine-tuning by elk to avoid hunters, rather

Fiber-optic displacement sensors on the Hunters Trophy UGT impulse gauge experiments

Energy Technology Data Exchange (ETDEWEB)

Green, R.E.L.; Poutiatine, A.I.

1995-03-01

As part of a program to develop gauges for measurement of various mechanical properties in hostile environments, the authors fielded purely optical displacement sensors at the ends of long fiber-optic cables as supplements to the regular displacement sensors of four impulse gauges fielded as part of a materials study on the Hunters Trophy underground effects test at the Nevada Test Site. These fiber-optic sensor systems and their performance on the Hunters Trophy test are described in this report.

Factors impacting hunter access to private lands in southeast Minnesota

Science.gov (United States)

Walberg, Eric; Cornicelli, Louis; Fulton, David C.

2018-01-01

White-tailed deer (Odocoileus virginianus) have important socioeconomic and ecological impacts in the United States. Hunting is considered to be important for the effective management of deer and relies on access to privately owned lands. In 2013, we surveyed nonindustrial private landowners in southeast Minnesota and created two logit models to examine factors that impact landowners’ decision to (a) allow public hunting access and (b) post private property. Parcel characteristics were found to impact landowner decisions to allow hunting access, particularly the size of the property and whether it was posted. Hunting access to small properties was more likely to be restricted to family, friends, and neighbors (83%) compared to medium (74%) or large properties (60%). Hunter concerns (e.g., liability) and knowledge about deer management was significant in both models, suggesting there are opportunities to educate landowners about the importance of allowing public hunting access and available liability protections.

Salinity and resource management in the Hunter Valley

Energy Technology Data Exchange (ETDEWEB)

Creelman, R.A.; Cooke, R.; Simons, M. [RA Creelman & Associates (Australia)

1995-08-01

If excess water salinity is to be managed in the Hunter Valley, its causes and behaviour must be understood. Although Hunter Valley hydrology, hydrogeology and hydrogeochemistry require further study, there is now enough information available to begin the development of both temporal and spatial models as valley management tools. Currently the Department of Water Resources is developing a model known as Integrated Water Quality and Quantity Model (IQQM). IQQM which includes a salinity module is essentially a surface water simulation model. It wll enable testing of alternate management and operation policies such as the salinity property rights trading scheme recently introduced by the EPA to manage salt release from coal mines and power stations. An overview is presented of the progress made to date on the salinity module for IQQM, and an outline is given of the geological and hydrogeochemical concepts that have been assembled to support the salinity module of IQQM. 17 refs., 3 figs., 1 tab.

perceptions and adaptations of beekeepers and honey hunters

African Journals Online (AJOL)

Prof. Adipala Ekwamu

honey sector (i.e. honey hunters) to climate change are, however, not adequately explored. The objective of .... The statistical software SPSS Version 16 was used for this purpose. ... content analysis is an effort of interpretation, that balances ... FORM. Discontinue. N o = 0 ; Yes = 1. ±. Creditavability. CRED. Discontinue. N.

Injury and Illness Among Deer Hunters

OpenAIRE

McRae, Shelagh M.

1989-01-01

General practice and out-patient emergency records for a five-year period were reviewed for injuries and illnesses that occurred during the week of deer rifle hunting on Manitoulin Island. Of 65 hunters who were identified, most had lacerations secondary to knife injuries. There were two deaths (one shooting and one in a motor vehicle accident), and 19 persons required hospitalization. More than half of these serious accidents occurred on the weekends immediately preceding or following the hu...

Project CHECO Southeast Asia Report. OV-1/AC-119 Hunter-Killer Team

Science.gov (United States)

1972-10-10

between Phan Rang, Phu Cat , and Danang in order to provide best coverage of the Vietnamese conflict. -- On 16 February 1970, three AC -ll9Ks and 70...SOUTHEAST ASIA D D DDiv AY/XDOSQA I OV-1/ AC -119 " i IWB I HUNTER-KILLER TEAM 19’.1’ CONTINUING REPORT CLASSIFIED Ey 7AFIDOOC DOWNGRADE TjU SECRET...xamination of C urrent, 0 per’tions I~ I fF!lr T I TII TIIII I OV=1/ AC -119 HUNTER-KILLER TEAMI 1 10 OCTOBER 1972 HQ PACAF Directorate of Operations

Ethical acceptability of recreational hunting - does the motive of the hunter matter?

DEFF Research Database (Denmark)

Gamborg, Christian; Jensen, Frank Søndergaard; Sandøe, Peter

2016-01-01

Recreational hunting can be a way of taking responsibility for acquiring one’s own meat. However, many recreational hunters focus instead on hunting as a hobby or sport. This distinction, between two rather different motives for hunting, is relevant to the activity’s moral justifiability. The pub......Recreational hunting can be a way of taking responsibility for acquiring one’s own meat. However, many recreational hunters focus instead on hunting as a hobby or sport. This distinction, between two rather different motives for hunting, is relevant to the activity’s moral justifiability...

Social networks and cooperation in hunter-gatherers.

Science.gov (United States)

Apicella, Coren L; Marlowe, Frank W; Fowler, James H; Christakis, Nicholas A

2012-01-25

Social networks show striking structural regularities, and both theory and evidence suggest that networks may have facilitated the development of large-scale cooperation in humans. Here, we characterize the social networks of the Hadza, a population of hunter-gatherers in Tanzania. We show that Hadza networks have important properties also seen in modernized social networks, including a skewed degree distribution, degree assortativity, transitivity, reciprocity, geographic decay and homophily. We demonstrate that Hadza camps exhibit high between-group and low within-group variation in public goods game donations. Network ties are also more likely between people who give the same amount, and the similarity in cooperative behaviour extends up to two degrees of separation. Social distance appears to be as important as genetic relatedness and physical proximity in explaining assortativity in cooperation. Our results suggest that certain elements of social network structure may have been present at an early point in human history. Also, early humans may have formed ties with both kin and non-kin, based in part on their tendency to cooperate. Social networks may thus have contributed to the emergence of cooperation.

Radium issues at Hunters Point Annex

International Nuclear Information System (INIS)

Dean, S.M.

1994-01-01

Radium was a common source of illumination used in numerous instruments and gauges for military equipment prior to 1970. As a result of its many military applications radium 226 is now a principle radionuclide of concern at military base closures sites throughout the United States. This is an overview of the site characterization strategy employed and a potential site remediation technology being considered at a radium contaminated landfill at Hunters Point Annex, a former U.S. Navy shipyard in San Francisco, California

Comparing Road-Kill Datasets from Hunters and Citizen Scientists in a Landscape Context

OpenAIRE

Florian Heigl; Carina R. Stretz; Wolfgang Steiner; Franz Suppan; Thomas Bauer; Gregor Laaha; Johann G. Zaller

2016-01-01

Road traffic has severe effects on animals, especially when road-kills are involved. In many countries, official road-kill data are provided by hunters or police; there are also road-kill observations reported by citizen scientists. The aim of the current study was to test whether road-kill reports by hunters stem from similar landscapes than those reported by citizen scientists. We analysed the surrounding landscapes of 712 road-kill reportings of European hares in the province of Lower Aust...

Undergraduate Planet Hunters: Tools and Results

Science.gov (United States)

Buzasi, Derek L.; Carboneau, Lindsey; Ferrell, Laura; Green, Gilbert; Kaiser, Maya; Kreke, Kira; Lundy, Samantha; Merritt, William; Passino, Matlin; Paxton, Harrison; Podaril, Alexandria; Stansfield, Alexis

2018-06-01

One student "Honors Experience" option at Florida Gulf Coast University is a research experience, and we have developed a "Planet Hunters" course to provide an astronomical research track that satisfies that requirement. Students spend the first semester learning astronomical background and exoplanet detection techniques, while the second semester is primarily devoted to planet searches in K2 data using student-oriented software tools developed specifically for the task. In this poster, we illustrate those tools and show results obtained by class participants during this years experience.

Targeting hunter distribution based on host resource selection and kill sites to manage disease risk

DEFF Research Database (Denmark)

Dugal, Cherie; van Beest, Floris; Vander Wal, Eric

2013-01-01

Endemic and emerging diseases are rarely uniform in their spatial distribution or prevalence among cohorts of wildlife. Spatial models that quantify risk-driven differences in resource selection and hunter mortality of animals at fine spatial scales can assist disease management by identifying high-risk...... areas and individuals. We used resource selection functions (RSFs) and selection ratios (SRs) to quantify sex- and age-specific resource selection patterns of collared (n = 67) and hunter-killed (n = 796) nonmigratory elk (Cervus canadensis manitobensis) during the hunting season between 2002 and 2012...... juvenile males and hunter-killed adult females. In instances where disease infects a metapopulation and eradication is infeasible, a principle goal of management is to limit the spread of disease among infected animals. We map high-risk areas that are regularly used by potentially infectious hosts...

Molecular and biometric assessment of Myzodium mimulicola (Drew & Sampson) (Hemiptera, Aphididae), new synonymy, host, and distributional data

Science.gov (United States)

Molecular and biometric assessment and subsequent redescription of Myzodium mimulicola (Drew & Sampson) is provided. New host and distributional data for North America are presented, including the first record from Alaska. The current study determined that Myzodium knowltoni (Smith & Robinson) is a ...

Blood, guts and knife cuts: reducing the risk of swine brucellosis in feral pig hunters in north-west New South Wales, Australia.

Science.gov (United States)

Massey, P D; Polkinghorne, B G; Durrheim, D N; Lower, T; Speare, R

2011-01-01

Humans who have close contact with livestock, wild or feral animals can risk acquiring zoonotic infections such as brucellosis, Q fever, and leptospirosis. Human infection with Brucella suis (swine brucellosis) usually follows occupational or recreational exposure to infected animals. Worldwide, many cases of human infection follow contact with infected feral pigs. In Australia there is a growing market for the export of 'wild boar' and a considerable number of people are involved in feral pig hunting. However, feral pig hunters are often hard to reach with health strategies. According to Australian authorities the most important means of preventing disease in humans includes covering cuts; wearing gloves; washing hands; and avoiding blood when coming into contact with feral pigs. There has not been an evaluation of the acceptability of these recommended risk-reduction strategies in the settings where feral pig hunting and evisceration occurs. Semi-structured interviews and small focus groups were conducted with feral pig hunters in north-west New South Wales (NSW), Australia, to explore their hunting experiences and views on the brucellosis prevention strategies. Interview and focus group notes were thematically analysed. There was a range of experiences of feral pig hunting, from a very professional approach to a purely recreational approach. The main domains that emerged from participants' experiences during their most recent feral pig hunting activity and their reflections on current swine brucellosis risk reduction strategies were: 'you've gotta be tough to be a feral pig hunter'; 'most of the suggested strategies won't work as they are'; 'reducing risk in the scrub'; and 'how to let pig hunters know'. The recreational nature and prevailing macho perspective of participants demand a pragmatic approach to risk reduction if it is going to prove acceptable to feral pig hunters. The 'you've gotta be tough to be a feral pig hunter' context of the activity and the

Medicinal and ethnoveterinary remedies of hunters in Trinidad

Directory of Open Access Journals (Sweden)

Georges Karla

2001-11-01

Full Text Available Abstract Background Ethnomedicines are used by hunters for themselves and their hunting dogs in Trinidad. Plants are used for snakebites, scorpion stings, for injuries and mange of dogs and to facilitate hunting success. Results Plants used include Piper hispidum, Pithecelobium unguis-cati, Bauhinia excisa, Bauhinia cumanensis, Cecropia peltata, Aframomum melegueta, Aristolochia rugosa, Aristolochia trilobata, Jatropha curcas, Jatropha gossypifolia, Nicotiana tabacum, Vernonia scorpioides, Petiveria alliacea, Renealmia alpinia, Justicia secunda, Phyllanthus urinaria,Phyllanthus niruri,Momordica charantia, Xiphidium caeruleum, Ottonia ovata, Lepianthes peltata, Capsicum frutescens, Costus scaber, Dendropanax arboreus, Siparuma guianensis, Syngonium podophyllum, Monstera dubia, Solanum species, Eclipta prostrata, Spiranthes acaulis, Croton gossypifolius, Barleria lupulina, Cola nitida, Acrocomia ierensis (tentative ID. Conclusion Plant use is based on odour, and plant morphological characteristics and is embedded in a complex cultural context based on indigenous Amerindian beliefs. It is suggested that the medicinal plants exerted a physiological action on the hunter or his dog. Some of the plants mentioned contain chemicals that may explain the ethnomedicinal and ethnoveterinary use. For instance some of the plants influence the immune system or are effective against internal and external parasites. Plant baths may contribute to the health and well being of the hunting dogs.

Medicinal and ethnoveterinary remedies of hunters in Trinidad.

Science.gov (United States)

Lans, C; Harper, T; Georges, K; Bridgewater, E

2001-01-01

Ethnomedicines are used by hunters for themselves and their hunting dogs in Trinidad. Plants are used for snakebites, scorpion stings, for injuries and mange of dogs and to facilitate hunting success. Plants used include Piper hispidum, Pithecelobium unguis-cati, Bauhinia excisa, Bauhinia cumanensis, Cecropia peltata, Aframomum melegueta, Aristolochia rugosa, Aristolochia trilobata, Jatropha curcas, Jatropha gossypifolia, Nicotiana tabacum, Vernonia scorpioides, Petiveria alliacea, Renealmia alpinia, Justicia secunda, Phyllanthus urinaria,Phyllanthus niruri,Momordica charantia, Xiphidium caeruleum, Ottonia ovata, Lepianthes peltata, Capsicum frutescens, Costus scaber, Dendropanax arboreus, Siparuma guianensis, Syngonium podophyllum, Monstera dubia, Solanum species, Eclipta prostrata, Spiranthes acaulis, Croton gossypifolius, Barleria lupulina, Cola nitida, Acrocomia ierensis (tentative ID). Plant use is based on odour, and plant morphological characteristics and is embedded in a complex cultural context based on indigenous Amerindian beliefs. It is suggested that the medicinal plants exerted a physiological action on the hunter or his dog. Some of the plants mentioned contain chemicals that may explain the ethnomedicinal and ethnoveterinary use. For instance some of the plants influence the immune system or are effective against internal and external parasites. Plant baths may contribute to the health and well being of the hunting dogs.

Estimating the mercury exposure dose in a population of migratory bird hunters in the St. Lawrence River region, Quebec, Canada

International Nuclear Information System (INIS)

Duchesne, J.-F.; Levesque, B.; Gauvin, Denis; Braune, Birgit; Gingras, Suzanne; Dewailly, E.

2004-01-01

St. Lawrence River hunters (Quebec, Canada) are exposed to the pollutants, especially mercury, that contaminate birds and fish. However, the health risks of this have remained unclear because of a lack of information about the hunters' duck, geese, and sportfish consumption habits. A nutritional survey was set up to characterize waterfowl and sportfish consumption in St. Lawrence River duck hunters and to estimate their daily exposure to mercury. During the winter of 2000, 512 hunters selected from the Canadian Wildlife Service database completed a self-administered questionnaire. Daily exposure to contaminants was measured using data from the Canadian Wildlife Service (waterfowl) and available data on St. Lawrence River sportfish. The annual average consumption was 7.5 meals of ducks and geese and 8.7 meals of sportfish. The daily exposure to mercury related to waterfowl consumption was below the Canadian tolerable daily intake (TDI) of 0.47 μg/kg body wt/day for all participants. The daily mercury intake associated with fish consumption was greater than the TDI in 2 duck hunters. The daily exposure to mercury was higher than the TDI in 4 participants when both waterfowl and fish consumption were combined. Our results suggest that fish consumption (especially freshwater fish) represents the main source of exposure to pollutants in duck hunters

Avian influenza prevalence among hunter-harvested birds in a remote Canadian First Nation community.

Science.gov (United States)

Liberda, Eric N; Meldrum, Richard; Charania, Nadia A; Davey, Robert; Tsuji, Leonard Js

2017-01-01

Avian influenza virus (AIV) prevalence has been associated with wild game and other bird species. The contamination of these birds may pose a greater risk to those who regularly hunt and consumed infected species. Due to resident concerns communicated by local Band Council, hunter-harvested birds from a remote First Nation community in subArctic Ontario, Canada were assessed for AIV. Hunters, and especially those who live a subsistence lifestyle, are at higher risk of AIV exposure due to their increased contact with wild birds, which represent an important part of their diet. Cloacal swabs from 304 harvested game birds representing several species of wild birds commonly hunted and consumed in this First Nation community were analyzed for AIV using real-time reverse transcription polymerase chain reaction. Subtyping was performed using reverse transcription polymerase chain reaction. Sequences were assembled using Lasergene, and the sequences were compared to Genbank. In total, 16 of the 304 cloacal swab samples were positive for AIV. Of the 16 positive samples, 12 were found in mallard ducks, 3 were found in snow geese (wavies), and 1 positive sample was found in partridge. The AIV samples were subtyped, when possible, and found to be positive for the low pathogenic avian influenza virus subtypes H3 and H4. No samples were positive for subtypes of human concern, namely H5 and H7. This work represents the first AIV monitoring program results of hunter-harvested birds in a remote subsistence First Nation community. Community-level surveillance of AIV in remote subsistence hunting communities may help to identify future risks, while educating those who may have the highest exposure about proper handling of hunted birds. Ultimately, only low pathogenic strains of AIV were found, but monitoring should be continued and expanded to safeguard those with the highest exposure risk to AIV.

Firewood, food and human niche construction: the potential role of Mesolithic hunter-gatherers in actively structuring Scotland's woodlands

Science.gov (United States)

Bishop, Rosie R.; Church, Mike J.; Rowley-Conwy, Peter A.

2015-01-01

Over the past few decades the potential role of Mesolithic hunter-gatherers in actively constructing their own niches, through the management of wild plants, has frequently been discussed. It is probable that Mesolithic hunter-gatherers systematically exploited specific woodland resources for food and fuel and influenced the 'natural' abundance or distribution of particular species within Mesolithic environments. Though there has been considerable discussion of the pollen evidence for potential small-scale human-woodland manipulation in Mesolithic Scotland, the archaeobotanical evidence for anthropogenic firewood and food selection has not been discussed in this context. This paper assesses the evidence for the active role of Mesolithic hunter-gatherer communities in systematically exploiting and managing woodlands for food and fuel in Scotland. While taphonomic factors may have impacted on the frequency of specific species in archaeobotanical assemblages, it is suggested that hunter-gatherers in Mesolithic Scotland were systematically using woodland plants, and in particular hazel and oak, for food and fuel. It is argued that the pollen evidence for woodland management is equivocal, but hints at the role of hunter-gatherers in shaping the structure of their environments, through the maintenance or creation of woodland clearings for settlement or as part of vegetation management strategies. It is proposed that Mesolithic hunter-gatherers may have actively contributed to niche construction and that the systematic use of hazel and oak as a fuel may reflect the deliberate pruning of hazel trees to increase nut-yields and the inadvertent - or perhaps deliberate - coppicing of hazel and oak during greenwood collection.

Fundación Book Hunters: Atrévete a experimentar con la lectura

OpenAIRE

Cruz Mejía, Fernanda

2017-01-01

La fundación Book Hunters es una organización sin ánimo de lucro que busca fortalecer la relación de la lectura en los niños desde temprana edad, involucrando a la comunidad y promoviendo el entendimiento del entorno que rodea hoy en día la infancia. El equipo considera que, para lograr los objetivos es necesario transformar el significado ha perseguido a la lectura durante años, es decir, para Book Hunters leer va más allá de tomar un libro e involucrarse en la historia, en cambio, el si...

Radioactive caesium in hunters and their families

Energy Technology Data Exchange (ETDEWEB)

Aagren, G; Bergman, R [Natonal Defence Research Establishment, Umeaa (Sweden); Drottz-Sjoeberg, B M [Center for Risk Research, Stockholm (Sweden); Enander, A [National Defence Research Establishment, Karlstad (Sweden); Johansson, K J [Swedish Univ. of Agricultural Sciences, Uppsala (Sweden)

1995-12-01

We have measured the whole-body content of radiocesium in men and women in households, where at least one member is a hunter. Hunter families live to a great extent on forest products, such as mushrooms, berries and meat from game. Measurements were performed in two areas in northern Sweden and in three areas in the middle part of Sweden with deposition levels between 7 to 80 kBq/m{sup 2}. The average whole body content of {sup 137}Cs varied between 0.3 to 1.9 kBq for women and 0.6 to 4.7 kBq for men, depending on the deposition level. Each individual in the measured group was also asked to fill in questionnaire and a food diary to provide complementary information of, e.g., food intake and other life conditions. The single dietary factor most clearly related to whole-body content in these groups is the intake of meat from moose. The best regression model with variables from the questionnaire explained 60% of the variance in the whole-body content of {sup 137}Cs in the measurement group. Some of the variables in this model were deposition level, sex, rate of intake and estimated consumption of moose meat and estimated amount of bilberries in the fridge. 6 refs, 5 figs, 14 tabs.

Radioactive caesium in hunters and their families

International Nuclear Information System (INIS)

Aagren, G.; Bergman, R.; Drottz-Sjoeberg, B.M.; Enander, A.; Johansson, K.J.

1995-12-01

We have measured the whole-body content of radiocesium in men and women in households, where at least one member is a hunter. Hunter families live to a great extent on forest products, such as mushrooms, berries and meat from game. Measurements were performed in two areas in northern Sweden and in three areas in the middle part of Sweden with deposition levels between 7 to 80 kBq/m 2 . The average whole body content of 137 Cs varied between 0.3 to 1.9 kBq for women and 0.6 to 4.7 kBq for men, depending on the deposition level. Each individual in the measured group was also asked to fill in questionnaire and a food diary to provide complementary information of, e.g., food intake and other life conditions. The single dietary factor most clearly related to whole-body content in these groups is the intake of meat from moose. The best regression model with variables from the questionnaire explained 60% of the variance in the whole-body content of 137 Cs in the measurement group. Some of the variables in this model were deposition level, sex, rate of intake and estimated consumption of moose meat and estimated amount of bilberries in the fridge. 6 refs, 5 figs, 14 tabs

Diagnosis of Hunter's syndrome carriers; radioactive sulphate incorporation into fibroblasts in the presence of fructose 1-phosphate

International Nuclear Information System (INIS)

Toennesen, T.; Lykkelund, C.; Guettler, F.

1982-01-01

Mutual correction of co-cultivated fibroblasts from patients with Hunter's and Hurler's syndrome could be inhibited by either fructose 1-phosphate or mannose 6-phosphate. In the presence of fructose 1-phosphate a 50% mixture of fibroblasts from a patient with Hunter's syndrome and a normal homozygous individual showed an increased 35 S-sulphate incorporation into acid mucopolysaccharides. When fibroblast cultures from one obligate and two possible carriers of Hunter's syndrome were tested for 35 S-sulphate incorporation, the cultures showed either twice the normal 35 S-sulphate incorporation into acid mucopolysaccharides in the presence of fructose 1-phosphate or an abnormally high incorporation in the presence as well as in the absence of the sugar phosphate. (orig.)

Hunters syndrom og hørenedsaettelse

DEFF Research Database (Denmark)

Kiaer, Eva Kirkegaard; Møller, Troels Reinholdt; Wetke, Randi

2010-01-01

A 30 month-old boy with delayed language development was referred to the Department of Audiology in Aarhus. At the time of referral he had had 19 cases of acute otitis media and had been tubulated four times. Furthermore, the boy had not developed according to age in several respects: his motor...... functions and language were delayed, and he made audible respiratory sounds and was obviously nasally congested. The boy was referred for further investigations at the Department of Paediatrics. The tests showed that the boy suffered from Hunter Syndrome (MPSII) and he underwent relevant treatment....

The formation of fire residues associated with hunter-gatherers in humid tropical environments: A geo-ethnoarchaeological perspective

Science.gov (United States)

Friesem, David E.; Lavi, Noa; Madella, Marco; Boaretto, Elisabetta; Ajithparsad, P.; French, Charles

2017-09-01

Tropical forests have been an important human habitat and played a significant role in early human dispersal and evolution. Likewise, the use of fire, besides being one of the exceptional characteristics of humans, serves as a marker for human evolution. While the use of fire by prehistoric hunter-gatherers is relatively well documented in arid and temperate environments, the archaeological evidence in humid tropical environment is to date very limited. We first review the archaeological evidence for hunter-gatherer use of fire in humid tropical environments and suggest that better understanding of formation processes is required. We present a geo-ethnoarchaeological study from South India, involving ethnography, excavations and laboratory-based analyses in order to build a new framework to study fire residues in humid tropical forests associated with hunter-gatherer's use of fire. Ethnographic observations point to a dynamic and ephemeral use of hearths. Hearths location were dictated by the social and ever-changing social dynamics of the site. The hearths deposited small amount of residues which were later swept on a daily basis, re-depositing ash and charcoal in waste areas and leaving only a microscopic signal in the original location. Particular acidic conditions and intensive biological activity within tropical sediments result in the complete dissolution of ash and bones while favouring the preservation of charcoal and phytoliths. Consequently, the identification of fire residues in humid tropical forests and the reconstruction of the human use of fire must involve multi-proxy microscopic analysis to detect its micro-signatures.

Project CHECO Southeast Asia Report. OV-1/AC-119 Hunter-Killer Team

National Research Council Canada - National Science Library

Sexton, Richard R; Hodgson, William M

1972-01-01

Hunter-Killer operations were but a logical extension of the resourceful thinking behind the development of gunships as a solution to some of the tactical problems of the unique war in Southeast Asia...

Sacrificing Steve: How I Killed the Crocodile Hunter

Directory of Open Access Journals (Sweden)

Luke Carman

2010-09-01

Full Text Available Bob Hodge and Vijay Mishra argue that the complex issues of illegitimacy at the core of Australian identity are repressed through a continual process of cyclical silencing, where traces of a shameful past are exorcised by a focus on images of a mythologised ‘legend’, embodied in characters such as 'The Man from Snowy River'. This article explores such a 'schizophrenic' cycle in relation to the life, death and resurrection of Steve 'Crocodile Hunter' Irwin.

Profile of idursulfase for the treatment of Hunter syndrome

Directory of Open Access Journals (Sweden)

Sestito S

2015-07-01

Full Text Available Simona Sestito, Ferdinando Ceravolo, Michele Grisolia, Elisa Pascale, Licia Pensabene, Daniela Concolino Department of Pediatrics, University Magna Graecia of Catanzaro, Catanzaro, Italy Abstract: Mucopolysaccharidosis type II (MPS II; Hunter syndrome is a rare X-linked lysosomal storage disorder caused by deficiency of the enzyme iduronate-2-sulfatase (IDS. Enzyme replacement therapy (ERT with recombinant human IDS, available since 2005, is currently the most appropriate treatment for this progressive, multisystemic, chronic, and life-threatening disease. Efficacy and safety of therapy with idursulfase have been assessed in several clinical trials, and confirmed in many clinical reports. Long-term follow-up of patients receiving ERT has demonstrated the importance of an early onset of treatment with idursulfase, before irreversible pathological changes occur. Intravenously administered idursulfase is not able to cross the blood–brain barrier, so neurological signs and symptoms cannot benefit from ERT, still remaining a major challenge in the treatment of MPS II. Keywords: MPS II, glycosaminoglycans, enzyme replacement therapy, ERT

Hide Tanning and Its Use in Taiga: The Case of the Orochen-Evenki Reindeer Herders and Hunters of Zabaikalye (East Siberia)

OpenAIRE

Donatas Brandišauskas

2010-01-01

This article documents the way in which the Orochen-Evenki hunters and herders in northern part of Zabaikalye tan hides and produce gear in the post-Soviet era. Here, I wish to present the argument that it is difficult to understand the reviving of hide tanning in remote villages and the taiga without understanding how hunters and herders in this region adapt to the unstable post-Soviet environment. I suggest that hunters and herders aim to maintain their autonomy from goods and resources imp...

Preliminary assessment of channel stability and bed-material transport along Hunter Creek, southwestern Oregon

Science.gov (United States)

Jones, Krista L.; Wallick, J. Rose; O'Connor, Jim E.; Keith, Mackenzie K.; Mangano, Joseph F.; Risley, John C.

2011-01-01

This preliminary assessment of (1) bed-material transport in the Hunter Creek basin, (2) historical changes in channel condition, and (3) supplementary data needed to inform permitting decisions regarding instream gravel extraction revealed the following: Along the lower 12.4 km (kilometers) of Hunter Creek from its confluence with the Little South Fork Hunter Creek to its mouth, the river has confined and unconfined segments and is predominately alluvial in its lowermost 11 km. This 12.4-km stretch of river can be divided into two geomorphically distinct study reaches based primarily on valley physiography. In the Upper Study Reach (river kilometer [RKM] 12.4-6), the active channel comprises a mixed bed of bedrock, boulders, and smaller grains. The stream is confined in the upper 1.4 km of the reach by a bedrock canyon and in the lower 2.4 km by its valley. In the Lower Study Reach (RKM 6-0), where the area of gravel bars historically was largest, the stream flows over bed material that is predominately alluvial sediments. The channel alternates between confined and unconfined segments. The primary human activities that likely have affected bed-material transport and the extent and area of gravel bars are (1) historical and ongoing aggregate extraction from gravel bars in the study area and (2) timber harvest and associated road construction throughout the basin. These anthropogenic activities likely have varying effects on sediment transport and deposition throughout the study area and over time. Although assessing the relative effects of these anthropogenic activities on sediment dynamics would be challenging, the Hunter Creek basin may serve as a case study for such an assessment because it is mostly free of other alterations to hydrologic and geomorphic processes such as flow regulation, dredging, and other navigation improvements that are common in many Oregon coastal basins. Several datasets are available that may support a more detailed physical assessment

HiggsHunters - a citizen science project for ATLAS

CERN Document Server

Haas, Andrew; The ATLAS collaboration

2016-01-01

Since the launch of HiggsHunters.org in November 2014, citizen science volunteers have classified more than a million points of interest in images from the ATLAS experiment at the LHC. Volunteers have been looking for displaced vertices and unusual features in images recorded during LHC Run-1. We discuss the design of the project, its impact on the public, and the surprising results of how the human volunteers performed relative to the computer algorithms in identifying displaced secondary vertices.

JEFX 10 demonstration of Cooperative Hunter Killer UAS and upstream data fusion

Science.gov (United States)

Funk, Brian K.; Castelli, Jonathan C.; Watkins, Adam S.; McCubbin, Christopher B.; Marshall, Steven J.; Barton, Jeffrey D.; Newman, Andrew J.; Peterson, Cammy K.; DeSena, Jonathan T.; Dutrow, Daniel A.; Rodriguez, Pedro A.

2011-05-01

The Johns Hopkins University Applied Physics Laboratory deployed and demonstrated a prototype Cooperative Hunter Killer (CHK) Unmanned Aerial System (UAS) capability and a prototype Upstream Data Fusion (UDF) capability as participants in the Joint Expeditionary Force Experiment 2010 in April 2010. The CHK capability was deployed at the Nevada Test and Training Range to prosecute a convoy protection operational thread. It used mission-level autonomy (MLA) software applied to a networked swarm of three Raven hunter UAS and a Procerus Miracle surrogate killer UAS, all equipped with full motion video (FMV). The MLA software provides the capability for the hunter-killer swarm to autonomously search an area or road network, divide the search area, deconflict flight paths, and maintain line of sight communications with mobile ground stations. It also provides an interface for an operator to designate a threat and initiate automatic engagement of the target by the killer UAS. The UDF prototype was deployed at the Maritime Operations Center at Commander Second Fleet, Naval Station Norfolk to provide intelligence analysts and the ISR commander with a common fused track picture from the available FMV sources. It consisted of a video exploitation component that automatically detected moving objects, a multiple hypothesis tracker that fused all of the detection data to produce a common track picture, and a display and user interface component that visualized the common track picture along with appropriate geospatial information such as maps and terrain as well as target coordinates and the source video.

Representações da Guerra Fria no discurso jornalístico norte-americano de Drew Pearson (1950-1960 = Representations of the Cold War in the north american journalistic discourse of Drew Pearson (1950-1960

Directory of Open Access Journals (Sweden)

Portela, Leonice

2014-01-01

Full Text Available O presente artigo pretende realizar uma análise nas páginas da revista O Cruzeiro no período de 1950 a 1960, na coluna Carrossel do Mundo escrita pelo jornalista norte-americano Drew Person. Nesta pesquisa evidenciaremos o cruzamento da história com a imprensa e as representações que esta fazia do contexto dos anos de 1950 a 1960. Além de utilizarmos a revistas O Cruzeiro como fonte de pesquisa, está também será nosso objeto de estudo na medida em que se pretende analisar a revista nos seus intrincados bastidores e relações com o poder. A revista é fonte de sua própria história e das mais diversas situações, encontramos dados sobre a sociedade, costumes, informando sobre questões políticas e econômicas inseridas em suas representações através de suas palavras e imagens. Realizaremos um panorama dos artigos de Drew Pearson no período de 1950 a 1960, sendo classificadas em três Eixos Temáticos que se destacam como: a Articulações Políticas dos Estados Unidos nas relações internas e externas; b As ameaças do Comunismo; c Guerra Fria na sua perspectiva de “guerra de nervos”

Co-residence patterns in hunter-gatherer societies show unique human social structure.

Science.gov (United States)

Hill, Kim R; Walker, Robert S; Bozicević, Miran; Eder, James; Headland, Thomas; Hewlett, Barry; Hurtado, A Magdalena; Marlowe, Frank; Wiessner, Polly; Wood, Brian

2011-03-11

Contemporary humans exhibit spectacular biological success derived from cumulative culture and cooperation. The origins of these traits may be related to our ancestral group structure. Because humans lived as foragers for 95% of our species' history, we analyzed co-residence patterns among 32 present-day foraging societies (total n = 5067 individuals, mean experienced band size = 28.2 adults). We found that hunter-gatherers display a unique social structure where (i) either sex may disperse or remain in their natal group, (ii) adult brothers and sisters often co-reside, and (iii) most individuals in residential groups are genetically unrelated. These patterns produce large interaction networks of unrelated adults and suggest that inclusive fitness cannot explain extensive cooperation in hunter-gatherer bands. However, large social networks may help to explain why humans evolved capacities for social learning that resulted in cumulative culture.

Maxwell Fry and Jane Drew Partners : The Contributions of British Architects to Built Environment in Colonial Nigeria, 1946-1959

Directory of Open Access Journals (Sweden)

Abiodun Akeem Oladiti

2016-06-01

Full Text Available This paper examines the contributions of two British architects, Maxwell Fry and Jane Drew in the development of built environment in Nigeria after World War II. It analyses the historical development of the built environment in Nigeria’s public space with respect to modernize infrastructures such as banks, schools, teachers training colleges and the university needed in support of the colonial administration in Nigeria. The agitation of the nationalists and postwar reconstruction facilitated and encouraged the British Empire to develop the edifice or structures that would be suitable for the environment. This, to a large extent, influenced the Nigerian architecture and built environment. Their design principles yielded functional institutional spaces and a hybrid aesthetics that signifies modernist construction and colonial influence. The paper concludes that the designs of both Fry and Drew represent a milestone and significant contribution to the development of built environment in colonial Nigeria.

AllerHunter: a SVM-pairwise system for assessment of allergenicity and allergic cross-reactivity in proteins.

Directory of Open Access Journals (Sweden)

Hon Cheng Muh

Full Text Available Allergy is a major health problem in industrialized countries. The number of transgenic food crops is growing rapidly creating the need for allergenicity assessment before they are introduced into human food chain. While existing bioinformatic methods have achieved good accuracies for highly conserved sequences, the discrimination of allergens and non-allergens from allergen-like non-allergen sequences remains difficult. We describe AllerHunter, a web-based computational system for the assessment of potential allergenicity and allergic cross-reactivity in proteins. It combines an iterative pairwise sequence similarity encoding scheme with SVM as the discriminating engine. The pairwise vectorization framework allows the system to model essential features in allergens that are involved in cross-reactivity, but not limited to distinct sets of physicochemical properties. The system was rigorously trained and tested using 1,356 known allergen and 13,449 putative non-allergen sequences. Extensive testing was performed for validation of the prediction models. The system is effective for distinguishing allergens and non-allergens from allergen-like non-allergen sequences. Testing results showed that AllerHunter, with a sensitivity of 83.4% and specificity of 96.4% (accuracy = 95.3%, area under the receiver operating characteristic curve AROC = 0.928+/-0.004 and Matthew's correlation coefficient MCC = 0.738, performs significantly better than a number of existing methods using an independent dataset of 1443 protein sequences. AllerHunter is available at (http://tiger.dbs.nus.edu.sg/AllerHunter.

Energy expenditure and activity among Hadza hunter-gatherers.

Science.gov (United States)

Pontzer, Herman; Raichlen, David A; Wood, Brian M; Emery Thompson, Melissa; Racette, Susan B; Mabulla, Audax Z P; Marlowe, Frank W

2015-01-01

Studies of total energy expenditure, (TEE; kcal/day) among traditional populations have challenged current models relating habitual physical activity to daily energy requirements. Here, we examine the relationship between physical activity and TEE among traditional Hadza hunter-gatherers living in northern Tanzania. Hadza adults were studied at two camps, with minimal intervention so as to monitor energy expenditure and activity during normal daily life. We measured daily walking distance and walking speed using wearable GPS units for 41 adults. For a subset of 30 adults, we measured TEE using doubly labeled water, three indices of work load (foraging return rate, maternal status, and number of dependent children), and urinary biomarkers of metabolic activity and stress (8-hydroxydeoxyguanosine, cortisol, and testosterone). Fat-free mass was the single strongest predictor of TEE among Hadza adults (r(2)  = 0.66, P < 0.001). Hadza men used greater daily walking distances and faster walking speeds compared with that of Hadza women, but neither sex nor any measure of physical activity or work load were correlated with TEE in analyses controlling for fat-free mass. Compared with developed, industrial populations, Hadza adults had similar TEE but elevated levels of metabolic stress as measured by 8-hydroxydeoxyguanosine. Our results indicate that daily physical activity may not predict TEE within traditional hunter-gatherer populations like the Hadza. Instead, adults with high levels of habitual physical activity may adapt by reducing energy allocation to other physiological activity. © 2015 Wiley Periodicals, Inc.

Mortality, fertility, and the OY ratio in a model hunter-gatherer system.

Science.gov (United States)

White, Andrew A

2014-06-01

An agent-based model (ABM) is used to explore how the ratio of old to young adults (the OY ratio) in a sample of dead individuals is related to aspects of mortality, fertility, and longevity experienced by the living population from which the sample was drawn. The ABM features representations of rules, behaviors, and constraints that affect person- and household-level decisions about marriage, reproduction, and infant mortality in hunter-gatherer systems. The demographic characteristics of the larger model system emerge through human-level interactions playing out in the context of "global" parameters that can be adjusted to produce a range of mortality and fertility conditions. Model data show a relationship between the OY ratios of living populations (the living OY ratio) and assemblages of dead individuals drawn from those populations (the dead OY ratio) that is consistent with that from empirically known ethnographic hunter-gatherer cases. The dead OY ratio is clearly related to the mean ages, mean adult mortality rates, and mean total fertility rates experienced by living populations in the model. Sample size exerts a strong effect on the accuracy with which the calculated dead OY ratio reflects the actual dead OY ratio of the complete assemblage. These results demonstrate that the dead OY ratio is a potentially useful metric for paleodemographic analysis of changes in mortality and mean age, and suggest that, in general, hunter-gatherer populations with higher mortality, higher fertility, and lower mean ages are characterized by lower dead OY ratios. Copyright © 2014 Wiley Periodicals, Inc.

Fairy tales? Marion Jones, C.J. Hunter and the framing of doping in American newspapers

DEFF Research Database (Denmark)

Pfister, Gertrud Ursula; Gems, Gerald

2015-01-01

This article deals with the images, metaphors and narratives in the media coverage of doping in the United States. It presents a case study with a focus on Marion Jones, the most celebrated track athlete of the turn of the millennium, and her husband, C.J. Hunter, a shot put world champion...... under suspicion. At the same time, the 2000 Olympics can be considered a watershed in American anti-doping policy. The media portrayed Jones and Hunter as the Beauty and the Beast or Svengali and his victim, using a famous fairy tale and a well-known novel to capture attention, label the protagonists...

Preferences for symmetry in human faces in two cultures: data from the UK and the Hadza, an isolated group of hunter-gatherers.

Science.gov (United States)

Little, Anthony C; Apicella, Coren L; Marlowe, Frank W

2007-12-22

Many studies show agreement within and between cultures for general judgements of facial attractiveness. Few studies, however, have examined the attractiveness of specific traits and few have examined preferences in hunter-gatherers. The current study examined preferences for symmetry in both the UK and the Hadza, a hunter-gatherer society of Tanzania. We found that symmetry was more attractive than asymmetry across both the cultures and was more strongly preferred by the Hadza than in the UK. The different ecological conditions may play a role in generating this difference. Such variation in preference may be adaptive if it reflects adaptation to local conditions. Symmetry is thought to indicate genetic quality, which may be more important among the Hadza with much higher mortality rates from birth onwards. Hadza men who were more often named as good hunters placed a greater value on symmetry in female faces. These results suggest that high quality Hadza men are more discriminating in their choice of faces. Hadza women had increased preferences for symmetry in men's faces when they were pregnant or nursing, perhaps due to their increased discrimination and sensitivity to foods and disease harmful to a foetus or nursing infant. These results imply that symmetry is an evolutionarily relevant trait and that variation in symmetry preference appears strategic both between cultures and within individuals of a single culture.

Game meat consumption by hunters and their relatives: A probabilistic approach.

Science.gov (United States)

Sevillano Morales, Jesus; Moreno-Ortega, Alicia; Amaro Lopez, Manual Angel; Arenas Casas, Antonio; Cámara-Martos, Fernando; Moreno-Rojas, Rafael

2018-06-18

This study aimed to estimate the consumption of meat and products derived from hunting by the consumer population and, specifically, by hunters and their relatives. For this purpose, a survey was conducted on the frequency of consuming meat from the four most representative game species in Spain, two of big game, wild boar (Sus scrofa) and red deer (Cervus elaphus) and two of small game, rabbit (Oryctolagus cunulucus) and red partridge (Alectoris rufa), as well as of processed meat products (salami-type sausage) made from those big game species. The survey was carried out on 337 habitual consumers of these types of products (hunters and their relatives). The total mean game meat consumption, per capita in this population group, is 6.87 kg/person/year of meat and 8.57 kg/person/year if the processed meat products are also considered. Consumption of rabbit, red partridge, red deer and wild boar, individually, was 1.85, 0.82, 2.28 and 1.92 kg/person/year, respectively. It was observed that hunters generally registered a larger intake of game meat, this being statistically significant in the case of rabbit meat consumption. Using probabilistic methods, the meat consumption frequency distributions for each hunting species studied were estimated, as well as the products made from big game species and the total consumption both of meat by itself and that including the products made from it. The consumption frequency distributions were adjusted to exponential ones, verified by the test suitable for it according to Akaike Information Criterion, Bayesian Information Criterion, the Chi-Squared and Kolmogorov-Smirnov statistics. In addition, the consumption percentiles of the different distributions were obtained. The latter could be a good tool when making nutrition or contaminant studies since they permit the assessment of exposure to the compound in question.

Hunter disease eClinic: interactive, computer-assisted, problem-based approach to independent learning about a rare genetic disease

Directory of Open Access Journals (Sweden)

Moldovan Laura

2010-10-01

Full Text Available Abstract Background Computer-based teaching (CBT is a well-known educational device, but it has never been applied systematically to the teaching of a complex, rare, genetic disease, such as Hunter disease (MPS II. Aim To develop interactive teaching software functioning as a virtual clinic for the management of MPS II. Implementation and Results The Hunter disease eClinic, a self-training, user-friendly educational software program, available at the Lysosomal Storage Research Group (http://www.lysosomalstorageresearch.ca, was developed using the Adobe Flash multimedia platform. It was designed to function both to provide a realistic, interactive virtual clinic and instantaneous access to supporting literature on Hunter disease. The Hunter disease eClinic consists of an eBook and an eClinic. The eClinic is the interactive virtual clinic component of the software. Within an environment resembling a real clinic, the trainee is instructed to perform a medical history, to examine the patient, and to order appropriate investigation. The program provides clinical data derived from the management of actual patients with Hunter disease. The eBook provides instantaneous, electronic access to a vast collection of reference information to provide detailed background clinical and basic science, including relevant biochemistry, physiology, and genetics. In the eClinic, the trainee is presented with quizzes designed to provide immediate feedback on both trainee effectiveness and efficiency. User feedback on the merits of the program was collected at several seminars and formal clinical rounds at several medical centres, primarily in Canada. In addition, online usage statistics were documented for a 2-year period. Feedback was consistently positive and confirmed the practical benefit of the program. The online English-language version is accessed daily by users from all over the world; a Japanese translation of the program is also available. Conclusions The

Hunter disease eClinic: interactive, computer-assisted, problem-based approach to independent learning about a rare genetic disease.

Science.gov (United States)

Al-Jasmi, Fatma; Moldovan, Laura; Clarke, Joe T R

2010-10-25

Computer-based teaching (CBT) is a well-known educational device, but it has never been applied systematically to the teaching of a complex, rare, genetic disease, such as Hunter disease (MPS II). To develop interactive teaching software functioning as a virtual clinic for the management of MPS II. The Hunter disease eClinic, a self-training, user-friendly educational software program, available at the Lysosomal Storage Research Group (http://www.lysosomalstorageresearch.ca), was developed using the Adobe Flash multimedia platform. It was designed to function both to provide a realistic, interactive virtual clinic and instantaneous access to supporting literature on Hunter disease. The Hunter disease eClinic consists of an eBook and an eClinic. The eClinic is the interactive virtual clinic component of the software. Within an environment resembling a real clinic, the trainee is instructed to perform a medical history, to examine the patient, and to order appropriate investigation. The program provides clinical data derived from the management of actual patients with Hunter disease. The eBook provides instantaneous, electronic access to a vast collection of reference information to provide detailed background clinical and basic science, including relevant biochemistry, physiology, and genetics. In the eClinic, the trainee is presented with quizzes designed to provide immediate feedback on both trainee effectiveness and efficiency. User feedback on the merits of the program was collected at several seminars and formal clinical rounds at several medical centres, primarily in Canada. In addition, online usage statistics were documented for a 2-year period. Feedback was consistently positive and confirmed the practical benefit of the program. The online English-language version is accessed daily by users from all over the world; a Japanese translation of the program is also available. The Hunter disease eClinic employs a CBT model providing the trainee with realistic

Levels and sources of forest fire prevention knowledge of California hunters

Science.gov (United States)

William S. Folkman

1963-01-01

Males 30-50 years of age from the smaller urban centers (under 25,000 population) make up the bulk of the California hunter population. They are mainly from the skilled-semiskilled and professional-managerial occupations. Their level of knowledge about forest fire prevention is generally high, but their knowledge is weak in some pertinent areas. Most frequently...

Favorable ecological circumstances promote life expectancy in chimpanzees similar to that of human hunter-gatherers.

Science.gov (United States)

Wood, Brian M; Watts, David P; Mitani, John C; Langergraber, Kevin E

2017-04-01

Demographic data on wild chimpanzees are crucial for understanding the evolution of chimpanzee and hominin life histories, but most data come from populations affected by disease outbreaks and anthropogenic disturbance. We present survivorship data from a relatively undisturbed and exceptionally large community of eastern chimpanzees (Pan troglodytes schweinfurthii) at Ngogo, Kibale National Park, Uganda. We monitored births, deaths, immigrations, and emigrations in the community between 1995 and 2016. Using known and estimated ages, we calculated survivorship curves for the whole community, for males and females separately, and for individuals ≤2 years old when identified. We used a novel method to address age estimation error by calculating stochastic survivorship curves. We compared Ngogo life expectancy, survivorship, and mortality rates to those from other chimpanzee communities and human hunter-gatherers. Life expectancy at birth for both sexes combined was 32.8 years, far exceeding estimates of chimpanzee life expectancy in other communities, and falling within the range of human hunter-gatherers (i.e., 27-37 years). Overall, the pattern of survivorship at Ngogo was more similar to that of human hunter-gatherers than to other chimpanzee communities. Maximum lifespan for the Ngogo chimpanzees, however, was similar to that reported at other chimpanzee research sites and was less than that of human-hunter gatherers. The absence of predation by large carnivores may contribute to some of the higher survivorship at Ngogo, but this cannot explain the much higher survivorship at Ngogo than at Kanyawara, another chimpanzee community in the same forest, which also lacks large carnivores. Higher survivorship at Ngogo appears to be an adaptive response to a food supply that is more abundant and varies less than that of Kanyawara. Future analyses of hominin life history evolution should take these results into account. Copyright © 2017 Elsevier Ltd. All rights

The seed hunter in het spoor van Vavilov (interview met C. Kik)

NARCIS (Netherlands)

Zanderink, R.; Kik, C.

2013-01-01

Er moet voor een veredelaar een grote variatie aan plantmateriaal aanwezig zijn om uit te kunnen putten zodat onze gewassen, die vaak bestaan uit monoculturen, voor de toekomst veiliggesteld worden. Het vinden van die variatie is het werk van seed hunters of zadenverzamelaars. Eén van die seed

The hunter a scientific novel

CERN Document Server

Genta, Giancarlo

2013-01-01

The 24th century: humankind has become a spacefaring civilization, colonizing the solar system and beyond. While no alien forms of life have yet been encountered in this expansion into space, colonists suddenly encounter machines of alien origin - huge robots able to reproduce themselves.  Called replicators by the colonists, they seem to have but a single goal: to destroy all organic life they come in contact with. Since the colonial governments have no means to fight this menace directly, they instead promise huge rewards to whoever destroys a replicator. As a result, the frontier attracts a new kind of adventurers, the Hunters, who work to find and destroy the replicators. Mike Edwards, a skilled young maintenance technician and robotics expert at a faraway outpost, will not only become one of them - but be the very first one to unlock the secret behind the replicators’ origin and mission.   The scientific and technical aspects underlying the plot - in particular space travel, robotics and self-replica...

Shooting history and presence of high-frequency hearing impairment in swedish hunters: A cross-sectional internet-based observational study.

Science.gov (United States)

Honeth, Louise; Ström, Peter; Ploner, Alexander; Bagger-Sjöbäck, Dan; Rosenhall, Ulf; Nyrén, Olof

2015-01-01

The aim of this cross-sectional study among Swedish hunters was to examine the association between shooting history and presence of high-frequency hearing impairment (HFHI). All hunters registered with an e-mail address in the membership roster of the Swedish Hunters' Association were invited via e-mail to a secure website with a questionnaire and an Internet-based audiometry test. Associations, expressed as prevalence ratio (PR), were multivariately modelled using Poisson regression. The questionnaire was answered by 1771 hunters (age 11-91 years), and 202 of them also completed the audiometry test. Subjective severe hearing loss was reported by 195/1771 (11%), while 23/202 (11%) exhibited HFHI upon testing with Internet-based audiometry. As many as 328/1771 (19%) had never used hearing protection during hunting. In the preceding 5 years, 785/1771 (45%), had fired >6 unprotected gunshots with hunting rifle calibers. The adjusted PR of HFHI when reporting 1-6 such shots, relative to 0, was 1.5 [95% confidence interval (CI) 1.1-2.1; P = 0.02]. We could not verify any excessive HFHI prevalence among 89 hunters reporting unprotected exposure to such gunshot noise >6 times. Nor did the total number of reported rifle shots seem to matter. These findings support the notion of a wide variation in individual susceptibility to impulse noise; that significant sound energy, corresponding to unprotected noise from hunting rifle calibers, seems to be required; that susceptible individuals may sustain irreversible damage to the inner ear from just one or a few shots; and that use of hearing protection should be encouraged from the first shot with such weapons.

Slow Earthquake Hunters: A New Citizen Science Project to Identify and Catalog Slow Slip Events in Geodetic Data

Science.gov (United States)

Bartlow, N. M.

2017-12-01

Slow Earthquake Hunters is a new citizen science project to detect, catalog, and monitor slow slip events. Slow slip events, also called "slow earthquakes", occur when faults slip too slowly to generate significant seismic radiation. They typically take between a few days and over a year to occur, and are most often found on subduction zone plate interfaces. While not dangerous in and of themselves, recent evidence suggests that monitoring slow slip events is important for earthquake hazards, as slow slip events have been known to trigger damaging "regular" earthquakes. Slow slip events, because they do not radiate seismically, are detected with a variety of methods, most commonly continuous geodetic Global Positioning System (GPS) stations. There is now a wealth of GPS data in some regions that experience slow slip events, but a reliable automated method to detect them in GPS data remains elusive. This project aims to recruit human users to view GPS time series data, with some post-processing to highlight slow slip signals, and flag slow slip events for further analysis by the scientific team. Slow Earthquake Hunters will begin with data from the Cascadia subduction zone, where geodetically detectable slow slip events with a duration of at least a few days recur at regular intervals. The project will then expand to other areas with slow slip events or other transient geodetic signals, including other subduction zones, and areas with strike-slip faults. This project has not yet rolled out to the public, and is in a beta testing phase. This presentation will show results from an initial pilot group of student participants at the University of Missouri, and solicit feedback for the future of Slow Earthquake Hunters.

Settlement-Size Scaling among Prehistoric Hunter-Gatherer Settlement Systems in the New World.

Directory of Open Access Journals (Sweden)

W Randall Haas

Full Text Available Settlement size predicts extreme variation in the rates and magnitudes of many social and ecological processes in human societies. Yet, the factors that drive human settlement-size variation remain poorly understood. Size variation among economically integrated settlements tends to be heavy tailed such that the smallest settlements are extremely common and the largest settlements extremely large and rare. The upper tail of this size distribution is often formalized mathematically as a power-law function. Explanations for this scaling structure in human settlement systems tend to emphasize complex socioeconomic processes including agriculture, manufacturing, and warfare-behaviors that tend to differentially nucleate and disperse populations hierarchically among settlements. But, the degree to which heavy-tailed settlement-size variation requires such complex behaviors remains unclear. By examining the settlement patterns of eight prehistoric New World hunter-gatherer settlement systems spanning three distinct environmental contexts, this analysis explores the degree to which heavy-tailed settlement-size scaling depends on the aforementioned socioeconomic complexities. Surprisingly, the analysis finds that power-law models offer plausible and parsimonious statistical descriptions of prehistoric hunter-gatherer settlement-size variation. This finding reveals that incipient forms of hierarchical settlement structure may have preceded socioeconomic complexity in human societies and points to a need for additional research to explicate how mobile foragers came to exhibit settlement patterns that are more commonly associated with hierarchical organization. We propose that hunter-gatherer mobility with preferential attachment to previously occupied locations may account for the observed structure in site-size variation.

Guidelines for diagnosis and treatment of Hunter Syndrome for clinicians in Latin America

Directory of Open Access Journals (Sweden)

Roberto Giugliani

2014-06-01

Full Text Available This review aims to provide clinicians in Latin America with the most current information on the clinical aspects, diagnosis, and management of Hunter syndrome, a serious and progressive disease for which specific treatment is available. Hunter syndrome is a genetic disorder where iduronate-2-sulfatase (I2S, an enzyme that degrades glycosaminoglycans, is absent or deficient. Clinical manifestations vary widely in severity and involve multiple organs and tissues. An attenuated and a severe phenotype are recognized depending on the degree of cognitive impairment. Early diagnosis is vital for disease management. Clinical signs common to children with Hunter syndrome include inguinal hernia, frequent ear and respiratory infections, facial dysmorphisms, macrocephaly, bone dysplasia, short stature, sleep apnea, and behavior problems. Diagnosis is based on screening urinary glycosaminoglycans and confirmation by measuring I2S activity and analyzing I2S gene mutations. Idursulfase (recombinant I2S (Elaprase®, Shire enzyme replacement therapy (ERT, designed to address the underlying enzyme deficiency, is approved treatment and improves walking capacity and respiratory function, and reduces spleen and liver size and urinary glycosaminoglycan levels. Additional measures, responding to the multi-organ manifestations, such as abdominal/inguinal hernia repair, carpal tunnel surgery, and cardiac valve replacement, should also be considered. Investigational treatment options such as intrathecal ERT are active areas of research, and bone marrow transplantation is in clinical practice. Communication among care providers, social workers, patients and families is essential to inform and guide their decisions, establish realistic expectations, and assess patients' responses.

The Teacher's Role in Quality Classroom Interactions: Q&A with Dr. Drew Gitomer. REL Mid-Atlantic Teacher Effectiveness Webinar Series

Science.gov (United States)

Regional Educational Laboratory Mid-Atlantic, 2013

2013-01-01

In this webinar, Dr. Drew Gitomer, professor at Rutgers University, shared results from recent studies of classroom observations that helped participants understand both general findings about the qualities of classroom interactions and also the challenges to carrying out valid and reliable observations. This Q&A addressed the questions…

The Mysterious Case of the Detective as Child Hero: Sherlock Holmes, Encyclopedia Brown and Nancy Drew as Role Models?

Science.gov (United States)

Sugarman, Sally

In the mystery genre, the one characteristic that the enduring figures of Sherlock Holmes, Nancy Drew, and Encyclopedia Brown have in common is a rational mind. The source of their strength is their ability to think and think well. A study examined some typical examples of the mystery genre in young adult literature and surveyed children and…

Coccidioidomycosis in armadillo hunters from the state of Ceará, Brazil

OpenAIRE

Brillhante, Raimunda Sâmia Nogueira; Moreira Filho, Renato Evando; Rocha, Marcos Fábio Gadelha; Castelo-Branco, Débora de Souza Collares Maia; Fechine, Maria Auxiliadora Bezerra; Lima, Rita Amanda Chaves de; Picanço, Yuri Vieira Cunha; Cordeiro, Rossana de Aguiar; Camargo, Zoilo Pires de; Queiroz, José Ajax Nogueira; Araujo, Roberto Wagner Bezerra de; Mesquita, Jacó Ricarte Lima de; Sidrim, José Júlio Costa

2012-01-01

Coccidioidomycosis is a systemic mycosis with a variable clinical presentation. Misdiagnosis of coccidioidomycosis as bacterial pneumopathy leads to inappropriate prescription of antibiotics and delayed diagnosis. This report describes an outbreak among armadillo hunters in northeastern Brazil in which an initial diagnosis of bacterial pneumonia was later confirmed as coccidioidomycosis caused by Coccidioides posadasii. Thus, this mycosis should be considered as an alternative diagnosis in pa...

Predicting hunter behavior of indigenous communities in the Ecuadorian Amazon: insights from a household production model

Directory of Open Access Journals (Sweden)

Enrique de la Montaña

2015-12-01

Full Text Available Many indigenous communities living in the Amazon rely on hunting and fishing to meet the majority of their protein needs. Despite the importance of these practices, few studies from the region have analyzed the socioeconomic drivers of hunting and fishing at the household level. We propose a household production model to assess the effect of key economic parameters on hunting and fishing in small indigenous communities located in the Ecuadorian Amazon, whose principal source of protein is derived from hunting and fishing. The model was validated using empirical data from two communities that reflect different levels of market integration and forest conservation. Demand and supply functions were generated from household data gathered over 19 months. Elasticities were derived to determine the sensitivity of the decision to engage in hunting to exogenous parameters such as off-farm wages, hunting costs, bushmeat price, penalties for the illegal sale of bushmeat, and biological characteristics of the game species. After calibrating the model, we simulated changes in the key economic parameters. The parameter that most directly affected hunting activity in both communities was off-farm wages. Simulating a 10% wage increase resulted in a 16-20% reduction in harvested biomass, while a 50% increase diminished harvested biomass by > 50%. Model simulations revealed that bushmeat price and penalties for illegal trade also had important effects on hunter behavior in terms of amount of bushmeat sold, but not in terms of total harvest. As a tool for understanding hunters' economic decision-making, the model provides a basis for developing strategies that promote sustainable hunting and wildlife conservation while protecting indigenous livelihoods.

Human behavior. Sex equality can explain the unique social structure of hunter-gatherer bands.

Science.gov (United States)

Dyble, M; Salali, G D; Chaudhary, N; Page, A; Smith, D; Thompson, J; Vinicius, L; Mace, R; Migliano, A B

2015-05-15

The social organization of mobile hunter-gatherers has several derived features, including low within-camp relatedness and fluid meta-groups. Although these features have been proposed to have provided the selective context for the evolution of human hypercooperation and cumulative culture, how such a distinctive social system may have emerged remains unclear. We present an agent-based model suggesting that, even if all individuals in a community seek to live with as many kin as possible, within-camp relatedness is reduced if men and women have equal influence in selecting camp members. Our model closely approximates observed patterns of co-residence among Agta and Mbendjele BaYaka hunter-gatherers. Our results suggest that pair-bonding and increased sex egalitarianism in human evolutionary history may have had a transformative effect on human social organization. Copyright © 2015, American Association for the Advancement of Science.

HiggsHunters - a citizen science project for ATLAS

CERN Document Server

AUTHOR|(INSPIRE)INSPIRE-00053405; The ATLAS collaboration

2017-01-01

Since the launch of HiggsHunters.org in November 2014, citizen science volunteers have classified more than a million points of interest in images from the ATLAS experiment at the LHC. Volunteers have been looking for displaced vertices and unusual features in images recorded during LHC Run-1. We discuss the design of the project, its impact on the public, and the results of how the human volunteers performed relative to the computer algorithms in identifying displaced secondary vertices. People were better than existing algorithms at identifying displaced vertices for some masses and lifetimes, and showed good ability to recognize unexpected new features in the data.

Deer hunting and television: are tv shows creating expectations among deer hunters?

Science.gov (United States)

Joshua D. Agee; Craig A. Miller

2009-01-01

Throughout the past two decades new media outlets emphasizing trophy deer hunting have come to dominate hunting culture. Using data collected through a mail survey of Illinois deer hunters (n = 2,683, 78.5-percent response), we tested two hypotheses to determine factors that contribute to preference for hunting trophy deer. In particular, we examined the relationship...

Period Determination of Binary Asteroid Targets Observed at Hunters Hill Observatory: May-September 2009

Science.gov (United States)

Higgins, David; Oey, Julian; Pravec, Petr

2011-01-01

Lightcurves for seven confirmed or possible binary asteroids were obtained at the Hunters Hill Observatory (HHO) and Leura Observatory from 2009 May through 2010 September: 1453 Fennia, 2501 Lohja, 3076 Garbor, 4029 Bridges, 5325 Silver, 6244 Okamoto, and (6265) 1985 TW3.

Nutrition, modernity and the archaeological record: coastal resources and nutrition among Middle Stone Age hunter-gatherers on the Western Cape coast of South Africa.

Science.gov (United States)

Kyriacou, Katharine; Parkington, John E; Marais, Adrian D; Braun, David R

2014-12-01

In this paper, we assess the nutritional value of some marine and terrestrial food resources available to Middle Stone Age hunter-gatherers in the Western Cape of South Africa with respect to an important macronutrient (protein) and an essential micronutrient (iron) and introduce a framework for assessing the relative utility of marine and terrestrial resources. Whilst the ability to extract nutrients from the environment has always been a lynchpin in archaeologists' reconstructions of human evolution, a recent paradigm shift has recognized the role of marine resources in encephalization. Nutritional research indicates that marine ecosystems are the best source for long chain polyunsaturated fatty acids essential for proper brain development, and excavations at securely dated archaeological sites in South Africa provide firm evidence for the exploitation of marine resources by Middle Stone Age hunter-gatherers from at least Marine Isotope Stage 5 (130 ka), and possibly even earlier. Because marine molluscs are abundant, predictably located and easily harvested, they would have been readily available to all members of the community, in contrast to terrestrial resources. The improving archaeological record gives important clues to resource choice, but many more nutritional observations are needed to determine the extent to which marine resources could have met the nutrient requirements of prehistoric people. Our observations indicate that marine and terrestrial fauna are both excellent sources of protein, and that marine molluscs have higher iron concentrations than we expected for invertebrate fauna. We calculate the number of individual food items from a selection of marine and terrestrial species needed to provide the protein and iron requirements of a hypothetical group of hunter-gatherers, identify contrasts in peoples' requirements for and access to nutrients and resources, and discuss the implications for prehistoric subsistence strategies and human evolution

Inferring the demographic history of African farmers and pygmy hunter-gatherers using a multilocus resequencing data set.

Directory of Open Access Journals (Sweden)

Etienne Patin

2009-04-01

Full Text Available The transition from hunting and gathering to farming involved a major cultural innovation that has spread rapidly over most of the globe in the last ten millennia. In sub-Saharan Africa, hunter-gatherers have begun to shift toward an agriculture-based lifestyle over the last 5,000 years. Only a few populations still base their mode of subsistence on hunting and gathering. The Pygmies are considered to be the largest group of mobile hunter-gatherers of Africa. They dwell in equatorial rainforests and are characterized by their short mean stature. However, little is known about the chronology of the demographic events-size changes, population splits, and gene flow--ultimately giving rise to contemporary Pygmy (Western and Eastern groups and neighboring agricultural populations. We studied the branching history of Pygmy hunter-gatherers and agricultural populations from Africa and estimated separation times and gene flow between these populations. We resequenced 24 independent noncoding regions across the genome, corresponding to a total of approximately 33 kb per individual, in 236 samples from seven Pygmy and five agricultural populations dispersed over the African continent. We used simulation-based inference to identify the historical model best fitting our data. The model identified included the early divergence of the ancestors of Pygmy hunter-gatherers and farming populations approximately 60,000 years ago, followed by a split of the Pygmies' ancestors into the Western and Eastern Pygmy groups approximately 20,000 years ago. Our findings increase knowledge of the history of the peopling of the African continent in a region lacking archaeological data. An appreciation of the demographic and adaptive history of African populations with different modes of subsistence should improve our understanding of the influence of human lifestyles on genome diversity.

From Head-hunter to Organ-thief: Verisimilitude, Doubt and Plausible Worlds in Indonesia and Beyond

DEFF Research Database (Denmark)

Bubandt, Nils Ole

2017-01-01

their victims and using the human heads in construction rituals as they used to do, head-hunters are now allegedly harvesting the victims’ organs for sale on the international organ market. Based on a comparison of ethnographic material from North Maluku, a province in the eastern part of Indonesia, and news...... reports I trace the shift from head-hunting to organ theft and suggest that this plasticity is not merely a symbolic representation of changing political and economic realities. Rather, I argue, the organ-stealing head-hunters are part of a global travelling package that includes and entangles organ...... trafficking practices, media accounts, political imaginaries, and social anxieties within the same field of reality and possibility, a field of verisimilitude in which fiction and fact, rumour and reality, are fundamentally blurred. The article proposes a ‘more-than-representational’ approach to the organ...

Fecundity and longevity of Bactrocera carambolae Drew & Hancock (Diptera: Tephritidae

Directory of Open Access Journals (Sweden)

Cristiane Ramos Jesus-Barros

2017-12-01

Full Text Available Bactrocera carambolae Drew & Hancock is an exotic species considered a quarantine pest in Brazil, with distribution limited to the states of Amapá and Roraima. Knowledge of its biology under Brazilian conditions is still limited. The objective of this work was to determine the fecundity and longevity of B. carambolae females, reared on artificial diet, under laboratory conditions. The experiment was carried out at Embrapa Amapá, where 20 newly emerged B. carambolae couples were selected (F3 generation. Each couple was placed in a plastic cage containing feed, distilled water and an artificial oviposition device and stored in an air-conditioned room (26 ± 1°C, 60 ± 10% R. H. and 12-hour photoperiod. The eggs deposited on each device were counted daily. Mean survival was 90.70 ± 9.97 days and the maximum longevity was 150 days. The mean duration of the pre-oviposition period was 25.15 ± 3.54 days and the oviposition period was 62.73 ± 7.84 days. Fecundity was variable over time, with an oviposition peak on the 28th day. The mean number of eggs per female was 1,088.26 ± 167.82. These results suggest that B. carambolae uses high fecundity and longevity as a reproductive strategy.

Assessment of risk to aquatic biota from elevated salinity -- a case study from the Hunter River, Australia.

Science.gov (United States)

Muschal, Monika

2006-05-01

An ecological risk assessment was performed on salinity levels of the Hunter River and its tributaries to respond to concerns that high salinity may be damaging aquatic ecosystems. Probabilistic techniques were used to assess likelihood and consequence, and hence the risk to aquatic biota from salinity. Continuous electrical conductivity distributions were used to describe the likelihood that high salinity would occur (exposure dataset) and toxicity values were compiled from the limited literature sources available to describe the consequence of high salinity (effects dataset). The assessment was preliminary in the sense that it modelled risk on the basis of existing data and did not undertake site-specific toxicity testing. Some sections of the Hunter River catchment have geologies that are saline because of their marine origins. Catchment development has increased the liberation rates of salts into surface-waters. Such modifying activities include coal-mining, power generation and land clearing. The aquatic biota of tributaries had a greater risk of impairment from high salinity than that of the Hunter River. High salinities in the tributaries were attributed to the combined factors of naturally saline geologies, increased liberation of salts due to modification of the landscape, and reduced dilution by flushing flows. A salinity guideline trigger value of 1100 mg L(-1) was recommended.

Indice de Indices en la Biblioteca de Hunter College para el Estudiante Hispano.

Science.gov (United States)

Talero Bielsa, Alberto; And Others

Designed for Spanish-speaking students of Hunter College of the City University of New York, this guide explains the use of 70 English-language indexes found in the college library. The explanations are given in Spanish in order to simplify the process of library research for students who are not completely comfortable with English. Each index is…

Near-source surface seismic measurements for the NPE, NPE Calibration, Hunter`s Trophy, and Mineral Quarry

Energy Technology Data Exchange (ETDEWEB)

Reinke, R.E.; Leverette, J.A. [Field Command Defense Nuclear Agency, Kirtland AFB, NM (United States); Stump, B.W. [Los Alamos National Laboratory, NM (United States)] [and others

1994-12-31

An extensive seismic network was deployed on the surface of Rainier Mesa for both the Non-Proliferation Experiment (NPE) Calibration shot as well as the full scale NPE event. This network was very similar to previous deployments for the nuclear events MISTY ECHO, MINERAL QUARRY, and HUNTERS TROPHY. For the full scale NPE event three-component accelerometers and seismometers were fielded at 32 sites across the mesa. A slightly smaller network with 28 stations was in operation for the 300 pound NPE calibration event. The mesa top array included both accelerometers and seismometers. The accelerometers were used to obtain data from the main NPE event while the seismometers with their higher sensitivity were used to record the 300 pound cal shot and several hundred after events from the NPE. Large spatial variations in ground motion are evident in both the full mesa data set as well as a small (80 m on a side) aperture, 9-element triangular array. This paper summarizes the data and discusses wave propagation effects. A companion paper presents a comparative source analysis.

Do individual differences in use of cover habitat affect red deer`s (Cervus elaphus) probability of being shot by hunters?

OpenAIRE

Stamnes, Inga

2014-01-01

The purpose of this study was to test if red deer (Cervus elaphus) habitat use affects their risk of being shot by hunters. I compared habitat use of 20 GPS-marked red deer that survived the hunting season with 20 individuals that were shot. I predicted that shot red deer used open areas within forested habitats with a better visibility for hunters than surviving red deer. I also predicted that the use of less risky habitat is costly in terms of foraging opportunity, with shot animals using b...

Evidence for early hunters beneath the Great Lakes.

Science.gov (United States)

O'Shea, John M; Meadows, Guy A

2009-06-23

Scholars have hypothesized that the poorly understood and rarely encountered archaeological sites from the terminal Paleoindian and Archaic periods associated with the Lake Stanley low water stage (10,000-7,500 BP) are lost beneath the modern Great Lakes. Acoustic and video survey on the Alpena-Amberley ridge, a feature that would have been a dry land corridor crossing the Lake Huron basin during this time period, reveals the presence of a series of stone features that match, in form and location, structures used for caribou hunting in both prehistoric and ethnographic times. These results present evidence for early hunters on the Alpena-Amberley corridor, and raise the possibility that intact settlements and ancient landscapes are preserved beneath Lake Huron.

Origin and diet of the prehistoric hunter-gatherers on the mediterranean island of Favignana (Ègadi Islands, Sicily.

Directory of Open Access Journals (Sweden)

Marcello A Mannino

Full Text Available Hunter-gatherers living in Europe during the transition from the late Pleistocene to the Holocene intensified food acquisition by broadening the range of resources exploited to include marine taxa. However, little is known on the nature of this dietary change in the Mediterranean Basin. A key area to investigate this issue is the archipelago of the Ègadi Islands, most of which were connected to Sicily until the early Holocene. The site of Grotta d'Oriente, on the present-day island of Favignana, was occupied by hunter-gatherers when Postglacial environmental changes were taking place (14,000-7,500 cal BP. Here we present the results of AMS radiocarbon dating, palaeogenetic and isotopic analyses undertaken on skeletal remains of the humans buried at Grotta d'Oriente. Analyses of the mitochondrial hypervariable first region of individual Oriente B, which belongs to the HV-1 haplogroup, suggest for the first time on genetic grounds that humans living in Sicily during the early Holocene could have originated from groups that migrated from the Italian Peninsula around the Last Glacial Maximum. Carbon and nitrogen isotope analyses show that the Upper Palaeolithic and Mesolithic hunter-gatherers of Favignana consumed almost exclusively protein from terrestrial game and that there was only a slight increase in marine food consumption from the late Pleistocene to the early Holocene. This dietary change was similar in scale to that at sites on mainland Sicily and in the rest of the Mediterranean, suggesting that the hunter-gatherers of Grotta d'Oriente did not modify their subsistence strategies specifically to adapt to the progressive isolation of Favignana. The limited development of technologies for intensively exploiting marine resources was probably a consequence both of Mediterranean oligotrophy and of the small effective population size of these increasingly isolated human groups, which made innovation less likely and prevented transmission of

Origin and Diet of the Prehistoric Hunter-Gatherers on the Mediterranean Island of Favignana (Ègadi Islands, Sicily)

Science.gov (United States)

Mannino, Marcello A.; Catalano, Giulio; Talamo, Sahra; Mannino, Giovanni; Di Salvo, Rosaria; Schimmenti, Vittoria; Lalueza-Fox, Carles; Messina, Andrea; Petruso, Daria; Caramelli, David; Richards, Michael P.; Sineo, Luca

2012-01-01

Hunter-gatherers living in Europe during the transition from the late Pleistocene to the Holocene intensified food acquisition by broadening the range of resources exploited to include marine taxa. However, little is known on the nature of this dietary change in the Mediterranean Basin. A key area to investigate this issue is the archipelago of the Ègadi Islands, most of which were connected to Sicily until the early Holocene. The site of Grotta d’Oriente, on the present-day island of Favignana, was occupied by hunter-gatherers when Postglacial environmental changes were taking place (14,000-7,500 cal BP). Here we present the results of AMS radiocarbon dating, palaeogenetic and isotopic analyses undertaken on skeletal remains of the humans buried at Grotta d’Oriente. Analyses of the mitochondrial hypervariable first region of individual Oriente B, which belongs to the HV-1 haplogroup, suggest for the first time on genetic grounds that humans living in Sicily during the early Holocene could have originated from groups that migrated from the Italian Peninsula around the Last Glacial Maximum. Carbon and nitrogen isotope analyses show that the Upper Palaeolithic and Mesolithic hunter-gatherers of Favignana consumed almost exclusively protein from terrestrial game and that there was only a slight increase in marine food consumption from the late Pleistocene to the early Holocene. This dietary change was similar in scale to that at sites on mainland Sicily and in the rest of the Mediterranean, suggesting that the hunter-gatherers of Grotta d’Oriente did not modify their subsistence strategies specifically to adapt to the progressive isolation of Favignana. The limited development of technologies for intensively exploiting marine resources was probably a consequence both of Mediterranean oligotrophy and of the small effective population size of these increasingly isolated human groups, which made innovation less likely and prevented transmission of fitness

76 FR 46149 - Financial Assistance: Wildlife Restoration, Sport Fish Restoration, Hunter Education and Safety

Science.gov (United States)

2011-08-01

... these regulations on June 10, 2010, to address changes in law, regulation, policy, technology, and... Service 50 CFR Part 80 Financial Assistance: Wildlife Restoration, Sport Fish Restoration, Hunter... 80 [Docket No. FWS-R9-WSR-2009-0088; 91400-5110-POLI-7B; 91400-9410-POLI- 7B] RIN 1018-AW65 Financial...

Gut microbiome of the Hadza hunter-gatherers.

Science.gov (United States)

Schnorr, Stephanie L; Candela, Marco; Rampelli, Simone; Centanni, Manuela; Consolandi, Clarissa; Basaglia, Giulia; Turroni, Silvia; Biagi, Elena; Peano, Clelia; Severgnini, Marco; Fiori, Jessica; Gotti, Roberto; De Bellis, Gianluca; Luiselli, Donata; Brigidi, Patrizia; Mabulla, Audax; Marlowe, Frank; Henry, Amanda G; Crittenden, Alyssa N

2014-04-15

Human gut microbiota directly influences health and provides an extra means of adaptive potential to different lifestyles. To explore variation in gut microbiota and to understand how these bacteria may have co-evolved with humans, here we investigate the phylogenetic diversity and metabolite production of the gut microbiota from a community of human hunter-gatherers, the Hadza of Tanzania. We show that the Hadza have higher levels of microbial richness and biodiversity than Italian urban controls. Further comparisons with two rural farming African groups illustrate other features unique to Hadza that can be linked to a foraging lifestyle. These include absence of Bifidobacterium and differences in microbial composition between the sexes that probably reflect sexual division of labour. Furthermore, enrichment in Prevotella, Treponema and unclassified Bacteroidetes, as well as a peculiar arrangement of Clostridiales taxa, may enhance the Hadza's ability to digest and extract valuable nutrition from fibrous plant foods.

The Piniariarneq Project: Inughuit hunters map their important hunting areas

DEFF Research Database (Denmark)

Johansen, Kasper Lambert; Flora, Janne; Oberborbeck Andersen, Astrid

industrialisation of the High Arctic in the near future. Mapping of important resource areas of local, human communities have also been conducted on numerous occasions, but has generally received much less attention, and often results from such efforts are difficult to integrate with biological data. Here, we...

Sex differences in Nintendo Wii performance as expected from hunter-gatherer selection.

Science.gov (United States)

Cherney, Isabelle D; Poss, Jordan L

2008-06-01

To test the hunter-gatherer theory of cognitive sex differences, men and women each played four video games on a Wii console: two games simulating skills necessary for hunting (navigation and shooting) and two games simulating skills necessary for gathering (fine motor and visual search). Men outperformed women on the two hunting games, whereas there were no sex differences on the gathering skill games. The findings are discussed in terms of evolutionary psychology theory.

High frequency of lactose intolerance in a prehistoric hunter-gatherer population in northern Europe

Directory of Open Access Journals (Sweden)

Holmlund Gunilla

2010-03-01

Full Text Available Abstract Background Genes and culture are believed to interact, but it has been difficult to find direct evidence for the process. One candidate example that has been put forward is lactase persistence in adulthood, i.e. the ability to continue digesting the milk sugar lactose after childhood, facilitating the consumption of raw milk. This genetic trait is believed to have evolved within a short time period and to be related with the emergence of sedentary agriculture. Results Here we investigate the frequency of an allele (-13910*T associated with lactase persistence in a Neolithic Scandinavian population. From the 14 individuals originally examined, 10 yielded reliable results. We find that the T allele frequency was very low (5% in this Middle Neolithic hunter-gatherer population, and that the frequency is dramatically different from the extant Swedish population (74%. Conclusions We conclude that this difference in frequency could not have arisen by genetic drift and is either due to selection or, more likely, replacement of hunter-gatherer populations by sedentary agriculturalists.

Seasonal and Long-term Variations in 137Cs Among Adults from Swedish Hunter Families

International Nuclear Information System (INIS)

Agren, G.

2001-01-01

To study seasonal variations in 137 Cs, whole-body content measurements of adults from Swedish hunter families have been performed in autumn 1997 and spring 1998. Measurements were performed in three locations, By, Harbo and Gavle, geographically close (within 100 km of each other) but with large differences in ground deposition levels. The hunter families at these three locations were previously measured in 1994. The measured persons were also asked for their frequency of intake of moose, roe-deer, freshwater fish, mushrooms and berries. A statistically significant lower frequency of intake of mushrooms and berries in By, moose, roe-deer and mushrooms in Harbo, and moose in Gavle was found in springtime compared to autumn. In one of the locations, there was a statistically significant lower average 137 Cs whole-body content in spring 1998 than in autumn 1997 while in the other two locations no such effects could be seen. The 137 Cs whole-body content has decreased by 37% from 1994 and to 1998 (including physical decay) correlated to an effective ecological half time of 6 years. (author)

Teaching Experientially with the Madeline Hunter Method: An Application in a Marketing Research Course

Science.gov (United States)

Burns, Alvin C.

2006-01-01

Due to concerns about the disparity of learning and the high nonresponse rates encountered by student marketing research teams working with sponsors, the author adopted the Hunter Method to restructure his course. This method requires the use of a model onto which students can map their learning via guided practice as well as independent practice.…

Estimation of the tourism climate in the Hunter Region, Australia, in the early twenty-first century

Science.gov (United States)

Shiue, Ivy; Matzarakis, Andreas

2011-07-01

Existing tourism-related climate information and evaluation are typically based on mean monthly conditions of air temperature and precipitation and do not include thermal perception and other climate parameters relevant for tourists. Here, we quantify climate based on the climate facets relevant to tourism (thermal, physical, aesthetical), and apply the results to the Climate-Tourism-Information-Scheme (CTIS). This paper presents bioclimatic and tourism climatological conditions in the Hunter Region—one of Australia's most popular tourist destinations. In the Hunter Region, generally, temperatures below 15°C occur from April through October, temperatures less than 25°C are expected throughout the whole year, while humidity sits around 50%. As expected, large differences between air temperature and physiologically equivalent temperature (PET) were clearly identified. The widest differences were seen in summer time rather than in the winter period. In addition, cold stress was observed less than 10% of the time in winter while around 40-60% of heat stress was observed in summer time. This correlates with the highest numbers of international visitors, who usually seek a warmer weather, at the beginning of summer time (November and December) and also to the number of domestic visitors, who tend to seek cooler places for recreation and leisure, in late summer (January-March). It was concluded that thermal bioclimate assessment such as PET and CTIS can be applied in the Hunter region, and that local governments and the tourism industry should take an integrated approach to providing more relevant weather and climate information for both domestic and international tourists in the near future.

Food Sharing among Hadza Hunter-Gatherer Children.

Directory of Open Access Journals (Sweden)

Alyssa N Crittenden

Full Text Available Human prosociality is one of the defining characteristics of our species, yet the ontogeny of altruistic behavior remains poorly understood. The evolution of widespread food sharing in humans helped shape cooperation, family formation, life history, language, and the development of economies of scale. While the behavioral and ecological correlates of food sharing among adults are widely studied, very little is known about food sharing among children. Here, in the first study to analyze the food sharing patterns of hunter-gatherer children, we show that while sharing may be biased towards kin, reciprocity characterizes the majority of all sharing dyads, both related and unrelated. These data lend support to the recent claim that discrimination among kin might be linked with reciprocal altruism theory. Furthermore, we show that age positively correlates with an increase in sharing, both in frequency and amount, supporting recent suggestions that prosocial behaviors and egalitarianism develop strongly in middle childhood when children acquire the normative rules of their society.

Food Sharing among Hadza Hunter-Gatherer Children.

Science.gov (United States)

Crittenden, Alyssa N; Zes, David A

2015-01-01

Human prosociality is one of the defining characteristics of our species, yet the ontogeny of altruistic behavior remains poorly understood. The evolution of widespread food sharing in humans helped shape cooperation, family formation, life history, language, and the development of economies of scale. While the behavioral and ecological correlates of food sharing among adults are widely studied, very little is known about food sharing among children. Here, in the first study to analyze the food sharing patterns of hunter-gatherer children, we show that while sharing may be biased towards kin, reciprocity characterizes the majority of all sharing dyads, both related and unrelated. These data lend support to the recent claim that discrimination among kin might be linked with reciprocal altruism theory. Furthermore, we show that age positively correlates with an increase in sharing, both in frequency and amount, supporting recent suggestions that prosocial behaviors and egalitarianism develop strongly in middle childhood when children acquire the normative rules of their society.

Coccidioidomycosis in armadillo hunters from the state of Ceará, Brazil.

Science.gov (United States)

Brillhante, Raimunda Sâmia Nogueira; Moreira Filho, Renato Evando; Rocha, Marcos Fábio Gadelha; Castelo-Branco, Débora de Souza Collares Maia; Fechine, Maria Auxiliadora Bezerra; Lima, Rita Amanda Chaves de; Picanço, Yuri Vieira Cunha; Cordeiro, Rossana de Aguiar; Camargo, Zoilo Pires de; Queiroz, José Ajax Nogueira; Araujo, Roberto Wagner Bezerra de; Mesquita, Jacó Ricarte Lima de; Sidrim, José Júlio Costa

2012-09-01

Coccidioidomycosis is a systemic mycosis with a variable clinical presentation. Misdiagnosis of coccidioidomycosis as bacterial pneumopathy leads to inappropriate prescription of antibiotics and delayed diagnosis. This report describes an outbreak among armadillo hunters in northeastern Brazil in which an initial diagnosis of bacterial pneumonia was later confirmed as coccidioidomycosis caused by Coccidioides posadasii. Thus, this mycosis should be considered as an alternative diagnosis in patients reporting symptoms of pneumonia, even if these symptoms are only presented for a short period, who are from areas considered endemic for this disease.

Coccidioidomycosis in armadillo hunters from the state of Ceará, Brazil

Directory of Open Access Journals (Sweden)

Raimunda Sâmia Nogueira Brillhante

2012-09-01

Full Text Available Coccidioidomycosis is a systemic mycosis with a variable clinical presentation. Misdiagnosis of coccidioidomycosis as bacterial pneumopathy leads to inappropriate prescription of antibiotics and delayed diagnosis. This report describes an outbreak among armadillo hunters in northeastern Brazil in which an initial diagnosis of bacterial pneumonia was later confirmed as coccidioidomycosis caused by Coccidioides posadasii. Thus, this mycosis should be considered as an alternative diagnosis in patients reporting symptoms of pneumonia, even if these symptoms are only presented for a short period, who are from areas considered endemic for this disease.

Beyond the drip-line: a high-resolution open-air Holocene hunter-gatherer sequence from highland Lesotho

CSIR Research Space (South Africa)

Mitchell, P

2011-03-01

Full Text Available the drip-line: a high-resolution open-air Holocene hunter-gatherer sequence from highland Lesotho Peter Mitchell1, Ina Plug2, Geoff Bailey3, Ruth Charles4, Amanda Esterhuysen5, Julia Lee Thorp6, Adrian Parker7 & Stephan Woodborne8 The activities...

Surface evolution and carbon sequestration in disturbed and undisturbed wetland soils of the Hunter estuary, southeast Australia

Science.gov (United States)

Howe, A. J.; Rodríguez, J. F.; Saco, P. M.

2009-08-01

The aim of this work was to quantify the soil carbon storage and sequestration rates of undisturbed natural wetlands and disturbed wetlands subject to restriction of tidal flow and subsequent rehabilitation in an Australian estuary. Disturbed and undisturbed estuarine wetlands of the Hunter estuary, New South Wales, Australia were selected as the study sites for this research. Vertical accretion rates of estuarine substrates were combined with soil carbon concentrations and bulk densities to determine the carbon store and carbon sequestration rates of the substrates tested. Relationships between estuary water level, soil evolution and vertical accretion were also examined. The carbon sequestration rate of undisturbed wetlands was lower (15% for mangrove and 55% for saltmarsh) than disturbed wetlands, but the carbon store was higher (65% for mangrove and 60% for saltmarsh). The increased carbon sequestration rate of the disturbed wetlands was driven by substantially higher rates of vertical accretion (95% for mangrove and 345% for saltmarsh). Estuarine wetland carbon stores were estimated at 700-1000 Gg C for the Hunter estuary and 3900-5600 Gg C for New South Wales. Vertical accretion and carbon sequestration rates of estuarine wetlands in the Hunter are at the lower end of the range reported in the literature. The comparatively high carbon sequestration rates reported for the disturbed wetlands in this study indicate that wetland rehabilitation has positive benefits for regulation of atmospheric carbon concentrations, in addition to more broadly accepted ecosystem services.

An improved assay for iduronate 2-sulphate sulphatase in serum and its use in the detection of carriers of the Hunter syndrome

International Nuclear Information System (INIS)

Archer, I.M.; Harper, P.S.; Wusteman, F.S.

1981-01-01

A more sensitive assay procedure has been developed for the enzyme iduronate 2-sulphate sulphatase which is deficient in the Hunter syndrome. The substrate is O-(α-L-idopyranosyluronic acid 2-sulphate)-(1 → 4)-2,5 anhydro-D-[ 3 H-1)mannitol 6-sulphate, which, after incubation, is separated from the product by ion-exchange chromatography on a micro-columnn of Dowex 1 X 2 (Cl - ). Serum analyses can be used to supplement those on hair roots in the detection of carriers of the Hunter syndrome. (Auth.)

The coexistence of Baird's tapir (Tapirus bairdii) and indigenous hunters in northeastern Honduras.

Science.gov (United States)

Dunn, Marc; Estrada, Nereyda; Smith, Derek A

2012-12-01

The Baird's tapir (Tapirus bairdii) is a popular game species throughout Central America, particularly among indigenous populations, and is currently endangered. Research on Miskitu hunting was conducted over 4 months in a remote region in northeastern Honduras that overlaps with the Río Plátano Biosphere Reserve. The hunting zone was mapped together with hunters and interviews were conducted with elders and other community members about tapir hunting. Results show that tapir harvesting is targeted toward specific habitats at specific times of year. Harvest rates for one year suggest that tapir hunting in the area exceeds estimates of maximum sustainable production. Nevertheless, field surveys reveal the presence of tapir within 1 km of the community, and its harvest tends to be nearby, in both forested and agricultural landscapes, suggesting that the animal has not been depleted in the area. It appears that the existence of forest areas adjacent to the hunting zone that do not experience hunting, together with the anthropogenic habitats created through shifting cultivation, are factors that help explain the presence of tapirs in the area. The article concludes with a discussion regarding the potential positive role of indigenous hunters in tapir conservation throughout its distribution range. © 2012 Wiley Publishing Asia Pty Ltd, ISZS and IOZ/CAS.

Ancient DNA reveals lack of continuity between neolithic hunter-gatherers and contemporary Scandinavians

DEFF Research Database (Denmark)

Malmström, Helena; Gilbert, M Thomas P; Thomas, Mark G

2009-01-01

of the two cultures in Scandinavia has been cited as an argument against population replacement between the Mesolithic and the present [7, 8]. Through analysis of DNA extracted from ancient Scandinavian human remains, we show that people of the Pitted Ware culture were not the direct ancestors of modern......]. Furthermore, our data are consistent with the view that the eastern Baltic represents a genetic refugia for some of the European hunter-gatherer populations....

Big game hunting practices, meanings, motivations and constraints: a survey of Oregon big game hunters

Science.gov (United States)

Suresh K. Shrestha; Robert C. Burns

2012-01-01

We conducted a self-administered mail survey in September 2009 with randomly selected Oregon hunters who had purchased big game hunting licenses/tags for the 2008 hunting season. Survey questions explored hunting practices, the meanings of and motivations for big game hunting, the constraints to big game hunting participation, and the effects of age, years of hunting...

Using obsidian transfer distances to explore social network maintenance in late Pleistocene hunter-gatherers.

Science.gov (United States)

Pearce, Eiluned; Moutsiou, Theodora

2014-12-01

Social behaviour is notoriously difficult to study archaeologically and it is unclear how large the networks of prehistoric humans were, or how they remained connected. Maintaining social cohesion was crucial for early humans because social networks facilitate cooperation and are imperative for survival and reproduction. Recent hunter-gatherer social organisation typically comprises a number of nested layers, ranging from the nuclear family through to the ~1500-strong ethnolinguistic tribe. Here we compare maximum obsidian transfer distances from the late Pleistocene with ethnographic data on the size of the geographic areas associated with each of these social grouping layers in recent hunter-gatherers. The closest match between the two is taken to indicate the maximum social layer within which contact could be sustained by Pleistocene hominins. Within both the (sub)tropical African and Subarctic biomes, the maximum obsidian transfer distances for Pleistocene modern humans (~200km and ~400km respectively) correspond to the geographic ranges of the outermost tribal layer in recent hunter-gatherers. This suggests that modern humans could potentially sustain the cohesion of their entire tribe at all latitudes, even though networks are more dispersed nearer the poles. Neanderthal obsidian transfer distances (300km) indicate that although Neanderthal home ranges are larger than those of low latitude hominins, Neanderthals travelled shorter distances than modern humans living at the same high latitudes. We argue that, like modern humans, Neanderthals could have maintained tribal cohesion, but that their tribes were substantially smaller than those of contemporary modern humans living in similar environments. The greater time taken to traverse the larger modern human tribal ranges may have limited the frequency of their face-to-face interactions and thus necessitated additional mechanisms to ensure network connectivity, such as the exchange of symbolic artefacts

MRI findings in the mild type of mucopolysaccharidosis II (Hunter's syndrome)

International Nuclear Information System (INIS)

Shimoda-Matsubayashi, S.; Ito, T.; Hattori, N.; Okuma, Y.; Mizuno, Y.; Kuru, Y.; Sumie, H.

1990-01-01

Neuroradiological findings in a 44-year-old male with the typical mild type of Hunter's disease are reported. Cranial MRI revealed patchy areas of increased and decreased signals in T1- and T2-weighted images in the thalamus and the basal ganglia giving rise to a honey comb-like appearance as a whole. The deep white matter showed high signals in the T2-weighted image. To our knowledge, the honey comb-like appearance has never been reported in this disorder. Deposition of mucopolysaccharides and/or glycolipids and increase in fluid content seem to be responsible for these changes. (orig.)

Establishment of native and exotic grasses on mine overburden and topsoil in the Hunter Valley, New South Wales

Energy Technology Data Exchange (ETDEWEB)

Huxtable, C.H.A.; Koen, T.B.; Waterhouse, D. [DNR, Dangar, NSW (Australia)

2005-07-01

Current recommendations for rehabilitation of open-cut coal mines in the Hunter Valley involve the sowing of exotic pasture species to reinstate mined land to Class IV and V under the Rural Land Capability System. Despite the importance of native grasses in the pre-mined landscape, they are currently not widely included in mine rehabilitation. To address this issue a project was conducted between 1994 and 2000 to research the use of native grasses for rehabilitation of open-cut coal mines in the Hunter Valley. This paper reports on 2 mine site experiments that aimed to assess establishment and persistence of a broad range of native and exotic grass species from an autumn sowing in both topsoil and raw spoil over a period of 61 months. The most promising natives in terms of early establishment, persistence and spread over time, included six C-3 accessions (five Austrodanthonia spp. and Austrostipa bigeniculata) and one C-4 accession (Cynodon dactylon). Persistence of these accessions was better in raw spoil than topsoil, despite initial low numbers, due to a lack of weed competition and their ability to spread by self-seeding. In topsoil, and in the absence of any biomass reduction, native species were mostly out-competed by vigorous exotic perennial grasses which were sown in these experiments and from seed influx from adjacent rehabilitation areas or from the soil seed bank. The effects of climatic conditions and differences in soil physical, chemical and seed bank characteristics at the 2 mine sites are also discussed.

How Do Hunter-Gatherer Children Learn Subsistence Skills? : A Meta-Ethnographic Review.

Science.gov (United States)

Lew-Levy, Sheina; Reckin, Rachel; Lavi, Noa; Cristóbal-Azkarate, Jurgi; Ellis-Davies, Kate

2017-12-01

Hunting and gathering is, evolutionarily, the defining subsistence strategy of our species. Studying how children learn foraging skills can, therefore, provide us with key data to test theories about the evolution of human life history, cognition, and social behavior. Modern foragers, with their vast cultural and environmental diversity, have mostly been studied individually. However, cross-cultural studies allow us to extrapolate forager-wide trends in how, when, and from whom hunter-gatherer children learn their subsistence skills. We perform a meta-ethnography, which allows us to systematically extract, summarize, and compare both quantitative and qualitative literature. We found 58 publications focusing on learning subsistence skills. Learning begins early in infancy, when parents take children on foraging expeditions and give them toy versions of tools. In early and middle childhood, children transition into the multi-age playgroup, where they learn skills through play, observation, and participation. By the end of middle childhood, most children are proficient food collectors. However, it is not until adolescence that adults (not necessarily parents) begin directly teaching children complex skills such as hunting and complex tool manufacture. Adolescents seek to learn innovations from adults, but they themselves do not innovate. These findings support predictive models that find social learning should occur before individual learning. Furthermore, these results show that teaching does indeed exist in hunter-gatherer societies. And, finally, though children are competent foragers by late childhood, learning to extract more complex resources, such as hunting large game, takes a lifetime.

Hepatitis E virus antibody prevalence in hunters from a district in Central Germany, 2013: a cross-sectional study providing evidence for the benefit of protective gloves during disembowelling of wild boars.

Science.gov (United States)

Schielke, A; Ibrahim, V; Czogiel, I; Faber, M; Schrader, C; Dremsek, P; Ulrich, R G; Johne, R

2015-10-22

In Germany, 17% of the general human population have antibodies to hepatitis E virus (HEV) (recomLine HEV-IgG/IgM immunoassay [Mikrogen GmbH]). Wild boars represent an animal reservoir for HEV genotype 3, which is the common genotype in Germany. We estimated the seroprevalence among hunters with contact to wild boars to identify factors that may be associated with past or present HEV infection. In 2013, the local veterinarian authority in a district in Central Germany attended meetings of hunters who provided blood specimens and completed a questionnaire collecting information on age, sex, hunting-related activities and consumption of wild boar meat. Specimens of wild boars were taken during drive hunts in this district during the season 2012/2013. All specimens were tested for HEV RNA and anti-HEV IgM and IgG antibodies. Log-binomial regression was used to estimate prevalence ratios (PR) for the hunters. Of 126 hunters (median age 55; 94% male) 21% tested positive for anti-HEV IgG antibodies (95% confidence interval [CI] 13-28%) (recomWell HEV IgG assay [Mikrogen GmbH]). Anti-HEV prevalence was highest in the age group of the 70-79-year-olds (67%; 95% CI 39-95%). Wild boars showed an average anti-HEV prevalence of 41%. HEV RNA was detected in 4/22 (18%) liver specimens and in 1/22 (4.5%) muscle specimens. Most wild boars were tested positive for HEV RNA (3/10; 30%) and HEV-specific antibodies (7/15; 47%) in the southwestern part of the district. Hunters preferring this hunting ground had a lower anti-HEV prevalence when gloves were frequently used during disembowelling of wild boars compared to hunters using gloves never or infrequently (age-adjusted PR 0.12; 95% CI 0.02-0.86). Hunters may benefit from wearing gloves when in contact with blood or body fluids of HEV animal reservoirs. Anti-HEV prevalence among the hunters of this study did not significantly differ from that of the general population suggesting that other factors play a major role in the

Evidence of Levy walk foraging patterns in human hunter-gatherers.

Science.gov (United States)

Raichlen, David A; Wood, Brian M; Gordon, Adam D; Mabulla, Audax Z P; Marlowe, Frank W; Pontzer, Herman

2014-01-14

When searching for food, many organisms adopt a superdiffusive, scale-free movement pattern called a Lévy walk, which is considered optimal when foraging for heterogeneously located resources with little prior knowledge of distribution patterns [Viswanathan GM, da Luz MGE, Raposo EP, Stanley HE (2011) The Physics of Foraging: An Introduction to Random Searches and Biological Encounters]. Although memory of food locations and higher cognition may limit the benefits of random walk strategies, no studies to date have fully explored search patterns in human foraging. Here, we show that human hunter-gatherers, the Hadza of northern Tanzania, perform Lévy walks in nearly one-half of all foraging bouts. Lévy walks occur when searching for a wide variety of foods from animal prey to underground tubers, suggesting that, even in the most cognitively complex forager on Earth, such patterns are essential to understanding elementary foraging mechanisms. This movement pattern may be fundamental to how humans experience and interact with the world across a wide range of ecological contexts, and it may be adaptive to food distribution patterns on the landscape, which previous studies suggested for organisms with more limited cognition. Additionally, Lévy walks may have become common early in our genus when hunting and gathering arose as a major foraging strategy, playing an important role in the evolution of human mobility.

The Catalyst Scholarship Program at Hunter College. A Partnership among Earth Science, Physics, Computer Science and Mathematics

Science.gov (United States)

Salmun, Haydee; Buonaiuto, Frank

2016-01-01

The Catalyst Scholarship Program at Hunter College of The City University of New York (CUNY) was established with a four-year award from the National Science Foundation (NSF) to fund scholarships to 40 academically talented but financially disadvantaged students majoring in four disciplines of science, technology, engineering and mathematics…

Process-based coastal erosion modeling for Drew Point (North Slope, Alaska)

Science.gov (United States)

Ravens, Thomas M.; Jones, Benjamin M.; Zhang, Jinlin; Arp, Christopher D.; Schmutz, Joel A.

2012-01-01

A predictive, coastal erosion/shoreline change model has been developed for a small coastal segment near Drew Point, Beaufort Sea, Alaska. This coastal setting has experienced a dramatic increase in erosion since the early 2000’s. The bluffs at this site are 3-4 m tall and consist of ice-wedge bounded blocks of fine-grained sediments cemented by ice-rich permafrost and capped with a thin organic layer. The bluffs are typically fronted by a narrow (∼ 5  m wide) beach or none at all. During a storm surge, the sea contacts the base of the bluff and a niche is formed through thermal and mechanical erosion. The niche grows both vertically and laterally and eventually undermines the bluff, leading to block failure or collapse. The fallen block is then eroded both thermally and mechanically by waves and currents, which must occur before a new niche forming episode may begin. The erosion model explicitly accounts for and integrates a number of these processes including: (1) storm surge generation resulting from wind and atmospheric forcing, (2) erosional niche growth resulting from wave-induced turbulent heat transfer and sediment transport (using the Kobayashi niche erosion model), and (3) thermal and mechanical erosion of the fallen block. The model was calibrated with historic shoreline change data for one time period (1979-2002), and validated with a later time period (2002-2007).

Hunter-gatherer adaptations and environmental change in the southern Great Basin: The evidence from Pahute and Rainier mesas

Energy Technology Data Exchange (ETDEWEB)

Pippin, L.C.

1998-06-01

This paper reviews the evidence for fluctuations in past environments in the southern Great Basin and examines how these changes may have affected the strategies followed by past hunter and gatherers in their utilization of the resources available on a highland in this region. The evidence used to reconstruct past environments for the region include botanical remains from packrat middens, pollen spectra from lake and spring deposits, faunal remains recovered from archaeological and geologic contexts, tree-ring indices from trees located in sensitive (tree-line) environments, and eolian, alluvial and fluvial sediments deposited in a variety of contexts. Interpretations of past hunter and gatherer adaptive strategies are based on a sample of 1,311 archaeological sites recorded during preconstruction surveys on Pahute and Rainier mesas in advance of the US Department of Energy`s nuclear weapons testing program. Projectile point chronologies and available tree-ring, radiocarbon, thermoluminescence and obsidian hydration dates were used to assign these archaeological sites to specific periods of use.

Vessel guardians: sculpture and graphics related to the ceramics of NorthEastern European hunter-gatherers

Directory of Open Access Journals (Sweden)

Ekaterina Aleksandrovna Kashina

2015-12-01

Full Text Available North-Eastern European hunter-gatherer ceramic sculptures, relief sculptures and graphic images on vessels are discussed. Five groups of finds are distinguished according to their chronology (4000–2500 BC cal and represented subject (birds, human head, human figure, mammal head etc.. Their production believes to be a female craft, their making had ritual aims and their emerging was independent from any influences of pastoral/agricultural societies.

Molecular characterization of Histoplasma capsulatum isolated from an outbreak in treasure hunters Histoplasma capsulatum in treasure hunters

Directory of Open Access Journals (Sweden)

Muñoz Bertha

2010-09-01

Full Text Available Abstract Background In Mexico, primary pulmonary histoplasmosis is the most relevant clinical form of the disease. The geographical distribution of specific strains of Histoplasma capsulatum circulating in Mexico has not been fully established. Outbreaks must be reported in order to have current, updated information on this disease, identifying new endemic areas, manner of exposure to the fungi, and molecular characterization of the causative agents. We report a recent outbreak of histoplasmosis in treasure hunters and the molecular characterization of two isolates obtained from these patients. Methods Six patients admitted to the National Institute of Respiratory Diseases (INER in Mexico City presented severe respiratory symptoms suggestive of histoplasmosis. They acquired the infection in the Veracruz (VZ endemic zone. Diagnosis was made by X-ray and Computed tomography (CT, liver function, immunological techniques, and culture. Identification of H. capsulatum isolates was confirmed by using Polymerase chain reaction (PCR was conducted with a probe from the M antigen, and the isolates were characterized by means of Random amplification of polymorphic DNA (RAPD-PCR employed the 1253 oligonucleotide and a mixture of oligonucleotides 1281 and 1283. These were compared to eight reference strain isolates from neighboring areas. Results X-ray and CT revealed disseminated micronodular images throughout lung parenchyma, as well as bilateral retrocaval, prevascular, subcarinal, and hilar adenopathies, hepatosplenomegaly, and altered liver function tests. Five of the six patients developed disseminated histoplasmosis. Two H. capsulatum strains were isolated. The same band profile was detected in both strains, indicating that both isolates corresponded to the sole H. capsulatum strain. Molecular characterization of the isolates was similar in 100% with the EH-53 Hidalgo human (HG strain (reference strain integrated into the LAm A clade described for

An examination of gender bias on the eighth-grade MEAP science test as it relates to the Hunter Gatherer Theory of Spatial Sex Differences

Science.gov (United States)

Armstrong-Hall, Judy Gail

The purpose of this study was to apply the Hunter-Gatherer Theory of sex spatial skills to responses to individual questions by eighth grade students on the Science component of the Michigan Educational Assessment Program (MEAP) to determine if sex bias was inherent in the test. The Hunter-Gatherer Theory on Spatial Sex Differences, an original theory, that suggested a spatial dimorphism concept with female spatial skill of pattern recall of unconnected items and male spatial skills requiring mental movement. This is the first attempt to apply the Hunter-Gatherer Theory on Spatial Sex Differences to a standardized test. An overall hypothesis suggested that the Hunter-Gatherer Theory of Spatial Sex Differences could predict that males would perform better on problems involving mental movement and females would do better on problems involving the pattern recall of unconnected items. Responses to questions on the 1994-95 MEAP requiring the use of male spatial skills and female spatial skills were analyzed for 5,155 eighth grade students. A panel composed of five educators and a theory developer determined which test items involved the use of male and female spatial skills. A MANOVA, using a random sample of 20% of the 5,155 students to compare male and female correct scores, was statistically significant, with males having higher scores on male spatial skills items and females having higher scores on female spatial skills items. Pearson product moment correlation analyses produced a positive correlation for both male and female performance on both types of spatial skills. The Hunter-Gatherer Theory of Spatial Sex Differences appears to be able to predict that males could perform better on the problems involving mental movement and females could perform better on problems involving the pattern recall of unconnected items. Recommendations for further research included: examination of male/female spatial skill differences at early elementary and high school levels to

Environmental injustice and air pollution in coal affected communities, Hunter Valley, Australia

Energy Technology Data Exchange (ETDEWEB)

Higginbotham, N.; Freeman, S.; Connor, L.; Albrecht, G. [University of Newcastle, Callaghan, NSW (Australia). School of Medicine & Public Health

2010-03-15

The authors describe environmental injustice from air pollution in the Upper Hunter, Australia, and analyse the inaction of state authorities in addressing residents' health concerns. Obstacles blocking a public-requested health study and air monitoring include: the interdependence of state government and corporations in reaping the economic benefits of coal production; lack of political will, regulatory inertia and procedural injustice; and study design and measurement issues. We analyse mining- and coal-related air pollution in a contested socio-political arena, where residents, civil society and local government groups struggle with corporations and state government over the burden of imposed health risk caused by air pollution.

Period Determination of Asteroid Targets Observed at Hunters Hill Observatory: May 2009 - September 2010

Science.gov (United States)

Higgins, David

2011-01-01

Lightcurves for 27 asteroids were obtained at the Hunters Hill Observatory (HHO) from 2009 May through 2010 September: 308 Polyxo, 326 Tamara, 369 Aeria, 504 Cora, 822 Lalage, 1164 Kobolda, 1619 Ueta, 1625 The NORC, 1685 Toro, 2189 Zaragoza, 2287 Kalmykia, 2639 Planman, 3695 Fiaia, 4786 Tatianina, 5333 Kanaya, (5452) 1937 NN, 6170 Levasseur, 7741 Fedoseev, 14815 Rutberg, 15724 Zille, 16525 Shumarinaiko, (21996) 1993 XP31, (29729) 1999 BY1, (35404) 1997 YV5, (39087) 2000 VN50, (66146) 1998 TU3, and (101769) 1999 FF52.

Measured elemental transfer factors for boreal hunter/gatherer scenarios: fish, game and berries

International Nuclear Information System (INIS)

Sheppard, S.C.; Long, J.M.; Sanipelli, B.

2010-01-01

The environmental assessment of long-term nuclear waste management requires data to estimate food chain transfers for radionuclides in various environmental settings. For key elements such as iodine (I) and chlorine (Cl), there is a paucity of transfer factor data, particularly outside of agricultural food chains. This study dealt with transfers of I, Cl and 28 other elements to foods that would be typical of boreal hunter/gatherer lifestyles, as well as being common foods for modern recreational and subsistence hunters. Food/substrate concentration ratios (CRs) and related transfer factors for eight species of widely distributed fish, whitetail deer (Odocoileus virginianus), Canada geese (Branta canadensis) and wild blueberries (Vaccinium myrtilloides) were measured and compared to the literature. Limited data were obtained for caribou (Rangifer tarandus), elk (Cervus elaphus) and moose (Alces americanus). Freshwater sediment Kd values and CRs for a ubiquitous freshwater macrophyte were also obtained. The CRs for I in fish were 29 L kg -1 in edible muscle (fillets) of large-bodied species and 85 L kg -1 for whole, small-bodied fish. The log CRs for fish and macrophytes were correlated across elements. For several elements, the Kds for sediments in deep water were ∼4-fold higher than for littoral samples. The elemental transfers to wild animals for some elements were notably different than the literature indicates for domestic animals. It is argued that the transfer data obtained using indigenous elements from real environmental settings, as opposed to contaminant elements in experimental or impacted environments, are especially relevant to assessment of long-term impacts.

Measured elemental transfer factors for boreal hunter/gatherer scenarios: fish, game and berries

Energy Technology Data Exchange (ETDEWEB)

Sheppard, S.C., E-mail: sheppards@ecomatters.co [ECOMatters Inc., WB Lewis Business Centre, 24 Aberdeen Avenue, Pinawa, Manitoba R0E 1L0 (Canada); Long, J.M.; Sanipelli, B. [ECOMatters Inc., WB Lewis Business Centre, 24 Aberdeen Avenue, Pinawa, Manitoba R0E 1L0 (Canada)

2010-11-15

The environmental assessment of long-term nuclear waste management requires data to estimate food chain transfers for radionuclides in various environmental settings. For key elements such as iodine (I) and chlorine (Cl), there is a paucity of transfer factor data, particularly outside of agricultural food chains. This study dealt with transfers of I, Cl and 28 other elements to foods that would be typical of boreal hunter/gatherer lifestyles, as well as being common foods for modern recreational and subsistence hunters. Food/substrate concentration ratios (CRs) and related transfer factors for eight species of widely distributed fish, whitetail deer (Odocoileus virginianus), Canada geese (Branta canadensis) and wild blueberries (Vaccinium myrtilloides) were measured and compared to the literature. Limited data were obtained for caribou (Rangifer tarandus), elk (Cervus elaphus) and moose (Alces americanus). Freshwater sediment Kd values and CRs for a ubiquitous freshwater macrophyte were also obtained. The CRs for I in fish were 29 L kg{sup -1} in edible muscle (fillets) of large-bodied species and 85 L kg{sup -1} for whole, small-bodied fish. The log CRs for fish and macrophytes were correlated across elements. For several elements, the Kds for sediments in deep water were {approx}4-fold higher than for littoral samples. The elemental transfers to wild animals for some elements were notably different than the literature indicates for domestic animals. It is argued that the transfer data obtained using indigenous elements from real environmental settings, as opposed to contaminant elements in experimental or impacted environments, are especially relevant to assessment of long-term impacts.

Improvements to the Hunter Dose tracking system

Energy Technology Data Exchange (ETDEWEB)

Whiteside, T. S. [Savannah River Site (SRS), Aiken, SC (United States). Savannah River National Lab. (SRNL); Aucott, T. J. [Savannah River Site (SRS), Aiken, SC (United States). Savannah River National Lab. (SRNL); Brand, A. D. [Savannah River Site (SRS), Aiken, SC (United States). Savannah River National Lab. (SRNL); Diprete, D. P. [Savannah River Site (SRS), Aiken, SC (United States). Savannah River National Lab. (SRNL)

2017-07-01

Since 1965, the Savannah River Site (SRS) has conducted deer hunts which are open to the general public. SRS performs field monitoring for cesium-137 (Cs-137) of each harvested animal to determine whether the animal may be released to the hunter. A new field system for measuring Cs-137 in the harvested animals has been developed. The system incorporates numerous enhancements compared to the original system. The original system was composed of two Ludlum Measurements scalar-driven 2 inch x 2 inch sodium iodide counters, while the new system is based on a single Ametek Ortec Digibase-driven 2 inch x 4 inch x 16 inch sodium iodide gamma spectrometer. The new system includes a series of easy-to-assemble stainless steel encapsulated lead shields. The combination of the larger detector size and lead shielding improved the detection limit of the new system by a factor of approximately three compared to the original system. This lower detection limit allows for a larger number of measurements to be directly compared to the laboratory results, in cases where animal portions have been sampled. The results from developing and using this system are presented as well as recommendations on improvements to the overall field monitoring of the SRS hunts.

Making a Home in the Taiga: Movements, Paths and Signs among Orochen-Evenki Hunters and Herders of Zabaikal Krai (South East Siberia

Directory of Open Access Journals (Sweden)

Donatas Brandišauskas

2012-06-01

Full Text Available In this article, I will explore interrelations between place making, movement, use of paths and signs among the Orochen of Zabaikal Krai (Province. Although under the Russian Tsars Orochen-Evenki hunters and herders were referred to negatively as wanderers; today my ethnography demonstrates how movements of animals and humans are crucial for the success of their subsistence, place making and worldview. Hence, walking in the taiga is an important skill that is essential to hunting and herding activities when humans strive to identify animals' 'living places' (Orochen bikit by reading their tracks and movements. Humans also leave their own tracks and paths as well as signs communicating with each other while subsisting in remote areas, in this way creating their own living places. Thereby, I show how movements and the use of paths is an important dimension of Orochen-Evenki wellbeing as well as their moral code.

General medicine advanced training: lessons from the John Hunter training programme.

Science.gov (United States)

Jackel, D; Attia, J; Pickles, R

2014-03-01

Recent years have seen a rapid growth in the number of advanced trainees pursuing general medicine as a specialty. This reflects an awareness of the need for broader training experiences to equip future consultant physicians with the skills to manage the healthcare challenges arising from the demographic trends of ageing and increasing comorbidity. The John Hunter Hospital training programme in general medicine has several characteristics that have led to the success in producing general physicians prepared for these challenges. These include support from a core group of committed general physicians, an appropriate and sustainable funding model, flexibility with a focus on genuine training and developing awareness of a systems approach, and strong links with rural practice. © 2014 The Authors; Internal Medicine Journal © 2014 Royal Australasian College of Physicians.

Síndrome de Hunter-Hurler

Directory of Open Access Journals (Sweden)

Antonio B. Lefèvre

1954-03-01

Full Text Available Les deux cas de gargoylisme présentés ont appelé l'attention des auteurs et ont mérité leur publication vue la rareté de la maladie en question. Le diagnostic repose en un certain nombre de signes cliniques, lesquels, cependant, n'ont pas besoin d'être au complet pour que l'on puisse affermir le diagnostic du syndrome de Hunter-Hurler. C'est ce qui arrive, d'ailleurs, avec la majorité des maladies de caractère génétique, dans les-quelles il est possible de verifier la transmission de quelques traits seule-ment de Pensemble clinique, insuffisants pour caractériser la maladie sous tous ses aspects, mais suffisants pour permettre un diagnostic très sûr. Cas nº 1: les auteurs font ressortir la face caractéristique de la maladie, la petite taille, les doigts en griffe, les alterations très caractéristiques de forme des vertèbres lombaires et le retard psycho-moteur considérable; comme antécédents familiaux, il a été constaté qu'une cousine-germaine du côté paternel de la malade est morte à 1'âge de 12 ans d'une maladie semblable. Cas nº 2: ici ressortent la face caractéristique, la petite taille, le développement retardé, les altérations des vertèbres lombaires et, à l'examen oculaire, un aspect suggestif de l'opacité cornéenne considérée comme pathognomonique du gargoylisme. Aucun traitement a été tenté dans les deux cas.

Pavlovian hunters on the margin - archaeozoological analysis of the animal remains discovered at the Pavlov II site (1966-67 excavations)

Czech Academy of Sciences Publication Activity Database

Wilczyński, J.; Wojtal, P.; Svoboda, Jiří

2017-01-01

Roč. 73, 3-4 (2017), s. 322-331 ISSN 2533-4050 Institutional support: RVO:68081758 Keywords : Gravettian * hunters-gatherers * southern Moravia * subsistence strategies Subject RIV: AC - Archeology, Anthropology, Ethnology OBOR OECD: Archaeology http://fi.nm.cz/wp-content/uploads/2017/12/06_Wilczynski_et-al_2017.pdf

Hunter color dimensions, sugar content and volatile compounds in pasteurized yellow passion fruit juice (Passiflora edulis var. flavicarpa during storage

Directory of Open Access Journals (Sweden)

Delcio Sandi

2004-06-01

Full Text Available Changes in Hunter L, a and b values, glucose, fructose and sucrose contents, concentration of four volatile compounds (ethyl butirate, ethyl caproate, hexyl butirate and hexyl caproate and furfural, were studied in yellow passion fruit juice (Passiflora edulis var. flavicarpa pasteurized at 75ºC/60s, 80ºC/41s or 85ºC/27s, during storage at room temperature (25±5ºC and refrigeration (5±1ºC for 120 days. While the sucrose content decreased, the glucose and fructose contents increased significantly over storage time. The Hunter L and b values behaved similarly, with a tendency to decrease over time, inversely to Hunter a value. Volatile compound concentrations also decreased over time, inversely to the furfural content. Pasteurization at 85ºC/27s resulted minimum changes in the studied passion fruit characteristics, while that at 75ºC/60s was the most harmful. Storage under refrigeration tended to keep the best quality characteristics of the juice.Foi estudada a variação dos valores "L", "a" e "b" do sistema de Hunter, dos teores de glucose, frutose e sacarose, e da concentração de quatro compostos voláteis (butirato de etila, caproato de etila, butirato de hexila e caproato de hexila e furfural, em suco de maracujá-amarelo (Passiflora edulis var. flavicarpa submetido à pasteurização (75ºC/60 s, 80ºC/41 s e 85ºC/27 s, durante o armazenamento a temperatura ambiente (25±5ºC e refrigerada (5±1ºC por 120 dias. Enquanto os teores de sacarose diminuíram, aqueles de glucose e frutose aumentaram significativamente. Os valores "L" e "b" apresentaram comportamento semelhante, com tendência a diminuir ao longo do tempo, inversamente ao valor "a". As concentrações dos compostos voláteis também diminuíram, exceto para o furfural. A pasteurização a 85ºC/27 s proporcionou as menores alterações nas características estudadas, enquanto aquela à 75ºC/60 s foi a mais prejudicial. O armazenamento sob refrigeração apresentou

Lead shot pellets dispersed by hunters: ingested by ducks

Energy Technology Data Exchange (ETDEWEB)

Danell, K [Univ. of Umea, Sweden; Andersson, A; Marcstrom, V

1977-01-01

Many of the lead pellets shot by waterfowl hunters over shores and waters fall on the feeding grounds of ducks and geese. These pellets, picked up and ingested by the birds, can remain in the gizzard where they are eroded by mechanical and chemical action. In some cases the bird absorbs enough lead to cause lead poisoning. This report describes the incidence of ingested lead shot pellets found in 928 ducks collected in Sweden during hunting season. Pellets were found in both dabbling and diving ducks and were present in birds from six of the eight localities sampled. Usually one or two pellets were found but some ducks contained up to 62 pellets. As the incidence of ingested pellets in the present study is approximately the same as that found in North America, where the annual duck loss due to lead poisoning is estimated to be 2 to 3 percent of the population, it may be assumed that lead poisoning is a mortality factor for Swedish ducks also.

Middle and Late Holocene hunter-gatherers in East Central Europe: changing paradigms of the ‘non-Neolithic’ way of life

Directory of Open Access Journals (Sweden)

Marek Nowak

2007-12-01

Full Text Available According to traditional views, the main reason for ‘demesolithisation’ in East Central Europe was the spread of the Neolithic oecumene, particularly from c. 4000 BC. Simultaneously, the disintegrated Late Mesolithic world gradually underwent typological unification, and finally reached the stage that is sometimes described as pre-Neolithic. However, we definitely have to bear in mind that as a matter of fact we deal only with the ‘history’ of archaeological artefacts that are treated as typical attributes of hunter-gatherers. The analyses of chronological, technological, settlement, economic, and social data referring to foragers of East Central Europe demonstrate that the quantitative decrease and changes of their archaeological attributes in the fifth, fourth, and third millennia were not connected with a profound reorientation of their spatial and ideological existence. It was rather a continuation of previous patterns, even though territories settled by farming societies were steadily growing in size. The final disappearance of Central European hunter-gatherers – but only in a strictly typological dimension – took place in the Late Neolithic and Early Bronze Age.

Silicone infusion tubing instead of Hunter rods for two-stage zone 2 flexor tendon reconstruction in a resource-limited surgical environment.

Science.gov (United States)

Kibadi, K; Moutet, F

2017-10-01

The authors describe their experience using silicone infusion tubing in place of Hunter rods for two-stage zone 2 flexor tendon reconstruction in a resource-limited surgical environment. This case report features a 47-year-old, right-handed man who had no active PIP and DIP joint flexion in four fingers of the right hand 5 months after an injury. During the first repair stage, the A2 and A4 pulleys were reconstructed using an extensor retinaculum graft. An infusion tube was inserted instead of Hunter rods. During the second stage, formation of a digital neo-canal around the infusion tubing was observed. The infusion tubing was removed and replaced with a palmaris longus tendon graft according to the conventional technique. Physiotherapy and rehabilitation followed surgery. At 6 months, very significant progress had been made with complete recovery of PIP and DIP flexion in the four fingers. Copyright © 2017 SFCM. Published by Elsevier Masson SAS. All rights reserved.

Statistical Validation of Calibrated Wind Data Collected From NOAA's Hurricane Hunter Aircraft

Science.gov (United States)

Graham, K.; Sears, I. T.; Holmes, M.; Henning, R. G.; Damiano, A. B.; Parrish, J. R.; Flaherty, P. T.

2015-12-01

Obtaining accurate in situ meteorological measurements from the NOAA G-IV Hurricane Hunter Aircraft currently requires annual wind calibration flights. This project attempts to demonstrate whether an alternate method to wind calibration flights can be implemented using data collected from many previous hurricane, winter storm, and surveying flights. Wind derivations require using airplane attack and slip angles, airplane pitch, pressure differentials, dynamic pressures, ground speeds, true air speeds, and several other variables measured by instruments on the aircraft. Through the use of linear regression models, future wind measurements may be fit to past statistical models. This method of wind calibration could replace the need for annual wind calibration flights, decreasing NOAA expenses and providing more accurate data. This would help to ensure all data users have reliable data and ultimately contribute to NOAA's goal of building of a Weather Ready Nation.

Rabbit hunter uveitis: case report of tularemia uveitis.

Science.gov (United States)

Terrada, Céline; Azza, Said; Bodaghi, Bahram; Le Hoang, Phuc; Drancourt, Michel

2016-09-01

Literature reports on ophthalmological manifestations related to tularemia, a zoonose caused by the bacterium Francisella tularensis, largely refer to Parinaud's oculoglandular syndrome, which consists of the association of conjunctivitis with preauricular lymphadenitis. In this paper, we report a case of intraocular inflammation during tularemia infection. A 52-year-old Caucasian man was diagnosed with unilateral uveitis. The uveitis was posterior, with a 2+ vitritis and a large yellowish lesion involving the macula with an overlying sub-retinal detachment, extending inferiorly, and subretinal hemorrhages. Fluorescein angiography showed a late hyperfluorescence with focal vascular leakage. Ultrasound biomicroscopy confirmed the presence of a 3.8 mm parietal granuloma with a few calcifications in the left eye. While extensive work-up eliminated any other infectious and non-infectious etiology, tularemia was diagnosed by advanced serology consisting of two-dimensional Western-immunoblotting. The patient, a hunter, recalled having killed rabbits in the days before the symptoms appeared. Uveitis was rapidly controlled following treatment with doxycycline, yet three years after initiation of the treatment, the patient still complained of loss of vision in the left eye with a central scotoma. Posterior uveitis may be an infrequent manifestation of tularemia infection, and therefore this infection should be considered in the differential diagnosis of intraocular inflammation in areas where F. tularensis is endemic.

Resource scarcity drives lethal aggression among prehistoric hunter-gatherers in central California.

Science.gov (United States)

Allen, Mark W; Bettinger, Robert Lawrence; Codding, Brian F; Jones, Terry L; Schwitalla, Al W

2016-10-25

The origin of human violence and warfare is controversial, and some scholars contend that intergroup conflict was rare until the emergence of sedentary foraging and complex sociopolitical organization, whereas others assert that violence was common and of considerable antiquity among small-scale societies. Here we consider two alternative explanations for the evolution of human violence: (i) individuals resort to violence when benefits outweigh potential costs, which is likely in resource poor environments, or (ii) participation in violence increases when there is coercion from leaders in complex societies leading to group level benefits. To test these hypotheses, we evaluate the relative importance of resource scarcity vs. sociopolitical complexity by evaluating spatial variation in three macro datasets from central California: (i) an extensive bioarchaeological record dating from 1,530 to 230 cal BP recording rates of blunt and sharp force skeletal trauma on thousands of burials, (ii) quantitative scores of sociopolitical complexity recorded ethnographically, and (iii) mean net primary productivity (NPP) from a remotely sensed global dataset. Results reveal that sharp force trauma, the most common form of violence in the record, is better predicted by resource scarcity than relative sociopolitical complexity. Blunt force cranial trauma shows no correlation with NPP or political complexity and may reflect a different form of close contact violence. This study provides no support for the position that violence originated with the development of more complex hunter-gatherer adaptations in the fairly recent past. Instead, findings show that individuals are prone to violence in times and places of resource scarcity.

Networks of Food Sharing Reveal the Functional Significance of Multilevel Sociality in Two Hunter-Gatherer Groups.

Science.gov (United States)

Dyble, Mark; Thompson, James; Smith, Daniel; Salali, Gul Deniz; Chaudhary, Nikhil; Page, Abigail E; Vinicuis, Lucio; Mace, Ruth; Migliano, Andrea Bamberg

2016-08-08

Like many other mammalian and primate societies [1-4], humans are said to live in multilevel social groups, with individuals situated in a series of hierarchically structured sub-groups [5, 6]. Although this multilevel social organization has been described among contemporary hunter-gatherers [5], questions remain as to the benefits that individuals derive from living in such groups. Here, we show that food sharing among two populations of contemporary hunter-gatherers-the Palanan Agta (Philippines) and Mbendjele BaYaka (Republic of Congo)-reveals similar multilevel social structures, with individuals situated in households, within sharing clusters of 3-4 households, within the wider residential camps, which vary in size. We suggest that these groupings serve to facilitate inter-sexual provisioning, kin provisioning, and risk reduction reciprocity, three levels of cooperation argued to be fundamental in human societies [7, 8]. Humans have a suite of derived life history characteristics including a long childhood and short inter-birth intervals that make offspring energetically demanding [9] and have moved to a dietary niche that often involves the exploitation of difficult to acquire foods with highly variable return rates [10-12]. This means that human foragers face both day-to-day and more long-term energetic deficits that conspire to make humans energetically interdependent. We suggest that a multilevel social organization allows individuals access to both the food sharing partners required to buffer themselves against energetic shortfalls and the cooperative partners required for skill-based tasks such as cooperative foraging. Copyright © 2016 Elsevier Ltd. All rights reserved.

Did warfare among ancestral hunter-gatherers affect the evolution of human social behaviors?

Science.gov (United States)

Bowles, Samuel

2009-06-05

Since Darwin, intergroup hostilities have figured prominently in explanations of the evolution of human social behavior. Yet whether ancestral humans were largely "peaceful" or "warlike" remains controversial. I ask a more precise question: If more cooperative groups were more likely to prevail in conflicts with other groups, was the level of intergroup violence sufficient to influence the evolution of human social behavior? Using a model of the evolutionary impact of between-group competition and a new data set that combines archaeological evidence on causes of death during the Late Pleistocene and early Holocene with ethnographic and historical reports on hunter-gatherer populations, I find that the estimated level of mortality in intergroup conflicts would have had substantial effects, allowing the proliferation of group-beneficial behaviors that were quite costly to the individual altruist.

Portrait of a Geothermal Spring, Hunter's Hot Springs, Oregon.

Science.gov (United States)

Castenholz, Richard W

2015-01-27

Although alkaline Hunter's Hot Springs in southeastern Oregon has been studied extensively for over 40 years, most of these studies and the subsequent publications were before the advent of molecular methods. However, there are many field observations and laboratory experiments that reveal the major aspects of the phototrophic species composition within various physical and chemical gradients of these springs. Relatively constant temperature boundaries demark the upper boundary of the unicellular cyanobacterium, Synechococcus at 73-74 °C (the world-wide upper limit for photosynthesis), and 68-70 °C the upper limit for Chloroflexus. The upper limit for the cover of the filamentous cyanobacterium, Geitlerinema (Oscillatoria) is at 54-55 °C, and the in situ lower limit at 47-48 °C for all three of these phototrophs due to the upper temperature limit for the grazing ostracod, Thermopsis. The in situ upper limit for the cyanobacteria Pleurocapsa and Calothrix is at ~47-48 °C, which are more grazer-resistant and grazer dependent. All of these demarcations are easily visible in the field. In addition, there is a biosulfide production in some sections of the springs that have a large impact on the microbiology. Most of the temperature and chemical limits have been explained by field and laboratory experiments.

Parental experience of enzyme replacement therapy for Hunter syndrome.

Science.gov (United States)

Buraczewska, M; O'Leary, D; Walsh, O; Monavari, A; Crushell, E

2013-04-01

We aimed to establish the profile of Irish patients with Hunter Syndrome (Mucopolysaccharidosis type II, MPS II) receiving weekly intravenous Enzyme Replacement Therapy (ERT) with recombinant iduronate-2-sulfatase and to assess the social impact and parental opinion of ERT through the use of a parental questionnaire. Nine patients aged 3.5- 14 years have received a mean of 2 (range 0.5-3.5) years of ERT. Treatment was associated with clinical improvements from baseline in hepatosplenomegaly in 6/7 (85%) respiratory manifestations in 4/6 (67%) and a mean reduction in urinary glycosaminoglycan excretion of 62%. Changes noted by parents included increased energy 3/9 (33%) and softening of skin, hair and facial features 8/9 (89%). Parents report that seven hours weekly were spent on hospitalizations for ERT. Parental employment was adversely affected in 8 (89%) families. One day of school/preschool (20%) was lost every week for 8 (89%) children. All parents believed the benefits of ERT out-weigh the difficulties involved. All families would welcome the introduction of home based therapy. In conclusion the social and educational burden of hospital-based ERT on these children and their families is significant. The introduction of home-based therapy is likely to improve overall quality of life for MPSII patients and their families.

Methyl eugenol aromatherapy enhances the mating competitiveness of male Bactrocera carambolae Drew & Hancock (Diptera: Tephritidae).

Science.gov (United States)

Haq, Ihsan; Vreysen, Marc J B; Cacéres, Carlos; Shelly, Todd E; Hendrichs, Jorge

2014-09-01

Males of Bactrocera carambolae Drew & Hancock (Diptera: Tephritidae) are strongly attracted to methyl eugenol (ME) (1,2-dimethoxy-4-(2-propenyl)benzene), a natural compound occurring in variety of plant species. ME-feeding is known to enhance male B. carambolae mating competitiveness 3 days after feeding. Enhanced male mating competitiveness due to ME-feeding can increase the effectiveness of sterile insect technique (SIT) manifolds. However, the common methods for emergence and holding fruit flies prior to field releases do not allow the inclusion of any ME feeding treatment after fly emergence. Therefore this study was planned to assess the effects of ME-aromatherapy in comparison with ME feeding on male B. carambolae mating competitiveness as aromatherapy is pragmatic for fruit flies emergence and holding facilities. Effects of ME application by feeding or by aromatherapy for enhanced mating competitiveness were evaluated 3d after treatments in field cages. ME feeding and ME aromatherapy enhanced male mating competitiveness as compared to untreated males. Males treated with ME either by feeding or by aromatherapy showed similar mating success but mating success was significantly higher than that of untreated males. The results are discussed in the context of application of ME by aromatherapy as a pragmatic approach in a mass-rearing facility and its implications for effectiveness of SIT. Copyright © 2014 The Authors. Published by Elsevier Ltd.. All rights reserved.

Una valigia caduta in mare: Jaume Serra Hunter e la "Scuola di Barcellona"

Directory of Open Access Journals (Sweden)

Nazzareno Fioraso

2014-12-01

Full Text Available Nella storiografia filosofica spagnola non esiste, probabilmente, una definizione ambigua e problematica come quella che riguarda la cosiddetta "Scuola di Barcellona". La tesi principale di questo articolo è che tale scuola non giunse mai a nascere, ma ne esistette soltanto una forma embrionale che non poté maturare perché, in conseguenza della situazione politica venutasi a creare con la guerra civile (1936-1939, i suoi componenti si dispersero nell'esilio. Ciò nonostante, è possibile riconoscere alcuni tratti comuni, seppur labili e (forse non sostanziali, nella diaspora degli intellettuali catalani che rendono possibile definirla, con le dovute cautele, "Scuola di Barcellona". Tali caratteristiche comuni si possono far risalire a colui che, in un certo senso, fu il fondatore della scuola, essendo il principale maestro delle nuove leve filosofiche della Catalogna all'inizio del XX secolo: Jaume Serra Hunter.

Results of the radiological survey at West Hunter Avenue Firehall, Maywood, New Jersey (MJ027)

International Nuclear Information System (INIS)

Foley, R.D.; Floyd, L.M.

1990-03-01

Maywood Chemical Works (MCW) of Maywood, New Jersey, generated process wastes and residues associated with the production and refining of thorium and thorium compounds from monazite ores from 1916 to 1956. At the request of the US Department of Energy (DOE), a group from Oak Ridge National Laboratory conducts investigative radiological surveys of properties in the vicinity of MCW to determine whether a property is contaminated with radioactive residues, principally 232 Th, derived from the MCW site. The survey typically includes direct measurement of gamma radiation levels and soil sampling for radionuclide analyses. The survey of this site, West Hunter Avenue Firehall, Maywood, New Jersey (MJ027), was conducted during 1987. 4 refs., 3 tabs

Origin of HTLV-1 in hunters of nonhuman primates in Central Africa.

Science.gov (United States)

Kazanji, Mirdad; Mouinga-Ondémé, Augustin; Lekana-Douki-Etenna, Sonia; Caron, Mélanie; Makuwa, Maria; Mahieux, Renaud; Gessain, Antoine

2015-02-01

Of 78 Gabonese individuals who had received bites from nonhuman primates (NHPs) while hunting, 7 were infected with human T lymphotropic virus (HTLV-1). Five had been bitten by gorillas and were infected with subtype B strains; however, a 12-year-old girl who was severely bitten by a Cercopithecus nictitans was infected with a subtype D strain that was closely related to the simian T lymphotropic virus (STLV-1) that infects this monkey species. Her mother was infected with a subtype B strain. These data confirm that hunters in Africa can be infected by HTLV-1 that is closely related to the strains circulating among local NHP game. Our findings strongly suggest that a severe bite represent a risk factor for STLV-1 acquisition. © The Author 2014. Published by Oxford University Press on behalf of the Infectious Diseases Society of America. All rights reserved. For Permissions, please e-mail: journals.permissions@oup.com.

Knowledge-Sharing Networks in Hunter-Gatherers and the Evolution of Cumulative Culture.

Science.gov (United States)

Salali, Gul Deniz; Chaudhary, Nikhil; Thompson, James; Grace, Olwen Megan; van der Burgt, Xander M; Dyble, Mark; Page, Abigail E; Smith, Daniel; Lewis, Jerome; Mace, Ruth; Vinicius, Lucio; Migliano, Andrea Bamberg

2016-09-26

Humans possess the unique ability for cumulative culture [1, 2]. It has been argued that hunter-gatherer's complex social structure [3-9] has facilitated the evolution of cumulative culture by allowing information exchange among large pools of individuals [10-13]. However, empirical evidence for the interaction between social structure and cultural transmission is scant [14]. Here we examine the reported co-occurrence of plant uses between individuals in dyads (which we define as their "shared knowledge" of plant uses) in BaYaka Pygmies from Congo. We studied reported uses of 33 plants of 219 individuals from four camps. We show that (1) plant uses by BaYaka fall into three main domains: medicinal, foraging, and social norms/beliefs; (2) most medicinal plants have known bioactive properties, and some are positively associated with children's BMI, suggesting that their use is adaptive; (3) knowledge of medicinal plants is mainly shared between spouses and biological and affinal kin; and (4) knowledge of plant uses associated with foraging and social norms is shared more widely among campmates, regardless of relatedness, and is important for camp-wide activities that require cooperation. Our results show the interdependence between social structure and knowledge sharing. We propose that long-term pair bonds, affinal kin recognition, exogamy, and multi-locality create ties between unrelated families, facilitating the transmission of medicinal knowledge and its fitness implications. Additionally, multi-family camps with low inter-relatedness between camp members provide a framework for the exchange of functional information related to cooperative activities beyond the family unit, such as foraging and regulation of social life. Copyright © 2016 Elsevier Ltd. All rights reserved.

A study on the revision of nuclear safety act to build the foundation of nuclear export and import control system in Korea

International Nuclear Information System (INIS)

Yang, Seung Hyo; Choi, Sun Do

2012-01-01

Nuclear related items require export and import control beyond the multilateral export control system according to Safeguard Agreement, Additional Protocol and bilateral agreements. Besides Korea as a nuclear supplier is needed to actively cope with its export control system, which is being reinforced internationally. In regard to this trend, this study drew the revision plan of present Nuclear Safety Act to found the nuclear export and import control system in Korea by examining the related legislations and analyzing the implementation status of nuclear export and import control

A study on the revision of nuclear safety act to build the foundation of nuclear export and import control system in Korea

Energy Technology Data Exchange (ETDEWEB)

Yang, Seung Hyo; Choi, Sun Do [Korea Institute of Nuclear Nonproliferation and Control, Daejeon (Korea, Republic of)

2012-10-15

Nuclear related items require export and import control beyond the multilateral export control system according to Safeguard Agreement, Additional Protocol and bilateral agreements. Besides Korea as a nuclear supplier is needed to actively cope with its export control system, which is being reinforced internationally. In regard to this trend, this study drew the revision plan of present Nuclear Safety Act to found the nuclear export and import control system in Korea by examining the related legislations and analyzing the implementation status of nuclear export and import control.

Occurrence and prevalence of selected zoonotic agents: Echinococcus multilocularis, Trichinella spiralis and hepatitis E virus (HEV) in the population of Polish hunters--results of the study conducted in 2010-2012.

Science.gov (United States)

Sadkowska-Todys, Małgorzata; Baumann-Popczyk, Anna; Wnukowska, Natalia; Popczyk, Bartłomiej; Kucharczyk, Bożena; Gołąb, Elżbieta

2015-01-01

In Poland the development of the knowledge concerning zoonotic pathogens, of which free-living animals are the reservoir of is gaining in importance both in epidemiological aspect as well as in the context of prevention for improving public health. Dietary habits such as the consumption of forest undergrowth products and wild game meat, and the way of those products being prepared (in the process of barbequing) pose a risk factors of infection with the foodborne pathogens such as Echinococcus multilocularis, Trichinella spp., and HEV. The aim of this study is to estimate the prevalence of infections caused by Trichinella spp., Echinococcus multilocularis, and HEV in the population of Polish hunters, describing their geographical distribution in Poland, and to try to define basic factors, which may contribute to their occurrence. In 2010-2012 a cross-sectional study was carried out among Polish hunters. A blood samples were collected as well as a survey of 1027 participants recruited in the 16 provinces was also carried out. Serological tests were performed for the presence of specific antibodies against Echinococcus multilocularis, Trichinella spp. and HEV using commercial or "in home" ELISA tests. In case of positive result for Echinococcus, an Em2plus ELISA or/and western blot test were carried out, and for positive results for IgM for HEV a recomLine HEV IgM test was carried out. In the studied population a total number of 2 cases of Echinococcus multilocularis infection were found. Moreover in 47 (4,6%) participants presence of antibodies against Trichinella spp. were found, including 17 positive and 30 borderline results. In 206 persons (25%) IgG anti-HEV antibodies were found (by ELISA test). Geographical diversity in prevalence of both, the Trichinella spp. and HEV cases was observed. The study confirmed presence of zoonotic infections such as Echinococcus multilocularis, Trichinella spp., and hepatitis E (HEV) among Polish hunters. In the case of

Analysis of PFAAs in American alligators part 2: Potential dietary exposure of South Carolina hunters from recreationally harvested alligator meat.

Science.gov (United States)

Tipton, Jessica J; Guillette, Louis J; Lovelace, Susan; Parrott, Benjamin B; Rainwater, Thomas R; Reiner, Jessica L

2017-11-01

Exposure to perfluorinated alkyl acids (PFAAs) has been linked to many harmful health effects including reproductive disorders, developmental delays, and altered liver and kidney function. Most human exposure to environmental contaminants, including PFAAs, occurs through consumption of contaminated food or drinking water. This study uses PFAA data from meat samples collected from recreationally harvested American alligators (Alligator mississippiensis) in South Carolina to assess potential dietary exposure of hunters and their families to PFAAs. Consumption patterns were investigated using intercept surveys of 23 hunters at a wild game meat processor. An exposure scenario using the average consumption frequency, portion size, and median perfluorooctane sulfonic acid (PFOS) concentration in alligator meat from all hunt units found the daily dietary exposure to be 2.11ng/kg body weight per day for an adult human. Dietary PFOS exposure scenarios based on location of harvest suggested the highest daily exposure occurs with alligator meat from the Middle Coastal hunt unit in South Carolina. Although no samples were found to exceed the recommended threshold for no consumption of PFOS found in Minnesota state guidelines, exposure to a mixture of PFAAs found in alligator meat and site-specific exposures based on harvest location should be considered in determining an appropriate guideline for vulnerable populations potentially exposed to PFAAs through consumption of wild alligator meat. Copyright © 2017. Published by Elsevier B.V.

"Founder crops" v. wild plants: Assessing the plant-based diet of the last hunter-gatherers in southwest Asia

Science.gov (United States)

Arranz-Otaegui, Amaia; González Carretero, Lara; Roe, Joe; Richter, Tobias

2018-04-01

The Natufian culture (c. 14.6-11.5 ka cal. BP) represents the last hunter-gatherer society that inhabited southwest Asia before the development of plant food production. It has long been suggested that Natufians based their economy on the exploitation of the wild ancestors of the Neolithic "founder crops", and that these hunter-gatherers were therefore on the "threshold to agriculture". In this work we review the available data on Natufian plant exploitation and we report new archaeobotanical evidence from Shubayqa 1, a Natufian site located in northeastern Jordan (14.6-11.5 ka cal. BP). Shubayqa 1 has produced an exceptionally large plant assemblage, including direct evidence for the continuous exploitation of club-rush tubers (often regarded as "missing foods") and other wild plants, which were probably used as food, fuel and building materials. Taking together this data we evaluate the composition of archaeobotanical assemblages (plant macroremains) from the Natufian to the Early Pre-Pottery Neolithic B (EPPNB). Natufian assemblages comprise large proportions of non-founder plant species (>90% on average), amongst which sedges, small-seeded grasses and legumes, and fruits and nuts predominate. During the Pre-Pottery Neolithic, in particular the EPPNB, the presence of "founder crops" increases dramatically and constitute up to c. 42% of the archaeobotanical assemblages on average. Our results suggest that plant exploitation strategies during the Natufian were very different from those attested during subsequent Neolithic periods. We argue that historically driven interpretations of the archaeological record have over-emphasized the role of the wild ancestors of domesticated crops previous to the emergence of agriculture.

Ceramics among Eurasian hunter-gatherers: 32 000 years of ceramic technology use and the perception of containment

Directory of Open Access Journals (Sweden)

Mihael Budja

2016-12-01

Full Text Available We present two parallel and 32 000 years long trajectories of episodic ceramic technology use in Eurasian pre-Neolithic hunter-gatherer societies. In eastern, Asian trajectory the pottery was produced from the beginning. Ceramic figurines mark the western, European trajectory. The western predates the eastern for about eleven millennia. While ceramic cones and figurines first appeared in Central Europe at c. 31 000 cal BC the earliest vessels in eastern Asia was dated at c. 20 000 cal BC. We discuss women’s agency, perception of containment, ‘cross-craft interactions’, and evolution of private property that that may influenced the inventions of ceramic (pyrotechnology.

Rudimentary functions:Important reminders of history and relationship

Directory of Open Access Journals (Sweden)

Natalia Y. Collings

2018-03-01

Full Text Available Background. When Vygotsky suggested the term rudimentary functions for psychological phenomena, he drew a parallel with organismic rudiments that existed and continue to exist in a number of biological species. These rudiments used to play an important role in the life of an organism and allow us to study that life in the process of its development. Vygotsky originally gave three explicit examples of psychological rudimentary functions: 1 attributing an important decision to the result of a solitaire card game, 2 tying a knot in a handkerchief in order to remember and do something later, and 3 counting on one’s fingers. Objective. The purpose of this article is to offer a contemporary overview and paths for development of L.S. Vygotsky’s notion of rudimentary function. Design. This paper, in the genre of a theoretical article, drew on existing research and theoretical literature to advance a theory. I analyzed Vygotsky’s original example of a solitaire game and similar actions (for example, flipping a coin, arguing that these actions represent key events mediating choice and exercising human will over affect. I then focused on three more psychological functions that fit Vygotsky’s definition of rudiments: 1 photographic memory and déjà vu as instances of historically primitive eidetic memory, 2 talking to oneself aloud as a rudiment of a key event forming the self-regulatory mechanism of inner speech in childhood, and 3 fantasizing, which could remind us of our young age, when imagination readily created what was lacking in external world. Results. This analysis allowed me to vividly illustrate the historical and relational focus of Vygotsky’s theories. Conclusions. Rudimentary functions, often perceived as mysterious, in their simplicity can be powerful reminders that historically primitive functions do not disappear, but enter complex relationships with other psychological functions, and that many relationships are possible within

CONDICIÓN FÍSICA Y HÁBITOS DE PRÁCTICA FÍSICO-DEPORTIVA DE LOS CAZADORES EXTREMEÑOS [Physical condition and habits of practice exercise of hunters extremeños

Directory of Open Access Journals (Sweden)

José Martín Gamonales Puerto

2016-12-01

Present study analyses the physical condition and the physical-sportive exercise in a random sample of hunters (n=144 in the Extremadura (Spain. Hunting is recognized as a sportive modality by the Board of the CDS (Spanish High Sports Council. In order to know the physical condition levels in hunters group, were used a selection of Eurofit and AFISAL-INEFC tests for adult. Final results show the relation which exist between physical condition and sociodemographic differences, as well as the influence that hunting can have in a healthy lifestyle. Attending to the results, there are differences in the physical condition according to the age of the individuals. Moreover, it shows a relation between the sociodemographic characteristics of the sample and the additional physical-sportive exercises of the different modalities of hunting.

A família Drew de Walworth: um século após a avaliação inicial finalmente o diagnóstico doença de Machado-Joseph The Drew family of Walworth: one century from the first evaluation until the final diagnosis, Machado-Joseph disease

Directory of Open Access Journals (Sweden)

Hélio A. Ghizoni Teive

2004-03-01

Full Text Available As enfermidades heredo-degenerativas, entre elas as ataxias cerebelares autossômicas dominantes, agora conhecidas como ataxias espinocerebelares (AEC, correspondem a extenso grupo de s com grande heterogeneidade genética. Algumas formas de AEC, em especial a de Machado-Joseph (DMJ, caracteriza-se por acentuada variabilidade de expressão fenotípica intra e inter-familial. Em 1895, na Grã-Bretanha, foi descrita uma família com uma forma autossômica dominante de AEC que viria a ser conhecida como a família Drew de Walworth. Desde sua descrição inicial até 1995, quando do diagnóstico genético final de DMJ, vários membros e gerações desta família foram examinados e seus achados descritos na literatura por famosos neurologistas como Gowers, Stewart, Collier, Kinnier-Wilson, Turner, Worster-Drought, Ferguson, Critchley e Anita Harding. Neste artigo, os autores descrevem a trajetória histórica tortuosa e as discussões sobre os diagnósticos nosológicos propostos no decorrer de um século, com o propósito de mostrar a impressionante e atraente complexidade que envolve este grupo de s neurodegenerativas.Autosomal dominant spinocerebellar ataxia (SCA is an heterogeneous group of neurodegenerative diseases involving cerebellum and its connections. Several forms have already been described, and it seems the most common form of SCA observed among the many series of families described worldwide is SCA3 (Machado-Joseph disease. SCA3 is characterized by a marked phenotypic expression with a wide spectrum of clinical findings including cerebellar ataxia, pyramidal and extrapyramidal (e.g. dystonia, parkinsonism, lower motor neuron syndrome and peripheral neuropathy. The Drew family of Walworth, England, has several affected members seen and described by famous neurologists including Gowers, Stewart, Collier, Kinnier-Wilson, Turner, Worster-Drought, Ferguson, Critchley, and Anita Harding from 1895 to our days. In fact, the final genetic

Proving communal warfare among hunter-gatherers: The Quasi-Rousseauan error.

Science.gov (United States)

Gat, Azar

2015-01-01

Was human fighting always there, as old as our species? Or is it a late cultural invention, emerging after the transition to agriculture and the rise of the state, which began, respectively, only around ten thousand and five thousand years ago? Viewed against the life span of our species, Homo sapiens, stretching back 150,000-200,000 years, let alone the roughly two million years of our genus Homo, this is the tip of the iceberg. We now have a temporal frame and plenty of empirical evidence for the "state of nature" that Thomas Hobbes and Jean-Jacque Rousseau discussed in the abstract and described in diametrically opposed terms. All human populations during the Pleistocene, until about 12,000 years ago, were hunter-gatherers, or foragers, of the simple, mobile sort that lacked accumulated resources. Studying such human populations that survived until recently or still survive in remote corners of the world, anthropology should have been uniquely positioned to answer the question of aboriginal human fighting or lack thereof. Yet access to, and the interpretation of, that information has been intrinsically problematic. The main problem has been the "contact paradox." Prestate societies have no written records of their own. Therefore, documenting them requires contact with literate state societies that necessarily affects the former and potentially changes their behavior, including fighting. © 2015 Wiley Periodicals, Inc.

Prey items and predation behavior of killer whales (Orcinus orca) in Nunavut, Canada based on Inuit hunter interviews

Science.gov (United States)

2012-01-01

Background Killer whales (Orcinus orca) are the most widely distributed cetacean, occurring in all oceans worldwide, and within ocean regions different ecotypes are defined based on prey preferences. Prey items are largely unknown in the eastern Canadian Arctic and therefore we conducted a survey of Inuit Traditional Ecological Knowledge (TEK) to provide information on the feeding ecology of killer whales. We compiled Inuit observations on killer whales and their prey items via 105 semi-directed interviews conducted in 11 eastern Nunavut communities (Kivalliq and Qikiqtaaluk regions) from 2007-2010. Results Results detail local knowledge of killer whale prey items, hunting behaviour, prey responses, distribution of predation events, and prey capture techniques. Inuit TEK and published literature agree that killer whales at times eat only certain parts of prey, particularly of large whales, that attacks on large whales entail relatively small groups of killer whales, and that they hunt cooperatively. Inuit observations suggest that there is little prey specialization beyond marine mammals and there are no definitive observations of fish in the diet. Inuit hunters and elders also documented the use of sea ice and shallow water as prey refugia. Conclusions By combining TEK and scientific approaches we provide a more holistic view of killer whale predation in the eastern Canadian Arctic relevant to management and policy. Continuing the long-term relationship between scientists and hunters will provide for successful knowledge integration and has resulted in considerable improvement in understanding of killer whale ecology relevant to management of prey species. Combining scientists and Inuit knowledge will assist in northerners adapting to the restructuring of the Arctic marine ecosystem associated with warming and loss of sea ice. PMID:22520955

OPERATION ODESSA: THE FLIGHT OF NAZI WAR CRIMINALS TO LATIN AMERICA AFTER WORLD WAR II AND THE NAZI HUNTERS

Directory of Open Access Journals (Sweden)

Marcos Eduardo Meinerz

2013-06-01

Full Text Available This article aims to analyze why Latin America, especially Argentina, was the region of the world that harbored the most Nazi war criminals—for example, Josef Mengele, Adolf Eichmann and Klaus Barbie—after World War II. It also aims to analyze how this fact has set the tone for the appearance of literary works about the fantastic adventures of “Nazi hunters” seeking the whereabouts of those individuals. For this purpose, in the first part of the article we will address Nazis’ escape to Latin America. Next, we analyze some literary works by authors who called themselves Nazi hunters.

Paraoxonases: ancient substrate hunters and their evolving role in ischemic heart disease.

Science.gov (United States)

Martinelli, Nicola; Consoli, Letizia; Girelli, Domenico; Grison, Elisa; Corrocher, Roberto; Olivieri, Oliviero

2013-01-01

Interest in the role of paraoxonases (PON) in cardiovascular research has increased substantially over the past two decades. These multifaceted and pleiotropic enzymes are encoded by three highly conserved genes (PON1, PON2, and PON3) located on chromosome 7q21.3-22.1. Phylogenetic analysis suggests that PON2 is the ancient gene from which PON1 and PON3 arose via gene duplication. Although PON are primarily lactonases with overlapping, but distinct specificities, their physiologic substrates remain poorly characterized. The most interesting characteristic of PON, however, is their multifunctional roles in various biochemical pathways. These include protection against oxidative damage and lipid peroxidation, contribution to innate immunity, detoxification of reactive molecules, bioactivation of drugs, modulation of endoplasmic reticulum stress, and regulation of cell proliferation/apoptosis. In general, PON appear as "hunters" of old and new substrates often involved in athero- and thrombogenesis. Although reduced PON activity appears associated with increased cardiovascular risk, the correlation between PON genotype and ischemic heart disease remains controversial. In this review, we examine the biochemical pathways impacted by these unique enzymes and investigate the potential use of PON as diagnostic tools and their impact on development of future therapeutic strategies.

A Biocultural Investigation of Gender Differences in Tobacco Use in an Egalitarian Hunter-Gatherer Population.

Science.gov (United States)

Roulette, Casey J; Hagen, Edward; Hewlett, Barry S

2016-06-01

In the developing world, the dramatic male bias in tobacco use is usually ascribed to pronounced gender disparities in social, political, or economic power. This bias might also reflect under-reporting by woman and/or over-reporting by men. To test the role of gender inequality on gender differences in tobacco use we investigated tobacco use among the Aka, a Congo Basin foraging population noted for its exceptionally high degree of gender equality. We also tested a sexual selection hypothesis-that Aka men's tobacco use is related to risk taking. Tobacco use, income, tobacco purchases, tobacco sharing, reasons for using tobacco, risk taking, and other variables were measured using structured surveys and peer reports. Tobacco use was verified by testing for salivary cotinine, a nicotine metabolite. Contrary to expectations, we found a very large male bias in tobacco use. Low levels of use among females appeared to be explained by aversions to tobacco, concerns over its negative effects on fetal health, and a desire to attract husbands, who prefer nonsmoking wives. High male use appeared to be related to a desire to enhance hunting abilities and attract and/or retain wives, who prefer husbands that smoke. We conclude that low levels of smoking by Aka women are better explained by the hypothesis that women evolved to avoid plant toxins to protect their fetuses and nursing infants. High male use might be better explained by sexual selection. We also highlight the important role that recreational drugs appear to play in hunter-gatherer sharing relationships.

The Implications of Victimhood Identity: The Case of ‘Persecution’ of Swedish Hunters

Directory of Open Access Journals (Sweden)

Erica von Essen

2017-06-01

Full Text Available This ethnographically based study examines Swedish hunters’ claims to victimhood through appeal to the term ‘persecution’. Perceiving disenfranchisement, injustice and discrimination on the basis of wolf conservation policy, we present hunters’ self-styled predicament as victimhood-claimants of persecution at the hands of a state that has been co-opted by a conservationist, pro-wolf agenda that systematically disenfranchises rural and hunting interests and lifestyles. Through the phenomenological accounts of hunter respondents, our paper takes seriously the hunters’ perception of persecution and, likewise, considers the opposite case made by conservationists: that wolves have been, and continue to be, the real victims of persecution in the conflict. Nonetheless, we show that the persecution language as it is applied from opposing parties in the conflict is problematic inasmuch as it is focused around creating a moral panic and confusion among the Swedish public who are ultimately responsible, as a democratic body-politic, for assessing the legitimacy of claims to moral wrong-doing and legal redress for the wronged. Our case study joins scholarship that explores the pathologies of claims to victimization

Diagnosis of tuberculosis in the wild boar (Sus scrofa: a comparison of methods applicable to hunter-harvested animals.

Directory of Open Access Journals (Sweden)

Nuno Santos

Full Text Available BACKGROUND: To obtain robust epidemiological information regarding tuberculosis (TB in wildlife species, appropriate diagnostic methods need to be used. Wild boar (Sus scrofa recently emerged as a major maintenance host for TB in some European countries. Nevertheless, no data is available to evaluate TB post-mortem diagnostic methods in hunter-harvested wild boar. METHODOLOGY/PRINCIPAL FINDINGS: Six different diagnostic methods for TB were evaluated in parallel in 167 hunter-harvested wild boar. Compared to bacteriological culture, estimates of sensitivity of histopathology was 77.8%, gross pathology 72.2%, PCR for the MPB70 gene 66.7%, detection of acid-fast bacilli (AFB in tissue contact smears 55.6% and in histopathology slides 16.7% (estimated specificity was 96.7%, 100%, 100%, 94.4% and 100%, respectively. Combining gross pathology with stained smears in parallel increased estimated sensitivity to 94.4% (94.4% specificity. Four probable bacteriological culture false-negative animals were identified by Discriminant Function Analysis. Recalculating the parameters considering these animals as infected generated estimated values for sensitivity of bacteriology and histopathology of 81.8%, gross pathology 72.7%, PCR for the MPB70 gene 63.6%, detection of AFB in tissue contact smears 54.5% and in histopathology slides 13.6% (estimated specificity was 100% for gross pathology, PCR, bacteriology and detection of AFB in histopathology slides, 96.7% for histopathology and 94.4% for stained smears. CONCLUSIONS/SIGNIFICANCE: These results show that surveys for TB in wild boar based exclusively on gross pathology considerably underestimate prevalence, while combination of tests in parallel much improves sensitivity and negative predictive values. This finding should thus be considered when planning future surveys and game meat inspection schemes. Although bacteriological culture is the reference test for TB diagnosis, it can generate false

Seasonal variation in Eurasian Wigeon Anas penelope sex and age ratios from hunter-based surveys

DEFF Research Database (Denmark)

Clausen, Kevin Kuhlmann; Dalby, Lars; Sunde, Peter

2013-01-01

dominated by adult males, and juvenile proportions were highest in November and significantly lower before and after this peak. Nationwide field assessments undertaken in January 2012 showed no significant differences from sex and age ratios in the wing survey data from that particular hunting season (2011...... schemes. This study found consistent seasonal variation in Eurasian Wigeon Anas penelope sex and age ratios among Danish hunter-based wing surveys, and describes how accounting for this variation might explain reported discrepancies between this and other monitoring methods. Early season flocks were....../2012), indicating that this survey is a good predictor of Wigeon demography. These results highlight the need to account for consistent temporal variation in such demographic time series when using the results to model population parameters....

Their grass is greener but ours is sweeter - thoroughbred breeding and water management in the Upper Hunter region of New South Wales, Australia

Energy Technology Data Exchange (ETDEWEB)

McManus, P. [University of Sydney, Sydney, NSW (Australia). School for Geoscience

2008-05-15

The Upper Hunter region (in New South Wales (NSW) around Scone is reputed to be the second most significant thoroughbred breeding region in the world after the Bluegrass region of Kentucky. This article identifies the importance and cultural constructions of grass, and hence water, in the thoroughbred breeding industry in this region. Thoroughbred stud managers attempt to produce environments attractive to potential horse purchasers and owners with mares to be mated. These environments are constructed from perceptions of how a thoroughbred stud should appear, and from the physical conditions of specific locations. One perception is that the grass should be green. There are differing opinions in the thoroughbred breeding industry about the nutritional value of irrigated grasses, the role of these grasses in horse development and the associated access to, cost of and efficacy of water used for this purpose. The paper concludes that effective water management in this industry is only possible if various cultures of nature are understood, where necessary challenged, and subsequently included in policy and planning.

Macrophysical climate models and Holocene hunter-gatherer subsistence shifts in Central Texas, USA

Science.gov (United States)

Mauldin, R. P.; Munoz, C.

2013-12-01

We use stable carbon isotopic values from bone collagen, as well as carbon values from carbonate extracted from bone apatite from 69 prehistoric human skeletal samples to investigate past resource use and climate relationships over the Middle and Late Holocene in Central Texas. Bone samples come from seven archaeological sites and samples date from 6,900 BP to the close of the prehistoric sequence at about 350 BP. Carbon isotopes from these samples suggest four broad dietary trends. From 6,900 through about 3,800 BP, carbon isotopes suggest a gradual increase in the consumption of resources that ultimately use a C3 photosynthetic pathway. A decline in δ13C in both collagen and carbonate values follows, suggesting a decrease in C3 resource use through roughly 2,900 BP. A variable, but once again increasing pattern on C3 resource use by prehistoric hunter-gatherers is indicated in bone isotopes through about 1,000 BP. After that date, a decrease in C3 resource dependence, with hints at greater subsistence diversity, is suggested through the close of the sequence at 350 BP. To assess the impact of climate shifts on this isotopic pattern, we developed a series of macrophysical climate models (MCM) for several locations in Central Texas focusing on fall, winter, and early spring precipitation. This fall-spring rainfall should closely determine C3 production. If subsistence shifts are responding to climate-induced changes in resource availability, then the measured hunter-gatherer carbon isotope trends summarized above should pattern with C3 production as monitored by the modeled fall-spring precipitation values. For the Middle Holocene portion of the sequence, the precipitation models suggest increasing C3 production, consistent with increasing C3 dependence shown in the isotopic data. A decline in C3 production between 3,900 and 3,000 BP in the models is also consistent with the isotopic decline at that point. After 3,000 BP, however, the coupling between fall

1500-year Record of trans-Pacific Dust Flux collected from the Denali Ice Core, Mt. Hunter, Alaska

Science.gov (United States)

Saylor, P. L.; Osterberg, E. C.; Koffman, B. G.; Winski, D.; Ferris, D. G.; Kreutz, K. J.; Wake, C. P.; Handley, M.; Campbell, S. W.

2016-12-01

Mineral dust aerosols are a critical component of the climate system through their influence on atmospheric radiative forcing, ocean productivity, and surface albedo. Dust aerosols derived from Asian deserts are known to reach as far as Europe through efficient transport in the upper tropospheric westerlies. While centennially-to-millennially resolved Asian dust records exist over the late Holocene from North Pacific marine sediment cores and Asian loess deposits, a high-resolution (sub-annual to decadal) record of trans-Pacific dust flux will significantly improve our understanding of North Pacific dust-climate interactions and provide paleoclimatological context for 20th century dust activity. Here we present an annually resolved 1500-year record of trans-Pacific dust transport based on chemical and physical dust measurements in parallel Alaskan ice cores (208 m to bedrock) collected from the summit plateau of Mt. Hunter in Denali National Park. The cores were sampled at high resolution using a continuous melter system with discrete analyses for major ions (Dionex ion chromatograph), trace elements (Element2 inductively coupled plasma mass spectrometer), and stable water isotope ratios (Picarro laser ringdown spectroscopy), and continuous flow analysis for dust concentration and size distribution (Klotz Abakus). We compare the ice core dust record to instrumental aerosol stations, satellite observations, and dust model data from the instrumental period, and evaluate climatic controls on dust emission and trans-Pacific transport using climate reanalysis data, to inform dust-climate relationships over the past 1500 years. Physical particulate and chemical data demonstrate remarkable fidelity at sub-annual resolution, with both displaying a strong springtime peak consistent with periods of high dust activity over Asian desert source regions. Preliminary results suggest volumetric mode typically ranges from 4.5 - 6.5 um, with a mean value of 5.5 um. Preliminary

Mitigating the health impacts of a natural disaster--the June 2007 long-weekend storm in the Hunter region of New South Wales.

Science.gov (United States)

Cretikos, Michelle A; Merritt, Tony D; Main, Kelly; Eastwood, Keith; Winn, Linda; Moran, Lucille; Durrheim, David N

A severe storm that began on Thursday, 7 June 2007 brought heavy rains and gale-force winds to Newcastle, Gosford, Wyong, Sydney, and the Hunter Valley region of New South Wales. The storm caused widespread flooding and damage to houses, businesses, schools and health care facilities, and damaged critical infrastructure. Ten people died as a result of the storm, and approximately 6000 residents were evacuated. A natural disaster was declared in 19 local government areas, with damage expected to reach $1.5 billion. Additional demands were made on clinical health services, and interruption of the electricity supply to over 200,000 homes and businesses, interruption of water and gas supplies, and sewerage system pump failures presented substantial public health threats. A public health emergency operations centre was established by the Hunter New England Area Health Service to coordinate surveillance activities, respond to acute public health issues and prevent disease outbreaks. Public health activities focused on providing advice, cooperating with emergency service agencies, monitoring water quality and availability, preventing illness from sewage-contaminated flood water, assessing environmental health risks, coordinating the local government public health response, and surveillance for storm-related illness and disease outbreaks, including gastroenteritis. The local ABC (Australian Broadcasting Corporation) radio station played a key role in disseminating public health advice. A household survey conducted within a fortnight of the storm established that household preparedness and storm warning systems could be improved.

Operations Charioteer, Musketeer, Touchstone, Cornerstone, Aqueduct, Sculpin and Julin. Tests Mill Yard, Diamond Beech, Mighty Oak, Middle Note Mission Ghost, Mission Cyber, Misty Echo, Disko Elm, Mineral Quarry, Distant Zenith, Diamond Fortune, and Hunters Trophy

National Research Council Canada - National Science Library

Schoengold, Carole

1999-01-01

...; Tests MILL YARD, DIAMOND BEECH, MIGHTY OAK, MIDDLE NOTE, MISSION GHOST, MISSION CYBER, MISTY ECHO, DISKO ELM, MINERAL QUARRY, DISTANT ZENITH, DIAMOND FORTUNE, and HUNTERS TROPHY, 9 October 1985 to 18 September 1992...

Hunter-gatherer postcranial robusticity relative to patterns of mobility, climatic adaptation, and selection for tissue economy.

Science.gov (United States)

Stock, J T

2006-10-01

Human skeletal robusticity is influenced by a number of factors, including habitual behavior, climate, and physique. Conflicting evidence as to the relative importance of these factors complicates our ability to interpret variation in robusticity in the past. It remains unclear how the pattern of robusticity in the skeleton relates to adaptive constraints on skeletal morphology. This study investigates variation in robusticity in claviculae, humeri, ulnae, femora, and tibiae among human foragers, relative to climate and habitual behavior. Cross-sectional geometric properties of the diaphyses are compared among hunter-gatherers from southern Africa (n = 83), the Andaman Islands (n = 32), Tierra del Fuego (n = 34), and the Great Lakes region (n = 15). The robusticity of both proximal and distal limb segments correlates negatively with climate and positively with patterns of terrestrial and marine mobility among these groups. However, the relative correspondence between robusticity and these factors varies throughout the body. In the lower limb, partial correlations between polar second moment of area (J(0.73)) and climate decrease from proximal to distal section locations, while this relationship increases from proximal to distal in the upper limb. Patterns of correlation between robusticity and mobility, either terrestrial or marine, generally increase from proximal to distal in the lower and upper limbs, respectively. This suggests that there may be a stronger relationship between observed patterns of diaphyseal hypertrophy and behavioral differences between populations in distal elements. Despite this trend, strength circularity indices at the femoral midshaft show the strongest correspondence with terrestrial mobility, particularly among males.

Genomic insights into the origin and diversification of late maritime hunter-gatherers from the Chilean Patagonia.

Science.gov (United States)

de la Fuente, Constanza; Ávila-Arcos, María C; Galimany, Jacqueline; Carpenter, Meredith L; Homburger, Julian R; Blanco, Alejandro; Contreras, Paloma; Cruz Dávalos, Diana; Reyes, Omar; San Roman, Manuel; Moreno-Estrada, Andrés; Campos, Paula F; Eng, Celeste; Huntsman, Scott; Burchard, Esteban G; Malaspinas, Anna-Sapfo; Bustamante, Carlos D; Willerslev, Eske; Llop, Elena; Verdugo, Ricardo A; Moraga, Mauricio

2018-04-24

Patagonia was the last region of the Americas reached by humans who entered the continent from Siberia ∼15,000-20,000 y ago. Despite recent genomic approaches to reconstruct the continental evolutionary history, regional characterization of ancient and modern genomes remains understudied. Exploring the genomic diversity within Patagonia is not just a valuable strategy to gain a better understanding of the history and diversification of human populations in the southernmost tip of the Americas, but it would also improve the representation of Native American diversity in global databases of human variation. Here, we present genome data from four modern populations from Central Southern Chile and Patagonia ( n = 61) and four ancient maritime individuals from Patagonia (∼1,000 y old). Both the modern and ancient individuals studied in this work have a greater genetic affinity with other modern Native Americans than to any non-American population, showing within South America a clear structure between major geographical regions. Native Patagonian Kawéskar and Yámana showed the highest genetic affinity with the ancient individuals, indicating genetic continuity in the region during the past 1,000 y before present, together with an important agreement between the ethnic affiliation and historical distribution of both groups. Lastly, the ancient maritime individuals were genetically equidistant to a ∼200-y-old terrestrial hunter-gatherer from Tierra del Fuego, which supports a model with an initial separation of a common ancestral group to both maritime populations from a terrestrial population, with a later diversification of the maritime groups.

The neutrino hunters the chase for the ghost particle and the secrets of the universe

CERN Document Server

Jayawardhana, Ray

2014-01-01

In Neutrino Hunters, the renowned astrophysicist and award-winning writer Ray Jayawardhana takes us on a thrilling journey into the shadowy world of neutrinos and the colorful lives of those who seek them. Demystifying particle science along the way, Jayawardhana tells a detective story with cosmic implications—interweaving tales of the sharp-witted theorist Wolfgang Pauli; the troubled genius Ettore Majorana; the harbinger of the atomic age Enrico Fermi; the notorious Cold War defector Bruno Pontecorvo; and the dynamic dream team of Marie and Pierre Curie. Then there are the scientists of today who have caught the neutrino bug, and whose experimental investigations stretch from a working nickel mine in Ontario to a long tunnel through a mountain in central Italy, from a nuclear waste site in New Mexico to a bay on the South China Sea, and from Olympic-size pools deep underground to a gigantic cube of Antarctic ice—called, naturally, IceCube. As Jayawardhana recounts a captivating saga of scientific disc...

Transsulfuration pathway thiols and methylated arginines: the Hunter Community Study.

Directory of Open Access Journals (Sweden)

Arduino A Mangoni

Full Text Available Serum homocysteine, when studied singly, has been reported to be positively associated both with the endogenous nitric oxide synthase inhibitor asymmetric dimethylarginine [ADMA, via inhibition of dimethylarginine dimethylaminohydrolase (DDAH activity] and with symmetric dimethylarginine (SDMA. We investigated combined associations between transsulfuration pathway thiols, including homocysteine, and serum ADMA and SDMA concentrations at population level.Data on clinical and demographic characteristics, medication exposure, C-reactive protein, serum ADMA and SDMA (LC-MS/MS, and thiols (homocysteine, cysteine, taurine, glutamylcysteine, total glutathione, and cysteinylglycine; capillary electrophoresis were collected from a sample of the Hunter Community Study on human ageing [n = 498, median age (IQR = 64 (60-70 years].REGRESSION ANALYSIS SHOWED THAT: a age (P = 0.001, gender (P = 0.03, lower estimated glomerular filtration rate (eGFR, P = 0.08, body mass index (P = 0.008, treatment with beta-blockers (P = 0.03, homocysteine (P = 0.02, and glutamylcysteine (P = 0.003 were independently associated with higher ADMA concentrations; and b age (P = 0.001, absence of diabetes (P = 0.001, lower body mass index (P = 0.01, lower eGFR (P<0.001, cysteine (P = 0.007, and glutamylcysteine (P < 0.001 were independently associated with higher SDMA concentrations. No significant associations were observed between methylated arginines and either glutathione or taurine concentrations.After adjusting for clinical, demographic, biochemical, and pharmacological confounders the combined assessment of transsulfuration pathway thiols shows that glutamylcysteine has the strongest and positive independent associations with ADMA and SDMA. Whether this reflects a direct effect of glutamylcysteine on DDAH activity (for ADMA and/or cationic amino acid transport requires further investigations.

Jaguar conservation in southern Belize: Conflicts, perceptions, and prospects among mayan hunters

Directory of Open Access Journals (Sweden)

Michael K Steinberg

2016-01-01

Full Text Available Belize has emerged as an international leader in jaguar conservation through the creation of numerous protected areas that contain prime cat habitat and by strengthening conservation laws. For example, in 1984, Belize created the Cockscomb Basin Jaguar Preserve, the first special jaguar protection area in the Americas. In 1995, the government expanded Cockscomb by creating the adjacent Chiquibul National Park. In 2010, the government continued this commitment to jaguar conservation by creating the Labouring Creek Jaguar Corridor Wildlife Sanctuary in central Belize. As a result of these protected areas, Belize has been rightfully lauded as a leader in nature-based tourism and protected areas creation in Central America. However, outside national parks and communities that directly benefit from ecotourism, it is less clear how supportive rural residents are of cat conservation. It is also not clear if jaguars persist outside protected areas in locations such as southern Belize, where the environment has been significantly altered by human activities. Through interviews with Mayan hunters, this paper investigates the attitudes towards jaguars, human-jaguar conflicts, and potential community-based jaguar conservation in two Mayan villages in the Toledo District in southern Belize. Also, using indirect methods, the paper documents the presence/absence and other temporal/spatial aspects of jaguars in a heavily altered landscape in southern Belize.

The Importance of Why: An Intelligence Approach for a Multi-Polar World

Science.gov (United States)

2016-04-04

code breakers drew information from 1 Sun Tzu , The Art of War. Translated by Samuel B...document_conversions/17/20110525.pdf (accessed December 29, 2015) Tzu , Sun . The Art of War. Translated by Samuel B. Griffith. New York: Oxford...Systems, and Game Theory..................................................... 63 Bibliography

Traditional Bulgarian Hunter's Cuisine (Hunter's Cooking Book (1939 [In Bulgarian

Directory of Open Access Journals (Sweden)

A. Petrushev

2012-09-01

Full Text Available This very rare book was published in Belogradchik in 1939. The publisher is Stamen Kamenov. Stamen Kamenov owned a printing press, where several books of local and national importance were printed. This is a cookbook with recipes for cooking wild game. The book is relevant to modern man because it shows what has been the cuisine of old Bulgarians.

Irradiation as a quarantine treatment against the invader fruit fly (Bactrocera Invadens, Drew) in mangoes (Mangifera Indica L,)

International Nuclear Information System (INIS)

Odai, B.T.

2010-06-01

The detection of the African invader fly, Bactrocera invadens Drew, Tsuruta and White, in Ghana has led to limitations in the export of mango fruits from Ghana to other countries. The limitations ranging from increased control costs to outright rejection of exports has necessitated a study in the area of quarantine treatment. A study was conducted to ascertain the effectiveness of gamma radiation for control of Bactrocera invadens in fruit destined for export. Pupae were obtained from the incubation of mango fruits collected from various locations. Adults were reared and infestation levels were determined after fruits were exposed to 5, 10, 20 females in different cages. Late instar larvae in fruits were irradiated at 15, 25, 35, 45, 50, 60 and 75 Gy to determine an effective dose for B. invadens. The mortality of the fly was determined at the various doses to obtain a probit 9 figure of 68.06 Gy (rounded to 70 Gy). The confirmatory test for 3050 larvae endorsed the effective dose as the probit 9 dose. Non-infested mature green export grade mango fruits were irradiated with 0, 70 and 150 Gy to determine its effect on ascorbic acid and total acidity content, sweetness, colour, juiciness, sourness, aroma and firmness of the mango fruits. Ascorbic acid and total acidity were not irradiation dependent. Varietal differences (p 0.05) by irradiation. Varietal differences did not affect the acceptability of the sweetness, sourness and colour of the fruits (p>0.05). Storage days significantly affected (p<0.05) the acceptability of all the sensory attributes. (au)

The night of the hunter: children & adults in the secret

Directory of Open Access Journals (Sweden)

Terry caesar

2010-04-01

Full Text Available Night of the Hunter is  the 1956 Charles Laughton’s film considered  one of the best discussions about childhood. In this film, the story revolves around the fate of John and Pearl, two orphaned siblings whose father was hanged for stealing. The father had given the children the money, and they hid the money inside the girl’s doll. When the Preacher Powell enters their lives , both John and Pearl are in danger. The siblings have to keep a secret which is both where they put the money, and the fact that, for children, money is simply paper.

Barley (Hordeum vulgare) in the Okhotsk culture (5th-10th century AD) of northern Japan and the role of cultivated plants in hunter-gatherer economies.

Science.gov (United States)

Leipe, Christian; Sergusheva, Elena A; Müller, Stefanie; Spengler, Robert N; Goslar, Tomasz; Kato, Hirofumi; Wagner, Mayke; Weber, Andrzej W; Tarasov, Pavel E

2017-01-01

existed ca. 600-1000 cal yr AD across the island region. Despite a large body of studies and numerous theoretical and conceptual debates, the question of how to differentiate between hunter-gatherer and farming economies persists reflecting the wide range of dynamic subsistence strategies used by humans through the Holocene. Our current study contributes to the ongoing discussion of this important issue.

Barley (Hordeum vulgare in the Okhotsk culture (5th-10th century AD of northern Japan and the role of cultivated plants in hunter-gatherer economies.

Directory of Open Access Journals (Sweden)

Christian Leipe

domains possibly existed ca. 600-1000 cal yr AD across the island region. Despite a large body of studies and numerous theoretical and conceptual debates, the question of how to differentiate between hunter-gatherer and farming economies persists reflecting the wide range of dynamic subsistence strategies used by humans through the Holocene. Our current study contributes to the ongoing discussion of this important issue.

Effect of resource spatial correlation and hunter-fisher-gatherer mobility on social cooperation in Tierra del Fuego.

Directory of Open Access Journals (Sweden)

José Ignacio Santos

Full Text Available This article presents an agent-based model designed to explore the development of cooperation in hunter-fisher-gatherer societies that face a dilemma of sharing an unpredictable resource that is randomly distributed in space. The model is a stylised abstraction of the Yamana society, which inhabited the channels and islands of the southernmost part of Tierra del Fuego (Argentina-Chile. According to ethnographic sources, the Yamana developed cooperative behaviour supported by an indirect reciprocity mechanism: whenever someone found an extraordinary confluence of resources, such as a beached whale, they would use smoke signals to announce their find, bringing people together to share food and exchange different types of social capital. The model provides insight on how the spatial concentration of beachings and agents' movements in the space can influence cooperation. We conclude that the emergence of informal and dynamic communities that operate as a vigilance network preserves cooperation and makes defection very costly.

Re-evaluating the resource potential of lomas fog oasis environments for Preceramic hunter-gatherers under past ENSO modes on the south coast of Peru

Science.gov (United States)

Beresford-Jones, David; Pullen, Alexander G.; Whaley, Oliver Q.; Moat, Justin; Chauca, George; Cadwallader, Lauren; Arce, Susana; Orellana, Alfonso; Alarcón, Carmela; Gorriti, Manuel; Maita, Patricia K.; Sturt, Fraser; Dupeyron, Agathe; Huaman, Oliver; Lane, Kevin J.; French, Charles

2015-12-01

Lomas - ephemeral seasonal oases sustained by ocean fogs - were critical to ancient human ecology on the desert Pacific coast of Peru: one of humanity's few independent hearths of agriculture and "pristine" civilisation. The role of climate change since the Late Pleistocene in determining productivity and extent of past lomas ecosystems has been much debated. Here we reassess the resource potential of the poorly studied lomas of the south coast of Peru during the long Middle Pre-ceramic period (c. 8000-4500 BP): a period critical in the transition to agriculture, the onset of modern El Niño Southern Oscillation ('ENSO') conditions, and eustatic sea-level rise and stabilisation and beach progradation. Our method combines vegetation survey and herbarium collection with archaeological survey and excavation to make inferences about both Preceramic hunter-gatherer ecology and the changed palaeoenvironments in which it took place. Our analysis of newly discovered archaeological sites - and their resource context - show how lomas formations defined human ecology until the end of the Middle Preceramic Period, thereby corroborating recent reconstructions of ENSO history based on other data. Together, these suggest that a five millennia period of significantly colder seas on the south coast induced conditions of abundance and seasonal predictability in lomas and maritime ecosystems, that enabled Middle Preceramic hunter-gatherers to reduce mobility by settling in strategic locations at the confluence of multiple eco-zones at the river estuaries. Here the foundations of agriculture lay in a Broad Spectrum Revolution that unfolded, not through population pressure in deteriorating environments, but rather as an outcome of resource abundance.

Autoradiographical detection of cholecystokinin-A receptors in primate brain using 125I-Bolton Hunter CCK-8 and 3H-MK-329

International Nuclear Information System (INIS)

Hill, D.R.; Shaw, T.M.; Graham, W.; Woodruff, G.N.

1990-01-01

In vitro autoradiography was performed in order to visualize cholecystokinin-A (CCK-A) receptors in sections of Cynomolgus monkey brain. CCK-A receptors were defined as those which displayed high affinity for the selective non-peptide antagonist MK-329 (L-364,718) and were detected in several regions by selective inhibition of 125I-Bolton Hunter CCK using MK-329 or direct labeling with 3H-MK-329. In the caudal medulla, high densities of CCK-A sites were present in the nucleus tractus solitarius, especially the caudal and medial aspects, and also the dorsal motor nucleus of the vagus. CCK-A sites were localized to a number of hypothalamic nuclei such as the supraoptic and paraventricular nuclei, the dorsomedial and infundibular nuclei as well as the neurohypophysis. The mammillary bodies and supramammillary nuclei also contained CCK-A receptor sites. High concentrations of CCK-A receptors were present in the substantia nigra zona compacta and also the ventral tegmental area and may be associated with dopamine cell bodies. Binding of 3H-MK-329 was also detected in parts of the caudate nucleus and ventral putamen. The detection, by autoradiographical means, of CCK-A receptors throughout the Cynomolgus monkey brain contrasts with similar studies performed using rodents and suggests differences in the density and, perhaps, the importance of CCK-A receptors in the primate as opposed to the rodent. The data suggest the possibility that CCK-A receptors may be involved in a number of important brain functions as diverse as the processing of sensory information from the gut, the regulation of hormone secretion, and the activity of dopamine cell activity

Perceptions of on-site hunters: Environmental concerns, future land use, and cleanup options at the Savannah River Site

International Nuclear Information System (INIS)

Burger, J.; Sanchez, J.

1999-01-01

The Department of Energy owns land in 34 states, and most of these lands have been off limits to the public for over 50 years. Although some parts of each site are contaminated, most of many sites are not. With the ending of the Cold War, the department is considering alternative land uses. In this article, the perceptions of hunters and fishermen allowed on site for a limited time were examined, about environmental concerns, future land use, and cleanup options. Although loss of jobs was the foremost concern, preserving parts of the site had more support as a future land use than continuing the nuclear mission, and nearly three-quarters of the sample supported cleanup, regardless of cost. On-site employment was a significant indicator of lower concern about safety and environmental issues, less support for designating the site for research, and more concern for maintaining jobs

Robert Plant (1818–1858: A Victorian plant hunter in Natal, Zululand, Mauritius and the Seychelles

Directory of Open Access Journals (Sweden)

Donal P. McCracken

2011-03-01

Full Text Available In the 1850s Robert William Plant collected plants and other natural specimens in what is now KwaZulu-Natal. This one-time Englishman compiled a dictionary for gardeners before emigrating to Natal in 1850. There he worked as the agent for Samuel Stevens, the London dealer in ‘curiosities of natural history’. Though Plant collected mainly plants, he also sent consignments of beetles, butterflies, bird skins and shells back to Britain. He published the first scientific paper on Zululand and was requested by the Royal Botanic Gardens at Kew to write the first Flora natalensis. It was while collecting for this never-to-be-completed treatise that Plant contracted malaria in Maputaland. He died in St Lucia in 1858 and in doing so became South Africa’s martyr to botany. What emerges from this study is a picture of the difficulties faced by plant hunters in mid-19th-century South Africa, the sort of plants they collected and the necessity for them sometimes to diversify into other natural history products to survive.

Ancient DNA from hunter-gatherer and farmer groups from Northern Spain supports a random dispersion model for the Neolithic expansion into Europe.

Directory of Open Access Journals (Sweden)

Montserrat Hervella

Full Text Available BACKGROUND/PRINCIPAL FINDINGS: The phenomenon of Neolithisation refers to the transition of prehistoric populations from a hunter-gatherer to an agro-pastoralist lifestyle. Traditionally, the spread of an agro-pastoralist economy into Europe has been framed within a dichotomy based either on an acculturation phenomenon or on a demic diffusion. However, the nature and speed of this transition is a matter of continuing scientific debate in archaeology, anthropology, and human population genetics. In the present study, we have analyzed the mitochondrial DNA diversity in hunter-gatherers and first farmers from Northern Spain, in relation to the debate surrounding the phenomenon of Neolithisation in Europe. METHODOLOGY/SIGNIFICANCE: Analysis of mitochondrial DNA was carried out on 54 individuals from Upper Paleolithic and Early Neolithic, which were recovered from nine archaeological sites from Northern Spain (Basque Country, Navarre and Cantabria. In addition, to take all necessary precautions to avoid contamination, different authentication criteria were applied in this study, including: DNA quantification, cloning, duplication (51% of the samples and replication of the results (43% of the samples by two independent laboratories. Statistical and multivariate analyses of the mitochondrial variability suggest that the genetic influence of Neolithisation did not spread uniformly throughout Europe, producing heterogeneous genetic consequences in different geographical regions, rejecting the traditional models that explain the Neolithisation in Europe. CONCLUSION: The differences detected in the mitochondrial DNA lineages of Neolithic groups studied so far (including these ones of this study suggest different genetic impact of Neolithic in Central Europe, Mediterranean Europe and the Cantabrian fringe. The genetic data obtained in this study provide support for a random dispersion model for Neolithic farmers. This random dispersion had a different

Morphological and histological damage on reproduction organ of radio-sterilized male fruit flies bactrocera carambolae (drew & hancock) (diptera; tephritidae)

International Nuclear Information System (INIS)

Achmad Nasroh Kuswadi

2011-01-01

It is known that gamma irradiation of 90 Gy on pupae of Bactrocera carambolae (Drew & Hancock) fruit fly induced sterility on the adults, however limited data on the cause of sterility is available. To obtain such information, morphological and histological damages on the reproduction organ of male adult flies emerged from irradiated pupae were observed. Pupae of 9 day-old were irradiated with 90 Gy gamma, and the male adults of 7 and 14 day-old emerged from the pupae were dissected to obtained the testis. Morphology and size of the testis of irradiated and unirradiated flies were observed under the microscopes, each in 10 replicates. Preparate of the testis were also made and observed under the microscopes of 400 magnification. The results showed that significant damages were found on testis of the irradiated B. carambolae flies due to irradiation, so that the growth of the organ disturbed as shown by the smallers size of the irradiated testis as compare to the normal one. On the irradiated 7 day-old flies, the length and width of testis were 25.9 and 30.2 % smaller, while on those of 14 day-old the testis were 39.20 and 44.42 % smaller, than the normal. Besides smaller in size, dead germinal cells on the testis preparate were also observed. It is concluded that sterility on the male flies was due to the damage on the germinal cells so that abnormal spermatogenesis process happened. The smaller in size of the testis, is also differentiate between of the irradiated from the normal flies of B. carambolae. (author)

City Life in the Midst of the Forest: a Punan Hunter-Gatherer's Vision of Conservation and Development

Directory of Open Access Journals (Sweden)

Patrice Levang

2007-06-01

Full Text Available The Punan Tubu, a group of hunter-gatherers in East-Kalimantan, Indonesia, are used to illustrate the very real trade-offs that are made between conservation and development. This group has undergone various forms of resettlement in the 20th century, to the point that some are now settled close to the city of Malinau whereas others remain in remote locations in the upper Tubu catchment. This study is based on several years of ethnographic and household analysis. The Punan clearly favor both conservation and development. In the city, the Punan benefit from all positive effects of development. Child and infant mortality rates are very low, and illiteracy has been eradicated among the younger generation. However, the Punan complain that nothing in town is free. The older generation, in particular, resents the loss of Punan culture. Because of frustration and unemployment, young people often succumb to alcoholism and drug addiction. The Punan do not want to choose between conservation and development, between forest life and city life. They want to benefit from the advantages of both locations, to enjoy both free forest products and the positive aspects of modern life, to go wild boar hunting in the morning and watch television in the evening. In short, they want to enjoy city life in the midst of the forest. The same kind of contradiction has led to identity problems. They want to uphold the traditional life of the hunter-gatherer, but at the same time they reject marginalization and seek integration into the larger society. In short, they want integration without loss of identity. The settlement of Sule-Pipa illustrates how some groups have dealt with the contradiction more successfully. Thanks to good organization and charitable donations, they have secured educational facilities and basic health care, and marketing costs are reduced by collectively organized road and river transportation. The economy of the village is thriving, mainly because of

Quality characteristics of rice inoculated with Inonotus obliquus ...

African Journals Online (AJOL)

latif

2013-08-14

Aug 14, 2013 ... scavenging activity, Hunter`s color values, free amino acid content, and mineral content were investigated. ... important foods in the human diet and one of the most extended cereal crops ...... Gluten-Free Cereal Products and.

Natural histories of infectious disease: ecological vision in twentieth-century biomedical science.

Science.gov (United States)

Anderson, Warwick

2004-01-01

During the twentieth century, disease ecology emerged as a distinct disciplinary network within infectious diseases research. The key figures were Theobald Smith, F. Macfarlane Burnet, René Dubos, and Frank Fenner. They all drew on Darwinian evolutionism to fashion an integrative (but rarely holistic) understanding of disease processes, distinguishing themselves from reductionist "chemists" and mere "microbe hunters." They sought a more complex, biologically informed epidemiology. Their emphasis on competition and mutualism in the animated environment differed from the physical determinism that prevailed in much medical geography and environmental health research. Disease ecology derived in part from studies of the interaction of organisms - micro and macro - in tropical medicine, veterinary pathology, and immunology. It developed in postcolonial settler societies. Once a minority interest, disease ecology has attracted more attention since the 1980s for its explanations of disease emergence, antibiotic resistance, bioterrorism, and the health impacts of climate change.

Balinese Y-chromosome perspective on the peopling of Indonesia: genetic contributions from pre-neolithic hunter-gatherers, Austronesian farmers, and Indian traders.

Science.gov (United States)

Karafet, Tatiana M; Lansing, J S; Redd, Alan J; Reznikova, Svetlana; Watkins, Joseph C; Surata, S P K; Arthawiguna, W A; Mayer, Laura; Bamshad, Michael; Jorde, Lynn B; Hammer, Michael F

2005-02-01

The island of Bali lies near the center of the southern chain of islands in the Indonesian archipelago, which served as a stepping-stone for early migrations of hunter-gatherers to Melanesia and Australia and for more recent migrations of Austronesian farmers from mainland Southeast Asia to the Pacific. Bali is the only Indonesian island with a population that currently practices the Hindu religion and preserves various other Indian cultural, linguistic, and artistic traditions (Lansing 1983). Here, we examine genetic variation on the Y chromosomes of 551 Balinese men to investigate the relative contributions of Austronesian farmers and pre-Neolithic hunter-gatherers to the contemporary Balinese paternal gene pool and to test the hypothesis of recent paternal gene flow from the Indian subcontinent. Seventy-one Y-chromosome binary polymorphisms (single nucleotide polymorphisms, SNPs) and 10 Y-chromosome-linked short tandem repeats (STRs) were genotyped on a sample of 1,989 Y chromosomes from 20 populations representing Indonesia (including Bali), southern China, Southeast Asia, South Asia, the Near East, and Oceania. SNP genotyping revealed 22 Balinese lineages, 3 of which (O-M95, O-M119, and O-M122) account for nearly 83.7% of Balinese Y chromosomes. Phylogeographic analyses suggest that all three major Y-chromosome haplogroups migrated to Bali with the arrival of Austronesian speakers; however, STR diversity patterns associated with these haplogroups are complex and may be explained by multiple waves of Austronesian expansion to Indonesia by different routes. Approximately 2.2% of contemporary Balinese Y chromosomes (i.e., K-M9*, K-M230, and M lineages) may represent the pre-Neolithic component of the Indonesian paternal gene pool. In contrast, eight other haplogroups (e.g., within H, J, L, and R), making up approximately 12% of the Balinese paternal gene pool, appear to have migrated to Bali from India. These results indicate that the Austronesian expansion had a

How does a carnivore guild utilise a substantial but unpredictable anthropogenic food source? Scavenging on hunter-shot ungulate carcasses by wild dogs/dingoes, red foxes and feral cats in south-eastern Australia revealed by camera traps.

Science.gov (United States)

Forsyth, David M; Woodford, Luke; Moloney, Paul D; Hampton, Jordan O; Woolnough, Andrew P; Tucker, Mark

2014-01-01

There is much interest in understanding how anthropogenic food resources subsidise carnivore populations. Carcasses of hunter-shot ungulates are a potentially substantial food source for mammalian carnivores. The sambar deer (Rusa unicolor) is a large (≥ 150 kg) exotic ungulate that can be hunted throughout the year in south-eastern Australia, and hunters are not required to remove or bury carcasses. We investigated how wild dogs/dingoes and their hybrids (Canis lupus familiaris/dingo), red foxes (Vulpes vulpes) and feral cats (Felis catus) utilised sambar deer carcasses during the peak hunting seasons (i.e. winter and spring). We placed carcasses at 1-km intervals along each of six transects that extended 4-km into forest from farm boundaries. Visits to carcasses were monitored using camera traps, and the rate of change in edible biomass estimated at ∼ 14-day intervals. Wild dogs and foxes fed on 70% and 60% of 30 carcasses, respectively, but feral cats seldom (10%) fed on carcasses. Spatial and temporal patterns of visits to carcasses were consistent with the hypothesis that foxes avoid wild dogs. Wild dog activity peaked at carcasses 2 and 3 km from farms, a likely legacy of wild dog control, whereas fox activity peaked at carcasses 0 and 4 km from farms. Wild dog activity peaked at dawn and dusk, whereas nearly all fox activity occurred after dusk and before dawn. Neither wild dogs nor foxes remained at carcasses for long periods and the amount of feeding activity by either species was a less important predictor of the loss of edible biomass than season. Reasons for the low impacts of wild dogs and foxes on sambar deer carcass biomass include the spatially and temporally unpredictable distribution of carcasses in the landscape, the rapid rate of edible biomass decomposition in warm periods, low wild dog densities and the availability of alternative food resources.

Some of SAWTRI's important research findings on mohair

CSIR Research Space (South Africa)

Turpie, DWF

1985-06-01

Full Text Available Part I: Long, Mediumand Short Good to Average Style Kids, Young Goats and Adults, SA WTRI Tech. Rep. 488 (November, 1981). 21. Robinson, G.A., Hunter, L.. & Tavlor. H.. Spinning and Weaving of DREF ~ a ' m s having specialit; Fibreson the &&e, S....2%). Vegetablecontamination was fairly low (from O,1 to 1,7%), largely due to the superior style of the hair selected for the study. The suint was found to be acidic with pH values ranging from 3,3 to 6,2. STAPLE LENGTH AND STRENGTH: Traditionally, staple length...

Recent Discoveries of the Paijanense in The Upper Chicama, Moche and Virú Valleys, Northern Perú: New Perspectives on the First Hunter-Gatherers in the Andes of South America

OpenAIRE

Briceño, Jesús

2014-01-01

We present newly-registered Paiján sites in the interior and upper parts of the Chicama, Moche and Virú valleys, with strong tiesto the highland region. The research indicates that Paiján hunter-gatherers were not only a coastal group whose subsistence was basedon marine resources. They also occupied diverse ecological environments preferring springs with high mobility across the Andes and exploiting diverse resources, such as white-tail deer (Odocoileus virginianus) and raw materials for pro...

Traditional Knowledge About Polar Bears (Ursus maritimus in East Greenland: Changes in the Catch and Climate Over Two Decades

Directory of Open Access Journals (Sweden)

Kristin L. Laidre

2018-05-01

Full Text Available In Greenland, polar bears (Ursus maritimus are nutritional, economic, and cultural subsistence resources for Inuit. Traditional Ecological Knowledge (TEK collected from subsistence hunters can provide important insights and improve management decisions when collected systematically. We report on the results of a TEK survey of subsistence polar bear hunters living in the areas around Tasiilaq and Ittoqqortoormiit, East Greenland. Twenty-five full-time polar bear hunters were interviewed between December 2014 and March 2015 in a conversation-style interview, where a local interviewer fluent in the East Greenlandic dialect asked a series of 55 predetermined questions. The primary goals were to (1 gather Inuit perspectives on polar bear subsistence quotas and hunting strategies, (2 understand how climate change is affecting the polar bear subsistence hunt, and (3 document observed changes in polar bear distribution, abundance, and biology. Approximately 40% of the Tasiilaq respondents had caught between 10 and 19 polar bears in their lifetime, while 67% of Ittoqqortoormiit respondents reported lifetime catches of ≥20 bears. In both areas, polar bears were most commonly hunted between February and April. Hunters noted large changes to the climate in the areas where they hunt polar bears. Most hunters reported loss of sea ice, receding glaciers, unstable weather, and warmer temperatures. In Tasiilaq 73% of the hunters said climate changes had affected the polar bear hunt and in Ittoqqortoormiit about 88% of respondents reported the same. Hunters indicated that sea ice loss has created more areas of open water so dog sledges have become unsafe for hunting transportation compared to 10–15 years ago (reported by 100% of hunters in Tasiilaq and 80% in Ittoqqortoormiit. In Ittoqqortoormiit, the distance traveled during polar bear hunting trips has decreased dramatically. In both areas hunters noted that more polar bears are coming into their

Quantitative autoradiographic localization of cholecystokinin receptors in rat and guinea pig brain using 125I-Bolton-Hunter-CCK8

International Nuclear Information System (INIS)

Niehoff, D.L.

1989-01-01

The autoradiographic localization of receptors for the brain-gut peptide cholecystokinin (CCK) has shown differences in receptor distribution between rat and guinea pig brain. However the full anatomical extent of the differences has not been determined quantitatively. In the present study, 125 I-Bolton-Hunter-CCK8 ( 125 I-BH-CCK8) was employed in a comparative quantitative autoradiographic analysis of the distribution of CCK receptors in these two species. The pharmacological profile of 125 I-BH-CCK8 binding in guinea pig forebrain sections was comparable to those previously reported for rat and human. Statistically significant differences in receptor binding between rat and guinea pig occurred in olfactory bulb, caudate-putamen, amygdala, several cortical areas, ventromedial hypothalamus, cerebellum, and a number of midbrain and brainstem nuclei. The results of this study confirm the presence of extensive species-specific variation in the distribution of CCK receptors, suggesting possible differences in the physiological roles of this peptide in different mammalian species

Energy drew up 2008

International Nuclear Information System (INIS)

2008-01-01

This article is about the following topics: energy analysis, production and use, supply and demand, consumption, energy sources, petroleum products for energy production, energy demand by economic sector and final consumption.

Schooling, Local Knowledge and Working Memory: A Study among Three Contemporary Hunter-Gatherer Societies.

Science.gov (United States)

Reyes-García, Victoria; Pyhälä, Aili; Díaz-Reviriego, Isabel; Duda, Romain; Fernández-Llamazares, Álvaro; Gallois, Sandrine; Guèze, Maximilien; Napitupulu, Lucentezza

2016-01-01

Researchers have analysed whether school and local knowledge complement or substitute each other, but have paid less attention to whether those two learning models use different cognitive strategies. In this study, we use data collected among three contemporary hunter-gatherer societies with relatively low levels of exposure to schooling yet with high levels of local ecological knowledge to test the association between i) schooling and ii) local ecological knowledge and verbal working memory. Participants include 94 people (24 Baka, 25 Punan, and 45 Tsimane') from whom we collected information on 1) schooling and school related skills (i.e., literacy and numeracy), 2) local knowledge and skills related to hunting and medicinal plants, and 3) working memory. To assess working memory, we applied a multi-trial free recall using words relevant to each cultural setting. People with and without schooling have similar levels of accurate and inaccurate recall, although they differ in their strategies to organize recall: people with schooling have higher results for serial clustering, suggesting better learning with repetition, whereas people without schooling have higher results for semantic clustering, suggesting they organize recall around semantically meaningful categories. Individual levels of local ecological knowledge are not related to accurate recall or organization recall, arguably due to overall high levels of local ecological knowledge. While schooling seems to favour some organization strategies this might come at the expense of some other organization strategies.

Schooling, Local Knowledge and Working Memory: A Study among Three Contemporary Hunter-Gatherer Societies.

Directory of Open Access Journals (Sweden)

Victoria Reyes-García

Full Text Available Researchers have analysed whether school and local knowledge complement or substitute each other, but have paid less attention to whether those two learning models use different cognitive strategies. In this study, we use data collected among three contemporary hunter-gatherer societies with relatively low levels of exposure to schooling yet with high levels of local ecological knowledge to test the association between i schooling and ii local ecological knowledge and verbal working memory. Participants include 94 people (24 Baka, 25 Punan, and 45 Tsimane' from whom we collected information on 1 schooling and school related skills (i.e., literacy and numeracy, 2 local knowledge and skills related to hunting and medicinal plants, and 3 working memory. To assess working memory, we applied a multi-trial free recall using words relevant to each cultural setting. People with and without schooling have similar levels of accurate and inaccurate recall, although they differ in their strategies to organize recall: people with schooling have higher results for serial clustering, suggesting better learning with repetition, whereas people without schooling have higher results for semantic clustering, suggesting they organize recall around semantically meaningful categories. Individual levels of local ecological knowledge are not related to accurate recall or organization recall, arguably due to overall high levels of local ecological knowledge. While schooling seems to favour some organization strategies this might come at the expense of some other organization strategies.

Clinical response to long term enzyme replacement treatment in children, adolescent and adult patients with Hunter syndrome.

Science.gov (United States)

Dalmau Serra, Jaime; Vitoria Miñana, Isidro; Calderón Fernández, Rafael; Cortell Aznar, Isidoro

2015-11-06

Since enzyme replacement treatment (ERT) with idursulfase is available for Hunter syndrome (HS; mucopolysaccharidosis type II), for the first time, disease progression can be limited and organ damage reduced or prevented. We described retrospectively the clinical evolution of eight HS males, treated with ERT and followed in routine clinical practice in Hospital Infantil La Fe (Valencia, Spain). We studied three children, three adolescents and two adults. Time from diagnosis to ERT ranged from 13.7 to 0.2 years, and duration of ERT ranged from 24 to 77.1 months. From the start of ERT, weight and height increased in children and adolescents and remained stable in adults. Glycosaminoglycans (GAG) decreased in all patients; in patient 5 (aged 23 years), we observed the highest reduction (86%) with recovery of carpal tunnel syndrome, splenomegaly and a decrease in nocturnal oxygen dependence. Our results show that ERT improve respiratory impairment and organomegalies and decrease GAGs levels in all patients including children, adolescent and adults. While cardiac manifestations and facial features stabilized, responses in other parameters were heterogeneous. Copyright © 2015 Elsevier España, S.L.U. All rights reserved.

Heart Failure Hospitalisations in the Hunter New England Area Over 10 years. A Changing Trend.

Science.gov (United States)

Al-Omary, Mohammed S; Davies, Allan J; Khan, Arshad A; McGee, Michael; Bastian, Bruce; Leitch, James; Attia, John; Fletcher, Peter J; Boyle, Andrew J

2017-06-01

Heart failure carries a major burden on our health system, mainly related to the high rate of hospital admission. An understanding of the recent trends in heart failure hospitalisation is essential to the future allocation of health resources. Our aim is to analyse the temporal trends in heart failure hospitalisation. We extracted all separations in the Hunter New England Local Health District between 2005-2014 (n=40,119) with an ICD 10 code for heart failure (I-50) in the first four diagnoses on discharge. The numbers of hospitalisations were age-standardised to the 2001 Australian population and compared based on gender and remoteness. There was a decline in the age-standardised hospitalisation. However, there was a clear inflection point between 2009-2010, after which the decline levelled off. The absolute number of hospitalisations increased between 2010 and 2014. Heart failure hospitalisation was higher in males compared to females and rural compared to metropolitan inhabitants. The gains in heart failure treatment noted in recent years seem to have come to an end. Patients aged 75 years and older are contributing the majority of age-standardised hospitalisations. Copyright © 2016 Australian and New Zealand Society of Cardiac and Thoracic Surgeons (ANZSCTS) and the Cardiac Society of Australia and New Zealand (CSANZ). Published by Elsevier B.V. All rights reserved.

Climate-driven environmental changes around 8,200 years ago favoured increases in cetacean strandings and Mediterranean hunter-gatherers exploited them.

Science.gov (United States)

Mannino, Marcello A; Talamo, Sahra; Tagliacozzo, Antonio; Fiore, Ivana; Nehlich, Olaf; Piperno, Marcello; Tusa, Sebastiano; Collina, Carmine; Di Salvo, Rosaria; Schimmenti, Vittoria; Richards, Michael P

2015-11-17

Cetacean mass strandings occur regularly worldwide, yet the compounded effects of natural and anthropogenic factors often complicate our understanding of these phenomena. Evidence of past stranding episodes may, thus, be essential to establish the potential influence of climate change. Investigations on bones from the site of Grotta dell'Uzzo in North West Sicily (Italy) show that the rapid climate change around 8,200 years ago coincided with increased strandings in the Mediterranean Sea. Stable isotope analyses on collagen from a large sample of remains recovered at this cave indicate that Mesolithic hunter-gatherers relied little on marine resources. A human and a red fox dating to the 8.2-kyr-BP climatic event, however, acquired at least one third of their protein from cetaceans. Numerous carcasses should have been available annually, for at least a decade, to obtain these proportions of meat. Our findings imply that climate-driven environmental changes, caused by global warming, may represent a serious threat to cetaceans in the near future.

Quantitative autoradiographic localization of cholecystokinin receptors in rat and guinea pig brain using sup 125 I-Bolton-Hunter-CCK8

Energy Technology Data Exchange (ETDEWEB)

Niehoff, D.L. (Abbott Laboratories, Abbott Park, IL (USA))

1989-03-01

The autoradiographic localization of receptors for the brain-gut peptide cholecystokinin (CCK) has shown differences in receptor distribution between rat and guinea pig brain. However the full anatomical extent of the differences has not been determined quantitatively. In the present study, {sup 125}I-Bolton-Hunter-CCK8 ({sup 125}I-BH-CCK8) was employed in a comparative quantitative autoradiographic analysis of the distribution of CCK receptors in these two species. The pharmacological profile of {sup 125}I-BH-CCK8 binding in guinea pig forebrain sections was comparable to those previously reported for rat and human. Statistically significant differences in receptor binding between rat and guinea pig occurred in olfactory bulb, caudate-putamen, amygdala, several cortical areas, ventromedial hypothalamus, cerebellum, and a number of midbrain and brainstem nuclei. The results of this study confirm the presence of extensive species-specific variation in the distribution of CCK receptors, suggesting possible differences in the physiological roles of this peptide in different mammalian species.

Macronutrient contributions of insects to the diets of hunter-gatherers: a geometric analysis.

Science.gov (United States)

Raubenheimer, David; Rothman, Jessica M; Pontzer, Herman; Simpson, Stephen J

2014-06-01

We present a geometric model for examining the macronutrient contributions of insects in the diets of pre-agricultural humans, and relate the findings to some contemporary societies that regularly eat insects. The model integrates published data on the macronutrient composition of insects and other foods in the diets of humans, recommended human macronutrient intakes, and estimated macronutrient intakes to examine the assumption that insects provided to pre-agricultural humans an invertebrate equivalent of vertebrate-derived meats, serving primarily as a source of protein. Our analysis suggests that insects vary more widely in their macronutrient content than is likely to be the case for most wild vertebrate meats, spanning a broad range of protein, fat and carbohydrate concentrations. Potentially, therefore, in terms of their proportional macronutrient composition, insects could serve as equivalents not only of wild meat, but of a range of other foods including some shellfish, nuts, pulses, vegetables and even fruits. Furthermore, humans might systematically manipulate the composition of edible insects to meet specific needs through pre-ingestive processing, such as cooking and selective removal of body parts. We present data suggesting that in modern societies for which protein is the more limiting macronutrient, pre-ingestive processing of edible insects might serve to concentrate protein. It is likely, however, that the dietary significance of insects was different for Paleolithic hunter-gatherers who were more limited in non-protein energy. Our conclusions are constrained by available data, but highlight the need for further studies, and suggest that our model provides an integrative framework for conceiving these studies. Copyright © 2014 Elsevier Ltd. All rights reserved.

Irradiation of Eggs and Larvae of Bactrocera Carambolae (Drew and Hancock) Fruit Fly to Produce Irradiation Host for Its Parasitoids

International Nuclear Information System (INIS)

Achmad Nasroh Kuswadi; Murni lndarwatmi; Nasution, Indah Arastuti

2004-01-01

Bactrocera carambolae (Drew and Hancock) fruit fly, a major pests of commercial fruits in Indonesia, is attacked by several species of parasitoids in the field, such as by Biosteres sp. that attacks on early instar larvae and Opius sp. on late instar larvae. In order to produce irradiated host in mass rearing of both species, several dosage of gamma were tested on both eggs and larvae. Egg masses of 0.5 ml were irradiated with 0, 10, 20, 30, 40 and 50 Gy and then inoculated into artificial diet. Viability of the eggs, the larval period and the number of pupae produced were observed. About 200 third instar larvae irradiated with 0, 10, 30, 50,70 dan 90 Gy and the number and quality of the pupae developed were then observed. The results showed that the eggs irradiated with tested dosage did not reduce its viability however it reduced the survival of larvae emerged. Number of pupae produced from 0.5 ml irradiated eggs were reduced from 2740 pupae to 407, 167, 113, 53 and 44 pupae, besides the pupation delayed up to three days. Irradiation on third instars larvae did not reduce its pupation, since pupae were developed from > 85 % of irradiated larvae. However, irradiation did reduced the fly emergence from the pupae. Irradiated hosts for Biosteres sp and Opius sp can be produced by irradiating eggs however it should be evaluated since the survival rate of the larvae reduced. Irradiation of third instar larvae may produce irradiated host for Opius sp So, the use of irradiated eggs or irradiated larvae as host in the colonization of the parasitoids will insure no hosts emerged as adult. However it remain to be proved whether irradiated hosts are prefered and able to support the life of parasitoid. (author)

9 CFR 94.19 - Restrictions on importation from BSE minimal-risk regions of meat and edible products from...

Science.gov (United States)

2010-01-01

... OF ANIMALS (INCLUDING POULTRY) AND ANIMAL PRODUCTS RINDERPEST, FOOT-AND-MOUTH DISEASE, EXOTIC... encephalopathy. (e) Meat or dressed carcasses of hunter-harvested wild sheep, goats, or other ruminants other than cervids. The meat or dressed carcass (eviscerated and the head is removed) is derived from a wild...

How does a carnivore guild utilise a substantial but unpredictable anthropogenic food source? Scavenging on hunter-shot ungulate carcasses by wild dogs/dingoes, red foxes and feral cats in south-eastern Australia revealed by camera traps.

Directory of Open Access Journals (Sweden)

David M Forsyth

Full Text Available There is much interest in understanding how anthropogenic food resources subsidise carnivore populations. Carcasses of hunter-shot ungulates are a potentially substantial food source for mammalian carnivores. The sambar deer (Rusa unicolor is a large (≥ 150 kg exotic ungulate that can be hunted throughout the year in south-eastern Australia, and hunters are not required to remove or bury carcasses. We investigated how wild dogs/dingoes and their hybrids (Canis lupus familiaris/dingo, red foxes (Vulpes vulpes and feral cats (Felis catus utilised sambar deer carcasses during the peak hunting seasons (i.e. winter and spring. We placed carcasses at 1-km intervals along each of six transects that extended 4-km into forest from farm boundaries. Visits to carcasses were monitored using camera traps, and the rate of change in edible biomass estimated at ∼ 14-day intervals. Wild dogs and foxes fed on 70% and 60% of 30 carcasses, respectively, but feral cats seldom (10% fed on carcasses. Spatial and temporal patterns of visits to carcasses were consistent with the hypothesis that foxes avoid wild dogs. Wild dog activity peaked at carcasses 2 and 3 km from farms, a likely legacy of wild dog control, whereas fox activity peaked at carcasses 0 and 4 km from farms. Wild dog activity peaked at dawn and dusk, whereas nearly all fox activity occurred after dusk and before dawn. Neither wild dogs nor foxes remained at carcasses for long periods and the amount of feeding activity by either species was a less important predictor of the loss of edible biomass than season. Reasons for the low impacts of wild dogs and foxes on sambar deer carcass biomass include the spatially and temporally unpredictable distribution of carcasses in the landscape, the rapid rate of edible biomass decomposition in warm periods, low wild dog densities and the availability of alternative food resources.

How Does a Carnivore Guild Utilise a Substantial but Unpredictable Anthropogenic Food Source? Scavenging on Hunter-Shot Ungulate Carcasses by Wild Dogs/Dingoes, Red Foxes and Feral Cats in South-Eastern Australia Revealed by Camera Traps

Science.gov (United States)

Forsyth, David M.; Woodford, Luke; Moloney, Paul D.; Hampton, Jordan O.; Woolnough, Andrew P.; Tucker, Mark

2014-01-01

There is much interest in understanding how anthropogenic food resources subsidise carnivore populations. Carcasses of hunter-shot ungulates are a potentially substantial food source for mammalian carnivores. The sambar deer (Rusa unicolor) is a large (≥150 kg) exotic ungulate that can be hunted throughout the year in south-eastern Australia, and hunters are not required to remove or bury carcasses. We investigated how wild dogs/dingoes and their hybrids (Canis lupus familiaris/dingo), red foxes (Vulpes vulpes) and feral cats (Felis catus) utilised sambar deer carcasses during the peak hunting seasons (i.e. winter and spring). We placed carcasses at 1-km intervals along each of six transects that extended 4-km into forest from farm boundaries. Visits to carcasses were monitored using camera traps, and the rate of change in edible biomass estimated at ∼14-day intervals. Wild dogs and foxes fed on 70% and 60% of 30 carcasses, respectively, but feral cats seldom (10%) fed on carcasses. Spatial and temporal patterns of visits to carcasses were consistent with the hypothesis that foxes avoid wild dogs. Wild dog activity peaked at carcasses 2 and 3 km from farms, a likely legacy of wild dog control, whereas fox activity peaked at carcasses 0 and 4 km from farms. Wild dog activity peaked at dawn and dusk, whereas nearly all fox activity occurred after dusk and before dawn. Neither wild dogs nor foxes remained at carcasses for long periods and the amount of feeding activity by either species was a less important predictor of the loss of edible biomass than season. Reasons for the low impacts of wild dogs and foxes on sambar deer carcass biomass include the spatially and temporally unpredictable distribution of carcasses in the landscape, the rapid rate of edible biomass decomposition in warm periods, low wild dog densities and the availability of alternative food resources. PMID:24918425

Poachers and Poverty: Assessing Objective and Subjective Measures of Poverty among Illegal Hunters Outside Ruaha National Park, Tanzania

Directory of Open Access Journals (Sweden)

Eli J Knapp

2017-01-01

Full Text Available Illegal hunters in Africa may be making rational decisions about the hunting activities they partake in. These decisions could be linked to their socioeconomic status and the livelihood opportunities available to them. In particular, poverty is widely considered the leading driver that causes a household's inhabitants to take up poaching in protected areas. Programs aiming to protect vulnerable wildlife populations by mitigating poaching have historically relied upon income-based poverty metrics in efforts to reduce regional poverty and incentivise local inhabitants to discontinue poaching activities. Because such data sets that deal with poachers directly are rare, assumptions about the role of poverty, and the extent of poverty, that drives poaching have been hard to test. This study uses a unique sample of 173 self-admitted poachers living in villages adjacent to Ruaha National Park in Tanzania to explore the influence of poverty on poaching. Results indicated high demographic and household economy heterogeneity among poaching households. Capability deprivation examined more subjective measures of poverty and revealed that poachers are strongly motivated by the need to improve their incomes, but are not necessarily the poorest of the poor.

ISOLASI DAN IDENTIFIKASI SENYAWA KIMIA SERTA UJI AKTIVITAS ANTICANDIDAISIS SERBUK DAUN SIRIH DUDUK (Piper sarmentosum Roxb. Ex Hunter

Directory of Open Access Journals (Sweden)

Suwandri

2006-11-01

Full Text Available Sirih duduk or Piper sarmentosum Roxb. ex Hunter have been long used the people in Indonesia for traditional medicine to cure various diseases. One of them was used to treat fungoid diseases. This research was aimed to examine the anticandidaisis activity from extract of P. sarmentosum leaves and to isolate and identify the anticandidaisis compounds from P. sarmentosum leaves. The isolation bioactive compounds of P. sarmentosum leaves was performed by extraction the powder of P. sarmentosum leaves using methanol and the bioactivity tests were performed against Candida albicans. The methanol extracts was then fractionated using organic solvents such as n-hexane, benzene, chloroform, and ethyl acetate. Identification of the bioactive compounds was carried out using ultraviolet-visible spectrometry, fourier transform infra red spectrometry and gas chromatography-mass spectrometry. The result showed that the chloroform fraction of methanol extract of P. sarmentosum leaves have activity against C. albicans. The fractionation was performed by coloumn chromatography using n-hexane-ethyl acetate(1:1 eluent. A bioactive compound of sinamic acid derivative was 4-ethoxy-2-hidroxy-3,5-dimethoxy sinamic acid could be purely isolated.

Bear-baiting may exacerbate wolf-hunting dog conflict.

Science.gov (United States)

Bump, Joseph K; Murawski, Chelsea M; Kartano, Linda M; Beyer, Dean E; Roell, Brian J

2013-01-01

The influence of policy on the incidence of human-wildlife conflict can be complex and not entirely anticipated. Policies for managing bear hunter success and depredation on hunting dogs by wolves represent an important case because with increasing wolves, depredations are expected to increase. This case is challenging because compensation for wolf depredation on hunting dogs as compared to livestock is less common and more likely to be opposed. Therefore, actions that minimize the likelihood of such conflicts are a conservation need. We used data from two US states with similar wolf populations but markedly different wolf/hunting dog depredation patterns to examine the influence of bear hunting regulations, bear hunter to wolf ratios, hunter method, and hunter effort on wolf depredation trends. Results indicated that the ratio of bear hunting permits sold per wolf, and hunter method are important factors affecting wolf depredation trends in the Upper Great Lakes region, but strong differences exist between Michigan and Wisconsin related in part to the timing and duration of bear-baiting (i.e., free feeding). The probability that a wolf depredated a bear-hunting dog increases with the duration of bear-baiting, resulting in a relative risk of depredation 2.12-7.22× greater in Wisconsin than Michigan. The net effect of compensation for hunting dog depredation in Wisconsin may also contribute to the difference between states. These results identified a potential tradeoff between bear hunting success and wolf/bear-hunting dog conflict. These results indicate that management options to minimize conflict exist, such as adjusting baiting regulations. If reducing depredations is an important goal, this analysis indicates that actions aside from (or in addition to) reducing wolf abundance might achieve that goal. This study also stresses the need to better understand the relationship among baiting practices, the effect of compensation on hunter behavior, and depredation

The role of hunting in village livelihoods in the Ashanti region, Ghana

Directory of Open Access Journals (Sweden)

D Crookes

2014-05-01

Full Text Available The article describes the results of two surveys conducted in six villages in the Ashanti region of Ghana.  The first was undertaken in August 2002 and the second during July 2004.  A total of 468 hunters and non-hunters were surveyed using targeted and systematic interviewing techniques.  The results indicate that hunting is an important contributor to total income in the villages, particularly for poorer households.  We find some evidence that hunting increases during lean periods, especially for hunters in the household survey.  Distance to Kumasi is a significant determinant of the number of animals sold on the market, and also influences the type of gear used for hunting.  Compliance with wildlife laws, notably species restrictions and the closed season is low, particularly amongst professional hunters.

Planet hunters. VI. An independent characterization of KOI-351 and several long period planet candidates from the Kepler archival data

International Nuclear Information System (INIS)

Schmitt, Joseph R.; Wang, Ji; Fischer, Debra A.; Moriarty, John C.; Boyajian, Tabetha S.; Jek, Kian J.; LaCourse, Daryll; Omohundro, Mark R.; Winarski, Troy; Goodman, Samuel Jon; Jebson, Tony; Schwengeler, Hans Martin; Paterson, David A.; Schwamb, Megan E.; Lintott, Chris; Simpson, Robert; Lynn, Stuart; Smith, Arfon M.; Parrish, Michael; Schawinski, Kevin

2014-01-01

We report the discovery of 14 new transiting planet candidates in the Kepler field from the Planet Hunters citizen science program. None of these candidates overlapped with Kepler Objects of Interest (KOIs) at the time of submission. We report the discovery of one more addition to the six planet candidate system around KOI-351, making it the only seven planet candidate system from Kepler. Additionally, KOI-351 bears some resemblance to our own solar system, with the inner five planets ranging from Earth to mini-Neptune radii and the outer planets being gas giants; however, this system is very compact, with all seven planet candidates orbiting ≲ 1 AU from their host star. A Hill stability test and an orbital integration of the system shows that the system is stable. Furthermore, we significantly add to the population of long period transiting planets; periods range from 124 to 904 days, eight of them more than one Earth year long. Seven of these 14 candidates reside in their host star's habitable zone.

Results of the radiological survey at 110 E Hunter Avenue, Maywood, New Jersey (MJ022)

International Nuclear Information System (INIS)

Foley, R.D.; Carrier, R.F.; Floyd, L.M.; Crutcher, J.W.

1989-09-01

Maywood Chemical Works (MCW) of Maywood, New Jersey, generated process wastes and residues associated with the production and refining of thorium and thorium compounds from monazite ores from 1916 to 1956. MCW supplied rare earth metals and thorium compounds to the Atomic Energy Commission and various other government agencies from the late 1940s to the mid-1950s. Area residents used the sandlike waste from this thorium extraction process mixed with tea and cocoa leaves as mulch in their yards. Some of these contaminated wastes also eroded from the site into Lodi Brook. At the request of the US Department of Energy (DOE), a group from Oak Ridge National Laboratory conducts investigative radiological surveys of properties in the vicinity of MCW to determine whether a property is contaminated with radioactive residues, principally 232 Th, derived from the MCW site. The survey typically includes direct measurement of gamma radiation levels and soil sampling for radionuclide analyses. The survey of this site, 110 E. Hunter Avenue, Maywood, New Jersey (MJ022), was conducted during 1987. Following the removal of a small chunk of material showing elevated gamma exposure rates, all radionuclide concentrations and measurements conformed to DOE remedial action criteria. The slightly elevated radionuclide concentrations found in other soil samples were the result of naturally enhances radioactivity characteristic of some environmental materials such as coal ash and were unrelated to operations at the MCW site. The survey data demonstrate that the property requires no further action on the part of DOE. 4 refs., 2 figs., 3 tabs

Polygyny without wealth: popularity in gift games predicts polygyny in BaYaka Pygmies.

Science.gov (United States)

Chaudhary, Nikhil; Salali, Gul Deniz; Thompson, James; Dyble, Mark; Page, Abigail; Smith, Daniel; Mace, Ruth; Migliano, Andrea Bamberg

2015-05-01

The occurrence of polygynous marriage in hunter-gatherer societies, which do not accumulate wealth, remains largely unexplored since resource availability is dependent on male hunting capacity and limited by the lack of storage. Hunter-gatherer societies offer the greatest insight in to human evolution since they represent the majority of our species' evolutionary history. In order to elucidate the evolution of hunter-gatherer polygyny, we study marriage patterns of BaYaka Pygmies. We investigate (i) rates of polygyny among BaYaka hunter-gatherers; (ii) whether polygyny confers a fitness benefit to BaYaka men; (iii) in the absence of wealth inequalities, what are the alternative explanations for polygyny among the BaYaka. To understand the latter, we explore differences in phenotypic quality (height and strength), and social capital (popularity in gift games). We find polygynous men have increased reproductive fitness; and that social capital and popularity but not phenotypic quality might have been important mechanisms by which some male hunter-gatherers sustained polygynous marriages before the onset of agriculture and wealth accumulation.

ISOLASI DAN IDENTIFIKASI SENYAWA KIMIA SERTA UJI AKTIVITAS ANTICANDIDAISIS SERBUK DAUN SIRIH DUDUK (Piper sarmentosum Roxb. Ex Hunter

Directory of Open Access Journals (Sweden)

Suwandri Suwandri

2006-11-01

Full Text Available Sirih duduk or Piper sarmentosum Roxb. ex Hunter have been long used the people in Indonesia for traditional medicine to cure various diseases. One of them was used to treat fungoid diseases. This research was aimed to examine the anticandidaisis activity from extract of P. sarmentosum leaves and to isolate and identify the anticandidaisis compounds from P. sarmentosum leaves. The isolation bioactive compounds of P. sarmentosumleaves was performed by extraction the powder of P. sarmentosum leaves using methanol and the bioactivity tests were performed against Candida albicans. The methanol extracts was then fractionated using organic solvents such as n-hexane, benzene, chloroform, and ethyl acetate. Identification of the bioactive compounds was carried out using ultraviolet-visible spectrometry, fourier transform infra red spectrometry and gas chromatography-mass spectrometry. The result showed that the chloroform fraction of methanol extract of P. sarmentosum leaves have activity against C. albicans. The fractionation was performed by coloumn chromatography using n-hexane-ethyl acetate(1:1 eluent. A bioactive compound of sinamic acid derivative was 4-ethoxy-2-hidroxy-3,5-dimethoxy sinamic acid could be purely isolated.

Access to Electric Light Is Associated with Shorter Sleep Duration in a Traditionally Hunter-Gatherer Community.

Science.gov (United States)

de la Iglesia, Horacio O; Fernández-Duque, Eduardo; Golombek, Diego A; Lanza, Norberto; Duffy, Jeanne F; Czeisler, Charles A; Valeggia, Claudia R

2015-08-01

Access to electric light might have shifted the ancestral timing and duration of human sleep. To test this hypothesis, we studied two communities of the historically hunter-gatherer indigenous Toba/Qom in the Argentinean Chaco. These communities share the same ethnic and sociocultural background, but one has free access to electricity while the other relies exclusively on natural light. We fitted participants in each community with wrist activity data loggers to assess their sleep-wake cycles during one week in the summer and one week in the winter. During the summer, participants with access to electricity had a tendency to a shorter daily sleep bout (43 ± 21 min) than those living under natural light conditions. This difference was due to a later daily bedtime and sleep onset in the community with electricity, but a similar sleep offset and rise time in both communities. In the winter, participants without access to electricity slept longer (56 ± 17 min) than those with access to electricity, and this was also related to earlier bedtimes and sleep onsets than participants in the community with electricity. In both communities, daily sleep duration was longer during the winter than during the summer. Our field study supports the notion that access to inexpensive sources of artificial light and the ability to create artificially lit environments must have been key factors in reducing sleep in industrialized human societies. © 2015 The Author(s).

Preliminary assessment report for Army Aviation Support Facility No. 3, Installation 13307, Hunter Army Airfield, Savannah, Georgia

International Nuclear Information System (INIS)

Kolpa, R.; Smith, K.

1993-07-01

This report presents the results of the preliminary assessment (PA) conducted by Argonne National Laboratory at the Georgia Army National Guard property located on Hunter Army Airfield (HAA) near Savannah, Georgia, known as Army Aviation Support Facility (AASF) No. 3. Preliminary assessments of federal facilities are being conducted to compile the information necessary for completing preremedial activities and to provide a basis for establishing corrective actions in response to releases of hazardous substances. The principal objective of the PA is to characterize the site accurately and determine the need for further action by examining site activities, types and quantities of hazardous substances utilized, the nature and amounts of wastes generated or stored at the facility, and potential pathways by which contamination could affect public health and the environment. This PA satisfies, for the AASF No. 3 property, requirements of the Department of Defense Installation Restoration Program (IRP). The scope of this assessment is limited to the facilities and past activities contained within the area now occupied by AASF No. 3. However, this assessment report is intended to be read in conjunction with a previous IRP assessment of HAA completed in 1992 (USATHAMA 1992) and to provide comprehensive information on AASF No. 3 for incorporation with information contained in that previous assessment for the entirety of HAA

A comparison of antemortem tooth loss in human hunter-gatherers and non-human catarrhines: implications for the identification of behavioral evolution in the human fossil record.

Science.gov (United States)

Gilmore, Cassandra C

2013-06-01

Middle and Late Pleistocene fossil hominin specimens with severe antemortem tooth loss are often regarded as evidence for the precocious evolution of human-like behaviors, such as conspecific care or cooking, in ancient hominin species. The goal of this project was to ask whether the theoretical association between antemortem tooth loss and uniquely human behaviors is supported empirically in a large skeletal sample of human hunter-gatherers, chimpanzees, orangutans, and baboons. Binomial regression modeling in a Bayesian framework allows for the investigation of the effects of tooth class, genus, age, and sex on the likelihood of tooth loss. The results strongly suggest that modern humans experience more antemortem tooth loss than non-human primates and identify age in years as an important predictor. Once age is accounted for, the difference between the humans and the closest non-human genus (chimpanzees) is less pronounced; humans are still more likely on average to experience antemortem tooth loss though 95% uncertainty envelopes around the average prediction for each genus show some overlap. These analyses support theoretical links between antemortem tooth loss and modern human characteristics; humans' significantly longer life history and a positive correlation between age and antemortem tooth loss explain, in part, the reason why humans are more likely to experience tooth loss than non-human primates, but the results do not exclude behavioral differences as a contributing factor. Copyright © 2013 Wiley Periodicals, Inc.

Bear-baiting may exacerbate wolf-hunting dog conflict.

Directory of Open Access Journals (Sweden)

Joseph K Bump

Full Text Available BACKGROUND: The influence of policy on the incidence of human-wildlife conflict can be complex and not entirely anticipated. Policies for managing bear hunter success and depredation on hunting dogs by wolves represent an important case because with increasing wolves, depredations are expected to increase. This case is challenging because compensation for wolf depredation on hunting dogs as compared to livestock is less common and more likely to be opposed. Therefore, actions that minimize the likelihood of such conflicts are a conservation need. METHODOLOGY/PRINCIPAL FINDINGS: We used data from two US states with similar wolf populations but markedly different wolf/hunting dog depredation patterns to examine the influence of bear hunting regulations, bear hunter to wolf ratios, hunter method, and hunter effort on wolf depredation trends. Results indicated that the ratio of bear hunting permits sold per wolf, and hunter method are important factors affecting wolf depredation trends in the Upper Great Lakes region, but strong differences exist between Michigan and Wisconsin related in part to the timing and duration of bear-baiting (i.e., free feeding. The probability that a wolf depredated a bear-hunting dog increases with the duration of bear-baiting, resulting in a relative risk of depredation 2.12-7.22× greater in Wisconsin than Michigan. The net effect of compensation for hunting dog depredation in Wisconsin may also contribute to the difference between states. CONCLUSIONS/SIGNIFICANCE: These results identified a potential tradeoff between bear hunting success and wolf/bear-hunting dog conflict. These results indicate that management options to minimize conflict exist, such as adjusting baiting regulations. If reducing depredations is an important goal, this analysis indicates that actions aside from (or in addition to reducing wolf abundance might achieve that goal. This study also stresses the need to better understand the relationship

Mollie Lentaigne, the nurse who drew McIndoe's Guinea pigs: Exploring the role of a medical artist at the Queen Victoria Hospital, 1940-1945.

Science.gov (United States)

Baldwin, Alexander J

2018-04-16

Mollie Lentaigne was a medical artist who worked at the Queen Victoria Hospital in East Grinstead during the Second World War alongside Archibald McIndoe and his dedicated team. She drew hundreds of medical illustrations for McIndoe and his fellow surgeons during the years between 1940 and 1945. Her illustrations depict the plastic surgery that was carried out in that hospital on the badly burnt RAF servicemen injured during the war that took place in the skies over Europe, which included many aircrew injured during the Battle of Britain. This project looks at the career of Lentaigne and her role within the surgical team in East Grinstead during that era and explores a number of Lentaigne's illustrations whilst providing context as to the procedures and patients depicted. An examination of Lentaigne's story, using an interview conducted by the author with the artist offers an alternative perspective with which to observe the events that unfolded in East Grinstead during that conflict. An analysis of these images shows the ability of this artist to portray relatively complex operations with a series of simple pencil or ink diagrams whilst also skilfully engaging the observer's sense of touch. The ability of a medical artist to be selective with her illustrations allowed them to provide clearer, less cluttered images that were preferred by McIndoe when recording the specific surgical procedures for use in the patient's medical records. Copyright © 2018 British Association of Plastic, Reconstructive and Aesthetic Surgeons. Published by Elsevier Ltd. All rights reserved.

Frequency and developmental timing of linear enamel hypoplasia defects in Early Archaic Texan hunter-gatherers

Directory of Open Access Journals (Sweden)

J. Colette Berbesque

2018-02-01

Full Text Available Digital photographs taken under controlled conditions were used to examine the incidence of linear enamel hypoplasia defects (LEHs in burials from the Buckeye Knoll archaeological site (41VT98 Victoria county, Texas, which spans the Early to Late Archaic Period (ca. 2,500–6,500 BP uncorrected radiocarbon. The majority (68 of 74 burials date to the Texas Early Archaic, including one extremely early burial dated to 8,500 BP. The photogrammetric data collection method also results in an archive for Buckeye Knoll, a significant rare Archaic period collection that has been repatriated and reinterred. We analyzed the incidence and developmental timing of LEHs in permanent canines. Fifty-nine percent of permanent canines (n = 54 had at least one defect. There were no significant differences in LEH frequency between the maxillary and mandibular canines (U = 640.5, n1 = 37, n2 = 43, p = .110. The sample studied (n = 92 permanent canines had an overall mean of 0.93 LEH defect per tooth, with a median of one defect, and a mode of zero defects. Average age at first insult was 3.92 (median = 4.00, range = 2.5–5.4 and the mean age of all insults per individual was 4.18 years old (range = 2.5–5.67. Age at first insult is consistent with onset of weaning stress—the weaning age range for hunter-gatherer societies is 1–4.5. Having an earlier age of first insult was associated with having more LEHs (n = 54, rho = −0.381, p = 0.005.

The importance of least restrictive care: the clinical implications of a recent High Court decision on negligence.

Science.gov (United States)

Ryan, Christopher James; Callaghan, Sascha; Large, Matthew

2015-08-01

This paper aims to explain the meaning and implications for practice of the High Court of Australia's finding in the negligence case, Hunter and New England Local Health District v McKenna [2014] HCA 44. The facts of the case and the law of negligence are reviewed before reporting the Court's decision. The High Court found that the obligation upon doctors to provide the least restrictive option for care that was imposed by the, then applicable, Mental Health Act 1990 (NSW) was inconsistent with an obligation that might otherwise be imposed by a common law duty to have regard to the interests of those with whom a psychiatric patient may come into contact if not detained. The Court's finding underlines the importance of clinicians documenting their clinical reasoning around why their negotiated management plan was the option least restrictive of the patient's freedom and most protective of his or her human rights. © The Royal Australian and New Zealand College of Psychiatrists 2015.

If Hunters End Up in the Emergency Room: A Retrospective Analysis of Hunting Injuries in a Swiss Emergency Department

Directory of Open Access Journals (Sweden)

Valentina Bestetti

2015-01-01

Full Text Available Aim. to characterize the mechanisms, patterns, and outcomes of nonfatal hunting-related injuries in patients presenting to Bern University Hospital, Switzerland, and compare these to reports of hunting injuries worldwide. Methods. patients presenting with hunting-related injuries to the Emergency Department at Bern University hospital from 2000 to 2014 were identified by retrospectively searching the department database using the keyword “hunt.” Each case was analyzed in terms of the patient age and gender, the mechanism and pattern of injury, and management and patient follow-up. Results. 19 patients were identified. 16 were male with a mean age of 50 years (range: 16–74. Mechanisms of injury included firearm-related injuries, falls, and knife wounds. The most common patterns of injury were head injuries (7, followed by injuries to the upper (5 or lower limb (5 and trunk (2. Over half of the patients were admitted, and nine required emergency surgery. Conclusion. Nonfatal hunting accidents in Bern, Switzerland, are largely caused by firearms and falls and tend to occur in male hunters with a mean age of 50 years. The most common patterns of injury are orthopedic and head injuries, often requiring surgery. These findings are consistent with international studies of nonfatal hunting accidents.

Synonymization of key pest species within the Bactrocera dorsalis species complex (Diptera: Tephritidae): taxonomic changes based on a review of 20 years of integrative morphological, molecular, cytogenetic, behavioural and chemoecological data

International Nuclear Information System (INIS)

Schutze, Mark K.

2015-01-01

Bactrocera papayae Drew & Hancock, Bactrocera philippinensis Drew & Hancock, Bactrocera carambolae Drew & Hancock, and Bactrocera invadens Drew, Tsuruta & White are four horticultural pest tephritid fruit fly species that are highly similar, morphologically and genetically, to the destructive pest, the Oriental fruit fly, Bactrocera dorsalis (Hendel) (Diptera: Tephritidae). This similarity has rendered the discovery of reliable diagnostic characters problematic, which, in view of the economic importance of these taxa and the international trade implications, has resulted in ongoing difficulties for many areas of plant protection and food security. Consequently, a major international collaborative and integrated multidisciplinary research effort was initiated in 2009 to build upon existing literature with the specific aim of resolving biological species limits among B. papayae, B. philippinensis, B. carambolae, B. invadens and B. dorsalis to overcome constraints to pest management and international trade. Bactrocera philippinensis has recently been synonymized with B. papayae as a result of this initiative and this review corroborates that finding; however, the other names remain in use. While consistent characters have been found to reliably distinguish B. carambolae from B. dorsalis, B. invadens and B. papayae, no such characters have been found to differentiate the latter three putative species. We conclude that B. carambolae is a valid species and that the remaining taxa, B. dorsalis, B. invadens and B. papayae, represent the same species. Thus, we consider B. dorsalis (Hendel) as the senior synonym of B. papayae Drew and Hancock syn.n. and B. invadens Drew, Tsuruta & White syn.n. A redescription of B. dorsalis is provided. Given the agricultural importance of B. dorsalis, this taxonomic decision will have significant global plant biosecurity implications, affecting pest management, quarantine, international trade, postharvest treatment and basic research

What enables size-selective trophy hunting of wildlife?

Directory of Open Access Journals (Sweden)

Chris T Darimont

Full Text Available Although rarely considered predators, wildlife hunters can function as important ecological and evolutionary agents. In part, their influence relates to targeting of large reproductive adults within prey populations. Despite known impacts of size-selective harvests, however, we know little about what enables hunters to kill these older, rarer, and presumably more wary individuals. In other mammalian predators, predatory performance varies with knowledge and physical condition, which accumulates and declines, respectively, with age. Moreover, some species evolved camouflage as a physical trait to aid in predatory performance. In this work, we tested whether knowledge-based faculty (use of a hunting guide with accumulated experience in specific areas, physical traits (relative body mass [RBM] and camouflage clothing, and age can predict predatory performance. We measured performance as do many hunters: size of killed cervid prey, using the number of antler tines as a proxy. Examining ∼ 4300 online photographs of hunters posing with carcasses, we found that only the presence of guides increased the odds of killing larger prey. Accounting for this effect, modest evidence suggested that unguided hunters presumably handicapped with the highest RBM actually had greater odds of killing large prey. There was no association with hunter age, perhaps because of our coarse measure (presence of grey hair and the performance trade-offs between knowledge accumulation and physical deterioration with age. Despite its prevalence among sampled hunters (80%, camouflage had no influence on size of killed prey. Should these patterns be representative of other areas and prey, and our interpretations correct, evolutionarily-enlightened harvest management might benefit from regulatory scrutiny on guided hunting. More broadly, we suggest that by being nutritionally and demographically de-coupled from prey and aided by efficient killing technology and road access

The ontogeny of visual-motor memory and its importance in handwriting and reading: a developing construct.

Science.gov (United States)

Waterman, Amanda H; Havelka, Jelena; Culmer, Peter R; Hill, Liam J B; Mon-Williams, Mark

2015-01-07

Humans have evolved a remarkable ability to remember visual shapes and use these representations to generate motor activity (from Palaeolithic cave drawings through Jiahu symbols to cursive handwriting). The term visual-motor memory (VMM) describes this psychological ability, which must have conveyed an evolutionary advantage and remains critically important to humans (e.g. when learning to write). Surprisingly, little empirical investigation of this unique human ability exists--almost certainly because of the technological difficulties involved in measuring VMM. We deployed a novel technique for measuring this construct in 87 children (6-11 years old, 44 females). Children drew novel shapes presented briefly on a tablet laptop screen, drawing their responses from memory on the screen using a digitizer stylus. Sophisticated algorithms (using point-registration techniques) objectively quantified the accuracy of the children's reproductions. VMM improved with age and performance decreased with shape complexity, indicating that the measure captured meaningful developmental changes. The relationship between VMM and scores on nationally standardized writing assessments were explored with the results showing a clear relationship between these measures, even after controlling for age. Moreover, a relationship between VMM and the nationally standardized reading test was mediated via writing ability, suggesting VMM's wider importance within language development. © 2014 The Author(s) Published by the Royal Society. All rights reserved.

Hadza hunter-gatherer men do not have more masculine digit ratios (2D:4D).

Science.gov (United States)

Apicella, Coren L; Tobolsky, Victoria A; Marlowe, Frank W; Miller, Kathleen W

2016-02-01

The ratio between the length of the second and the length of the fourth digit (2D:4D) is sexually dimorphic such that males of many species possess a lower ratio than females, particularly in the right hand. Still, men and women often exhibit overlapping 2D:4D ranges and the ratio is highly variable between populations. In order to further explore populational variability, we chose to analyze 2D:4D in the Hadza, a population of hunter-gatherers living in Tanzania. Data were collected separately by two researchers over the course of three years (1998, 2001, 2006) from 152 adult participants (male: n = 76, female: n = 76). Independent samples t-tests were used to explore sex differences, paired samples t-tests were used to explore directional effects within each sex, and linear regression and one-way ANOVA were used to test possible age effects. In none of the years, or pooled (n = 152), did we find evidence that adult men have a lower 2D:4D than adult women. If anything, the data suggest that women in this population have a significantly lower right hand 2D:4D than men (P < 0.001, d = 0.57). In contrast, left hand 2D:4D did not exhibit a sex difference (P = 0.862, d = 0.03). These findings challenge the current view that lower 2D:4D in men is a uniform characteristic of our species. Cross-populational variance in 2D:4D may be related to known patterns of hormonal variation resulting from both genetic and environmental mechanisms, though this relationship merits further investigation. © 2015 Wiley Periodicals, Inc.

Bone transplantation and tissue engineering, part I. Mythology, miracles and fantasy: from Chimera to the Miracle of the Black Leg of Saints Cosmas and Damian and the cock of John Hunter.

Science.gov (United States)

Hernigou, Philippe

2014-12-01

The replacement of diseased organs and tissues by the healthy ones of others has been a unique milestone in modern medicine. However, even though cloning, member transplantation and regenerative therapies with stem cells are available in the twentieth and twenty-first centuries, one should remember that all these techniques were in the imagination more than 2,000 years ago. For centuries, transplantation remained a theme of mythology, miracle or fantasy and was found only in literature and arts. This first paper explains the concept of tissue transplantation from the period when it was relegated to the imagination to the work of the Scottish surgeon and anatomist, John Hunter, who demonstrated the viability of bone allograft.

Utilizing hunter harvest effort to survey for wildlife disease: a case study of West Nile virus in greater sage-grouse

Science.gov (United States)

Dusek, Robert J.; Hagen, Christian A.; Franson, J. Christian; Budeau, David A.; Hofmeister, Erik K.

2014-01-01

Greater sage-grouse (Centrocercus urophasianus; sage-grouse) are highly susceptible to infection with West Nile virus (WNV), with substantial mortality reported in wild populations and in experimentally infected birds. Although sage-grouse are hunted throughout much of their range, they have also recently been considered for protection under the Endangered Species Act. We used blood samples collected on filter-paper strips during the 2006–2010 Oregon, USA, annual sage-grouse hunt to survey for specific WNV-neutralizing antibodies that indicate a previous infection with WNV. During this period, hunters submitted 1,880 blood samples from sage-grouse they harvested. Samples obtained were proportional for all 12 Oregon sage-grouse hunting units. Laboratory testing of 1,839 samples by the WNV epitope-blocking enzyme-linked immunosorbent assay (bELISA) followed by plaque reduction neutralization test on bELISA-positive samples yielded 19 (1%) and 1 (0.05%) positive samples, respectively. These data provided early baseline information for future comparisons regarding the prevalence of WNV-specific neutralizing antibodies in sage-grouse in Oregon. This methodology may provide other states where sage-grouse (or other species) populations are hunted and where WNV constitutes a species conservation concern with a viable option to track the relative prevalence of the virus in populations.

Metabolic and physiologic effects from consuming a hunter-gatherer (Paleolithic)-type diet in type 2 diabetes.

Science.gov (United States)

Masharani, U; Sherchan, P; Schloetter, M; Stratford, S; Xiao, A; Sebastian, A; Nolte Kennedy, M; Frassetto, L

2015-08-01

The contemporary American diet figures centrally in the pathogenesis of numerous chronic diseases--'diseases of civilization'--such as obesity and diabetes. We investigated in type 2 diabetes whether a diet similar to that consumed by our pre-agricultural hunter-gatherer ancestors ('Paleolithic' type diet) confers health benefits. We performed an outpatient, metabolically controlled diet study in type 2 diabetes patients. We compared the findings in 14 participants consuming a Paleo diet comprising lean meat, fruits, vegetables and nuts, and excluding added salt, and non-Paleolithic-type foods comprising cereal grains, dairy or legumes, with 10 participants on a diet based on recommendations by the American Diabetes Association (ADA) containing moderate salt intake, low-fat dairy, whole grains and legumes. There were three ramp-up diets for 7 days, then 14 days of the test diet. Outcomes included the following: mean arterial blood pressure; 24-h urine electrolytes; hemoglobin A1c and fructosamine levels; insulin resistance by euglycemic hyperinsulinemic clamp and lipid levels. Both groups had improvements in metabolic measures, but the Paleo diet group had greater benefits on glucose control and lipid profiles. Also, on the Paleo diet, the most insulin-resistant subjects had a significant improvement in insulin sensitivity (r = 0.40, P = 0.02), but no such effect was seen in the most insulin-resistant subjects on the ADA diet (r = 0.39, P = 0.3). Even short-term consumption of a Paleolithic-type diet improved glucose control and lipid profiles in people with type 2 diabetes compared with a conventional diet containing moderate salt intake, low-fat dairy, whole grains and legumes.

PLANET HUNTERS. VIII. CHARACTERIZATION OF 41 LONG-PERIOD EXOPLANET CANDIDATES FROM KEPLER ARCHIVAL DATA

International Nuclear Information System (INIS)

Wang, Ji; Fischer, Debra A.; Picard, Alyssa; Schmitt, Joseph R.; Boyajian, Tabetha S.; Barclay, Thomas; Ma, Bo; Bowler, Brendan P.; Riddle, Reed; Jek, Kian J.; LaCourse, Daryll; Simister, Dean Joseph; Grégoire, Boscher; Babin, Sean P.; Poile, Trevor; Jacobs, Thomas Lee; Baranec, Christoph; Law, Nicholas M.; Lintott, Chris; Schawinski, Kevin

2015-01-01

The census of exoplanets is incomplete for orbital distances larger than 1 AU. Here, we present 41 long-period planet candidates in 38 systems identified by Planet Hunters based on Kepler archival data (Q0–Q17). Among them, 17 exhibit only one transit, 14 have two visible transits, and 10 have more than three visible transits. For planet candidates with only one visible transit, we estimate their orbital periods based on transit duration and host star properties. The majority of the planet candidates in this work (75%) have orbital periods that correspond to distances of 1–3 AU from their host stars. We conduct follow-up imaging and spectroscopic observations to validate and characterize planet host stars. In total, we obtain adaptive optics images for 33 stars to search for possible blending sources. Six stars have stellar companions within 4″. We obtain high-resolution spectra for 6 stars to determine their physical properties. Stellar properties for other stars are obtained from the NASA Exoplanet Archive and the Kepler Stellar Catalog by Huber et al. We validate 7 planet candidates that have planet confidence over 0.997 (3σ level). These validated planets include 3 single-transit planets (KIC-3558849b, KIC-5951458b, and KIC-8540376c), 3 planets with double transits (KIC-8540376b, KIC-9663113b, and KIC-10525077b), and 1 planet with four transits (KIC-5437945b). This work provides assessment regarding the existence of planets at wide separations and the associated false positive rate for transiting observation (17%–33%). More than half of the long-period planets with at least three transits in this paper exhibit transit timing variations up to 41 hr, which suggest additional components that dynamically interact with the transiting planet candidates. The nature of these components can be determined by follow-up radial velocity and transit observations

Isolation And Identification Of Antioxidant Compounds Leaf Betel Seating (Piper sarmentosum Roxb. Ex Hunter

Directory of Open Access Journals (Sweden)

Hartiwi Diastutia

2012-02-01

Full Text Available Sirih duduk or Piper sarmentosum Roxb. ex Hunter have been long used the people in Indonesia for traditional medicine to cure various diseases. This research was aimed to isolate and identify antioxidant compounds from P. sarmentosum leaves. The isolation bioactive compounds of P. sarmentosum leaves was performed by extraction the powder of P. sarmentosum leaves using methanol. The methanol extract was fractionated using n-hexane and ethylacetate in their various composition.  The fractions respectively was examined their antioxidant activity. The most active extract was fractionated again performed by coloumn chromatography Identification of the bioactive compounds was carried out using ultraviolet-visible (UV-Vis spectrometry, infra red (IR spectrometry and gas chromatography-mass spectrometry (GCMS. The result showed that the methanol extract of  P. sarmentosum leaves have antioxidant activity. The fractionation was performed by coloumn chromatography using n-hexane-ethylacetate (4:6 eluent, a bioactive compound of sinamic acid derivative was 4-ethoxy-2-hidroxy-3,5-dimethoxy sinamic acid could be purely isolated. Keywords: Piper sarmentosum, antioxidant, sinamic acid derivative. Normal 0 false false false EN-US X-NONE X-NONE st1\\:*{behavior:url(#ieooui } /* Style Definitions */ table.MsoNormalTable {mso-style-name:"Table Normal"; mso-tstyle-rowband-size:0; mso-tstyle-colband-size:0; mso-style-noshow:yes; mso-style-priority:99; mso-style-qformat:yes; mso-style-parent:""; mso-padding-alt:0in 5.4pt 0in 5.4pt; mso-para-margin-top:0in; mso-para-margin-right:0in; mso-para-margin-bottom:10.0pt; mso-para-margin-left:0in; line-height:115%; mso-pagination:widow-orphan; font-size:11.0pt; font-family:"Calibri","sans-serif"; mso-ascii-font-family:Calibri; mso-ascii-theme-font:minor-latin; mso-fareast-font-family:"Times New Roman"; mso-fareast-theme-font:minor-fareast; mso-hansi-font-family:Calibri; mso-hansi-theme-font:minor-latin; mso

PLANET HUNTERS. VIII. CHARACTERIZATION OF 41 LONG-PERIOD EXOPLANET CANDIDATES FROM KEPLER ARCHIVAL DATA

Energy Technology Data Exchange (ETDEWEB)

Wang, Ji; Fischer, Debra A.; Picard, Alyssa; Schmitt, Joseph R.; Boyajian, Tabetha S. [Department of Astronomy, Yale University, New Haven, CT 06511 (United States); Barclay, Thomas [NASA Ames Research Center, M/S 244-30, Moffett Field, CA 94035 (United States); Ma, Bo [Department of Astronomy, University of Florida, 211 Bryant Space Science Center, Gainesville, FL 32611-2055 (United States); Bowler, Brendan P.; Riddle, Reed [California Institute of Technology, 1200 East California Boulevard, Pasadena, CA 91101 (United States); Jek, Kian J.; LaCourse, Daryll; Simister, Dean Joseph; Grégoire, Boscher; Babin, Sean P.; Poile, Trevor; Jacobs, Thomas Lee; Baranec, Christoph [Institute for Astronomy, University of Hawai‘i at Mānoa, Hilo, HI 96720-2700 (United States); Law, Nicholas M. [Department of Physics and Astronomy, University of North Carolina at Chapel Hill, Chapel Hill, NC 27599-3255 (United States); Lintott, Chris [Oxford Astrophysics, Denys Wilkinson Building, Keble Road, Oxford OX1 3RH (United Kingdom); Schawinski, Kevin [Institute for Astronomy, Department of Physics, ETH Zurich, Wolfgang-Pauli-Strasse 27, CH-8093 Zurich (Switzerland); and others

2015-12-20

The census of exoplanets is incomplete for orbital distances larger than 1 AU. Here, we present 41 long-period planet candidates in 38 systems identified by Planet Hunters based on Kepler archival data (Q0–Q17). Among them, 17 exhibit only one transit, 14 have two visible transits, and 10 have more than three visible transits. For planet candidates with only one visible transit, we estimate their orbital periods based on transit duration and host star properties. The majority of the planet candidates in this work (75%) have orbital periods that correspond to distances of 1–3 AU from their host stars. We conduct follow-up imaging and spectroscopic observations to validate and characterize planet host stars. In total, we obtain adaptive optics images for 33 stars to search for possible blending sources. Six stars have stellar companions within 4″. We obtain high-resolution spectra for 6 stars to determine their physical properties. Stellar properties for other stars are obtained from the NASA Exoplanet Archive and the Kepler Stellar Catalog by Huber et al. We validate 7 planet candidates that have planet confidence over 0.997 (3σ level). These validated planets include 3 single-transit planets (KIC-3558849b, KIC-5951458b, and KIC-8540376c), 3 planets with double transits (KIC-8540376b, KIC-9663113b, and KIC-10525077b), and 1 planet with four transits (KIC-5437945b). This work provides assessment regarding the existence of planets at wide separations and the associated false positive rate for transiting observation (17%–33%). More than half of the long-period planets with at least three transits in this paper exhibit transit timing variations up to 41 hr, which suggest additional components that dynamically interact with the transiting planet candidates. The nature of these components can be determined by follow-up radial velocity and transit observations.

[125I]Bolton-Hunter neuropeptide-Y-binding sites on folliculo-stellate cells of the pars intermedia of Xenopus laevis: A combined autoradiographic and immunocytochemical study

International Nuclear Information System (INIS)

De Rijk, E.P.; Cruijsen, P.M.; Jenks, B.G.; Roubos, E.W.

1991-01-01

It has previously been established that neuropeptide-Y (NPY) is a potent inhibitor of alpha MSH release from the pars intermedia of the amphibian Xenopus laevis. The location of binding sites for NPY in the pars intermedia of the pituitary has now been studied with light microscopic autoradiography, using a dispersed cell labeling method with the specific NPY receptor ligand [ 125 I]Bolton-Hunter NPY. The majority of radioactive labeling was associated with folliculo-stellate cells; the percentage of labeling as well as the mean number of grains were approximately 5 times higher for folliculo-stellate cells than for melanotropes. An excess of nonlabeled NPY drastically reduced radiolabeling of folliculo-stellate cells, but had no effect on the degree of labeling of melanotropes. These results show that folliculo-stellate cells of X. laevis possess specific binding sites for NPY and indicate that NPY exerts its inhibitory action on the release of alpha MSH in an indirect fashion, by acting on the folliculo-stellate cells

Drivers of bushmeat hunting and perceptions of zoonoses in Nigerian hunting communities.

Directory of Open Access Journals (Sweden)

Sagan Friant

2015-05-01

Full Text Available Bushmeat hunting threatens biodiversity and increases the risk of zoonotic pathogen transmission. Nevertheless, limited information exists on patterns of contact with wildlife in communities that practice bushmeat hunting, especially with respect to social drivers of hunting behavior. We used interview responses from hunters and non-hunters in rural hunting communities in Nigeria to: 1 quantify contact rates with wildlife, 2 identify specific hunting behaviors that increase frequency of contact, 3 identify socioeconomic factors that predispose individuals to hunt, and 4 measure perceptions of risk. Participants engaged in a variety of behaviors that increased contact with wild animals, including: butchering to sell (37%, being injured (14%, using body parts for traditional medicine (19%, collecting carcasses found in forests and/or farms (18%, and keeping as pets (16%. Hunters came into contact with wildlife significantly more than non-hunters, even through non-hunting exposure pathways. Participants reported hunting rodents (95%, ungulates (93%, carnivores (93%, primates (87%, and bats (42%, among other prey. Reported hunting frequencies within taxonomic groups of prey were different for different hunting behaviors. Young age, lower education level, larger household size, having a father who hunts, and cultural group were all associated with becoming a hunter. Fifty-five percent of respondents were aware that they could contract diseases from wild animals, but only 26% of these individuals reported taking protective measures. Overall, hunters in this setting frequently contact a diversity of prey in risky ways, and the decision to become a hunter stems from family tradition, modified by economic necessity. Conservation and public health interventions in such settings may be most efficient when they capitalize on local knowledge and target root socio-economic and cultural drivers that lead to hunting behavior. Importantly, interventions that

"And first he drew a line"

DEFF Research Database (Denmark)

Graham, Brian Russell

At the end of “Night the Seventh” of Blake’s The Four Zoas, Blake’s Los, against a background of “furious war”, takes a stance and then performs an act which might seem powerless and quaint against such a backdrop: he draws a line, beginning work consisting of lines which Enitharmon, his companion......, tinctures, as it emerges. Placing this moment in the context of the poem’s epic struggle, this paper explores the reasons for Blake’s choice of image at this juncture in the “history”, thereby making a contribution to our understanding of the opposition between form and formlessness in the narrative....

DCS Terrain Submission for Drew AR

Data.gov (United States)

Federal Emergency Management Agency, Department of Homeland Security — Terrain data, as defined in FEMA Guidelines and Specifications, Appendix N: Data Capture Standards, describes the digital topographic data that was used to create...

Preliminary assessment report for Army Aviation Support Facility No. 3, Installation 13307, Hunter Army Airfield, Savannah, Georgia. Installation Restoration Program

Energy Technology Data Exchange (ETDEWEB)

Kolpa, R.; Smith, K.

1993-07-01

This report presents the results of the preliminary assessment (PA) conducted by Argonne National Laboratory at the Georgia Army National Guard property located on Hunter Army Airfield (HAA) near Savannah, Georgia, known as Army Aviation Support Facility (AASF) No. 3. Preliminary assessments of federal facilities are being conducted to compile the information necessary for completing preremedial activities and to provide a basis for establishing corrective actions in response to releases of hazardous substances. The principal objective of the PA is to characterize the site accurately and determine the need for further action by examining site activities, types and quantities of hazardous substances utilized, the nature and amounts of wastes generated or stored at the facility, and potential pathways by which contamination could affect public health and the environment. This PA satisfies, for the AASF No. 3 property, requirements of the Department of Defense Installation Restoration Program (IRP). The scope of this assessment is limited to the facilities and past activities contained within the area now occupied by AASF No. 3. However, this assessment report is intended to be read in conjunction with a previous IRP assessment of HAA completed in 1992 (USATHAMA 1992) and to provide comprehensive information on AASF No. 3 for incorporation with information contained in that previous assessment for the entirety of HAA.

Synonymization of key pest species within the Bactrocera dorsalis species complex (Diptera: Tephritidae): taxonomic changes based on a review of 20 years of integrative morphological, molecular, cytogenetic, behavioral, and c

Science.gov (United States)

Bactrocera papayae Drew & Hancock, Bactrocera philippinensis Drew & Hancock, Bactrocera carambolae Drew & Hancock, and Bactrocera invadens Drew, Tsuruta & White are four horticultural pest tephritid fruit fly species that are highly morphologically and genetically similar to the destructive pest, th...

It counts who counts: an experimental evaluation of the importance of observer effects on spotlight count estimates

DEFF Research Database (Denmark)

Sunde, Peter; Jessen, Lonnie

2013-01-01

observers with respect to their ability to detect and estimate distance to realistic animal silhouettes at different distances. Detection probabilities were higher for observers experienced in spotlighting mammals than for inexperienced observers, higher for observers with a hunting background compared...... with non-hunters and decreased as function of age but were independent of sex or educational background. If observer-specific detection probabilities were applied to real counting routes, point count estimates from inexperienced observers without a hunting background would only be 43 % (95 % CI, 39...

Cultural Landscapes and Neolithisation Processes: Outline of a model for the Scheldt basin (Belgium

Directory of Open Access Journals (Sweden)

Erick N. Robinson

2007-12-01

Full Text Available Recent research has indicated the continuation of a hunting-fishing-gathering way of life in the lower Scheldt basin (Belgium for over a millennium after the first arrival of agriculture in the middle Scheldt. Current evidence suggests multiple hiatuses in cultural change from the late 6th-late 5th millennium BC. This article provides the outline of a model that seeks to explain these hiatuses from the perspective of indigenous hunter-fisher-gatherer cultural landscapes. The outline investigates the significance of palaeoecological and social contexts in relation to contact and cultural transmission processes during the transition to agriculture. Recent ethnoarchaeological research from hunter-fisher-gatherers in temperate and boreal environments is referenced as a structural analogy for illuminating the important relationship between territoriality and social mediation within hunter-gatherer groups at the Mesolithic-Neolithic interface.

Zolpidem and traffic safety - the importance of treatment compliance.

Science.gov (United States)

Verster, Joris C; Volkerts, Edmund R; Olivier, Berend; Johnson, William; Liddicoat, Laura

2007-09-01

Zolpidem is among the most frequently prescribed hypnotic drugs for those who suffer from insomnia. Recent media reports drew attention to driving impairment after zolpidem misuse. This review summarizes the available data on the effects of recommended use and misuse of zolpidem on driving ability and traffic safety. Both experimental studies and roadside evidence were taken into account. From these studies it must be concluded that patients should fully comply with the prescription instructions of zolpidem, i.e. to take the medication just prior to a full 8 hours of uninterrupted sleep. If this strategy is adopted, zolpidem is a safe alternative to benzodiazpine hypnotics and zopiclone who do show significant driving impairment the morning following bedtime administration. However, to ensure traffic safety higher dosages than recommended (10 mg) or allowing less than 8 hours between zolpidem intake and actual operation of a motor vehicle should be avoided.

Rational management of hunting and gathering: An aristotelian entelechy or a chimera?

Directory of Open Access Journals (Sweden)

Juan Mario Vargas Yáñez

2018-01-01

Full Text Available Rational management of hunting and gathering: An Aristotelian entelechy or a chimera? Since the dawn of time, consumption of animal protein has been crucially important to the evolution of humans. Cooperative hunting is an Evolutionarily Stable Strategy from the time when Palaeolithic hunters specialized in the pursuit of large animals. The entire process involves making decisions related to game management, some of which are still used by contemporary hunter-gatherers. In these societies, which still practice subsistence hunting, the composition of their diets and the exploitation techniques employed are explained by the theoretical underpinnings contained in the Optimal Foraging Theory (OFT. In order to test this theory, we have taken into account four decisions involving the adoption of different management strategies by hunter-gatherers: I what to eat, II where and how to look for food, III the most appropriate size and composition of the group of hunter-gatherers and IV the most efficient guidelines for the handling and distribution of prey. The OFT has been tested several times, and in a high percentage of cases studied, its predictions fit observations made in various hunter-gatherer societies. This means that maximizing catch yields in the short term is their main concern, rather than behaving as ‘cautious predators’ or passively selecting prey according to their size, accessibility and abundance. Such behaviour does not contradict the possibility that hunter-gatherers can act as conservationists, but discards the idea that this is the main focus of their way of life. There is no doubt that indigenous peoples have a wide knowledge of the environment, but it is unclear this knowledge is used to maintain a balance with nature or to be more efficient hunters. It more likely that the presence of sustainable hunting of game is due to low hunting pressure in areas where animal prey is abundant, and is thus an epiphenomenon rather than a

Hunter syndrome in an 11-year old girl on enzyme replacement therapy with idursulfase: brain magnetic resonance imaging features and evolution.

Science.gov (United States)

Manara, Renzo; Rampazzo, Angelica; Cananzi, Mara; Salviati, Leonardo; Mardari, Rodica; Drigo, Paola; Tomanin, Rosella; Gasparotto, Nicoletta; Priante, Elena; Scarpa, Maurizio

2010-12-01

Mucopolysaccharidosis type II (MPS-II, Hunter disease) is a X-linked recessive disorder. Affected females are extremely rare, mostly due to skewed X chromosome inactivation. A few papers outline MPS-II brain magnetic resonance imaging (MRI) "gestalt" in males, but neuroradiological reports on females are still lacking. We present an 11-year-old girl affected by the severe form of MPS-II who was followed up over a time span of 8 years, focusing on clinical and brain MRI evolution. In the last 2.5 years, the patient has been treated with enzyme replacement therapy (ERT) with idursulfase (Elaprase™, Shire Human Genetic Therapies AB, Sweden). On brain and cervical MRI examination, abnormalities in our patient did not differ from those detected in male patients: J-shaped pituitary sella, enlargement of perivascular spaces, brain atrophy, mild T2-hyperintensity in the paratrigonal white matter, diffuse platyspondylia, and mild odontoid dysplasia with odontoid cup. Brain atrophy progressed despite ERT introduction, whereas perivascular space enlargement did not change significantly before and after ERT. Cognitive impairment worsened independently from the course of white matter abnormality. Despite a profound knowledge of genetic and biochemical aspects in MPS-II, neuroradiology is still poorly characterized, especially in female patients. Spinal and brain involvement and its natural course and evolution after ERT introduction still need to be clarified.

Hunter-gatherer dental pathology: Do historic accounts of Aboriginal Australians correspond to the archeological record of dental disease?

Science.gov (United States)

Littleton, Judith

2018-03-01

Studies of hunter-gatherer oral pathology, particularly in Australia, often focus upon dental wear and caries or assume that historic studies of Aboriginal people reflect the precontact past. Consequently the range of population variation has been underestimated. In this paper dental pathology from human remains from Roonka are compared with a model of dental pathology derived from historic studies. The aim is to identify aspects of dental pathology indicative of regional or intra-population diversity. Adult dentitions (n = 115) dating from the mid to late Holocene were recorded for the following conditions: dental wear, caries, periapical voids, calculus, periodontal disease and antemortem tooth loss. Statistical analysis was used to identify patterns of dental pathology and to identify causal relationships between conditions. Dental wear is marked while dental caries rates are extremely low. Other indications of dental pathology are uncommon (<7% of teeth affected). Temporal heterogeneity is apparent: there are 3 young adults with caries who died in the postcontact period. There is also a small group of middle age to old adults with disproportionate abscessing and pulp exposure who may represent temporal variation or heterogeneity in individual frailty. The results confirm dental wear as the major cause of dental pathology in this group and that, at a general level, historic accounts do correspond with this archeological sample. However, intra-sample heterogeneity is apparent while 2 dental conditions, calculus and periodontal disease, along with the pattern of sex differences deviate from expectation, demonstrating that to identify regional variation attention needs to be paid to the dentoalveolar complex as a whole. © 2017 Wiley Periodicals, Inc.

O pós-humano, cyborgs e a (reevolução do corpo em Mega Man Maverick Hunter X

Directory of Open Access Journals (Sweden)

Simão Cireneu Milani Addôr Nunes da Silva

2017-07-01

Full Text Available Este trabalho propõe a análise da conformação híbrida do robô X (humano e máquina, personagem principal do game Mega Man Maverick Hunter X, lançado em 2005, que é um remake do jogo Megaman X, produzido pela Capcom para a plataforma Super Nintendo em 1993. No universo narrativo do game, X é único robô a possuir a capacidade de ter sentimentos, sendo seu projeto o ponto de partida para a criação dos reploids (cyborgs com a capacidade de livre arbítrio, que, como ele,demonstram empatia por todos os seres, sejam humanos ou robóticos. Apesar de X ter o que é considerada a maior “fraqueza” dos humanos: sentimentos, ele é o personagem mais poderoso da série, justamente pela percepção de que esse potencial o torna ilimitado como os humanos; pois enquanto os humanos são capazes de evoluir física e intelectualmente, os robôs estarão permanentemente atrelados à função para a qual foram criados. Para analisar a constituição de X como uma possibilidade de discussão da perspectiva do pós-humano, utilizamos teorias desenvolvidas por Paula Sibilia (2002 em O homem pós-orgânico, e Lucia Santaella, em Culturas e artes do pós-humano (2003.

Pottery use by early Holocene hunter-gatherers of the Korean peninsula closely linked with the exploitation of marine resources

Science.gov (United States)

Shoda, Shinya; Lucquin, Alexandre; Ahn, Jae-ho; Hwang, Chul-joo; Craig, Oliver E.

2017-08-01

The earliest pottery on the Korean peninsula dates to the early Holocene, notably later than other regions of East Asia, such as Japan, the Russian Far East and Southern China. To shed light on the function of such early Korean pottery and to understand the motivations for its adoption, organic residue analysis was conducted on pottery sherds and adhered surface deposit on the wall of pottery vessels (foodcrusts) excavated from the Sejuk shell midden (7.7-6.8ka calBP) on the southeastern coast and the Jukbyeon-ri site (7.9-6.9ka calBP) on the eastern coast of the Korean peninsula, that represents the earliest pottery assemblages with reliable radiocarbon dates. Through chemical and isotopic residue analysis, we conclude that the use of pottery at these sites was oriented towards marine resources, supported by lipid biomarkers typical of aquatic organisms and stable carbon isotope values that matched authentic marine reference fats. The findings contrast with other archaeological evidence, which shows that a wider range of available food resources were exploited. Therefore, we conclude pottery was used selectively for processing aquatic organisms perhaps including the rendering of aquatic oils for storage. Early pottery use in Korea is broadly similar to other prehistoric temperate hunter-gatherers, such as in Japan, northern Europe and northern America. However, it is also notable that elaborately decorated red burnished pottery excavated from isolated location at the Jukbyeon-ri site had a different usage pattern, which indicates that division of pottery use by vessel form was established even at this early stage.

Ancient lipids document continuity in the use of early hunter-gatherer pottery through 9,000 years of Japanese prehistory.

Science.gov (United States)

Lucquin, Alexandre; Gibbs, Kevin; Uchiyama, Junzo; Saul, Hayley; Ajimoto, Mayumi; Eley, Yvette; Radini, Anita; Heron, Carl P; Shoda, Shinya; Nishida, Yastami; Lundy, Jasmine; Jordan, Peter; Isaksson, Sven; Craig, Oliver E

2016-04-12

The earliest pots in the world are from East Asia and date to the Late Pleistocene. However, ceramic vessels were only produced in large numbers during the warmer and more stable climatic conditions of the Holocene. It has long been assumed that the expansion of pottery was linked with increased sedentism and exploitation of new resources that became available with the ameliorated climate, but this hypothesis has never been tested. Through chemical analysis of their contents, we herein investigate the use of pottery across an exceptionally long 9,000-y sequence from the Jōmon site of Torihama in western Japan, intermittently occupied from the Late Pleistocene to the mid-Holocene. Molecular and isotopic analyses of lipids from 143 vessels provides clear evidence that pottery across this sequence was predominantly used for cooking marine and freshwater resources, with evidence for diversification in the range of aquatic products processed during the Holocene. Conversely, there is little indication that ruminant animals or plants were processed in pottery, although it is evident from the faunal and macrobotanical remains that these foods were heavily exploited. Supported by other residue analysis data from Japan, our results show that the link between pottery and fishing was established in the Late Paleolithic and lasted well into the Holocene, despite environmental and socio-economic change. Cooking aquatic products in pottery represents an enduring social aspect of East Asian hunter-gatherers, a tradition based on a dependable technology for exploiting a sustainable resource in an uncertain and changing world.

A view to a (staged) kill?

DEFF Research Database (Denmark)

Gamborg, Christian; Jensen, Frank Søndergaard; Sandøe, Peter

2015-01-01

Is it acceptable, in principle, to shoot wild animals as a sport? The ethical controversy around recreational hunting is not only of academic interest but plays an important role in public and political discussions concerning the legitimacy of hunting. For the hunter, hunting is typically imbued...... with a perception of deeper meaning. For ardent non-hunters it may be hard to understand the meaning of enjoying nature by shooting at other living beings. This lack of mutual understanding makes it difficult to create a dialogue. However, the issue is not just about whether or not to accept hunting but also......-based questionnaires) of different Danish stakeholders. Results show that a majority of the general public is primarily against the practice; a majority of hunters are pro, and landowners somewhere in between. Reasons may be found in relation to views on wildlife, naturalness and what constitutes ‘proper’ hunting...

Man the fat hunter: the demise of Homo erectus and the emergence of a new hominin lineage in the Middle Pleistocene (ca. 400 kyr Levant.

Directory of Open Access Journals (Sweden)

Miki Ben-Dor

Full Text Available The worldwide association of H. erectus with elephants is well documented and so is the preference of humans for fat as a source of energy. We show that rather than a matter of preference, H. erectus in the Levant was dependent on both elephants and fat for his survival. The disappearance of elephants from the Levant some 400 kyr ago coincides with the appearance of a new and innovative local cultural complex--the Levantine Acheulo-Yabrudian and, as is evident from teeth recently found in the Acheulo-Yabrudian 400-200 kyr site of Qesem Cave, the replacement of H. erectus by a new hominin. We employ a bio-energetic model to present a hypothesis that the disappearance of the elephants, which created a need to hunt an increased number of smaller and faster animals while maintaining an adequate fat content in the diet, was the evolutionary drive behind the emergence of the lighter, more agile, and cognitively capable hominins. Qesem Cave thus provides a rare opportunity to study the mechanisms that underlie the emergence of our post-erectus ancestors, the fat hunters.

Importance of doctor-patient relationship for patient adherence with medication regimes

DEFF Research Database (Denmark)

Sokolowski, Ineta; Vedsted, Peter

Aim: It has been supposed that the relation between the doctor and the patient has implications for the adherence to medication. This study explores the effect of patient reported doctor-patient relationship on patient adherence with medication regiments. Methods: Design: Prospective cohort study...... practices. Doctor-patient relationship was measured from The Danish version of the 23-item EUROPEP questionnaire measuring patient evaluation of general practice. From the register data on prescriptions we drew all subsidised drugs redeemed at pharmacies for each patient in 2002-2005. Patients, who did...... was measured as secondary non-compliance and as persistence. The incidence rate ratio of non-adherence was calculated for different levels of the patient evaluated doctor-patient-relationship. Results: A total of 482 patients started new treatment of which 98 were non-compliant and 7 were censored. This study...

Epicuticular chemistry reinforces the new taxonomic classification of the Bactrocera dorsalis species complex (Diptera: Tephritidae, Dacinae)

Science.gov (United States)

Vaníčková, Lucie; Nagy, Radka; Pompeiano, Antonio

2017-01-01

Bactrocera invadens Drew, Tsuruta & White, Bactrocera papayae Drew & Hancock, and Bactrocera philippinensis Drew & Hancock, key pest species within the Bactrocera dorsalis species complex, have been recently synonymized under the name Bactrocera dorsalis (Hendel). The closely related Bactrocera carambolae Drew & Hancock remains as a discrete taxonomic entity. Although the synonymizations have been accepted by most researchers, debate about the species limits remains. Because of the economic importance of this group of taxa, any new information available to support or deny the synonymizations is valuable. We investigated the chemical epicuticle composition of males and females of B. dorsalis, B. invadens, B. papayae, B. philippinensis, and B. carambolae by means of one- and two-dimensional gas chromatography–mass spectrometry, followed by multiple factor analyses and principal component analysis. Clear segregation of complex cuticule profiles of both B. carambolae sexes from B. dorsalis (Hendel) was observed. In addition to cuticular hydrocarbons, abundant complex mixtures of sex-specific oxygenated lipids (three fatty acids and 22 fatty acid esters) with so far unknown function were identified in epicuticle extracts from females of all species. The data obtained supports both taxonomic synonymization of B. invadens, B. papayae, and B. philippinensis with B. dorsalis, as well as the exclusion of B. carambolae from B. dorsalis. PMID:28873446

Psychophysical studies of the performance of an image database retrieval system

Science.gov (United States)

Papathomas, Thomas V.; Conway, Tiffany E.; Cox, Ingemar J.; Ghosn, Joumana; Miller, Matt L.; Minka, Thomas P.; Yianilos, Peter N.

1998-07-01

We describe psychophysical experiments conducted to study PicHunter, a content-based image retrieval (CBIR) system. Experiment 1 studies the importance of using (a) semantic information, (2) memory of earlier input and (3) relative, rather than absolute, judgements of image similarity. The target testing paradigm is used in which a user must search for an image identical to a target. We find that the best performance comes from a version of PicHunter that uses only semantic cues, with memory and relative similarity judgements. Second best is use of both pictorial and semantic cues, with memory and relative similarity judgements. Most reports of CBIR systems provide only qualitative measures of performance based on how similar retrieved images are to a target. Experiment 2 puts PicHunter into this context with a more rigorous test. We first establish a baseline for our database by measuring the time required to find an image that is similar to a target when the images are presented in random order. Although PicHunter's performance is measurably better than this, the test is weak because even random presentation of images yields reasonably short search times. This casts doubt on the strength of results given in other reports where no baseline is established.

Inland Ertebølle Culture: the importance of aquatic resources and the freshwater reservoir effect in radiocarbon dates from pottery food crusts

Directory of Open Access Journals (Sweden)

Bente Philippsen

2014-11-01

Full Text Available The Ertebølle culture is a late Mesolithic hunter-gatherer-fisher culture in southern Scandinavia, northern Germany and Poland. Archaeological finds as well as scientific analyses of humans and their artefacts indicate the great importance of aquatic resources, both marine and freshwater, to Ertebølle subsistence. In northern Germany, modern freshwater fish samples can have very high apparent radiocarbon ages (up to 3000 years. If such dramatic 'freshwater reservoir effects' also existed during the late Mesolithic, they could lead to artificially old radiocarbon dates for the bones of Ertebølle humans and domestic dogs, and for carbonised food crusts on cooking pots. Conversely, if we can demonstrate radiocarbon age 'offsets' in such samples, we can often attribute them to the exploitation of freshwater food resources. This article discusses methods of identifying freshwater resources in prehistoric pottery, including radiocarbon reservoir effects. We consider the results of radiocarbon, stable isotope and elemental analyses of food crusts on prehistoric pottery from four sites in the Alster and Trave valleys: Kayhude, Schlamersdorf, Bebensee and Seedorf.

Hunter Syndrome

Science.gov (United States)

... type and severity of the disease. Complications can affect the lungs, heart, joints, connective tissue, and brain and nervous system. Respiratory complications An enlarged tongue, thickened gums, and ...

A synergistic effort among geoscience, physics, computer science and mathematics at Hunter College of CUNY as a Catalyst for educating Earth scientists.

Science.gov (United States)

Salmun, H.; Buonaiuto, F. S.

2016-12-01

The Catalyst Scholarship Program at Hunter College of The City University of New York (CUNY) was established with a four-year award from the National Science Foundation (NSF) to fund scholarships for academically talented but financially disadvantaged students majoring in four disciplines of science, technology, engineering and mathematics (STEM). Led by Earth scientists the Program awarded scholarships to students in their junior or senior years majoring in computer science, geosciences, mathematics and physics to create two cohorts of students that spent a total of four semesters in an interdisciplinary community. The program included mentoring of undergraduate students by faculty and graduate students (peer-mentoring), a sequence of three semesters of a one-credit seminar course and opportunities to engage in research activities, research seminars and other enriching academic experiences. Faculty and peer-mentoring were integrated into all parts of the scholarship activities. The one-credit seminar course, although designed to expose scholars to the diversity STEM disciplines and to highlight research options and careers in these disciplines, was thematically focused on geoscience, specifically on ocean and atmospheric science. The program resulted in increased retention rates relative to institutional averages. In this presentation we will discuss the process of establishing the program, from the original plans to its implementation, as well as the impact of this multidisciplinary approach to geoscience education at our institution and beyond. An overview of accomplishments, lessons learned and potential for best practices will be presented.

Effect of different doses of aerobic exercise on total white blood cell (WBC and WBC subfraction number in postmenopausal women: results from DREW.

Directory of Open Access Journals (Sweden)

Neil M Johannsen

Full Text Available BACKGROUND: Elevated total white blood cell (WBC count is associated with an increased risk of coronary heart disease and death. Aerobic exercise is associated with lower total WBC, neutrophil, and monocyte counts. However, no studies have evaluated the effect of the amount of aerobic exercise (dose on total WBC and WBC subfraction counts. PURPOSE: To examine the effects of 3 different doses of aerobic exercise on changes in total WBC and WBC subfraction counts and independent effects of changes in fitness, adiposity, markers of inflammation (IL-6, TNF-α, C-reactive protein, fasting glucose metabolism, and adiponectin. METHODS: Data from 390 sedentary, overweight/obese postmenopausal women from the DREW study were used in these analyses. Women were randomized to a non-exercise control group or one of 3 exercise groups: energy expenditure of 4, 8, or 12 kcal kg(-1⋅week(-1 (KKW for 6 months at an intensity of 50% VO2peak. RESULTS: A dose-dependent decrease in total WBC counts (trend P = 0.002 was observed with a significant decrease in the 12KKW group (-163.1±140.0 cells/µL; mean±95%CI compared with the control (138.6±144.7 cells/µL. A similar response was seen in the neutrophil subfraction (trend P = 0.001 with a significant decrease in the 12KKW group (-152.6±115.1 cells/µL compared with both the control and 4KKW groups (96.4±119.0 and 21.9±95.3 cells/µL, respectively and in the 8KKW group (-102.4±125.0 cells/µL compared with the control. When divided into high/low baseline WBC categories (median split, a dose-dependent decrease in both total WBCs (P = 0.003 and neutrophils (P<0.001 was observed in women with high baseline WBC counts. The effects of exercise dose on total WBC and neutrophil counts persisted after accounting for significant independent effects of change in waist circumference and IL-6. CONCLUSION: Aerobic exercise training reduces total WBC and neutrophil counts, in a dose-dependent manner, in

Estimating the unknown components of nutrient mass balances for forestry plantations in mine rehabilitation, upper Hunter Valley, New South Wales, Australia.

Science.gov (United States)

Mercuri, A M; Duggin, J A; Daniel, H; Lockwood, P V; Grant, C D

2006-04-01

Commercial forestry plantations as a postmining land use in the Upper Hunter Valley of New South Wales, Australia are restricted by both the poor nutrient availability of mining substrates and low regional rainfall. An experiment was conducted to investigate whether municipal waste products and saline groundwater from coal mining operations could improve early tree growth without impacting on the environment through salt accumulation and/or nutrient enrichment and changes in groundwater quality. Potential impacts were investigated by quantifying the nutrient cycling dynamics within the plantation using an input-output mass balance approach for exchangeable calcium (Ca(2+)), exchangeable magnesium (Mg(2+)), exchangeable potassium (K(+)), exchangeable sodium (Na(+)), nitrogen (N), and phosphorus (P). Measured inputs to and outputs from the available nutrient pool in the 0-30 cm of the overburden subsystem were used to estimate the net effect of unmeasured inputs and outputs (termed "residuals"). Residual values in the mass balance of the irrigated treatments demonstrated large leaching losses of exchangeable Ca, Mg, K, and Na. Between 96% and 103% of Na applied in saline mine-water irrigation was leached below the 0-30-cm soil profile zone. The fate of these salts beyond 30 cm is unknown, but results suggest that irrigation with saline mine water had minimal impact on the substrate to 30 cm over the first 2 years since plantation establishment. Accumulations of N and P were detected for the substrate amendments, suggesting that organic amendments (particularly compost) retained the applied nutrients with very little associated losses, particularly through leaching.

Forest Stakeholder Participation in Improving Game Habitat in Swedish Forests

Directory of Open Access Journals (Sweden)

Eugene E. Ezebilo

2012-07-01

Full Text Available Although in Sweden the simultaneous use of forests for timber production and game hunting are both of socioeconomic importance it often leads to conflicting interests. This study examines forest stakeholder participation in improving game habitat to increase hunting opportunities as well as redistribute game activities in forests to help reduce browsing damage in valuable forest stands. The data for the study were collected from a nationwide survey that involved randomly selected hunters and forest owners in Sweden. An ordered logit model was used to account for possible factors influencing the respondents’ participation in improving game habitat. The results showed that on average, forest owning hunters were more involved in improving game habitat than non-hunting forest owners. The involvement of non-forest owning hunters was intermediate between the former two groups. The respondents’ participation in improving game habitat were mainly influenced by factors such as the quantity of game meat obtained, stakeholder group, forests on hunting grounds, the extent of risk posed by game browsing damage to the economy of forest owners, importance of bagging game during hunting, and number of hunting days. The findings will help in designing a more sustainable forest management strategy that integrates timber production and game hunting in forests.

Hydrology, water quality, and water-supply potential of ponds at Hunter Army Airfield, Chatham County, Georgia, November 2008-July 2009

Science.gov (United States)

Clarke, John S.; Painter, Jaime A.

2010-01-01

The hydrology, water quality, and water-supply potential of four ponds constructed to capture stormwater runoff at Hunter Army Airfield, Chatham County, Georgia, were evaluated as potential sources of supplemental irrigation supply. The ponds are, Oglethorpe Lake, Halstrum Pond, Wilson Gate Pond, and golf course pond. During the dry season, when irrigation demand is highest, ponds maintain water levels primarily from groundwater seepage. The availability of water from ponds during dry periods is controlled by the permeability of surficial deposits, precipitation and evaporation, and the volume of water stored in the pond. Net groundwater seepage (Gnet) was estimated using a water-budget approach that used onsite and nearby climatic and hydrologic data collected during November-December 2008 including precipitation, evaporation, pond stage, and discharge. Gnet was estimated at three of the four sites?Oglethorpe Lake, Halstrum Pond, and Wilson Gate Pond?during November-December 2008. Pond storage volume in the three ponds ranged from 5.34 to 12.8 million gallons. During November-December 2008, cumulative Gnet ranged from -5.74 gallons per minute (gal/min), indicating a net loss in pond volume, to 19 gal/min, indicating a net gain in pond volume. During several periods of stage recovery, daily Gnet rates were higher than the 2-month cumulative amount, with the highest rates of 178 to 424 gal/min following major rainfall events during limited periods. These high rates may include some contribution from stormwater runoff; more typical recovery rates were from 23 to 223 gal/min. A conservative estimate of the volume of water available for irrigation supply from three of the ponds was provided by computing the rate of depletion of pond volume for a variety of withdrawal rates based on long-term average July precipitation and evaporation and the lowest estimated Gnet rate at each pond. Withdrawal rates of 1,000, 500, and 250 gal/min were applied during an 8-hour daily

Sediment tracing in the upper Hunter catchment using elemental and mineralogical compositions: Implications for catchment-scale suspended sediment (dis)connectivity and management

Science.gov (United States)

Fryirs, Kirstie; Gore, Damian

2013-07-01

River bed colmation layers clog the interstices of gravel-bed rivers, impeding the vertical exchange of water and nutrients that drives ecosystem function in the hyporheic zone. In catchments where fine-grained sediment supply has increased since human disturbance, understanding sediment provenance and the (dis)connectivity of supply allows practitioners to target sediment source problems and treat them within catchment management plans. Release of alluvial fine-grained sediment from channel bank erosion since European settlement has resulted in the formation of a colmation layer along the upper Hunter River at Muswellbrook, eastern Australia. X-ray fluorescence spectrometry (XRF) and X-ray diffractometry (XRD) are used to determine the elemental and mineralogical signatures of colmation layer and floodplain sediment sources across this 4480 km2 catchment. This sediment tracing technique is used to construct a picture of how suspended sediment supply and (dis)connectivity operates in this catchment. In this system, the primary source areas are subcatchments in which sediments are stored largely in partly confined floodplain pockets, but from which sediment supply is unimpeded and directly connected to the receiving reach. Subcatchments in which alluvial sediment storage is significant — and which contain large, laterally unconfined valleys — are essentially 'switched off' or disconnected from the receiving reach. This is because large sediment sinks act to trap fine-grained sediment before it reaches the receiving reach, forming a buffer along the sediment conveyor belt. Given the age structure of floodplains in the receiving reach, this pattern of source area contributions and (dis)connectivity must have occurred throughout the Holocene.

Development of idursulfase therapy for mucopolysaccharidosis type II (Hunter syndrome: the past, the present and the future

Directory of Open Access Journals (Sweden)

Whiteman DAH

2017-08-01

Full Text Available David AH Whiteman,* Alan Kimura* Research & Development, Shire Human Genetic Therapies, Inc., Lexington, MA, USA *These authors contributed equally to this work Abstract: Mucopolysaccharidosis type II (MPS II; Hunter syndrome; OMIM 309900 is a rare, multisystemic, progressive lysosomal storage disease caused by deficient activity of the iduronate-2-sulfatase (I2S enzyme. Accumulation of the glycosaminoglycans dermatan sulfate and heparan sulfate results in a broad range of disease manifestations that are highly variable in presentation and severity; notably, approximately two-thirds of individuals are affected by progressive central nervous system involvement. Historically, management of this disease was palliative; however, during the 1990s, I2S was purified to homogeneity for the first time, leading to cloning of the corresponding gene and offering a means of addressing the underlying cause of MPS II using enzyme replacement therapy (ERT. Recombinant I2S (idursulfase was produced for ERT using a human cell line and was shown to be indistinguishable from endogenous I2S. Preclinical studies utilizing the intravenous route of administration provided valuable insights that informed the design of the subsequent clinical studies. The pivotal Phase II/III clinical trial of intravenous idursulfase (Elaprase®; Shire, Lexington, MA, USA demonstrated improvements in a range of clinical parameters; based on these findings, intravenous idursulfase was approved for use in patients with MPS II in the USA in 2006 and in Europe and Japan in 2007. Evidence gained from post-approval programs has helped to improve our knowledge and understanding of management of patients with the disease; as a result, idursulfase is now available to young pediatric patients, and in some countries patients have the option to receive their infusions at home. Although ERT with idursulfase has been shown to improve somatic signs and symptoms of MPS II, the drug does not cross the

Human prehistory: Hunting for the earliest farmers.

Science.gov (United States)

Rowley-Conwy, Peter

2009-11-03

The degree to which the spread of farming into Europe was accompanied by demographic shifts is subject to intense debate. Genetic evidence from Europe's first farmers and their hunter-gatherer counterparts now suggests an important role for the immigration of farmers.

Unretrieved shooting loss of mourning doves in north-central South Carolina

Science.gov (United States)

Haas, G.H.

1977-01-01

Unretrieved loss for mourning doves (Zenaida macroura) in north-central South Carolina was between 27 and 41 percent of the retrieved kill for the 1973 through 1975 hunting seasons based on 1,396 doves shot by 281 hunters. Dove hunters hunted in groups, fired 8.6 shots per retrieved dove, and engaged in a substantial number of illegal activities. Increased dove populations and hunter bag resulted in increased unretrieved loss, numbers of shots per bagged bird, and illegal activities. Retriever dogs increased the efficiency of dove hunters.

Characterising Wildlife Trade Market Supply-Demand Dynamics

Science.gov (United States)

Rowcliffe, M.; Cowlishaw, G.; Alexander, J. S.; Ntiamoa-Baidu, Y.; Brenya, A.; Milner-Gulland, E. J.

2016-01-01

The trade in wildlife products can represent an important source of income for poor people, but also threaten wildlife locally, regionally and internationally. Bushmeat provides livelihoods for hunters, traders and sellers, protein to rural and urban consumers, and has depleted the populations of many tropical forest species. Management interventions can be targeted towards the consumers or suppliers of wildlife products. There has been a general assumption in the bushmeat literature that the urban trade is driven by consumer demand with hunters simply fulfilling this demand. Using the urban bushmeat trade in the city of Kumasi, Ghana, as a case study, we use a range of datasets to explore the processes driving the urban bushmeat trade. We characterise the nature of supply and demand by explicitly considering three market attributes: resource condition, hunter behaviour, and consumer behaviour. Our results suggest that bushmeat resources around Kumasi are becoming increasingly depleted and are unable to meet demand, that hunters move in and out of the trade independently of price signals generated by the market, and that, for the Kumasi bushmeat system, consumption levels are driven not by consumer choice but by shortfalls in supply and consequent price responses. Together, these results indicate that supply-side processes dominate the urban bushmeat trade in Kumasi. This suggests that future management interventions should focus on changing hunter behaviour, although complementary interventions targeting consumer demand are also likely to be necessary in the long term. Our approach represents a structured and repeatable method to assessing market dynamics in information-poor systems. The findings serve as a caution against assuming that wildlife markets are demand driven, and highlight the value of characterising market dynamics to inform appropriate management. PMID:27632169

An Evaluation of PET Based on Longitudinal Data.

Science.gov (United States)

Mandeville, Garrett K.

Although teacher inservice programs based on Madeline Hunter's Program for Effective Teaching (PET) have become very popular in U.S. schools, there is little evidence that the Hunter model ultimately results in increased student achievement. This longitudinal study attempts to evaluate the effects of Hunter-based staff development programs on…

Career Stories

Science.gov (United States)

Lean Six Sigma Office coaches the Los Alamos Little League Girls Softball Team, which in 2017 won the annual benefit performance in Los Alamos. - 9/29/15 James Hunter James Hunter-Discovering Oz James Hunter of nuclear weapons performance and enhance the safety of the nation's nuclear stockpile. - 4/1/15

Condor's biggest threat A California Condor's dinner in the wild is ...

African Journals Online (AJOL)

now condor protectionists are trying to persuade hunters to switch voluntarily to condor-safe lead-free bullets. The. Arizona Game and Fish Department has pioneered a program that distributes free copper bullets to hunters, and environmentalists are trying to convince hunters that lead bullets threaten not only condors but ...

50 CFR 32.43 - Mississippi.

Science.gov (United States)

2010-10-01

... Hunter Education Safety Course card or certificate. You may obtain permits at North Mississippi Refuges.... Youth hunters age 15 and under must possess and carry a hunter safety course card or certificate. Each... roads designated as vehicle access roads on the refuge map (see § 27.31 of this chapter). We prohibit...

Killing animals for recreation?

DEFF Research Database (Denmark)

Gamborg, Christian; Jensen, Frank Søndergaard; Sandøe, Peter

2018-01-01

Hunters in the Western world today do not need to hunt to obtain food and other animal products. So why do they hunt? This paper examines the motives of hunters, the motives ascribed to hunters by members of the general public, and the role motives play for the moral acceptability of hunting among...

Household and kin provisioning by Hadza men.

Science.gov (United States)

Wood, Brian M; Marlowe, Frank W

2013-09-01

We use data collected among Hadza hunter-gatherers between 2005 and 2009 to examine hypotheses about the causes and consequences of men's foraging and food sharing. We find that Hadza men foraged for a range of food types, including fruit, honey, small animals, and large game. Large game were shared not like common goods, but in ways that significantly advantaged producers' households. Food sharing and consumption data show that men channeled the foods they produced to their wives, children, and their consanguineal and affinal kin living in other households. On average, single men brought food to camp on 28% of days, married men without children at home on 31% of days, and married men with children at home on 42% of days. Married men brought fruit, the least widely shared resource, to camp significantly more often than single men. A model of the relationship between hunting success and household food consumption indicates that the best hunters provided 3-4 times the amount of food to their families than median or poor hunters. These new data fill important gaps in our knowledge of the subsistence economy of the Hadza and uphold predictions derived from the household and kin provisioning hypotheses. Key evidence and assumptions backing prior claims that Hadza hunting is largely a form of status competition were not replicated in our study. In light of this, family provisioning is a more viable explanation for why good hunters are preferred as husbands and have higher fertility than others.

Long-timescale dynamics of the Drew-Dickerson dodecamer

Czech Academy of Sciences Publication Activity Database

Dans, P. D.; Danilane, L.; Ivani, I.; Dršata, Tomáš; Lankaš, Filip; Hospital, A.; Walther, J.; Pujagut, R. I.; Battistini, F.; Gelpí, J. L.; Lavery, R.; Orozco, M.

2016-01-01

Roč. 44, č. 9 (2016), s. 4052-4066 ISSN 0305-1048 R&D Projects: GA ČR(CZ) GA14-21893S Institutional support: RVO:61388963 Keywords : microsecond molecular dynamics * B-DNA dodecamer * analyzing ion distributions Subject RIV: CE - Biochemistry Impact factor: 10.162, year: 2016 http://nar.oxfordjournals.org/content/44/9/4052.full

Hydrogeologic characteristics and water quality of a confined sand unit in the surficial aquifer system, Hunter Army Airfield, Chatham County, Georgia

Science.gov (United States)

Gonthier, Gerard

2012-01-01

An 80-foot-deep well (36Q397, U.S. Geological Survey site identification 320146081073701) was constructed at Hunter Army Airfield to assess the potential of using the surficial aquifer system as a water source to irrigate a ballfield complex. A 300-foot-deep test hole was drilled beneath the ballfield complex to characterize the lithology and water-bearing characteristics of sediments above the Upper Floridan aquifer. The test hole was then completed as well 36Q397 open to a 19-foot-thick shallow, confined sand unit contained within the surficial aquifer system. A single-well, 24-hour aquifer test was performed by pumping well 36Q397 at a rate of 50 gallons per minute during July 13-14, 2011, to characterize the hydrologic properties of the shallow, confined sand unit. Two pumping events prior to the aquifer test affected water levels. Drawdown during all three pumping events and residual drawdown during recovery periods were simulated using the Theis formula on multiple changes in discharge rate. Simulated drawdown and residual drawdown match well with measured drawdown and residual drawdown using values of horizontal hydraulic conductivity and specific storage, which are typical for a confined sand aquifer. Based on the hydrologic parameters used to match simulated drawdown and residual drawdown to measured drawdown and residual drawdown, the transmissivity of the sand was determined to be about 400 feet squared per day. The horizontal hydraulic conductivity of the sand was determined to be about 20 feet per day. Analysis of a water-quality sample indicated that the water is suitable for irrigation. Sample analysis indicated a calcium-carbonate type water having a total dissolved solids concentration of 39 milligrams per liter. Specific conductance and concentrations of all analyzed constituents were below those that would be a concern for irrigation, and were below primary and secondary water-quality criteria levels.

Field Testing of Activated Carbon Mixing and In Situ Stabilization of PCBs in Sediment

Science.gov (United States)

2009-05-01

tract irritation Carcinogen, lung, GI system disease Zinc Inh, Ing Metal fume fever, skin irritation GI system effects, dermatitis GI...Metal Slag Areas, Parcel E, Hunters Point Shipyard, San Francisco, California. Appendix D: Final Radiation Control Plan. June 18. Draft Hunters...printed) Signature Final Radiological Control Plan Metal Debris Reef and Metal Slag Areas Parcel E, Hunters Point

Inland Ertebølle culture

DEFF Research Database (Denmark)

Philippsen, Bente

The Ertebølle culture is a late-Mesolithic hunter-gatherer-fisher culture in Southern Scandinavia, Northern Germany and Poland. Archaeological finds as well as scientific analyses of humans and their artefacts indicate the great importance of aquatic resources for this culture. This applies both...

Propagandes, films et guerre du Vietnam : histoires d’hommes et de femmes ou propagande du « genre » de The Deer Hunter (1978 à Path to War (2002 Vietnam War and Films: Men and Women’s Stories or Gender Propaganda? From The DeerHunter (1978 to Path to War (2002

Directory of Open Access Journals (Sweden)

Alexandra Boudet-Brugal

2009-06-01

Full Text Available Drawing from a selection of movies (and a documentary, I propose to study some images of men and women in the context of the Vietnam War, taking a closer look at women’s. To some extent, they contribute to revealing how the “field of battle” has become a “field of gender” and what is at stake. The film as a medium is involved in what we may call “war propaganda”: in the movies, there are elements that are part and parcel of what makes the traditional image of men and women in wartime. It is mostly about defining men as visible acting characters on stage and women as secondary characters (Path to War, playing the part of the apolitical and maternal Other (Heaven and Earth. Indeed, their historical identity mainly defines them as “those who do not make war” (The Deer Hunter. Sometimes, the female image is ambivalent. But the portraits of those who betray their gender, the women warriors (Full Metal Jacket and the unfaithful (Coming Home, though proposing new facets, do integrate into gender war propaganda. Occasionally the images showed also reveal new voices and paths (Regret to Inform, In Country, Heaven and Earth. It is true that overall we encounter no heroines but “super-hero soldiers” who rescue women (Heaven and Earth, Coming Home; however the representations offer a new space, emancipated from historical and social expectations. But do these stories suggest that women’s stories may be war stories and be part of history?

CSIR Annual report 1960-61

CSIR Research Space (South Africa)

CSIR

1960-01-01

Full Text Available In its last Annual Report, the Council drew attention to the important role it is called upon to play in stimulating the development of research in industry. It was pointed out that, for the first fifteen years of its existence, the Council has been...

Functions and values of hunting and its management in Spain: scientific studies on the hunting community

Directory of Open Access Journals (Sweden)

Miguel Delibes-Mateos

2018-01-01

Full Text Available We summarize information provided by some recent scientific studies in relation to the opinions, views and attitudes of Spanish hunters regarding hunting and its management. In particular, we discuss the different functions (economic, ecological and social that hunters attribute to hunting, as well as their moral judgements associated with the different motives for hunting. In addition, we explore how hunters value different game management tools (including predator control, releases of farm-reared animals and the regulation of hunting pressure, and we discuss how such valuations affect their decision-making. Finally, we assess potential future trends of hunting, as expressed by the hunters themselves.

Highlight: Dr David Butler-Jones on fighting pandemics | IDRC ...

International Development Research Centre (IDRC) Digital Library (Canada)

2016-04-15

Apr 15, 2016 ... In the context of developing countries, Butler-Jones drew attention to the importance of public healthcare teams of doctors and paramedics, data, and accreditation standards in identifying appropriate interventions. There is a need to explore the public-private nexus, traditional medicines, and public health ...

Higher Ambitions Summit. Rapporteur Report

Science.gov (United States)

Nash, Ian

2014-01-01

The Sutton Trust and Pearson two-day summit on higher ambitions in apprenticeships and vocational education drew more than 120 leaders in education, training and employment, policy makers, academics, and researchers to London. Delegates heard from political leaders stressing the importance they attach to high-quality apprenticeships. Presentations…

A Decision for War: The Formulation of English Foreign Policy from September 1754 to July 1755.

Science.gov (United States)

1981-07-31

traditional colonial enemy in an area of vital economic importance . 8 3 Thus, when Mirepoix arrived in London on 14 January, both England and France earnestly...and her position in the event of an Anglo-French confrontation either in Europe or America was of the utmost importance . France drew attention to the...of Honduras remained sources of Anglo-Spanish friction. The English mini- stry realized the importance of retaining the goodwill and neutrality of

Worldwide Emerging Environmental Issues Affecting the U.S. Military. October 2007 Report

Science.gov (United States)

2007-10-01

species ’ extinction , and unsustainable depletion of the world’s scarce resources are the most important threats to human survival. The report reiterates...diamond hunters and hopes of independence to Greenland http://www.guardian.co.uk/environment/2007/oct/04/1 Warming Revives Flora and Fauna in Greenland

Study of stability of the ceramic Ba{sub 2}NiWO{sub 6} in crude petroleum drew back from state - Brazil oil wells; Microestrutura e propriedades mecanicas da ceramica Ba{sub 2}NiWO{sub 6} apos imersao em petroleo cru retirado de pocos de prtroleo do estado de Sergipe - Brasil

Energy Technology Data Exchange (ETDEWEB)

Yadava, Y.P.; Bezerra, L.P.; Diniz, M.J.L.; Ferreira, R.A.S. [Universidade Federal de Pernambuco (DEM/UFPE), Recife, PE (Brazil). Dept. de Engenharia Mecanica], e-mail: yadava@ufpe.br

2008-07-01

The necessity of developing technologies which make practical the oil-well exploration is notorious. Knowing that those are hostile places is necessary to find materials which are capable to resist to the inclemency caused by those environments. Pondering that the ceramics show the required characteristics to this purpose the present assignment views the elaboration of complex perovskite ceramic Ba{sub 2}NiWO{sub 6} to produce ceramics components parts of temperature sensors to oil-well. To this purpose we studied the ceramic stability when they are vulnerable to the attack of the crude petroleum drew back from ocean and earth's oil-wells of Sergipe state-Brazil. The ceramics were submersed in the mentioned petroleum during thirty days and then they were analyzed by X-ray diffraction, optics microscopy and microhardness Vickers to verify if changes happened in the structure, microstructure and mechanics proprieties characteristics. These results are showed and discussed in this assignment. (author)

Scientific Research & Subsistence: Protocols to Ensure Co-Existence

Science.gov (United States)

Nachman, C.; Holman, A.; DeMaster, D.

2017-12-01

used in a larger context to address concerns over increased vessel traffic from other activities. We will outline the importance of establishing the guidelines, describe the general process, and highlight examples of positive interactions with Alaska Native hunters during scientific research operations using this protocol.

Lead exposure through consumption of big game meat in Quebec, Canada: risk assessment and perception.

Science.gov (United States)

Fachehoun, Richard Coovi; Lévesque, Benoit; Dumas, Pierre; St-Louis, Antoine; Dubé, Marjolaine; Ayotte, Pierre

2015-01-01

Game meat from animals killed by lead ammunition may expose consumers to lead. We assessed the risk related to lead intake from meat consumption of white-tailed deer and moose killed by lead ammunition and documented the perception of hunters and butchers regarding this potential contamination. Information on cervid meat consumption and risk perception were collected using a mailed self-administrated questionnaire which was addressed to a random sample of Quebec hunters. In parallel, 72 samples of white-tailed deer (n = 35) and moose (n = 37) meats were collected from voluntary hunters and analysed for lead content using inductively coupled plasma-mass spectrometry. A risk assessment for people consuming lead shot game meat was performed using Monte Carlo simulations. Mean lead levels in white-tailed deer and moose killed by lead ammunition were 0.28 and 0.17 mg kg(-1) respectively. Risk assessment based on declared cervid meat consumption revealed that 1.7% of the surveyed hunters would exceed the dose associated with a 1 mmHg increase in systolic blood pressure (SBP). For consumers of moose meat once, twice or three times a week, simulations predicted that 0.5%, 0.9% and 1.5% of adults would be exposed to a dose associated with a 1 mmHg increase in SBP, whereas 0.9%, 1.9% and 3.3% of children would be exposed to a dose associated with 1 point intelligence quotient (IQ) decrease, respectively. For consumers of deer meat once, twice or three times a week, the proportions were 1.6%, 2.9% and 4% for adults and 2.9%, 5.8% and 7.7% for children, respectively. The consumption of meat from cervids killed with lead ammunition may increase lead exposure and its associated health risks. It would be important to inform the population, particularly hunters, about this potential risk and promote the use of lead-free ammunition.

Sex Differences in Food Preferences of Hadza Hunter-Gatherers

OpenAIRE

Julia Colette Berbesque; Frank W. Marlowe

2009-01-01

Food preferences are important for understanding foraging choices. In studying human foragers rather than other animals, we have the advantage of being able to ask them which foods they prefer. Yet surprisingly, no studies of systematically collected data exist on human forager food preferences. The Hadza of Tanzania are full-time foragers in an area where the hominin record extends back to 3-4 million years ago, so their diet is very relevant for understanding the paleo-diet. Here, we report...

Hunting, Livelihoods and Declining Wildlife in the Hponkanrazi Wildlife Sanctuary, North Myanmar

Science.gov (United States)

Rao, Madhu; Htun, Saw; Zaw, Than; Myint, Than

2010-08-01

The Hponkanrazi Wildlife Sanctuary, North Myanmar and three contiguous protected areas, comprise some of the largest expanses of natural forest remaining in the region. Demand for wildlife products has resulted in unsustainable exploitation of commercially valuable species resulting in local extirpation of vulnerable species. Camera trap, track and sign, and questionnaire-based surveys were used to examine (a) wildlife species targeted by hunters, (b) the importance of wild meat for household consumption, and (c) the significance of hunting as a livelihood activity for resident villages. Certain commercially valuable species highly preferred by hunters were either completely absent from hunt records (tiger, musk deer and otter) or infrequently obtained during actual hunts (bear, pangolin). Species obtained by hunters were commonly occurring species such as muntjacs with low commercial value and not highly preferred by hunters. Fifty eight percent of respondents ( n = 84) indicated trade, 27% listed subsistence use and 14% listed human-wildlife conflict as the main reason for hunting ( n = 84). Average amount of wild meat consumed per month is not significantly higher during the hunting season compared to the planting season (paired t-test, P > 0.05). Throughout the year, the average amount of fish consumed per month was higher than livestock or wild meat (Friedman test, P < 0.0001). Hunting is driven largely by trade and wild meat, while not a critical source of food for a large number of families could potentially be an important, indirect source of access to food for hunting families. Findings and trends from this study are potentially useful in helping design effective conservation strategies to address globally prevalent problems of declining wildlife populations and dependent human communities. The study provides recommendations to reduce illegal hunting and protect vulnerable species by strengthening park management through enforcement, increasing the

Colonial Military Intelligence in the Zulu Rebellion, 1906 | Thompson ...

African Journals Online (AJOL)

In the Zulu Rebellion of 1906, the Natal Militia defeated the Zulu rebels without British imperial forces having to intervene in the conflict. The colonial forces were well adapted to the local circumstances, but in one important respect they drew heavily on imperial experience, namely military field intelligence. Colonial military ...

Boekbesprekings/Book Review: "Pioneers of the Waterberg: a ...

African Journals Online (AJOL)

Abstract. ELIZABETH HUNTER (samesteller) Pioneers of the Waterberg: a photographic journey. Lephalale: Elizabeth Hunter (uitgewer); Johannesburg: Camera Press (drukker&binder), 2010 128 pp. ISBN: 978-0-620-49969-9 ...

colonial military intelligence in the zulu rebellion, 1906

African Journals Online (AJOL)

user

The colonial forces were well adapted to the local circumstances, but in one important respect they drew heavily on imperial experience, namely military field intelligence. .... There was a militia library, and for a while, militia orders listed new ..... intelligence called the questioning of women “a very difficult matter” in which a.

Fine-scale genetic structure and social organization in female white-tailed deer

Science.gov (United States)

Christopher E. Comer; John C. Kilgo; Gino J. D' Angelo; Travis C. Glenn; Karl V. Miller

2005-01-01

Social behavior of white-tailed deer (Odocoileus virginianus) can have important management implications. The formation of matrilineal social groups among female deer has been documented and management strategies have been proposed based on this well-developed social structure. Using radiocollared (n = 17) and hunter or vehicle-killed (n = 21) does, we examined spatial...

Timemanagement op Spitsbergen : Een historisch-archeologische benadering van Pomoren in de 18de eeuw

NARCIS (Netherlands)

Dresscher, Sarah

2015-01-01

Past peoples living in the Arctic had to deal with seasonal extremes. They needed to plan ahead and make vitally important choices concerning where to live, what and when to hunt, and what to store for later use. This kind of planning and time-management was vital for hunter-gatherers living across

Identification of genes differentially expressed in Jining Grey and ...

African Journals Online (AJOL)

ejiro

As an important reproductive and endocrine organ, ovary plays a pivotal role in determining female prolifi- ... 3') were designed according to the third generation primers of. GenHunter Company. Total RNA (4 μg) treated ... based on their differences (lack, density and size). However, some of the recovered bands could not ...

Speciation of Bactrocera dorsalis complex based on aedeagus length

International Nuclear Information System (INIS)

Osamu Iwahashi

2000-01-01

A species complex of Bactrocera dorsalis (Hendel) in Southeast Asia is composed of 52 species (Drew and Hancock, 1994) and while some of these species are economically very important, distinguishing them based on morphological characters has been difficult (White and Elson-Harris 1992). Specifically, there is considerable difficulty in differentiating between males of two pairs of sympatric species, B. philippinensis Drew and Hancock/B. occipitalis (Bezzi) in the Philippines and B. carambolae Drew and Hancock/B. papayae Drew and Hancock in Indonesia. This may be, in part, because the evolutionary processes within this species complex are still very dynamic, and that natural hybridisation between sympatric species pairs might be occurring on a regular basis (He and Haymer 1997). Iwaizumi et al. (1997) developed a simple method to differentiate the two sets of sympatric species based on aedeagus lengths. However, these flies had been reared artificially under laboratory conditions and only a small number of specimens (n=5) was used. Consequently, they were not able to obtain a frequency distribution of the aedeagus length for each species. Iwahashi (1998) measured a larger number of wild flies collected on Guimaras Is, Philippines, and found that flies with the aedeagus length of 2.89 mm are B. philippinensis. Iwahashi (1999) also showed that the measurement of the aedeagal length of fruit flies is a reliable characteristic for distinguishing between the 2 sympatric species pairs in the B. dorsalis complex. This being so, it may also be interesting to interpret phylogenetic relationships among B. dorsalis complex species based on the aedeagus length. Thus, aedeagus lengths of different populations of five B. dorsalis complex species are measured and their relationships discussed

Optimization of Maillard Reaction in Model System of Glucosamine and Cysteine Using Response Surface Methodology.

Science.gov (United States)

Arachchi, Shanika Jeewantha Thewarapperuma; Kim, Ye-Joo; Kim, Dae-Wook; Oh, Sang-Chul; Lee, Yang-Bong

2017-03-01

Sulfur-containing amino acids play important roles in good flavor generation in Maillard reaction of non-enzymatic browning, so aqueous model systems of glucosamine and cysteine were studied to investigate the effects of reaction temperature, initial pH, reaction time, and concentration ratio of glucosamine and cysteine. Response surface methodology was applied to optimize the independent reaction parameters of cysteine and glucosamine in Maillard reaction. Box-Behnken factorial design was used with 30 runs of 16 factorial levels, 8 axial levels and 6 central levels. The degree of Maillard reaction was determined by reading absorption at 425 nm in a spectrophotometer and Hunter's L, a, and b values. ΔE was consequently set as the fifth response factor. In the statistical analyses, determination coefficients (R 2 ) for their absorbance, Hunter's L, a, b values, and ΔE were 0.94, 0.79, 0.73, 0.96, and 0.79, respectively, showing that the absorbance and Hunter's b value were good dependent variables for this model system. The optimum processing parameters were determined to yield glucosamine-cysteine Maillard reaction product with higher absorbance and higher colour change. The optimum estimated absorbance was achieved at the condition of initial pH 8.0, 111°C reaction temperature, 2.47 h reaction time, and 1.30 concentration ratio. The optimum condition for colour change measured by Hunter's b value was 2.41 h reaction time, 114°C reaction temperature, initial pH 8.3, and 1.26 concentration ratio. These results can provide the basic information for Maillard reaction of aqueous model system between glucosamine and cysteine.

Integration of Human Reliability Analysis Models into the Simulation-Based Framework for the Risk-Informed Safety Margin Characterization Toolkit

International Nuclear Information System (INIS)

Boring, Ronald; Mandelli, Diego; Rasmussen, Martin; Ulrich, Thomas; Groth, Katrina; Smith, Curtis

2016-01-01

This report presents an application of a computation-based human reliability analysis (HRA) framework called the Human Unimodel for Nuclear Technology to Enhance Reliability (HUNTER). HUNTER has been developed not as a standalone HRA method but rather as framework that ties together different HRA methods to model dynamic risk of human activities as part of an overall probabilistic risk assessment (PRA). While we have adopted particular methods to build an initial model, the HUNTER framework is meant to be intrinsically flexible to new pieces that achieve particular modeling goals. In the present report, the HUNTER implementation has the following goals: • Integration with a high fidelity thermal-hydraulic model capable of modeling nuclear power plant behaviors and transients • Consideration of a PRA context • Incorporation of a solid psychological basis for operator performance • Demonstration of a functional dynamic model of a plant upset condition and appropriate operator response This report outlines these efforts and presents the case study of a station blackout scenario to demonstrate the various modules developed to date under the HUNTER research umbrella.

Integration of Human Reliability Analysis Models into the Simulation-Based Framework for the Risk-Informed Safety Margin Characterization Toolkit

Energy Technology Data Exchange (ETDEWEB)

Boring, Ronald [Idaho National Lab. (INL), Idaho Falls, ID (United States); Mandelli, Diego [Idaho National Lab. (INL), Idaho Falls, ID (United States); Rasmussen, Martin [Norwegian Univ. of Science and Technology, Trondheim (Norway). Social Research; Herberger, Sarah [Idaho National Lab. (INL), Idaho Falls, ID (United States); Ulrich, Thomas [Idaho National Lab. (INL), Idaho Falls, ID (United States); Groth, Katrina [Sandia National Lab. (SNL-NM), Albuquerque, NM (United States); Smith, Curtis [Idaho National Lab. (INL), Idaho Falls, ID (United States)

2016-06-01

This report presents an application of a computation-based human reliability analysis (HRA) framework called the Human Unimodel for Nuclear Technology to Enhance Reliability (HUNTER). HUNTER has been developed not as a standalone HRA method but rather as framework that ties together different HRA methods to model dynamic risk of human activities as part of an overall probabilistic risk assessment (PRA). While we have adopted particular methods to build an initial model, the HUNTER framework is meant to be intrinsically flexible to new pieces that achieve particular modeling goals. In the present report, the HUNTER implementation has the following goals: • Integration with a high fidelity thermal-hydraulic model capable of modeling nuclear power plant behaviors and transients • Consideration of a PRA context • Incorporation of a solid psychological basis for operator performance • Demonstration of a functional dynamic model of a plant upset condition and appropriate operator response This report outlines these efforts and presents the case study of a station blackout scenario to demonstrate the various modules developed to date under the HUNTER research umbrella.

Structure, Stiffness and Substates of the Dickerson-Drew Dodecamer

Czech Academy of Sciences Publication Activity Database

Dršata, Tomáš; Pérez, A.; Orozco, M.; Morozov, A. V.; Šponer, Jiří; Lankaš, Filip

2013-01-01

Roč. 9, č. 1 (2013), s. 707-721 ISSN 1549-9618 R&D Projects: GA ČR(CZ) GAP208/11/1822 Grant - others:CEITEC(XE) CZ.1.05/1.1.00/02.0068 Institutional support: RVO:61388963 ; RVO:68081707 Keywords : DNA * mechanical properties * molecular dynamics Subject RIV: CF - Physical ; Theoretical Chemistry Impact factor: 5.310, year: 2013

Stemcell Information: SKIP000984 [SKIP Stemcell Database[Archive

Lifescience Database Archive (English)

Full Text Available istochemistry ... Yes Differentiation Yes RT-PCR No ... Yes ... Yes RT-PCR ... Tony Hunter Tony Hunter Molecular and Cell Biology... Laboratory, Salk Institute for Biological Studies, La Jolla, United States Molecular and Cell Biology...tes Molecular and Cell Biology Laboratory, Salk Institute for Biological Studies, La Jolla, United States Molecular and Cell Biology...ter Tony Hunter Information Only Molecular and Cell Biology Laboratory, Salk Inst...itute for Biological Studies, La Jolla, United States Molecular and Cell Biology Laboratory, Salk Institute

My Oar Keeps Breaking: How to Move Your Part of the Program Forward

Science.gov (United States)

2016-02-01

ship analogy. I had a whiteboard in my office. One day, I drew a large sailing ship with two masts and labeled the ship the S.S. Program. I drew...the journey over the edge. Finally, another drew a little boat popping up out of the water and labeled it the alternative to our program that the...that I needed to focus my energies on the part of the program I could control. 55 Defense AT&L: January–February 2016 moron! Of course you can’t

A comparison of two procedures for labelling the surface of the hydatid disease organism, Echinococcus granulosus, with 125I

International Nuclear Information System (INIS)

McManus, D.P.; McLaren, D.J.; Clark, N.W.T.; Parkhouse, R.M.E.

1987-01-01

Living, intact protoscoleces of the British horse and sheep strains of Echinococcus granulosus were subjected to surface radioiodination procedures using 125 I and Iodogen and 125 I-Bolton Hunter reagent. Subsequent combined electron microscopy and autoradiography revealed specific surface membrane labelling with the Iodogen procedure, but significant tegumental labelling with the Bolton-Hunter reagent. The two parasite strains yielded different profiles of electrophoretically separated labelled proteins; the Iodogen method, not surprisingly, resulted in a less complex pattern of labelled polypeptides than the Bolton and Hunter reagent. (author)

Brown bear-human interactions associated with deer hunting on Kodiak Island

Science.gov (United States)

Barnes, Victor G.

1994-01-01

I compared distribution and range of brown bears (Ursus arctos middendorffi) with temporal and spatial distribution of Sitka black-tailed deer (Odocoileus hemionus sitkensis) hunting activity on westside Kodiak Island, Alaska, to examine impacts of deer hunting on bears. Mean number of bears that annually ranged ≤5 km from the coast, >5 km inland from the coast, or in both areas was 10, 8, and 11, respectively. Bears that exclusively or seasonally occupied the coast zone were usually classed as having moderate or high potential to interact with hunters because most hunter access and effort (>95%) was via the coast. Bears that ranged exclusively inland were considered unlikely to encounter hunters. Animals that ranged in both zones often (39%) moved inland during fall (Oct-Dec) and most bears (70%) denned in the inland zone. Females that denned near the coast entered dens later (x̄ = 22 Nov) than females that denned inland (x̄ = 12 Nov). Two radio-collared bears were known to raid deer-hunting camps and 9 other marked bears were observed by hunters or were located bear during their hunt. Seven to 21% of the respondents reported having a threatening encounter with a bear and 5-26% reported losing deer meat to bears. Human-induced mortality to radio-collared bears occurred more often near the coast (5) than inland (3); 7 bears were harvested by sport hunters and 1 was killed (nonsport) in a Native village. Deer hunters killed 2 unmarked females in defense of life or property situations in the study area. High bear densities and concentrated deer-hunting activity combine to make conflicts unavoidable. Adverse impacts to bears can be minimized by maintaining low levels of human activity in inland areas and improving hunter awareness of bear ecology and behavior.

Oil and gas development influences big-game hunting in Wyoming

Science.gov (United States)

Dorning, Monica; Garman, Steven L.; Diffendorfer, James E.; Semmens, Darius J.; Hawbaker, Todd J.; Bagstad, Kenneth J.

2017-01-01

Development from extracting oil and gas resources can have unintended effects on multiple ecosystem functions, with cascading effects on wildlife, ecosystem services, and local economies. Big-game hunting opportunities may be closely related to these effects, but empirical analyses of impacts of energy development on hunting are limited. We examined the influence of oil and gas development density on harvest efficiency, or harvest per unit of hunter effort, within all hunt areas in Wyoming, USA, from 2008 to 2014 for 3 big-game species: elk (Cervus canadensis), mule deer (Odocoileus hemionus), and pronghorn (Antilocapra americana). Using harvest/hunter day as the response variable, we compared linear mixed-effects models for each species that included total well density (i.e., all wells constructed up to the year of record), active well density (i.e., only those wells currently producing oil or gas in that year), or neither as a predictor variable. We used well densities as indicators of development in the absence of data specifying the locations of other oil and gas infrastructure (e.g., roads, well pads). Models also accounted for the fixed effects of road density, hunter density, proportion of the area that is public land with unrestricted hunter access, proportion of the area that is forested, year of observation, and random effects of variation among hunt areas nested within associated game herd units. Presence of oil and gas wells had a positive influence on harvest efficiency for elk and mule deer. Although there was no overall effect to pronghorn, there was a negative influence of wells on juvenile pronghorn harvest efficiency. Changes in harvest efficiency due to expanding oil and gas development could alter the time spent hunting by hunters and their chances of harvesting an animal. This could have subsequent impacts on hunter satisfaction, game populations, and economic revenue generated from recreational hunters.

Target-Searching on Percolation

International Nuclear Information System (INIS)

Yang Shijie

2005-01-01

We study target-searching processes on a percolation, on which a hunter tracks a target by smelling odors it emits. The odor intensity is supposed to be inversely proportional to the distance it propagates. The Monte Carlo simulation is performed on a 2-dimensional bond-percolation above the threshold. Having no idea of the location of the target, the hunter determines its moves only by random attempts in each direction. For lager percolation connectivity p ∼> 0.90, it reveals a scaling law for the searching time versus the distance to the position of the target. The scaling exponent is dependent on the sensitivity of the hunter. For smaller p, the scaling law is broken and the probability of finding out the target significantly reduces. The hunter seems trapped in the cluster of the percolation and can hardly reach the goal.

Comparison of two procedures for labelling the surface of the hydatid disease organism, Echinococcus granulosus, with /sup 125/I

Energy Technology Data Exchange (ETDEWEB)

McManus, D.P.; McLaren, D.J.; Clark, N.W.T.; Parkhouse, R.M.E.

1987-03-01

Living, intact protoscoleces of the British horse and sheep strains of Echinococcus granulosus were subjected to surface radioiodination procedures using /sup 125/I and Iodogen and /sup 125/I-Bolton Hunter reagent. Subsequent combined electron microscopy and autoradiography revealed specific surface membrane labelling with the Iodogen procedure, but significant tegumental labelling with the Bolton-Hunter reagent. The two parasite strains yielded different profiles of electrophoretically separated labelled proteins; the Iodogen method, not surprisingly, resulted in a less complex pattern of labelled polypeptides than the Bolton and Hunter reagent.

Improved Storage Stability of Meal, Ready-To-Eat Cheese Spread Under Heat-Stressing Conditions

Science.gov (United States)

2009-11-01

7 3.2 Hunter L*a*b Colorimetry ...10 4.2 Hunter L*a*b Colorimetry ...testing, the study consisted of L*a*b* colorimetry , photography, emulsion stability testing, and First Strike Ration™ field testing at Fort Bragg, NC

Brown bear (Ursus arctos attacks resulting in human casualties in Scandinavia 1977-2016; management implications and recommendations.

Directory of Open Access Journals (Sweden)

Ole-Gunnar Støen

Full Text Available Human persecution and habitat loss have endangered large carnivore populations worldwide, but some are recovering, exacerbating old conflicts. Carnivores can injure and kill people; the most dramatic form of wildlife-human conflict. In Scandinavia, the brown bear (Ursus arctos population increased from ~500 bears in 1977 to ~3300 in 2008, with an increase in injuries, fatalities, and public fear of bear attacks. We reviewed media coverage and interviewed victims to explore how bear population trends, hunter education, and other factors may have influenced the number of injuries and fatalities in Scandinavia from 1977 to 2016. We found 42 incidents with 42 injuries and 2 fatalities; 42 were adult men, one was an adult woman conducting forestry work, and one was a boy skiing off-piste. Thirty-three adult men were hunting bears, moose, or small game, often with a hunting dog, and 26 had shot at the bear at 8±11 m before injury. Eleven nonhunters were conducting forestry work, inspecting a hunting area, picking berries, tending livestock, hiking, harassing a denned bear, and one person was killed outside his house at night. Eight of the 11 incidents of nonhunters involved female bears with cubs; three of these family groups were in dens and two were on carcasses. The annual number of hunters injured/killed was mostly influenced by the increase in the bear population size. The pattern was similar regarding injuries/fatalities to other outdoor users, but the relation with the bear population size was weaker than for hunters, and the null model was equally supported. Bear physiology at denning may make encounters with bears more risky in the fall, when bears show prehibernation behavior. Awareness and education efforts, especially among hunters, seem important to ensure human safety. Recreationists and forestry workers should avoid dense vegetation or make noise to warn bears of their presence.

Adding functionality to garments

CSIR Research Space (South Africa)

Hunter, L

2014-11-01

Full Text Available stream_source_info Hunter_2014_ABSTRACT.pdf.txt stream_content_type text/plain stream_size 1139 Content-Encoding UTF-8 stream_name Hunter_2014_ABSTRACT.pdf.txt Content-Type text/plain; charset=UTF-8 Textiles and Fashion...

De Las Vegas a Marina D'or. O como llegar desde el New Jornalism norteamericano de Hunter S. Thompson hasta la nueva narrativa española de Robert Juan-Cantavella

Directory of Open Access Journals (Sweden)

María Angulo Egea

2011-12-01

Full Text Available The north-american trend called 'New Journalism' born in the 60's, was a revolution for the USA traditional Journalism, for its use of literary elements with other ones that belong to the journalistic research. Hunter S. Thompson, author of Fear and loathing in Las Vegas (1971, with his gonzo style, was going to shed new light on the New Journalism proposals, improving the immersión process using drugs until he gets implied personally in his reports and taking all his narrative influences from the 50's beat movement. Almost 35 years later, in El Dorado, Juan-Cantavella makes a paralellism between Las Vegas and the holiday city in the mediterranean coast, Marina D'Or and he develops in this space a novel, where his alter ego, the punk journalist Escargot, plays the lead. Novel, journalism, gonzo, fiction, story, punk, essay, report, 'aportaje', discursive fragmentation, dialogs, internal monologues, descriptions, memorandums, telegrams, emails, press releases, radio news, songs, slogans, all fits to reenact genres, to re-read journalistic and literary traditions and to build something new. This work analyses this process, that goes from the gonzo journalism of Fear and loathing in Las Vegas to the current Spanish narrative of El Dorado. It tries to distinguish the literary resources that the gonzo journalist uses to build his reports and the journalistic tools that nourish Juan-Cantavella's 'punk narrative'. A particular example of literary-journalistic symbiosisLa corriente norteamericana llamada 'Nuevo periodismo', nacida en los años sesenta, supuso para la Periodística tradicional de Estados Unidos toda una revolución por la combinación de elementos literarios con otros propios de la investigación periodística. Hunter S. Thompson, autor de Miedo y asco en las Vegas (1971, con su periodismo gonzo, le iba a dar una vuelta más a la propuesta del New Journalism, llevando al extremo el proceso de inmersión, hasta implicarse personalmente

Frederick National Lab Encourages Healthy Living at the Annual In The Street Festival | Poster

Science.gov (United States)

While it was the pleasant weather, live music, and scores of vendors that drew thousands to Frederick’s 2017 In The Street festival, it was the eye-catching activities and prizes that drew attendees to the Frederick National Laboratory for Cancer Research tent.

Weaning age in an expanding population: stable carbon and nitrogen isotope analysis of infant feeding practices in the Okhotsk culture (5th-13th centuries AD) in Northern Japan.

Science.gov (United States)

Tsutaya, Takumi; Ishida, Hajime; Yoneda, Minoru

2015-08-01

The Okhotsk people were sedentary hunter-gatherer-fishers who lived and prospered in Sakhalin, Hokkaido, and the Kurile Islands during the 5th to 13th centuries AD. They expanded rapidly along the northeastern coast of Hokkaido. We reconstructed infant feeding practices of the Moyoro population of the Okhotsk culture in eastern Hokkaido, Japan. Stable isotope ratios in 58 subadult human skeletons were measured. The results suggest that complementary foods with a relatively low carbon isotope ratio were consumed during and after weaning, as observed in ethnographic descriptions of northern human populations such as the Ainu and isotopically suggested in ancient northern hunter-gatherer-fisher populations. Nitrogen isotope ratios of subadults showed that the age at the end of weaning in the Moyoro population was 1.8 (1.4-2.2 in 95% credible interval) years, which is earlier than that in other northern hunter-gatherer-fisher populations. Because weaning age is one of the most important determinants of fertility, a shorter breastfeeding period suggests increased fertility. Furthermore, better nutrition would further promote the population increase, and thus populations of the Okhotsk culture could expand into new regions. These findings are consistent with recent emerging evidence of great contributions of the Okhotsk to the formation of later Ainu populations and culture. © 2015 Wiley Periodicals, Inc.

A wild controversy

DEFF Research Database (Denmark)

Emborg, Jens; Gamborg, Christian

2016-01-01

(n = 1130) and landowners (n = 1207). A series of qualitative interviews with a sample of landowners and hunters determined their approach to conflict management. The findings showed that relatively few negative encounters take place between hunters and other users compared to the frequency...

Colegio Hunter. Nueva York

Directory of Open Access Journals (Sweden)

Breuer, Marcel

1960-12-01

Full Text Available En marcado contraste con las edificaciones existentes del Colegio, han sido construidos dos nuevos elementos independientes, pero enlazados entre sí, destinados, respectivamente, a biblioteca y a clases. El estilo gótico tradicional, grave y estrecho que muestran los pabellones primitivos y la línea escueta, simplista, limpia de los dos prismas nuevos, juegan una brillante y notable armonía por contraste, cuyo éxito se debe a un cuidado estudio general y a una composición esmerada, en cuanto a masas, línea y materiales se refiere. Estos últimos, con sus colores característicos; son los mismos que predominan en las fachadas del Colegio: piedra caliza, piedra natural y ladrillo tostado.

THE HUNTER OF MAN

African Journals Online (AJOL)

as 1755, in which year the British Government, licking their wounds after an ... were adept at sniping from behind rocks and any .... ing rifles in the world, incredibly had no effective .... awarded third prize for the above contribution to the Military.

Guerrilla Hunter Killer Smartbook

Science.gov (United States)

2009-07-04

down the Host Nation Government vs . GH/K views by opposing sides. Observing the model becomes convoluted unless the relationship between these two...be measured only by land ownership , but by area of influence to where human needs can be marked by spheres of influence. Concentration inside of... franchisement amongst the populace if the efforts of external advisors and civil organizations (Coalition Forces), the Host Nation Government, or even the

Homo habitus: agency, structure and the transformation of tradition in the constitution of the TRB foraging-farming communities in the North European plain (ca 4500–2000 BC

Directory of Open Access Journals (Sweden)

Marek Zvelebil

2005-12-01

Full Text Available The current generally accepted view of the dispersal of farming into Europe is that farming groups in the eastern Mediterranean colonised selectively optimal farming areas. The role of contact between indigenous hunter-gatherers and incoming farmers was very important to the operation of this process. This general view of the spread of farming at a broad inter-regional scale gives us our understanding of the origins of the Neolithic but merits closer examination at the local and regional level, as increasingly it is becoming apparent that the causes and motivations may have differed. In this paper, Mesolithic to Neolithic communities with evidence of the transition from hunter-gatherer to farmer will be examined at a regional scale, in the central part of the north European plain, focussing on Kujavia. Additionally, the theory of structuration will be applied in order to elucidate the transition process at this level.

Employment, Employability and History: Helping Students to See the Connection

Science.gov (United States)

Baker, Geoff

2013-01-01

Five years ago, in "Teaching History 132", Harris and Haydn drew attention to the fact that while the vast majority of Key Stage 3 students claimed to enjoy history and even to regard it as a useful subject, relatively few of them were able to explain why they thought it was so important. Geoff Baker set out to address this issue, in…

Friendly Combat Casualties and Operational Narratives

Science.gov (United States)

2015-06-21

of the importance of consensus. By the time that the Battle of Mogadishu took place and the decision taken to remove US forces shortly thereafter...internationally.42 The media immediately drew parallels between the deaths in Fallujah and the Battle of Mogadishu in Somalia in 1993, and political leaders...18 Operation Al Fajr – the Second Battle of Fallujah ........................................................... 18

Digital Masterpieces

Science.gov (United States)

Hunter-Doniger, Tracey

2005-01-01

Tracey Hunter-Doniger is an elementary visual arts teacher who is fortunate enough to work in a school that realizes the value and influence art has on technology. Twice a year, her first-through fifth-grade classes meet in the computer lab to create computer-generated works of art. the class discusses the importance of art in technology, such as…

On nonlocal symmetries of some shallow water equations

Energy Technology Data Exchange (ETDEWEB)

Reyes, Enrique G [Departamento de Matematicas y Ciencia de la Computacion, Universidad de Santiago de Chile, Casilla 307 Correo 2 Santiago (Chile)

2007-04-27

A recent construction of nonlocal symmetries for the Korteweg-de Vries, Camassa-Holm and Hunter-Saxton equations is reviewed, and it is pointed out that-in the Camassa-Holm and Hunter-Saxton case-these symmetries can be considered as (nonlocal) symmetries of integro-differential equations.

Ethnobotanical Study of Medicinal Plants Used as Anti-Obesity Remedies in the Nomad and Hunter Communities of Burkina Faso

Directory of Open Access Journals (Sweden)

Dramane Pare

2016-04-01

Full Text Available Background: Obesity is a global epidemic that affects both developed and developing countries. According to World Health Organization (WHO, in 2014, over 1.9 billion adults were overweight. Burkina Faso, like other countries, faces the problem of obesity, with a prevalence of 7.3%. The main cause is excessive intake of caloric foods combined with low physical activity, although genetic, endocrine and environmental influences (pollution can sometimes be predisposing factors. This metabolic imbalance often leads to multiple pathologies (heart failure, Type II diabetes, cancers, etc.. Drugs have been developed for the treatment of these diseases; but in addition to having many side effects, locally these products are not economically accessible to the majority of the population. Burkina Faso, like the other countries bordering the Sahara, has often been confronted in the past with periods of famine during which populations have generally used anorectic plants to regulate their food needs. This traditional ethnobotanical knowledge has not been previously investigated. An ethnobotanical survey was conducted in Burkina Faso in the provinces of Seno (North and Nayala (Northwest to list the plants used by local people as an anorectic and/or fort weight loss. Methods: The survey, conducted in the two provinces concerned traditional healers, herbalists, hunters, nomads and resourceful people with knowledge of plants. It was conducted over a period of two months and data were collected following a structured interview with the respondents. The approach was based on dialogue in the language of choice of the respondent and the use of a questionnaire. The data have been structured and then statistically analyzed. Results: The fifty-five (55 respondents of the survey were aged between 40 and 80 years. Sixty-one (61 plant species, belonging to thirty-one (31 families were listed as appetite suppressants and/or for their anti-obesity properties. The main

76 FR 54051 - Migratory Bird Hunting; Final Frameworks for Early-Season Migratory Bird Hunting Regulations

Science.gov (United States)

2011-08-30

... season dates, shooting hours, and daily bag and possession limits for the 2011-12 season. These... weekend, holidays, or other non-school days when youth hunters would have the maximum opportunity to... hunters would encounter whooping cranes. Kentucky has also opted to delay legal shooting hours until...

DEER BELIEF AND DEER SACRIFICE AROUND STEPPE CULTURE

Directory of Open Access Journals (Sweden)

Aslı KAHRAMAN ÇINAR

2016-04-01

Full Text Available Turkish people have spreaded on a large area historically. They have left a mark on all the places they reach. The history of Turks begun in Central Asian Steppes. In reaction to the steppe culture, the human communities of Turks are hunter-nomad communities. The hunter-nomad comminuties make a living from stockfarming and apiculture. The deer is one of the essential animals for t he hunter-nomad communities in the daily life. In the steppe, the deer is seen in all area of social life. Further, the deer motives are commonly used in political, military, financial, the most religious areas. The hunter-nomad comminuties benefit by the meat, milk, leather, horns, nails, etc of the deer. In this study, we dwell on the deer with regard to its intended purposes and usage areas according to steppe culture. The references of this study are references are inscriptions, mythologic stories and archeological datas.

Scarcity, Alterity and Value: Decline of the Pangolin, the World′s Most Trafficked Mammal

Directory of Open Access Journals (Sweden)

Alex Aisher

2016-01-01

Full Text Available The pangolin, now recognised as the world's most trafficked mammal, is currently undergoing population collapse across South and Southeast Asia, primarily because of the medicinal value attributed to its meat and scales. This paper explores how scarcity and alterity (otherness drive the perceived value of these creatures for a range of human and more-than-human stakeholders: wildlife traffickers, Traditional Chinese Medicine (TCM practitioners, Asian consumers of their meat and scales, hunters and poachers, pangolin-rearing master-spirits, and conservation organisations. Based on archival research and long-term ethnographic study with indigenous hunters in the Eastern Himalayas, the paper analyses the commodity chains linking hunters and consumers of pangolin across South, Southeast and East Asia. It shows that whilst the nonlinear interaction of scarcity, alterity and value is driving the current overexploitation of pangolins, for some indigenous hunters in the Eastern Himalayas, these same dynamics interact to preserve these animals in the forests where they dwell.

The increasing importance of community-acquired methicillin-resistant Staphylococcus aureus infections.

Science.gov (United States)

Agostino, Jason W; Ferguson, John K; Eastwood, Keith; Kirk, Martyn D

2017-11-06

To identify groups at risk of methicillin-resistant Staphylococcus aureus (MRSA) infection, patterns of antimicrobial resistance, and the proportion of patients with MRSA infections but no history of recent hospitalisation. Case series of 39 231 patients with S. aureus isolates from specimens processed by the Hunter New England Local Health District (HNELHD) public pathology provider during 2008-2014. Proportion of MRSA infections among people with S. aureus isolates; antimicrobial susceptibility of MRSA isolates; origin of MRSA infections (community- or health care-associated); demographic factors associated with community-associated MRSA infections. There were 71 736 S. aureus-positive specimens during the study period and MRSA was isolated from 19.3% of first positive specimens. Most patients (56.9%) from whom MRSA was isolated had not been admitted to a public hospital in the past year. Multiple regression identified that patients with community-associated MRSA were more likely to be younger (under 40), Indigenous Australians (odds ratio [OR], 2.6; 95% CI, 2.3-2.8), or a resident of an aged care facility (OR, 4.7; 95% CI, 3.8-5.8). The proportion of MRSA isolates that included the dominant multi-resistant strain (AUS-2/3-like) declined from 29.6% to 3.4% during the study period (P resistant strain decreased, new strategies for controlling infections in the community are needed to reduce the prevalence of non-multi-resistant strains.

West Europe Report, No. 2174.

Science.gov (United States)

1983-07-15

and inks , 4 billion for acrylics, adhesives, glues, etc.). Finally, the contract places emphasis on the foreign trade balance. This means that CDF...cafe he took a white napkin and drew a large circle and a smaller circle. They represented social democracy and communism. Then Hermansson drew a

75 FR 62838 - Award of a Single-Source Expansion Supplement to the Research Foundation of CUNY on Behalf of...

Science.gov (United States)

2010-10-13

...-Source Expansion Supplement to the Research Foundation of CUNY on Behalf of Hunter College School of... single-source program expansion supplement to the Research Foundation of CUNY on behalf of Hunter College... removal, of the relative's options to become a placement resource for the child. The supplemental funding...

Autonomy dimensions and care seeking for delivery in Zambia; the prevailing importance of cluster-level measurement.

Science.gov (United States)

Gabrysch, Sabine; McMahon, Shannon A; Siling, Katja; Kenward, Michael G; Campbell, Oona M R

2016-03-02

It is widely held that decisions whether or when to attend health facilities for childbirth are not only influenced by risk awareness and household wealth, but also by factors such as autonomy or a woman's ability to act upon her own preferences. How autonomy should be constructed and measured - namely, as an individual or cluster-level variable - has been less examined. We drew on household survey data from Zambia to study the effect of several autonomy dimensions (financial, relationship, freedom of movement, health care seeking and violence) on place of delivery for 3200 births across 203 rural clusters (villages). In multilevel logistic regression, two autonomy dimensions (relationship and health care seeking) were strongly associated with facility delivery when measured at the cluster level (OR 1.27 and 1.57, respectively), though not at the individual level. This suggests that power relations and gender norms at the community level may override an individual woman's autonomy, and cluster-level measurement may prove critical to understanding the interplay between autonomy and care seeking in this and similar contexts.

Autonomy dimensions and care seeking for delivery in Zambia; the prevailing importance of cluster-level measurement

Science.gov (United States)

Gabrysch, Sabine; McMahon, Shannon A.; Siling, Katja; Kenward, Michael G.; Campbell, Oona M. R.

2016-01-01

It is widely held that decisions whether or when to attend health facilities for childbirth are not only influenced by risk awareness and household wealth, but also by factors such as autonomy or a woman’s ability to act upon her own preferences. How autonomy should be constructed and measured – namely, as an individual or cluster-level variable – has been less examined. We drew on household survey data from Zambia to study the effect of several autonomy dimensions (financial, relationship, freedom of movement, health care seeking and violence) on place of delivery for 3200 births across 203 rural clusters (villages). In multilevel logistic regression, two autonomy dimensions (relationship and health care seeking) were strongly associated with facility delivery when measured at the cluster level (OR 1.27 and 1.57, respectively), though not at the individual level. This suggests that power relations and gender norms at the community level may override an individual woman’s autonomy, and cluster-level measurement may prove critical to understanding the interplay between autonomy and care seeking in this and similar contexts. PMID:26931301

Telemedicine in the 'Hood.

Science.gov (United States)

Elgrably, Jordan

1998-01-01

Telemedicine, the ability to examine patients while physically removed from them by using high-tech virtual treatment, is used increasingly to diagnose and prescribe treatment for patients in nontraditional settings. In Los Angeles (California), Charles R. Drew University of Medicine and King-Drew Medical Center communicate in real time with…

Muskox site fidelity and group cohesion in Jameson Land, East Greenland

DEFF Research Database (Denmark)

Aastrup, P. J.

2004-01-01

. Muskoxen in this area had a very loose group structure, with mother-young pairs as the only apparent bond between individuals. Furthermore, the tagged muskoxen lacked strong fidelity to the site where they were tagged and roamed within an 11.000-km2 area. Hunters reported tagged muskoxen shot up to 120 km...... away from the capture site. From the hunters' reports, we determined that the central part of Jameson Land around Mikael Bjerg was the preferred hunting area in winter. In summer, most muskoxen were shot near the coast of the central part of Jameson Land. The hunter compliance in this study confirms...

Upper Palaeolithic genomes reveal deep roots of modern Eurasians

KAUST Repository

Jones, Eppie R.

2015-11-16

We extend the scope of European palaeogenomics by sequencing the genomes of Late Upper Palaeolithic (13,300 years old, 1.4-fold coverage) and Mesolithic (9,700 years old, 15.4-fold) males from western Georgia in the Caucasus and a Late Upper Palaeolithic (13,700 years old, 9.5-fold) male from Switzerland. While we detect Late Palaeolithic–Mesolithic genomic continuity in both regions, we find that Caucasus hunter-gatherers (CHG) belong to a distinct ancient clade that split from western hunter-gatherers ~45 kya, shortly after the expansion of anatomically modern humans into Europe and from the ancestors of Neolithic farmers ~25 kya, around the Last Glacial Maximum. CHG genomes significantly contributed to the Yamnaya steppe herders who migrated into Europe ~3,000 BC, supporting a formative Caucasus influence on this important Early Bronze age culture. CHG left their imprint on modern populations from the Caucasus and also central and south Asia possibly marking the arrival of Indo-Aryan languages.

Upper Palaeolithic genomes reveal deep roots of modern Eurasians

KAUST Repository

Jones, Eppie R.; Gonzalez-Fortes, Gloria; Connell, Sarah; Siska, Veronika; Eriksson, Anders; Martiniano, Rui; McLaughlin, Russell L.; Gallego Llorente, Marcos; Cassidy, Lara M.; Gamba, Cristina; Meshveliani, Tengiz; Bar-Yosef, Ofer; Mü ller, Werner; Belfer-Cohen, Anna; Matskevich, Zinovi; Jakeli, Nino; Higham, Thomas F. G.; Currat, Mathias; Lordkipanidze, David; Hofreiter, Michael; Manica, Andrea; Pinhasi, Ron; Bradley, Daniel G.

2015-01-01

We extend the scope of European palaeogenomics by sequencing the genomes of Late Upper Palaeolithic (13,300 years old, 1.4-fold coverage) and Mesolithic (9,700 years old, 15.4-fold) males from western Georgia in the Caucasus and a Late Upper Palaeolithic (13,700 years old, 9.5-fold) male from Switzerland. While we detect Late Palaeolithic–Mesolithic genomic continuity in both regions, we find that Caucasus hunter-gatherers (CHG) belong to a distinct ancient clade that split from western hunter-gatherers ~45 kya, shortly after the expansion of anatomically modern humans into Europe and from the ancestors of Neolithic farmers ~25 kya, around the Last Glacial Maximum. CHG genomes significantly contributed to the Yamnaya steppe herders who migrated into Europe ~3,000 BC, supporting a formative Caucasus influence on this important Early Bronze age culture. CHG left their imprint on modern populations from the Caucasus and also central and south Asia possibly marking the arrival of Indo-Aryan languages.

The Mythology of the Night Sky An Amateur Astronomer's Guide to the Ancient Greek and Roman Legends

CERN Document Server

Falkner, David E

2011-01-01

Every amateur astronomer can easily recognize most of the constellations, but how many of us know the story behind them? What myths did the Ancient Greeks weave around the mighty hunter Orion that places him so prominently in the sky? Did you know that this mythical being was said to have been killed by Diana, herself a hunter, while he was exhausted by his fight with Scorpius? The constellation of Scorpius, the giant scorpion, is dominated by the red supergiant Antares and hangs in the sky opposite Orion. Yet there is no constellation of Diana to be found! The Mythology of the Night Sky strikes a balance between backyard astronomy and ancient mythology. Organized by seasons, this book describes Ptolemy's 48 constellations with location and description in detail, while also telling the mythological tales in full. Along with the named constellations, this title also incorporates the lore behind the christening of the planets and their satellites. Readers discover the importance of the ancient characters, why...

Sex Differences in Food Preferences of Hadza Hunter-Gatherers

Directory of Open Access Journals (Sweden)

Julia Colette Berbesque

2009-10-01

Full Text Available Food preferences are important for understanding foraging choices. In studying human foragers rather than other animals, we have the advantage of being able to ask them which foods they prefer. Yet surprisingly, no studies of systematically collected data exist on human forager food preferences. The Hadza of Tanzania are full-time foragers in an area where the hominin record extends back to 3-4 million years ago, so their diet is very relevant for understanding the paleo-diet. Here, we report on their food preferences, elicited with photographs of species within the five major food categories in their diet: honey, meat, berries, baobab, and tubers. There were sex differences in the ranks of two food categories: meat and berries. While male and female ranks agreed on the other three food categories, females ranked berries second and meat fourth, whereas males ranked meat second and berries fourth. Theses similarities and differences are interesting in light of the fact that the sexes target different foods. We discuss the implications of Hadza food preferences for the origin of the uniquely human sexual division of foraging labor.

Only an Expensive Horoscope.

Science.gov (United States)

Berg, Craig A.; Clough, Michael

1991-01-01

Madeline Hunter's statements and teaching examples lead to a conception of teaching best described as a teacher-centered, funnel model. The Hunter lesson design may be useful to science teachers for some instructional objectives, but it cannot be expected to improve the state of science education. Includes five references. (MLH)

Analysis of bushmeat collection and trade in Epe, Ikorodu and ...

African Journals Online (AJOL)

Bushmeat hunting and trade in Epe, Ikorodu and Oyingbo in Lagos State were investigated. Data were obtained by interview method using questionnaire administered separately to hunters in Epe and Ikorodu and traders in Epe, Ikorodu and Oyingbo. The hunters were all men, mostly young adults between age 21 and 40 ...

The Influence of Drawing on Third Graders' Writing Performance.

Science.gov (United States)

Norris, Edith A.; Reichard, Carla; Mokhtari, Kouider

1997-01-01

Compares writing products of 60 third-grade students who drew before writing a story to writing products of 59 students who wrote without drawing. Finds that students who drew produced more words and overall wrote better than nondrawers. Notes that results were consistent for boys and girls regardless of group membership. (PA)

Protein structure modelling and evaluation based on a 4-distance description of side-chain interactions

Directory of Open Access Journals (Sweden)

Inbar Yuval

2010-07-01

Full Text Available Abstract Background Accurate evaluation and modelling of residue-residue interactions within and between proteins is a key aspect of computational structure prediction including homology modelling, protein-protein docking, refinement of low-resolution structures, and computational protein design. Results Here we introduce a method for accurate protein structure modelling and evaluation based on a novel 4-distance description of residue-residue interaction geometry. Statistical 4-distance preferences were extracted from high-resolution protein structures and were used as a basis for a knowledge-based potential, called Hunter. We demonstrate that 4-distance description of side chain interactions can be used reliably to discriminate the native structure from a set of decoys. Hunter ranked the native structure as the top one in 217 out of 220 high-resolution decoy sets, in 25 out of 28 "Decoys 'R' Us" decoy sets and in 24 out of 27 high-resolution CASP7/8 decoy sets. The same concept was applied to side chain modelling in protein structures. On a set of very high-resolution protein structures the average RMSD was 1.47 Å for all residues and 0.73 Å for buried residues, which is in the range of attainable accuracy for a model. Finally, we show that Hunter performs as good or better than other top methods in homology modelling based on results from the CASP7 experiment. The supporting web site http://bioinfo.weizmann.ac.il/hunter/ was developed to enable the use of Hunter and for visualization and interactive exploration of 4-distance distributions. Conclusions Our results suggest that Hunter can be used as a tool for evaluation and for accurate modelling of residue-residue interactions in protein structures. The same methodology is applicable to other areas involving high-resolution modelling of biomolecules.

Harry Potter's Provocative Moral World: Is There a Place for Good and Evil in Moral Education?

Science.gov (United States)

Glanzer, Perry L.

2008-01-01

In a challenging critique of moral education in public schools, James Davison Hunter argues that the unspoken imperative of all moral education is to teach only those virtues, principles, and other moral teachings about which there is essentially no disagreement in American society. Hunter claims that almost every major form of moral education in…

Multi-scalar insights into hunter-gatherer-farmer-fisher subsistence and diet

DEFF Research Database (Denmark)

Philippsen, Bente

. Establishing the relative importance of these varied resources in the diets of PWC people, however, is challenged by poor preservation of bone assemblages, poor chronological resolution and the diversity of subsistence strategies on the different sites. As part of the multidisciplinary project “CONTACT...... residues, respectively. We focus our discussion on the site Kainsbakke on Djursland, Denmark. Furthermore, we present isotope data from a series of other sites around the Kattegat. Our integrated data provide a sound baseline for calculating human diets from isotope ratios of human bones. Furthermore...

Cherokee Indians and the United States: A Failed Effort at Adaptation but Survival

Science.gov (United States)

2011-04-28

de Soto’s expedition encountered large and successful populations of farmers whose primary riches were food . Eventually, deSoto died on the banks...farming and hunting. Living near water allowed the Cherokee to raise crops such as com, beans, tobacco, pumpkins , and squash all of which were an...important part of their overall food supply. Additionally, the Cherokee Indians were accomplished hunters adept with a multitude of weapons, to

Elk and mule deer responses to variation in hunting pressure.

Science.gov (United States)

Bruce K. Johnson; Alan A. Ager; James H. Noyes; Norm. Cimon

2004-01-01

Hunting can exert a variety of effects on both targeted and nontargeted ungulates, and animals either run or hide in response to hunting pressure. If animals successfully elude hunters by running, the energetic cost may deplete fat reserves needed for survival during winter in temperate regions. If animals successfully elude hunters by hiding, there may be an energetic...

Environmental issues and solutions for exploratory drilling in sensitive areas

International Nuclear Information System (INIS)

Smith, R.M.

1995-01-01

Chevron USA Production Company (CPDN), the National Forest Service (FS) and the Bureau of Land Management (BLM) successfully utilized a multi-disciplinary team approach to design and implement innovative environmental solutions to drill the 8,000 foot deep, Hunter Creek exploratory well. The project was located in the Bridger-Teton National Forest, less than 20 miles from Grand Teton National Park. Acquiring permission from the FS, the BLM, and ultimately, the public to drill the Hunter Creek well involved substantial teamwork in identifying many potential, environmental pitfalls. Creative, workable and cost-effective mitigation measures employed at Hunter Creek included: utilizing a helicopter and limiting vehicle use of an existing road, conducting environmental and safety training, an erosion control and reclamation plan, designing an environmentally friendly, near-zero-discharge drilling location, initiating a water quality monitoring program to establish baseline data and to ensure protection of surface and ground water, designing a waste minimization plan, identifying threatened and endangered and special status species possibly affected by project activities, and ensuring compliance with all mitigation measures and Federal and State regulations. The Hunter Creek project successfully demonstrates that oil and gas exploration can be conducted with a soft footprint in environmentally sensitive areas if mitigation measures are front-end loaded in the project and honored by all personnel involved. Teamwork, training and communication were found to be indispensable components of achieving success at Hunter Creek

A Study on Narrative Perspectives in The Heart is a Lonely Hunter%论《心是孤独的猎手》中的叙事视角

Institute of Scientific and Technical Information of China (English)

陈博

2012-01-01

The theme of loneliness in McCullers＂ works has always been the focus of which the connotations of feminism, poetic traits as well as cultural background of criticism have been circles, out explored to the fullest extent over the past few years. McCullers＂ genius is not only embodied in her keen and deep insight; but also in her unique and exquisite narrative skill. This thesis attempts to elaborate on the narrative strategies of McCullers＂ The Heart is a Lonely Hunter, of which the narrative perspective is of variety. That is mainly embodied in the applications of third person external perspective, zero perspective and internal perspective. These three kinds of perspective are switched back and forth tactfully, reflecting the unique creative concept of the author.%麦卡勒斯作品的孤独主题一直占据评论界的中心，其引申出的女性主义、诗性特征以及文化背景义涵都得到了充分的拓展。麦卡勒斯的天才不仅体现在其敏锐深刻的洞察力上，也体现在其独特精致的叙事技巧上。麦卡勒斯作品《心是孤独的猎手》的叙事视角具有多变性特征，主要表现在第三人称外视角的应用，零视角的应用，以及内视角的应用等方面。三种视角巧妙地来回切换，体现了作者独具匠心的创作理念。

Importance measures

International Nuclear Information System (INIS)

Gomez Cobo, A.

1997-01-01

The presentation discusses the following: general concepts of importance measures; example fault tree, used to illustrate importance measures; Birnbaum's structural importance; criticality importance; Fussel-Vesely importance; upgrading function; risk achievement worth; risk reduction worth

Gifted and Talented Students’ Images of Scientists

Directory of Open Access Journals (Sweden)

Sezen Camcı-Erdoğan

2013-06-01

Full Text Available The purpose of this study was to investigate gifted students’ images of scientists. The study involved 25 students in grades 7 and 8. The Draw-a-Scientist Test (DAST (Chamber, 183 was used to collect data. Drawings were eval-uated using certain criterion such as a scien-tist’s appearance and investigation, knowledge and technology symbols and gender and working style, place work, expressions, titles-captions-symbols and alternative images and age. The results showed that gifted students’ perceptions about scientists were stereotypical, generally with glasses and laboratory coats and working with experiment tubes, beakers indoors and using books, technological tools and dominantly lonely males. Most gifted stu-dents drew male scientists. Although females drew male scientists, none of the boys drew female scientist.

Using XML/HTTP to Store, Serve and Annotate Tactical Scenarios for X3D Operational Visualization and Anti-Terrorist Training

Science.gov (United States)

2003-03-01

PXSLServlet Paul A. Open Source Relational x X 23 Tchistopolskii sql2dtd David Mertz Public domain Relational x -- sql2xml Scott Hathaway Public...March 2003. [Hunter 2001] Hunter, David ; Cagle, Kurt; Dix, Chris; Kovack, Roger; Pinnock, Jonathan, Rafter, Jeff; Beginning XML (2nd Edition...Postgraduate School Monterey, California 4. Curt Blais Naval Postgraduate School Monterey, California 5 Erik Chaum NAVSEA Undersea

Basic personal values and the meaning of left-right political orientations in 20 countries

OpenAIRE

Piurko, Yuval; Schwartz, Shalom H; Davidov, Eldad

2011-01-01

This study used basic personal values to elucidate the motivational meanings of ‘left’ and ‘right’ political orientations in 20 representative national samples from the European Social Survey (2002-3). It also compared the importance of personal values and socio-demographic variables as determinants of political orientation. Hypotheses drew on the different histories, prevailing culture, and socio-economic level of 3 sets of countries—liberal, traditional and post-communist. As hy...

Differences between Pygmy and Non-Pygmy Hunting in Congo Basin Forests.

Directory of Open Access Journals (Sweden)

John E Fa

Full Text Available We use data on game harvest from 60 Pygmy and non-Pygmy settlements in the Congo Basin forests to examine whether hunting patterns and prey profiles differ between the two hunter groups. For each group, we calculate hunted animal numbers and biomass available per inhabitant, P, per year (harvest rates and killed per hunter, H, per year (extraction rates. We assess the impact of hunting of both hunter groups from estimates of numbers and biomass of prey species killed per square kilometre, and by examining the proportion of hunted taxa of low, medium and high population growth rates as a measure of their vulnerability to overhunting. We then map harvested biomass (kg-1P-1Yr-1 of bushmeat by Pygmies and non-Pygmies throughout the Congo Basin. Hunting patterns differ between Pygmies and non-Pygmies; Pygmies take larger and different prey and non-Pygmies sell more for profit. We show that non-Pygmies have a potentially more severe impact on prey populations than Pygmies. This is because non-Pygmies hunt a wider range of species, and twice as many animals are taken per square kilometre. Moreover, in non-Pygmy settlements there was a larger proportion of game taken of low population growth rate. Our harvest map shows that the non-Pygmy population may be responsible for 27 times more animals harvested than the Pygmy population. Such differences indicate that the intense competition that may arise from the more widespread commercial hunting by non-Pygmies is a far more important constraint and source of conflict than are protected areas.

Permutation importance: a corrected feature importance measure.

Science.gov (United States)

Altmann, André; Toloşi, Laura; Sander, Oliver; Lengauer, Thomas

2010-05-15

In life sciences, interpretability of machine learning models is as important as their prediction accuracy. Linear models are probably the most frequently used methods for assessing feature relevance, despite their relative inflexibility. However, in the past years effective estimators of feature relevance have been derived for highly complex or non-parametric models such as support vector machines and RandomForest (RF) models. Recently, it has been observed that RF models are biased in such a way that categorical variables with a large number of categories are preferred. In this work, we introduce a heuristic for normalizing feature importance measures that can correct the feature importance bias. The method is based on repeated permutations of the outcome vector for estimating the distribution of measured importance for each variable in a non-informative setting. The P-value of the observed importance provides a corrected measure of feature importance. We apply our method to simulated data and demonstrate that (i) non-informative predictors do not receive significant P-values, (ii) informative variables can successfully be recovered among non-informative variables and (iii) P-values computed with permutation importance (PIMP) are very helpful for deciding the significance of variables, and therefore improve model interpretability. Furthermore, PIMP was used to correct RF-based importance measures for two real-world case studies. We propose an improved RF model that uses the significant variables with respect to the PIMP measure and show that its prediction accuracy is superior to that of other existing models. R code for the method presented in this article is available at http://www.mpi-inf.mpg.de/ approximately altmann/download/PIMP.R CONTACT: altmann@mpi-inf.mpg.de, laura.tolosi@mpi-inf.mpg.de Supplementary data are available at Bioinformatics online.

Blasting the Language of Colonialism

DEFF Research Database (Denmark)

Sandbye, Mette

2016-01-01

exceptions, such as the documentary photographs and films of Jette Bang, the visual image transmitted through photography was highly stereotypical: ice and wild nature, peopled by tough sealers and hunters. Documen tary photography and art in general, from Greenland as well as Denmark, usually confirmed...... into the tradition of that most referential of media, photography, and manage to ‘blast’ this tradition from within, thereby representing an important renewal of the discourse of photography....

Environmental Assessment for Landfill Drainage Improvements Vandenberg Air Force Base, California

Science.gov (United States)

2003-04-07

became increasingly important, corresponding to development of the tomol (a plank canoe), single-piece shell fishhooks, and harpoons (Glassow 1996...Chumash had a culture that "was as elaborate as that of any hunter-gatherer society on earth" (Moratto 1984: 118). Leadership was hereditary and chiefs...Improvements Vandenberg Air Force Base, California I I I I I I I Erlandson, Jon M., and Kevin Bartoy 1995 Cabrillo, the Chumash, and Old

CONFLICTS BETWEEN TOURISTS AND HUNTERS

Directory of Open Access Journals (Sweden)

Ionica Soare

2015-05-01

Full Text Available Tourism recreational outdoors bring revenue for the major economies of many states, for example communities should contribute with more than 800 billion dollars annually on U.S. economy, where three out of four Americans participate actively in the open air at recreation each year, as well as as well as hiking, biking, camping, wildlife generates an enormous economic power and a multiplier effect in major sectors of the economy. Empirical Research reveals a ambiguity of the feelings and attitudes concerning the relationship and potential for real conflicts between hunting recreational-sports and leisure and other activities of tourism recreational outdoors. Quantitative methods of analysis have revealed many common items, the reasons for and the environment, which are shared by both classes. An investigation carried out by means of interviews and questionnaires revealed three key elements which offers the potential of conflict: group characteristics, behavior and use of weapons for killing of animals.

Border Hunter Research Technical Report

Science.gov (United States)

2010-07-31

paintballs) keep everybody on their toes . • Specific actions on contact, force on force to implement tactics • None - good job!! • All...suspect or keep them in jail. For this event, the terrain becomes a little bit easier – hard sand and rock, sandy dunes with plants – so that intricate...the toe -first primary impact point and uneven stride, and increasing pressure of one of the tracks, you surmise that one of the party is injured

Stellar recipes for axion hunters

International Nuclear Information System (INIS)

Giannotti, Maurizio; Ringwald, Andreas; Saikawa, Ken'ichi

2017-08-01

There are a number of observational hints from astrophysics which point to the existence of stellar energy losses beyond the ones accounted for by neutrino emission. These excessive energy losses may be explained by the existence of a new sub-keV mass pseudoscalar Nambu-Goldstone boson with tiny couplings to photons, electrons, and nucleons. An attractive possibility is to identify this particle with the axion - the hypothetical pseudo Nambu-Goldstone boson predicted by the Peccei-Quinn solution to the strong CP problem. We explore this possibility in terms of a DFSZ-type axion and of a KSVZ-type axion/majoron, respectively. Both models allow a good global fit to the data, prefering an axion mass around 10 meV. We show that future axion experiments - the fifth force experiment ARIADNE and the helioscope IAXO - can attack the preferred mass range from the lower and higher end, respectively. An axion in this mass range can also be the main constituent of dark matter.

PALEOLITHIC HUNTER-GATHERERS' DIETARY PATTERNS ...

African Journals Online (AJOL)

Dr. Al-Domi

This has displaced local and traditional food items as well ... genes, which could be attributed to a possible failure in the natural selection process to .... Over the last 50 years, the rapid rise of convenience and take away fast foods among.

Stellar recipes for axion hunters

Energy Technology Data Exchange (ETDEWEB)

Giannotti, Maurizio [Physical Sciences, Barry University, 11300 NE 2nd Ave., Miami Shores, FL 33161 (United States); Irastorza, Igor G.; Redondo, Javier [Departamento de Física Teórica, Universidad de Zaragoza, Pedro Cerbuna 12, E-50009, Zaragoza (Spain); Ringwald, Andreas; Saikawa, Ken' ichi, E-mail: mgiannotti@barry.edu, E-mail: igor.irastorza@cern.ch, E-mail: jredondo@unizar.es, E-mail: andreas.ringwald@desy.de, E-mail: kenichi.saikawa@desy.de [Theory Group, Deutsches Elektronen-Synchrotron DESY, Notkestraße 85, D-22607 Hamburg (Germany)

2017-10-01

There are a number of observational hints from astrophysics which point to the existence of stellar energy losses beyond the ones accounted for by neutrino emission. These excessive energy losses may be explained by the existence of a new sub-keV mass pseudoscalar Nambu-Goldstone boson with tiny couplings to photons, electrons, and nucleons. An attractive possibility is to identify this particle with the axion—the hypothetical pseudo Nambu-Goldstone boson predicted by the Peccei-Quinn solution to the strong CP problem. We explore this possibility in terms of a DFSZ-type axion and of a KSVZ-type axion/majoron, respectively. Both models allow a good global fit to the data, prefering an axion mass around 10 meV. We show that future axion experiments—the fifth force experiment ARIADNE and the helioscope IAXO—can attack the preferred mass range from the lower and higher end, respectively. An axion in this mass range can also be the main constituent of dark matter.

Stellar recipes for axion hunters

Energy Technology Data Exchange (ETDEWEB)

Giannotti, Maurizio [Barry Univ., Miami Shores, FL (United States). Physical Sciences; Irastorza, Igor G. [Zaragoza Univ. (Spain). Dept. de Fisica Teorica; Redondo, Javier [Zaragoza Univ. (Spain). Dept. de Fisica Teorica; Max-Planck-Institut fuer Physik, Muenchen (Germany); Ringwald, Andreas; Saikawa, Ken' ichi [DESY, Hamburg (Germany). Theory Group

2017-08-15

There are a number of observational hints from astrophysics which point to the existence of stellar energy losses beyond the ones accounted for by neutrino emission. These excessive energy losses may be explained by the existence of a new sub-keV mass pseudoscalar Nambu-Goldstone boson with tiny couplings to photons, electrons, and nucleons. An attractive possibility is to identify this particle with the axion - the hypothetical pseudo Nambu-Goldstone boson predicted by the Peccei-Quinn solution to the strong CP problem. We explore this possibility in terms of a DFSZ-type axion and of a KSVZ-type axion/majoron, respectively. Both models allow a good global fit to the data, prefering an axion mass around 10 meV. We show that future axion experiments - the fifth force experiment ARIADNE and the helioscope IAXO - can attack the preferred mass range from the lower and higher end, respectively. An axion in this mass range can also be the main constituent of dark matter.

Pressed flowers: notions of indigenous and alien vegetation in South Africa's Western Cape, c. 1902-1945.

Science.gov (United States)

Pooley, Simon

2010-01-01

In the early twentieth century, botanists in South Africa's Western Cape sought urgently to popularise and protect the region's unique indigenous Fynbos flora. Plants imported from the 1840s, some of which proved invasive, became a physical and symbolic focus for their advocacy. The botanists' efforts resonated with political attempts to forge a common white South African national identity that drew on notions of landscape and the indigenous flora for symbolism and that consciously exploited the politically integrative potential of the new science of ecology. Introduced by overseas-trained experts, ecological theory was, however, inappropriate for the local flora, and had unfortunate consequences for the scientifically-informed research and management particularly of the fire-maintained Fynbos. While botanists and conservationists were united in defending the local flora against invasive introduced plants, they drew distinctions between what was 'indigenous' and what was 'natural' that further complicated their attitudes to the local flora. These historical debates illuminate agendas and policies on introduced ('alien') and indigenous flora in the region today.

When roads appear jaguars decline: Increased access to an Amazonian wilderness area reduces potential for jaguar conservation.

Science.gov (United States)

Espinosa, Santiago; Celis, Gerardo; Branch, Lyn C

2018-01-01

Roads are a main threat to biodiversity conservation in the Amazon, in part, because roads increase access for hunters. We examine how increased landscape access by hunters may lead to cascading effects that influence the prey community and abundance of the jaguar (Panthera onca), the top Amazonian terrestrial predator. Understanding such ecological effects originating from anthropogenic actions is essential for conservation and management of wildlife populations in areas undergoing infrastructure development. Our study was conducted in Yasuní Biosphere Reserve, the protected area with highest potential for jaguar conservation in Ecuador, and an area both threatened by road development and inhabited by indigenous groups dependent upon bushmeat. We surveyed prey and jaguar abundance with camera traps in four sites that differed in accessibility to hunters and used site occupancy and spatially explicit capture-recapture analyses to evaluate prey occurrence and estimate jaguar density, respectively. Higher landscape accessibility to hunters was linked with lower occurrence and biomass of game, particularly white-lipped peccary (Tayassu pecari) and collared peccary (Pecari tajacu), the primary game for hunters and prey for jaguars. Jaguar density was up to 18 times higher in the most remote site compared to the most accessible site. Our results provide a strong case for the need to: 1) consider conservation of large carnivores and other wildlife in policies about road construction in protected areas, 2) coordinate conservation initiatives with local governments so that development activities do not conflict with conservation objectives, and 3) promote development of community-based strategies for wildlife management that account for the needs of large carnivores.

Symposium on Molecular Spectroscopy (42nd) Held in Columbus, Ohio on June 15-19, 1987.

Science.gov (United States)

1987-06-19

Department of bomiotry, Indism Univereity, Sloomimtom, Isdiamo, 47405. NT PSRUSA-JAUU, NDICA AMU Department of Cemistry , University of Nerylands Collge Pork...DEPARTMENT OF CEMISTRY , HUNTER, COLLEGE, CUMY, NEW YORK, NEW YORK, 10021. . T DISSILKAMP, ROBERT SCOTT DEPARTMENT OF CHEMISTRY, INDIANA UNIVERSITY...43210. NTWRF L LAUGHLIN, KEN DEPARTM3MT OF CIDEISTRY, UNIVERSITY OF CALIFORNIA, BEREALEY, CALIFORNIA, 94720. TIWRF LEE, DU DEPARMENT OF CEMISTRY , HUNTER

USE OF REPTILES BETWEEN YOREMES AND YORIS IN THE MUNICIPALITY OF EL FUERTE, SINALOA

Directory of Open Access Journals (Sweden)

Erika Pascual-Ramos

2014-01-01

Full Text Available According to an ethnozoological study about the use of wild vertebrate in 11 indigenous communities of the municipality of El Fuerte, Sinaloa, México, the reptiles were the third group the of local wildlife most used after birds and mammals. The purpose of this study was to characterize and describe the use of wild reptiles that are hunted both indigenous (called Yoremes and mestizo people (called Yoris. 58% of hunters belonged to the May-Yoreme ethnicity, and the rest were mestizos. Nine species of reptiles, of which 44% are in a risk category, were recorded. The hunters said they hunted between one and three species, which were recorded for up to five uses, of which the most common were food, medicinal and handcrafts. The most important species were the rattlesnake, green and black iguanas, although evidence for food use Turtle River, and to a lesser extent, the olive ridley turtle is endangered found. Knowledge of the hunted species of reptiles and their uses will take another step towards managing cultural and subsistence harvesting in indigenous communities in northern Sinaloa.

Lead bullet fragments in venison from rifle-killed deer: potential for human dietary exposure.

Directory of Open Access Journals (Sweden)

W Grainger Hunt

Full Text Available Human consumers of wildlife killed with lead ammunition may be exposed to health risks associated with lead ingestion. This hypothesis is based on published studies showing elevated blood lead concentrations in subsistence hunter populations, retention of ammunition residues in the tissues of hunter-killed animals, and systemic, cognitive, and behavioral disorders associated with human lead body burdens once considered safe. Our objective was to determine the incidence and bioavailability of lead bullet fragments in hunter-killed venison, a widely-eaten food among hunters and their families. We radiographed 30 eviscerated carcasses of White-tailed Deer (Odocoileus virginianus shot by hunters with standard lead-core, copper-jacketed bullets under normal hunting conditions. All carcasses showed metal fragments (geometric mean = 136 fragments, range = 15-409 and widespread fragment dispersion. We took each carcass to a separate meat processor and fluoroscopically scanned the resulting meat packages; fluoroscopy revealed metal fragments in the ground meat packages of 24 (80% of the 30 deer; 32% of 234 ground meat packages contained at least one fragment. Fragments were identified as lead by ICP in 93% of 27 samples. Isotope ratios of lead in meat matched the ratios of bullets, and differed from background lead in bone. We fed fragment-containing venison to four pigs to test bioavailability; four controls received venison without fragments from the same deer. Mean blood lead concentrations in pigs peaked at 2.29 microg/dL (maximum 3.8 microg/dL 2 days following ingestion of fragment-containing venison, significantly higher than the 0.63 microg/dL averaged by controls. We conclude that people risk exposure to bioavailable lead from bullet fragments when they eat venison from deer killed with standard lead-based rifle bullets and processed under normal procedures. At risk in the U.S. are some ten million hunters, their families, and low

How important is importance for prospective memory? A review

Directory of Open Access Journals (Sweden)

Stefan eWalter

2014-06-01

Full Text Available Forgetting to carry out an intention as planned can have serious consequences in everyday life. People sometimes even forget intentions that they consider as very important. Here, we review the literature on the impact of importance on prospective memory performance. We highlight different methods used to manipulate the importance of a prospective memory task such as providing rewards, importance relative to other ongoing activities, absolute importance, and providing social motives. Moreover, we address the relationship between importance and other factors known to affect prospective memory and ongoing task performance such as type of prospective memory task (time-, event- or activity-based, cognitive loads, and cue focality. Finally, we provide a connection to motivation, we summarize the effects of task importance and we identify important venues for future research.

How important is importance for prospective memory? A review

Science.gov (United States)

Walter, Stefan; Meier, Beat

2014-01-01

Forgetting to carry out an intention as planned can have serious consequences in everyday life. People sometimes even forget intentions that they consider as very important. Here, we review the literature on the impact of importance on prospective memory performance. We highlight different methods used to manipulate the importance of a prospective memory task such as providing rewards, importance relative to other ongoing activities, absolute importance, and providing social motives. Moreover, we address the relationship between importance and other factors known to affect prospective memory and ongoing task performance such as type of prospective memory task (time-, event-, or activity-based), cognitive loads, and processing overlaps. Finally, we provide a connection to motivation, we summarize the effects of task importance and we identify important venues for future research. PMID:25018743

Adaptive Importance Sampling with a Rapidly Varying Importance Function

International Nuclear Information System (INIS)

Booth, Thomas E.

2000-01-01

It is known well that zero-variance Monte Carlo solutions are possible if an exact importance function is available to bias the random walks. Monte Carlo can be used to estimate the importance function. This estimated importance function then can be used to bias a subsequent Monte Carlo calculation that estimates an even better importance function; this iterative process is called adaptive importance sampling.To obtain the importance function, one can expand the importance function in a basis such as the Legendre polynomials and make Monte Carlo estimates of the expansion coefficients. For simple problems, Legendre expansions of order 10 to 15 are able to represent the importance function well enough to reduce the error geometrically by ten orders of magnitude or more. The more complicated problems are addressed in which the importance function cannot be represented well by Legendre expansions of order 10 to 15. In particular, a problem with a cross-section notch and a problem with a discontinuous cross section are considered

How important is importance for prospective memory? A review

OpenAIRE

Walter, Stefan; Meier, Beat

2014-01-01

Forgetting to carry out an intention as planned can have serious consequences in everyday life. People sometimes even forget intentions that they consider as very important. Here, we review the literature on the impact of importance on prospective memory performance. We highlight different methods used to manipulate the importance of a prospective memory task such as providing rewards, importance relative to other ongoing activities, absolute importance, and providing social motives. Moreover...

A US Air Force Strategy for Africa (Drew Paper, Number 7)

Science.gov (United States)

2009-08-01

of the French empire. In 1935 the French war minister “insisted that sparse French military resources— mechanized weaponry, field artillery...elsewhere might receive them.”3 The common argument against such broad-ranging consideration of consequences is that it engen - ders “analysis

The resilience of postglacial hunter-gatherers to abrupt climate change.

Science.gov (United States)

Blockley, Simon; Candy, Ian; Matthews, Ian; Langdon, Pete; Langdon, Cath; Palmer, Adrian; Lincoln, Paul; Abrook, Ashley; Taylor, Barry; Conneller, Chantal; Bayliss, Alex; MacLeod, Alison; Deeprose, Laura; Darvill, Chris; Kearney, Rebecca; Beavan, Nancy; Staff, Richard; Bamforth, Michael; Taylor, Maisie; Milner, Nicky

2018-05-01

Understanding the resilience of early societies to climate change is an essential part of exploring the environmental sensitivity of human populations. There is significant interest in the role of abrupt climate events as a driver of early Holocene human activity, but there are very few well-dated records directly compared with local climate archives. Here, we present evidence from the internationally important Mesolithic site of Star Carr showing occupation during the early Holocene, which is directly compared with a high-resolution palaeoclimate record from neighbouring lake beds. We show that-once established-there was intensive human activity at the site for several hundred years when the community was subject to multiple, severe, abrupt climate events that impacted air temperatures, the landscape and the ecosystem of the region. However, these results show that occupation and activity at the site persisted regardless of the environmental stresses experienced by this society. The Star Carr population displayed a high level of resilience to climate change, suggesting that postglacial populations were not necessarily held hostage to the flickering switch of climate change. Instead, we show that local, intrinsic changes in the wetland environment were more significant in determining human activity than the large-scale abrupt early Holocene climate events.

Using improved technology for filter paper-based blood collection to survey wild Sika deer for antibodies to hepatitis E virus

OpenAIRE

Yu, Claro; Zimmerman, Carl; Stone, Roger; Engle, Ronald E.; Elkins, William; Nardone, Glenn A.; Emerson, Suzanne U.; Purcell, Robert H.

2007-01-01

Recent reports from Japan implicated wild Sika deer (Cervus nippon) in the zoonotic transmission of hepatitis E to humans. Seroprevalence studies were performed to determine if imported feral populations of Sika deer in Maryland and Virginia posed a similar risk of transmitting hepatitis E virus (HEV). Hunters collected blood on filter paper disks from freshly killed deer. The disks were desiccated and delivered to a collection point. The dried filters were weighed to estimate the amount of b...

Lionfish predators use flared fin displays to initiate cooperative hunting.

Science.gov (United States)

Lönnstedt, Oona M; Ferrari, Maud C O; Chivers, Douglas P

2014-06-01

Despite considerable study, mystery surrounds the use of signals that initiate cooperative hunting in animals. Using a labyrinth test chamber, we examined whether a lionfish, Dendrochirus zebra, would initiate cooperative hunts with piscine partners. We found that D. zebra uses a stereotyped flared fin display to alert conspecific and heterospecific lionfish species Pterois antennata to the presence of prey. Per capita success rate was significantly higher for cooperative hunters when compared with solitary ones, with hunt responders assisting hunt initiators in cornering the prey using their large extended pectoral fins. The initiators would most often take the first strike at the group of prey, but both hunters would then alternate striking at the remaining prey. Results suggest that the cooperative communication signal may be characteristic to the lionfish family, as interspecific hunters were equally coordinated and successful as intraspecific hunters. Our findings emphasize the complexity of collaborative foraging behaviours in lionfish; the turn-taking in strikes suggests that individuals do not solely try to maximize their own hunting success: instead they equally share the resources between themselves. Communicative group hunting has enabled Pteroine fish to function as highly efficient predators. © 2014 The Author(s) Published by the Royal Society. All rights reserved.

Black Hole Hunters Set New Distance Record

Science.gov (United States)

2010-01-01

billion times as much as the Sun. So far, around 20 stellar-mass black holes have been found. [2] In astronomy, heavy chemical elements, or "metals", are any chemical elements heavier than helium. [3] Predicted by Einstein's theory of general relativity, gravitational waves are ripples in the fabric of space and time. Significant gravitational waves are generated whenever there are extreme variations of strong gravitational fields with time, such as during the merger of two black holes. The detection of gravitational waves, never directly observed to date, is one of the major challenges for the next few decades. [4] The LIGO and Virgo experiments have the goal of detecting gravitational waves using sensitive interferometers in Italy and the United States. More information This research was presented in a letter to appear in the Monthly Notices of the Royal Astronomical Society (NGC 300 X-1 is a Wolf-Rayet/Black Hole binary, P.A. Crowther et al.). The team is composed of Paul Crowther and Vik Dhillon (University of Sheffield, UK), Robin Barnard and Simon Clark (The Open University, UK), and Stefania Carpano and Andy Pollock (ESAC, Madrid, Spain). ESO, the European Southern Observatory, is the foremost intergovernmental astronomy organisation in Europe and the world's most productive astronomical observatory. It is supported by 14 countries: Austria, Belgium, the Czech Republic, Denmark, France, Finland, Germany, Italy, the Netherlands, Portugal, Spain, Sweden, Switzerland and the United Kingdom. ESO carries out an ambitious programme focused on the design, construction and operation of powerful ground-based observing facilities enabling astronomers to make important scientific discoveries. ESO also plays a leading role in promoting and organising cooperation in astronomical research. ESO operates three unique world-class observing sites in Chile: La Silla, Paranal and Chajnantor. At Paranal, ESO operates the Very Large Telescope, the world's most advanced visible

The relationship between weather and caribou productivity for the La-Poile Caribou Herd, Newfoundland

Directory of Open Access Journals (Sweden)

Steven H. Ferguson

1991-10-01

Full Text Available To describe the relationship between weather and caribou (Rangifer tarandus productivity, we compared weather variables (snow on ground, winter temperature and measures of growing season with measures of productivity (calves seen by hunters, calves and yearlings in the harvest and percent calves and yearlings and pregnancy rate for caribou classified during fall and spring surveys for the LaPoile Caribou Herd in southwestern Newfoundland. Hunter statistics reliably estimated changes in population demography. Percent calves seen by hunters was correlated with calves/100 females classified in fall. Weather may have influenced productivity for the LaPoile Caribou Herd in Newfoundland. Colder winter temperatures were associated with fewer calves the next fall and pregnancy rates and yearlings/100 females in the spring were negatively correlated with snow on ground the previous winter. These relationships appear to be density related.

Man-midwifery history: 1730-1930.

Science.gov (United States)

Shelton, D C

2012-11-01

This paper seeks to determine whether the man-midwives William Smellie and William Hunter deserve continuing approbation as 'Founding Fathers' of the obstetrics profession. Scrutiny of their careers reveals their involvement in murders for dissection. In addition, the man-midwifery initiative of delivery in lying-in hospitals resulted in around 1 million more deaths in Britain and Ireland between 1730 and 1930, than would have occurred had home-births remained as the norm. While some may still credit Smellie and Hunter with obstetric discoveries, their knowledge was obtained by murder-for-dissection. That indictment, together with the lying-in hospital legacy, far outweighs their discoveries. The paper invites further constructive discussion and debate, but concludes the accolade of Founding Fathers is undeserved. Any continuing endorsement of Smellie and Hunter effectively demeans the high ethical standards and reputation of current obstetric professionals.

Southeast Asia Report

Science.gov (United States)

1987-05-04

the taban beta had audiences that suffered in comparison with the big crowds he and other PnB candidates belonging to the "militant bloc" drew...Bacolod City—A soft drinks boycott is going on in the Netherlands this week to pressure Pepsi Cola and Coca Cola "to take partial responsibility...many newspapers in the audience at the banquet, but only one or two reported his remarks, and it was a small news item, not an important piece of

Sphygmomanometers--an audit in general practice.

Science.gov (United States)

Shah, Nayankumar C; Sibbritt, David W; Heaney, Susan; Sharples, Jan

2004-11-01

The accuracy of sphygmomanometers used in Australian general practice is unknown but potentially important. We measured the accuracy of sphygmomanometers in general practice in the Hunter region of New South Wales using a gold standard. Practices were recruited by an advertisement in the division newsletter. Sixty practices (35%) volunteered. A total of 404 instruments were checked. Over 95% of sphygmomanometers were within 4 mmHg of gold standard sphygmomanometer across the clinical pressure range. Mercury sphygmomanometers were more accurate than aneroid (pmercury.

Metaphoric Car Drawings By a 12-Year-Old Congenitally Blind Girl.

Science.gov (United States)

Chao, Hsin-Yi; Kennedy, John M

2015-12-01

A 12-year-old congenitally-blind girl drew a car moving, stationary, and braking. For stationary, she put the wheels inside the car and, for braking, drew the wheels as rough rectangles. At the age verbal metaphor is understood (Winner, 1988), the girl invented metaphoric drawings. In these, what is shown is not what is meant. In late childhood, metaphor may be understood similarly in pictures and words and by the sighted and blind. © The Author(s) 2015.

Co-ordinated research project: Ingestion and organ content of trace elements of importance in radiological protection (CRP: E4.30.08). Reference Asian man project, phase 2

International Nuclear Information System (INIS)

2000-01-01

The Second Research Coordination Meeting for the Co-ordinated Research Project (CRP) on 'Ingestion and Organ Content of Trace Elements of Importance in Radiological Protection: Reference Asian Man Project, Phase 2' was held at the China Institute for Radiation Protection (CIRP) in Taiyuan, People's Republic of China. During the first technical Session, an overview of the current status of the CRP was presented by the IAEA technical officer, Dr. Parr, and the responsible officer of the Central Reference Laboratory (NIRS, Japan), Dr. Kawamura. They drew attention to the agreed programme of work, as described in the project documentation, and the timetable foreseen for the CRP as summarized in table 1. In general, they concluded that the achievements of the CRP to-date appear to be good, particularly in relation to sample collection (in most countries) and quality control (the development of appropriate reference materials). However, some aspects of the work appear to be a little behind schedule, particularly (1) the final stages of preparation of total diet samples (because of delays in providing a suitable food blender), (2) the analysis of some of the elements of first priority (because of the non-availability, until now, of suitable analytical reference materials), and (3) in some countries, the collection of autopsy specimens. One country (Malaysia) has experienced considerable difficulties in implementing the project due to the retirement of the former Chief Scientific Investigator. For this reason it was unfortunately not possible for the Malaysian representative to be present at the RCM

The regulation of hunting

DEFF Research Database (Denmark)

Abildtrup, Jens; Jensen, Frank

2014-01-01

This paper examines a tax/subsidy on hunters based on game population. The tax/subsidy is the difference between actual and optimal population multiplied by an individual, variable tax rate. The tax rate is, among other things, based on the difference between the marginal value of the game popula...... population to the hunter and the regulator and differences in user costs of the population. The paper shows that the population tax/subsidy secures a first-best optimum....

コンゴ盆地北西部に暮らすバカ・ピグミーの生活と長期狩猟採集行(モロンゴ)--熱帯雨林における狩猟採集生活の可能性を示す事例として (特集 森からみたアジア・アフリカ)

OpenAIRE

安岡, 宏和

2004-01-01

While "Pygmy" hunter-gatherers were generally assumed to be the original inhabitants of the central African rain forest, recent studies have proposed the hypothesis that it is impossible to subsist by hunting and gathering alone in the tropical rain forests without some degree of dependence on agricultural products. This hypothesis has been debated among researchers of hunter-gatherer societies in different parts of the world. There have been, however, few studies on this issue that were base...

Os saberes matemáticos em armadilhas dos caçadores Nyaneka-nkhumbi do sul de Angola

Directory of Open Access Journals (Sweden)

Domingos Dias

2015-01-01

Full Text Available Math knowledge and skills are not found exclusively in schools. The Nyaneka-nkhumbi ethnic group is one of the linguistic groups in southern Angola, with rich and unknown ethnomatematics knowledge and know-how. With this study we intend to contribute to the research in ethnomathematics and to the development and dissemination of mathematics knowledge 'hidden' in the culture of Nyaneka-nkhumbi; in particular, we will identify this knowledge in the traps made by this ethnic group. In this context traps are the artifacts often used by hunters to catch prey such as birds and / or various small animals. This paper is based on studies by various authors such as Gerdes, D'Ambrosio, Palhares and many others who are apologists of ethnomathematical studies. The procedures used to collect the data were: direct observation, informal interviews with hunters and former hunters, photographic records and field notes.

Os saberes matemáticos em armadilhas dos caçadores Nyaneka-nkhumbi do sul de Angola

Directory of Open Access Journals (Sweden)

Domingos Dias

2015-07-01

Full Text Available Math knowledge and skills are not found exclusively in schools. The Nyaneka-nkhumbi ethnic group is one of the linguistic groups in southern Angola, with rich and unknown ethnomatematics knowledge and know-how. With this study we intend to contribute to the research in ethnomathematics and to the development and dissemination of mathematics knowledge 'hidden' in the culture of Nyaneka-nkhumbi; in particular, we will identify this knowledge in the traps made by this ethnic group. In this context traps are the artifacts often used by hunters to catch prey such as birds and / or various small animals. This paper is based on studies by various authors such as Gerdes, D'Ambrosio, Palhares and many others who are apologists of ethnomathematical studies. The procedures used to collect the data were: direct observation, informal interviews with hunters and former hunters, photographic records and field notes.

The thrill of the chase: uncovering illegal sport hunting in Brazil through YouTube™ posts

Directory of Open Access Journals (Sweden)

Hani R. El Bizri

2015-09-01

Full Text Available The impacts of unregulated sport hunting can severely affect populations of target game species. Because hunting in Brazil is limited by law, obtaining data on illegal sport hunting in this country is challenging. We used an unusual online resource, YouTube™, to detect the occurrence of sport hunting in Brazil, measure the impacts of the activity on the main Brazilian game species and biomes, evaluate the opinions of hunters and internet users on sport hunting, and discuss the need for policy interventions in wildlife conservation in this country. We found 383 videos related to Brazilian sport hunting on YouTube™, accounting for more than 15 million views. Most videos were produced in the Cerrado (Brazilian savannah and approximately 70% of them depicted events of pursuit and killing of wild animals, especially lowland pacas (Cuniculus paca and armadillos (Family Dasypodidae. Videos were posted primarily in July and December, coinciding with the two main Brazilian vacation periods. Furthermore, the shotguns identified on videos show that sport hunters expend large sums of money to undertake their hunts. These results indicate that Brazilian sport hunters are possibly wealthier urban residents who travel to rural areas to hunt, contrasting with previous hunting studies in the country. Most viewers declared themselves in favor of sport hunting in comments (n = 2893 and ratings (n = 36,570 of the videos. Discussions generated by comments suggest that Brazilian sport hunters employ several informal management strategies to maintain game species stocks for future hunting and intensely question the restrictions of Brazilian environmental policies. Our results demonstrate that solutions are needed for the regulation of sport hunting in Brazil. Government actions, whether to increase surveillance or legalize hunting programs, should take into account the opinions of sport hunters and their perceptions on hunting dynamics to support effective policy

Sustainability and comanagement of subsistence hunting in an indigenous reserve in Guyana.

Science.gov (United States)

Shaffer, Christopher A; Milstein, Marissa S; Yukuma, Charakura; Marawanaru, Elisha; Suse, Phillip

2017-10-01

Although hunting is a key component of subsistence strategies of many Amazonians, it is also one of the greatest threats to wildlife. Because indigenous reserves comprise over 20% of Amazonia, effective conservation often requires that conservation professionals work closely with indigenous groups to manage resource use. We used hunter-generated harvesting data in spatially explicit biodemographic models to assess the sustainability of subsistence hunting of indigenous Waiwai in Guyana. We collected data through a hunter self-monitoring program, systematic follows of hunters, and semistructured interviews. We used these data to predict future densities of 2 indicator species, spider monkeys (Ateles paniscus) and bearded sakis (Chiropotes sagulatus), under different scenarios of human population expansion and changing hunting technology. We used encounter rates from transect surveys and hunter catch-per-unit effort (CPUE) to validate model predictions. Paca (Cuniculus paca) (198 /year), Currosaw (Crax alector) (168), and spider monkey (117) were the most frequently harvested species. Predicted densities of spider monkeys were statistically indistinguishable from empirically derived transect data (Kolmogorov-Smirnov D = 0.67, p = 0.759) and CPUE (D = 0.32, p = 1.000), demonstrating the robustness of model predictions. Ateles paniscus and C. sagulatus were predicted to be extirpated from <13% of the Waiwai reserve in 20 years, even under the most intensive hunting scenarios. Our results suggest Waiwai hunting is currently sustainable, primarily due to their low population density and use of bow and arrow. Continual monitoring is necessary, however, particularly if human population increases are accompanied by a switch to shotgun-only hunting. We suggest that hunter self-monitoring and biodemographic modeling can be used effectively in a comanagement approach in which indigenous parabiologists continuously provide hunting data that is then used to update model

Birdlime in Western Myanmar: Preparation, Use, and Conservation Implications for an Endemic Bird

Directory of Open Access Journals (Sweden)

Steven G. Platt

2012-12-01

Full Text Available Birdlimes are adhesive entangling compounds that passively capture birds by binding them to a substrate and rendering flight feathers useless. We investigated birdlime use among indigenous Chin hunters during a wildlife survey of Natma Taung National Park (NTNP in western Myanmar (May-June 2011. We found that birdlime is prepared from the sap of various banyan trees (Ficus spp. collected during the annual dry season (December-May. Birdlime is prepared by boiling sap to remove water, and the finished product is a readily malleable and extremely adhesive compound known locally as nghet phan te kaw (“bird glue”. Hunters employ four principal strategies when using birdlime: 1 limed sticks are placed at waterholes and springs; 2 limed sticks are placed in fruiting trees or nocturnal roost sites; 3 limed sticks are positioned at prominent vantage points and hunters mimic vocalizations to attract birds; 4 small insects (possibly termites are affixed to a limed pole and serve as bait to attract birds. Large numbers (>200 of birds can reportedly be captured during a single day by hunters using birdlime. At least 186 (63.9% of 291 species of birds occurring in Natma Taung National Park are thought to be vulnerable to this non-selective hunting strategy. The endangered white-browed nuthatch (Sitta victoriae Rippon Sittidae, a poorly-studied endemic species restricted to high elevation Oak-Rhododendron forest in NTNP, is vulnerable to birdliming, although the impact of hunting on populations remains unclear. We recommend that future investigations determine the sustainability of the Chin bird harvest by relating hunter off-take to recruitment and survivorship of nuthatches. If conservation action is deemed prudent, management plans should be developed in close collaboration with local Chin communities.

Human occupation and environmental change in Holocene from a case of XDW2 relic site in the Tibetan Plateau at above 4000 meters above sea level.

Science.gov (United States)

Hou, G.; Li, F.; Zhu, Y.

2017-12-01

XDW2 is an important microlithic cultural relics with continuous stratum that is located in the the Tibetan plateau at above 4,000 masl, wich is a window of revealing the evolution of early human activities and the response and adaptation to extreme environmental in the principal part of Tibetan plateau. So it has important research significance. The analysis on human activity indicator(stoneware, potsherds) and environmental indicators(magnetic susceptibility, color, granularity and pollen) showed: the winter wind and dust storm intensity is weak in this area during 7.0-6 cal. Ka BP, pedogenesis is strong, the climate is humid, environment is suitable relatively, when is Holocene Megathermal; the active phase of microlithic human activities occurred during 7.2-6 cal. ka BP, and quickly weakened after 6 cal. ka BP. The number of stone tools reveal that human activities are concentrated before and after 7-6.2 cal. ka BP, charcoal fragmental concentration indicates that microlithic human activity reached the peak at around 6.7 cal. ka BP. Thus relatively suitable environment during Holocene Megathermal is the important motivating factor of active hunter-gatherer activities in the principal part of Tibetan plateau. After 6 cal. ka BP, summer monsoon weakened rapidly, agricultural growers in the Loess Plateau began to expand towards the plateau, under the effect of environmental degradation and new technologies, microlithic hunter-gatherers in the principal part of plateau moved towards the river valley at low altitude, and learnt settlement and plantation, microlithic activity in the main plateau began to decline.

Three recent ice entrapments of Arctic cetaceans in West Greenland and the eastern Canadian High Arctic

Directory of Open Access Journals (Sweden)

MP Heide-Jørgensen

2002-07-01

Full Text Available Three ice entrapments of Monodontids have been reported in the western North Atlantic since 1993. Hunters in Disko Bay, West Greenland, discovered one in March 1994 that included about 150 narwhals (Monodon monoceros. The entrapment occurred during a sudden cold period which caused ice to form rapidly. The trapped whales were subject to hunting, but about 50 of the killed whales could not be retrieved in the ice. The whales were trapped in a small opening in the ice and because of that they would probably have succumbed even if not discovered by hunters. Two entrapments involving white whales or belugas (Delphinapterus leucas occurred in the eastern Canadian Arctic in May 1999; one in Lancaster Sound discovered by polar bear (Ursus maritimus researchers and one in Jones Sound discovered by hunters. The first included one bowhead whale (Balaena mysticetus and about 40 belugas that were being preyed upon by polar bears. The second involved at least 170 belugas, of which about 100 were killed by polar bears and 17 were taken by hunters. The entrapments in Disko Bay and Jones Sound both occurred in areas where entrapments have previously been reported, whereas the one in Lancaster Sound was in a new area.

Spontaneous potential and telluric measurements on Rainier Mesa relaed to the NPE

Energy Technology Data Exchange (ETDEWEB)

Sweeney, J.J. [Lawrence Livermore National Lab., CA (United States)

1994-12-31

We made measurements of spontaneous potential (SP) on Rainier Mesa to see if changes in subsurface electrical properties of rock related to the Non-Proliferation Experiment (NPE) explosion can be detected at the surface. A north-south line, repeated 3 times and running within 50 m of surface ground zero (SGZ) of Hunter`s Trophy and within 20 m of SGZ of the NPE, was measured before and after the NPE. An east-west line, with one end within 20 m of SGZ of the NPE was also run before and after the NPE. High values of surface potential along the north-south line in the vicinity of the NPE apparently moved northward after the detonation. A similar change was not noted on the east-west line. A telluric line (0.025-0.1 Hz and 8.0 Hz) was also run prior to the NPE along the same north-south line as the SP measurement, but farther to the west of SGZ for Hunter`s Trophy. There is a prominent high in the 8 Hz data in the northern part that may be related to a former nuclear test, but it could also be related to local geology. Results from these geophysical methods, while showing some promise for use in an on-site monitoring regime, also emphasize the need for repeatable background reference data.

A history of cryptorchidism: lessons from the eighteenth century.

Science.gov (United States)

Tackett, Leslie D; Patel, Sutchin R; Caldamone, Anthony A

2007-12-01

John Hunter in 1786 opened the door to more than 200 years of study and discussion of the cryptorchid testis. We review the history that has brought us to our current surgical treatment of this condition. We performed a review of the medical and historical surgical literature pertaining to cryptorchidism. The study of cryptorchidism began with the anatomical descriptions of Baron Albrecht von Haller and John Hunter. Attempts at surgical correction of the undescended testis began in the early 1800s, culminating in the first successful orchidopexy by Thomas Annandale in 1877. Further contributions to the surgical technique include: (1) Arthur Dean Bevan's division of the processus vaginalis to prevent reascent and his stress on the importance of adequate mobilization of the spermatic cord, (2) the description by Robert Prentiss of surgical triangles which allowed for mobilization of the spermatic cord and placement of the testis into the scrotum without tension, and (3) Lattimer's subdartos pouch. Our understanding and the surgical treatment of cryptorchidism have continued to evolve over the last 200 years. A study of the history of surgical management of the undescended testis sheds light on the rationale behind current management.

Genetics and southern African prehistory: an archaeological view.

Science.gov (United States)

Mitchell, Peter

2010-01-01

Southern African populations speaking languages that are often - but inaccurately - grouped together under the label 'Khoisan' are an important focus of molecular genetic research, not least in tracking the early stages of human genetic diversification. This paper reviews these studies from an archaeological standpoint, concentrating on modern human origins, the introduction of pastoralism to southern Africa and admixture between the region's indigenous foragers and incoming Bantu-speaking farmers. To minimise confusion and facilitate correlation with anthropological, linguistic and archaeological data it emphasises the need to use ethnolinguistic labels accurately and with due regard for the particular histories of individual groups. It also stresses the geographically and culturally biased nature of the genetic studies undertaken to date, which employ data from only a few 'Khoisan' groups. Specific topics for which the combined deployment of genetic and archaeological methods would be particularly useful include the early history of Ju-Hoan- and Tuu-speaking hunter-gatherers, the expansion of Khoe-speaking populations, the chronology of genetic exchange between hunter-gatherers and farmers, and the origins of the Sotho/Tswana- and Nguni-speaking populations that dominate much of southern Africa today.

Increasing Effectiveness of U.S. Counterintelligence: Domestic and International Micro-Restructuring Initiatives to Mitigate Cyberespionage

Science.gov (United States)

2012-06-01

keys: Data Breach at the Pentagon’s Largest Supplier,” ITNEWS (30 May 2011). 116 Christopher Drew and John Markoff, “ Data Breach at Security Firm...117 Drew and Markoff, “ Data Breach at Security Firm Linked to Attack on Lockheed Martin.” 118 Hjortdal, “China’s Use of Cyber...John Markoff. “ Data Breach at Security Firm Linked to Attack on Lockheed Martin.” The New York Times, 27 May 2011. http://www.nytimes.com/2011/05/28

IMPORTANT NOTIFICATION

CERN Multimedia

HR Department

2009-01-01

Green plates, removals and importation of personal effects Please note that, as from 1 April 2009, formalities relating to K and CD special series French vehicle plates (green plates), removals and importation of personal effects into France and Switzerland will be dealt with by GS Department (Building 73/3-014, tel. 73683/74407). Importation and purchase of tax-free vehicles in Switzerland, as well as diplomatic privileges, will continue to be dealt with by the Installation Service of HR Department (Building 33/1-011, tel. 73962). HR and GS Departments

Games with a purpose (GWAPs)

CERN Document Server

Lafourcade, Mathieu; Le Brun, Nathalie

2015-01-01

Human brains can be seen as knowledge processors in a distributed system. Each of them can achieve, conscious or not, a small part of a treatment too important to be done by one. These are also ""hunter / gatherers"" of knowledge.  Provided that the number of contributors is large enough, the results are usually better quality than if they were the result of the activity of a single person, even if it is a domain expert.  This type of activity is done via online games.

Conundrums in neurology: diagnosing serotonin syndrome - a meta-analysis of cases.

Science.gov (United States)

Werneke, Ursula; Jamshidi, Fariba; Taylor, David M; Ott, Michael

2016-07-12

Serotonin syndrome is a toxic state, caused by serotonin (5HT) excess in the central nervous system. Serotonin syndrome's main feature is neuro-muscular hyperexcitability, which in many cases is mild but in some cases can become life-threatening. The diagnosis of serotonin syndrome remains challenging since it can only be made on clinical grounds. Three diagnostic criteria systems, Sternbach, Radomski and Hunter classifications, are available. Here we test the validity of four assumptions that have become widely accepted: (1) The Hunter classification performs clinically better than the Sternbach and Radomski criteria; (2) in contrast to neuroleptic malignant syndrome, the onset of serotonin syndrome is usually rapid; (3) hyperthermia is a hallmark of severe serotonin syndrome; and (4) serotonin syndrome can readily be distinguished from neuroleptic malignant syndrome on clinical grounds and on the basis of medication history. Systematic review and meta-analysis of all cases of serotonin syndrome and toxicity published between 2004 and 2014, using PubMed and Web of Science. Two of the four assumptions (1 and 2) are based on only one published study each and have not been independently validated. There is little agreement between current criteria systems for the diagnosis of serotonin syndrome. Although frequently thought to be the gold standard for the diagnosis of the serotonin syndrome, the Hunter criteria did not perform better than the Sternbach and Radomski criteria. Not all cases seem to be of rapid onset and only relatively few cases may present with hyperthermia. The 0 differential diagnosis between serotonin syndrome and neuroleptic malignant syndrome is not always clear-cut. Our findings challenge four commonly made assumptions about serotonin syndrome. We propose our meta-analysis of cases (MAC) method as a new way to systematically pool and interpret anecdotal but important clinical information concerning uncommon or emergent phenomena that cannot be

ESPRESSO: The next European exoplanet hunter

Science.gov (United States)

Pepe, F.; Molaro, P.; Cristiani, S.; Rebolo, R.; Santos, N. C.; Dekker, H.; Mégevand, D.; Zerbi, F. M.; Cabral, A.; Di Marcantonio, P.; Abreu, M.; Affolter, M.; Aliverti, M.; Allende Prieto, C.; Amate, M.; Avila, G.; Baldini, V.; Bristow, P.; Broeg, C.; Cirami, R.; Coelho, J.; Conconi, P.; Coretti, I.; Cupani, G.; D'Odorico, V.; De Caprio, V.; Delabre, B.; Dorn, R.; Figueira, P.; Fragoso, A.; Galeotta, S.; Genolet, L.; Gomes, R.; González Hernández, J. I.; Hughes, I.; Iwert, O.; Kerber, F.; Landoni, M.; Lizon, J.-L.; Lovis, C.; Maire, C.; Mannetta, M.; Martins, C.; Monteiro, M.; Oliveira, A.; Poretti, E.; Rasilla, J. L.; Riva, M.; Santana Tschudi, S.; Santos, P.; Sosnowska, D.; Sousa, S.; Spanó, P.; Tenegi, F.; Toso, G.; Vanzella, E.; Viel, M.; Zapatero Osorio, M. R.

2014-01-01

The acronym ESPRESSO stems for Echelle SPectrograph for Rocky Exoplanets and Stable Spectroscopic Observations; this instrument will be the next VLT high resolution spectrograph. The spectrograph will be installed at the Combined-Coudé Laboratory of the VLT and linked to the four 8.2 m Unit Telescopes (UT) through four optical Coudé trains. ESPRESSO will combine efficiency and extreme spectroscopic precision. ESPRESSO is foreseen to achieve a gain of two magnitudes with respect to its predecessor HARPS, and to improve the instrumental radial-velocity precision to reach the 10 cm s-1 level. It can be operated either with a single UT or with up to four UTs, enabling an additional gain in the latter mode. The incoherent combination of four telescopes and the extreme precision requirements called for many innovative design solutions while ensuring the technical heritage of the successful HARPS experience. ESPRESSO will allow to explore new frontiers in most domains of astrophysics that require precision and sensitivity. The main scientific drivers are the search and characterization of rocky exoplanets in the habitable zone of quiet, nearby G to M-dwarfs and the analysis of the variability of fundamental physical constants. The project passed the final design review in May 2013 and entered the manufacturing phase. ESPRESSO will be installed at the Paranal Observatory in 2016 and its operation is planned to start by the end of the same year.

The leptoquark hunter's guide: pair production

Science.gov (United States)

Diaz, Bastian; Schmaltz, Martin; Zhong, Yi-Ming

2017-10-01

Leptoquarks occur in many new physics scenarios and could be the next big discovery at the LHC. The purpose of this paper is to point out that a model-independent search strategy covering all possible leptoquarks is possible and has not yet been fully exploited. To be systematic we organize the possible leptoquark final states according to a leptoquark matrix with entries corresponding to nine experimentally distinguishable leptoquark decays: any of {light-jet, b-jet, top} with any of {neutrino, e/ μ, τ}. The 9 possibilities can be explored in a largely model-independent fashion with pair-production of leptoquarks at the LHC. We review the status of experimental searches for the 9 components of the leptoquark matrix, pointing out which 3 have not been adequately covered. We plead that experimenters publish bounds on leptoquark cross sections as functions of mass for as wide a range of leptoquark masses as possible. Such bounds are essential for reliable recasts to general leptoquark models. To demonstrate the utility of the leptoquark matrix approach we collect and summarize searches with the same final states as leptoquark pair production and use them to derive bounds on a complete set of Minimal Leptoquark models which span all possible flavor and gauge representations for scalar and vector leptoquarks.

Pulmonary coccidioidomycosis in a armadillo hunter

OpenAIRE

COSTA, FABRÍCIO ANDRÉ MARTINS DA; REIS, RICARDO COELHO; BENEVIDES, FÁBIO; TOMÉ, GERALDO DE SOUSA; HOLANDA, MARCELO ALCÂNTARA

2001-01-01

A coccidioidomicose, uma doença fúngica adquirida através da inalação do agente Coccidioides immitis sob forma de artroconídio, vem sendo descrita desde 1892. Restringe-se principalmente a áreas de clima árido, solo alcalino e regiões de baixo índice pluviométrico. Não por acaso, a maioria dos casos descritos no Brasil ocorreu na região Nordeste. Relata-se o caso de um homem de 19 anos, imunocompetente, com queixa de dor pleural bilateral, febre, adinamia e tosse seca havia dois meses. A radi...

DREW-UCLA Breast Cancer Research and Training Program: Molecular/Cellular Pathogenesis Model

Science.gov (United States)

2007-03-01

RHS1764-9209568) were designed corresponding to nucleotides 575 to 595 of the coding region (gccctggccgtgctagacaat) of Homo sapiens ERBB2 transcript...variant 1, mRNA sequence (NM_004448, NCBI database), and 2896 to 2917 of the coding region (gctgaactggtgtatgcagatt) of Homo sapiens ERBB2, transcript...responsible for alanine transport. Springer Apoptosis (2007) 12:593–612 599 * T ra n sp o rt V el o ci ty (n m o l/m g p ro te in /m in ) 0.0 0.5 1.0

The Sea Ice for Walrus Outlook: A collaboration between scientific and Indigenous communities to support safety and food security in a changing Arctic

Science.gov (United States)

Sheffield Guy, L.; Wiggins, H. V.; Schreck, M. B.; Metcalf, V. K.

2017-12-01

The Sea Ice for Walrus Outlook (SIWO) provides Alaskan Native subsistence walrus hunters and Bering Strait coastal communities with weekly reports on spring sea ice and weather conditions to promote hunter safety, food security, and preservation of cultural heritage. These reports integrate scientific and Indigenous knowledge into a co-produced tool that is used by both local and scientific communities. SIWO is a team effort led by the Arctic Research Consortium of the U.S. (ARCUS, with funding from NSF Arctic Sciences Section), with the Eskimo Walrus Commission, National Weather Service - Alaska Sea Ice Program, University of Alaska Fairbanks - International Arctic Research Center, and local observers. For each weekly outlook, the National Weather Service provides location-specific weather and sea ice forecasts and regional satellite imagery. Local observations of sea ice, weather, and hunting conditions are provided by observers from five Alaskan communities in the Bering Strait region: Wales, Shishmaref, Nome, Gambell, and Savoonga. These observations typically include a written description of conditions accompanied by photographs of sea ice or subsistence activities. Outlooks are easily accessible and provide a platform for sharing of knowledge among hunters in neighboring communities. The opportunity to contribute is open, and Indigenous language and terms are encouraged. These observations from local hunters and community members also provide a valuable tool for validation of weather forecasts, satellite products, and other information for scientists. This presentation will discuss the process, products, and mutually beneficial outcomes of the Sea Ice for Walrus Outlook.

Astronomy in the Service of Christianity

Science.gov (United States)

McCluskey, Stephen C.

Medieval European scholars drew on ancient traditions of astronomical knowledge to develop astronomical practices that served the needs of religious institutions by defining the sacred time and sacred space of religious ritual. Techniques employing the luni-solar calendar to determine the date of Easter, observations of the stars and Sun to determine the time of prayer, and orienting churches astronomically to face the symbolically important direction, east, were widely practiced. These varieties of religious astronomy were employed by persons of varying levels of education, working within a variety of contexts.

Molecular footprints of domestication and improvement in soybean revealed by whole genome re-sequencing

DEFF Research Database (Denmark)

Li, Ying-hui; Zhao, Shan-cen; Ma, Jian-xin

2013-01-01

and genetic improvement were identified.CONCLUSIONS:Given the uniqueness of the soybean germplasm sequenced, this study drew a clear picture of human-mediated evolution of the soybean genomes. The genomic resources and information provided by this study would also facilitate the discovery of genes......BACKGROUND:Artificial selection played an important role in the origin of modern Glycine max cultivars from the wild soybean Glycine soja. To elucidate the consequences of artificial selection accompanying the domestication and modern improvement of soybean, 25 new and 30 published whole-genome re...

A RuleML Study on Integrating Geographical and Health Information

DEFF Research Database (Denmark)

Gao, Sheng; Mioc, Darka; Boley, Harold

2008-01-01

To facilitate health surveillance, flexible ways to represent, integrate, and deduce health information become increasingly important. In this paper, an ontology is used to support the semantic definition of spatial, temporal and thematic factors of health information. The ontology is realized...... as an interchangeable RuleML knowledge base, consisting of facts and rules. Rules are also used for integrating geographical and health information. The implemented eHealthGeo system uses the OO jDREW reasoning engine to deduce implicit information such as spatial relationships. The system combines this with spatial...

Smoking as a Determinant of High Organochlorine Levels in Greenland

DEFF Research Database (Denmark)

Deutch, Bente; Pedersen, Henning Sloth; Bonefeld-Jørgensen, Eva Cecilie

2003-01-01

diet, and smoking or plasma cotinine in multiple linear-regression models (p smoking status. These findings confirm that the source of POPs among the Inuit in Greenland is diet, but smoking......The authors investigated the accumulation of organochlorines among smoking and nonsmoking Inuit hunters (n = 48) in Uummanaq, Greenland, a population with high dietary exposure to persistent organic pollutants (POPs). Human plasma organochlorine levels were positively correlated with age, marine...... is an important determinant of POP bioaccumulation. Smoking cessation may provide a means to lower the body burden of POPs....

Review of: Ancient Scandinavia: An Archaeological History from the First Humans to the Vikings (Oxford University Press, Oxford, 2016) T. Douglas Price

DEFF Research Database (Denmark)

Løvschal, Mette

2017-01-01

, barrows and megaliths that still mark the present-day landscape and bear witness to an intriguing prehistory. One of the important factors involved in the discovery of these archaeological remains is the nature of Scandinavian landscapes, riddled as they are with wet marshes, bogs, rivers and flooded......), providing better opportunities for strategic sampling and systematic data storage than in many other regions of Europe. This book draws together the main historical lines in this rich body of archaeological remains from Scandinavian prehistory from the arrival of the first reindeer hunters after the last...

Natural-Language Parser for PBEM

Science.gov (United States)

James, Mark

2010-01-01

A computer program called "Hunter" accepts, as input, a colloquial-English description of a set of policy-based-management rules, and parses that description into a form useable by policy-based enterprise management (PBEM) software. PBEM is a rules-based approach suitable for automating some management tasks. PBEM simplifies the management of a given enterprise through establishment of policies addressing situations that are likely to occur. Hunter was developed to have a unique capability to extract the intended meaning instead of focusing on parsing the exact ways in which individual words are used.

Harepest hos jaeger

DEFF Research Database (Denmark)

Edfors, Robert; Smith, Birgitte; Lillebaek, Troels

2010-01-01

"Rabbit fever" (Francisella Tularensis) is a rare infection in Denmark. It was first described in Denmark in 1987. It is most likely to affect people who come into close contact with infected animals or ticks, such as hunters, butchers and veterinarians. The diagnosis should be suspected in such ......"Rabbit fever" (Francisella Tularensis) is a rare infection in Denmark. It was first described in Denmark in 1987. It is most likely to affect people who come into close contact with infected animals or ticks, such as hunters, butchers and veterinarians. The diagnosis should be suspected...

Living Lands

DEFF Research Database (Denmark)

Christensen, Suna Møller

2015-01-01

, hunters attended to questions like safe-journeying on ice or the role of natural surroundings in children’s education, in ways revealing a relational perception of ‘nature’ and dissolving culture-nature dualisms. Hunters’ experiences in living the land afforded children a dwelling position from which...... to grow with the features of the land. Framed this way, ‘nature’ was regarded as part of the social world. I suggest that learning among Arctic hunters is social and twofold. First, we can learn how human-environment relations influence individual life trajectories. Secondly, ‘nature’ as part...

The Real Sustainability Challenge

CSIR Research Space (South Africa)

Unknown author

2002-11-01

Full Text Available is well illustrated in the following story: The great white hunter came upon a tribe of pygmies celebrating around a dead elephant. The hunter was really mystified by how these small people could kill something so big. “O easy,” the pygmy replied... business. However, your greatest responsibility as a country is to set a good example for the rest of the world to follow. The citizens of America set the aspirations for the rest of the world. But if the world follows the example that you, as a nation...

Perceived cultural importance and actual self-importance of values in cultural identification.

Science.gov (United States)

Wan, Ching; Chiu, Chi-yue; Tam, Kim-pong; Lee, Sau-lai; Lau, Ivy Yee-man; Peng, Siqing

2007-02-01

Cross-cultural psychologists assume that core cultural values define to a large extent what a culture is. Typically, core values are identified through an actual self-importance approach, in which core values are those that members of the culture as a group strongly endorse. In this article, the authors propose a perceived cultural importance approach to identifying core values, in which core values are values that members of the culture as a group generally believe to be important in the culture. In 5 studies, the authors examine the utility of the perceived cultural importance approach. Results consistently showed that, compared with values of high actual self-importance, values of high perceived cultural importance play a more important role in cultural identification. These findings have important implications for conceptualizing and measuring cultures. ((c) 2007 APA, all rights reserved).

IMPORT COMPONENTS AND IMPORT MULTIPLIERS IN INDONESIAN ECONOMY: WORLD INPUT-OUTPUT ANALYSIS

Directory of Open Access Journals (Sweden)

Muchdie Muchdie

2018-03-01

Full Text Available This paper calculates, presents and discusses on import components and the impact of final demand change on Indonesian imports using Indonesian 36 sector input-output tables of years: 2000, 2005, 2010 and 2014 from World Input-Output Tables. The results showed that firstly, Indonesian import components of input were, on average, more than 20 percent; meaning that input that locally provided were less than 80 percent. Secondly, Indonesian import of input had increased significantly from US$ 36,011 million in 2000 to US$ 151,505 million in 2014. Thirdly, Indonesian imports have been dominated by Sector-3: Manufacture of food products, beverages and tobacco products, Sector-4: Manufacture of textiles, wearing apparel and leather products, Sector-24: Construction, Sector-25: Wholesale and retail trade and repair, and Sector-26: Transportation and post services. Fourthly, by country of origin, Indonesian imports have been dominated by Japan, Korea, the USA, Australia, and China. Imports from Australia, Japan, and the US have been decreased significantly, but import from China has steadily increased. Finally, highest sectoral import multipliers occurred if final demands change in Sector-1: Crop and animal production, forestry, fishing and aquaculture, Sector-2: Mining and quarrying, Sector-23: Water collection; sewerage; waste collection, treatment and disposal activities, and Sector-30: Real estate activities, but there was no significant difference of import multipliers for country origin of import.

AND/OR Importance Sampling

OpenAIRE

Gogate, Vibhav; Dechter, Rina

2012-01-01

The paper introduces AND/OR importance sampling for probabilistic graphical models. In contrast to importance sampling, AND/OR importance sampling caches samples in the AND/OR space and then extracts a new sample mean from the stored samples. We prove that AND/OR importance sampling may have lower variance than importance sampling; thereby providing a theoretical justification for preferring it over importance sampling. Our empirical evaluation demonstrates that AND/OR importance sampling is ...

Survival of adult female elk in yellowstone following wolf restoration

Science.gov (United States)

Evans, S.B.; Mech, L.D.; White, P.J.; Sargeant, G.A.

2006-01-01

Counts of northern Yellowstone elk (Cervus elaphus) in northwestern Wyoming and adjacent Montana, USA, have decreased at an average rate of 6-8% per year since wolves (Canis lupus) were reintroduced in 1995. Population growth rates of elk are typically sensitive to variations in adult female survival; populations that are stable or increasing exhibit high adult female survival. We used survival records for 85 radiocollared adult female elk 1-19 years old to estimate annual survival from March 2000 to February 2004. Weighted average annual survival rates were approximately 0.83 (95% CI = 0.77-0.89) for females 1-15 years old and 0.80 (95% CI = 0.73-0.86) for all females. Our estimates were much lower than the rate of 0.99 observed during 1969-1975 when fewer elk were harvested by hunters, wolves were not present, and other predators were less numerous. Of 33 documented deaths included in our analysis, we attributed 11 to hunter harvest, 14 to predation (10 wolf, 2 unknown, 1 cougar [Puma concolor], and 1 bear [Ursus sp.]), 6 to unknown causes, and 2 to winter-kill. Most deaths occurred from December through March. Estimates of cause-specific annual mortality rates were 0.09 (0.05-0.14) for all predators, 0.08 (0.04-0.13) for hunting, and 0.07 (0.03-0.11) for wolves specifically. Wolf-killed elk were typically older (median = 12 yr) than hunter-killed elk (median = 9 yr, P = 0.03). However, elk that winter outside the park where they were exposed to hunting were also younger (median = 7 yr) than elk that we did not observe outside the park (median = 9 yr, P wolves and hunters may reflect characteristics of elk exposed to various causes of mortality, as well as differences in susceptibility. Unless survival rates of adult females increase, elk numbers are likely to continue declining. Hunter harvest is the only cause of mortality that is amenable to management at the present time.

The elusive importance effect: more failure for the Jamesian perspective on the importance of importance in shaping self-esteem.

Science.gov (United States)

Marsh, Herbert W

2008-10-01

Following William James (1890/1963), many leading self-esteem researchers continue to support the Individual-importance hypothesis-that the relation between specific facets of self-concept and global self-esteem depends on the importance an individual places on each specific facet. However, empirical support for the hypothesis is surprisingly elusive, whether evaluated in terms of an importance-weighted average model, a generalized multiple regression approach for testing self-concept-by-importance interactions, or idiographic approaches. How can actual empirical support for such an intuitively appealing and widely cited psychological principle be so elusive? Hardy and Moriarty (2006), acknowledging this previous failure of the Individual-importance hypothesis, claim to have solved the conundrum, demonstrating an innovative idiographic approach that provides clear support for it. However, a critical evaluation of their new approach, coupled with a reanalysis of their data, undermines their claims. Indeed, their data provide compelling support against the Individual-importance hypothesis, which remains as elusive as ever.

'We call it a virus but I want to say it's the devil inside': redemption, moral reform and relationships with God among people living with HIV in Papua New Guinea.

Science.gov (United States)

Kelly-Hanku, Angela; Aggleton, Peter; Shih, Patti

2014-10-01

There is growing recognition of the importance of religion and religious beliefs as they relate to the experience of HIV, globally and in Papua New Guinea in particular. Based on 36 in-depth qualitative interviews conducted with people living with HIV receiving HIV antiretroviral therapy in 2008, this paper examines the cultural aetiology of HIV of in Papua New Guinea, the country with the highest reported burden of HIV in the Pacific. Narratives provided drew upon a largely moral framework, which viewed HIV acquisition as a consequence of moral failing and living an un-Christian life. This explanation for suffering viewed the individual as responsible for their condition in much the same way that neo-liberal biomedical discourses do. Moral reform and re-establishing a relationship with God were seen as key actions necessary to effect healing on the material body infected with HIV. Religious understandings of HIV drew upon a pre-existing cultural aetiology of dis-ease and misfortune widespread in Papua New Guinea. Understanding the centrality of Christianity to explanations of disease, and subsequently the actions necessary to bring about health, is essential in order to understand how people with HIV in receipt of antiretroviral therapies internalise biomedical perspectives and reconcile these with Christian beliefs. Copyright © 2014 Elsevier Ltd. All rights reserved.

The genomic history of southeastern Europe.

Science.gov (United States)

Mathieson, Iain; Alpaslan-Roodenberg, Songül; Posth, Cosimo; Szécsényi-Nagy, Anna; Rohland, Nadin; Mallick, Swapan; Olalde, Iñigo; Broomandkhoshbacht, Nasreen; Candilio, Francesca; Cheronet, Olivia; Fernandes, Daniel; Ferry, Matthew; Gamarra, Beatriz; Fortes, Gloria González; Haak, Wolfgang; Harney, Eadaoin; Jones, Eppie; Keating, Denise; Krause-Kyora, Ben; Kucukkalipci, Isil; Michel, Megan; Mittnik, Alissa; Nägele, Kathrin; Novak, Mario; Oppenheimer, Jonas; Patterson, Nick; Pfrengle, Saskia; Sirak, Kendra; Stewardson, Kristin; Vai, Stefania; Alexandrov, Stefan; Alt, Kurt W; Andreescu, Radian; Antonović, Dragana; Ash, Abigail; Atanassova, Nadezhda; Bacvarov, Krum; Gusztáv, Mende Balázs; Bocherens, Hervé; Bolus, Michael; Boroneanţ, Adina; Boyadzhiev, Yavor; Budnik, Alicja; Burmaz, Josip; Chohadzhiev, Stefan; Conard, Nicholas J; Cottiaux, Richard; Čuka, Maja; Cupillard, Christophe; Drucker, Dorothée G; Elenski, Nedko; Francken, Michael; Galabova, Borislava; Ganetsovski, Georgi; Gély, Bernard; Hajdu, Tamás; Handzhyiska, Veneta; Harvati, Katerina; Higham, Thomas; Iliev, Stanislav; Janković, Ivor; Karavanić, Ivor; Kennett, Douglas J; Komšo, Darko; Kozak, Alexandra; Labuda, Damian; Lari, Martina; Lazar, Catalin; Leppek, Maleen; Leshtakov, Krassimir; Vetro, Domenico Lo; Los, Dženi; Lozanov, Ivaylo; Malina, Maria; Martini, Fabio; McSweeney, Kath; Meller, Harald; Menđušić, Marko; Mirea, Pavel; Moiseyev, Vyacheslav; Petrova, Vanya; Price, T Douglas; Simalcsik, Angela; Sineo, Luca; Šlaus, Mario; Slavchev, Vladimir; Stanev, Petar; Starović, Andrej; Szeniczey, Tamás; Talamo, Sahra; Teschler-Nicola, Maria; Thevenet, Corinne; Valchev, Ivan; Valentin, Frédérique; Vasilyev, Sergey; Veljanovska, Fanica; Venelinova, Svetlana; Veselovskaya, Elizaveta; Viola, Bence; Virag, Cristian; Zaninović, Joško; Zäuner, Steve; Stockhammer, Philipp W; Catalano, Giulio; Krauß, Raiko; Caramelli, David; Zariņa, Gunita; Gaydarska, Bisserka; Lillie, Malcolm; Nikitin, Alexey G; Potekhina, Inna; Papathanasiou, Anastasia; Borić, Dušan; Bonsall, Clive; Krause, Johannes; Pinhasi, Ron; Reich, David

2018-03-08

Farming was first introduced to Europe in the mid-seventh millennium bc, and was associated with migrants from Anatolia who settled in the southeast before spreading throughout Europe. Here, to understand the dynamics of this process, we analysed genome-wide ancient DNA data from 225 individuals who lived in southeastern Europe and surrounding regions between 12000 and 500 bc. We document a west-east cline of ancestry in indigenous hunter-gatherers and, in eastern Europe, the early stages in the formation of Bronze Age steppe ancestry. We show that the first farmers of northern and western Europe dispersed through southeastern Europe with limited hunter-gatherer admixture, but that some early groups in the southeast mixed extensively with hunter-gatherers without the sex-biased admixture that prevailed later in the north and west. We also show that southeastern Europe continued to be a nexus between east and west after the arrival of farmers, with intermittent genetic contact with steppe populations occurring up to 2,000 years earlier than the migrations from the steppe that ultimately replaced much of the population of northern Europe.

Mountain lions prey selectively on prion-infected mule deer

Science.gov (United States)

Krumm, Caroline E.; Conner, Mary M.; Hobbs, N. Thompson; Hunter, Don O.; Miller, Michael W.

2010-01-01

The possibility that predators choose prey selectively based on age or condition has been suggested but rarely tested. We examined whether mountain lions (Puma concolor) selectively prey upon mule deer (Odocoileus hemionus) infected with chronic wasting disease, a prion disease. We located kill sites of mountain lions in the northern Front Range of Colorado, USA, and compared disease prevalence among lion-killed adult (≥2 years old) deer with prevalence among sympatric deer taken by hunters in the vicinity of kill sites. Hunter-killed female deer were less likely to be infected than males (odds ratios (OR) = 0.2, 95% confidence intervals (CI) = 0.1–0.6; p = 0.015). However, both female (OR = 8.5, 95% CI = 2.3–30.9) and male deer (OR = 3.2, 95% CI = 1–10) killed by a mountain lion were more likely to be infected than same-sex deer killed in the vicinity by a hunter (p < 0.001), suggesting that mountain lions in this area actively selected prion-infected individuals when targeting adult mule deer as prey items. PMID:19864271

Multiple Zoonotic Parasites Identified in Dog Feces Collected in Ponte de Lima, Portugal — A Potential Threat to Human Health

Science.gov (United States)

Letra Mateus, Teresa; Castro, António; Niza Ribeiro, João; Vieira-Pinto, Madalena

2014-01-01

Dogs play many roles and their presence within people’s houses has increased. In rural settings dog faeces are not removed from the streets, representing an environmental pollution factor. Our aim was to evaluate the occurrence of environmental contamination with zoonotic intestinal parasites of three groups of dogs in Ponte de Lima, Portugal, with a particular emphasis on Echinococcus granulosus. We collected 592 dog faecal samples from the environment, farm and hunting dogs. Qualitative flotation coprological analysis was performed and the frequency in the positive samples ranged between 57.44% and 81.19% in different groups. We isolated up to four different parasites in one sample and detected seven intestinal parasitic species, genera or families overall. Ancylostomatidae was the most prevalent parasite, followed by Trichuris spp., Toxocara spp., Isospora spp., Dipylidium caninum, Taeniidae and Toxascaris leonina. Taeniidae eggs were analyzed with the PCR technique and revealed not to be from Echinococcus. The parasite prevalence and the diversity of zoonotic parasites found were high, which calls for a greater awareness of the problem among the population, especially hunters. Promoting research at the local level is important to plan control strategies. Health education should be developed with regard to farmers and hunters, and a closer collaboration between researchers, practitioners and public health authorities is needed. PMID:25257358

Unexpected and undesired conservation outcomes of wildlife trade bans—An emerging problem for stakeholders?

Directory of Open Access Journals (Sweden)

Diana S. Weber

2015-01-01

Full Text Available CITES regulates international trade with the goal of preventing over-exploitation, thus the survival of species are not jeopardized from trade practices; however it has been used recently in nontrade conservation measures. As an example, the US proposed to up-list polar bears under CITES Appendix I, despite that the species did not conform to the biological criteria. Polar bears were listed as ‘threatened’ under US ESA in 2008, in response to loss of sea-ice and warming temperatures. In Nunavut, where most of Canada’s polar bears are harvested, the resulting trade ban did not decrease total harvest after the ESA listing but reduced US hunter participation and the proportion of quotas taken by sport hunters from specific populations. Consequently, the import ban impacted livelihoods of Arctic indigenous communities with negative conservation — reduced tolerance for dangerous fauna and affected local participation in shared management initiatives. The polar bear may be the exemplar of an emerging problem: the use of trade bans in place of action for non-trade threats, e.g., climate change. Conservation prospects for this species and other climate-sensitive wildlife will likely diminish if the increasing use of trade bans to combat non-trade issues cause stakeholders to lose faith in participatory management.

Hunting, Sale, and Consumption of Bushmeat Killed by Lead-Based Ammunition in Benin

Directory of Open Access Journals (Sweden)

Shukrullah Ahmadi

2018-06-01

Full Text Available Human consumption of animal meat killed by lead ammunition has been reported as a risk factor for elevated blood lead levels. However, little is known about how meat killed by lead ammunition is hunted, prepared, sold, and consumed. We explored the process from hunting to consumption within communities in Benin from the perspective of preventive measures. We conducted 38 semi-structured interviews with hunters (n = 9 and sellers (n = 8 of bushmeat and families (n = 21 as consumers of bushmeat killed by lead ammunition. Data were transcribed, translated, and coded for analysis. We conducted content analysis to identify and describe key themes and processes from hunting to consumption. Many hunters (n = 7/9 used lead-based ammunition. After the meat is hunted, market sellers often buy it directly from the hunters. Amongst the hunters and sellers, few (n = 4/17 acknowledged removing the meat impacted by lead shot prior to sale. Many families (n = 15/21 mentioned consumption of the hunted bushmeat. The meat is cooked before sharing with children. Many families (n = 19/21 mentioned they look for the remains of the lead shot or remove the meat impacted by the shot. The finding suggests that hunting, sale, and consumption of bushmeat killed by lead ammunition are well-known practices in Allada, Benin. The bushmeat often hunted illegally with lead shot is sold in the markets and eventually consumed by families who attempt to clean the meat impacted by the lead shot before cooking it.

Math achievement is important, but task values are critical, too: examining the intellectual and motivational factors leading to gender disparities in STEM careers

Science.gov (United States)

Wang, Ming-Te; Degol, Jessica; Ye, Feifei

2015-01-01

Although young women now obtain higher course grades in math than boys and are just as likely to be enrolled in advanced math courses in high school, females continue to be underrepresented in some Science, Technology, Engineering, and Mathematics (STEM) occupations. This study drew on expectancy-value theory to assess (1) which intellectual and motivational factors in high school predict gender differences in career choices and (2) whether students’ motivational beliefs mediated the pathway of gender on STEM career via math achievement by using a national longitudinal sample in the United States. We found that math achievement in 12th grade mediated the association between gender and attainment of a STEM career by the early to mid-thirties. However, math achievement was not the only factor distinguishing gender differences in STEM occupations. Even though math achievement explained career differences between men and women, math task value partially explained the gender differences in STEM career attainment that were attributed to math achievement. The identification of potential factors of women’s underrepresentation in STEM will enhance our ability to design intervention programs that are optimally tailored to female needs to impact STEM achievement and occupational choices. PMID:25741292

Math Achievement is Important, but Task Values are Critical, Too: Examining the Intellectual and Motivational Factors Leading to Gender Disparities in STEM Careers

Directory of Open Access Journals (Sweden)

Mingte eWang

2015-02-01

Full Text Available Although young women now obtain higher course grades in math than boys and are just as likely to be enrolled in advanced math courses in high school, females continue to be underrepresented in some STEM occupations. This study drew on expectancy-value theory to assess (1 which intellectual and motivational factors in high school predict gender differences in career choices and (2 whether students’ motivational beliefs mediated the pathway of gender on STEM career via math achievement by using a national longitudinal sample in the United States. We found that math achievement in twelfth grade mediated the association between gender and attainment of a STEM career by the early to mid-thirties. However, math achievement was not the only factor distinguishing gender differences in STEM occupations. Even though math achievement explained career differences between men and women, math task value partially explained the gender differences in STEM career attainment that were attributed to math achievement. The identification of potential factors of women’s underrepresentation in STEM will enhance our ability to design intervention programs that are optimally tailored to female needs to impact STEM achievement and occupational choices.

Math achievement is important, but task values are critical, too: examining the intellectual and motivational factors leading to gender disparities in STEM careers.

Science.gov (United States)

Wang, Ming-Te; Degol, Jessica; Ye, Feifei

2015-01-01

Although young women now obtain higher course grades in math than boys and are just as likely to be enrolled in advanced math courses in high school, females continue to be underrepresented in some Science, Technology, Engineering, and Mathematics (STEM) occupations. This study drew on expectancy-value theory to assess (1) which intellectual and motivational factors in high school predict gender differences in career choices and (2) whether students' motivational beliefs mediated the pathway of gender on STEM career via math achievement by using a national longitudinal sample in the United States. We found that math achievement in 12th grade mediated the association between gender and attainment of a STEM career by the early to mid-thirties. However, math achievement was not the only factor distinguishing gender differences in STEM occupations. Even though math achievement explained career differences between men and women, math task value partially explained the gender differences in STEM career attainment that were attributed to math achievement. The identification of potential factors of women's underrepresentation in STEM will enhance our ability to design intervention programs that are optimally tailored to female needs to impact STEM achievement and occupational choices.

Climate impacts from import of waste fuels; Klimatpaaverkan fraan import av braennbart avfall

Energy Technology Data Exchange (ETDEWEB)

Haraldsson, Maarten; Sundberg, Johan (Profu, Moelndal (Sweden))

2009-04-15

Imports of combustible waste has increased in recent years and imported waste has become an increasingly important fuel in the Swedish district heating systems. The projections for the next few years show that the imports can be much higher, partly due to reduced amounts of waste in the wake of economic downturn the world economy, partly because several new incinerators will be put into operation. In a environmental perspective, imports are controversial and it has been proposed that imports should be restricted. This report provides an assessment of the climate impact of importing waste for combustion. The report shows that greenhouse gas emissions due to imports of waste to the Swedish district heating plants in 2007 was reduced by 500 000 tonnes of carbon dioxide. This is equivalent to the emissions from 300 000 Swedes car journeys a year, or 2.5% of the total emission reduction target set by the Government for the non-trading sector until 2020. Imports of wood waste-chips accounts for the largest reduction, but the study shows that imports of other types of waste contribute to a reduction in emissions of greenhouse gases. The reasons for the reduction is that the use of imported waste fuel substitute for other heating and electricity generation, which gives the consequence that emissions are avoided. The largest emission reductions are obtained, however, by the importation of household waste by replacing the alternative waste treatment of the corresponding waste in the country of origin. In the countries from which imports of waste currently takes place there is a lack of treatment capacity for organic waste. The alternative treatment available is primarily deposition. This treatment causes significant emissions of methane, which is a very strong greenhouse gas. The shipment of waste that occur as a result of imports gives a marginal contribution of greenhouse gases, compared against the emission reductions outlined above

Health at the dawn of development: the thought of Abraham Horwitz

Directory of Open Access Journals (Sweden)

Fernando A. Pires-Alves

2015-03-01

Full Text Available The article explores the ideas of Pan American Health Organization director Abraham Horwitz on the relations between health and development at the time the Alliance for Progress was established, in 1961. Taking development discourse as a public philosophy of international cooperation, the discussion centers on how Horwitz worked to mediate between health and development. Horwitz endeavored to establish arguments that highlighted the importance of social policy, especially in health; he also strove to reach different audiences and drew connections between elements like health, illness, and labor productivity, without ignoring the humanistic considerations so dear to the public health tradition

Health at the dawn of development: the thought of Abraham Horwitz.

Science.gov (United States)

Pires-Alves, Fernando A; Maio, Marcos Chor

2015-01-01

The article explores the ideas of Pan American Health Organization director Abraham Horwitz on the relations between health and development at the time the Alliance for Progress was established, in 1961. Taking development discourse as a public philosophy of international cooperation, the discussion centers on how Horwitz worked to mediate between health and development. Horwitz endeavored to establish arguments that highlighted the importance of social policy, especially in health; he also strove to reach different audiences and drew connections between elements like health, illness, and labor productivity, without ignoring the humanistic considerations so dear to the public health tradition.

Calculations of tritium breeding ratio and inventory distributions of FEB blanket

International Nuclear Information System (INIS)

Deng Baiquan

2001-01-01

Based on the design features of FEB reactor blanket, the tritium breeding ratio and tritium concentrations in liquid lithium of each breeding zone have been calculated after 10 days full power operation for outboard blanket and one day operation for inboard blanket. The comparisons with the results calculated by Monte-Carlo code MORSE-CGT are made. Meanwhile the inventory in beryllium multiplier after one-year full power operation has also been estimated. An important conclusion has been drew the thermal hydraulic design should be careful to guarantee the blanket temperature should not rise as high as 680 degree C

Die Wahrnehmung der Pädagogik Johann Friedrich Herbart in Polen

Directory of Open Access Journals (Sweden)

Jan Wnęk

2017-11-01

Full Text Available The article shows the development of Polish interests in the pedagogical mind of J. F. Herbart. In this work we chronologically presented the most important Polish publications on Herbart we drew attention to the change of its perception in different historical periods. There is no doubt that a large part of Polish authors esteem the educational Herbart and tried to popularize his ideas among Polish teachers. It is understood that the greatest interest in ‘herbartyzmem’ was in the nineteenth century but it declined sharply in the next century. This was associated with the development of new educational systems. The article is an important contribution to a better understanding of the reception of the German educational thought in other countries.

Implications of agricultural transitions and urbanization for ecosystem services.

Science.gov (United States)

Cumming, Graeme S; Buerkert, Andreas; Hoffmann, Ellen M; Schlecht, Eva; von Cramon-Taubadel, Stephan; Tscharntke, Teja

2014-11-06

Historically, farmers and hunter-gatherers relied directly on ecosystem services, which they both exploited and enjoyed. Urban populations still rely on ecosystems, but prioritize non-ecosystem services (socioeconomic). Population growth and densification increase the scale and change the nature of both ecosystem- and non-ecosystem-service supply and demand, weakening direct feedbacks between ecosystems and societies and potentially pushing social-ecological systems into traps that can lead to collapse. The interacting and mutually reinforcing processes of technological change, population growth and urbanization contribute to over-exploitation of ecosystems through complex feedbacks that have important implications for sustainable resource use.

PACIFIC WALRUS PROTECTION AND MANAGEMENT IN A CHANGING CLIMATE

Directory of Open Access Journals (Sweden)

E. Ristroph

2017-01-01

Full Text Available This article identifies and evaluates strategies and policies for walrus management in both Chukotka and Alaska. As the climate and walrus migration continue to change, it is important to follow adaptable strategies that are not fixed to specific geographic areas. Many of the recommendations may be easier to accomplish in the United States, which offers more opportunities for co-management and stakeholder involvement. The United States government can implement most recommendations without making substantive changes to law. This was significant to most participants – hunters as well as regulators – who supported voluntary approaches over those requiring legal changes.

カーソン・マッカラーズ論

OpenAIRE

石田, 敏行

1983-01-01

Loneliness is one of the most important themes in the literary works of Carson McCullers-such as The Heart is a Lonely Hunter, The Ballad of the Sad Cafe and 'A Tree, a Rock, a Cloud'. The characters of her works do not love because they are lonely. On the contrary they feel all the lonelier because they love. And it must be added that those who love are not loved by the beloved. The town which she describes are not large enough for the people to be very active. They love someone but do not l...

The environmental conditionings of the location of primeval settlements in the Wieprz River valley

Science.gov (United States)

Kozieł, Marcin; Kozieł, Wojciech

2012-01-01

The Wieprz River along the section currently occupied by the Nadwieprzański Landscape Park (NLP) constituted a convenient place of human settlement from the moment of retreat of the last ice sheet. Depending on the types of economy preferred by representatives of individual archaeological cultures, the river valley from Spiczyn to Dorohucza offered continuous access to water. This obviously gained additional importance from the moment of appearance of Neolithic cultures, particularly the Globular Amphora culture and Corded Ware culture with semi-nomadic style of life, dealing with breeding. Neolithic hunters-gatherers exploited the animal resources available in the river and its vicinity. The further role of fishing, i.e. providing a diet element or supplementation already in the conditions of agricultural-breeding economy, seems to be evidenced by findings of fishing hooks at Lusatian and Wielbark sites. Another factor affecting the location of settlements in NLP was also its close vicinity to the crops of the Rejowiec flint. According to archaeologists, this is particularly obvious in the case of the Late Palaeolithic and the turn of the Neolithic and Bronze Age. The communication function of the river could also be of importance: in the case of seasonal animal migrations of animals and hunters (Late Palaeolithic); livestock and shepherds (Globular Amphora culture and Corded Ware culture); or people alone (migration of the population of the Wielbark culture to the Red Sea). The fact that a commercial trail fragment was located along the Wieprz River is probably evidenced by the abundance of import from various parts of Europe at site 53 in Spiczyn. Fertile soils (black soils, silt-peat soils) prevailing in the valley also favoured the settlement of cultures with an agricultural-breeding model of economy, providing good conditions for horticulture. Meadows near the river could be used as pastures.

An Evaluation of the Species Status of Bactrocera Invadens and the Systematics of the Bactrocera Dorsalis (Diptera: Tephritidae) Complex

Energy Technology Data Exchange (ETDEWEB)

Jose, Michael San; Leblanc, Luc; Rubinoff, Daniel [Department of Plant and Environmental Protection Sciences, University of Hawaii at Manoa, Honolulu, HI 96822 (United States); Geib, Scott M. [U.S. Department of Agriculture Pacific Basin Agricultural Research Center, Hilo, HI 96720 (United States)

2014-01-15

Full text: The genus Bactrocera (Tephritidae) contains 500 species, including many severe pests of fruits and vegetables. Although native to tropical and subtropical areas of Africa, India, Southeast Asia, and Australasia, a number of the pest species, largely members of the Bactrocera dorsalis (Hendel) complex, have become wide- spread through accidental introduction associated with agricultural trade. The B. dorsalis complex includes several morphologically and ecologically similar pests, making species designations uncertain. One of these, Bactrocera invadens Drew, Tsuruta, and White, endemic to Sri Lanka, has spread across Africa in the last decade and become a major agricultural pest. We sequenced one mitochondrial and two nuclear genes from 73 specimens, belonging to 19 species to construct phylogenies and examine species relationships and limits within the genus Bactrocera and several species of the B. dorsalis complex specifically addressing the placement of B. invadens. Results indicate the B. dorsalis complex is polyphyletic. B. invadens and several other species within the B. dorsalis complex (B. dorsalis, Bactrocera papaya Drew and Hancock, and Bactrocera philippinensis (Drew and Hancock) are also paraphyletic with respect to each other and probably represent a single genetically indistinguishable, phenotypically plastic, pest species that has spread throughout the world. (author)

PROSPEK PENGEMBANGAN KEBUN BURU RUSA PERUM PERHUTANI BKPH JONGGOL JAWA BARAT BERDASARKAN TINJAUAN EKOLOGI

Directory of Open Access Journals (Sweden)

Yanto Santosa

2012-04-01

Full Text Available One form of sustainable wildlife utilization with ecological and economic values is game hunting. Due to game hunting’s promising prospects, Perum Perhutani planned to develop their deer captive breeding area (PRJ into a hunting garden. The objective of this research was to study the prospects of deer captive breeding area of Perum Perhutani BKPH Jonggol, West Java into a hunting garden based on ecological considerations. The research was conducted in 2006. Based on direct observation, interviews with the locals and local officers, and observation of land cover change due to increase in population, it was concluded that Block 9 was the most ideal site for hunting garden due to its varied slopes which was preferred by deers, ideal land coverages such as grassland, shrubs and plantation forest, lack of enclave, abundant grazing area and accessible by the hunters. Based on land topography and land coverage, the most suitable hunting method for Block 9 was stalking. According to the Directorate General of PHPA (1988, the only weapon allowed for game hunting is firearm. Based on calculations and literature reviews, the maximum number of hunters allowed in Block 9 is 108 hunters per year with a hunting season of two months, during July and October. Assuming 100% hunting success with maximum number of hunters allowed, the hunting quota would be 108 deer per year. Further studies are required to determine the number of initial population to be introduced to the hunting area and time to start hunting activities, as well as prospects of PRJ development as hunting garden based on socio-economic considerations

Fast iterative technique for the calculation of frequency dependent gain in excimer laser amplifiers

International Nuclear Information System (INIS)

Sze, R.C.

1991-01-01

The motivation in initiating these calculations is to allow us to observe the frequency evolution of a laser pulse as it propagates through an amplifier and then through a sequence of amplifiers. The question we seek to answer is what pulse shape do we need to produce out of a front-end oscillator so that after it propagates through the whole Aurora KrF fusion amplifier chain will result in high energy, broad-band laser fields of a given bandwidth that can be focussed onto a fusion target. The propagation of a single frequency source through an amplifier with distributed loss was considered by Rigrod and was significantly expanded by Hunter and Hunter. The latter included amplified spontaneous emission [ASE] considerations both in the direction of and transverse to the coherent field. Analytic solutions that include forward and backward prapagating fields and ASE were derived which were transcendental in nature but allowed for fairly easy computer calculations. Transverse ASE were calculated using the unsaturated gain resulting from longitudinal fields and were used to compare this with the longitudinal field equations. Large computer programs are now available at LANL which include the influence of transverse ASE on the longitudinal fields. However, none of these considerations have worried about the changes in the frequency characteristics of the propagating field or of how each of the frequency field components contributes to the saturation of the gain. The inclusion of full frequency characteristics to the analytic solutions of Hunter and Hunter proved impossible at least for this author and a new calculational technique was developed and is the subject of this talk

A spatial approach to combatting wildlife crime.

Science.gov (United States)

Faulkner, S C; Stevens, M C A; Romañach, S S; Lindsey, P A; Le Comber, S C

2018-06-01

Poaching can have devastating impacts on animal and plant numbers, and in many countries has reached crisis levels, with illegal hunters employing increasingly sophisticated techniques. We used data from an 8-year study in Savé Valley Conservancy, Zimbabwe, to show how geographic profiling-a mathematical technique originally developed in criminology and recently applied to animal foraging and epidemiology-can be adapted for use in investigations of wildlife crime. The data set contained information on over 10,000 incidents of illegal hunting and the deaths of 6,454 wild animals. We used a subset of data for which the illegal hunters' identities were known. Our model identified the illegal hunters' home villages based on the spatial locations of the hunting incidences (e.g., snares). Identification of the villages was improved by manipulating the probability surface inside the conservancy to reflect the fact that although the illegal hunters mostly live outside the conservancy, the majority of hunting occurs inside the conservancy (in criminology terms, commuter crime). These results combined with rigorous simulations showed for the first time how geographic profiling can be combined with GIS data and applied to situations with more complex spatial patterns, for example, where landscape heterogeneity means some parts of the study area are less likely to be used (e.g., aquatic areas for terrestrial animals) or where landscape permeability differs (e.g., forest bats tend not to fly over open areas). More broadly, these results show how geographic profiling can be used to target antipoaching interventions more effectively and more efficiently and to develop management strategies and conservation plans in a range of conservation scenarios. © 2017 Society for Conservation Biology.

Learning to hunt Crocodiles: social organization in the process of knowledge generation and the emergence of management practices among Mayan of Mexico.

Science.gov (United States)

Zamudio, Fernando; Bello-Baltazar, Eduardo; Estrada-Lugo, Erin I J

2013-05-24

New kinds of knowledge, usage patterns and management strategies of natural resources emerge in local communities as a way of coping with uncertainty in a changing world. Studying how human groups adapt and create new livelihoods strategies are important research topics for creating policies in natural resources management. Here, we study the adoption and development of lagartos (Crocodylus moreletii) commercial hunting by Mayan people from a communal land in Quintana Roo state. Two questions guided our work: how did the Mayan learn to hunt lagartos? And how, and in what context, did knowledge and management practices emerge? We believe that social structures, knowledge and preexisting skills facilitate the hunting learning process, but lagarto ecological knowledge and organizational practice were developed in a "learning by doing" process. We conducted free, semi-structured and in-depth interviews over 17 prestigious lagartos hunters who reconstructed the activity through oral history. Then, we analyzed the sources of information and routes of learning and investigated the role of previous knowledge and social organization in the development of this novel activity. Finally, we discussed the emergence of hunting in relation to the characteristic of natural resource and the tenure system. Lagarto hunting for skin selling was a short-term activity, which represented an alternative source of money for some Mayans known as lagarteros. They acquired different types of knowledge and skills through various sources of experience (individual practice, or from foreign hunters and other Mayan hunters). The developed management system involved a set of local knowledge about lagartos ecology and a social organization structure that was then articulated in the formation of "working groups" with particular hunting locations (rumbos and trabajaderos), rotation strategies and collaboration among them. Access rules and regulations identified were in an incipient state of development

Import-Export Business Plan

OpenAIRE

Asad, Muhammad

2014-01-01

Import export businesses, also known as international trading, are one of the hottest commercial trends of this decade. Since the owner of an import export enterprise, can work as a distributor by focusing on exporting and importing goods and services that cannot be obtained on national soil. With a rapidly growing population of about 150 million, Pakistan is a major country, recognized by the international community, and is one of the most important actors in the Islamic world. Based on its ...

Portrait of a Hunter and His Dog.

Science.gov (United States)

Tolbert, Peggy Manulikow

1985-01-01

Instructional strategies based on a portrait painting of Jean-Baptiste Oudry familiarize intermediate grade students with the techniques of portraiture and introduce the characteristics of eighteenth-century French rococo painting. (RM)

Clinical Presentation of Mucopolysaccharidosis Type II (Hunter's ...

African Journals Online (AJOL)

This report is of a 7-year-old boy who presented to the children outpatient through a referral with a history of inability to grasp objects, inability to express self, and coarse skin, which started 5 years ago. On examination, he was short statured, with a big head, protruding abdomen, coarse skin, swollen wrist joints, and ...

CERN's eagle-eyed movement hunters in action

CERN Multimedia

2007-01-01

Vibrations, movements, strains - nothing escapes the eagle eyes of CERN's Mechanical Measurements Laboratory, which helps groups needing mechanical testing and delicate transport operations. Graphical representation of the natural mode shape of one of the end-caps of the ATLAS inner detector, determined through experimentation.After installation of sensors on one of the end-caps of the ATLAS inner detector, CERN's Mechanical Measurements team performs remote checks to ensure the sensors are working properly before transport. They are on the look-out for anything that moves, shakes or changes shape. The slightest movement, however minute, will attract their attention. The Mechanical Measurements team, which is part of the Installation Coordination Group (TS-IC), specialises in all kinds of vibration studies, for design projects as well as for the transport of fragile objects. The Mechanical Measurements Laboratory was created in 1973 and, after a lull at the end of the century, was given a new lease of life ...

Hunter-gatherer plant use in southwest Asia

DEFF Research Database (Denmark)

Otaegui, Amaia Arranz; Ibañez, Juan José; Zapata, Lydia

2016-01-01

to have been the staple plant foods but other plants were also present: wild pulses, acorns, almonds, pistachios, wild olives, fruits, and berries. Grinding and pounding stone tools were in use at this time for processing plant resources. During the Late Epipaleolithic (Natufian) period plant use...

Clinical Presentation of Mucopolysaccharidosis Type II (Hunter's ...

African Journals Online (AJOL)

hanumantp

MPS is a group of metabolic disorders caused by absence or malfunctioning of the lysosomal enzymes needed to break down molecules called glycosaminoglycans (GAGs).[1]. Children with MPs either do not produce enough of one of the two enzymes required to break down the sugar chains into proteins and simpler ...

Microbiological and Physicochemical Quality Characterization of Commercial Red Pepper Powders

International Nuclear Information System (INIS)

Jeong, M.S.; Ahn, J.J.; Kashig, A.; Kim, G.R.; Kwon, J.H.; Im, J.G.

2013-01-01

Ten commercially available red pepper powders were investigated for their hygienic quality (total aerobic count, yeasts and molds, and coliforms) and physicochemical properties (moisture content, pH, Hunters color values, American Spice Trade Association (ASTA) color and particle size). Microbial analysis resulted in 10 3 -10 6 CFU/g of total aerobic count and same of yeasts and molds, where 2 samples were positive (103 CFU/g) for coliforms. The moisture contents (7.25% to 12.73%) were with in the range as described in the Korean Food Standards Codex. Noteworthy variations were observed in pH (4.97 to 5.15), Hunters E values (47.19 to 58.04) and ASTA color values (89.31 to 98.61). Although the color differences were evident among the samples, but the Hunter values were not in good correlations with ASTA color values. The average particle sizes of the all samples were comparable ranging from 605 μm to 1251 μm with few exceptions. There was a great variation in the key quality attributes of commercially available red pepper powders that should be considered for their various uses in food products. (author)

Evaluating two irrigation controllers under subsurface drip irrigated tomato crop

International Nuclear Information System (INIS)

Al-Ghobari, H.M.; Mohammad, F.S.; El Marazky, M.S.A.

2016-01-01

Smart systems could be used to improve irrigation scheduling and save water under Saudi Arabia’s present water crisis scenario. This study investigated two types of evapotranspiration-based smart irrigation controllers, SmartLine and Hunter Pro-C2, as promising tools for scheduling irrigation and quantifying plants’ water requirements to achieve water savings. The effectiveness of these technologies in reducing the amount of irrigation water was compared with the conventional irrigation scheduling method as a control treatment. The two smart irrigation sensors were used for subsurface irrigation of a tomato crop (cv. Nema) in an arid region. The results showed that the smart controllers significantly reduced the amount of applied water and increased the crop yield. In general, the Hunter Pro-C2 system saved the highest amount of water and produced the highest crop yield, resulting in the highest water irrigation efficiency compared with the SmartLine controller and the traditional irrigation schedule. It can be concluded that the application of advanced scheduling irrigation techniques such as the Hunter controller under arid conditions can realise economic benefits by saving large amounts of irrigation water.

Genomic insights into the origin of farming in the ancient Near East

Science.gov (United States)

Lazaridis, Iosif; Nadel, Dani; Rollefson, Gary; Merrett, Deborah C.; Rohland, Nadin; Mallick, Swapan; Fernandes, Daniel; Novak, Mario; Gamarra, Beatriz; Sirak, Kendra; Connell, Sarah; Stewardson, Kristin; Harney, Eadaoin; Fu, Qiaomei; Gonzalez-Fortes, Gloria; Jones, Eppie R.; Roodenberg, Songül Alpaslan; Lengyel, György; Bocquentin, Fanny; Gasparian, Boris; Monge, Janet M.; Gregg, Michael; Eshed, Vered; Mizrahi, Ahuva-Sivan; Meiklejohn, Christopher; Gerritsen, Fokke; Bejenaru, Luminita; Blüher, Matthias; Campbell, Archie; Cavalleri, Gianpiero; Comas, David; Froguel, Philippe; Gilbert, Edmund; Kerr, Shona M.; Kovacs, Peter; Krause, Johannes; McGettigan, Darren; Merrigan, Michael; Merriwether, D. Andrew; O'Reilly, Seamus; Richards, Martin B.; Semino, Ornella; Shamoon-Pour, Michel; Stefanescu, Gheorghe; Stumvoll, Michael; Tönjes, Anke; Torroni, Antonio; Wilson, James F.; Yengo, Loic; Hovhannisyan, Nelli A.; Patterson, Nick; Pinhasi, Ron; Reich, David

2016-01-01

We report genome-wide ancient DNA from 44 ancient Near Easterners ranging in time between ~12,000-1,400 BCE, from Natufian hunter-gatherers to Bronze Age farmers. We show that the earliest populations of the Near East derived around half their ancestry from a ‘Basal Eurasian’ lineage that had little if any Neanderthal admixture and that separated from other non-African lineages prior to their separation from each other. The first farmers of the southern Levant (Israel and Jordan) and Zagros Mountains (Iran) were strongly genetically differentiated, and each descended from local hunter-gatherers. By the time of the Bronze Age, these two populations and Anatolian-related farmers had mixed with each other and with the hunter-gatherers of Europe to drastically reduce genetic differentiation. The impact of the Near Eastern farmers extended beyond the Near East: farmers related to those of Anatolia spread westward into Europe; farmers related to those of the Levant spread southward into East Africa; farmers related to those from Iran spread northward into the Eurasian steppe; and people related to both the early farmers of Iran and to the pastoralists of the Eurasian steppe spread eastward into South Asia. PMID:27459054

Diagnosis of wildlife use, in the flora and fauna protection Area “Usumacinta Canyon, Tenosique, Tabasco.

Directory of Open Access Journals (Sweden)

Victoria Aquino-Bravata

2013-01-01

Full Text Available Describes the use of the wildlife in 7 localities in the path of Redención del Campesino-San Francisco within the Area of Protection of Flora and Fauna "Cañón del Rio Usumacinta", located in Tenosique Tabasco. The work provides information on the traditions of use of wildlife by the local settlers and the way of understanding the activity itself in the region. Describes the cultural value of the wildlife, identifying and quantifying the recognized species andused; the modalities and pressure on the use of some species; arts of capture, characterizing the profile of the hunters. There were a total of 26 species of fauna (12 mammals, 12 birds and 2 reptile; the mammals were the most recognized and used by the inhabitants, in second order birds. The use of animals in these communities is closelylinked with the knowledge and tradition. Were detected as most frequent uses: food, pets and as seconds flat, the uses of craftsmanship and medicinal. To obtain the hunters use dogs, firearms and other instruments, such as machetes, traps and slingshots. The main motivation of the hunters is the subsistence, exclusively male activity, group and individual occasionally.

Evaluating two irrigation controllers under subsurface drip irrigated tomato crop

Energy Technology Data Exchange (ETDEWEB)

Al-Ghobari, H.M.; Mohammad, F.S.; El Marazky, M.S.A.

2016-07-01

Smart systems could be used to improve irrigation scheduling and save water under Saudi Arabia’s present water crisis scenario. This study investigated two types of evapotranspiration-based smart irrigation controllers, SmartLine and Hunter Pro-C2, as promising tools for scheduling irrigation and quantifying plants’ water requirements to achieve water savings. The effectiveness of these technologies in reducing the amount of irrigation water was compared with the conventional irrigation scheduling method as a control treatment. The two smart irrigation sensors were used for subsurface irrigation of a tomato crop (cv. Nema) in an arid region. The results showed that the smart controllers significantly reduced the amount of applied water and increased the crop yield. In general, the Hunter Pro-C2 system saved the highest amount of water and produced the highest crop yield, resulting in the highest water irrigation efficiency compared with the SmartLine controller and the traditional irrigation schedule. It can be concluded that the application of advanced scheduling irrigation techniques such as the Hunter controller under arid conditions can realise economic benefits by saving large amounts of irrigation water.

Corrigendum

CERN Multimedia

2004-01-01

In the 27th issue of the Weekly Bulletin (28th June 2004) we have reported, under the heading "Lord Shiva Statue Unveiled", that "Carl Sagan drew the metaphor between the cosmic dance of the Nataraj and the modern study of the ‘cosmic dance' of subatomic particles." In fact, as was kindly pointed out to us by his editors, it was Fritjof Capra,  who in his well-known book "The Tao of Physics" (1975), drew this metaphor, and not Carl Sagan. We have apologized for this unintentional misappropriation and we have also modified the relevant part of the text as shown on the explanatory plaque adjacent to the statue.

An Investigation of Primary School Students' Perceptions of Violence Revealed Through Their Drawings

Directory of Open Access Journals (Sweden)

Ahmet Saban

2012-07-01

Full Text Available In this study, primary school students' perceptions of violence were investigated by means of pictures drawn by them. The participants included 80 students between the ages of 9 and 11 who attended three primary schools (3rd, 4th, and 5th grades in the city of Konya during the 2011-2012 academic year. According to the findings of the study, the students mostly drew pictures of general violence which occurred in a family environment in the form of physical violence. In addition, students drew “father” as a figure practicing violence most, and “male child” and “mother” as figures exposed to violence most.

77 FR 70714 - Electronic Import Inspection Application and Certification of Imported Products and Foreign...

Science.gov (United States)

2012-11-27

... Import Inspection Application and Certification of Imported Products and Foreign Establishments..., the egg products import regulations provide for foreign country (not establishment) certification to... imported egg products at this time. The Agency will propose foreign establishment certification in a...

The regulation of hunting

DEFF Research Database (Denmark)

Abildtrup, Jens; Jensen, Frank

Within hunting, wildlife populations are estimated to be too high in many countries which is assumed to be due to the market failure, that each hunter harvests too little compared to what the regulator wants. This may be due to the existing regulation which, among other things, requires knowledge...... by an individual, variable tax rate. The variable tax rate is, among other things, based on the difference in marginal value of the population between the hunter and the regulator. The paper shows that the population tax/subsidy secures a first-best optimum. Thus, the population tax is a good alternative...... to the existing regulation....

The scaup conservation action plan: working toward coherence

Science.gov (United States)

Austin, Jane E.

2010-01-01

The last in a series of three workshops to develop a decision framework for the scaup conservation action plan was conducted in September 2009. Fifteen waterfowl biologists and managers met in Memphis, Tennessee at the Ducks Unlimited Headquarters to review and refine the decision statement, objectives, and prototype model for the continental scaup population, with a special focus on vital rate parameters that are affected during migration and winter. In a significant step toward coherence, the participants also developed models for incorporating human dimensions – hunters – into the decision framework, and to link the population of diving duck hunters with the continental scaup population.

Analysis of soybean production and import trends and its import factors in Indonesia

Science.gov (United States)

Ningrum, I. H.; Irianto, H.; Riptanti, E. W.

2018-03-01

This study aims to analyze the factors affecting soybean imports in Indonesia and to know the trend and projection of Indonesian soybean production as well as the import in 2016-2020. The basic method used in this research is the description analysis method. The data used are secondary data in the form of time series data from 1979-2015. Methods of data analysis using simultaneous equations model with 2SLS (Two Stage Least Square) method and Trend analysis. The results showed that the factors affecting soybean imports in Indonesia are consumption and production. Consumption has positive effect while production is negatively affected. The percentage changed in soybean imports is greater than the percentage change in consumption and production of soybeans. Consumption is positively influenced by imports and production, while production is influenced positively by consumption and negative by imports. The production trend of soybean in 2016-2020 has a tendency to increase with a percentage of 11.18% per year. Production in 2016 is projected at 1.110.537 tons while in 2020 it will increase to 1,721,350 tons. The import trend in 2016-2020 has a tendency to increase with an average percentage of 4.13% per year. Import in 2016 is projected at 2.224.188 tons while in 2020 it will increase to 2.611.270 tons.

Linking hunter knowledge with forest change to understand changing deer harvest opportunities in intensively logged landscapes

Science.gov (United States)

Tidd J. Brinkman; Terry Chapin; Gary Kofinas; David K. Person

2009-01-01

The effects of landscape changes caused by intensive logging on the availability of wild game are important when the harvest of wild game is a critical cultural practice, food source, and recreational activity. We assessed the influence of extensive industrial logging on the availability of wild game by drawing on local knowledge and ecological science to evaluate the...

Enhancing importance-performance analysis

DEFF Research Database (Denmark)

Eskildsen, Jacob Kjær; Kristensen, Kai

2006-01-01

Purpose: The interpretation of the importance/performance map is based on an assumption of independence between importance and performance but many studies question the validity of this assumption. The aim of this research is to develop a new typology for job satisfaction attributes as well...... as a new importance/performance map that can be an aid for organizations when they prioritize their improvement actions based on a job satisfaction study. Design/methodology/approach: A typology for possible relationships between importance and performance in job satisfaction studies is developed based...... on theoretical considerations. This typology is then applied and validated on approximately 10,000 responses from the European Employee Index 2002. Ultimately a new importance/performance map for priority setting in job satisfaction studies is developed based on the new typology for possible relationships...

Importance classification

International Nuclear Information System (INIS)

Mizumachi, Wataru; Kobayashi, Masahide

2008-01-01

Conventionally, the design of a nuclear reactor has been performed from a viewpoint of a safety function and the importance on earthquake-proof on the basis of not giving off the mainly included radioactivity outside. In this Niigataken-Chuetsuoki earthquake, there is almost no damage to the system, components and structure on safe also in the earthquake beyond assumption, and the validity of the design was checked. But, the situation peculiar to a big earthquake was also generated. The emergency plan room which should serve as a connection center with the exterior was not able to open a door and use at the beginning. Fire-extinguishing system piping fractured and self-defense fire fighting was not made. And so on. Discussion from the following three viewpoints was performed. 1st: The importance from a viewpoint which should maintain a function also with the disaster in case of an earthquake like an emergency plan room etc. 2nd: In the earthquake, since the safe system and un-safe system was influenced, the importance from a viewpoint which may have influence safely inquired when the un-safe system broke down. 3rd: Although it was not directly related safely, discussion from a viewpoint which influences fear of insecurity, such as taking out smoke, for example, was performed (author)

THE IMPACT OF REFORMING WHEAT IMPORTING STATE-TRADING ENTERPRISES ON THE QUALITY OF WHEAT IMPORTED

OpenAIRE

Lavoie, Nathalie

2003-01-01

Recent surveys of wheat importers indicate that countries that import wheat via a state trader are less sensitive to quality issues in import decision making than countries that import wheat through private traders. This study examines conceptually and empirically the impact of the deregulation of wheat imports on the quality and source of wheat imports.

Bion and the sublime: the origins of an aesthetic paradigm.

Science.gov (United States)

Civitarese, Giuseppe

2014-12-01

In constructing his theory Bion drew on a number of symbolic matrices: psychoanalysis, philosophy, mathematics, literature, aesthetics. The least investigated of these is the last. True, we know that Bion cites many authors of the Romantic period, such as Coleridge, Keats, Blake and Wordsworth, as well as others who were held in high esteem in the Romantic period, such as Milton. However, less is known about the influence exerted on him by the aesthetics of the sublime, which while chronologically preceding Romanticism is in fact one of its components. My working hypothesis is that tracing a number of Bion's concepts back to this secret model can serve several purposes: firstly, it contributes to the study of the sources, and, secondly, it makes these concepts appear much less occasional and idiosyncratic than we might believe, being as they are mostly those less immediately understandable but not less important (O, negative capability, nameless dread, the infinite, the language of achievement, unison etc.). Finally, connecting these notions to a matrix, that is, disclosing the meaning of elements that are not simply juxtaposed but dynamically interrelated, in my view significantly increases not only their theoretical intelligibility but also their usefulness in clinical practice. In conclusion, one could legitimately argue that Bion gradually subsumed all the other paradigms he drew on within the aesthetic paradigm. Copyright © 2014 Institute of Psychoanalysis.