Xie, Hong-rong; Hu, Lin-sen; Li, Guo-yi
2010-04-20
To evaluate the human neuroblastoma SH-SY5Y cell line as an in vitro model of dopaminergic (DAergic) neurons for Parkinson's disease (PD) research and to determine the effect of differentiation on this cell model. The data of this review were selected from the original reports and reviews related to SH-SY5Y cells published in Chinese and foreign journals (Pubmed 1973 to 2009). After searching the literature, 60 articles were selected to address this review. The SH-SY5Y cell line has become a popular cell model for PD research because this cell line posses many characteristics of DAergic neurons. For example, these cells express tyrosine hydroxylase and dopamine-beta-hydroxylase, as well as the dopamine transporter. Moreover, this cell line can be differentiated into a functionally mature neuronal phenotype in the presence of various agents. Upon differentiation, SH-SY5Y cells stop proliferating and a constant cell number is subsequently maintained. However, different differentiating agents induce different neuronal phenotypes and biochemical changes. For example, retinoic acid induces differentiation toward a cholinergic neuronal phenotype and increases the susceptibility of SH-SY5Y cells to neurotoxins and neuroprotective agents, whereas treatment with retinoic acid followed by phorbol ester 12-O-tetradecanoylphorbol-13-acetate results in a DAergic neuronal phenotype and decreases the susceptibility of cells to neurotoxins and neuroprotective agents. Some differentiating agents also alter kinetics of 1-methyl-4-phenyl-pyridinium (MPP(+)) uptake, making SH-SY5Y cells more similar to primary mesencephalic neurons. Differentiated and undifferentiated SH-SY5Y cells have been widely used as a cell model of DAergic neurons for PD research. Some differentiating agents afford SH-SY5Y cells with more potential for studying neurotoxicity and neuroprotection and are thus more relevant to experimental PD research.
Paracrine Maturation and Migration of SH-SY5Y Cells by Dental Pulp Stem Cells.
Gervois, P; Wolfs, E; Dillen, Y; Hilkens, P; Ratajczak, J; Driesen, R B; Vangansewinkel, T; Bronckaers, A; Brône, B; Struys, T; Lambrichts, I
2017-06-01
Neurological disorders are characterized by neurodegeneration and/or loss of neuronal function, which cannot be adequately repaired by the host. Therefore, there is need for novel treatment options such as cell-based therapies that aim to salvage or reconstitute the lost tissue or that stimulate host repair. The present study aimed to evaluate the paracrine effects of human dental pulp stem cells (hDPSCs) on the migration and neural maturation of human SH-SY5Y neuroblastoma cells. The hDPSC secretome had a significant chemoattractive effect on SH-SY5Y cells as shown by a transwell assay. To evaluate neural maturation, SH-SY5Y cells were first induced toward neuronal cells, after which they were exposed to the hDPSC secretome. In addition, SH-SY5Y cells subjected to the hDPSC secretome showed increased neuritogenesis compared with nonexposed cells. Maturated cells were shown to increase immune reactivity for neuronal markers compared with controls. Ultrastructurally, retinoic acid (RA) signaling and subsequent exposure to the hDPSC secretome induced a gradual rise in metabolic activity and neuronal features such as multivesicular bodies and cytoskeletal elements associated with cellular communication. In addition, electrophysiological recordings of differentiating cells demonstrated a transition toward a neuronal electrophysiological profile based on the maximum tetrodotoxin (TTX)-sensitive, Na + current. Moreover, conditioned medium (CM)-hDPSC-maturated SH-SY5Y cells developed distinct features including, Cd 2+ -sensitive currents, which suggests that CM-hDPSC-maturated SH-SY5Y acquired voltage-gated Ca 2+ channels. The results reported in this study demonstrate the potential of hDPSCs to support differentiation and recruitment of cells with neuronal precursor characteristics in a paracrine manner. Moreover, this in vitro experimental design showed that the widely used SH-SY5Y cell line can improve and simplify the preclinical in vitro research on the molecular
Directory of Open Access Journals (Sweden)
Shahid Iqbal
2012-08-01
Full Text Available The neuroprotective and antioxidative effects of germinated brown rice (GBR, brown rice (BR and commercially available γ-aminobutyric acid (GABA against cell death induced by hydrogen peroxide (H2O2 in human neuroblastoma SH-SY5Y cells have been investigated. Results show that GBR suppressed H2O2-mediated cytotoxicity and induced G0/G1 phase cell cycle arrest in SH-SY5Y cells. Moreover, GBR reduced mitochondrial membrane potential (MMP and prevented phosphatidylserine (PS translocation in SH-SY5Y cells, key features of apoptosis, and subsequent cell death. GBR exhibited better neuroprotective and antioxidative activities as compared to BR and GABA. These results indicate that GBR possesses high antioxidative activities and suppressed cell death in SH-SY5Y cells by blocking the cell cycle re-entry and apoptotic mechanisms. Therefore, GBR could be developed as a value added functional food to prevent neurodegenerative diseases caused by oxidative stress and apoptosis.
Hydrogen Peroxide Toxicity Induces Ras Signaling in Human Neuroblastoma SH-SY5Y Cultured Cells
Directory of Open Access Journals (Sweden)
Jirapa Chetsawang
2010-01-01
Full Text Available It has been reported that overproduction of reactive oxygen species occurs after brain injury and mediates neuronal cells degeneration. In the present study, we examined the role of Ras signaling on hydrogen peroxide-induced neuronal cells degeneration in dopaminergic neuroblastoma SH-SY5Y cells. Hydrogen peroxide significantly reduced cell viability in SH-SY5Y cultured cells. An inhibitor of the enzyme that catalyzes the farnesylation of Ras proteins, FTI-277, and a competitive inhibitor of GTP-binding proteins, GDP-beta-S significantly decreased hydrogen peroxide-induced reduction in cell viability in SH-SY5Y cultured cells. The results of this study might indicate that a Ras-dependent signaling pathway plays a role in hydrogen peroxide-induced toxicity in neuronal cells.
Zhang, Nan; Wen, Qingping; Ren, Lu; Liang, Wenbo; Xia, Yang; Zhang, Xiaodan; Zhao, Dan; Sun, Dong; Hu, Yv; Hao, Haiguang; Yan, Yaping; Zhang, Guangxian; Yang, Jingxian; Kang, Tingguo
2013-01-01
Arctigenin (Arc) has been shown to act on scopolamine-induced memory deficit mice and to provide a neuroprotective effect on cultured cortical neurons from glutamate-induced neurodegeneration through mechanisms not completely defined. Here, we investigated the neuroprotective effect of Arc on H89-induced cell damage and its potential mechanisms in mouse cortical neurons and human SH-SY5Y neuroblastoma cells. We found that Arc prevented cell viability loss induced by H89 in human SH-SY5Y cells. Moreover, Arc reduced intracellular beta amyloid (Aβ) production induced by H89 in neurons and human SH-SY5Y cells, and Arc also inhibited the presenilin 1(PS1) protein level in neurons. In addition, neural apoptosis in both types of cells, inhibition of neurite outgrowth in human SH-SY5Y cells and reduction of synaptic marker synaptophysin (SYN) expression in neurons were also observed after H89 exposure. All these effects induced by H89 were markedly reversed by Arc treatment. Arc also significantly attenuated downregulation of the phosphorylation of CREB (p-CREB) induced by H89, which may contribute to the neuroprotective effects of Arc. These results demonstrated that Arc exerted the ability to protect neurons and SH-SY5Y cells against H89-induced cell injury via upregulation of p-CREB. PMID:24025424
Directory of Open Access Journals (Sweden)
Tingguo Kang
2013-09-01
Full Text Available Arctigenin (Arc has been shown to act on scopolamine-induced memory deficit mice and to provide a neuroprotective effect on cultured cortical neurons from glutamate-induced neurodegeneration through mechanisms not completely defined. Here, we investigated the neuroprotective effect of Arc on H89-induced cell damage and its potential mechanisms in mouse cortical neurons and human SH-SY5Y neuroblastoma cells. We found that Arc prevented cell viability loss induced by H89 in human SH-SY5Y cells. Moreover, Arc reduced intracellular beta amyloid (Aβ production induced by H89 in neurons and human SH-SY5Y cells, and Arc also inhibited the presenilin 1(PS1 protein level in neurons. In addition, neural apoptosis in both types of cells, inhibition of neurite outgrowth in human SH-SY5Y cells and reduction of synaptic marker synaptophysin (SYN expression in neurons were also observed after H89 exposure. All these effects induced by H89 were markedly reversed by Arc treatment. Arc also significantly attenuated downregulation of the phosphorylation of CREB (p-CREB induced by H89, which may contribute to the neuroprotective effects of Arc. These results demonstrated that Arc exerted the ability to protect neurons and SH-SY5Y cells against H89-induced cell injury via upregulation of p-CREB.
Directory of Open Access Journals (Sweden)
Sandeep Vasant More
2017-05-01
Full Text Available Oxidative stress and apoptosis are the major mechanisms that induce dopaminergic cell death. Our study investigates the protective effects of atractylenolide-I (ATR-I on 1-methyl-4-phenylpyridinium (MPP+-induced cytotoxicity in human dopaminergic SH-SY5Y cells, as well as its underlying mechanism. Our experimental data indicates that ATR-I significantly inhibits the loss of cell viability induced by MPP+ in SH-SY5Y cells. To further unravel the mechanism, we examined the effect of ATR-I on MPP+-induced apoptotic cell death characterized by an increase in the Bax/Bcl-2 mRNA ratio, the release of cytochrome-c, and the activation of caspase-3 leading to elevated levels of cleaved poly(ADP-ribose polymerase (PARP resulting in SH-SY5Y cell death. Our results demonstrated that ATR-I decreases the level of pro-apoptotic proteins induced by MPP+ and also restored Bax/Bcl-2 mRNA levels, which are critical for inducing apoptosis. In addition, ATR-I demonstrated a significant increase in the protein expression of heme-oxygenase in MPP+-treated SH-SY5Y cells. These results suggest that the pharmacological effect of ATR-I may be, at least in part, caused by the reduction in pro-apoptotic signals and also by induction of anti-oxidant protein.
Salicin from Willow Bark can Modulate Neurite Outgrowth in Human Neuroblastoma SH-SY5Y Cells.
Wölfle, Ute; Haarhaus, Birgit; Kersten, Astrid; Fiebich, Bernd; Hug, Martin J; Schempp, Christoph M
2015-10-01
Salicin from willow bark has been used throughout centuries in China and Europe for the treatment of pain, headache, and inflammatory conditions. Recently, it could be demonstrated that salicin binds and activates the bitter taste receptor TAS2R16. Studies on rodent tissues showed the general expression of bitter taste receptors (TAS2Rs) in rodent brain. Here, we demonstrate the expression of hTAS2R16 in human neuronal tissues and the neuroblastoma cell line SH-SY5Y. The functionality was analyzed in the neuroblastoma cell line SH-SY5Y after stimulation with salicin, a known TAS2R16 agonist. In this setting salicin induced in SH-SY5Y cells phosphorylation of ERK and CREB, the key transcription factor of neuronal differentiation. PD98059, an inhibitor of the ERK pathway, as well as probenecid, a TAS2R16 antagonist, inhibited receptor phosphorylation as well as neurite outgrowth. These data show that salicin might modulate neurite outgrowth by bitter taste receptor activation. Copyright © 2015 John Wiley & Sons, Ltd.
Neurotoxicity of "ecstasy" and its metabolites in human dopaminergic differentiated SH-SY5Y cells.
Ferreira, Patrícia Silva; Nogueira, Tiago Bernandes; Costa, Vera Marisa; Branco, Paula Sério; Ferreira, Luísa Maria; Fernandes, Eduarda; Bastos, Maria Lourdes; Meisel, Andreas; Carvalho, Félix; Capela, João Paulo
2013-02-04
"Ecstasy" (3,4-methylenedioxymethamphetamine or MDMA) is a widely abused recreational drug, reported to produce neurotoxic effects, both in laboratory animals and in humans. MDMA metabolites can be major contributors for MDMA neurotoxicity. This work studied the neurotoxicity of MDMA and its catechol metabolites, α-methyldopamine (α-MeDA) and N-methyl-α-methyldopamine (N-Me-α-MeDA) in human dopaminergic SH-SY5Y cells differentiated with retinoic acid and 12-O-tetradecanoyl-phorbol-13-acetate. Differentiation led to SH-SY5Y neurons with higher ability to accumulate dopamine and higher resistance towards dopamine neurotoxicity. MDMA catechol metabolites were neurotoxic to SH-SY5Y neurons, leading to caspase 3-independent cell death in a concentration- and time-dependent manner. MDMA did not show a concentration- and time-dependent death. Pre-treatment with the antioxidant and glutathione precursor, N-acetylcysteine (NAC), resulted in strong protection against the MDMA metabolites' neurotoxicity. Neither the superoxide radical scavenger, tiron, nor the inhibitor of the dopamine (DA) transporter, GBR 12909, prevented the metabolites' toxicity. Cells exposed to α-MeDA showed an increase in intracellular glutathione (GSH) levels, which, at the 48 h time-point, was not dependent in the activity increase of γ-glutamylcysteine synthetase (γ-GCS), revealing a possible transient effect. Importantly, pre-treatment with buthionine sulfoximine (BSO), an inhibitor of γ-GCS, prevented α-MeDA induced increase in GSH levels, but did not augment this metabolite cytotoxicity. Even so, BSO pre-treatment abolished NAC protective effects against α-MeDA neurotoxicity, which were, at least partially, due to GSH de novo synthesis. Inversely, pre-treatment of cells with BSO augmented N-Me-α-MeDA-induced neurotoxicity, but only slightly affected NAC neuroprotection. In conclusion, MDMA catechol metabolites promote differential toxic effects to differentiated dopaminergic human SH-SY
Differentiation of the SH-SY5Y Human Neuroblastoma Cell Line.
Shipley, Mackenzie M; Mangold, Colleen A; Szpara, Moriah L
2016-02-17
Having appropriate in vivo and in vitro systems that provide translational models for human disease is an integral aspect of research in neurobiology and the neurosciences. Traditional in vitro experimental models used in neurobiology include primary neuronal cultures from rats and mice, neuroblastoma cell lines including rat B35 and mouse Neuro-2A cells, rat PC12 cells, and short-term slice cultures. While many researchers rely on these models, they lack a human component and observed experimental effects could be exclusive to the respective species and may not occur identically in humans. Additionally, although these cells are neurons, they may have unstable karyotypes, making their use problematic for studies of gene expression and reproducible studies of cell signaling. It is therefore important to develop more consistent models of human neurological disease. The following procedure describes an easy-to-follow, reproducible method to obtain homogenous and viable human neuronal cultures, by differentiating the chromosomally stable human neuroblastoma cell line, SH-SY5Y. This method integrates several previously described methods(1-4) and is based on sequential removal of serum from media. The timeline includes gradual serum-starvation, with introduction of extracellular matrix proteins and neurotrophic factors. This allows neurons to differentiate, while epithelial cells are selected against, resulting in a homogeneous neuronal culture. Representative results demonstrate the successful differentiation of SH-SY5Y neuroblastoma cells from an initial epithelial-like cell phenotype into a more expansive and branched neuronal phenotype. This protocol offers a reliable way to generate homogeneous populations of neuronal cultures that can be used for subsequent biochemical and molecular analyses, which provides researchers with a more accurate translational model of human infection and disease.
Teppola, Heidi; Sarkanen, Jertta-Riina; Jalonen, Tuula O.; Linne, Marja-Leena
2015-01-01
Human SH-SY5Y neuroblastoma cells maintain their potential for differentiation and regression in culture conditions. The induction of differentiation could serve as a strategy to inhibit cell proliferation and tumor growth. Previous studies have shown that differentiation of SH-SY5Y cells can be induced by all-trans-retinoic-acid (RA) and cholesterol (CHOL). However, signaling pathways that lead to terminal differentiation of SH-SY5Y cells are still largely unknown. The goal of this study was...
Teppola, Heidi; Sarkanen, Jertta-Riina; Jalonen, Tuula; Linne, Marja-Leena
2016-01-01
Human SH-SY5Y neuroblastoma cells maintain their potential for differentiation and regression in culture conditions. The induction of differentiation could serve as a strategy to inhibit cell proliferation and tumor growth. Previous studies have shown that differentiation of SH-SY5Y cells can be induced by all-trans-retinoic-acid (RA) and cholesterol (CHOL). However, signaling pathways that lead to terminal differentiation of SH-SY5Y cells are still largely unknown. The goal of this study was...
Directory of Open Access Journals (Sweden)
Ana O. Pires
2014-01-01
Full Text Available The goal of this study was to determine and compare the effects of the secretome of mesenchymal stem cells (MSCs isolated from human bone-marrow (BMSCs and the Wharton jelly surrounding the vein and arteries of the umbilical cord (human umbilical cord perivascular cells (HUCPVCs on the survival and differentiation of a human neuroblastoma cell line (SH-SY5Y. For this purpose, SH-SY5Y cells were differentiated with conditioned media (CM from the MSCs populations referred above. Retinoic acid cultured cells were used as control for neuronal differentiated SH-SY5Y cells. SH-SY5Y cells viability assessment revealed that the secretome of BMSCs and HUCPVCs, in the form of CM, was able to induce their survival. Moreover, immunocytochemical experiments showed that CM from both MSCs was capable of inducing neuronal differentiation of SH-SY5Y cells. Finally, neurite lengths assessment and quantitative real-time reverse-transcription polymerase chain reaction (RT-PCR analysis demonstrated that CM from BMSCs and HUCPVCs differently induced neurite outgrowth and mRNA levels of neuronal markers exhibited by SH-SY5Y cells. Overall, our results show that the secretome of both BMSCs and HUCPVCs was capable of supporting SH-SY5Y cells survival and promoting their differentiation towards a neuronal phenotype.
Cuevas, Carlos; Huenchuguala, Sandro; Muñoz, Patricia; Villa, Monica; Paris, Irmgard; Mannervik, Bengt; Segura-Aguilar, Juan
2015-04-01
U373MG cells are able to take up aminochrome that induces glutathione transferase M2-2 (GSTM2) expression in a concentration-dependent manner where 100 µM aminochrome increases GSTM2 expression by 2.1-fold (P protects SH-SY5Y cells incubated with 10 µM aminochrome. The significant protection provided by U373MG-conditioned medium in SH-SY5Y cells incubated with aminochrome was dependent on GSTM2 internalization into SH-SY5Y cells as evidenced by (i) uptake of (14)C-GSTM2 released from U373MG cells into SH-SY5Y cells, a process inhibited by anti-GSTM2 antiserum; (ii) lack of protection of U373MG-conditioned medium in the presence of anti-GSTM2 antiserum on SH-SY5Y cells treated with aminochrome; and (iii) lack of protection of conditioned medium from U373MGsiGST6 that expresses an siRNA directed against GSTM2 on SH-SY5Y cells treated with aminochrome. In conclusion, our results demonstrated that U373MG cells protect SH-SY5Y cells against aminochrome neurotoxicity by releasing GSTM2 into the conditioned medium and subsequent internalization of GSTM2 into SH-SY5Y cells. These results suggest a new mechanism of protection of dopaminergic neurons mediated by astrocytes by releasing GSTM2 into the intersynaptic space and subsequent internalization into dopaminergic neuron in order to protect these cells against aminochrome neurotoxicity.
Shipley, Mackenzie M; Mangold, Colleen A; Kuny, Chad V; Szpara, Moriah L
2017-12-01
Neuron-virus interactions that occur during herpes simplex virus (HSV) infection are not fully understood. Neurons are the site of lifelong latency and are a crucial target for long-term suppressive therapy or viral clearance. A reproducible neuronal model of human origin would facilitate studies of HSV and other neurotropic viruses. Current neuronal models in the herpesvirus field vary widely and have caveats, including incomplete differentiation, nonhuman origins, or the use of dividing cells that have neuropotential but lack neuronal morphology. In this study, we used a robust approach to differentiate human SH-SY5Y neuroblastoma cells over 2.5 weeks, producing a uniform population of mature human neuronal cells. We demonstrate that terminally differentiated SH-SY5Y cells have neuronal morphology and express proteins with subcellular localization indicative of mature neurons. These neuronal cells are able to support a productive HSV-1 infection, with kinetics and overall titers similar to those seen in undifferentiated SH-SY5Y cells and the related SK-N-SH cell line. However, terminally differentiated, neuronal SH-SY5Y cells release significantly less extracellular HSV-1 by 24 h postinfection (hpi), suggesting a unique neuronal response to viral infection. With this model, we are able to distinguish differences in neuronal spread between two strains of HSV-1. We also show expression of the antiviral protein cyclic GMP-AMP synthase (cGAS) in neuronal SH-SY5Y cells, which is the first demonstration of the presence of this protein in nonepithelial cells. These data provide a model for studying neuron-virus interactions at the single-cell level as well as via bulk biochemistry and will be advantageous for the study of neurotropic viruses in vitro IMPORTANCE Herpes simplex virus (HSV) affects millions of people worldwide, causing painful oral and genital lesions, in addition to a multitude of more severe symptoms such as eye disease, neonatal infection, and, in rare
Directory of Open Access Journals (Sweden)
Yee-Wen Ng
2018-04-01
Full Text Available Background Obesity-related central nervous system (CNS pathologies like neuroinflammation and reactive gliosis are associated with high-fat diet (HFD related elevation of saturated fatty acids like palmitic acid (PA in neurons and astrocytes of the brain. Methods Human neuroblastoma cells SH-SY5Y (as a neuronal model and human glioblastoma cells T98G (as an astrocytic model, were treated with 100–500 µM PA, oleic acid (OA or lauric acid (LA for 24 h or 48 h, and their cell viability was assessed by 3-(4,5-dimetylthiazol-2-yl-2,5-diphenyltetrazolium bromide (MTT assay. The effects of stable overexpression of γ-synuclein (γ-syn, a neuronal protein recently recognized as a novel regulator of lipid handling in adipocytes, and transient overexpression of Parkinson’s disease (PD α-synuclein [α-syn; wild-type (wt and its pathogenic mutants A53T, A30P and E46K] in SH-SY5Y and T98G cells, were also evaluated. The effects of co-treatment of PA with paraquat (PQ, a Parkinsonian pesticide, and leptin, a hormone involved in the brain-adipose axis, were also assessed. Cell death mode and cell cycle were analyzed by Annexin V/PI flow cytometry. Reactive oxygen species (ROS level was determined using 2′,7′-dichlorofluorescien diacetate (DCFH-DA assay and lipid peroxidation level was determined using thiobarbituric acid reactive substances (TBARS assay. Results MTT assay revealed dose- and time-dependent PA cytotoxicity on SH-SY5Y and T98G cells, but not OA and LA. The cytotoxicity was significantly lower in SH-SY5Y-γ-syn cells, while transient overexpression of wt α-syn or its PD mutants (A30P and E46K, but not A53T modestly (but still significantly rescued the cytotoxicity of PA in SH-SY5Y and T98G cells. Co-treatment of increasing concentrations of PQ exacerbated PA’s neurotoxicity. Pre-treatment of leptin, an anti-apoptotic adipokine, did not successfully rescue SH-SY5Y cells from PA-induced cytotoxicity—suggesting a mechanism of PA
Ras-MAPK signaling in differentiating SH-SY5Y human neuroblastoma cells
Olsson, Anna-Karin
2000-01-01
Neuroblastoma is a malignant childhood cancer, originating from sympathetic neuroblasts of the peripheral nervous system. Neuroblastoma is a heterogenous group of tumours, while some are highly malignant others can spontaneosly mature into a more benign form or regress. Less than half of the patients survive and this statistics has improved only modestly over the past 20 years. SH-SY5Y is a human neuroblastoma cell line established from a highly malignant tumour. The cells have retained a ca...
The SH-SY5Y cell line in Parkinson's disease research: a systematic review.
Xicoy, Helena; Wieringa, Bé; Martens, Gerard J M
2017-01-24
Parkinson's disease (PD) is a devastating and highly prevalent neurodegenerative disease for which only symptomatic treatment is available. In order to develop a truly effective disease-modifying therapy, improvement of our current understanding of the molecular and cellular mechanisms underlying PD pathogenesis and progression is crucial. For this purpose, standardization of research protocols and disease models is necessary. As human dopaminergic neurons, the cells mainly affected in PD, are difficult to obtain and maintain as primary cells, current PD research is mostly performed with permanently established neuronal cell models, in particular the neuroblastoma SH-SY5Y lineage. This cell line is frequently chosen because of its human origin, catecholaminergic (though not strictly dopaminergic) neuronal properties, and ease of maintenance. However, there is no consensus on many fundamental aspects that are associated with its use, such as the effects of culture media composition and of variations in differentiation protocols. Here we present the outcome of a systematic review of scientific articles that have used SH-SY5Y cells to explore PD. We describe the cell source, culture conditions, differentiation protocols, methods/approaches used to mimic PD and the preclinical validation of the SH-SY5Y findings by employing alternative cellular and animal models. Thus, this overview may help to standardize the use of the SH-SY5Y cell line in PD research and serve as a future user's guide.
Autophagy regulates chlorpyrifos-induced apoptosis in SH-SY5Y cells
International Nuclear Information System (INIS)
Park, Jae Hyeon; Lee, Jeong Eun; Shin, In Chul; Koh, Hyun Chul
2013-01-01
Recent studies have shown that up-regulation of autophagy may be a tractable therapeutic intervention for clearing disease-causing proteins, including α-synuclein, ubiquitin, and other misfolded or aggregated proteins in pesticide-induced neurodegeneration. In a previous study, we reported that chlorpyrifos (CPF)-induced mitochondria-dependent apoptosis is mediated through reactive oxygen species in SH-SY5Y cells. In this study, we explored a novel pharmacotherapeutic approach to prevent CPF neurotoxicity involving the regulation of autophagy. We investigated the modulation of CPF-induced apoptosis according to autophagy regulation. We found that CPF induced apoptosis in SH-SY5Y cells, as demonstrated by the activation of caspase-3 and nuclear condensation. In addition, we observed that cells treated with CPF underwent autophagic cell death by monitoring the expression of LC3-II and p62. Pretreatment with the autophagy inducer rapamycin significantly enhanced the cell viability of CPF-exposed cells, and the enhancement of cell viability was partially due to alleviation of CPF-induced apoptosis via a decrease in levels of cleaved caspase-3. Specifically, rapamycin pretreatment decreased Bax and increased Bcl-2 expression in mitochondria. In addition, rapamycin significantly decreased cytochrome c release in from mitochondria into the cytosol. However, pretreatment of cells with the autophagy inhibitor, 3-methyladenine (3MA), remarkably increased CPF toxicity in these cells; this with correlated with increased expression of Bax and decreased expression of Bcl-2 in mitochondria. Our results suggest that CPF-induced cytotoxicity is modified by autophagy regulation and that rapamycin protects against CPF-induced apoptosis by enhancing autophagy. Pharmacologic induction of autophagy by rapamycin may be a useful treatment strategy in neurodegenerative disorders. - Highlights: ► Chlorpyrifos (CPF) is cytotoxic to SH-SY5Y cells ► CPF-induced cytotoxicity is mediated by
Autophagy regulates chlorpyrifos-induced apoptosis in SH-SY5Y cells
Energy Technology Data Exchange (ETDEWEB)
Park, Jae Hyeon [Department of Pharmacology, College of Medicine, Hanyang University (Korea, Republic of); Hanyang Biomedical Research Institute, Seoul (Korea, Republic of); Graduate School of Biomedical Science and Engineering, Hanyang University, Seoul (Korea, Republic of); Lee, Jeong Eun [Department of Pharmacology, College of Medicine, Hanyang University (Korea, Republic of); Hanyang Biomedical Research Institute, Seoul (Korea, Republic of); Shin, In Chul [Department of Pharmacology, College of Medicine, Hanyang University (Korea, Republic of); Koh, Hyun Chul, E-mail: hckoh@hanyang.ac.kr [Department of Pharmacology, College of Medicine, Hanyang University (Korea, Republic of); Hanyang Biomedical Research Institute, Seoul (Korea, Republic of); Graduate School of Biomedical Science and Engineering, Hanyang University, Seoul (Korea, Republic of)
2013-04-01
Recent studies have shown that up-regulation of autophagy may be a tractable therapeutic intervention for clearing disease-causing proteins, including α-synuclein, ubiquitin, and other misfolded or aggregated proteins in pesticide-induced neurodegeneration. In a previous study, we reported that chlorpyrifos (CPF)-induced mitochondria-dependent apoptosis is mediated through reactive oxygen species in SH-SY5Y cells. In this study, we explored a novel pharmacotherapeutic approach to prevent CPF neurotoxicity involving the regulation of autophagy. We investigated the modulation of CPF-induced apoptosis according to autophagy regulation. We found that CPF induced apoptosis in SH-SY5Y cells, as demonstrated by the activation of caspase-3 and nuclear condensation. In addition, we observed that cells treated with CPF underwent autophagic cell death by monitoring the expression of LC3-II and p62. Pretreatment with the autophagy inducer rapamycin significantly enhanced the cell viability of CPF-exposed cells, and the enhancement of cell viability was partially due to alleviation of CPF-induced apoptosis via a decrease in levels of cleaved caspase-3. Specifically, rapamycin pretreatment decreased Bax and increased Bcl-2 expression in mitochondria. In addition, rapamycin significantly decreased cytochrome c release in from mitochondria into the cytosol. However, pretreatment of cells with the autophagy inhibitor, 3-methyladenine (3MA), remarkably increased CPF toxicity in these cells; this with correlated with increased expression of Bax and decreased expression of Bcl-2 in mitochondria. Our results suggest that CPF-induced cytotoxicity is modified by autophagy regulation and that rapamycin protects against CPF-induced apoptosis by enhancing autophagy. Pharmacologic induction of autophagy by rapamycin may be a useful treatment strategy in neurodegenerative disorders. - Highlights: ► Chlorpyrifos (CPF) is cytotoxic to SH-SY5Y cells ► CPF-induced cytotoxicity is mediated by
Directory of Open Access Journals (Sweden)
Roberta Filograna
Full Text Available Human cell lines are often used to investigate cellular pathways relevant for physiological or pathological processes or to evaluate cell toxicity or protection induced by different compounds, including potential drugs. In this study, we analyzed and compared the differentiating activities of three agents (retinoic acid, staurosporine and 12-O-tetradecanoylphorbol-13-acetate on the human neuroblastoma SH-SY5Y and BE(2-M17 cell lines; the first cell line is largely used in the field of neuroscience, while the second is still poorly characterized. After evaluating their effects in terms of cell proliferation and morphology, we investigated their catecholaminergic properties by assessing the expression profiles of the major genes involved in catecholamine synthesis and storage and the cellular concentrations of the neurotransmitters dopamine and noradrenaline. Our results demonstrate that the two cell lines possess similar abilities to differentiate and acquire a neuron-like morphology. The most evident effects in SH-SY5Y cells were observed in the presence of staurosporine, while in BE(2-M17 cells, retinoic acid induced the strongest effects. Undifferentiated SH-SY5Y and BE(2-M17 cells are characterized by the production of both NA and DA, but their levels are considerably higher in BE(2-M17 cells. Moreover, the NAergic phenotype appears to be more pronounced in SH-SY5Y cells, while BE(2-M17 cells have a more prominent DAergic phenotype. Finally, the catecholamine concentration strongly increases upon differentiation induced by staurosporine in both cell lines. In conclusion, in this work the catecholaminergic phenotype of the human BE(2-M17 cell line upon differentiation was characterized for the first time. Our data suggest that SH-SY5Y and BE(2-M17 represent two alternative cell models for the neuroscience field.
Filograna, Roberta; Civiero, Laura; Ferrari, Vanni; Codolo, Gaia; Greggio, Elisa; Bubacco, Luigi; Beltramini, Mariano; Bisaglia, Marco
2015-01-01
Human cell lines are often used to investigate cellular pathways relevant for physiological or pathological processes or to evaluate cell toxicity or protection induced by different compounds, including potential drugs. In this study, we analyzed and compared the differentiating activities of three agents (retinoic acid, staurosporine and 12-O-tetradecanoylphorbol-13-acetate) on the human neuroblastoma SH-SY5Y and BE(2)-M17 cell lines; the first cell line is largely used in the field of neuroscience, while the second is still poorly characterized. After evaluating their effects in terms of cell proliferation and morphology, we investigated their catecholaminergic properties by assessing the expression profiles of the major genes involved in catecholamine synthesis and storage and the cellular concentrations of the neurotransmitters dopamine and noradrenaline. Our results demonstrate that the two cell lines possess similar abilities to differentiate and acquire a neuron-like morphology. The most evident effects in SH-SY5Y cells were observed in the presence of staurosporine, while in BE(2)-M17 cells, retinoic acid induced the strongest effects. Undifferentiated SH-SY5Y and BE(2)-M17 cells are characterized by the production of both NA and DA, but their levels are considerably higher in BE(2)-M17 cells. Moreover, the NAergic phenotype appears to be more pronounced in SH-SY5Y cells, while BE(2)-M17 cells have a more prominent DAergic phenotype. Finally, the catecholamine concentration strongly increases upon differentiation induced by staurosporine in both cell lines. In conclusion, in this work the catecholaminergic phenotype of the human BE(2)-M17 cell line upon differentiation was characterized for the first time. Our data suggest that SH-SY5Y and BE(2)-M17 represent two alternative cell models for the neuroscience field.
Kume, Toshiaki; Kawato, Yuka; Osakada, Fumitaka; Izumi, Yasuhiko; Katsuki, Hiroshi; Nakagawa, Takayuki; Kaneko, Shuji; Niidome, Tetsuhiro; Takada-Takatori, Yuki; Akaike, Akinori
2008-10-10
Dibutyryl cyclic AMP (dbcAMP) and retinoic acid (RA) have been demonstrated to be the inducers of morphological differentiation in SH-SY5Y cells, a human catecholaminergic neuroblastoma cell line. However, it remains unclear whether morphologically differentiated SH-SY5Y cells by these compounds acquire catecholaminergic properties. We focused on the alteration of tyrosine hydroxylase (TH) expression and intracellular content of noradrenaline (NA) as the indicators of functional differentiation. Three days treatment with dbcAMP (1mM) and RA (10microM) induced morphological changes and an increase of TH-positive cells using immunocytochemical analysis in SH-SY5Y cells. The percentage of TH-expressing cells in dbcAMP (1mM) treatment was larger than that in RA (10microM) treatment. In addition, dbcAMP increased intracellular NA content, whereas RA did not. The dbcAMP-induced increase in TH-expressing cells is partially inhibited by KT5720, a protein kinase A (PKA) inhibitor. We also investigated the effect of butyrate on SH-SY5Y cells, because dbcAMP is enzymatically degraded by intracellular esterase, thereby resulting in the formation of butyrate. Butyrate induced the increase of NA content at lower concentrations than dbcAMP, although the increase in TH-expressing cells by butyrate was smaller than that by dbcAMP. The dbcAMP (1mM)- and butyrate (0.3mM)-induced increase in NA content was completely suppressed by alpha-methyl-p-tyrosine (1mM), an inhibitor of TH. These results suggest that dbcAMP induces differentiation into the noradrenergic phenotype through both PKA activation and butyrate.
Teppola, Heidi; Sarkanen, Jertta-Riina; Jalonen, Tuula O; Linne, Marja-Leena
2016-04-01
Human SH-SY5Y neuroblastoma cells maintain their potential for differentiation and regression in culture conditions. The induction of differentiation could serve as a strategy to inhibit cell proliferation and tumor growth. Previous studies have shown that differentiation of SH-SY5Y cells can be induced by all-trans-retinoic-acid (RA) and cholesterol (CHOL). However, signaling pathways that lead to terminal differentiation of SH-SY5Y cells are still largely unknown. The goal of this study was to examine in the RA and CHOL treated SH-SY5Y cells the additive impacts of estradiol (E2) and brain-derived neurotrophic factor (BDNF) on cell morphology, cell population growth, synaptic vesicle recycling and presence of neurofilaments. The above features indicate a higher level of neuronal differentiation. Our data show that treatment for 10 days in vitro (DIV) with RA alone or when combined with E2 (RE) or CHOL (RC), but not when combined with BDNF (RB), significantly (p differentiation.
Fjaeraa, Christina; Nånberg, Eewa
2009-05-01
Ellagic acid, a polyphenolic compound found in berries, fruits and nuts, has been shown to possess growth-inhibiting and apoptosis promoting activities in cancer cell lines in vitro. The objective of this study was to investigate the effect of ellagic acid in human neuroblastoma SH-SY5Y cells. In cultures of SH-SY5Y cells incubated with ellagic acid, time- and concentration-dependent inhibitory effects on cell number were demonstrated. Ellagic acid induced cell detachment, decreased cell viability and induced apoptosis as measured by DNA strand breaks. Ellagic acid-induced alterations in cell cycle were also observed. Simultaneous treatment with all-trans retinoic acid did not rescue the cells from ellagic acid effects. Furthermore, the results suggested that pre-treatment with all-trans retinoic acid to induce differentiation and cell cycle arrest did not rescue the cells from ellagic acid-induced cell death.
Presenilin-1 mutations alter K+ currents in the human neuroblastoma cell line, SH-SY5Y
DEFF Research Database (Denmark)
Plant, Leigh D; Boyle, John P; Thomas, Natasha M
2002-01-01
Mutations in presenilin 1 (PS1) are the major cause of autosomal dominant Alzheimer's disease. We have measured the voltage-gated K+ current in the human neuroblastoma cell line SH-SY5Y using whole-cell patch-clamp. When cells were stably transfected to over-express PS1, no change in K+ current...
Cheung, Yuen-Ting; Lau, Way Kwok-Wai; Yu, Man-Shan; Lai, Cora Sau-Wan; Yeung, Sze-Chun; So, Kwok-Fai; Chang, Raymond Chuen-Chung
2009-01-01
Human neuroblastoma SH-SY5Y is a dopaminergic neuronal cell line which has been used as an in vitro model for neurotoxicity experiments. Although the neuroblastoma is usually differentiated by all-trans-retinoic acid (RA), both RA-differentiated and undifferentiated SH-SY5Y cells have been used in neuroscience research. However, the changes in neuronal properties triggered by RA as well as the subsequent responsiveness to neurotoxins have not been comprehensively studied. Therefore, we aim to re-evaluate the differentiation property of RA on this cell line. We hypothesize that modulation of signaling pathways and neuronal properties during RA-mediated differentiation in SH-SY5Y cells can affect their susceptibility to neurotoxins. The differentiation property of RA was confirmed by showing an extensive outgrowth of neurites, increased expressions of neuronal nuclei, neuron specific enolase, synaptophysin and synaptic associated protein-97, and decreased expression of inhibitor of differentiation-1. While undifferentiated SH-SY5Y cells were susceptible to 6-OHDA and MPP+, RA-differentiation conferred SH-SY5Y cells higher tolerance, potentially by up-regulating survival signaling, including Akt pathway as inhibition of Akt removed RA-induced neuroprotection against 6-OHDA. As a result, the real toxicity cannot be revealed in RA-differentiated cells. Therefore, undifferentiated SH-SY5Y is more appropriate for studying neurotoxicity or neuroprotection in experimental Parkinson's disease research.
Cheng, Lesley; Smith, Danielle J; Anderson, Robin L; Nagley, Phillip
2011-01-01
Terminally differentiated neurones in the central nervous system need to be protected from stress. We ask here whether differentiation of progenitor cells to neurones is accompanied by up-regulation of Hsp72, with acquisition of enhanced thermotolerance. Human neuroblastoma SH-SY5Y cells were propagated in an undifferentiated form and subsequently differentiated into neurone-like cells. Thermotolerance tests were carried out by exposure of cells to various temperatures, monitoring nuclear morphology as index of cell death. Abundance of Hsp72 was measured in cell lysates by western immunoblotting. The differentiation of SH-SY5Y cells was accompanied by increased expression of Hsp72. Further, in both cell states, exposure to mild hyperthermic stress (43°C for 30 min) increased Hsp72 expression. After differentiation, SH-SY5Y cells were more resistant to hyperthermic stress compared to their undifferentiated state, correlating with levels of Hsp72. Stable exogenous expression of Hsp72 in SH-SY5Y cells (transfected line 5YHSP72.1, containing mildly elevated levels of Hsp72), led to enhanced resistance to hyperthermic stress. Hsp72 was found to be inducible in undifferentiated 5YHSP72.1 cells; such heat-treated cells displayed enhanced thermotolerance. Treatment of cells with KNK437, a suppressor of Hsp72 induction, resulted in acute thermosensitisation of all cell types tested here. Hsp72 has a major role in the enhanced hyperthermic resistance acquired during neuronal differentiation of SH-SY5Y cells. These findings model the requirement in intact organisms for highly differentiated neurones to be specially protected against thermal stress.
DEFF Research Database (Denmark)
Warpman, U; Friberg, L; Gillespie, A
1998-01-01
investigated in human neuroblastoma SH-SY5Y cells (expressing alpha3, alpha5, beta2, and beta4 nAChR subunits). Nicotine exhibited a 14 times lower affinity for the nAChRs in SH-SY5Y cells as compared with M10 cells, whereas epibatidine showed similar affinities for the nAChRs expressed in the two cell lines...
Directory of Open Access Journals (Sweden)
Jerry W. Marlin
2010-04-01
Full Text Available p21-activated kinase 2 (PAK-2 appears to have a dual function in the regulation of cell survival and cell death. Activation of full-length PAK-2 by the p21 G-proteins Rac or Cdc42 stimulates cell survival. However, PAK-2 is unique among the PAK family because it is also activated through proteolytic cleavage by caspase 3 or similar caspases to generate the constitutively active PAK-2p34 fragment. Caspase activation of PAK-2 correlates with the induction of apoptosis in response to many stimuli and recombinant expression of PAK-2p34 has been shown to stimulate apoptosis in several human cell lines. Here, we show that caspase activation of PAK-2 also occurs during cisplatin-induced apoptosis of SH-SY5Y neuroblastoma cells as well as in SH-SY5Y cell culture models for Alzheimer’s and Parkinson’s disease. Inhibition of mitochondrial complex I or of ubiquitin/proteasome-mediated protein degradation, which both appear to be involved in Parkinson’s disease, induce apoptosis and caspase activation of PAK-2 in SH-SY5Y cells. Overexpression of the amyloid precursor protein, which results in accumulation and aggregation of β-amyloid peptide, the main component of β-amyloid plaques in Alzheimer’s disease, also induces apoptosis and caspase activation of PAK-2 in SH-SY5Y cells. Expression of the PAK-2 regulatory domain inhibits caspase-activated PAK-2p34 and prevents apoptosis in 293T human embryonic kidney cells, indicating that caspase activation of PAK-2 is directly involved in the apoptotic response. This is the first evidence that caspase activation of PAK-2 correlates with apoptosis in cell culture models of Alzheimer’s and Parkinson’s disease and that selective inhibition of caspase-activated PAK-2p34 could prevent apoptosis.
Ana O. Pires; Andreia Neves-Carvalho; Nuno Sousa; António J. Salgado
2014-01-01
The goal of this study was to determine and compare the effects of the secretome of mesenchymal stem cells (MSCs) isolated from human bone-marrow (BMSCs) and the Wharton jelly surrounding the vein and arteries of the umbilical cord (human umbilical cord perivascular cells (HUCPVCs)) on the survival and differentiation of a human neuroblastoma cell line (SH-SY5Y). For this purpose, SH-SY5Y cells were differentiated with conditioned media (CM) from the MSCs populations referred above. Retinoic ...
Nishida, Yuichiro; Adati, Naoki; Ozawa, Ritsuko; Maeda, Aasami; Sakaki, Yoshiyuki; Takeda, Tadayuki
2008-10-28
SH-SY5Y cells exhibit a neuronal phenotype when treated with all-trans retinoic acid (RA), but the molecular mechanism of activation in the signalling pathway mediated by phosphatidylinositol 3-kinase (PI3K) is unclear. To investigate this mechanism, we compared the gene expression profiles in SK-N-SH cells and two subtypes of SH-SY5Y cells (SH-SY5Y-A and SH-SY5Y-E), each of which show a different phenotype during RA-mediated differentiation. SH-SY5Y-A cells differentiated in the presence of RA, whereas RA-treated SH-SY5Y-E cells required additional treatment with brain-derived neurotrophic factor (BDNF) for full differentiation. After exposing cells to a PI3K inhibitor, LY294002, we identified 386 genes and categorised these genes into two clusters dependent on the PI3K signalling pathway during RA-mediated differentiation in SH-SY5Y-A cells. Transcriptional regulation of the gene cluster, including 158 neural genes, was greatly reduced in SK-N-SH cells and partially impaired in SH-SY5Y-E cells, which is consistent with a defect in the neuronal phenotype of these cells. Additional stimulation with BDNF induced a set of neural genes that were down-regulated in RA-treated SH-SY5Y-E cells but were abundant in differentiated SH-SY5Y-A cells. We identified gene clusters controlled by PI3K- and TRKB-mediated signalling pathways during the differentiation of two subtypes of SH-SY5Y cells. The TRKB-mediated bypass pathway compensates for impaired neural function generated by defects in several signalling pathways, including PI3K in SH-SY5Y-E cells. Our expression profiling data will be useful for further elucidation of the signal transduction-transcriptional network involving PI3K or TRKB.
Directory of Open Access Journals (Sweden)
Junjun Ni
2017-01-01
Full Text Available Oxidative stress and synapse dysfunction are the major neurodegenerative damage correlated to cognitive impairment in Alzheimer’s disease (AD. We have found that Brazilian green propolis (propolis improves the cognitive functions of mild cognitive impairment patients living at high altitude; however, mechanism underlying the effects of propolis is unknown. In the present study, we investigated the effects of propolis on oxidative stress, expression of brain-derived neurotrophic factor (BDNF, and activity-regulated cytoskeleton-associated protein (Arc, the critical factors of synapse efficacy, using human neuroblastoma SH-SY5Y cells. Pretreatment with propolis significantly ameliorated the hydrogen peroxide- (H2O2- induced cytotoxicity in SH-SY5Y cells. Furthermore, propolis significantly reduced the H2O2-generated reactive oxygen species (ROS derived from mitochondria and 8-oxo-2′-deoxyguanosine (8-oxo-dG, the DNA oxidative damage marker but significantly reversed the fibrillar β-amyloid and IL-1β-impaired BDNF-induced Arc expression in SH-SY5Y cells. Furthermore, propolis significantly upregulated BDNF mRNA expression in time- and dose-dependent manners. In addition, propolis induced Arc mRNA and protein expression via phosphoinositide-3 kinase (PI3K. These observations strongly suggest that propolis protects from the neurodegenerative damage in neurons through the properties of various antioxidants. The present study provides a potential molecular mechanism of Brazilian green propolis in prevention of cognitive impairment in AD as well as aging.
Klacanova, Katarina; Pilchova, Ivana; Klikova, Katarina; Racay, Peter
2016-04-01
Both translation arrest and proteasome stress associated with accumulation of ubiquitin-conjugated protein aggregates were considered as a cause of delayed neuronal death after transient global brain ischemia; however, exact mechanisms as well as possible relationships are not fully understood. The aim of this study was to compare the effect of chemical ischemia and proteasome stress on cellular stress responses and viability of neuroblastoma SH-SY5Y and glioblastoma T98G cells. Chemical ischemia was induced by transient treatment of the cells with sodium azide in combination with 2-deoxyglucose. Proteasome stress was induced by treatment of the cells with bortezomib. Treatment of SH-SY5Y cells with sodium azide/2-deoxyglucose for 15 min was associated with cell death observed 24 h after treatment, while glioblastoma T98G cells were resistant to the same treatment. Treatment of both SH-SY5Y and T98G cells with bortezomib was associated with cell death, accumulation of ubiquitin-conjugated proteins, and increased expression of Hsp70. These typical cellular responses to proteasome stress, observed also after transient global brain ischemia, were not observed after chemical ischemia. Finally, chemical ischemia, but not proteasome stress, was in SH-SY5Y cells associated with increased phosphorylation of eIF2α, another typical cellular response triggered after transient global brain ischemia. Our results showed that short chemical ischemia of SH-SY5Y cells is not sufficient to induce both proteasome stress associated with accumulation of ubiquitin-conjugated proteins and stress response at the level of heat shock proteins despite induction of cell death and eIF2α phosphorylation.
Suebsoonthron, Junjira; Jaroonwitchawan, Thiranut; Yamabhai, Montarop; Noisa, Parinya
2017-06-01
Neuroblastoma is one of the most common cancers in infancy, arising from the neuroblasts during embryonic development. This cancer is difficult to treat and resistance to chemotherapy is often found; therefore, clinical trials of novel therapeutic approaches, such as targeted-cancer signaling, could be an alternative for a better treatment. WNT signaling plays significant roles in the survival, proliferation, and differentiation of human neuroblastoma. In this report, WNT signaling of a malignant human neuroblastoma cell line, SH-SY5Y cells, was inhibited by XAV939, a specific inhibitor of the Tankyrase enzyme. XAV939 treatment led to the reduction of β-catenin within the cells, confirming its inhibitory effect of WNT. The inhibition of WNT signaling by XAV939 did not affect cell morphology, survival, and proliferation; however, the differentiation and sensitivity to anticancer drugs of human neuroblastoma cells were altered. The treatment of XAV939 resulted in the downregulation of mature neuronal markers, including β-tubulin III, PHOX2A, and PHOX2B, whereas neural progenitor markers (PAX6, TFAP2α, and SLUG) were upregulated. In addition, the combination of XAV939 significantly enhanced the sensitivity of SH-SY5Y and IMR-32 cells to doxorubicin in both 2D and 3D culture systems. Microarray gene expression profiling suggested numbers of candidate target genes of WNT inhibition by XAV939, in particular, p21, p53, ubiquitin C, ZBED8, MDM2, CASP3, and FZD1, and this explained the enhanced sensitivity of SH-SY5Y cells to doxorubicin. Altogether, these results proposed that the altered differentiation of human malignant neuroblastoma cells by inhibiting WNT signaling sensitized the cells to anticancer drugs. This approach could thus serve as an effective treatment option for aggressive brain malignancy.
Nishida, Yuichiro; Adati, Naoki; Ozawa, Ritsuko; Maeda, Aasami; Sakaki, Yoshiyuki; Takeda, Tadayuki
2008-01-01
Abstract Background SH-SY5Y cells exhibit a neuronal phenotype when treated with all-trans retinoic acid (RA), but the molecular mechanism of activation in the signalling pathway mediated by phosphatidylinositol 3-kinase (PI3K) is unclear. To investigate this mechanism, we compared the gene expression profiles in SK-N-SH cells and two subtypes of SH-SY5Y cells (SH-SY5Y-A and SH-SY5Y-E), each of which show a different phenotype during RA-mediated differentiation. Findings SH-SY5Y-A cells diffe...
Directory of Open Access Journals (Sweden)
Sakaki Yoshiyuki
2008-10-01
Full Text Available Abstract Background SH-SY5Y cells exhibit a neuronal phenotype when treated with all-trans retinoic acid (RA, but the molecular mechanism of activation in the signalling pathway mediated by phosphatidylinositol 3-kinase (PI3K is unclear. To investigate this mechanism, we compared the gene expression profiles in SK-N-SH cells and two subtypes of SH-SY5Y cells (SH-SY5Y-A and SH-SY5Y-E, each of which show a different phenotype during RA-mediated differentiation. Findings SH-SY5Y-A cells differentiated in the presence of RA, whereas RA-treated SH-SY5Y-E cells required additional treatment with brain-derived neurotrophic factor (BDNF for full differentiation. After exposing cells to a PI3K inhibitor, LY294002, we identified 386 genes and categorised these genes into two clusters dependent on the PI3K signalling pathway during RA-mediated differentiation in SH-SY5Y-A cells. Transcriptional regulation of the gene cluster, including 158 neural genes, was greatly reduced in SK-N-SH cells and partially impaired in SH-SY5Y-E cells, which is consistent with a defect in the neuronal phenotype of these cells. Additional stimulation with BDNF induced a set of neural genes that were down-regulated in RA-treated SH-SY5Y-E cells but were abundant in differentiated SH-SY5Y-A cells. Conclusion We identified gene clusters controlled by PI3K- and TRKB-mediated signalling pathways during the differentiation of two subtypes of SH-SY5Y cells. The TRKB-mediated bypass pathway compensates for impaired neural function generated by defects in several signalling pathways, including PI3K in SH-SY5Y-E cells. Our expression profiling data will be useful for further elucidation of the signal transduction-transcriptional network involving PI3K or TRKB.
Zhang, G-L; Zhang, L; Guo, Y-Y; Ma, Z-L; Wang, H-Y; Li, T; Liu, J; Du, Y; Yao, L; Li, T-T; Du, J-M
2017-05-20
Amyloid-β (Aβ)-induced oxidative stress plays an important role in the pathogenesis of Alzheimer's disease (AD). Recent studies show that Aβ accumulation may lead to mitochondrial oxidative damage. In the present study, we investigated the protective effect of edaravone on mitochondrial damage in SH-SY5Y cells treated with Aβ25-35. SH-SY5Y cells were pre-treated with 20, 40 or 80 μM edaravone before treatment with 25 μM Aβ25-35. After 24h cell culture, cellular apoptosis, intracellular reactive oxygen species (ROS), mitochondrial membrane potential (ΔΨm), ATP levels and mitochondrial morphology were evaluated. SH-SY5Y cells exposed to Aβ25-35 had high levels of apoptosis and ROS; loss of ΔΨm, decreased ATP levels and presence of mitochondrial swelling. However, these effects were significantly inhibited by edaravone pre-treatment. These results indicate that edaravone prevents mitochondria oxidative damage caused by Aβ in SH-SY5Y cells, which suggests that it may have potential clinical application in AD therapy.
Ansari, Mubeen A; Keller, Jeffrey N; Scheff, Stephen W
2008-12-01
Oxidative stress is one of the hypotheses involved in the etiology of Alzheimer's disease (AD). Considerable attention has been focused on increasing the intracellular glutathione (GSH) levels in many neurodegenerative diseases, including AD. Pycnogenol (PYC) has antioxidant properties and stabilizes intracellular antioxidant defense systems including glutathione levels. The present study investigated the protective effects of PYC on acrolein-induced oxidative cell toxicity in cultured SH-SY5Y neuroblastoma cells. Decreased cell survival in SH-SY5Y cultures treated with acrolein correlated with oxidative stress, increased NADPH oxidase activity, free radical production, protein oxidation/nitration (protein carbonyl, 3-nitrotyrosine), and lipid peroxidation (4-hydroxy-2-nonenal). Pretreatment with PYC significantly attenuated acrolein-induced cytotoxicity, protein damage, lipid peroxidation, and cell death. A dose-response study suggested that PYC showed protective effects against acrolein toxicity by modulating oxidative stress and increasing GSH. These findings provide support that PYC may provide a promising approach for the treatment of oxidative stress-related neurodegenerative diseases such as AD.
Paracrine Maturation and Migration of SH-SY5Y Cells by Dental Pulp Stem Cells
Gervois, Pascal; Wolfs, Esther; Dillen, Yörg; Hilkens, Petra; Ratajczak, Jessica; Driesen, Ronald; Vangansewinkel, Tim; Bronckaers, Annelies; Brône, Bert; Struys, Tom; Lambrichts, Ivo
2017-01-01
Neurological disorders are characterized by neurodegeneration and/or loss of neuronal function, which cannot be adequately repaired by the host. Therefore, there is need for novel treatment options such as cell-based therapies that aim to salvage or reconstitute the lost tissue or that stimulate host repair. The present study aimed to evaluate the paracrine effects of human dental pulp stem cells (hDPSCs) on the migration and neural maturation of human SH-SY5Y neuroblastoma cells. The hDPSC s...
Khwanraj, Kawinthra; Phruksaniyom, Chareerut; Madlah, Suriyat; Dharmasaroja, Permphan
2015-01-01
The human neuroblastoma SH-SY5Y cell line has been used as a dopaminergic cell model for Parkinson's disease research. Whether undifferentiated or differentiated SH-SY5Y cells are more suitable remains controversial. This study aims to evaluate the expression of apoptosis-related mRNAs activated by MPP+ and evaluate the differential expression of tyrosine hydroxylase (TH) in undifferentiated and retinoic acid- (RA-) induced differentiated cells. The western blot results showed a gradual decre...
Energy Technology Data Exchange (ETDEWEB)
Sun, Xingyuan, E-mail: sunxingyuan@sina.com; Ren, Zhanjun; Pan, Yunzhi; Zhang, Chenxin
2016-09-02
Hypoxia-induced apoptosis-related mechanisms involved in the brain damage following cerebral ischemia injury. A subset of the small noncoding microRNA (miRNAs) is regulated by tissue oxygen levels, and miR-24 was found to be activated by hypoxic conditions. However, the roles of miR-24 and its target gene in neuron are not well understood. Here, we validated miRNA-24 is down-regulated in patients with cerebral infarction. Hypoxia suppressed the expression of miR-24, but increased the expression of neurocan in both mRNA and protein levels in SH-SY5Y cells. MiR-24 mimics reduced the expression of neurocan, suppressed cell apoptosis, induced cell cycle progression and cell proliferation in SH-SY5Y cells under hypoxia. By luciferase reporter assay, neurocan is validated a direct target gene of miR-24. Furthermore, knockdown of neurocan suppressed cell apoptosis, induced cell cycle progression and cell proliferation in SH-SY5Y cells under hypoxia. Taken together, miR-24 overexpression or silencing of neurocan shows an antihypoxic effect in SH-SY5Y cells. Therefore, miR-24 and neurocan play critical roles in neuron cell apoptosis and are potential therapeutic targets for ischemic brain disease. - Highlights: • miR-24 and neurocan play critical roles in neuron cell apoptosis. • miR-24 and neurocan are potential therapeutic targets for ischemic brain disease. • Antihypoxic effect of miR-24 and neurocan in SH-SY5Y cells.
Effect of graphene oxide on undifferentiated and retinoic acid-differentiated SH-SY5Y cells line
Lv, Min; Zhang, Yujie; Liang, Le; Wei, Min; Hu, Wenbing; Li, Xiaoming; Huang, Qing
2012-06-01
Graphene oxide (GO), has created an unprecedented opportunity for development and application in biology, due to its abundant functional groups and well water solubility. Recently, the potential toxicity of GO in the environment and in humans has garnered more and more attention. In this paper, we systematically studied the cytotoxicity of GO nanosheets via examining the effect of GO on the morphology, viability and differentiation of a human neuroblastoma SH-SY5Y cell line, which was an ideal model used to study neuronal disease in vitro. The results suggested that GO had no obvious cytotoxicity at low concentration (cells exhibited dose- and time-dependent decreases at high concentration (>=80 μg mL-1). Moreover, GO did not induce apoptosis. Very interestingly, GO significantly enhanced the differentiation of SH-SY5Y induced-retinoic acid (RA) by evaluating neurite length and the expression of neuronal marker MAP2. These data provide a promising application for neurodegenerative diseases.
Lopes, Fernanda Martins; Londero, Giovana Ferreira; de Medeiros, Liana Marengo; da Motta, Leonardo Lisbôa; Behr, Guilherme Antônio; de Oliveira, Valeska Aguiar; Ibrahim, Mohammad; Moreira, José Cláudio Fonseca; Porciúncula, Lisiane de Oliveira; da Rocha, João Batista Teixeira; Klamt, Fábio
2012-08-01
It is well established that oxidative stress plays a major role in several neurodegenerative conditions, like Parkinson disease (PD). Hence, there is an enormous effort for the development of new antioxidants compounds with therapeutic potential for the management of PD, such as synthetic organoselenides molecules. In this study, we selected between nine different synthetic organoselenides the most eligible ones for further neuroprotection assays, using the differentiated human neuroblastoma SH-SY5Y cell line as in vitro model. Neuronal differentiation of exponentially growing human neuroblastoma SH-SY5Y cells was triggered by cultivating cells with DMEM/F12 medium with 1% of fetal bovine serum (FBS) with the combination of 10 μM retinoic acid for 7 days. Differentiated cells were further incubated with different concentrations of nine organoselenides (0.1, 0.3, 3, 10, and 30 μM) for 24 h and cell viability, neurites densities and the immunocontent of neuronal markers were evaluated. Peroxyl radical scavenging potential of each compound was determined with TRAP assay. Three organoselenides tested presented low cytotoxicity and high antioxidant properties. Pre-treatment of cells with those compounds for 24 h lead to a significantly neuroprotection against 6-hydroxydopamine (6-OHDA) toxicity, which were directly related to their antioxidant properties. Neuroprotective activity of all three organoselenides was compared to diphenyl diselenide (PhSe)₂, the simplest of the diaryl diselenides tested. Our results demonstrate that differentiated human SH-SY5Y cells are suitable cellular model to evaluate neuroprotective/neurotoxic role of compounds, and support further evaluation of selected organoselenium molecules as potential pharmacological and therapeutic drugs in the treatment of PD.
International Nuclear Information System (INIS)
Piotrowski, Marek; Szczepanowicz, Krzysztof; Jantas, Danuta; Leśkiewicz, Monika; Lasoń, Władysław; Warszyński, Piotr
2013-01-01
The emulsion-core and polyelectrolyte-coated nanocapsules, designed as water-insoluble neuroprotective drug delivery system, were synthesized using layer-by-layer saturation method. The isopropyl myristate was used as oil phase and docusate sodium salt as emulsifier. For the polyelectrolyte shell preparation, synthetic polyelectrolytes, cationic (PDADMAC, PAH, and PLL) and anionic (PGA) were used. The particle size and zeta potential of nanocapsules were characterized by the dynamic light scattering. The average size of synthesized nanocapsules ranged from ∼80 to ∼100 nm. Zeta potential values ranged from less than approximately −30 mV for the polyanion layers to greater than approximately +30 mV for the polycation layers. Biocompatibilities of the synthesized nanocarriers were evaluated against SH-SY5Y human neuroblastoma cells using various biochemical assays. The results obtained show that synthesized nanocapsules coated with PLL and PGA were nontoxic to SH-SY5Y cells, and they were used as nanocarriers for model neuroprotective drug (a calpain inhibitor MDL 28170). The neuroprotective action of the encapsulated MDL 28170 against hydrogen peroxide-induced oxidative stress cytotoxicity was evaluated in the same cell line. The results showed that nanoencapsulated form of MDL 28170 were biocompatible and protected SH-SY5Y cells against the H 2 O 2 (0.5 mM/24 h)-induced damage in 20–40 times lower concentrations than those of the same drug added directly to the culture medium. These data suggest that the nanoscale carriers of neuroprotective drugs might serve as novel promising therapeutic agents for oxidative stress-related neurodegenerative processes
Energy Technology Data Exchange (ETDEWEB)
Piotrowski, Marek, E-mail: ncpiotro@cyf-kr.edu.pl; Szczepanowicz, Krzysztof [Polish Academy of Sciences, Jerzy Haber Institute of Catalysis and Surface Chemistry (Poland); Jantas, Danuta; Leśkiewicz, Monika; Lasoń, Władysław [Polish Academy of Sciences, Institute of Pharmacology (Poland); Warszyński, Piotr [Polish Academy of Sciences, Jerzy Haber Institute of Catalysis and Surface Chemistry (Poland)
2013-11-15
The emulsion-core and polyelectrolyte-coated nanocapsules, designed as water-insoluble neuroprotective drug delivery system, were synthesized using layer-by-layer saturation method. The isopropyl myristate was used as oil phase and docusate sodium salt as emulsifier. For the polyelectrolyte shell preparation, synthetic polyelectrolytes, cationic (PDADMAC, PAH, and PLL) and anionic (PGA) were used. The particle size and zeta potential of nanocapsules were characterized by the dynamic light scattering. The average size of synthesized nanocapsules ranged from ∼80 to ∼100 nm. Zeta potential values ranged from less than approximately −30 mV for the polyanion layers to greater than approximately +30 mV for the polycation layers. Biocompatibilities of the synthesized nanocarriers were evaluated against SH-SY5Y human neuroblastoma cells using various biochemical assays. The results obtained show that synthesized nanocapsules coated with PLL and PGA were nontoxic to SH-SY5Y cells, and they were used as nanocarriers for model neuroprotective drug (a calpain inhibitor MDL 28170). The neuroprotective action of the encapsulated MDL 28170 against hydrogen peroxide-induced oxidative stress cytotoxicity was evaluated in the same cell line. The results showed that nanoencapsulated form of MDL 28170 were biocompatible and protected SH-SY5Y cells against the H{sub 2}O{sub 2} (0.5 mM/24 h)-induced damage in 20–40 times lower concentrations than those of the same drug added directly to the culture medium. These data suggest that the nanoscale carriers of neuroprotective drugs might serve as novel promising therapeutic agents for oxidative stress-related neurodegenerative processes.
Graser, Stephanie; Mentrup, Birgit; Schneider, Doris; Klein-Hitpass, Ludger; Jakob, Franz; Hofmann, Christine
2015-10-01
Patients suffering from the rare hereditary disease hypophosphatasia (HPP), which is based on mutations in the ALPL gene, tend to develop central nervous system (CNS) related issues like epileptic seizures and neuropsychiatric illnesses such as anxiety and depression, in addition to well-known problems with the mineralization of bones and teeth. Analyses of the molecular role of tissue-nonspecific alkaline phosphatase (TNAP) in transgenic SH-SY5Y(TNAPhigh) neuroblastoma cells compared to SH-SY5Y(TNAPlow) cells indicate that the enzyme influences the expression levels of neuronal marker genes like RNA-binding protein, fox-1 homolog 3 (NEUN) and enolase 2, gamma neuronal (NSE) as well as microtubule-binding proteins like microtubule-associated protein 2 (MAP2) and microtubule-associated protein tau (TAU) during neurogenic differentiation. Fluorescence staining of SH-SY5Y(TNAPhigh) cells reveals TNAP localization throughout the whole length of the developed projection network and even synapsin Ι co-localization with strong TNAP signals at some spots at least at the early time points of differentiation. Additional immunocytochemical staining shows higher MAP2 expression in SH-SY5Y(TNAPhigh) cells and further a distinct up-regulation of tau and MAP2 in the course of neurogenic differentiation. Interestingly, transgenic SH-SY5Y(TNAPhigh) cells are able to develop longer cellular processes compared to control cells after stimulation with all-trans retinoic acid (RA). Current therapies for HPP prioritize improvement of the bone phenotype. Unraveling the molecular role of TNAP in extraosseous tissues, like in the CNS, will help to improve treatment strategies for HPP patients. Taking this rare disease as a model may also help to dissect TNAP's role in neurodegenerative diseases and even improve future treatment of common pathologies. Copyright © 2015 Elsevier Inc. All rights reserved.
Chorfa, Areski; Bétemps, Dominique; Morignat, Eric; Lazizzera, Corinne; Hogeveen, Kevin; Andrieu, Thibault; Baron, Thierry
2013-06-01
Epidemiological studies indicate a role of genetic and environmental factors in Parkinson's disease involving alterations of the neuronal α-synuclein (α-syn) protein. In particular, a relationship between Parkinson's disease and occupational exposure to pesticides has been repeatedly suggested. Our objective was to precisely assess changes in α-syn levels in human neuroblastoma (SH-SY5Y) and melanoma (SK-MEL-2) cell lines following acute exposure to pesticides (rotenone, paraquat, maneb, and glyphosate) using Western blot and flow cytometry. These human cell lines express α-syn endogenously, and overexpression of α-syn (wild type or mutated A53T) can be obtained following recombinant adenoviral transduction. We found that endogenous α-syn levels in the SH-SY5Y neuroblastoma cell line were markedly increased by paraquat, and to a lesser extent by rotenone and maneb, but not by glyphosate. Rotenone also clearly increased endogenous α-syn levels in the SK-MEL-2 melanoma cell line. In the SH-SY5Y cell line, similar differences were observed in the α-syn adenovirus-transduced cells, with a higher increase of the A53T mutated protein. Paraquat markedly increased α-syn in the SK-MEL-2 adenovirus-transduced cell line, similarly for the wild-type or A53T proteins. The observed differences in the propensities of pesticides to increase α-syn levels are in agreement with numerous reports that indicate a potential role of exposure to certain pesticides in the development of Parkinson's disease. Our data support the hypothesis that pesticides can trigger some molecular events involved in this disease and also in malignant melanoma that consistently shows a significant but still unexplained association with Parkinson's disease.
Doo, Ah-Reum; Kim, Seung-Nam; Kim, Seung-Tae; Park, Ji-Yeun; Chung, Sung-Hyun; Choe, Bo-Young; Chae, Younbyoung; Lee, Hyejung; Yin, Chang-Shik; Park, Hi-Joon
2012-01-06
Parkinson's disease (PD) is a progressive neurodegenerative disorder characterized by progressive selective loss of dopaminergic neurons in the substantia nigra. Recently, bee venom was reported to protect dopaminergic neurons in the 1-methyl-4-phenyl-1,2,3,6-tetrahydropyridine induced mice PD model, however, the underlying mechanism is not fully understood. The objective of the present study is to investigate the neuroprotective mechanism of bee venom against Parkinsonian toxin, 1-methyl-4-phenylpyridine (MPP(+)), in SH-SY5Y human neuroblastoma cells. Our results revealed that bee venom pretreatment (1-100 ng/ml) increased the cell viability and decreased apoptosis assessed by DNA fragmentation and caspase-3 activity assays in MPP(+)-induced cytotoxicity in SH-SY5Y cells. Bee venom increased the anti-apoptotic Bcl-2 expression and decreased the pro-apoptotic Bax, cleaved PARP expressions. In addition, bee venom prevented the MPP(+)-induced suppression of Akt phosphorylation, and the neuroprotective effect of bee venom against MPP(+)-induced cytotoxicity was inhibited by a phosphatidylinositol 3-kinase (PI3K) inhibitor, LY294002. These results suggest that the anti-apoptotic effect of bee venom is mediated by the cell survival signaling, the PI3K/Akt pathway. These results provide new evidence for elucidating the mechanism of neuroprotection of bee venom against PD. Copyright © 2011 Elsevier B.V. All rights reserved.
Song, Ju-Xian; Choi, Mandy Yuen-Man; Wong, Kavin Chun-Kit; Chung, Winkie Wing-Yan; Sze, Stephen Cho-Wing; Ng, Tzi-Bun; Zhang, Kalin Yan-Bo
2012-01-21
Two active compounds, baicalein and its glycoside baicalin were found in the dried root of Scutellaria baicalensis Georgi, and reported to be neuroprotective in vitro and in vivo. This study aims to evaluate the protective effects of baicalein on the rotenone-induced apoptosis in dopaminergic SH-SY5Y cells related to parkinsonism. Cell viability and cytotoxicity were determined by MTT assay. The degree of nuclear apoptosis was evaluated with a fluorescent DNA-binding probe Hoechst 33258. The production of reactive oxidative species (ROS) and loss of mitochondrial membrane potential (ΔΨm) were determined by fluorescent staining with DCFH-DA and Rhodanmine 123, respectively. The expression of Bax, Bcl-2, cleaved caspase-3 and phosphorylated ERK1/2 was determined by the Western blots. Baicalein significantly increased viability and decreased rotenone-induced death of SH-SY5Y cells in a dose-dependent manner. Pre- and subsequent co-treatment with baicalein preserved the cell morphology and attenuated the nuclear apoptotic characteristics triggered by rotenone. Baicalein antagonized rotenone-induced overproduction of ROS, loss of ΔΨm, the increased expression of Bax, cleaved caspase-3 and phosphorylated ERK1/2 and the decreased expression of Bcl-2. The antioxidative effect, mitochondrial protection and modulation of anti-and pro-apoptotic proteins are related to the neuroprotective effects of baicalein against rotenone induced cell death in SH-SY5Y cells.
Directory of Open Access Journals (Sweden)
M. A. Esmaeili
2015-08-01
Full Text Available Background and objectives: Oxidative stress is implicated in the neuronal damage associated with Alzheimer’s disease, Parkinson’s disease, Huntington’s disease, amyotropic lateral sclerosis and cerebral ischemic stroke. The present work was designed to establish the neuroprotective effects of Salvia aristata extract on H2O2-induced apoptosis in human dopaminergic SH-SY5Y cells. Methods: The total phenol and flavonoids contents of the plant extracts were quantified by colorimetric methods. The antioxidant activity was assessed using DPPH free radicals scavenging activity assay, and the neuroprotective effect on H2O2-induced oxidative stress was also investigated using human dopaminergic SH-SY5Y cells by MTT assay and western blotting techniques. Results: The highest scavenging activity was found for methanol extract of S. aristata roots (85.28 ± 2.61 μg/mL, with the highest total phenolic and flavonoids content (90.28 mg total phenols as gallic acid and 250.12 mg total flavonoids as rutin, respectively. Our results also, showed that H2O2-induced cytotoxicity in SH-SY5Y cells was suppressed by treatment with S. aristata. Moreover, S. aristata root extract was effective in attenuating the disruption of mitochondrial membrane potential and apoptotic cell death has induced by H2O2. S. aristata suppressed the down-regulation of Bcl-2, upregulation of Bax, and the release of mitochondrial cytochrome c to cytosol. In addition, S. aristata attenuated caspase-3, and -9 activation, and eventually protected the cells against H2O2-induced apoptosis. Conclusion: Theresults of the present study suggest that treatment of SH-SY5Y cells with S. aristata could block H2O2-induced apoptosis by regulating Bcl-2 family members and by suppressing caspase cascade activation.
Fan, You-Ling; Li, Heng-Chang; Zhao, Wei; Peng, Hui-Hua; Huang, Fang; Jiang, Wei-Hang; Xu, Shi-Yuan
2016-09-01
Bupivacaine is widely used for regional anesthesia, spinal anesthesia, and pain management. However, bupivacaine could cause neuronal injury. Curcumin, a low molecular weight polyphenol, has a variety of bioactivities and may exert neuroprotective effects against damage induced by some stimuli. In the present study, we tested whether curcumin could attenuate bupivacaine-induced neurotoxicity in SH-SY5Y cells. Cell injury was evaluated by examining cell viability, mitochondrial damage and apoptosis. We also investigated the levels of activation of the Akt signaling pathway and the effect of Akt inhibition by triciribine on cell injury following bupivacaine and curcumin treatment. Our findings showed that the bupivacaine treatment could induce neurotoxicity. Pretreatment of the SH-SY5Y cells with curcumin significantly attenuated bupivacaine-induced neurotoxicity. Interestingly, the curcumin treatment increased the levels of Akt phosphorylation. More significantly, the pharmacological inhibition of Akt abolished the cytoprotective effect of curcumin against bupivacaine-induced cell injury. Our data suggest that pretreating SH-SY5Y cells with curcumin provides a protective effect on bupivacaine-induced neuronal injury via activation of the Akt signaling pathway.
Neurotoxicity Induced by Bupivacaine via T-Type Calcium Channels in SH-SY5Y Cells
Wen, Xianjie; Xu, Shiyuan; Liu, Hongzhen; Zhang, Quinguo; Liang, Hua; Yang, Chenxiang; Wang, Hanbing
2013-01-01
There is concern regarding neurotoxicity induced by the use of local anesthetics. A previous study showed that an overload of intracellular calcium is involved in the neurotoxic effect of some anesthetics. T-type calcium channels, which lower the threshold of action potentials, can regulate the influx of calcium ions. We hypothesized that T-type calcium channels are involved in bupivacaine-induced neurotoxicity. In this study, we first investigated the effects of different concentrations of bupivacaine on SH-SY5Y cell viability, and established a cell injury model with 1 mM bupivacaine. The cell viability of SH-SY5Y cells was measured following treatment with 1 mM bupivacaine and/or different dosages (10, 50, or 100 µM) of NNC 55-0396 dihydrochloride, an antagonist of T-type calcium channels for 24 h. In addition, we monitored the release of lactate dehydrogenase, cytosolic Ca2+ ([Ca2+]i), cell apoptosis and caspase-3 expression. SH-SY5Y cells pretreated with different dosages (10, 50, or 100 µM) of NNC 55-0396 dihydrochloride improved cell viability, reduced lactate dehydrogenase release, inhibited apoptosis, and reduced caspase-3 expression following bupivacaine exposure. However, the protective effect of NNC 55-0396 dihydrochloride plateaued. Overall, our results suggest that T-type calcium channels may be involved in bupivacaine neurotoxicity. However, identification of the specific subtype of T calcium channels involved requires further investigation. PMID:23658789
Neurotoxicity induced by bupivacaine via T-type calcium channels in SH-SY5Y cells.
Directory of Open Access Journals (Sweden)
Xianjie Wen
Full Text Available There is concern regarding neurotoxicity induced by the use of local anesthetics. A previous study showed that an overload of intracellular calcium is involved in the neurotoxic effect of some anesthetics. T-type calcium channels, which lower the threshold of action potentials, can regulate the influx of calcium ions. We hypothesized that T-type calcium channels are involved in bupivacaine-induced neurotoxicity. In this study, we first investigated the effects of different concentrations of bupivacaine on SH-SY5Y cell viability, and established a cell injury model with 1 mM bupivacaine. The cell viability of SH-SY5Y cells was measured following treatment with 1 mM bupivacaine and/or different dosages (10, 50, or 100 µM of NNC 55-0396 dihydrochloride, an antagonist of T-type calcium channels for 24 h. In addition, we monitored the release of lactate dehydrogenase, cytosolic Ca(2+ ([Ca2+]i, cell apoptosis and caspase-3 expression. SH-SY5Y cells pretreated with different dosages (10, 50, or 100 µM of NNC 55-0396 dihydrochloride improved cell viability, reduced lactate dehydrogenase release, inhibited apoptosis, and reduced caspase-3 expression following bupivacaine exposure. However, the protective effect of NNC 55-0396 dihydrochloride plateaued. Overall, our results suggest that T-type calcium channels may be involved in bupivacaine neurotoxicity. However, identification of the specific subtype of T calcium channels involved requires further investigation.
Santillo, Michael F; Liu, Yitong
2015-01-01
Acetylcholinesterase (AChE) is an enzyme responsible for metabolism of the neurotransmitter acetylcholine, and inhibition of AChE can have therapeutic applications (e.g., drugs for Alzheimer's disease) or neurotoxic consequences (e.g., pesticides). A common absorbance-based AChE activity assay that uses 5,5'-dithiobis(2-nitrobenzoic acid) (DTNB) can have limited sensitivity and be prone to interference. Therefore, an alternative assay was developed, in which AChE activity was determined by measuring fluorescence of resorufin produced from coupled enzyme reactions involving acetylcholine and Amplex Red (10-acetyl-3,7-dihydroxyphenoxazine). The Amplex Red assay was used for two separate applications. First, AChE activity was measured in rat whole blood, which is a biomarker for exposure to AChE inhibitor pesticides. Activity was quantified from a 10(5)-fold dilution of whole blood, and there was a linear correlation between Amplex Red and DTNB assays. For the second application, Amplex Red assay was used to measure AChE inhibition potency in a human neuroblastoma cell line (SH-SY5Y), which is important for assessing pharmacological and toxicological potential of AChE inhibitors including drugs, phytochemicals, and pesticides. Five known reversible inhibitors were evaluated (IC50, 7-225 nM), along with irreversible inhibitors chlorpyrifos-oxon (ki=1.01 nM(-1)h(-1)) and paraoxon (ki=0.16 nM(-1)h(-1)). Lastly, in addition to inhibition, AChE reactivation was measured in SH-SY5Y cells incubated with pralidoxime chloride (2-PAM). The Amplex Red assay is a sensitive, specific, and reliable fluorescence method for measuring AChE activity in both rat whole blood and cultured SH-SY5Y cells. Published by Elsevier Inc.
Directory of Open Access Journals (Sweden)
Song Ju-Xian
2012-01-01
Full Text Available Abstract Background Two active compounds, baicalein and its glycoside baicalin were found in the dried root of Scutellaria baicalensis Georgi, and reported to be neuroprotective in vitro and in vivo. This study aims to evaluate the protective effects of baicalein on the rotenone-induced apoptosis in dopaminergic SH-SY5Y cells related to parkinsonism. Methods Cell viability and cytotoxicity were determined by MTT assay. The degree of nuclear apoptosis was evaluated with a fluorescent DNA-binding probe Hoechst 33258. The production of reactive oxidative species (ROS and loss of mitochondrial membrane potential (ΔΨm were determined by fluorescent staining with DCFH-DA and Rhodanmine 123, respectively. The expression of Bax, Bcl-2, cleaved caspase-3 and phosphorylated ERK1/2 was determined by the Western blots. Results Baicalein significantly increased viability and decreased rotenone-induced death of SH-SY5Y cells in a dose-dependent manner. Pre- and subsequent co-treatment with baicalein preserved the cell morphology and attenuated the nuclear apoptotic characteristics triggered by rotenone. Baicalein antagonized rotenone-induced overproduction of ROS, loss of ΔΨm, the increased expression of Bax, cleaved caspase-3 and phosphorylated ERK1/2 and the decreased expression of Bcl-2. Conclusion The antioxidative effect, mitochondrial protection and modulation of anti-and pro-apoptotic proteins are related to the neuroprotective effects of baicalein against rotenone induced cell death in SH-SY5Y cells.
Directory of Open Access Journals (Sweden)
Tingting Yan
2016-01-01
Full Text Available Excessive alcohol consumption can lead to brain tissue damage and cognitive dysfunction. It has been shown that heavy drinking is associated with an earlier onset of neurodegenerative diseases such as Alzheimer’s disease. Acetaldehyde, the most toxic metabolite of ethanol, is speculated to mediate the brain tissue damage and cognitive dysfunction induced by the chronic excessive consumption of alcohol. However, the exact mechanisms by which acetaldehyde induces neurotoxicity are not totally understood. In this study, we investigated the cytotoxic effects of acetaldehyde in SH-SY5Y cells and found that acetaldehyde induced apoptosis of SH-SY5Y cells by downregulating the expression of antiapoptotic Bcl-2 and Bcl-xL and upregulating the expression of proapoptotic Bax. Acetaldehyde treatment led to a significant decrease in the levels of activated Akt and cyclic AMP-responsive element binding protein (CREB. In addition, acetaldehyde induced the activation of p38 mitogen-activated protein kinase (MAPK while inhibiting the activation of extracellular signal-regulated kinases (ERKs, p44/p42MAPK. Meanwhile, acetaldehyde treatment caused an increase in the production of reactive oxygen species and elevated the oxidative stress in SH-SY5Y cells. Therefore, acetaldehyde induces cytotoxicity of SH-SY5Y cells via promotion of apoptotic signaling, inhibition of cell survival pathway, and induction of oxidative stress.
Jaworska-Feil, L; Jantas, D; Leskiewicz, M; Budziszewska, B; Kubera, M; Basta-Kaim, A; Lipkowski, A W; Lason, W
2010-12-01
TRH (thyroliberin) and its analogues were reported to possess neuroprotective effects in cellular and animal experimental models of acute and chronic neurodegenerative diseases. In the present study we evaluated effects of TRH and its three stable analogues, montirelin (CG-3703), RGH-2202 and Z-TRH (N-(carbobenzyloxy)-pGlutamyl-Histydyl-Proline) on the neuronally differentiated human neuroblastoma SH-SY5Y cell line, which is widely accepted for studying potential neuroprotectants. We found that TRH and all the tested analogues at concentrations 0.1-50 μM attenuated cell damage induced by MPP(+) (2 mM), 3-nitropropionate (10 mM), hydrogen peroxide (0.5 mM), homocysteine (250 μM) and beta-amyloid (20μM) in retinoic acid differentiated SH-SY5Y cells. Furthermore, we demonstrated that TRH and its analogues decreased the staurosporine (0.5 μM)-induced LDH release, caspase-3 activity and DNA fragmentation, which indicate the anti-apoptotic proprieties of these peptides. The neuroprotective effects of TRH (10 μM) and RGH-2202 (10 μM) on St-induced cell death was attenuated by inhibitors of PI3-K pathway (wortmannin and LY294002), but not MAPK/ERK1/2 (PD98059 and U0126). Moreover, TRH and its analogues at neuroprotective concentrations (1 and 10 μM) increased expression of Bcl-2 protein, as confirmed by Western blot analysis. All in all, these results extend data on neuroprotective properties of TRH and its analogues and provide evidence that mechanism of anti-apoptotic effects of these peptides in SH-SY5Y cell line involves induction of PI3K/Akt pathway and Bcl-2. Furthermore, the data obtained on human cell line with a dopaminergic phenotype suggest potential utility of TRH and its analogues in the treatment of some neurodegenerative diseases including Parkinson's disease. Copyright © 2010 Elsevier Ltd. All rights reserved.
Hall, Susan; Anoopkumar-Dukie, Shailendra; Grant, Gary D; Desbrow, Ben; Lai, Richard; Arora, Devinder; Hong, Yinna
2017-06-01
Chemotherapy is an important treatment modality for malignancy but is limited by significant toxicity and it susceptibility to numerous drug interactions. While the interacting effects with medications are well known, there is limited evidence on the interaction with commonly consumed food and natural products. The aim of this study was to evaluate the bioactive constituents of coffee (caffeine and chlorogenic acid) on the cytotoxicity of doxorubicin, gemcitabine, and paclitaxel in vitro. Pretreatment with caffeine (100 nM and 10 μM) sensitized SH-SY5Y cells to doxorubicin-induced toxicity and increased apoptosis and sensitized PC3 cells to gemcitabine-induced toxicity. Pretreatment with 10 μM caffeine decreased total cell reactive oxygen species (ROS) production but increased mitochondrial ROS production. In contrast, caffeine (10 nM and 10 μM) protected cells against gemcitabine-induced toxicity and apoptosis. Similarly, 1 μM and 10 μM caffeine protected cells against paclitaxel-induced toxicity and mitochondrial ROS production. Chlorogenic acid had no effect on chemotherapy-induced toxicity in SH-SY5Y cells. In conclusion, this study provides preliminary evidence that caffeine, not chlorogenic acid, modulates the cytotoxicity of doxorubicin, gemcitabine, and paclitaxel in SH-SY5Y cells via different mechanisms.
Watanabe, Ryoko; Kurose, Takumi; Morishige, Yuta; Fujimori, Ko
2018-02-01
6-Hydroxydopamine (6-OHDA) induces the production of reactive oxygen species (ROS) that are associated with various neurodegenerative diseases such as Parkinson's disease. 3,3',4',7-Tetrahydroxyflavone (fisetin), a plant flavonoid has a variety of physiological effects such as antioxidant activity. In this study, we investigated the molecular mechanism of the neuroprotective effects of fisetin against 6-OHDA-induced cell death in human neuroblastoma SH-SY5Y cells. 6-OHDA-mediated cell toxicity was reduced in a fisetin concentration-dependent manner. 6-OHDA-mediated elevation of the expression of the oxidative stress-related genes such as hemeoxygenase-1, NAD(P)H dehydrogenase quinone 1, NF-E2-related factor 2, and γ-glutamate-cysteine ligase modifier was suppressed by fisetin. Fisetin also lowered the ratio of the proapoptotic Bax protein and the antiapoptotic Bcl-2 protein in SH-SY5Y cells. Moreover, fisetin effectively suppressed 6-OHDA-mediated activation of caspase-3 and caspase-9, which leads to the cell death, while, 6-OHDA-induced caspase-3/7 activity was lowered. Furthermore, fisetin activated the PI3K-Akt signaling, which inhibits the caspase cascade, and fisetin-mediated inhibition of 6-OHDA-induced cell death was negated by the co-treatment with an Akt inhibitor. These results indicate that fisetin protects 6-OHDA-induced cell death by activating PI3K-Akt signaling in human neuronal SH-SY5Y cells. This is the first report that the PI3K-Akt signaling is involved in the fisetin-protected ROS-mediated neuronal cell death.
Directory of Open Access Journals (Sweden)
Elina M Sutinen
2014-08-01
Full Text Available Chronic inflammation and oxidative stress (OS are present in Alzheimer´s disease (AD brains in addition to neuronal loss, Amyloid-β (Aβ plaques and hyperphosphorylated tau-protein neurofibrillary tangles. Previously we showed that levels of the pro-inflammatory cytokine, interleukin-18 (IL-18, are elevated in post-mortem AD brains. IL-18 can modulate the tau kinases, Cdk5 and GSK3β, as well as Aβ-production. IL-18 levels are also increased in AD risk diseases, including type-2 diabetes and obesity. Here, we explored other IL-18 regulated proteins in neuron-like SH-SY5Y cells. Differentiated SH-SY5Y cells, incubated with IL-18 for 24, 48 or 72h, were analyzed by two-dimensional gel electrophoresis (2D-DIGE. Specific altered protein spots were chosen and identified with mass spectrometry and verified by western immunoblotting. IL-18 had time-dependent effects on the SH-SY5Y proteome, modulating numerous protein levels/modifications. We concentrated on those related to OS (DDAH2, peroxiredoxins 2, 3 and 6, DJ-1, BLVRA, Aβ-degradation (MMP14, TIMP2, Aβ-aggregation (Septin-2 and modifications of axon growth and guidance associated, collapsing response mediator protein 2 (CRMP2. IL-18 significantly increased antioxidative enzymes, indicative of OS, and altered levels of glycolytic α- and γ-enolase and multifunctional 14-3-3γ and -ε, commonly affected in neurodegenerative diseases. MMP14, TIMP2, α-enolase and 14-3-3ε, indirectly involved in Aβ metabolism, as well as Septin-2 showed changes that increase Aβ levels. Increased 14-3-3γ may contribute to GSK3β driven tau hyperphosphorylation and CRMP2 Thr514 and Ser522 phosphorylation with the Thr555-site, a target for Rho kinase, showing time-dependent changes. IL-18 also increased caspase-1 levels and vacuolization of the cells. Although our SH-SY5Y cells were not aged, as neurons in AD, our work suggests that heightened or prolonged IL-18 levels can drive protein changes of known
Lee, M. C.; Lee, W. S.; Park, C. S.; Juhng, S. W.
1994-01-01
Human neuroblastoma SH-SY5Y cell is a cloned cell line which has many attractive features for the study of neuronal proliferation and neurite outgrowth, because it has receptors for insulin, IGF-I and PDGF. Gangliosides are sialic acid containing glycosphingolipids which form an integral part of the plasma membrane of many mammalian cells. They inhibit cell growth mediated by tyrosine kinase receptors and ligand-stimulated tyrosine kinase activity, and autophosphorylation of EGF(epidermal gro...
Rosiglitazone protects human neuroblastoma SH-SY5Y cells against acetaldehyde-induced cytotoxicity
International Nuclear Information System (INIS)
Jung, Tae Woo; Lee, Ji Young; Shim, Wan Sub; Kang, Eun Seok; Kim, Soo Kyung; Ahn, Chul Woo; Lee, Hyun Chul; Cha, Bong Soo
2006-01-01
Acetaldehyde, an inhibitor of mitochondrial function, has been widely used as a neurotoxin because it elicits a severe Parkinson's disease-like syndrome with elevation of the intracellular reactive oxygen species level and apoptosis. Rosiglitazone, a peroxisome proliferator-activated receptor-γ agonist, has been known to show various non-hypoglycemic effects, including anti-inflammatory, anti-atherogenic, and anti-apoptotic. In this study, we investigated the protective effects of rosiglitazone on acetaldehyde-induced apoptosis in human neuroblastoma SH-SY5Y cells and attempted to examine its mechanism. Acetaldehyde-induced apoptosis was moderately reversed by rosiglitazone treatment. Our results suggest that the protective effects of rosiglitazone on acetaldehyde-induced apoptosis may be ascribed to ability to induce the expression of anti-oxidant enzymes and to regulate Bcl-2 and Bax expression. These data indicate that rosiglitazone may provide a useful therapeutic strategy for the prevention of progressive neurodegenerative disease such as Parkinson's disease
Pirou, Caroline; Montazer-Torbati, Fatemeh; Jah, Nadège; Delmas, Elisabeth; Lasbleiz, Christelle; Mignotte, Bernard; Renaud, Flore
2017-01-01
Neuroblastoma, a sympathetic nervous system tumor, accounts for 15% of cancer deaths in children. In contrast to most human tumors, p53 is rarely mutated in human primary neuroblastoma, suggesting impaired p53 activation in neuroblastoma. Various studies have shown correlations between fgf1 expression levels and both prognosis severity and tumor chemoresistance. As we previously showed that fibroblast growth factor 1 (FGF1) inhibited p53-dependent apoptosis in neuron-like PC12 cells, we initiated the study of the interaction between the FGF1 and p53 pathways in neuroblastoma. We focused on the activity of either extracellular FGF1 by adding recombinant rFGF1 in media, or of intracellular FGF1 by overexpression in human SH-SY5Y and mouse N2a neuroblastoma cell lines. In both cell lines, the genotoxic drug etoposide induced a classical mitochondrial p53-dependent apoptosis. FGF1 was able to inhibit p53-dependent apoptosis upstream of mitochondrial events in SH-SY5Y cells by both extracellular and intracellular pathways. Both rFGF1 addition and etoposide treatment increased fgf1 expression in SH-SY5Y cells. Conversely, rFGF1 or overexpressed FGF1 had no effect on p53-dependent apoptosis and fgf1 expression in neuroblastoma N2a cells. Using different FGF1 mutants (that is, FGF1K132E, FGF1S130A and FGF1S130D), we further showed that the C-terminal domain and phosphorylation of FGF1 regulate its intracrine anti-apoptotic activity in neuroblastoma SH-SY5Y cells. This study provides the first evidence for a role of an intracrine growth factor pathway on p53-dependent apoptosis in neuroblastoma, and could lead to the identification of key regulators involved in neuroblastoma tumor progression and chemoresistance. PMID:29048426
Speen, Adam; Jones, Colton; Patel, Ruby; Shah, Halley; Nallasamy, Palanisamy; Brooke, Elizabeth A S; Zhu, Hong; Li, Y Robert; Jia, Zhenquan
2015-10-01
Acrolein is a ubiquitous unsaturated aldehyde has been implicated in the pathogenesis of various neurological disorders. However, limited study has been conducted into potential therapeutic protection and underlying mechanism against acrolein-induced cytotoxicity via upregulation of cellular aldehyde-detoxification defenses. In this study we have utilized RA-differentiated human SH-SY5Y cells and primary human astrocytes to investigate the induction of glutathione (GSH) by the synthetic triterpenoid 2-cyano-3,12-dixooleana-1,9-dien-28-imidazolide (CDDO-Im) and the protective effects CDDO-Im-mediated antioxidant defenses on acrolein toxicity. Acrolein exposure to RA-differentiated SH-SY5Y cells resulted in a significant time dependent depletion of cellular GSH preceding a reduction in cell viability and LDH release. Further, we demonstrated the predominance of cellular GSH in protection against acrolein-induced cytotoxicity. Buthionine sulfoximine (BSO) at 25μM dramatically depleted GSH and significantly potentiated acrolein-induced cytotoxicity. Pretreatment of the cells with 100nM CDDO-Im afforded a dramatic protection against acrolein-induced cytotoxicity. Pretreatment of BSO and CDDO was found to prevent the CDDO-Im-mediated GSH induction and partially reversed the cytoprotective effects of CDDO-Im against acrolein cytotoxicity. Overall, this study represents for the first time the CDDO-Im mediated upregulation of GSH is a predominant mechanism against acrolein-induced neurotoxicity. Copyright © 2015 Elsevier Ireland Ltd. All rights reserved.
Energy Technology Data Exchange (ETDEWEB)
Zhang, L.; Liang, H. [Department of Pediatrics, Qilu Hospital, Shandong University, Jinan (China); Cao, W. [Department of Obstetrics, Qingdao Central Hospital, Qingdao (China); Xu, R.; Ju, X.L. [Department of Pediatrics, Qilu Hospital, Shandong University, Jinan (China)
2014-05-23
Neuroblastoma is a solid tumor that occurs mainly in children. Malignant neuroblastomas have a poor prognosis because conventional chemotherapeutic agents are not very effective. Survivin, a member of the inhibitor of the apoptosis protein family, plays a significant role in cell division, inhibition of apoptosis, and promotion of cell proliferation and invasion. Previous studies found that survivin is highly expressed in some malignant neuroblastomas and is correlated with poor prognosis. The aim of this study was to investigate whether survivin could serve as a potential therapeutic target of human neuroblastoma. We employed RNA interference to reduce survivin expression in the human neuroblastoma SH-SY5Y cell line and analyzed the effect of RNA interference on cell proliferation and invasion in vitro and in vivo. RNA interference of survivin led to a significant decrease in invasiveness and proliferation and increased apoptosis in SH-SY5Y cells in vitro. RNA interference of survivin inhibited tumor growth in vivo by 68±13% (P=0.002) and increased the number of apoptotic cells by 9.8±1.2% (P=0.001) compared with negative small interfering RNA (siRNA) treatment controls. Moreover, RNA interference of survivin inhibited the formation of lung metastases by 92% (P=0.002) and reduced microvascular density by 60% (P=0.0003). Survivin siRNA resulted in significant downregulation of survivin mRNA and protein expression both in vitro and in vivo compared with negative siRNA treatment controls. RNA interference of survivin was found to be a potent inhibitor of SH-SY5Y tumor growth and metastasis formation. These results support further clinical development of RNA interference of survivin as a treatment of neuroblastoma and other cancer types.
Salimi, Leila; Rahbarghazi, Reza; Jafarian, Vahab; Biray Avci, Çıgır; Goker Bagca, Bakiye; Pinar Ozates, Neslihan; Khaksar, Majid; Nourazarian, Alireza
2018-01-18
In the current experiment, detrimental effects of high glucose condition were investigated on human neuroblastoma cells. Human neuroblastoma cell line SH-SY5Y were exposed to 5, 40, and 70 mM glucose over a period of 72 h. Survival rate and the proliferation of cells were analyzed by MTT and BrdU incorporation assays. Apoptosis was studied by the assays of flow cytometry and PCR array. In order to investigate the trans-differentiation capacity of the cell into mature neurons, we used immunofluorescence imaging to follow NeuN protein level. The transcription level of HSP70 was shown by real-time PCR analysis. MMP-2 and -9 activities were shown by gelatin Zymography. According to data from MTT and BrdU incorporation assay, 70 mM glucose reduced cell viability and proliferation rate as compared to control (5 mM glucose) and cells treated with 40 mM glucose (P Cell exposure to 70 mM glucose had potential to induced apoptosis after 72 h (P SH-SY5Y cells to detrimental effects of high glucose condition during trans-differentiation into mature neuron-like cells. Real-time PCR analysis confirmed the expression of HSP70 in cells under high content glucose levels, demonstrating the possible cell compensatory response to an insulting condition (p control vs 70 mM group cells being exposed to 70 mM glucose. High glucose condition could abrogate the dynamics of neural progenitor cells. The intracellular level of HSP70 was proportional to cell damage in high glucose condition. © 2018 Wiley Periodicals, Inc.
Lin, Yi-Chin; Uang, Hao-Wei; Lin, Rong-Jyh; Chen, Ing-Jun; Lo, Yi-Ching
2007-12-01
Glyceryl nonivamide (GLNVA), a vanilloid receptor (VR) agonist, has been reported to have calcitonin gene-related peptide-associated vasodilatation and to prevent subarachnoid hemorrhage-induced cerebral vasospasm. In this study, we investigated the neuroprotective effects of GLNVA on activated microglia-like cell mediated- and proparkinsonian neurotoxin 6-hydroxydopamine (6-OHDA)-induced neurotoxicity in human dopaminergic neuroblastoma SH-SY5Y cells. In coculture conditions, we used lipopolysaccharide (LPS)-stimulated BV-2 cells as a model of activated microglia. LPS-induced neuronal death was significantly inhibited by diphenylene iodonium (DPI), an inhibitor of NADPH oxidase. However, capsazepine, the selective VR1 antagonist, did not block the neuroprotective effects of GLNVA. GLNVA reduced LPS-activated microglia-mediated neuronal death, but it lacked protection in DPI-pretreated cultures. GLNVA also decreased LPS activated microglia induced overexpression of neuronal nitric-oxide synthase (nNOS) and glycoprotein 91 phagocyte oxidase (gp91(phox)) on SH-SY5Y cells. Pretreatment of BV-2 cells with GLNVA diminished LPS-induced nitric oxide production, overexpression of inducible nitric-oxide synthase (iNOS), and gp91(phox) and intracellular reactive oxygen species (iROS). GLNVA also reduced cyclooxygenase (COX)-2 expression, inhibitor of nuclear factor (NF)-kappaB (IkappaB)alpha/IkappaBbeta degradation, NF-kappaB activation, and the overproduction of tumor necrosis factor-alpha, interleukin (IL)-1beta, and prostaglandin E2 in BV-2 cells. However, GLNVA augmented anti-inflammatory cytokine IL-10 production on LPS-stimulated BV-2 cells. Furthermore, in 6-OHDA-treated SH-SY5Y cells, GLNVA rescued the changes in condensed nuclear and apoptotic bodies, prevented the decrease in mitochondrial membrane potential, and reduced cells death. GLNVA also suppressed accumulation of iROS and up-regulated heme oxygenase-1 expression. 6-OHDA-induced overexpression of nNOS, i
International Nuclear Information System (INIS)
Chun, Hong Sung; Low, Walter C.
2012-01-01
Although ursodeoxycholic acid (UDCA) and its highly water-soluble formula (Yoo's solution; YS) have been shown to prevent neuronal damage, the effects of UDCA or YS against Parkinson's disease (PD)-related dopaminergic cell death has not been studied. This study investigated the protective effects of UDCA and YS on sodium nitroprusside (SNP)-induced cytotoxicity in human dopaminergic SH-SY5Y cells. Both UDCA (50–200 μM) and YS (100–200 μM) dose-dependently prevented SNP (1 mM)-induced cell death. Results showed that both UDCA and YS effectively attenuated the production of total reactive oxygen species (ROS), peroxynitrite (ONOO − ) and nitric oxide (NO), and markedly inhibited the mitochondrial membrane potential (MMP) loss and intracellular reduced glutathione (GSH) depletion. SNP-induced programmed cell death events, such as nuclear fragmentation, caspase-3/7 and -9 activation, Bcl-2/Bax ratio decrease, and cytochrome c release, were significantly attenuated by both UDCA and YS. Furthermore, selective inhibitor of phosphatidylinositiol-3-kinase (PI3K), LY294002, and Akt/PKB inhibitor, triciribine, reversed the preventive effects of UDCA on the SNP-induced cytotoxicity and Bax translocation. These results suggest that UDCA can protect SH-SY5Y cells under programmed cell death process by regulating PI3K-Akt/PKB pathways.
International Nuclear Information System (INIS)
Alleaume, Celine; Eychene, Alain; Harnois, Thomas; Bourmeyster, Nicolas; Constantin, Bruno; Caigneaux, Evelyne; Muller, Jean-Marc; Philippe, Michel
2004-01-01
Vasoactive intestinal peptide (VIP) is known to regulate proliferation or differentiation in normal and tumoral cells. SH-SY5Y is a differentiated cell subclone derived from the SK-N-SH human neuroblastoma cell line and possess all the components for an autocrine action of VIP. In the present study, we investigated the morphological changes and intracellular signaling pathways occurring upon VIP treatment of SH-SY5Y cells. VIP induced an early remodeling of cell projections: a branched neurite network spread out and prominent varicosities developed along neurites. Although activated by VIP, the Ras/ERK pathway was not required for the remodeling process. In contrast, pull-down experiments revealed a strong Cdc42 activation by VIP while expression of a dominant-negative Cdc42 prevented the VIP-induced neurite changes, suggesting an important role for this small GTPase in the process. These data provide the first evidence for a regulation of the activity of Rho family GTPases by VIP and bring new insights in the signaling pathways implicated in neurite remodeling process induced by VIP in neuroblastoma cells
Czech Academy of Sciences Publication Activity Database
Pajuelo-Reguera, David; Alán, Lukáš; Olejár, Tomáš; Ježek, Petr
2015-01-01
Roč. 46, č. 6 (2015), s. 2409-2418 ISSN 1019-6439 R&D Projects: GA MŠk(CZ) EE2.3.30.0025 Institutional support: RVO:67985823 Keywords : dichloroacetate * mitochondria * mitophagy * neuroblastoma SH-SY5Y cells * mitochondrial network Subject RIV: EI - Biotechnology ; Bionics Impact factor: 3.018, year: 2015
Directory of Open Access Journals (Sweden)
Sangiliyandi Gurunathan
2017-11-01
Full Text Available Recently, graphene and graphene related nanocomposite receive much attention due to high surface-to-volume ratio, and unique physiochemical and biological properties. The combination of metallic nanoparticles with graphene-based materials offers a promising method to fabricate novel graphene–silver hybrid nanomaterials with unique functions in biomedical nanotechnology, and nanomedicine. Therefore, this study was designed to prepare graphene oxide (GO silver nanoparticles (AgNPs nanocomposite (GO-AgNPs containing two different nanomaterials in single platform with distinctive properties using luciferin as reducing agents. In addition, we investigated the effect of GO-AgNPs on differentiation in SH-SY5Y cells. The synthesized GO-AgNPs were characterized by ultraviolet-visible absorption spectroscopy (UV-vis, X-ray diffraction (XRD, scanning electron microscopy (SEM, transmission electron microscopy (TEM and Raman spectroscopy. The differentiation was confirmed by series of cellular and biochemical assays. The AgNPs were distributed uniformly on the surface of graphene oxide with an average size of 25 nm. As prepared GO-AgNPOs induces differentiation by increasing the expression of neuronal differentiation markers and decreasing the expression of stem cell markers. The results indicated that the redox biology involved the expression of various signaling molecules, which play an important role in differentiation. This study suggests that GO-AgNP nanocomposite could stimulate differentiation of SH-SY5Y cells. Furthermore, understanding the mechanisms of differentiation of neuroblastoma cells could provide new strategies for cancer and stem cell therapies. Therefore, these studies suggest that GO-AgNPs could target specific chemotherapy-resistant cells within a tumor.
Mitochondrial Effects of PGC-1alpha Silencing in MPP+ Treated Human SH-SY5Y Neuroblastoma Cells
Directory of Open Access Journals (Sweden)
Qinyong Ye
2017-05-01
Full Text Available The dopaminergic neuron degeneration and loss that occurs in Parkinson’s disease (PD has been tightly linked to mitochondrial dysfunction. Although the aged-related cause of the mitochondrial defect observed in PD patients remains unclear, nuclear genes are of potential importance to mitochondrial function. Human peroxisome proliferator-activated receptor γ coactivator-1alpha (PGC-1α is a multi-functional transcription factor that tightly regulates mitochondrial biogenesis and oxidative capacity. The goal of the present study was to explore the potential pathogenic effects of interference by the PGC-1α gene on N-methyl-4-phenylpyridinium ion (MPP+-induced SH-SY5Y cells. We utilized RNA interference (RNAi technology to probe the pathogenic consequences of inhibiting PGC-1α in the SH-SY5Y cell line. Remarkably, a reduction in PGC-1α resulted in the reduction of mitochondrial membrane potential, intracellular ATP content and intracellular H2O2 generation, leading to the translocation of cytochrome c (cyt c to the cytoplasm in the MPP+-induced PD cell model. The expression of related proteins in the signaling pathway (e.g., estrogen-related receptor α (ERRα, nuclear respiratory factor 1 (NRF-1, NRF-2 and Peroxisome proliferator-activated receptor γ (PPARγ also decreased. Our finding indicates that small interfering RNA (siRNA interference targeting the PGC-1α gene could inhibit the function of mitochondria in several capacities and that the PGC-1α gene may modulate mitochondrial function by regulating the expression of ERRα, NRF-1, NRF-2 and PPARγ. Thus, PGC-1α can be considered a potential therapeutic target for PD.
Neuroprotective Effect of Ginkgolide B on Bupivacaine-Induced Apoptosis in SH-SY5Y Cells
Li, Le; Zhang, Qing-guo; Lai, Lu-ying; Wen, Xian-jie; Zheng, Ting; Cheung, Chi-wai; Zhou, Shu-qin; Xu, Shi-yuan
2013-01-01
Local anesthetics are used routinely and effectively. However, many are also known to activate neurotoxic pathways. We tested the neuroprotective efficacy of ginkgolide B (GB), an active component of Ginkgo biloba, against ROS-mediated neurotoxicity caused by the local anesthetic bupivacaine. SH-SY5Y cells were treated with different concentrations of bupivacaine alone or following preincubation with GB. Pretreatment with GB increased SH-SY5Y cell viability and attenuated intracellular ROS accumulation, apoptosis, mitochondrial dysfunction, and ER stress. GB suppressed bupivacaine-induced mitochondrial depolarization and mitochondria complex I and III inhibition and increased cleaved caspase-3 and Htra2 expression, which was strongly indicative of activation of mitochondria-dependent apoptosis with concomitantly enhanced expressions of Grp78, caspase-12 mRNA, protein, and ER stress. GB also improved ultrastructural changes indicative of mitochondrial and ER damage induced by bupivacaine. These results implicate bupivacaine-induced ROS-dependent mitochondria, ER dysfunction, and apoptosis, which can be attenuated by GB through its antioxidant property. PMID:24228138
Jantas, D; Greda, A; Golda, S; Korostynski, M; Grygier, B; Roman, A; Pilc, A; Lason, W
2014-08-01
Recent studies have documented that metabotropic glutamate receptors from group II and III (mGluR II/III) are a potential target in the symptomatic treatment of Parkinson's disease (PD), however, the neuroprotective effects of particular mGluR II/III subtypes in relation to PD pathology are recognized only partially. In the present study, we investigated the effect of various mGluR II/III activators in the in vitro model of PD using human neuroblastoma SH-SY5Y cell line and mitochondrial neurotoxin MPP(+). We demonstrated that all tested mGluR ligands: mGluR II agonist - LY354740, mGluR III agonist - ACPT-I, mGluR4 PAM - VU0361737, mGluR8 agonist - (S)-3,4-DCPG, mGluR8 PAM - AZ12216052 and mGluR7 allosteric agonist - AMN082 were protective against MPP(+)-evoked cell damage in undifferentiated (UN-) SH-SY5Y cells with the highest neuroprotection mediated by mGluR8-specific agents. However, in retinoic acid- differentiated (RA-) SH-SY5Y cells we found protection mediated only by mGluR8 activators. We also demonstrated the cell proliferation stimulating effect for mGluR4 and mGluR8 PAMs. Next, we showed that the protection mediated by mGluR II/III activators in UN-SH-SY5Y was not accompanied by the modulation of caspase-3 activity, however, a decrease in the number of apoptotic nuclei was found. Finally, we showed that the inhibitor of necroptosis, necrostatin-1 blocked the mGluR III-mediated protection. Altogether our comparative in vitro data add a further proof to neuroprotective effects of mGluR agonists or PAMs and point to mGluR8 as a promising target for neuroprotective interventions in PD. The results also suggest the participation of necroptosis-related molecular pathways in neuroprotective effects of mGluR III activation. Copyright © 2014 Elsevier Ltd. All rights reserved.
Directory of Open Access Journals (Sweden)
Kawinthra Khwanraj
2015-01-01
Full Text Available The human neuroblastoma SH-SY5Y cell line has been used as a dopaminergic cell model for Parkinson’s disease research. Whether undifferentiated or differentiated SH-SY5Y cells are more suitable remains controversial. This study aims to evaluate the expression of apoptosis-related mRNAs activated by MPP+ and evaluate the differential expression of tyrosine hydroxylase (TH in undifferentiated and retinoic acid- (RA- induced differentiated cells. The western blot results showed a gradual decrease in TH in undifferentiated cells and a gradual increase in TH in differentiated cells from days 4 to 10 after cell plating. Immunostaining revealed a gradual increase in TH along with neuritic outgrowth in differentiated cells on days 4 and 7 of RA treatment. For the study on cell susceptibility to MPP+ and the expression of apoptosis-related genes, MTT assay showed a decrease in cell viability to approximately 50% requiring 500 and 1000 μM of MPP+ for undifferentiated and RA-differentiated cells, respectively. Using real-time RT-PCR, treatment with 500 μM MPP+ led to significant increases in the Bax/Bcl-2 ratio, p53, and caspase-3 in undifferentiated cells but was without significance in differentiated cells. In conclusion, differentiated cells may be more suitable, and the shorter duration of RA differentiation may make the SH-SY5Y cell model more accessible.
Song, Jie; Li, Na; Xia, Yang; Gao, Zhong; Zou, Sa-Feng; Yan, Yu-Hui; Li, Shao-Heng; Wang, Yue; Meng, Ya-Kun; Yang, Jing-Xian; Kang, Ting-Guo
2016-09-01
Mechanical trauma injury is a severe insult to neural cells. Subsequent secondary injury involves the release of inflammatory factors that have dramatic consequences for undamaged cells, leading to normal cell death after the initial injury. The present study investigated the capacity for arctigenin (ARC) to prevent secondary effects and evaluated the mechanism underlying the action of microRNA (miRNA)-199a and miRNA-16 in a mechanical trauma injury (MTI) model using SH-SY5Y cells in vitro. SH-SY5Y cells are often applied to in vitro models of neuronal function and differentiation. Recently, miRNAs have been demonstrated to play a crucial role in NF-κB and cholinergic signaling, which can regulate inflammation. The cell model was established by scratch-induced injury of human SH-SY5Y cells, which mimics the characteristics of MTI. A cell counting kit-8 (CCK-8), terminal deoxynucleotidyl transferase dUTP nick end labeling (TUNEL), and immunocytochemistry were used to measure cell viability. Enzyme-linked immunosorbent assay (ELISA) was used to evaluate the inflammatory cytokine and cholinesterase (CHE) content. The lactate dehydrogenase (LDH) content was measured to assess the degree of cell injury. The mRNA levels were measured by RT-PCR to analyze ARC's mechanism of action. miRNA inhibitors and mimics were used to inhibit and strengthen the expression of miRNAs. Protein expression was detected by western blotting analysis. ARC treatment reduced the TNF-α and IL-6 levels as well as the number of TUNEL+ apoptotic SH-SY5Y cells surrounding the scratch and increased the IL-10 level compared to the controls. ARC attenuated the increase of the cell damage degree and LDH content induced by scratching, indicating increased cell survival. Mechanistic studies showed that ARC upregulated the miRNA-16 and miRNA-199a levels to reduce upstream protein (IKKα and IKKβ) expression and inhibit NF-κB signaling pathway activity; moreover, the increased miRNA-199a suppresses
Directory of Open Access Journals (Sweden)
Jukka Luukkonen
Full Text Available BACKGROUND: Extremely low frequency (ELF magnetic fields (MF are generated by power lines and various electric appliances. They have been classified as possibly carcinogenic by the International Agency for Research on Cancer, but a mechanistic explanation for carcinogenic effects is lacking. A previous study in our laboratory showed that pre-exposure to ELF MF altered cancer-relevant cellular responses (cell cycle arrest, apoptosis to menadione-induced DNA damage, but it did not include endpoints measuring actual genetic damage. In the present study, we examined whether pre-exposure to ELF MF affects chemically induced DNA damage level, DNA repair rate, or micronucleus frequency in human SH-SY5Y neuroblastoma cells. METHODOLOGY/PRINCIPAL FINDINGS: Exposure to 50 Hz MF was conducted at 100 µT for 24 hours, followed by chemical exposure for 3 hours. The chemicals used for inducing DNA damage and subsequent micronucleus formation were menadione and methyl methanesulphonate (MMS. Pre-treatment with MF enhanced menadione-induced DNA damage, DNA repair rate, and micronucleus formation in human SH-SY5Y neuroblastoma cells. Although the results with MMS indicated similar effects, the differences were not statistically significant. No effects were observed after MF exposure alone. CONCLUSIONS: The results confirm our previous findings showing that pre-exposure to MFs as low as 100 µT alters cellular responses to menadione, and show that increased genotoxicity results from such interaction. The present findings also indicate that complementary data at several chronological points may be critical for understanding the MF effects on DNA damage, repair, and post-repair integrity of the genome.
Luukkonen, Jukka; Liimatainen, Anu; Höytö, Anne; Juutilainen, Jukka; Naarala, Jonne
2011-03-23
Extremely low frequency (ELF) magnetic fields (MF) are generated by power lines and various electric appliances. They have been classified as possibly carcinogenic by the International Agency for Research on Cancer, but a mechanistic explanation for carcinogenic effects is lacking. A previous study in our laboratory showed that pre-exposure to ELF MF altered cancer-relevant cellular responses (cell cycle arrest, apoptosis) to menadione-induced DNA damage, but it did not include endpoints measuring actual genetic damage. In the present study, we examined whether pre-exposure to ELF MF affects chemically induced DNA damage level, DNA repair rate, or micronucleus frequency in human SH-SY5Y neuroblastoma cells. Exposure to 50 Hz MF was conducted at 100 µT for 24 hours, followed by chemical exposure for 3 hours. The chemicals used for inducing DNA damage and subsequent micronucleus formation were menadione and methyl methanesulphonate (MMS). Pre-treatment with MF enhanced menadione-induced DNA damage, DNA repair rate, and micronucleus formation in human SH-SY5Y neuroblastoma cells. Although the results with MMS indicated similar effects, the differences were not statistically significant. No effects were observed after MF exposure alone. The results confirm our previous findings showing that pre-exposure to MFs as low as 100 µT alters cellular responses to menadione, and show that increased genotoxicity results from such interaction. The present findings also indicate that complementary data at several chronological points may be critical for understanding the MF effects on DNA damage, repair, and post-repair integrity of the genome.
Directory of Open Access Journals (Sweden)
João Barbosa Martins
2013-01-01
Full Text Available Paraquat (PQ, a cationic nonselective bipyridyl herbicide, has been used as neurotoxicant to modulate Parkinson’s disease in laboratory settings. Other compounds like rotenone (ROT, a pesticide, and 1-methyl-4-phenylpyridinium ion (MPP+ have been widely used as neurotoxicants. We compared the toxicity of these three neurotoxicants using differentiated dopaminergic SH-SY5Y human cells, aiming to elucidate their differential effects. PQ-induced neurotoxicity was shown to be concentration and time dependent, being mitochondrial dysfunction followed by neuronal death. On the other hand, cells exposure to MPP+ induced mitochondrial dysfunction, but not cellular lyses. Meanwhile, ROT promoted both mitochondrial dysfunction and neuronal death, revealing a biphasic pattern. To further elucidate PQ neurotoxic mechanism, several protective agents were used. SH-SY5Y cells pretreatment with tiron (TIR and 2-hydroxybenzoic acid sodium salt (NaSAL, both antioxidants, and Nω-nitro-L-arginine methyl ester hydrochloride (L-NAME, a nitric oxide synthase inhibitor, partially protected against PQ-induced cell injury. Additionally, 1-(2-[bis(4-fluorophenylmethoxy]ethyl-4-(3-phenyl-propylpiperazine (GBR 12909, a dopamine transporter inhibitor, and cycloheximide (CHX, a protein synthesis inhibitor, also partially protected against PQ-induced cell injury. In conclusion, we demonstrated that PQ, MPP+, and ROT exerted differential toxic effects on dopaminergic cells. PQ neurotoxicity occurred through exacerbated oxidative stress, with involvement of uptake through the dopamine transporter and protein synthesis.
Directory of Open Access Journals (Sweden)
Belinda J Goldie
2014-10-01
Full Text Available The SH-SY5Y culture system is a convenient neuronal model with the potential to elaborate human/primate-specific transcription networks and pathways related to human cognitive disorders. While this system allows for the exploration of specialised features in the human genome, there is still significant debate about how this model should be implemented, and its appropriateness for answering complex functional questions related to human neural architecture. In view of these questions we sought to characterise the posttranscriptional regulatory structure of the two-stage ATRA differentiation, BDNF maturation protocol proposed by Encinas and colleagues (2010 using integrative whole-genome gene and microRNA (miRNA expression analysis. We report that ATRA-BDNF induced significant increases in expression of key synaptic genes, brain-specific miRNA and miRNA biogenesis machinery, and in AChE activity, compared with ATRA alone. Functional annotation clustering associated BDNF more significantly with neuronal terms, and with synaptic terms not found in ATRA-only clusters. While our results support use of SH-SY5Y as a neuronal model, we advocate considered selection of the differentiation agent/s relative to the system being modelled.
Goldie, Belinda J; Barnett, Michelle M; Cairns, Murray J
2014-01-01
The SH-SY5Y culture system is a convenient neuronal model with the potential to elaborate human/primate-specific transcription networks and pathways related to human cognitive disorders. While this system allows for the exploration of specialized features in the human genome, there is still significant debate about how this model should be implemented, and its appropriateness for answering complex functional questions related to human neural architecture. In view of these questions we sought to characterize the posttranscriptional regulatory structure of the two-stage ATRA differentiation, BDNF maturation protocol proposed by Encinas et al. (2000) using integrative whole-genome gene and microRNA (miRNA) expression analysis. We report that ATRA-BDNF induced significant increases in expression of key synaptic genes, brain-specific miRNA and miRNA biogenesis machinery, and in AChE activity, compared with ATRA alone. Functional annotation clustering associated BDNF more significantly with neuronal terms, and with synaptic terms not found in ATRA-only clusters. While our results support use of SH-SY5Y as a neuronal model, we advocate considered selection of the differentiation agent/s relative to the system being modeled.
SNJ-1945, a calpain inhibitor, protects SH-SY5Y cells against MPP+ and rotenone
Knaryan, Varduhi H.; Samantaray, Supriti; Sookyoung, Park; Azuma, Mitsuyoshi; Inoue, Jun; Banik, Naren L.
2013-01-01
Complex pathophysiology of Parkinson’s disease (PD) involves multiple CNS cell types. Degeneration in spinal cord neurons alongside brain has been shown to be involved in PD and evidenced in experimental parkinsonism. However, the mechanisms of these degenerative pathways are not well understood. In order to unravel these mechanisms SH-SY5Y neuroblastoma cells were differentiated into dopaminergic and cholinergic phenotypes respectively and used as cell culture model following exposure to two...
Xiao, Yaruo; Zhang, Enqi; Fu, Ailing
2017-12-01
Much effort has been devoted to the discovery of effective biomaterials for nerve regeneration. Here, we reported a novel application of gold nanoparticles (AuNPs) modified with 6-mercaptopurine (6MP) and a neuron-penetrating peptide (RDP) as a neurophic agent to promote proliferation and neurite growth of human neuroblastoma (SH-SY5Y) cells. When the cells were treated with 6MP-AuNPs-RDP conjugates, they showed higher metabolic activity than the control. Moreover, SH-SY5Y cells were transplanted onto the surface coated with 6MP-AuNPs-RDP to examine the effect of neurite development. It can be concluded that 6MP-AuNPs-RDP attached to the cell surface and then internalized into cells, leading to a significant increase of neurite growth. Even though 6MP-AuNPs-RDP-treated cells were recovered from frozen storage, the cells still maintained constant growth, indicating that the cells have excellent tolerance to 6MP-AuNPs-RDP. The results suggested that the 6MP-AuNPs-RDP had promising potential to be developed as a neurophic nanomaterial for neuronal growth.
Oxidative stress response in SH-SY5Y cells exposed to short-term 1800 MHz radiofrequency radiation.
Marjanovic Cermak, Ana Marija; Pavicic, Ivan; Trosic, Ivancica
2018-01-28
The exact mechanism that could explain the effects of radiofrequency (RF) radiation exposure at non-thermal level is still unknown. Increasing evidence suggests a possible involvement of reactive oxygen species (ROS) and development of oxidative stress. To test the proposed hypothesis, human neuroblastoma cells (SH-SY5Y) were exposed to 1800 MHz short-term RF exposure for 10, 30 and 60 minutes. Electric field strength within Gigahertz Transverse Electromagnetic cell (GTEM) was 30 V m -1 and specific absorption rate (SAR) was calculated to be 1.6 W kg -1 . Cellular viability was measured by MTT assay and level of ROS was determined by fluorescent probe 2',7'-dichlorofluorescin diacetate. Concentrations of malondialdehyde and protein carbonyls were used to assess lipid and protein oxidative damage and antioxidant activity was evaluated by measuring concentrations of total glutathione (GSH). After radiation exposure, viability of irradiated cells remained within normal physiological values. Significantly higher ROS level was observed for every radiation exposure time. After 60 min of exposure, the applied radiation caused significant lipid and protein damage. The highest GSH concentration was detected after 10 minute-exposure. The results of our study showed enhanced susceptibility of SH-SY5Y cells for development of oxidative stress even after short-term RF exposure.
Directory of Open Access Journals (Sweden)
Paola Maura Tricarico
2017-03-01
Full Text Available Background/Aims: Mevalonate Kinase Deficiency (MKD, is a hereditary disease due to mutations in mevalonate kinase gene (MVK. MKD has heterogeneous clinical phenotypes: the correlation between MVK mutations and MKD clinical phenotype is still to be fully elucidated. Deficiency of prenylated proteins has been hypothesized as possible MKD pathogenic mechanism. Based on this hypothesis and considering that neurologic impairment characterizes Mevalonic Aciduria (MA, the most severe form of MKD, we studied the effects of I268T and N301T MVK mutations on protein prenylation, autophagy and programmed cell death in SH-SY5Y neuroblastoma cell lines. Methods: SH-SY5Y cells were transiently transfected, with the pCMV-6 plasmid containing MVK wild type and the two mutated sequences. Protein prenylation levels were evaluated using GFP-RhoA-F to assess farnesylation, and GFP-RhoA to evaluate geranylgeranylation; autophagy was measured by evaluating LC3 and p62 protein levels, while Annexin V-FITC and Propidium Iodide staining allowed apoptosis detection. Results: MVK mutants’ over-expression causes decreased levels of farnesylation and geranylgeranylation, and also increased LC3 lipidation in SH-SY5Y, with concomitant p62 accumulation. Treatment with bafilomycin A1 (an inhibitor of vacuolar H+-ATPase, a late autophagy inhibitor further increase LC3-II and p62 levels, suggesting that degradation of autophagolysosome could be impaired. SH-SY5Y, with both MVK mutants, showed apoptosis increase; the presence of N301T associated with augmented cell death. Conclusions: We hypothesize that mevalonate pathway impairment causes alteration of farnesylation and geranylgeranylation proteins and alteration of the autophagic flux; these changes can induce apoptosis, possibly more relevant in the presence of N301T mutation.
Tricarico, Paola Maura; Romeo, Alessandra; Gratton, Rossella; Crovella, Sergio; Celsi, Fulvio
2017-01-01
Mevalonate Kinase Deficiency (MKD), is a hereditary disease due to mutations in mevalonate kinase gene (MVK). MKD has heterogeneous clinical phenotypes: the correlation between MVK mutations and MKD clinical phenotype is still to be fully elucidated. Deficiency of prenylated proteins has been hypothesized as possible MKD pathogenic mechanism. Based on this hypothesis and considering that neurologic impairment characterizes Mevalonic Aciduria (MA), the most severe form of MKD, we studied the effects of I268T and N301T MVK mutations on protein prenylation, autophagy and programmed cell death in SH-SY5Y neuroblastoma cell lines. SH-SY5Y cells were transiently transfected, with the pCMV-6 plasmid containing MVK wild type and the two mutated sequences. Protein prenylation levels were evaluated using GFP-RhoA-F to assess farnesylation, and GFP-RhoA to evaluate geranylgeranylation; autophagy was measured by evaluating LC3 and p62 protein levels, while Annexin V-FITC and Propidium Iodide staining allowed apoptosis detection. MVK mutants' over-expression causes decreased levels of farnesylation and geranylgeranylation, and also increased LC3 lipidation in SH-SY5Y, with concomitant p62 accumulation. Treatment with bafilomycin A1 (an inhibitor of vacuolar H+-ATPase, a late autophagy inhibitor) further increase LC3-II and p62 levels, suggesting that degradation of autophagolysosome could be impaired. SH-SY5Y, with both MVK mutants, showed apoptosis increase; the presence of N301T associated with augmented cell death. We hypothesize that mevalonate pathway impairment causes alteration of farnesylation and geranylgeranylation proteins and alteration of the autophagic flux; these changes can induce apoptosis, possibly more relevant in the presence of N301T mutation. © 2017 The Author(s)Published by S. Karger AG, Basel.
Ba, Xiao-Hong; Min, Lian-Qiu
2015-01-01
The aim was to observe the effects of the extract of Ginkgo biloba (EGb761) on the apoptosis of oxygen and glucose-deprived (OGD) human neuroblastoma cells (SH-SY5Y) cells and explore its mechanism. SH-SY5Y cells were divided into normal control group, OGD group, OGD for 4 h and EGb761-pretreated groups including very low-concentration (20 μg/ml), low-concentration group (25 μg/ml), moderate-concentration group (50 μg/ml) and high-concentration group (100 μg/ml). Twenty four hours after reoxygenation, cell viability was determined with 3-[4, 5-dimehyl-2-thiazolyl]-2, 5-diphenyl-2H-tetrazolium bromide assay, apoptosis rate was detected with annexin V-fluorescein isothiocyanate/propidium iodide double staining flow cytometry and the protein level of apoptosis-inducing factor (AIF) was observed with immunofluorescence technique in each group. Cell viability was significantly lower in OGD group than in EGb761-pretreated groups, especially in moderate-concentration group (50 μg/ml) (P cells probably through inhibiting AIF nuclear translocation. This study provides a theoretical basis for the application of EGb761 in clinical practice.
Cheng, Benxu; Maffi, Shivani Kaushal; Martinez, Alex Anthony; Acosta, Yolanda P Villarreal; Morales, Liza D; Roberts, James L
2011-01-01
The proteasome is an enzyme complex responsible for targeted intracellular proteolysis. Alterations in proteasome-mediated protein clearance have been implicated in the pathogenesis of aging, Alzheimer's disease (AD) and Parkinson's disease (PD). In such diseases, proteasome inhibition may contribute to formation of abnormal protein aggregates, which in turn activate intracellular unfolded protein responses that cause oxidative stress and apoptosis. In this study, we investigated the protective effect of Insulin-like Growth Factor-I (IGF-1) for neural SH-SY5Y cells treated with the proteasomal inhibitor, Epoxomicin, In SH-SY5Y cells, Epoxomicin treatment results in accumulation of intracellular ubiquitinated proteins and cytochrome c release from damaged mitochondria, leading to cell death, in Epoxomicin time- and dose-dependent manner. In cells treated with small amounts of IGF-1, the same dosages of Epoxomicin reduced both mitochondrial damage (cytochrome c release) and reduced caspase-3 activation and PARP cleavage, both of which are markers of apoptosis. Notably, however, IGF-1-treated SH-SY5Y cells still contained ubiquitinated protein aggregates. This result indicates that IGF-1 blocks the downstream apoptotic consequences of Epoxomicin treatment leading to decreased proteasome function. Clues as to the mechanism for this protective effect come from (a) increased AKT phosphorylation observed in IGF-1-protected cells, vs. cells exposed to Epoxomicin without IGF-1, and (b) reduction of IGF-1 protection by pretreatment of the cells with LY294002 (an inhibitor of PI3-kinase). Together these findings suggest that activation of PI3/AKT pathways by IGF-1 is involved in IGF-1 neuroprotection against apoptosis following proteasome inhibition. PMID:21545837
PPARbeta agonists trigger neuronal differentiation in the human neuroblastoma cell line SH-SY5Y.
Di Loreto, S; D'Angelo, B; D'Amico, M A; Benedetti, E; Cristiano, L; Cinque, B; Cifone, M G; Cerù, M P; Festuccia, C; Cimini, A
2007-06-01
Neuroblastomas are pediatric tumors originating from immature neuroblasts in the developing peripheral nervous system. Differentiation therapies could help lowering the high mortality due to rapid tumor progression to advanced stages. Oleic acid has been demonstrated to promote neuronal differentiation in neuronal cultures. Herein we report on the effects of oleic acid and of a specific synthetic PPARbeta agonist on cell growth, expression of differentiation markers and on parameters responsible for the malignancy such as adhesion, migration, invasiveness, BDNF, and TrkB expression of SH-SY5Y neuroblastoma cells. The results obtained demonstrate that many, but not all, oleic acid effects are mediated by PPARbeta and support a role for PPARbeta in neuronal differentiation strongly pointing towards PPAR ligands as new therapeutic strategies against progression and recurrences of neuroblastoma.
Kakio, Shota; Funakoshi-Tago, Megumi; Kobata, Kenji; Tamura, Hiroomi
2017-07-01
Recent evidence indicates that hypoxia-inducible vascular endothelial growth factor (VEGF) has neurotrophic and neuroprotective effects on neuronal and glial cells. On the other hand, recent epidemiological studies showed that daily coffee consumption has been associated with a lower risk of several neuronal disorders. Therefore, we investigated the effect of coffee on VEGF expression in human neuroblastoma SH-SY5Y cells. We found that even low concentration of coffee (coffee was attributed to the coffee-dependent inhibition of prolyl hydroxylation of HIF1α, which is essential for proteolytic degradation of HIF-1α. However, no inhibition was observed at the catalytic activity in vitro. Coffee component(s) responsible for the activation of HIF-1α was not major constituents such as caffeine, caffeic acid, chlorogenic acid, and trigonelline, but was found to emerge during roasting process. The active component(s) was extractable with ethyl acetate. Our results suggest that daily consumption of coffee may induce VEGF expression in neuronal cells. This might be related to protective effect of coffee on neural disorders such as Alzheimer's disease and Parkinson's disease.
Song Ju-Xian; Choi Mandy; Wong Kavin; Chung Winkie; Sze Stephen; Ng Tzi-Bun; Zhang Kalin
2012-01-01
Abstract Background Two active compounds, baicalein and its glycoside baicalin were found in the dried root of Scutellaria baicalensis Georgi, and reported to be neuroprotective in vitro and in vivo. This study aims to evaluate the protective effects of baicalein on the rotenone-induced apoptosis in dopaminergic SH-SY5Y cells related to parkinsonism. Methods Cell viability and cytotoxicity were determined by MTT assay. The degree of nuclear apoptosis was evaluated with a fluorescent DNA-bindi...
Energy Technology Data Exchange (ETDEWEB)
Li, Lingyun, E-mail: lingyunlee@126.com [Department of Pharmacology, College of Pharmaceutical Sciences, Soochow University, Suzhou 215123 (China); Experimental Center, The Second Affiliated Hospital of Soochow University, Suzhou 215004 (China); Gao, Luyan [Experimental Center, The Second Affiliated Hospital of Soochow University, Suzhou 215004 (China); Song, Yunzhen; Qin, Zheng-Hong [Department of Pharmacology, College of Pharmaceutical Sciences, Soochow University, Suzhou 215123 (China); Liang, Zhongqin, E-mail: liangzhongqin@suda.edu.cn [Department of Pharmacology, College of Pharmaceutical Sciences, Soochow University, Suzhou 215123 (China)
2016-02-12
Autophagy and apoptosis are common responses to pathological damage in the process of Parkinson's disease (PD), and lysosome dysfunction may contribute to the etiology of PD's neurodegenerative process. In this study, we demonstrated that the neurotoxin 6-hydroxydopamine (6-OHDA) increased autophagy in SH-SY5Y cells, as determined by detection of the lysosome marker lysosomal-associated membrane protein1, the autophagy protein light chain 3 (LC3)-II and the autophagy substrate P62 protein. Meanwhile, autophagy repression with 3-methyladenine accelerated the activation of caspase-3 and PARP and aggravated the cell apoptotic death induced by 6-OHDA. Furthermore, we found that 6-OHDA treatment resulted in a transient increase in the intracellular and nuclear expression of cathepsin L (CTSL). The CTSL inhibitor, Z-FY-CHO, could promote autophagy, decrease accumulation of P62, and block activation of caspase-3 and PARP. Taken together, these results suggest that activation of autophagy may primarily be a protective process in SH-SY5Y cell death induced by 6-OHDA, and the nuclear translocation of CTSL could enhance the cell apoptotic cascade via disturbing autophagy-apoptotic systems in SH-SY5Y cells. Our findings highlight the potential role of CTSL in the cross talk between autophagy and apoptosis, which might be considered a therapeutic strategy for treatment of pathologic conditions associated with neurodegeneration. - Highlights: • Inhibition of autophagy aggravated the cell apoptotic death in SH-SY5Y cells. • Activation of cathepsin L impaired the autophagy pathway. • Activation of cathepsin L enhanced the cell apoptotic cascade. • Cathepsin L involves in the cross talk between autophagy and apoptosis.
Directory of Open Access Journals (Sweden)
Warisa Amornrit
2015-09-01
Full Text Available Amaranthus plants, or spinach, are used extensively as a vegetable and are known to possess medicinal properties. Neuroinflammation and oxidative stress play a major role in the pathogenesis of many neurodegenerative diseases, such as Alzheimer’s disease and Parkinson’s disease. Advanced glycation end-products (AGEs cause cell toxicity in the human neuronal cell line, SH-SY5Y, through an increase in oxidative stress, as shown by reducing cell viability and increasing cell toxicity in a dose-dependent manner. We found that preincubation of SH-SY5Y cells with either petroleum ether, dichloromethane or methanol extracts of A. lividus and A. tricolor dose-dependently attenuated the neuron toxicity caused by AGEs treatment. Moreover, the results showed that A. lividus and A. tricolor extracts significantly downregulated the gene expression of the pro-inflammatory cytokines, TNF-α, IL-1 and IL-6 genes in AGEs-induced cells. We concluded that A. lividus and A. tricolor extracts not only have a neuroprotective effect against AGEs toxicity, but also have anti-inflammatory activity by reducing pro-inflammatory cytokine gene expression. This suggests that Amaranthus may be useful for treating chronic inflammation associated with neurodegenerative disorders.
Mazzoccoli, Carmela; Ruggieri, Vitalba; Tataranni, Tiziana; Agriesti, Francesca; Laurenzana, Ilaria; Fratello, Angelo; Capitanio, Nazzareno; Piccoli, Claudia
2016-05-03
Neuroblastoma is the most commonly extra-cranial solid tumor of childhood frequently diagnosed. The nervous system-specific metabolite N-acetylaspartate (NAA) is synthesized from aspartate and acetyl-CoA in neurons, it is among the most abundant metabolites present in the central nervous system (CNS) and appears to be involved in many CNS disorders. The functional significance of the high NAA concentration in the brain remains uncertain, but it confers to NAA a unique clinical significance exploited in magnetic resonance spectroscopy. In the current study, we show that treatment of SH-SY5Y neuroblastoma-derived cell line with sub-cytotoxic physiological concentrations of NAA inhibits cell growth. This effect is partly due to enhanced apoptosis, shown by decrease of the anti-apoptotic factors survivin and Bcl-xL, and partly to arrest of the cell-cycle progression, linked to enhanced expression of the cyclin-inhibitors p53, p21Cip1/Waf1 and p27Kip1. Moreover, NAA-treated SH-SY5Y cells exhibited morphological changes accompanied with increase of the neurogenic markers TH and MAP2 and down-regulation of the pluripotency markers OCT4 and CXCR4/CD184. Finally, NAA-pre-treated SH-SY5Y cells resulted more sensitive to the cytotoxic effect of the chemotherapeutic drugs Cisplatin and 5-fluorouracil.To our knowledge, this is the first study demonstrating the neuronal differentiating effects of NAA in neuroblastoma cells. NAA may be a potential preconditioning or adjuvant compound in chemotherapeutic treatment.
Neuronal differentiation and long-term culture of the human neuroblastoma line SH-SY5Y.
Constantinescu, R; Constantinescu, A T; Reichmann, H; Janetzky, B
2007-01-01
Parkinson's disease (PD) is the second most prevalent neurodegenerative disorder in industrialized countries. Present cell culture models for PD rely on either primary cells or immortal cell lines, neither of which allow for long-term experiments on a constant population, a crucial requisite for a realistic model of slowly progressing neurodegenerative diseases. We differentiated SH-SY5Y human dopaminergic neuroblastoma cells to a neuronal-like state in a perfusion culture system using a combination of retinoic acid and mitotic inhibitors. The cells could be cultivated for two months without the need for passage. We show, by various means, that the differentiated cells exhibit, at the molecular level, many neuronal properties not characteristic to the starting line. This approach opens the possibility to develop chronic models, in which the effect of perturbations and putative counteracting strategies can be monitored over long periods of time in a quasi-stable cell population.
Directory of Open Access Journals (Sweden)
Shamim Akhter
Full Text Available VGF (non-acronymicis a secreted chromogranin/secretogranin that gives rise to a number of bioactive peptides by a complex proteolysis mechanism. VGF-derived peptides exert an extensive array of biological effects in energy metabolism, mood regulation, pain, gastric secretion function, reproduction and, perhaps, cancer. It is therefore surprising that very little is known about receptors and binding partners of VGF-derived peptides and their downstream molecular mechanisms of action. Here, using affinity chromatography and mass spectrometry-based protein identification, we have identified the heat shock cognate 71 kDa protein A8 (HSPA8as a binding partner of human TLQP-21 on the surface of human neuroblastomaSH-SY5Y cells. Binding of TLQP-21 to membrane associated HSPA8 in live SH-SY5Y cells was further supported by cross-linking to live cells. Interaction between HSPA8 and TLQP-21 was confirmed in vitro by label-free Dynamic Mass Redistribution (DMR studies. Furthermore, molecular modeling studies show that TLQP-21 can be docked into the HSPA8 peptide binding pocket. Identification of HSPA8 as a cell surface binding partner of TLQP-21 opens new avenues to explore the molecular mechanisms of its physiological actions, and of pharmacological modulation thereof.
Olivera Santa-Catalina, Marta; Caballero Bermejo, Montaña; Argent, Ricardo; Alonso, Juan C; Centeno, Francisco; Lorenzo, María J
2017-12-15
Growing evidence suggests that Diabetes Mellitus increases the risk of developing Alzheimer's disease. It is well known that hyperglycemia, a key feature of Diabetes Mellitus, may induce plasma osmolarity disturbances. Both hyperglycemia and hyperosmolarity promote the altered post-translational regulation of microtubule-associated protein Tau. Interestingly, abnormal hyperphosphorylation and cleavage of Tau have been proven to lead to the genesis of filamentous structures referred to as neurofibrillary tangles, the main pathological hallmark of Alzheimer's disease. We have previously described that hyperosmotic stress induced by sorbitol promotes Tau proteolysis and apoptosis in SH-SY5Y cells via caspase-3 activation. In order to gain insights into the regulatory mechanisms of such processes, in this work we explored the intracellular signaling pathways that regulate these events. We found that sorbitol treatment significantly enhanced the activation of conventional families of MAPK in SH-SY5Y cells. Tau proteolysis was completely prevented by JNK inhibition but not affected by either ERK1/2 or p38 MAPK blockade. Moreover, inhibition of JNK, but not ERK1/2 or p38 MAPK, efficiently prevented sorbitol-induced apoptosis and caspase-3 activation. In summary, we provide evidence that JNK signaling pathway is an upstream regulator of hyperosmotic stress-induced Tau cleavage and apoptosis in SH-SY5Y through the control of caspase-3 activation. Copyright © 2017 Elsevier Inc. All rights reserved.
Presenilin expression during induced differentiation of the human neuroblastoma SH-SY5Y cell line.
Flood, Fiona; Sundström, Erik; Samuelsson, Eva-Britt; Wiehager, Birgitta; Seiger, Ake; Johnston, Janet A; Cowburn, Richard F
2004-06-01
Human neuroblastoma SH-SY5Y cells stably transfected with both wild-type and exon-9 deleted (deltaE9) presenilin constructs were used to study the role of the presenilin proteins during differentiation. Cells transfected with either wild-type or deltaE9 PS1, of which the latter abolishes normal endoproteolytic cleavage of the protein, showed no obvious differences in their ability to differentiate to a neuronal-like phenotype upon treatment with retinoic acid (RA). A defined pattern of PS1 expression was observed during differentiation with both RA and the phorbol ester TPA. Full-length PS1 was shown to increase dramatically within 5-24 h of RA treatment. TPA gave an earlier and longer lasting increase in full-length PS1 levels. The intracellular distribution pattern of PS1 was markedly altered following RA treatment. Within 24h PS1 was highly up-regulated throughout the cell body around the nucleus. Between 2 and 4 weeks PS1 staining appeared punctate and also localised to the nucleus. Increases in PS1 expression upon treatment with RA and TPA were blocked by treatment with cycloheximide, indicating a role of de-novo protein synthesis in this effect. PS2 expression remained unchanged during differentiation. Levels of full-length PS1 were also seen to increase during neurogenesis and neuronal differentiation in the forebrain of first trimester human foetuses between 6.5 and 11 weeks. These combined observations support the idea that PS1 is involved in neuronal differentiation by a mechanism likely independent of endoproteolysis of the protein.
Nopparat, Chutikorn; Chantadul, Varunya; Permpoonputtana, Kannika; Govitrapong, Piyarat
2017-06-01
Brain inflammaging is considered as one of the underlying factors of neurodegenerative diseases. The present study aimed to investigate the effects of melatonin, an endogenous indoleamine mainly synthesized by the pineal gland, on hydrogen peroxide (H 2 O 2 )-induced inflammaging state in SH-SY5Y cells. Our data showed that p21 Cip1 and p16 INK4a , cell cycle arrest markers, and the number of senescence-associated β-galactosidase (SA-βgal) staining increased significantly in H 2 O 2 -treated cells. Melatonin treatment could reverse this effect. Flow cytometry analysis showed a significantly higher percentage in the G0/G1 phase and a lower proportion in the S phase of H 2 O 2 treated cells. Cells pretreated with H 2 O 2 showed a dramatic decrease in the formation of Ki67 immunoactivity while the treatment with melatonin increased Ki67-positive cell. Both mRNA and protein expression levels of the pro-inflammatory cytokines, interleukin-1β (IL-1β), IL-6 and, tumor necrosis factor-α (TNF-α) which were increased after induction with H 2 O 2 , could be attenuated by melatonin. In addition, melatonin decreased the phospho-nuclear factor kappa B (pNF-κB) expression and prevented its nuclear translocation, as well as abrogated the reduction of nuclear factor erythroid 2-related factor 2 (Nrf2) in SH-SY5Y cells exposed to H 2 O 2 . The present data suggested the importance of melatonin on ameliorating inflammation in SH-SY5Y cells. Copyright © 2017 Elsevier B.V. All rights reserved.
International Nuclear Information System (INIS)
Hossain, Md. Motarab; Banik, Naren L.; Ray, Swapan K.
2012-01-01
Neuroblastoma is a solid tumor that mostly occurs in children. Malignant neuroblastomas have poor prognosis because conventional chemotherapeutic agents are hardly effective. Survivin, which is highly expressed in some malignant neuroblastomas, plays a significant role in inhibiting differentiation and apoptosis and promoting cell proliferation, invasion, and angiogenesis. We examined consequences of survivin knockdown by survivin short hairpin RNA (shRNA) plasmid and then treatment with (−)-epigallocatechin-3-gallate (EGCG), a green tea flavonoid, in malignant neuroblastoma cells. Our Western blotting and laser scanning confocal immunofluorescence microscopy showed that survivin was highly expressed in malignant neuroblastoma SK-N-BE2 and SH-SY5Y cell lines and slightly in SK-N-DZ cell line. Expression of survivin was very faint in malignant neuroblastoma IMR32 cell line. We transfected SK-N-BE2 and SH-SY-5Y cells with survivin shRNA, treated with EGCG, and confirmed knockdown of survivin at mRNA and protein levels. Survivin knockdown induced morphological features of neuronal differentiation, as we observed following in situ methylene blue staining. Combination of survivin shRNA and EGCG promoted neuronal differentiation biochemically by increases in the expression of NFP, NSE, and e-cadherin and also decreases in the expression of Notch-1, ID2, hTERT, and PCNA. Our in situ Wright staining and Annexin V-FITC/PI staining showed that combination therapy was highly effective in inducing, respectively, morphological and biochemical features of apoptosis. Apoptosis occurred with activation of caspase-8 and cleavage of Bid to tBid, increase in Bax:Bcl-2 ratio, mitochondrial release of cytochrome c, and increases in the expression and activity of calpain and caspase-3. Combination therapy decreased migration of cells through matrigel and inhibited proliferative (p-Akt and NF-κB), invasive (MMP-2 and MMP-9), and angiogenic (VEGF and b-FGF) factors. Also, in vitro
Directory of Open Access Journals (Sweden)
Mostafa Waly
2016-01-01
Full Text Available The folate and cobalamin (Cbl- dependent enzyme methionine synthase (MS is highly sensitive to oxidation and its activity affects all methylation reactions. Recent studies have revealed alternative splicing of MS mRNA in human brain and patient-derived fibroblasts. Here we show that MS mRNA in SH-SY5Y human neuroblastoma cells is alternatively spliced, resulting in three primary protein species, thus providing a useful model to examine cofactor dependence of these variant enzymes. MS activity was dependent upon methylcobalamin (MeCbl or the combination of hydroxocobalamin (OHCbl and S-adenosylmethionine (SAM. OHCbl-based activity was eliminated by depletion of the antioxidant glutathione (GSH but could be rescued by provision of either glutathionylcobalamin (GSCbl or MeCbl. Pretreatment of cells with lead, arsenic, aluminum, mercury, or the ethylmercury-containing preservative thimerosal lowered GSH levels and inhibited MS activity in association with decreased uptake of cysteine, which is rate-limiting for GSH synthesis. Thimerosal treatment decreased cellular levels of GSCbl and MeCbl. These findings indicate that the alternatively spliced form of MS expressed in SH-SY5Y human neuronal cells is sensitive to inhibition by thimerosal and neurotoxic metals, and lower GSH levels contribute to their inhibitory action.
Synthesis of reduced-size gold nanostars and internalization in SH-SY5Y cells
Dacarro, Giacomo
2017-07-01
The synthesis of large pentatwinned five-branched gold nanostars (GNS) has been modified so to obtain overall dimensions shrunk to 60% and a lower branches aspect ratio, leading to a dramatic blue shift of their two near-infrared (NIR) localized surface plasmon resonances (LSPR) absorptions but still maintaining one LSPR in the biotransparent NIR range. The interactions of polyethylene glycol (PEG) coated large and shrunk GNS with SH-SY5Y cells revealed that the large ones (DCI - diameter of the circumference in which GNS can be inscribed = 76 nm) are internalized more efficiently than the shrunk ones (DCI = 46 nm), correlating with a decreased cells surving fraction.
Synthesis of reduced-size gold nanostars and internalization in SH-SY5Y cells
Dacarro, Giacomo; Pallavicini, Piersandro; Bertani, Serena Maria; Chirico, Giuseppe; D'Alfonso, Laura; Falqui, Andrea; Marchesi, Nicoletta; Pascale, Alessia; Sironi, Laura; Taglietti, Angelo; Zuddas, Efisio
2017-01-01
The synthesis of large pentatwinned five-branched gold nanostars (GNS) has been modified so to obtain overall dimensions shrunk to 60% and a lower branches aspect ratio, leading to a dramatic blue shift of their two near-infrared (NIR) localized surface plasmon resonances (LSPR) absorptions but still maintaining one LSPR in the biotransparent NIR range. The interactions of polyethylene glycol (PEG) coated large and shrunk GNS with SH-SY5Y cells revealed that the large ones (DCI - diameter of the circumference in which GNS can be inscribed = 76 nm) are internalized more efficiently than the shrunk ones (DCI = 46 nm), correlating with a decreased cells surving fraction.
Energy Technology Data Exchange (ETDEWEB)
Hossain, Md. Motarab [Department of Pathology, Microbiology, and Immunology, University of South Carolina School of Medicine, Columbia, SC (United States); Banik, Naren L. [Department of Neurosciences, Medical University of South Carolina, Charleston, SC (United States); Ray, Swapan K., E-mail: swapan.ray@uscmed.sc.edu [Department of Pathology, Microbiology, and Immunology, University of South Carolina School of Medicine, Columbia, SC (United States)
2012-08-01
Neuroblastoma is a solid tumor that mostly occurs in children. Malignant neuroblastomas have poor prognosis because conventional chemotherapeutic agents are hardly effective. Survivin, which is highly expressed in some malignant neuroblastomas, plays a significant role in inhibiting differentiation and apoptosis and promoting cell proliferation, invasion, and angiogenesis. We examined consequences of survivin knockdown by survivin short hairpin RNA (shRNA) plasmid and then treatment with (-)-epigallocatechin-3-gallate (EGCG), a green tea flavonoid, in malignant neuroblastoma cells. Our Western blotting and laser scanning confocal immunofluorescence microscopy showed that survivin was highly expressed in malignant neuroblastoma SK-N-BE2 and SH-SY5Y cell lines and slightly in SK-N-DZ cell line. Expression of survivin was very faint in malignant neuroblastoma IMR32 cell line. We transfected SK-N-BE2 and SH-SY-5Y cells with survivin shRNA, treated with EGCG, and confirmed knockdown of survivin at mRNA and protein levels. Survivin knockdown induced morphological features of neuronal differentiation, as we observed following in situ methylene blue staining. Combination of survivin shRNA and EGCG promoted neuronal differentiation biochemically by increases in the expression of NFP, NSE, and e-cadherin and also decreases in the expression of Notch-1, ID2, hTERT, and PCNA. Our in situ Wright staining and Annexin V-FITC/PI staining showed that combination therapy was highly effective in inducing, respectively, morphological and biochemical features of apoptosis. Apoptosis occurred with activation of caspase-8 and cleavage of Bid to tBid, increase in Bax:Bcl-2 ratio, mitochondrial release of cytochrome c, and increases in the expression and activity of calpain and caspase-3. Combination therapy decreased migration of cells through matrigel and inhibited proliferative (p-Akt and NF-{kappa}B), invasive (MMP-2 and MMP-9), and angiogenic (VEGF and b-FGF) factors. Also, in vitro
SNJ-1945, a calpain inhibitor, protects SH-SY5Y cells against MPP+ and rotenone
Knaryan, Varduhi H.; Samantaray, Supriti; Sookyoung, Park; Azuma, Mitsuyoshi; Inoue, Jun; Banik, Naren L.
2014-01-01
Complex pathophysiology of Parkinson’s disease (PD) involves multiple CNS cell types. Degeneration in spinal cord neurons alongside brain has been shown to be involved in PD and evidenced in experimental parkinsonism. However, the mechanisms of these degenerative pathways are not well understood. In order to unravel these mechanisms SH-SY5Y neuroblastoma cells were differentiated into dopaminergic and cholinergic phenotypes respectively and used as cell culture model following exposure to two parkinsonian neurotoxicants MPP+ and rotenone. SNJ-1945, a cell-permeable calpain inhibitor was tested for its neuroprotective efficacy. MPP+ and rotenone dose-dependently elevated the levels of intracellular free Ca2+ and induced a concomitant rise in the levels of active calpain. SNJ-1945 pre-treatment significantly protected cell viability and preserved cellular morphology following MPP+ and rotenone exposure. The neurotoxicants elevated the levels of reactive oxygen species (ROS) more profoundly in SH-SY5Y cells differentiated into dopaminergic phenotype, and this effect could be attenuated with SNJ-1945 pre-treatment. In contrast, significant levels of inflammatory mediators (cyclooxygenase-2, Cox-2 and cleaved p10 fragment of caspase-1) were upregulated in the cholinergic phenotype, which could be dose-dependently attenuated by the calpain inhibitor. Overall, SNJ-1945 was efficacious against MPP+ or rotenone-induced ROS generation, inflammatory mediators, and proteolysis. A post-treatment regimen of SNJ-1945 was also examined in cells and partial protection was attained with calpain inhibitor administration 1–3 h after exposure to MPP+ or rotenone. Taken together these results indicate that calpain inhibition is a valid target for protection against parkinsonian neurotoxicants, and SNJ-1945 is an efficacious calpain inhibitor in this context. PMID:24341912
Jantas, Danuta; Piotrowski, Marek; Lason, Wladyslaw
2015-12-01
Undecylenic acid (UDA), a naturally occurring 11-carbon unsaturated fatty acid, has been used for several years as an economical antifungal agent and a nutritional supplement. Recently, the potential usefulness of UDA as a neuroprotective drug has been suggested based on the ability of this agent to inhibit μ-calpain activity. In order to verify neuroprotective potential of UDA, we tested protective efficacy of this compound against cell damage evoked by pro-apoptotic factors (staurosporine and doxorubicin) and oxidative stress (hydrogen peroxide) in human neuroblastoma SH-SY5Y cells. We showed that UDA partially protected SH-SY5Y cells against the staurosporine- and doxorubicin-evoked cell death; however, this effect was not connected with its influence on caspase-3 activity. UDA decreased the St-induced changes in mitochondrial and cytosolic AIF level, whereas in Dox-model it affected only the cytosolic AIF content. Moreover, UDA (1-40 μM) decreased the hydrogen peroxide-induced cell damage which was connected with attenuation of hydrogen peroxide-mediated necrotic (PI staining, ADP/ATP ratio) and apoptotic (mitochondrial membrane potential, caspase-3 activation, AIF translocation) changes. Finally, we demonstrated that an inhibitor of PI3-K/Akt (LY294002) but not MAPK/ERK1/2 (U0126) pathway blocked the protection mediated by UDA in all tested models of SH-SY5Y cell injury. These in vitro data point to UDA as potentially effective neuroprotectant the utility of which should be further validated in animal studies. © 2015 Wiley Periodicals, Inc.
Directory of Open Access Journals (Sweden)
Fuli Wang
2014-06-01
Full Text Available The adaptive immune system has implications in pathology of Parkinson’s disease (PD. Research data demonstrated that the peripheral CD4+ T-cell population decreased in pathogenesis of PD. The effect of damaged dopaminergic neurons on peripheral T cells of PD is still unknown. In this study, we constructed a neuronal and glial cells co-culture model by using human neuroblastoma cells SH-SY5Y and gliomas cells U87. After the co-culture cells were treated with neurotoxin 1-methyl-4-phenylpyridinium (MPP+ for 24 h, the conditioned media was harvested and used to cultivate T-cell leukemia Jurkat cells for another 24 h. We then analyzed the cell proliferation, cell cycle and necrosis effect of Jurkat cells. The results showed that co-culture medium of SH-SY5Y and U87 cells with MPP+ treatment inhibited the proliferation of Jurkat cells compared to control medium without MPP+, even though the same concentration of MPP+ had very little toxicity to the Jurkat cell. Furthermore, co-culture medium with low concentration of MPP+ (100 µM arrested Jurkat cells cycle in G2/M phase through increasing cell cycle division 2 (CDC2 and CyclinB1 expression level, whereas co-culture medium with high concentration of MPP+ (500 µM induced Jurkat cell necrosis through cellular swelling and membrane breakage. Our data implies that damaged dopamine neurons with glial cells can lead to the reduced number or inhibited proliferation activity of peripheral T cells.
Akki, Rachid; Siracusa, Rosalba; Morabito, Rossana; Remigante, Alessia; Campolo, Michela; Errami, Mohammed; La Spada, Giuseppina; Cuzzocrea, Salvatore; Marino, Angela
2018-03-01
Preconditioning (PC) is a cell adaptive response to oxidative stress and, with regard to neurons, can be considered as a neuroprotective strategy. The aim of the present study was to verify how neuronal-like differentiated SH-SY5Y cells adapt to a mild and transient H 2 O 2 -induced oxidative stress and, hence, whether may be considered as more sensitive cell model to study PC pathways. A first screening allowed to define H 2 O 2 concentrations for PC (10μM-50μM), applied before damage(100μM H 2 O 2 ). Cell viability measured 24 hours after 100μM H 2 O 2 -induced damage was ameliorated by 24-hour pre-exposure to low-concentration H 2 O 2 (10μM-30μM) with cell size as well restored. Markers for apoptosis (Bcl-2 and Bad), inflammation (iNOS), and redox system (MnSOD) were also determined, showing that, in cells pre-exposed to 10μM H 2 O 2 and then submitted to 100μM H 2 O 2 , Bcl-2 levels were higher, Bad and iNOS levels were lower than those observed in damaged cells, and MnSOD levels were unchanged. Such findings show that (1) neuronal-like differentiated SH-SY5Y cells are a suitable model to investigate PC response and more sensitive to the effect of a mild and transient H 2 O 2 -induced oxidative stress with respect to other neuronal cells; (2) 10μM H 2 O 2 -induced PC is mediated by apoptotic and inflammatory pathways, unlike antioxidant system; (3) such neuroprotective strategy and underlying signals proven in neuronal-like differentiated SH-SY5Y cells may contribute to understand in vivo PC mechanisms and to define a window for pharmacological intervention, namely, related to ischemic brain damage. Neuronal-like differentiated SH-SY5Y cells are a suitable model to investigate PC, an endogenous neuroprotective response to a mild and transient H 2 O 2 -induced oxidative stress, elicited by 24-hour exposure to very low H 2 O 2 concentrations and mediated by both apoptotic and inflammatory pathways. This model reflects in vivo PC mechanisms occurring
Hossain, Md Motarab; Banik, Naren L; Ray, Swapan K
2012-08-01
Neuroblastoma is a solid tumor that mostly occurs in children. Malignant neuroblastomas have poor prognosis because conventional chemotherapeutic agents are hardly effective. Survivin, which is highly expressed in some malignant neuroblastomas, plays a significant role in inhibiting differentiation and apoptosis and promoting cell proliferation, invasion, and angiogenesis. We examined consequences of survivin knockdown by survivin short hairpin RNA (shRNA) plasmid and then treatment with (-)-epigallocatechin-3-gallate (EGCG), a green tea flavonoid, in malignant neuroblastoma cells. Our Western blotting and laser scanning confocal immunofluorescence microscopy showed that survivin was highly expressed in malignant neuroblastoma SK-N-BE2 and SH-SY5Y cell lines and slightly in SK-N-DZ cell line. Expression of survivin was very faint in malignant neuroblastoma IMR32 cell line. We transfected SK-N-BE2 and SH-SY-5Y cells with survivin shRNA, treated with EGCG, and confirmed knockdown of survivin at mRNA and protein levels. Survivin knockdown induced morphological features of neuronal differentiation, as we observed following in situ methylene blue staining. Combination of survivin shRNA and EGCG promoted neuronal differentiation biochemically by increases in the expression of NFP, NSE, and e-cadherin and also decreases in the expression of Notch-1, ID2, hTERT, and PCNA. Our in situ Wright staining and Annexin V-FITC/PI staining showed that combination therapy was highly effective in inducing, respectively, morphological and biochemical features of apoptosis. Apoptosis occurred with activation of caspase-8 and cleavage of Bid to tBid, increase in Bax:Bcl-2 ratio, mitochondrial release of cytochrome c, and increases in the expression and activity of calpain and caspase-3. Combination therapy decreased migration of cells through matrigel and inhibited proliferative (p-Akt and NF-κB), invasive (MMP-2 and MMP-9), and angiogenic (VEGF and b-FGF) factors. Also, in vitro
Directory of Open Access Journals (Sweden)
S. Caponi
2016-11-01
Full Text Available A living bio-hybrid system has been successfully implemented. It is constituted by neuroblastic cells, the SH-SY5Y human neuroblastoma cells, adhering to a poly-anyline (PANI a semiconductor polymer with memristive properties. By a multidisciplinary approach, the biocompatibility of the substrate has been analyzed and the functionality of the adhering cells has been investigated. We found that the PANI films can support the cell adhesion. Moreover, the SH-SY5Y cells were successfully differentiated into neuron-like cells for in vitro applications demonstrating that PANI can also promote cell differentiation. In order to deeply characterize the modifications of the bio-functionality induced by the cell-substrate interaction, the functional properties of the cells have been characterized by electrophysiology and Raman spectroscopy. Our results confirm that the PANI films do not strongly affect the general properties of the cells, ensuring their viability without toxic effects on their physiology. Ascribed to the adhesion process, however, a slight increase of the markers of the cell suffering has been evidenced by Raman spectroscopy and accordingly the electrophysiology shows a reduction at positive stimulations in the cells excitability.
Energy Technology Data Exchange (ETDEWEB)
Kazmi, S.M.I.; Mishra, R.K.
1986-06-13
Human neuroblastoma SH-SY5Y cells exhibited a heterogeneous population of ..mu.. and delta types of opioid binding sites. These specific binding sites displayed the characteristic saturability, stereospecificity and reversibility, expected of a receptor. Scatchard analysis of (/sup 3/H)-D-Ala/sup 2/-D-Leu/sup 5/-enkephalin (DADLE) in the presence of 10/sup -5/M D-Pro/sup 4/-morphiceptin (to block the ..mu.. receptors) and the competitive displacement by various highly selective ligands yielded the binding parameters of delta sites which closely resemble those of the delta receptors in brain and mouse neuroblastoma clones. Similarly, the high affinity binding of (/sup 3/H)-dihydromorphine, together with the higher potency of morphine analogues to displace (/sup 3/H)-naloxone binding established the presence of ..mu.. sites. Guanine nucleotides and NaCl significantly inhibited the association and increased the dissociation of (/sup 3/H)-DADLE binding.
Directory of Open Access Journals (Sweden)
Yongping Zhang
2017-03-01
Full Text Available Increased evidence suggests that marine unsaturated fatty acids (FAs can protect neurons from amyloid-β (Aβ-induced neurodegeneration. Nuclear magnetic resonance (NMR, high performance liquid chromatography (HPLC and gas chromatography (GC assays showed that the acetone extract 4-2A obtained from shrimp Pandalus borealis industry processing wastes contained 67.19% monounsaturated FAs and 16.84% polyunsaturated FAs. The present study evaluated the anti-oxidative and anti-inflammatory effects of 4-2A in Aβ25–35-insulted differentiated SH-SY5Y cells. Cell viability and cytotoxicity were measured by using 3-(4,5-Dimethylthiazol-2-yl-2,5-diphenyltetrazolium bromide (MTT and lactate dehydrogenase (LDH assays. Quantitative PCR and Western blotting were used to study the expression of neurotrophins, pro-inflammatory cytokines and apoptosis-related genes. Administration of 20 μM Aβ25–35 significantly reduced SH-SY5Y cell viability, the expression of nerve growth factor (NGF and its tyrosine kinase TrkA receptor, as well as the level of glutathione, while increased reactive oxygen species (ROS, nitric oxide, tumor necrosis factor (TNF-α, brain derived neurotrophic factor (BDNF and its TrkB receptor. Aβ25–35 also increased the Bax/Bcl-2 ratio and Caspase-3 expression. Treatment with 4-2A significantly attenuated the Aβ25–35-induced changes in cell viability, ROS, GSH, NGF, TrkA, TNF-α, the Bax/Bcl-2 ratio and Caspase-3, except for nitric oxide, BDNF and TrKB. In conclusion, 4-2A effectively protected SH-SY5Y cells against Aβ-induced neuronal apoptosis/death by suppressing inflammation and oxidative stress and up-regulating NGF and TrKA expression.
Hossain, Md. Motarab; Banik, Naren L.; Ray, Swapan K.
2012-01-01
Neuroblastoma is a solid tumor that mostly occurs in children. Malignant neuroblastomas have poor prognosis because conventional chemotherapeutic agents are hardly effective. Survivin, which is highly expressed in some malignant neuroblastomas, plays a significant role in inhibiting differentiation and apoptosis and promoting cell proliferation, invasion, and angiogenesis. We examined consequences of survivin knockdown by survivin short hairpin RNA (shRNA) plasmid and then treatment with (−)-epigallocatechin-3-gallate (EGCG), a green tea flavonoid, in malignant neuroblastoma cells. Our Western blotting and laser scanning confocal immunofluorescence microscopy showed that survivin was highly expressed in malignant neuroblastoma SK-N-BE2 and SH-SY5Y cell lines and slightly in SK-N-DZ cell line. Expression of survivin was very faint in malignant neuroblastoma IMR32 cell line. We transfected SK-N-BE2 and SH-SY-5Y cells with survivin shRNA, treated with EGCG, and confirmed knockdown of survivin at mRNA and protein levels. Survivin knockdown induced morphological features of neuronal differentiation, as we observed following in situ methylene blue staining. Combination of survivin shRNA and EGCG promoted neuronal differentiation biochemically by increases in expression of NFP, NSE, and e-cadherin and also decreases in expression of Notch-1, ID2, hTERT, and PCNA. Our in situ Wright staining and Annexin V-FITC/PI staining showed that combination therapy was highly effective in inducing, respectively, morphological and biochemical features of apoptosis. Apoptosis occurred with activation of caspase-8 and cleavage of Bid to tBid, increase in Bax:Bcl-2 ratio, mitochondrial release of cytochrome c, and increases in expression and activity of calpain and caspase-3. Combination therapy decreased migration of cells through matrigel and inhibited proliferative (p-Akt and NF-κB), invasive (MMP-2 and MMP-9), and angiogenic (VEGF and b-FGF) factors. Also, in vitro network
Zou, Ying-Xin; Liu, Yu-Xiang; Ruan, Ming-Hua; Zhou, Yi; Wang, Jia-Chun; Chu, Zhi-Yong
2016-01-01
Cordyceps sinensis has been used in traditional Chinese medicine for thousands of years. It has been demonstrated to have a variety of biological activities, and an extract of it has been demonstrated to possess a protective effect in occlusion-induced focal cerebral ischemia of the middle cerebral artery in rats. It could be explored as an agent for treatment of ischemic stroke, and the mechanisms need to be studied further. The study intended to investigate the protective effects of the Cordyceps sinensis oral liquid (CSOL) against damage induced by oxygen and glucose deprivation (OGD) in SH-SY5Y cells. DESIGN • The research team designed an in vitro study. The study occurred at the Naval Medical Research Institute in Shanghai, China. SH-SY5Y cells were exposed to CSOL in doses of 0.01, 0.03, 0.10, 0.30, and 1.00 mg/mL, creating 5 intervention groups. The OGD condition was induced by transfer of the cells from high-glucose Dulbecco's Modified Eagle's medium (DMEM) in a box gassed with air containing 5% CO2 to glucose-free DMEM in a box gassed with 94% N2, 5% CO2, and 1% O2. Like the cells for the interventions groups, the cells for a model group were cultured with high-glucose DMEM and were transferred to the OGD, but they received no dose of COSL. Cells in a control group were cultured with high-glucose DMEM, were not transferred to the OGD condition, and did not receive any dose of COSL. Cell viability was assayed using the 3-(4,5-dimethylthiazol-2-yl)-2,5-diphenyltetrazolium bromide (MTT) method. The apoptosis and the mitochondrial membrane potential (MMP) were detected by flow cytometry, and the protein expression of caspase-3 was observed by western blot. After exposure to OGD, the cell viability of cells treated with 0.01, 0.03, 0.10, 0.30, and 1.00 mg/mL of CSOL increased in a dose-effect relationship. Compared with the cells in the model group, the treatment of CSOL at all the experimental concentrations significantly inhibited both the cell apoptosis
Oh, Yoojung; Jeong, Kwon; Kim, Kiyoon; Lee, Young-Seok; Jeong, Suyun; Kim, Sung Soo; Yoon, Kyung-Sik; Ha, Joohun; Kang, Insug; Choe, Wonchae
2016-09-23
Parkinson's disease (PD) is the second most common neurodegenerative disorder of aging. PD involves a progressive loss of dopaminergic neurons in the substantia nigra pars compacta. 1-Methyl-4-phenyl-1, 2, 3, 6-tetrahydropyidine (MPTP) and its toxic metabolite 1-methyl-4-phenylpyridinium ion (MPP+) inhibit the complex I of the mitochondrial electron transport chain, and have been widely used to construct PD models. Cyclophilin B (CypB) is an endoplasmic reticulum protein that binds to cyclosporine A as a cyclophilin family member. CypB has peptidyl-prolyl cis-trans isomerase (PPIase) activity. We investigated the protective effects of overexpressed CypB on MPP+-induced neurocytotoxicity in SH-SY5Y human neuroblastoma cells. Overexpressed CypB decreased MPP(+)-induced oxidative stress through the modulation of antioxidant enzymes including manganese superoxide dismutase and catalase, and prevented neurocytotoxicity via mitogen-activated protein kinase, especially the c-Jun N-terminal kinase pathway. In addition, CypB inhibited the activation of MPP(+)-induced the pro-apoptotic molecules poly (ADP-ribose) polymerase, Bax, and Bcl-2, and attenuated MPP(+)-induced mitochondrial dysfunction. The data suggest that overexpressed CypB protects neuronal cells from MPP+-induced dopaminergic neuronal cell death. Copyright © 2016 Elsevier Inc. All rights reserved.
Kwon, Sangwoo; Yang, Woochul; Choi, Yun Kyong; Park, Jung Keuck
2014-05-01
Atomic force microscopy (AFM) is utilized in many studies for measuring the structure and the physical characteristics of soft and bio materials. In particular, the force spectroscopy function in the AFM system allows us to explore the mechanical properties of bio cells. In this study, we probe the variation in the membrane hardness of human neuroblastoma SH-SY5Y cells (SH-cells) before and after differentiation by using force spectroscopy. The SH-cell, which is usually differentiated by using a chemical treatment with retinoic acid (RA), is a neuronal cell line employed widely as an in-vitro model for neuroscience research. In force spectroscopy, the force-distance curves are obtained from both the original and the RA-treated cells while the AFM tip approaches and pushes on the cell membranes. The slope deduced from linear region in the force-distance curve is the spring constant and corresponds to the hardness of the cell membrane. The spring constant of the RA-treated cells (0.597 ± 0.010 nN/nm) was smaller than that of the original cells (0.794 ± 0.010 nN/nm), reflecting a hardness decrease in the cells differentiated with the RA treatments. The results clearly demonstrated that the differentiated cells are softer than the original cells. The change in the elasticity of the differentiated cells might be caused by morphological modification during differentiation process. We suggest that force spectroscopy can be employed as a novel method to determine the degree of differentiation of stem cells into various functional cells.
Zinc oxide nanoparticles and SH-SY5Y cell line
Zheng, Jinghui
The Arctic and sub-arctic regions are impacted by the growth of the global nanotechnology industry. Nanomaterials have unique chemical and physical properties that may lead to toxicological effects that interfere with normal cellular metabolism. Zinc oxide nanoparticles (ZnO NPs) are now very common and widely used in daily life. In industry, ZnO NPs are used to protect different materials from damage caused by UV exposure. The scientific literature suggests that ZnO NPs can have negative impacts on both living organisms and plants. However, there is a paucity of research on the mechanisms by which ZnO NPs may affect the neuronal cells. This study investigates how ZnO NPs interact with the neuroblastoma cell line SH-SY5Y. Using transmission electron microscopy, we observed that the ZnO NPs form 36 nm particles on average, and increase the level of vascular endothelial growth factor (VEGF) in extracellular fluid, as measured by an enzyme-linked immunosorbent assay (ELISA). Moreover, ZnO NPs, in presence of tumor necrosis factor-alpha (TNF-alpha), can also decrease the level of extracellular VEGF compared with TNF-alpha treatment alone. These findings suggest the basis for more studies on understanding the mechanism by which ZnO NPs impact cytokine signaling. Another direction is using ELISA technology to observe the interactions of NPs with different cell types such as neuronal stem cells.
Fujihara, Koji; Koike, Shin; Ogasawara, Yuki; Takahashi, Kunio; Koyama, Kiyotaka; Kinoshita, Kaoru
2017-07-01
Alzheimer's disease (AD) destroys brain function, especially in the hippocampus, and is a social problem worldwide. A major pathogenesis of AD is related to the accumulation of amyloid beta (Aβ) peptides, resulting in neuronal cell death in the brain. Here, we isolated four saponins (1-4) and elucidated their structures from 1D and 2D NMR and HRFABMS spectral data. The structures of 1 and 2 were determined as new saponins which have cochalic acid as the aglycon, and 3 was determined as a new saponin with oleanolic acid as the aglycon. Compound 4 was confirmed as the known saponin chikusetsusaponin V (=ginsenoside R 0 ). Isolated saponins (1-4) and six previously reported saponins (5-10) were tested for their inhibitory effects of Aβ aggregation and their protective effects on SH-SY5Y cells against Aβ-associated toxicity. As the results, compounds 3 and 4 showed inhibitory effect of Aβ aggregation and compounds 5-8 exerted the protective effects on SH-SY5Y cells against Aβ-associated toxicity. Copyright © 2017 Elsevier Ltd. All rights reserved.
de Oliveira, Marcos Roberto; da Costa Ferreira, Gustavo; Brasil, Flávia Bittencourt; Peres, Alessandra
2018-02-01
Mitochondria are susceptible to redox impairment, which has been associated with neurodegeneration. These organelles are both a source and target of reactive species. In that context, there is increasing interest in finding natural compounds that modulate mitochondrial function and mitochondria-related signaling in order to prevent or to treat diseases involving mitochondrial impairment. Herein, we investigated whether and how pinocembrin (PB) would prevent mitochondrial dysfunction elicited by the exposure of human neuroblastoma SH-SY5Y cells to hydrogen peroxide (H 2 O 2 ). PB (25 μM) was administrated for 4 h before H 2 O 2 treatment (300 μM for 24 h). PB prevented H 2 O 2 -induced loss of cell viability mitochondrial depolarization in SH-SY5Y cells. PB also attenuated redox impairment in mitochondrial membranes. The production of superoxide anion radical (O 2 -• ) and nitric oxide (NO • ) was alleviated by PB in cells exposed to H 2 O 2 . PB suppressed the H 2 O 2 -induced inhibition of the tricarboxylic acid (TCA) cycle enzymes aconitase, α-ketoglutarate dehydrogenase, and succinate dehydrogenase. Furthermore, PB induced anti-inflammatory effects by abolishing the H 2 O 2 -dependent activation of the nuclear factor-κB (NF-κB) and upregulation of interleukin-1β (IL-1β) and tumor necrosis factor-α (TNF-α). The PB-induced antioxidant and anti-inflammatory effects are dependent on the heme oxygenate-1 (HO-1) enzyme and on the activation of the transcription factor nuclear factor erythroid 2-related factor 2 (Nrf2), since HO-1 inhibition (with 0.5 μM ZnPP IX) or Nrf2 silencing (with small interfering RNA (siRNA)) abolished the effects of PB. Overall, PB afforded cytoprotection by the Nrf2/HO-1 axis in H 2 O 2 -treated SH-SY5Y cells.
Directory of Open Access Journals (Sweden)
Sergio Perez-Alvarez
2012-01-01
Full Text Available Previously, we have shown that SH-SY5Y cells exposed to high concentrations of methadone died due to a necrotic-like cell death mechanism related to delayed calcium deregulation (DCD. In this study, we show that, in terms of their Ca2+ responses to 0.5 mM methadone, SH-SY5Y cells can be pooled into four different groups. In a broad pharmacological survey, the relevance of different Ca2+-related mechanisms on methadone-induced DCD was investigated including extracellular calcium, L-type Ca2+ channels, μ-opioid receptor, mitochondrial inner membrane potential, mitochondrial ATP synthesis, mitochondrial Ca2+/2Na+-exchanger, reactive oxygen species, and mitochondrial permeability transition. Only those compounds targeting mitochondria such as oligomycin, FCCP, CGP 37157, and cyclosporine A were able to amend methadone-induced Ca2+ dyshomeostasis suggesting that methadone induces DCD by modulating the ability of mitochondria to handle Ca2+. Consistently, mitochondria became dramatically shorter and rounder in the presence of methadone. Furthermore, analysis of oxygen uptake by isolated rat liver mitochondria suggested that methadone affected mitochondrial Ca2+ uptake in a respiratory substrate-dependent way. We conclude that methadone causes failure of intracellular Ca2+ homeostasis, and this effect is associated with morphological and functional changes of mitochondria. Likely, this mechanism contributes to degenerative side effects associated with methadone treatment.
Budni, J; Romero, A; Molz, S; Martín-de-Saavedra, M D; Egea, J; Del Barrio, L; Tasca, C I; Rodrigues, A L S; López, M G
2011-09-08
Folic acid (folate) is a vitamin of the B-complex group that is essential for cell replication. Folate is a major determinant of one-carbon metabolism, in which S-adenosylmethionine donates methyl groups that are crucial for neurological function. Many roles for folic acid have been reported, including neuroprotective and antidepressant properties. On the other hand, increased concentrations of corticoids have proven neurotoxic effects and hypersecretion of glucocorticoids has been linked to different mood disorders. The purpose of this study was to investigate the potential protective effect of folic acid on dexamethasone-induced cellular death in SH-SY5Y neuroblastoma cell line and the possible intracellular signaling pathway involved in such effect. Exposure to 1 mM dexamethasone for 48 h caused a significant reduction of cell viability measured as 3-[4,5 dimethylthiazol-2-yl]-2,5-diphenyl-tetrazolium bromide (MTT) reduction. Exposure of SH-SY5Y cells for 72 h to increasing concentrations of folate (1-300 μM) was not cytotoxic. However, pretreatment with folate (10-300 μM) reduced dexamethasone-induced toxicity in a significant manner. To explore the putative intracellular signaling pathways implicated in the protective effect of folate we used different protein kinase inhibitors. The protective effect of folic acid on dexamethasone-induced neurotoxicity was reversed by the phosphatidylinositol-3 kinase/Akt (PI3K/Akt, LY294002), Ca²⁺/Calmodulin-dependent protein kinase II (CaMKII, KN-93), and protein kinase A (PKA, H-89) inhibitors, but not the mitogen-activated protein/extracellular signal-regulated kinase (MEK1/2, PD98059) and protein kinase C (PKC, chelerythrine) inhibitors. In conclusion, the results of this study show that folic acid can protect against dexamethasone-induced neurotoxicity and its protective mechanism is related to a signaling pathway that involves PI3K/Akt, CaMKII, and PKA. Copyright © 2011. Published by Elsevier Ltd.
Ramkumar, Muthu; Rajasankar, Srinivasagam; Gobi, Veerappan Venkatesh; Dhanalakshmi, Chinnasamy; Manivasagam, Thamilarasan; Justin Thenmozhi, Arokiasamy; Essa, Musthafa Mohamed; Kalandar, Ameer; Chidambaram, Ranganathan
2017-04-18
Mitochondrial dysfunction and oxidative stress are the main toxic events leading to dopaminergic neuronal death in Parkinson's disease (PD) and identified as vital objective for therapeutic intercession. This study investigated the neuro-protective effects of the demethoxycurcumin (DMC), a derivative of curcumin against rotenone induced neurotoxicity. SH-SY5Y neuroblastoma cells are divided into four experimental groups: untreated cells, cells incubated with rotenone (100 nM), cells treated with DMC (50 nM) + rotenone (100 nM) and DMC alone treated. 24 h after treatment with rotenone and 28 h after treatment with DMC, cell viability was assessed using the MTT assay, and levels of ROS and MMP, plus expression of apoptotic protein were analysed. Rotenone induced cell death in SH-SY5Y cells was significantly reduced by DMC pretreatment in a dose-dependent manner, indicating the potent neuroprotective effects of DMC. Rotenone treatment significantly increases the levels of ROS, loss of MMP, release of Cyt-c and expression of pro-apoptotic markers and decreases the expression of anti-apoptotic markers. Even though the results of the present study indicated that the DMC may serve as a potent therapeutic agent particularly for the treatment of neurodegenerative diseases like PD, further pre-clinical and clinical studies are required.
Song, Ju-Xian; Shaw, Pang-Chui; Wong, Ngok-Shun; Sze, Cho-Wing; Yao, Xin-Sheng; Tang, Chi-Wai; Tong, Yao; Zhang, Yan-Bo
2012-07-11
Chrysotoxine is a naturally occurring bibenzyl compound found in medicinal Dendrobium species. We previously reported that chrysotoxine structure-specifically suppressed 6-hydroxydopamine (6-OHDA)-induced dopaminergic cell death. Whether chrysotoxine and other structurally similar bibenzyl compounds could also inhibit the neurotoxicity of 1-methyl-4-phenyl pyridinium (MPP(+)) and rotenone has not been investigated. We showed herein that chrysotoxine inhibited MPP(+), but not rotenone, induced dopaminergic cell death in SH-SY5Y cells. The overproduction of reactive oxygen species (ROS), mitochondrial dysfunction as indexed by the decrease in membrane potential, increase in calcium concentration and NF-κB activation triggered by MPP(+) were blocked by chrysotoxine pretreatment. The imbalance between the pro-apoptotic signals (Bax, caspase-3, ERK and p38 MAPK) and the pro-survival signals (Akt/PI3K/GSK-3β) induced by MPP(+) was partially or totally rectified by chrysotoxine. The results indicated that ROS inhibition, mitochondria protection, NF-κB modulation and regulation of multiple signals determining cell survival and cell death were involved in the protective effects of chrysotoxine against MPP(+) toxicity in SH-SY5Y cells. Given the different toxic profiles of 6-OHDA and MPP(+) as compared to rotenone, our results also indicated that DAT inhibition may partially account for the neuroprotective effects of chrysotoxine. Copyright © 2012 Elsevier Ireland Ltd. All rights reserved.
Shen, Wei-Bin; Vaccaro, Dennis E; Fishman, Paul S; Groman, Ernest V; Yarowsky, Paul
2016-05-01
This is the first report of the synthesis of a new nanoparticle, sans iron oxide rhodamine B (SIRB), an example of a new class of nanoparticles. SIRB is designed to provide all of the cell labeling properties of the ultrasmall superparamagnetic iron oxide (USPIO) nanoparticle Molday ION Rhodamine B (MIRB) without containing the iron oxide core. MIRB was developed to label cells and allow them to be tracked by MRI or to be manipulated by magnetic gradients. SIRB possesses a similar size, charge and cross-linked dextran coating as MIRB. Of great interest is understanding the biological and physiological changes in cells after they are labeled with a USPIO. Whether these effects are due to the iron oxide buried within the nanoparticle or to the surface coating surrounding the iron oxide core has not been considered previously. MIRB and SIRB represent an ideal pairing of nanoparticles to identify nanoparticle anatomy responsible for post-labeling cytotoxicity. Here we report the effects of SIRB labeling on the SH-SY5Y neuroblastoma cell line and primary human neuroprogenitor cells (hNPCs). These effects are contrasted with the effects of labeling SH-SY5Y cells and hNPCs with MIRB. We find that SIRB labeling, like MIRB labeling, (i) occurs without the use of transfection reagents, (ii) is packaged within lysosomes distributed within cell cytoplasm, (iii) is retained within cells with no loss of label after cell storage, and (iv) does not alter cellular viability or proliferation, and (v) SIRB labeled hNPCs differentiate normally into neurons or astrocytes. Copyright © 2016 John Wiley & Sons, Ltd. Copyright © 2016 John Wiley & Sons, Ltd.
DEFF Research Database (Denmark)
Tanii, H; Ankarcrona, M; Flood, F
2000-01-01
. In the present study, we determined whether PS1 mutations also sensitize cells to hyperosmotic stress-induced apoptosis. For this, we established SH-SY5Y neuroblastoma cell lines stably transfected with wild-type PS1 or either the PS1 exon 9 deletion (deltaE9) or PS1 L250S mutants. Cultured cells were exposed...
Directory of Open Access Journals (Sweden)
Liu Lei
2008-12-01
Full Text Available Abstract Background Parkinson's disease, the most common adult neurodegenerative movement disorder, demonstrates a brain-wide pathology that begins pre-clinically with alpha-synuclein aggregates ("Lewy neurites" in processes of gut enteric and vagal motor neurons. Rostral progression into substantia nigra with death of dopamine neurons produces the motor impairment phenotype that yields a clinical diagnosis. The vast majority of Parkinson's disease occurs sporadically, and current models of sporadic Parkinson's disease (sPD can utilize directly infused or systemic neurotoxins. Results We developed a differentiation protocol for human SH-SY5Y neuroblastoma that yielded non-dividing dopaminergic neural cells with long processes that we then exposed to 50 nM rotenone, a complex I inhibitor used in Parkinson's disease models. After 21 days of rotenone, ~60% of cells died. Their processes retracted and accumulated ASYN-(+ and UB-(+ aggregates that blocked organelle transport. Mitochondrial movement velocities were reduced by 8 days of rotenone and continued to decline over time. No cytoplasmic inclusions resembling Lewy bodies were observed. Gene microarray analyses showed that the majority of genes were under-expressed. qPCR analyses of 11 mtDNA-encoded and 10 nDNA-encoded mitochondrial electron transport chain RNAs' relative expressions revealed small increases in mtDNA-encoded genes and lesser regulation of nDNA-encoded ETC genes. Conclusion Subacute rotenone treatment of differentiated SH-SY5Y neuroblastoma cells causes process retraction and partial death over several weeks, slowed mitochondrial movement in processes and appears to reproduce the Lewy neuritic changes of early Parkinson's disease pathology but does not cause Lewy body inclusions. The overall pattern of transcriptional regulation is gene under-expression with minimal regulation of ETC genes in spite of rotenone's being a complex I toxin. This rotenone-SH-SY5Y model in a
International Nuclear Information System (INIS)
Wu, C.-W.; Ping, Y.-H.; Yen, J.-C.; Chang, C.-Y.; Wang, S.-F.; Yeh, C.-L.; Chi, C.-W.; Lee, H.-C.
2007-01-01
Methamphetamine (METH) is an abused drug that may cause psychiatric and neurotoxic damage, including degeneration of monoaminergic terminals and apoptosis of non-monoaminergic cells in Brain. The cellular and molecular mechanisms underlying these METH-induced neurotoxic effects remain to be clarified. In this study, we performed a time course assessment to investigate the effects of METH on intracellular oxidative stress and mitochondrial alterations in a human dopaminergic neuroblastoma SH-SY5Y cell line. We characterized that METH induces a temporal sequence of several cellular events including, firstly, a decrease in mitochondrial membrane potential within 1 h of the METH treatment, secondly, an extensive decline in mitochondrial membrane potential and increase in the level of reactive oxygen species (ROS) after 8 h of the treatment, thirdly, an increase in mitochondrial mass after the drug treatment for 24 h, and finally, a decrease in mtDNA copy number and mitochondrial proteins per mitochondrion as well as the occurrence of apoptosis after 48 h of the treatment. Importantly, vitamin E attenuated the METH-induced increases in intracellular ROS level and mitochondrial mass, and prevented METH-induced cell death. Our observations suggest that enhanced oxidative stress and aberrant mitochondrial biogenesis may play critical roles in METH-induced neurotoxic effects
Bajinskis, Ainars; Lindegren, Heléne; Johansson, Lotta; Harms-Ringdahl, Mats; Forsby, Anna
2011-02-01
The effects of low doses of ionizing radiation on cellular development in the nervous system are presently unclear. The focus of the present study was to examine low-dose γ-radiation-induced effects on the differentiation of neuronal cells and on the development of neural stem cells to glial cells. Human neuroblastoma SH-SY5Y cells were exposed to (137)Cs γ rays at different stages of retinoic acid-induced neuronal differentiation, and neurite formation was determined 6 days after exposure. When SH-SY5Y cells were exposed to low-dose-rate γ rays at the onset of differentiation, the number of neurites formed per cell was significantly less after exposure to either 10, 30 or 100 mGy compared to control cells. Exposure to 10 and 30 mGy attenuated differentiation of immature C17.2 mouse-derived neural stem cells to glial cells, as verified by the diminished expression of glial fibrillary acidic protein. Proteomic analysis of the neuroblastoma cells by 2D-PAGE after 30 mGy irradiation showed that proteins involved in neuronal development were downregulated. Proteins involved in cell cycle and proliferation were altered in both cell lines after exposure to 30 mGy; however, the rate of cell proliferation was not affected in the low-dose range. The radiation-induced attenuation of differentiation and the persistent changes in protein expression is indicative of an epigenetic rather than a cytotoxic mechanism.
Polychlorinated Biphenyls Induce Mitochondrial Dysfunction in SH-SY5Y Neuroblastoma Cells.
Directory of Open Access Journals (Sweden)
Stefania Cocco
Full Text Available Chronic exposure to polychlorinated biphenyls (PCBs, ubiquitous environmental contaminants, can adversely affect the development and function of the nervous system. Here we evaluated the effect of PCB exposure on mitochondrial function using the PCB mixture Aroclor-1254 (A1254 in SH-SY5Y neuroblastoma cells. A 6-hour exposure to A1254 (5 μg/ml reduced cellular ATP production by 45%±7, and mitochondrial membrane potential, detected by TMRE, by 49%±7. Consistently, A1254 significantly decreased oxidative phosphorylation and aerobic glycolysis measured by extracellular flux analyzer. Furthermore, the activity of mitochondrial protein complexes I, II, and IV, but not V (ATPase, measured by BN-PAGE technique, was significantly reduced after 6-hour exposure to A1254. The addition of pyruvic acid during exposure to A1254 significantly prevent A1254-induced cell injury, restoring resting mitochondrial membrane potential, ATP levels, oxidative phosphorylation and aerobic glycolysis. Furthermore, pyruvic acid significantly preserved the activity of mitochondrial complexes I, II and IV and increased basal activity of complex V. Collectively, the present results indicate that the neurotoxicity of A1254 depends on the impairment of oxidative phosphorylation, aerobic glycolysis, and mitochondrial complexes I, II, and IV activity and it was counteracted by pyruvic acid.
International Nuclear Information System (INIS)
Chen Yan; Yu Min; Jones, Dean P.; Greenamyre, J. Timothy; Cai Jiyang
2006-01-01
Mitochondrial oxidative stress plays important roles in aging and age-related degenerative disorders. The newly identified mitochondrial thioredoxin (mtTrx; Trx2) is a key component of the mitochondrial antioxidant system which is responsible for the clearance of reactive intermediates and repairs proteins with oxidative damage. Here, we show that in cultured SH-SY5Y human neuroblastoma 1cells, overexpression of mtTrx inhibited apoptosis and loss of mitochondrial membrane potential induced by a chemical oxidant, tert-butylhydroperoxide (tBH). The effects of calcium ionophore (Br-A23187) were not affected by mtTrx, suggesting the protection was specific against oxidative injury. The mitochondrial glutathione pool was oxidized by tBH, and this oxidation was not inhibited by increased mtTrx. Consequently, the antioxidant function of mtTrx is not redundant, but rather in addition, to that of GSH. Mutations of Cys90 and Cys93 to serines rendered mtTrx ineffective in protection against tBH-induced cytoxicity. These data indicate that mtTrx controls the mitochondrial redox status independently of GSH and is a key component of the defensive mechanism against oxidative stress in cultured neuronal cells
Tian, Xing; Gao, Lingyue; An, Li; Jiang, Xiaowen; Bai, Junpeng; Huang, Jian; Meng, Weihong; Zhao, Qingchun
2016-12-01
Compound MQA (1,5-O-dicaffeoyl-3-O-[4-malic acid methyl ester]-quinic acid) is a natural caffeoylquinic acid derivative isolated from Arctium lappa L. roots. This study aims to explore the neuroprotective effects of MQA against hydrogen peroxide (H 2 O 2 )-induced oxidative stress in SH-SY5Y neuroblastoma cells. The SH-SY5Y cells were divided into four groups, including control, 20 μM MQA, 200 μM H2O2, 200 μM H2O2 + 20 μM MQA groups. The effects of MQA on H 2 O 2 -induced cell death were measured by MTT and LDH assays. Hoechst 33342 and Annexin V-PI double staining were used to observed H2O2-induced apoptosis. Also, the effects of MQA on antioxidant system and mitochondrial pathway were explored. Further, steady-state phosphorylation levels of ERK1/2, Akt and GSK-3β were examined by Western blot analysis. Pretreatment with MQA prevented cell death in SH-SY5Y cells exposed to 200 μM H2O2 for 3 h. Meanwhile, Hoechst 33342 and Annexin V-PI double staining showed that MQA attenuated H 2 O 2 -induced apoptosis. These changes are related to elevation in SOD activity, reduction in MDA production and ROS formation, and increases in mitochondrial membrane potential (MMP). In addition, the potential mechanisms of MQA against H 2 O 2 -induced apoptosis are associated with increases in the Bcl-2/Bax ratio, decreases in cytochrome c release, caspase-3 and caspase-9 expressions, phosphorylation of ERK1/2, and dephosphorylation of AKT and GSK-3β. These findings suggest that protective effects of MQA against H 2 O 2 -induced apoptosis might be associated with mitochondrial apoptosis, ERK1/2 and AKT/GSK-3β pathway.
Pouresmaeili-Babaki, Elham; Esmaeili-Mahani, Saeed; Abbasnejad, Mehdi; Ravan, Hadi
2018-04-01
Parkinson's disease (PD) is a severe neurodegenerative disorder characterized by the loss of brain dopaminergic neurons. Beside pharmacologic and symptomatic treatment of PD the neuroprotective therapy has recently attracted more attention. Apelin, a novel neuropeptide, and its receptors have numerous reported roles in regulating brain functions. In addition, this peptide has potent neuroprotective effects in some neurodegenerative situations. In this study, the effects of apelin-13 were investigated in a cell model of PD. Human neuroblastoma SH-SY5Y cell damage was induced by 150 μM 6-hydroxydopamine (6-OHDA) and the cells viability was examined by MTT assay. Intracellular reactive oxygen species (ROS) and mitochondrial membrane potential were determined by fluorescence spectrophotometry method. Immunoblotting analysis was also employed to evaluate cytochrome c release and caspase-3 activity. Data showed that 6-OHDA could decrease cell viability and mitochondrial membrane potential and increase intracellular ROS, cytochrome c, and cleaved caspase-3 levels. Pretreatment of SH-SY5Y cells with apelin-13 (5 and 10 nM) significantly prevented the mentioned biochemical and molecular markers of 6-OHDA-induced neurotoxicity. Furthermore, the results showed that apelin receptor and PI3K signaling contributed to the observed protective effects of apelin. The results suggest that apelin-13 has protective effects against dopaminergic neural toxicity and its antioxidant and antiapoptotic properties are involved, at least in part, in such protection.
Manavalan, Sridharan; Getachew, Bruk; Manaye, Kebreten F; Khundmiri, Syed J; Csoka, Antonei B; McKinley, Raechel; Tamas, Andrea; Reglodi, Dora; Tizabi, Yousef
2017-07-01
The detrimental effects of heavy drinking and smoking are multiplied when the two are combined. Treatment modalities for each and especially for the combination are very limited. Although in low concentration, alcohol and nicotine, each may have beneficial effects including neuroprotection, their combination, instead of providing additive protection, may actually lead to toxicity in cell cultures. Pituitary adenylate cyclase-activating polypeptide (PACAP) is an endogenous 38 amino-acid peptide with demonstrated protection against neuronal injury, trauma as well as various endogenous and exogenous toxic agents. The aim of this study was to investigate whether PACAP may also protect against toxicity induced by high alcohol, high nicotine, or the combination of low alcohol and nicotine concentrations, and if so, whether this effect was mediated via PAC1 receptor. We used the neuroblastoma-derived SH-SY5Y cells and applied various colorimetric assays for determination of cell viability or toxicity. Results indicate that PACAP blocks toxicity induced by high alcohol and high nicotine as well as their combination at low concentrations. The effects of PACAP in turn were blocked by the PACAP antagonist (PACAP 6-38), indicating involvement of the PACAP receptor PAC1 and possibly vasoactive intestinal peptide (VIP) receptors in PACAP's protection. Moreover, no combined toxicity of low alcohol and low nicotine could be detected in calcium-free medium. These findings suggest possible beneficial effects of PACAP in preventing alcohol and nicotine toxicity and that calcium contributes to the damage induced by combination of low alcohol and nicotine in SH-SY5Y cells.
Shiohira, Hideo; Kitaoka, Akira; Enjoji, Munechika; Uno, Tsukasa; Nakashima, Manabu
2012-01-01
Am80, a synthetic retinoid, has been used in differentiation therapy for acute promyelocytic leukemia (APL). All-trans retinoic acid (ATRA) as one of natural retinoid has been also used to treat APL. ATRA treatment causes neuronal differentiation by inducing tropomyosin-related kinase B (TrkB) expression and increasing the sensitivity to brain-derived neurotrophic factor (BDNF), a TrkB ligand. In the present study, we investigated the effects of Am80 on neuronal differentiation, BDNF sensitivity and TrkB expression in human neuroblastoma SH-SY5Y cells. Treatment with Am80 induced morphological differentiation of neurite outgrowth and increased the expression of GAP43 mRNA, a neuronal differentiation marker. Additionally, TrkB protein was also increased, and exogenous BDNF stimulation after treatment with Am80 induced greater neurite outgrowth than without BDNF treatment. These results suggest that Am80 induced neuronal differentiation by increasing TrkB expression and BDNF sensitivity.
Directory of Open Access Journals (Sweden)
Alba Garcimartín
2017-08-01
Full Text Available The involvement of cholinergic system and the reactive oxygen species (ROS in the pathogenesis of some degenerative diseases has been widely reported; however, the specific impact of hydrogen peroxide (H2O2 on the acetylcholinesterase (AChE activity as well as AChE isoform levels has not been clearly established. Hence, the purpose of present study is to clarify whether H2O2 alters these parameters.Human neuroblastoma SH-SY5Y cells were treated with H2O2 (1–1000 µM for 24 h and AChE activity and AChE and cytochrome c levels were evaluated. AChE activity was strongly increased from 1 µM to 1000 µM of H2O2. The results of the kinetic study showed that H2O2 affected Vmax but not Km; and also that H2O2 changed the sigmoid kinetic observed in control samples to hyperbolic kinetic. Thus, results suggest that H2O2 acts as an allosteric activators. In addition, H2O2, (100–1000 µM reduced the total AChE content and modified its isoform profile (mainly 50-, 70-, and 132-kDa·H2O2 from 100 µM to 1000 µM induced cytochrome c release confirming cell death by apoptosis. All these results together suggest: a the involvement of oxidative stress in the imbalance of AChE; and b treatment with antioxidant agents may be a suitable strategy to protect cholinergic system alterations promoted by oxidative stress. Keywords: Acetylcholinesterase, Hydrogen peroxide, Alternative splicing, Cell culture, Cell death
Directory of Open Access Journals (Sweden)
Hai-Jie Yang
2018-05-01
Full Text Available The cold shock protein RBM3 can mediate mild hypothermia-related protection in neurodegeneration such as Alzheimer's disease. However, it remains unclear whether RBM3 and mild hypothermia provide same protection in model of Parkinson's disease (PD, the second most common neurodegenerative disorder. In this study, human SH-SY5Y neuroblastoma cells subjected to insult by 1-methyl-4-phenylpyridinium (MPP+ served as an in-vitro model of PD. Mild hypothermia (32°C aggravated MPP+-induced apoptosis, which was boosted when RBM3 was silenced by siRNA. In contrast, overexpression of RBM3 significantly reduced this apoptosis. MPP+ treatment downregulated the expression of RBM3 both endogenously and exogenously and suppressed its induction by mild hypothermia (32°C. In conclusion, our data suggest that cold shock protein RBM3 provides neuroprotection in a cell model of PD, suggesting that RBM3 induction may be a suitable strategy for PD therapy. However, mild hypothermia exacerbates MPP+-induced apoptosis even that RBM3 could be synthesized during mild hypothermia.
Directory of Open Access Journals (Sweden)
Ana Marote
2016-11-01
Full Text Available Poly (L-lactic acid (PLLA is a biodegradable and biocompatible polymer that has been put forward as a promising material for therapeutic approaches aiming to restore neuronal function. The topographic cues present in PLLA-based scaffolds, defined by the technique used in their preparation, have been shown to play a role on the cellular behavior of adherent cells. Even though this interaction has been shown to influence the regenerative output of the scaffold, there is a lack of studies addressing this response at the proteomic level. Hence, this work focuses on the effect of electrospun PLLA-based nanofibers on the proteome, cellular processes and signaling pathways of SH-SY5Y neuroblastoma cells. It also further explores how these molecular mediators might influence cell proliferation and differentiation upon in vitro culture. For that, mass spectrometry followed by bioinformatics analysis was firstly performed and further complemented with Western blot, cell viability and imaging assays. Results show that PLLA nanofibers differentially activate and inhibit specific cellular functions and signaling pathways related to cell division, apoptosis, actin remodeling, among others. These ultimately block cellular proliferation and induce morphological rearrangements through cytoskeleton remodeling, adaptations that turn cells more prone to differentiate. In synthesis, PLLA nanofibers shift the SH-SY5Y cells proteome towards a state more responsive to differentiation-inductive cues such as the retinoic acid. Unveiling cells responses to nanomaterials is an important step to increase the tools available for their manipulation and potentiate their use in neural tissue engineering. Further studies should be performed to compare the effects of other topographic cues on cellular behavior.
Muscella, Antonella; Vetrugno, Carla; Calabriso, Nadia; Cossa, Luca Giulio; De Pascali, Sandra Angelica; Fanizzi, Francesco Paolo; Marsigliante, Santo
2014-01-01
We previously showed that [Pt(O,O’-acac)(γ-acac)(DMS)] ([Pt(acac)2(DMS)]) exerted substantial cytotoxic effects in SH-SY5Y neuroblastoma cells, and decreased metalloproteases (MMPs) production and cells migration in MCF-7 breast cancer cells. The ubiquitously distributed sodium-hydrogen antiporter 1 (NHE1) is involved in motility and invasion of many solid tumours. The present study focuses on the effects of [Pt(acac)2(DMS)] in SH-SY5Y cell migration and also on the possibility that NHE1 may be involved in such effect. After sublethal [Pt(acac)2(DMS)] treatment cell migration was examined by wounding assay and cell invasion by transwell assay. NHE1 activity was measured in BCECF-loaded SH-SY5Y as the rate of Na+-dependent intracellular pH recovery in response to an acute acid pulse. Gelatin zymography for MMP-2/9 activities, Western blottings of MMPs, MAPKs, mTOR, S6 and PKCs and small interfering RNAs to PKC-ε/-δ mRNA were performed. Sublethal concentrations of [Pt(acac)2(DMS)] decreases NHE1 activity, inhibites cell migration and invasion and decreases expression and activity of MMP-2 and -9. [Pt(acac)2(DMS)] administered to SH-SY5Y cells provokes the increment of ROS, generated by NADPH oxidase, responsible for the PKC-ε and PKC-δ activation. Whilst PKC-δ activates p38/MAPK, responsible for the inhibition of MMP-2 and -9 secretion, PKC-ε activates a pathway made of ERK1/2, mTOR and S6K responsible for the inhibition of NHE1 activity and cell migration. In conclusion, we have shown a drastic impairment in tumour cell metastatization in response to inhibition of NHE1 and MMPs activities by [Pt(acac)2(DMS)] occurring through a novel mechanism mediated by PKC-δ/-ε activation. PMID:25372487
Muscella, Antonella; Vetrugno, Carla; Calabriso, Nadia; Cossa, Luca Giulio; De Pascali, Sandra Angelica; Fanizzi, Francesco Paolo; Marsigliante, Santo
2014-01-01
We previously showed that [Pt(O,O'-acac)(γ-acac)(DMS)] ([Pt(acac)2(DMS)]) exerted substantial cytotoxic effects in SH-SY5Y neuroblastoma cells, and decreased metalloproteases (MMPs) production and cells migration in MCF-7 breast cancer cells. The ubiquitously distributed sodium-hydrogen antiporter 1 (NHE1) is involved in motility and invasion of many solid tumours. The present study focuses on the effects of [Pt(acac)2(DMS)] in SH-SY5Y cell migration and also on the possibility that NHE1 may be involved in such effect. After sublethal [Pt(acac)2(DMS)] treatment cell migration was examined by wounding assay and cell invasion by transwell assay. NHE1 activity was measured in BCECF-loaded SH-SY5Y as the rate of Na+-dependent intracellular pH recovery in response to an acute acid pulse. Gelatin zymography for MMP-2/9 activities, Western blottings of MMPs, MAPKs, mTOR, S6 and PKCs and small interfering RNAs to PKC-ε/-δ mRNA were performed. Sublethal concentrations of [Pt(acac)2(DMS)] decreases NHE1 activity, inhibits cell migration and invasion and decreases expression and activity of MMP-2 and -9. [Pt(acac)2(DMS)] administered to SH-SY5Y cells provokes the increment of ROS, generated by NADPH oxidase, responsible for the PKC-ε and PKC-δ activation. Whilst PKC-δ activates p38/MAPK, responsible for the inhibition of MMP-2 and -9 secretion, PKC-ε activates a pathway made of ERK1/2, mTOR and S6K responsible for the inhibition of NHE1 activity and cell migration. In conclusion, we have shown a drastic impairment in tumour cell metastatization in response to inhibition of NHE1 and MMPs activities by [Pt(acac)2(DMS)] occurring through a novel mechanism mediated by PKC-δ/-ε activation.
Schmidt, Andreas Johannes; Hemmeter, Ulrich Michael; Krieg, Jürgen-Christian; Vedder, Helmut; Heiser, Philip
2009-05-01
Antipsychotics are known to alter antioxidant activities in vivo. Therefore, the aim of the present study was to examine in the human neuroblastoma SH-SY5Y cell line the impact of a typical (haloperidol) and an atypical (quetiapine) antipsychotic on the expression of genes encoding the key enzymes of the antioxidant metabolism (Cu, Zn superoxide dismutase; Mn superoxide dismutase; glutathione peroxidase; catalase) and enzymes of the glutathione metabolism (gamma-glutamyl cysteine synthetase, glutathione-S-transferase, gamma-glutamyltranspeptidase, glutathione reductase). The cells were incubated for 24h with 0.3, 3, 30 and 300microM haloperidol and quetiapine, respectively; mRNA levels were measured by polymerase chain reaction. In the present study, we observed mostly significant decreases of mRNA contents. With respect to the key pathways, we detected mainly effects on the mRNA levels of the hydrogen peroxide detoxifying enzymes. Among the enzymes of the glutathione metabolism, glutathione-S-transferase- and gamma-glutamyltranspeptidase-mRNA levels showed the most prominent effects. Taken together, our results demonstrate a significantly reduced expression of genes encoding for antioxidant enzymes after treatment with the antipsychotics, haloperidol and quetiapine.
Energy Technology Data Exchange (ETDEWEB)
Lee, Jeong Eun [Department of Pharmacology, College of Medicine, Hanyang University, Seoul (Korea, Republic of); Hanyang Biomedical Research Institute, Seoul (Korea, Republic of); Park, Jae Hyeon; Jang, Sea Jeong [Hanyang Biomedical Research Institute, Seoul (Korea, Republic of); Graduate School of Biomedical Science and Engineering, Hanyang University, Seoul (Korea, Republic of); Koh, Hyun Chul, E-mail: hckoh@hanyang.ac.kr [Department of Pharmacology, College of Medicine, Hanyang University, Seoul (Korea, Republic of); Hanyang Biomedical Research Institute, Seoul (Korea, Republic of); Graduate School of Biomedical Science and Engineering, Hanyang University, Seoul (Korea, Republic of)
2014-07-15
Oxidative stress can lead to expression of inflammatory transcription factors, which are important regulatory elements in the induction of inflammatory responses. One of the transcription factors, nuclear transcription factor kappa-B (NF-κB) plays a significant role in the inflammation regulatory process. Inflammatory cell death has been implicated in neuronal cell death in some neurodegenerative disorders such as Parkinson's disease (PD). In this study, we investigated the molecular mechanisms underlying apoptosis initiated by chlorpyrifos (CPF)-mediated oxidative stress. Based on the cytotoxic mechanism of CPF, we examined the neuroprotective effects of rosiglitazone (RGZ), a peroxisome proliferator-activated receptor gamma (PPAR-γ) agonist, against CPF-induced neuronal cell death. The treatment of SH-SY5Y cells with CPF induced oxidative stress. In addition, CPF activated the p38, JNK and ERK mitogen-activated protein kinases (MAPKs), and induced increases in the inflammatory genes such as COX-2 and TNF-α. CPF also induced nuclear translocation of NF-κB and inhibitors of NF-κB abolished the CPF-induced COX-2 expression. Pretreatment with RGZ significantly reduced ROS generation and enhanced HO-1 expression in CPF-exposed cells. RGZ blocked the activation of both p38 and JNK signaling, while ERK activation was strengthened. RGZ also attenuated CPF-induced cell death through the reduction of NF-κB-mediated proinflammatory factors. Results from this study suggest that RGZ may exert an anti-apoptotic effect against CPF-induced cytotoxicity by attenuation of oxidative stress as well as inhibition of the inflammatory cascade via inactivation of signaling by p38 and JNK, and NF-κB. - Highlights: • CPF induces apoptotic cell death in SH-SY5Y cells • ROS involved in CPF-mediated apoptotic cell death • Inflammation involved in CPF-mediated apoptotic cell death • Rosiglitazone modulates ROS and inflammatory response in CPF-treated cells.
IGF-1 protects SH-SY5Y cells against MPP+-induced apoptosis via PI3K/PDK-1/Akt pathway.
Kim, Chanyang; Park, Seungjoon
2018-03-01
Insulin-like growth factor (IGF)-1 is a well-known anti-apoptotic pro-survival factor and phosphatidylinositol-3-kinase (PI3K)/Akt pathway is linked to cell survival induced by IGF-1. It is also reported that Akt signaling is modulated by 3-phosphoinositide-dependent kinase-1 (PDK1). In the current study, we investigated whether the anti-apoptotic effect of IGF-1 in SH-SY5Y cells exposed to 1-methyl-4-phenylpyridinium (MPP + ) is associated with the activity of PI3K/PDK1/Akt pathway. Treatment of cells with IGF-1 inhibited MPP + -induced apoptotic cell death. IGF-1-induced activation of Akt and the protective effect of IGF-1 on MPP + -induced apoptosis were abolished by chemical inhibition of PDK1 (GSK2334470) or PI3K (LY294002). The phosphorylated levels of Akt and PDK1 were significantly suppressed after MPP + exposure, while IGF-1 treatment completely restored MPP+-induced reductions in phosphorylation. IGF-1 protected cells from MPP + insult by suppressing intracellular reactive oxygen species (ROS) production and malondialdehyde levels and increasing superoxide dismutase activity. Mitochondrial ROS levels were also increased during MPP + exposure, which were attenuated by IGF-1 treatment. In addition, IGF-1-treated cells showed increased activities of succinate dehydrogenase and citrate synthase, stabilization of mitochondrial transmembrane potential, increased ratio of Bcl-2 to Bax, prevention of cytochrome c release and inhibition of caspase-3 activation with PARP cleavage. Furthermore, the protective effects of IGF-1 on oxidative stress and mitochondrial dysfunction were attenuated when cells were preincubated with GSK2334470 or LY294002. Our data suggest that IGF-1 protects SH-SY5Y cells against MPP + -associated oxidative stress by preserving mitochondrial integrity and inhibiting mitochondrial apoptotic cascades via the activation of PI3K/PDK1/Akt pathway. © 2018 The authors.
Directory of Open Access Journals (Sweden)
Simon Auer
2017-05-01
Full Text Available NADPH oxidases of human cells are not only functional in defense against invading microorganisms and for oxidative reactions needed for specialized biosynthetic pathways but also during the past few years have been established as signaling modules. It has been shown that human Nox4 is expressed in most somatic cell types and produces hydrogen peroxide, which signals to remodel the actin cytoskeleton. This correlates well with the function of Yno1, the only NADPH oxidase of yeast cells. Using two established tumor cell lines, which are derived from hepatic and neuroblastoma tumors, respectively, we are showing here that in both tumor models Nox4 is expressed in the ER (like the yeast NADPH oxidase, where according to published literature, it produces hydrogen peroxide. Reducing this biochemical activity by downregulating Nox4 transcription leads to loss of F-actin stress fibers. This phenotype is reversible by adding hydrogen peroxide to the cells. The effect of the Nox4 silencer RNA is specific for this gene as it does not influence the expression of Nox2. In the case of the SH-SY5Y neuronal cell line, Nox4 inhibition leads to loss of cell mobility as measured in scratch assays. We propose that inhibition of Nox4 (which is known to be strongly expressed in many tumors could be studied as a new target for cancer treatment, in particular for inhibition of metastasis.
Directory of Open Access Journals (Sweden)
Park SY
2017-06-01
Full Text Available Sun Young Park,1 Seon Yeong Chae,1,2 Jin Oh Park,2 Kyu Jin Lee,2 Geuntae Park1,2 1Bio-IT Fusion Technology Research Institute, 2Department of Nanofusion Technology, Graduate School, Pusan National University, Busan, Republic of Korea Abstract: Recently, environment-friendly synthesis of gold nanoparticles (GNPs has been extensively explored by biologists and chemists. However, significant research is still required to determine whether “eco-friendly” GNPs are beneficial to human health and to elucidate the molecular mechanisms of their effects on human cells. We used human neuronal SH-SY5Y cells to show that treatment with Kalopanacis Cortex extract-capped GNPs (KC-GNs, prepared via an eco-friendly, fast, one-pot synthetic route, protected neuronal cells against oxygen–glucose deprivation/reoxygenation (OGD/R-induced damage. To prepare GNPs, Kalopanacis Cortex was used without any chemical reducing and stabilizing agents. Ultraviolet–visible spectroscopy showed maximum absorbance at 526 nm owing to KC-GN surface plasmon resonance. Hydrodynamic size (54.02±2.19 nm and zeta potential (-20.3±0.04 mV were determined by dynamic light scattering. The average diameter (41.07±3.05 nm was determined by high-resolution transmission electron microscopy. Energy-dispersive X-ray diffraction spectroscopy and X-ray diffraction confirmed the presence of assembled GNPs. Fourier transform infrared analysis suggested that functional groups such as O–H, C–C, and C–N participated in KC-GN formation. Cell viability assays indicated that KC-GNs restored the viability of OGD/R-treated SH-SY5Y cells. Flow cytometry demonstrated that KC-GNs inhibited the OGD/R-induced reactive oxygen species production and mitochondrial membrane potential disruption. KC-GNs also inhibited the apoptosis of OGD/R-exposed cells. Western blot analysis indicated that the OGD/R-induced cellular apoptosis and simultaneous increases in the expression of cleaved caspase-3, p
Choudhury, Arnab; Kar, Sudeshna; Tabassum, Heena
2017-01-01
Oxaliplatin (Oxa) treatment to SH-SY5Y human neuroblastoma cells has been shown by previous studies to induce oxidative stress, which in turn modulates intracellular signaling cascades resulting in cell death. While this phenomenon of Oxa-induced neurotoxicity is known, the underlying mechanisms involved in this cell death cascade must be clarified. Moreover, there is still little known regarding the roles of neuronal mitochondria and cytosolic compartments in mediating Oxa-induced neurotoxicity. With a better grasp of the mechanisms driving neurotoxicity in Oxa-treated SH-SY5Y cells, we can then identify certain pathways to target in protecting against neurotoxic cell damage. Therefore, the purpose of this study was to determine whether one such agent, melatonin (Mel), could confer protection against Oxa-induced neurotoxicity in SH-SY5Y cells. Results from the present study found Oxa to significantly reduce SH-SY5Y cell viability in a dose-dependent manner. Alternatively, we found Mel pre-treatment to SH-SY5Y cells to attenuate Oxa-induced toxicity, resulting in a markedly increased cell viability. Mel exerted its protective effects by regulating reactive oxygen species (ROS) production and reducing superoxide radicals inside Oxa-exposed. In addition, we observed pre-treatment with Mel to rescue Oxa-treated cells by protecting mitochondria. As Oxa-treatment alone decreases mitochondrial membrane potential (Δψm), resulting in an altered Bcl-2/Bax ratio and release of sequestered cytochrome c, so Mel was shown to inhibit these pathways. Mel was also found to inhibit proteolytic activation of caspase 3, inactivation of Poly (ADP Ribose) polymerase, and DNA damage, thereby allowing SH-SY5Y cells to resist apoptotic cell death. Collectively, our results suggest a role for melatonin in reducing Oxa induced neurotoxicity. Further studies exploring melatonin’s protective effects may prove successful in eliciting pathways to further alter the neurotoxic pathways of
Directory of Open Access Journals (Sweden)
Mohammad Waseem
Full Text Available Oxaliplatin (Oxa treatment to SH-SY5Y human neuroblastoma cells has been shown by previous studies to induce oxidative stress, which in turn modulates intracellular signaling cascades resulting in cell death. While this phenomenon of Oxa-induced neurotoxicity is known, the underlying mechanisms involved in this cell death cascade must be clarified. Moreover, there is still little known regarding the roles of neuronal mitochondria and cytosolic compartments in mediating Oxa-induced neurotoxicity. With a better grasp of the mechanisms driving neurotoxicity in Oxa-treated SH-SY5Y cells, we can then identify certain pathways to target in protecting against neurotoxic cell damage. Therefore, the purpose of this study was to determine whether one such agent, melatonin (Mel, could confer protection against Oxa-induced neurotoxicity in SH-SY5Y cells. Results from the present study found Oxa to significantly reduce SH-SY5Y cell viability in a dose-dependent manner. Alternatively, we found Mel pre-treatment to SH-SY5Y cells to attenuate Oxa-induced toxicity, resulting in a markedly increased cell viability. Mel exerted its protective effects by regulating reactive oxygen species (ROS production and reducing superoxide radicals inside Oxa-exposed. In addition, we observed pre-treatment with Mel to rescue Oxa-treated cells by protecting mitochondria. As Oxa-treatment alone decreases mitochondrial membrane potential (Δψm, resulting in an altered Bcl-2/Bax ratio and release of sequestered cytochrome c, so Mel was shown to inhibit these pathways. Mel was also found to inhibit proteolytic activation of caspase 3, inactivation of Poly (ADP Ribose polymerase, and DNA damage, thereby allowing SH-SY5Y cells to resist apoptotic cell death. Collectively, our results suggest a role for melatonin in reducing Oxa induced neurotoxicity. Further studies exploring melatonin's protective effects may prove successful in eliciting pathways to further alter the neurotoxic
International Nuclear Information System (INIS)
Zhu Xuhui; Yao Honghong; Peng Fuwang; Callen, Shannon; Buch, Shilpa
2009-01-01
The human immunodeficiency virus (HIV-1) protein Tat has been implicated in mediating neuronal apoptosis, one of the hallmark features of HIV-associated dementia (HAD). Mitigation of the toxic effects of Tat could thus be a potential mechanism for reducing HIV toxicity in the brain. In this study we demonstrated that Tat-induced neurotoxicity was abolished by NMDA antagonist-MK801, suggesting the role of glutamate in this process. Furthermore, we also found that pretreatment of SH-SY5Y cells with PDGF exerted protection against Tat toxicity by decreasing extracellular glutamate levels. We also demonstrated that extracellular calcium chelator EGTA was able to abolish PDGF-mediated neuroprotection, thereby underscoring the role of calcium signaling in PDGF-mediated neuroprotection. We also showed that Erk signaling pathway was critical for PDGF-mediated protection of cells. Additionally, blocking calcium entry with EGTA resulted in suppression of PDGF-induced Erk activation. These findings thus underscore the role of PDGF-mediated calcium signaling and Erk phosphorylation in the protection of cells against HIV Tat toxicity.
Li, Yuan; Zhang, Hongwei; Zhu, Xiaoyu; Feng, Dongchuan; Gong, Jinchao; Han, Tao
2013-11-01
Neuroblastoma is among the most aggressive tumors that occur in childhood and infancy. The clinical prognosis of children with advanced-stage neuroblastoma is still poor. Interleukin-24 (IL-24) is emerging as a new cytokine involved in tumor cellular proliferation, differentiation, and apoptosis and has been widely studied as a tumor inhibitor. However, little is known about this cytokine's role in neuroblastoma. In this study, we investigated the possible effects of IL-24 on inducing neuroblastoma cell differentiation, growth inhibition, and apoptosis in vitro. Our data show that IL-24 promotes neuroblastoma SH-SY5Y cell differentiation, growth inhibition, and apoptosis. Furthermore, we found that the differentiation- and apoptosis-inducing action of IL-24 depends on the accumulation of reactive oxygen species (ROS). These results suggest that IL-24 can induce neuroblastoma cell differentiation and apoptosis and may be a potential therapeutic agent for neuroblastoma.
International Nuclear Information System (INIS)
Liu, P.-S.; Chiung, Y.-M.; Kao, Y.-Y.
2006-01-01
The mechanisms of TDI (2,4-toluene diisocyanate)-induced occupational asthma are not fully established. Previous studies have indicated that TDI induces non-specific bronchial hyperreactivity to methacholine and induces contraction of smooth muscle tissue by activating 'capsaicin-sensitive' nerves resulting asthma. Cytosolic-free calcium ion concentrations ([Ca 2+ ] c ) are elevated when either capsaicin acts at vanilloid receptors, or methacholine at muscarinic receptors. This study therefore investigated the effects of TDI on Ca 2+ mobilization in human neuroblastoma SH-SY5Y cells. TDI was found to elevate [Ca 2+ ] c by releasing Ca 2+ from the intracellular stores and extracellular Ca 2+ influx. 500 μM TDI induced a net [Ca 2+ ] c increase of 112 ± 8 and 78 ± 6 nM in the presence and absence of extracellular Ca 2+ , respectively. In Ca 2+ -free buffer, TDI induced Ca 2+ release from internal stores to reduce their Ca 2+ content and this reduction was evidenced by a suppression occurring on the [Ca 2+ ] c rise induced by thapsigargin, ionomycin, and methacholine after TDI incubation. In the presence of extracellular Ca 2+ , simultaneous exposure to TDI and methacholine led a higher level of [Ca 2+ ] c compared to single methacholine stimulation, that might explain that TDI induces bronchial hyperreactivity to methacholine. We conclude that TDI is capable of interfering the [Ca 2+ ] c homeostasis including releasing Ca 2+ from internal stores and inducing extracellular Ca 2+ influx. The interaction of this novel character and bronchial hyperreactivity need further investigation
Directory of Open Access Journals (Sweden)
Pengfei Ge
2013-10-01
Full Text Available To investigate the role of mitochondria in the protective effects of ginsenoside Rb1 on cellular apoptosis caused by oxygen-glucose deprivation, in this study, MTT assay, TUNEL staining, flow cytometry, immunocytochemistry and western blotting were used to examine the cellular viability, apoptosis, ROS level, mitochondrial membrane potential, and the distribution of apoptosis inducing factor, cytochrome c, Bax and Bcl-2 in nucleus, mitochondria and cytoplasm. We found that pretreatment with GRb1 improved the cellular viability damaged by OGD. Moreover, GRb1 inhibited apoptosis in SH-SY5Y cells induced by OGD. Further studies showed that the elevation of cellular reactive oxygen species levels and the reduction of mitochondrial membrane potential caused by OGD were both counteracted by GRb1. Additionally, GRb1 not only suppressed the translocation of apoptosis inducing factor into nucleus and cytochrome c into cytoplasm, but also inhibited the increase of Bax within mitochondria and alleviated the decrease of mitochondrial Bcl-2. Our study indicates that the protection of GRb1 on OGD-induced apoptosis in SH-SY5Y cells is associated with its protection on mitochondrial function and inhibition of release of AIF and cytochrome c.
TNF-alpha-induced apoptosis is prevented by erythropoietin treatment on SH-SY5Y cells
International Nuclear Information System (INIS)
Pregi, Nicolas; Wenker, Shirley; Vittori, Daniela; Leiros, Claudia Perez; Nesse, Alcira
2009-01-01
The growth factor erythropoietin (Epo) has shown neuronal protective action in addition to its well known proerythroid activity. Furthermore, Epo has dealt with cellular inflammation by inhibiting the expression of several proinflammatory cytokines, such as IL-1 and TNF-α. The action of TNF can have both apoptotic and antiapoptotic consequences due to altered balance between different cell signalling pathways. This work has focused on the apoptotic effects of this cytokine and the potential protective action of Epo. The model we used was neuroblastoma SH-SY5Y cells cultured in the presence of 25 ng/ml TNF-α or pretreated with 25 U/ml Epo for 12 h before the addition of TNF-α. Apoptosis was evaluated by differential cell count after Hoechst staining, analysis of DNA ladder pattern, and measurement of caspase activity. Despite its ability to induce NF-κB nuclear translocation, TNF-α induced cell death, which was found to be associated to upregulation of TNF Receptor 1 expression. On the other hand, cells activated by Epo became resistant to cell death. Prevention of death receptor upregulation and caspase activation may explain this antiapoptotic effect of Epo, which may be also favoured by the induction of a higher expression of protective factors, such as Bcl-2 and NF-κB, through mechanisms involving Jak/STAT and PI3K signalling pathways
Daijo, Hiroki; Kai, Shinichi; Tanaka, Tomoharu; Wakamatsu, Takuhiko; Kishimoto, Shun; Suzuki, Kengo; Harada, Hiroshi; Takabuchi, Satoshi; Adachi, Takehiko; Fukuda, Kazuhiko; Hirota, Kiichi
2011-09-30
Hypoxia-inducible factor 1 (HIF-1) is the main transcription factor responsible for hypoxia-induced gene expression. Perioperative drugs including anesthetics have been reported to affect HIF-1 activity. However, the effect of fentanyl on HIF-1 activity is not well documented. In this study, we investigated the effect of fentanyl and other opioids on HIF-1 activity in human SH-SY5Y neuroblastoma cells, hepatoma Hep3B cells, lung adenocarcinoma A549 cells and mice. Cells were exposed to fentanyl, and HIF-1 protein expression was examined by Western blot analysis using anti-HIF-1α and β antibodies. HIF-1-dependent gene expression was investigated by semi-quantitative real-time reverse transcriptase (RT)-PCR (qRT-PCR) and luciferase assay. Furthermore, fentanyl was administered intraperitoneally and HIF-1-dependent gene expression was investigated by qRT-PCR in the brains and kidneys of mice. A 10-μM concentration of fentanyl and other opioids, including 1 μM morphine and 4 μM remifentanil, induced HIF-1α protein expression and HIF-1 target gene expression in an opioid receptor-dependent manner in SH-SY5Y cells with activity peaking at 24h. Fentanyl did not augment HIF-1α expression during hypoxia-induced induction. HIF-1α stabilization assays and experiments with cycloheximide revealed that fentanyl increased translation from HIF-1α mRNA but did not stabilize the HIF-1α protein. Furthermore, fentanyl induced HIF-1 target gene expression in the brains of mice but not in their kidneys in a naloxone-sensitive manner. In this report, we describe for the first time that fentanyl, both in vitro and in vivo, induces HIF-1 activation under non-hypoxic conditions, leading to increases in expression of genes associated with adaptation to hypoxia. Copyright © 2011 Elsevier B.V. All rights reserved.
Schmidt, Andreas Johannes; Krieg, Jürgen-Christian; Hemmeter, Ulrich Michael; Kircher, Tilo; Schulz, Eberhard; Clement, Hans-Willi; Heiser, Philip
2010-10-01
Plant extracts such as Hypericum perforatum and Pycnogenol have been tested as alternatives to the classical ADHD drugs. It has been possible to describe neuroprotective effects of such plant extracts. A reduction of ADHD symptoms could be shown in clinical studies after the application of Pycnogenol, which is a pine bark extract. The impacts of the standardized herbal extracts Hypericum perforatum, Pycnogenol and Enzogenol up to a concentration of 5000 ng/mL on cell survival and energy metabolism in human SH-SY5Y neuroblastoma cells has been investigated in the present examination. Hypericum perforatum significantly decreased the survival of cells after treatment with a concentration of 5000 ng/mL, whereas lower concentrations exerted no significant effects. Pycnogenol( induced a significant increase of cell survival after incubation with a concentration of 32.25 ng/mL and a concentration of 250 ng/mL. Other applied concentrations of Pycnogenol failed to exert significant effects. Treatment with Enzogenol did not lead to significant changes in cell survival.Concerning energy metabolism, the treatment of cells with a concentration of 5000 ng/mL Hypericum perforatum led to a significant increase of ATP levels, whereas treatment with a concentration of 500 ng/mL had no significant effect. Incubation of cells with Pycnogenol and Enzogenol exerted no significant effects.None of the tested substances caused any cytotoxic effect when used in therapeutically relevant concentrations. Copyright © 2010 John Wiley & Sons, Ltd.
The effect of UV-filters on the viability of neuroblastoma (SH-SY5Y) cell line.
Broniowska, Żaneta; Pomierny, Bartosz; Smaga, Irena; Filip, Małgorzata; Budziszewska, Bogusława
2016-05-01
Topical application of cosmetic products, containing ultraviolet filters (UV filters) are recommended as a protection against sunburns and in order to reduce the risk of skin cancer. However, some UV filters can be absorbed through skin and by consuming contaminated food. Among the chemical UV filters, benzophenone-3 (BP-3), 3-(4-methylbenzylidene)camphor (4-MBC) and 2-ethylhexyl-4-methoxycinnamate (OMC) are absorbed through the skin to the greatest extent. So far, these lipophilic compounds were demonstrated to influence the gonadal and thyroid hormone function, but their effect on central nervous system cells has not been investigated, yet. In the present study, we investigated the effect of some UV filters on cell viability and caspase-3 activity in SH-SY5Y cells. It has been found that benzophenone-2 (BP-2), BP-3, 4-methylbenzophenone (4-MBP) and OMC present in the culture medium for 72h in high concentration (10(-5) and 10(-4)M) and 4-MBC only 10(-4)M produced a significant cytotoxic effect, as determined both by the MTT reduction test and LDH release assay. In contrast to necrotic changes, all tested UV filters increased caspase-3 activity in much lower concentrations (from 10(-8) to 10(-7)M). Proapoptotic properties of the test compounds were positively verified by Hoechst staining. The obtained results indicated that UV filters adversely affected the viability of nerve cells, most likely by enhancing the process of apoptosis. The most potent effect was exerted by BP-3 and 4-MBC and at concentrations that may be reached in vivo. Since human exposure to UV filters is significant these compound should be taken into consideration as one of the possible factors involved in pathogenesis of neurodegenerative diseases. Copyright © 2016 Elsevier Inc. All rights reserved.
2014-01-01
Background Gelsemium sempervirens L. (Gelsemium s.) is a traditional medicinal plant, employed as an anxiolytic at ultra-low doses and animal models recently confirmed this activity. However the mechanisms by which it might operate on the nervous system are largely unknown. This work investigates the gene expression of a human neurocyte cell line treated with increasing dilutions of Gelsemium s. extract. Methods Starting from the crude extract, six 100 × (centesimal, c) dilutions of Gelsemium s. (2c, 3c, 4c, 5c, 9c and 30c) were prepared according to the French homeopathic pharmacopoeia. Human SH-SY5Y neuroblastoma cells were exposed for 24 h to test dilutions, and their transcriptome compared by microarray to that of cells treated with control vehicle solutions. Results Exposure to the Gelsemium s. 2c dilution (the highest dose employed, corresponding to a gelsemine concentration of 6.5 × 10-9 M) significantly changed the expression of 56 genes, of which 49 were down-regulated and 7 were overexpressed. Several of the down-regulated genes belonged to G-protein coupled receptor signaling pathways, calcium homeostasis, inflammatory response and neuropeptide receptors. Fisher exact test, applied to the group of 49 genes down-regulated by Gelsemium s. 2c, showed that the direction of effects was significantly maintained across the treatment with high homeopathic dilutions, even though the size of the differences was distributed in a small range. Conclusions The study shows that Gelsemium s., a medicinal plant used in traditional remedies and homeopathy, modulates a series of genes involved in neuronal function. A small, but statistically significant, response was detected even to very low doses/high dilutions (up to 30c), indicating that the human neurocyte genome is extremely sensitive to this regulation. PMID:24642002
Tian, Xing; Guo, Li-Ping; Hu, Xiao-Long; Huang, Jin; Fan, Yan-Hua; Ren, Tian-Shu; Zhao, Qing-Chun
2015-04-01
Accumulated evidence has shown that excessive reactive oxygen species (ROS) have been implicated in neuronal cell death related with various chronic neurodegenerative disorders. This study was designed to explore neuroprotective effects of ethyl acetate extract of Arctium lappa L. roots (EAL) on hydrogen peroxide (H2O2)-induced cell injury in human SH-SY5Y neuroblastoma cells. The cell viability was significantly decreased after exposure to 200 μM H2O2, whereas pretreatment with different concentrations of EAL attenuated the H2O2-induced cytotoxicity. Hoechst 33342 staining indicated that EAL reversed nuclear condensation in H2O2-treated cells. Meanwhile, TUNEL assay with DAPI staining showed that EAL attenuated apoptosis was induced by H2O2. Pretreatment with EAL also markedly elevated activities of antioxidant enzyme (GSH-Px and SOD), reduced lipid peroxidation (MDA) production, prevented ROS formation, and the decrease of mitochondrial membrane potential. In addition, EAL showed strong radical scavenging ability in 2,2'-azino-bis(3-ethylbenzthiazoline-6-sulfonic acid) assays. Furthermore, EAL inhibited H2O2-induced apoptosis by increases in the Bcl-2/Bax ratio, decreases in cytochrome c release, and attenuation of caspase-3, caspase-9 activities, and expressions. These findings suggest that EAL may be regarded as a potential antioxidant agent and possess potent neuroprotective activity against H2O2-induced injury.
Engin, Ayse Basak; Engin, Evren Doruk; Karakus, Resul; Aral, Arzu; Gulbahar, Ozlem; Engin, Atilla
2017-11-01
High glucose and insulin lead to neuronal insulin resistance. Glucose transport into the neurons is achieved by regulatory induction of surface glucose transporter-3 (GLUT3) instead of the insulin. N-methyl-D aspartate (NMDA) receptor activity increases GLUT3 expression. This study explored whether an endogenous NMDA receptor antagonist, kynurenic acid (KynA) affects the neuronal cell viability at high glucose concentrations. SH-SY5Y neuroblastoma cells were exposed to 150-250 mg/dL glucose and 40 μU/mL insulin. In KynA and N-nitro-l-arginine methyl ester (L-NAME) supplemented cultures, oxidative stress, mitochondrial metabolic activity (MTT), nitric oxide as nitrite+nitrate (NOx) and GLUT3 were determined at the end of 24 and 48-h incubation periods. Viable cells were counted by trypan blue dye. High glucose-exposed SH-SY5Y cells showed two-times more GLUT3 expression at second 24-h period. While GLUT3-stimulated glucose transport and oxidative stress was increased, total mitochondrial metabolic activity was significantly reduced. Insulin supplementation to high glucose decreased NOx synthesis and GLUT3 levels, in contrast oxidative stress increased three-fold. KynA significantly reduced oxidative stress, and increased MTT by regulating NOx production and GLUT3 expression. KynA is a noteworthy compound, as an endogenous, specific NMDA receptor antagonist; it significantly reduces oxidative stress, while increasing cell viability at high glucose and insulin concentrations. Copyright © 2017 Elsevier Ltd. All rights reserved.
Energy Technology Data Exchange (ETDEWEB)
Luukkonen, Jukka [Department of Environmental Science, University of Kuopio, Bioteknia 2, P.O. Box 1627, FI-70211 Kuopio (Finland)], E-mail: Jukka.Luukkonen@uku.fi; Hakulinen, Pasi; Maeki-Paakkanen, Jorma [Department of Environmental Health, National Public Health Institute, P.O. Box 95, FI-70701 Kuopio (Finland); Juutilainen, Jukka; Naarala, Jonne [Department of Environmental Science, University of Kuopio, Bioteknia 2, P.O. Box 1627, FI-70211 Kuopio (Finland)
2009-03-09
The objective of the study was to investigate effects of 872 MHz radiofrequency (RF) radiation on intracellular reactive oxygen species (ROS) production and DNA damage at a relatively high SAR value (5 W/kg). The experiments also involved combined exposure to RF radiation and menadione, a chemical inducing intracellular ROS production and DNA damage. The production of ROS was measured using the fluorescent probe dichlorofluorescein and DNA damage was evaluated by the Comet assay. Human SH-SY5Y neuroblastoma cells were exposed to RF radiation for 1 h with or without menadione. Control cultures were sham exposed. Both continuous waves (CW) and a pulsed signal similar to that used in global system for mobile communications (GSM) mobile phones were used. Exposure to the CW RF radiation increased DNA breakage (p < 0.01) in comparison to the cells exposed only to menadione. Comparison of the same groups also showed that ROS level was higher in cells exposed to CW RF radiation at 30 and 60 min after the end of exposure (p < 0.05 and p < 0.01, respectively). No effects of the GSM signal were seen on either ROS production or DNA damage. The results of the present study suggest that 872 MHz CW RF radiation at 5 W/kg might enhance chemically induced ROS production and thus cause secondary DNA damage. However, there is no known mechanism that would explain such effects from CW RF radiation but not from GSM modulated RF radiation at identical SAR.
International Nuclear Information System (INIS)
Luukkonen, Jukka; Hakulinen, Pasi; Maeki-Paakkanen, Jorma; Juutilainen, Jukka; Naarala, Jonne
2009-01-01
The objective of the study was to investigate effects of 872 MHz radiofrequency (RF) radiation on intracellular reactive oxygen species (ROS) production and DNA damage at a relatively high SAR value (5 W/kg). The experiments also involved combined exposure to RF radiation and menadione, a chemical inducing intracellular ROS production and DNA damage. The production of ROS was measured using the fluorescent probe dichlorofluorescein and DNA damage was evaluated by the Comet assay. Human SH-SY5Y neuroblastoma cells were exposed to RF radiation for 1 h with or without menadione. Control cultures were sham exposed. Both continuous waves (CW) and a pulsed signal similar to that used in global system for mobile communications (GSM) mobile phones were used. Exposure to the CW RF radiation increased DNA breakage (p < 0.01) in comparison to the cells exposed only to menadione. Comparison of the same groups also showed that ROS level was higher in cells exposed to CW RF radiation at 30 and 60 min after the end of exposure (p < 0.05 and p < 0.01, respectively). No effects of the GSM signal were seen on either ROS production or DNA damage. The results of the present study suggest that 872 MHz CW RF radiation at 5 W/kg might enhance chemically induced ROS production and thus cause secondary DNA damage. However, there is no known mechanism that would explain such effects from CW RF radiation but not from GSM modulated RF radiation at identical SAR
Directory of Open Access Journals (Sweden)
Pierdomenico Ruggeri
Full Text Available The developmental and stress-regulated alternative TrkAIII splice variant of the NGF receptor TrkA is expressed by advanced stage human neuroblastomas (NBs, correlates with worse outcome in high TrkA expressing unfavourable tumours and exhibits oncogenic activity in NB models. In the present study, we report that constitutive TrkAIII expression in human SH-SY5Y NB cells inhibits Rotenone, Paraquat and LY83583-induced mitochondrial free radical reactive oxygen species (ROS-mediated death by stimulating SOD2 expression, increasing mitochondrial SOD2 activity and attenuating mitochondrial free radical ROS production, in association with increased mitochondrial capacity to produce H2O2, within the context of a more tumour stem cell-like phenotype. This effect can be reversed by the specific TrkA tyrosine kinase inhibitor GW441756, by the multi-kinase TrkA inhibitors K252a, CEP-701 and Gö6976, which inhibit SOD2 expression, and by siRNA knockdown of SOD2 expression, which restores the sensitivity of TrkAIII expressing SH-SY5Y cells to Rotenone, Paraquat and LY83583-induced mitochondrial free radical ROS production and ROS-mediated death. The data implicate the novel TrkAIII/SOD2 axis in promoting NB resistance to mitochondrial free radical-mediated death and staminality, and suggest that the combined use of TrkAIII and/or SOD2 inhibitors together with agents that induce mitochondrial free radical ROS-mediated death could provide a therapeutic advantage that may also target the stem cell niche in high TrkA expressing unfavourable NB.
Xun, Zhiyin; Lee, Do-Yup; Lim, James; Canaria, Christie A; Barnebey, Adam; Yanonne, Steven M; McMurray, Cynthia T
2012-04-01
Retinoic acid (RA) is used in differentiation therapy to treat a variety of cancers including neuroblastoma. The contributing factors for its therapeutic efficacy are poorly understood. However, mitochondria (MT) have been implicated as key effectors in RA-mediated differentiation process. Here we utilize the SH-SY5Y human neuroblastoma cell line as a model to examine how RA influences MT during the differentiation process. We find that RA confers an approximately sixfold increase in the oxygen consumption rate while the rate of glycolysis modestly increases. RA treatment does not increase the number of MT or cause measurable changes in the composition of the electron transport chain. Rather, RA treatment significantly increases the mitochondrial spare respiratory capacity. We propose a competition model for the therapeutic effects of RA. Specifically, the high metabolic rate in differentiated cells limits the availability of metabolic nutrients for use by the undifferentiated cells and suppresses their growth. Thus, RA treatment provides a selective advantage for the differentiated state. Published by Elsevier Ireland Ltd.
Park, Sun Young; Kim, Do Yeon; Kang, Jong-Koo; Park, Geuntae; Choi, Young-Whan
2014-09-01
Free radical-mediated neurodegeneration is one of the many causes of Parkinson's disease (PD). As part of our ongoing studies on the identification of biologically active Schisandra chinensis components, we have isolated and structurally elucidated α-iso-cubebenol. This study was carried out in an attempt to clarify the neuroprotective effect of α-iso-cubebenol on toxin-insulted dopaminergic neuronal death using 6-hydroxy-dopamine (6-OHDA)-induced dopaminergic SH-SY5Y cells. α-iso-cubebenol significantly attenuated the loss of mitochondrial function (MTT assay) and membrane integrity (lactate dehydrogenase assay) associated with 6-OHDA-induced neurotoxicity. Pretreatment of the cells with α-iso-cubebenol diminished the intracellular accumulation of reactive oxygen species (ROS) and calcium in response to 6-OHDA. Moreover, α-iso-cubebenol protected against 6-OHDA-induced neurotoxicity through inhibition of SH-SY5Y cell apoptosis. In addition, JC-1 staining, which is a well-established measure of mitochondrial damage, was decreased after treatment with α-iso-cubebenol. Notably, α-iso-cubebenol inhibited the release of mitochondrial flavoprotein apoptosis inducing factor (AIF) from the mitochondria to the cytosol and nucleus following 6-OHDA treatment. In addition, α-iso-cubebenol reduced the 6-OHDA-induced phosphorylation of ERK and induced the phosphorylation of PKA, PKB, and CREB in a dose-dependent manner. Moreover, α-iso-cubebenol stimulated the activation of Nrf2, a downstream target of CREB. Furthermore, α-iso-cubebenol stimulated the expression of multiple antioxidant response genes (NQO-1 and HO-1). Finally, CREB and Nrf2 siRNA transfection diminished α-iso-cubebenol-mediated neuroprotection. Copyright © 2014 Elsevier Inc. All rights reserved.
Pinweha, Sirinthorn; Wanikiat, Payong; Sanvarinda, Yupin; Supavilai, Porntip
2008-12-19
Ganoderma lucidum (GL) is a medicinal mushroom that possesses various pharmacological properties which are also documented in the ancient reports where GL is praised for its effects on the promotion of health and longevity. In this study, we have investigated the effect of GL mycelia extracts on the non-amyloidogenic protein secretion (sAPPalpha) and the amyloid precursor protein (APP) expression in SH-SY5Y neuroblastoma cells. In order to characterize the signaling pathway which mediates GL-enhanced sAPPalpha secretion, we used inhibitors of nerve growth factor (NGF) signaling pathways, phosphatidylinositol 3 kinase (PI3K), phospholipase Cgamma1 (PLCgamma1), protein kinase C (PKC) and extracellular signal-regulated kinase (ERK1/2), to block GL-mediated sAPPalpha secretion as well as ERK1/2 and PKC activation by using Western blot analysis. Our results provided for the first time evidence that GL mycelia extracts increased APP expression and promoted sAPPalpha secretion. In addition, GL extracts activated ERK1/2 and PKC phosphorylation. The complex signaling cascades of PI3K and ERK may be responsible for GL-mediated sAPPalpha secretion.
Meesarapee, Benjawan; Thampithak, Anusorn; Jaisin, Yamaratee; Sanvarinda, Pimtip; Suksamrarn, Apichart; Tuchinda, Patoomratana; Morales, Noppawan Phumala; Sanvarinda, Yupin
2014-04-01
6-Hydroxydopamine (6-OHDA) selectively enters dopaminergic neurons and undergoes auto-oxidation resulting in the generation of reactive oxygen species and dopamine quinones, subsequently leading to apoptosis. This mechanism mimics the pathogenesis of Parkinson's disease and has been used to induce experimental Parkinsonism in both in vitro and in vivo systems. In this study, we investigated the effects of curcumin I (diferuloylmethane) purified from Curcuma longa on quinoprotein production, phosphorylation of p38 MAPK (p-p38), and caspase-3 activation in 6-OHDA-treated SH-SY5Y dopaminergic cells. Pretreatment of SH-SY5Y with curcumin I at concentrations of 1, 5, 10, and 20 μM, significantly decreased the formation of quinoprotein and reduced the levels of p-p38 and cleaved caspase-3 in a dose-dependent manner. Moreover, the levels of the dopaminergic neuron marker, phospho-tyrosine hydroxylase (p-TH), were also dose-dependently increased upon treatment with curcumin I. Our results clearly demonstrated that curcumin I protects neurons against oxidative damage, as shown by attenuation of p-p38 expression, caspase-3-activation, and toxic quinoprotein formation, together with the restoration of p-TH levels. This study provides evidence for the therapeutic potential of curcumin I in the chemoprevention of oxidative stress-related neurodegeneration. Copyright © 2013 John Wiley & Sons, Ltd.
Directory of Open Access Journals (Sweden)
Chinnasamy Dhanalakshmi
2015-01-01
Full Text Available Vanillin, a phenolic compound, has been reported to offer neuroprotection against experimental Huntington’s disease and global ischemia by virtue of its antioxidant, anti-inflammatory, and antiapoptotic properties. The present study aims to elucidate the underlying neuroprotective mechanism of vanillin in rotenone induced neurotoxicity. Cell viability was assessed by exposing SH-SY5Y cells to various concentrations of rotenone (5–200 nM for 24 h. The therapeutic effectiveness of vanillin against rotenone was measured by pretreatment of vanillin at various concentrations (5–200 nM and then incubation with rotenone (100 nM. Using effective dose of vanillin (100 nM, mitochondrial membrane potential, levels of reactive oxygen species (ROS, and expression patterns of apoptotic markers were assessed. Toxicity of rotenone was accompanied by the loss of mitochondrial membrane potential, increased ROS generation, release of cyt-c, and enhanced expressions of proapoptotic and downregulation of antiapoptotic indices via the upregulation of p38 and JNK-MAPK pathway proteins. Our results indicated that the pretreatment of vanillin attenuated rotenone induced mitochondrial dysfunction, oxidative stress, and apoptosis. Thus, vanillin may serve as a potent therapeutic agent in the future by virtue of its multiple pharmacological properties in the treatment of neurodegenerative diseases including PD.
Chen, Ta-Fu; Tang, Ming-Chi; Chou, Chia-Hui; Chiu, Ming-Jang; Huang, R-F S
2013-12-01
Increased dietary folic acid (FA) is associated with reduced risks of Alzheimer's disease (AD). The AD drug memantine (Mn) has had limited therapeutic effects for the treatment of patients with moderate to severe AD. This study investigated whether and the underlying mechanisms by which the combination of Mn and FA may have synergistic or additive effects in protecting against amyloid-β(25-35) peptide (Aβ)-induced neurocytotoxicity. Aβ treatment of human neuroblastoma SH-SY5Y cells significantly induced a 6-fold increase of apoptotic cells compared with the Aβ-untreated group. Preincubation of Aβ-exposed cells with FA (500 μM) or Mn (20 μM) caused a 22% and 10% reduction of apoptotic cells, respectively, whereas the combo-treatments at such doses synergistically alleviated Aβ-induced apoptosis by 60% (P<0.05). The apoptotic protection by the combo-treatments coincided with attenuating Aβ-elicited mitochondrial (mt) membrane depolarization and abolishing Aβ-induced mt cytochrome c release to the cytosol. Increased levels of FA at 1000 μM in combination with 20 μM Mn exerted an additive protection against Aβ(25-35)-induced-apoptosis as compared to the isolate Mn group (P<0.05). The combo-treatments reversed Aβ-elicited mt membrane depolarization, attenuated Aβ-elicited mt cytochrome c release to the cytosol, and diminished Aβ-promoted superoxide generation. The apoptotic-protection by such combo-treatments was partially abolished by carbonyl cyanide 3-chlorophenylhydrazone (mt membrane potential uncoupler) and sodium azide (mt cytochrome c oxidase inhibitor). Taken together, the data demonstrated that dose-dependent FA and Mn synergistically or additively protected SH-SY5Y cells against Aβ-induced apoptosis, which was partially, if not completely, mediated by mt stress-associated death signals. Copyright © 2013 Elsevier Ltd. All rights reserved.
Agmatine Protects Against 6-OHDA-Induced Apoptosis, and ERK and Akt/GSK Disruption in SH-SY5Y Cells.
Amiri, Esmat; Ghasemi, Rasoul; Moosavi, Maryam
2016-08-01
6-Hydroxydopamine (6-OHDA), a metabolite of dopamine is known to induce dopaminergic cell toxicity which makes that a suitable agent inducing an experimental model of Parkinson's disease (PD). Agmatine has been shown to protect against some cellular and animal PD models. This study was aimed to assess whether agmatine prevents 6-OHDA-induced SH-SY5Y cell death and if yes, then how it affects Akt/glycogen synthesis kinase-3β (GSK-3β) and extracellular signal-regulated kinases (ERK) signals. The cells were treated with different drugs, and their viability was examined via MTT (3-[4,5-dimethylthiazol-2-yl]-2,5-diphenyl tetrazolium bromide) assay and morphological observation. Western blot studies were done to assess cleaved caspase-3, Akt/GSK-3β, and ERK proteins. 6-OHDA-induced cell death and caspase-3 cleavage, while agmatine prevented those changes. 6-OHDA also decreased the amount of phosphorylated Akt (pAkt)/Akt while increased GSK-3β activity which was prevented by agmatine. Additionally, this toxin increased pERK/ERK ratio which was averted again by agmatine. The PI3/Akt inhibitor, LY294002, impeded the changes induced by agmatine, while ERK inhibitor (PD98059) did not disturb the effects of agmatine, and by itself, it preserved the cells against 6-OHDA toxicity. This study revealed that agmatine is protective in 6-OHDA model of PD and affects Akt/GSK-3β and ERK pathways.
Gawlik-Kotelnicka, Oliwia; Mielicki, Wojciech; Rabe-Jabłońska, Jolanta; Lazarek, Jerry; Strzelecki, Dominik
2016-02-01
It has been reported that lithium may inhibit lipid peroxidation and protein oxidation. Lithium salts also appear to stimulate cell proliferation, increase neurogenesis, and delay cell death. Oxidative stress and neurodegeneration may play an important role in the pathophysiology of bipolar disorder and the disease course thereof. The aim of this research is to estimate the influence of lithium (alone and in combination with haloperidol) on the parameters of oxidative stress and viability of SH-SY5Y cell lines in neutral and pro-oxidative conditions. The evaluated oxidative stress parameter was lipid peroxidation. The viability of the cell lines was measured utilising the MTT test. In neutral conditions, higher levels of thiobarbituric acid reactive substances were observed in those samples which contained both haloperidol and lithium than in other samples. However, these differences were not statistically significant. Cell viability was significantly higher in therapeutic lithium samples than in the controls; samples of haloperidol alone as well as those of haloperidol with lithium did not differ from controls. The results of our study may indicate that lithium possess neuroprotective properties that may be partly due to antioxidative effects. The combination of lithium and haloperidol may generate increased oxidative stress.
Directory of Open Access Journals (Sweden)
Bhushan Vijay Nagpure
Full Text Available Alzheimer's disease (AD is the leading cause of senile dementia in today's society. Its debilitating symptoms are manifested by disturbances in many important brain functions, which are influenced by adenosine. Hence, adenosinergic system is considered as a potential therapeutic target in AD treatment. In the present study, we found that sodium hydrosulfide (NaHS, an H2S donor, 100 µM attenuated HENECA (a selective A2A receptor agonist, 10-200 nM induced β-amyloid (1-42 (Aβ42 production in SH-SY5Y cells. NaHS also interfered with HENECA-stimulated production and post-translational modification of amyloid precursor protein (APP by inhibiting its maturation. Measurement of the C-terminal APP fragments generated from its enzymatic cleavage by β-site amyloid precursor protein cleaving enzyme 1 (BACE1 showed that NaHS did not have any significant effect on β-secretase activity. However, the direct measurements of HENECA-elevated γ-secretase activity and mRNA expressions of presenilins suggested that the suppression of Aβ42 production in NaHS pretreated cells was mediated by inhibiting γ-secretase. NaHS induced reductions were accompanied by similar decreases in intracellular cAMP levels and phosphorylation of cAMP responsive element binding protein (CREB. NaHS significantly reduced the elevated cAMP and Aβ42 production caused by forskolin (an adenylyl cyclase, AC agonist alone or forskolin in combination with IBMX (a phosphodiesterase inhibitor, but had no effect on those caused by IBMX alone. Moreover, pretreatment with NaHS significantly attenuated HENECA-elevated AC activity and mRNA expressions of various AC isoforms. These data suggest that NaHS may preferentially suppress AC activity when it was stimulated. In conclusion, H2S attenuated HENECA induced Aβ42 production in SH-SY5Y neuroblastoma cells through inhibiting γ-secretase via a cAMP dependent pathway.
Role of D-Limonene in Autophagy Induced by Bergamot Essential Oil in SH-SY5Y Neuroblastoma Cells
Russo, Rossella; Cassiano, Maria Gilda Valentina; Ciociaro, Antonella; Adornetto, Annagrazia; Varano, Giuseppe Pasquale; Chiappini, Carlotta; Berliocchi, Laura; Tassorelli, Cristina; Bagetta, Giacinto; Corasaniti, Maria Tiziana
2014-01-01
Bergamot (Citrus bergamia, Risso et Poiteau) essential oil (BEO) is a well characterized, widely used plant extract. BEO exerts anxiolytic, analgesic and neuroprotective activities in rodents through mechanisms that are only partly known and need to be further investigated. To gain more insight into the biological effects of this essential oil, we tested the ability of BEO (0.005–0.03%) to modulate autophagic pathways in human SH-SY5Y neuroblastoma cells. BEO-treated cells show increased LC3II levels and appearance of dot-like formations of endogenous LC3 protein that colocalize with the lysosome marker LAMP-1. Autophagic flux assay using bafilomycin A1 and degradation of the specific autophagy substrate p62 confirmed that the observed increase of LC3II levels in BEO-exposed cells is due to autophagy induction rather than to a decreased autophagosomal turnover. Induction of autophagy is an early and not cell-line specific response to BEO. Beside basal autophagy, BEO also enhanced autophagy triggered by serum starvation and rapamycin indicating that the underlying mechanism is mTOR independent. Accordingly, BEO did not affect the phosphorylation of ULK1 (Ser757) and p70S6K (Thr389), two downstream targets of mTOR. Furthermore, induction of autophagy by BEO is beclin-1 independent, occurs in a concentration-dependent manner and is unrelated to the ability of BEO to induce cell death. In order to identify the active constituents responsible for these effects, the two most abundant monoterpenes found in the essential oil, d-limonene (125–750 µM) and linalyl acetate (62.5–375 µM), were individually tested at concentrations comparable to those found in 0.005–0.03% BEO. The same features of stimulated autophagy elicited by BEO were reproduced by d-limonene, which rapidly increases LC3II and reduces p62 levels in a concentration-dependent manner. Linalyl acetate was ineffective in replicating BEO effects; however, it greatly enhanced LC3 lipidation triggered by d
Ahmad, Waqas; Li, Yingying; Guo, Yidi; Wang, Xinyu; Duan, Ming; Guan, Zhenhong; Liu, Zengshan; Zhang, Maolin
2017-06-01
Rabies virus (RABV) is a highly neurotropic virus that follows clathrin-mediated endocytosis and pH-dependent pathway for trafficking and invasion into endothelial cells. Early (Rab5, EEA1) and late (Rab7, LAMP1) endosomal proteins play critical roles in endosomal sorting, maturity and targeting various molecular cargoes, but their precise functions in the early stage of RABV neuronal infection remain elusive. In this study, the relationship between enigmatic entry of RABV with these endosomal proteins into neuronal and SH-SY5Y cells was investigated. Immunofluorescence, TCID 50 titers, electron microscopy and western blotting were carried out to determine the molecular interaction of the nucleoprotein (N) of RABV with early or late endosomal proteins in these cell lines. The expression of N was also determined by down-regulating Rab5 and Rab7 in both cell lines through RNA interference. The results were indicative that N proficiently colocalized with Rab5/EEA1 and Rab7/LAMP1 in both cell lines at 24 and 48 h post-infection, while N titers significantly decreased in early infection of RABV. Down-regulation of Rab5 and Rab7 did not inhibit N expression, but it prevented productive infection via blocking the normal trafficking of RABV in a low pH environment. Ultrathin sections of cells studied by electron microscope also verified the close association of RABV with Rab5 and Rab7 in neurons. From the data it was concluded that primary entry of RABV strongly correlates with the kinetics of Rab-proteins present on early and late vesicles, which provides helpful clues to explain the early events of RABV in nerve cells.
Silva, Aline H.; Fonseca, Francisco Noé; Pimenta, Antônia T. A.; Lima, MaryAnne S.; Silveira, Edilberto Rocha; Viana, Glauce S. B.; Vasconcelos, Silvânia M. M.; Leal, Luzia Kalyne A. M.
2016-01-01
Background: Erythrina velutina is a tree common in the northeast of Brazil extensively used by traditional medicine for the treatment of central nervous system disorders. Objective: To develop a standardized ethanol extract of E. velutina (EEEV) and to investigate the neuroprotective potential of the extract and rizonic acid (RA) from E. velutina on neuronal cells. Materials and methods: The plant drug of E. velutina previously characterized was used for the production of EEEV. Three methods were evaluated in order to obtain an extract with higher content of phenols. The neuroprotective effect of standardized EEEV (HPLC-PDA) and RA was investigated on SH-SY5Y cell exposure to the neurotoxin 6-hydroxydopamine (6-OHDA). Results: The powder of the plant drug was classified as moderately coarse and several quality control parameters were determined. EEEV produced by percolation gave the highest phenol content when related to others extractive methods, and its HPLC-PDA analysis allowed to identify four flavonoids and RA, some reported for the first time for the species. EEEV and RA reduced significantly the neurotoxicity induced by 6-OHDA in SH-SY5Y cells determined by the MTT assay and the nitrite concentration. EEEV also showed a free radical scavenging activity. Conclusion: This is the first pharmacological study about E. velutina which used a controlled standardized extract since the preparation of the herbal drug. This extract and RA, acting as an antioxidant, presents a neuroprotective effect suggesting that they have potential for future development as a therapeutic agent in neurodegenerative disease as Parkinson. SUMMARY The powder of Erythrina velutina was classified as moderately coarse and several quality-control parameters were determined.Ethanolic extract from E. velutina (EEEV) produced by percolation gave the highest phenol content when related to others extractive methods and its HPLC–PDA analysis of EEEV allowed to identify four flavonoids and rizonic
Talman, Virpi; Amadio, Marialaura; Osera, Cecilia; Sorvari, Salla; Boije Af Gennäs, Gustav; Yli-Kauhaluoma, Jari; Rossi, Daniela; Govoni, Stefano; Collina, Simona; Ekokoski, Elina; Tuominen, Raimo K; Pascale, Alessia
2013-07-01
Protein kinase C (PKC) is a family of serine/threonine phosphotransferases ubiquitously expressed and involved in multiple cellular functions, such as proliferation, apoptosis and differentiation. The C1 domain of PKC represents an attractive drug target, especially for developing PKC activators. Dialkyl 5-(hydroxymethyl)isophthalates are a novel group of synthetic C1 domain ligands that exhibit antiproliferative effect in HeLa cervical carcinoma cells. Here we selected two isophthalates, HMI-1a3 and HMI-1b11, and characterized their effects in the human neuroblastoma cell line SH-SY5Y. Both of the active isophthalates exhibited significant antiproliferative and differentiation-inducing effects. Since HMI-1b11 did not impair cell survival even at the highest concentration tested (20μM), and supported neurite growth and differentiation of SH-SY5Y cells, we focused on studying its downstream signaling cascades and effects on gene expression. Consistently, genome-wide gene expression microarray and gene set enrichment analysis indicated that HMI-1b11 (10μM) induced changes in genes mainly related to cell differentiation. In particular, further studies revealed that HMI-1b11 exposure induced up-regulation of GAP-43, a marker for neurite sprouting and neuronal differentiation. These effects were induced by a 7-min HMI-1b11 treatment and specifically depended on PKCα activation, since pretreatment with the selective inhibitor Gö6976 abolished the up-regulation of GAP-43 protein observed at 12h. In parallel, we found that a 7-min exposure to HMI-1b11 induced PKCα accumulation to the cytoskeleton, an effect that was again prevented by pretreatment with Gö6976. Despite similar binding affinities to PKC, the isophthalates had different effects on PKC-dependent ERK1/2 signaling: HMI-1a3-induced ERK1/2 phosphorylation was transient, while HMI-1b11 induced a rapid but prolonged ERK1/2 phosphorylation. Overall our data are in accordance with previous studies showing that
Wang, Guan; Zhu, Lingjuan; Zhao, Yuqian; Gao, Suyu; Sun, Dejuan; Yuan, Jingquan; Huang, Yuxin; Zhang, Xue; Yao, Xinsheng
2017-06-01
Homeodomain-interacting protein kinase 2 (HIPK2) is a conserved serine/threonine kinase, which regulate transcription, cell differentiation, proliferation and apoptosis. Previous evidences indicated that HIPK2 could be involved in the pathogenesis of neurodegenerative diseases, suggesting as a novel target for Parkinson's disease (PD) therapeutic development. Herein, gene microarray analysis was performed to verify the key regulatory function of HIPK2 in PD. (Z)-methylp-hydroxycinnamate (ZMHC, 7) with other eighteen compounds were isolated from Cannabis sativa subsp. sativa, growing in Bama Yao Autonomous County, one of the five largest longevity regions of the world. Intriguingly, ZMHC was identified to bind HIPK2 with high affinity through molecular modeling and molecular dynamics (MD) simulations. Moreover, cell morphology, flow cytometry and western blot assay suggested that ZMHC inhibited HIPK2, which attenuated MPP + -induced apoptosis in SH-SY5Y cells. In conclusion, these findings discovered a natural product that inhibited HIPK2, and highlighted that ZMHC could be a potential precursor agent for future PD therapy. Copyright © 2017 Elsevier Inc. All rights reserved.
Martinez, Jimena Hebe; Alaimo, Agustina; Gorojod, Roxana Mayra; Porte Alcon, Soledad; Fuentes, Federico; Coluccio Leskow, Federico; Kotler, Mónica Lidia
2018-04-01
Parkinson's disease is a neurodegenerative movement disorder caused by the loss of dopaminergic neurons from substantia nigra. It is characterized by the accumulation of aggregated α-synuclein as the major component of the Lewy bodies. Additional common features of this disease are the mitochondrial dysfunction and the activation/inhibition of autophagy both events associated to the intracellular accumulation of α-synuclein. The mechanism by which these events contribute to neural degeneration remains unknown. In the present work we investigated the effect of α-synuclein on mitochondrial dynamics and autophagy/mitophagy in SH-SY5Y cells, an in vitro model of Parkinson disease. We demonstrated that overexpression of wild type α-synuclein causes moderated toxicity, ROS generation and mitochondrial dysfunction. In addition, α-synuclein induces the mitochondrial fragmentation on a Drp-1-dependent fashion. Overexpression of the fusion protein Opa-1 prevented both mitochondrial fragmentation and cytotoxicity. On the other hand, cells expressing α-synuclein showed activated autophagy and particularly mitophagy. Employing a genetic strategy we demonstrated that autophagy is triggered in order to protect cells from α-synuclein-induced cell death. Our results clarify the role of Opa-1 and Drp-1 in mitochondrial dynamics and cell survival, a controversial α-synuclein research issue. The findings presented point to the relevance of mitochondrial homeostasis and autophagy in the pathogenesis of PD. Better understanding of the molecular interaction between these processes could give rise to novel therapeutic methods for PD prevention and amelioration. Copyright © 2018 Elsevier Inc. All rights reserved.
Directory of Open Access Journals (Sweden)
Fawaz Al-Mousa
Full Text Available Brominated flame retardants (BFRs are chemicals commonly used to reduce the flammability of consumer products and are considered pollutants since they have become widely dispersed throughout the environment and have also been shown to bio-accumulate within animals and man. This study investigated the cytotoxicity of some of the most commonly used groups of BFRs on SH-SY5Y human neuroblastoma cells. The results showed that of the BFRs tested, hexabromocyclododecane (HBCD, tetrabromobisphenol-A (TBBPA and decabromodiphenyl ether (DBPE, all are cytotoxic at low micromolar concentrations (LC(50 being 2.7 ± 0.7 µM, 15 ± 4 µM and 28 ± 7 µM, respectively. They induced cell death, at least in part, by apoptosis through activation of caspases. They also increased intracellular [Ca(2+] levels and reactive-oxygen-species within these neuronal cells. Furthermore, these BFRs also caused rapid depolarization of the mitochondria and cytochrome c release in these neuronal cells. Elevated intracellular [Ca(2+] levels appear to occur through a mechanism involving microsomal Ca(2+-ATPase inhibition and this maybe responsible for Ca(2+-induced mitochondrial dysfunction. In addition, µM levels of these BFRs caused β-amyloid peptide (Aβ-42 processing and release from these cells with a few hours of exposure. These results therefore shows that these pollutants are both neurotoxic and amyloidogenic in-vitro.
Directory of Open Access Journals (Sweden)
Joana Silva
2014-06-01
Full Text Available Parkinson Disease (PD is characterized by the loss of dopaminergic cell bodies in the substantia nigra and oxidative stress, mitochondrial dysfunction and apoptosis seem to be involved in the pathogenesis of the disease. The aim of this study was to evaluate the neuroprotective effect of different algae extracts on the cell death induced by by 6-OH-dopamine on a neuronal human cell model (SH- SY5Y. The neuroprotective effect of methanolic and dichloromethane algae extract (Padina pavonica, Sargassum muticum, Saccorhiza polyschides, Codium tomentosum, Ulva compressa in the presence of 6-OH-DA was assessed using the MTT method. The activity of caspase-3 and the quantification of hydrogen peroxide (extracellular environment and real time production production were studied in the presence and in the absence of the macroalgae extracts. The highest neuroprotective effect was exhibited by methanolic fractions (1000 µg/ml; 24 hours of S. muticum (115.80 ± 8.53% of viable cells, S. polyschides (106.51 ± 4.26 of viable cells, P. pavonica (95.98 ± 3.95 of viable cells and dichloromethane (1000 µg/ml; 24 hours fraction of C. tomentosum alga (102.22 ± 4.24 of viable cells, when compared with 6-OH-DA condition (100μM; 24 hours (67.40 ± 3.56 of viable cells. For the extracts that exhibited the highest neuroprotective effect was studied the possible alterations induced in the mechanisms of action previous selected. The dichloromethane fraction of Codium tomentosum alga (1000 µg/ml highly reduced the 6-OH-DA induced increase of caspase-3 activity, the less quantity of H2O2 in the extracellular environment and less production of H2O2 on real time (2.58 ± 1.77 UAF mg of protein-1 min-1; 0.0 ± 0.005 µM of H2O2, 54.07 ± 6.66 UAF min-1, respectively when compared with the 6-OH-DA condition at 100μM (4.5 ± 1:35 UAF mg of protein-1 min-1; ± 0.4 0.0019 µM of H2O2; 214.26 ± 8:46 UAF min-1, respectively. These results suggest that Codium tomentosum
International Nuclear Information System (INIS)
Florea, Ana-Maria; Splettstoesser, Frank; Dopp, Elke; Rettenmeier, Albert W.; Buesselberg, Dietrich
2005-01-01
Physiological modifications of intracellular Ca 2+ ([Ca 2+ ] i ) levels trigger and/or regulate a diversity of cellular activities (e.g. neurotransmitter release, synaptic plasticity, muscular contraction, cell proliferation), while calcium overloads could result in cytotoxicity. Previously, we have shown that trimethyltin chloride (Me 3 SnCl; TMT) modulates calcium homeostasis in cervix adenocarcinoma (HeLa S3) cells [Florea, A.-M., Dopp, E., Buesselberg, D., 2005. TMT induces elevated calcium transients in HeLa cells: types and levels of response. Cell Calcium 37, 252-258]. Here we compare [Ca 2+ ] i -changes induced by trimethyltin chloride in neuroblastoma SY5Y and HeLa S3 cells using calcium-sensitive dyes (fluo-4/AM (fluo-4) and rhod-2/AM (rhod-2)) and laser scanning microscopy (LSM). TMT-induced calcium elevations in neuroblastoma SY5Y as well as in HeLa S3 cells. [Ca 2+ ] i rose to a sustained plateau or to transient spikes. Overall, the detected averaged increase of the maximum calcium elevation were: 0.5 μM ∼125.6%; 5 μM ∼130.1%; 500 μM ∼145% in HeLa S3 cells and 0.5 μM ∼133.3%; 5 μM ∼136.1%; 500 μM ∼147.1% in neuroblastoma SY5Y cells. The calcium rise derived from internal stores did not significantly depend on the presence of calcium in the external solution: ∼109% (no calcium added) versus ∼117% (2 mM calcium; 5 μM TMT) in HeLa cells. This difference was similar in neuroblastoma SY5Y cells, were ∼127% versus ∼136% increase (5 μM TMT) were measured. Staining of calcium stores with rhod-2 showed a TMT-induced [Ca 2+ ] i -decrease in the stores followed by an increase of the calcium concentration in the nuclei of the two cell lines tested. Our results suggest that toxic effects in human tumour cells after exposure to trimethyltin compounds might be due to an elevation of [Ca 2+ ] i
FENG, CHUNSHENG; LUO, TIANFEI; ZHANG, SHUYAN; LIU, KAI; ZHANG, YANHONG; LUO, YINAN; GE, PENGFEI
2016-01-01
Oxidative stress, which is characterized by excessive production of reactive oxygen species (ROS), is a common pathway that results in neuronal injury or death due to various types of pathological stress. Although lycopene has been identified as a potent antioxidant, its effect on hydrogen peroxide (H2O2)-induced neuronal damage remains unclear. In the present study, pretreatment with lycopene was observed to protect SH-SY5Y neuroblastoma cells against H2O2-induced death via inhibition of apoptosis resulting from activation of caspase-3 and translocation of apoptosis inducing factor (AIF) to the nucleus. Furthermore, the over-produced ROS, as well as the reduced activities of anti-oxidative enzymes, superoxide dismutase and catalase, were demonstrated to be alleviated by lycopene. Additionally, lycopene counteracted H2O2-induced mitochondrial dysfunction, which was evidenced by suppression of mitochondrial permeability transition pore opening, attenuation of the decline of the mitochondrial membrane potential, and inhibition of the increase of Bax and decrease of Bcl-2 levels within the mitochondria. The release of cytochrome c and AIF from the mitochondria was also reduced. These results indicate that lycopene is a potent neuroprotectant against apoptosis, oxidative stress and mitochondrial dysfunction, and could be administered to prevent neuronal injury or death. PMID:27035331
Seoposengwe, Keabetswe; van Tonder, Jacob John; Steenkamp, Vanessa
2013-12-12
Lannea schweinfurthii, Zanthoxylum capense, Scadoxus puniceus and Crinum bulbispermum are used traditionally to treat neurological disorders. The aim of this study was to evaluate the cytoprotective potential of the four plants, after induction of toxicity using rotenone, in SH-SY5Y neuroblastoma cells. Cytotoxicity of the plant extracts and rotenone was assessed using the sulforhodamine B (SRB) assay. Fluorometry was used to measure intracellular redox state (reactive oxygen species (ROS) and intracellular glutathione content), mitochondrial membrane potential (MMP) and caspase-3 activity, as a marker of apoptotic cell death. Of the tested plants, the methanol extract of Z. capense was the least cytotoxic; LC50 121.3 ± 6.97 μg/ml, while S. puniceus methanol extract was the most cytotoxic; LC50 20.75 ± 1.47 μg/ml. Rotenone reduced intracellular ROS levels after 24 h exposure. Pre-treating cells with S. puniceus and C. bulbispermum extracts reversed the effects of rotenone on intracellular ROS levels. Rotenone exposure also decreased intracellular glutathione levels, which was counteracted by pre-treatment with any one of the extracts. MMP was reduced by rotenone, which was neutralized by pre-treatment with C. bulbispermum ethyl acetate extract. All extracts inhibited rotenone-induced activation of caspase-3. The studied plants demonstrated anti-apoptotic activity and restored intracellular glutathione content following rotenone treatment, suggesting that they may possess neuroprotective properties.
Directory of Open Access Journals (Sweden)
Guanhua Du
2011-03-01
Full Text Available Luteolin, a 3’,4’,5,7-tetrahydroxyflavone, is a plant flavonoid and pharmacologically active agent that has been isolated from several plant species. In the present study, the effects of luteolin obtained from the medicinal plant Elsholtzia rugulosa and the related mechanisms were examined in an Alzheimer's disease (AD cell model. In this model, copper was used to exacerbate the neurotoxicity in β-amyloid precursor protein Swedish mutation stably overexpressed SH-SY5Y cells (named “APPsw cells” for short. Based on this model, we demonstrated that luteolin increased cell viability, reduced intracellular ROS generation, enhanced the activity of SOD and reversed mitochondrial membrane potential dissipation. Inhibition of caspase-related apoptosis was consistently involved in the neuroprotection afforded by luteolin. Furthermore, it down-regulated the expression of AβPP and lowered the secretion of Aβ1-42. These results indicated that luteolin from the Elsholtzia rugulosa exerted neroprotective effects through mechanisms that decrease AβPP expression, lower Aβ secretion, regulate the redox imbalance, preserve mitochondrial function, and depress the caspase family-related apoptosis.
Liu, Zhong-Jie; Zhao, Wei; Zhang, Qing-Guo; Li, Le; Lai, Lu-Ying; Jiang, Shan; Xu, Shi-Yuan
2015-01-01
Hyperglycemia can inhibit expression of the 8-oxoG-DNA glycosylase (OGG1) which is one of the key repair enzymes for DNA oxidative damage. The effect of hyperglycemia on OGG1 expression in response to local anesthetics-induced DNA damage is unknown. This study was designed to determine whether high glucose inhibits OGG1 expression and aggravates bupivacaine-induced DNA damage via reactive oxygen species (ROS). SH-SY5Y cells were cultured with or without 50 mM glucose for 8 days before they were treated with 1.5 mM bupivacaine for 24 h. OGG1 expression was measured by quantitative real-time polymerase chain reaction (qRT-PCR) and western blot. ROS was estimated using the redox-sensitive fluorescent dye DCFH-DA. DNA damage was investigated with immunostaining for 8-oxodG and comet assays. OGG1 expression was inhibited in cells exposed to high glucose with concomitant increase in ROS production and more severe DNA damage as compared to control culture conditions, and these changes were further exacerbated by bupivacaine. Treatment with the antioxidant N-acetyl-L-cysteine (NAC) prevented high glucose and bupivacaine mediated increase in ROS production and restored functional expression of OGG1, which lead to attenuated high glucose-mediated exacerbation of bupivacaine neurotoxicity. Our findings indicate that subjects with diabetes may experience more detrimental effects following bupivacaine use. PMID:26161242
Directory of Open Access Journals (Sweden)
Zhong-Jie Liu
2015-01-01
Full Text Available Hyperglycemia can inhibit expression of the 8-oxoG-DNA glycosylase (OGG1 which is one of the key repair enzymes for DNA oxidative damage. The effect of hyperglycemia on OGG1 expression in response to local anesthetics-induced DNA damage is unknown. This study was designed to determine whether high glucose inhibits OGG1 expression and aggravates bupivacaine-induced DNA damage via reactive oxygen species (ROS. SH-SY5Y cells were cultured with or without 50 mM glucose for 8 days before they were treated with 1.5 mM bupivacaine for 24 h. OGG1 expression was measured by quantitative real-time polymerase chain reaction (qRT-PCR and western blot. ROS was estimated using the redox-sensitive fluorescent dye DCFH-DA. DNA damage was investigated with immunostaining for 8-oxodG and comet assays. OGG1 expression was inhibited in cells exposed to high glucose with concomitant increase in ROS production and more severe DNA damage as compared to control culture conditions, and these changes were further exacerbated by bupivacaine. Treatment with the antioxidant N-acetyl-L-cysteine (NAC prevented high glucose and bupivacaine mediated increase in ROS production and restored functional expression of OGG1, which lead to attenuated high glucose-mediated exacerbation of bupivacaine neurotoxicity. Our findings indicate that subjects with diabetes may experience more detrimental effects following bupivacaine use.
Adeosun, Samuel O; Albert, Paul R; Austin, Mark C; Iyo, Abiye H
2012-05-01
Nuclear deformed epidermal autoregulatory factor-1 (NUDR/Deaf-1) and five prime repressor element under dual repression (Freud-1) are novel transcriptional regulators of the 5-HT(1A) receptor, a receptor that has been implicated in the pathophysiology of various psychiatric illnesses. The antidepressant effect of 17β-Estradiol (17βE(2)) is purported to involve the downregulation of this receptor. We investigated the possible role of NUDR and Freud-1 in 17βE(2)-induced downregulation of the 5-HT(1A) receptor in the neuroblastoma cell line SH SY5Y. Cells were treated with 10 nM of 17βE(2) for 3 or 48 h, followed by a 24-h withdrawal period. Proteins were isolated and analyzed by western blotting. 17βE(2) treatment increased NUDR immunoreactivity while Freud-1 and the 5-HT(1A) receptor showed significant decreases. Upon withdrawal of 17βE(2), protein expression returned to control levels, except for NUDR, which remained significantly elevated in the 3-h treatment. Taken together, these data support a non-genomic downregulation of 5-HT(1A) receptor protein by 17βE(2), which does not involve NUDR and Freud-1. Rather, changes in both transcription factors seem to be compensatory/homeostatic responses to changes in 5-HT(1A) receptor induced by 17βE(2). These observations further highlight the importance of NUDR and Freud-1 in regulating 5-HT(1A) receptor expression.
Nopparat, Chutikorn; Sinjanakhom, Puritat; Govitrapong, Piyarat
2017-08-01
Autophagy, a degradation mechanism that plays a major role in maintaining cellular homeostasis and diminishes in aging, is considered an aging characteristic. Melatonin is an important hormone that plays a wide range of physiological functions, including the anti-aging effect, potentially via the regulation of the Sirtuin1 (SIRT1) pathway. The deacetylation ability of SIRT1 is important for controlling the function of several transcription factors, including nuclear factor kappa B (NF-ĸB). Apart from inflammation, NF-ĸB can regulate autophagy by inhibiting Beclin1, an initiator of autophagy. Although numerous studies have revealed the role of melatonin in regulating autophagy, very limited experiments have shown that melatonin can increase autophagic activity via SIRT1 in a senescent model. This study focuses on the effect of melatonin on autophagy via the deacetylation activity of SIRT1 on RelA/p65, a subunit of NF-ĸB, to determine whether melatonin can attenuate the aging condition. SH-SY5Y cells were treated with H 2 O 2 to induce the senescent state. These results demonstrated that melatonin reduced a number of beta-galactosidase (SA-βgal)-positive cells, a senescent marker. In addition, melatonin increased the protein levels of SIRT1, Beclin1, and LC3-II, a hallmark protein of autophagy, and reduced the levels of acetylated-Lys310 in the p65 subunit of NF-ĸB in SH-SY5Y cells treated with H 2 O 2 . Furthermore, in the presence of SIRT1 inhibitor, melatonin failed to increase autophagic markers. The present data indicate that melatonin enhances autophagic activity via the SIRT1 signaling pathway. Taken together, we propose that in modulating autophagy, melatonin may provide a therapeutically beneficial role in the anti-aging processes. © 2017 John Wiley & Sons A/S. Published by John Wiley & Sons Ltd.
Khan, Mahfuz B; Lang, Michelle J; Huang, Ming-Bo; Raymond, Andrea; Bond, Vincent C; Shiramizu, Bruce; Powell, Michael D
2016-04-01
In the era of combined antiretroviral therapy (CART), many of the complications due to HIV-1 infection have diminished. One exception is HIV-associated neurocognitive disorder (HAND). HAND is a spectrum of disorders in cognitive function that ranges from asymptomatic disease to severe dementia (HAD). The milder form of HAND has actually remained the same or slightly increased in prevalence in the CART era. Even in individuals who have maintained undetectable HIV RNA loads, viral proteins such as Nef and Tat can continue to be expressed. In this report, we show that Nef protein and nef messenger RNA (mRNA) are packaged into exosomes that remain in circulation in patients with HAD. Plasma-derived Nef exosomes from patients with HAD have the ability to interact with the neuroblastoma cell line SH-SY5Y and deliver nef mRNA. The mRNA can induce expression of Nef in target cells and subsequently increase expression and secretion of beta-amyloid (Aβ) and Aβ peptides. Increase secretion of amyloid peptide could contribute to cognitive impairment seen in HAND.
van der Merwe, Celia; van Dyk, Hayley Christy; Engelbrecht, Lize; van der Westhuizen, Francois Hendrikus; Kinnear, Craig; Loos, Ben; Bardien, Soraya
2017-05-01
Parkinson's disease (PD) is a neurodegenerative disorder characterised by the loss of dopaminergic neurons in the substantia nigra. Mutations in the PINK1 gene result in an autosomal recessive form of early-onset PD. PINK1 plays a vital role in mitochondrial quality control via the removal of dysfunctional mitochondria. The aim of the present study was to create a cellular model of PD using siRNA-mediated knock down of PINK1 in SH-SY5Y neuroblastoma cells The possible protective effects of curcumin, known for its many beneficial properties including antioxidant and anti-inflammatory effects, was tested on this model in the presence and absence of paraquat, an additional stressor. PINK1 siRNA and control cells were separated into four treatment groups: (i) untreated, (ii) treated with paraquat, (iii) pre-treated with curcumin then treated with paraquat, or (iv) treated with curcumin. Various parameters of cellular and mitochondrial function were then measured. The PINK1 siRNA cells exhibited significantly decreased cell viability, mitochondrial membrane potential (MMP), mitochondrial respiration and ATP production, and increased apoptosis. Paraquat-treated cells exhibited decreased cell viability, increased apoptosis, a more fragmented mitochondrial network and decreased MMP. Curcumin pre-treatment followed by paraquat exposure rescued cell viability and increased MMP and mitochondrial respiration in control cells, and significantly decreased apoptosis and increased MMP and maximal respiration in PINK1 siRNA cells. These results highlight a protective effect of curcumin against mitochondrial dysfunction and apoptosis in PINK1-deficient and paraquat-exposed cells. More studies are warranted to further elucidate the potential neuroprotective properties of curcumin.
Neurotrophic effects of growth/differentiation factor 5 in a neuronal cell line.
Toulouse, André; Collins, Grace C; Sullivan, Aideen M
2012-04-01
The neurotrophin growth/differentiation factor 5 (GDF5) is studied as a potential therapeutic agent for Parkinson's disease as it is believed to play a role in the development and maintenance of the nigrostriatal system. Progress in understanding the effects of GDF5 on dopaminergic neurones has been hindered by the use of mixed cell populations derived from primary cultures or in vivo experiments, making it difficult to differentiate between direct and indirect effects of GDF5 treatment on neurones. In an attempt to establish an useful model to study the direct neuronal influence of GDF5, we have characterised the effects of GDF5 on a human neuronal cell line, SH-SY5Y. Our results show that GDF5 has the capability to promote neuronal but not dopaminergic differentiation. We also show that it promotes neuronal survival in vitro following a 6-hydroxydopamine insult. Our results show that application of GDF5 to SH-SY5Y cultures induces the SMAD pathway which could potentially be implicated in the intracellular transmission of GDF5's neurotrophic effects. Overall, our study shows that the SH-SY5Y neuroblastoma cell line provides an excellent neuronal model to study the neurotrophic effects of GDF5.
C282Y-HFE gene variant affects cholesterol metabolism in human neuroblastoma cells.
Ali-Rahmani, Fatima; Huang, Michael A; Schengrund, C-L; Connor, James R; Lee, Sang Y
2014-01-01
Although disruptions in the maintenance of iron and cholesterol metabolism have been implicated in several cancers, the association between variants in the HFE gene that is associated with cellular iron uptake and cholesterol metabolism has not been studied. The C282Y-HFE variant is a risk factor for different cancers, is known to affect sphingolipid metabolism, and to result in increased cellular iron uptake. The effect of this variant on cholesterol metabolism and its possible relevance to cancer phenotype was investigated using wild type (WT) and C282Y-HFE transfected human neuroblastoma SH-SY5Y cells. Expression of C282Y-HFE in SH-SY5Y cells resulted in a significant increase in total cholesterol as well as increased transcription of a number of genes involved in its metabolism compared to cells expressing WT-HFE. The marked increase in expression of NPC1L1 relative to that of most other genes, was accompanied by a significant increase in expression of NPC1, a protein that functions in cholesterol uptake by cells. Because inhibitors of cholesterol metabolism have been proposed to be beneficial for treating certain cancers, their effect on the viability of C282Y-HFE neuroblastoma cells was ascertained. C282Y-HFE cells were significantly more sensitive than WT-HFE cells to U18666A, an inhibitor of desmosterol Δ24-reductase the enzyme catalyzing the last step in cholesterol biosynthesis. This was not seen for simvastatin, ezetimibe, or a sphingosine kinase inhibitor. These studies indicate that cancers presenting in carriers of the C282Y-HFE allele might be responsive to treatment designed to selectively reduce cholesterol content in their tumor cells.
Chandrasekhar, Y; Phani Kumar, G; Ramya, E M; Anilakumar, K R
2018-04-18
Gallic acid is one of the most important polyphenolic compounds, which is considered an excellent free radical scavenger. 6-Hydroxydopamine (6-OHDA) is a neurotoxin, which has been implicated in mainly Parkinson's disease (PD). In this study, we investigated the molecular mechanism of the neuroprotective effects of gallic acid on 6-OHDA induced apoptosis in human dopaminergic cells, SH-SY5Y. Our results showed that 6-OHDA induced cytotoxicity in SH-SY5Y cells was suppressed by pre-treatment with gallic acid. The percentage of live cells (90%) was high in the pre-treatment of gallic acid when compared with 6-OHDA alone treated cell line. Moreover, gallic acid was very effective in attenuating the disruption of mitochondrial membrane potential, elevated levels of intracellular ROS and apoptotic cell death induced by 6-OHDA. Gallic acid also lowered the ratio of the pro-apoptotic Bax protein and the anti-apoptotic Bcl-2 protein in SH-SY5Y cells. 6-OHDA exposure was up-regulated caspase-3 and Keap-1 and, down-regulated Nrf2, BDNF and p-CREB, which were sufficiently reverted by gallic acid pre-treatment. These findings indicate that gallic acid is able to protect the neuronal cells against 6-OHDA induced injury and proved that gallic acid might potentially serve as an agent for prevention of several human neurodegenerative diseases caused by oxidative stress and apoptosis.
Directory of Open Access Journals (Sweden)
Madhusudhanan Narasimhan
Full Text Available Nuclear factor-erythroid 2-related factor 2 (Nrf2/NFE2L2, a redox-sensitive transcription factor plays a critical role in adaptation to cellular stress and affords cellular defense by initiating transcription of antioxidative and detoxification genes. While a protein can be regulated at multiple levels, control of Nrf2 has been largely studied at post-translational regulation points by Keap1. Importantly, post-transcriptional/translational based regulation of Nrf2 is less understood and to date there are no reports on such mechanisms in neuronal systems. In this context, studies involving the role of microRNAs (miRs which are normally considered as fine tuning regulators of protein production through translation repression and/or post-transcriptional alterations, are in place. In the current study, based on in-silico analysis followed by immunoblotting and real time analysis, we have identified and validated for the first time that human NFE2L2 could be targeted by miR153/miR27a/miR142-5p/miR144 in neuronal, SH-SY5Y cells. Co-transfection studies with individual miR mimics along with either WT 3' UTR of human Nrf2 or mutated miRNA targeting seed sequence within Nrf2 3' UTR, demonstrated that Nrf2 is a direct regulatory target of these miRs. In addition, ectopic expression of miR153/miR27a/miR142-5p/miR144 affected Nrf2 mRNA abundance and nucleo-cytoplasmic concentration of Nrf2 in a Keap1 independent manner resulting in inefficient transactivating ability of Nrf2. Furthermore, forced expression of miRs diminished GCLC and GSR expression resulting in alteration of Nrf2 dependent redox homeostasis. Finally, bioinformatics based miRNA-disease network analysis (MDN along with extended computational network analysis of Nrf2 associated pathologic processes suggests that if in a particular cellular scenario where any of these miR153/miR27a/miR142-5p/miR144 either individually or as a group is altered, it could affect Nrf2 thus triggering and
Pan, Li-Long; Liu, Xin-Hua; Jia, Yao-Ling; Wu, Dan; Xiong, Qing-Hui; Gong, Qi-Hai; Wang, Yang; Zhu, Yi-Zhun
2013-04-01
Heme oxygenase-1 (HO-1) has potential anti-apoptotic properties. A novel compound [4-(2-acetoxy-3-((R)-3-(benzylthio)-1-methoxy-1-oxopropan-2- ylamino)-3-oxopropyl)-1,2-phenylene diacetate (DSC)] was synthesized by joining danshensu and cysteine through an appropriate linker. This study investigated if the cytoprotective properties of DSC involved the induction of HO-1. We evaluated the cytoprotective effects of DSC on H2O2-induced cell damage, apoptosis, intracellular and mitochondrial reactive oxygen species (ROS) production, mitochondrial membrane potential (ΔΨm) loss, and apoptosis-related proteins expression and its underlying mechanisms. DSC concentration-dependently attenuated cell death, lactate dehydrogenase release, intracellular and mitochondrial ROS production, and ΔΨm collapse, modulated apoptosis-related proteins (Bcl-2, Bax, caspase-3, p53, and cleaved PARP) expression, and inhibited phosphorylation of extracellular signal-regulated kinase 1/2 in SH-SY5Y cells induced by H2O2. In addition, DSC concentration-dependently induced HO-1 expression associated with nuclear translocation of nuclear factor-erythroid 2 related factor 2 (Nrf-2), while the effect of DSC was inhibited by a phosphoinositide 3-kinase (PI3K) inhibitor LY294002. Furthermore, the protective effect of DSC on H2O2-induced cell death was abolished by HO-1 inhibitor ZnPP, but was mimicked by carbon monoxide-releasing moiety CORM-3 or HO-1 by-product bilirubin. Finally, DSC inhibited H2O2-induced changes of Bcl-2, Bax, and caspase-3 expression, and all of these effects were reversed by HO-1 silencing. Induction of HO-1 may be, at least in part, responsible for the anti-apoptotic property of DSC, an effect that involved the activation of PI3K/Akt/Nrf-2 axis. DSC might have the potential for beneficial therapeutic interventions for neurodegenerative diseases. Copyright © 2013. Published by Elsevier B.V.
Directory of Open Access Journals (Sweden)
Gurdeep Marwarha
Full Text Available β-amyloid (Aβ peptide, accumulation of which is a culprit for Alzheimer's disease (AD, is derived from the initial cleavage of amyloid precursor protein by the aspartyl protease BACE1. Identification of cellular mechanisms that regulate BACE1 production is of high relevance to the search for potential disease-modifying therapies that inhibit BACE1 to reduce Aβ accumulation and AD progression. In the present study, we show that the cholesterol oxidation product 27-hydroxycholesterol (27-OHC increases BACE1 and Aβ levels in human neuroblastoma SH-SY5Y cells. This increase in BACE1 involves a crosstalk between the two transcription factors NF-κB and the endoplasmic reticulum stress marker, the growth arrest and DNA damage induced gene-153 (gadd153, also called CHOP. We specifically show that 27-OHC induces a substantial increase in NF-κB binding to the BACE1 promoter and subsequent increase in BACE1 transcription and Aβ production. The NF-κB inhibitor, sc514, significantly attenuated the 27-OHC-induced increase in NF-κB-mediated BACE1 expression and Aβ genesis. We further show that the 27-OHC-induced NF-κB activation and increased NF-κB-mediated BACE1 expression is contingent on the increased activation of gadd153. Silencing gadd153 expression with siRNA alleviated the 27-OHC-induced increase in NF-κB activation, NF-κB binding to the BACE1 promoter, and subsequent increase in BACE1 transcription and Aβ production. We also show that increased levels of BACE1 in the triple transgenic mouse model for AD is preceded by gadd153 and NF-κB activation. In summary, our study demonstrates that gadd153 and NF-κB work in concert to regulate BACE1 expression. Agents that inhibit gadd153 activation and subsequent interaction with NF-κB might be promising targets to reduce BACE1 and Aβ overproduction and may ultimately serve as disease-modifying treatments for AD.
Rogers, Danny A; Schor, Nina F
2013-03-10
Peripheral neuroblastic tumors exist as a heterogeneous mixture of neuroblastic (N-type) cells and Schwannian stromal (S-type) cells. These stromal cells not only represent a differentiated and less aggressive fraction of the tumor, but also have properties that can influence the further differentiation of nearby malignant cells. In vitro neuroblastoma cultures exhibit similar heterogeneity with N-type and S-type cells representing the neuroblastic and stromal portions of the tumor, respectively, in behavior, morphology, and molecular expression patterns. In this study, we deplete kinase D-interacting substrate of 220kD (Kidins220) with an shRNA construct and thereby cause morphologic transition of the human SH-SY5Y neuroblastoma cell line from N-type to S-type. The resulting cells have similar morphology and expression profile to SH-EP1 cells, a native S-type cell line from the same parent cell line, and to SH-SY5Y cells treated with BrdU, a treatment that induces S-type morphology. Specifically, both Kidins220-deficient SH-SY5Y cells and native SH-EP1 cells demonstrate down-regulation of the genes DCX and STMN2, markers for the neuronal lineage. We further show that Kidins220, DCX and STMN2 are co-down-regulated in cells of S-type morphology generated by methods other than Kidins220 depletion. Finally, we report that the association of low Kidins220 expression with S-type morphology and low DCX and STMN2 expression is demonstrated in spontaneously occurring human peripheral neuroblastic tumors. We propose that Kidins220 is critical in N- to S-type transition of neural crest tumor cells. Copyright © 2013 Elsevier Inc. All rights reserved.
Caspase 8/10 are not mediating apoptosis in neuroblastoma cells treated with CDK inhibitory drugs
Ribas i Fortuny, Judit; Gómez Arbonés, Javier; Boix Torras, Jacint
2005-01-01
Olomoucine and Roscovitine are pharmacological inhibitors of cyclin-dependent kinases (CDK) displaying a promising profile as anticancer agents. Both compounds are effective inductors of apoptosis in a human neuroblastoma cell line, SH-SY5Y. The characterization of this process had suggested the involvement of an extrinsic pathway [Ribas, J., Boix, J., 2004. Cell differentiation, Caspase inhibition, and macromolecular synthesis blockage, but not Bcl-2 or Bcl-XL proteins, protect SH-SY5Y cells...
International Nuclear Information System (INIS)
Park, Jeongyeon; Kwon, Jong Hwa; Kim, Nam; Song, Kiwon
2018-01-01
Alzheimer’s disease (AD) is a neurodegenerative disease leading to progressive loss of memory and other cognitive functions. One of the well-known pathological markers of AD is the accumulation of amyloid-beta protein (Aβ), and its plaques, in the brain. Recent studies using Tg-5XFAD mice as a model of AD have reported that exposure to radiofrequency electromagnetic fields (RF-EMF) from cellular phones reduced Aβ plaques in the brain and showed beneficial effects on AD. In this study, we examined whether exposure to 1950 MHz RF-EMF affects Aβ processing in neural cells. We exposed HT22 mouse hippocampal neuronal cells and SH-SY5Y human neuroblastoma cells to RF-EMF (SAR 6 W/kg) for 2 h per day for 3 days, and analyzed the mRNA and protein expression of the key genes related to Aβ processing. When exposed to RF-EMF, mRNA levels of APP, BACE1, ADAM10 and PSEN1 were decreased in HT22, but the mRNA level of APP was not changed in SH-SY5Y cells. The protein expression of APP and BACE1, as well as the secreted Aβ peptide, was not significantly different between RF-EMF–exposed 7w-PSML, HT22 and SH-SY5Y cells and the unexposed controls. These observations suggest that RF-EMF exposure may not have a significant physiological effect on Aβ processing of neural cells in the short term. However, considering that we only exposed HT22 and SH-SY5Y cells to RF-EMF for 2 h per day for 3 days, we cannot exclude the possibility that 1950 MHz RF-EMF induces physiological change in Aβ processing with long-term and continuous exposure.
Human neuronal cell based assay: A new in vitro model for toxicity evaluation of ciguatoxin.
Coccini, Teresa; Caloni, Francesca; De Simone, Uliana
2017-06-01
Ciguatoxins (CTXs) are emerging marine neurotoxins representing the main cause of ciguatera fish poisoning, an intoxication syndrome which configures a health emergency and constitutes an evolving issue constantly changing due to new vectors and derivatives of CTXs, as well as their presence in new non-endemic areas. The study applied the neuroblastoma cell model of human origin (SH-SY5Y) to evaluate species-specific mechanistic information on CTX toxicity. Metabolic functionality, cell morphology, cytosolic Ca 2+ i responses, neuronal cell growth and proliferation were assessed after short- (4-24h) and long-term exposure (10days) to P-CTX-3C. In SH-SY5Y, P-CTX-3C displayed a powerful cytotoxicity requiring the presence of both Veratridine and Ouabain. SH-SY5Y were very sensitive to Ouabain: 10 and 0.25nM appeared the optimal concentrations, for short- and long-term toxicity studies, respectively, to be used in co-incubation with Veratridine (25μM), simulating the physiological and pathological endogenous Ouabain levels in humans. P-CTX-3C cytotoxic effect, on human neurons co-incubated with OV (Ouabain+Veratridine) mix, was expressed starting from 100pM after short- and 25pM after long-term exposure. Notably, P-CTX-3C alone at 25nM induced cytotoxicity after 24h and prolonged exposure. This human brain-derived cell line appears a suitable cell-based-model to evaluate cytotoxicity of CTX present in marine food contaminated at low toxic levels and to characterize the toxicological profile of other/new congeners. Copyright © 2017 Elsevier B.V. All rights reserved.
Tong, Zhi-Bin; Hogberg, Helena; Kuo, David; Sakamuru, Srilatha; Xia, Menghang; Smirnova, Lena; Hartung, Thomas; Gerhold, David
2017-02-01
More than 75 000 man-made chemicals contaminate the environment; many of these have not been tested for toxicities. These chemicals demand quantitative high-throughput screening assays to assess them for causative roles in neurotoxicities, including Parkinson's disease and other neurodegenerative disorders. To facilitate high throughput screening for cytotoxicity to neurons, three human neuronal cellular models were compared: SH-SY5Y neuroblastoma cells, LUHMES conditionally-immortalized dopaminergic neurons, and Neural Stem Cells (NSC) derived from human fetal brain. These three cell lines were evaluated for rapidity and degree of differentiation, and sensitivity to 32 known or candidate neurotoxicants. First, expression of neural differentiation genes was assayed during a 7-day differentiation period. Of the three cell lines, LUHMES showed the highest gene expression of neuronal markers after differentiation. Both in the undifferentiated state and after 7 days of neuronal differentiation, LUHMES cells exhibited greater cytotoxic sensitivity to most of 32 suspected or known neurotoxicants than SH-SY5Y or NSCs. LUHMES cells were also unique in being more susceptible to several compounds in the differentiating state than in the undifferentiated state; including known neurotoxicants colchicine, methyl-mercury (II), and vincristine. Gene expression results suggest that differentiating LUHMES cells may be susceptible to apoptosis because they express low levels of anti-apoptotic genes BCL2 and BIRC5/survivin, whereas SH-SY5Y cells may be resistant to apoptosis because they express high levels of BCL2, BIRC5/survivin, and BIRC3 genes. Thus, LUHMES cells exhibited favorable characteristics for neuro-cytotoxicity screening: rapid differentiation into neurons that exhibit high level expression neuronal marker genes, and marked sensitivity of LUHMES cells to known neurotoxicants. Copyright © 2016 John Wiley & Sons, Ltd. Copyright © 2016 John Wiley & Sons, Ltd.
La Marca, Valeria; Spagnuolo, Maria Stefania; Cigliano, Luisa; Marasco, Daniela; Abrescia, Paolo
2014-07-01
Cholesterol is mostly removed from the CNS by its conversion to cerebrosterol (24(S)-hydroxycholesterol, 24(S)OH-C), which is transported to the circulation for bile formation in liver. A neurotoxic role of this oxysterol was previously demonstrated in cell culture. Here, we provide evidence that the enzyme lecithin-cholesterol acyltransferase, long known to esterify cholesterol, also produces monoesters of 24(S)OH-C. Proteoliposomes containing apolipoprotein A-I or apolipoprotein E were used to stimulate the enzyme activity and entrap the formed esters. Proteoliposomes with apolipoprotein A-I were found to be more active than those with apolipoprotein E in stimulating the production of oxysteryl esters. Cholesterol and 24(S)OH-C were found to compete for enzyme activity. High levels of haptoglobin, as those circulating during the acute inflammatory phase, inhibited 24(S)OH-C esterification. When highly neurotoxic 24(S)OH-C was treated with enzyme and proteoliposomes before incubation with differentiated SH-SY5Y cells, the neuron survival improved. The esters of 24(S)OH-C, embedded into proteoliposomes by the enzyme and isolated from unesterified 24(S)OH-C by gel filtration chromatography, did not enter the neurons in culture. These results suggest that the enzyme, in the presence of the apolipoproteins, converts 24(S)OH-C into esters restricted to the extracellular environment, thus preventing or limiting oxysterol-induced neurotoxic injuries to neurons in culture. 24-hydroxycholesterol (24(S)OH-C) is neurotoxic. The enzyme lecithin-cholesterol acyltransferase (LCAT) synthesizes monoesters of 24(S)OH-C in reaction mixtures with proteoliposomes containing phospholipids and apolipoprotein A-I or apolipoprotein E. The esters, also produced by incubation of cerebrospinal fluid only with tritiated 24(S)OH-C, are embedded into lipoproteins that do not enter neurons in culture. The enzyme activity limits the toxicity of 24-hydroxycholesterol in neuron culture. © 2014
Zhao, Qing; Ye, Junli; Wei, Na; Fong, Chichun; Dong, Xiaoli
2016-07-01
The cause of Parkinson's disease (PD) could be ascribed to the progressive and selective loss of dopaminergic neurons in the substantia nigra pars compacta, and thus molecules with neuroprotective ability may have therapeutic value against PD. In the current study, the neuroprotective effects and underlying mechanisms of tormentic acid (TA), a naturally occurring triterpene extracted from medicinal plants such as Rosa rugosa and Potentilla chinensis, were evaluated in a widely used cellular PD model in which neurotoxicity was induced by MPP(+) in cultured SH-SY5Y cells. We found that TA at 1-30 μM substantially protected against MPP(+)-induced neurotoxicity, as evidenced by the increase in cell viability, decrease in lactate dehydrogenase release and the reduction in apoptotic nuclei. Moreover, TA effectively inhibited the elevated intracellular accumulation of reactive oxygen species as well as Bax/Bcl-2 ratio caused by MPP(+). Most importantly, TA markedly reversed the inhibition of protein expression of phosphorylated Akt (Ser 473) and phosphorylated GSK3β (Ser 9) caused by MPP(+). LY294002, the specific inhibitor of PI3-K, significantly abrogated the up-regulated phosphorylated Akt and phosphorylated GSK3β offered by TA, suggesting that the neuroprotection of TA was mainly dependent on the activation of PI3-K/Akt/GSK3β signaling pathway. The results taken together indicate that TA may be a potential candidate for further preclinical study aimed at the prevention and treatment of PD. Copyright © 2016 Elsevier Ltd. All rights reserved.
International Nuclear Information System (INIS)
Florea, Ana-Maria; Splettstoesser, Frank; Buesselberg, Dietrich
2007-01-01
Arsenic trioxide (As 2 O 3 ) has anticancer properties; however, its use also leads to neuro-, hepato- or nephro-toxicity, and therefore, it is important to understand the mechanism of As 2 O 3 toxicity. We studied As 2 O 3 influence on intracellular calcium ([Ca 2+ ] i ) homeostasis of human neuroblastoma SY-5Y and embryonic kidney cells (HEK 293).We also relate the As 2 O 3 induced [Ca 2+ ] i modifications with cytotoxicity. We used Ca 2+ sensitive dyes (fluo-4 and rhod-2) combined with laser scanning microscopy or fluorescence activated cell sorting to measure Ca 2+ changes during the application of As 2 O 3 and we approach evaluation of cytotoxicity. As 2 O 3 (1 μM) increased [Ca 2+ ] i in SY-5Y and HEK 293 cells. Three forms of [Ca 2+ ] i -elevations were found: (1) steady-state increases (2) transient [Ca 2+ ] i -elevations and (3) Ca 2+ -spikes. [Ca 2+ ] i modifications were independent from extracellular Ca 2+ but dependent on internal calcium stores. The effect was not reversible. Inositol triphosphate (IP 3 ) and ryanodine (Ry) receptors are involved in regulation of signals induced by As 2 O 3 . 2-APB and dantrolene significantly reduced the [Ca 2+ ] i -rise (p 2+ ] i -elevation or spiking. This indicates that other Ca 2+ regulating mechanisms are involved. In cytotoxicity tests As 2 O 3 significantly reduced cell viability in both cell types. Staining with Hoechst 33342 showed occurrence of apoptosis and DNA damage. Our data suggest that [Ca 2+ ] i is an important messenger in As 2 O 3 induced cell death
Dose-dependent effect of Curcuma longa for the treatment of Parkinson's disease.
Ma, Xiao-Wei; Guo, Rui-You
2017-05-01
Curcuma longa is a plant that belongs to the ginger family, Zingiberaceae. It has been used in Siddha medicine for thousands of years in Asia. Parkinson's disease (PD) is a degenerative disorder of the central nervous system that affects the motor system of the brain. Death of dopamine-producing cells in the substantia nigra leads to PD. Exposure to salsolinol, which is an endogenous neurotoxin, has been associated with damage to dopamine-producing cells. The present study assessed the toxicity of salsolinol in SH-SY5Y human neuroblastoma cells and subsequently investigated the neuroprotective potential of C. longa extract in salsolinol-induced toxic conditions in SH-SY5Y cells. Sulphorhodamine-B assay showed the protective effect of the anti-apoptotic effect of treated SH-SY5Y cells. Fluorescence microscopy and confocal laser scanning microscope analysis indicated the anti-apoptotic impact of the C. longa extract. Mitochondria-derived reactive oxygen species were reduced in C. longa extract-treated SH-SY5Y cells. Downregulated mRNA expression levels of p53, Bcl-2-associated X protein and caspase 3 were observed in the C. longa extract-treated SH-SY5Y cells. Caspase 3 activity was reduced in the C. longa extract-treated SH-SY5Y cells. In conclusion, the present findings demonstrated that solsolinol is neurotoxic to SH-SY5Y cells, and C. longa extract may be useful in the treatment of PD.
Filomeni, Giuseppe; Cardaci, Simone; Da Costa Ferreira, Ana Maria; Rotilio, Giuseppe; Ciriolo, Maria Rosa
2011-08-01
We have demonstrated previously that the complex bis[(2-oxindol-3-ylimino)-2-(2-aminoethyl)pyridine-N,N']copper(II), named [Cu(isaepy)(2)], induces AMPK (AMP-activated protein kinase)-dependent/p53-mediated apoptosis in tumour cells by targeting mitochondria. In the present study, we found that p38(MAPK) (p38 mitogen-activated protein kinase) is the molecular link in the phosphorylation cascade connecting AMPK to p53. Transfection of SH-SY5Y cells with a dominant-negative mutant of AMPK resulted in a decrease in apoptosis and a significant reduction in phospho-active p38(MAPK) and p53. Similarly, reverse genetics of p38(MAPK) yielded a reduction in p53 and a decrease in the extent of apoptosis, confirming an exclusive hierarchy of activation that proceeds via AMPK/p38(MAPK)/p53. Fuel supplies counteracted [Cu(isaepy)(2)]-induced apoptosis and AMPK/p38(MAPK)/p53 activation, with glucose being the most effective, suggesting a role for energetic imbalance in [Cu(isaepy)(2)] toxicity. Co-administration of 3BrPA (3-bromopyruvate), a well-known inhibitor of glycolysis, and succinate dehydrogenase, enhanced apoptosis and AMPK/p38(MAPK)/p53 signalling pathway activation. Under these conditions, no toxic effect was observed in SOD (superoxide dismutase)-overexpressing SH-SY5Y cells or in PCNs (primary cortical neurons), which are, conversely, sensitized to the combined treatment with [Cu(isaepy)(2)] and 3BrPA only if grown in low-glucose medium or incubated with the glucose-6-phosphate dehydrogenase inhibitor dehydroepiandrosterone. Overall, the results suggest that NADPH deriving from the pentose phosphate pathway contributes to PCN resistance to [Cu(isaepy)(2)] toxicity and propose its employment in combination with 3BrPA as possible tool for cancer treatment. © The Authors Journal compilation © 2011 Biochemical Society
Guo, Zheng; Cao, Wei; Zhao, Shifeng; Han, Zengtai; Han, Boxiang
2016-07-06
Parkinson's disease (PD) can be ascribed to the progressive and selective loss of dopaminergic neurons in the substantia nigra pars compacta, and thus molecules with neuroprotective ability may have therapeutic value against PD. In the current study, the neuroprotective effects and underlying mechanisms of Soyasaponin I (Soya-I), a naturally occurring triterpene extracted from a widely used ingredient in many foods, such as Glycine max (soybean), were evaluated in a widely used cellular PD model in which neurotoxicity was induced by 1-methyl-4-phenyl pyridinium (MPP) in cultured SH-SY5Y cells. We found that Soya-I at 10-40 μM considerably protected against MPP-induced neurotoxicity as evidenced by an increase in cell viability, a decrease in lactate dehydrogenase release, and a reduction in apoptotic nuclei. Moreover, Soya-I effectively inhibited the elevated intracellular accumulation of reactive oxygen species as well as the Bax/Bcl-2 ratio caused by MPP. Most importantly, Soya-I markedly reversed the inhibition of protein expression of phosphorylated AKT and phosphorylated GSK3β caused by MPP. LY294002, the specific inhibitor of phosphoinositide 3-kinase, significantly abrogated the upregulated phosphorylated AKT and phosphorylated GSK3β offered by Soya-I, suggesting that the neuroprotection of Soya-I was mainly dependent on the activation of the phosphoinositide 3-kinase/AKT/GSK3β signaling pathway. The results taken together indicate that Soya-I may be a potential candidate for further preclinical study aimed at the prevention and treatment of PD.
Molecular mechanism of action of opioids in human neuroblastoma cells
International Nuclear Information System (INIS)
Yu, V.C.K.
1987-01-01
A series of human neuroblastoma cell lines was screened for the presence of opioid receptor sites. Of these cell lines, SK-N-SH was found to express approximately 50,000 μ and 10,000 δ opioid receptor sites/cell. In vitro characterization revealed that the binding properties of these receptor sites closely resembled those of human and rodent brain. Phosphatidylinositol turnover as a potential second messenger system for the μ receptor was examined in SK-N-SH cells. Neurotransmitter receptor systems were determined in the three sub-clones of SK-N-SH cells. Cells of the SH-SY5Y line, a phenotypically stable subclone of SK-N-SH cells, were induced to differentiate by treatment with various inducing agents, and changes of several neurotransmitter receptor systems were determined. Nerve growth factor (NGF) and retinoic acid (RA) up-regulated, while dBcAMP down-regulated opioid receptor sites. [ 3 H]Dopamine uptake was slightly enhanced only in RA-treated cells. Strikingly, the efficacy of PGE 1 -stimulated accumulation of cAMP was enhanced by 15- to 30-fold upon RA treatment
Jagannath, Vinita; Brotzakis, Zacharias Faidon; Parrinello, Michele; Walitza, Susanne; Grünblatt, Edna
2017-01-01
Dysfunction of D-amino acid oxidase ( DAO ) and DAO activator ( DAOA )/ G72 genes have been linked to neuropsychiatric disorders. The glutamate hypothesis of schizophrenia has proposed that increased DAO activity leads to decreased D-serine, which subsequently may lead to N-methyl-D-aspartate (NMDA) receptor hypofunction. It has been shown that DAOA binds to DAO and increases its activity. However, there are also studies showing DAOA decreases DAO activity. Thus, the effect of DAOA on DAO is controversial. We aimed to understand the effect of DAOA on DAO activity in neuron-like (SH-SY5Y), astrocyte-like (1321N1) and kidney-like (HEK293) human cell lines. DAO activity was measured based on the release of hydrogen peroxide and its interaction with Amplex Red reagent. We found that DAOA increases DAO activity only in HEK293 cells, but has no effect on DAO activity in SH-SY5Y and 1321N1 cells. This might be because of different signaling pathways, or due to lower DAO and DAOA expression in SH-SY5Y and 1321N1 cells compared to HEK293 cells, but also due to different compartmentalization of the proteins. The lower DAO and DAOA expression in neuron-like SH-SY5Y and astrocyte-like 1321N1 cells might be due to tightly regulated expression, as previously reported in the human post-mortem brain. Our simulation experiments to demonstrate the interaction between DAOA and human DAO (hDAO) showed that hDAO holoenzyme [hDAO with flavine adenine dinucleotide (FAD)] becomes more flexible and misfolded in the presence of DAOA, whereas DAOA had no effect on hDAO apoprotein (hDAO without FAD), which indicate that DAOA inactivates hDAO holoenzyme. Furthermore, patch-clamp analysis demonstrated no effect of DAOA on NMDA receptor activity in NR1/NR2A HEK293 cells. In summary, the interaction between DAO and DAOA seems to be cell type and its biochemical characteristics dependent which still needs to be elucidated.
Directory of Open Access Journals (Sweden)
Vinita Jagannath
2017-10-01
Full Text Available Dysfunction of D-amino acid oxidase (DAO and DAO activator (DAOA/G72 genes have been linked to neuropsychiatric disorders. The glutamate hypothesis of schizophrenia has proposed that increased DAO activity leads to decreased D-serine, which subsequently may lead to N-methyl-D-aspartate (NMDA receptor hypofunction. It has been shown that DAOA binds to DAO and increases its activity. However, there are also studies showing DAOA decreases DAO activity. Thus, the effect of DAOA on DAO is controversial. We aimed to understand the effect of DAOA on DAO activity in neuron-like (SH-SY5Y, astrocyte-like (1321N1 and kidney-like (HEK293 human cell lines. DAO activity was measured based on the release of hydrogen peroxide and its interaction with Amplex Red reagent. We found that DAOA increases DAO activity only in HEK293 cells, but has no effect on DAO activity in SH-SY5Y and 1321N1 cells. This might be because of different signaling pathways, or due to lower DAO and DAOA expression in SH-SY5Y and 1321N1 cells compared to HEK293 cells, but also due to different compartmentalization of the proteins. The lower DAO and DAOA expression in neuron-like SH-SY5Y and astrocyte-like 1321N1 cells might be due to tightly regulated expression, as previously reported in the human post-mortem brain. Our simulation experiments to demonstrate the interaction between DAOA and human DAO (hDAO showed that hDAO holoenzyme [hDAO with flavine adenine dinucleotide (FAD] becomes more flexible and misfolded in the presence of DAOA, whereas DAOA had no effect on hDAO apoprotein (hDAO without FAD, which indicate that DAOA inactivates hDAO holoenzyme. Furthermore, patch-clamp analysis demonstrated no effect of DAOA on NMDA receptor activity in NR1/NR2A HEK293 cells. In summary, the interaction between DAO and DAOA seems to be cell type and its biochemical characteristics dependent which still needs to be elucidated.
International Nuclear Information System (INIS)
Guida, Natascia; Laudati, Giusy; Galgani, Mario; Santopaolo, Marianna; Montuori, Paolo; Triassi, Maria; Di Renzo, Gianfranco; Canzoniero, Lorella M.T.; Formisano, Luigi
2014-01-01
Phthalates, phthalic acid esters, are widely used as plasticizers to produce polymeric materials in industrial production of plastics and daily consumable products. Animal studies have shown that di(2-ethylhexyl)phthalate (DEHP) may cause toxic effects in the rat brain. In the present study, chronic exposure to DEHP (0.1–100 μM) caused dose-dependent cell death via the activation of caspase-3 in neuroblastoma cells. Intriguingly, this harmful effect was prevented by the pan-histone deacetylase (HDAC) inhibitor trichostatin A, by the class II HDAC inhibitor MC-1568, but not by the class I HDAC inhibitor MS-275. Furthermore, DEHP reduced specificity protein 3 (Sp3) gene expression, but not Sp3 mRNA, after 24 and 48 h exposures. However, Sp3 protein reduction was prevented by pre-treatment with MC-1568, suggesting the involvement of class II HDACs in causing this effect. Then, we investigated the possible relationship between DEHP-induced neuronal death and the post-translational mechanisms responsible for the down-regulation of Sp3. Interestingly, DEHP-induced Sp3 reduction was associated to its deacetylation and polyubiquitination. Co-immunoprecipitation studies showed that Sp3 physically interacted with HDAC4 after DEHP exposure, while HDAC4 inhibition by antisense oligodeoxynucleotide reverted the DEHP-induced degradation of Sp3. Notably, Sp3 overexpression was able to counteract the detrimental effect induced by DEHP. Taken together, these results suggest that DEHP exerts its toxic effect by inducing deacetylation of Sp3 via HDAC4, and afterwards, Sp3-polyubiquitination. - Highlights: • Di(2-ethylhexyl)phthalate (DEHP) is cytotoxic to SH-SY5Y cells and cortical neurons. • DEHP-induced cytotoxicity is mediated by apoptosis. • DEHP-induced apoptotic cell death is inhibited by class II HDAC MC-1568. • DEHP neurotoxicity is caused by HDAC4-mediated Sp3 degradation by ubiquitin
Energy Technology Data Exchange (ETDEWEB)
Guida, Natascia; Laudati, Giusy [Division of Pharmacology, Department of Neuroscience, Reproductive and Odontostomatologic Sciences, School of Medicine, “Federico II” University of Naples, Via Pansini 5, 80131 Naples (Italy); Galgani, Mario; Santopaolo, Marianna [Laboratorio di Immunologia, Istituto di Endocrinologia e Oncologia Sperimentale, Consiglio Nazionale delle Ricerche (IEOS-CNR), Napoli (Italy); Montuori, Paolo; Triassi, Maria [Department of Preventive Medical Sciences, University Federico II, Via Pansini 5, 80131 Naples (Italy); Di Renzo, Gianfranco [Division of Pharmacology, Department of Neuroscience, Reproductive and Odontostomatologic Sciences, School of Medicine, “Federico II” University of Naples, Via Pansini 5, 80131 Naples (Italy); Canzoniero, Lorella M.T., E-mail: canzon@unisannio.it [Division of Pharmacology, Department of Neuroscience, Reproductive and Odontostomatologic Sciences, School of Medicine, “Federico II” University of Naples, Via Pansini 5, 80131 Naples (Italy); Division of Pharmacology, Department of Science and Technology, University of Sannio, Via Port' Arsa 11, 82100 Benevento (Italy); Formisano, Luigi, E-mail: cformisa@unisannio.it [Division of Pharmacology, Department of Neuroscience, Reproductive and Odontostomatologic Sciences, School of Medicine, “Federico II” University of Naples, Via Pansini 5, 80131 Naples (Italy); Division of Pharmacology, Department of Science and Technology, University of Sannio, Via Port' Arsa 11, 82100 Benevento (Italy)
2014-10-01
Phthalates, phthalic acid esters, are widely used as plasticizers to produce polymeric materials in industrial production of plastics and daily consumable products. Animal studies have shown that di(2-ethylhexyl)phthalate (DEHP) may cause toxic effects in the rat brain. In the present study, chronic exposure to DEHP (0.1–100 μM) caused dose-dependent cell death via the activation of caspase-3 in neuroblastoma cells. Intriguingly, this harmful effect was prevented by the pan-histone deacetylase (HDAC) inhibitor trichostatin A, by the class II HDAC inhibitor MC-1568, but not by the class I HDAC inhibitor MS-275. Furthermore, DEHP reduced specificity protein 3 (Sp3) gene expression, but not Sp3 mRNA, after 24 and 48 h exposures. However, Sp3 protein reduction was prevented by pre-treatment with MC-1568, suggesting the involvement of class II HDACs in causing this effect. Then, we investigated the possible relationship between DEHP-induced neuronal death and the post-translational mechanisms responsible for the down-regulation of Sp3. Interestingly, DEHP-induced Sp3 reduction was associated to its deacetylation and polyubiquitination. Co-immunoprecipitation studies showed that Sp3 physically interacted with HDAC4 after DEHP exposure, while HDAC4 inhibition by antisense oligodeoxynucleotide reverted the DEHP-induced degradation of Sp3. Notably, Sp3 overexpression was able to counteract the detrimental effect induced by DEHP. Taken together, these results suggest that DEHP exerts its toxic effect by inducing deacetylation of Sp3 via HDAC4, and afterwards, Sp3-polyubiquitination. - Highlights: • Di(2-ethylhexyl)phthalate (DEHP) is cytotoxic to SH-SY5Y cells and cortical neurons. • DEHP-induced cytotoxicity is mediated by apoptosis. • DEHP-induced apoptotic cell death is inhibited by class II HDAC MC-1568. • DEHP neurotoxicity is caused by HDAC4-mediated Sp3 degradation by ubiquitin.
Bos, Sandra; Viranaicken, Wildriss; Turpin, Jonathan; El-Kalamouni, Chaker; Roche, Marjolaine; Krejbich-Trotot, Pascale; Desprès, Philippe; Gadea, Gilles
2018-03-01
Mosquito-borne Zika virus (ZIKV) recently emerged in South Pacific islands and Americas where large epidemics were documented. In the present study, we investigated the contribution of the structural proteins C, prM and E in the permissiveness of human host cells to epidemic strains of ZIKV. To this end, we evaluated the capacity of the epidemic strain BeH819015 to infect epithelial A549 and neuronal SH-SY5Y cells in comparison to the African historical MR766 strain. For that purpose, we generated a molecular clone of BeH819015 and a chimeric clone of MR766 which contains the BeH819015 structural protein region. We showed that ZIKV containing BeH819015 structural proteins was much less efficient in cell-attachment leading to a reduced susceptibility of A549 and SH-SY5Y cells to viral infection. Our data illustrate a previously underrated role for C, prM, and E in ZIKV epidemic strain ability to initiate viral infection in human host cells. Copyright © 2018 The Authors. Published by Elsevier Inc. All rights reserved.
Cortés-Castell, Ernesto; Veciana-Galindo, Carmen; Torró-Montell, Luis; Palazón-Bru, Antonio; Sirvent-Segura, Elia; Gil-Guillén, Vicente; Rizo-Baeza, Mercedes
2016-02-16
We evaluated the protective activity of an extract from a by-product such as olive stones, through its ability to inhibit H202 induced apoptosis in the SH-SY5Y human neuroblastoma cell line. To such end, 20,000 cells/well were cultivated and differentiation with retinoic acid was initiated. Once the cells were differentiated, apoptosis was induced with and without H2O2 extract. Finally, cDNA extraction was performed, and pro-apoptotic genes Bax and anti-apoptotic genes Bcl-2 were analyzed. Quantification of the gene expression was performed using the GAPDH gene marker. Cell viability with the extract is 97.6% (SD 5.7) with 10 mg/l and 62.8% (SD 1.2) to 50 mg/l, using 10 mg/l for the biomarker assay. The retinoic acid differentiated SH-S cell line (10 μM) shows a clear apoptosis when treated with H2O2 150 μM, with a Bax/Bcl-2 ratio of 3.75 (SD 0.80) in contrast to the differentiated control cells subjected to H2O2 and with extract, which have the same ratio of 1.02 (SD 0.01-0.03). The olive stone extract shows anti-apoptotic activity in the provoked cell death of SH-SY5Y human neuroblastoma cells in their normal state, defending them from oxidative stress which produces a significant increase in the apoptotic gene ratio in contrast to anti-apoptotic genes (Bax/Bcl-2).
Neuronal effects of 4-t-Butylcatechol: A model for catechol-containing antioxidants
International Nuclear Information System (INIS)
Lo, Y.-C.; Liu Yuxin; Lin, Y.-C.; Shih, Y.-T.; Liu, C.-M.; Burka, Leo T.
2008-01-01
Many herbal medicines and dietary supplements sold as aids to improve memory or treat neurodegenerative diseases or have other favorable effects on the CNS contain a catechol or similar 1,2-dihydroxy aromatic moiety in their structure. As an approach to isolate and examine the neuroprotective properties of catechols, a simple catechol 4-t-Butylcatechol (TBC) has been used as a model. In this study, we investigated the effects of TBC on lipopolysaccharide (LPS)-activated microglial-induced neurotoxicity by using the in vitro model of coculture murine microglial-like cell line HAPI with the neuronal-like human neuroblastoma cell line SH-SY5Y. We also examined the effects of TBC on 6-hydroxydopamine (6-OHDA)-induced neurotoxicity in human dopaminergic neuroblastoma SH-SY5Y cells. TBC at concentrations from 0.1-10 μM had no toxic effect on HAPI cells and SH-SY5Y cells, and it inhibited LPS (100 ng/ml)-induced increases of superoxide, intracellular ROS, gp91 Phox , iNOS and a decrease of HO-1 in HAPI cells. Under coculture condition, TBC significantly reduced LPS-activated microglia-induced dopaminergic SH-SY5Y cells death. Moreover, TBC (0.1-10 μM) inhibited 6-OHDA-induced increases of intracellular ROS, iNOS, nNOS, and a decrease of mitochondria membrane potential, and cell death in SH-SY5Y cells. However, the neurotoxic effects of TBC (100 μM) on SH-SY5Y cells were also observed including the decrease in mitochondria membrane potential and the increase in COX-2 expression and cell death. TBC-induced SH-SY5Y cell death was attenuated by pretreatment with NS-398, a selective COX-2 inhibitor. In conclusion, this study suggests that TBC might possess protective effects on inflammation- and oxidative stress-related neurodegenerative disorders. However, the high concentration of TBC might be toxic, at least in part, for increasing COX-2 expression
Chaban, Victor V; Cho, Taehoon; Reid, Christopher B; Norris, Keith C
2013-01-01
Cell-cell communication occurs via a variety of mechanisms, including long distances (hormonal), short distances (paracrine and synaptic) or direct coupling via gap junctions, antigen presentation, or ligand-receptor interactions. We evaluated the possibility of neuro-hormonal independent, non-diffusible, physically disconnected pathways for cell-cell communication using dorsal root ganglion (DRG) neurons. We assessed intracellular calcium ([Ca(2+)]) in primary culture DRG neurons that express ATP-sensitive P2X3, capsaicinsensitive TRPV1 receptors modulated by estradiol. Physically disconnected (dish-in-dish system; inner chamber enclosed) mouse DRG were cultured for 12 hours near: a) media alone (control 1), b) mouse DRG (control 2), c) human neuroblastoma SHSY-5Y cells (cancer intervention), or d) mouse DRG treated with KCl (apoptosis intervention). Chemosensitive receptors [Ca(2+)](i) signaling did not differ between control 1 and 2. ATP (10 μM) and capsaicin (100nM) increased [Ca(2+)](i) transients to 425.86 + 49.5 nM, and 399.21 ± 44.5 nM, respectively. 17β-estradiol (100 nM) exposure reduced ATP (171.17 ± 48.9 nM) and capsaicin (175.01±34.8 nM) [Ca(2+)](i) transients. The presence of cancer cells reduced ATP- and capsaicin-induced [Ca(2+)](i) by >50% (pcommunication.
Directory of Open Access Journals (Sweden)
Ming-Hui Yang
2016-01-01
Full Text Available The microenvironment of neuron cells plays a crucial role in regulating neural development and regeneration. Hyaluronic acid (HA biomaterial has been applied in a wide range of medical and biological fields and plays important roles in neural regeneration. PC12 cells have been reported to be capable of endogenous NGF synthesis and secretion. The purpose of this research was to assess the effect of HA biomaterial combining with PC12 cells conditioned media (PC12 CM in neural regeneration. Using SH-SY5Y cells as an experimental model, we found that supporting with PC12 CM enhanced HA function in SH-SY5Y cell proliferation and adhesion. Through RP-nano-UPLC-ESI-MS/MS analyses, we identified increased expression of HSP60 and RanBP2 in SH-SY5Y cells grown on HA-modified surface with cotreatment of PC12 CM. Moreover, we also identified factors that were secreted from PC12 cells and may promote SH-SY5Y cell proliferation and adhesion. Here, we proposed a biomaterial surface enriched with neurotrophic factors for nerve regeneration application.
Fernanda Martins Lopes
2012-01-01
Os mecanismos moleculares que levam ao dano da via nigroestriatal durante a progressão da Doença de Parkinson (DP) ainda não estão totalmente elucidados. Dessa forma, existe a necessidade de desenvolver modelos experimentais adequados para o estudo desse distúrbio neurodegenerativo. A linhagem de neuroblastoma humano SH-SY5Y tratada com neurotoxinas indutoras deste distúrbio (ex.: 6-hidroxidopamina - 6-OHDA) é amplamente utilizada como modelo in vitro da DP. Muitos estudos mostram que esta li...
Vidau, Cyril; González-Polo, Rosa A; Niso-Santano, Mireia; Gómez-Sánchez, Rubén; Bravo-San Pedro, José M; Pizarro-Estrella, Elisa; Blasco, Rafael; Brunet, Jean-Luc; Belzunces, Luc P; Fuentes, José M
2011-12-01
Fipronil is a phenylpyrazole insecticide known to elicit neurotoxicity via an interaction with ionotropic receptors, namely GABA and glutamate receptors. Recently, we showed that fipronil and other phenylpyrazole compounds trigger cell death in Caco-2 cells. In this study, we investigated the mode of action and the type of cell death induced by fipronil in SH-SY5Y human neuroblastoma cells. Flow cytometric and western blot analyses demonstrated that fipronil induces cellular events belonging to the apoptosis process, such as mitochondrial potential collapse, cytochrome c release, caspase-3 activation, nuclear condensation and phosphatidylserine externalization. In addition, fipronil induces a rapid ATP depletion with concomitant activation of anaerobic glycolysis. This cellular response is characteristic of mitochondrial injury associated with a defect of the respiration process. Therefore, we also investigated the effect of fipronil on the oxygen consumption in isolated mitochondria. Interestingly, we show for the first time that fipronil is a strong uncoupler of oxidative phosphorylation at relative low concentrations. Thus in this study, we report a new mode of action by which the insecticide fipronil could triggers apoptosis. Copyright © 2011 Elsevier Inc. All rights reserved.
Schmidt, Andreas Johannes; Clement, Hans-Willi; Gebhardt, Stefan; Hemmeter, Ulrich Michael; Schulz, Eberhard; Krieg, Jürgen-Christian; Kircher, Tilo; Heiser, Philip
2010-06-01
Oxidative DNA damage as one sign of reactive oxygen species induced oxidative stress is an important factor in the pathogenesis of various psychiatric disorders. Altered levels of DNA base damage products as well as the expression of the main repair enzyme 8-hydroxyguanine glycosylase 1 have been described. The aim of the present study was to examine the effects of drugs (amphetamine, methylphenidate and atomoxetine) used in the treatment of attention deficit-hyperactivity disorder on the expression of this enzyme via reverse transcriptase-polymerase chain reaction in human neuroblastoma SH-SY5Y and human monocytic U-937 cells at concentrations of 50, 500 and 5,000 ng/ml. We observed decreased expression of this enzyme for all applied substances. In U-937 cells, the significance level was reached after treatment with 5,000 ng/ml amphetamine as well as after treatment with 50, 500 and 5,000 ng/ml atomoxetine. Incubation of SH-SY5Y cells with 50 and 5,000 ng/ml amphetamine and 5,000 ng/ml methylphenidate led to significant decreases of 8-hydroxyguanine glycosylase 1. As a positive correlation between the expression of 8-hydroxyguanine glycosylase 1 and the level of oxidative DNA damage products has been described, we accordingly consider these substances (amphetamine, methylphenidate and atomoxetine) to possibly play a protective role in this process.
International Nuclear Information System (INIS)
Mei, Lin.
1989-01-01
The data of this study indicate that pirenzepine (PZ)-high affinity muscarinic receptors (mAChRs) are coupled to the hydrolysis of inositol lipids and not to the adenylate cyclase system in human neuroblastoma SH-SY5Y cells. The maximal carbachol(CCh)-stimulated [ 3 H]IP 1 accumulation in the SH-SY5Y cells was decreased in the presence of 1μg/ml pertussis toxin, suggesting that a pertussis toxin sensitive G-protein may be involved in the coupling. Several cell clones which express only M 1 mAChR were generated by transfecting the murine fibroblast B82 cells with the cloned rat genomic m 1 gene. The transfected B82 cells (cTB10) showed specific [ 3 H](-)QNB binding activity. The mAChRs in these cells are of the M 1 type defined by their high affinity for PZ and low affinity for AF-DX 116 and coupled to hydrolysis of inositol lipids, possibly via a pertussis toxin sensitive G protein. The relationship between the M 1 mAChR density and the receptor-mediated hydrolysis of inositol lipids was studied in 7 clones. The M 1 mAChR densities in these cells characterized by [ 3 H](-)MQNB binding ranged from 12 fmol/10 6 cells in LK3-1 cells to 260 fmol/10 6 cells in the LK3-8 cells
Experiment list: SRX757029 [Chip-atlas[Archive
Lifescience Database Archive (English)
Full Text Available s; ChIP-Seq source_name=Cultured SH-SY5Y cells || cell line=SH-SY5Y || infection=control shRNA || neuronal m... Diagnosis=Neuroblastoma 26745539,88.4,7.1,1085 GSM1542254: Sample H3K9me2 Input SH-SY5Y B3 I19; Homo sapien
Directory of Open Access Journals (Sweden)
HORACIO MALDONADO
2008-01-01
Full Text Available HTLV-I-associated myelopathy/tropical spastic paraparesis (HAM/TSP is characterized by axonal degeneration of the corticospinal tracts. The specific requirements for transport of proteins and organelles to the distal part of the long axon are crucial in the corticospinal tracts. Microtubule dysfunction could be involved in this disease, configuring an axonal transport disease. We measured tubulin and its post-translational modified forms (acetylated and tyrosinated in CSF of patients and controls, as well as tau and its phosphorylated forms. There were no significant differences in the contents of tubulin and acetyl-tubulin between patients and controls; tyrosyl-tubulin was not detected. In HAM/TSP, tau levéis were significantly reduced, while the ratio of pT181/total tau was higher in patients than in controls, this being completely different from what is reported in other neurodegenerative diseases. Phosphorylation at T181 was also confirmed by Mass Spectrometry analysis. Western Blotting with monospecific polyclonal antibodies against pS199, pT205, pT231, pS262, pS356, pS396, pS404 and pS422 did not show differences in phosphorylation in these residues between patients and controls. Treating human SH-SY5Y neuroblastoma cells, a well-known in vitro neurite retraction model, with culture supernatant of MT-2 cells (HTLV-I infected cell line that secretes the viral Tax protein we observed neurite retraction and an increase in tau phosphorylation at T181. A disruption of normal phosphorylation of tau protein in T181 could result in its dysfunction, contributing to axonal damage.
Alkholifi, Faisal K; Albers, David S
2015-10-05
There is accumulating evidence that supports the involvement of reactive oxygen species (ROS), mitochondrial dysfunction and inflammation in the pathogenesis of neurodegenerative diseases. Thus, it is plausible that a multi-targeted therapeutic approach may be a more effective strategy to retard or even potentially halt the progression of the disease. Taurine is an organic acid that has a role in the regulation of oxidative stress and promoting mitochondrial normal functions, and N-Acetyl cysteine (NAC) is a well-known anti-oxidant and glutathione precursor. The main purpose of this study was to examine the cytoprotective effects of taurine alone or in combination with NAC against rotenone-induced toxicity in the SH-SY5Y neuroblastoma cell line. Taurine treatment produced a concentration-dependent reduction in rotenone-induced cell death. From this, we tested sub-effective concentrations of taurine in combination with low, sub-effective concentrations of NAC against rotenone toxicity, and found the combined treatment afforded greater cytoprotection than either treatment alone. The combined taurine/NAC treatment also attenuated rotenone-induced reductions in aconitase activity suggesting the cytoprotection afforded by the combined treatment may be associated with anti-oxidative mechanisms. Together, our data suggest that a multi-targeted approach may yield new avenues of research exploring the utility of combining therapeutic agents with different mechanisms of actions at concentrations lower than previously tested and shown to be cytoprotective. Copyright © 2015 Elsevier B.V. All rights reserved.
Directory of Open Access Journals (Sweden)
Ryan T Pitman
Full Text Available Recent studies suggest that FTO variants strongly correlate with obesity and mainly influence energy intake with little effect on the basal metabolic rate. We suggest that FTO influences eating behavior by modulating intracellular energy levels and downstream signaling mechanisms which control energy intake and metabolism. Since FTO plays a particularly important role in adipocytes and in hypothalamic neurons, SH-SY5Y neuronal cells and 3T3-L1 adipocytes were used to understand how siRNA mediated knockdown of FTO expression alters cellular energy homeostasis. Cellular energy status was evaluated by measuring ATP levels using a luminescence assay and uptake of fluorescent glucose. FTO siRNA in SH-SY5Y cells mediated mRNA knockdown (-82%, increased ATP concentrations by up to 46% (P = 0.013 compared to controls, and decreased phosphorylation of AMPk and Akt in SH-SY5Y by -52% and -46% respectively as seen by immunoblotting. In contrast, FTO siRNA in 3T3-L1 cells decreased ATP concentration by -93% (p<0.0005, and increased AMPk and Akt phosphorylation by 204% and 70%, respectively suggesting that FTO mediates control of energy levels in a cell-type specific manner. Furthermore, glucose uptake was decreased in both SH-SY5Y (-51% p = 0.015 and 3T3-L1 cells (-30%, p = 0.0002. We also show that FTO knockdown decreases NPY mRNA expression in SH-SY5Y cells (-21% through upregulation of pSTAT3 (118%. These results provide important evidence that FTO-variant linked obesity may be associated with altered metabolic functions through activation of downstream metabolic mediators including AMPk.
Sirtuin-2 Protects Neural Cells from Oxidative Stress and Is Elevated in Neurodegeneration
Directory of Open Access Journals (Sweden)
Preeti Singh
2017-01-01
Full Text Available Sirtuins are highly conserved lysine deacetylases involved in ageing, energy production, and lifespan extension. The mammalian SIRT2 has been implicated in Parkinson’s disease (PD where studies suggest SIRT2 promotes neurodegeneration. We therefore evaluated the effects of SIRT2 manipulation in toxin treated SH-SY5Y cells and determined the expression and activity of SIRT2 in postmortem brain tissue from patients with PD. SH-SY5Y viability in response to oxidative stress induced by diquat or rotenone was measured following SIRT2 overexpression or inhibition of deacetylase activity, along with α-synuclein aggregation. SIRT2 in human tissues was evaluated using Western blotting, immunohistochemistry, and fluorometric activity assays. In SH-SY5Y cells, elevated SIRT2 protected cells from rotenone or diquat induced cell death and enzymatic inhibition of SIRT2 enhanced cell death. SIRT2 protection was mediated, in part, through elevated SOD2 expression. SIRT2 reduced the formation of α-synuclein aggregates but showed minimal colocalisation with α-synuclein. In postmortem PD brain tissue, SIRT2 activity was elevated compared to controls but also elevated in other neurodegenerative disorders. Results from both in vitro work and brain tissue suggest that SIRT2 is necessary for protection against oxidative stress and higher SIRT2 activity in PD brain may be a compensatory mechanism to combat neuronal stress.
Jaroonwitchawan, Thiranut; Chaicharoenaudomrung, Nipha; Namkaew, Jirapat; Noisa, Parinya
2017-01-01
Paraquat is a neurotoxic agent, and oxidative stress plays an important role in neuronal cell death after paraquat exposure. In this study, we assessed the neuroprotective effect of curcumin against paraquat and explored the underlying mechanisms of curcumin in vitro. Curcumin treatment prevented paraquat-induced reactive oxygen species (ROS) and apoptotic cell death. Curcumin also exerted a neuroprotective effect by increasing the expression of anti-apoptotic and antioxidant genes. The pretreatment of curcumin significantly decreased gene expression and protein production of amyloid precursor protein. The activation of autophagy process was found defective in paraquat-induced cells, indicated by the accumulation and reduction of LC3I/II. Noteworthy, curcumin restored LC3I/II expression after the pretreatment. Collectively, curcumin demonstrated as a prominent suppressor of ROS, and could reverse autophagy induction in SH-SY5Y cells. The consequences of this were the reduction of APP production and prevention of SH-SY5Y cells from apoptosis. Altogether, curcumin potentially serves as a therapeutic agent of neurodegenerative diseases, associated with ROS overproduction and autophagy dysfunction. Copyright © 2016 Elsevier Ireland Ltd. All rights reserved.
Naz, Huma; Tarique, Mohd; Khan, Parvez; Luqman, Suaib; Ahamad, Shahzaib; Islam, Asimul; Ahmad, Faizan; Hassan, Md Imtaiyaz
2018-01-01
Human calcium/calmodulin-dependent protein kinase IV (CAMKIV) is a member of Ser/Thr kinase family, and is associated with different types of cancer and neurodegenerative diseases. Vanillin is a natural compound, a primary component of the extract of the vanilla bean which possesses varieties of pharmacological features including anti-oxidant, anti-inflammatory, anti-bacterial and anti-tumor. Here, we have investigated the binding mechanism and affinity of vanillin to the CAMKIV which is being considered as a potential drug target for cancer and neurodegenerative diseases. We found that vanillin binds strongly to the active site cavity of CAMKIV and stabilized by a large number of non-covalent interactions. We explored the utility of vanillin as anti-cancer agent and found that it inhibits the proliferation of human hepatocyte carcinoma (HepG2) and neuroblastoma (SH-SY5Y) cells in a dose-dependent manner. Furthermore, vanillin treatment resulted into the significant reduction in the mitochondrial membrane depolarization and ROS production that eventually leads to apoptosis in HepG2 and SH-SY5Y cancer cells. These findings may offer a novel therapeutic approach by targeting the CAMKIV using natural product and its derivative with a minimal side effect.
Differentiation-associated decrease in muscarinic receptor sensitivity in human neuroblastoma cells
International Nuclear Information System (INIS)
Heikkilae, J.E.; Scott, J.G.; Suominen, L.A.; Akerman, K.E.O.
1987-01-01
Muscarinic receptor-linked increases in intracellular free Ca 2+ as measured with quin-2 and Ca 2+ release from monolayers of cells have been measured in the human neuroblastoma cell line SH-SY5Y. Induction of differentiation with the phorbol ester 12-O-tetradecanoylphorbol-13-acetate (TPA) leads to a decrease in the sensitivity of the cells to low concentrations of agonists with respect to the induced increase in cytosolic free Ca 2+ and stimulation of Ca 2+ efflux. No decrease in agonist binding affinity was observed when the displacement of a labelled antagonist, 3 H-NMS, by a non-labelled agonist was studied
sY116, a human Y-linked polymorphic STS
Indian Academy of Sciences (India)
linked STS, showed different electrophoretic mobilities in three males, two infertile and one fertile. A study of this STS among 35 other normal males showed that this locus is polymorphic. sY116 has a poly A-rich stretch whose instability ...
Berliocchi, Laura; Chiappini, Carlotta; Adornetto, Annagrazia; Gentile, Debora; Cerri, Silvia; Russo, Rossella; Bagetta, Giacinto; Corasaniti, Maria Tiziana
2018-02-01
d-Limonene is a natural monoterpene abundant in Citrus essential oils. It is endowed with several biological activities, including inhibition of carcinogenesis and promotion of tumour regression. Recently, d-limonene has been shown to modulate autophagic markers in vitro at concentrations found in vivo, in clinical pharmacokinetic studies. Autophagy is an intracellular catabolic process serving as both an adaptive metabolic response and a quality control mechanism. Because autophagy defects have been linked to a wide range of human pathologies, including neurodegeneration and cancer, there is a need for new pharmacological tools to control deregulated autophagy. To better understand the effects of d-limonene on autophagy, to identify the molecular mechanisms through which this monoterpene rapidly triggers LC3 lipidation and to evaluate the role for autophagy in long-term effects of d-limonene. Human SH-SY5Y neuroblastoma, HepG2 hepatocellular carcinoma and MCF7 breast cancer cells were used. Endogenous LC3-II levels were evaluated by western blotting. Autophagic flux assay was performed using bafilomycin A1 and chloroquine. Intracellular distribution of LC3 protein was studied by confocal microscopy analysis of LC3B-GFP transduced cells. Expression of lysosomal-membrane protein LAMP-1 was assessed by immunofluorescence analysis. Phosphorylated levels of downstream substrates of mTOR kinase (p70S6 kinase, 4E-BP1, and ULK1) and ERK were analyzed by western blotting. Production of reactive oxygen species (ROS) was assessed by live confocal microscopy of cells loaded with CellROX ® Green Reagent. Clonogenic assay was used to evaluate the ability of treated cells to proliferate and form colonies. LC3 lipidation promoted by d-limonene correlates with autophagosome formation and stimulation of basal autophagy. LC3 lipidation does not rely on inhibition of mTOR kinase, which instead appears to be transiently activated. In addition, d-limonene rapidly activates ERK and
Directory of Open Access Journals (Sweden)
Patricia Valentao
2011-05-01
Full Text Available The sea constitutes one of the most promising sources of novel compounds with potential application in human therapeutics. In particular, algae have proved to be an interesting source of new bioactive compounds. In this work, six meroditerpenoids (epitaondiol, epitaondiol diacetate, epitaondiol monoacetate, stypotriol triacetate, 14-ketostypodiol diacetate and stypodiol isolated from the brown alga Stypopodium flabelliforme were tested for their cell proliferation inhibitory activity in five cell lines. Cell lines tested included human colon adenocarcinoma (Caco-2, human neuroblastoma (SH-SY5Y, rat basophilic leukemia (RBL-2H3, murine macrophages (RAW.267 and Chinese hamster fibroblasts (V79. Antimicrobial activity of the compounds was also evaluated against Staphylococcus aureus, Salmonella typhimurium, Proteus mirabilis, Bacillus cereus, Enterococcus faecalis and Micrococcus luteus. Overall, the compounds showed good activity against all cell lines, with SH-SY5Y and RAW.267 being the most susceptible. Antimicrobial capacity was observed for epitaondiol monoacetate, stypotriol triacetate and stypodiol, with the first being the most active. The results suggest that these molecules deserve further studies in order to evaluate their potential as therapeutic agents.
Expression of caspase-3 gene in apoptotic HL-60 cell and different human tumor cell lines
International Nuclear Information System (INIS)
Li Xiaoming; Song Tianbao
1999-01-01
Objective: To research the expression of caspase-3 gene in the apoptotic and the control HL-60 cells and in the different human tumor cell lines. Methods: Caspase-3 mRNA in the control and γ-radiation-induced apoptotic HL-60 cells, and in the 6 types of human tumor cell lines, was analysed by Northern blot. Results: The caspase-3 gene transcript was more highly expressed in leukemia cells HL-60, CEM, K562 and neuroblastoma SH-SY5Y than in cervical adenocarcinoma HeLa and breast carcinoma MCF7, and more highly in the radiation-induced apoptotic HL-60 than in the control HL-60 cells. Conclusion: The high level of expression of caspase-3 may aid the efforts to understand the tumor cell sensitivity to radiation, apoptosis and its inherent ability to survive
DEFF Research Database (Denmark)
Emanuelsson, I; Almokhtar, M; Wikvall, K
2018-01-01
investigation we studied the expression of these enzymes in cultured primary rat astrocytes, in neuron-enriched cells from rat cerebral cortex and in human neuroblastoma SH-SY5Y cells, a cell line often used as an in vitro model of neuronal function and differentiation. As part of this study we also examined...
Copetti, Cristiane; Franco, Fernanda Wouters; Machado, Eduarda da Rosa; Soquetta, Marcela Bromberger; Quatrin, Andréia; Ramos, Vitor de Miranda; Moreira, José Cláudio Fonseca; Emanuelli, Tatiana; Sautter, Cláudia Kaehler; Penna, Neidi Garcia
2018-01-01
Few studies investigated the biological effects of American grape cultivars. We investigated the metabolic response after acute consumption of grape juice or wine from Bordo grapes ( Vitis labrusca ) in a placebo-controlled crossover study with fifteen healthy volunteers. Blood samples were collected 1 hour after the intake of 100 mL of water, juice, or wine to measure TBARS, ABTS, FRAP, glucose, and uric acid levels. To evaluate differences in cellular response, intracellular reactive species production (DCFH-DA) and metabolic mitochondrial viability (MTT) were assessed after exposure of human neuron-like cells (SH-SY5Y) to juice or wine. Glycemia was reduced after juice or wine consumption, whereas blood levels of uric acid were reduced after juice consumption but increased after wine consumption. Juice and wine consumption reduced plasma lipid peroxidation and increased plasma antioxidant capacity (ABTS and FRAP assays). Furthermore, juice inhibited H 2 O 2 -induced intracellular production of reactive species (RS) and increased the viability of SH-SY5Y cells. In contrast, wine (dealcoholized) exhibited a per se effect by inducing the production of RS and reducing cell viability. These results indicate a positive impact of acute consumption of Bordo juice and wine on human oxidative status, whereas only juice had protective effects against oxidative stress-induced cytotoxicity.
Nataraj, Jagatheesan; Manivasagam, Thamilarasan; Justin Thenmozhi, Arokiasamy; Essa, Musthafa Mohamed
2017-07-01
Parkinson's disease (PD) is a chronic neurodegenerative disease, manifested due to the loss of dopaminergic neurons, which ultimately leads to impaired movement in elderly populations. The pathogenesis of PD is associated with numerous factors including oxidative stress, mitochondrial dysfunction and apoptosis. There is no effective therapy available to cure or halt the progression of this disease still now. Asiatic acid (AA) is a triterpene extracted from Centella asiatica has been reported as an antioxidant and anti-inflammatory agent, that offers neuroprotection against glutamate toxicity. Therefore, in this study, we have investigated the effect of AA in a rotenone (an inhibitor of mitochondrial complex I) induced in vitro model of PD. Following the exposure of SH-SY5Y cells to rotenone, there was a marked overproduction of ROS, mitochondrial dysfunction (as indexed by the decrease in mitochondrial membrane potential) and apoptosis (Hoechst and dual staining, comet assay; expressions of pro-apoptotic and anti-apoptotic indices). Pre-treatment with AA reversed these changes might be due to its antioxidant, mitoprotective and anti-apoptotic properties. However further extensive studies on in vivo models of PD are warranted to prove AA neuroprotective effect before entering into the clinical trial.
Directory of Open Access Journals (Sweden)
In-Su Kim
2017-02-01
Full Text Available We employed transcriptome analysis of epidermal growth factor receptor related gene expression changes in cellular and animal models of Parkinson’s disease (PD. We used a well-known Parkinsonian toxin 1-methyl-4-phenylpyridine (MPP+ to induce neuronal apoptosis in the human neuroblastoma SH-SY5Y cell line. The MPP+-treatment of SH-SY5Y cells was capable of inducing neuro-apoptosis, but it remains unclear what kinds of transcriptional genes are affected by MPP+ toxicity. Therefore the pathways that were significantly perturbed in MPP+ treated human neuroblastoma SH-SY5Y cells were identified based on genome-wide gene expression data at two time points (24 and 48 h. We found that the Epidermal Growth Factor Receptor (EGFR pathway-related genes showed significantly differential expression at all time points. The EGFR pathway has been linked to diverse cellular events such as proliferation, differentiation, and apoptosis. Further, to evaluate the functional significance of the altered EGFR related gene expression observed in MPP+-treated SH-SY5Y cells, the EGFR related GJB2 (Cx26 gene expression was analyzed in an MPP+-intoxicated animal PD model. Our findings identify that the EGFR signaling pathway and its related genes, such as Cx26, might play a significant role in dopaminergic (DAergic neuronal cell death during the process of neuro-apoptosis and therefore can be focused on as potential targets for therapeutic intervention.
Directory of Open Access Journals (Sweden)
Michael D Coleman
Full Text Available Many pesticides are used increasingly in combinations during crop protection and their stability ensures the presence of such combinations in foodstuffs. The effects of three fungicides, pyrimethanil, cyprodinil and fludioxonil, were investigated together and separately on U251 and SH-SY5Y cells, which can be representative of human CNS glial and neuronal cells respectively. Over 48h, all three agents showed significant reductions in cellular ATP, at concentrations that were more than tenfold lower than those which significantly impaired cellular viability. The effects on energy metabolism were reflected in their marked toxic effects on mitochondrial membrane potential. In addition, evidence of oxidative stress was seen in terms of a fall in cellular thiols coupled with increases in the expression of enzymes associated with reactive species formation, such as GSH peroxidase and superoxide dismutase. The glial cell line showed significant responsiveness to the toxin challenge in terms of changes in antioxidant gene expression, although the neuronal SH-SY5Y line exhibited greater vulnerability to toxicity, which was reflected in significant increases in caspase-3 expression, which is indicative of the initiation of apoptosis. Cyprodinil was the most toxic agent individually, although oxidative stress-related enzyme gene expression increases appeared to demonstrate some degree of synergy in the presence of the combination of agents. This report suggests that the impact of some pesticides, both individually and in combinations, merits further study in terms of their impact on human cellular health.
Algarni, Alanood S; Hargreaves, Alan J; Dickenson, John M
2018-02-05
NGF (nerve growth factor) and tissue transglutaminase (TG2) play important roles in neurite outgrowth and modulation of neuronal cell survival. In this study, we investigated the regulation of TG2 transamidase activity by NGF in retinoic acid-induced differentiating mouse N2a and human SH-SY5Y neuroblastoma cells. TG2 transamidase activity was determined using an amine incorporation and a peptide cross linking assay. In situ TG2 activity was assessed by visualising the incorporation of biotin-X-cadaverine using confocal microscopy. The role of TG2 in NGF-induced cytoprotection and neurite outgrowth was investigated by monitoring hypoxia-induced cell death and appearance of axonal-like processes, respectively. The amine incorporation and protein crosslinking activity of TG2 increased in a time and concentration-dependent manner following stimulation with NGF in N2a and SH-SY5Y cells. NGF mediated increases in TG2 activity were abolished by the TG2 inhibitors Z-DON (Z-ZON-Val-Pro-Leu-OMe; Benzyloxycarbonyl-(6-Diazo-5-oxonorleucinyl)-l-valinyl-l-prolinyl-l-leucinmethylester) and R283 (1,3,dimethyl-2[2-oxo-propyl]thio)imidazole chloride) and by pharmacological inhibition of extracellular signal-regulated kinases 1 and 2 (ERK1/2), protein kinase B (PKB) and protein kinase C (PKC), and removal of extracellular Ca 2+ . Fluorescence microscopy demonstrated NGF induced in situ TG2 activity. TG2 inhibition blocked NGF-induced attenuation of hypoxia-induced cell death and neurite outgrowth in both cell lines. Together, these results demonstrate that NGF stimulates TG2 transamidase activity via a ERK1/2, PKB and PKC-dependent pathway in differentiating mouse N2a and human SH-SY5Y neuroblastoma cells. Furthermore, NGF-induced cytoprotection and neurite outgrowth are dependent upon TG2. These results suggest a novel and important role of TG2 in the cellular functions of NGF. Copyright © 2017 Elsevier B.V. All rights reserved.
Nitro-Oxidative Stress after Neuronal Ischemia Induces Protein Nitrotyrosination and Cell Death
Directory of Open Access Journals (Sweden)
Marta Tajes
2013-01-01
Full Text Available Ischemic stroke is an acute vascular event that obstructs blood supply to the brain, producing irreversible damage that affects neurons but also glial and brain vessel cells. Immediately after the stroke, the ischemic tissue produces nitric oxide (NO to recover blood perfusion but also produces superoxide anion. These compounds interact, producing peroxynitrite, which irreversibly nitrates protein tyrosines. The present study measured NO production in a human neuroblastoma (SH-SY5Y, a murine glial (BV2, a human endothelial cell line (HUVEC, and in primary cultures of human cerebral myocytes (HC-VSMCs after experimental ischemia in vitro. Neuronal, endothelial, and inducible NO synthase (NOS expression was also studied up to 24 h after ischemia, showing a different time course depending on the NOS type and the cells studied. Finally, we carried out cell viability experiments on SH-SY5Y cells with H2O2, a prooxidant agent, and with a NO donor to mimic ischemic conditions. We found that both compounds were highly toxic when they interacted, producing peroxynitrite. We obtained similar results when all cells were challenged with peroxynitrite. Our data suggest that peroxynitrite induces cell death and is a very harmful agent in brain ischemia.
Vieira-Marques, Claudia; Arbo, Bruno Dutra; Ruiz-Palmero, Isabel; Ortiz-Rodriguez, Ana; Ghorbanpoor, Samar; Kucharski, Luiz Carlos; Arevalo, Maria A; Garcia-Segura, Luis Miguel; Ribeiro, Maria Flávia M
2016-08-01
Dehydroepiandrosterone (DHEA) modulates neurogenesis, neuronal function, neuronal survival and metabolism, enhancing mitochondrial oxidative capacity. Glucose deprivation and hypometabolism have been implicated in the mechanisms that mediate neuronal damage in neurological disorders, and some studies have shown that these mechanisms are sexually dimorphic. It was also demonstrated that DHEA is able to attenuate the hypometabolism that is related to some neurodegenerative diseases, eliciting neuroprotective effects in different experimental models of neurodegeneration. The aim of this study was to evaluate the effect of DHEA on the viability of male and female hippocampal neurons and SH-SY5Y neuroblastoma cells exposed to glucose deprivation. It was observed that after 12h of pre-treatment, DHEA was able to protect SH-SY5Y cells from glucose deprivation for 6h (DHEA 10(-12), 10(-8) and 10(-6)M) and 8h (DHEA 10(-8)M). In contrast, DHEA was not neuroprotective against glucose deprivation for 12 or 24h. DHEA (10(-8)M) also protected SH-SY5Y cells when added together or even 1h after the beginning of glucose deprivation (6h). Furthermore, DHEA (10(-8)M) also protected primary neurons from both sexes against glucose deprivation. In summary, our findings indicate that DHEA is neuroprotective against glucose deprivation in human neuroblastoma cells and in male and female mouse hippocampal neurons. These results suggest that DHEA could be a promising candidate to be used in clinical studies aiming to reduce neuronal damage in people from both sexes. Copyright © 2016 Elsevier B.V. All rights reserved.
Directory of Open Access Journals (Sweden)
Cristiane Copetti
2018-01-01
Full Text Available Few studies investigated the biological effects of American grape cultivars. We investigated the metabolic response after acute consumption of grape juice or wine from Bordo grapes (Vitis labrusca in a placebo-controlled crossover study with fifteen healthy volunteers. Blood samples were collected 1 hour after the intake of 100 mL of water, juice, or wine to measure TBARS, ABTS, FRAP, glucose, and uric acid levels. To evaluate differences in cellular response, intracellular reactive species production (DCFH-DA and metabolic mitochondrial viability (MTT were assessed after exposure of human neuron-like cells (SH-SY5Y to juice or wine. Glycemia was reduced after juice or wine consumption, whereas blood levels of uric acid were reduced after juice consumption but increased after wine consumption. Juice and wine consumption reduced plasma lipid peroxidation and increased plasma antioxidant capacity (ABTS and FRAP assays. Furthermore, juice inhibited H2O2-induced intracellular production of reactive species (RS and increased the viability of SH-SY5Y cells. In contrast, wine (dealcoholized exhibited a per se effect by inducing the production of RS and reducing cell viability. These results indicate a positive impact of acute consumption of Bordo juice and wine on human oxidative status, whereas only juice had protective effects against oxidative stress-induced cytotoxicity.
International Nuclear Information System (INIS)
Guida, Natascia; Laudati, Giusy; Anzilotti, Serenella; Secondo, Agnese; Montuori, Paolo; Di Renzo, Gianfranco; Canzoniero, Lorella M.T.; Formisano, Luigi
2015-01-01
Resveratrol (3,5,4′-trihydroxystilbene) (RSV), a polyphenol widely present in plants, exerts a neuroprotective function in several neurological conditions; it is an activator of class III histone deacetylase sirtuin1 (SIRT1), a crucial regulator in the pathophysiology of neurodegenerative diseases. By contrast, the RE1-silencing transcription factor (REST) is involved in the neurotoxic effects following exposure to polychlorinated biphenyl (PCB) mixture A1254. The present study investigated the effects of RSV-induced activation of SIRT1 on REST expression in SH-SY5Y cells. Further, we investigated the possible relationship between the non-dioxin-like (NDL) PCB-95 and REST through SIRT1 to regulate neuronal death in rat cortical neurons. Our results revealed that RSV significantly decreased REST gene and protein levels in a dose- and time-dependent manner. Interestingly, overexpression of SIRT1 reduced REST expression, whereas EX-527, an inhibitor of SIRT1, increased REST expression and blocked RSV-induced REST downregulation. These results suggest that RSV downregulates REST through SIRT1. In addition, RSV enhanced activator protein 1 (AP-1) transcription factor c-Jun expression and its binding to the REST promoter gene. Indeed, c-Jun knockdown reverted RSV-induced REST downregulation. Intriguingly, in SH-SY5Y cells and rat cortical neurons the NDL PCB-95 induced necrotic cell death in a concentration-dependent manner by increasing REST mRNA and protein expression. In addition, SIRT1 knockdown blocked RSV-induced neuroprotection in rat cortical neurons treated with PCB-95. Collectively, these results indicate that RSV via SIRT1 activates c-Jun, thereby reducing REST expression in SH-SY5Y cells under physiological conditions and blocks PCB-95-induced neuronal cell death by activating the same SIRT1/c-Jun/REST pathway. - Highlights: • Resveratrol via SIRT1/c-Jun downregulates REST mRNA and protein in SH-SY5Y cells. • Non-dioxin-like (NDL) PCB-95 is cytotoxic to
Energy Technology Data Exchange (ETDEWEB)
Guida, Natascia [IRCSS SDN, Naples 80131 (Italy); Laudati, Giusy [Division of Pharmacology, Department of Neuroscience, Reproductive and Dentistry Sciences, School of Medicine, “Federico II” University of Naples, Via Pansini, 5, 80131 Naples (Italy); Anzilotti, Serenella [IRCSS SDN, Naples 80131 (Italy); Secondo, Agnese [Division of Pharmacology, Department of Neuroscience, Reproductive and Dentistry Sciences, School of Medicine, “Federico II” University of Naples, Via Pansini, 5, 80131 Naples (Italy); Montuori, Paolo [Department of Public Health, ‘Federico II’ University of Naples, Naples (Italy); Di Renzo, Gianfranco [Division of Pharmacology, Department of Neuroscience, Reproductive and Dentistry Sciences, School of Medicine, “Federico II” University of Naples, Via Pansini, 5, 80131 Naples (Italy); Canzoniero, Lorella M.T. [Division of Pharmacology, Department of Neuroscience, Reproductive and Dentistry Sciences, School of Medicine, “Federico II” University of Naples, Via Pansini, 5, 80131 Naples (Italy); Division of Pharmacology, Department of Science and Technology, University of Sannio, Via Port' Arsa 11, 82100 Benevento (Italy); Formisano, Luigi, E-mail: cformisa@unisannio.it [Division of Pharmacology, Department of Neuroscience, Reproductive and Dentistry Sciences, School of Medicine, “Federico II” University of Naples, Via Pansini, 5, 80131 Naples (Italy); Division of Pharmacology, Department of Science and Technology, University of Sannio, Via Port' Arsa 11, 82100 Benevento (Italy)
2015-11-01
Resveratrol (3,5,4′-trihydroxystilbene) (RSV), a polyphenol widely present in plants, exerts a neuroprotective function in several neurological conditions; it is an activator of class III histone deacetylase sirtuin1 (SIRT1), a crucial regulator in the pathophysiology of neurodegenerative diseases. By contrast, the RE1-silencing transcription factor (REST) is involved in the neurotoxic effects following exposure to polychlorinated biphenyl (PCB) mixture A1254. The present study investigated the effects of RSV-induced activation of SIRT1 on REST expression in SH-SY5Y cells. Further, we investigated the possible relationship between the non-dioxin-like (NDL) PCB-95 and REST through SIRT1 to regulate neuronal death in rat cortical neurons. Our results revealed that RSV significantly decreased REST gene and protein levels in a dose- and time-dependent manner. Interestingly, overexpression of SIRT1 reduced REST expression, whereas EX-527, an inhibitor of SIRT1, increased REST expression and blocked RSV-induced REST downregulation. These results suggest that RSV downregulates REST through SIRT1. In addition, RSV enhanced activator protein 1 (AP-1) transcription factor c-Jun expression and its binding to the REST promoter gene. Indeed, c-Jun knockdown reverted RSV-induced REST downregulation. Intriguingly, in SH-SY5Y cells and rat cortical neurons the NDL PCB-95 induced necrotic cell death in a concentration-dependent manner by increasing REST mRNA and protein expression. In addition, SIRT1 knockdown blocked RSV-induced neuroprotection in rat cortical neurons treated with PCB-95. Collectively, these results indicate that RSV via SIRT1 activates c-Jun, thereby reducing REST expression in SH-SY5Y cells under physiological conditions and blocks PCB-95-induced neuronal cell death by activating the same SIRT1/c-Jun/REST pathway. - Highlights: • Resveratrol via SIRT1/c-Jun downregulates REST mRNA and protein in SH-SY5Y cells. • Non-dioxin-like (NDL) PCB-95 is cytotoxic to
Zhang, Jingyu; Shu, Yongwei; Qu, Yang; Zhang, Lina; Chu, Tingting; Zheng, Yonghui; Zhao, Hong
2017-12-01
There have been numerous reports about neurodegenerative diseases, including Alzheimer's disease. Nevertheless, the molecules responsible for the neurodegeneration in Alzheimer's disease are basically unknown. Recent findings indicate that the cellular myeloblastosis (c-myb) regulates neural progenitor cell proliferation. In the current study, the function of insulin-like growth factor-1 (IGF-1) against cell toxicity in SH-SY5Y cells induced by β-amyloid 25-35 (Aβ 25-35 ) and its molecular mechanism were investigated. It was found that p25 protein production was raised by Aβ 25-35 (25 μM), similar to the increased expression of μ-calpain. The results also showed that Aβ 25-35 reduced c-myb, elevated tau hyper-phosphorylation, and induced death of SH-SY5Y cells. Loss of cell viability and apoptosis of SH-SY5Y cells induced by Aβ 25-35 were attenuated by IGF-1 pretreatment in a dose-dependent manner. In addition, IGF-1 blocked μ-calpain expression, which was induced by Aβ 25-35 and reduced p25 formation and tau hyper-phosphorylation. Moreover, the expression of c-myb in SH-SY5Y cells was increased by combining IGF-1 with Aβ 25-35 or IGF-1 alone. The neuroprotective function of IGF-1 was attenuated in the SH-SY5Y cells, which were transfected with a c-myb small interfering RNA. Furthermore, LY294002, a specific PI3K inhibitor, reduced c-myb expression and abolished IGF-1's protective function in SH-SY5Y cell apoptosis induced by Aβ 25-35 . The facts above indicate that c-myb has a role in IGF-1-mediated protection from Aβ 25-35 -induced cytotoxicity via the PI3K/Akt pathway.
Mohan, Nishant; Banik, Naren L; Ray, Swapan K
2011-11-01
Neuroblastoma is the most prevalent extracranial solid tumor mainly in pediatric patients. We explored the efficacy of the combination of 2[(3-[2,3-dichlorophenoxy]propyl)amino]ethanol (2,3-DCPE, a small molecule inhibitor of the anti-apoptotic protein Bcl-x(L)) and N-(4-hydroxyphenyl) retinamide (4-HPR, a synthetic retinoid) in inducing differentiation and apoptosis in human malignant neuroblastoma cells. Immunofluorescence confocal microscopy and flow cytometry showed that the highest level of Bcl-x(L) expression occurred in SK-N-DZ cells followed by SH-SY5Y and IMR-32 cells. Combination of 20 μM 2,3-DCPE and 1 μM 4-HPR acted synergistically in decreasing viability of SK-N-DZ and SH-SY5Y cells. In situ methylene blue staining and protein gel blotting showed the efficacy of this combination of drugs in inducing neuronal differentiation morphologically and also biochemically with upregulation of the neuronal markers such as neurofilament protein (NFP) and neuron specific enolase (NSE) and downregulation of the differentiation inhibiting molecules such as N-Myc and Notch-1 in SK-N-DZ and SH-SY5Y cells. Annexin V-FITC/PI staining showed the synergistic action of this combination therapy in increasing apoptosis in both cell lines. Protein gel blotting manifested that combination therapy increased apoptosis with downregulation of the anti-apoptotic proteins Bcl-x(L), Bcl-2 and Mcl-1 and upregulation of the pro-apoptotic proteins Bax, p53, Puma (p53 upregulated modulator of apoptosis), and Noxa, ultimately causing activation of caspase-3. In conclusion, our results appeared highly encouraging in advocating the use of 2,3-DCPE and 4-HPR as a novel combination therapy for increasing both differentiation and apoptosis in human malignant neuroblastoma cells having Bcl-x(L) overexpression.
Effects of the Absorption Behaviour of ZnO Nanoparticles on Cytotoxicity Measurements
Directory of Open Access Journals (Sweden)
Nigar Najim
2014-01-01
Full Text Available ZnO absorbs certain wavelengths of light and this behavior is more pronounced for nanoparticles of ZnO. As many toxicity measurements rely on measuring light transmission in cell lines, it is essential to determine how far this light absorption influences experimental toxicity measurements. The main objective was to study the ZnO absorption and how this influenced the cytotoxicity measurements. The cytotoxicity of differently sized ZnO nanoparticles in normal and cancer cell lines derived from lung tissue (Hs888Lu, neuron-phenotypic cells (SH-SY5Y, neuroblastoma (SH-SY5Y, human histiocytic lymphoma (U937, and lung cancer (A549 was investigated. Our results demonstrate that the presence of ZnO affected the cytotoxicity measurements due to the absorption characteristic of ZnO nanoparticles. The data revealed that the ZnO nanoparticles with an average particle size of around 85.7 nm and 190 nm showed cytotoxicity towards U937, SH-SY5Y, differentiated SH-SY5Y, and Hs888Lu cell lines. No effect on the A549 cells was observed. It was also found that the cytotoxicity of ZnO was particle size, concentration, and time dependent. These studies are the first to quantify the influence of ZnO nanoparticles on cytotoxicity assays. Corrections for absorption effects were carried out which gave an accurate estimation of the concentrations that produce the cytotoxic effects.
Actions of piperidine alkaloid teratogens at fetal nicotinic acetylcholine receptors.
Green, Benedict T; Lee, Stephen T; Panter, Kip E; Welch, Kevin D; Cook, Daniel; Pfister, James A; Kem, William R
2010-01-01
Teratogenic alkaloids are found in many species of plants including Conium maculatum L., Nicotiana glauca, Nicotiana tabaccum, and multiple Lupinus spp. Fetal musculoskeletal defects produced by alkaloids from these plants include arthrogyropisis, scoliosis, torticollis, kyposis, lordosis, and cleft palate. A pharmacodynamic comparison of the alkaloids ammodendrine, anabasine, anabaseine, anagyrine, and coniine in SH-SY5Y cells and TE-671 cells was made. These alkaloids and their enantiomers were more effective in depolarizing TE-671 cells which express the human fetal-muscle type nicotinic acetylcholine receptor (nAChR) relative to SH-SY5Y cells which predominately express autonomic nAChRs. The rank order of potency in TE-671 cells was: anabaseine>(+)-anabasine>(-)-anabasine > (+/-)-anabasine>anagyrine>(-)-coniine > (+/-)-coniine>(+)-coniine>(+/-)-ammodendrine>(+)-ammodendrine. The rank order potency in SH-SY5Y cells was: anabaseine>(+)-anabasine>(-)-coniine>(+)-coniine>(+)-ammodendrine>anagyrine>(-)-anabasine>(+/-)-coniine>(+/-)-anabasine>(-)-ammodendrine. The actions of these alkaloids at nAChRs in both cell lines could be distinguished by their maximum effects in depolarizing cell membrane potential. The teratogenic action of these compounds may be related to their ability to activate and subsequently desensitize nAChRs.
Endoplasmic reticulum stress-mediated neuronal apoptosis by acrylamide exposure
Energy Technology Data Exchange (ETDEWEB)
Komoike, Yuta, E-mail: komoike@research.twmu.ac.jp; Matsuoka, Masato, E-mail: matsuoka@research.twmu.ac.jp
2016-11-01
Acrylamide (AA) is a well-known neurotoxic compound in humans and experimental animals. However, intracellular stress signaling pathways responsible for the neurotoxicity of AA are still not clear. In this study, we explored the involvement of the endoplasmic reticulum (ER) stress response in AA-induced neuronal damage in vitro and in vivo. Exposure of SH-SY5Y human neuroblastoma cells to AA increased the levels of phosphorylated form of eukaryotic translation initiation factor 2α (eIF2α) and its downstream effector, activating transcription factor 4 (ATF4), indicating the induction of the unfolded protein response (UPR) by AA exposure. Furthermore, AA exposure increased the mRNA level of c/EBP homologous protein (CHOP), the ER stress-dependent apoptotic factor, and caused the accumulation of reactive oxygen species (ROS) in SH-SY5Y cells. Treatments of SH-SY5Y cells with the chemical chaperone, 4-phenylbutyric acid and the ROS scavenger, N-acetyl-cysteine reduced the AA-induced expression of ATF4 protein and CHOP mRNA, and resulted in the suppression of apoptosis. In addition, AA-induced eIF2α phosphorylation was also suppressed by NAC treatment. In consistent with in vitro study, exposure of zebrafish larvae at 6-day post fertilization to AA induced the expression of chop mRNA and apoptotic cell death in the brain, and also caused the disruption of brain structure. These findings suggest that AA exposure induces apoptotic neuronal cell death through the ER stress and subsequent eIF2α–ATF4–CHOP signaling cascade. The accumulation of ROS by AA exposure appears to be responsible for this ER stress-mediated apoptotic pathway. - Highlights: • Exposure of SH-SY5Y cells to AA activates the eIF2α–ATF4 pathway of the UPR. • Exposure of SH-SY5Y cells to AA induces the CHOP expression and apoptosis. • Exposure of zebrafish to AA induces the chop expression and apoptosis in the brain. • AA possibly induces apoptotic neuronal cell death through the ER
Costa, Delfina; Gigoni, Arianna; Würth, Roberto; Cancedda, Ranieri; Florio, Tullio; Pagano, Aldo
2014-01-01
Background Metformin is a widely used oral hypoglycemizing agent recently proposed as potential anti-cancer drug. In this study we report the antiproliferative effect of metformin treatment in a high risk neuroblastoma cell model, focusing on possible effects associated to different levels of differentiation and/or tumor initiating potential. Methods Antiproliferative and cytotoxic effects of metformin were tested in human SKNBE2 and SH-SY5Y neuroblastoma cell lines and in SKNBE2 cells in whi...
The SH-SY5Y cell line in Parkinson's disease research: a systematic review
Xicoy, H; Wieringa, B; Martens, G.J.
2017-01-01
Parkinson?s disease (PD) is a devastating and highly prevalent neurodegenerative disease for which only symptomatic treatment is available. In order to develop a truly effective disease-modifying therapy, improvement of our current understanding of the molecular and cellular mechanisms underlying PD pathogenesis and progression is crucial. For this purpose, standardization of research protocols and disease models is necessary. As human dopaminergic neurons, the cells mainly affected in PD, ar...
Cosmosiin Increases ADAM10 Expression via Mechanisms Involving 5’UTR and PI3K Signaling
Directory of Open Access Journals (Sweden)
Zhuo Min
2018-06-01
Full Text Available The α-secretase “a disintegrin and metalloproteinase domain-containing protein” (ADAM10 is involved in the processing of amyloid precursor protein (APP. Upregulation of ADAM10 precludes the generation of neurotoxic β-amyloid protein (Aβ and represents a plausible therapeutic strategy for Alzheimer’s disease (AD. In this study, we explored compounds that can potentially promote the expression of ADAM10. Therefore, we performed high-throughput small-molecule screening in SH-SY5Y (human neuroblastoma cells that stably express a luciferase reporter gene driven by the ADAM10 promoter, including a portion of its 5’-untranslated region (5’UTR. This has led to the discovery of cosmosiin (apigenin 7-O-β-glucoside. Here, we report that in human cell lines (SH-SY5Y and HEK293, cosmosiin proportionally increased the levels of the immature and mature forms of the ADAM10 protein without altering its mRNA level. This effect was attenuated by translation inhibitors or by deleting the 5’UTR of ADAM10, suggesting that a translational mechanism was responsible for the increased levels of ADAM10. Luciferase deletion assays revealed that the first 144 nucleotides of the 5’UTR were necessary for mediating the cosmosiin-induced enhancement of ADAM10 expression in SH-SY5Y cells. Cosmosiin failed to increase the levels of the ADAM10 protein in murine cells, which lack native expression of the ADAM10 transcript containing the identified 5’UTR element. The potential signaling pathway may involve phosphatidylinositide 3-kinase (PI3K because pharmacological inhibition of PI3K attenuated the effect of cosmosiin on the expression of the ADAM10 protein. Finally, cosmosiin attenuated Aβ generation because the levels of Aβ40/42 in HEK-APP cells were significantly reduced after cosmosiin treatment. Collectively, we found that the first 144 nucleotides of the ADAM10 5’UTR, and PI3K signaling, are involved in cosmosiin-induced enhancement of the expression
Janson, Juliette; Eketjäll, Susanna; Tunblad, Karin; Jeppsson, Fredrik; Von Berg, Stefan; Niva, Camilla; Radesäter, Ann-Cathrin; Fälting, Johanna; Visser, Sandra A G
2014-03-01
The aims were to quantify the in vivo time-course between the oral dose, the plasma and brain exposure and the inhibitory effect on Amyloid β (Aβ) in brain and cerebrospinal fluid, and to establish the correlation between in vitro and in vivo potency of novel β-secretase (BACE1) inhibitors. BACE1-mediated inhibition of Aβ was quantified in in vivo dose- and/or time-response studies and in vitro in SH-SY5Y cells, N2A cells, and primary cortical neurons (PCN). An indirect response model with inhibition on Aβ production rate was used to estimate unbound in vivo IC 50 in a population pharmacokinetic-pharmacodynamic modeling approach. Estimated in vivo inhibitory potencies varied between 1 and 1,000 nM. The turnover half-life of Aβ40 in brain was predicted to be 0.5 h in mouse and 1 h in guinea pig. An excellent correlation between PCN and in vivo potency was observed. Moreover, a strong correlation in potency was found between human SH-SY5Y cells and mouse PCN, being 4.5-fold larger in SH-SY5Y cells. The strong in vivo-in vitro correlation increased the confidence in using human cell lines for screening and optimization of BACE1 inhibitors. This can optimize the design and reduce the number of preclinical in vivo effect studies.
Modulation of DNA base excision repair during neuronal differentiation
DEFF Research Database (Denmark)
Sykora, Peter; Yang, Jenq-Lin; Ferrarelli, Leslie K
2013-01-01
DNA damage susceptibility and base excision DNA repair (BER) capacity in undifferentiated and differentiated human neural cells. The results show that undifferentiated human SH-SY5Y neuroblastoma cells are less sensitive to oxidative damage than their differentiated counterparts, in part because...
L-Dopa decarboxylase expression profile in human cancer cells.
Chalatsa, Ioanna; Nikolouzou, Eleftheria; Fragoulis, Emmanuel G; Vassilacopoulou, Dido
2011-02-01
L-Dopa decarboxylase (DDC) catalyses the decarboxylation of L-Dopa. It has been shown that the DDC gene undergoes alternative splicing within its 5'-untranslated region (UTR), in a tissue-specific manner, generating identical protein products. The employment of two alternative 5'UTRs is thought to be responsible for tissue-specific expression of the human DDC mRNA. In this study, we focused on the investigation of the nature of the mRNA expression in human cell lines of neural and non-neural origin. Our results show the expression of a neural-type DDC mRNA splice variant, lacking exon 3 in all cell lines studied. Co-expression of the full length non-neural DDC mRNA and the neural-type DDC splice variant lacking exon 3 was detected in all cell lines. The alternative DDC protein isoform, Alt-DDC, was detected in SH-SY5Y and HeLa cells. Our findings suggest that the human DDC gene undergoes complex processing, leading to the formation of multiple mRNA isoforms. The study of the significance of this phenomenon of multiple DDC mRNA isoforms could provide us with new information leading to the elucidation of the complex biological pathways that the human enzyme is involved in.
Chen, Tong; Ma, Zhanqiang; Zhu, Lingpeng; Jiang, Wenjiao; Wei, Tingting; Zhou, Rui; Luo, Fen; Zhang, Kai; Fu, Qiang; Ma, Chunhua; Yan, Tianhua
2016-11-01
The purpose of the current study was to detect the effect of salidroside (Sal) on cerebral ischemia and explore its potential mechanism. Middle cerebral artery occlusion (MCAO) was performed to investigate the effects of Sal on cerebral ischemia. The rats were randomly divided into five groups: sham group, vehicle group, clopidogrel (7.5 mg/kg) group, Sal (20 mg/kg) group, and Sal (40 mg/kg) group. SH-SY5Y cells were exposed to ischemia-reperfusion (I/R) injury to verify the protective effect of Sal in vitro. We also built the stable receptor-interacting protein 140 (RIP140)-overexpressing SH-SY5Y cells. The results showed that Sal significantly reduces brain infarct size and cerebral edema. Sal could effectively decrease the levels of interleukin-6 (IL-6), interleukin-1β (IL-1β), and tumor necrosis factor-α (TNF-α) in serum of the MCAO rats and supernatant of I/R-induced SH-SY5Y cells. Immunohistochemical and Western blot results demonstrated that Sal inhibited RIP140-mediated inflammation and apoptosis in the MCAO rats and SH-SY5Y cells. In addition, we further confirmed that RIP140/NF-κB signaling plays a crucial role by evaluating the protein expression in RIP140-overexpressing SH-SY5Y cells. Our findings suggested that Sal could be used as an effective neuroprotective agent for cerebral ischemia due to its significant effect on preventing neuronal cell injury after cerebral ischemia both in vivo and in vitro by the inhibitions of RIP140-mediated inflammation and apoptosis.
Quercetin, not caffeine, is a major neuroprotective component in coffee.
Lee, Moonhee; McGeer, Edith G; McGeer, Patrick L
2016-10-01
Epidemiologic studies indicate that coffee consumption reduces the risk of Parkinson's disease and Alzheimer's disease. To determine the factors involved, we examined the protective effects of coffee components. The test involved prevention of neurotoxicity to SH-SY5Y cells that was induced by lipopolysaccharide plus interferon-γ or interferon-γ released from activated microglia and astrocytes. We found that quercetin, flavones, chlorogenic acid, and caffeine protected SH-SY5Y cells from these toxins. They also reduced the release of tumor necrosis factor-α and interleukin-6 from the activated microglia and astrocytes and attenuated the activation of proteins from P38 mitogen-activated protein kinase (MAPK) and nuclear factor kappa light chain enhancer of activated B cells (NFκB). After exposure to toxin containing glial-stimulated conditioned medium, we also found that quercetin reduced oxidative/nitrative damage to DNA, as well as to the lipids and proteins of SH-SY5Y cells. There was a resultant increase in [GSH]i in SH-SY5Y cells. The data indicate that quercetin is the major neuroprotective component in coffee against Parkinson's disease and Alzheimer's disease. Copyright © 2016 Elsevier Inc. All rights reserved.
Interaction between human BAP31 and respiratory syncytial virus small hydrophobic (SH) protein
International Nuclear Information System (INIS)
Li, Yan; Jain, Neeraj; Limpanawat, Suweeraya; To, Janet; Quistgaard, Esben M.; Nordlund, Par; Thanabalu, Thirumaran; Torres, Jaume
2015-01-01
The small hydrophobic (SH) protein is a short channel-forming polypeptide encoded by the human respiratory syncytial virus (hRSV). Deletion of SH protein leads to the viral attenuation in mice and primates, and delayed apoptosis in infected cells. We have used a membrane-based yeast two-hybrid system (MbY2H) and a library from human lung cDNA to detect proteins that bind SH protein. This led to the identification of a membrane protein, B-cell associated protein 31 (BAP31). Transfected SH protein co-localizes with transfected BAP31 in cells, and pulls down endogenous BAP31. Titration of purified C-terminal endodomain of BAP31 against isotopically labeled SH protein in detergent micelles suggests direct interaction between the two proteins. Given the key role of BAP31 in protein trafficking and its critical involvement in pro- and anti-apoptotic pathways, this novel interaction may constitute a potential drug target. - Highlights: • A yeast two-hybrid system (MbY2H) detected BAP31 as a binder of RSV SH protein. • Transfected SH and BAP31 co-localize in lung epithelial cells. • Endogenous BAP31 is pulled down by RSV SH protein. • BAP31 endodomain interacts with the N-terminal α-helix of SH protein in micelles. • This interaction is proposed to be a potential drug target
Interaction between human BAP31 and respiratory syncytial virus small hydrophobic (SH) protein
Energy Technology Data Exchange (ETDEWEB)
Li, Yan; Jain, Neeraj; Limpanawat, Suweeraya; To, Janet [School of Biological Sciences, Nanyang Technological University, 637551 (Singapore); Quistgaard, Esben M. [Department of Medical Biochemistry and Biophysics, Karolinska Institutet, Stockholm (Sweden); Nordlund, Par [School of Biological Sciences, Nanyang Technological University, 637551 (Singapore); Department of Medical Biochemistry and Biophysics, Karolinska Institutet, Stockholm (Sweden); Thanabalu, Thirumaran [School of Biological Sciences, Nanyang Technological University, 637551 (Singapore); Torres, Jaume, E-mail: jtorres@ntu.edu.sg [School of Biological Sciences, Nanyang Technological University, 637551 (Singapore)
2015-08-15
The small hydrophobic (SH) protein is a short channel-forming polypeptide encoded by the human respiratory syncytial virus (hRSV). Deletion of SH protein leads to the viral attenuation in mice and primates, and delayed apoptosis in infected cells. We have used a membrane-based yeast two-hybrid system (MbY2H) and a library from human lung cDNA to detect proteins that bind SH protein. This led to the identification of a membrane protein, B-cell associated protein 31 (BAP31). Transfected SH protein co-localizes with transfected BAP31 in cells, and pulls down endogenous BAP31. Titration of purified C-terminal endodomain of BAP31 against isotopically labeled SH protein in detergent micelles suggests direct interaction between the two proteins. Given the key role of BAP31 in protein trafficking and its critical involvement in pro- and anti-apoptotic pathways, this novel interaction may constitute a potential drug target. - Highlights: • A yeast two-hybrid system (MbY2H) detected BAP31 as a binder of RSV SH protein. • Transfected SH and BAP31 co-localize in lung epithelial cells. • Endogenous BAP31 is pulled down by RSV SH protein. • BAP31 endodomain interacts with the N-terminal α-helix of SH protein in micelles. • This interaction is proposed to be a potential drug target.
Najem, Dema; Bamji-Mirza, Michelle; Yang, Ze; Zhang, Wandong
2016-06-01
Alzheimer's disease (AD) is characterized by amyloid-β (Aβ) toxicity, tau pathology, insulin resistance, neuroinflammation, and dysregulation of cholesterol homeostasis, all of which play roles in neurodegeneration. Insulin has polytrophic effects on neurons and may be at the center of these pathophysiological changes. In this study, we investigated possible relationships among insulin signaling and cholesterol biosynthesis, along with the effects of Aβ42 on these pathways in vitro. We found that neuroblastoma 2a (N2a) cells transfected with the human gene encoding amyloid-β protein precursor (AβPP) (N2a-AβPP) produced Aβ and exhibited insulin resistance by reduced p-Akt and a suppressed cholesterol-synthesis pathway following insulin treatment, and by increased phosphorylation of insulin receptor subunit-1 at serine 612 (p-IRS-S612) as compared to parental N2a cells. Treatment of human neuroblastoma SH-SY5Y cells with Aβ42 also increased p-IRS-S612, suggesting that Aβ42 is responsible for insulin resistance. The insulin resistance was alleviated when N2a-AβPP cells were treated with higher insulin concentrations. Insulin increased Aβ release from N2a-AβPP cells, by which it may promote Aβ clearance. Insulin increased cholesterol-synthesis gene expression in SH-SY5Y and N2a cells, including 24-dehydrocholesterol reductase (DHCR24) and 3-hydroxy-3-methyl-glutaryl-CoA reductase (HMGCR) through sterol-regulatory element-binding protein-2 (SREBP2). While Aβ42-treated SH-SY5Y cells exhibited increased HMGCR expression and c-Jun phosphorylation as pro-inflammatory responses, they also showed down-regulation of neuro-protective/anti-inflammatory DHCR24. These results suggest that Aβ42 may cause insulin resistance, activate JNK for c-Jun phosphorylation, and lead to dysregulation of cholesterol homeostasis, and that enhancing insulin signaling may relieve the insulin-resistant phenotype and the dysregulated cholesterol-synthesis pathway to promote A
Tripathi, Vinay Kumar; Kumar, Vivek; Pandey, Ankita; Vatsa, Pankhi; Dhasmana, Anupam; Singh, Rajat Pratap; Appikonda, Sri Hari Chandan; Hwang, Inho; Lohani, Mohtashim
2017-07-01
Expression of various cytochrome P450s (CYPs) in mammalian brain cells is well documented. However, such studies are hampered in neural/glial cells of human origin due to nonavailability of human brain cells. To address this issue, we investigated the expression and inducibility of CYP2C8 and CYP3A4 and their responsiveness against cyclophosphamide (CPA) and organophosphorus pesticide monocrotophos (MCP), a known developmental neurotoxicant in human neural (SH-SY5Y) and glial (U373-MG) cell lines. CPA induced significant expression of CYP2C8 and CYP3A4 in both types of cells in a time-dependent manner. Neural cell line exhibited relatively higher constitutive and inducible expression of CYPs than the glial cell line. MCP exposure alone could not induce the significant expression of CYPs, whereas the cells preexposed to CPA showed a significant response to MCP. Similar to the case of CPA induced expressions, neural cells were found to be more vulnerable than glial cells. Our data indicate differential expressions of CYPs in cultured human neural and glial cell lines. The findings were synchronized with protein ligand docking studies, which showed a significant modulatory capacity of MCP by strong interaction with CYP regulators-CAR and PXR. Similarly, the known CYP inducer CPA has also shown significant high docking scores with the two studied CYP regulators. We also observed a significant induction in reactive oxygen species (ROS), lipid peroxides (LPO), micronucleus (MN), chromosomal aberration (CA), and reduction in reduced glutathione (GSH) and catalase following the exposure of MCP. Moreover, the expressions of apoptotic markers such as caspase-3, caspase-9, Bax, and p53 were significantly upregulated, whereas the levels of antiapoptotic marker, Bcl2, was downregulated after the exposure of MCP in both cell lines. These findings confirm the involvement of ROS-mediated oxidative stress, which subsequently triggers apoptosis pathways in both human neural (SH-SY5Y
Carroll, C B; Zeissler, M-L; Hanemann, C O; Zajicek, J P
2012-10-01
Δ⁹-tetrahydrocannabinol (Δ⁹-THC) is neuroprotective in models of Parkinson's disease (PD). Although CB1 receptors are increased within the basal ganglia of PD patients and animal models, current evidence suggests a role for CB1 receptor-independent mechanisms. Here, we utilized a human neuronal cell culture PD model to further investigate the protective properties of Δ⁹-THC. Differentiated SH-SY5Y neuroblastoma cells were exposed to PD-relevant toxins: 1-methyl-4-phenylpyridinium (MPP+), lactacystin and paraquat. Changes in CB1 receptor level were determined by quantitative polymerase chain reaction and Western blotting. Cannabinoids and modulatory compounds were co-administered with toxins for 48 h and the effects on cell death, viability, apoptosis and oxidative stress assessed. We found CB1 receptor up-regulation in response to MPP+, lactacystin and paraquat and a protective effect of Δ⁹-THC against all three toxins. This neuroprotective effect was not reproduced by the CB1 receptor agonist WIN55,212-2 or blocked by the CB1 antagonist AM251. Furthermore, the antioxidants α-tocopherol and butylhydroxytoluene as well as the antioxidant cannabinoids, nabilone and cannabidiol were unable to elicit the same neuroprotection as Δ⁹-THC. However, the peroxisome proliferator-activated receptor-gamma (PPARγ) antagonist T0070907 dose-dependently blocked the neuroprotective, antioxidant and anti-apoptotic effects of Δ⁹-THC, while the PPARγ agonist pioglitazone resulted in protection from MPP+-induced neurotoxicity. Furthermore, Δ⁹-THC increased PPARγ expression in MPP+-treated SH-SY5Y cells, another indicator of PPARγ activation. We have demonstrated up-regulation of the CB1 receptor in direct response to neuronal injury in a human PD cell culture model, and a direct neuronal protective effect of Δ⁹-THC that may be mediated through PPARγ activation. © 2011 The Authors. Neuropathology and Applied Neurobiology © 2011 British Neuropathological
Directory of Open Access Journals (Sweden)
Beilei Chen
2015-01-01
Full Text Available Background. Calreticulin (CRT can bind to Fas ligand (FasL and inhibit Fas/FasL-mediated apoptosis of Jurkat T cells. However, its effect on neuronal cell apoptosis has not been investigated. Purpose. We aimed to evaluate the neuroprotective effect of CRT following ischemia-reperfusion injury (IRI. Methods. Mice underwent middle cerebral artery occlusion (MCAO and SH-SY5Y cells subjected to oxygen glucose deprivation (OGD were used as models for IRI. The CRT protein level was detected by Western blotting, and mRNA expression of CRT, caspase-3, and caspase-8 was measured by real-time PCR. Immunofluorescence was used to assess the localization of CRT and FasL. The interaction of CRT with FasL was verified by coimmunoprecipitation. SH-SY5Y cell viability was determined by MTT assay, and cell apoptosis was assessed by flow cytometry. The measurement of caspase-8 and caspase-3 activity was carried out using caspase activity assay kits. Results. After IRI, CRT was upregulated on the neuron surface and bound to FasL, leading to increased viability of OGD-exposed SH-SY5Y cells and decreased activity of caspase-8 and caspase-3. Conclusions. This study for the first time revealed that increased CRT inhibited Fas/FasL-mediated neuronal cell apoptosis during the early stage of ischemic stroke, suggesting it to be a potential protector activated soon after IRI.
Pieri, Laura; Chafey, Philippe; Le Gall, Morgane; Clary, Guilhem; Melki, Ronald; Redeker, Virginie
2016-01-01
α-Synuclein (α-Syn) fibrils are the main constituent of Lewy bodies and a neuropathological hallmark of Parkinson's disease (PD). The propagation of α-Syn assemblies from cell to cell suggests that they are involved in PD progression. We previously showed that α-Syn fibrils are toxic because of their ability to bind and permeabilize cell membranes. Here, we document the cellular response in terms of proteome changes of SH-SY5Y cells exposed to exogenous α-Syn fibrils. We compare the proteomes of cells of neuronal origin exposed or not either to oligomeric or fibrillar α-Syn using two dimensional differential in-gel electrophoresis (2D-DIGE) and mass spectrometry. Only α-Syn fibrils induce significant changes in the proteome of SH-SY5Y cells. In addition to proteins associated to apoptosis and toxicity, or proteins previously linked to neurodegenerative diseases, we report an overexpression of proteins involved in intracellular vesicle trafficking. We also report a remarkable increase in fibrillar α-Syn heterogeneity, mainly due to C-terminal truncations. Our results show that cells of neuronal origin adapt their proteome to exogenous α-Syn fibrils and actively modify those assemblies. Cells of neuronal origin adapt their proteome to exogenous toxic α-Syn fibrils and actively modify those assemblies. Our results bring insights into the cellular response and clearance events the cells implement to face the propagation of α-Syn assemblies associated to pathology.
Directory of Open Access Journals (Sweden)
Gwon-Soo Jung
2013-05-01
Full Text Available In this study, we aimed to compare the morphogenetic andneuronal characteristics between monolayer cells andspheroids. For this purpose, we established spheroid formationby growing SH-SY5Y cells on the hydrophobic surfaces ofthermally-collapsed elastin-like polypeptide. After 4 days ofculture, the relative proliferation of the cells within spheroidswas approximately 92% of the values for monolayer cultures.As measured by quantitative assays for mRNA and proteinexpressions, the production of synaptophysin and neuronspecificenolase (NSE as well as the contents of cell adhesionmolecules (CAMs and extracellular matrix (ECM proteins aremuch higher in spheroids than in monolayer cells. Under theall-trans-retinoic acid (RA-induced differentiation condition,spheroids extended neurites and further up-regulated theexpression of synaptophysin, NSE, CAMs, and ECM proteins.Our data indicate that RA-differentiated SH-SY5Y neurospheroidsare functionally matured neuronal architectures. [BMBReports 2013; 46(5: 276-281
Directory of Open Access Journals (Sweden)
Koon-Ho Chan
Full Text Available Beta-amyloid (Aβ neurotoxicity is important in Alzheimer's disease (AD pathogenesis. Aβ neurotoxicity causes oxidative stress, inflammation and mitochondrial damage resulting in neuronal degeneration and death. Oxidative stress, inflammation and mitochondrial failure are also pathophysiological mechanisms of type 2 diabetes (T(2DM which is characterized by insulin resistance. Interestingly, T(2DM increases risk to develop AD which is associated with reduced neuronal insulin sensitivity (central insulin resistance. We studied the potential protective effect of adiponectin (an adipokine with insulin-sensitizing, anti-inflammatory and anti-oxidant properties against Aβ neurotoxicity in human neuroblastoma cells (SH-SY5Y transfected with the Swedish amyloid precursor protein (Sw-APP mutant, which overproduced Aβ with abnormal intracellular Aβ accumulation. Cytotoxicity was measured by assay for lactate dehydrogenase (LDH released upon cell death and lysis. Our results revealed that Sw-APP transfected SH-SY5Y cells expressed both adiponectin receptor 1 and 2, and had increased AMP-activated protein kinase (AMPK activation and enhanced nuclear factor-kappa B (NF-κB activation compared to control empty-vector transfected SH-SY5Y cells. Importantly, adiponectin at physiological concentration of 10 µg/ml protected Sw-APP transfected SH-SY5Y cells against cytotoxicity under oxidative stress induced by hydrogen peroxide. This neuroprotective action of adiponectin against Aβ neurotoxicity-induced cytotoxicity under oxidative stress involved 1 AMPK activation mediated via the endosomal adaptor protein APPL1 (adaptor protein with phosphotyrosine binding, pleckstrin homology domains and leucine zipper motif and possibly 2 suppression of NF-κB activation. This raises the possibility of novel therapies for AD such as adiponectin receptor agonists.
Directory of Open Access Journals (Sweden)
Zänker Kurt S
2010-07-01
Full Text Available Abstract Background Tumor cells interact with the cells of the microenvironment not only by cell-cell-contacts but also by the release of signal substances. These substances are known to induce tumor vascularization, especially under hypoxic conditions, but are also supposed to provoke other processes such as tumor innervation and inflammatory conditions. Inflammation is mediated by two organ systems, the neuroendocrine system and the immune system. Therefore, we investigated the influence of substances released by PC-3 human prostate carcinoma cells on SH-SY5Y neuroblastoma cells as well as neutrophil granulocytes and cytotoxic T lymphocytes, especially with regard to their migratory activity. Results PC-3 cells express several cytokines and growth factors including vascular endothelial growth factors, fibroblast growth factors, interleukins and neurotrophic factors. SH-SY5Y cells are impaired in their migratory activity by PC-3 cell culture supernatant, but orientate chemotactically towards the source. Neutrophil granulocytes increase their locomotory activity only in response to cell culture supernantant of hypoxic but not of normoxic PC-3 cells. In contrast, cytotoxic T lymphocytes do not change their migratory activity in response to either culture supernatant, but increase their cytotoxicity, whereas supernatant of normoxic PC-3 cells leads to a stronger increase than that of hypoxic PC-3 cells. Conclusions PC-3 cells release several signal substances that influence the behavior of the cells in the tumor's microenvironment, whereas no clear pattern towards proinflammatory or immunosuppressive conditions can be seen.
Janefjord, Emelie; Mååg, Jesper L V; Harvey, Benjamin S; Smid, Scott D
2014-01-01
Cannabinoid (CB) ligands have demonstrated neuroprotective properties. In this study we compared the effects of a diverse set of CB ligands against β amyloid-mediated neuronal toxicity and activated microglial-conditioned media-based neurotoxicity in vitro, and compared this with a capacity to directly alter β amyloid (Aβ) fibril or aggregate formation. Neuroblastoma (SH-SY5Y) cells were exposed to Aβ1-42 directly or microglial (BV-2 cells) conditioned media activated with lipopolysaccharide (LPS) in the presence of the CB1 receptor-selective agonist ACEA, CB2 receptor-selective agonist JWH-015, phytocannabinoids Δ(9)-THC and cannabidiol (CBD), the endocannabinoids 2-arachidonoyl glycerol (2-AG) and anandamide or putative GPR18/GPR55 ligands O-1602 and abnormal-cannabidiol (Abn-CBD). TNF-α and nitrite production was measured in BV-2 cells to compare activation via LPS or albumin with Aβ1-42. Aβ1-42 evoked a concentration-dependent loss of cell viability in SH-SY5Y cells but negligible TNF-α and nitrite production in BV-2 cells compared to albumin or LPS. Both albumin and LPS-activated BV-2 conditioned media significantly reduced neuronal cell viability but were directly innocuous to SH-SY5Y cells. Of those CB ligands tested, only 2-AG and CBD were directly protective against Aβ-evoked SH-SY5Y cell viability, whereas JWH-015, THC, CBD, Abn-CBD and O-1602 all protected SH-SY5Y cells from BV-2 conditioned media activated via LPS. While CB ligands variably altered the morphology of Aβ fibrils and aggregates, there was no clear correlation between effects on Aβ morphology and neuroprotective actions. These findings indicate a neuroprotective action of CB ligands via actions at microglial and neuronal cells.
International Nuclear Information System (INIS)
Valentiner, Ursula; Carlsson, Margarita; Erttmann, Rudolf; Hildebrandt, Herbert; Schumacher, Udo
2005-01-01
The thiazolidinedione (TZD) or glitazone class of peroxisome proliferator-activated-γ (PPAR-γ) ligands not only induce adipocyte differentiation and increase insulin sensitivity, but also exert growth inhibitory effects on several carcinoma cell lines in vitro as well as in vivo. In the current study the in vitro effect of four PPAR-γ agonists (ciglitazone, pioglitazone, troglitazone, rosiglitazone) on the cell growth of seven human neuroblastoma cell lines (Kelly, LAN-1, LAN-5, LS, IMR-32, SK-N-SH, SH-SY5Y) was investigated. Growth rates were assessed by a colorimetric XTT-based assay kit. Expression of PPAR-γ protein was examined by immunohistochemistry and Western blot analysis. All glitazones inhibited in vitro growth and viability of the human neuroblastoma cell lines in a dose-dependent manner showing considerable effects only at high concentrations (10 μM and 100 μM). Effectiveness of the glitazones on neuroblastoma cell growth differed depending on the cell line and the agent. The presence of PPAR-γ protein was demonstrated in all cell lines. Our findings indicate that ligands for PPAR-γ may be useful therapeutic agents for the treatment of neuroblastoma. Thus the effect of glitazones on the growth of neuroblastoma should now be investigated in an in vivo animal model
Directory of Open Access Journals (Sweden)
Giorgio Cantelli-Forti
2012-08-01
Full Text Available Oxidative stress (OS contributes to the cascade leading to the dysfunction or death of dopaminergic neurons during Parkinson’s disease (PD. A strategy to prevent the OS of dopaminergic neurons may be the use of phytochemicals as inducers of endogenous antioxidants and phase 2 enzymes. In this study, we demonstrated that treatment of the dopaminergic-like neuroblastoma SH-SY5Y cell line with isothiocyanate erucin (ER, a compound of cruciferous vegetables, resulted in significant increases of both total glutathione (GSH levels and total antioxidant capacity at the cytosolic level. The increase of GSH levels was associated with an increase in the resistance of SH-SY5Y cells to neuronal death, in terms of apoptosis, induced by 6-hydroxydopamine (6-OHDA. The pretreatment of SH-SY5Y cells with ER was also shown to prevent the redox status impairment, in terms of intracellular ROS and O2•− formation, and loss of mitochondrial membrane potential, early events that are initiators of the apoptotic process, induced by 6-OHDA. Last, the antiapoptotic and antioxidant effects of ER were abolished by buthionine sulfoximine, supporting the main role of GSH in the neuroprotective effects recorded by ER. These results suggest that ER may prevent the oxidative damage induced by 6-OHDA.
Ethyl Alcohol Extract of Hizikia fusiforme Induces Caspase ...
African Journals Online (AJOL)
Ethyl Alcohol Extract of Hizikia fusiforme Induces Caspase-dependent Apoptosis in Human Leukemia U937 Cells by Generation of Reactive Oxygen Species. C-H Kang, S-H Kang, S-H Boo, S-Y Park, D-O Moon, G-Y Kim ...
Evaluation of neuroprotective properties of two synthetic prenylated ...
African Journals Online (AJOL)
Human neuroblastoma SH-SY5Y cell, 6-Hydroxydopamine. Tropical Journal of ... in vivo and in vitro settings. 6-OHDA ... dopaminergic neurons and reestablishes a new ... cell death as seen in Parkinson's disease [3]. ... and 6- hydroxydopamine in a dopaminergic cell line - ..... previous study demonstrated in rodent model.
Monitoring the effects of doxorubicin on 3D-spheroid tumor cells in real-time
Directory of Open Access Journals (Sweden)
Baek N
2016-11-01
Full Text Available NamHuk Baek,1,* Ok Won Seo,1,* MinSung Kim,1 John Hulme,2 Seong Soo A An2 1Department of R & D, NanoEntek Inc., Seoul, Republic of Korea; 2Department of BioNano Technology Gachon University, Gyeonggi-do, Republic of Korea *These authors contributed equally to this work Abstract: Recently, increasing numbers of cell culture experiments with 3D spheroids presented better correlating results in vivo than traditional 2D cell culture systems. 3D spheroids could offer a simple and highly reproducible model that would exhibit many characteristics of natural tissue, such as the production of extracellular matrix. In this paper numerous cell lines were screened and selected depending on their ability to form and maintain a spherical shape. The effects of increasing concentrations of doxorubicin (DXR on the integrity and viability of the selected spheroids were then measured at regular intervals and in real-time. In total 12 cell lines, adenocarcinomic alveolar basal epithelial (A549, muscle (C2C12, prostate (DU145, testis (F9, pituitary epithelial-like (GH3, cervical cancer (HeLa, HeLa contaminant (HEp2, embryo (NIH3T3, embryo (PA317, neuroblastoma (SH-SY5Y, osteosarcoma U2OS, and embryonic kidney cells (293T, were screened. Out of the 12, 8 cell lines, NIH3T3, C2C12, 293T, SH-SY5Y, A549, HeLa, PA317, and U2OS formed regular spheroids and the effects of DXR on these structures were measured at regular intervals. Finally, 5 cell lines, A549, HeLa, SH-SY5Y, U2OS, and 293T, were selected for real-time monitoring and the effects of DXR treatment on their behavior were continuously recorded for 5 days. A potential correlation regarding the effects of DXR on spheroid viability and ATP production was measured on days 1, 3, and 5. Cytotoxicity of DXR seemed to occur after endocytosis, since the cellular activities and ATP productions were still viable after 1 day of the treatment in all spheroids, except SH-SY5Y. Both cellular activity and ATP production were
Laserna Mendieta, Emilio J.; Masiá, Susana; Barettino, Domingo
2007-01-01
Retinoic acid (RA), the active form of vitamin A, induces neuroblastoma cells SH-SY5Y to differentiate. In addition to its classical transcriptional actions regulating the expression of specific genes, RA acts in an extra-genomic way, modulating the activity of relevant signalling cascades. In particular, RA treatment of SH-SY5Y neuroblastoma cells results in activation of phosphatidyl-inositol-3-kinase (PI3K) signaling pathway, and this activation is required for RA-induced differentiation (...
Branca, Jacopo J V; Morucci, Gabriele; Malentacchi, Francesca; Gelmini, Stefania; Ruggiero, Marco; Pacini, Stefania
2015-09-01
The biological properties and characteristics of microglia in rodents have been widely described, but little is known about these features in human microglia. Several murine microglial cell lines are used to investigate neurodegenerative and neuroinflammatory conditions; however, the extrapolation of the results to human conditions is frequently met with criticism because of the possibility of species-specific differences. This study compares the effects of oxaliplatin and of oleic acid Gc-protein-derived macrophage-activating factor (OA-GcMAF) on two microglial cell lines, murine BV-2 cells and human C13NJ cells. Cell viability, cAMP levels, microglial activation, and vascular endothelial growth factor (VEGF) expression were evaluated. Our data demonstrate that oxaliplatin induced a significant decrease in cell viability in BV-2 and in C13NJ cells and that this effect was not reversed with OA-GcMAF treatment. The signal transduction pathway involving cAMP/VEGF was activated after treatment with oxaliplatin and/or OA-GcMAF in both cell lines. OA-GcMAF induced a significant increase in microglia activation, as evidenced by the expression of the B7-2 protein, in BV-2 as well as in C13NJ cells that was not associated with a concomitant increase in cell number. Furthermore, the effects of oxaliplatin and OA-GcMAF on coculture morphology and apoptosis were evaluated. Oxaliplatin-induced cell damage and apoptosis were nearly completely reversed by OA-GcMAF treatment in both BV-2/SH-SY5Y and C13NJ/SH-SY5Y cocultures. Our data show that murine and human microglia share common signal transduction pathways and activation mechanisms, suggesting that the murine BV-2 cell line may represent an excellent model for studying human microglia. © 2015 Wiley Periodicals, Inc.
International Nuclear Information System (INIS)
Plant, Kathryn E.; Anderson, Elizabeth; Simecek, Nicole; Brown, Richard; Forster, Sam; Spinks, Jenny; Toms, Nick; Gibson, G. Gordon; Lyon, Jon; Plant, Nick
2009-01-01
The mood stabilizing agents lithium chloride (LiCl) and sodium valproate (VPA) have recently gained interest as potential neuroprotective therapeutics. However, exploitation of these therapeutic applications is hindered by both a lack of molecular understanding of the mode of action, and a number of sub-optimal properties, including a relatively small therapeutic window and variable patient response. Human neuroblastoma cells (SH-SY5Y) were exposed to 1 mM lithium chloride or 1 mM sodium valproate for 6 h or 72 h, and transcriptomes measured by Affymetrix U133A/B microarray. Statistically significant gene expression changes were identified using SAM software, with selected changes confirmed at transcript (TaqMan) and protein (Western blotting) levels. Finally, anti-apoptotic action was measured by an in vitro fluorescent assay. Exposure of SH-SY5Y cells to therapeutically relevant concentrations of either lithium chloride or sodium valproate elicited 936 statistically significant changes in gene expression. Amongst these changes we observed a large (maximal 31.3-fold) increase in the expression of the homeodomain protein Six1, and have characterized the time- and dose-dependent up-regulation of this gene in response to both drugs. In addition, we demonstrate that, like LiCl or VPA treatment, Six1 over-expression protects SH-SY5Y cells from staurosporine-induced apoptosis via the blockade of caspsase-3 activation, whereas removal of Six1 protein via siRNA antagonises the ability of LiCl and VPA to protect SH-SY5Y cells from STS-induced apoptosis. These results provide a novel mechanistic rationale underlying the neuroprotective mechanism of LiCl and VPA, suggesting exciting possibilities for the development of novel therapeutic agents against neurodegenerative diseases such as Alzheimer's or Parkinsonism
Directory of Open Access Journals (Sweden)
Tae Hyuk Kang
2011-01-01
Full Text Available We have used microarray-based methods of global gene expression together with quantitative PCR and Western blot analysis to identify dysregulation of genes and aberrant cellular processes in human fibroblasts and in SH-SY5Y neuroblastoma cells made HPRT-deficient by transduction with a retrovirus stably expressing an shRNA targeted against HPRT. Analysis of the microarray expression data by Gene ontology (GO and Gene Set Enrichment Analysis (GSEA as well as significant pathway analysis by GeneSpring GX10 and Panther Classification System reveal that HPRT deficiency is accompanied by aberrations in a variety of pathways known to regulate neurogenesis or to be implicated in neurodegenerative disease, including the canonical Wnt/β-catenin and the Alzheimer's disease/presenilin signaling pathways. Dysregulation of the Wnt/β-catenin pathway is confirmed by Western blot demonstration of cytosolic sequestration of β-catenin during in vitro differentiation of the SH-SY5Y cells toward the neuronal phenotype. We also demonstrate that two key transcription factor genes known to be regulated by Wnt signaling and to be vital for the generation and function of dopaminergic neurons; i.e., Lmx1a and Engrailed 1, are down-regulated in the HPRT knockdown SH-SY5Y cells. In addition to the Wnt signaling aberration, we found that expression of presenilin-1 shows severely aberrant expression in HPRT-deficient SH-SY5Y cells, reflected by marked deficiency of the 23 kDa C-terminal fragment of presenilin-1 in knockdown cells. Western blot analysis of primary fibroblast cultures from two LND patients also shows dysregulated presenilin-1 expression, including aberrant proteolytic processing of presenilin-1. These demonstrations of dysregulated Wnt signaling and presenilin-1 expression together with impaired expression of dopaminergic transcription factors reveal broad pleitropic neuro-regulatory defects played by HPRT expression and suggest new directions for
Niso-Santano, Mireia; González-Polo, Rosa A; Bravo-San Pedro, José M; Gómez-Sánchez, Rubén; Lastres-Becker, Isabel; Ortiz-Ortiz, Miguel A; Soler, Germán; Morán, José M; Cuadrado, Antonio; Fuentes, José M
2010-05-15
Although oxidative stress is fundamental to the etiopathology of Parkinson disease, the signaling molecules involved in transduction after oxidant exposure to cell death are ill-defined, thus making it difficult to identify molecular targets of therapeutic relevance. We have addressed this question in human dopaminergic neuroblastoma SH-SY5Y cells exposed to the parkinsonian toxin paraquat (PQ). This toxin elicited a dose-dependent increase in reactive oxygen species and cell death that correlated with activation of ASK1 and the stress kinases p38 and JNK. The relevance of these kinases in channeling PQ neurotoxicity was demonstrated with the use of interference RNA for ASK1 and two well-established pharmaceutical inhibitors for JNK and p38. The toxic effect of PQ was substantially attenuated by preincubation with vitamin E, blocking ASK1 pathways and preventing oxidative stress and cell death. In a search for a physiological pathway that might counterbalance PQ-induced ASK1 activation, we analyzed the role of the transcription factor Nrf2, master regulator of redox homeostasis, and its target thioredoxin (Trx), which binds and inhibits ASK1. Trx levels were undetectable in Nrf2-deficient mouse embryo fibroblasts (MEFs), whereas they were constitutively high in Keap1-deficient MEFs as well as in SH-SY5Y cells treated with sulforaphane (SFN). Consistent with these data, Nrf2-deficient MEFs were more sensitive and Keap1-deficient MEFs and SH-SY5Y cells incubated with SFN were more resistant to PQ-induced cell death. This study identifies ASK1/JNK and ASK1/p38 as two critical pathways involved in the activation of cell death under oxidative stress conditions and identifies the Nrf2/Trx axis as a new target to block these pathways and protect from oxidant exposure such as that found in Parkinson and other neurodegenerative diseases. Copyright 2010 Elsevier Inc. All rights reserved.
Dengue virus infection down-regulates differentiation markers in neuroblastoma cells
Rincón Forero, Verónica; Alvear Gómez, Diana; Solano Orjuela, Oscar; Prada-Arismendy, Jeanette; Castellanos Parra, Jaime Eduardo
2011-01-01
Introducción: cerca del 5% de los pacientes con dengue hemorrágico pueden presentar manifestaciones neurológicas; sin embargo, existe poca información sobre la infección directa por el virus dengue (DENV) en neuronas. Objetivo: determinar el papel del fenotipo neuronal en la infección por DENV en células de neuroblastoma SH-SY5Y inducidas o no a la diferenciación con ácido retinoico (AR). Materiales y métodos: células SH-SY5Y fueron inducidas con AR a diferenciarse e infectadas con DENV. Post...
Real-time monitoring of cisplatin cytotoxicity on three-dimensional spheroid tumor cells
Directory of Open Access Journals (Sweden)
Baek NH
2016-07-01
Full Text Available NamHuk Baek,1,* Ok Won Seo,1,* Jaehwa Lee,1 John Hulme,2 Seong Soo A An2 1Department of Research and Development, NanoEntek Inc., Seoul, 2Department of BioNano Technology, Gachon University, Gyeonggi-do, Korea *These authors contributed equally to this work Abstract: Three-dimensional (3D cell cultivation is a powerful technique for monitoring and understanding diverse cellular mechanisms in developmental cancer and neuronal biology, tissue engineering, and drug development. 3D systems could relate better to in vivo models than two-dimensional (2D cultures. Several factors, such as cell type, survival rate, proliferation rate, and gene and protein expression patterns, determine whether a particular cell line can be adapted to a 3D system. The 3D system may overcome some of the limitations of 2D cultures in terms of cell–cell communication and cell networks, which are essential for understanding differentiation, structural organization, shape, and extended connections with other cells or organs. Here, the effect of the anticancer drug cisplatin, also known as cis-diamminedichloroplatinum (II or CDDP, on adenosine triphosphate (ATP generation was investigated using 3D spheroid-forming cells and real-time monitoring for 7 days. First, 12 cell lines were screened for their ability to form 3D spheroids: prostate (DU145, testis (F9, embryonic fibroblast (NIH-3T3, muscle (C2C12, embryonic kidney (293T, neuroblastoma (SH-SY5Y, adenocarcinomic alveolar basal epithelial cell (A549, cervical cancer (HeLa, HeLa contaminant (HEp2, pituitary epithelial-like cell (GH3, embryonic cell (PA317, and osteosarcoma (U-2OS cells. Of these, eight cell lines were selected: NIH-3T3, C2C12, 293T, SH-SY5Y, A549, HeLa, PA317, and U-2OS; and five underwent real-time monitoring of CDDP cytotoxicity: HeLa, A549, 293T, SH-SY5Y, and U-2OS. ATP generation was blocked 1 day after addition of 50 µM CDDP, but cytotoxicity in HeLa, A549, SH-SY5Y, and U-2OS cells could be
Park, Sun Young; Son, Beung Gu; Park, Young Hoon; Kim, Cheol-Min; Park, Geuntae; Choi, Young-Whan
2014-09-01
As a part of ongoing studies to elucidate pharmacologically active components of Schisandra chinensis, we isolated and studied α-iso-cubebene. The neuroprotective mechanisms of α-iso-cubebene in human neuroblastoma SH-SY5Y cells were investigated. α-Iso-cubebene significantly inhibited cytotoxicity and apoptosis due to 6-hydroxydopamine (6-OHDA)-induced neurotoxicity in dopaminergic SH-SY5Y cells. Pretreatment of cells with α-iso-cubebene reduced intracellular accumulation of ROS and calcium in response to 6-OHDA. The neuroprotective effects of α-iso-cubebene were found to result from protecting the mitochondrial membrane potential. Notably, α-iso-cubebene inhibited the release of apoptosis-inducing factor from the mitochondria into the cytosol and nucleus after 6-OHDA treatment. α-Iso-cubebene also induced the activation of PKA/PKB/CREB/Nrf2 and suppressed 6-OHDA-induced neurotoxicity. α-Iso-cubebene was found to induce phosphorylation of PKA and PKB and activate Nrf2 and CREB signaling pathways in a dose-dependent manner. Additionally, α-iso-cubebene stimulated the expression of the antioxidant response genes NQO1 and HO-1. Finally, α-iso-cubebene-mediated neuroprotective effects were found to be reversible after transfection with CREB and Nrf2 small interfering RNAs.
Alfredsson, Christina Fjæraa; Rendel, Filip; Liang, Qui-Li; Sundström, Birgitta E; Nånberg, Eewa
2015-12-01
Ellagic acid has previously been reported to induce reduced proliferation and activation of apoptosis in several tumor cell lines including our own previous data from non-differentiated human neuroblastoma SH-SY5Y cells. The aim of this study was now to investigate if in vitro differentiation with the phorbol ester 12-O- tetradecanoylphorbol-13-acetate or the vitamin A derivative all-trans retinoic acid altered the sensitivity to ellagic acid in SH-SY5Y cells. The methods used were cell counting and LDH-assay for evaluation of cell number and cell death, flow cytometric analysis of SubG1- and TUNEL-analysis for apoptosis and western blot for expression of apoptosis-associated proteins. In vitro differentiation was shown to reduce the sensitivity to ellagic acid with respect to cell detachment, loss of viability and activation of apoptosis. The protective effect was phenotype-specific and most prominent in all-trans retinoic acid-differentiated cultures. Differentiation-dependent up-regulation of Bcl-2 and integrin expression is introduced as possible protective mechanisms. The presented data also point to a positive correlation between proliferative activity and sensitivity to ellagic-acid-induced cell detachment. In conclusion, the presented data emphasize the need to consider degree of neuronal differentiation and phenotype of neuroblastoma cells when discussing a potential pharmaceutical application of ellagic acid in tumor treatment. Copyright © 2015 Elsevier Masson SAS. All rights reserved.
Neurotropic and neuroprotective activities of the earthworm peptide Lumbricusin
International Nuclear Information System (INIS)
Kim, Dae Hong; Lee, Ik Hwan; Nam, Seung Taek; Hong, Ji; Zhang, Peng; Hwang, Jae Sam; Seok, Heon; Choi, Hyemin; Lee, Dong Gun; Kim, Jae Il; Kim, Ho
2014-01-01
Highlights: • 11-mer peptide Lumbricusin, a defensin like peptide, is isolated from earthworm. • We here demonstrated that Lumbricusin has neurotropic and neuroprotective effects. • p27 degradation by Lumbricusin mediates effects of Lumbricusin on neuronal cells. - Abstract: We recently isolated a polypeptide from the earthworm Lumbricus terrestris that is structurally similar to defensin, a well-known antibacterial peptide. An 11-mer antibacterial peptide (NH 2 -RNRRWCIDQQA), designated Lumbricusin, was synthesized based on the amino acid sequence of the isolated polypeptide. Since we previously reported that CopA3, a dung beetle peptide, enhanced neuronal cell proliferation, we here examined whether Lumbricusin exerted neurotropic and/or neuroprotective effects. Lumbricusin treatment induced a time-dependent increase (∼51%) in the proliferation of human neuroblastoma SH-SY5Y cells. Lumbricusin also significantly inhibited the apoptosis and decreased viability induced by treatment with 6-hydroxy dopamine, a Parkinson’s disease-mimicking agent. Immunoblot analyses revealed that Lumbricusin treatment increased ubiquitination of p27 Kip1 protein, a negative regulator of cell-cycle progression, in SH-SY5Y cells, and markedly promoted its degradation. Notably, adenoviral-mediated over-expression of p27 Kip1 significantly blocked the antiapoptotic effect of Lumbricusin in 6-hydroxy dopamine-treated SH-SY5Y cells. These results suggest that promotion of p27 Kip1 degradation may be the main mechanism underlying the neuroprotective and neurotropic effects of Lumbricusin
Neurotropic and neuroprotective activities of the earthworm peptide Lumbricusin
Energy Technology Data Exchange (ETDEWEB)
Kim, Dae Hong; Lee, Ik Hwan; Nam, Seung Taek; Hong, Ji; Zhang, Peng [Department of Life Science, College of Natural Science, Daejin University, Pocheon, Gyeonggido 487-711 (Korea, Republic of); Hwang, Jae Sam [Department of Agricultural Biology, National Academy of Agricultural Science, RDA, Suwon 441-707 (Korea, Republic of); Seok, Heon [Department of Biomedical Engineering, Jungwon University, Goesan, Chungcheongbukdo 367-700 (Korea, Republic of); Choi, Hyemin; Lee, Dong Gun [School of Life Sciences, KNU Creative Bioresearch Group (BK21 Plus Program), College of Natural Sciences, Kyungpook National University, Daehak-ro 80, Buk-gu, Daegu 702-701 (Korea, Republic of); Kim, Jae Il [School of Life Sciences, Gwangju Institute of Science and Technology, Oryong-dong, Buk-gu, Gwangju 500-712 (Korea, Republic of); Kim, Ho, E-mail: hokim@daejin.ac.kr [Department of Life Science, College of Natural Science, Daejin University, Pocheon, Gyeonggido 487-711 (Korea, Republic of)
2014-06-06
Highlights: • 11-mer peptide Lumbricusin, a defensin like peptide, is isolated from earthworm. • We here demonstrated that Lumbricusin has neurotropic and neuroprotective effects. • p27 degradation by Lumbricusin mediates effects of Lumbricusin on neuronal cells. - Abstract: We recently isolated a polypeptide from the earthworm Lumbricus terrestris that is structurally similar to defensin, a well-known antibacterial peptide. An 11-mer antibacterial peptide (NH{sub 2}-RNRRWCIDQQA), designated Lumbricusin, was synthesized based on the amino acid sequence of the isolated polypeptide. Since we previously reported that CopA3, a dung beetle peptide, enhanced neuronal cell proliferation, we here examined whether Lumbricusin exerted neurotropic and/or neuroprotective effects. Lumbricusin treatment induced a time-dependent increase (∼51%) in the proliferation of human neuroblastoma SH-SY5Y cells. Lumbricusin also significantly inhibited the apoptosis and decreased viability induced by treatment with 6-hydroxy dopamine, a Parkinson’s disease-mimicking agent. Immunoblot analyses revealed that Lumbricusin treatment increased ubiquitination of p27{sup Kip1} protein, a negative regulator of cell-cycle progression, in SH-SY5Y cells, and markedly promoted its degradation. Notably, adenoviral-mediated over-expression of p27{sup Kip1} significantly blocked the antiapoptotic effect of Lumbricusin in 6-hydroxy dopamine-treated SH-SY5Y cells. These results suggest that promotion of p27{sup Kip1} degradation may be the main mechanism underlying the neuroprotective and neurotropic effects of Lumbricusin.
Piotrowski, Marek; Jantas, Danuta; Szczepanowicz, Krzysztof; Łukasiewicz, Sylwia; Lasoń, Władysław; Warszyński, Piotr
2015-11-01
The main objectives of the present study were to investigate the biocompatibility of polyelectrolyte-coated nanocapsules and to evaluate the neuroprotective action of the nanoencapsulated water-insoluble neuroprotective drug-undecylenic acid (UDA), in vitro. Core-shell nanocapsules were synthesized using nanoemulsification and the layer-by-layer (LbL) technique (by saturation method). The average size of synthesized nanocapsules was around 80 nm and the concentration was 2.5 × 10(10) particles/ml. Their zeta potential values ranged from less than -30 mV for the ones with external polyanion layers through -4 mV for the PEG-ylated layers to more than 30 mV for the polycation layers. Biocompatibility of synthesized nanocarriers was evaluated in the SH-SY5Y human neuroblastoma cell line using cell viability/toxicity assays (MTT reduction, LDH release). The results obtained showed that synthesized nanocapsules coated with PLL and PGA (also PEG-ylated) were non-toxic to SH-SY5Y cells, therefore, they were used as nanocarriers for UDA. Moreover, studies with ROD/FITC-labeled polyelectrolytes demonstrated approximately 20% cellular uptake of synthetized nanocapsules. Further studies showed that nanoencapsulated form of UDA was biocompatible and protected SH-SY5Y cells against the staurosporine-induced damage in lower concentrations than those of the same drug added directly to the culture medium. These data suggest that designed nanocapsules might serve as novel, promising delivery systems for neuroprotective agents. Copyright © 2015 Elsevier B.V. All rights reserved.
Alternative polyadenylation and miR-34 family members regulate tau expression
DEFF Research Database (Denmark)
Dickson, John R; Kruse, Carla; Montagna, Daniel R
2013-01-01
. Tau expresses two 3'-UTR isoforms, long and short, as a result of alternative polyadenylation. Using luciferase reporter constructs, we found that expression from these isoforms is differentially controlled in human neuroblastoma cell lines M17D and SH-SY5Y. Several microRNAs were computationally...
Singh, Preeti; Hanson, Peter S; Morris, Christopher M
2017-06-02
Sirtuins (SIRTs) are NAD + dependent lysine deacetylases which are conserved from bacteria to humans and have been associated with longevity and lifespan extension. SIRT1, the best studied mammalian SIRT is involved in many physiological and pathological processes and changes in SIRT1 have been implicated in neurodegenerative disorders, with SIRT1 having a suggested protective role in Parkinson's disease. In this study, we determined the effect of SIRT1 on cell survival and α-synuclein aggregate formation in SH-SY5Y cells following oxidative stress. Over-expression of SIRT1 protected SH-SY5Y cells from toxin induced cell death and the protection conferred by SIRT1 was partially independent of its deacetylase activity, which was associated with the repression of NF-кB and cPARP expression. SIRT1 reduced the formation of α-synuclein aggregates but showed minimal co-localisation with α-synuclein. In post-mortem brain tissue obtained from patients with Parkinson's disease, Parkinson's disease with dementia, dementia with Lewy bodies and Alzheimer's disease, the activity of SIRT1 was observed to be down-regulated. These findings suggests a negative effect of oxidative stress in neurodegenerative disorders and possibly explain the reduced activity of SIRT1 in neurodegenerative disorders. Our study shows that SIRT1 is a pro-survival protein that is downregulated under cellular stress.
Directory of Open Access Journals (Sweden)
Libo Zhang
2017-08-01
Full Text Available BACKGROUND: Anaplastic lymphoma kinase (ALK inhibitor crizotinib has proven to be effective in the treatment of ALK-mutated neuroblastoma, but crizotinib resistance was commonly observed in patients. We aimed to overcome crizotinib resistance by combining with the MEK inhibitor trametinib or low-dose metronomic (LDM topotecan in preclinical neuroblastoma models. METHODS: We selected a panel of neuroblastoma cell lines carrying various ALK genetic aberrations to assess the therapeutic efficacy on cell proliferation in vitro. Downstream signals of ALK activation, including phosphorylation of ERK1/2, Akt as well as HIF-1α expression were evaluated under normoxic and hypoxic conditions. Tumor growth inhibition was further assessed in NOD/SCID xenograft mouse models. RESULTS: All NBL cell lines responded to crizotinib treatment but at variable ED50 levels, ranging from 0.25 to 5.58 μM. ALK-mutated cell lines SH-SY5Y, KELLY, LAN-5, and CHLA-20 are more sensitive than ALK wild-type cell lines. In addition, we demonstrated that under hypoxic conditions, all NBL cell lines showed marked decrease of ED50s when compared to normoxia except for KELLY cells. Taking into consideration the hypoxia sensitivity to crizotinib, combined treatment with crizotinib and LDM topotecan demonstrated a synergistic effect in ALKF1174L-mutated SH-SY5Y cells. In vivo, single-agent crizotinib showed limited antitumor activity in ALKF1174L-mutated SH-SY5Y and KELLY xenograft models; however, when combined with topotecan, significantly delayed tumor development was achieved in both SH-SY5Y and KELLY tumor models. CONCLUSIONS: Oral metronomic topotecan reversed crizotinib drug resistance in the ALKF1174L-mutated neuroblastoma preclinical model.
Functional coupling between heterologously expressed dopamine D(2) receptors and KCNQ channels
DEFF Research Database (Denmark)
Ljungstrom, Trine; Grunnet, Morten; Jensen, Bo Skaaning
2003-01-01
protein of the G(alphai/o) subtype. Cells of the human neuroblastoma line SH-SY5Y were co-transfected transiently with KCNQ4 and D(2L) receptors. Stimulation of D(2L) receptors increased the KCNQ4 current ( n=6) as determined in whole-cell patch-clamp recordings. The specificity of the dopaminergic...
Protolichesterinic acid enhances doxorubicin-induced apoptosis in HeLa cells in vitro.
Brisdelli, Fabrizia; Perilli, Mariagrazia; Sellitri, Doriana; Bellio, Pierangelo; Bozzi, Argante; Amicosante, Gianfranco; Nicoletti, Marcello; Piovano, Marisa; Celenza, Giuseppe
2016-08-01
The aim of this study was to investigate the effect of protolichesterinic acid, a lichen secondary metabolite, on anti-proliferative activity of doxorubicin in three human cancer cell lines, HeLa, SH-SY5Y and K562 cells. The data obtained from MTT assays, performed on cells treated with protolichesterinic acid and doxorubicin alone and in combination, were analysed by the median-effect method as proposed by Chou and Talalay and the Bliss independence model. Apoptosis rate was evaluated by fluorescence microscopy, caspase-3, 8 and 9 activities were detected by spectrofluorimetric analysis and protein expression of Bim, Bid, Bax and Mcl-2 was analysed by Western blotting. The interaction of protolichesterinic acid with thioesterase domain of human fatty acid synthase (hFAS) was investigated by a molecular docking study. The in vitro activity of doxorubicin against HeLa cancer cell line, but not against SH-SY5Y and K562 cells, was synergically increased by protolichesterinic acid. The increased cytotoxicity caused by protolichesterinic acid in HeLa cells was due to a pro-apoptotic effect and was associated to caspase-3, 8 and 9 activation. The simultaneous treatment for 24h with protolichesterinic acid plus doxorubicin caused an increase of Bim protein expression and the appearance of cleaved form of Bid protein. The molecular modelling analysis showed that protolichesterinic acid seemed to behave as a competitive inhibitor of hFAS. These results suggest that protolichesterinic acid could be envisaged as an useful tool against certain types of tumor cells in combination with anticancer drugs. Copyright © 2016 Elsevier Inc. All rights reserved.
International Nuclear Information System (INIS)
Qian Yongchang; Venkatraj, Jijayanagaram; Barhoumi, Rola; Pal, Ranadip; Datta, Aniruddha; Wild, James R.; Tiffany-Castiglioni, Evelyn
2007-01-01
The objective of this study was to evaluate the comparative non-cholinergic neurotoxic effects of paraoxon, which is acutely neurotoxic, and diisopropyl fluorophosphate (DFP), which induces OPIDN, in the human neuroblastoma SY5Y and the human astrocytoma cell line CCF-STTG1. SY5Y cells have been studied extensively as a model for OP-induced neurotoxicity, but CCF cells have not previously been studied. We conducted a preliminary human gene array assay of OP-treated SY5Y cells in order to assess at the gene level whether these cells can distinguish between OP compounds that do and do not cause OPIDN. Paraoxon and DFP induced dramatically different profiles of gene expression. Two genes were upregulated and 13 downregulated by at least 2-fold in paraoxon-treated cells. In contrast, one gene was upregulated by DFP and none was downregulated at the 2-fold threshold. This finding is consistent with current and previous observations that SY5Y cells can distinguish between OPs that do or do not induce OPIDN. We also examined gene array results for possible novel target proteins or metabolic pathways for OP neurotoxicity. Protein levels of glucose regulated protein 78 (GRP78) revealed that paraoxon exposure at 3 μM for 24 h significantly reduced GRP78 levels by 30% in neuroblastoma cells, whereas DFP treatment had no effect. In comparison with SY5Y neuroblastoma cells, paraoxon and DFP (3 μM for 24 h) each significantly increased GRP78 levels by 23-24% in CCF astrocytoma cells. As we have previously evaluated intracellular changes in Ca 2+ levels in SY5Y cells, we investigated the effects of paraoxon and DFP on cellular Ca 2+ homeostasis in CCF by studying cytosolic and mitochondrial basal calcium levels. A significant decrease in the ratio of mitochondrial to cytosolic Ca 2+ fluorescence was detected in CCF cultures treated for either 1 or 3 days with 1, 3, 10, or 30 μM paraoxon. In contrast, treatment with DFP for 1 day had no significant effect on the ratio of
International Nuclear Information System (INIS)
Yan, Xu; Jia, Mei; Li, Jiaxin; Yuan, Fang; Qiao, Yajun; Ouyang, Jiting
2017-01-01
Atmospheric pressure plasma jet (APPJ) can produce biological active species for biomedical applications. This work proves direct evidence of the protective effects of APPJ against oxidative stress. SH-SY5Y cells, a commonly used cell model for the study of neurotoxicity and neuroprotection, were treated with APPJ for different durations. Then, cells were exposed to 200 µ M H 2 O 2 for 24 h and cell viability was measured using a CCK-8 kit. Changes in cell apoptosis were further confirmed by calcein-AM fluorescence imaging and flow cytometry. Extracellular NO production was detected using the Griess method. The results showed that APPJ protected SH-SY5Y from H 2 O 2 -induced apoptosis in a time-dependent manner. Moreover, extracellular NO production was significantly increased with the APPJ treatment. The results show in vitro that APPJ treatment could protect SH-SY5Y cells from oxidative stress by reducing cell apoptosis, which might be related to the reactive nitrogen species induced by the APPJ treatment. Our results indicate that the APPJ may have therapeutic potential as a novel ‘NO donor drug’ in neuroprotection and in the treatment of neurodegenerative diseases. (paper)
Phukan, Geetika; Shin, Tae Hwan; Shim, Jeom Soon; Paik, Man Jeong; Lee, Jin-Kyu; Choi, Sangdun; Kim, Yong Man; Kang, Seong Ho; Kim, Hyung Sik; Kang, Yup; Lee, Soo Hwan; Mouradian, M. Maral; Lee, Gwang
2016-01-01
The potential toxicity of nanoparticles, particularly to neurons, is a major concern. In this study, we assessed the cytotoxicity of silica-coated magnetic nanoparticles containing rhodamine B isothiocyanate dye (MNPs@SiO2(RITC)) in HEK293 cells, SH-SY5Y cells, and rat primary cortical and dopaminergic neurons. In cells treated with 1.0 μg/μl MNPs@SiO2(RITC), the expression of several genes related to the proteasome pathway was altered, and proteasome activity was significantly reduced, compared with control and with 0.1 μg/μl MNPs@SiO2(RITC)-treated cells. Due to the reduction of proteasome activity, formation of cytoplasmic inclusions increased significantly in HEK293 cells over-expressing the α–synuclein interacting protein synphilin-1 as well as in primary cortical and dopaminergic neurons. Primary neurons, particularly dopaminergic neurons, were more vulnerable to MNPs@SiO2(RITC) than SH-SY5Y cells. Cellular polyamines, which are associated with protein aggregation, were significantly altered in SH-SY5Y cells treated with MNPs@SiO2(RITC). These findings highlight the mechanisms of neurotoxicity incurred by nanoparticles. PMID:27378605
Chlapek, Petr; Redova, Martina; Zitterbart, Karel; Hermanova, Marketa; Sterba, Jaroslav; Veselska, Renata
2010-05-11
We performed expression profiling of two neuroblastoma cell lines, SK-N-BE(2) and SH-SY5Y, after combined treatment with all-trans retinoic acid (ATRA) and inhibitors of lipoxygenases (LOX) and cyclooxygenases (COX). This study is a continuation of our previous work confirming the possibility of enhancing ATRA-induced cell differentiation in these cell lines by the application of LOX/COX inhibitors and brings more detailed information concerning the mechanisms of the enhancement of ATRA-induced differentiation of neuroblastoma cells. Caffeic acid, as an inhibitor of 5-lipoxygenase, and celecoxib, as an inhibitor on cyclooxygenase-2, were used in this study. Expression profiling was performed using Human Cancer Oligo GEArray membranes that cover 440 cancer-related genes. Cluster analyses of the changes in gene expression showed the concentration-dependent increase in genes known to be involved in the process of retinoid-induced neuronal differentiation, especially in cytoskeleton remodeling. These changes were detected in both cell lines, and they were independent of the type of specific inhibitors, suggesting a common mechanism of ATRA-induced differentiation enhancement. Furthermore, we also found overexpression of some genes in the same cell line (SK-N-BE(2) or SH-SY5Y) after combined treatment with both ATRA and CA, or ATRA and CX. Finally, we also detected that gene expression was changed after treatment with the same inhibitor (CA or CX) in combination with ATRA in both cell lines. Obtained results confirmed our initial hypothesis of the common mechanism of enhancement in ATRA-induced cell differentiation via inhibition of arachidonic acid metabolic pathway.
Guida, Natascia; Laudati, Giusy; Anzilotti, Serenella; Secondo, Agnese; Montuori, Paolo; Di Renzo, Gianfranco; Canzoniero, Lorella M T; Formisano, Luigi
2015-11-01
Resveratrol (3,5,4'-trihydroxystilbene) (RSV), a polyphenol widely present in plants, exerts a neuroprotective function in several neurological conditions; it is an activator of class III histone deacetylase sirtuin1 (SIRT1), a crucial regulator in the pathophysiology of neurodegenerative diseases. By contrast, the RE1-silencing transcription factor (REST) is involved in the neurotoxic effects following exposure to polychlorinated biphenyl (PCB) mixture A1254. The present study investigated the effects of RSV-induced activation of SIRT1 on REST expression in SH-SY5Y cells. Further, we investigated the possible relationship between the non-dioxin-like (NDL) PCB-95 and REST through SIRT1 to regulate neuronal death in rat cortical neurons. Our results revealed that RSV significantly decreased REST gene and protein levels in a dose- and time-dependent manner. Interestingly, overexpression of SIRT1 reduced REST expression, whereas EX-527, an inhibitor of SIRT1, increased REST expression and blocked RSV-induced REST downregulation. These results suggest that RSV downregulates REST through SIRT1. In addition, RSV enhanced activator protein 1 (AP-1) transcription factor c-Jun expression and its binding to the REST promoter gene. Indeed, c-Jun knockdown reverted RSV-induced REST downregulation. Intriguingly, in SH-SY5Y cells and rat cortical neurons the NDL PCB-95 induced necrotic cell death in a concentration-dependent manner by increasing REST mRNA and protein expression. In addition, SIRT1 knockdown blocked RSV-induced neuroprotection in rat cortical neurons treated with PCB-95. Collectively, these results indicate that RSV via SIRT1 activates c-Jun, thereby reducing REST expression in SH-SY5Y cells under physiological conditions and blocks PCB-95-induced neuronal cell death by activating the same SIRT1/c-Jun/REST pathway. Copyright © 2015 Elsevier Inc. All rights reserved.
Human erythrocytes and neuroblastoma cells are affected in vitro by Au(III) ions
International Nuclear Information System (INIS)
Suwalsky, Mario; Gonzalez, Raquel; Villena, Fernando; Aguilar, Luis F.; Sotomayor, Carlos P.; Bolognin, Silvia; Zatta, Paolo
2010-01-01
Gold compounds are well known for their neurological and nephrotoxic implications. However, haematological toxicity is one of the most serious toxic and less studied effects. The lack of information on these aspects of Au(III) prompted us to study the structural effects induced on cell membranes, particularly that of human erythrocytes. AuCl 3 was incubated with intact erythrocytes, isolated unsealed human erythrocyte membranes (IUM) and molecular models of the erythrocyte membrane. The latter consisted of multibilayers of dimyristoylphosphatidylcholine and dimyristoylphosphatidylethanolamine, phospholipids classes located in the outer and inner monolayers of the human erythrocyte membrane, respectively. This report presents evidence that Au(III) interacts with red cell membranes as follows: (a) in scanning electron microscopy studies on human erythrocytes it was observed that Au(III) induced shape changes at a concentration as low as 0.01 μM; (b) in isolated unsealed human erythrocyte membranes Au(III) induced a decrease in the molecular dynamics and/or water content at the glycerol backbone level of the lipid bilayer polar groups in a 5-50 μM concentration range, and (c) X-ray diffraction studies showed that Au(III) in the 10 μm-1 mM range induced increasing structural perturbation only to dimyristoylphosphatidylcholine bilayers. Additional experiments were performed in human neuroblastoma cells SH-SY5Y. A statistically significant decrease of cell viability was observed with Au(III) ranging from 0.1 μM to 100 μM.
More, Swati S.; Itsara, Melissa; Yang, Xiaodong; Geier, Ethan G.; Tadano, Michelle K.; Seo, Youngho; VanBrocklin, Henry F.; Weiss, William A.; Mueller, Sabine; Haas-Kogan, Daphne A.; DuBois, Steven G.; Matthay, Katherine K.; Giacomini, Kathleen M.
2011-01-01
Purpose Histone deacetylase (HDAC) inhibition causes transcriptional activation or repression of several genes that in turn can influence the biodistribution of other chemotherapeutic agents. Here, we hypothesize that the combination of vorinostat, a HDAC inhibitor, with 131I-metaiodobenzylguanidine (MIBG) would lead to preferential accumulation of the latter in neuroblastoma (NB) tumors via increased expression of the human norepinephrine transporter (NET). Experimental Design In vitro and in vivo experiments examined the effect of vorinostat on the expression of NET, an uptake transporter for 131I-MIBG. Human NB cell lines (Kelly and SH-SY-5Y) and NB1691luc mouse xenografts were employed. The upregulated NET protein was characterized for its effect on 123I-MIBG biodistribution. Results Preincubation of NB cell lines, Kelly and SH-SY-5Y, with vorinostat caused dose-dependent increases in NET mRNA and protein levels. Accompanying this was a corresponding dose-dependent increase in MIBG uptake in NB cell lines. Four-fold and 2.5 fold increases were observed in Kelly and SH-SY-5Y cells, respectively, pre-treated with vorinostat in comparison to untreated cells. Similarly, NB xenografts, created by intravenous tail vein injection of NB1691-luc, and harvested from nude mice livers treated with vorinostat (150 mg/kg i.p.) showed substantial increases in NET protein expression. Maximal effect of vorinostat pretreatment in NB xenografts on 123I-MIBG biodistribution was observed in tumors that exhibited enhanced uptake in vorinostat treated (0.062 ± 0.011 μCi/(mg tissue-dose injected)) versus untreated mice (0.022 ± 0.003 μCi/(mg tissue-dose injected); p vorinostat treatment can enhance NB therapy with 131I-MIBG. PMID:21421857
Identification of proteins sensitive to thermal stress in human neuroblastoma and glioma cell lines.
Directory of Open Access Journals (Sweden)
Guilian Xu
Full Text Available Heat-shock is an acute insult to the mammalian proteome. The sudden elevation in temperature has far-reaching effects on protein metabolism, leads to a rapid inhibition of most protein synthesis, and the induction of protein chaperones. Using heat-shock in cells of neuronal (SH-SY5Y and glial (CCF-STTG1 lineage, in conjunction with detergent extraction and sedimentation followed by LC-MS/MS proteomic approaches, we sought to identify human proteins that lose solubility upon heat-shock. The two cell lines showed largely overlapping profiles of proteins detected by LC-MS/MS. We identified 58 proteins in detergent insoluble fractions as losing solubility in after heat shock; 10 were common between the 2 cell lines. A subset of the proteins identified by LC-MS/MS was validated by immunoblotting of similarly prepared fractions. Ultimately, we were able to definitively identify 3 proteins as putatively metastable neural proteins; FEN1, CDK1, and TDP-43. We also determined that after heat-shock these cells accumulate insoluble polyubiquitin chains largely linked via lysine 48 (K-48 residues. Collectively, this study identifies human neural proteins that lose solubility upon heat-shock. These proteins may represent components of the human proteome that are vulnerable to misfolding in settings of proteostasis stress.
Directory of Open Access Journals (Sweden)
Yuanli Dong
2015-01-01
Full Text Available Background: Hypocretin (HCRT signaling plays an important role in the pathogenesis of narcolepsy and can be significantly influenced by Chinese herbal therapy. Our previous study showed that xingshentongqiao decoction (XSTQ is clinically effective for the treatment of narcolepsy. To determine whether XSTQ improves narcolepsy by modulating HCRT signaling, we investigated its effects on SH-SY5Y cell proliferation, apoptosis, and HCRT receptor 1/2 (orexin receptor 1 [OX1R] and orexin receptor 2 [OX2R] expression. The signaling pathways involved in these processes were also assessed. Methods: The effects of XSTQ on proliferation and apoptosis in SH-SY5Y cells were assessed using cell counting kit-8 and annexin V-fluorescein isothiocyanate assays. OX1R and OX2R expression was assessed by quantitative real-time polymerase chain reaction analysis. Western blotting for mitogen-activated protein kinase (MAPK pathway activation was performed to further assess the signaling mechanism of XSTQ. Results: XSTQ reduced the proliferation and induced apoptosis of SH-SY5Y cells. This effect was accompanied by the upregulation of OX1R and OX2R expression and the reduced phosphorylation of extracellular signal-regulated kinase (Erk 1/2, p38 MAPK and c-Jun N-terminal kinase (JNK. Conclusions: XSTQ inhibits proliferation and induces apoptosis in SH-SY5Y cells. XSTQ also promotes OX1R and OX2R expression. These effects are associated with the repression of the Erk1/2, p38 MAPK, and JNK signaling pathways. These results define a molecular mechanism for XSTQ in regulating HCRT and MAPK activation, which may explain its ability to treat narcolepsy.
Directory of Open Access Journals (Sweden)
France Massicot
Full Text Available Limited information is available regarding the cellular mechanisms of oxaliplatin-induced painful neuropathy during exposure of patients to this drug. We therefore determined oxidative stress in cultured cells and evaluated its occurrence in C57BL/6 mice. Using both cultured neuroblastoma (SH-SY5Y and macrophage (RAW 264.7 cell lines and also brain tissues of oxaliplatin-treated mice, we investigated whether oxaliplatin (OXA induces oxidative stress and apoptosis. Cultured cells were treated with 2-200 µM OXA for 24 h. The effects of pharmacological inhibitors of oxidative stress or inflammation (N-acetyl cysteine, ibuprofen, acetaminophen were also tested. Inhibitors were added 30 min before OXA treatment and then in combination with OXA for 24 h. In SH-SY5Y cells, OXA caused a significant dose-dependent decrease in viability, a large increase in ROS and NO production, lipid peroxidation and mitochondrial impairment as assessed by a drop in mitochondrial membrane potential, which are deleterious for the cell. An increase in levels of negatively charged phospholipids such as cardiolipin but also phosphatidylserine and phosphatidylinositol, was also observed. Additionally, OXA caused concentration-dependent P2X7 receptor activation, increased chromatin condensation and caspase-3 activation associated with TNF-α and IL-6 release. The majority of these toxic effects were equally observed in Raw 264.7 which also presented high levels of PGE2. Pretreatment of SH-SY5Y cells with pharmacological inhibitors significantly reduced or blocked all the neurotoxic OXA effects. In OXA-treated mice (28 mg/kg cumulated dose significant cold hyperalgesia and oxidative stress in the tested brain areas were shown. Our study suggests that targeting P2X7 receptor activation and mitochondrial impairment might be a potential therapeutic strategy against OXA-induced neuropathic pain.
de Carvalho, Otavio Valério; Félix, Daniele Mendes; de Mendonça, Leila Rodrigues; de Araújo, Catarina Maria Cataldi Sabino; de Oliveira Franca, Rafael Freitas; Cordeiro, Marli Tenório; Silva Júnior, Abelardo; Pena, Lindomar José
2017-12-01
Since the emergence of Zika virus (ZIKV) in Brazil in 2015, 48 countries and territories in the Americas have confirmed autochthonous cases of disease caused by the virus. ZIKV-associated neurological manifestations and congenital defects make the development of safe and effective antivirals against ZIKV of utmost importance. Here we evaluated the antiviral activity of 6-methylmercaptopurine riboside (6MMPr), a thiopurine nucleoside analogue derived from the prodrug azathioprine, against the epidemic ZIKV strain circulating in Brazil. In all of the assays, an epithelial (Vero) and a human neuronal (SH-SY5Y) cell line were used to evaluate the cytotoxicity and effective concentrations of 6MMPr against ZIKV. Levels of ZIKV-RNA, viral infectious titre and the percentage of infected cells in the presence or absence of 6MMPr were used to determine antiviral efficacy. 6MMPr decreased ZIKV production by >99% in both cell lines in a dose- and time-dependent manner. Interestingly, 6MMPr was 1.6 times less toxic to SH-SY5Y cells compared with Vero cells, presenting a 50% cytotoxic concentrations (CC 50 ) of 460.3 µM and 291 µM, respectively. The selectivity index of 6MMPr for Vero and SH-SY5Y cells was 11.9 and 22.7, respectively, highlighting the safety profile of the drug to neuronal cells. Taken together, these results identify, for the first time, the thiopurine nucleoside analogue 6MMPr as a promising antiviral candidate against ZIKV that warrants further in vivo evaluation. Copyright © 2017 Elsevier B.V. and International Society of Chemotherapy. All rights reserved.
Khalouei, Sam; Chow, Ari M; Brown, Ian R
2014-05-01
The localization of yellow fluorescent protein (YFP)-tagged HSP70 proteins was employed to identify stress-sensitive sites in human neurons following temperature elevation. Stable lines of human SH-SY5Y neuronal cells were established that expressed YFP-tagged protein products of the human inducible HSP70 genes HSPA6 (HSP70B') and HSPA1A (HSP70-1). Following a brief period of thermal stress, YFP-tagged HSPA6 and HSPA1A rapidly appeared at centrioles in the cytoplasm of human neuronal cells, with HSPA6 demonstrating a more prolonged signal compared to HSPA1A. Each centriole is composed of a distal end and a proximal end, the latter linking the centriole doublet. The YFP-tagged HSP70 proteins targeted the proximal end of centrioles (identified by γ-tubulin marker) rather than the distal end (centrin marker). Centrioles play key roles in cellular polarity and migration during neuronal differentiation. The proximal end of the centriole, which is involved in centriole stabilization, may be stress-sensitive in post-mitotic, differentiating human neurons.
Directory of Open Access Journals (Sweden)
Hermanova Marketa
2010-05-01
Full Text Available Abstract Background We performed expression profiling of two neuroblastoma cell lines, SK-N-BE(2 and SH-SY5Y, after combined treatment with all-trans retinoic acid (ATRA and inhibitors of lipoxygenases (LOX and cyclooxygenases (COX. This study is a continuation of our previous work confirming the possibility of enhancing ATRA-induced cell differentiation in these cell lines by the application of LOX/COX inhibitors and brings more detailed information concerning the mechanisms of the enhancement of ATRA-induced differentiation of neuroblastoma cells. Methods Caffeic acid, as an inhibitor of 5-lipoxygenase, and celecoxib, as an inhibitor on cyclooxygenase-2, were used in this study. Expression profiling was performed using Human Cancer Oligo GEArray membranes that cover 440 cancer-related genes. Results Cluster analyses of the changes in gene expression showed the concentration-dependent increase in genes known to be involved in the process of retinoid-induced neuronal differentiation, especially in cytoskeleton remodeling. These changes were detected in both cell lines, and they were independent of the type of specific inhibitors, suggesting a common mechanism of ATRA-induced differentiation enhancement. Furthermore, we also found overexpression of some genes in the same cell line (SK-N-BE(2 or SH-SY5Y after combined treatment with both ATRA and CA, or ATRA and CX. Finally, we also detected that gene expression was changed after treatment with the same inhibitor (CA or CX in combination with ATRA in both cell lines. Conclusions Obtained results confirmed our initial hypothesis of the common mechanism of enhancement in ATRA-induced cell differentiation via inhibition of arachidonic acid metabolic pathway.
The activation of autophagy protects neurons and astrocytes against bilirubin-induced cytotoxicity.
Qaisiya, Mohammed; Mardešić, Paula; Pastore, Beatrice; Tiribelli, Claudio; Bellarosa, Cristina
2017-11-20
Unconjugated bilirubin (UCB) neurotoxicity involves oxidative stress, calcium signaling and ER-stress. The same insults can also induce autophagy, a process of "self-eating", with both a pro-survival or a pro-apoptotic role. Our aim was to study the outcome of autophagy activation by UCB in the highly sensitive neuronal SH-SY5Y cells and in the resistant astrocytoma U87 cells. Upon treatment with a toxic dose of UCB, the conversion of LC3-I to LC3-II was detected in both cell lines. Inhibition of autophagy by E64d before UCB treatment increased SH-SY5Y cell mortality and made U87 cells sensitive to UCB. In SH-SY5Y autophagy related genes ATG8 (5 folds), ATG18 (5 folds), p62 (3 folds) and FAM 129A (4.5 folds) were induced 8h after UCB treatment while DDIT4 upregulation (13 folds) started at 4h. mTORC1 inactivation by UCB was confirmed by phosphorylation of 4EBP1. UCB induced LC3-II conversion was completely prevented by pretreating cells with the calcium chelator BAPTA and reduced by 65% using the ER-stress inhibitor 4-PBA. Pretreatment with the PKC inhibitor reduced LC3 mRNA by 70% as compared to cells exposed to UCB alone. Finally, autophagy induction by Trifluoroperazine (TFP) increased the cell viability of rat hippocampal primary neurons upon UCB treatment from 60% to 80%. In SH-SY5Y cells, TFP pretreatment blocked the UCB-induced cleaved caspase-3 protein expression, decreased LDH release from 50% to 23%, reduced the UCB-induction of HO1, CHOP and IL-8 mRNAs by 85%, 70% and 97%. Collectively these data indicate that the activation of autophagy protects neuronal cells from UCB cytotoxicity. The mechanisms of autophagy activation by UCB involves mTOR/ER-stress/PKC/calcium signaling. Copyright © 2017 Elsevier B.V. All rights reserved.
Moringa isothiocyanate complexed with α-cyclodextrin: a new perspective in neuroblastoma treatment.
Giacoppo, Sabrina; Iori, Renato; Rollin, Patrick; Bramanti, Placido; Mazzon, Emanuela
2017-07-14
Several lines of evidence suggest the consume of natural products for cancer prevention or treatment. In particular, isothiocyanates (ITCs) exerting anti-cancer properties, have received great interest as potential chemotherapeutic agents. This study was designed to assess the anti-proliferative activities of a new preparation of Moringa oleifera-derived 4-(α-L-rhamnopyranosyloxy)benzyl ITC (moringin) complexed with alpha-cyclodextrin (moringin + α-CD; MAC) on SH-SY5Y human neuroblastoma cells. This new formulation arises in the attempt to overcome the poor solubility and stability of moringin alone in aqueous media. SH-SY5Y cells were cultured and exposed to increasing concentrations of MAC (1.0, 2.5 and 5.0 μg). Cell proliferation was examined by MTT and cell count assays. The cytotoxic activity of the MAC complex was assessed by lactate dehydrogenase (LDH) assay and trypan blue exclusion test. In addition, western blotting analyses for the main apoptosis-related proteins were performed. Treatment of SH-SY5Y cells with the MAC complex reduced cell growth in concentration dependent manner. Specifically, MAC exhibited a potent action in inhibiting the PI3K/Akt/mTOR pathway, whose aberrant activation was found in many types of cancer. MAC was also found to induce the nuclear factor-κB (NF-κB) p65 activation by phosphorylation and its translocation into the nucleus. Moreover, treatment with MAC was able to down-regulate MAPK pathway (results focused on JNK and p38 expression). Finally, MAC was found to trigger apoptotic death pathway (based on expression levels of cleaved-caspase 3, Bax/Bcl-2 balance, p53 and p21). These findings suggest that use of MAC complex may open novel perspectives to improve the poor prognosis of patients with neuroblastoma.
Jadwin, Joshua A
2017-01-01
Over the last two decades there has been a significant effort in the field to characterize the phosphosite binding specificities of SH2 domains with the goal of deciphering the pY signaling code. Although high throughput studies in various formats using most SH2 domains have collectively provided a rich resource of in vitro SH2-pTyr site specificity maps, this data can only be used approximate what is happening in the cell where protein concentrations and localization are not homogenous, as they are for in vitro experiments. Here we describe an in vivo approach, SH2 site protection assay, which can capture the pTyr binding specificity of SH2 domains in the cell. The basis of this approach is SH2-pY site protection, the ability of SH2 domains to prevent the PTP-dependent dephosphorylation of their pY site binding partners. We overexpress a tracer SH2 domain in cells and quantify the change in abundance of tyrosine phosphorylated sites using MS. Since the method is performed in vivo, it has the advantage of identifying SH2-pY interactions as they occur within in the cell.
Xie, Zhi; Ding, Sheng-quan; Shen, Ya-fang
2014-11-14
In this study, we explored the cytoprotective potential of silibinin against oxygen-glucose deprivation (OGD)-induced neuronal cell damages, and studied underling mechanisms. In vitro model of ischemic stroke was created by keeping neuronal cells (SH-SY5Y cells and primary mouse cortical neurons) in an OGD condition followed by re-oxygenation. Pre-treatment of silibinin significantly inhibited OGD/re-oxygenation-induced necrosis and apoptosis of neuronal cells. OGD/re-oxygenation-induced reactive oxygen species (ROS) production and mitochondrial membrane potential (MMP) reduction were also inhibited by silibinin. At the molecular level, silibinin treatment in SH-SY5Y cells and primary cortical neurons led to significant AMP-activated protein kinase (AMPK) signaling activation, detected by phosphorylations of AMPKα1, its upstream kinase liver kinase B1 (LKB1) and the downstream target acetyl-CoA Carboxylase (ACC). Pharmacological inhibition or genetic depletion of AMPK alleviated the neuroprotective ability of silibinin against OGD/re-oxygenation. Further, ROS scavenging ability by silibinin was abolished with AMPK inhibition or silencing. While A-769662, the AMPK activator, mimicked silibinin actions and suppressed ROS production and neuronal cell death following OGD/re-oxygenation. Together, these results show that silibinin-mediated neuroprotection requires activation of AMPK signaling. Copyright © 2014 Elsevier Inc. All rights reserved.
Tropical Journal of Pharmaceutical Research - Vol 10, No 6 (2011)
African Journals Online (AJOL)
Ethyl Alcohol Extract of Hizikia fusiforme Induces Caspase-dependent Apoptosis in Human Leukemia U937 Cells by Generation of Reactive Oxygen Species · EMAIL FREE FULL TEXT EMAIL FREE FULL TEXT · DOWNLOAD FULL TEXT DOWNLOAD FULL TEXT. C-H Kang, S-H Kang, S-H Boo, S-Y Park, D-O Moon, G-Y ...
Zhu, Haili; Ding, Jieqiong; Wu, Ji; Liu, Tingting; Liang, Jing; Tang, Qiong; Jiao, Ming
2017-11-01
Bone cancer pain (BCP) is one of the most common pains in patients with malignant cancers. The mechanism underlying BCP is largely unknown. Our previous studies and the increasing evidence both have shown that acid-sensing ion channels 3 (ASIC3) is an important protein in the pathological pain state in some pain models. We hypothesized that the expression change of ASIC3 might be one of the factors related to BCP. In this study, we established the BCP model through intrathecally injecting rat mammary gland carcinoma cells (MRMT-1) into the left tibia of Sprague-Dawley female rats, and found that the BCP rats showed bone destruction, increased mechanical pain sensitivities and up-regulated ASIC3 protein expression levels in L4-L6 dorsal root ganglion. Then, resveratrol, which was intraperitoneally injected into the BCP rats on post-operative Day 21, dose-dependently increased the paw withdrawal threshold of BCP rats, reversed the pain behavior, and had an antinociceptive effect on BCP rats. In ASIC3-transfected SH-SY5Y cells, the ASIC3 protein expression levels were regulated by resveratrol in a dose- and time-dependent manner. Meanwhile, resveratrol also had an antinociceptive effect in ASIC3-mediated pain rat model. Furthermore, resveratrol also enhanced the phosphorylation of AMPK, SIRT1, and LC3-II levels in ASIC3-transfected SH-SY5Y cells, indicating that resveratrol could activate the AMPK-SIRT1-autophagy signal pathway in ASIC3-transfected SH-SY5Y cells. In BCP rats, SIRT1 and LC3-II were also down-regulated. These findings provide new evidence for the use of resveratrol as a therapeutic treatment during BCP states. © The Author 2017. Published by Oxford University Press on behalf of the Institute of Biochemistry and Cell Biology, Shanghai Institutes for Biological Sciences, Chinese Academy of Sciences. All rights reserved. For permissions, please e-mail: journals.permissions@oup.com.
Directory of Open Access Journals (Sweden)
Justin Y.D. Lu
2017-10-01
Full Text Available Clinical evidence points to neuroprotective effects of smoking in Parkinson’s disease (PD, but the molecular mechanisms remain unclear. We investigated the pharmacological pathways involved in these neuroprotective effects, which could provide novel ideas for developing targeted neuroprotective treatments for PD. We used the ETC complex I inhibitor methylpyridinium ion (MPP+ to induce cell death in SH-SY5Y cells as a cellular model for PD and found that nicotine inhibits cell death. Using choline as a nicotinic acetylcholine receptor (nAChR agonist, we found that nAChR stimulation was sufficient to protect SH-SY5Y cells against cell death from MPP+. Blocking α7 nAChR with methyllycaconitine (MLA prevented the protective effects of nicotine, demonstrating that these receptors are necessary for the neuroprotective effects of nicotine. The neuroprotective effect of nicotine involves other pathways relevant to PD. Cleaved Poly (ADP-ribose polymerase-1 (PARP-1 and cleaved caspase-3 were decreased by nicotine in 6-hydroxydopamine (6-OHDA lesioned mice and in MPP+-treated SH-SY5Y cells. In conclusion, our data indicate that nicotine likely exerts neuroprotective effects in PD through the α7 nAChR and downstream pathways including PARP-1 and caspase-3. This knowledge could be pursued in future research to develop neuroprotective treatments for PD.
Yu, Jie; Zheng, Jiacheng; Lin, Jiajia; Jin, Linlu; Yu, Rui; Mak, Shinghung; Hu, Shengquan; Sun, Hongya; Wu, Xiang; Zhang, Zaijun; Lee, Mingyuen; Tsim, Wahkeung; Su, Wei; Zhou, Wenhua; Cui, Wei; Han, Yifan; Wang, Qinwen
2017-05-01
Oxidative stress-induced neuronal apoptosis plays an important role in many neurodegenerative disorders. In this study, we have shown that indirubin-3-oxime, a derivative of indirubin originally designed for leukemia therapy, could prevent hydrogen peroxide (H 2 O 2 )-induced apoptosis in both SH-SY5Y cells and primary cerebellar granule neurons. H 2 O 2 exposure led to the increased activities of glycogen synthase kinase 3β (GSK3β) and extracellular signal-regulated kinase (ERK) in SH-SY5Y cells. Indirubin-3-oxime treatment significantly reversed the altered activity of both the PI3-K/Akt/GSK3β cascade and the ERK pathway induced by H 2 O 2 . In addition, both GSK3β and mitogen-activated protein kinase inhibitors significantly prevented H 2 O 2 -induced neuronal apoptosis. Moreover, specific inhibitors of the phosphoinositide 3-kinase (PI3-K) abolished the neuroprotective effects of indirubin-3-oxime against H 2 O 2 -induced neuronal apoptosis. These results strongly suggest that indirubin-3-oxime prevents H 2 O 2 -induced apoptosis via concurrent inhibiting GSK3β and the ERK pathway in SH-SY5Y cells, providing support for the use of indirubin-3-oxime to treat neurodegenerative disorders caused or exacerbated by oxidative stress.
International Nuclear Information System (INIS)
Nilsson, S.; Paahlman, S.; Arnberg, H.; Letocha, H.; Westlin, J.E.
1993-01-01
Cells from an established human neuroblastoma cell line, SH-SY5Y, were demonstrated to grow and form solid tumours in nude rats. This cell line, which is an adrenergic subclone of the SK-N-SH cell line, has previously been used in differentiation model studies. The tumours retained the neuronal phenotype of the cultured cells, as evidenced by the expression of neuron-specific enolase (NSE) and chromogranin A + B. The transcription factor Isl-1, a protein expressed in subsets of neurons and endocrine cells as well as in neuroblastoma cells, was also expressed in the transplanted tumours, thus further verifying the retained phenotype of the cells under in vivo conditions. At scintigraphy utilizing 123 I-MIBG the optimal tumour/background ratio was obtained 20 h after injection. The assessment of tissue/serum ratios showed the highest uptake in the spleen (0.067% per gram of inj. activity), neuroblastoma tumours (0.067% per gram of inj. activity) and in the adrenals (0.065% per gram of inj. activity). (orig.)
Energy Technology Data Exchange (ETDEWEB)
Nilsson, S. (Dept. of Oncology, Univ. Hospital, Uppsala (Sweden)); Paahlman, S. (Dept. of Pathology, Univ. Hospital, Uppsala (Sweden)); Arnberg, H. (Dept. of Oncology, Univ. Hospital, Uppsala (Sweden)); Letocha, H. (Dept. of Oncology, Univ. Hospital, Uppsala (Sweden)); Westlin, J.E. (Dept. of Oncology, Univ. Hospital, Uppsala (Sweden))
1993-01-01
Cells from an established human neuroblastoma cell line, SH-SY5Y, were demonstrated to grow and form solid tumours in nude rats. This cell line, which is an adrenergic subclone of the SK-N-SH cell line, has previously been used in differentiation model studies. The tumours retained the neuronal phenotype of the cultured cells, as evidenced by the expression of neuron-specific enolase (NSE) and chromogranin A + B. The transcription factor Isl-1, a protein expressed in subsets of neurons and endocrine cells as well as in neuroblastoma cells, was also expressed in the transplanted tumours, thus further verifying the retained phenotype of the cells under in vivo conditions. At scintigraphy utilizing [sup 123]I-MIBG the optimal tumour/background ratio was obtained 20 h after injection. The assessment of tissue/serum ratios showed the highest uptake in the spleen (0.067% per gram of inj. activity), neuroblastoma tumours (0.067% per gram of inj. activity) and in the adrenals (0.065% per gram of inj. activity). (orig.).
Engskog, Mikael K R; Ersson, Lisa; Haglöf, Jakob; Arvidsson, Torbjörn; Pettersson, Curt; Brittebo, Eva
2017-05-01
β-Methylamino-L-alanine (BMAA) is a non-proteinogenic amino acid that induces long-term cognitive deficits, as well as an increased neurodegeneration and intracellular fibril formation in the hippocampus of adult rodents following short-time neonatal exposure and in vervet monkey brain following long-term exposure. It has also been proposed to be involved in the etiology of neurodegenerative disease in humans. The aim of this study was to identify metabolic effects not related to excitotoxicity or oxidative stress in human neuroblastoma SH-SY5Y cells. The effects of BMAA (50, 250, 1000 µM) for 24 h on cells differentiated with retinoic acid were studied. Samples were analyzed using LC-MS and NMR spectroscopy to detect altered intracellular polar metabolites. The analysis performed, followed by multivariate pattern recognition techniques, revealed significant perturbations in protein biosynthesis, amino acid metabolism pathways and citrate cycle. Of specific interest were the BMAA-induced alterations in alanine, aspartate and glutamate metabolism and as well as alterations in various neurotransmitters/neuromodulators such as GABA and taurine. The results indicate that BMAA can interfere with metabolic pathways involved in neurotransmission in human neuroblastoma cells.
Methadone induces CAD degradation and AIF-mediated necrotic-like cell death in neuroblastoma cells.
Perez-Alvarez, Sergio; Iglesias-Guimarais, Victoria; Solesio, María E; Melero-Fernandez de Mera, Raquel María; Yuste, Víctor J; Galindo, María F; Jordán, Joaquín
2011-04-01
Methadone (d,l-methadone hydrochloride) is a full-opioid agonist, originally developed as a substitution for heroin or other opiates abusers. Nowadays methadone is also being applied as long-lasting analgesics in cancer, and it is proposed as a promising agent for leukemia therapy. Previously, we have demonstrated that high concentrations of methadone (0.5mM) induced necrotic-like cell death in SH-SY5Y cells. The pathway involved is caspase-independent but involves impairment of mitochondrial ATP synthesis and mitochondrial cytochrome c release. However, the downstream mitochondrial pathways remained unclear. Here, we studied the participation of apoptosis inducing factor (AIF) in methadone-induced cell death. Methadone resulted in a translocation of AIF from mitochondria to the nucleus. Translocation was inhibited by cyclosporine A, but not by lack of Bax protein. Therefore the effect seems mediated by the formation of the mitochondrial transition pore, but is apparently independent of Bax. Furthermore, methadone-treated SH-SY5Y nuclei show characteristics that are typical for stage I nuclear condensation. Methadone did not induce degradation of DNA into oligonucleosomal fragments or into high molecular weight DNA fragments. Absence of DNA fragmentation coincided with a considerable decrease in the levels of the caspase-actived endonuclase DNase and its chaperone-inhibitor ICAD. In conclusion, our results provide mechanistic insights into the molecular mechanisms that underlie methadone-induced cell death. This knowledge may prove useful to develop novel strategies to prevent toxic side-effects of methadone thereby sustaining its use as therapeutical agent against tumors. Copyright © 2010 Elsevier Ltd. All rights reserved.
International Nuclear Information System (INIS)
Nam, Seung Taek; Kim, Dae Hong; Lee, Min Bum; Nam, Hyo Jung; Kang, Jin Ku; Park, Mi Jung; Lee, Ik Hwan; Seok, Heon; Lee, Dong Gun; Hwang, Jae Sam; Kim, Ho
2013-01-01
Highlights: •CopA3 peptide isolated from the Korean dung beetle has antimicrobial activity. •Our study reported that CopA3 has anticancer and immunosuppressive effects. •We here demonstrated that CopA3 has neurotropic and neuroprotective effects. •CopA3 degrades p27Kip1 protein and this mediates effects of CopA3 on neuronal cells. -- Abstract: We recently demonstrated that the antibacterial peptide, CopA3 (a D-type disulfide dimer peptide, LLCIALRKK), inhibits LPS-induced macrophage activation and also has anticancer activity in leukemia cells. Here, we examined whether CopA3 could affect neuronal cell proliferation. We found that CopA3 time-dependently increased cell proliferation by up to 31 ± 2% in human neuroblastoma SH-SY5Y cells, and up to 29 ± 2% in neural stem cells isolated from neonatal mouse brains. In both cell types, CopA3 also significantly inhibited the apoptosis and viability losses caused by 6-hydroxy dopamine (a Parkinson disease-mimicking agent) and okadaic acid (an Alzheimer’s disease-mimicking agent). Immunoblotting revealed that the p27Kip1 protein (a negative regulator of cell cycle progression) was markedly degraded in CopA3-treated SH-SY5Y cells. Conversely, an adenovirus expressing p27Kip1 significantly inhibited the antiapoptotic effects of CopA3 against 6-hydroxy dopamine- and okadaic acid-induced apoptosis, and decreased the neurotropic effects of CopA3. These results collectively suggest that CopA3-mediated protein degradation of p27Kip1 may be the main mechanism through which CopA3 exerts neuroprotective and neurotropic effects
Energy Technology Data Exchange (ETDEWEB)
Nam, Seung Taek; Kim, Dae Hong; Lee, Min Bum; Nam, Hyo Jung; Kang, Jin Ku; Park, Mi Jung; Lee, Ik Hwan [Department of Life Science, College of Natural Science, Daejin University, Pocheon, Gyeonggido 487-711 (Korea, Republic of); Seok, Heon [Department of Biomedical Science, Jungwon University, Goesan, Chungcheongbukdo 367-700 (Korea, Republic of); Lee, Dong Gun [School of Life Sciences and Biotechnology, College of Natural Sciences, Kyungpook National University, Daegu 702-701 (Korea, Republic of); Hwang, Jae Sam [Department of Agricultural Biology, National Academy of Agricultural Science, RDA, Suwon 441-707 (Korea, Republic of); Kim, Ho, E-mail: hokim@daejin.ac.kr [Department of Life Science, College of Natural Science, Daejin University, Pocheon, Gyeonggido 487-711 (Korea, Republic of)
2013-07-19
Highlights: •CopA3 peptide isolated from the Korean dung beetle has antimicrobial activity. •Our study reported that CopA3 has anticancer and immunosuppressive effects. •We here demonstrated that CopA3 has neurotropic and neuroprotective effects. •CopA3 degrades p27Kip1 protein and this mediates effects of CopA3 on neuronal cells. -- Abstract: We recently demonstrated that the antibacterial peptide, CopA3 (a D-type disulfide dimer peptide, LLCIALRKK), inhibits LPS-induced macrophage activation and also has anticancer activity in leukemia cells. Here, we examined whether CopA3 could affect neuronal cell proliferation. We found that CopA3 time-dependently increased cell proliferation by up to 31 ± 2% in human neuroblastoma SH-SY5Y cells, and up to 29 ± 2% in neural stem cells isolated from neonatal mouse brains. In both cell types, CopA3 also significantly inhibited the apoptosis and viability losses caused by 6-hydroxy dopamine (a Parkinson disease-mimicking agent) and okadaic acid (an Alzheimer’s disease-mimicking agent). Immunoblotting revealed that the p27Kip1 protein (a negative regulator of cell cycle progression) was markedly degraded in CopA3-treated SH-SY5Y cells. Conversely, an adenovirus expressing p27Kip1 significantly inhibited the antiapoptotic effects of CopA3 against 6-hydroxy dopamine- and okadaic acid-induced apoptosis, and decreased the neurotropic effects of CopA3. These results collectively suggest that CopA3-mediated protein degradation of p27Kip1 may be the main mechanism through which CopA3 exerts neuroprotective and neurotropic effects.
Perforin Promotes Amyloid Beta Internalisation in Neurons.
Lana, Erica; Khanbolouki, Mahbod; Degavre, Charline; Samuelsson, Eva-Britt; Åkesson, Elisabet; Winblad, Bengt; Alici, Evren; Lithner, Christina Unger; Behbahani, Homira
2017-03-01
Studies on the mechanisms of neuronal amyloid-β (Aβ) internalisation are crucial for understanding the neuropathological progression of Alzheimer's disease (AD). We here investigated how extracellular Aβ peptides are internalised and focused on three different pathways: (i) via endocytic mechanisms, (ii) via the receptor for advanced glycation end products (RAGE) and (iii) via the pore-forming protein perforin. Both Aβ 40 and Aβ 42 were internalised in retinoic acid differentiated neuroblastoma (RA-SH-SY5Y) cells. A higher concentration was required for Aβ 40 (250 nM) compared with Aβ 42 (100 nM). The internalised Aβ 40 showed a dot-like pattern of distribution whereas Aβ 42 accumulated in larger and distinct formations. By confocal microscopy, we showed that Aβ 40 and Aβ 42 co-localised with mitochondria, endoplasmic reticulum (ER) and lysosomes. Aβ treatment of human primary cortical neurons (hPCN) confirmed our findings in RA-SH-SY5Y cells, but hPCN were less sensitive to Aβ; therefore, a 20 (Aβ 40 ) and 50 (Aβ 42 ) times higher concentration was needed for inducing uptake. The blocking of endocytosis completely inhibited the internalisation of Aβ peptides in RA-SH-SY5Y cells and hPCN, indicating that this is a major pathway by which Aβ enters the cells. In addition, the internalisation of Aβ 42 , but not Aβ 40 , was reduced by 55 % by blocking RAGE. Finally, for the first time we showed that pore formation in cell membranes by perforin led to Aβ internalisation in hPCN. Understanding how Aβ is internalised sheds light on the pathological role of Aβ and provides further ideas of inhibitory strategies for preventing Aβ internalisation and the spreading of neurodegeneration in AD.
Directory of Open Access Journals (Sweden)
Coralie Di Scala
2016-03-01
Full Text Available The data here consists of calcium imaging of human neuroblastoma SH-SY5Y cells treated with the calcium-sensitive dye Fluo-4AM and then incubated with nanomolar concentrations of either human or rat Alzheimer’s β-amyloid peptide Aβ1-42. These data are both of a qualitative (fluorescence micrographs and semi-quantitative nature (estimation of intracellular calcium concentrations of cells probed by Aβ1-42 peptides vs. control untreated cells. Since rat Aβ1-42 differs from its human counterpart at only three amino acid positions, this comparative study is a good assessment of the specificity of the amyloid pore forming assay. The interpretation of this dataset is presented in the accompanying study “Broad neutralization of calcium-permeable amyloid pore channels with a chimeric Alzheimer/Parkinson peptide targeting brain gangliosides” [1].
DEFF Research Database (Denmark)
Zheng, Lin; Terman, Alexei; Hallbeck, Martin
2011-01-01
and accumulation of Aβ within lysosomes, induced apoptosis in differentiated SH-SY5Y neuroblastoma cells. Cells under hyperoxia showed: (1) increased numbers of autophagic vacuoles that contained amyloid precursor protein (APP) as well as Aβ monomers and oligomers, (2) increased reactive oxygen species production...... and resulting lysosomal Aβ accumulation are essential for oxidant-induced apoptosis in cultured neuroblastoma cells and provide additional support for the interactive role of oxidative stress and the lysosomal system in AD-related neurodegeneration....
Inhibitory Effect of Lycopene on Amyloid-β-Induced Apoptosis in Neuronal Cells.
Hwang, Sinwoo; Lim, Joo Weon; Kim, Hyeyoung
2017-08-16
Alzheimer's disease (AD) is a fatal neurodegenerative disease. Brain amyloid-β deposition is a crucial feature of AD, causing neuronal cell death by inducing oxidative damage. Reactive oxygen species (ROS) activate NF-κB, which induces expression of Nucling. Nucling is a pro-apoptotic factor recruiting the apoptosome complex. Lycopene is an antioxidant protecting from oxidative stress-induced cell damage. We investigated whether lycopene inhibits amyloid-β-stimulated apoptosis through reducing ROS and inhibiting mitochondrial dysfunction and NF-κB-mediated Nucling expression in neuronal SH-SY5Y cells. We prepared cells transfected with siRNA for Nucling or nontargeting control siRNA to determine the role of Nucling in amyloid-β-induced apoptosis. The amyloid-β increased intracellular and mitochondrial ROS levels, apoptotic indices (p53, Bax/Bcl-2 ratio, caspase-3 cleavage), NF-kB activation and Nucling expression, while cell viability, mitochondrial membrane potential, and oxygen consumption rate decreased in SH-SY5Y cells. Lycopene inhibited these amyloid-β-induced alterations. However, amyloid-β did not induce apoptosis, determined by cell viability and apoptotic indices (p53, Bax/Bcl-2 ratio, caspase-3 cleavage), in the cells transfected with siRNA for Nucling. Lycopene inhibited apoptosis by reducing ROS, and by inhibiting mitochondrial dysfunction and NF-κB-target gene Nucling expression in neuronal cells. Lycopene may be beneficial for preventing oxidative stress-mediated neuronal death in patients with neurodegeneration.
Peptidomic analysis of human cell lines
Gelman, Julia S.; Sironi, Juan; Castro, Leandro M.; Ferro, Emer S.; Fricker, Lloyd D.
2011-01-01
Peptides have been proposed to function in intracellular signaling within the cytosol. Although cytosolic peptides are considered to be highly unstable, a large number of peptides have been detected in mouse brain and other biological samples. In the present study, we evaluated the peptidome of three diverse cell lines: SH-SY5Y, MCF7, and HEK293 cells. A comparison of the peptidomes revealed considerable overlap in the identity of the peptides found in each cell line. The majority of the observed peptides are not derived from the most abundant or least stable proteins in the cell, and approximately half of the cellular peptides correspond to the N- or C- termini of the precursor proteins. Cleavage site analysis revealed a preference for hydrophobic residues in the P1 position. Quantitative peptidomic analysis indicated that the levels of most cellular peptides are not altered in response to elevated intracellular calcium, suggesting that calpain is not responsible for their production. The similarity of the peptidomes of the three cell lines and the lack of correlation with the predicted cellular degradome implies the selective formation or retention of these peptides, consistent with the hypothesis that they are functional in the cells. PMID:21204522
Enhanced growth of neural networks on conductive cellulose-derived nanofibrous scaffolds
International Nuclear Information System (INIS)
Kuzmenko, Volodymyr; Kalogeropoulos, Theodoros; Thunberg, Johannes; Johannesson, Sara; Hägg, Daniel; Enoksson, Peter; Gatenholm, Paul
2016-01-01
The problem of recovery from neurodegeneration needs new effective solutions. Tissue engineering is viewed as a prospective approach for solving this problem since it can help to develop healthy neural tissue using supportive scaffolds. This study presents effective and sustainable tissue engineering methods for creating biomaterials from cellulose that can be used either as scaffolds for the growth of neural tissue in vitro or as drug screening models. To reach this goal, nanofibrous electrospun cellulose mats were made conductive via two different procedures: carbonization and addition of multi-walled carbon nanotubes. The resulting scaffolds were much more conductive than untreated cellulose material and were used to support growth and differentiation of SH-SY5Y neuroblastoma cells. The cells were evaluated by scanning electron microscopy and confocal microscopy methods over a period of 15 days at different time points. The results showed that the cellulose-derived conductive scaffolds can provide support for good cell attachment, growth and differentiation. The formation of a neural network occurred within 10 days of differentiation, which is a promising length of time for SH-SY5Y neuroblastoma cells. - Highlights: • The conductive scaffolds for neural tissue engineering are derived from cellulose. • The scaffolds are used to support growth and differentiation of SH-SY5Y cells. • Distinctive cell differentiation occurs within 10 days on conductive scaffolds. • Electrical conductivity and nanotopography improve neural network formation.
Jouha, Jabrane; Loubidi, Mohammed; Bouali, Jamila; Hamri, Salha; Hafid, Abderrafia; Suzenet, Franck; Guillaumet, Gérald; Dagcı, Taner; Khouili, Mostafa; Aydın, Fadime; Saso, Luciano; Armagan, Güliz
2017-03-31
Neurodegenerative disorders including Alzheimer's disease, Parkinson's disease, and Huntington's disease affect millions of people in the world. Thus several new approaches to treat brain disorders are under development. The aim of the present study is to synthesize potential neuroprotective heterocyclic compounds based on pyrazolopyridine derivatives and then to evaluate their effects in MPP + -induced neurodegeneration in human neuroblastoma cell line (SH-SY5Y cells). The effects of the compounds on cell viability were measured by MTT assay and the changes in apoptosis-related proteins including bax, Bcl-2, Bcl-xl and caspase-3 were investigated by western blot technique. Based on the cell viability results obtained by MTT assay, the percentage of neuroprotection-induced by compounds against MPP + -induced neurotoxicity in SH-SY5Y cells was between 20% and 30% at 5 μM concentrations of all synthesized compounds. Moreover, the downregulation in pro-apoptotic proteins including bax and caspase-3 were found following the novel synthesized compounds treatments and these effects were observed in a dose-dependent manner. Our results provide an evidence that these heterocyclic compounds based on pyrazolopyridine derivatives may have a role on dopaminergic neuroprotection via antiapoptotic pathways. Copyright © 2017 Elsevier Masson SAS. All rights reserved.
Sakka, Laurent; Delétage, Nathalie; Chalus, Maryse; Aissouni, Youssef; Sylvain-Vidal, Valérie; Gobron, Stéphane; Coll, Guillaume
2017-01-01
Selective serotonin reuptake inhibitors (SSRI) are common antidepressants which cytotoxicity has been assessed in cancers notably colorectal carcinomas and glioma cell lines. We assessed and compared the cytotoxicity of 2 SSRI, citalopram and escitalopram, on neuroblastoma cell lines. The study was performed on 2 non-MYCN amplified cell lines (rat B104 and human SH-SY5Y) and 2 human MYCN amplified cell lines (IMR32 and Kelly). Citalopram and escitalopram showed concentration-dependent cytotoxicity on all cell lines. Citalopram was more cytotoxic than escitalopram. IMR32 was the most sensitive cell line. The absence of toxicity on human primary Schwann cells demonstrated the safety of both molecules for myelin. The mechanisms of cytotoxicity were explored using gene-expression profiles and quantitative real-time PCR (qPCR). Citalopram modulated 1 502 genes and escitalopram 1 164 genes with a fold change ≥ 2. 1 021 genes were modulated by both citalopram and escitalopram; 481 genes were regulated only by citalopram while 143 genes were regulated only by escitalopram. Citalopram modulated 69 pathways (KEGG) and escitalopram 42. Ten pathways were differently modulated by citalopram and escitalopram. Citalopram drastically decreased the expression of MYBL2, BIRC5 and BARD1 poor prognosis factors of neuroblastoma with fold-changes of -107 (pescitalopram. PMID:28467792
Sakka, Laurent; Delétage, Nathalie; Chalus, Maryse; Aissouni, Youssef; Sylvain-Vidal, Valérie; Gobron, Stéphane; Coll, Guillaume
2017-06-27
Selective serotonin reuptake inhibitors (SSRI) are common antidepressants which cytotoxicity has been assessed in cancers notably colorectal carcinomas and glioma cell lines. We assessed and compared the cytotoxicity of 2 SSRI, citalopram and escitalopram, on neuroblastoma cell lines. The study was performed on 2 non-MYCN amplified cell lines (rat B104 and human SH-SY5Y) and 2 human MYCN amplified cell lines (IMR32 and Kelly). Citalopram and escitalopram showed concentration-dependent cytotoxicity on all cell lines. Citalopram was more cytotoxic than escitalopram. IMR32 was the most sensitive cell line. The absence of toxicity on human primary Schwann cells demonstrated the safety of both molecules for myelin. The mechanisms of cytotoxicity were explored using gene-expression profiles and quantitative real-time PCR (qPCR). Citalopram modulated 1 502 genes and escitalopram 1 164 genes with a fold change ≥ 2. 1 021 genes were modulated by both citalopram and escitalopram; 481 genes were regulated only by citalopram while 143 genes were regulated only by escitalopram. Citalopram modulated 69 pathways (KEGG) and escitalopram 42. Ten pathways were differently modulated by citalopram and escitalopram. Citalopram drastically decreased the expression of MYBL2, BIRC5 and BARD1 poor prognosis factors of neuroblastoma with fold-changes of -107 (pescitalopram.
CCL5 and CCR5 interaction promotes cell motility in human osteosarcoma.
Directory of Open Access Journals (Sweden)
Shih-Wei Wang
Full Text Available BACKGROUND: Osteosarcoma is characterized by a high malignant and metastatic potential. CCL5 (previously called RANTES was originally recognized as a product of activated T cells, and plays a crucial role in the migration and metastasis of human cancer cells. It has been reported that the effect of CCL5 is mediated via CCR receptors. However, the effect of CCL5 on migration activity and integrin expression in human osteosarcoma cells is mostly unknown. METHODOLOGY/PRINCIPAL FINDINGS: Here we found that CCL5 increased the migration and expression of αvβ3 integrin in human osteosarcoma cells. Stimulation of cells with CCL5 increased CCR5 but not CCR1 and CCR3 expression. CCR5 mAb, inhibitor, and siRNA reduced the CCL5-enhanced the migration and integrin up-regulation of osteosarcoma cells. Activations of MEK, ERK, and NF-κB pathways after CCL5 treatment were demonstrated, and CCL5-induced expression of integrin and migration activity was inhibited by the specific inhibitor and mutant of MEK, ERK, and NF-κB cascades. In addition, over-expression of CCL5 shRNA inhibited the migratory ability and integrin expression in osteosarcoma cells. CONCLUSIONS/SIGNIFICANCE: CCL5 and CCR5 interaction acts through MEK, ERK, which in turn activates NF-κB, resulting in the activations of αvβ3 integrin and contributing the migration of human osteosarcoma cells.
International Nuclear Information System (INIS)
Kang, Kyoung Ah; Lee, Hyung Chul; Lee, Je-Jung
2014-01-01
The objective of this study was to investigate the effects of the combined RF radiation (837 MHz CDMA plus 1950 MHz WCDMA) signal on levels of intracellular reactive oxygen species (ROS) in neuronal cells. Exposure of the combined RF signal was conducted at specific absorption rate values of 2 W/kg of CDMA plus 2 W/kg of WCDMA for 2 h. Co-exposure to combined RF radiation with either H 2 O 2 or menadione was also performed. The experimental exposure groups were incubator control, sham-exposed, combined RF radiation-exposed with or without either H 2 O 2 or menadione groups. The intracellular ROS level was measured by flow cytometry using the fluorescent probe dichlorofluorescein diacetate. Intracellular ROS levels were not consistently affected by combined RF radiation exposure alone in a time-dependent manner in U87, PC12 or SH-SY5Y cells. In neuronal cells exposed to combined RF radiation with either H 2 O 2 or menadione, intracellular ROS levels showed no statically significant alteration compared with exposure to menadione or H 2 O 2 alone. These findings indicate that neither combined RF radiation alone nor combined RF radiation with menadione or H 2 O 2 influences the intracellular ROS level in neuronal cells such as U87, PC12 or SH-SY5Y. (author)
Detection of Temperature Difference in Neuronal Cells.
Tanimoto, Ryuichi; Hiraiwa, Takumi; Nakai, Yuichiro; Shindo, Yutaka; Oka, Kotaro; Hiroi, Noriko; Funahashi, Akira
2016-03-01
For a better understanding of the mechanisms behind cellular functions, quantification of the heterogeneity in an organism or cells is essential. Recently, the importance of quantifying temperature has been highlighted, as it correlates with biochemical reaction rates. Several methods for detecting intracellular temperature have recently been established. Here we develop a novel method for sensing temperature in living cells based on the imaging technique of fluorescence of quantum dots. We apply the method to quantify the temperature difference in a human derived neuronal cell line, SH-SY5Y. Our results show that temperatures in the cell body and neurites are different and thus suggest that inhomogeneous heat production and dissipation happen in a cell. We estimate that heterogeneous heat dissipation results from the characteristic shape of neuronal cells, which consist of several compartments formed with different surface-volume ratios. Inhomogeneous heat production is attributable to the localization of specific organelles as the heat source.
Directory of Open Access Journals (Sweden)
Wen Di
2012-06-01
Full Text Available Abstract Background Cholecystokinin octapeptide (CCK-8, the most potent endogenous anti-opioid peptide, has been shown to regulate the processes of morphine dependence. In our previous study, we found that exogenous CCK-8 attenuated naloxone induced withdrawal symptoms. To investigate the precise effect of exogenous CCK-8 and the role of cholecystokinin (CCK 1 and/or 2 receptors in morphine dependence, a SH-SY5Y cell model was employed, in which the μ-opioid receptor, CCK1/2 receptors, and endogenous CCK are co-expressed. Results Forty-eight hours after treating SH-SY5Y cells with morphine (10 μM, naloxone (10 μM induced a cAMP overshoot, indicating that cellular morphine dependence had been induced. The CCK receptor and endogenous CCK were up-regulated after chronic morphine exposure. The CCK2 receptor antagonist (LY-288,513 at 1–10 μM inhibited the naloxone-precipitated cAMP overshoot, but the CCK1 receptor antagonist (L-364,718 did not. Interestingly, CCK-8 (0.1-1 μM, a strong CCK receptor agonist, dose-dependently inhibited the naloxone-precipitated cAMP overshoot in SH-SY5Y cells when co-pretreated with morphine. The L-364,718 significantly blocked the inhibitory effect of exogenous CCK-8 on the cAMP overshoot at 1–10 μM, while the LY-288,513 did not. Therefore, the CCK2 receptor appears to be necessary for low concentrations of endogenous CCK to potentiate morphine dependence in SH-SY5Y cells. An additional inhibitory effect of CCK-8 at higher concentrations appears to involve the CCK1 receptor. Conclusions This study reveals the difference between exogenous CCK-8 and endogenous CCK effects on the development of morphine dependence, and provides the first evidence for the participation of the CCK1 receptor in the inhibitory effects of exogenous CCK-8 on morphine dependence.
Chen, Wei; Mao, Liuqun; Xing, Huanhuan; Xu, Lei; Fu, Xiang; Huang, Liyingzi; Huang, Dongling; Pu, Zhijun; Li, Qinghua
2015-11-03
Growing evidence suggests concentration of lycopene was reduced in plasma of patients with Alzheimer disease (AD). Lycopene, a member of the carotenoid family, has been identified as an antioxidant to attenuate oxidative damage and has neuroprotective role in several AD models. However, whether lycopene is involved in the pathogenesis of AD and molecular underpinnings are elusive. In this study, we found that lycopene can significantly delay paralysis in the Aβ1-42-transgenic Caenorhabditis elegans strain GMC101. Lycopene treatment reduced Aβ1-42 secretion in SH-SY5Y cells overexpressing the Swedish mutant form of human β-amyloid precursor protein (APPsw). Next, we found lycopene can down-regulate expression level of β-amyloid precursor protein(APP) in APPsw cells. Moreover, lycopene treatment can not change endogenous reactive oxygen species level and apoptosis in APPsw cells. However, lycopene treatment protected against H2O2-induced oxidative stress and copper-induced damage in APPsw cells. Collectively, our data support that elevated lycopene contributes to the lower pathogenesis of AD. Our findings suggest that increasing lycopene in neurons may be a novel approach to attenuate onset and development of AD. Copyright © 2015 Elsevier Ireland Ltd. All rights reserved.
Caputo, Lucia; Souza, Lucéia Fátima; Alloisio, Susanna; Cornara, Laura; De Feo, Vincenzo
2016-11-30
The aims of this study are to determine the chemical composition of Lavandula angustifolia Mill. and Coriandrum sativum L. essential oils, to evaluate their cytotoxic effects in SH-SY5Y human neuroblastoma cells, to investigate whether an alteration of adenylate cyclase 1 (ADCY1) and of extracellular signal-regulated kinase (ERK) expression can take part in the molecular mechanisms of the essential oils, and to study their possible neuronal electrophysiological effects. The essential oils were obtained by hydrodistillation, and studied by GC and GC-MS. In the oils from L. angustifolia and C. sativum , linalool was the main component (33.1% and 67.8%, respectively). SH-SY5Y cells were incubated with different concentrations of essential oils and of linalool. Cell viability and effects on ADCY1 and ERK expression were analyzed using 3-(4,5-dimethylthiazol-2-yl)-2,5-diphenyltetrazolium bromide MTT and Western blotting, respectively. Variation in cellular electrophysiology was studied in primary cultures of rat cortical neurons with a multi-electrode array (MEA)-based approach. The essential oils and linalool revealed different cytotoxic activities. Linalool inhibited ADCY1 and ERK expression. Neuronal networks subjected to L. angustifolia and C. sativum essential oils showed a concentration-dependent inhibition of spontaneous electrical activity.
ent-Kaurane Diterpenoids with Neuroprotective Properties from Corn Silk ( Zea mays).
Qi, Xiao-Li; Zhang, Ying-Ying; Zhao, Peng; Zhou, Le; Wang, Xiao-Bo; Huang, Xiao-Xiao; Lin, Bin; Song, Shao-Jiang
2018-05-25
Thirteen new ent-kaurane diterpenoids, stigmaydenes A-M (1-13), together with two known compounds (14, 15), were isolated from the crude extract of corn silk ( Zea mays). The structures of the compounds were confirmed by comprehensive spectroscopic analyses. The absolute configuration of compound 1 was defined by single-crystal X-ray diffraction. The absolute configurations of the compounds were also confirmed by comparison of experimental and calculated specific rotations. The compounds were evaluated for their neuroprotective effects against H 2 O 2 -induced SH-SY5Y cell injury, and compound 8 was active at 100 μM, as determined by flow cytometry (annexin V-FITC/PI staining) and Hoechst 33258 staining. The results suggested that compound 8 could protect neuronal cells from H 2 O 2 -induced injury by inhibiting apoptosis in SH-SY5Y cells.
International Nuclear Information System (INIS)
Cebulska-Wasilewska, A.
1999-01-01
The report presents some of the results of genotoxicity of the environmental agents studied in somatic cells of Tradescantia and show similarity between responses of the Tradescantia stamen hair cells (Trad-SH) and human blood cells to the physical and chemical mutagens. In the studies in vitro chromosome aberrations (CA) and sister chromatid exchanges (SCE) were applied to evaluate genotoxicity of pesticides. For comparison of genotoxic effectiveness of agrochemicals with other chemicals, there are also presented results of the genotoxicity of well-known mutagens (EMS, X-rays). The results confirm that in the environment a chemical pollution might cause higher genetic risk than radiation. Trad-SH assay was applied for in situ monitoring of the ambient air mutagenicity caused by benzene and petroleum associated compounds. The studies showed that gene mutation frequencies were slightly dependent on the distance from the petroleum work center. Results of measures of the cell cycle factor have shown also that the chemical pollutants in the air played also an important role in physiological cellular processes. The similarity of the Trad-SH and human blood cells responses to the physical and chemical mutagens showed that the gene mutations in Tradescantia present a simple and sensitive model, which can be very useful in biological monitoring
Liu, Ting; Wu, Hai-Jun; Liang, Yu; Liang, Xu-Jun; Huang, Hui-Chao; Zhao, Yan-Zhong; Liao, Qing-Chuan; Chen, Ya-Qi; Leng, Ai-Min; Yuan, Wei-Jian; Zhang, Gui-Ying; Peng, Jie; Chen, Yong-Heng
2016-06-21
To develop a potent and safe gene therapy for esophageal cancer. An expression vector carrying fusion suicide gene (yCDglyTK) and shRNA against vascular endothelial growth factor (VEGF) was constructed and delivered into EC9706 esophageal cancer cells by calcium phosphate nanoparticles (CPNP). To achieve tumor selectivity, expression of the fusion suicide gene was driven by a tumor-specific human telomerase reverse transcriptase (hTERT) promoter. The biologic properties and therapeutic efficiency of the vector, in the presence of prodrug 5-fluorocytosine (5-FC), were evaluated in vitro and in vivo. Both in vitro and in vivo testing showed that the expression vector was efficiently introduced by CPNP into tumor cells, leading to cellular expression of yCDglyTK and decreased VEGF level. With exposure to 5-FC, it exhibited strong anti-tumor effects against esophageal cancer. Combination of VEGF shRNA with the fusion suicide gene demonstrated strong anti-tumor activity. The shVEGF-hTERT-yCDglyTK/5-FC system provided a novel approach for esophageal cancer-targeted gene therapy.
Defined α-synuclein prion-like molecular assemblies spreading in cell culture.
Aulić, Suzana; Le, Tran Thanh Nhat; Moda, Fabio; Abounit, Saïda; Corvaglia, Stefania; Casalis, Loredana; Gustincich, Stefano; Zurzolo, Chiara; Tagliavini, Fabrizio; Legname, Giuseppe
2014-06-04
α-Synuclein (α-syn) plays a central role in the pathogenesis of synucleinopathies, a group of neurodegenerative disorders that includes Parkinson disease, dementia with Lewy bodies and multiple system atrophy. Several findings from cell culture and mouse experiments suggest intercellular α-syn transfer. Through a methodology used to obtain synthetic mammalian prions, we tested whether recombinant human α-syn amyloids can promote prion-like accumulation in neuronal cell lines in vitro. A single exposure to amyloid fibrils of human α-syn was sufficient to induce aggregation of endogenous α-syn in human neuroblastoma SH-SY5Y cells. Remarkably, endogenous wild-type α-syn was sufficient for the formation of these aggregates, and overexpression of the protein was not required. Our results provide compelling evidence that endogenous α-syn can accumulate in cell culture after a single exposure to exogenous α-syn short amyloid fibrils. Importantly, using α-syn short amyloid fibrils as seed, endogenous α-syn aggregates and accumulates over several passages in cell culture, providing an excellent tool for potential therapeutic screening of pathogenic α-syn aggregates.
Scatena, Alessia; Fornai, Francesco; Trincavelli, Maria Letizia; Taliani, Sabrina; Daniele, Simona; Pugliesi, Isabella; Cosconati, Sandro; Martini, Claudia; Da Settimo, Federico
2011-09-21
In this study, compound FTBI (3-(2-furyl)-10-(2-phenylethyl)[1,2,4]triazino[4,3-a]benzimidazol-4(10H)-one) was selected from a small library of triazinobenzimidazole derivatives as a potent A(2A) adenosine receptor (AR) antagonist and tested for its neuroprotective effects against two different kinds of dopaminergic neurotoxins, 1-methyl-4-phenylpyridinium (MPP+) and methamphetamine (METH), in rat PC12 and in human neuroblastoma SH-SY5Y cell lines. FTBI, in a concentration range corresponding to its affinity for A(2A) AR subtype, significantly increased the number of viable PC12 cells after their exposure to METH and, to a similar extent, to MPP+, as demonstrated in both trypan blue exclusion assay and in cytological staining. These neuroprotective effects were also observed with a classical A(2A) AR antagonist, ZM241385, and appeared to be completely counteracted by the AR agonist, NECA, supporting A(2A) ARs are directly involved in FTBI-mediated effects. Similarly, in human SH-SY5Y cells, FTBI was able to prevent cell toxicity induced by MPP+ and METH, showing that this A(2A) AR antagonist has a neuroprotective effect independently by the specific cell model. Altogether these results demonstrate that the A(2A) AR blockade mediates cell protection against neurotoxicity induced by dopaminergic neurotoxins in dopamine containing cells, supporting the potential use of A(2A) AR antagonists in dopaminergic degenerative diseases including Parkinson's disease.
Directory of Open Access Journals (Sweden)
Yoona Seo
Full Text Available Neuroblastoma (NB originates from immature neuronal cells and currently has a poor clinical outcome. NB cells possess cancer stem cells (CSCs characteristics that facilitate the initiation of a tumor, as well as its metastasis. Human bitter taste receptors, referred to as TAS2Rs, are one of five types of basic taste receptors and they belong to a family of G-protein coupled receptors. The recent finding that taste receptors are expressed in non-gustatory tissues suggest that they mediate additional functions distinct from taste perception. While it is generally admitted that the recognition of bitter tastes may be associated with a self-defense system to prevent the ingestion of poisonous food compounds, this recognition may also serve as a disease-related function in the human body. In particular, the anti-cancer stemness and invasion effects of TAS2Rs on NB cells remain poorly understood. In the present study, endogenous expression of TAS2R8 and TAS2R10 in SK-N-BE(2C and SH-SY5Y cells was examined. In addition, higher levels of TAS2R8 and TAS2R10 expression were investigated in more differentiated SY5Y cells. Both TAS2Rs were up-regulated following the induction of neuronal cell differentiation by retinoic acid. In addition, ectopic transfection of the two TAS2Rs induced neurite elongation in the BE(2C cells, and down-regulated CSCs markers (including DLK1, CD133, Notch1, and Sox2, and suppressed self-renewal characteristics. In particular, TAS2RS inhibited tumorigenicity. Furthermore, when TAS2Rs was over-expressed, cell migration, cell invasion, and matrix metalloproteinases activity were inhibited. Expression levels of hypoxia-inducible factor-1α, a well-known regulator of tumor metastasis, as well as its downstream targets, vascular endothelial growth factor and glucose transporter-1, were also suppressed by TAS2Rs. Taken together, these novel findings suggest that TAS2Rs targets CSCs by suppressing cancer stemness characteristics and NB
The Biological Effects of Bilirubin Photoisomers
Jasprova, Jana; Dal Ben, Matteo; Vianello, Eleonora; Goncharova, Iryna; Urbanova, Marie; Vyroubalova, Karolina; Gazzin, Silvia; Tiribelli, Claudio; Sticha, Martin; Cerna, Marcela; Vitek, Libor
2016-01-01
Although phototherapy was introduced as early as 1950’s, the potential biological effects of bilirubin photoisomers (PI) generated during phototherapy remain unclear. The aim of our study was to isolate bilirubin PI in their pure forms and to assess their biological effects in vitro. The three major bilirubin PI (ZE- and EZ-bilirubin and Z-lumirubin) were prepared by photo-irradiation of unconjugated bilirubin. The individual photoproducts were chromatographically separated (TLC, HPLC), and their identities verified by mass spectrometry. The role of Z-lumirubin (the principle bilirubin PI) on the dissociation of bilirubin from albumin was tested by several methods: peroxidase, fluorescence quenching, and circular dichroism. The biological effects of major bilirubin PI (cell viability, expression of selected genes, cell cycle progression) were tested on the SH-SY5Y human neuroblastoma cell line. Lumirubin was found to have a binding site on human serum albumin, in the subdomain IB (or at a close distance to it); and thus, different from that of bilirubin. Its binding constant to albumin was much lower when compared with bilirubin, and lumirubin did not affect the level of unbound bilirubin (Bf). Compared to unconjugated bilirubin, bilirubin PI did not have any effect on either SH-SY5Y cell viability, the expression of genes involved in bilirubin metabolism or cell cycle progression, nor in modulation of the cell cycle phase. The principle bilirubin PI do not interfere with bilirubin albumin binding, and do not exert any toxic effect on human neuroblastoma cells. PMID:26829016
Directory of Open Access Journals (Sweden)
Tianfei Luo
2014-09-01
Full Text Available Lethal autophagy is a pathway leading to neuronal death caused by transient global ischemia. In this study, we examined the effect of Ginsenoside Rb1 (GRb1 on ischemia/reperfusion-induced autophagic neuronal death and investigated the role of PI3K/Akt. Ischemic neuronal death in vitro was induced by using oxygen glucose deprivation (OGD in SH-SY5Y cells, and transient global ischemia was produced by using two vessels occlusion in rats. Cellular viability of SH-SY5Y cells was assessed by MTT assay, and CA1 neuronal death was evaluated by Hematoxylin-eosin staining. Autophagic vacuoles were detected by using both fluorescent microscopy in combination with acridine orange (AO and Monodansylcadaverine (MDC staining and transmission electronic microscopy. Protein levels of LC3II, Beclin1, total Akt and phosphor-Akt at Ser473 were examined by western blotting analysis. GRb1 inhibited both OGD and transient ischemia-induced neuronal death and mitigated OGD-induced autophagic vacuoles in SH-SY5Y cells. By contrast, PI3K inhibitor LY294002 counteracted the protection of GRb1 against neuronal death caused by either OGD or transient ischemia. LY294002 not only mitigated the up-regulated protein level of phosphor Akt at Ser473 caused by GRb1, but also reversed the inhibitory effect of GRb1 on OGD and transient ischemia-induced elevation in protein levels of LC3II and Beclin1.
Ono, Takeshi; Kaneda, Toshio; Muto, Akihiro; Yoshida, Tadashi
2009-07-24
Micro opioid receptor (MOR) agonists such as morphine are applied widely in clinical practice as pain therapy. The effects of morphine through MOR, such as analgesia and development of tolerance and dependence, are influenced by individual specificity. Recently, we analyzed single nucleotide polymorphisms on the human MOR gene to investigate the factors that contribute to individual specificity. In process of single nucleotide polymorphisms analysis, we found that specific nuclear proteins bound to G(-172) --> T region in exon 1 in MOR gene, and its affinity to DNA was increased by base substitution from G(-172) to T(-172). The isolated protein was identified by mass spectrometry and was confirmed by Western blotting to be poly(ADP-ribose) polymerase-1 (PARP-1). The overexpressed PARP-1 bound to G(-172) --> T and enhanced the transcription of reporter vectors containing G(-172) and T(-172). Furthermore, PARP-1 inhibitor (benzamide) decreased PARP-1 binding to G(-172) --> T without affecting mRNA or protein expression level of PARP-1 and down-regulated the subsequent MOR gene expression in SH-SY5Y cells. Moreover, we found that tumor necrosis factor-alpha enhanced MOR gene expression as well as increased PARP-1 binding to the G(-172) --> T region and G(-172) --> T-dependent transcription in SH-SY5Y cells. These effects were also inhibited by benzamide. In this study, our data suggest that PARP-1 positively regulates MOR gene transcription via G(-172) --> T, which might influence individual specificity in therapeutic opioid effects.
Energy Technology Data Exchange (ETDEWEB)
Catauro, Michelina, E-mail: michelina.catauro@unina2.it [Department of Industrial and Information Engineering, Second University of Naples, Via Roma 29, 81031 Aversa (Italy); Bollino, Flavia [Department of Industrial and Information Engineering, Second University of Naples, Via Roma 29, 81031 Aversa (Italy); Nocera, Paola; Piccolella, Simona; Pacifico, Severina [Department Environmental, Biological and Pharmaceutical Sciences and Technologies, Second University of Naples, Via Vivaldi 43, 81100 Caserta (Italy)
2016-11-01
Sol-gel synthesis was exploited to entrap quercetin, a natural occurring antioxidant polyphenol, in silica-based hybrid materials, which differed in their polyethylene glycol (PEG) content (6, 12, 24 and 50 wt%). The materials obtained, whose nano-composite nature was ascertained by Scanning Electron Microscopy (SEM), were chemically characterized by Fourier Transform InfraRed (FT-IR) and UV-Vis spectroscopies. The results prove that a reaction between the polymer and the drug occurred. Bioactivity tests showed their ability to induce hydroxyapatite nucleation on the sample surfaces. The direct contact method was applied to screen the cytotoxicity of the synthetized materials towards fibroblast NIH 3T3 cells, commonly used for in vitro biocompatibility studies, and three nervous system cell lines (neuroblastoma SH-SY5Y, glioma U251, and pheochromocytoma PC12 cell lines), adopted as models in oxidative stress related studies. Using the MTT (3-[4,5-dimethylthiazol-2-yl]-2,5-diphenyltetrazolium bromide) assay NIH 3T3 proliferation was assessed and the morphology was not compromised by direct exposure to the materials. Analogously, PC-12, and U-251 cell lines were not affected by new materials. SH-SY5Y appeared to be the most sensitive cell line with cytotoxic effects of 20–35%. - Highlights: • SiO{sub 2}/PEG quercetin organic-inorganic hybrids were synthesized via sol-gel. • The formation of apatite on materials surface after SBF proved their bioactivity. • Viability of NIH-3T3 cells was significantly increased by exposure to the hybrids. • Viability of PC-12 and U-251 cell lines was not affected by new materials. • SH-SY5Y cell proliferation was inhibited and their morphology was changed by hybrids.
Zeng, Zhiwen; Wang, Dejun; Gaur, Uma; Rifang, Liao; Wang, Haitao; Zheng, Wenhua
2017-09-12
Impairment of insulin-like growth factor I (IGF-I) signaling plays an important role in the development of neurodegeneration. In the present study, we investigated the effect of H 2 O 2 on the survival signaling of IGF-1 and its underlying mechanisms in human neuronal cells SH-SY5Y. Our results showed that IGF-1 promoted cell survival and stimulated phosphorylation of IGF-1R as well as its downstream targets like AKT and ERK1/2 in these cells. Meanwhile, these effects of IGF-1 were abolished by H 2 O 2 at 200μM concentration which did not cause any significant toxicity to cells itself in our experiments. Moreover, studies using various glutamate receptor subtype antagonists displayed that N-methyl-D -aspartate (NMDA) receptor antagonist dizocilpine maleate (MK-801) blocked the effects of H 2 O 2 , whereas other glutamate receptor subtype antagonists, such as non-NMDA receptor antagonist 6,7-dinitroquinoxaline-2,3-dione (DNQX), metabolic glutamate receptor antagonists LY341495 and CPCCOEt, had no effect. Further studies revealed that NR2B-containing NMDARs are responsible for these effects as its effects were blocked by pharmacological inhibitor Ro25-698 or specific siRNA for NR2B, but not NR2A. Finally, our data also showed that Ca 2+ influx contributes to the effects of H 2 O 2 . Similar results were obtained in primary cultured cortical neurons. Taken together, the results from the present study suggested that H 2 O 2 attenuated IGF-1R tyrosine phosphorylation and its survival signaling properties via NR2B containing NMDA receptors and Ca 2+ influx in SH-SY5Y cells. Therefore, NMDAR antagonists, especially NR2B-selective ones, combined with IGF-1 may serve as an alternative therapeutic agent for oxidative stress related neurodegenerative disease.
Directory of Open Access Journals (Sweden)
Yejin Ha
2017-07-01
Full Text Available In the brain, nitric oxide (NO and carbon monoxide (CO are important signaling gases which have multifaceted roles, such as neurotransmitters, neuromodulators, and vasodilators. Even though it is difficult to measure NO and CO in a living system due to their high diffusibility and extremely low release levels, electrochemical sensors are promising tools to measure in vivo and in vitro NO and CO gases. In this paper, using amperometric dual and septuple NO/CO microsensors, real-time NO and CO changes evoked by glutamate were monitored simultaneously for human neuroblastoma (SH-SY5Y cells. In cultures, the cells were differentiated and matured into functional neurons by retinoic acid and brain-derived neurotrophic factor. When glutamate was administrated to the cells, both NO and CO increases and subsequent decreases returning to the basal levels were observed with a dual NO/CO microsensor. In order to facilitate sensor’s measurement, a flower-type septuple NO/CO microsensor was newly developed and confirmed in terms of the sensitivity and selectivity. The septuple microsensor was employed for the measurements of NO and CO changes as a function of distances from the position of glutamate injection. Our sensor measurements revealed that only functionally differentiated cells responded to glutamate and released NO and CO.
Tong, Jiefei; Cao, Biyin; Martyn, Gregory D; Krieger, Jonathan R; Taylor, Paul; Yates, Bradley; Sidhu, Sachdev S; Li, Shawn S C; Mao, Xinliang; Moran, Michael F
2017-03-01
Recently, "superbinder" SH2 domain variants with three amino acid substitutions (sSH2) were reported to have 100-fold or greater affinity for protein-phosphotyrosine (pY) than natural SH2 domains. Here we report a protocol in which His-tagged Src sSH2 efficiently captures pY-peptides from protease-digested HeLa cell total protein extracts. Affinity purification of pY-peptides by this method shows little bias for pY-proximal amino acid sequences, comparable to that achieved by using antibodies to pY, but with equal or higher yield. Superbinder-SH2 affinity purification mass spectrometry (sSH2-AP-MS) therefore provides an efficient and economical approach for unbiased pY-directed phospho-proteome profiling without the use of antibodies. © 2016 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim.
Human ClC-6 is a late endosomal glycoprotein that associates with detergent-resistant lipid domains.
Directory of Open Access Journals (Sweden)
Sofie Ignoul
Full Text Available BACKGROUND: The mammalian CLC protein family comprises nine members (ClC-1 to -7 and ClC-Ka, -Kb that function either as plasma membrane chloride channels or as intracellular chloride/proton antiporters, and that sustain a broad spectrum of cellular processes, such as membrane excitability, transepithelial transport, endocytosis and lysosomal degradation. In this study we focus on human ClC-6, which is structurally most related to the late endosomal/lysomal ClC-7. PRINCIPAL FINDINGS: Using a polyclonal affinity-purified antibody directed against a unique epitope in the ClC-6 COOH-terminal tail, we show that human ClC-6, when transfected in COS-1 cells, is N-glycosylated in a region that is evolutionary poorly conserved between mammalian CLC proteins and that is located between the predicted helices K and M. Three asparagine residues (N410, N422 and N432 have been defined by mutagenesis as acceptor sites for N-glycosylation, but only two of the three sites seem to be simultaneously N-glycosylated. In a differentiated human neuroblastoma cell line (SH-SY5Y, endogenous ClC-6 colocalizes with LAMP-1, a late endosomal/lysosomal marker, but not with early/recycling endosomal markers such as EEA-1 and transferrin receptor. In contrast, when transiently expressed in COS-1 or HeLa cells, human ClC-6 mainly overlaps with markers for early/recycling endosomes (transferrin receptor, EEA-1, Rab5, Rab4 and not with late endosomal/lysosomal markers (LAMP-1, Rab7. Analogously, overexpression of human ClC-6 in SH-SY5Y cells also leads to an early/recycling endosomal localization of the exogenously expressed ClC-6 protein. Finally, in transiently transfected COS-1 cells, ClC-6 copurifies with detergent-resistant membrane fractions, suggesting its partitioning in lipid rafts. Mutating a juxtamembrane string of basic amino acids (amino acids 71-75: KKGRR disturbs the association with detergent-resistant membrane fractions and also affects the segregation of ClC-6
Brütting, Christine; Narasimhan, Harini; Hoffmann, Frank; Kornhuber, Malte E; Staege, Martin S; Emmer, Alexander
2018-01-01
Human endogenous retroviruses (ERVs) have been found to be associated with different diseases, e.g., multiple sclerosis (MS). Most human ERVs integrated in our genome are not competent to replicate and these sequences are presumably silent. However, transcription of human ERVs can be reactivated, e.g., by hypoxia. Interestingly, MS has been linked to hypoxia since decades. As some patterns of demyelination are similar to white matter ischemia, hypoxic damage is discussed. Therefore, we are interested in the association between hypoxia and ERVs. As a model, we used human SH-SY5Y neuroblastoma cells after treatment with the hypoxia-mimetic cobalt chloride and analyzed differences in the gene expression profiles in comparison to untreated cells. The vicinity of up-regulated genes was scanned for endogenous retrovirus-derived sequences. Five genes were found to be strongly up-regulated in SH-SY5Y cells after treatment with cobalt chloride: clusterin, glutathione peroxidase 3, insulin-like growth factor 2, solute carrier family 7 member 11, and neural precursor cell expressed developmentally down-regulated protein 9. In the vicinity of these genes we identified large (>1,000 bp) open reading frames (ORFs). Most of these ORFs showed only low similarities to proteins from retro-transcribing viruses. However, we found very high similarity between retrovirus envelope sequences and a sequence in the vicinity of neural precursor cell expressed developmentally down-regulated protein 9. This sequence encodes the human endogenous retrovirus group FRD member 1, the encoded protein product is called syncytin 2. Transfection of syncytin 2 into the well-characterized Ewing sarcoma cell line A673 was not able to modulate the low immunostimulatory activity of this cell line. Future research is needed to determine whether the identified genes and the human endogenous retrovirus group FRD member 1 might play a role in the etiology of MS.
DEFF Research Database (Denmark)
Emdal, Kristina B; Pedersen, Anna-Kathrine; Bekker-Jensen, Dorte B
2015-01-01
SH-SY5Y neuroblastoma cells respond to nerve growth factor (NGF)-mediated activation of the tropomyosin-related kinase A (TrkA) with neurite outgrowth, thereby providing a model to study neuronal differentiation. We performed a time-resolved analysis of NGF-TrkA signaling in neuroblastoma cells...... then becomes phosphorylated and ubiquitylated and decreases in abundance. We also found that recruitment of Cbl-b promotes TrkA ubiquitylation and degradation. Furthermore, the amount of phosphorylation of the kinase ERK and neurite outgrowth increased upon Cbl-b depletion in several neuroblastoma cell lines...
Chuang, Dennis Y; Simonyi, Agnes; Cui, Jiankun; Lubahn, Dennis B; Gu, Zezong; Sun, Grace Y
2016-09-01
Microglia play a significant role in the generation and propagation of oxidative/nitrosative stress, and are the basis of neuroinflammatory responses in the central nervous system. Upon stimulation by endotoxins such as lipopolysaccharides (LPS), these cells release pro-inflammatory factors which can exert harmful effects on surrounding neurons, leading to secondary neuronal damage and cell death. Our previous studies demonstrated the effects of botanical polyphenols to mitigate inflammatory responses induced by LPS, and highlighted an important role for cytosolic phospholipase A2 (cPLA2) upstream of the pro-inflammatory pathways (Chuang et al. in J Neuroinflammation 12(1):199, 2015. doi: 10.1186/s12974-015-0419-0 ). In this study, we investigate the action of botanical compounds and assess whether suppression of cPLA2 in microglia is involved in the neurotoxic effects on neurons. Differentiated SH-SY5Y neuroblastoma cells were used to test the neurotoxicity of conditioned medium from stimulated microglial cells, and WST-1 assay was used to assess for the cell viability of SH-SY5Y cells. Botanicals such as quercetin and honokiol (but not cyanidin-3-O-glucoside, 3CG) were effective in inhibiting LPS-induced nitric oxide (NO) production and phosphorylation of cPLA2. Conditioned medium from BV-2 cells stimulated with LPS or IFNγ caused neurotoxicity to SH-SY5Y cells. Decrease in cell viability could be ameliorated by pharmacological inhibitors for cPLA2 as well as by down-regulating cPLA2 with siRNA. Botanicals effective in inhibition of LPS-induced NO and cPLA2 phosphorylation were also effective in ameliorating microglial-induced neurotoxicity. Results demonstrated cytotoxic factors from activated microglial cells to cause damaging effects to neurons and potential use of botanical polyphenols to ameliorate the neurotoxic effects.
Piperidine alkaloids are found in many species of plants including Conium maculatum, Nicotiana spp., and Lupinus spp. A pharmacodynamic comparison was made of the alkaloids ammodendrine, anabasine, anabaseine, and coniine in; SH-SY5Y cells which express autonomic-type nicotinic acetylcholine recept...
Swirski, Marta; Miners, J Scott; de Silva, Rohan; Lashley, Tammaryn; Ling, Helen; Holton, Janice; Revesz, Tamas; Love, Seth
2014-01-01
Introduction Lewy body and Alzheimer-type pathologies often co-exist. Several studies suggest a synergistic relationship between amyloid-β (Aβ) and α-synuclein (α-syn) accumulation. We have explored the relationship between Aβ accumulation and the phosphorylation of α-syn at serine-129 (pSer129 α-syn), in post-mortem human brain tissue and in SH-SY5Y neuroblastoma cells transfected to overexpress human α-syn. Methods We measured levels of Aβ40, Aβ42, α-syn and pSer129 α-syn by sandwich enzyme...
Schweigel, Hardy; Geiger, Jörg; Beck, Florian; Buhs, Sophia; Gerull, Helwe; Walter, Ulrich; Sickmann, Albert; Nollau, Peter
2013-03-01
Tyrosine phosphorylation plays a central role in signal transduction controlling many important biological processes. In platelets, the activity of several signaling proteins is controlled by tyrosine phosphorylation ensuring proper platelet activation and aggregation essential for regulation of the delicate balance between bleeding and hemostasis. Here, we applied Src-homology 2 region (SH2)-profiling for deciphering of the phosphotyrosine state of human platelets activated by adenosine diphosphate (ADP). Applying a panel of 31 SH2-domains, rapid and complex regulation of the phosphotyrosine state of platelets was observed after ADP stimulation. Specific inhibition of platelet P2Y receptors by synthetic drugs revealed a major role for the P2Y1 receptor in tyrosine phosphorylation. Concomitant activation of protein kinase A (PKA) abolished ADP-induced tyrosine phosphorylation in a time and concentration-dependent manner. Given the fact that PKA activity is negatively regulated by the P2Y12 receptor, our data provide evidence for a novel link of synergistic control of the state of tyrosine phosphorylation by both P2Y receptors. By SH2 domain pull down and MS/MS analysis, we identified distinct tyrosine phosphorylation sites in cell adhesion molecules, intracellular adapter proteins and phosphatases suggesting a major, functional role of tyrosine phosphorylation of theses candidate proteins in ADP-dependent signaling in human platelets. © 2013 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim.
Caspase cleaved presenilin-1 is part of active gamma-secretase complexes
DEFF Research Database (Denmark)
Hansson, Camilla A; Popescu, Bogdan O; Laudon, Hanna
2006-01-01
, and Abeta is believed to be central for the molecular pathogenesis of AD. Apoptosis has been implicated as one of the mechanisms behind the neuronal cell loss seen in AD. We have studied preservation and activity of the gamma-secretase complex during apoptosis in neuroblastoma cells (SH-SY5Y) exposed...
Mesenchymal Stem Cell-Derived Factors Restore Function to Human Frataxin-Deficient Cells.
Kemp, Kevin; Dey, Rimi; Cook, Amelia; Scolding, Neil; Wilkins, Alastair
2017-08-01
Friedreich's ataxia is an inherited neurological disorder characterised by mitochondrial dysfunction and increased susceptibility to oxidative stress. At present, no therapy has been shown to reduce disease progression. Strategies being trialled to treat Friedreich's ataxia include drugs that improve mitochondrial function and reduce oxidative injury. In addition, stem cells have been investigated as a potential therapeutic approach. We have used siRNA-induced knockdown of frataxin in SH-SY5Y cells as an in vitro cellular model for Friedreich's ataxia. Knockdown of frataxin protein expression to levels detected in patients with the disorder was achieved, leading to decreased cellular viability, increased susceptibility to hydrogen peroxide-induced oxidative stress, dysregulation of key anti-oxidant molecules and deficiencies in both cell proliferation and differentiation. Bone marrow stem cells are being investigated extensively as potential treatments for a wide range of neurological disorders, including Friedreich's ataxia. The potential neuroprotective effects of bone marrow-derived mesenchymal stem cells were therefore studied using our frataxin-deficient cell model. Soluble factors secreted by mesenchymal stem cells protected against cellular changes induced by frataxin deficiency, leading to restoration in frataxin levels and anti-oxidant defences, improved survival against oxidative stress and stimulated both cell proliferation and differentiation down the Schwann cell lineage. The demonstration that mesenchymal stem cell-derived factors can restore cellular homeostasis and function to frataxin-deficient cells further suggests that they may have potential therapeutic benefits for patients with Friedreich's ataxia.
Germacranes and m-Menthane from Illicium lanceolatum
Directory of Open Access Journals (Sweden)
Ming Zhao
2014-04-01
Full Text Available Three new germacrane sesquiterpenes and a new m-menthane monoterpene were isolated together with four known compounds from the pericarp of Illicium lanceolatum, an adulterant to star anise (Illicium verum. All compounds were isolated from Illicium plants for the first time. The absolute stereochemistry of all germacranes and m-menthane was established by a combination of NMR and the modified Mosher’s ester method. The biological activity was evaluated on SH-SY5Y neuroblastoma cell line. (1S,5R,7R-1,5-Dihydroxygermacra-4(15,10(14,11(12-triene (at 62.5 µM and (1R,5R,7R-1,5-dihydroxygermacra-4(15,10(14,11(12-triene (at 15.6 µM promoted the proliferation of SH-SY5Y by 36.2% and 45.8%, respectively, after 48 h incubation, indicating potential neurotrophic activity.
Lou, Haiyan; Jing, Xu; Wei, Xinbing; Shi, Huanying; Ren, Dongmei; Zhang, Xiumei
2014-04-01
There is increasing evidence that oxidative stress is critically involved in the pathogenesis of Parkinson's disease (PD), suggesting that pharmacological targeting of the antioxidant machinery may have therapeutic value. Naringenin, a natural flavonoid compound, has been reported to possess neuroprotective effect against PD related pathology; however the mechanisms underlying its beneficial effects are poorly defined. Thus, the purpose of the present study was to investigate the potential neuroprotective role of naringenin and to delineate its mechanism of action against 6-hydroxydopamine (6-OHDA)-induced neurotoxicity in models of PD both in vitro and in vivo. Naringenin treatment resulted in an increase in nuclear factor E2-related factor 2 (Nrf2) protein levels and subsequent activation of antioxidant response element (ARE) pathway genes in SH-SY5Y cells and in mice. Exposure of SH-SY5Y cells to naringenin provided protection against 6-OHDA-induced oxidative insults that was dependent on Nrf2, since treatment with Nrf2 siRNA failed to block against 6-OHDA neurotoxicity or induce Nrf2-dependent cytoprotective genes in SH-SY5Y cells. In mice, oral administration of naringenin resulted in significant protection against 6-OHDA-induced nigrostriatal dopaminergic neurodegeneration and oxidative damage. Our results indicate that activation of Nrf2/ARE signaling by naringenin is strongly associated with its neuroprotective effects against 6-OHDA neurotoxicity and suggest that targeting the Nrf2/ARE pathway may be a promising approach for therapeutic intervention in PD. Copyright © 2013 Elsevier Ltd. All rights reserved.
Directory of Open Access Journals (Sweden)
Schäfer Reinhold
2010-06-01
Full Text Available Abstract Background Signal transduction processes mediated by phosphatidyl inositol phosphates affect a broad range of cellular processes such as cell cycle progression, migration and cell survival. The protein kinase AKT is one of the major effectors in this signaling network. Chronic AKT activation contributes to oncogenic transformation and tumor development. Therefore, analogs of phosphatidyl inositol phosphates (PIAs were designed as new small drugs to block AKT activity for cancer treatment. Here we characterize the biological effects of the PIAs SH-5 and SH-6 in colorectal cancer cell lines. Methods Serum-starved or serum-supplemented human colorectal cancer cell lines SW480, HT29 and HCT116 were exposed to SH-5 and SH-6. AKT activation was determined by western blotting. Cell viability was assessed using a colorimetric XTT-based assay, apoptosis and cell cycle changes were monitored by FACS analysis. The dynamics of cell morphology alterations was evaluated by confocal and time-lapse microscopy. Transcriptional changes due to inhibitor treatment were analyzed using Affymetrix HG-U133A microarrays and RT-PCR. Results While the PIAs clearly reduce AKT phosphorylation in serum starved cells, we did not observe a significant reduction under serum supplemented conditions, giving us the opportunity to analyze AKT independent effects of these compounds. Both inhibitors induce broadly the same morphological alterations, in particular changes in cell shape and formation of intracellular vesicles. Moreover, we observed the induction of binucleated cells specifically in the SW480 cell line. Gene expression analysis revealed transcriptional alterations, which are mostly cell line specific. In accordance to the phenotype we found a gene group associated with mitosis and spindle organization down regulated in SW480 cells, but not in the other cell lines. A bioinformatics analysis using the Connectivity Map linked the gene expression pattern of the
International Nuclear Information System (INIS)
Krech, Till; Thiede, Margarethe; Hilgenberg, Ellen; Schäfer, Reinhold; Jürchott, Karsten
2010-01-01
Signal transduction processes mediated by phosphatidyl inositol phosphates affect a broad range of cellular processes such as cell cycle progression, migration and cell survival. The protein kinase AKT is one of the major effectors in this signaling network. Chronic AKT activation contributes to oncogenic transformation and tumor development. Therefore, analogs of phosphatidyl inositol phosphates (PIAs) were designed as new small drugs to block AKT activity for cancer treatment. Here we characterize the biological effects of the PIAs SH-5 and SH-6 in colorectal cancer cell lines. Serum-starved or serum-supplemented human colorectal cancer cell lines SW480, HT29 and HCT116 were exposed to SH-5 and SH-6. AKT activation was determined by western blotting. Cell viability was assessed using a colorimetric XTT-based assay, apoptosis and cell cycle changes were monitored by FACS analysis. The dynamics of cell morphology alterations was evaluated by confocal and time-lapse microscopy. Transcriptional changes due to inhibitor treatment were analyzed using Affymetrix HG-U133A microarrays and RT-PCR. While the PIAs clearly reduce AKT phosphorylation in serum starved cells, we did not observe a significant reduction under serum supplemented conditions, giving us the opportunity to analyze AKT independent effects of these compounds. Both inhibitors induce broadly the same morphological alterations, in particular changes in cell shape and formation of intracellular vesicles. Moreover, we observed the induction of binucleated cells specifically in the SW480 cell line. Gene expression analysis revealed transcriptional alterations, which are mostly cell line specific. In accordance to the phenotype we found a gene group associated with mitosis and spindle organization down regulated in SW480 cells, but not in the other cell lines. A bioinformatics analysis using the Connectivity Map linked the gene expression pattern of the inhibitor treated SW480 cells to PKC signaling. Using
PREVALENCE OF Y CHROMOSOME MICRODELETIONS IN IRANIAN INFERTILE MEN
Directory of Open Access Journals (Sweden)
F. Akbari Asbagh
2003-07-01
Full Text Available This study was designed to determine the frequency of Y chromosome AZF (Azoospermia Factor subregions, microdeletions in patients with idiopathic nonobstructive azoospermia and severe oligozoospermia. Subjects included 40 men who had been referred to infertility clinics for assisted reproduction, 37 were azoospermic and 3 had severe oligospermia. Medical history and physical exam revealed no evidence of infection, obstruction of seminal tract, endocrine failure or chromosomal anomalies. Hormonal study was performed for all patients. Twenty six men had biopsies of the testes including 11 patients with hypospermatogenesis, 9 patients with maturation arrest, 4 patients with sertoli cell only syndrome and 2 patients with tubular sclerosis. In 14 men who did not have a testicular biopsy multiple, epididymal and testicular sperm aspirations under anesthesia failed and testicular sperm extraction was subsequently performed for ICSI. DNA was isolated from blood samples. Polymerase chain reaction (PCR amplification of 11 loci spanning the AZFa, AZFb and AZFc subregions of the Y chromosome using sY81, sY83, sY127, sY130, sY131, sY147, sY149, sY157, sY158, sY254 and sY276 was performed. Microdeletions of the Y chromosome were found in two of the patients (5%, who had azoospermia. Deletions were restricted to DAZ (deleted in azoospermia locus in AZFc subregion. One of the patients had a history of cryptorchidism and the second had undergone a left side varicocelectomy. Testicular pathology showed sertoli cell only syndrome in both of them. Our experience adds to the current logic that men with azoospermia or severe oligospermia should be evaluated for Yq11 microdeletions before deciding to operate varicoceles or else scheduling them for assisted reproductive techniques.
Bace1 activity impairs neuronal glucose metabolism: rescue by beta-hydroxybutyrate and lipoic acid
Directory of Open Access Journals (Sweden)
John A Findlay
2015-10-01
Full Text Available Glucose hypometabolism and impaired mitochondrial function in neurons have been suggested to play early and perhaps causative roles in Alzheimer’s disease (AD pathogenesis. Activity of the aspartic acid protease, beta-site amyloid precursor protein (APP cleaving enzyme 1 (BACE1, responsible for beta amyloid peptide generation, has recently been demonstrated to modify glucose metabolism. We therefore examined, using a human neuroblastoma (SH-SY5Y cell line, whether increased BACE1 activity is responsible for a reduction in cellular glucose metabolism. Overexpression of active BACE1, but not a protease-dead mutant BACE1, protein in SH-SY5Y cells reduced glucose oxidation and the basal oxygen consumption rate, which was associated with a compensatory increase in glycolysis. Increased BACE1 activity had no effect on the mitochondrial electron transfer process but was found to diminish substrate delivery to the mitochondria by inhibition of key mitochondrial decarboxylation reaction enzymes. This BACE1 activity-dependent deficit in glucose oxidation was alleviated by the presence of beta hydroxybutyrate or α-lipoic acid. Consequently our data indicate that raised cellular BACE1 activity drives reduced glucose oxidation in a human neuronal cell line through impairments in the activity of specific tricarboxylic acid cycle enzymes. Because this bioenergetic deficit is recoverable by neutraceutical compounds we suggest that such agents, perhaps in conjunction with BACE1 inhibitors, may be an effective therapeutic strategy in the early-stage management or treatment of AD.
Directory of Open Access Journals (Sweden)
Lin PY
2015-10-01
Full Text Available Pao-Yen Lin1,2 1Department of Psychiatry, Kaohsiung Chang Gung Memorial Hospital, Chang Gung University College of Medicine, 2Center for Translational Research in Biomedical Sciences, Kaohsiung Chang Gung Memorial Hospital, Kaohsiung, Taiwan Abstract: Evidence has supported the role of brain-derived neurotrophic factor (BDNF in antidepressant effect. The precursor of BDNF (proBDNF often exerts opposing biological effects on mature BDNF (mBDNF. Hence, the balance between proBDNF and mBDNF might be critical in total neurotrophic effects, leading to susceptibility to or recovery from depression. In the current study, we measured the protein expression levels of proBDNF, and its proteolytic products, truncated BDNF, and mBDNF, in human SH-SY5Y cells treated with different antidepressants. We found that the treatment significantly increased the production of mBDNF, but decreased the production of truncated BDNF and proBDNF. These results support that antidepressants can promote proBDNF cleavage. Further studies are needed to clarify whether proBDNF cleavage plays a role in antidepressant mechanisms. Keywords: antidepressant, mature BDNF, neurotrophic effect, proBDNF cleavage
Cui, Li; Xu, Shuaimei; Ma, Dandan; Gao, Jie; Liu, Ying; Yue, Jing; Wu, Buling
2014-02-01
It has been reported that integrin-α5 (ITGA5) activity is related to cell proliferation, differentiation, migration, and organ development. However, the involvement of ITGA5 in the biological functions of human dental pulp stem cells (hDPSCs) has not been explored. The aim of this study was to investigate the role of ITGA5 in the proliferation and odontogenic differentiation of hDPSCs. We knocked down ITGA5 in hDPSCs using lentivirus-mediated ITGA5 short hairpin RNA (shRNA). Changes in the proliferation in hDPSCs infected with lentiviruses expressing ITGA5-specific shRNA or negative control shRNA were examined using the 3-(4,5-Dimethylthiazol-2-yl)-2,5-diphenyltetrazolium bromide (MTT) assay and 5-ethynyl-2'-deoxyuridine labeling. Both ITGA5 knockdown cells and shMock cells were cultured in mineralization medium for 3 weeks, and the differentiation of cells was detected with alizarin red S staining. The expression of odontogenic differentiation-related molecular markers was assessed using real-time polymerase chain reaction and Western blot assays. The knockdown of ITGA5 decreased the proliferation capacity of hDPSCs. ITGA5 shRNA promoted odontogenic differentiation of hDPSCs with the enhanced formation of mineralized nodules. It also up-regulated the messenger RNA expression of multiple markers of odontogenesis and the expression of dentin sialophosphoprotein protein. These findings suggest that ITGA5 plays an important role in maintaining hDPSCs in a proliferative state. The inhibition of ITGA5 signaling promotes the odontogenic differentiation of hDPSCs. Copyright © 2014 American Association of Endodontists. Published by Elsevier Inc. All rights reserved.
Kinase activation through dimerization by human SH2-B.
Nishi, Masahiro; Werner, Eric D; Oh, Byung-Chul; Frantz, J Daniel; Dhe-Paganon, Sirano; Hansen, Lone; Lee, Jongsoon; Shoelson, Steven E
2005-04-01
The isoforms of SH2-B, APS, and Lnk form a family of signaling proteins that have been described as activators, mediators, or inhibitors of cytokine and growth factor signaling. We now show that the three alternatively spliced isoforms of human SH2-B readily homodimerize in yeast two-hybrid and cellular transfections assays, and this is mediated specifically by a unique domain in its amino terminus. Consistent with previous reports, we further show that the SH2 domains of SH2-B and APS bind JAK2 at Tyr813. These findings suggested a model in which two molecules of SH2-B or APS homodimerize with their SH2 domains bound to two JAK2 molecules, creating heterotetrameric JAK2-(SH2-B)2-JAK2 or JAK2-(APS)2-JAK2 complexes. We further show that APS and SH2-B isoforms heterodimerize. At lower levels of SH2-B or APS expression, dimerization approximates two JAK2 molecules to induce transactivation. At higher relative concentrations of SH2-B or APS, kinase activation is blocked. SH2-B or APS homodimerization and SH2-B/APS heterodimerization thus provide direct mechanisms for activating and inhibiting JAK2 and other kinases from the inside of the cell and for potentiating or attenuating cytokine and growth factor receptor signaling when ligands are present.
SH2 Domains Serve as Lipid-Binding Modules for pTyr-Signaling Proteins.
Park, Mi-Jeong; Sheng, Ren; Silkov, Antonina; Jung, Da-Jung; Wang, Zhi-Gang; Xin, Yao; Kim, Hyunjin; Thiagarajan-Rosenkranz, Pallavi; Song, Seohyeon; Yoon, Youngdae; Nam, Wonhee; Kim, Ilshin; Kim, Eui; Lee, Dong-Gyu; Chen, Yong; Singaram, Indira; Wang, Li; Jang, Myoung Ho; Hwang, Cheol-Sang; Honig, Barry; Ryu, Sungho; Lorieau, Justin; Kim, You-Me; Cho, Wonhwa
2016-04-07
The Src-homology 2 (SH2) domain is a protein interaction domain that directs myriad phosphotyrosine (pY)-signaling pathways. Genome-wide screening of human SH2 domains reveals that ∼90% of SH2 domains bind plasma membrane lipids and many have high phosphoinositide specificity. They bind lipids using surface cationic patches separate from pY-binding pockets, thus binding lipids and the pY motif independently. The patches form grooves for specific lipid headgroup recognition or flat surfaces for non-specific membrane binding and both types of interaction are important for cellular function and regulation of SH2 domain-containing proteins. Cellular studies with ZAP70 showed that multiple lipids bind its C-terminal SH2 domain in a spatiotemporally specific manner and thereby exert exquisite spatiotemporal control over its protein binding and signaling activities in T cells. Collectively, this study reveals how lipids control SH2 domain-mediated cellular protein-protein interaction networks and suggest a new strategy for therapeutic modulation of pY-signaling pathways. Copyright © 2016 Elsevier Inc. All rights reserved.
Luciani, Paola; Deledda, Cristiana; Benvenuti, Susanna; Squecco, Roberta; Cellai, Ilaria; Fibbi, Benedetta; Marone, Ilaria Maddalena; Giuliani, Corinna; Modi, Giulia; Francini, Fabio; Vannelli, Gabriella Barbara; Peri, Alessandro
2013-01-01
Exendin-4 is a molecule currently used, in its synthetic form exenatide, for the treatment of type 2 diabetes mellitus. Exendin-4 binds and activates the Glucagon-Like Peptide-1 Receptor (GLP-1R), thus inducing insulin release. More recently, additional biological properties have been associated to molecules that belong to the GLP-1 family. For instance, Peptide YY and Vasoactive Intestinal Peptide have been found to affect cell adhesion and migration and our previous data have shown a considerable actin cytoskeleton rearrangement after exendin-4 treatment. However, no data are currently available on the effects of exendin-4 on tumor cell motility. The aim of this study was to investigate the effects of this molecule on cell adhesion, differentiation and migration in two neuroblastoma cell lines, SH-SY5Y and SK-N-AS. We first demonstrated, by Extra Cellular Matrix cell adhesion arrays, that exendin-4 increased cell adhesion, in particular on a vitronectin substrate. Subsequently, we found that this molecule induced a more differentiated phenotype, as assessed by i) the evaluation of neurite-like protrusions in 3D cell cultures, ii) the analysis of the expression of neuronal markers and iii) electrophysiological studies. Furthermore, we demonstrated that exendin-4 reduced cell migration and counteracted anchorage-independent growth in neuroblastoma cells. Overall, these data indicate for the first time that exendin-4 may have anti-tumoral properties.
Lee, Eunyoung; Eom, Ji-Eun; Kim, Hye-Lin; Kang, Da-Hye; Jun, Kyu-Yeon; Jung, Duk Sang; Kwon, Youngjoo
2012-05-12
The key neuropathological features of Alzheimer's disease are abnormal deposition of Aβ plaques and insoluble Aβ peptides in extracellular brain and intracellular neurofibril tangles induced by abnormal tau hyperphosphorylation. μ-Calpain is one of the factors that bridge these Aβ- and hyperphosphorylated tau-mediated pathological pathways. Undecylenic acid (UDA), a naturally occurring unsaturated fatty acid, was discovered as a μ-calpain inhibitor by screening a chemical library using a substrate specific μ-calpain assay method. UDA inhibited Aβ oligomerization and Aβ fibrillation and reversed Aβ-induced neuronal cell death. In addition, UDA scavenged ROS and reversed the levels of proapoptotic proteins induced by ROS in SH-SY5Y cells. UDA inhibited μ-calpain activity with better potency than the known peptide-like μ-calpain inhibitor, MDL28170, in SH-SY5Y and HEK293T cells transfected with the catalytic subunit of μ-calpain. These results suggest that UDA is a novel non-peptide-like μ-calpain inhibitor with good cell permeability and potent neuroprotective effect. Copyright © 2012 Elsevier B.V. All rights reserved.
Ma, Hang; DaSilva, Nicholas A; Liu, Weixi; Nahar, Pragati P; Wei, Zhengxi; Liu, Yongqiang; Pham, Priscilla T; Crews, Rebecca; Vattem, Dhiraj A; Slitt, Angela L; Shaikh, Zahir A; Seeram, Navindra P
2016-11-01
Published data supports the neuroprotective effects of several phenolic-containing natural products, including certain fruit, berries, spices, nuts, green tea, and olive oil. However, limited data are available for phenolic-containing plant-derived natural sweeteners including maple syrup. Herein, we investigated the neuroprotective effects of a chemically standardized phenolic-enriched maple syrup extract (MSX) using a combination of biophysical, in vitro, and in vivo studies. Based on biophysical data (Thioflavin T assay, transmission electron microscopy, circular dichroism, dynamic light scattering, and zeta potential), MSX reduced amyloid β 1-42 peptide (Aβ 1-42 ) fibrillation in a concentration-dependent manner (50-500 μg/mL) with similar effects as the neuroprotective polyphenol, resveratrol, at its highest test concentration (63.5 % at 500 μg/mL vs. 77.3 % at 50 μg/mL, respectively). MSX (100 μg/mL) decreased H 2 O 2 -induced oxidative stress (16.1 % decrease in ROS levels compared to control), and down-regulated the production of lipopolysaccharide (LPS)-stimulated inflammatory markers (22.1, 19.9, 74.8, and 87.6 % decrease in NOS, IL-6, PGE 2 , and TNFα levels, respectively, compared to control) in murine BV-2 microglial cells. Moreover, in a non-contact co-culture cell model, differentiated human SH-SY5Y neuronal cells were exposed to conditioned media from BV-2 cells treated with MSX (100 μg/mL) and LPS or LPS alone. MSX-BV-2 media increased SH-SY5Y cell viability by 13.8 % compared to media collected from LPS-BV-2 treated cells. Also, MSX (10 μg/mL) showed protective effects against Aβ 1-42 induced neurotoxicity and paralysis in Caenorhabditis elegans in vivo. These data support the potential neuroprotective effects of MSX warranting further studies on this natural product.
DNA binding of the p21 repressor ZBTB2 is inhibited by cytosine hydroxymethylation
Energy Technology Data Exchange (ETDEWEB)
Lafaye, Céline; Barbier, Ewa; Miscioscia, Audrey; Saint-Pierre, Christine [Laboratoire Lésions des Acides Nucléiques, Service de Chimie Inorganique et Biologique, UMR E_3 CEA/UJF-Grenoble 1, INAC, 17 rue des Martyrs, Grenoble F-38054 (France); Kraut, Alexandra; Couté, Yohann [Etude de la Dynamique des Protéomes, Biologie à Grande Echelle, UMR S_1038 CEA/INSERM/UJF-Grenoble 1, iRTSV, 17 rue des Martyrs, Grenoble F-38054 (France); Plo, Isabelle [INSERM, U1009, Institut Gustave Roussy, Université Paris 11, 114 rue Edouard Vaillant, Villejuif F-94805 (France); Gasparutto, Didier; Ravanat, Jean-Luc [Laboratoire Lésions des Acides Nucléiques, Service de Chimie Inorganique et Biologique, UMR E_3 CEA/UJF-Grenoble 1, INAC, 17 rue des Martyrs, Grenoble F-38054 (France); Breton, Jean, E-mail: jean.breton@cea.fr [Laboratoire Lésions des Acides Nucléiques, Service de Chimie Inorganique et Biologique, UMR E_3 CEA/UJF-Grenoble 1, INAC, 17 rue des Martyrs, Grenoble F-38054 (France)
2014-03-28
Highlights: • 5-hmC epigenetic modification is measurable in HeLa, SH-SY5Y and UT7-MPL cell lines. • ZBTB2 binds to DNA probes containing 5-mC but not to sequences containing 5-hmC. • This differential binding is verified with DNA sequences involved in p21 regulation. - Abstract: Recent studies have demonstrated that the modified base 5-hydroxymethylcytosine (5-hmC) is detectable at various rates in DNA extracted from human tissues. This oxidative product of 5-methylcytosine (5-mC) constitutes a new and important actor of epigenetic mechanisms. We designed a DNA pull down assay to trap and identify nuclear proteins bound to 5-hmC and/or 5-mC. We applied this strategy to three cancerous cell lines (HeLa, SH-SY5Y and UT7-MPL) in which we also measured 5-mC and 5-hmC levels by HPLC-MS/MS. We found that the putative oncoprotein Zinc finger and BTB domain-containing protein 2 (ZBTB2) is associated with methylated DNA sequences and that this interaction is inhibited by the presence of 5-hmC replacing 5-mC. As published data mention ZBTB2 recognition of p21 regulating sequences, we verified that this sequence specific binding was also alleviated by 5-hmC. ZBTB2 being considered as a multifunctional cell proliferation activator, notably through p21 repression, this work points out new epigenetic processes potentially involved in carcinogenesis.
DNA binding of the p21 repressor ZBTB2 is inhibited by cytosine hydroxymethylation
International Nuclear Information System (INIS)
3 CEA/UJF-Grenoble 1, INAC, 17 rue des Martyrs, Grenoble F-38054 (France))" data-affiliation=" (Laboratoire Lésions des Acides Nucléiques, Service de Chimie Inorganique et Biologique, UMR E3 CEA/UJF-Grenoble 1, INAC, 17 rue des Martyrs, Grenoble F-38054 (France))" >Lafaye, Céline; 3 CEA/UJF-Grenoble 1, INAC, 17 rue des Martyrs, Grenoble F-38054 (France))" data-affiliation=" (Laboratoire Lésions des Acides Nucléiques, Service de Chimie Inorganique et Biologique, UMR E3 CEA/UJF-Grenoble 1, INAC, 17 rue des Martyrs, Grenoble F-38054 (France))" >Barbier, Ewa; 3 CEA/UJF-Grenoble 1, INAC, 17 rue des Martyrs, Grenoble F-38054 (France))" data-affiliation=" (Laboratoire Lésions des Acides Nucléiques, Service de Chimie Inorganique et Biologique, UMR E3 CEA/UJF-Grenoble 1, INAC, 17 rue des Martyrs, Grenoble F-38054 (France))" >Miscioscia, Audrey; 3 CEA/UJF-Grenoble 1, INAC, 17 rue des Martyrs, Grenoble F-38054 (France))" data-affiliation=" (Laboratoire Lésions des Acides Nucléiques, Service de Chimie Inorganique et Biologique, UMR E3 CEA/UJF-Grenoble 1, INAC, 17 rue des Martyrs, Grenoble F-38054 (France))" >Saint-Pierre, Christine; 1038 CEA/INSERM/UJF-Grenoble 1, iRTSV, 17 rue des Martyrs, Grenoble F-38054 (France))" data-affiliation=" (Etude de la Dynamique des Protéomes, Biologie à Grande Echelle, UMR S1038 CEA/INSERM/UJF-Grenoble 1, iRTSV, 17 rue des Martyrs, Grenoble F-38054 (France))" >Kraut, Alexandra; 1038 CEA/INSERM/UJF-Grenoble 1, iRTSV, 17 rue des Martyrs, Grenoble F-38054 (France))" data-affiliation=" (Etude de la Dynamique des Protéomes, Biologie à Grande Echelle, UMR S1038 CEA/INSERM/UJF-Grenoble 1, iRTSV, 17 rue des Martyrs, Grenoble F-38054 (France))" >Couté, Yohann; Plo, Isabelle; 3 CEA/UJF-Grenoble 1, INAC, 17 rue des Martyrs, Grenoble F-38054 (France))" data-affiliation=" (Laboratoire Lésions des Acides Nucléiques, Service de Chimie Inorganique et Biologique, UMR E3 CEA/UJF-Grenoble 1, INAC, 17 rue des Martyrs, Grenoble F-38054 (France))" >Gasparutto, Didier; 3 CEA/UJF-Grenoble 1, INAC, 17 rue des Martyrs, Grenoble F-38054 (France))" data-affiliation=" (Laboratoire Lésions des Acides Nucléiques, Service de Chimie Inorganique et Biologique, UMR E3 CEA/UJF-Grenoble 1, INAC, 17 rue des Martyrs, Grenoble F-38054 (France))" >Ravanat, Jean-Luc; 3 CEA/UJF-Grenoble 1, INAC, 17 rue des Martyrs, Grenoble F-38054 (France))" data-affiliation=" (Laboratoire Lésions des Acides Nucléiques, Service de Chimie Inorganique et Biologique, UMR E3 CEA/UJF-Grenoble 1, INAC, 17 rue des Martyrs, Grenoble F-38054 (France))" >Breton, Jean
2014-01-01
Highlights: • 5-hmC epigenetic modification is measurable in HeLa, SH-SY5Y and UT7-MPL cell lines. • ZBTB2 binds to DNA probes containing 5-mC but not to sequences containing 5-hmC. • This differential binding is verified with DNA sequences involved in p21 regulation. - Abstract: Recent studies have demonstrated that the modified base 5-hydroxymethylcytosine (5-hmC) is detectable at various rates in DNA extracted from human tissues. This oxidative product of 5-methylcytosine (5-mC) constitutes a new and important actor of epigenetic mechanisms. We designed a DNA pull down assay to trap and identify nuclear proteins bound to 5-hmC and/or 5-mC. We applied this strategy to three cancerous cell lines (HeLa, SH-SY5Y and UT7-MPL) in which we also measured 5-mC and 5-hmC levels by HPLC-MS/MS. We found that the putative oncoprotein Zinc finger and BTB domain-containing protein 2 (ZBTB2) is associated with methylated DNA sequences and that this interaction is inhibited by the presence of 5-hmC replacing 5-mC. As published data mention ZBTB2 recognition of p21 regulating sequences, we verified that this sequence specific binding was also alleviated by 5-hmC. ZBTB2 being considered as a multifunctional cell proliferation activator, notably through p21 repression, this work points out new epigenetic processes potentially involved in carcinogenesis
Ubiquitin Proteasome System in Parkinson Disease: a keeper or a witness?
Martins-Branco, Diogo; Esteves, Ana R.; Santos, Daniel; Arduino, Daniela M.; Swerdlow, Russell H.; Oliveira, Catarina R.; Januario, Cristina; Cardoso, Sandra M.
2014-01-01
Objective The aim of this work was to evaluate the role of Ubiquitin-Proteasome System (UPS) on mitochondrial-driven alpha-synuclein (aSN) clearance in in vitro, ex vivo and in vivo Parkinson disease (PD) cellular models. Method We used SH-SY5Y ndufa2 knock-down (KD) cells, PD cybrids and peripheral blood mononuclear cells (PBMC) from patients meeting the diagnostic criteria for PD. We quantified aSN aggregation, proteasome activity and protein ubiquitination levels. In PBMC of PD patients population we evaluated aSN levels in plasma and the influence of several demographic characteristics in the above mentioned determinations. Results We found that ubiquitin-independent proteasome activity was up-regulated in SH-SY5Y ndufa2 KD cells while a down regulation was observed in PD cybrids and PBMC. Moreover, we observed an increase in protein ubiquitination that correlates with a decrease in ubiquitin-dependent proteasome activity. Accordingly, proteasome inhibition prevented ubiquitin-dependent aSN clearance. Ubiquitin-independent proteasome activity was positively correlated with ubiquitination in PBMC. We also report a negative correlation of chymotrypsin-like activity with age in control and late-onset PD groups. Total ubiquitin content is positively correlated with aSN oligomers levels, which leads to an age-dependent increase of aSN ubiquitination in LOPD. Moreover, aSN levels are increased in the plasma of PD patients. Interpretation aSN oligomers are ubiquitinated and we identified an ubiquitin-dependent clearance insufficiency with accumulation of both aSN and ubiquitin. However, SH-SY5Y ndufa2 KD cells showed a significant up-regulation of ubiquitin-independent proteasomal enzymatic activity that could mean a cell rescue attempt. Moreover, we identified that UPS function is age-dependent in PBMC. PMID:22921536
Endogenous S-sulfhydration of PTEN helps protect against modification by nitric oxide
International Nuclear Information System (INIS)
Ohno, Kazuki; Okuda, Kosaku; Uehara, Takashi
2015-01-01
Highlights: • PTEN is S-sulfhydrated endogenously in SH-SY5Y human neuroblastoma cells. • Preventing this modification by knocking down CBS renders PTEN sensitive to NO. • pAkt levels are increased significantly in CBS siRNA-transfected cells. • H 2 S functions as an endogenous regulator of PTEN in neuronal cells. - Abstract: Hydrogen sulfide (H 2 S) is a gaseous regulatory factor produced by several enzymes, and plays a pivotal role in processes such as proliferation or vasodilation. Recent reports demonstrated the physiological and pathophysiological functions of H 2 S in neurons. PTEN is a target of nitric oxide (NO) or hydrogen peroxide, and the oxidative modification of cysteine (Cys) residue(s) attenuates its enzymatic activity. In the present study, we assessed the effect of H 2 S on the direct modification of PTEN and the resulting downstream signaling. A modified biotin switch assay in SH-SY5Y human neuroblastoma cells revealed that PTEN is S-sulfhydrated endogenously. Subsequently, site-directed mutagenesis demonstrated that both Cys71 and Cys124 in PTEN are targets for S-sulfhydration. Further, the knockdown of cystathionine β-synthetase (CBS) using siRNA decreased this modification in a manner that was correlated to amount of H 2 S. PTEN was more sensitive to NO under these conditions. These results suggest that the endogenous S-sulfhydration of PTEN via CBS/H 2 S plays a role in preventing the S-nitrosylation that would inhibition its enzymatic activity under physiological conditions
Endogenous S-sulfhydration of PTEN helps protect against modification by nitric oxide
Energy Technology Data Exchange (ETDEWEB)
Ohno, Kazuki; Okuda, Kosaku; Uehara, Takashi, E-mail: uehara@pharm.okayama-u.ac.jp
2015-01-02
Highlights: • PTEN is S-sulfhydrated endogenously in SH-SY5Y human neuroblastoma cells. • Preventing this modification by knocking down CBS renders PTEN sensitive to NO. • pAkt levels are increased significantly in CBS siRNA-transfected cells. • H{sub 2}S functions as an endogenous regulator of PTEN in neuronal cells. - Abstract: Hydrogen sulfide (H{sub 2}S) is a gaseous regulatory factor produced by several enzymes, and plays a pivotal role in processes such as proliferation or vasodilation. Recent reports demonstrated the physiological and pathophysiological functions of H{sub 2}S in neurons. PTEN is a target of nitric oxide (NO) or hydrogen peroxide, and the oxidative modification of cysteine (Cys) residue(s) attenuates its enzymatic activity. In the present study, we assessed the effect of H{sub 2}S on the direct modification of PTEN and the resulting downstream signaling. A modified biotin switch assay in SH-SY5Y human neuroblastoma cells revealed that PTEN is S-sulfhydrated endogenously. Subsequently, site-directed mutagenesis demonstrated that both Cys71 and Cys124 in PTEN are targets for S-sulfhydration. Further, the knockdown of cystathionine β-synthetase (CBS) using siRNA decreased this modification in a manner that was correlated to amount of H{sub 2}S. PTEN was more sensitive to NO under these conditions. These results suggest that the endogenous S-sulfhydration of PTEN via CBS/H{sub 2}S plays a role in preventing the S-nitrosylation that would inhibition its enzymatic activity under physiological conditions.
Encapsulation of curcumin in polyelectrolyte nanocapsules and their neuroprotective activity
Szczepanowicz, Krzysztof; Jantas, Danuta; Piotrowski, Marek; Staroń, Jakub; Leśkiewicz, Monika; Regulska, Magdalena; Lasoń, Władysław; Warszyński, Piotr
2016-09-01
Poor water solubility and low bioavailability of lipophilic drugs can be potentially improved with the use of delivery systems. In this study, encapsulation of nanoemulsion droplets was utilized to prepare curcumin nanocarriers. Nanosize droplets containing the drug were encapsulated in polyelectrolyte shells formed by the layer-by-layer (LbL) adsorption of biocompatible polyelectrolytes: poly-L-lysine (PLL) and poly-L-glutamic acid (PGA). The size of synthesized nanocapsules was around 100 nm. Their biocompatibility and neuroprotective effects were evaluated on the SH-SY5Y human neuroblastoma cell line using cell viability/toxicity assays (MTT reduction, LDH release). Statistically significant toxic effect was clearly observed for PLL coated nanocapsules (reduction in cell viability about 20%-60%), while nanocapsules with PLL/PGA coating did not evoke any detrimental effects on SH-SY5Y cells. Curcumin encapsulated in PLL/PGA showed similar neuroprotective activity against hydrogen peroxide (H2O2)-induced cell damage, as did 5 μM curcumin pre-dissolved in DMSO (about 16% of protection). Determination of concentration of curcumin in cell lysate confirmed that curcumin in nanocapsules has cell protective effect in lower concentrations (at least 20 times) than when given alone. Intracellular mechanisms of encapsulated curcumin-mediated protection engaged the prevention of the H2O2-induced decrease in mitochondrial membrane potential (MMP) but did not attenuate Reactive Oxygen Species (ROS) formation. The obtained results indicate the utility of PLL/PGA shell nanocapsules as a promising, alternative way of curcumin delivery for neuroprotective purposes with improved efficiency and reduced toxicity.
Covalent modification of cytoskeletal proteins in neuronal cells by tryptamine-4,5-dione
Directory of Open Access Journals (Sweden)
Yoji Kato
2014-01-01
Full Text Available Serotonin, 5-hydroxytryptamine, is a systemic bioactive amine that acts in the gut and brain. As a substrate of myeloperoxidase in vitro, serotonin is oxidized to tryptamine-4,5-dione (TD, which is highly reactive with thiols. In this work, we successively prepared a monoclonal antibody to quinone-modified proteins and found that the antibody preferentially recognizes the TD–thiol adduct. Using the antibody, we observed that the chloride ion, the predominant physiological substrate for myeloperoxidase in vivo, is not competitive toward the enzyme catalyzed serotonin oxidation process, suggesting that serotonin is a plausible physiological substrate for the enzyme in vivo. Immunocytochemical analyses revealed that TD staining was observed in the cytosol of SH-SY5Y neuroblastoma cells while blot analyses showed that some cellular proteins were preferentially modified. Pull-down analyses confirmed that the cytoskeletal proteins tubulins, vimentin, and neurofilament-L were modified. When pure tubulins were exposed to micromolar levels of synthetic TD, self-polymerization was initially enhanced and then suppressed. These results suggest that serotonin oxidation by myeloperoxidase or the action of other oxidants could cause functional alteration of cellular proteins, which may be related to neurodegeneration processes or irritable bowel syndrome.
Therapeutic effects of lentivirus-mediated shRNA targeting of cyclin D1 in human gastric cancer
International Nuclear Information System (INIS)
Seo, Jin-Hee; Jeong, Eui-Suk; Choi, Yang-Kyu
2014-01-01
Gastric cancer is the second most common cause of cancer-related death in males and the fourth in females. Traditional treatment has poor prognosis because of recurrence and systemic side effects. Therefore, the development of new therapeutic strategies is an important issue. Lentivirus-mediated shRNA stably inhibits target genes and can efficiently transduce most cells. Since overexpressed cyclin D1 is closely related to human gastric cancer progression, inhibition of cyclin D1 using specific targeting could be an effective treatment method of human gastric cancer. The therapeutic effect of lentivirus-mediated shRNA targeting of cyclin D1 (ShCCND1) was analyzed both in vitro and in vivo experiments. In vitro, NCI-N87 cells with downregulation of cyclin D1 by ShCCND1 showed significant inhibition of cell proliferation, cell motility, and clonogenicity. Downregulation of cyclin D1 in NCI-N87 cells also resulted in significantly increased G1 arrest and apoptosis. In vivo, stable NCI-N87 cells expressing ShCCND1 were engrafted into nude mice. Then, the cancer-growth inhibition effect of lentivirus was confirmed. To assess lentivirus including ShCCND1 as a therapeutic agent, intratumoral injection was conducted. Tumor growth of the lentivirus-treated group was significantly inhibited compared to growth of the control group. These results are in accordance with the in vitro data and lend support to the mitotic figure count and apoptosis analysis of the tumor mass. The lentivirus-mediated ShCCND1 was constructed, which effectively inhibited growth of NCI-N87-derived cancer both in vitro and in vivo. The efficiency of shRNA knockdown and variation in the degree of inhibition is mediated by different shRNA sequences and cancer cell lines. These experimental results suggest the possibility of developing new gastric cancer therapies using lentivirus-mediated shRNA
Neuroprotective effect of creatine against propionic acid toxicity in ...
African Journals Online (AJOL)
edoja
2013-07-31
Jul 31, 2013 ... Full Length Research Paper. Neuroprotective effect of creatine against propionic acid toxicity in neuroblastoma SH-SY5Y cells in culture. Afaf El-Ansary*, Ghada Abu-Shmais and Abeer Al-Dbass. Biochemistry Department, College of Science, King Saud University, P.O. Box 22452, Zip code 11495, Riyadh, ...
Cytoprotective effects of atmospheric-pressure plasmas against hypoxia-induced neuronal injuries
Yan, Xu; Meng, Zhaozhong; Ouyang, Jiting; Qiao, Yajun; Li, Jiaxin; Jia, Mei; Yuan, Fang; (Ken Ostrikov, Kostya
2018-02-01
Atmospheric pressure plasma jet (APPJ) has recently been the focus of cytoprotective research due to the physiological roles of ROS and RNS. In the current study, we investigated the effect of APPJ treatment on the hypoxia (1% oxygen) induced cell injuries. SH-SY5Y cells were treated by APPJ for different duration and incubated in normoxic condition (20% oxygen) for 5 h followed by 24 h hypoxia treatment. Cell viability was evaluated by lactate dehydrogenase (LDH) release and further monitored using the electric cell-substrate impedance sensing (ECIS) system after APPJ treatment. Results showed that APPJ could reduce cell injuries after 24 h hypoxia, which was consistent with the ECIS results. Furthermore, extracellular NO and H2O2 production was significantly increased with the APPJ treatment. It was also interesting to find that APPJ treatment reduced SH-SY5Y cells proliferation in the hypoxic microenvironment during the first 20 h of hypoxia. Although more work was still need to clarify whether the cell viability maintenance was related to the cell proliferation during hypoxia, our results provide the first evidence of real-time cell viability changes after APPJ treatment under both normoxic and hypoxic conditions, which could provide evidence for the neuroprotective applications of APPJ.
Directory of Open Access Journals (Sweden)
Antonietta R. Farina
2013-01-01
Full Text Available The alternative TrkAIII splice variant is expressed by advanced stage human neuroblastomas (NBs and exhibits oncogenic activity in NB models. In the present study, employing stable transfected cell lines and assays of indirect immunofluorescence, immunoprecipitation, Western blotting, microtubule regrowth, tubulin kinase, and tubulin polymerisation, we report that TrkAIII binds α-tubulin and promotes MT nucleation and assembly at the centrosome. This effect depends upon spontaneous TrkAIII activity, TrkAIII localisation to the centrosome and pericentrosomal area, and the capacity of TrkAIII to bind, phosphorylate, and polymerise tubulin. We propose that this novel role for TrkAIII contributes to MT involvement in the promotion and maintenance of an undifferentiated anaplastic NB cell morphology by restricting and augmenting MT nucleation and assembly at the centrosomal MTOC.
The epigenetic regulation of HIF-1α by SIRT1 in MPP{sup +} treated SH-SY5Y cells
Energy Technology Data Exchange (ETDEWEB)
Dong, Su-Yan; Guo, Yan-Jie; Feng, Ya; Cui, Xin-Xin [Department of Neurology, Shanghai General Hospital, Shanghai Jiao Tong University School of Medicine, Shanghai 200080 (China); Kuo, Sheng-Han [Department of Neurology, College of Physicians and Surgeons, Columbia University, New York (United States); Liu, Te, E-mail: liute1979@126.com [Shanghai Geriatric Institute of Chinese Medicine, Longhua Hospital, Shanghai University of Traditional Chinese Medicine, Shanghai 200031 (China); Wu, Yun-Cheng, E-mail: yunchw@medmail.com.cn [Department of Neurology, Shanghai General Hospital, Shanghai Jiao Tong University School of Medicine, Shanghai 200080 (China)
2016-02-05
Both silent information regulator 1 (SIRT1) and hypoxia inducible factor 1 (HIF-1) have been found to play important roles in the pathophysiology of Parkinson's disease (PD). However, their mechanisms and their relationship still require further study. In the present study, we focused on the change and relationship of SIRT1 and HIF-1α in PD. PD cell models were established by using methyl-4-phenylpyridinium (MPP{sup +}), which induced inhibition of cell proliferation, cell cycle arrest and apoptosis. We found that the expression of HIF-1α and its target genes VEGFA and LDHA increased and that SIRT1 expression was inhibited in MPP{sup +} treated cells. With further analysis, we found that the acetylation of H3K14 combined with the HIF-1α promoter was dramatically increased in cells treated with MPP{sup +}, which resulted in the transcriptional activation of HIF-1α. Moreover, the acetylation of H3K14 and the expression of HIF-1α increased when SIRT1 was knocked down, suggesting that SIRT1 was involved in the epigenetic regulation of HIF-1α. At last, phenformin, another mitochondrial complex1 inhibitor, was used to testify that the increased HIF-1a was not due to off target effects of MPP{sup +}. Therefore, our results support a link between PD and SIRT1/HIF-1α signaling, which may serve as a clue for understanding PD.
Isolation and characterization of a plant growth-promoting rhizobacterium, Serratia sp. SY5.
Koo, So-Yeon; Cho, Kyung-Suk
2009-11-01
The role of plant growth-promoting rhizobacteria (PGPR) in the phytoremediation of heavy-metal-contaminated soils is important in overcoming its limitations for field application. A plant growth-promoting rhizobacterium, Serratia sp. SY5, was isolated from the rhizoplane of barnyard grass (Echinochloa crus-galli) grown in petroleum and heavy-metal-contaminated soil. This isolate has shown capacities for indole acetic acid production and siderophores synthesis. Compared with a non-inoculated control, the radicular root growth of Zea mays seedlings inoculated with SY5 can be increased by 27- or 15.4-fold in the presence of 15 mg-Cd/l or 15 mg-Cu/l, respectively. The results from hydroponic cultures showed that inoculation of Serratia sp. SY5 had a favorable influence on the initial shoot growth and biomass of Zea mays under noncontaminated conditions. However, under Cd-contaminated conditions, the inoculation of SY5 significantly increased the root biomass of Zea mays. These results indicate that Serratia sp. SY5 can serve as a promising microbial inoculant for increased plant growth in heavy-metal-contaminated soils to improve the phytoremediation efficiency.
Gastrodin Protects Apoptotic Dopaminergic Neurons in a Toxin-Induced Parkinson’s Disease Model
Directory of Open Access Journals (Sweden)
Hemant Kumar
2013-01-01
Full Text Available Gastrodia elata (GE Blume is one of the most important traditional plants in Oriental countries and has been used for centuries to improve various conditions. The phenolic glucoside gastrodin is an active constituent of GE. The aim of this study was to investigate the neuroprotective role of gastrodin in 1-methyl-4-phenylpyridinium (MPP+/1-methyl-4-phenyl-1,2,3,6-tetrahydropyridine- (MPTP induced human dopaminergic SH-SY5Y cells and mouse model of Parkinson’s disease (PD, respectively. Gastrodin significantly and dose dependently protected dopaminergic neurons against neurotoxicity through regulating free radicals, Bax/Bcl-2 mRNA, caspase-3, and cleaved poly(ADP-ribose polymerase (PARP in SH-SY5Y cells stressed with MPP+. Gastrodin also showed neuroprotective effects in the subchronic MPTP mouse PD model by ameliorating bradykinesia and motor impairment in the pole and rotarod tests, respectively. Consistent with this finding, gastrodin prevented dopamine depletion and reduced reactive astrogliosis caused by MPTP as assessed by immunohistochemistry and immunoblotting in the substantiae nigrae and striatata of mice. Moreover, gastrodin was also effective in preventing neuronal apoptosis by attenuating antioxidant and antiapoptotic activities in these brain areas. These results strongly suggest that gastrodin has protective effects in experimental PD models and that it may be developed as a clinical candidate to ameliorate PD symptoms.
International Nuclear Information System (INIS)
Kita, Kayoko; Suzuki, Toshihide; Ochi, Takafumi
2007-01-01
In a poisonous incident in Kamisu, Japan, it is understood that diphenylarsinic acid (DPAA) was a critical contaminant of ground water. Most patients showed dysfunction of the central nervous system. To understand the overall mechanism of DPAA toxicity and to gain some insight into the application of a remedy specific for intoxication, the molecular target must be clarified. As an approach, a high throughput analysis of cell proteins in cultured human hepatocarcinoma HpG2 exposed to DPAA was performed by two-dimensional electrophoresis (2-DE). Four proteins, which were up- and down-regulated by exposure of cultured HepG2 cells to DPAA, were identified. They were chaperonin containing TCP-1 (CCT) beta subunit, aldehyde dehydrogenase 1 (ALDH1), ribosomal protein P0 and glutaminase C (GAC). Of these, GAC was the only protein that was down-regulated by DPAA exposure, and cellular expression levels were reduced by DPAA in a concentration- and time-dependent manner. Decrease in cellular GAC levels was accompanied by decreased activity of the enzyme, phosphate-activated glutaminase (PAG). Decreased expression of GAC by DPAA was also observed in human cervical carcinoma HeLa and neuroblastoma SH-SY5Y cells. By contrast, no significant changes in GAC protein expression were observed when cells were incubated with arsenite [iAs (III)] and trivalent dimethylarsinous acid [DMA (III)]. In the central nervous system, GAC plays a role in the production of the neurotransmitter glutamic acid. Selective inhibition of GAC expression by DPAA may be a cause of dysfunction of glutamatergic neuronal transmission and the resultant neurological impairments
Energy Technology Data Exchange (ETDEWEB)
Kita, Kayoko [Laboratory of Toxicology, Faculty of Pharmaceutical Sciences, Teikyo University, 1091-1 Sagamiko-chou, Sagamihara, Kanagawa 229-0195 (Japan); Suzuki, Toshihide [Laboratory of Toxicology, Faculty of Pharmaceutical Sciences, Teikyo University, 1091-1 Sagamiko-chou, Sagamihara, Kanagawa 229-0195 (Japan); Ochi, Takafumi [Laboratory of Toxicology, Faculty of Pharmaceutical Sciences, Teikyo University, 1091-1 Sagamiko-chou, Sagamihara, Kanagawa 229-0195 (Japan)
2007-05-01
In a poisonous incident in Kamisu, Japan, it is understood that diphenylarsinic acid (DPAA) was a critical contaminant of ground water. Most patients showed dysfunction of the central nervous system. To understand the overall mechanism of DPAA toxicity and to gain some insight into the application of a remedy specific for intoxication, the molecular target must be clarified. As an approach, a high throughput analysis of cell proteins in cultured human hepatocarcinoma HpG2 exposed to DPAA was performed by two-dimensional electrophoresis (2-DE). Four proteins, which were up- and down-regulated by exposure of cultured HepG2 cells to DPAA, were identified. They were chaperonin containing TCP-1 (CCT) beta subunit, aldehyde dehydrogenase 1 (ALDH1), ribosomal protein P0 and glutaminase C (GAC). Of these, GAC was the only protein that was down-regulated by DPAA exposure, and cellular expression levels were reduced by DPAA in a concentration- and time-dependent manner. Decrease in cellular GAC levels was accompanied by decreased activity of the enzyme, phosphate-activated glutaminase (PAG). Decreased expression of GAC by DPAA was also observed in human cervical carcinoma HeLa and neuroblastoma SH-SY5Y cells. By contrast, no significant changes in GAC protein expression were observed when cells were incubated with arsenite [iAs (III)] and trivalent dimethylarsinous acid [DMA (III)]. In the central nervous system, GAC plays a role in the production of the neurotransmitter glutamic acid. Selective inhibition of GAC expression by DPAA may be a cause of dysfunction of glutamatergic neuronal transmission and the resultant neurological impairments.
Amyloid-β secretion, generation, and lysosomal sequestration in response to proteasome inhibition
DEFF Research Database (Denmark)
Agholme, Lotta; Hallbeck, Martin; Benedikz, Eirikur
2012-01-01
, as the autophagosome has been suggested as a site of amyloid-β (Aβ) generation. In this study, we investigated the effect of proteasome inhibition on Aβ accumulation and secretion, as well as the processing of amyloid-β protein precursor (AβPP) in AβPP(Swe) transfected SH-SY5Y neuroblastoma cells. We show...
Directory of Open Access Journals (Sweden)
V. Villa
2011-01-01
Full Text Available The effects of quinacrine and minocycline on the toxicity induced by hPrP90-231 were studied. By mild thermal denaturation, hPrP90-231 can be converted in a toxic PrPSc-like structure affecting the survival of SH-SY5Y cells. Quinacrine and minocycline prevented hPrP90-231-induced toxicity interfering with different mechanisms: protective effects of quinacrine are mediated by the binding to the fragment that abolished hPrP90-231 structural changes and cell internalization, whereas, minocycline reverted MAP kinase neurotoxic signaling exerted by the prion fragment.
International Nuclear Information System (INIS)
Nakamura, Yohko; Ozaki, Toshinori; Niizuma, Hidetaka; Ohira, Miki; Kamijo, Takehiko; Nakagawara, Akira
2007-01-01
p53 is a key modulator of a variety of cellular stresses. In human neuroblastomas, p53 is rarely mutated and aberrantly expressed in cytoplasm. In this study, we have identified a novel p53 mutant lacking its COOH-terminal region in neuroblastoma SK-N-AS cells. p53 accumulated in response to cisplatin (CDDP) and thereby promoting apoptosis in neuroblastoma SH-SY5Y cells bearing wild-type p53, whereas SK-N-AS cells did not undergo apoptosis. We found another p53 (p53ΔC) lacking a part of oligomerization domain and nuclear localization signals in SK-N-AS cells. p53ΔC was expressed largely in cytoplasm and lost the transactivation function. Furthermore, a 3'-part of the p53 locus was homozygously deleted in SK-N-AS cells. Thus, our present findings suggest that p53 plays an important role in the DNA-damage response in certain neuroblastoma cells and it seems to be important to search for p53 mutations outside DNA-binding domain
Curcumin Protects -SH Groups and Sulphate Transport after Oxidative Damage in Human Erythrocytes
Directory of Open Access Journals (Sweden)
Rossana Morabito
2015-05-01
Full Text Available Background/Aims: Erythrocytes, continuously exposed to oxygen pressure and toxic compounds, are sensitive to oxidative stress, namely acting on integral Band 3 protein, with consequences on cell membranes deformability and anion transport efficiency. The aim of the present investigation, conducted on human erythrocytes, is to verify whether curcumin (1 or 10µM, a natural compound with proved antioxidant properties, may counteract Band 3-mediated anion transport alterations due to oxidative stress. Methods: Oxidative conditions were induced by exposure to, alternatively, either 2 mM N-ethylmaleimide (NEM or pH-modified solutions (6.5 and 8.5. Rate constant for SO4= uptake and -SH groups estimation were measured to verify the effect of oxidative stress on anion transport efficiency and erythrocyte membranes. Results: After the exposure of erythrocytes to, alternatively, NEM or pH-modified solutions, a significant decrease in both rate constant for SO4= uptake and -SH groups was observed, which was prevented by curcumin, with a dose-dependent effect. Conclusions: Our results show that: i the decreased efficiency of anion transport may be due to changes in Band 3 protein structure caused by cysteine -SH groups oxidation, especially after exposure to NEM and pH 6.5; ii 10 µM Curcumin is effective in protecting erythrocytes from oxidative stress events at level of cell membrane transport.
Pereskia aculeata Muller (Cactaceae Leaves: Chemical Composition and Biological Activities
Directory of Open Access Journals (Sweden)
Lucèia Fàtima Souza
2016-09-01
Full Text Available The aims of this work were to study the chemical composition of the essential oil from the leaves of Pereskia aculeata and to evaluate some biological activities of three leaf extracts. The phenolic content, antioxidant activity, and in vitro antimicrobial and antifungal activities were determined. The methanol extract showed antioxidant activity (EC50 7.09 mg/mL and high polyphenols content (15.04 ± 0.31 mg gallic acid equivalents (GAE/g. The petroleum ether extract exhibited potent antibacterial activity against Escherichia coli, whereas the chloroform extract showed inhibitory activity against Bacillus cereus and Staphylococcus aureus. The petroleum ether and methanol extracts were more effective in inhibiting the growth of Aspergillus versicolor. The possible cytotoxicity of extracts on neuroblastoma SH-SY5Y cancer cell line and the influence on adenylate cyclase (ADCY expression was also studied. P. aculeata chloroform extract showed antiproliferative activity with an IC50 value of 262.83 µg/mL. Treatments of SH-SY5Y neuroblastoma cells with 100 µg/mL of methanol extract significantly reduced ADCY1 expression.
Pereskia aculeata Muller (Cactaceae) Leaves: Chemical Composition and Biological Activities.
Souza, Lucèia Fàtima; Caputo, Lucia; Inchausti De Barros, Ingrid Bergman; Fratianni, Florinda; Nazzaro, Filomena; De Feo, Vincenzo
2016-09-03
The aims of this work were to study the chemical composition of the essential oil from the leaves of Pereskia aculeata and to evaluate some biological activities of three leaf extracts. The phenolic content, antioxidant activity, and in vitro antimicrobial and antifungal activities were determined. The methanol extract showed antioxidant activity (EC50 7.09 mg/mL) and high polyphenols content (15.04 ± 0.31 mg gallic acid equivalents (GAE)/g). The petroleum ether extract exhibited potent antibacterial activity against Escherichia coli, whereas the chloroform extract showed inhibitory activity against Bacillus cereus and Staphylococcus aureus. The petroleum ether and methanol extracts were more effective in inhibiting the growth of Aspergillus versicolor. The possible cytotoxicity of extracts on neuroblastoma SH-SY5Y cancer cell line and the influence on adenylate cyclase (ADCY) expression was also studied. P. aculeata chloroform extract showed antiproliferative activity with an IC50 value of 262.83 µg/mL. Treatments of SH-SY5Y neuroblastoma cells with 100 µg/mL of methanol extract significantly reduced ADCY1 expression.
Peng, Zhi; Luo, Hong-Wei; Yuan, Ying; Shi, Jing; Huang, Shi-Feng; Li, Chun-Li; Cao, Wei-Xi; Huang, Zong-Gan; Feng, Wen-Li
2011-05-01
The persistence of Bcr-Abl-positive cells in patients on imatinib therapy indicates that inhibition of the Bcr-Abl kinase activity alone might not be sufficient to eradicate the leukemia cells. Many downstream effectors of Bcr-Abl have been described, including activation of both the Grb2-SoS-Ras-MAPK and Grb2-Gab2-PI3K-Akt pathways. The Bcr-Abl-Grb2 interaction, which is mediated by the direct interaction of the Grb2 SH2 domain with the phospho-Bcr-Abl Y177, is required for activation of these signaling pathways. Therefore, disrupting their interaction represents a potential therapeutic strategy for inhibiting the oncogenic downstream signals of Bcr-Abl. Adenovirus Ad-SH2-HA expressing the Grb2 SH2 domain was constructed and applied in this study. As expected, Ad-SH2-HA efficiently infected CML cells and functioned by binding to the phospho-Bcr-Abl Y177 site, competitively disrupting the Grb2 SH2-phospho-Bcr-Abl Y177 complex. They induced potent anti-proliferation and apoptosis-inducing effects in CML cell lines. Moreover, the Ras, MAPK and Akt activities were significantly reduced in the Ad-SH2-HA treated cells. These were not observed with the point-mutated control adenovirus Ad-Sm-HA with abolished phospho-Bcr-Abl Y177 binding sites. These data indicate that, in addition to the direct targeting of Bcr-Abl, selective inhibition of its downstream signaling pathways may be a therapeutic option for CML, and the Ad-SH2-HA-mediated killing strategy could be explored as a promising anti-leukemia agent in CML.
Energy Technology Data Exchange (ETDEWEB)
Kükenshöner, Tim; Schmit, Nadine Eliane; Bouda, Emilie; Sha, Fern; Pojer, Florence; Koide, Akiko; Seeliger, Markus; Koide, Shohei; Hantschel, Oliver
2017-05-01
The binding of Src-homology 2 (SH2) domains to phosphotyrosine (pY) sites is critical for the autoinhibition and substrate recognition of the eight Src family kinases (SFKs). The high sequence conservation of the 120 human SH2 domains poses a significant challenge to selectively perturb the interactions of even the SFK SH2 family against the rest of the SH2 domains. We have developed synthetic binding proteins, termed monobodies, for six of the SFK SH2 domains with nanomolar affinity. Most of these monobodies competed with pY ligand binding and showed strong selectivity for either the SrcA (Yes, Src, Fyn, Fgr) or SrcB subgroup (Lck, Lyn, Blk, Hck). Interactome analysis of intracellularly expressed monobodies revealed that they bind SFKs but no other SH2-containing proteins. Three crystal structures of monobody–SH2 complexes unveiled different and only partly overlapping binding modes, which rationalized the observed selectivity and enabled structure-based mutagenesis to modulate inhibition mode and selectivity. In line with the critical roles of SFK SH2 domains in kinase autoinhibition and T-cell receptor signaling, monobodies binding the Src and Hck SH2 domains selectively activated respective recombinant kinases, whereas an Lck SH2-binding monobody inhibited proximal signaling events downstream of the T-cell receptor complex. Our results show that SFK SH2 domains can be targeted with unprecedented potency and selectivity using monobodies. They are excellent tools for dissecting SFK functions in normal development and signaling and to interfere with aberrant SFK signaling networks in cancer cells.
International Nuclear Information System (INIS)
Aravindan, Natarajan; Veeraraghavan, Jamunarani; Madhusoodhanan, Rakhesh; Herman, Terence S.; Natarajan, Mohan
2011-01-01
Purpose: We recently reported that curcumin attenuates ionizing radiation (IR)-induced survival signaling and proliferation in human neuroblastoma cells. Also, in the endothelial system, we have demonstrated that NFκB regulates IR-induced telomerase activity (TA). Accordingly, we investigated the effect of curcumin in inhibiting IR-induced NFκB-dependent hTERT transcription, TA, and cell survival in neuroblastoma cells. Methods and Materials: SK-N-MC or SH-SY5Y cells exposed to IR and treated with curcumin (10-100 nM) with or without IR were harvested after 1 h through 24 h. NFκB-dependent regulation was investigated either by luciferase reporter assays using pNFκB-, pGL3-354-, pGL3-347-, or pUSE-IκBα-Luc, p50/p65, or RelA siRNA-transfected cells. NFκB activity was analyzed using an electrophoretic mobility shift assay and hTERT expression using the quantitative polymerase chain reaction. TA was determined using the telomerase repeat amplification protocol assay and cell survival using the 3-(4,5-dimethylthiazol-2-yl)-2,5-diphenyltertrazolium bromide and clonogenic assay. Results: Curcumin profoundly inhibited IR-induced NFκB. Consequently, curcumin significantly inhibited IR-induced TA and hTERT mRNA at all points investigated. Furthermore, IR-induced TA is regulated at the transcriptional level by triggering telomerase reverse transcriptase (TERT) promoter activation. Moreover, NFκB becomes functionally activated after IR and mediates TA upregulation by binding to the κB-binding region in the promoter region of the TERT gene. Consistently, elimination of the NFκB-recognition site on the telomerase promoter or inhibition of NFκB by the IκBα mutant compromises IR-induced telomerase promoter activation. Significantly, curcumin inhibited IR-induced TERT transcription. Consequently, curcumin inhibited hTERT mRNA and TA in NFκB overexpressed cells. Furthermore, curcumin enhanced the IR-induced inhibition of cell survival. Conclusions: These results
Interferon-γ increases neuronal death in response to amyloid-β1-42
Directory of Open Access Journals (Sweden)
Williams Alun
2006-03-01
Full Text Available Abstract Background Alzheimer's disease is a neurodegenerative disorder characterized by a progressive cognitive impairment, the consequence of neuronal dysfunction and ultimately the death of neurons. The amyloid hypothesis proposes that neuronal damage results from the accumulation of insoluble, hydrophobic, fibrillar peptides such as amyloid-β1-42. These peptides activate enzymes resulting in a cascade of second messengers including prostaglandins and platelet-activating factor. Apoptosis of neurons is thought to follow as a consequence of the uncontrolled release of second messengers. Biochemical, histopathological and genetic studies suggest that pro-inflammatory cytokines play a role in neurodegeneration during Alzheimer's disease. In the current study we examined the effects of interferon (IFN-γ, tumour necrosis factor (TNFα, interleukin (IL-1β and IL-6 on neurons. Methods Primary murine cortical or cerebellar neurons, or human SH-SY5Y neuroblastoma cells, were grown in vitro. Neurons were treated with cytokines prior to incubation with different neuronal insults. Cell survival, caspase-3 activity (a measure of apoptosis and prostaglandin production were measured. Immunoblots were used to determine the effects of cytokines on the levels of cytoplasmic phospholipase A2 or phospholipase C γ-1. Results While none of the cytokines tested were directly neurotoxic, pre-treatment with IFN-γ sensitised neurons to the toxic effects of amyloid-β1-42 or HuPrP82-146 (a neurotoxic peptide found in prion diseases. The effects of IFN-γ were seen on cortical and cerebellar neurons, and on SH-SY5Y neuroblastoma cells. However, pre-treatment with IFN-γ did not affect the sensitivity to neurons treated with staurosporine or hydrogen peroxide. Pre-treatment with IFN-γ increased the levels of cytoplasmic phospholipase A2 in SH-SY5Y cells and increased prostaglandin E2 production in response to amyloid-β1-42. Conclusion Treatment of neuronal cells
International Nuclear Information System (INIS)
Hong, Seokheon; Kim, Joo Yeon; Hwang, Joohyun; Shin, Ki Soon; Kang, Shin Jung
2013-01-01
Highlights: •Heptachlor inhibited mitochondrial electron transport chain complex III activity. •Heptachlor promoted generation of reactive oxygen species. •Heptachlor induced Bax activation. •Heptachlor induced mitochondria-mediated and caspase-dependent apoptosis. -- Abstract: Environmental toxins like pesticides have been implicated in the pathogenesis of Parkinson’s disease (PD). Epidemiological studies suggested that exposures to organochlorine pesticides have an association with an increased PD risk. In the present study, we examined the mechanism of toxicity induced by an organochlorine pesticide heptachlor. In a human dopaminergic neuroblastoma SH-SY5Y cells, heptachlor induced both morphological and functional damages in mitochondria. Interestingly, the compound inhibited mitochondrial electron transport chain complex III activity. Rapid generation of reactive oxygen species and the activation of Bax were then detected. Subsequently, mitochondria-mediated, caspase-dependent apoptosis followed. Our results raise a possibility that an organochlorine pesticide heptachlor can act as a neurotoxicant associated with PD
Energy Technology Data Exchange (ETDEWEB)
Hong, Seokheon; Kim, Joo Yeon; Hwang, Joohyun [Department of Molecular Biology, Sejong University, Seoul 143-747 (Korea, Republic of); Shin, Ki Soon [Department of Biology, Department of Life and Nanopharmaceutical Sciences, Kyung Hee University, Seoul 130-701 (Korea, Republic of); Kang, Shin Jung, E-mail: sjkang@sejong.ac.kr [Department of Molecular Biology, Sejong University, Seoul 143-747 (Korea, Republic of)
2013-08-09
Highlights: •Heptachlor inhibited mitochondrial electron transport chain complex III activity. •Heptachlor promoted generation of reactive oxygen species. •Heptachlor induced Bax activation. •Heptachlor induced mitochondria-mediated and caspase-dependent apoptosis. -- Abstract: Environmental toxins like pesticides have been implicated in the pathogenesis of Parkinson’s disease (PD). Epidemiological studies suggested that exposures to organochlorine pesticides have an association with an increased PD risk. In the present study, we examined the mechanism of toxicity induced by an organochlorine pesticide heptachlor. In a human dopaminergic neuroblastoma SH-SY5Y cells, heptachlor induced both morphological and functional damages in mitochondria. Interestingly, the compound inhibited mitochondrial electron transport chain complex III activity. Rapid generation of reactive oxygen species and the activation of Bax were then detected. Subsequently, mitochondria-mediated, caspase-dependent apoptosis followed. Our results raise a possibility that an organochlorine pesticide heptachlor can act as a neurotoxicant associated with PD.
DEFF Research Database (Denmark)
Popescu, Bogdan O; Cedazo-Minguez, Angel; Benedikz, Eirikur
2004-01-01
, we studied the effect of two other FAD PS1 mutants (M146V and L250S) and two dominant negative PS1 mutants (D257A and D385N) on basal and carbachol-stimulated phosphoinositide (PI) hydrolysis and intracellular calcium concentrations ([Ca2+]i) in SH-SY5Y neuroblastoma cells. We found a significant...
The role of alpha-synuclein in melanin synthesis in melanoma and dopaminergic neuronal cells.
Directory of Open Access Journals (Sweden)
Tianhong Pan
Full Text Available The relatively high co-occurrence of Parkinson's disease (PD and melanoma has been established by a large number of epidemiological studies. However, a clear biological explanation for this finding is still lacking. Ultra-violet radiation (UVR-induced skin melanin synthesis is a defense mechanism against UVR-induced damage relevant to the initiation of melanoma, whereas, increased neuromelanin (NM, the melanin synthesized in dopaminergic neurons, may enhance the susceptibility to oxidative stress-induced neuronal injury relevant to PD. SNCA is a PD-causing gene coding for alpha-Synuclein (α-Syn that expresses not only in brain, but also in skin as well as in tumors, such as melanoma. The findings that α-Syn can interact with tyrosinase (TYR and inhibit tyrosine hydroxylase (TH, both of which are enzymes involved in the biosynthesis of melanin and dopamine (DA, led us to propose that α-Syn may participate in the regulation of melanin synthesis. In this study, by applying ultraviolet B (UVB light, a physiologically relevant stimulus of melanogenesis, we detected melanin synthesis in A375 and SK-MEL-28 melanoma cells and in SH-SY5Y and PC12 dopaminergic neuronal cells and determined effects of α-Syn on melanin synthesis. Our results showed that UVB light exposure increased melanin synthesis in all 4 cell lines. However, we found that α-Syn expression reduced UVB light-induced increase of melanin synthesis and that melanin content was lower when melanoma cells were expressed with α-Syn, indicating that α-Syn may have inhibitory effects on melanin synthesis in melanoma cells. Different from melanoma cells, the melanin content was higher in α-Syn-over-expressed dopaminergic neuronal SH-SY5Y and PC12 cells, cellular models of PD, than that in non-α-Syn-expressed control cells. We concluded that α-Syn could be one of the points responsible for the positive association between PD and melanoma via its differential roles in melanin synthesis in
Directory of Open Access Journals (Sweden)
Vinay K Tripathi
Full Text Available The expression and metabolic profile of cytochrome P450s (CYPs is largely missing in human brain due to non-availability of brain tissue. We attempted to address the issue by using human brain neuronal (SH-SY5Y and glial (U373-MG cells. The expression and activity of CYP1A1, 2B6 and 2E1 were carried out in the cells exposed to CYP inducers viz., 3-methylcholanthrene (3-MC, cyclophosphamide (CPA, ethanol and known neurotoxicant- monocrotophos (MCP, a widely used organophosphorous pesticide. Both the cells show significant induction in the expression and CYP-specific activity against classical inducers and MCP. The induction level of CYPs was comparatively lower in MCP exposed cells than cells exposed to classical inducers. Pre-exposure (12 h of cells to classical inducers significantly added the MCP induced CYPs expression and activity. The findings were concurrent with protein ligand docking studies, which show a significant modulatory capacity of MCP by strong interaction with CYP regulators-CAR, PXR and AHR. Similarly, the known CYP inducers- 3-MC, CPA and ethanol have also shown significantly high docking scores with all the three studied CYP regulators. The expression of CYPs in neuronal and glial cells has suggested their possible association with the endogenous physiology of the brain. The findings also suggest the xenobiotic metabolizing capabilities of these cells against MCP, if received a pre-sensitization to trigger the xenobiotic metabolizing machinery. MCP induced CYP-specific activity in neuronal cells could help in explaining its effect on neurotransmission, as these CYPs are known to involve in the synthesis/transport of the neurotransmitters. The induction of CYPs in glial cells is also of significance as these cells are thought to be involved in protecting the neurons from environmental insults and safeguard them from toxicity. The data provide better understanding of the metabolizing capability of the human brain cells against
Kükenshöner, Tim; Schmit, Nadine Eliane; Bouda, Emilie; Sha, Fern; Pojer, Florence; Koide, Akiko; Seeliger, Markus; Koide, Shohei; Hantschel, Oliver
2017-05-05
The binding of Src-homology 2 (SH2) domains to phosphotyrosine (pY) sites is critical for the autoinhibition and substrate recognition of the eight Src family kinases (SFKs). The high sequence conservation of the 120 human SH2 domains poses a significant challenge to selectively perturb the interactions of even the SFK SH2 family against the rest of the SH2 domains. We have developed synthetic binding proteins, termed monobodies, for six of the SFK SH2 domains with nanomolar affinity. Most of these monobodies competed with pY ligand binding and showed strong selectivity for either the SrcA (Yes, Src, Fyn, Fgr) or SrcB subgroup (Lck, Lyn, Blk, Hck). Interactome analysis of intracellularly expressed monobodies revealed that they bind SFKs but no other SH2-containing proteins. Three crystal structures of monobody-SH2 complexes unveiled different and only partly overlapping binding modes, which rationalized the observed selectivity and enabled structure-based mutagenesis to modulate inhibition mode and selectivity. In line with the critical roles of SFK SH2 domains in kinase autoinhibition and T-cell receptor signaling, monobodies binding the Src and Hck SH2 domains selectively activated respective recombinant kinases, whereas an Lck SH2-binding monobody inhibited proximal signaling events downstream of the T-cell receptor complex. Our results show that SFK SH2 domains can be targeted with unprecedented potency and selectivity using monobodies. They are excellent tools for dissecting SFK functions in normal development and signaling and to interfere with aberrant SFK signaling networks in cancer cells. Copyright © 2017 The Author(s). Published by Elsevier Ltd.. All rights reserved.
Li, Lixuan; Li, Jia
2015-05-01
To study the effects of lentivirus-mediated short hairpin RNA (shRNA) silencing of lysosome-associated membrane protein type 2A (LAMP2A) expression on the proliferation of multiple myeloma cells. The constructed shRNA lentiviral vector was applied to infect human multiple myeloma cell line MM.1S, and stable expression cell line was obtained by puromycin screening. Western blotting was used to verify the inhibitory effect on LAMP2A protein expression. MTT assay was conducted to detect the effect of knocked-down LAMP2A on MM.1S cell proliferation, and the anti-tumor potency of suberoylanilide hydroxamic acid (SAHA) against the obtained MM.1S LAMP2A(shRNA) stable cell line. Lactate assay was performed to observe the impact of low LAMP2A expression on cell glycolysis. The stable cell line with low LAMP2A expression were obtained with the constructed human LAMP2A-shRNA lentiviral vector. Down-regulation of LAMP2A expression significantly inhibited MM.1S cell proliferation and enhanced the anti-tumor activity of SAHA. Interestingly, decreased LAMP2A expression also inhibited MM.1S cell lactic acid secretion. Down-regulation of LAMP2A expression could inhibit cell proliferation in multiple myeloma cells.
Meulenberg, C.J.W.; de Groot, A.; Westerink, R.H.S.; Vijverberg, H.P.M.
2016-01-01
Exposure to organic solvents may cause narcotic effects. At the cellular level, these narcotic effects have been associated with a reduction in neuronal excitability caused by changes in membrane structure and function. In order to critically test whether changes in membrane geometry contribute to
Background Levels of Neomorphic 2-hydroxyglutarate Facilitate Proliferation of Primary Fibroblasts
Czech Academy of Sciences Publication Activity Database
Dvořák, Aleš; Zelenka, Jaroslav; Smolková, Katarína; Vítek, L.; Ježek, Petr
2017-01-01
Roč. 66, č. 2 (2017), s. 293-304 ISSN 0862-8408 R&D Projects: GA ČR(CZ) GPP301/12/P381; GA ČR(CZ) GA16-04788S Institutional support: RVO:67985823 Keywords : 2-hydroxyglutarate * fibroblast proliferation * SH-SY5Y neuroblastoma cells Subject RIV: CE - Biochemistry OBOR OECD: Oncology Impact factor: 1.461, year: 2016
The prevalence of Y chromosome microdeletions in Pakistani infertile men
Directory of Open Access Journals (Sweden)
Rubina Tabassum Siddiqui
2013-01-01
Full Text Available Background: Microdeletions of the azoospermia factor locus of the long arm of Y chromosome are an etiological factor of severe oligozoospermia or azoospermia. Objective: The aim of this study was to investigate the prevalence of Y-chromosome microdeletions in AZF region and their role in infertility in Pakistani population. Materials and Methods: The type of deletions in AZF locus were detected in infertile men (n=113 and the association of Y chromosome microdeletions with male infertility was assessed by including men (50 with normal karyotype and having children. Y chromosome microdeletions were detected by multiplex PCR using 10 sequence tagged sites namely sY81, sY130, sY141, sY142, sY155, sY157, sY160, sY182, sY231, and sY202 that covered all three regions of AZF. Results: Individuals with severe oligozoospermia showed 2.86% deletion frequency in AZFc region as compared to azoospermic males (5.5%. Conclusion: The results of our study showed that deletions in Y chromosome are not playing major part in male infertility. Moreover, multiplex-PCR strategy might preferably be employed for the detection of Y chromosome microdeletions allied to male infertility.
CXCL5 knockdown expression inhibits human bladder cancer T24 cells proliferation and migration
Energy Technology Data Exchange (ETDEWEB)
Zheng, Jiajia [Department of Laboratory Medicine, Peking University Third Hospital, Beijing (China); Zhu, Xi [Department of Urology, Beijing Friendship Hospital Affiliated to Capital Medical University, Beijing (China); Zhang, Jie, E-mail: zhangjiebjmu@163.com [Department of Laboratory Medicine, Peking University Third Hospital, Beijing (China)
2014-03-28
Highlights: • We first demonstrated CXCL5 is highly expressed in human bladder tumor tissues and cells. • CXCL5 knockdown inhibits proliferation, migration and promotes apoptosis in T24 cells. • CXCL5 knockdown inhibits Snail, PI3K-AKT and ERK1/2 signaling pathways in T24 cells. • CXCL5 is critical for bladder tumor growth and progression. - Abstract: CXCL5 (epithelial neutrophil activating peptide-78) which acts as a potent chemoattractant and activator of neutrophil function was reported to play a multifaceted role in tumorigenesis. To investigate the role of CXCL5 in bladder cancer progression, we examined the CXCL5 expression in bladder cancer tissues by real-time PCR and Western blot, additionally, we used shRNA-mediated silencing to generate stable CXCL5 silenced bladder cancer T24 cells and defined its biological functions. Our results demonstrated that mRNA and protein of CXCL5 is increased in human bladder tumor tissues and cell lines, down-regulation of CXCL5 in T24 cells resulted in significantly decreased cell proliferation, migration and increased cell apoptosis in vitro through Snail, PI3K-AKT and ERK1/2 signaling pathways. These data suggest that CXCL5 is critical for bladder tumor growth and progression, it may represent a potential application in cancer diagnosis and therapy.
CXCL5 knockdown expression inhibits human bladder cancer T24 cells proliferation and migration
International Nuclear Information System (INIS)
Zheng, Jiajia; Zhu, Xi; Zhang, Jie
2014-01-01
Highlights: • We first demonstrated CXCL5 is highly expressed in human bladder tumor tissues and cells. • CXCL5 knockdown inhibits proliferation, migration and promotes apoptosis in T24 cells. • CXCL5 knockdown inhibits Snail, PI3K-AKT and ERK1/2 signaling pathways in T24 cells. • CXCL5 is critical for bladder tumor growth and progression. - Abstract: CXCL5 (epithelial neutrophil activating peptide-78) which acts as a potent chemoattractant and activator of neutrophil function was reported to play a multifaceted role in tumorigenesis. To investigate the role of CXCL5 in bladder cancer progression, we examined the CXCL5 expression in bladder cancer tissues by real-time PCR and Western blot, additionally, we used shRNA-mediated silencing to generate stable CXCL5 silenced bladder cancer T24 cells and defined its biological functions. Our results demonstrated that mRNA and protein of CXCL5 is increased in human bladder tumor tissues and cell lines, down-regulation of CXCL5 in T24 cells resulted in significantly decreased cell proliferation, migration and increased cell apoptosis in vitro through Snail, PI3K-AKT and ERK1/2 signaling pathways. These data suggest that CXCL5 is critical for bladder tumor growth and progression, it may represent a potential application in cancer diagnosis and therapy
International Nuclear Information System (INIS)
Shi, Zhuliang; Liang, Ning; Xu, Wei; Li, Kuai; Sheng, Guoqing; Liu, Jinsong; Xu, Aimin; Li, Xiao-Jiang; Wu, Donghai
2009-01-01
The SH3 domain of human AHI1 has been cloned and expressed in Escherichia coli. The protein was purified by affinity and size-exclusion chromatography and was crystallized using the sitting-drop vapour-diffusion method at 293 K. The SH3 domain of human AHI1 was cloned and expressed in Escherichia coli. The protein was purified by affinity and size-exclusion chromatography and was crystallized using the sitting-drop vapour-diffusion method at 293 K. A complete data set was collected to 2.5 Å resolution at 110 K. The crystal belonged to space group P4 1 2 1 2, with unit-cell parameters a = 67.377, b = 67.377, c = 98.549 Å
Rayleigh SAW-Assisted SH-SAW Immunosensor on X-Cut 148-Y LiTaO3.
Kogai, Takashi; Yatsuda, Hiromi; Kondoh, Jun
2017-09-01
In this paper, we describe a shear horizontal surface acoustic wave (SH-SAW) immunosensor that utilizes induce agitation by a Rayleigh SAW (R-SAW) on an X-cut 148-Y LiTaO 3 substrate. On this substrate, SH-SAWs and R-SAWs with different frequencies can be effectively generated at an interdigital transducer (IDT). First, to consider the power flow angles of SH-SAWs and R-SAWs on this substrate, the 360-MHz delay lines with six different tilt angles were designed and fabricated. From the experiments, an optimal power flow angle of 9° for the SH-SAW on this substrate is obtained. Second, in order to consider the immunoreactions of the SH-SAW immunosensors, a delay line with a tilt angle of 9° was designed and fabricated on this substrate. The delay line, which can generate two SAWs, namely, a 100-MHz SH-SAW and an 88.8-MHz R-SAW, has a propagation area covered with antigens of human serum albumin between transmitting and receiving IDTs. The immunoreactions caused by antigen-antibody binding events on the surface of the delay line were investigated on the basis of the velocity changes of the SH-SAWs for sensing with and without the assistance of an R-SAW. As a result, it was confirmed that the SH-SAW velocity changes due to antigen-antibody reactions can be markedly increased by the assistance of R-SAW agitation.
Directory of Open Access Journals (Sweden)
Yuan YG
2017-08-01
Full Text Available Yu-Guo Yuan,1 Yan-Hong Wang,1 Hui-Hui Xing,1 Sangiliyandi Gurunathan2 1Jiangsu Co-Innovation Center for Prevention and Control of Important Animal Infectious Diseases and Zoonosis, College of Veterinary Medicine, Yangzhou University, Yangzhou, Jiangsu, People’s Republic of China; 2Department of Stem Cell and Regenerative Biotechnology, Konkuk University, Seoul, Republic of Korea Background: Graphene and graphene-related materials have gained substantial interest from both academia and industry for the development of unique nanomaterials for biomedical applications. Graphene oxide (GO and silver nanoparticles (AgNPs are a valuable platform for the development of nanocomposites, permitting the combination of nanomaterials with different physical and chemical properties to generate novel materials with improved and effective functionalities in a single platform. Therefore, this study was conducted to synthesize a graphene oxide–silver nanoparticle (GO-AgNPs nanocomposite using the biomolecule quercetin and evaluate the potential cytotoxicity and mechanism of GO-AgNPs in human neuroblastoma cancer cells (SH-SY5Y.Methods: The synthesized GO-AgNPs were characterized using various analytical techniques. The potential toxicities of GO-AgNPs were evaluated using a series of biochemical and cellular assays. The expression of apoptotic and anti-apoptotic genes was measured by quantitative real-time reverse transcription polymerase chain reaction. Further, apoptosis was confirmed by caspase-9/3 activity and a terminal deoxynucleotidyl transferase dUTP nick end labeling assay, and GO-AgNPs-induced autophagy was also confirmed by transmission electron microscopy.Results: The prepared GO-AgNPs exhibited significantly higher cytotoxicity toward SH-SY5Y cells than GO. GO-AgNPs induced significant cytotoxicity in SH-SY5Y cells by the loss of cell viability, inhibition of cell proliferation, increased leakage of lactate dehydrogenase, decreased level of
Directory of Open Access Journals (Sweden)
Gene-Errol E Ringpis
Full Text Available Down-regulation of the HIV-1 coreceptor CCR5 holds significant potential for long-term protection against HIV-1 in patients. Using the humanized bone marrow/liver/thymus (hu-BLT mouse model which allows investigation of human hematopoietic stem/progenitor cell (HSPC transplant and immune system reconstitution as well as HIV-1 infection, we previously demonstrated stable inhibition of CCR5 expression in systemic lymphoid tissues via transplantation of HSPCs genetically modified by lentiviral vector transduction to express short hairpin RNA (shRNA. However, CCR5 down-regulation will not be effective against existing CXCR4-tropic HIV-1 and emergence of resistant viral strains. As such, combination approaches targeting additional steps in the virus lifecycle are required. We screened a panel of previously published shRNAs targeting highly conserved regions and identified a potent shRNA targeting the R-region of the HIV-1 long terminal repeat (LTR. Here, we report that human CD4(+ T-cells derived from transplanted HSPC engineered to co-express shRNAs targeting CCR5 and HIV-1 LTR are resistant to CCR5- and CXCR4- tropic HIV-1-mediated depletion in vivo. Transduction with the combination vector suppressed CXCR4- and CCR5- tropic viral replication in cell lines and peripheral blood mononuclear cells in vitro. No obvious cytotoxicity or interferon response was observed. Transplantation of combination vector-transduced HSPC into hu-BLT mice resulted in efficient engraftment and subsequent stable gene marking and CCR5 down-regulation in human CD4(+ T-cells within peripheral blood and systemic lymphoid tissues, including gut-associated lymphoid tissue, a major site of robust viral replication, for over twelve weeks. CXCR4- and CCR5- tropic HIV-1 infection was effectively inhibited in hu-BLT mouse spleen-derived human CD4(+ T-cells ex vivo. Furthermore, levels of gene-marked CD4(+ T-cells in peripheral blood increased despite systemic infection with either
Chemical Characterization of an Encapsulated Red Wine Powder and Its Effects on Neuronal Cells
Directory of Open Access Journals (Sweden)
Diego Rocha-Parra
2018-04-01
Full Text Available Red wine polyphenols are known for their implications for human health protection, although they suffer from high instability. For this reason, a red wine powder was prepared by freeze-drying encapsulation in maltodextrin/arabic gum matrix, and its composition was determined by means of high-performance liquid chromatography coupled quadrupole time-of-flight mass spectrometry (HPLC-MS-QTOF. More than thirty polyphenols, including anthocyanins, flavanols, flavonols, phenolic acids and stilbenoids, were identified. Some of the main quantified polyphenols were: malvidin-3-O-glucoside, malvidin 3-O-(6″-acetyl-glucose, petunidin-3-O-glucoside, quercetin-3-O-glucuronide, syringenin-3-O-glucoside, epicatechin, gallic acid and syringic acid. The biological activity of this de-alcoholized and encapsulated red wine on human neuroblastoma SH-SY5Y cells was studied. The results showed that the encapsulated red wine powder has active redox properties, as verified by performing reactive oxygen species (ROS analysis utilizing a neuronal model. This could help explain its action against the neurotoxicity induced by 6-hydroxydopamine (6-OHDA.
Chemical Characterization of an Encapsulated Red Wine Powder and Its Effects on Neuronal Cells.
Rocha-Parra, Diego; Chirife, Jorge; Zamora, Clara; de Pascual-Teresa, Sonia
2018-04-07
Red wine polyphenols are known for their implications for human health protection, although they suffer from high instability. For this reason, a red wine powder was prepared by freeze-drying encapsulation in maltodextrin/arabic gum matrix, and its composition was determined by means of high-performance liquid chromatography coupled quadrupole time-of-flight mass spectrometry (HPLC-MS-QTOF). More than thirty polyphenols, including anthocyanins, flavanols, flavonols, phenolic acids and stilbenoids, were identified. Some of the main quantified polyphenols were: malvidin-3- O -glucoside, malvidin 3- O -(6″-acetyl-glucose), petunidin-3- O -glucoside, quercetin-3- O -glucuronide, syringenin-3- O -glucoside, epicatechin, gallic acid and syringic acid. The biological activity of this de-alcoholized and encapsulated red wine on human neuroblastoma SH-SY5Y cells was studied. The results showed that the encapsulated red wine powder has active redox properties, as verified by performing reactive oxygen species (ROS) analysis utilizing a neuronal model. This could help explain its action against the neurotoxicity induced by 6-hydroxydopamine (6-OHDA).
Directory of Open Access Journals (Sweden)
Nur Hanisah Azmi
2015-01-01
Full Text Available The pathogenesis of Alzheimer’s disease involves complex etiological factors, of which the deposition of beta-amyloid (Aβ protein and oxidative stress have been strongly implicated. We explored the effects of H2O2, which is a precursor for highly reactive hydroxyl radicals, on neurotoxicity and genes related to AD on neuronal cells. Candidate bioactive compounds responsible for the effects were quantified using HPLC-DAD. Additionally, the effects of germinated brown rice (GBR on the morphology of Aβ(1-42 were assessed by Transmission Electron Microscopy and its regulatory effects on gene expressions were explored. The results showed that GBR extract had several phenolic compounds and γ-oryzanol and altered the structure of Aβ(1-42 suggesting an antiamyloidogenic effect. GBR was also able to attenuate the oxidative effects of H2O2 as implied by reduced LDH release and intracellular ROS generation. Furthermore, gene expression analyses showed that the neuroprotective effects of GBR were partly mediated through transcriptional regulation of multiple genes including Presenilins, APP, BACE1, BACE2, ADAM10, Neprilysin, and LRP1. Our findings showed that GBR exhibited neuroprotective properties via transcriptional regulation of APP metabolism with potential impact on Aβ aggregation. These findings can have important implications for the management of neurodegenerative diseases like AD and are worth exploring further.
Wang, Feixiang; Jia, Yali; Liu, Jiajing; Zhai, Jinglei; Cao, Ning; Yue, Wen; He, Huixia; Pei, Xuetao
2017-06-01
Alzheimer's disease (AD) is an incurable neurodegenerative disease and many types of stem cells have been used in AD therapy with some favorable effects. In this study, we investigated the potential therapeutical effects of human dental pulp stem cells (hDPSCs) on AD cellular model which established by okadaic acid (OA)-induced damage to human neuroblastoma cell line, SH-SY5Y, in vitro for 24 h. After confirmed the AD cellular model, the cells were co-culture with hDPSCs by transwell co-culture system till 24 h for treatment. Then the cytomorphology of the hDPSCs-treated cells were found to restore gradually with re-elongation of retracted dendrites. Meanwhile, Cell Counting Kit-8 assay and Hoechst 33258 staining showed that hDPSCs caused significant increase in the viability and decrease in apoptosis of the model cells, respectively. Observation of DiI labeling also exhibited the prolongation dendrites in hDPSCs-treated cells which were obviously different from the retraction dendrites in AD model cells. Furthermore, specific staining of α-tubulin and F-actin demonstrated that the hDPSCs-treated cells had the morphology of restored neurons, with elongated dendrites, densely arranged microfilaments, and thickened microtubular fibrils. In addition, results from western blotting revealed that phosphorylation at Ser 396 of Tau protein was significantly suppressed by adding of hDPSCs. These results indicate that hDPSCs may promote regeneration of damaged neuron cells in vitro model of AD and may serve as a useful cell source for treatment of AD. © 2017 International Federation for Cell Biology.
Iglesias-Guimarais, Victoria; Gil-Guiñon, Estel; Gabernet, Gisela; García-Belinchón, Mercè; Sánchez-Osuna, María; Casanelles, Elisenda; Comella, Joan X.; Yuste, Victor J.
2012-01-01
Apoptotic cell death is characterized by nuclear fragmentation and oligonucleosomal DNA degradation, mediated by the caspase-dependent specific activation of DFF40/CAD endonuclease. Here, we describe how, upon apoptotic stimuli, SK-N-AS human neuroblastoma-derived cells show apoptotic nuclear morphology without displaying concomitant internucleosomal DNA fragmentation. Cytotoxicity afforded after staurosporine treatment is comparable with that obtained in SH-SY5Y cells, which exhibit a complete apoptotic phenotype. SK-N-AS cell death is a caspase-dependent process that can be impaired by the pan-caspase inhibitor q-VD-OPh. The endogenous inhibitor of DFF40/CAD, ICAD, is correctly processed, and dff40/cad cDNA sequence does not reveal mutations altering its amino acid composition. Biochemical approaches show that both SH-SY5Y and SK-N-AS resting cells express comparable levels of DFF40/CAD. However, the endonuclease is poorly expressed in the cytosolic fraction of healthy SK-N-AS cells. Despite this differential subcellular distribution of DFF40/CAD, we find no differences in the subcellular localization of both pro-caspase-3 and ICAD between the analyzed cell lines. After staurosporine treatment, the preferential processing of ICAD in the cytosolic fraction allows the translocation of DFF40/CAD from this fraction to a chromatin-enriched one. Therefore, the low levels of cytosolic DFF40/CAD detected in SK-N-AS cells determine the absence of DNA laddering after staurosporine treatment. In these cells DFF40/CAD cytosolic levels can be restored by the overexpression of their own endonuclease, which is sufficient to make them proficient at degrading their chromatin into oligonucleosome-size fragments after staurosporine treatment. Altogether, the cytosolic levels of DFF40/CAD are determinants in achieving a complete apoptotic phenotype, including oligonucleosomal DNA degradation. PMID:22253444
Directory of Open Access Journals (Sweden)
Willbold Dieter
2003-05-01
Full Text Available Abstract Background Protein tyrosine kinases are involved in signal transduction pathways that regulate cell growth, differentiation, activation and transformation. Human lymphocyte specific kinase (Lck is a 56 kDa protein involved in T-cell- and IL2-receptor signaling. Three-dimensional structures are known for SH3, SH2 and kinase domains of Lck as well as for other tyrosine kinases. No structure is known for the unique domain of any Src-type tyrosine kinase. Results Lck(1–120 comprising unique and SH3 domains was structurally investigated by nuclear magnetic resonance spectroscopy. We found the unique domain, in contrast to the SH3 part, to have basically no defined structural elements. The solution structure of the SH3 part could be determined with very high precision. It does not show significant differences to Lck SH3 in the absence of the unique domain. Minor differences were observed to the X-ray structure of Lck SH3. Conclusion The unique domain of Lck does not contain any defined structure elements in the absence of ligands and membranes. Presence of the unique domain is not relevant to the three-dimensional structure of the Lck SH3 domain.
Analgesic treatment of ciguatoxin-induced cold allodynia.
Zimmermann, Katharina; Deuis, Jennifer R; Inserra, Marco C; Collins, Lindon S; Namer, Barbara; Cabot, Peter J; Reeh, Peter W; Lewis, Richard J; Vetter, Irina
2013-10-01
Ciguatera, the most common form of nonbacterial ichthyosarcotoxism, is caused by consumption of fish that have bioaccumulated the polyether sodium channel activator ciguatoxin. The neurological symptoms of ciguatera include distressing, often persistent sensory disturbances such as paraesthesias and the pathognomonic symptom of cold allodynia. We show that intracutaneous administration of ciguatoxin in humans elicits a pronounced axon-reflex flare and replicates cold allodynia. To identify compounds able to inhibit ciguatoxin-induced Nav responses, we developed a novel in vitro ciguatoxin assay using the human neuroblastoma cell line SH-SY5Y. Pharmacological characterisation of this assay demonstrated a major contribution of Nav1.2 and Nav1.3, but not Nav1.7, to ciguatoxin-induced Ca2+ responses. Clinically available Nav inhibitors, as well as the Kv7 agonist flupirtine, inhibited tetrodotoxin-sensitive ciguatoxin-evoked responses. To establish their in vivo efficacy, we used a novel animal model of ciguatoxin-induced cold allodynia. However, differences in the efficacy of these compounds to reverse ciguatoxin-induced cold allodynia did not correlate with their potency to inhibit ciguatoxin-induced responses in SH-SY5Y cells or at heterologously expressed Nav1.3, Nav1.6, Nav1.7, or Nav1.8, indicating cold allodynia might be more complex than simple activation of Nav channels. These findings highlight the need for suitable animal models to guide the empiric choice of analgesics, and suggest that lamotrigine and flupirtine could be potentially useful for the treatment of ciguatera. Copyright © 2013 International Association for the Study of Pain. Published by Elsevier B.V. All rights reserved.
Dioxin induces expression of hsa-miR-146b-5p in human neuroblastoma cells.
Xu, Tuan; Xie, Heidi Q; Li, Yunping; Xia, Yingjie; Sha, Rui; Wang, Lingyun; Chen, Yangsheng; Xu, Li; Zhao, Bin
2018-01-01
Dioxin can cause a series of neural toxicological effects. MicroRNAs (miRs) play important roles in regulating nervous system function and mediating cellular responses to environmental pollutants, such as dioxin. Hsa-miR-146b-5p appears to be involved in neurodegenerative diseases and brain tumors. However, little is known about effects of dioxin on the expression of hsa-miR-146b-5p. We found that the hsa-miR-146b-5p expression and its promoter activity were significantly increased in dioxin treated SK-N-SH cells, a human-derived neuroblastoma cell line. Potential roles of hsa-miR-146b-5p in mediating neural toxicological effects of dioxin may be due to the regulation of certain target genes. We further confirmed that hsa-miR-146b-5p significantly suppressed acetylcholinesterase (AChE) activity and targeted the 3'-untranslated region of the AChE T subunit, which has been down-regulated in dioxin treated SK-N-SH cells. Functional bioinformatic analysis showed that the known and predicted target genes of hsa-miR-146b-5p were involved in some brain functions or cyto-toxicities related to known dioxin effects, including synapse transmission, in which AChE may serve as a responsive gene for mediating the effect. Copyright © 2017. Published by Elsevier B.V.
Nrf2 signaling contributes to the neuroprotective effects of urate against 6-OHDA toxicity.
Directory of Open Access Journals (Sweden)
Ning Zhang
Full Text Available BACKGROUND: Mounting evidence shows that urate may become a biomarker of Parkinson's disease (PD diagnosis and prognosis and a neuroprotectant candidate for PD therapy. However, the cellular and molecular mechanisms underlying its neuroprotective actions remain poorly understood. RESULTS: In this study, we showed that urate pretreatment protected dopaminergic cell line (SH-SY5Y and MES23.5 against 6-hydroxydopamine (6-OHDA- and hydrogen peroxide- induced cell damage. Urate was found to be accumulated into SH-SY5Y cells after 30 min treatment. Moreover, urate induced NF-E2-related factor 2 (Nrf2 accumulation by inhibiting its ubiquitinationa and degradation, and also promoted its nuclear translocation; however, it did not modulate Nrf2 mRNA level or Kelch-like ECH-associated protein 1 (Keap1 expression. In addition, urate markedly up-regulated the transcription and protein expression of γ-glutamate-cysteine ligase catalytic subunit (γ-GCLC and heme oxygenase-1 (HO-1, both of which are controlled by Nrf2 activity. Furthermore, Nrf2 knockdown by siRNA abolished the intracellular glutathione augmentation and the protection exerted by urate pretreatment. CONCLUSION: Our findings demonstrated that urate treatment may result in Nrf2-targeted anti-oxidant genes transcription and expression by reducing Nrf2 ubiquitination and degradation and promoting its nuclear translocation, and thus offer neuroprotection on dopaminergic cells against oxidative stresses.
International Nuclear Information System (INIS)
Hwang, Yong Pil; Kim, Hyung Gyun; Han, Eun Hee; Jeong, Hye Gwang
2008-01-01
The zinc-binding protein metallothionein-III (MT-III) is associated with resistance to neuronal injury. However, the underlying mechanism for its effects is unclear. In this study, we demonstrate that MT-III prevents the accumulation of reactive oxygen species (ROS) in dopaminergic SH-SY5Y cells challenged with the Parkinson's disease-related neurotoxin 6-hydroxydopamine (6-OHDA) by a mechanism that involves phosphatidylinositol 3-kinase (PI3K) and ERK kinase/NF-E2-related factor 2 (Nrf2) dependent induction of the stress response protein heme oxygenase-1 (HO-1). Pretreatment of SH-SY5Y cells with MT-III significantly reduced 6-OHDA-induced generation of ROS, caspase-3 activation, and subsequent cell death. Also, MT-III up-regulates HO-1 expression and this expression confers neuroprotection against oxidative injury induced by 6-OHDA. Moreover, MT-III induces Nrf2 nuclear translocation, which is upstream of MT-III-induced HO-1 expression, and PI3K and ERK1/2 activation, a pathway that is involved in induced Nrf2 nuclear translocation, HO-1 expression and neuroprotection. Taken together, these results suggest that the PI3K and ERK/Nrf2 signaling pathway controls the intracellular levels of ROS by regulating the expression of the antioxidant enzyme HO-1
Micro deletion in the y-chromosome of egyptian infertile men
International Nuclear Information System (INIS)
El-maghraby, T.; Hussein, A.H.; El-sayed, N.M.; Elghandor, T.
2003-01-01
The present investigation was designed to study the microdeletions in 5 different sites of azoospermia factor (AZF) in y-chromosome, SY 239, SY 254, SY 277, SY 283 in AZFc and SY 133 in AZFcb region using polymerase chain reactions. The present investigation included also measuring the levels of FSH, LH, testosterone and prolactin. Semen orgasm and cytogenetic analysis were also done. The study included 50 Egyptian men, 30 patients with azoospermia or oligospermia and 20 fertile men as control. Patients were classified into 2 groups, one having sertoli cells only (SCO) and the other suffering from maturation arrest (MA) according to testis biopsies. Three patients from SCO have been exposed to radiotherapy for different reasons. Results revealed that 13.3% of infertile men (SCO and MA) showed Y microdeletions (15% and 10% respectively). Moreover, SY 239 and SY 254 in DAZ gene were the common microdeletion sitesa more in patients of the present study. However, SY 133 microdeletion was detected in SCO patients only. As expected, there were highly significant increases in serum FSH and LH in SCO group compared with normal and MA groups. PCR based assay is important to detect microdeletions in AZF region of Y-chromosome in non-idiopathic infertile men
Di Crescenzo, A.; Cacciatore, I.; Petrini, M.; D'Alessandro, M.; Petragnani, N.; Del Boccio, P.; Di Profio, P.; Boncompagni, S.; Spoto, G.; Turkez, H.; Ballerini, P.; Di Stefano, A.; Fontana, A.
2017-01-01
We report the facile and non-covalent preparation of gold nanoparticles (AuNPs) stabilized by an antiparkinson codrug based on lipoic acid (LA). The obtained AuNPs appear stable in both dimethyl sulfoxide and fetal bovine serum and able to load an amount of codrug double the weight of gold. These NPs were demonstrated to be safe and biocompatible towards primary human blood cells and human neuroblastoma cells, one of the most widely used cellular models to study dopaminergic neural cells, therefore are ideal drug carriers for difficult to solubilize molecules. Very interestingly, the codrug-stabilized AuNPs were shown to reduce the accumulation of reactive oxygen species in SH-SY5Y cells treated with LD and did not change total oxidant status levels in cultured human blood cells, thus confirming the antioxidant role of LA although bound to AuNPs. The characterization of AuNPs in terms of loading and stability paves the way for their use in biomedical and pharmacological applications.
Nalvarte, Ivan; Damdimopoulos, Anastasios E.; Rüegg, Joëlle; Spyrou, Giannis
2015-01-01
The mammalian redox-active selenoprotein thioredoxin reductase (TrxR1) is a main player in redox homoeostasis. It transfers electrons from NADPH to a large variety of substrates, particularly to those containing redox-active cysteines. Previously, we reported that the classical form of cytosolic TrxR1 (TXNRD1_v1), when overexpressed in human embryonic kidney cells (HEK-293), prompted the cells to undergo differentiation [Nalvarte et al. (2004) J. Biol. Chem. 279, 54510–54517]. In the present study, we show that several genes associated with differentiation and adhesion are differentially expressed in HEK-293 cells stably overexpressing TXNRD1_v1 compared with cells expressing its splice variant TXNRD1_v2. Overexpression of these two splice forms resulted in distinctive effects on various aspects of cellular functions including gene regulation patterns, alteration of growth rate, migration and morphology and susceptibility to selenium-induced toxicity. Furthermore, differentiation of the neuroblastoma cell line SH-SY5Y induced by all-trans retinoic acid (ATRA) increased both TXNRD1_v1 and TXNRD1_v2 expressions along with several of the identified genes associated with differentiation and adhesion. Selenium supplementation in the SH-SY5Y cells also induced a differentiated morphology and changed expression of the adhesion protein fibronectin 1 and the differentiation marker cadherin 11, as well as different temporal expression of the studied TXNRD1 variants. These data suggest that both TXNRD1_v1 and TXNRD1_v2 have distinct roles in differentiation, possibly by altering the expression of the genes associated with differentiation, and further emphasize the importance in distinguishing each unique action of different TrxR1 splice forms, especially when studying the gene silencing or knockout of TrxR1. PMID:26464515
Desulfurization of dibenzothiophene by Corynebacterium sp. strain SY1
International Nuclear Information System (INIS)
Omori, Toshio; Monna, L.; Saiki, Yuko; Kodama, Tohru
1992-01-01
Strain SY1, identified as a Corynebacterium sp., was isolated on the basis of the ability to utilize dibenzothiophene (DBT) as a sole source of sulfur. Strain SY1 could utilize a wide range of organic and inorganic sulfur compounds, such as DBT sulfone, dimethyl sulfide, dimethyl sulfoxide, dimethyl sulfone, CS 2 , FeS 2 , and even elemental sulfur. Strain SY1 metabolized DBT to dibenzothiophene-5-oxide, DBT sulfone, and 2-hydroxybiphenyl, which was subsequently nitrated to produce at least two different hydroxynitrobiphenyls during cultivation. These metabolites were separated by silica gel column chromatography and identified by nuclear magnetic resonance, UV, and mass spectral techniques. Resting cells of SY1 desulfurized toluenesulfonic acid and released sulfite anion. On the basis of these results, a new DBT degradation pathway is proposed
Directory of Open Access Journals (Sweden)
Sanna V
2014-10-01
Full Text Available Vanna Sanna,1,2 Nicolino Pala,1 Giuseppina Dessì,1 Paola Manconi,1 Alberto Mariani,1 Sonia Dedola,3 Mauro Rassu,3 Claudia Crosio,3 Ciro Iaccarino,3 Mario Sechi1,2 1Department of Chemistry and Pharmacy, University of Sassari, Sassari, Italy; 2Laboratory of Nanomedicine, Department of Chemistry and Pharmacy, University of Sassari, c/o Porto Conte Ricerche, Tramariglio, Alghero, Italy; 3Department of Biomedical Sciences, University of Sassari, Sassari, Italy Background: Gold nanoparticles (GNPs are likely to provide an attractive platform for combining a variety of biophysicochemical properties into a unified nanodevice with great therapeutic potential. In this study we investigated the capabilities of three different natural polyphenols, epigallocatechin-3-gallate (EGCG, resveratrol (RSV, and fisetin (FS, to allow synergistic chemical reduction of gold salts to GNPs and stabilization in a single-step green process. Moreover, antioxidant properties of the nanosystems, as well as preliminary antiproliferative activity and apoptotic process investigation of model EGCG-GNPs on stable clones of neuroblastoma SH-SY5Y cells expressing CFP-DEVD-YFP reporter, were examined. Methods: The GNPs were characterized by physicochemical techniques, polyphenol content, and in vitro stability. The antioxidant activity of the GNPs was also determined by 2,2-diphenyl-1-picrylhydrazyl (DPPH and 2,2'-azinobis(3-ethylbenzothiazoline-6-sulfonic acid cation (ABTS radical-scavenging assays. Stable clones of neuronal SH-SY5Y-CFP-DEVD-YFP were generated and characterized, and cell viability after treatment with EGCG-GNPs was assessed after 72 hours through a 3(4,5-dimethylthiazol-2yl-5-(3-carboxymethoxyphenyl-2-(4-sulfophenyl-2H-tetrazolium assay. Activation of the apoptotic pathways was also investigated by Western blot analysis. Results: With a diameter in the size range of 10–25 nm, the obtained nanoparticles (NPs were found to contain 2.71%, 3.23%, and 5.47% of EGCG
[Similarity of cycloprolylglycine to piracetam in antihypoxic and neuroprotective effects].
Kolisnikova, K N; Gudasheva, T A; Nazarova, G A; Antipov, T A; Voronina, T A; Seredenin, S B
2012-01-01
The antihypoxic activity of the endogenous cyclic dipeptide cycloprolylglycine (CPG) has been studied on a model of normobaric hypoxia with hypercapnia and its neuroprotective activity has been studied on a model of human neuroblastoma SH-SY5Y cell damage by 6-hydroxydopamine. It is established that CPG exhibits the antihypoxic activity at doses of 0.5 and 1.0 mg/kg (i.p.) on outbred and BALB/c mice, but not on C57B1/6 mice. The neuroprotective activity of CPG was detected in 10(-5) - 10(-8) M concentration range only when the treatment was carried out 24h before toxin introduction. The obtained data confirm the hypothesis that piracetam is a mimetic of the endogenous CPG neuropeptide.
Dhaouadi, Karima; Raboudi, Faten; Estevan, Carmen; Barrajón, Enrique; Vilanova, Eugenio; Hamdaoui, Mohamed; Fattouch, Sami
2011-01-12
The aqueous-acetone polyphenolic extract of the traditionally derived date syrup, known as "Rub El Tamer", was analyzed using RP-HPLC-DAD and ESI-MS. The phenolic content of the extract was 394.53 ± 1.13 mg per 100 g of syrup with caffeoylsinapylquinic acid as the most abundant compound (72.23%). The extract exhibited strong antioxidant activities as evaluated using the ABTS (2,2'-azinobis(3-ethylbenzothiazoline-6-sulfonic acid)), DPPH (2,2-diphenyl-1-picrylhydrazyl) and FRAP (ferric reducing antioxidant power) methods. The extract antimicrobial potential against a range of microorganism strains showed that Staphylococcus aureus, Staphylococcus epidermidis, and Bacillus cereus were the most sensitive bacteria with MBC in the range of 0.5-0.05 mg/mL. Furthermore, in the presence of the syrup extract (8.18-131 μg/mL), the Human SH-SY5Y neuroblastoma and the 3T3 fibroblast cell lines showed dissimilar reduction of viability suggesting a higher cytotoxic effect against tumorigenic cells. Our results provide new insights into date syrup characterization which should stimulate further studies of this hot desert resource.
Jeon, Songhee; Hur, Jinyoung; Jeong, Ha Jin; Koo, Byung-Soo; Pak, Sok Cheon
2011-01-01
SuHeXiang Wan (SHXW), a traditional Chinese medicine, has been used orally for the treatment of seizures, infantile convulsions and stroke. Previously, we reported the effects of a modified SHXW essential oil in terms of sedative effect, anticonvulsant activity and antioxidative activity. The purpose of this study was to evaluate the potential beneficial effects of SHXW essential oil in neurodegenerative diseases such as Alzheimer's disease (AD). SHXW essential oil was extracted from nine herbs. The mouse AD model was induced by a single injection of amyloid β protein (Aβ(1-42)) into the hippocampus. The animals were divided into four groups, the negative control group injected with Aβ(42-1), the Aβ group injected with Aβ(1-42), the SHXW group inhaled SHXW essential oil and received Aβ(1-42) injection, and the positive control group administered with docosahexaenoic acid (DHA, 10 mg/kg) and with subsequent Aβ(1-42) injection. Mice were analyzed by behavioral tests and immunological examination in the hippocampus. An additional in vitro investigation was performed to examine whether SHXW essential oil inhibits Aβ(1-42) induced neurotoxicity in a human neuroblastoma cell line, SH-SY5Y cells. Pre-inhalation of SHXW essential oil improved the Aβ(1-42) induced memory impairment and suppressed Aβ(1-42) induced JNK, p38 and Tau phosphorylation in the hippocampus. SHXW essential oil suppressed Aβ-induced apoptosis and ROS production via an up-regulation of HO-1 and Nrf2 expression in SH-SY5Y cells. The present study suggests that SHXW essential oil may have potential as a therapeutic inhalation drug for the prevention and treatment of AD.
Steviol Glycosides Modulate Glucose Transport in Different Cell Types
Rizzo, Benedetta; Zambonin, Laura; Leoncini, Emanuela; Vieceli Dalla Sega, Francesco; Prata, Cecilia; Fiorentini, Diana; Hrelia, Silvana
2013-01-01
Extracts from Stevia rebaudiana Bertoni, a plant native to Central and South America, have been used as a sweetener since ancient times. Currently, Stevia extracts are largely used as a noncaloric high-potency biosweetener alternative to sugar, due to the growing incidence of type 2 diabetes mellitus, obesity, and metabolic disorders worldwide. Despite the large number of studies on Stevia and steviol glycosides in vivo, little is reported concerning the cellular and molecular mechanisms underpinning the beneficial effects on human health. The effect of four commercial Stevia extracts on glucose transport activity was evaluated in HL-60 human leukaemia and in SH-SY5Y human neuroblastoma cells. The extracts were able to enhance glucose uptake in both cellular lines, as efficiently as insulin. Our data suggest that steviol glycosides could act by modulating GLUT translocation through the PI3K/Akt pathway since treatments with both insulin and Stevia extracts increased the phosphorylation of PI3K and Akt. Furthermore, Stevia extracts were able to revert the effect of the reduction of glucose uptake caused by methylglyoxal, an inhibitor of the insulin receptor/PI3K/Akt pathway. These results corroborate the hypothesis that Stevia extracts could mimic insulin effects modulating PI3K/Akt pathway. PMID:24327825
Rösner, H; Williams, L A; Jung, A; Kraus, W
2001-08-22
Dibenzyl trisulphide (DTS), a main lipophilic compound in Petiveria alliacea L. (Phytolaccaceae), was identified as one of the active immunomodulatory compounds in extracts of the plant. To learn more about its biological activities and molecular mechanisms, we conducted one-dimensional NMR interaction studies with bovine serum albumin (BSA) and tested DTS and related compounds in two well-established neuronal cell-and-tissue culture systems. We found that DTS preferentially binds to an aromatic region of BSA which is rich in tyrosyl residues. In SH-SY5Y neuroblastoma cells, DTS attenuates the dephosphorylation of tyrosyl residues of MAP kinase (erk1/erk2). In the same neuroblastoma cell line and in Wistar 38 human lung fibroblasts, DTS causes a reversible disassembly of microtubules, but it did not affect actin dynamics. Probably due to the disruption of the microtubule dynamics, DTS also inhibits neuroblastoma cell proliferation and neurite outgrowth from spinal cord explants. Related dibenzyl compounds with none, one, or two sulphur atoms were found to be significantly less effective. These data confirmed that the natural compound DTS has a diverse spectrum of biological properties, including cytostatic and neurotoxic actions in addition to immunomodulatory activities.
Directory of Open Access Journals (Sweden)
Kwang Min Lee
2017-09-01
Full Text Available Oxidative stress plays a significant role in the etiology of a variety of neurodegenerative diseases. In this study, we found that Melandrii Herba extract (ME attenuated oxidative-induced damage in cells. Mechanistically, ME exhibited protection from H2O2-induced neurotoxicity via caspase-3 inactivation, Bcl-2 downregulation, Bax upregulation, and MAPK activation (ERK 1/2, JNK 1/2, and p38 MAPK in vitro. Moreover, our in vivo data showed that ME was able to attenuate scopolamine-induced cognitive impairment. These results provide in vitro and in vivo evidence that ME exhibits neuroprotective properties against oxidative stress, which suggests that ME is worthy of further investigation as a complementary, or even as an alternative, product for preventing and treating neurodegenerative disorders.
Friedemann, Thomas; Otto, Benjamin; Klätschke, Kristin; Schumacher, Udo; Tao, Yi; Leung, Alexander Kai-Man; Efferth, Thomas; Schröder, Sven
2014-08-08
The dried rhizome of Coptis chinensis Franch. (family Ranunculaceae) is traditionally used in Chinese medicine for the treatment of inflammatory diseases and diabetes. Recent studies showed a variety of activities of Coptis chinensis Franch. alkaloids, including neuroprotective, neuroregenerative, anti-diabetic, anti-oxidative and anti-inflammatory effects. However, there is no report on the neuroprotective effect of Coptis chinensis Franch. watery extract against tert-butylhydroperoxide (t-BOOH) induced oxidative damage. The aim of the study is to investigate neuroprotective properties of Coptis chinensis Franch. rhizome watery extract (CRE) and to evaluate its potential mechanism of action. Neuroprotective properties on t-BOOH induced oxidative stress were investigated in SH-SY5Y human neuroblastoma cells. Cells were pretreated with CRE for 2 h or 24 h followed by 2 h of treatment with t-BOOH. To evaluate the neuroprotective effect of CRE, cell viability, cellular reactive oxygen species (ROS), mitochondrial membrane potential (MMP) and the apoptotic rate were determined and microarray analyses, as well as qRT-PCR analyses were conducted. Two hours of exposure to 100 µM t-BOOH resulted in a significant reduction of cell viability, increased apoptotic rate, declined mitochondrial membrane potential (MMP) and increased ROS production. Reduction of cell viability, increased apoptotic rate and declined mitochondrial membrane potential (MMP) could be significantly reduced in cells pretreated with CRE (100 µg/ml) for 2h or 24h ahead of t-BOOH exposure with the greatest effect after 24h of pretreatment; however ROS production was not changed significantly. Furthermore, microarray analyses revealed that the expressions of 2 genes; thioredoxin-interacting protein (TXNIP) and mitochondrially encoded NADH dehydrogenase 1, were significantly regulated. Down regulation of TXNIP was confirmed by qRT-PCR. Due to its neuroprotective properties CRE might be a potential
Eliassen, Liv Tone; Berge, Gerd; Leknessund, Arild; Wikman, Mari; Lindin, Inger; Løkke, Cecilie; Ponthan, Frida; Johnsen, John Inge; Sveinbjørnsson, Baldur; Kogner, Per; Flaegstad, Trond; Rekdal, Øystein
2006-08-01
Antimicrobial peptides have been shown to exert cytotoxic activity towards cancer cells through their ability to interact with negatively charged cell membranes. In this study the cytotoxic effect of the antimicrobial peptide, LfcinB was tested in a panel of human neuroblastoma cell lines. LfcinB displayed a selective cytotoxic activity against both MYCN-amplified and non-MYCN-amplified cell lines. Non-transformed fibroblasts were not substantially affected by LfcinB. Treatment of neuroblastoma cells with LfcinB induced rapid destabilization of the cytoplasmic membrane and formation of membrane blebs. Depolarization of the mitochondria membranes and irreversible changes in the mitochondria morphology was also evident. Immuno- and fluorescence-labeled LfcinB revealed that the peptide co-localized with mitochondria. Furthermore, treatment of neuroblastoma cells with LfcinB induced cleavage of caspase-6, -7 and -9 followed by cell death. However, neither addition of the pan-caspase inhibitor, zVAD-fmk, or specific caspase inhibitors could reverse the cytotoxic effect induced by LfcinB. Treatment of established SH-SY-5Y neuroblastoma xenografts with repeated injections of LfcinB resulted in significant tumor growth inhibition. These results revealed a selective destabilizing effect of LfcinB on two important targets in the neuroblastoma cells, the cytoplasmic- and the mitochondria membrane. Copyright (c) 2006 Wiley-Liss, Inc.
International Nuclear Information System (INIS)
Chiueh, C.C.; Andoh, Tsugunobu; Chock, P. Boon
2005-01-01
Hormesis, a stress tolerance, can be induced by ischemic preconditioning stress. In addition to preconditioning, it may be induced by other means, such as gas anesthetics. Preconditioning mechanisms, which may be mediated by reprogramming survival genes and proteins, are obscure. A known neurotoxicant, 1-Methyl-4-phenyl-1,2,3,6-tetrahydropyridine (MPTP), causes less neurotoxicity in the mice that are preconditioned. Pharmacological evidences suggest that the signaling pathway of ·NO-cGMP-PKG (protein kinase G) may mediate preconditioning phenomenon. We developed a human SH-SY5Y cell model for investigating · NO-mediated signaling pathway, gene regulation, and protein expression following a sublethal preconditioning stress caused by a brief 2-h serum deprivation. Preconditioned human SH-SY5Y cells are more resistant against severe oxidative stress and apoptosis caused by lethal serum deprivation and 1-mehtyl-4-phenylpyridinium (MPP + ). Both sublethal and lethal oxidative stress caused by serum withdrawal increased neuronal nitric oxide synthase (nNOS/NOS1) expression and · NO levels to a similar extent. In addition to free radical scavengers, inhibition of nNOS, guanylyl cyclase, and PKG blocks hormesis induced by preconditioning. S-nitrosothiols and 6-Br-cGMP produce a cytoprotection mimicking the action of preconditioning tolerance. There are two distinct cGMP-mediated survival pathways: (i) the up-regulation of a redox protein thioredoxin (Trx) for elevating mitochondrial levels of antioxidant protein Mn superoxide dismutase (MnSOD) and antiapoptotic protein Bcl-2, and (ii) the activation of mitochondrial ATP-sensitive potassium channels [K(ATP)]. Preconditioning induction of Trx increased tolerance against MPP + , which was blocked by Trx mRNA antisense oligonucleotide and Trx reductase inhibitor. It is concluded that Trx plays a pivotal role in · NO-dependent preconditioning hormesis against MPTP/MPP +
SH2 dependent autophosphorylation within the Tec family kinase Itk
Joseph, Raji E.; Severin, Andrew; Min, Lie; Fulton, D. Bruce; Andreotti, Amy H.
2009-01-01
The Tec family kinase, Itk, undergoes an in cis autophosphorylation on Y180 within its SH3 domain. Autophosphorylation of the Itk SH3 domain by the Itk kinase domain is strictly dependent on the presence of the intervening SH2 domain. A direct docking interaction between the Itk kinase and SH2 domains brings the Itk SH3 domain into the active site where Y180 is then phosphorylated. We now identify the residues on the surface of the Itk SH2 domain responsible for substrate docking and show that this SH2 surface mediates autophosphorylation in the full length Itk molecule. The canonical phospholigand binding site on the SH2 domain is not involved in substrate docking, instead the docking site consists of side chains from three loop regions (AB, EF and BG) and part of the βD strand. These results are extended into Btk, a Tec family kinase linked to the B cell deficiency X-linked agammaglobulinemia (XLA). Our results suggest that some XLA causing mutations might impair Btk phosphorylation. PMID:19523959
Huang, Xiaoli; Borgström, Björn; Månsson, Linda; Persson, Lo; Oredsson, Stina; Hegardt, Cecilia; Strand, Daniel
2014-07-18
Salinomycin, a naturally occurring polyether ionophore was recently found to selectively reduce the proportion of CD44(+)/CD24(-) cells, a phenotype associated with breast cancer stem cells. Subsequent studies from our group showed that chemical modification of the allylic C20 hydroxyl of salinomycin, located at the C-ring, can enhance the activity of derivatives against breast cancer cells over 5-fold compared to the native structure. Access to C-ring-modified salinomycin analogues is thus of interest from both a mechanistic and a synthetic perspective. Here, we report efficient strategies for gram scale synthesis of the natural product SY-1 (20-deoxy salinomycin), and a saturated analogue, 18,19-dihydro SY-1, for a comparative in vitro investigation of the biological profiles of these compounds with that of salinomycin. Across several assays, the deoxygenated structures required higher concentrations to elicit similar cellular responses to that of salinomycin. Similarly to salinomycin, SY-1 or 18,19-dihydro SY-1 treatment was found to reduce the proportion of CD44(+)/CD24(-) cells with essentially complete selectivity up to ∼IC25. Importantly, the proportion of CD44(+)/CD24(-) cells showed a pronounced U-shaped dose response curve for salinomycin and its derivatives, but not for paclitaxel. The concentration for maximum response in this assay followed differences in IC50 for salinomycin and its analogues, which emphasizes the importance of taking concentration dependence into account when comparing effects on the CD44(+)/CD24(-) phenotype. Small differences in the global conformation within the triad of compounds investigated together with differences in activity across assays emphasize the importance of substitution at C20 for the activity of salinomycin and its derivatives.
Zeng, J Q; Wu, J Q; Li, M H; Wang, P J
2017-11-07
Objective: To construct magnetic nanoparticles targeting β-amyloid (Aβ) plaques, the pathological biomarker of Alzheimer's disease (AD) and to study their binding capability in vitro . Methods: Superparamagnetic nanoparticles Mn(0.6)Zn(0.4)Fe(2)O(4) (MZF) were coated with amphiphilic star-block copolymeric micelles and modified with Aβ-specific probe Pittsburgh compound B (PiB) to construct a novel magnetic nanoparticle MZF-PiB, which specifically targeted amyloid plaques. Transmission electron microscope was used to study the morphological features of MZF-PiB. Superparamagnetism of MZF-PiB was assessed by its r(2) relaxation rate by using 3.0 T MRI scanner. Cytotoxic test was applied to determine biosafety of MZF-PiB nanoparticles in differentiated human neuroblastoma cells (SH-SY5Y) and Madin-Darby canine kidney (MDCK). In vitro binding tests were conducted via immunohistochemistry on 6-month old AD mice brain sections. Differences of cell viability between groups were compared with one-way analysis of variance. Results: MZF-PiB nanoparticles were successfully constructed. Transmission electron microscope images showed that the nanoparticles were about 100 nm in size. The r(2) relaxation rate was 163.11 mMS(-1). No differences were found in cell viability of SH-SY5Y and MDCK incubated with MZF-PiB suspension for 24 h or 48 h when compared with those of untreated cells ( F =2.336, 2.539, 0.293, 1.493, all P >0.05). In vitro binding tests indicated that the MZF-PiB were specifically bound to amyloid plaques. The smallest size of detected plaques was 27 μm. Conclusion: PiB-modified nanoparticles targeting Aβ are biologically safe and highly superparamagnetic, possessing the capability to detect amyloid plaques early in vitro and the potential for early diagnosis of AD.
Directory of Open Access Journals (Sweden)
Vik-Mo Audun O
2006-10-01
Full Text Available Abstract Background The etiology of schizophrenia is unknown, but neurodevelopmental disturbances, myelin- and oligodendrocyte abnormalities and synaptic dysfunction have been suggested as pathophysiological factors in this severe psychiatric disorder. Cholesterol is an essential component of myelin and has proved important for synapse formation. Recently, we demonstrated that the antipsychotic drugs clozapine and haloperidol stimulate lipogenic gene expression in cultured glioma cells through activation of the sterol regulatory element-binding protein (SREBP transcription factors. We here compare the action of chlorpromazine, haloperidol, clozapine, olanzapine, risperidone and ziprasidone on SREBP activation and SREBP-controlled gene expression (ACAT2, HMGCR, HMGCS1, FDPS, SC5DL, DHCR7, LDLR, FASN and SCD1 in four CNS-relevant human cell lines. Results There were marked differences in the ability of the antipsychotic drugs to activate the expression of SREBP target genes, with clozapine and chlorpromazine as the most potent stimulators in a context of therapeutically relevant concentrations. Glial-like cells (GaMg glioma and CCF-STTG1 astrocytoma cell lines displayed more pronounced drug-induced SREBP activation compared to the response in HCN2 human cortical neurons and SH-SY5Y neuroblastoma cells, indicating that antipsychotic-induced activation of lipogenesis is most prominent in glial cells. Conclusion Our present data show a marked variation in the ability of different antipsychotics to induce SREBP-controlled transcriptional activation of lipogenesis in cultured human CNS-relevant cells. We propose that this effect could be relevant for the therapeutic efficacy of some antipsychotic drugs.
Oxidative stress reduces levels of dysbindin-1A via its PEST domain.
Yap, Mei-Yi Alicia; Lo, Yew-Long; Talbot, Konrad; Ong, Wei-Yi
2014-12-01
Oxidative stress resulting from the generation of reactive oxygen species has been proposed as an etiological factor in schizophrenia. The present study tests the hypothesis that oxidative stress can affect levels of dysbindin-1A, encoded by Dtnbp1, a genetic risk factor for schizophrenia, via its PEST domain. In vitro studies on SH-SY5Y cells indicate that oxidative stress triggers proteasomal degradation of dysbindin-1A, and that this requires interactions with its PEST domain, which may be a TRIM32 target. We specifically found (a) that oxidative stress induced in SH-SY5Y cells by 500 µM hydrogen peroxide reduced levels of full-length dysbindin-1, but did not reduce levels of that protein lacking its PEST domain and (b) that levels of full-length dysbindin-1, but not dysbindin-1 lacking its PEST domain, were higher in cells treated with the proteasome inhibitor MG132. Oxidative stress thus emerges as the first known cellular factor regulating dysbindin-1 isoforms with PEST domains. These findings are consistent with the previously noted fact that phosphorylation of PEST domains often marks proteins for proteasomal degradation, and raises the possibility that treatments reducing oxidative stress in the brain, especially during development, may lower schizophrenia risk. Copyright © 2014 Elsevier Ltd. All rights reserved.
International Nuclear Information System (INIS)
Kang, Wen; Mukerjee, Ruma; Gartner, Jared J.; Hatzigeorgiou, Artemis G.; Sandri-Goldin, Rozanne M.; Fraser, Nigel W.
2006-01-01
The latency-associated transcripts (LATs) of herpes simplex virus type-1 (HSV-1) are the only viral RNAs accumulating during latent infections in the sensory ganglia of the peripheral nervous system. The major form of LAT that accumulates in latently infected neurons is a 2 kb intron, spliced from a much less abundant 8.3 primary transcript. The spliced exon mRNA has been hard to detect. However, in this study, we have examined the spliced exon RNA in productively infected cells using ribonuclease protection (RPA), and quantitative RT-PCR (q-PCR) assays. We were able to detect the LAT exon RNA in productively infected SY5Y cells (a human neuronal cell line). The level of the LAT exon RNA was found to be approximately 5% that of the 2 kb intron RNA and thus is likely to be relatively unstable. Quantitative RT-PCR (q-PCR) assays were used to examine the LAT exon RNA and its properties. They confirmed that the LAT exon mRNA is present at a very low level in productively infected cells, compared to the levels of other viral transcripts. Furthermore, experiments showed that the LAT exon mRNA is expressed as a true late gene, and appears to be polyadenylated. In SY5Y cells, in contrast to most late viral transcripts, the LAT exon RNA was found to be mainly nuclear localized during the late stage of a productive infection. Interestingly, more LAT exon RNA was found in the cytoplasm in differentiated compared to undifferentiated SY5Y cells, suggesting the nucleocytoplasmic distribution of the LAT exon RNA and its related function may be influenced by the differentiation state of cells
Canaparo, Roberto; Varchi, Greta; Ballestri, Marco; Foglietta, Federica; Sotgiu, Giovanna; Guerrini, Andrea; Francovich, Andrea; Civera, Pierluigi; Frairia, Roberto; Serpe, Loredana
2013-01-01
Purpose Sonodynamic therapy is a developing noninvasive modality for cancer treatment, based on the selective activation of a sonosensitizer agent by acoustic cavitation. The activated sonosensitizer agent might generate reactive oxygen species leading to cancer cell death. We investigated the potential poly-methyl methacrylate core-shell nanoparticles (NPs) loaded with meso-tetrakis (4-sulfonatophenyl) porphyrin (TPPS) have to function as an innovative sonosensitizing system, ie, TPPS-NPs. Methods Shockwaves (SWs) generated by a piezoelectric device were used to induce acoustic cavitation. The cytotoxic effect of the sonodynamic treatment with TPPS-NPs and SWs was investigated on the human neuroblastoma cell line, SH-SY5Y. Cells were exposed for 12 hours to TPPS-NPs (100 μg/mL) and then to SWs (0.43 mJ/mm2 for 500 impulses, 4 impulses/second). Treatment with SWs, TPPS, and NPs alone or in combination was carried out as control. Results There was a statistically significant decrease in SH-SY5Y cell proliferation after the sonodynamic treatment with TPPS-NPs and SWs. Indeed, there was a significant increase in necrotic (16.91% ± 3.89%) and apoptotic (27.45% ± 3.03%) cells at 48 hours. Moreover, a 15-fold increase in reactive oxygen species production for cells exposed to TPPS-NPs and SWs was observed at 1 hour compared with untreated cells. A statistically significant enhanced mRNA (messenger ribonucleic acid) expression of NRF2 (P<0.001) and a significant downregulation of TIGAR (P<0.05) and MAP3K5 (P<0.05) genes was observed in cells exposed to TPPS-NPs and SWs at 24 hours, along with a statistically significant release of cytochrome c (P<0.01) at 48 hours. Lastly, the sonosensitizing system was also investigated in an in vitro three-dimensional model, and the sonodynamic treatment significantly decreased the neuroblastoma spheroid growth. Conclusion The sonosensitizing properties of TPPS were significantly enhanced once loaded onto NPs, thus enhancing the
Radiosensitization by overexpression of the nonphosphorylation form of IκB-α in human glioma cells
International Nuclear Information System (INIS)
Honda, Naoko; Yagi, Kasumi; Ding, Gui-Rong; Miyakoshi, Junji
2002-01-01
To assess the role of NF-κB in cellular radiosensitivity, we constructed mutated IκB expression plasmids for SY-IκB (with mutations at residues of 32, 36 and 42) expression in human malignant glioma cells (radiosensitive MO54 and radioresistant T98 cells), giving respective cell types referred to as MO54-SY4 and T98-SY14. Both of the clones expressing SY-IκB became radiosensitive, compared with the parental MO54 and T98 cells. A treatment with herbimycin A or genistein did not change the radiosensitivity of cells expressing SY-IκB, but made both the MO54 and T98 parental cells more sensitive to ionizing radiation. A treatment with TNF-α induced DNA fragmentation and apoptosis in cells expressing SY-IκB, but not in MO54 and T98 cells. The survival after X-ray exposure of the parental MO54 cells was slightly increased by a TNF-α treatment, but that of the parental T98 cells did not change. The change in sensitivity to ultra-violet (UV) radiation and adriamycin in MO54-SY4 cells was very similar to that for X-ray sensitivity, but no change was observed in T98-SY14 cells. Significant sublethal damage repair was observed in T98 cells, whereas MO54 cells showed little repair activity. The expression of p53 was enhanced in the parental MO54 cells, while the p53 levels in the MO54-SY4, and in the parent and clonal T98 cells, did not change. Our data suggest that the serine and tyrosine phosphorylation of IκB-α may play a role in determining the radiosensitivity of malignant glioma cells. (author)
A New Triterpene from Buddleja lindleyana with Neuroprotective Effect
Directory of Open Access Journals (Sweden)
Ya-Shuo Ren
2017-07-01
Full Text Available In the phytochemical investigation of Buddleja lindleyana , a new 3-acetyl substituted triterpene, 13, 28-epoxy-23-hydroxy-3β-acetoxy-olean-11-ene (1, together with four same skeleton type known compounds (2-5 were isolated. The structure of 1 was elucidated by means of extensive spectroscopic analysis. Their neuroprotective effect against 1-methyl-4 -phenylpyridinium ion-induced (MPP +-induced neurotoxicity in SH-SY5Y cells were evaluated. The structure activity relationship of compounds 1-5 has been discussed preliminarily.
Directory of Open Access Journals (Sweden)
Shiwang Li
Full Text Available Neuroblastoma is the most common extracranial solid tumor of childhood. It accounts for 15% of pediatric cancer deaths. Chemotherapy is the mainstay of treatment in children with advanced neuroblastoma. Noscapine, a nontoxic natural compound, can trigger apoptosis in many cancer types. We now show that p53 is dispensable for Noscapine-induced cell death in neuroblastoma cell lines, proapoptotic response to this promising chemopreventive agent is mediated by suppression of survivin protein expression. The Noscapine treatment increased levels of total and Ser(15-phosphorylated p53 protein in SK-SY5Y cells, but the proapoptotic response to this agent was maintained even after knockdown of the p53 protein level. Exposure of SK-SY5Y and LA1-5S cells to Noscapine resulted in a marked decrease in protein and mRNA level of survivin as early as 12 hours after treatment. Ectopic expression of survivin conferred statistically significant protection against Noscapine-mediated cytoplasmic histone-associated apoptotic DNA fragmentation. Also, the Noscapine-induced apoptosis was modestly but statistically significantly augmented by RNA interference of survivin in both cell lines. Furthermore, Noscapine-induced apoptotic cell death was associated with activation of caspase-3 and cleavage of PARP. In conclusion, the present study provides novel insight into the molecular circuitry of Noscapine-induced apoptosis to indicate suppression of survivin expression as a critical mediator of this process.
Fernandes, Carlos; Pinto, Miguel; Martins, Cláudia; Gomes, Maria João; Sarmento, Bruno; Oliveira, Paulo J; Remião, Fernando; Borges, Fernanda
2018-05-16
The uptake and transport of dietary antioxidants remains the most important setback for their application in therapy. To overcome the limitations, a PEGylated-based platform was developed to improve the delivery properties of two dietary hydroxycinnamic (HCA) antioxidants-caffeic and ferulic acids. The antioxidant properties of the new polymer-antioxidant conjugates (PEGAntiOxs), prepared by linking poly(ethylene glycol) (PEG) to the cinnamic acids by a one-step Knovenagel condensation reaction, were evaluated. PEGAntiOxs present a higher lipophilicity than the parent compounds (caffeic and ferulic acids) and similar, or higher, antioxidant properties. PEGAntiOxs were not cytotoxic at the tested concentrations in SH-SY5Y, Caco-2, and hCMEC/D3 cells. By contrast, cytotoxic effects in hCMEC/D3 and SH-SY5Y cells were observed, at 50 and 100 μM, for caffeic and ferulic acids. PEGAntiOxs operate as antioxidants against several oxidative stress-cellular inducers in a neuronal cell-based model, and were able to inhibit glycoprotein-P in Caco-2 cells. PEGAntiOxs can cross hCMEC/D3 monolayer cells, a model of the blood-brain barrier (BBB) endothelial membrane. In summary, PEGAntiOxs are valid antioxidant prototypes that can uphold the antioxidant properties of HCAs, reduce their cytotoxicity, and improve their BBB permeability. PEGAntiOxs can be used in the near future as drug candidates to prevent or slow oxidative stress associated with neurodegenerative diseases.
Garrity, P A; Rao, Y; Salecker, I; McGlade, J; Pawson, T; Zipursky, S L
1996-05-31
Mutations in the Drosophila gene dreadlocks (dock) disrupt photoreceptor cell (R cell) axon guidance and targeting. Genetic mosaic analysis and cell-type-specific expression of dock transgenes demonstrate dock is required in R cells for proper innervation. Dock protein contains one SH2 and three SH3 domains, implicating it in tyrosine kinase signaling, and is highly related to the human proto-oncogene Nck. Dock expression is detected in R cell growth cones in the target region. We propose Dock transmits signals in the growth cone in response to guidance and targeting cues. These findings provide an important step for dissection of signaling pathways regulating growth cone motility.
Effect of four medicinal plants on amyloid-beta induced neurotoxicity in SH-SY5Y Cells
CSIR Research Space (South Africa)
Adewusi, EA
2013-01-01
Full Text Available Amyloid-beta peptide (Aß) is implicated in the pathogenesis of Alzheimer’s disease (AD), a neurodegenerative disorder. This study was designed to determine the effect of four medicinal plants used to treat neurodegenerative diseases on Aß...
Odai, H; Sasaki, K; Iwamatsu, A; Nakamoto, T; Ueno, H; Yamagata, T; Mitani, K; Yazaki, Y; Hirai, H
1997-04-15
Grb2/Ash and Shc are the adapter proteins that link tyrosine-kinase receptors to Ras and make tyrosine-kinase functionally associated with receptors and Ras in fibroblasts and hematopoietic cells. Grb2/Ash and Shc have the SH3, SH2, or phosphotyrosine binding domains. These domains bind to proteins containing proline-rich regions or tyrosine-phosphorylated proteins and contribute to the association of Grb2/Ash and Shc with other signaling molecules. However, there could remain unidentified signaling molecules that physically and functionally interact with these adapter proteins and have biologically important roles in the signaling pathways. By using the GST fusion protein including the full length of Grb2/Ash, we have found that c-Cbl and an unidentified 135-kD protein (pp135) are associated with Grb2/Ash. We have also found that they become tyrosine-phosphorylated by treatment of a human leukemia cell line, UT-7, with granulocyte-macrophage colony-stimulating factor (GM-CSF). We have purified the pp135 by using GST-Grb2/Ash affinity column and have isolated the full-length complementary DNA (cDNA) encoding the pp135 using a cDNA probe, which was obtained by the degenerate polymerase chain reaction based on a peptide sequence of the purified pp135. The cloned cDNA has 3,958 nucleotides that contain a single long open reading frame of 3,567 nucleotides, encoding a 1,189 amino acid protein with a predicted molecular weight of approximately 133 kD. The deduced amino acid sequence reveals that pp135 is a protein that has one SH2, one SH3, and one proline-rich domain. The pp135, which contains two motifs conserved among the inositol polyphosphate-5-phosphatase proteins, was shown to have the inositol polyphosphate-5-phosphatase activity. The pp135 was revealed to associate constitutively with Grb2/Ash and inducibly with Shc using UT-7 cells stimulated with GM-CSF. In the cell lines derived from human chronic myelogenous leukemia, pp135 was constitutively tyrosine
Morris, David L.; Cho, Kae Won; Rui, Liangyou
2010-01-01
SH2B1 is an SH2 domain-containing adaptor protein that plays a key role in the regulation of energy and glucose metabolism in both rodents and humans. Genetic deletion of SH2B1 in mice results in obesity and type 2 diabetes. Single-nucleotide polymorphisms in the SH2B1 loci and chromosomal deletions of the SH2B1 loci associate with obesity and insulin resistance in humans. In cultured cells, SH2B1 promotes leptin and insulin signaling by binding via its SH2 domain to phosphorylated tyrosines ...
SH2-dependent autophosphorylation within the Tec family kinase Itk.
Joseph, Raji E; Severin, Andrew; Min, Lie; Fulton, D Bruce; Andreotti, Amy H
2009-08-07
The Tec family kinase, Itk (interleukin-2 tyrosine kinase), undergoes an in cis autophosphorylation on Y180 within its Src homology 3 (SH3) domain. Autophosphorylation of the Itk SH3 domain by the Itk kinase domain is strictly dependent on the presence of the intervening Src homology 2 (SH2) domain. A direct docking interaction between the Itk kinase and SH2 domains brings the Itk SH3 domain into the active site where Y180 is then phosphorylated. We now identify the residues on the surface of the Itk SH2 domain responsible for substrate docking and show that this SH2 surface mediates autophosphorylation in the full-length Itk molecule. The canonical phospholigand binding site on the SH2 domain is not involved in substrate docking, instead the docking site consists of side chains from three loop regions (AB, EF and BG) and part of the betaD strand. These results are extended into Btk (Bruton's tyrosine kinase), a Tec family kinase linked to the B-cell deficiency X-linked agammaglobulinemia (XLA). Our results suggest that some XLA-causing mutations might impair Btk phosphorylation.
Harvey, Benjamin S; Ohlsson, Katharina S; Mååg, Jesper L V; Musgrave, Ian F; Smid, Scott D
2012-01-01
Cannabinoids have been widely reported to have neuroprotective properties in vitro and in vivo. In this study we compared the effects of CB1 and CB2 receptor-selective ligands, the endocannabinoid anandamide and the phytocannabinoid cannabidiol, against oxidative stress and the toxic hallmark Alzheimer's protein, β-amyloid (Aβ) in neuronal cell lines. PC12 or SH-SY5Y cells were selectively exposed to either hydrogen peroxide, tert-butyl hydroperoxide or Aβ, alone or in the presence of the CB1 specific agonist arachidonyl-2'-chloroethylamide (ACEA), CB2 specific agonist JWH-015, anandamide or cannabidiol. Cannabidiol improved cell viability in response to tert-butyl hydroperoxide in PC12 and SH-SY5Y cells, while hydrogen peroxide-mediated toxicity was unaffected by cannabidiol pretreatment. Aβ exposure evoked a loss of cell viability in PC12 cells. Of the cannabinoids tested, only anandamide was able to inhibit Aβ-evoked neurotoxicity. ACEA had no effect on Aβ-evoked neurotoxicity, suggesting a CB1 receptor-independent effect of anandamide. JWH-015 pretreatment was also without protective influence on PC12 cells from either pro-oxidant or Aβ exposure. None of the cannabinoids directly inhibited or disrupted preformed Aβ fibrils and aggregates. In conclusion, the endocannabinoid anandamide protects neuronal cells from Aβ exposure via a pathway unrelated to CB1 or CB2 receptor activation. The protective effect of cannabidiol against oxidative stress does not confer protection against Aβ exposure, suggesting divergent pathways for neuroprotection of these two cannabinoids. Copyright © 2011 Elsevier Inc. All rights reserved.
Singh, Rahul; Gangwar, Vinod K.; Daga, D. D.; Singh, Abhishek; Ghosh, A. K.; Kumar, Manoranjan; Lakhani, A.; Singh, Rajeev; Chatterjee, Sandip
2018-03-01
The magneto-transport properties of Bi2Se3-ySy were investigated. Magnetoresistance (MR) decreases with an increase in the S content, and finally, for 7% (i.e., y = 0.21) S doping, the magnetoresistance becomes negative. This negative MR is unusual as it is observed when a magnetic field is applied in the perpendicular direction to the plane of the sample. The magneto-transport behavior shows the Shubnikov-de Haas (SdH) oscillation, indicating the coexistence of surface and bulk states. The negative MR has been attributed to the non-trivial bulk conduction.
Itakura, Masanori; Nakajima, Hidemitsu; Semi, Yuko; Higashida, Shusaku; Azuma, Yasu-Taka; Takeuchi, Tadayoshi
2015-11-13
The glycolytic enzyme glyceraldehyde-3-phosphate dehydrogenase (GAPDH) has multiple functions, including mediating oxidative stress-induced neuronal cell death. This process is associated with disulfide-bonded GAPDH aggregation. Some reports suggest a link between GAPDH and the pathogenesis of several oxidative stress-related diseases. However, the pathological significance of GAPDH aggregation in disease pathogenesis remains unclear due to the lack of an effective GAPDH aggregation inhibitor. In this study, we identified a GAPDH aggregation inhibitor (GAI) peptide and evaluated its biological profile. The decapeptide GAI specifically inhibited GAPDH aggregation in a concentration-dependent manner. Additionally, the GAI peptide did not affect GAPDH glycolytic activity or cell viability. The GAI peptide also exerted a protective effect against oxidative stress-induced cell death in SH-SY5Y cells. This peptide could potentially serve as a tool to investigate GAPDH aggregation-related neurodegenerative and neuropsychiatric disorders and as a possible therapy for diseases associated with oxidative stress-induced cell death. Copyright © 2015 Elsevier Inc. All rights reserved.
Directory of Open Access Journals (Sweden)
Weninger Annette
2008-12-01
conclude that increasing the Aβ42/Aβ40 ratio up-regulates CRABP1, which in turn reduces the differentiation potential of the human neuroblastoma cell line SH-SY5Y, but increases cell proliferation. This work might contribute to the better understanding of AD neurogenesis, currently a controversial topic.
Sulfuretin Attenuates MPP+-Induced Neurotoxicity through Akt/GSK3β and ERK Signaling Pathways
Directory of Open Access Journals (Sweden)
Ramesh Pariyar
2017-12-01
Full Text Available Parkinson’s disease (PD is the second most common neurodegenerative disease. It is caused by the death of dopaminergic neurons in the substantia nigra pars compacta. Oxidative stress and mitochondrial dysfunction contribute to the loss of dopaminergic neurons in PD. Sulfuretin is a potent antioxidant that is reported to be beneficial in the treatment of neurodegenerative diseases. In this study, we examined the protective effect of sulfuretin against 1-methyl-4-phenyl pyridinium (MPP+-induced cell model of PD in SH-SY5Y cells and the underlying molecular mechanisms. Sulfuretin significantly decreased MPP+-induced apoptotic cell death, accompanied by a reduction in caspase 3 activity and polyADP-ribose polymerase (PARP cleavage. Furthermore, it attenuated MPP+-induced production of intracellular reactive oxygen species (ROS and disruption of mitochondrial membrane potential (MMP. Consistently, sulfuretin decreased p53 expression and the Bax/Bcl-2 ratio. Moreover, sulfuretin significantly increased the phosphorylation of Akt, GSK3β, and ERK. Pharmacological inhibitors of PI3K/Akt and ERK abolished the cytoprotective effects of sulfuretin against MPP+. An inhibitor of GSK3β mimicked sulfuretin-induced protection against MPP+. Taken together, these results suggest that sulfuretin significantly attenuates MPP+-induced neurotoxicity through Akt/GSK3β and ERK signaling pathways in SH-SY5Y cells. Our findings suggest that sulfuretin might be one of the potential candidates for the treatment of PD.
Institute of Scientific and Technical Information of China (English)
郑艇; 徐世元; 赖露颖; 李乐; 李亚文; 周树勤
2017-01-01
Objective Investigating whether bupivacaine induces decline of intracellular nicotinamide adenine dinucleotide (NAD) level,and whether NAD level decreasing is involved in bupivacaine-induced neurotoxicity.Methods SH-SY5Y cell were treated with 1 mmol/L for indicated time points (30 min to 7 h),the intracellular NAD content and cell viability were detected.SH-SY5Y cells were treated with bupivacaine at concentrations varying from 1 mmol/L to 10 mmol/L for 30 min.The intracellular NAD content and cell viability were then detected.SH-SY5Y cells exposed to 5 mmol/L bupivacaine for 30 min,upon 30 min pre-,postNAD treatment at different concentrations.The intracellular NAD levels and the cell viabilities in all groups were examined.Results The intracellular NAD level began to decline after 3 h bupivacaine treatment.The level was decreased to (27.8±8.47)% at 7 h time point of treatment.The intracellular NAD content of SH-SY5Y cells were decreased to (21.50±3.15)%,(25.73±7.22)%,and (16.07±13.93)% respectively after receiving 2,5,10 mmol/L bupivacaine treatment for 30 min.Thus,the content levels of NAD were significantly lower than untreated control (P<0.05).Upon same conditions,there were no significant differences among different experimental groups with 1 mmol/L bupivacaine treatment at indicated time points (P>0.05).And cell viability were also decreased while concentrations of bupivacaine increasing [cell viability significantly declined to (49.44±8.55)%,(35.75±15.83)%,and (25.58±4.45)%,respectively,at the concentration of 2,5,10 mmol/L (P<0.05).The cellular NAD levels reached (85.87±11.82)%,(89.21±11.55)%,and (105.05±58.82)% in 2.5,5,10 mmol/L NAD pre-treatment groups respectively.The cellular NAD levels were significantly higher than the levels in bupivacaine groups (P<0.05).The cell viabilities were higher in cells receiving NAD pretreatment or post-treatment than viability of cells were treated with 5 mmol/L bupivacaine alone
KIM, JIN HEE
2014-01-01
Alzheimer’s disease (AD) brains demonstrate decreased levels of brain-derived neurotrophic factor (BDNF) and increased levels of β-amyloid peptide (Aβ), which is neurotoxic. The present study assessed the impact of BDNF on the toxic effects of Aβ25–35-induced apoptosis and the effects on BDNF-mediated signaling using the MTT assay, western blotting and reverse transcription quantitative polymerase chain reaction. Aβ25–35 was found to induce an apoptosis, dose-dependent effect on SH-SY5Y neuro...
Suppression of Cpn10 increases mitochondrial fission and dysfunction in neuroblastoma cells.
Directory of Open Access Journals (Sweden)
So Jung Park
Full Text Available To date, several regulatory proteins involved in mitochondrial dynamics have been identified. However, the precise mechanism coordinating these complex processes remains unclear. Mitochondrial chaperones regulate mitochondrial function and structure. Chaperonin 10 (Cpn10 interacts with heat shock protein 60 (HSP60 and functions as a co-chaperone. In this study, we found that down-regulation of Cpn10 highly promoted mitochondrial fragmentation in SK-N-MC and SH-SY5Y neuroblastoma cells. Both genetic and chemical inhibition of Drp1 suppressed the mitochondrial fragmentation induced by Cpn10 reduction. Reactive oxygen species (ROS generation in 3-NP-treated cells was markedly enhanced by Cpn10 knock down. Depletion of Cpn10 synergistically increased cell death in response to 3-NP treatment. Furthermore, inhibition of Drp1 recovered Cpn10-mediated mitochondrial dysfunction in 3-NP-treated cells. Moreover, an ROS scavenger suppressed cell death mediated by Cpn10 knockdown in 3-NP-treated cells. Taken together, these results showed that down-regulation of Cpn10 increased mitochondrial fragmentation and potentiated 3-NP-mediated mitochondrial dysfunction in neuroblastoma cells.
Energy Technology Data Exchange (ETDEWEB)
Dang, N.N. [Department of Dermatology, Jinan Central Hospital Affiliated to Shandong University, Jinan, Shandong Province (China); College of Life Science, Shandong Normal University, Jinan, Shandong Province (China); Pang, S.G. [Department of Endocrinology, Jinan Central Hospital Affiliated to Shandong University, Jinan, Shandong Province (China); Song, H.Y. [Department of Dermatology, Jinan Central Hospital Affiliated to Shandong University, Jinan, Shandong Province (China); An, L.G. [College of Life Science, Shandong Normal University, Jinan, Shandong Province (China); Ma, X.L. [Central Laboratory, Jinan Central Hospital Affiliated to Shandong University, Jinan, Shandong Province (China)
2014-11-14
The objective of this study was to investigate whether a single defect in skin barrier function simulated by filaggrin silencing could induce Th2-predominant inflammation. Filaggrin gene expression was silenced in cultured normal human epidermal keratinocytes (NHEKs) using small hairpin RNA (shRNA, GTTGGCTCAAGCATATTATTT). The efficacy of silencing was confirmed by polymerase chain reaction (PCR) and Western blotting. Filaggrin-silenced cells (LV group), shRNA control cells (NC group), and noninfected cells (Blank group) were evaluated. The expression of cornified cell envelope-related proteins, including cytokeratin (CK)-5, -10, -14, loricrin, involucrin, and transglutaminase (TGM)-1, was detected by Western blotting. Interleukins (IL)-2, IL-4, IL-5, IL-12p70, IL-13, and interferon-gamma (IFN-γ) were detected by enzyme-linked immunosorbent assay (ELISA). After filaggrin was successfully silenced by shRNA, the expressions of CK-5, -10, -14, involucrin, and TGM-1 in NHEKs were significantly downregulated compared to the Blank and NC groups (P<0.05 or P<0.01); only loricrin expression was markedly upregulated (P<0.01). Filaggrin silencing also resulted in significant increases of IL-2, IL-4, IL-5, and IL-13 (P<0.05 or P<0.01), and significant decreases of IL-12p70 and IFN-γ (P<0.01) compared with cells in the Blank and NC groups. Filaggrin silencing impaired normal skin barrier function mainly by targeting the cornified cell envelope. The immune response after filaggrin silencing was characterized by Th2 cells, mainly because of the inhibition of IFN-γ expression. Lack of filaggrin may directly impair skin barrier function and then further induce the immune response.
DNA Methylation Analysis of BRD1 Promoter Regions and the Schizophrenia rs138880 Risk Allele.
Directory of Open Access Journals (Sweden)
Mads Dyrvig
Full Text Available The bromodomain containing 1 gene, BRD1 is essential for embryogenesis and CNS development. It encodes a protein that participates in histone modifying complexes and thereby regulates the expression of a large number of genes. Genetic variants in the BRD1 locus show association with schizophrenia and bipolar disorder and risk alleles in the promoter region correlate with reduced BRD1 expression. Insights into the transcriptional regulation of BRD1 and the pathogenic mechanisms associated with BRD1 risk variants, however, remain sparse. By studying transcripts in human HeLa and SH-SY5Y cells we provide evidence for differences in relative expression of BRD1 transcripts with three alternative 5' UTRs (exon 1C, 1B, and 1A. We further show that expression of these transcript variants covaries negatively with DNA methylation proportions in their upstream promoter regions suggesting that promoter usage might be regulated by DNA methylation. In line with findings that the risk allele of the rs138880 SNP in the BRD1 promoter region correlates with reduced BRD1 expression, we find that it is also associated with moderate regional BRD1 promoter hypermethylation in both adipose tissue and blood. Importantly, we demonstrate by inspecting available DNA methylation and expression data that these regions undergo changes in methylation during fetal brain development and that differences in their methylation proportions in fetal compared to postnatal frontal cortex correlate significantly with BRD1 expression. These findings suggest that BRD1 may be dysregulated in both the developing and mature brain of risk allele carriers. Finally, we demonstrate that commonly used mood stabilizers Lithium, Valproate, and Carbamazepine affect the expression of BRD1 in SH-SY5Y cells. Altogether this study indicates a link between genetic risk and epigenetic dysregulation of BRD1 which raises interesting perspectives for targeting the mechanisms pharmacologically.
Directory of Open Access Journals (Sweden)
Selander Martin
2007-02-01
Full Text Available Abstract Background Recombinant adenovirus vectors and transfection agents comprising cationic lipids are widely used as gene delivery vehicles for functional expression in cultured cells. Consequently, these tools are utilized to investigate the effects of functional over-expression of proteins on insulin mediated events. However, we have previously reported that cationic lipid reagents cause a state of insulin unresponsiveness in cell cultures. In addition, we have found that cultured cells often do not respond to insulin stimulation following adenovirus treatment. Infection with adenovirus compromises vital functions of the host cell leading to the activation of protein kinases central to insulin signalling, such as protein kinase B/Akt. Therefore, we investigated the effect of adenovirus infection on insulin unresponsiveness by means of Akt activation in cultured cells. Moreover, we investigated the use of baculovirus as a heterologous viral gene delivery vehicle to circumvent these phenomena. Since the finding that baculovirus can efficiently transduce mammalian cells, the applications of this viral system in gene delivery has greatly expanded and one advantage is the virtual absence of cytotoxicity in mammalian cells. Results We show that infection of human neuroblastoma SHSY-5Y and liver C3A cells with recombinant adenovirus results in the activation of Akt in a dose dependent manner. In addition, this activation makes treated cells unresponsive to insulin stimulation as determined by an apparent lack of differential phosphorylation of Akt on serine-473. Our data further indicate that the use of recombinant baculovirus does not increase the phosphorylation of Akt in SHSY-5Y and C3A cells. Moreover, following infection with baculovirus, SHSY-5Y and C3A cells respond to insulin by means of phosphorylation of Akt on serine-473 in the same manner as uninfected cells. Conclusion Widely-used adenovirus vectors for gene delivery cause a state of
Emerick, Guilherme L; Fernandes, Laís S; de Paula, Eloísa Silva; Barbosa, Fernando; dos Santos, Neife Aparecida Guinaim; dos Santos, Antonio Cardozo
2015-08-01
Organophosphorus-induced delayed neuropathy (OPIDN) is a central-peripheral distal axonopathy that develops 8-14 days after poisoning by a neuropathic organophosphorus compound (OP). Several OPs that caused OPIDN were withdrawn from the agricultural market due to induction of serious delayed effects. Therefore, the development of in vitro screenings able to differentiate neuropathic from non-neuropathic OPs is of crucial importance. Thus, the aim of this study was to evaluate the differences in the neurotoxic effects of mipafox (neuropathic OP) and paraoxon (non-neuropathic OP) in SH-SY5Y human neuroblastoma cells, using the inhibition and aging of neuropathy target esterase (NTE), inhibition of acetylcholinesterase (AChE), activation of calpain, neurite outgrowth, cytotoxicity and intracellular calcium as indicators. Additionally, the potential of fenamiphos and profenofos to cause acute and/or delayed effects was also evaluated. Mipafox had the lowest IC50 and induced the highest percentage of aging of NTE among the OPs evaluated. Only mipafox was able to cause calpain activation after 24 h of incubation. Concentrations of mipafox and fenamiphos which inhibited at least 70% of NTE were also able to reduce neurite outgrowth. Cytotoxicity was higher in non-neuropathic than in neuropathic OPs while the intracellular calcium levels were higher in neuropathic than in non-neuropathic OPs. In conclusion, the SH-SY5Y cellular model was selective to differentiate neuropathic from non-neuropathic OPs; fenamiphos, but not profenofos presented results compatible with the induction of OPIDN. Copyright © 2015 Elsevier Ltd. All rights reserved.
Directory of Open Access Journals (Sweden)
Rafael Fenutría
Full Text Available CD5 is a lymphoid-specific transmembrane glycoprotein constitutively expressed on thymocytes and mature T and B1a lymphocytes. Current data support the view that CD5 is a negative regulator of antigen-specific receptor-mediated signaling in these cells, and that this would likely be achieved through interaction with CD5 ligand/s (CD5L of still undefined nature expressed on immune or accessory cells. To determine the functional consequence of loss of CD5/CD5L interaction in vivo, a new transgenic mouse line was generated (shCD5EμTg, expressing a circulating soluble form of human CD5 (shCD5 as a decoy to impair membrane-bound CD5 function. These shCD5EμTg mice showed an enhanced response to autologous antigens, as deduced from the presentation of more severe forms of experimentally inducible autoimmune disease (collagen-induced arthritis, CIA; and experimental autoimmune encephalitis, EAE, as well as an increased anti-tumoral response in non-orthotopic cancer models (B16 melanoma. This enhancement of the immune response was in agreement with the finding of significantly reduced proportions of spleen and lymph node Treg cells (CD4+CD25+FoxP3+, and of peritoneal IL-10-producing and CD5+ B cells, as well as an increased proportion of spleen NKT cells in shCD5EμTg mice. Similar changes in lymphocyte subpopulations were observed in wild-type mice following repeated administration of exogenous recombinant shCD5 protein. These data reveal the relevant role played by CD5/CD5L interactions on the homeostasis of some functionally relevant lymphocyte subpopulations and the modulation of immune responses to autologous antigens.
Bussiere, Renaud; Lacampagne, Alain; Reiken, Steven; Liu, Xiaoping; Scheuerman, Valerie; Zalk, Ran; Martin, Cécile; Checler, Frederic; Marks, Andrew R; Chami, Mounia
2017-06-16
Alteration of ryanodine receptor (RyR)-mediated calcium (Ca 2+ ) signaling has been reported in Alzheimer disease (AD) models. However, the molecular mechanisms underlying altered RyR-mediated intracellular Ca 2+ release in AD remain to be fully elucidated. We report here that RyR2 undergoes post-translational modifications (phosphorylation, oxidation, and nitrosylation) in SH-SY5Y neuroblastoma cells expressing the β-amyloid precursor protein (βAPP) harboring the familial double Swedish mutations (APPswe). RyR2 macromolecular complex remodeling, characterized by depletion of the regulatory protein calstabin2, resulted in increased cytosolic Ca 2+ levels and mitochondrial oxidative stress. We also report a functional interplay between amyloid β (Aβ), β-adrenergic signaling, and altered Ca 2+ signaling via leaky RyR2 channels. Thus, post-translational modifications of RyR occur downstream of Aβ through a β2-adrenergic signaling cascade that activates PKA. RyR2 remodeling in turn enhances βAPP processing. Importantly, pharmacological stabilization of the binding of calstabin2 to RyR2 channels, which prevents Ca 2+ leakage, or blocking the β2-adrenergic signaling cascade reduced βAPP processing and the production of Aβ in APPswe-expressing SH-SY5Y cells. We conclude that targeting RyR-mediated Ca 2+ leakage may be a therapeutic approach to treat AD. © 2017 by The American Society for Biochemistry and Molecular Biology, Inc.
Pavlov, Pavel F; Hutter-Paier, Birgit; Havas, Daniel; Windisch, Manfred; Winblad, Bengt
2018-04-27
Mitochondrial dysfunction is an early feature of Alzheimer's disease (AD) and may play an important role in the pathogenesis of disease. It has been shown that amyloid beta peptide (Aβ) and amyloid precursor protein (APP) interact with mitochondria contributing to the mitochondrial dysfunction in AD. Prevention of abnormal protein targeting to mitochondria can protect normal mitochondrial function, increase neuronal survival and at the end, ameliorate symptoms of AD and other neurodegenerative disorders. First steps of mitochondrial protein import are coordinated by molecular chaperones Hsp70 and Hsp90 that bind to the newly synthesized mitochondria-destined proteins and deliver them to the protein import receptors on the surface of organelle. Here, we have described the development of a novel compound named GMP-1 that disrupts interactions between Hsp70/Hsp90 molecular chaperones and protein import receptor Tom70. GMP-1 treatment of SH-SY5Y cells results in decrease in mitochondria-associated APP and protects SH-SY5Y cells from toxic effect of Aβ 1-42 exposure. Experiments in drosophila and mice models of AD demonstrated neuroprotective effect of GMP-1 treatment, improvement in memory and behaviour tests as well as restoration of mitochondrial function. © 2018 The Authors. Journal of Cellular and Molecular Medicine published by John Wiley & Sons Ltd and Foundation for Cellular and Molecular Medicine.
Qiao, Chen; Zhang, Lin-Xia; Sun, Xi-Yang; Ding, Jian-Hua; Lu, Ming; Hu, Gang
2017-08-01
Caspase family has been recognized to be involved in dopaminergic (DA) neuronal death and to exert an unfavorable role in Parkinson's disease (PD) pathology. Our previous study has revealed that caspase-1, as an important component of NLRP3 inflammasome, induces microglia-mediated neuroinflammation in the pathogenesis of PD. However, the role of caspase-1 in DA neuronal degeneration in the onset of PD remains unclear. Here, we showed that caspase-1 knockout ameliorated DA neuronal loss and dyskinesia in 1-methyl-4-phenyl-1, 2, 3, 6-tetrahydropyridine/probenecid (MPTP/p)-induced PD model mice. We further found that caspase-1 knockout decreased MPTP/p-induced caspase-7 cleavage, subsequently inhibited nuclear translocation of poly (ADP-ribose) polymerase 1 (PARP1), and reduced the release of apoptosis-inducing factor (AIF). Consistently, we demonstrated that caspase-1 inhibitor suppressed caspase-7/PARP1/AIF-mediated apoptosis pathway by 1-methyl-4-phenylpyridinium ion (MPP + ) stimulation in SH-SY5Y cells. Caspase-7 overexpression reduced the protective effects of caspase-1 inhibitor on SH-SY5Y cell apoptosis. Collectively, our results have revealed that caspase-1 regulates DA neuronal death in the pathogenesis of PD in mice via caspase-7/PARP1/AIF pathway. These findings will shed new insight into the potential of caspase-1 as a target for PD therapy.
Guan, Junhong; Du, Shaonan; Lv, Tao; Qu, Shengtao; Fu, Qiang; Yuan, Ye
2016-01-01
Bone morphogenetic protein (BMP)-7 mediated neuroprotective effect of cerebral ischemic preconditioning (IPC) has been studied in an ischemic animal model, but the underlying cellular mechanisms have not been clearly clarified. In this study, primary cortical neurons and the SH-SY5Y cell line were used to investigate the role of BMP-7 and its downstream signals in the neuroprotective effects of oxygen-glucose deprivation preconditioning (OGDPC). Immunocytochemistry was used to detect the expression of neurofilament in neurons. MTT and lactate dehydrogenase activity assays were used to measure the cytotoxicity. Western blot was used to detect the protein expression of BMP-7 and downstream signals. BMP inhibitor, mitogen-activated protein kinase inhibitors, Smad inhibitor and siRNA of Smad 1 were used to investigate the role of corresponding signalling pathways in the OGDPC. Results showed that OGDPC-induced overexpression of BMP-7 in primary cortical neurons and SH-SY5Y cells. Both of endogenous and exogenous BMP-7 could replicate the neuroprotective effects seen in OGDPC pretreatment. In addition, extracellular regulated protein kinases, p38 and Smad signalling pathway were found to be involved in the neuroprotective effects mediated by OGDPC via BMP-7. This study primarily reveals the cellular mechanisms of the neuroprotection mediated by OGDPC, and provides evidence for better understanding of this intrinsic factor against ischemia. © 2015 Wiley Publishing Asia Pty Ltd.
Freese, Christian; Reinhardt, Sven; Hefner, Gudrun; Unger, Ronald E; Kirkpatrick, C James; Endres, Kristina
2014-01-01
In the pathogenesis of Alzheimer's disease (AD) the homeostasis of amyloid precursor protein (APP) processing in the brain is impaired. The expression of the competing proteases ADAM10 (a disintegrin and metalloproteinase 10) and BACE-1 (beta site APP cleaving enzyme 1) is shifted in favor of the A-beta generating enzyme BACE-1. Acitretin--a synthetic retinoid-e.g., has been shown to increase ADAM10 gene expression, resulting in a decreased level of A-beta peptides within the brain of AD model mice and thus is of possible value for AD therapy. A striking challenge in evaluating novel therapeutically applicable drugs is the analysis of their potential to overcome the blood-brain barrier (BBB) for central nervous system targeting. In this study, we established a novel cell-based bio-assay model to test ADAM10-inducing drugs for their ability to cross the BBB. We therefore used primary porcine brain endothelial cells (PBECs) and human neuroblastoma cells (SH-SY5Y) transfected with an ADAM10-promoter luciferase reporter vector in an indirect co-culture system. Acitretin served as a model substance that crosses the BBB and induces ADAM10 expression. We ensured that ADAM10-dependent constitutive APP metabolism in the neuronal cells was unaffected under co-cultivation conditions. Barrier properties established by PBECs were augmented by co-cultivation with SH-SY5Y cells and they remained stable during the treatment with acitretin as demonstrated by electrical resistance measurement and permeability-coefficient determination. As a consequence of transcellular acitretin transport measured by HPLC, the activity of the ADAM10-promoter reporter gene was significantly increased in co-cultured neuronal cells as compared to vehicle-treated controls. In the present study, we provide a new bio-assay system relevant for the study of drug targeting of AD. This bio-assay can easily be adapted to analyze other Alzheimer- or CNS disease-relevant targets in neuronal cells, as their
International Nuclear Information System (INIS)
Xiao, Anqi; Gan, Xueqi; Chen, Ruiqi; Ren, Yanming; Yu, Haiyang; You, Chao
2017-01-01
Oxidative stress plays a central role in the pathogenesis of various neurodegenerative diseases. Increasing evidences have demonstrated that structural abnormalities in mitochondria are involved in oxidative stress related nerve cell damage. And Drp1 plays a critical role in mitochondrial dynamic imbalance insulted by oxidative stress-derived mitochondria. However, the status of mitochondrial fusion and fission pathway and its relationship with mitochondrial properties such as mitochondrial membrane permeability transition pore (mPTP) have not been fully elucidated. Here, we demonstrated for the first time the role of Cyclophilin D (CypD), a crucial component for mPTP formation, in the regulation of mitochondrial dynamics in oxidative stress treated nerve cell. We observed that CypD-mediated phosphorylation of Drp1 and subsequently augmented Drp1 recruitment to mitochondria and shifts mitochondrial dynamics toward excessive fission, which contributes to the mitochondrial structural and functional dysfunctions in oxidative stress-treated nerve cells. CypD depletion or over expression accompanies mitochondrial dynamics/functions recovery or aggravation separately. We also demonstrated first time the link between the CypD to mitochondrial dynamics. Our data offer new insights into the mechanism of mitochondrial dynamics which contribute to the mitochondrial dysfunctions, specifically the role of CypD in Drp1-mediated mitochondrial fission. The protective effect of CsA, or other molecules affecting the function of CypD hold promise as a potential novel therapeutic strategy for governing oxidative stress pathology via mitochondrial pathways. - Highlights: • Demonstrated first time the link between the mPTP to mitochondrial dynamics. • The role of Cyclophilin D in the regulation of Drp1-mediated mitochondrial fission. • CsA as a potential target for governing oxidative stress related neuropathology.
Cejudo-Martin, Pilar; Yuen, Angela; Vlahovich, Nicole; Lock, Peter; Courtneidge, Sara A; Díaz, Begoña
2014-01-01
Tks5 is a scaffold protein and Src substrate involved in cell migration and matrix degradation through its essential role in invadosome formation and function. We have previously described that Tks5 is fundamental for zebrafish neural crest cell migration in vivo. In the present study, we sought to investigate the function of Tks5 in mammalian development by analyzing mice mutant for sh3pxd2a, the gene encoding Tks5. Homozygous disruption of the sh3pxd2a gene by gene-trapping in mouse resulted in neonatal death and the presence of a complete cleft of the secondary palate. Interestingly, embryonic fibroblasts from homozygous gene-trap sh3pxd2a mice lacked only the highest molecular weight band of the characteristic Tks5 triplet observed in protein extracts, leaving the lower molecular weight bands unaffected. This finding, together with the existence of two human Expressed Sequence Tags lacking the first 5 exons of SH3PXD2A, made us hypothesize about the presence of a second alternative transcription start site located in intron V. We performed 5'RACE on mouse fibroblasts and isolated a new transcript of the sh3pxd2a gene encoding a novel Tks5 isoform, that we named Tks5β. This novel isoform diverges from the long form of Tks5 in that it lacks the PX-domain, which confers affinity for phosphatidylinositol-3,4-bisphosphate. Instead, Tks5β has a short unique amino terminal sequence encoded by the newly discovered exon 6β; this exon includes a start codon located 29 bp from the 5'-end of exon 6. Tks5β mRNA is expressed in MEFs and all mouse adult tissues analyzed. Tks5β is a substrate for the Src tyrosine kinase and its expression is regulated through the proteasome degradation pathway. Together, these findings indicate the essentiality of the larger Tks5 isoform for correct mammalian development and the transcriptional complexity of the sh3pxd2a gene.
Directory of Open Access Journals (Sweden)
Pilar Cejudo-Martin
Full Text Available Tks5 is a scaffold protein and Src substrate involved in cell migration and matrix degradation through its essential role in invadosome formation and function. We have previously described that Tks5 is fundamental for zebrafish neural crest cell migration in vivo. In the present study, we sought to investigate the function of Tks5 in mammalian development by analyzing mice mutant for sh3pxd2a, the gene encoding Tks5. Homozygous disruption of the sh3pxd2a gene by gene-trapping in mouse resulted in neonatal death and the presence of a complete cleft of the secondary palate. Interestingly, embryonic fibroblasts from homozygous gene-trap sh3pxd2a mice lacked only the highest molecular weight band of the characteristic Tks5 triplet observed in protein extracts, leaving the lower molecular weight bands unaffected. This finding, together with the existence of two human Expressed Sequence Tags lacking the first 5 exons of SH3PXD2A, made us hypothesize about the presence of a second alternative transcription start site located in intron V. We performed 5'RACE on mouse fibroblasts and isolated a new transcript of the sh3pxd2a gene encoding a novel Tks5 isoform, that we named Tks5β. This novel isoform diverges from the long form of Tks5 in that it lacks the PX-domain, which confers affinity for phosphatidylinositol-3,4-bisphosphate. Instead, Tks5β has a short unique amino terminal sequence encoded by the newly discovered exon 6β; this exon includes a start codon located 29 bp from the 5'-end of exon 6. Tks5β mRNA is expressed in MEFs and all mouse adult tissues analyzed. Tks5β is a substrate for the Src tyrosine kinase and its expression is regulated through the proteasome degradation pathway. Together, these findings indicate the essentiality of the larger Tks5 isoform for correct mammalian development and the transcriptional complexity of the sh3pxd2a gene.
Directory of Open Access Journals (Sweden)
Pero Stephanie C
2007-09-01
Full Text Available Abstract Background Human growth factor receptor bound protein 7 (Grb7 is an adapter protein that mediates the coupling of tyrosine kinases with their downstream signaling pathways. Grb7 is frequently overexpressed in invasive and metastatic human cancers and is implicated in cancer progression via its interaction with the ErbB2 receptor and focal adhesion kinase (FAK that play critical roles in cell proliferation and migration. It is thus a prime target for the development of novel anti-cancer therapies. Recently, an inhibitory peptide (G7-18NATE has been developed which binds specifically to the Grb7 SH2 domain and is able to attenuate cancer cell proliferation and migration in various cancer cell lines. Results As a first step towards understanding how Grb7 may be inhibited by G7-18NATE, we solved the crystal structure of the Grb7 SH2 domain to 2.1 Å resolution. We describe the details of the peptide binding site underlying target specificity, as well as the dimer interface of Grb 7 SH2. Dimer formation of Grb7 was determined to be in the μM range using analytical ultracentrifugation for both full-length Grb7 and the SH2 domain alone, suggesting the SH2 domain forms the basis of a physiological dimer. ITC measurements of the interaction of the G7-18NATE peptide with the Grb7 SH2 domain revealed that it binds with a binding affinity of Kd = ~35.7 μM and NMR spectroscopy titration experiments revealed that peptide binding causes perturbations to both the ligand binding surface of the Grb7 SH2 domain as well as to the dimer interface, suggesting that dimerisation of Grb7 is impacted on by peptide binding. Conclusion Together the data allow us to propose a model of the Grb7 SH2 domain/G7-18NATE interaction and to rationalize the basis for the observed binding specificity and affinity. We propose that the current study will assist with the development of second generation Grb7 SH2 domain inhibitors, potentially leading to novel inhibitors of
Jiang, Yumao; Jiao, Yue; Liu, Yang; Zhang, Meiyu; Wang, Zhiguo; Li, Yujuan; Li, Tao; Zhao, Xiaoliang; Wang, Danqiao
2018-03-14
As shown in our previous study, sinomenine hydrochloride (SH), the major bioactive alkaloid isolated from Sinomenium acutum Rehd. et Wils. (Fam. Menispermaceae ), initiates the autophagy-mediated death of human glioblastoma cells by generating reactive oxygen species and activating the autophagy-lysosome pathway. However, its effects on the migration and invasion of human glioblastoma cells have not yet been elucidated. Therefore, human glioblastoma U87 and SF767 cells were treated with SH (0.125 and 0.25 mM) for 24 h, and cell migration and invasion were assessed using scratch wound healing, migration and invasion assays. SH promoted G0/G1 phase arrest, inhibited the migration and invasion of the two cell lines, suppressed the activation of nuclear factor kappa B (NFκB) and the expression of matrix metalloproteinase (MMP)-2/-9, triggered endoplasmic reticulum (ER) stress, reversed the exogenous epithelial-mesenchymal transition (EMT) induced by the inflammatory microenvironment and the endogenous EMT. Additionally, NFκB p65 overexpression blocked the SH-mediated inhibitory effects on MMP-2/-9 expression and cell invasion. SH-induced autophagy was reduced in CCAAT/enhancer binding protein (C/EBP) homologous protein (CHOP) or autophagy-related 5 (ATG5)-silenced human glioblastoma cells and cells treated with 4-phenylbutyric acid (4-PBA) or 3-methyladenine (3-MA), as shown by the decreased levels of the microtubule-associated protein light chain 3B (LC3B)-II and autophagic vacuoles (AVs) stained with monodansylcadaverine (MDC), respectively. Moreover, knockdown of CHOP or ATG5 and treatment with 4-PBA or 3-MA abolished the SH-mediated inhibition of mesenchymal markers (vimentin, Snail and Slug) expression and cell invasion, respectively. Importantly, SH also regulated the above related pathways in nude mice. Based on these findings, SH inhibited cell proliferation by inducing cell cycle arrest, and attenuated the metastasis of U87 and SF767 cells by suppressing MMP
Directory of Open Access Journals (Sweden)
Yumao Jiang
2018-03-01
Full Text Available As shown in our previous study, sinomenine hydrochloride (SH, the major bioactive alkaloid isolated from Sinomenium acutum Rehd. et Wils. (Fam. Menispermaceae, initiates the autophagy-mediated death of human glioblastoma cells by generating reactive oxygen species and activating the autophagy-lysosome pathway. However, its effects on the migration and invasion of human glioblastoma cells have not yet been elucidated. Therefore, human glioblastoma U87 and SF767 cells were treated with SH (0.125 and 0.25 mM for 24 h, and cell migration and invasion were assessed using scratch wound healing, migration and invasion assays. SH promoted G0/G1 phase arrest, inhibited the migration and invasion of the two cell lines, suppressed the activation of nuclear factor kappa B (NFκB and the expression of matrix metalloproteinase (MMP-2/-9, triggered endoplasmic reticulum (ER stress, reversed the exogenous epithelial-mesenchymal transition (EMT induced by the inflammatory microenvironment and the endogenous EMT. Additionally, NFκB p65 overexpression blocked the SH-mediated inhibitory effects on MMP-2/-9 expression and cell invasion. SH-induced autophagy was reduced in CCAAT/enhancer binding protein (C/EBP homologous protein (CHOP or autophagy-related 5 (ATG5-silenced human glioblastoma cells and cells treated with 4-phenylbutyric acid (4-PBA or 3-methyladenine (3-MA, as shown by the decreased levels of the microtubule-associated protein light chain 3B (LC3B-II and autophagic vacuoles (AVs stained with monodansylcadaverine (MDC, respectively. Moreover, knockdown of CHOP or ATG5 and treatment with 4-PBA or 3-MA abolished the SH-mediated inhibition of mesenchymal markers (vimentin, Snail and Slug expression and cell invasion, respectively. Importantly, SH also regulated the above related pathways in nude mice. Based on these findings, SH inhibited cell proliferation by inducing cell cycle arrest, and attenuated the metastasis of U87 and SF767 cells by suppressing
International Nuclear Information System (INIS)
Chen Zhiyong; Liu Min; Dong Lihua; Gong Shouliang
2011-01-01
Objective: To investigate the effect of recombinant plasmid pshuttle-Egr1-shTRAIL stable transfection in combination with X-ray irradiation on the TRAIL protein expression and the apoptosis in human SMMC7721 hepatoma cells. Methods: The pshuttle-Egr1-shTRAIL packaged with liposome was stably transfected into SMMC7721 cells in vitro. The shTRAIL protein expression were measured with ELISA assay, Annexin V-FITC kit was adopted to measure the apoptosis of pshuttle-Egr1-shTRAIL cells, and the changes in survival rate of SMMC7721 cells measured with cell cloning assay. Results: The TRAIL protein expressions in pshuttle-Egr1-shTRAIL plus different doses of irradiation groups were significantly increased compared with 0 Gy group (P<0.001). The percentage of apoptotic cells was significantly higher than that in 0 Gy group (P<0.05 or P<0.001), and the survival rate of SMMC7721 cells was decreased significantly (P<0.05 or P<0.001). Conclusion: The pshuttle-Egr1-shTRAIL stable transfection in combination with irradiation can significantly induce the apoptosis of SMMC7721 tumor cells and inhibit the cell proliferation. (authors)
Mikkola, Esa T; Gahmberg, Carl G
2010-06-18
The protein tyrosine kinase C-terminal Src kinase (Csk) is activated by the engagement of its Src homology (SH) 2 domain. However, the molecular mechanism required for this is not completely understood. The crystal structure of the active Csk indicates that Csk could be activated by contact between the SH2 domain and the beta3-alphaC loop in the N-terminal lobe of the kinase domain. To study the importance of this interaction for the SH2-domain-mediated activation of Csk, we mutated the amino acid residues forming the contacts between the SH2 domain and the beta3-alphaC loop. The mutation of the beta3-alphaC loop Ala228 to glycine and of the SH2 domain Tyr116, Tyr133, Leu138, and Leu149 to alanine resulted in the inability of the SH2 domain ligand to activate Csk. Furthermore, the overexpressed Csk mutants A228G, Y133A/Y116A, L138A, and L149A were unable to efficiently inactivate endogenous Src in human embryonic kidney 293 cells. The results suggest that the SH2-domain-mediated activation of Csk is dependent on the binding of the beta3-alphaC loop Ala228 to the hydrophobic pocket formed by the side chains of Tyr116, Tyr133, Leu138, and Leu149 on the surface of the SH2 domain. Copyright (c) 2010 Elsevier Ltd. All rights reserved.
Directory of Open Access Journals (Sweden)
Ratti Antonia
2007-12-01
Full Text Available Abstract Background CDK5R1 plays a central role in neuronal migration and differentiation during central nervous system development. CDK5R1 has been implicated in neurodegenerative disorders and proposed as a candidate gene for mental retardation. The remarkable size of CDK5R1 3'-untranslated region (3'-UTR suggests a role in post-transcriptional regulation of CDK5R1 expression. Results The bioinformatic study shows a high conservation degree in mammals and predicts several AU-Rich Elements (AREs. The insertion of CDK5R1 3'-UTR into luciferase 3'-UTR causes a decreased luciferase activity in four transfected cell lines. We identified 3'-UTR subregions which tend to reduce the reporter gene expression, sometimes in a cell line-dependent manner. In most cases the quantitative analysis of luciferase mRNA suggests that CDK5R1 3'-UTR affects mRNA stability. A region, leading to a very strong mRNA destabilization, showed a significantly low half-life, indicating an accelerated mRNA degradation. The 3' end of the transcript, containing a class I ARE, specifically displays a stabilizing effect in neuroblastoma cell lines. We also observed the interaction of the stabilizing neuronal RNA-binding proteins ELAV with the CDK5R1 transcript in SH-SY5Y cells and identified three 3'-UTR sub-regions showing affinity for ELAV proteins. Conclusion Our findings evince the presence of both destabilizing and stabilizing regulatory elements in CDK5R1 3'-UTR and support the hypothesis that CDK5R1 gene expression is post-transcriptionally controlled in neurons by ELAV-mediated mechanisms. This is the first evidence of the involvement of 3'-UTR in the modulation of CDK5R1 expression. The fine tuning of CDK5R1 expression by 3'-UTR may have a role in central nervous system development and functioning, with potential implications in neurodegenerative and cognitive disorders.
MicroRNA-138 is a potential regulator of memory performance in humans
Directory of Open Access Journals (Sweden)
Julia eSchröder
2014-07-01
Full Text Available Genetic factors underlie a substantial proportion of individual differences in cognitive functions in humans, including processes related to episodic and working memory. While genetic association studies have proposed several candidate memory genes, these currently explain only a minor fraction of the phenotypic variance. Here, we performed genome-wide screening on 13 episodic and working memory phenotypes in 1,318 participants of the Berlin Aging Study II aged 60 years or older. The analyses highlight a number of novel single nucleotide polymorphisms (SNPs associated with memory performance, including one located in a putative regulatory region of microRNA (miRNA hsa-mir-138-5p (rs9882688, P-value = 7.8x10-9. Expression quantitative trait locus analyses on next-generation RNA-sequencing data revealed that rs9882688 genotypes show a significant correlation with the expression levels of this miRNA in 309 human lymphoblastoid cell lines (P-value = 5x10-4. In silico modeling of other top-ranking GWAS signals identified an additional memory-associated SNP in the 3' untranslated region (3'UTR of DCP1B, a gene encoding a core component of the mRNA decapping complex in humans, predicted to interfere with hsa-mir-138-5p binding. This prediction was confirmed in vitro by luciferase assays showing differential binding of hsa-mir-138-5p to 3'UTR reporter constructs in two human cell lines (HEK293: P-value = 0.0470; SH-SY5Y: P-value = 0.0866. Finally, expression profiling of hsa-mir-138-5p and DCP1B mRNA in human post-mortem brain tissue revealed that both molecules are expressed simultaneously in frontal cortex and hippocampus, suggesting that the proposed interaction between hsa-mir-138-5p and DCP1B may also take place in vivo. In summary, by combining unbiased genome-wide screening with extensive in silico modeling, in vitro functional assays, and gene expression profiling, our study identified miRNA-138 as a potential molecular regulator of human memory
Characterizing tyrosine phosphorylation signaling in lung cancer using SH2 profiling.
Directory of Open Access Journals (Sweden)
Kazuya Machida
2010-10-01
Full Text Available Tyrosine kinases drive the proliferation and survival of many human cancers. Thus profiling the global state of tyrosine phosphorylation of a tumor is likely to provide a wealth of information that can be used to classify tumors for prognosis and prediction. However, the comprehensive analysis of tyrosine phosphorylation of large numbers of human cancer specimens is technically challenging using current methods.We used a phosphoproteomic method termed SH2 profiling to characterize the global state of phosphotyrosine (pTyr signaling in human lung cancer cell lines. This method quantifies the phosphorylated binding sites for SH2 domains, which are used by cells to respond to changes in pTyr during signaling. Cells could be grouped based on SH2 binding patterns, with some clusters correlated with EGF receptor (EGFR or K-RAS mutation status. Binding of specific SH2 domains, most prominently RAS pathway activators Grb2 and ShcA, correlated with EGFR mutation and sensitivity to the EGFR inhibitor erlotinib. SH2 binding patterns also reflected MET activation and could identify cells driven by multiple kinases. The pTyr responses of cells treated with kinase inhibitors provided evidence of distinct mechanisms of inhibition.This study illustrates the potential of modular protein domains and their proteomic binding profiles as powerful molecular diagnostic tools for tumor classification and biomarker identification.
Ye, Xueting; Xie, Jing; Huang, Hang; Deng, Zhexian
2018-01-01
Melanoma antigen A6 (MAGEA6) is a cancer-specific ubiquitin ligase of AMP-activated protein kinase (AMPK). The current study tested MAGEA6 expression and potential function in renal cell carcinoma (RCC). MAGEA6 and AMPK expression in human RCC tissues and RCC cells were tested by Western blotting assay and qRT-PCR assay. shRNA method was applied to knockdown MAGEA6 in human RCC cells. Cell survival and proliferation were tested by MTT assay and BrdU ELISA assay, respectively. Cell apoptosis was tested by the TUNEL assay and single strand DNA ELISA assay. The 786-O xenograft in nude mouse model was established to test RCC cell growth in vivo. MAGEA6 is specifically expressed in RCC tissues as well as in the established (786-O and A498) and primary human RCC cells. MAGEA6 expression is correlated with AMPKα1 downregulation in RCC tissues and cells. It is not detected in normal renal tissues nor in the HK-2 renal epithelial cells. MAGEA6 knockdown by targeted-shRNA induced AMPK stabilization and activation, which led to mTOR complex 1 (mTORC1) in-activation and RCC cell death/apoptosis. AMPK inhibition, by AMPKα1 shRNA or the dominant negative AMPKα1 (T172A), almost reversed MAGEA6 knockdown-induced RCC cell apoptosis. Conversely, expression of the constitutive-active AMPKα1 (T172D) mimicked the actions by MAGEA6 shRNA. In vivo, MAGEA6 shRNA-bearing 786-O tumors grew significantly slower in nude mice than the control tumors. AMPKα1 stabilization and activation as well as mTORC1 in-activation were detected in MAGEA6 shRNA tumor tissues. MAGEA6 knockdown inhibits human RCC cells via activating AMPK signaling. © 2018 The Author(s). Published by S. Karger AG, Basel.
Noncoding RNA in the Transcriptional Landscape of Human Neural Progenitor Cell Differentiation
Directory of Open Access Journals (Sweden)
Patrick eHecht
2015-10-01
Full Text Available Increasing evidence suggests that noncoding RNAs play key roles in cellular processes, particularly in the brain. The present study used RNA sequencing to identify the transcriptional landscape of two human neural progenitor cell lines, SK-N-SH and ReNcell CX, as they differentiate into human cortical projection neurons. Protein coding genes were found to account for 54.8% and 57.0% of expressed genes, respectively, and alignment of RNA sequencing reads revealed that only 25.5-28.1% mapped to exonic regions of the genome. Differential expression analysis in the two cell lines identified altered gene expression in both protein coding and noncoding RNAs as they undergo neural differentiation with 222 differentially expressed genes observed in SK-N-SH cells and 19 differentially expressed genes in ReNcell CX. Interestingly, genes showing differential expression in SK-N-SH cells are enriched in genes implicated in autism spectrum disorder, but not in gene sets related to cancer or Alzheimer’s disease. Weighted gene co-expression network analysis (WGCNA was used to detect modules of co-expressed protein coding and noncoding RNAs in SK-N-SH cells and found four modules to be associated with neural differentiation. These modules contain varying levels of noncoding RNAs ranging from 10.7% to 49.7% with gene ontology suggesting roles in numerous cellular processes important for differentiation. These results indicate that noncoding RNAs are highly expressed in human neural progenitor cells and likely hold key regulatory roles in gene networks underlying neural differentiation and neurodevelopmental disorders.
Querobino, Samyr Machado; Ribeiro, César Augusto João; Alberto-Silva, Carlos
2018-05-01
Bradykinin-potentiating peptides (BPPs - 5a, 7a, 9a, 10c, 11e, and 12b) of Bothrops jararaca (Bj) were described as argininosuccinate synthase (AsS) activators, improving l-arginine availability. Agmatine and polyamines, which are l-arginine metabolism products, have neuroprotective properties. Here, we investigated the neuroprotective effects of low molecular mass fraction from Bj venom (LMMF) and two synthetic BPPs (BPP-10c, BPP-12b, BPP-10c showed higher protective capacity than BPP-12b. LMMF pretreatment was unable to prevent the reduction of cell viability caused by H 2 O 2 . The neuroprotective mechanism of BPP-10c against oxidative stress was investigated. BPP-10c reduced ROS generation and lipid peroxidation in relation to cells treated only with H 2 O 2 . BBP-10c increased AsS expression and was not neuroprotective in the presence of MDLA, a specific inhibitor of AsS. BPP-10c reduced iNOS expression and nitrate levels but decreased NF-kB expression. Furthermore, BPP-10c protected the mitochondrial membrane against oxidation. Overall, we demonstrated for the first time neuroprotective mechanisms of BPPs against oxidative stress, opening new perspectives to the study and application of these peptides for the treatment of neurodegenerative diseases. Copyright © 2018 Elsevier Inc. All rights reserved.
In silico simulations of STAT1 and STAT3 inhibitors predict SH2 domain cross-binding specificity.
Szelag, Malgorzata; Sikorski, Krzysztof; Czerwoniec, Anna; Szatkowska, Katarzyna; Wesoly, Joanna; Bluyssen, Hans A R
2013-11-15
Signal transducers and activators of transcription (STATs) comprise a family of transcription factors that are structurally related and which participate in signaling pathways activated by cytokines, growth factors and pathogens. Activation of STAT proteins is mediated by the highly conserved Src homology 2 (SH2) domain, which interacts with phosphotyrosine motifs for specific contacts between STATs and receptors and for STAT dimerization. By generating new models for human (h)STAT1, hSTAT2 and hSTAT3 we applied comparative in silico docking to determine SH2-binding specificity of the STAT3 inhibitor stattic, and of fludarabine (STAT1 inhibitor). Thus, we provide evidence that by primarily targeting the highly conserved phosphotyrosine (pY+0) SH2 binding pocket stattic is not a specific hSTAT3 inhibitor, but is equally effective towards hSTAT1 and hSTAT2. This was confirmed in Human Micro-vascular Endothelial Cells (HMECs) in vitro, in which stattic inhibited interferon-α-induced phosphorylation of all three STATs. Likewise, fludarabine inhibits both hSTAT1 and hSTAT3 phosphorylation, but not hSTAT2, by competing with the highly conserved pY+0 and pY-X binding sites, which are less well-preserved in hSTAT2. Moreover we observed that in HMECs in vitro fludarabine inhibits cytokine and lipopolysaccharide-induced phosphorylation of hSTAT1 and hSTAT3 but does not affect hSTAT2. Finally, multiple sequence alignment of STAT-SH2 domain sequences confirmed high conservation between hSTAT1 and hSTAT3, but not hSTAT2, with respect to stattic and fludarabine binding sites. Together our data offer a molecular basis that explains STAT cross-binding specificity of stattic and fludarabine, thereby questioning the present selection strategies of SH2 domain-based competitive small inhibitors. © 2013 Elsevier B.V. All rights reserved.
Meinerz, Daiane F; Branco, Vasco; Aschner, Michael; Carvalho, Cristina; Rocha, João Batista T
2017-09-01
Exposure to methylmercury (MeHg), an important environmental toxicant, may lead to serious health risks, damaging various organs and predominantly affecting the brain function. The toxicity of MeHg can be related to the inhibition of important selenoenzymes, such as glutathione peroxidase (GPx) and thioredoxin reductase (TrxR). Experimental studies have shown that selenocompounds play an important role as cellular detoxifiers and protective agents against the harmful effects of mercury. The present study investigated the mechanisms by which diphenyl diselenide [(PhSe) 2 ] and ebselen interfered with the interaction of mercury (MeHg) and selenoenzymes (TrxR and GPx) in an in vitro experimental model of cultured human neuroblastoma cells (SH-SY5Y). Our results established that (PhSe) 2 and ebselen increased the activity and expression of TrxR. In contrast, MeHg inhibited TrxR activity even at low doses (0.5 μm). Coexposure to selenocompounds and MeHg showed a protective effect of (PhSe) 2 on both the activity and expression of TrxR. When selenoenzyme GPx was evaluated, selenocompounds did not alter its activity or expression significantly, whereas MeHg inhibited the activity of GPx (from 1 μm). Among the selenocompounds only (PhSe) 2 significantly protected against the effects of MeHg on GPx activity. Taken together, these results indicate a potential use for ebselen and (PhSe) 2 against MeHg toxicity. Furthermore, for the first time, we have demonstrated that (PhSe) 2 caused a more pronounced upregulation of TrxR than ebselen in neuroblastoma cells, likely reflecting an important molecular mechanism involved in the antioxidant properties of this compound. Copyright © 2017 John Wiley & Sons, Ltd. Copyright © 2017 John Wiley & Sons, Ltd.
Superbinder SH2 domains act as antagonists of cell signaling.
Kaneko, Tomonori; Huang, Haiming; Cao, Xuan; Li, Xing; Li, Chengjun; Voss, Courtney; Sidhu, Sachdev S; Li, Shawn S C
2012-09-25
Protein-ligand interactions mediated by modular domains, which often play important roles in regulating cellular functions, are generally of moderate affinities. We examined the Src homology 2 (SH2) domain, a modular domain that recognizes phosphorylated tyrosine (pTyr) residues, to investigate how the binding affinity of a modular domain for its ligand influences the structure and cellular function of the protein. We used the phage display method to perform directed evolution of the pTyr-binding residues in the SH2 domain of the tyrosine kinase Fyn and identified three amino acid substitutions that critically affected binding. We generated three SH2 domain triple-point mutants that were "superbinders" with much higher affinities for pTyr-containing peptides than the natural domain. Crystallographic analysis of one of these superbinders revealed that the superbinder SH2 domain recognized the pTyr moiety in a bipartite binding mode: A hydrophobic surface encompassed the phenyl ring, and a positively charged site engaged the phosphate. When expressed in mammalian cells, the superbinder SH2 domains blocked epidermal growth factor receptor signaling and inhibited anchorage-independent cell proliferation, suggesting that pTyr superbinders might be explored for therapeutic applications and useful as biological research tools. Although the SH2 domain fold can support much higher affinity for its ligand than is observed in nature, our results suggest that natural SH2 domains are not optimized for ligand binding but for specificity and flexibility, which are likely properties important for their function in signaling and regulatory processes.
Directory of Open Access Journals (Sweden)
Nerurkar Vivek R
2010-10-01
Full Text Available Abstract Background WNV-associated encephalitis (WNVE is characterized by increased production of pro-inflammatory mediators, glial cells activation and eventual loss of neurons. WNV infection of neurons is rapidly progressive and destructive whereas infection of non-neuronal brain cells is limited. However, the role of neurons and pathological consequences of pro-inflammatory cytokines released as a result of WNV infection is unclear. Therefore, the objective of this study was to examine the role of key cytokines secreted by WNV-infected neurons in mediating neuroinflammatory markers and neuronal death. Methods A transformed human neuroblastoma cell line, SK-N-SH, was infected with WNV at multiplicity of infection (MOI-1 and -5, and WNV replication kinetics and expression profile of key pro-inflammatory cytokines were analyzed by plaque assay, qRT-PCR, and ELISA. Cell death was measured in SK-N-SH cell line in the presence and absence of neutralizing antibodies against key pro-inflammatory cytokines using cell viability assay, TUNEL and flow cytometry. Further, naïve primary astrocytes were treated with UV-inactivated supernatant from mock- and WNV-infected SK-N-SH cell line and the activation of astrocytes was measured using flow cytometry and ELISA. Results WNV-infected SK-N-SH cells induced the expression of IL-1β, -6, -8, and TNF-α in a dose- and time-dependent manner, which coincided with increase in virus-induced cell death. Treatment of cells with anti-IL-1β or -TNF-α resulted in significant reduction of the neurotoxic effects of WNV. Furthermore treatment of naïve astrocytes with UV-inactivated supernatant from WNV-infected SK-N-SH cell line increased expression of glial fibrillary acidic protein and key inflammatory cytokines. Conclusion Our results for the first time suggest that neurons are one of the potential sources of pro-inflammatory cytokines in WNV-infected brain and these neuron-derived cytokines contribute to WNV
The SH2 Domain Interaction Landscape
Directory of Open Access Journals (Sweden)
Michele Tinti
2013-04-01
Full Text Available Members of the SH2 domain family modulate signal transduction by binding to short peptides containing phosphorylated tyrosines. Each domain displays a distinct preference for the sequence context of the phosphorylated residue. We have developed a high-density peptide chip technology that allows for probing of the affinity of most SH2 domains for a large fraction of the entire complement of tyrosine phosphopeptides in the human proteome. Using this technique, we have experimentally identified thousands of putative SH2-peptide interactions for more than 70 different SH2 domains. By integrating this rich data set with orthogonal context-specific information, we have assembled an SH2-mediated probabilistic interaction network, which we make available as a community resource in the PepspotDB database. A predicted dynamic interaction between the SH2 domains of the tyrosine phosphatase SHP2 and the phosphorylated tyrosine in the extracellular signal-regulated kinase activation loop was validated by experiments in living cells.
Protection of dopaminergic neurons by 5-lipoxygenase inhibitor.
Kang, Kai-Hsiang; Liou, Horng-Hui; Hour, Mann-Jen; Liou, Houng-Chi; Fu, Wen-Mei
2013-10-01
Neuroinflammation and oxidative stress are important factors that induce neurodegeneration in age-related neurological disorders. 5-Lipoxygenase (5-LOX) is the enzyme responsible for catalysing the synthesis of leukotriene or 5-HETE from arachidonic acid. 5-LOX is expressed in the central nervous system and may cause neurodegenerative disease. In this study, we investigated the effect of the pharmacological inhibition of 5-lipoxygenase on 1-methyl-4-phenyl-1,2,3,6-tetrahydropyridine (MPTP)/MPP(+)-induced dopaminergic neuronal death in midbrain neuron-glia co-cultures and in mice. It was found that 5-LOX was over-expressed in astrocytes after the injection of MPTP into C57BL6 mice. MK-886, a specific inhibitor of 5-LOX activating protein (FLAP), significantly increased [(3)H]-dopamine uptake, a functional indicator of the integrity of dopaminergic neurons, in midbrain cultures or the SH-SY5Y human dopaminergic cell line following MPP(+) treatment. In addition, LTB₄, one of 5-LOX's downstream products, was increased in the striatum and substantia nigra following MPTP injection in mice. LTB₄ but not LTD₄ and 5-HETE enhanced MPP(+)-induced neurotoxicity in primary midbrain cultures. MK-886 administration increased the number of tyrosine hydroxylase-positive neurons in the substantia nigra and the dopamine content in the striatum in MPTP-induced parkinsonian mice. Furthermore, the MPTP-induced upregulation of LTB₄ in the striatum and substantia nigra was antagonised by MK-886. These results suggest that 5-LOX inhibitors may be developed as novel neuroprotective agents and LTB₄ may play an important pathological role in Parkinson's disease. Copyright © 2013 Elsevier Ltd. All rights reserved.
[Knockdown of ATG5 enhances the sensitivity of human renal carcinoma cells to sunitinib].
Li, Peng; Han, Qi; Tang, Ming; Zhang, Keqin
2017-03-01
Objective To investigate the expression levels of autophagy-related gene 5 (ATG5) and microtubule-associated protein 1 light chain 3 (LC3) and their effects on sunitinib resistance in human renal carcinoma cells. Methods After clinic-pathologic feature and survival analysis, 99 renal clear cell carcinoma tissues with different histological grades were used to detect the expression of ATG5 and LC3 by immunohistochemistry. Renal carcinoma cell line A-498 was infected with lentivirus-mediated ATG5 shRNA. Western blot analysis was performed to confirm the efficiency of ATG5 knockdown. Proliferation rate of A-498 cells in control group and ATG5 low expression group was determined by flow cytometry. Finally, the survival rate was detected by MTT assay after A-498 cells were treated with different concentrations of sunitinib. Results The expression levels of ATG5 and LC3 in renal clear cell carcinoma tissues were significantly higher than those in para-tumor tissues. The expression levels of ATG5 and LC3 were associated with classification, histological grade, TNM stage and survival rate, rather than gender, age, location, tumor size. Compared with the control group, the protein expressions of ATG5 and LC3 significantly decreased in A-498 cells with ATG5 low expression. The cell proliferation rate in ATG5 downregulation group was lower than that in the control group. Compared with control group, the survival rate in ATG5 low expression group were significantly reduced in a dose-dependent manner after sunitinib treatment. Conclusion Autophagy is active in renal clear cell carcinoma, and the drug sensitivity to sunitinib in renal cancer cells can be enhanced by the downregulation of ATG5.
Novel high-throughput screening system for identifying STAT3-SH2 antagonists
International Nuclear Information System (INIS)
Uehara, Yutaka; Mochizuki, Masato; Matsuno, Kenji; Haino, Takeharu; Asai, Akira
2009-01-01
Constitutive activation of the oncogenic transcription factor STAT3 frequently occurs in various human malignancies. STAT3 activation involves dimerization via intermolecular pTyr-SH2 interaction. Thus, antagonizing this interaction is a feasible approach to inhibit STAT3 activation for cancer therapy. In order to identify selective STAT3 inhibitors, we developed a biochemical HTS system based on AlphaScreen technology, which measures the abilities of test compounds to antagonize pTyr-SH2 interactions. We screened our chemical libraries using this system and identified 5,15-diphenylporphyrin (5,15-DPP) as a selective STAT3-SH2 antagonist. Selective inhibition of STAT3 nuclear translocation and DNA biding activity was observed in cells treated with 5,15-DPP. IL-6-dependent dimerization of STAT3, c-myc promoter binding and c-myc protein expression were all suppressed by 5,15-DPP, whereas no decrement in either expression or phosphorylation level of STAT3 was observed. Thus, the HTS assay system represented herein may be useful for identifying novel STAT3-SH2 antagonists.
Wang, Xin; Shi, Qi; Xu, Kun; Gao, Chen; Chen, Cao; Li, Xiao-Li; Wang, Gui-Rong; Tian, Chan; Han, Jun; Dong, Xiao-Ping
2011-01-01
Background Genetic prion diseases are linked to point and inserted mutations in the prion protein (PrP) gene that are presumed to favor conversion of the cellular isoform of PrP (PrPC) to the pathogenic one (PrPSc). The pathogenic mechanisms and the subcellular sites of the conversion are not completely understood. Here we introduce several PRNP gene mutations (such as, PrP-KDEL, PrP-3AV, PrP-A117V, PrP-G114V, PrP-P102L and PrP-E200K) into the cultured cells in order to explore the pathogenic mechanism of familial prion disease. Methodology/Principal Findings To address the roles of aberrant retention of PrP in endoplasmic reticulum (ER), the recombinant plasmids expressing full-length human PrP tailed with an ER signal peptide at the COOH-terminal (PrP-KDEL) and PrP with three amino acids exchange in transmembrane region (PrP-3AV) were constructed. In the preparations of transient transfections, 18-kD COOH-terminal proteolytic resistant fragments (Ctm-PrP) were detected in the cells expressing PrP-KDEL and PrP-3AV. Analyses of the cell viabilities in the presences of tunicamycin and brefeldin A revealed that expressions of PrP-KDEL and PrP-3AV sensitized the transfected cells to ER stress stimuli. Western blots and RT-PCR identified the clear alternations of ER stress associated events in the cells expressing PrP-KDEL and PrP-3AV that induced ER mediated apoptosis by CHOP and capase-12 apoptosis pathway. Moreover, several familial CJD related PrP mutants were transiently introduced into the cultured cells. Only the mutants within the transmembrane region (G114V and A117V) induced the formation of Ctm-PrP and caused the ER stress, while the mutants outside the transmembrane region (P102L and E200K) failed. Conclusions/Significance The data indicate that the retention of PrP in ER through formation of Ctm-PrP results in ER stress and cell apoptosis. The cytopathic activities caused by different familial CJD associated PrP mutants may vary, among them the mutants
Directory of Open Access Journals (Sweden)
Xin Wang
Full Text Available BACKGROUND: Genetic prion diseases are linked to point and inserted mutations in the prion protein (PrP gene that are presumed to favor conversion of the cellular isoform of PrP (PrP(C to the pathogenic one (PrP(Sc. The pathogenic mechanisms and the subcellular sites of the conversion are not completely understood. Here we introduce several PRNP gene mutations (such as, PrP-KDEL, PrP-3AV, PrP-A117V, PrP-G114V, PrP-P102L and PrP-E200K into the cultured cells in order to explore the pathogenic mechanism of familial prion disease. METHODOLOGY/PRINCIPAL FINDINGS: To address the roles of aberrant retention of PrP in endoplasmic reticulum (ER, the recombinant plasmids expressing full-length human PrP tailed with an ER signal peptide at the COOH-terminal (PrP-KDEL and PrP with three amino acids exchange in transmembrane region (PrP-3AV were constructed. In the preparations of transient transfections, 18-kD COOH-terminal proteolytic resistant fragments (Ctm-PrP were detected in the cells expressing PrP-KDEL and PrP-3AV. Analyses of the cell viabilities in the presences of tunicamycin and brefeldin A revealed that expressions of PrP-KDEL and PrP-3AV sensitized the transfected cells to ER stress stimuli. Western blots and RT-PCR identified the clear alternations of ER stress associated events in the cells expressing PrP-KDEL and PrP-3AV that induced ER mediated apoptosis by CHOP and caspase-12 apoptosis pathway. Moreover, several familial CJD related PrP mutants were transiently introduced into the cultured cells. Only the mutants within the transmembrane region (G114V and A117V induced the formation of Ctm-PrP and caused the ER stress, while the mutants outside the transmembrane region (P102L and E200K failed. CONCLUSIONS/SIGNIFICANCE: The data indicate that the retention of PrP in ER through formation of Ctm-PrP results in ER stress and cell apoptosis. The cytopathic activities caused by different familial CJD associated PrP mutants may vary, among them
Jami, Mohammad-Saeid; Salehi-Najafabadi, Zahra; Ahmadinejad, Fereshteh; Hoedt, Esthelle; Chaleshtori, Morteza Hashemzadeh; Ghatrehsamani, Mahdi; Neubert, Thomas A; Larsen, Jan Petter; Møller, Simon Geir
2015-11-01
Neuronal cell death, in neurodegenerative disorders, is mediated through a spectrum of biological processes. Excessive amounts of free radicals, such as reactive oxygen species (ROS), has detrimental effects on neurons leading to cell damage via peroxidation of unsaturated fatty acids in the cell membrane. Edaravone (3-methyl-1-phenyl-2-pyrazolin-5-one) has been used for neurological recovery in several countries, including Japan and China, and it has been suggested that Edaravone may have cytoprotective effects in neurodegeneration. Edaravone protects nerve cells in the brain by reducing ROS and inhibiting apoptosis. To gain further insight into the cytoprotective effects of Edaravone against oxidative stress condition we have performed comparative two-dimensional gel electrophoresis (2DE)-based proteomic analyses on SH-SY5Y neuroblastoma cells exposed to oxidative stress and in combination with Edaravone. We showed that Edaravone can reverse the cytotoxic effects of H2O2 through its specific mechanism. We observed that oxidative stress changes metabolic pathways and cytoskeletal integrity. Edaravone seems to reverse the H2O2-mediated effects at both the cellular and protein level via induction of Peroxiredoxin-2. Copyright © 2015 Elsevier Ltd. All rights reserved.
Gao, Hui; Jiang, Qixiao; Han, Yantao; Peng, Jianjun; Wang, Chunbo
2015-03-01
EMMPRIN is a widely distributed cell surface glycoprotein, which plays an important role in tumor progression and confers resistance to some chemotherapeutic drugs. Recent studies have shown that EMMPRIN overexpression indicates poor prognosis in acute myeloid leukemia (AML). However, little was known on the role of EMMPRIN in leukemia. Human leukemia cell line U937 was stably transfected with a EMMPRIN-targeted shRNA-containing vector to investigate the effect of EMMPRIN on cellular functions. EMMPRIN expression was monitored by qRT-PCR and Western blotting. Cell viability and proliferation were determined by trypan blue exclusion and BrdU labeling, respectively. Cell cycle and apoptosis were analyzed by flow cytometry. Cytotoxicity of chemotherapeutic agent adriamycin on cells was assessed by MTT assay. Knockdown of EMMPRIN gene significantly inhibited cell viability and decreased cell proliferation. Fluorescence-activated cell-sorting analysis revealed that the reduced EMMPRIN expression resulted in cell cycle arrest at G1 phase and induced apoptosis. Meanwhile, western blotting analysis showed that EMMPRIN knockdown was associated with downregulation of cell cycle- and apoptosis-related molecules including cyclin D1, cyclin E, as well as increase in cleavage of caspase-3 and PARP. This study also showed that silencing of EMMPRIN sensitized U937 cells to Adriamycin. EMMPRIN is involved in proliferation, growth, and chemosensitivity of human AML line U937, indicating that EMMPRIN may be a promising therapeutic target for AML.
Neuropilin-2 mediated β-catenin signaling and survival in human gastro-intestinal cancer cell lines.
Directory of Open Access Journals (Sweden)
Shaija Samuel
Full Text Available NRP-2 is a high-affinity kinase-deficient receptor for ligands belonging to the class 3 semaphorin and vascular endothelial growth factor families. NRP-2 has been detected on the surface of several types of human cancer cells, but its expression and function in gastrointestinal (GI cancer cells remains to be determined. We sought to determine the function of NRP-2 in mediating downstream signals regulating the growth and survival of human gastrointestinal cancer cells. In human gastric cancer specimens, NRP-2 expression was detected in tumor tissues but not in adjacent normal mucosa. In CNDT 2.5 cells, shRNA mediated knockdown NRP-2 expression led to decreased migration and invasion in vitro (p<0.01. Focused gene-array analysis demonstrated that loss of NRP-2 reduced the expression of a critical metastasis mediator gene, S100A4. Steady-state levels and function of β-catenin, a known regulator of S100A4, were also decreased in the shNRP-2 clones. Furthermore, knockdown of NRP-2 sensitized CNDT 2.5 cells in vitro to 5FU toxicity. This effect was associated with activation of caspases 3 and 7, cleavage of PARP, and downregulation of Bcl-2. In vivo growth of CNDT 2.5 cells in the livers of nude mice was significantly decreased in the shNRP-2 group (p<0.05. Intraperitoneal administration of NRP-2 siRNA-DOPC decreased the tumor burden in mice (p = 0.01. Collectively, our results demonstrate that tumor cell-derived NRP-2 mediates critical survival signaling in gastrointestinal cancer cells.
International Nuclear Information System (INIS)
1994-08-01
This document contains the appendices to the Remedial Investigation Report on Bear Creek Valley Operable Unit 2 (Rust Spoil Area, Spoil Area 1, and SY-200 Yard) at the Oak Ridge Y-12 Plant, Oak Ridge, Tennessee. The appendices include Current and historical soil boring and groundwater monitoring well information, well construction logs, and field change orders; Analytical data; Human health risk assessment data; and Data quality
Energy Technology Data Exchange (ETDEWEB)
1994-08-01
This document contains the appendices to the Remedial Investigation Report on Bear Creek Valley Operable Unit 2 (Rust Spoil Area, Spoil Area 1, and SY-200 Yard) at the Oak Ridge Y-12 Plant, Oak Ridge, Tennessee. The appendices include Current and historical soil boring and groundwater monitoring well information, well construction logs, and field change orders; Analytical data; Human health risk assessment data; and Data quality.
Diversity in peptide recognition by the SH2 domain of SH2B1.
McKercher, Marissa A; Guan, Xiaoyang; Tan, Zhongping; Wuttke, Deborah S
2018-02-01
SH2B1 is a multidomain protein that serves as a key adaptor to regulate numerous cellular events, such as insulin, leptin, and growth hormone signaling pathways. Many of these protein-protein interactions are mediated by the SH2 domain of SH2B1, which recognizes ligands containing a phosphorylated tyrosine (pY), including peptides derived from janus kinase 2, insulin receptor, and insulin receptor substrate-1 and -2. Specificity for the SH2 domain of SH2B1 is conferred in these ligands either by a hydrophobic or an acidic side chain at the +3 position C-terminal to the pY. This specificity for chemically disparate species suggests that SH2B1 relies on distinct thermodynamic or structural mechanisms to bind to peptides. Using binding and structural strategies, we have identified unique thermodynamic signatures for each peptide binding mode, and several SH2B1 residues, including K575 and R578, that play distinct roles in peptide binding. The high-resolution structure of the SH2 domain of SH2B1 further reveals conformationally plastic protein loops that may contribute to the ability of the protein to recognize dissimilar ligands. Together, numerous hydrophobic and electrostatic interactions, in addition to backbone conformational flexibility, permit the recognition of diverse peptides by SH2B1. An understanding of this expanded peptide recognition will allow for the identification of novel physiologically relevant SH2B1/peptide interactions, which can contribute to the design of obesity and diabetes pharmaceuticals to target the ligand-binding interface of SH2B1 with high specificity. © 2017 Wiley Periodicals, Inc.
Neuroprotective effect of creatine against propionic acid toxicity in ...
African Journals Online (AJOL)
With sufficient research and clinical trials in future, this could prove to be successful in treatment or management of autism as a neurodevelopmental disorder recently related to PA neurotoxicity. Keywords: Propionic acid, creatine, SH-SY5Y, comet assay, DNA fragmentation assay, apoptosis, neuroprotection. African Journal ...
Doggui, Sihem; Sahni, Jasjeet Kaur; Arseneault, Madeleine; Dao, Lé; Ramassamy, Charles
2012-01-01
Curcumin, a natural polyphenolic pigment present in the spice turmeric (Curcuma longa), is known to possess a pleiotropic activity such as antioxidant, anti-inflammatory, and anti-amyloid-β activities. However, these benefits of curcumin are limited by its poor aqueous solubility and oral bioavailability. In the present study, a polymer-based nanoparticle approach has been utilized to deliver drugs to neuronal cells. Curcumin was encapsulated in biodegradable poly (lactide-co-glycolide) (PLGA) based-nanoparticulate formulation (Nps-Cur). Dynamic laser light scattering and transmission electronic microscopy analysis indicated a particle diameter ranging from 80 to 120 nm. The entrapment efficiency was 31% with 15% drug-loading. In vitro release kinetics of curcumin from Nps-Cur revealed a biphasic pattern with an initial exponential phase followed by a slow release phase. Cellular internalization of Nps-Cur was confirmed by fluorescence and confocal microscopy with a wide distribution of the fluorescence in the cytoplasm and within the nucleus. The prepared nanoformulation was characterized for cellular toxicity and biological activity. Cytotoxicity assays showed that void PLGA-nanoparticles (Nps) and curcumin-loaded PLGA nanoparticles (Nps-Cur) were nontoxic to human neuroblastoma SK-N-SH cells. Moreover, Nps-Cur was able to protect SK-N-SH cells against H2O2 and prevent the elevation of reactive oxygen species and the consumption of glutathione induced by H2O2. Interestingly, Nps-Cur was also able to prevent the induction of the redox-sensitive transcription factor Nrf2 in the presence of H2O2. Taken together, these results suggest that Nps-Cur could be a promising drug delivery strategy to protect neurons against oxidative damage as observed in Alzheimer's disease.
Bae, Jae Hyun; Lew, Erin Denise; Yuzawa, Satoru; Tomé, Francisco; Lax, Irit; Schlessinger, Joseph
2009-08-07
SH2 domain-mediated interactions represent a crucial step in transmembrane signaling by receptor tyrosine kinases. SH2 domains recognize phosphotyrosine (pY) in the context of particular sequence motifs in receptor phosphorylation sites. However, the modest binding affinity of SH2 domains to pY containing peptides may not account for and likely represents an oversimplified mechanism for regulation of selectivity of signaling pathways in living cells. Here we describe the crystal structure of the activated tyrosine kinase domain of FGFR1 in complex with a phospholipase Cgamma fragment. The structural and biochemical data and experiments with cultured cells show that the selectivity of phospholipase Cgamma binding and signaling via activated FGFR1 are determined by interactions between a secondary binding site on an SH2 domain and a region in FGFR1 kinase domain in a phosphorylation independent manner. These experiments reveal a mechanism for how SH2 domain selectivity is regulated in vivo to mediate a specific cellular process.
Identification of novel targets for PGC-1α and histone deacetylase inhibitors in neuroblastoma cells
International Nuclear Information System (INIS)
Cowell, Rita M.; Talati, Pratik; Blake, Kathryn R.; Meador-Woodruff, James H.; Russell, James W.
2009-01-01
Recent evidence suggests that the transcriptional coactivator peroxisome proliferator activated receptor γ coactivator 1α (PGC-1α) is involved in the pathology of Huntington's Disease (HD). While animals lacking PGC-1α express lower levels of genes involved in antioxidant defense and oxidative phosphorylation in the brain, little is known about other targets for PGC-1α in neuronal cells and whether there are ways to pharmacologically target PGC-1α in neurons. Here, PGC-1α overexpression in SH-SY5Y neuroblastoma cells upregulated expression of genes involved in mitochondrial function, glucose transport, fatty acid metabolism, and synaptic function. Overexpression also decreased vulnerability to hydrogen peroxide-induced cell death and caspase 3 activation. Treatment of cells with the histone deacetylase inhibitors (HDACi's) trichostatin A and valproic acid upregulated PGC-1α and glucose transporter 4 (GLUT4). These results suggest that PGC-1α regulates multiple pathways in neurons and that HDACi's may be good candidates to target PGC-1α and GLUT4 in HD and other neurological disorders.
Directory of Open Access Journals (Sweden)
Gang Li
2014-01-01
Full Text Available The aim of this study is to evaluate the protection of ginsenoside Rg3 against oxidative stress in human neuroblastoma SK-N-SH cells. 20(R-ginsenoside Rg3 (20(R-Rg3 and 20(S-ginsenoside Rg3 (20(S-Rg3 were prepared by the method of chemical degradation and column chromatography, and the structure of the two compounds was characterized by 1H-NMR and 13C-NMR spectroscopy. MTT assay and LDH leakage assay were used to determine the cell viability and the oxidative stress cellular model was established by means of H2O2 (600 μM for 4 h. We also investigated the changes of intracellular MDA content, SOD activity, and ROS formation after the treatment of ginsenoside Rg3 for 20 h. The results indicated that both 20 (R-Rg3 and 20 (S-Rg3 had obvious protection against H2O2-induced oxidative stress in SK-N-SH cells. Moreover, 20(R-Rg3 exhibited better antioxidant activity than 20(S-Rg3 in vitro. These findings are expected to provide some implication for further research and application of ginsenoside Rg3 in neuroprotection.