WorldWideScience

Sample records for human salivary epidermal

  1. Variation of Human Salivary O-Glycome.

    Directory of Open Access Journals (Sweden)

    Radoslaw P Kozak

    Full Text Available The study of saliva O-glycosylation is receiving increasing attention due to the potential of glycans for disease biomarkers, but also due to easy access and non-invasive collection of saliva as biological fluid. Saliva is rich in glycoproteins which are secreted from the bloodstream or produced by salivary glands. Mucins, which are highly O-glycosylated proteins, are particularly abundant in human saliva. Their glycosylation is associated with blood group and secretor status, and represents a reservoir of potential disease biomarkers. This study aims to analyse and compare O-glycans released from whole human mouth saliva collected 3 times a day from a healthy individual over a 5 days period. O-linked glycans were released by hydrazinolysis, labelled with procainamide and analysed by ultra-high performance liquid chromatography with fluorescence detection (UHPLC-FLR coupled to electrospray ionization mass spectrometry (ESI-MS/MS. The sample preparation method showed excellent reproducibility and can therefore be used for biomarker discovery. Our data demonstrates that the O-glycosylation in human saliva changes significantly during the day. These changes may be related to changes in the salivary concentrations of specific proteins.

  2. Anatomy and Histology of Rodent and Human Major Salivary Glands

    Science.gov (United States)

    Amano, Osamu; Mizobe, Kenichi; Bando, Yasuhiko; Sakiyama, Koji

    2012-01-01

    Major salivary glands of both humans and rodents consist of three pairs of macroscopic glands: parotid, submandibular, and sublingual. These glands secrete serous, mucous or mixed saliva via the proper main excretory ducts connecting the glandular bodies with the oral cavity. A series of discoveries about the salivary ducts in the 17th century by Niels Stensen (1638–1686), Thomas Wharton (1614–1673), and Caspar Bartholin (1655–1738) established the concept of exocrine secretion as well as salivary glands. Recent investigations have revealed the endocrine functions of parotin and a variety of cell growth factors produced by salivary glands. The present review aims to describe macroscopic findings on the major salivary glands of rodents and the microscopic differences between those of humans and rodents, which review should be of interest to those researchers studying salivary glands. PMID:23209333

  3. Polymeric membranes modulate human keratinocyte differentiation in specific epidermal layers.

    Science.gov (United States)

    Salerno, Simona; Morelli, Sabrina; Giordano, Francesca; Gordano, Amalia; Bartolo, Loredana De

    2016-10-01

    In vitro models of human bioengineered skin substitutes are an alternative to animal experimentation for testing the effects and toxicity of drugs, cosmetics and pollutants. For the first time specific and distinct human epidermal strata were engineered by using membranes and keratinocytes. To this purpose, biodegradable membranes of chitosan (CHT), polycaprolactone (PCL) and a polymeric blend of CHT-PCL were prepared by phase-inversion technique and characterized in order to evaluate their morphological, physico-chemical and mechanical properties. The capability of membranes to modulate keratinocyte differentiation inducing specific interactions in epidermal membrane systems was investigated. The overall results demonstrated that the membrane properties strongly influence the cell morpho-functional behaviour of human keratinocytes, modulating their terminal differentiation, with the creation of specific epidermal strata or a fully proliferative epidermal multilayer system. In particular, human keratinocytes adhered on CHT and CHT-PCL membranes, forming the structure of the epidermal top layers, such as the corneum and granulosum strata, characterized by withdrawal or reduction from the cell cycle and cell proliferation. On the PCL membrane, keratinocytes developed an epidermal basal lamina, with high proliferating cells that stratified and migrated over time to form a complete differentiating epidermal multilayer system. Copyright © 2016 Elsevier B.V. All rights reserved.

  4. Anatomy and histology of rodent and human major salivary glands: -overview of the Japan salivary gland society-sponsored workshop-.

    Science.gov (United States)

    Amano, Osamu; Mizobe, Kenichi; Bando, Yasuhiko; Sakiyama, Koji

    2012-10-31

    MAJOR SALIVARY GLANDS OF BOTH HUMANS AND RODENTS CONSIST OF THREE PAIRS OF MACROSCOPIC GLANDS: parotid, submandibular, and sublingual. These glands secrete serous, mucous or mixed saliva via the proper main excretory ducts connecting the glandular bodies with the oral cavity. A series of discoveries about the salivary ducts in the 17th century by Niels Stensen (1638-1686), Thomas Wharton (1614-1673), and Caspar Bartholin (1655-1738) established the concept of exocrine secretion as well as salivary glands. Recent investigations have revealed the endocrine functions of parotin and a variety of cell growth factors produced by salivary glands.The present review aims to describe macroscopic findings on the major salivary glands of rodents and the microscopic differences between those of humans and rodents, which review should be of interest to those researchers studying salivary glands.

  5. Salivary

    Directory of Open Access Journals (Sweden)

    Mohie Aldeen Abd Alzaher Khalifa

    2014-10-01

    Conclusion: Prevalence of dental caries was higher in asthmatics than controls. High caries incidence in asthmatics related to salivary acidic pH, increase S. mutans, Lactobacilli count and medication. There is a need to create awareness among dental practitioners and pulmonologists regarding the increased caries risk in asthmatics.

  6. Pattern of hormone receptors and human epidermal growth factor ...

    African Journals Online (AJOL)

    Introduction: Breast cancer is the most common cancer among women globally. With immunohistochemistry (IHC), breast cancer is classified into four groups based on IHC profile of estrogen receptor (ER)/progesterone receptor (PR) and human epidermal growth factor receptor 2 (HER2/neu) expression, positive (+) and/or ...

  7. Does human pancreas contain salivary-type isoamylase?

    Science.gov (United States)

    Shimamura, J; Fridhandler, L; Berk, J E

    1975-01-01

    Amylase isoenzyme analysis was made of extracts of normal human pancreatic tissue by first conducting ion exchange chromatography of the purified material. This gave evidence of only pancreatic type (P-type) isoamylase for all purposes. However, when effluent fractions in which salivary type isoamylase would ordinarily be expected to be present were harvested, pooled, concentrated, and rechromatographed, the pancreatic extracts were found to contain some salivary type (S-type) isoamylase. The latter accounted for approximately 0-8 to 1-7% of the total recovered amylase activity. This finding of S-type isoamylase in normal human pancreas potentially has important bearing on the interpretation of isamylase analysis. PMID:1218813

  8. Human Salivary Gland Stem Cells Functionally Restore Radiation Damaged Salivary Glands

    DEFF Research Database (Denmark)

    Pringle, Sarah; Maimets, Martti; van der Zwaag, Marianne

    2016-01-01

    Adult stem cells are often touted as therapeutic agents in the regenerative medicine field, however data detailing both the engraftment and functional capabilities of solid tissue derived human adult epithelial stem cells is scarce. Here we show the isolation of adult human salivary gland (SG) st...... for the first time that salispheres cultured from human SGs contain stem/progenitor cells capable of self-renewal and differentiation and rescue of saliva production. Our study underpins the therapeutic promise of salisphere cell therapy for the treatment of xerostomia....

  9. Sensing radiosensitivity of human epidermal stem cells

    International Nuclear Information System (INIS)

    Rachidi, Walid; Harfourche, Ghida; Lemaitre, Gilles; Amiot, Franck; Vaigot, Pierre; Martin, Michele T.

    2007-01-01

    Purpose: Radiosensitivity of stem cells is a matter of debate. For mouse somatic stem cells, both radiosensitive and radioresistant stem cells have been described. By contrast, the response of human stem cells to radiation has been poorly studied. As epidermis is a radiosensitive tissue, we evaluated in the present work the radiosensitivity of cell populations enriched for epithelial stem cells of human epidermis. Methods and materials: The total keratinocyte population was enzymatically isolated from normal human skin. We used flow cytometry and antibodies against cell surface markers to isolate basal cell populations from human foreskin. Cell survival was measured after a dose of 2 Gy with the XTT assay at 72 h after exposure and with a clonogenic assay at 2 weeks. Transcriptome analysis using oligonucleotide microarrays was performed to assess the genomic cell responses to radiation. Results: Cell sorting based on two membrane proteins, α6 integrin and the transferrin receptor CD71, allowed isolation of keratinocyte populations enriched for the two types of cells found in the basal layer of epidermis: stem cells and progenitors. Both the XTT assay and the clonogenic assay showed that the stem cells were radioresistant whereas the progenitors were radiosensitive. We made the hypothesis that upstream DNA damage signalling might be different in the stem cells and used microarray technology to test this hypothesis. The stem cells exhibited a much more reduced gene response to a dose of 2 Gy than the progenitors, as we found that 6% of the spotted genes were regulated in the stem cells and 20% in the progenitors. Using Ingenuity Pathway Analysis software, we found that radiation exposure induced very specific pathways in the stem cells. The most striking responses were the repression of a network of genes involved in apoptosis and the induction of a network of cytokines and growth factors. Conclusion: These results show for the first time that keratinocyte

  10. Radiosensitivity of normal human epidermal cells in culture

    International Nuclear Information System (INIS)

    Dover, R.; Potten, C.S.

    1983-01-01

    Using an in vitro culture system the authors have derived #betta#-radiation survival curves over a dose range 0-8 Gy for the clonogenic cells of normal human epidermis. The culture system used allows the epidermal cells to stratify and form a multi-layered sheet of keratinizing cells. The cultures appear to be a very good model for epidermis in vivo. The survival curves show a population which is apparently more sensitive than murine epidermis in vivo. It remains unclear whether this is an intrinsic difference between the species or is a consequence of the in vitro cultivation of the human cells. (author)

  11. Weather conditions: a neglected factor in human salivary cortisol research?

    Science.gov (United States)

    Milas, Goran; Šupe-Domić, Daniela; Drmić-Hofman, Irena; Rumora, Lada; Klarić, Irena Martinović

    2018-02-01

    There is ample evidence that environmental stressors such as extreme weather conditions affect animal behavior and that this process is in part mediated through the elevated activity of the hypothalamic pituitary adrenal axis which results in an increase in cortisol secretion. This relationship has not been extensively researched in humans, and weather conditions have not been analyzed as a potential confounder in human studies of stress. Consequently, the goal of this paper was to assess the relationship between salivary cortisol and weather conditions in the course of everyday life and to test a possible moderating effect of two weather-related variables, the climate region and timing of exposure to outdoors conditions. The sample consisted of 903 secondary school students aged 18 to 21 years from Mediterranean and Continental regions. Cortisol from saliva was sampled in naturalistic settings at three time points over the course of a single day. We found that weather conditions are related to salivary cortisol concentration and that this relationship may be moderated by both the specific climate and the anticipation of immediate exposure to outdoors conditions. Unpleasant weather conditions are predictive for the level of salivary cortisol, but only among individuals who anticipate being exposed to it in the immediate future (e.g., in students attending school in the morning shift). We also demonstrated that isolated weather conditions or their patterns may be relevant in one climate area (e.g., Continental) while less relevant in the other (e.g., Mediterranean). Results of this study draw attention to the importance of controlling weather conditions in human salivary cortisol research.

  12. Expression of epidermal growth factor receptors in human endometrial carcinoma

    DEFF Research Database (Denmark)

    Nyholm, H C; Nielsen, Anette Lynge; Ottesen, B

    1993-01-01

    Little data exist on the expression of epidermal growth factor receptors (EGF-Rs) in human endometrial cancer. EGF-R status was studied in 65 patients with endometrial carcinomas and in 26 women with nonmalignant postmenopausal endometria, either inactive/atrophic endometrium or adenomatous...... hyperplasia. EGF-R was identified on frozen tissue sections by means of an indirect immunoperoxidase technique with a monoclonal antibody against the external domain of the EGF-R. Seventy-one percent of the carcinomas expressed positive EGF-R immunoreactivity. In general, staining was most prominent...

  13. Impact of a vegan diet on the human salivary microbiota.

    Science.gov (United States)

    Hansen, Tue H; Kern, Timo; Bak, Emilie G; Kashani, Alireza; Allin, Kristine H; Nielsen, Trine; Hansen, Torben; Pedersen, Oluf

    2018-04-11

    Little is known about the effect of long-term diet patterns on the composition and functional potential of the human salivary microbiota. In the present study, we sought to contribute to the ongoing elucidation of dietary effects on the oral microbial community by examining the diversity, composition and functional potential of the salivary microbiota in 160 healthy vegans and omnivores using 16S rRNA gene amplicon sequencing. We further sought to identify bacterial taxa in saliva associated with host inflammatory markers. We show that compositional differences in the salivary microbiota of vegans and omnivores is present at all taxonomic levels below phylum level and includes upper respiratory tract commensals (e.g. Neisseria subflava, Haemophilus parainfluenzae, and Rothia mucilaginosa) and species associated with periodontal disease (e.g. Campylobacter rectus and Porphyromonas endodontalis). Dietary intake of medium chain fatty acids, piscine mono- and polyunsaturated fatty acids, and dietary fibre was associated with bacterial diversity, community structure, as well as relative abundance of several species-level operational taxonomic units. Analysis of imputed genomic potential revealed several metabolic pathways differentially abundant in vegans and omnivores indicating possible effects of macro- and micro-nutrient intake. We also show that certain oral bacteria are associated with the systemic inflammatory state of the host.

  14. Human corpus luteum: presence of epidermal growth factor receptors and binding characteristics

    International Nuclear Information System (INIS)

    Ayyagari, R.R.; Khan-Dawood, F.S.

    1987-01-01

    Epidermal growth factor receptors are present in many reproductive tissues but have not been demonstrated in the human corpus luteum. To determine the presence of epidermal growth factor receptors and its binding characteristics, we carried out studies on the plasma cell membrane fraction of seven human corpora lutea (days 16 to 25) of the menstrual cycle. Specific epidermal growth factor receptors were present in human corpus luteum. Insulin, nerve growth factor, and human chorionic gonadotropin did not competitively displace epidermal growth factor binding. The optimal conditions for corpus luteum-epidermal growth factor receptor binding were found to be incubation for 2 hours at 4 degrees C with 500 micrograms plasma membrane protein and 140 femtomol 125 I-epidermal growth factor per incubate. The number (mean +/- SEM) of epidermal growth factor binding sites was 12.34 +/- 2.99 X 10(-19) mol/micrograms protein; the dissociation constant was 2.26 +/- 0.56 X 10(-9) mol/L; the association constant was 0.59 +/- 0.12 X 10(9) L/mol. In two regressing corpora lutea obtained on days 2 and 3 of the menstrual cycle, there was no detectable specific epidermal growth factor receptor binding activity. Similarly no epidermal growth factor receptor binding activity could be detected in ovarian stromal tissue. Our findings demonstrate that specific receptors for epidermal growth factor are present in the human corpus luteum. The physiologic significance of epidermal growth factor receptors in human corpus luteum is unknown, but epidermal growth factor may be involved in intragonadal regulation of luteal function

  15. Epidermal growth factor receptor in primary human lung cancer

    International Nuclear Information System (INIS)

    Yu Xueyan; Hu Guoqiang; Tian Keli; Wang Mingyun

    1996-01-01

    Cell membranes were prepared from 12 human lung cancers for the study of the expression of epidermal growth factor receptors (EGFR). EGFR concentration was estimated by ligand binding studies using 125 I-radiolabeled EGF. The dissociation constants of the high affinity sites were identical, 1.48 nmol and 1.1 nmol in cancer and normal lung tissues, the EGFR contents were higher in lung cancer tissues (range: 2.25 to 19.39 pmol·g -1 membrane protein) than that in normal tissues from the same patients (range: 0.72 to 7.43 pmol·g -1 membrane protein). These results suggest that EGF and its receptor may play a role in the regulatory mechanisms in the control of lung cellular growth and tumor promotion

  16. Impact of a vegan diet on the human salivary microbiota

    DEFF Research Database (Denmark)

    Hansen, Tue H; Kern, Timo; Bak, Emilie G

    2018-01-01

    Little is known about the effect of long-term diet patterns on the composition and functional potential of the human salivary microbiota. In the present study, we sought to contribute to the ongoing elucidation of dietary effects on the oral microbial community by examining the diversity, composi......Little is known about the effect of long-term diet patterns on the composition and functional potential of the human salivary microbiota. In the present study, we sought to contribute to the ongoing elucidation of dietary effects on the oral microbial community by examining the diversity...... of vegans and omnivores is present at all taxonomic levels below phylum level and includes upper respiratory tract commensals (e.g. Neisseria subflava, Haemophilus parainfluenzae, and Rothia mucilaginosa) and species associated with periodontal disease (e.g. Campylobacter rectus and Porphyromonas...... endodontalis). Dietary intake of medium chain fatty acids, piscine mono- and polyunsaturated fatty acids, and dietary fibre was associated with bacterial diversity, community structure, as well as relative abundance of several species-level operational taxonomic units. Analysis of imputed genomic potential...

  17. Salivary Proteome Patterns Affecting Human Salt Taste Sensitivity.

    Science.gov (United States)

    Stolle, Theresa; Grondinger, Freya; Dunkel, Andreas; Meng, Chen; Médard, Guillaume; Kuster, Bernhard; Hofmann, Thomas

    2017-10-25

    To investigate the role of perireceptor events in inter-individual variability in salt taste sensitivity, 31 volunteers were monitored in their detection functions for sodium chloride (NaCl) and classified into sensitive (0.6-1.7 mmol/L), medium-sensitive (1.8-6.9 mmol/L), and nonsensitive (7.0-11.2 mmol/L) subjects. Chemosensory intervention of NaCl-sensitive (S + ) and nonsensitive (S - ) panellists with potassium chloride, ammonium chloride, and sodium gluconate showed the salt taste sensitivity to be specific for NaCl. As no significant differences were found between S + and S - subjects in salivary sodium and protein content, salivary proteome differences and their stimulus-induced dynamic changes were analyzed by tryptic digestion, iTRAQ labeling, and liquid chromatography-tandem mass spectrometry analysis. Differences in the salivary proteome between S + and S - subjects were found primarily in resting saliva and were largely independent of the dynamic alterations observed upon salt stimulation. Gene ontology enrichment analysis of key proteins, i.e., immunoglobulin heavy constant y1, myeloblastin, cathepsin G, and kallikrein, revealed significantly increased serine-type endopeptidase activity for the S + group, while the S - group exhibited augmented cysteine-type endopeptidase inhibitor activity by increased abundances in lipocalin-1 and cystatin-D, -S, and -SN, respectively. As proteases have been suggested to facilitate transepithelial sodium transport by cleaving the y-subunit of the epithelial sodium channel (ENaC) and protease inhibitors have been shown to reduce ENaC-mediated sodium transport, the differentially modulated proteolytic activity patterns observed in vivo for S + and S - subjects show evidence of them playing a crucial role in affecting human NaCl sensitivity.

  18. Effects of Wnt3a on proliferation and differentiation of human epidermal stem cells

    International Nuclear Information System (INIS)

    Jia Liwei; Zhou Jiaxi; Peng Sha; Li Juxue; Cao Yujing; Duan Enkui

    2008-01-01

    Epidermal stem cells maintain development and homeostasis of mammalian epidermis throughout life. However, the molecular mechanisms involved in the proliferation and differentiation of epidermal stem cells are far from clear. In this study, we investigated the effects of Wnt3a and Wnt/β-catenin signaling on proliferation and differentiation of human fetal epidermal stem cells. We found both Wnt3a and active β-catenin, two key members of the Wnt/β-catenin signaling, were expressed in human fetal epidermis and epidermal stem cells. In addition, Wnt3a protein can promote proliferation and inhibit differentiation of epidermal stem cells in vitro culture. Our results suggest that Wnt/β-catenin signaling plays important roles in human fetal skin development and homeostasis, which also provide new insights on the molecular mechanisms of oncogenesis in human epidermis

  19. Enrichment of unlabeled human Langerhans cells from epidermal cell suspensions by discontinuous density gradient centrifugation

    NARCIS (Netherlands)

    Teunissen, M. B.; Wormmeester, J.; Kapsenberg, M. L.; Bos, J. D.

    1988-01-01

    In this report we introduce an alternative procedure for enrichment of human epidermal Langerhans cells (LC) from epidermal cell suspensions of normal skin. By means of discontinuous Ficoll-Metrizoate density gradient centrifugation, a fraction containing high numbers of viable, more than 80% pure

  20. Homologous radioimmunoassay for human epidermal growth factor (urogastrone)

    International Nuclear Information System (INIS)

    Dailey, G.E.; Kraus, J.W.; Orth, D.N.

    1978-01-01

    Epidermal growth factor (EGF), a polypeptide hormone originally discovered in the mouse submaxillary gland, stimulates growth in a variety of tissues in several species. This hormone has recently been identified in human urine. A homologous RIA for human EGF (RIA-hEGF) has been developed. In general, levels were similar to those recently reported using a heterologous RIA system. Twenty-four-hour urinary excretion of RIA-hEGF by normal adult males and females was 63.0 +- 3.0 and 52.0 +- 3.5 (mean +- SE) μg/total vol, or 29.7 +- 1.1 and 39.8 +- 1.7 μg/g creatinine, respectively. Excretion by females taking oral contraceptives was significantly greater (60.1 +- 2.7 μg/g creatinine; P 0.05). Several of those with very low values had histories of alcohol abuse. Excretion by patients with Cushing's syndrome was normal. Patients with psoriasis or recovering from major burns excreted both abnormally high and abnormally low levels of RIA-hEGF, with no obvious correlation to their clinical condition. There was no apparent diurnal or postprandial variation in urinary RIA-hEGF excretion by normal subjects. An excellent linear correlation was observed between RIA-hEGF and creatinine concentrations in each urine sample for each subject, suggesting that RIA-hEGF concentration in a random urine sample provides a valid index of 24-h RIA-hEGF excretion

  1. Predicting human epidermal melanin concentrations for different skin tones

    CSIR Research Space (South Africa)

    Smit, Jacoba E

    2011-07-01

    Full Text Available epidermal melanin concentrations for different skin tones JE Smit 1 , AE Karsten 2 , RW Sparrow 1 1 CSIR Biosciences, Pretoria, South Africa 2 CSIR National Laser Centre, Pretoria, South Africa Author e-mail address: KSmit...

  2. Effects of soap-water wash on human epidermal penetration.

    Science.gov (United States)

    Zhu, Hanjiang; Jung, Eui-Chang; Phuong, Christina; Hui, Xiaoying; Maibach, Howard

    2016-08-01

    Skin decontamination is a primary interventional method used to decrease dermal absorption of hazardous contaminants, including chemical warfare agents, pesticides and industrial pollutants. Soap and water wash, the most common and readily available decontamination system, may enhance percutaneous absorption through the "wash-in effect." To understand better the effect of soap-water wash on percutaneous penetration, and provide insight to improving skin decontamination methods, in vitro human epidermal penetration rates of four C(14) -labeled model chemicals (hydroquinone, clonidine, benzoic acid and paraoxon) were assayed using flow-through diffusion cells. Stratum corneum (SC) absorption rates of these chemicals at various hydration levels (0-295% of the dry SC weights) were determined and compared with the results of the epidermal penetration study to clarify the effect of SC hydration on skin permeability. Results showed accelerated penetration curves of benzoic acid and paraoxon after surface wash at 30 min postdosing. Thirty minutes after washing (60 min postdosing), penetration rates of hydroquinone and benzoic acid decreased due to reduced amounts of chemical on the skin surface and in the SC. At the end of the experiment (90 min postdosing), a soap-water wash resulted in lower hydroquinone penetration, greater paraoxon penetration and similar levels of benzoic acid and clonidine penetration compared to penetration levels in the non-wash groups. The observed wash-in effect agrees with the enhancement effect of SC hydration on the SC chemical absorption rate. These results suggest SC hydration derived from surface wash to be one cause of the wash-in effect. Further, the occurrence of a wash-in effect is dependent on chemical identity and elapsed time between exposure and onset of decontamination. By reducing chemical residue quantity on skin surface and in the SC reservoir, the soap-water wash may decrease the total quantity of chemical absorbed in the

  3. Epidermal growth factor and its receptors in human pancreatic carcinoma

    International Nuclear Information System (INIS)

    Chen, Y.F.; Pan, G.Z.; Hou, X.; Liu, T.H.; Chen, J.; Yanaihara, C.; Yanaihara, N.

    1990-01-01

    The role of epidermal growth factor (EGF) in oncogenesis and progression of malignant tumors is a subject of vast interest. In this study, radioimmunoassay and radioreceptor assay of EGF were established. EGF contents in malignant and benign pancreatic tumors, in normal pancreas tissue, and in culture media of a human pancreatic carcinoma cell line were determined. EGF receptor binding studies were performed. It was shown that EGF contents in pancreatic carcinomas were significantly higher than those in normal pancreas or benign pancreatic tumors. EGF was also detected in the culture medium of a pancreatic carcinoma cell line. The binding of 125I-EGF to the pancreatic carcinoma cells was time and temperature dependent, reversible, competitive, and specific. Scatchard analysis showed that the dissociation constant of EGF receptor was 2.1 X 10(-9) M, number of binding sites was 1.3 X 10(5) cell. These results indicate that there is an over-expression of EGF/EGF receptors in pancreatic carcinomas, and that an autocrine regulatory mechanism may exist in the growth-promoting effect of EGF on tumor cells

  4. Kinetics of growth and differentiation of cultured human epidermal keratinocytes

    International Nuclear Information System (INIS)

    Albers, K.M.

    1985-01-01

    A study was made of the interrelationship between replication and differentiation in cultures of human epidermal keratinocytes. Measures of both parameters were made using newly developed methods to quantify the rate at which keratinocytes replicate and the rate at which they withdraw from the cell cycle. Keratinocyte replication was measured by determining the cell doubling time, labeling index, and cell cycle duration. Cell cycle length was measured using a double label assay that determines the length of time between two successive phases of DNA synthesis. The first DNA synthesis phase was marked by labeling keratinocytes with 14 C-thymidine. At the next round of DNA synthesis, cells were labeled with bromodeoxyuridine, a heavy analog of thymidine. The cell cycle length is given by the time required for the 14 C-labeled DNA to become double labeled. To measure keratinocyte differentiation, the rate at which cells withdraw from the cell cycle was determined. To measure withdrawal, the percentage of cells labeled by a pulse of 14 C-thymidine that failed to undergo a second cycle of DNA synthesis, as measured by bromodeoxyuridine incorporation, was determined. Cells which failed to undergo a second cycle of synthesis were considered to have differentiated and withdrawn from the cell cycle

  5. Response of human epidermal keratinocytes to UV light

    International Nuclear Information System (INIS)

    Kartasova, A.A.

    1987-01-01

    This thesis presents a study on the response of human epidermal keratinocytes to UV light as well as to other agents like 4-NQO and TPA. The effects of ultraviolet (UV) light on the protein synthesis in cultured keratinocytes are presented in ch. III. The next chapter describes the construction of a cDNA library using mRNA isolated from UV irradiated kernatinocytes. This library was differentially screened with cDNA probes synthesized on mRNA from either UV irradiated or nonirradiated cells. Several groups of cDNA clones corresponding to transcripts whose level in the cytoplasm seem to be affected by exposure to UV light have been isolated and characterized by cross-hybridization, sequencing and Northern blot analysis. More detailed analysis of some of the cDNA clones is presented in the two chapters following ch. IV. The complete cDNA sequence of the proteinase inhibitor cystatin A and the modulation of its expression by UV light and the carcinogen 4-nitroquinoline 1-oxide (4-NQO) in keratinocytes are described in ch. V. Two other groups of cDNA clones have been isolated which do not cross-hybridize with each other on Southern blots. However, the primary structures of the proteins deduced from the nucleotide sequences of these two groups of cDNA clones are very similar. 212 refs.; 33 figs.; 2 tabs

  6. Structural and biophysical characteristics of human skin in maintaining proper epidermal barrier function

    Directory of Open Access Journals (Sweden)

    Magdalena Boer

    2016-02-01

    Full Text Available The complex structure of human skin and its physicochemical properties turn it into an efficient outermost defence line against exogenous factors, and help maintain homeostasis of the human body. This role is played by the epidermal barrier with its major part – stratum corneum. The condition of the epidermal barrier depends on individual and environmental factors. The most important biophysical parameters characterizing the status of this barrier are the skin pH, epidermal hydration, transepidermal water loss and sebum excretion. The knowledge of biophysical skin processes may be useful for the implementation of prophylactic actions whose aim is to restore the barrier function.

  7. Influence of topical human epidermal growth factor on postkeratoplasty re-epithelialisation

    NARCIS (Netherlands)

    M.M. Dellaert; T.A. Casey; S. Wiffen; J. Gordon (Jocelynne); P. Johnson (Jürgen); A.J. Geerards (Annette); W.J. Rijneveld (Wilhelmina); L. Remeijer (Lies); W.H. Beekhuis (Houdijn); P.G.H. Mulder (Paul)

    1997-01-01

    textabstractAIM: To test the efficacy and safety of recombinant human epidermal growth factor (hEGF) on corneal re-epithelialisation following penetrating keratoplasty. METHODS: A prospective, randomised, placebo controlled study was carried out in which patients were

  8. Flow cytometry of human primary epidermal and follicular keratinocytes.

    Science.gov (United States)

    Gragnani, Alfredo; Ipolito, Michelle Zampieri; Sobral, Christiane S; Brunialti, Milena Karina Coló; Salomão, Reinaldo; Ferreira, Lydia Masako

    2008-02-19

    The aim of this study was to characterize using flow cytometry cultured human primary keratinocytes isolated from the epidermis and hair follicles by different methods. Human keratinocytes derived from discarded fragments of total skin and scalp hair follicles from patients who underwent plastic surgery in the Plastic Surgery Division at UNIFESP were used. The epidermal keratinocytes were isolated by using 3 different methods: the standard method, upon exposure to trypsin for 30 minutes; the second, by treatment with dispase for 18 hours and with trypsin for 10 minutes; and the third, by treatment with dispase for 18 hours and with trypsin for 30 minutes. Follicular keratinocytes were isolated using the standard method. On comparing the group treated with dispase for 18 hours and with trypsin for 10 minutes with the group treated with dispase for 18 hours and with trypsin for 30 minutes, it was observed that the first group presented the largest number of viable cells, the smallest number of cells in late apoptosis and necrosis with statistical significance, and no difference in apoptosis. When we compared the group treated with dispase for 18 hours and with trypsin for 10 minutes with the group treated with trypsin, the first group presented the largest number of viable cells, the smallest number of cells in apoptosis with statistical significance, and no difference in late apoptosis and necrosis. When we compared the results of the group treated with dispase for 18 hours and with trypsin for 10 minutes with the results for follical isolation, there was a statistical difference in apoptosis and viable cells. The isolation method of treatment with dispase for 18 hours and with trypsin for 10 minutes produced the largest number of viable cells and the smallest number of cells in apoptosis/necrosis.

  9. Use of etanercept to treat toxic epidermal necrolysis in a human immunodeficiency virus-positive patient

    OpenAIRE

    Yung-Yi Lee; Jui-Hung Ko; Chia-Hung Wei; Wen-Hung Chung

    2013-01-01

    Toxic epidermal necrolysis (TEN) is an uncommon and severe cutaneous adverse drug reaction that causes disseminated necrosis of epidermal cells and mucocutaneous detachment. Here, we report the case of a 32-year-old man with human immunodeficiency virus infection who presented with generalized violaceous macules and blister formation 4 days after the administration of mefenamic acid and amoxicillin for a dental procedure. Additional symptoms included oral ulcers and conjunctivitis. Results of...

  10. Nicotinic acid receptor abnormalities in human skin cancer: implications for a role in epidermal differentiation.

    Directory of Open Access Journals (Sweden)

    Yira Bermudez

    Full Text Available Chronic UV skin exposure leads to epidermal differentiation defects in humans that can be largely restored by pharmacological doses of nicotinic acid. Nicotinic acid has been identified as a ligand for the human G-protein-coupled receptors GPR109A and GPR109B that signal through G(i-mediated inhibition of adenylyl cyclase. We have examined the expression, cellular distribution, and functionality of GPR109A/B in human skin and skin derived epidermal cells.Nicotinic acid increases epidermal differentiation in photodamaged human skin as judged by the terminal differentiation markers caspase 14 and filaggrin. Both GPR109A and GPR109B genes are transcribed in human skin and in epidermal keratinocytes, but expression in dermal fibroblasts is below limits of detection. Receptor transcripts are greatly over-expressed in squamous cell cancers. Receptor protein in normal skin is prominent from the basal through granular layers of the epidermis, with cellular localization more dispersive in the basal layer but predominantly localized at the plasma membrane in more differentiated epidermal layers. In normal human primary and immortalized keratinocytes, nicotinic acid receptors show plasma membrane localization and functional G(i-mediated signaling. In contrast, in a squamous cell carcinoma derived cell line, receptor protein shows a more diffuse cellular localization and the receptors are nearly non-functional.The results of these studies justify future genetic and pharmacological intervention studies to define possible specific role(s of nicotinic acid receptors in human skin homeostasis.

  11. Evolution of the clonogenic potential of human epidermal stem/progenitor cells with age

    Directory of Open Access Journals (Sweden)

    Zobiri O

    2012-02-01

    Full Text Available Olivia Zobiri, Nathalie Deshayes, Michelle Rathman-JosserandDepartment of Biological Research, L'Oréal Advanced Research, Clichy Cedex, FranceAbstract: A number of clinical observations have indicated that the regenerative potential and overall function of the epidermis is modified with age. The epidermis becomes thinner, repairs itself less efficiently after wounding, and presents modified barrier function recovery. In addition, the dermal papillae flatten out with increasing age, suggesting a modification in the interaction between epidermal and dermal compartments. As the epidermal regenerative capacity is dependent upon stem and progenitor cell function, it is naturally of interest to identify and understand age-related changes in these particular keratinocyte populations. Previous studies have indicated that the number of stem cells does not decrease with age in mouse models but little solid evidence is currently available concerning human skin. The objective of this study was to evaluate the clonogenic potential of keratinocyte populations isolated from the epidermis of over 50 human donors ranging from 18 to 71 years old. The data indicate that the number of epidermal cells presenting high regenerative potential does not dramatically decline with age in human skin. The authors believe that changes in the microenvironment controlling epidermal basal cell activity are more likely to explain the differences in epidermal function observed with increasing age.Keywords: skin, epidermal stem cells, aging, colony-forming efficiency test

  12. Grafting of human epidermal cells, presence and perspectives

    Czech Academy of Sciences Publication Activity Database

    Smetana, Karel; Dvořánková, B.; Labský, Jiří; Vacík, Jiří; Holíková, Z.

    2001-01-01

    Roč. 102, č. 1 (2001), s. 1-6 ISSN 0036-5327 R&D Projects: GA ČR GA203/00/1310; GA AV ČR IBS4050005; GA MZd ND6340; GA MŠk LN00A065; GA AV ČR KSK4055109 Institutional research plan: CEZ:AV0Z4050913 Keywords : cell therapy-keratinocyte-epidermal stem cell * skin defect Subject RIV: CD - Macromolecular Chemistry

  13. A comparative study between mixed-type tumours from human salivary and canine mammary glands

    International Nuclear Information System (INIS)

    Genelhu, Marisa CLS; Cardoso, Sérgio V; Gobbi, Helenice; Cassali, Geovanni D

    2007-01-01

    In comparative pathology, canine mammary tumours have special interest because of their similarities with human breast cancer. Mixed tumours are uncommon lesions in the human breast, but they are found most frequently in the mammary gland of the female dogs and in the human salivary glands. The aim of the study was to compare clinical, morphological and immunohistochemical features of human salivary and canine mammary gland mixed tumours, in order to evaluate the latter as an experimental model for salivary gland tumours. Ten examples of each mixed tumour type (human pleomorphic adenoma and carcinomas ex-pleomorphic adenomas and canine mixed tumour and metaplastic carcinoma) were evaluated. First, clinical and morphologic aspects of benign and malignant variants were compared between the species. Then, streptavidin-biotin-peroxidase immunohistochemistry was performed to detect the expression of cytokeratins, vimentin, p63 protein, estrogen receptor, β-catenin, and E-cadherin. After standardization, similar age and site distributions were observed in human and canine tumours. Histological similarities were identified in the comparison of the benign lesions as well. Metaplastic carcinomas also resembled general aspects of carcinomas ex-pleomorphic adenomas in morphological evaluation. Additionally, immunohistochemical staining further presented similar antigenic expression between lesions. There are many similar features between human salivary and canine mammary gland mixed tumours. This observation is of great relevance for those interested in the study and management of salivary gland tumours, since canine lesions may constitute useful comparative models for their investigations

  14. Human Papilloma Viral DNA Replicates as a Stable Episome in Cultured Epidermal Keratinocytes

    Science.gov (United States)

    Laporta, Robert F.; Taichman, Lorne B.

    1982-06-01

    Human papilloma virus (HPV) is poorly understood because systems for its growth in tissue culture have not been developed. We report here that cultured human epidermal keratinocytes could be infected with HPV from plantar warts and that the viral DNA persisted and replicated as a stable episome. There were 50-200 copies of viral DNA per cell and there was no evidence to indicate integration of viral DNA into the cellular genome. There was also no evidence to suggest that viral DNA underwent productive replication. We conclude that cultured human epidermal keratinocytes may be a model for the study of certain aspects of HPV biology.

  15. Timing of food intake impacts daily rhythms of human salivary microbiota: a randomized, crossover study.

    Science.gov (United States)

    Collado, María Carmen; Engen, Phillip A; Bandín, Cristina; Cabrera-Rubio, Raúl; Voigt, Robin M; Green, Stefan J; Naqib, Ankur; Keshavarzian, Ali; Scheer, Frank A J L; Garaulet, Marta

    2018-04-01

    The composition of the diet (what we eat) has been widely related to the microbiota profile. However, whether the timing of food consumption (when we eat) influences microbiota in humans is unknown. A randomized, crossover study was performed in 10 healthy normal-weight young women to test the effect of the timing of food intake on the human microbiota in the saliva and fecal samples. More specifically, to determine whether eating late alters daily rhythms of human salivary microbiota, we interrogated salivary microbiota in samples obtained at 4 specific time points over 24 h, to achieve a better understanding of the relationship between food timing and metabolic alterations in humans. Results revealed significant diurnal rhythms in salivary diversity and bacterial relative abundance ( i.e., TM7 and Fusobacteria) across both early and late eating conditions. More importantly, meal timing affected diurnal rhythms in diversity of salivary microbiota toward an inverted rhythm between the eating conditions, and eating late increased the number of putative proinflammatory taxa, showing a diurnal rhythm in the saliva. In a randomized, crossover study, we showed for the first time the impact of the timing of food intake on human salivary microbiota. Eating the main meal late inverts the daily rhythm of salivary microbiota diversity which may have a deleterious effect on the metabolism of the host.-Collado, M. C., Engen, P. A., Bandín, C., Cabrera-Rubio, R., Voigt, R. M., Green, S. J., Naqib, A., Keshavarzian, A., Scheer, F. A. J. L., Garaulet, M. Timing of food intake impacts daily rhythms of human salivary microbiota: a randomized, crossover study.

  16. Extraction of high-quality epidermal RNA after ammonium thiocyanate-induced dermo-epidermal separation of 4 mm human skin biopsies

    DEFF Research Database (Denmark)

    Clemmensen, Anders; Thomassen, Mads; Clemmensen, Ole

    2009-01-01

    To obtain a separation of the epidermal and dermal compartments to examine compartment specific biological mechanisms in the skin, we incubated 4 mm human skin punch biopsies in ammonium thiocyanate. We wanted to test (i) the histological quality of the dermo-epidermal separation obtained...... by different incubation times; (ii) the amount and quality of extractable epidermal RNA and (iii) its impact on sample RNA expression profiles assessed by large-scale gene expression microarray analysis in both normal and inflamed skin. At 30-min incubation, the split between dermis and epidermis...... and almost completely separated from the dermis of 4 mm skin biopsies by 30 min incubation in 3.8% ammonium thiocyanate combined with curettage of the dermal surface, producing high-quality RNA suitable for transcriptional analysis. Our refined method of dermo-epidermal separation will undoubtedly prove...

  17. Immunohistochemical localisation of keratin and luminal epithelial antigen in myoepithelial and luminal epithelial cells of human mammary and salivary gland tumours.

    Science.gov (United States)

    Nathrath, W B; Wilson, P D; Trejdosiewicz, L K

    1982-01-01

    Rabbit antisera to human 40-63 000 MW epidermal keratin, one batch with restricted distribution of reactivity from an initial (aK1) and one with "broad spectrum" distribution of reactivity from a late bleeding (aK), and to "luminal epithelial antigen" (aLEA) were applied to formalin fixed paraffin embedded sections of human normal and neoplastic mammary and salivary glands using an indirect immunoperoxidase method. aK1 reacted with myoepithelial cells, aLEA with luminal epithelial cells and aK with both cell types in normal mammary and salivary gland. In breast carcinomas the majority of intraluminal and infiltrating carcinoma cells reacted with aLEA but not with aK1 which reacted only with surrounding myoepithelial cells. aK reacted with both myoepithelial cells and with intraluminal and infiltrating tumour cells. In the salivary gland adenomas the majority of cells reacted with aK, and those cells arranged in a tubular fashion reacted with aLEA.

  18. Growth of melanocytes in human epidermal cell cultures

    International Nuclear Information System (INIS)

    Staiano-Coico, L.; Hefton, J.M.; Amadeo, C.; Pagan-Charry, I.; Madden, M.R.; Cardon-Cardo, C.

    1990-01-01

    Epidermal cell cultures were grown in keratinocyte-conditioned medium for use as burn wound grafts; the melanocyte composition of the grafts was studied under a variety of conditions. Melanocytes were identified by immunohistochemistry based on a monoclonal antibody (MEL-5) that has previously been shown to react specifically with melanocytes. During the first 7 days of growth in primary culture, the total number of melanocytes in the epidermal cultures decreased to 10% of the number present in normal skin. Beginning on day 2 of culture, bipolar melanocytes were present at a mean cell density of 116 +/- 2/mm2; the keratinocyte to melanocyte ratio was preserved during further primary culture and through three subpassages. Moreover, exposure of cultures to mild UVB irradiation stimulated the melanocytes to proliferate, suggesting that the melanocytes growing in culture maintained their responsiveness to external stimuli. When the sheets of cultured cells were enzymatically detached from the plastic culture flasks before grafting, melanocytes remained in the basal layer of cells as part of the graft applied to the patient

  19. Human epidermal growth factor: molecular forms and application of radioimmunoassay and radioreceptor assay

    International Nuclear Information System (INIS)

    Hirata, Y.; Orth, D.N.

    1981-01-01

    Epidermal growth factor (EGF), a 53 amino acid polypeptide, was first isolated by Cohen. EGF's growth-promoting activity is not limited to epidermal cells, but is expressed on a wide variety of tissues derived from a number of different species. Human EGF (hEGF) was isolated and subsequently purified from human urine. Unexpectedly, a close structural relationship was recognized between mEGF and human β-urogastrone. The authors recently developed both an homologous hEGF radioimmunoassay (RIA) and a radioreceptor assay (RRA) using a human placental membrane fraction. Using these assays, the molecular size of hEGF in human body fluids and tissues was evaluated, and partial characterization of a high molecular weight form of hEGF isolated from human urine was carried out. The concentrations of immunoreactive hEGF were also determined in human tissues and plasma after extraction either with cationic exchange chromatography or with immunoaffinity chromatography. (Auth.)

  20. The organization of human epidermis: functional epidermal units and phi proportionality.

    Science.gov (United States)

    Hoath, Steven B; Leahy, D G

    2003-12-01

    The concept that mammalian epidermis is structurally organized into functional epidermal units has been proposed on the basis of stratum corneum (SC) architecture, proliferation kinetics, melanocyte:keratinocyte ratios (1:36), and, more recently, Langerhans cell: epidermal cell ratios (1:53). This article examines the concept of functional epidermal units in human skin in which the maintenance of phi (1.618034) proportionality provides a central organizing principle. The following empirical measurements were used: 75,346 nucleated epidermal cells per mm2, 1394 Langerhans cells per mm2, 1999 melanocytes per mm2, 16 (SC) layers, 900-microm2 corneocyte surface area, 17,778 corneocytes per mm2, 14-d (SC) turnover time, and 93,124 per mm2 total epidermal cells. Given these empirical data: (1) the number of corneocytes is a mean proportional between the sum of the Langerhans cell + melanocyte populations and the number of epidermal cells, 3393/17,778-17,778/93,124; (2) the ratio of nucleated epidermal cells over corneocytes is phi proportional, 75,346/17,778 approximately phi3; (3) assuming similar 14-d turnover times for the (SC) and Malpighian epidermis, the number of corneocytes results from subtraction of a cellular fraction equal to approximately 2/phi2 x the number of living cells, 75,436 - (2/phi2 x 75,346) approximately 17,778; and (4) if total epidermal turnover time equals (SC) turnover time x the ratio of living/dead cells, then compartmental turnover times are unequal (14 d for (SC) to 45.3 d for nucleated epidermis approximately 1/2phi) and cellular replacement rates are 52.9 corneocytes/69.3 keratinocytes per mm2 per h approximately 2/phi2. These empirically derived equivalences provide logicomathematical support for the presence of functional epidermal units in human skin. Validation of a phi proportional unit architecture in human epidermis will be important for tissue engineering of skin and the design of instruments for skin measurement.

  1. Human α-defensin (DEFA) gene expression helps to characterise benign and malignant salivary gland tumours

    International Nuclear Information System (INIS)

    Winter, Jochen; Wenghoefer, Matthias; Pantelis, Annette; Kraus, Dominik; Reckenbeil, Jan; Reich, Rudolf; Jepsen, Soeren; Fischer, Hans-Peter; Allam, Jean-Pierre; Novak, Natalija

    2012-01-01

    Because of the infrequence of salivary gland tumours and their complex histopathological diagnosis it is still difficult to exactly predict their clinical course by means of recurrence, malignant progression and metastasis. In order to define new proliferation associated genes, purpose of this study was to investigate the expression of human α-defensins (DEFA) 1/3 and 4 in different tumour entities of the salivary glands with respect to malignancy. Tissue of salivary glands (n=10), pleomorphic adenomas (n=10), cystadenolymphomas (n=10), adenocarcinomas (n=10), adenoidcystic carcinomas (n=10), and mucoepidermoid carcinomas (n=10) was obtained during routine surgical procedures. RNA was extracted according to standard protocols. Transcript levels of DEFA 1/3 and 4 were analyzed by quantitative realtime PCR and compared with healthy salivary gland tissue. Additionally, the proteins encoded by DEFA 1/3 and DEFA 4 were visualized in paraffin-embedded tissue sections by immunohistochemical staining. Human α-defensins are traceable in healthy as well as in pathological altered salivary gland tissue. In comparison with healthy tissue, the gene expression of DEFA 1/3 and 4 was significantly (p<0.05) increased in all tumours – except for a significant decrease of DEFA 4 gene expression in pleomorphic adenomas and a similar transcript level for DEFA 1/3 compared to healthy salivary glands. A decreased gene expression of DEFA 1/3 and 4 might protect pleomorphic adenomas from malignant transformation into adenocarcinomas. A similar expression pattern of DEFA-1/3 and -4 in cystadenolymphomas and inflamed salivary glands underlines a potential importance of immunological reactions during the formation of Warthin’s tumour

  2. Brief study about the distribution of recombinant human Epidermic Growth Factor (rh-EGF)

    International Nuclear Information System (INIS)

    Rodriguez Garcia, J.C.; De Dios D Espaux, R.; Bello Garciga, J.L.

    1997-01-01

    This report describes results of the study about biodistribution of I-125 recombinant human Epidermic Growth Factor (rhEGF). The radiolabelled product was administrated to Sprague Dawley rats in three different ways: intramuscular, subcutaneous and epidermic; the highest concentration of EGF in blood was found 4 hours after rhEGF administration, with a greater distribution in the plasma with regard to cellular pellet. The slowest plasma clearance corresponded to the intramuscular administration. The highest concentration of radiolabelled rhEGF was found in liver, kidney and intestine. It was found that radiolabelled EGF is excreted mainly throughout urine and faeces although other excretion pathways could exist

  3. Influence of epidermal hydration on the friction of human skin against textiles

    OpenAIRE

    Gerhardt, L.-C; Strässle, V; Lenz, A; Spencer, N.D; Derler, S

    2008-01-01

    Friction and shear forces, as well as moisture between the human skin and textiles are critical factors in the formation of skin injuries such as blisters, abrasions and decubitus. This study investigated how epidermal hydration affects the friction between skin and textiles.

  4. Influence of epidermal hydration on the friction of human skin against textile

    NARCIS (Netherlands)

    Gerhardt, L.C.; Strässle, V.; Lenz, A.; Spencer, N.D.; Derler, S.

    2008-01-01

    Friction and shear forces, as well as moisture between the human skin and textiles are critical factors in the formation of skin injuries such as blisters, abrasions and decubitus. This study investigated how epidermal hydration affects the friction between skin and textiles. The friction between

  5. Toxicity Assessment of Six Titanium Dioxide Nanoparticles in Human Epidermal Keratinocytes

    Science.gov (United States)

    Toxicity Assessment of Six Titanium Dioxide Nanoparticles in Human Epidermal Keratinocytes Nanoparticle uptake in cells may be an important determinant of their potential cytotoxic and inflammatory effects. Six commercial TiO2 NP (A=Alfa Aesar,10nm, A*=Alfa Aesar 32nm, B=P25 27...

  6. Establishment of functional acinar-like cultures from human salivary glands.

    Science.gov (United States)

    Jang, S I; Ong, H L; Gallo, A; Liu, X; Illei, G; Alevizos, I

    2015-02-01

    Disorders of human salivary glands resulting from therapeutic radiation treatment for head and neck cancers or from the autoimmune disease Sjögren syndrome (SS) frequently result in the reduction or complete loss of saliva secretion. Such irreversible dysfunction of the salivary glands is due to the impairment of acinar cells, the major glandular cells of protein, salt secretion, and fluid movement. Availability of primary epithelial cells from human salivary gland tissue is critical for studying the underlying mechanisms of these irreversible disorders. We applied 2 culture system techniques on human minor salivary gland epithelial cells (phmSG) and optimized the growth conditions to achieve the maintenance of phmSG in an acinar-like phenotype. These phmSG cells exhibited progenitor cell markers (keratin 5 and nanog) as well as acinar-specific markers-namely, α-amylase, cystatin C, TMEM16A, and NKCC1. Importantly, with an increase of the calcium concentration in the growth medium, these phmSG cells were further promoted to acinar-like cells in vitro, as indicated by an increase in AQP5 expression. In addition, these phmSG cells also demonstrated functional calcium mobilization, formation of epithelial monolayer with high transepithelial electrical resistance (TER), and polarized secretion of α-amylase secretion after β-adrenergic receptor stimulation. Taken together, suitable growth conditions have been established to isolate and support culture of acinar-like cells from the human salivary gland. These primary epithelial cells can be useful for study of molecular mechanisms involved in regulating the function of acinar cells and in the loss of salivary gland function in patients. © International & American Associations for Dental Research 2014.

  7. Prevalence of human papillomavirus and Epstein-Barr virus in salivary gland diseases.

    Science.gov (United States)

    Lin, Frank Cheau-Feng; Chen, Pei-Liang; Tsao, Tang-Yi; Li, Chia-Ru; Jeng, Kee-Ching; Tsai, Stella Chin-Shaw

    2014-10-01

    The roles of human papillomavirus (HPV) and Epstein-Barr virus (EBV) in head and neck neoplasms have been well reported, but little is known about their relationship with salivary gland tumours. This study investigated the presence of HPV and EBV in salivary gland diseases. The presence of HPV 16/18 and EBV was analysed in archival pathological specimens collected from patients who had undergone surgery for salivary gland diseases. HPV 16/18 DNA was detected using nested polymerase chain reaction (PCR) and further confirmed with immunohistochemistry. EBV DNA was detected using real-time PCR. A total of 61 pathological specimens were examined: 39.5% (15/38) of pleomorphic adenomas, 33.3% (3/9) of Warthin's tumours, 33.3% (one of 3) of mucoepidermoid carcinomas, and 25.0% (one of 4) of benign lymphoepithelial lesions were positive for high-risk HPV 16/18. Only two Warthin's tumours were positive for EBV. The infectious nature of salivary gland neoplasms was revealed by the high prevalence of HPV infection, and the specific presence of EBV in Warthin's tumours, suggesting a potential role for HPV and EBV in salivary gland diseases. © The Author(s) 2014 Reprints and permissions: sagepub.co.uk/journalsPermissions.nav.

  8. Salivary alpha-amylase : a measure associated with satiety and subsequent food intake in humans

    NARCIS (Netherlands)

    Harthoorn, L.F.

    2008-01-01

    Food intake regulation in humans involves various central and peripheral mechanisms. In this study salivary -amylase was examined for functioning as a measure of satiety and food intake. In a 1.25-h session, 32 fasted subjects were given a preload of starch-based custard (849 kJ) followed by ad

  9. Humanized versus murine anti-human epidermal growth factor receptor monoclonal antibodies for immunoscintigraphic studies

    Energy Technology Data Exchange (ETDEWEB)

    Morales, Alejo A. Morales; Duconge, Jorge; Alvarez-Ruiz, Daniel; Becquer-Viart, Maria de Los Angeles; Nunez-Gandolff, Gilda; Fernandez, Eduardo; Caballero-Torres, Idania; Iznaga-Escobar, Normando

    2000-02-01

    The anti-human epidermal growth factor receptor (EGF-R) humanized antibody h-R3 (IgG{sub 1}), which binds to an extracellular domain of EGF-R, was used to evaluate the biodistribution on nude mice xenografted with A431 epidermoid carcinoma cell line. Results are compared with its murine version ior egf/r3 monoclonal antibody (mAb). Twenty-one athymic female 4NMRI nu/nu mice were injected intravenously with 10 {mu}g/100 {mu}Ci of {sup 99m}Tc-labeled mAbs. The mAb ior C5 that recognizes an antigen expressed preferentially on the surface of malignant and cytoplasm of normal colorectal cells was used as negative control. Immunoreactivity of {sup 99m}Tc-labeled mAbs was measured by enzyme linked immunosorbent assay on A431 cell line and the immunoreactive fractions determined by Lindmo method. Among all organs significant accumulation was found in tumor (6.14{+-}2.50 %ID/g, 5.06{+-}2.61 %ID/g for murine and humanized mAbs, respectively) 4 h after injection. The immunoreactive fractions were found to be 0.88 and 0.81 for murine and humanized mAb, respectively. Thus, we expect better results using the humanized mAb h-R3 for diagnostic immunoscintigraphy.

  10. Humanized versus murine anti-human epidermal growth factor receptor monoclonal antibodies for immunoscintigraphic studies

    International Nuclear Information System (INIS)

    Morales, Alejo A. Morales; Duconge, Jorge; Alvarez-Ruiz, Daniel; Becquer-Viart, Maria de Los Angeles; Nunez-Gandolff, Gilda; Fernandez, Eduardo; Caballero-Torres, Idania; Iznaga-Escobar, Normando

    2000-01-01

    The anti-human epidermal growth factor receptor (EGF-R) humanized antibody h-R3 (IgG 1 ), which binds to an extracellular domain of EGF-R, was used to evaluate the biodistribution on nude mice xenografted with A431 epidermoid carcinoma cell line. Results are compared with its murine version ior egf/r3 monoclonal antibody (mAb). Twenty-one athymic female 4NMRI nu/nu mice were injected intravenously with 10 μg/100 μCi of 99m Tc-labeled mAbs. The mAb ior C5 that recognizes an antigen expressed preferentially on the surface of malignant and cytoplasm of normal colorectal cells was used as negative control. Immunoreactivity of 99m Tc-labeled mAbs was measured by enzyme linked immunosorbent assay on A431 cell line and the immunoreactive fractions determined by Lindmo method. Among all organs significant accumulation was found in tumor (6.14±2.50 %ID/g, 5.06±2.61 %ID/g for murine and humanized mAbs, respectively) 4 h after injection. The immunoreactive fractions were found to be 0.88 and 0.81 for murine and humanized mAb, respectively. Thus, we expect better results using the humanized mAb h-R3 for diagnostic immunoscintigraphy

  11. Dermal-epidermal membrane systems by using human keratinocytes and mesenchymal stem cells isolated from dermis

    Energy Technology Data Exchange (ETDEWEB)

    Salerno, Simona, E-mail: s.salerno@itm.cnr.it [Institute on Membrane Technology, National Research Council of Italy, ITM-CNR, c/o University of Calabria, via P. Bucci cubo 17/C, I-87036, Rende (CS) (Italy); Messina, Antonietta [Institute on Membrane Technology, National Research Council of Italy, ITM-CNR, c/o University of Calabria, via P. Bucci cubo 17/C, I-87036, Rende (CS) (Italy); Giordano, Francesca [Department of Pharmacy, Health and Nutritional Sciences, University of Calabria, I-87036 Rende, (CS) (Italy); Bader, Augustinus [Biomedical-Biotechnological Center, BBZ, University of Leipzig, D-04103 Leipzig (Germany); Drioli, Enrico [Institute on Membrane Technology, National Research Council of Italy, ITM-CNR, c/o University of Calabria, via P. Bucci cubo 17/C, I-87036, Rende (CS) (Italy); WCU Energy Engineering Department, Hanyang University, Seoul (Korea, Republic of); De Bartolo, Loredana, E-mail: l.debartolo@itm.cnr.it [Institute on Membrane Technology, National Research Council of Italy, ITM-CNR, c/o University of Calabria, via P. Bucci cubo 17/C, I-87036, Rende (CS) (Italy)

    2017-02-01

    Dermal-epidermal membrane systems were developed by co-culturing human keratinocytes with Skin derived Stem Cells (SSCs), which are Mesenchymal Stem Cells (MSCs) isolated from dermis, on biodegradable membranes of chitosan (CHT), polycaprolactone (PCL) and a polymeric blend of CHT and PCL. The membranes display physico-chemical, morphological, mechanical and biodegradation properties that could satisfy and fulfil specific requirements in skin tissue engineering. CHT membrane exhibits an optimal biodegradation rate for acute wounds; CHT-PCL for the chronic ones. On the other hand, PCL membrane in spite of its very slow biodegradation rate exhibits mechanical properties similar to in vivo dermis, a lower hydrophilic character, and a surface roughness, all properties that make it able to sustain cell adhesion and proliferation for in vitro skin models. Both CHT–PCL and PCL membranes guided epidermal and dermal differentiation of SSCs as pointed out by the expression of cytokeratins and the deposition of the ECM protein fibronectin, respectively. In the dermal-epidermal membrane systems, a more suitable microenvironment for the SSCs differentiation was promoted by the interactions and the mutual interplay with keratinocytes. Being skin tissue-biased stem cells committed to their specific final dermal and/or epidermal cell differentiation, SSCs are more suitable for skin tissue engineering than other adult MSCs with different origin. For this reason, they represent a useful autologous cell source for engineering skin substitutes for both in vivo and in vitro applications.

  12. Hesperetin induces melanin production in adult human epidermal melanocytes.

    Science.gov (United States)

    Usach, Iris; Taléns-Visconti, Raquel; Magraner-Pardo, Lorena; Peris, José-Esteban

    2015-06-01

    One of the major sources of flavonoids for humans are citrus fruits, hesperidin being the predominant flavonoid. Hesperetin (HSP), the aglycon of hesperidin, has been reported to provide health benefits such as antioxidant, anti-inflammatory and anticarcinogenic effects. However, the effect of HSP on skin pigmentation is not clear. Some authors have found that HSP induces melanogenesis in murine B16-F10 melanoma cells, which, if extrapolated to in vivo conditions, might protect skin against photodamage. Since the effect of HSP on normal melanocytes could be different to that observed on melanoma cells, the described effect of HSP on murine melanoma cells has been compared to the effect obtained using normal human melanocytes. HSP concentrations of 25 and 50 µM induced melanin synthesis and tyrosinase activity in human melanocytes in a concentration-dependent manner. Compared to control melanocytes, 25 µM HSP increased melanin production and tyrosinase activity 1.4-fold (p melanin production in human melanocyte cultures could be reproduced on human skin. Copyright © 2015 Elsevier Ltd. All rights reserved.

  13. Use of etanercept to treat toxic epidermal necrolysis in a human immunodeficiency virus-positive patient

    Directory of Open Access Journals (Sweden)

    Yung-Yi Lee

    2013-06-01

    Full Text Available Toxic epidermal necrolysis (TEN is an uncommon and severe cutaneous adverse drug reaction that causes disseminated necrosis of epidermal cells and mucocutaneous detachment. Here, we report the case of a 32-year-old man with human immunodeficiency virus infection who presented with generalized violaceous macules and blister formation 4 days after the administration of mefenamic acid and amoxicillin for a dental procedure. Additional symptoms included oral ulcers and conjunctivitis. Results of skin biopsy were compatible with Stevens–Johnson syndrome (SJS. SJS progressed to TEN within 2 days. Etanercept treatment showed a dramatic improvement in the symptoms of mucocutaneous lesions. To our knowledge, this is the first report on the treatment of TEN using etanercept in a human immunodeficiency virus-positive patient.

  14. Heavy metal-induced cytotoxicity to cultured human epidermal keratinocytes and effects of antioxidants.

    Science.gov (United States)

    Kappus, H; Reinhold, C

    1994-04-01

    Human epidermal keratinocytes which have been cultured were treated with the heavy metal ions of cadmium, mercury, copper and zinc. Cytotoxicity was measured either by protein estimation or by using the neutral red assay. Antioxidants were added in order to find out whether heavy metal-induced cytotoxicity is related to oxidative stress. All metals used showed considerable cytotoxic effects within 24 h in moderate concentrations. None of the antioxidants vitamin E (alpha-tocopherol), pyrogallol, propyl gallate, BHT or ebselen showed any protective or preventive effect. This indicates that oxidative stress may not be involved in the cytotoxicity induced by heavy metals in human epidermal keratinocytes. The cells used are, however, a valuable tool to study mechanisms of cytotoxicity.

  15. Mercuric dichloride induces DNA damage in human salivary gland tissue cells and lymphocytes

    Energy Technology Data Exchange (ETDEWEB)

    Schmid, Katharina; Kroemer, Susanne [University of Regensburg, Regensburg (Germany); Sassen, Andrea [University of Regensburg, Department of Pathology, Regensburg (Germany); Staudenmaier, Rainer [Technical University of Munich, Department of Otorhinolaryngology, Head and Neck Surgery, Munich (Germany); Reichl, Franz-Xaver [University of Munich, Institute of Pharmacology and Toxicology, Munich (Germany); Harreus, Ulrich [University of Munich, Department of Otorhinolaryngology, Head and Neck Surgery, Munich (Germany); Hagen, Rudolf; Kleinsasser, Norbert [University of Wuerzburg, Department of Otorhinolaryngology, Head and Neck Surgery, Wuerzburg (Germany)

    2007-11-15

    Amalgam is still one of the most frequently used dental filling materials. However, the possible adverse effects especially that of the mercuric component have led to continued controversy. Considering that mercury may be released from amalgam fillings into the oral cavity and also reach the circulating blood after absorption and resorption, it eventually may contribute to tumorigenesis in a variety of target cells. The present investigation focuses on genotoxic effects below a cytotoxic dose level of mercuric dichloride (HgCl{sub 2}) in human samples of salivary glands and lymphocytes to elucidate a possible role in tumor initiation. DNA migration due to single strand breaks, alkali labile sites and incomplete excision repair was quantified with the aid of the single cell microgel electrophoresis (Comet) assay. The concepts of Olive Tail Moment, percentage of DNA in the Tail and Tail Length were used as measures of DNA damage. To control for cytotoxic effects, the trypan blue exclusion test was applied. Human samples of the parotid salivary gland and lymphocytes of ten donors were exposed to HgCl{sub 2} concentrations from 1 to 50 {mu}M. N-methyl-N'-nitro-N-nitrosoguanidine (MNNG) and dimethyl sulfoxide (DMSO) served as controls. Increasing dose-dependent DNA migration could be demonstrated after exposure to HgCl{sub 2} in cells of the salivary glands and lymphocytes. In both cell types a significant increase in DNA migration could be shown starting from HgCl{sub 2} concentrations of 5 {mu}M in comparison to the negative control. The viability of the cell systems was not affected except at the highest concentration (50 {mu}M) tested. These data indicate genotoxic effects of mercuric dichloride in human salivary glands and lymphocytes at concentrations not leading to cytotoxic effects or cell death. Consequently, a contributory role in oral salivary gland tumor initiation warrants further investigation. (orig.)

  16. Frozen allogeneic human epidermal cultured sheets for the cure of complicated leg ulcers.

    Science.gov (United States)

    Bolívar-Flores, Y J; Kuri-Harcuch, W

    1999-08-01

    Skin ulcers due to venous stasis or diabetes are common among the elderly and are difficult to treat. Repeated applications of cell-based products have been reported to result in cure or improvement of leg ulcers of small size in a fraction of patients. To examine the effects of frozen human allogeneic epidermal cultures for the treatment of acute and chronic ulcers. We treated a series of 10 consecutive patients with leg ulcers of different etiology and duration with frozen human allogeneic epidermal cultures stored frozen and thawed for 5-10 minutes at room temperature before application. Three patients had ulcers with exposed Achilles or extensor tendon. The ulcers treated were as large as 160 cm2 in area and of up to 20-years' duration. After preliminary preparation of the wounds by debridement to remove necrotic tissue and application of silver sulfadiazine to control infection, thawed cultures were applied biweekly from 2 to 15 times depending on the size and complexity of the ulcer. All ulcers healed, including those with tendon exposure. After the first few applications, granulation tissue formed in the ulcer bed and on exposed tendons, and epidermal healing took place through proliferation and migration of cells from the margins of the wound. The time required for complete healing ranged from 1 to 31 weeks after the first application. The use of frozen human allogeneic epidermal cultures is a safe and effective treatment for venous or diabetic ulcers, even those with tendon exposure. It seems possible that any leg ulcer will be amenable to successful treatment by this method.

  17. Copy number variation of human AMY1 is a minor contributor to variation in salivary amylase expression and activity.

    Science.gov (United States)

    Carpenter, Danielle; Mitchell, Laura M; Armour, John A L

    2017-02-20

    Salivary amylase in humans is encoded by the copy variable gene AMY1 in the amylase gene cluster on chromosome 1. Although the role of salivary amylase is well established, the consequences of the copy number variation (CNV) at AMY1 on salivary amylase protein production are less well understood. The amylase gene cluster is highly structured with a fundamental difference between odd and even AMY1 copy number haplotypes. In this study, we aimed to explore, in samples from 119 unrelated individuals, not only the effects of AMY1 CNV on salivary amylase protein expression and amylase enzyme activity but also whether there is any evidence for underlying difference between the common haplotypes containing odd numbers of AMY1 and even copy number haplotypes. AMY1 copy number was significantly correlated with the variation observed in salivary amylase production (11.7% of variance, P structure may affect expression, but this was not significant in our data.

  18. Autodegradation of 125I-labeled human epidermal cell surface proteins

    International Nuclear Information System (INIS)

    Hashimoto, K.; Singer, K.H.; Lazarus, G.S.

    1982-01-01

    Triton X-100 extracts of cultured human epidermal cells exhibited proteolytic activity as measured by the hydrolysis of [ 3 H]-casein at neutral pH. The majority of endogenous proteolytic activity was inhibited by parahydroxy mercuribenzoate and by mersalyl acid, indicating the enzyme(s) was a thiol class proteinase(s). Crude Triton X-100 extracts were prepared from epidermal cells following labeling of proteins with 125 I. Autodegradation of labeled proteins at 37 degrees C was detected as early as 1 hr and reached a plateau level by 4 hr. Degradation was inhibited by thiol class proteinase inhibitors. Among the detergent-solubilized radiolabeled proteins a polypeptide chain of Mr 155,000 was particularly sensitive to degradation by endogenous thiol proteinase(s)

  19. Assessment of Salivary Human Herpesvirus-6 and Immunoglobulin A Levels in Nurses Working Shifts

    Directory of Open Access Journals (Sweden)

    Hirom Fukuda, RN, PhD

    2008-09-01

    Conclusion: Salivary HHV-6 level may be a more sensitive stress marker than salivary IgA or mood for assessing chronic fatigue in nurses working shifts. Improvement to shift assignments using assessment by salivary HHV-6 is required.

  20. The peanut lectin-binding glycoproteins of human epidermal keratinocytes

    International Nuclear Information System (INIS)

    Morrison, A.I.; Keeble, S.; Watt, F.M.

    1988-01-01

    The peanut lectin (PNA) is known to bind more strongly to keratinocytes that are undergoing terminal differentiation than to proliferating keratinocytes. In order to investigate the significance of this change in cell-surface carbohydrate authors have identified the PNA-binding glycoproteins of cultured human keratinocytes and antibodies against them. Two heavily glycosylated bands of 110 and 250 kDa were resolved by PAGE of [ 14 C]galactose- or [ 14 C]mannose- and [ 14 C]glucosamine-labeled cell extracts eluted with galactose from PNA affinity columns. The higher molecular weight band was also detected on PNA blots of unlabeled cell extracts transferred to nitrocellulose. Both bands were sensitive to pronase digestion, but only the 250-kDa band was digested with trypsin. A rabbit antiserum that we prepared (anti-PNA-gp) immunoprecipitated both bands from cell extracts. In contrast to PNA, anti-PNA-gp bound equally to proliferating and terminally differentiating cells, indicating that some epitope(s) of the PNA-binding glycoproteins is present on the cell surface prior to terminal differentiation. When keratinocytes grown as a monolayer in low-calcium medium were switched to medium containing 2 mM calcium ions in order to induce desmosome formation and stratification, there was a dramatic redistribution of the PNA-binding glycoproteins, which became concentrated at the boundaries between cells. This may suggest a role for the glycoproteins in cell-cell interactions during stratification

  1. Physical Properties of Human Whole Salivary Mucin:A Dynamic Light Scattering Study

    Science.gov (United States)

    Mahajan, Manish; Kumar, Vijay; Saraswat, Mayank; Yadav, Savita; Shukla, N. K.; Singh, T. P.

    2008-04-01

    Human salivary mucin, a primary mucous membrane coating glycoprotein forms the first line of defense against adverse environments, attributed to the complex formation between mucin subunits and non mucin species. Aim of the study was to emphasize the effect of pH, denaturants (guanidinum hydrochloride, urea) and detergents (CHAPS, TRITON X -100, SDS on human whole salivary mucin. Hydrodynamic size distribution was measured using DLS. It was observed that aggregation was due to increase in hydrophobic interactions, believed to be accomplished by unfolding of the protein core. Whereas, the detergents which solubilize the proteins by decreasing hydrophobicity lead to disaggregation of mucin into smaller fragments. Mucin subjected to tobacco extract and upon subsequent addition of nicotine was found to have a disaggregating effect on it, suggesting nicotine may be one of the factors responsible for the disaggregating effect of tobacco on mucin, an important carcinogenetic mechanism.

  2. Isolation and characterization of human salivary gland cells for stem cell transplantation to reduce radiation-induced hyposalivation

    International Nuclear Information System (INIS)

    Feng Jielin; Zwaag, Marianne van der; Stokman, Monique A.; Os, Ronald van; Coppes, Robert P.

    2009-01-01

    Background: Recently, we showed that transplantation of 100-300 c-Kit + stem cells isolated from cultured salispheres ameliorates radiation-damage in murine salivary glands. The aim of this study is to optimize and translate these findings from mice to man. Methods: Mouse and human non-malignant parotid and submandibular salivary gland tissue was collected and enzymatically digested. The remaining cell suspension was cultured according to our salisphere culture method optimized for murine salispheres. Salisphere cells were tested using 3D matrix culturing for their in vitro stem cell characteristics such as the potential to differentiate into tissue specific cell types. Several potential mouse and human salivary gland stem cells were selected using FACS. Results: In human salivary gland, c-Kit + cells were only detected in excretory ducts as shown previously in mice. From both human parotid and submandibular gland cell suspensions salispheres could be grown, which when placed in 3D culture developed ductal structures and mucin-expressing acinar-like cells. Moreover, cells dispersed from primary salispheres were able to form secondary spheres in matrigel, a procedure that could be repeated for at least seven passages. Approximately 3000 c-Kit + cells could be isolated from primary human salispheres per biopsy. Conclusion: Human salivary glands contain a similar 'putative' stem cell population as rodents, expressing c-kit and capable of in vitro differentiation and self-renewal. In the future, these cells may have the potential to reduce radiotherapy-induced salivary gland dysfunction in patients.

  3. Dermal Contributions to Human Interfollicular Epidermal Architecture and Self-Renewal

    Directory of Open Access Journals (Sweden)

    Kynan T. Lawlor

    2015-11-01

    Full Text Available The human interfollicular epidermis is renewed throughout life by populations of proliferating basal keratinocytes. Though interfollicular keratinocyte stem cells have been identified, it is not known how self-renewal in this compartment is spatially organized. At the epidermal-dermal junction, keratinocytes sit atop a heterogeneous mix of dermal cells that may regulate keratinocyte self-renewal by influencing local tissue architecture and signalling microenvironments. Focusing on the rete ridges and complementary dermal papillae in human skin, we review the identity and organisation of abundant dermal cells types and present evidence for interactions between the dermal microenvironment and the interfollicular keratinocytes.

  4. External apical root resorption diagnosis by using FII human dentine fraction and salivary IGg.

    Science.gov (United States)

    Da-Costa, Tânia Maris Pedrini Soares; Hidalgo, Mirian Marubayashi; Consolaro, Alberto; Lima, Carlos Eduardo de Oliveira; Tanaka, Evelise Ono; Itano, Eiko Nakagawa

    2018-06-01

    External apical root resorption as a consequence of orthodontic treatment is an inflammatory pathological process that results in permanent loss of tooth structure from the root apex. This study aimed to investigate the diagnostic potential of human dentine fractions and salivary IgG in external apical root resorption. Saliva samples were collected from 10 patients before (T0) and after 3 (T3), 6 (T6) and 12 (T12) months of orthodontic treatment. The total dentinal extract, obtained from human third molars, was fractioned by gel filtration chromatography in three fractions denominated FI, FII and FIII. The root resorption analysis of the upper central incisors was performed by digital image subtraction method. Reactivity of salivary IgG to antigenic fractions of dentine was determined by enzyme-linked immunosorbent assay (Elisa). Regardless of treatment, FI dentin fraction with high MM (root resorptions were detected. Our results suggest that FII human dentine fraction and salivary IgG have potential to be used in diagnosis and monitoring of external apical root resorption. The development of a practical and accessible biochemical test using saliva and FII dentine fraction may help in the prevention of severe root resorption. Copyright © 2018. Published by Elsevier Masson SAS.

  5. Urea uptake enhances barrier function and antimicrobial defense in humans by regulating epidermal gene expression

    Science.gov (United States)

    Grether-Beck, Susanne; Felsner, Ingo; Brenden, Heidi; Kohne, Zippora; Majora, Marc; Marini, Alessandra; Jaenicke, Thomas; Rodriguez-Martin, Marina; Trullas, Carles; Hupe, Melanie; Elias, Peter M.; Krutmann, Jean

    2012-01-01

    Urea is an endogenous metabolite, known to enhance stratum corneum hydration. Yet, topical urea anecdotally also improves permeability barrier function, and it appears to exhibit antimicrobial activity. Hence, we hypothesized that urea is not merely a passive metabolite, but a small-molecule regulator of epidermal structure and function. In 21 human volunteers, topical urea improved barrier function in parallel with enhanced antimicrobial peptide (LL-37 and β-defensin-2) expression. Urea both stimulates expression of, and is transported into keratinocytes by two urea transporters, UT-A1 and UT-A2, and by aquaporin 3, 7 and 9. Inhibitors of these urea transporters block the downstream biological effects of urea, which include increased mRNA and protein levels for: (i) transglutaminase-1, involucrin, loricrin and filaggrin; (ii) epidermal lipid synthetic enzymes, and (iii) cathelicidin/LL-37 and β-defensin-2. Finally, we explored the potential clinical utility of urea, showing that topical urea applications normalized both barrier function and antimicrobial peptide expression in a murine model of atopic dermatitis (AD). Together, these results show that urea is a small-molecule regulator of epidermal permeability barrier function and antimicrobial peptide expression after transporter uptake, followed by gene regulatory activity in normal epidermis, with potential therapeutic applications in diseased skin. PMID:22418868

  6. Computational Prediction of Human Salivary Proteins from Blood Circulation and Application to Diagnostic Biomarker Identification

    Science.gov (United States)

    Wang, Jiaxin; Liang, Yanchun; Wang, Yan; Cui, Juan; Liu, Ming; Du, Wei; Xu, Ying

    2013-01-01

    Proteins can move from blood circulation into salivary glands through active transportation, passive diffusion or ultrafiltration, some of which are then released into saliva and hence can potentially serve as biomarkers for diseases if accurately identified. We present a novel computational method for predicting salivary proteins that come from circulation. The basis for the prediction is a set of physiochemical and sequence features we found to be discerning between human proteins known to be movable from circulation to saliva and proteins deemed to be not in saliva. A classifier was trained based on these features using a support-vector machine to predict protein secretion into saliva. The classifier achieved 88.56% average recall and 90.76% average precision in 10-fold cross-validation on the training data, indicating that the selected features are informative. Considering the possibility that our negative training data may not be highly reliable (i.e., proteins predicted to be not in saliva), we have also trained a ranking method, aiming to rank the known salivary proteins from circulation as the highest among the proteins in the general background, based on the same features. This prediction capability can be used to predict potential biomarker proteins for specific human diseases when coupled with the information of differentially expressed proteins in diseased versus healthy control tissues and a prediction capability for blood-secretory proteins. Using such integrated information, we predicted 31 candidate biomarker proteins in saliva for breast cancer. PMID:24324552

  7. Low calcium culture condition induces mesenchymal cell-like phenotype in normal human epidermal keratinocytes

    International Nuclear Information System (INIS)

    Takagi, Ryo; Yamato, Masayuki; Murakami, Daisuke; Sugiyama, Hiroaki; Okano, Teruo

    2011-01-01

    Highlights: → Normal human epidermal keratinocytes serially cultured under low calcium concentration were cytokeratin and vimentin double positive cells. → The human keratinocytes expressed some epithelial stem/progenitor cell makers, mesenchymal cell markers, and markers of epithelial-mesenchymal transition. → Mesenchymal cell-like phenotype in the keratinocytes was suppressed under high-calcium condition. -- Abstract: Epithelial-mesenchymal transition (EMT) is an important cellular phenomenon in organ developments, cancer invasions, and wound healing, and many types of transformed cell lines are used for investigating for molecular mechanisms of EMT. However, there are few reports for EMT in normal human epithelial cells, which are non-transformed or non-immortalized cells, in vitro. Therefore, normal human epidermal keratinocytes (NHEK) serially cultured in low-calcium concentration medium (LCM) were used for investigating relations between differentiation and proliferation and mesenchymal-like phenotype in the present study, since long-term cultivation of NHEK is achieved in LCM. Interestingly, NHEK serially cultured in LCM consisted essentially of cytokeratin-vimentin double positive cells (98%), although the NHEK exhibited differentiation under high-calcium culture condition with 3T3 feeder layer. The vimentin expression was suppressed under high-calcium condition. These results may indicate the importance of mesenchymal-like phenotype for serially cultivation of NHEK in vitro.

  8. Immunohistochemical localization of epidermal growth factor in the second-trimester human fetus

    DEFF Research Database (Denmark)

    Poulsen, Steen Seier; Kryger-Baggesen, N; Nexø, Ebba

    1996-01-01

    Epidermal growth factor (EGF) is considered to be important in mammalian neonatal growth and development. In order to clarify its developmental role, we have investigated, by immunohistochemistry, the localization of EGF and the time of its first appearance in various organs from a series of 25...... midtrimester human fetuses with a gestational age ranging from 13 to 22 weeks. The first detectable EGF immunoreactivity occurred in week 15-16 fetuses in the placenta, the skin, the distal tubules of the kidney, the surface epithelium of the stomach, and the tips of the small intestinal villi, as well...

  9. Gene expression response of A253 human salivary cell line to radiation, Cis-Pt, and EGF

    International Nuclear Information System (INIS)

    Woloschak, G.; Paunesku, T.; Mittal, B.; Dyck, P.; Pauloski, B.; Rademaker, A.; Logemann, J.; Quigg, R.

    2003-01-01

    We are interested in long and short term effects of head and neck cancers treatment, and prior to the studies of patient samples, experiments were designed to observe treatment effects in cultured cells, and examine gene expression profiles from A253 human salivary cells (derived from a head and neck tumor) following exposure to gamma-rays, cisplatin (cis-Pt), and a combination of either with epidermal growth factor (EGF) treatment. A253 cells were treated by: 2 Gy or 10 Gy of γ-rays (Cs137 source, 77 cGy/min), Cis-Pt at 50 μ/mL, and EGF at 40 ng/mL. RNAs were processed and hybridized with Affymetrix Hu95A arrays according to the manufacturer's instructions. Data were scanned and analyzed and we found significant differences in the expression patterns of numerous genes were observed. Some of the more interesting genes are: Requeim [a protein required for apoptosis]; Cyclin D1 (prad1/bcl1) [a cyclin that can function as an oncogene]; FK506 Binding Protein [which may be competing with TGF-beta type I receptor for binding with FK506 thus acting against this powerful immunosuppressant]; Thioredoxin (TXN) [an oxidoreductase with multiple in vitro substrates, including ribonuclease, choriogonadotropins, coagulation factors, glucocorticoid receptor, and insulin]; Glutathione Peroxidase (GPX) [whose role in protection against oxidative stress was long ago well documented]; Aquaporin 3 (AQP3) [protein with a water-channel function that was confirmed by functional expression in Xenopus oocytes]; Eukaryotic Initiation Factor 1A (EIF1A) [a translation factor, proposed as a candidate gene for Turner syndrome]; and finally Insulin-like Growth Factor-Binding Protein 6 (IGFBP6) [an autocrine growth inhibitor shown to inhibit growth of HaCat cells and other keratinocyte cell lines

  10. Pregnancy related changes in human salivary secretion and composition in a Nigerian population.

    Science.gov (United States)

    Lasisi, T J; Ugwuadu, P N

    2014-12-01

    A variety of physiological changes occurring during pregnancy has been shown to affect the oral health. Saliva is critical for preserving and maintaining the health of oral tissues and has been used as a source of non-invasive investigation of different conditions in human and animal studies. This study was designed to evaluate changes in secretion and composition of saliva in pregnant women in a Nigerian population. This was a descriptive cross-sectional study using purposive sampling technique. Saliva samples were collected from 50 pregnant and age matched 50 non-pregnant women. Salivary flow rate, pH, total protein and concentrations of sodium, potassium, calcium, phosphate and bicarbonate were determined and compared using paired independent sample t test. Salivary pH,mean concentrations of potassium and bicarbonate were significantly reduced while mean concentrations of salivary sodium and phosphate were significantly elevated in pregnant women compared to non-pregnant women (P pH, bicarbonate and potassium concentrations were reduced while sodium and phosphate concentrations were elevated in pregnant women. These findings suggest that pregnant women may be predisposed to higher caries incidence.

  11. Improvement of hydration and epidermal barrier function in human skin by a novel compound isosorbide dicaprylate.

    Science.gov (United States)

    Chaudhuri, R K; Bojanowski, K

    2017-10-01

    The study involved the synthesis of a novel derivative of caprylic acid - isosorbide dicaprylate (IDC) - and the evaluation of its potential in improving water homoeostasis and epidermal barrier function in human skin. The effect of IDC on gene expression was assayed in skin organotypic cultures by DNA microarrays. The results were then confirmed for a few key genes by quantitative PCR, immuno- and cytochemistry. Final validation of skin hydration properties was obtained by four separate clinical studies. Level of hydration was measured by corneometer either by using 2% IDC lotion alone vs placebo or in combination with 2% glycerol lotion vs 2% glycerol only. A direct comparison in skin hydration between 2% IDC and 2% glycerol lotions was also carried out. The epidermal barrier function improvement was assessed by determining changes in transepidermal water loss (TEWL) on the arms before and after treatment with 2% IDC lotion versus placebo. IDC was found to upregulate the expression of AQP3, CD44 and proteins involved in keratinocyte differentiation as well as the formation and function of stratum corneum. A direct comparison between 2% IDC versus 2% glycerol lotions revealed a three-fold advantage of IDC in providing skin hydration. Severely dry skin treated with 2% IDC in combination with 2% glycerol showed 133% improvement, whereas 35% improvement was observed with moderately dry human skin. Topical isosorbide dicaprylate favourably modulates genes involved in the maintenance of skin structure and function, resulting in superior clinical outcomes. By improving skin hydration and epidermal permeability barrier, it offers therapeutic applications in skin ageing. © 2017 Society of Cosmetic Scientists and the Société Française de Cosmétologie.

  12. Salivary pH and buffering capacity in early and late human immunodeficiency virus infection.

    Science.gov (United States)

    Hegde, Mithra N; Malhotra, Amit; Hegde, Nidarsh D

    2013-11-01

    Human immunodeficiency virus (HIV) causes severe immunosuppression due to progressive decrease in the CD4 T lymphocyte cells during the course of the disease and this affects all the body systems including glandular secretions. A number of lesions affecting the salivary glands have been noted in HIV infection. The objective of this study was to evaluate the salivary pH and the buffering capacity in HIV positive individuals and comparing it with the HIV negative healthy individuals. The study was carried out on 200 HIV positive subjects aged 20-40 years, divided into two groups on the basis of CD4 count and 100 HIV negative healthy individuals as control group. Both unstimulated and stimulated saliva were collected and the pH and buffering capacity ascertained using the saliva check kit. (GC Asia Dental Pvt. Ltd., Singapore, 508724). All the three groups were compared using the ANOVA and it was found there was highly significant decrease in pH and buffering capacity with increase in immunosuppression. The intergroup comparison was carried out using the Tukey honestly significant difference (HSD) and the Chi square test. Group 1; CD4 count 200 showed a significant decrease in unstimulated salivary flow, stimulated salivary flow, and pH in comparison to HIV negative individuals; however, change in buffering capacity in Group 2 was not significant. There is a decrease in pH and buffering capacity in HIV infected patients. This decrease may be one of the factors responsible for increased caries in HIV infected population.

  13. Leptin regulates the pro-inflammatory response in human epidermal keratinocytes.

    Science.gov (United States)

    Lee, Moonyoung; Lee, Eunyoung; Jin, Sun Hee; Ahn, Sungjin; Kim, Sae On; Kim, Jungmin; Choi, Dalwoong; Lim, Kyung-Min; Lee, Seung-Taek; Noh, Minsoo

    2018-05-01

    The role of leptin in cutaneous wound healing process has been suggested in genetically obese mouse studies. However, the molecular and cellular effects of leptin on human epidermal keratinocytes are still unclear. In this study, the whole-genome-scale microarray analysis was performed to elucidate the effect of leptin on epidermal keratinocyte functions. In the leptin-treated normal human keratinocytes (NHKs), we identified the 151 upregulated and 53 downregulated differentially expressed genes (DEGs). The gene ontology (GO) enrichment analysis with the leptin-induced DEGs suggests that leptin regulates NHKs to promote pro-inflammatory responses, extracellular matrix organization, and angiogenesis. Among the DEGs, the protein expression of IL-8, MMP-1, fibronectin, and S100A7, which play roles in which is important in the regulation of cutaneous inflammation, was confirmed in the leptin-treated NHKs. The upregulation of the leptin-induced proteins is mainly regulated by the STAT3 signaling pathway in NHKs. Among the downregulated DEGs, the protein expression of nucleosome assembly-associated centromere protein A (CENPA) and CENPM was confirmed in the leptin-treated NHKs. However, the expression of CENPA and CENPM was not coupled with those of other chromosome passenger complex like Aurora A kinase, INCENP, and survivin. In cell growth kinetics analysis, leptin had no significant effect on the cell growth curves of NHKs in the normal growth factor-enriched condition. Therefore, leptin-dependent downregulation of CENPA and CENPM in NHKs may not be directly associated with mitotic regulation during inflammation.

  14. Epidermal growth factor increases LRF/Pokemon expression in human prostate cancer cells.

    Science.gov (United States)

    Aggarwal, Himanshu; Aggarwal, Anshu; Agrawal, Devendra K

    2011-10-01

    Leukemia/lymphoma related factor/POK erythroid myeloid ontogenic factor (LRF/Pokemon) is a member of the POK family of proteins that promotes oncogenesis in several forms of cancer. Recently, we found higher LRF expression in human breast and prostate carcinomas compared to the corresponding normal tissues. The aim of this study was to examine the regulation of LRF expression in human prostate cells. Epidermal growth factor (EGF) and its receptors mediate several tumorigenic cascades that regulate cell differentiation, proliferation, migration and survival of prostate cancer cells. There was significantly higher level of LRF expression in the nucleus of LNCaP and PC-3 cells than RWPE-1 cells. A significant increase in LRF expression was observed with increasing doses of EGF in more aggressive and androgen-sensitive prostate cancer cells suggesting that EGF signaling pathway is critical in upregulating the expression of LRF/Pokemon to promote oncogenesis. Copyright © 2011 Elsevier Inc. All rights reserved.

  15. Expression of the epidermal growth factor system in human endometrium during the menstrual cycle

    DEFF Research Database (Denmark)

    Ejskjaer, Kirsten; Sørensen, B S; Poulsen, Steen Seier

    2005-01-01

    The epidermal growth factor (EGF) system is ubiquitous in humans and plays fundamental roles in embryogenesis, development, proliferation and differentiation. As the endometrium of fertile women is characterized by proliferation and differentiation, we hypothesize a role for the EGF system....... Fourteen premenopausal women had endometrial samples removed on day 6 +/- 1 and day 6 +/- 1 and 12 +/- 1 after ovulation during one menstrual cycle. RNA was extracted and analysed by real-time PCR, and immunohistochemistry was performed to localize the components of the EGF system. Human EGF Receptor 1...... (HER1) showed highest expression during the proliferative phase, HER2 and HER4 during the early and HER3 during the late secretory phase. Amphiregulin (AR) and transforming growth factor alpha (TGFalpha) expression is highest in proliferative phase. Heparin binding (HB)-EGF and betacellulin (BCL) show...

  16. In vivo UVB irradiation induces clustering of Fas (CD95) on human epidermal cells

    DEFF Research Database (Denmark)

    Bang, Bo; Gniadecki, Robert; Larsen, Jørgen K

    2003-01-01

    In vitro studies with human cell lines have demonstrated that the death receptor Fas plays a role in ultraviolet (UV)-induced apoptosis. The purpose of the present study was to investigate the relation between Fas expression and apoptosis as well as clustering of Fas in human epidermis after...... a single dose of UVB irradiation. Normal healthy individuals were irradiated with three minimal erythema doses (MED) of UVB on forearm or buttock skin. Suction blisters from unirradiated and irradiated skin were raised, and Fas, FasL, and apoptosis of epidermal cells quantified by flow cytometry....... Clustering of Fas was from skin biopsied. Soluble FasL in suction blister fluid was quantified by ELISA. Flow cytometric analysis demonstrated increased expression intensity of Fas after irradiation, with 1.6-,2.2- and 2.7-fold increased median expression at 24, 48 and 72 h after irradiation, respectively (n...

  17. Insulin binding properties of normal and transformed human epidermal cultured keratinocytes

    International Nuclear Information System (INIS)

    Verrando, P.; Ortonne, J.P.

    1985-01-01

    Insulin binding to its receptors was studied in cultured normal and transformed (A431 line) human epidermal keratinocytes. The specific binding was a temperature-dependent, saturable process. Normal keratinocytes possess a mean value of about 80,000 receptors per cell. Fifteen hours exposure of the cells to insulin lowered their receptor number (about 65% loss in available sites); these reappeared when the hormone was removed from the culture medium. In the A431 epidermoid carcinoma cell line, there is a net decrease in insulin binding (84% of the initial bound/free hormone ratio in comparison with normal cells) essentially related to a loss in receptor affinity for insulin. Thus, cultured human keratinocytes which express insulin receptors may be a useful tool in understanding skin pathology related to insulin disorders

  18. Effects of epidermal growth factor, transferrin, and insulin on lipofection efficiency in human lung carcinoma cells.

    Science.gov (United States)

    Yanagihara, K; Cheng, H; Cheng, P W

    2000-01-01

    Poor transfection efficiency is the major drawback of lipofection. We showed previously that addition of transferrin (TF) to Lipofectin enhanced the expression of a reporter gene in HeLa cells by 120-fold and achieved close to 100% transfection efficiency. The purpose of this study was to determine whether TF and other ligands could improve the efficiency of lipofection in lung carcinoma cells. Confluent A549, Calu3, and H292 cells were transfected for 18 hours with a plasmid DNA (pCMVlacZ) using Lipofectin plus TF, insulin, or epidermal growth factor as the vector. The transfected cells were assessed for transfection efficiency by beta-galactosidase activity (light units/microg protein) and the percentage of blue cells following 5-bromo-4-chloro-3-indolyl beta-D-galactopyranoside staining. Lipofectin supplemented with epidermal growth factor yielded the largest enhancement of lipofection efficiency (lipofection efficiency in A549 and Calu3 cells but not in H292 cells, whereas TF showed significant lipofection efficiency-enhancing effect in Calu3 and H292 cells but not in A549 cells. The transfection efficiency correlated well with the amounts of DNA delivered to the nucleus as well as the amounts of the receptor. These results indicate that the gene delivery strategy employing ligand-facilitated lipofection can achieve high transfection efficiency in human lung carcinoma cells. In addition, enhancement of the expression of the receptor may be a possible strategy for increasing the efficiency of gene targeting.

  19. Trastuzumab for HER-2-Positive Advanced Salivary Gland Cancer

    Directory of Open Access Journals (Sweden)

    Yi-Tsung Yang

    2014-12-01

    Full Text Available Salivary gland adenocarcinoma is a rare type of head and neck cancer and often has aggressive behavior with propensity to recur and metastasize. Currently, there are no standard treatment guidelines. Surgery is however, the mainstay of treatment in resectable disease and radiation is also considered for most patients after surgery. Systemic chemotherapy is reserved for metastatic cases, but its results are often disappointing. Recent development of molecular biology has shown that salivary gland caner has several molecular changes which may guide potential therapeutic targets. Here, we report a 67 year-old man diagnosed to have metastasized minor salivary gland adenocarcinoma with diffuse human epidermal growth factor receptor-2 (HER-2-positive, by the immunohistochemical (IHC stain. He was treated with a trastuzumab-containing chemotherapeutic regimen with encouraging results.

  20. Immunohistochemical detection of cytochrome P450 isoenzymes in cultured human epidermal cells.

    Science.gov (United States)

    Van Pelt, F N; Meierink, Y J; Blaauboer, B J; Weterings, P J

    1990-12-01

    We used specific monoclonal antibodies (MAb) to human cytochrome P450 isoenzymes to determine the presence of these proteins in human epidermal cells. Two MAb (P450-5 and P450-8) recognize major forms of hepatic cytochrome P450 involved in biotransformation of xenobiotics. A third MAb, to cytochrome P450-9, is not fully characterized. The proteins were determined by the indirect immunoperoxidase technique after fixation with methanol and acetone. Biopsy materials for cultured keratinocytes, i.e., foreskin and hair follicles, contained the two major forms of cytochrome P450. In cultured keratinocytes derived from hair follicles the proteins were undetectable, whereas the keratinocytes derived from foreskin continued to express the two major forms of hepatic cytochrome P450. Cultured human fibroblasts and a human keratinocyte cell line (SVK14) showed staining similar to that of the foreskin keratinocytes. Cytochrome P450-9 was detectable only in human hepatocytes. The results indicate that, under the culture conditions applied, cultured human foreskin cells and the cell line SVK14 continue to express specific cytochrome P450 isoenzymes in culture, in contrast to hair follicle keratinocytes.

  1. Recycling of epidermal growth factor in a human pancreatic carcinoma cell line

    International Nuclear Information System (INIS)

    Korc, M.; Magun, B.E.

    1985-01-01

    PANC-1 human pancreatic carcinoma cells readily bound and internalized 125 I-labeled epidermal growth factor (EGF). Bound 125 I-labeled EGF was then partially processed to a number of high molecular weight acidic species. Percoll gradient centrifugation of cell homogenates indicated that the majority of 125 I activity localized to several intracellular vesicular compartments. Both intact EGF and its processed species were subsequently released into the incubation medium. A major portion of the released radioactivity was capable of rebinding to the cell. Only a small amount of bound 125 I-labeled EGF was degraded to low molecular weight products, and this degradation was completely blocked by methylamine. These findings suggest that in PANC-1 cells, bound EGF undergoes only limited processing. Both intact EGF and its major processed species bypass the cellular degradative pathways, are slowly released from the cell, and then rebind to the cell

  2. Human Epidermal Langerhans Cells Maintain Immune Homeostasis in Skin by Activating Skin Resident Regulatory T Cells

    Science.gov (United States)

    Seneschal, Julien; Clark, Rachael A.; Gehad, Ahmed; Baecher-Allan, Clare M.; Kupper, Thomas S.

    2013-01-01

    Recent discoveries indicate that the skin of a normal individual contains 10-20 billion resident memory T cells ( which include various T helper, T cytotoxic, and T regulatory subsets, that are poised to respond to environmental antigens. Using only autologous human tissues, we report that both in vitro and in vivo, resting epidermal Langerhan cells (LC) selectively and specifically induced the activation and proliferation of skin resident regulatory T cells (Treg), a minor subset of skin resident memory T cells. In the presence of foreign pathogen, however, the same LC activated and induced proliferation of effector memory T (Tem) cells and limited Treg cells activation. These underappreciated properties of LC: namely maintenance of tolerance in normal skin, and activation of protective skin resident memory T cells upon infectious challenge, help clarify the role of LC in skin. PMID:22560445

  3. Cultivation of human dermal fibroblasts and epidermal keratinocytes on keratin-coated silica bead substrates.

    Science.gov (United States)

    Tan, Bee Yi; Nguyen, Luong T H; Kim, Hyo-Sop; Kim, Jae-Ho; Ng, Kee Woei

    2017-10-01

    Human hair keratin is promising as a bioactive material platform for various biomedical applications. To explore its versatility further, human hair keratin was coated onto monolayers of silica beads to produce film-like substrates. This combination was hypothesized to provide a synergistic effect in improving the biochemical properties of the resultant composite. Atomic force microscopy analysis showed uniform coatings of keratin on the silica beads with a slight increase in the resulting surface roughness. Keratin-coated silica beads had higher surface energy and relatively lower negative charge than those of bare silica beads. To investigate cell response, human dermal fibroblasts (HDFs), and human epidermal keratinocytes (HEKs) were cultured on the substrates over 4 days. Results showed that keratin coatings significantly enhanced the metabolic activity of HDFs and encouraged cell spreading but did not exert any significant effects on HEKs. HDF expression of collagen I was significantly more intense on the keratin-coated compared to the bare silica substrates. Furthermore, HDF secretion of various cytokines suggested that keratin coatings triggered active cell responses related to wound healing. Collectively, our study demonstrated that human hair keratin-coated silica bead monolayers have the potential to modulate HDF behavior in culture and may be exploited further. © 2017 Wiley Periodicals, Inc. J Biomed Mater Res Part A: 105A: 2789-2798, 2017. © 2017 Wiley Periodicals, Inc.

  4. Topical Human Epidermal Growth Factor in the Treatment of Senile Purpura and the Prevention of Dermatoporosis.

    Science.gov (United States)

    McKnight, Braden; Seidel, Rachel; Moy, Ron

    2015-10-01

    Senile purpura presents itself as a largely unexplored challenge as it has been long thought of as a benign condition without long-term health sequelae. It is becoming increasingly accepted that skin aging not only results in cosmetic disturbances, but as a functional ones. With modern increases in lifespan, skin atrophy associated with solar damage is presenting as a clinically significant inability to mechanically protect patients. This chronic cutaneous insufficiency/fragility syndrome was recently termed dermatoporosis and senile purpura appears to be a visible marker of early stage dysfunction. To examine the effects of topically human epidermal growth factor on the clinical presence of senile purpura and its effect on skin thickness as measured via cutaneous ultrasound. Six subjects applied human epidermal growth factor morning and night for six weeks. Clinical outcomes were evaluated by comparing initial clinical photos to 6-week photos and performing a blinded investigator's global assessment (IGA). Skin thickness was evaluated via cutaneous ultrasound measurement. Ultrasound measurements indicated a mean skin thickening of 195.2 ± 35.7 um (SEM) over 6 weeks. The average number of purpuric lesions decreased from 15 ± 4.6 (SEM) to 2.3 ± 0.7 (SEM) over that same period. Senile purpura presents itself as a cosmetic disturbance posing significant psychological distress and serves as a marker of the severity of skin thinning. In this study, we demonstrate that topical h-EGF diminishes the appearance of senile purpura by thickening skin and may help prevent the development of late stage dermatoporosis.

  5. Limited human epidermal growth factor receptor 2 discordance in metastatic breast cancer patients treated with trastuzumab, a population based study

    NARCIS (Netherlands)

    van Rooijen, J.M.; de Munck, L.; de Graaf, J.C.; Siesling, Sabine; de Vries, Erik G.; Boers, J.E.

    2014-01-01

    Background Accurate assessment of the human epidermal growth factor receptor 2 (HER2) in breast cancer is essential for proper treatment decisions. HER2 positivity confirmation rates in breast cancer trials by central testing pathology laboratories were reported to be approximately 85%. The aim of

  6. Tumor necrosis factor related apoptosis inducing ligand triggers apoptosis in dividing but not in differentiating human epidermal keratinocytes

    NARCIS (Netherlands)

    Jansen, Bastiaan J. H.; van Ruissen, Fred; Cerneus, Stefanie; Cloin, Wendy; Bergers, Mieke; van Erp, Piet E. J.; Schalkwijk, Joost

    2003-01-01

    Using serial analysis of gene expression we have previously identified the expression of several pro-apoptotic and anti-apoptotic genes in cultured human primary epidermal keratinocytes, including tumor necrosis factor related apoptosis inducing ligand (TRAIL). TRAIL is a potent inducer of apoptosis

  7. Limited human epidermal growth factor receptor 2 discordance in metastatic breast cancer patients treated with trastuzumab, a population based study

    NARCIS (Netherlands)

    van Rooijen, J. M.; de Munck, L.; de Graaf, J. C.; Siesling, S.; de Vries, E. G.; Boers, J. E.

    Background: Accurate assessment of the human epidermal growth factor receptor 2 (HER2) in breast cancer is essential for proper treatment decisions. HER2 positivity confirmation rates in breast cancer trials by central testing pathology laboratories were reported to be approximately 85%. The aim of

  8. Bioengineering a human plasma-based epidermal substitute with efficient grafting capacity and high content in clonogenic cells.

    Science.gov (United States)

    Alexaline, Maia M; Trouillas, Marina; Nivet, Muriel; Bourreau, Emilie; Leclerc, Thomas; Duhamel, Patrick; Martin, Michele T; Doucet, Christelle; Fortunel, Nicolas O; Lataillade, Jean-Jacques

    2015-06-01

    Cultured epithelial autografts (CEAs) produced from a small, healthy skin biopsy represent a lifesaving surgical technique in cases of full-thickness skin burn covering >50% of total body surface area. CEAs also present numerous drawbacks, among them the use of animal proteins and cells, the high fragility of keratinocyte sheets, and the immaturity of the dermal-epidermal junction, leading to heavy cosmetic and functional sequelae. To overcome these weaknesses, we developed a human plasma-based epidermal substitute (hPBES) for epidermal coverage in cases of massive burn, as an alternative to traditional CEA, and set up critical quality controls for preclinical and clinical studies. In this study, phenotypical analyses in conjunction with functional assays (clonal analysis, long-term culture, or in vivo graft) showed that our new substitute fulfills the biological requirements for epidermal regeneration. hPBES keratinocytes showed high potential for cell proliferation and subsequent differentiation similar to healthy skin compared with a well-known reference material, as ascertained by a combination of quality controls. This work highlights the importance of integrating relevant multiparameter quality controls into the bioengineering of new skin substitutes before they reach clinical development. This work involves the development of a new bioengineered epidermal substitute with pertinent functional quality controls. The novelty of this work is based on this quality approach. ©AlphaMed Press.

  9. Salivary human beta defensins affected by oral Candida status in Chinese HIV/AIDS patients undergoing ART.

    Science.gov (United States)

    Liu, Zhenmin; Yong, Xiangzhi; Jiang, Lanlan; Zhang, Linlin; Lin, Xuefang; Liu, Wei; Peng, Yuanyuan; Tao, Renchuan

    2018-03-02

    To observe relationships between oral Candida status and salivary human beta defensin-2 and -3 (hBD-2 and hBD-3) levels in HIV/AIDS patients of Guangxi, China during the first year of antiretroviral therapy (ART) dynamically, and to understand the influence of ART on oral Candida status and salivary hBDs expressions. A prospective self-controlled study was carried to observe the dynamic changes of CD4 + T cell counts, oral Candida carriages and salivary hBD-2,3 expressions in HIV/AIDS patients during the first year of ART. A total of 90 HIV/AIDS patients were enrolled, and were examined at the baseline, 3rd, 6th, 12th month of ART. Thirty healthy individuals were enrolled as control. Peripheral blood, oral rinse sample and unstimulated whole saliva were collected to test CD4 + T cell counts, oral Candida carriages and hBD-2,3 expressions. In the first year of ART, CD4 + T cell counts increased significantly. However, oral Candida carriages and oral candidiasis decreased significantly, and salivary hBD-2 expressions in HIV/AIDS patients decreased gradually, salivary hBD-3 levels were highly variable. Salivary hBD-2 concentrations were positively related to oral Candida carriages. The incidence of oral candidiasis among HIV/AIDS patients gradually decreased due to the immune reconstruction of ART. Salivary defensins might play an important role in Candida-host interaction in HIV/AIDS patients. This article is protected by copyright. All rights reserved. This article is protected by copyright. All rights reserved.

  10. Isolation of human salivary extracellular vesicles by iodixanol density gradient ultracentrifugation and their characterizations

    Directory of Open Access Journals (Sweden)

    Kazuya Iwai

    2016-05-01

    Full Text Available Diagnostic methods that focus on the extracellular vesicles (EVs present in saliva have been attracting great attention because of their non-invasiveness. EVs contain biomolecules such as proteins, messenger RNA (mRNA and microRNA (miRNA, which originate from cells that release EVs, making them an ideal source for liquid biopsy. Although there have been many reports on density-based fractionation of EVs from blood and urine, the number of reports on EVs from saliva has been limited, most probably because of the difficulties in separating EVs from viscous saliva using density gradient centrifugation. This article establishes a protocol for the isolation of EVs from human saliva using density gradient centrifugation. The fractionated salivary EVs were characterized by atomic force microscopy, western blot and reverse transcription polymerase chain reaction. The results indicate that salivary EVs have a smaller diameter (47.8±12.3 nm and higher density (1.11 g/ml than EVs isolated from conditioned cell media (74.0±23.5 nm and 1.06 g/ml, respectively. Additionally, to improve the throughput of density-based fractionation of EVs, the original protocol was further modified by using a fixed angle rotor instead of a swinging rotor. It was also confirmed that several miRNAs were expressed strongly in the EV-marker-expressing fractions.

  11. Quantitative Analysis of Human Salivary Gland-Derived Intact Proteome Using Top-Down Mass Spectrometry

    Energy Technology Data Exchange (ETDEWEB)

    Wu, Si; Brown, Joseph N.; Tolic, Nikola; Meng, Da; Liu, Xiaowen; Zhang, Haizhen; Zhao, Rui; Moore, Ronald J.; Pevzner, Pavel A.; Smith, Richard D.; Pasa-Tolic, Ljiljana

    2014-05-31

    There are several notable challenges inherent to fully characterizing the entirety of the human saliva proteome using bottom-up approaches, including polymorphic isoforms, post-translational modifications, unique splice variants, deletions, and truncations. To address these challenges, we have developed a top-down based liquid chromatography-mass spectrometry (LC-MS) approach, which cataloged 20 major human salivary proteins with a total of 83 proteoforms, containing a broad range of post-translational modifications. Among these proteins, several previously reported disease biomarker proteins were identified at the intact protein level, such as beta-2 microglobulin (B2M). In addition, intact glycosylated proteoforms of several saliva proteins were also characterized, including intact N-glycosylated protein prolactin inducible protein (PIP) and O-glycosylated acidic protein rich protein (aPRP). These characterized proteoforms constitute an intact saliva proteoform database, which was used for quantitative comparison of intact salivary proteoforms among six healthy individuals. Human parotid (PS) and submandibular/sublingual gland (SMSL) secretion samples (2 μg of protein each) from six healthy individuals were compared using RPLC coupled with the 12T FTICR mass spectrometer. Significantly different protein and PTM patterns were resolved with high reproducibility between PS and SMSL glands. The results from this study provide further insight into the potential mechanisms of PTM pathways in oral glandular secretion, expanding our knowledge of this complex yet easily accessible fluid. Intact protein LC-MS approach presented herein can potentially be applied for rapid and accurate identification of biomarkers from only a few microliters of human glandular saliva.

  12. Upregulation of FOXM1 induces genomic instability in human epidermal keratinocytes

    Directory of Open Access Journals (Sweden)

    Philpott Michael P

    2010-02-01

    Full Text Available Abstract Background The human cell cycle transcription factor FOXM1 is known to play a key role in regulating timely mitotic progression and accurate chromosomal segregation during cell division. Deregulation of FOXM1 has been linked to a majority of human cancers. We previously showed that FOXM1 was upregulated in basal cell carcinoma and recently reported that upregulation of FOXM1 precedes malignancy in a number of solid human cancer types including oral, oesophagus, lung, breast, kidney, bladder and uterus. This indicates that upregulation of FOXM1 may be an early molecular signal required for aberrant cell cycle and cancer initiation. Results The present study investigated the putative early mechanism of UVB and FOXM1 in skin cancer initiation. We have demonstrated that UVB dose-dependently increased FOXM1 protein levels through protein stabilisation and accumulation rather than de novo mRNA expression in human epidermal keratinocytes. FOXM1 upregulation in primary human keratinocytes triggered pro-apoptotic/DNA-damage checkpoint response genes such as p21, p38 MAPK, p53 and PARP, however, without causing significant cell cycle arrest or cell death. Using a high-resolution Affymetrix genome-wide single nucleotide polymorphism (SNP mapping technique, we provided the evidence that FOXM1 upregulation in epidermal keratinocytes is sufficient to induce genomic instability, in the form of loss of heterozygosity (LOH and copy number variations (CNV. FOXM1-induced genomic instability was significantly enhanced and accumulated with increasing cell passage and this instability was increased even further upon exposure to UVB resulting in whole chromosomal gain (7p21.3-7q36.3 and segmental LOH (6q25.1-6q25.3. Conclusion We hypothesise that prolonged and repeated UVB exposure selects for skin cells bearing stable FOXM1 protein causes aberrant cell cycle checkpoint thereby allowing ectopic cell cycle entry and subsequent genomic instability. The aberrant

  13. Human eccrine sweat gland cells turn into melanin-uptaking keratinocytes in dermo-epidermal skin substitutes.

    Science.gov (United States)

    Böttcher-Haberzeth, Sophie; Biedermann, Thomas; Pontiggia, Luca; Braziulis, Erik; Schiestl, Clemens; Hendriks, Bart; Eichhoff, Ossia M; Widmer, Daniel S; Meuli-Simmen, Claudia; Meuli, Martin; Reichmann, Ernst

    2013-02-01

    Recently, Biedermann et al. (2010) have demonstrated that human eccrine sweat gland cells can develop a multilayered epidermis. The question still remains whether these cells can fulfill exclusive and very specific functional properties of epidermal keratinocytes, such as the incorporation of melanin, a feature absent in sweat gland cells. We added human melanocytes to eccrine sweat gland cells to let them develop into an epidermal analog in vivo. The interaction between melanocytes and sweat gland-derived keratinocytes was investigated. The following results were gained: (1) macroscopically, a pigmentation of the substitutes was seen 2-3 weeks after transplantation; (2) we confirmed the development of a multilayered, stratified epidermis with melanocytes distributed evenly throughout the basal layer; (3) melanocytic dendrites projected to suprabasal layers; and (4) melanin was observed to be integrated into former eccrine sweat gland cells. These skin substitutes were similar or equal to skin substitutes cultured from human epidermal keratinocytes. The only differences observed were a delay in pigmentation and less melanin uptake. These data suggest that eccrine sweat gland cells can form a functional epidermal melanin unit, thereby providing striking evidence that they can assume one of the most characteristic keratinocyte properties.

  14. Pharmacologic induction of epidermal melanin and protection against sunburn in a humanized mouse model.

    Science.gov (United States)

    Amaro-Ortiz, Alexandra; Vanover, Jillian C; Scott, Timothy L; D'Orazio, John A

    2013-09-07

    Fairness of skin, UV sensitivity and skin cancer risk all correlate with the physiologic function of the melanocortin 1 receptor, a Gs-coupled signaling protein found on the surface of melanocytes. Mc1r stimulates adenylyl cyclase and cAMP production which, in turn, up-regulates melanocytic production of melanin in the skin. In order to study the mechanisms by which Mc1r signaling protects the skin against UV injury, this study relies on a mouse model with "humanized skin" based on epidermal expression of stem cell factor (Scf). K14-Scf transgenic mice retain melanocytes in the epidermis and therefore have the ability to deposit melanin in the epidermis. In this animal model, wild type Mc1r status results in robust deposition of black eumelanin pigment and a UV-protected phenotype. In contrast, K14-Scf animals with defective Mc1r signaling ability exhibit a red/blonde pigmentation, very little eumelanin in the skin and a UV-sensitive phenotype. Reasoning that eumelanin deposition might be enhanced by topical agents that mimic Mc1r signaling, we found that direct application of forskolin extract to the skin of Mc1r-defective fair-skinned mice resulted in robust eumelanin induction and UV protection (1). Here we describe the method for preparing and applying a forskolin-containing natural root extract to K14-Scf fair-skinned mice and report a method for measuring UV sensitivity by determining minimal erythematous dose (MED). Using this animal model, it is possible to study how epidermal cAMP induction and melanization of the skin affect physiologic responses to UV exposure.

  15. Salivary alpha amylase activity in human beings of different age groups subjected to psychological stress.

    Science.gov (United States)

    Sahu, Gopal K; Upadhyay, Seema; Panna, Shradha M

    2014-10-01

    Salivary alpha-amylase (sAA) has been proposed as a sensitive non-invasive biomarker for stress-induced changes in the body that reflect the activity of the sympathetic nervous system. Though several experiments have been conducted to determine the validity of this salivary component as a reliable stress marker in human subjects, the effect of stress induced changes on sAA level in different age groups is least studied. This article reports the activity of sAA in human subjects of different age groups subjected to psychological stress induced through stressful video clip. Differences in sAA level based on sex of different age groups under stress have also been studied. A total of 112 subjects consisting of both the male and female subjects, divided into two groups on basis of age were viewed a video clip of corneal transplant surgery as stressor. Activity of sAA from saliva samples of the stressed subjects were measured and compared with the activity of the samples collected from the subjects before viewing the clip. The age ranges of subjects were 18-25 and 40-60 years. The sAA level increased significantly in both the groups after viewing the stressful video. The increase was more pronounced in the younger subjects. The level of sAA was comparatively more in males than females in the respective groups. No significant change in sAA activity was observed after viewing the soothed video clip. Significant increase of sAA level in response to psychological stress suggests that it might act as a reliable sympathetic activity biochemical marker in different stages of human beings.

  16. Protective Effect of Liposome-Encapsulated Glutathione in a Human Epidermal Model Exposed to a Mustard Gas Analog

    Directory of Open Access Journals (Sweden)

    Victor Paromov

    2011-01-01

    Full Text Available Sulfur mustard or mustard gas (HD and its monofunctional analog, 2-chloroethyl ethyl sulfide (CEES, or “half-mustard gas,” are alkylating agents that induce DNA damage, oxidative stress, and inflammation. HD/CEES are rapidly absorbed in the skin causing extensive injury. We hypothesize that antioxidant liposomes that deliver both water-soluble and lipid-soluble antioxidants protect skin cells from immediate CEES-induced damage via attenuating oxidative stress. Liposomes containing water-soluble antioxidants and/or lipid-soluble antioxidants were evaluated using in vitro model systems. Initially, we found that liposomes containing encapsulated glutathione (GSH-liposomes increased cell viability and attenuated production of reactive oxygen species (ROS in HaCaT cells exposed to CEES. Next, GSH-liposomes were tested in a human epidermal model, EpiDerm. In the EpiDerm, GSH-liposomes administered simultaneously or 1 hour after CEES exposure (2.5 mM increased cell viability, inhibited CEES-induced loss of ATP and attenuated changes in cellular morphology, but did not reduce caspase-3 activity. These findings paralleled the previously described in vivo protective effect of antioxidant liposomes in the rat lung and established the effectiveness of GSH-liposomes in a human epidermal model. This study provides a rationale for use of antioxidant liposomes against HD toxicity in the skin considering further verification in animal models exposed to HD.

  17. Long-wave ultraviolet light induces phospholipase activation in cultured human epidermal keratinocytes

    International Nuclear Information System (INIS)

    Hanson, D.; DeLeo, V.

    1990-01-01

    Long wave ultraviolet radiation (UVA) has been shown to play an important role in the overall response of skin to solar radiation, including sunburn, tanning, premature aging, and non-melanoma skin cancer. UVA induction of inflammation in human skin is thought to be mediated by membrane lipid derived products. In order to investigate the mechanism of this response we examined the effect of UVA on phospholipid metabolism of human epidermal keratinocytes in culture. Keratinocytes were grown in serum free low calcium medium. The cells were prelabeled with [3H] arachidonic acid or [3H] choline and irradiated with UVA (Honle 2002-Hg vapor lamp). Identification and quantitation of specific membrane phospholipid-derived components was achieved using high-performance liquid chromatography, paper chromatography, and radioimmunoassay. UVA resulted in a linear dose dependent release of [3H] arachidonic acid into medium between 1 and 20 joule/cm2. This response was inhibited in an oxygen-reduced environment. The radiolabel released was predominantly free arachidonate and cyclooxygenase metabolites. Cyclooxygenase metabolites prostaglandin E2 and prostacyclin derivative, 6-keto-prostaglandin F1a, were stimulated following UVA irradiation, but the lipoxygenase metabolite, leukotriene B was not detected. Maximal release was measured immediately after irradiation and changed little over 24 h post-irradiation. UVA stimulated an increase of [3H] choline metabolites glycerophosphorylcholine and phosphorylcholine in media extracts suggesting UVA activation of phospholipase C and phospholipase A2 or diacylglyceride lipase

  18. Updating the salivary gland transcriptome of Phlebotomus papatasi (Tunisian strain: the search for sand fly-secreted immunogenic proteins for humans.

    Directory of Open Access Journals (Sweden)

    Maha Abdeladhim

    Full Text Available Sand fly saliva plays an important role in both blood feeding and outcome of Leishmania infection. A cellular immune response against a Phlebotomus papatasi salivary protein was shown to protect rodents against Leishmania major infection. In humans, P. papatasi salivary proteins induce a systemic cellular immune response as well as a specific antisaliva humoral immune response, making these salivary proteins attractive targets as markers of exposure for this Leishmania vector. Surprisingly, the repertoire of salivary proteins reported for P. papatasi-a model sand fly for Leishmania-vector-host molecular interactions-is very limited compared with other sand fly species. We hypothesize that a more comprehensive study of the transcripts present in the salivary glands of P. papatasi will provide better knowledge of the repertoire of proteins of this important vector and will aid in selection of potential immunogenic proteins for humans and of those proteins that are highly conserved between different sand fly strains.A cDNA library from P. papatasi (Tunisian strain salivary glands was constructed, and randomly selected transcripts were sequenced and analyzed. The most abundant transcripts encoding secreted proteins were identified and compared with previously reported sequences. Importantly, we identified salivary proteins not described before in this sand fly species.Comparative analysis between the salivary proteins of P. papatasi from Tunisia and Israel strains shows a high level of identity, suggesting these proteins as potential common targets for markers of vector exposure or inducers of cellular immune responses in humans for different geographic areas.

  19. Human Epidermal Growth Factor Receptor 2 Overexpression in Micropapillary and Other Variants of Urothelial Carcinoma.

    Science.gov (United States)

    Behzatoğlu, Kemal; Yörükoğlu, Kutsal; Demir, Hale; Bal, Nebil

    2016-06-21

    Human epidermal growth factor receptor 2 (HER2) protein overexpression or gene amplification has been shown in urothelial bladder cancer. This could be helpful when using targeted anti-HER2 therapy on these tumors. To evaluate HER2 immunohistochemical expression in conventional urothelial carcinoma (UC), in situ UC, and UC variants primarily in micropapillary urothelial carcinoma (MPUC). The study evaluated 60 MPUC cases; 25 invasive, 20 low-grade noninvasive, and 10 high-grade noninvasive UC cases; 8 in situ UC cases; and 69 UC variant cases. The immunohistochemistry staining was scored according to recommendations of the American Society of Clinical Oncology/College of American Pathologists 2013 HER2 test guideline established for breast cancer and only 3+ staining was considered HER2 overexpression. HER2 overexpression was determined by 3+ staining. 34 of 60 MPUC cases (56%) showed HER2 overexpression (3+ staining). We observed 3+ staining HER2 overexpression in nine of 25 conventional invasive UC cases (36%), four of eight in situ UC cases (50%), and three of six lipid cell variant cases (50%). 3+ staining HER2 overexpression was not seen in eight glandular, six small cell, and five sarcomatoid variant cases. HER2 overexpression was negative in the 20 low-grade noninvasive UC cases but positive in two of the 10 high-grade noninvasive UC cases (20%). We observed HER2 overexpression most commonly in MPUC cases. We also found HER2 overexpression in conventional invasive and in situ UC cases. Pure in situ UC and conventional invasive UC, especially MPUC, could be candidate tumors for treatment with anti-HER2 antibody (trastuzumab therapy). Targeted therapy has a limited place in treatment of bladder cancer. In this study, human epidermal growth factor receptor 2 (HER2) overexpression in bladder carcinomas was evaluated in a large number of cases. Anti-HER2 therapy could be used in bladder cancers, as in breast and gastric cancers. Copyright © 2016 European

  20. MO-F-CAMPUS-I-01: EIT Imaging to Monitor Human Salivary Gland Functionality: A Feasibility Study

    International Nuclear Information System (INIS)

    Kohli, K; Karvat, A; Liu, J; Krishnan, K

    2015-01-01

    Purpose: Clinically, there exists a need to develop a non-invasive technique for monitoring salivary activity. In this study, we investigate the feasibility of a using the electrical conductivity information from Electrical Impedance Tomography (EIT) to monitor salivary flow activity. Methods: To acquire EIT data, eight Ag/AgCl ECG electrodes were placed around the mandible of the subject. An EIT scan was obtained by injecting current at 50 KHz, 0.4 mA through each pair of electrodes and recording voltage across other electrode pairs. The functional conductivity image was obtained through reconstruction of the voltage data, using Electrical Impedance Tomography and Diffuse Optical Tomography Reconstruction Software (EIDORS) in Matlab. In using EIDORS, forward solution was obtained using a user-defined finite element model shape and inverse solution was obtained using one-step Gaussian solver. EIT scans of volunteer research team members were acquired for three different physiological states: pre-stimulation, stimulation and post-stimulation. For pre-stimulation phase, data were collected in intervals of 5 minutes for 15 minutes. The salivary glands were then stimulated in the subject using lemon and the data were collected immediately. Post-stimulation data were collected at 4 different timings after stimulation. Results: Variations were observed in the electrical conductivity patterns near parotid regions between the pre- and post-stimulation stages. The three images acquired during the 15 minute pre-stimulation phase showed no major changes in the conductivity. Immediately after stimulation, electrical conductivity increased near parotid regions and 15 minutes later slowly returned to pre-stimulation level. Conclusion: In the present study involving human subjects, the change in electrical conductivity pattern shown in the EIT images, acquired at different times with and without stimulation of salivary glands, appeared to be consistent with the change in salivary

  1. MO-F-CAMPUS-I-01: EIT Imaging to Monitor Human Salivary Gland Functionality: A Feasibility Study

    Energy Technology Data Exchange (ETDEWEB)

    Kohli, K; Karvat, A; Liu, J; Krishnan, K [BC Cancer Agency, Surrey, BC (United Kingdom)

    2015-06-15

    Purpose: Clinically, there exists a need to develop a non-invasive technique for monitoring salivary activity. In this study, we investigate the feasibility of a using the electrical conductivity information from Electrical Impedance Tomography (EIT) to monitor salivary flow activity. Methods: To acquire EIT data, eight Ag/AgCl ECG electrodes were placed around the mandible of the subject. An EIT scan was obtained by injecting current at 50 KHz, 0.4 mA through each pair of electrodes and recording voltage across other electrode pairs. The functional conductivity image was obtained through reconstruction of the voltage data, using Electrical Impedance Tomography and Diffuse Optical Tomography Reconstruction Software (EIDORS) in Matlab. In using EIDORS, forward solution was obtained using a user-defined finite element model shape and inverse solution was obtained using one-step Gaussian solver. EIT scans of volunteer research team members were acquired for three different physiological states: pre-stimulation, stimulation and post-stimulation. For pre-stimulation phase, data were collected in intervals of 5 minutes for 15 minutes. The salivary glands were then stimulated in the subject using lemon and the data were collected immediately. Post-stimulation data were collected at 4 different timings after stimulation. Results: Variations were observed in the electrical conductivity patterns near parotid regions between the pre- and post-stimulation stages. The three images acquired during the 15 minute pre-stimulation phase showed no major changes in the conductivity. Immediately after stimulation, electrical conductivity increased near parotid regions and 15 minutes later slowly returned to pre-stimulation level. Conclusion: In the present study involving human subjects, the change in electrical conductivity pattern shown in the EIT images, acquired at different times with and without stimulation of salivary glands, appeared to be consistent with the change in salivary

  2. Chemical allergens stimulate human epidermal keratinocytes to produce lymphangiogenic vascular endothelial growth factor.

    Science.gov (United States)

    Bae, Ok-Nam; Ahn, Seyeon; Jin, Sun Hee; Hong, Soo Hyun; Lee, Jinyoung; Kim, Eun-Sun; Jeong, Tae Cheon; Chun, Young-Jin; Lee, Ai-Young; Noh, Minsoo

    2015-03-01

    Allergic contact dermatitis (ACD) is a cell-mediated immune response that involves skin sensitization in response to contact with various allergens. Angiogenesis and lymphangiogenesis both play roles in the allergic sensitization process. Epidermal keratinocytes can produce vascular endothelial growth factor (VEGF) in response to UV irradiation and during wound healing. However, the effect of haptenic chemical allergens on the VEGF production of human keratinocytes, which is the primary contact site of toxic allergens, has not been thoroughly researched. We systematically investigated whether immune-regulatory cytokines and chemical allergens would lead to the production of VEGF in normal human keratinocytes (NHKs) in culture. VEGF production significantly increased when NHKs were treated with IFNγ, IL-1α, IL-4, IL-6, IL-17A, IL-22 or TNFα. Among the human sensitizers listed in the OECD Test Guideline (TG) 429, we found that CMI/MI, DNCB, 4-phenylenediamine, cobalt chloride, 2-mercaptobenzothiazole, citral, HCA, cinnamic alcohol, imidazolidinyl urea and nickel chloride all significantly upregulated VEGF production in NHKs. In addition, common human haptenic allergens such as avobenzone, formaldehyde and urushiol, also induced the keratinocyte-derived VEGF production. VEGF upregulation by pro-inflammatory stimuli, IFNγ, DNCB or formaldehyde is preceded by the production of IL-8, an acute inflammatory phase cytokine. Lymphangiogenic VEGF-C gene transcription was significantly increased when NHKs were treated with formaldehyde, DNCB or urushiol, while transcription of VEGF-A and VEGF-B did not change. Therefore, the chemical allergen-induced VEGF upregulation is mainly due to the increase in lymphangiogenic VEGF-C transcription in NHKs. These results suggest that keratinocyte-derived VEGF may regulate the lymphangiogenic process during the skin sensitization process of ACD. Copyright © 2015 Elsevier Inc. All rights reserved.

  3. Contribution of Human Oral Cells to Astringency by Binding Salivary Protein/Tannin Complexes.

    Science.gov (United States)

    Soares, Susana; Ferrer-Galego, Raúl; Brandão, Elsa; Silva, Mafalda; Mateus, Nuno; Freitas, Victor de

    2016-10-10

    The most widely accepted mechanism to explain astringency is the interaction and precipitation of salivary proteins by food tannins, in particular proline-rich proteins. However, other mechanisms have been arising to explain astringency, such as binding of tannins to oral cells. In this work, an experimental method was adapted to study the possible contribution of both salivary proteins and oral cells to astringency induced by grape seed procyanidin fractions. Overall, in the absence of salivary proteins, the extent of procyanidin complexation with oral cells increased with increasing procyanidin degree of polymerization (mDP). Procyanidin fractions rich in monomers were the ones with the lowest ability to bind to oral cells. In the presence of salivary proteins and for procyanidins with mDP 2 the highest concentrations (1.5 and 2.0 mM) resulted in an increased binding of procyanidins to oral cells. This was even more evident for fractions III and IV at 1.0 mM and upper concentrations. Regarding the salivary proteins affected, it was possible to observe a decrease of P-B peptide and aPRP proteins for fractions II and III. This decrease is greater as the procyanidins' mDP increases. In fact, for fraction IV an almost total depletion of all salivary proteins was observed. This decrease is due to the formation of insoluble salivary protein/procyanidin complexes. Altogether, these data suggest that some procyanidins are able to bind to oral cells and that the salivary proteins interact with procyanidins forming salivary protein/procyanidin complexes that are also able to link to oral cells. The procyanidins that remain unbound to oral cells are able to bind to salivary proteins forming a large network of salivary protein/procyanidin complexes. Overall, the results presented herein provide one more step to understand food oral astringency onset.

  4. Slug silencing inhibited perineural invasion through regulation of EMMPRIN expression in human salivary adenoid cystic carcinoma.

    Science.gov (United States)

    Wu, Baolei; Wei, Jianhua; Hu, Zhiqiang; Shan, Chun; Wang, Lei; Zhang, Chenping; Yang, Xi; Yang, Xinjie; Lei, Delin

    2016-02-01

    Salivary adenoid cystic carcinoma (SACC) is the most frequent salivary gland malignancy with a unique characteristic that has been named perineural invasion (PNI). EMMPRIN is a transmembrane glycoprotein that has been demonstrated to promote PNI in SACC. Slug, one of the most effective promoters of the epithelial-to-mesenchymal transition (EMT), has been found to be associated with PNI in SACC. The aim of the present study was to investigate the roles and relationships of Slug, EMMPRIN, and E-cadherin in the PNI process of SACC. The expression levels of Slug, EMMPRIN, and E-cadherin in 115 primary SACC cases were statistically analyzed by immunohistochemistry. Simultaneously, the SACC cell line SACC-83 was transfected with recombinant plasmids of silencing Slug (si-Slug) and/or silencing EMMPRIN (si-EMMPRIN). The functions of Slug and EMMPRIN in the EMT and PNI process were assessed by reverse transcription PCR (RT-PCR), western blotting, morphological observation, scratch test, migration assay, and in vitro perineural invasion assay. The immunohistochemical statistics revealed that the high expression of Slug and EMMPRIN and the low expression of E-cadherin were significantly associated with the PNI of SACC (P EMMPRIN expression (P EMMPRIN expression were both significantly negatively associated with E-cadherin expression (P EMMPRIN silencing both significantly inhibited EMMPRIN expression but promoted E-cadherin expression in SACC-83 cells (P EMMPRIN, or both induced cell morphology changes and inhibited tumor cell motility and PNI ability in SACC-83 cells (P EMMPRIN and then upregulating E-cadherin in the PNI process of SACC. The present study indicated that Slug and EMMPRIN are potential biomarkers and therapeutic targets for the diagnosis and treatment of PNI in human SACC.

  5. Human epidermal growth factor receptor2 expression in unresectable gastric cancers: Relationship with CT characteristics

    Energy Technology Data Exchange (ETDEWEB)

    Lee, Jeong Sub [Dept. of Radiology, Jeju National University Hospital, Jeju (Korea, Republic of); Kim, Se Hyung; Im, Seock Ah; Kim, Min A; Han, Joon Koo [Seoul National University Hospital, Seoul (Korea, Republic of)

    2017-09-15

    To retrospectively analyze the qualitative CT features that correlate with human epidermal growth factor receptor 2 (HER2)-expression in pathologically-proven gastric cancers. A total of 181 patients with pathologically-proven unresectable gastric cancers with HER2-expression (HER2-positive [n = 32] and negative [n = 149]) were included. CT features of primary gastric and metastatic tumors were reviewed. The prevalence of each CT finding was compared in both groups. Thereafter, binary logistic regression determined the most significant differential CT features. Clinical outcomes were compared using Kaplan-Meier method. HER2-postive cancers showed lower clinical T stage (21.9% vs. 8.1%; p = 0.015), hyperattenuation on portal phase (62.5% vs. 30.9%; p = 0.003), and was more frequently metastasized to the liver (62.5% vs. 32.2%; p = 0.001), than HER2-negative cancers. On binary regression analysis, hyperattenuation of the tumor (odds ratio [OR], 4.68; p < 0.001) and hepatic metastasis (OR, 4.43; p = 0.001) were significant independent factors that predict HER2-positive cancers. Median survival of HER2-positive cancers (13.7 months) was significantly longer than HER2-negative cancers (9.6 months) (p = 0.035). HER2-positive gastric cancers show less-advanced T stage, hyperattenuation on the portal phase, and frequently metastasize to the liver, as compared to HER2-negative cancers.

  6. Recurrent exposure to nicotine differentiates human bronchial epithelial cells via epidermal growth factor receptor activation

    International Nuclear Information System (INIS)

    Martinez-Garcia, Eva; Irigoyen, Marta; Anso, Elena; Martinez-Irujo, Juan Jose; Rouzaut, Ana

    2008-01-01

    Cigarette smoking is the major preventable cause of lung cancer in developed countries. Nicotine (3-(1-methyl-2-pyrrolidinyl)-pyridine) is one of the major alkaloids present in tobacco. Besides its addictive properties, its effects have been described in panoply of cell types. In fact, recent studies have shown that nicotine behaves as a tumor promoter in transformed epithelial cells. This research focuses on the effects of acute repetitive nicotine exposure on normal human bronchial epithelial cells (NHBE cells). Here we show that treatment of NHBE cells with recurrent doses of nicotine up to 500 μM triggered cell differentiation towards a neuronal-like phenotype: cells emitted filopodia and expressed neuronal markers such as neuronal cell adhesion molecule, neurofilament-M and the transcription factors neuronal N and Pax-3. We also demonstrate that nicotine treatment induced NF-kB translocation to the nucleus, phosphorylation of the epidermal growth factor receptor (EGFR), and accumulation of heparin binding-EGF in the extracellular medium. Moreover, addition of AG1478, an inhibitor of EGFR tyrosine phosphorylation, or cetuximab, a monoclonal antibody that precludes ligand binding to the same receptor, prevented cell differentiation by nicotine. Lastly, we show that differentiated cells increased their adhesion to the extracellular matrix and their protease activity. Given that several lung pathologies are strongly related to tobacco consumption, these results may help to better understand the damaging consequences of nicotine exposure

  7. Phosphoproteomic fingerprinting of epidermal growth factor signaling and anticancer drug action in human tumor cells.

    Science.gov (United States)

    Lim, Yoon-Pin; Diong, Lang-Shi; Qi, Robert; Druker, Brian J; Epstein, Richard J

    2003-12-01

    Many proteins regulating cancer cell growth are tyrosine phosphorylated. Using antiphosphotyrosine affinity chromatography, thiourea protein solubilization, two-dimensional PAGE, and mass spectrometry, we report here the characterization of the epidermal growth factor (EGF)-induced phosphoproteome in A431 human epidermoid carcinoma cells. Using this approach, more than 50 distinct tyrosine phosphoproteins are identifiable within five main clusters-cytoskeletal proteins, signaling enzymes, SH2-containing adaptors, chaperones, and focal adhesion proteins. Comparison of the phosphoproteomes induced in vitro by transforming growth factor-alpha and platelet-derived growth factor demonstrates the pathway- and cell-specific nature of the phosphoproteomes induced. Elimination of both basal and ligand-dependent phosphoproteins by cell exposure to the EGF receptor catalytic inhibitor gefitinib (Iressa, ZD1839) suggests either an autocrine growth loop or the presence of a second inhibited kinase in A431 cells. By identifying distinct patterns of phosphorylation involving novel signaling substrates, and by clarifying the mechanism of action of anticancer drugs, these findings illustrate the potential of immunoaffinity-based phosphoproteomics for guiding the discovery of new drug targets and the rational utilization of pathway-specific chemotherapies.

  8. High Efficient Expression, Purification, and Functional Characterization of Native Human Epidermal Growth Factor in Escherichia coli

    Directory of Open Access Journals (Sweden)

    Yi Ma

    2016-01-01

    Full Text Available Human epidermal growth factor (hEGF is a small, mitotic growth polypeptide that promotes the proliferation of various cells and is widely applied in clinical practices. However, high efficient expression of native hEGF in Escherichia coli has not been successful, since three disulfide bonds in monomer hEGF made it unable to fold into correct 3D structure using in vivo system. To tackle this problem, we fused Mxe GyrA intein (Mxe at the C-terminal of hEGF followed by small ubiquitin-related modifier (SUMO and 10x His-tag to construct a chimeric protein hEGF-Mxe-SUMO-H10. The fusion protein was highly expressed at the concentration of 281 mg/L and up to 59.5% of the total cellular soluble proteins. The fusion protein was purified by affinity chromatography and 29.4 mg/L of native hEGF can be released by thiol induced N-terminal cleavage without any proteases. The mitotic activity in Balb/c 3T3 cells is proliferated by commercial and recombinant hEGF measured with methylthiazolyldiphenyl-tetrazolium bromide (MTT assay which indicated that recombinant hEGF protein stimulates the cell proliferation similar to commercial protein. This study significantly improved the yield and reduced the cost of hEGF in the recombinant E. coli system and could be a better strategy to produce native hEGF for pharmaceutical development.

  9. High Efficient Expression, Purification, and Functional Characterization of Native Human Epidermal Growth Factor in Escherichia coli.

    Science.gov (United States)

    Ma, Yi; Yu, Jieying; Lin, Jinglian; Wu, Shaomin; Li, Shan; Wang, Jufang

    2016-01-01

    Human epidermal growth factor (hEGF) is a small, mitotic growth polypeptide that promotes the proliferation of various cells and is widely applied in clinical practices. However, high efficient expression of native hEGF in Escherichia coli has not been successful, since three disulfide bonds in monomer hEGF made it unable to fold into correct 3D structure using in vivo system. To tackle this problem, we fused Mxe GyrA intein (Mxe) at the C-terminal of hEGF followed by small ubiquitin-related modifier (SUMO) and 10x His-tag to construct a chimeric protein hEGF-Mxe-SUMO-H 10 . The fusion protein was highly expressed at the concentration of 281 mg/L and up to 59.5% of the total cellular soluble proteins. The fusion protein was purified by affinity chromatography and 29.4 mg/L of native hEGF can be released by thiol induced N-terminal cleavage without any proteases. The mitotic activity in Balb/c 3T3 cells is proliferated by commercial and recombinant hEGF measured with methylthiazolyldiphenyl-tetrazolium bromide (MTT) assay which indicated that recombinant hEGF protein stimulates the cell proliferation similar to commercial protein. This study significantly improved the yield and reduced the cost of hEGF in the recombinant E. coli system and could be a better strategy to produce native hEGF for pharmaceutical development.

  10. Human epidermal growth factor receptor2 expression in unresectable gastric cancers: Relationship with CT characteristics

    International Nuclear Information System (INIS)

    Lee, Jeong Sub; Kim, Se Hyung; Im, Seock Ah; Kim, Min A; Han, Joon Koo

    2017-01-01

    To retrospectively analyze the qualitative CT features that correlate with human epidermal growth factor receptor 2 (HER2)-expression in pathologically-proven gastric cancers. A total of 181 patients with pathologically-proven unresectable gastric cancers with HER2-expression (HER2-positive [n = 32] and negative [n = 149]) were included. CT features of primary gastric and metastatic tumors were reviewed. The prevalence of each CT finding was compared in both groups. Thereafter, binary logistic regression determined the most significant differential CT features. Clinical outcomes were compared using Kaplan-Meier method. HER2-postive cancers showed lower clinical T stage (21.9% vs. 8.1%; p = 0.015), hyperattenuation on portal phase (62.5% vs. 30.9%; p = 0.003), and was more frequently metastasized to the liver (62.5% vs. 32.2%; p = 0.001), than HER2-negative cancers. On binary regression analysis, hyperattenuation of the tumor (odds ratio [OR], 4.68; p < 0.001) and hepatic metastasis (OR, 4.43; p = 0.001) were significant independent factors that predict HER2-positive cancers. Median survival of HER2-positive cancers (13.7 months) was significantly longer than HER2-negative cancers (9.6 months) (p = 0.035). HER2-positive gastric cancers show less-advanced T stage, hyperattenuation on the portal phase, and frequently metastasize to the liver, as compared to HER2-negative cancers

  11. Brain metastasis in human epidermal growth factor receptor 2-positive breast cancer: from biology to treatment

    Energy Technology Data Exchange (ETDEWEB)

    Koo, Tae Ryool [Dept. of Radiation Oncology, Hallym University Chuncheon Sacred Heart Hospital, Chuncheon (Korea, Republic of); Kim, In Ah [Dept. of Radiation Oncology, Seoul National University Bundang Hospital, Seongnam (Korea, Republic of)

    2016-03-15

    Overexpression of human epidermal growth factor receptor 2 (HER2) is found in about 20% of breast cancer patients. With treatment using trastuzumab, an anti-HER2 monoclonal antibody, systemic control is improved. Nonetheless, the incidence of brain metastasis does not be improved, rather seems to be increased in HER2-positive breast cancer. The mainstay treatment for brain metastases is radiotherapy. According to the number of metastatic lesions and performance status of patients, radiosurgery or whole brain radiotherapy can be performed. The concurrent use of a radiosensitizer further improves intracranial control. Due to its large molecular weight, trastuzumab has a limited ability to cross the blood-brain barrier. However, small tyrosine kinase inhibitors such as lapatinib, has been noted to be a promising agent that can be used as a radiosensitizer to affect HER2-positive breast cancer. This review will outline general management of brain metastases and will focus on preclinical findings regarding the radiosensitizing effect of small molecule HER2 targeting agents.

  12. An Ixodes ricinus Tick Salivary Lectin Pathway Inhibitor Protects Borrelia burgdorferi sensu lato from Human Complement

    NARCIS (Netherlands)

    Wagemakers, Alex; Coumou, Jeroen; Schuijt, Tim J.; Oei, Anneke; Nijhof, Ard M.; van 't Veer, Cornelis; van der Poll, Tom; Bins, Adriaan D.; Hovius, Joppe W. R.

    2016-01-01

    We previously identified tick salivary lectin pathway inhibitor (TSLPI) in Ixodes scapularis, a vector for Borrelia burgdorferi sensu stricto (s.s.) in North America. TSLPI is a salivary protein facilitating B. burgdorferi s.s. transmission and acquisition by inhibiting the host lectin complement

  13. The effect of wound dressings on a bio-engineered human dermo-epidermal skin substitute in a rat model

    OpenAIRE

    Hüging, Martina; Biedermann, Thomas; Sobrio, Monia; Meyer, Sarah; Böttcher-Haberzeth, Sophie; Manuel, Edith; Horst, Maya; Hynes, Sally; Reichmann, Ernst; Schiestl, Clemens; Hartmann-Fritsch, Fabienne

    2017-01-01

    Autologous bio-engineered dermo-epidermal skin substitutes are a promising treatment for large skin defects such as burns. For their successful clinical application, the graft dressing must protect and support the keratinocyte layer and, in many cases, possess antimicrobial properties. However, silver in many antimicrobial dressings may inhibit keratinocyte growth and differentiation. The purpose of our study is to evaluate the effect of various wound dressings on the healing of a human hydro...

  14. Expression and significance of HMGB1, TLR4 and NF-κB p65 in human epidermal tumors

    International Nuclear Information System (INIS)

    Weng, Hui; Deng, Yunhua; Xie, Yuyan; Liu, Hongbo; Gong, Feili

    2013-01-01

    High mobility group protein box 1 (HMGB1) is a DNA binding protein located in nucleus. It is released into extracellular fluid where it acts as a novel proinflammatory cytokine which interacts with Toll like receptor 4 (TLR4) to activate nuclear factor-κB (NF-κB). This sequence of events is involved in tumor growth and progression. However, the effects of HMGB1, TLR4 and NF-κB on epidermal tumors remain unclear. Human epidermal tumor specimens were obtained from 96 patients. Immunohistochemistry was used to detect expression of HMGB1, TLR4 and NF-κB p65 in human epidermal tumor and normal skin specimens. Western blot analysis was used to detect the expression of NF-κB p65 in epithelial cell nuclei in human epidermal tumor and normal tissues. Immunohistochemistry and western blot analysis indicated a progressive but statistically significant increase in p65 expression in epithelial nuclei in benign seborrheic keratosis (SK), precancerous lesions (PCL), low malignancy basal cell carcinoma (BCC) and high malignancy squamous cell carcinoma (SCC) (P <0.01). The level of extracellular HMGB1 in SK was significantly higher than in normal skin (NS) (P <0.01), and was higher than in SCC but without statistical significance. The level of TLR4 on epithelial membranes of SCC cells was significantly higher than in SK, PCL, BCC and NS (P <0.01). There was a significant positive correlation between p65 expression in the epithelial nuclei and TLR4 expression on the epithelial cell membranes (r = 0.3212, P <0.01). These findings indicate that inflammation is intensified in parallel with increasing malignancy. They also indicate that the TLR4 signaling pathway, rather than HMGB1, may be the principal mediator of inflammation in high-grade malignant epidermal tumors. Combined detection of p65 in the epithelial nuclei and TLR4 on the epithelial membranes may assist the accurate diagnosis of malignant epidermal tumors

  15. Chemical allergens stimulate human epidermal keratinocytes to produce lymphangiogenic vascular endothelial growth factor

    Energy Technology Data Exchange (ETDEWEB)

    Bae, Ok-Nam [College of Pharmacy, Institute of Pharmaceutical Science and Technology, Hanyang University, Ansan 426-791 (Korea, Republic of); Ahn, Seyeon; Jin, Sun Hee; Hong, Soo Hyun; Lee, Jinyoung [College of Pharmacy, Natural Products Research Institute, Seoul National University, Seoul 151-742 (Korea, Republic of); Kim, Eun-Sun [College of Pharmacy, Institute of Pharmaceutical Science and Technology, Hanyang University, Ansan 426-791 (Korea, Republic of); Jeong, Tae Cheon [College of Pharmacy, Yeungnam University, Gyeongsan 712-749 (Korea, Republic of); Chun, Young-Jin [College of Pharmacy, Chung-Ang University, Seoul 156-756 (Korea, Republic of); Lee, Ai-Young, E-mail: leeay@duih.org [Department of Dermatology, Dongguk University Ilsan Hospital, Goyang 410-773 (Korea, Republic of); Noh, Minsoo, E-mail: minsoo@alum.mit.edu [College of Pharmacy, Natural Products Research Institute, Seoul National University, Seoul 151-742 (Korea, Republic of)

    2015-03-01

    Allergic contact dermatitis (ACD) is a cell-mediated immune response that involves skin sensitization in response to contact with various allergens. Angiogenesis and lymphangiogenesis both play roles in the allergic sensitization process. Epidermal keratinocytes can produce vascular endothelial growth factor (VEGF) in response to UV irradiation and during wound healing. However, the effect of haptenic chemical allergens on the VEGF production of human keratinocytes, which is the primary contact site of toxic allergens, has not been thoroughly researched. We systematically investigated whether immune-regulatory cytokines and chemical allergens would lead to the production of VEGF in normal human keratinocytes (NHKs) in culture. VEGF production significantly increased when NHKs were treated with IFNγ, IL-1α, IL-4, IL-6, IL-17A, IL-22 or TNFα. Among the human sensitizers listed in the OECD Test Guideline (TG) 429, we found that CMI/MI, DNCB, 4-phenylenediamine, cobalt chloride, 2-mercaptobenzothiazole, citral, HCA, cinnamic alcohol, imidazolidinyl urea and nickel chloride all significantly upregulated VEGF production in NHKs. In addition, common human haptenic allergens such as avobenzone, formaldehyde and urushiol, also induced the keratinocyte-derived VEGF production. VEGF upregulation by pro-inflammatory stimuli, IFNγ, DNCB or formaldehyde is preceded by the production of IL-8, an acute inflammatory phase cytokine. Lymphangiogenic VEGF-C gene transcription was significantly increased when NHKs were treated with formaldehyde, DNCB or urushiol, while transcription of VEGF-A and VEGF-B did not change. Therefore, the chemical allergen-induced VEGF upregulation is mainly due to the increase in lymphangiogenic VEGF-C transcription in NHKs. These results suggest that keratinocyte-derived VEGF may regulate the lymphangiogenic process during the skin sensitization process of ACD. - Highlights: • Pro-inflammatory cytokines induced VEGF production in normal human

  16. Chemical allergens stimulate human epidermal keratinocytes to produce lymphangiogenic vascular endothelial growth factor

    International Nuclear Information System (INIS)

    Bae, Ok-Nam; Ahn, Seyeon; Jin, Sun Hee; Hong, Soo Hyun; Lee, Jinyoung; Kim, Eun-Sun; Jeong, Tae Cheon; Chun, Young-Jin; Lee, Ai-Young; Noh, Minsoo

    2015-01-01

    Allergic contact dermatitis (ACD) is a cell-mediated immune response that involves skin sensitization in response to contact with various allergens. Angiogenesis and lymphangiogenesis both play roles in the allergic sensitization process. Epidermal keratinocytes can produce vascular endothelial growth factor (VEGF) in response to UV irradiation and during wound healing. However, the effect of haptenic chemical allergens on the VEGF production of human keratinocytes, which is the primary contact site of toxic allergens, has not been thoroughly researched. We systematically investigated whether immune-regulatory cytokines and chemical allergens would lead to the production of VEGF in normal human keratinocytes (NHKs) in culture. VEGF production significantly increased when NHKs were treated with IFNγ, IL-1α, IL-4, IL-6, IL-17A, IL-22 or TNFα. Among the human sensitizers listed in the OECD Test Guideline (TG) 429, we found that CMI/MI, DNCB, 4-phenylenediamine, cobalt chloride, 2-mercaptobenzothiazole, citral, HCA, cinnamic alcohol, imidazolidinyl urea and nickel chloride all significantly upregulated VEGF production in NHKs. In addition, common human haptenic allergens such as avobenzone, formaldehyde and urushiol, also induced the keratinocyte-derived VEGF production. VEGF upregulation by pro-inflammatory stimuli, IFNγ, DNCB or formaldehyde is preceded by the production of IL-8, an acute inflammatory phase cytokine. Lymphangiogenic VEGF-C gene transcription was significantly increased when NHKs were treated with formaldehyde, DNCB or urushiol, while transcription of VEGF-A and VEGF-B did not change. Therefore, the chemical allergen-induced VEGF upregulation is mainly due to the increase in lymphangiogenic VEGF-C transcription in NHKs. These results suggest that keratinocyte-derived VEGF may regulate the lymphangiogenic process during the skin sensitization process of ACD. - Highlights: • Pro-inflammatory cytokines induced VEGF production in normal human

  17. H{sup +}/peptide transporter (PEPT2) is expressed in human epidermal keratinocytes and is involved in skin oligopeptide transport

    Energy Technology Data Exchange (ETDEWEB)

    Kudo, Michiko; Katayoshi, Takeshi; Kobayashi-Nakamura, Kumiko [DHC Corporation Laboratories, Division 2, 2-42 Hamada, Mihama-ku, Chiba 261-0025 (Japan); Akagawa, Mitsugu [Department of Biological Chemistry, Division of Applied Life Science, Graduate School of Life and Environmental Sciences, Osaka Prefecture University, 1-1 Gakuen-cho, Naka-ku, Sakai 599-8531 (Japan); Tsuji-Naito, Kentaro, E-mail: knaito@dhc.co.jp [DHC Corporation Laboratories, Division 2, 2-42 Hamada, Mihama-ku, Chiba 261-0025 (Japan)

    2016-07-08

    Peptide transporter 2 (PEPT2) is a member of the proton-coupled oligopeptide transporter family, which mediates the cellular uptake of oligopeptides and peptide-like drugs. Although PEPT2 is expressed in many tissues, its expression in epidermal keratinocytes remains unclear. We investigated PEPT2 expression profile and functional activity in keratinocytes. We confirmed PEPT2 mRNA expression in three keratinocyte lines (normal human epidermal keratinocytes (NHEKs), immortalized keratinocytes, and malignant keratinocytes) by reverse transcription-polymerase chain reaction (RT-PCR) and quantitative real-time RT-PCR. In contrast to PEPT1, PEPT2 expression in the three keratinocytes was similar or higher than that in HepG2 cells, used as PEPT2-positive cells. Immunolocalization analysis using human skin showed epidermal PEPT2 localization. We studied keratinocyte transport function by measuring the oligopeptide content using liquid chromatography/tandem mass spectrometry. Glycylsarcosine uptake in NHEKs was pH-dependent, suggesting that keratinocytes could absorb small peptides in the presence of an inward H{sup +} gradient. We also performed a skin-permeability test of several oligopeptides using skin substitute, suggesting that di- and tripeptides pass actively through the epidermis. In conclusion, PEPT2 is expressed in keratinocytes and involved in skin oligopeptide uptake. -- Highlights: •PEPT2 is expressed in keratinocytes, which are more common than other skin cells. •Immunolocalization analysis using human skin revealed epidermal PEPT2 localization. •Keratinocytes could absorb small peptides in the presence of an inward H{sup +} gradient. •Di- and tripeptide pass actively through the epidermis.

  18. Dynamic changes in nicotinamide pyridine dinucleotide content in normal human epidermal keratinocytes and their effect on retinoic acid biosynthesis

    International Nuclear Information System (INIS)

    Pinkas-Sarafova, Adriana; Markova, N.G.; Simon, M.

    2005-01-01

    The function of many enzymes that regulate metabolism and transcription depends critically on the nicotinamide pyridine dinucleotides. To understand the role of NAD(P)(H) in physiology and pathophysiology, it is imperative to estimate both their amount and ratios in a given cell type. In human epidermis and in cultured epidermal keratinocytes, we found that the total dinucleotide content is in the low millimolar range. The dinucleotide pattern changes during proliferation and maturation of keratinocytes in culture. Differences in the concentrations of NAD(P)(H) of 1.5- to 12-fold were observed. This resulted in alteration of the NAD(P)H/NAD(P) ratio, which could impact the differential regulation of both transcriptional and metabolic processes. In support of this notion, we provide evidence that the two-step oxidation of retinol to retinoic acid, a nuclear hormone critical for epidermal homeostasis, can be regulated by the relative physiological amounts of the pyridine dinucleotides

  19. Killing of Candida albicans by Human Salivary Histatin 5 Is Modulated, but Not Determined, by the Potassium Channel TOK1

    OpenAIRE

    Baev, Didi; Rivetta, Alberto; Li, Xuewei S.; Vylkova, Slavena; Bashi, Esther; Slayman, Clifford L.; Edgerton, Mira

    2003-01-01

    Salivary histatin 5 (Hst 5), a potent toxin for the human fungal pathogen Candida albicans, induces noncytolytic efflux of cellular ATP, potassium, and magnesium in the absence of cytolysis, implicating these ion movements in the toxin's fungicidal activity. Hst 5 action on Candida resembles, in many respects, the action of the K1 killer toxin on Saccharomyces cerevisiae, and in that system the yeast plasma membrane potassium channel, Tok1p, has recently been reported to be a primary target o...

  20. Radiolabeled pertuzumab for imaging of human epidermal growth factor receptor 2 expression in ovarian cancer

    Energy Technology Data Exchange (ETDEWEB)

    Jiang, Dawei [Shenzhen University, Guangdong Key Laboratory for Biomedical Measurements and Ultrasound Imaging, School of Biomedical Engineering, Shenzhen (China); University of Wisconsin - Madison, Department of Radiology, Madison, WI (United States); Im, Hyung-Jun [University of Wisconsin - Madison, Department of Radiology, Madison, WI (United States); Seoul National University, Graduate School of Convergence Science and Technology, Seoul (Korea, Republic of); Sun, Haiyan; Cho, Steve Y. [University of Wisconsin - Madison, Department of Radiology, Madison, WI (United States); Valdovinos, Hector F.; England, Christopher G.; Ehlerding, Emily B.; Nickles, Robert J. [University of Wisconsin - Madison, Department of Medical Physics, Madison, WI (United States); Lee, Dong Soo [Seoul National University, Graduate School of Convergence Science and Technology, Seoul (Korea, Republic of); Huang, Peng [Shenzhen University, Guangdong Key Laboratory for Biomedical Measurements and Ultrasound Imaging, School of Biomedical Engineering, Shenzhen (China); Cai, Weibo [University of Wisconsin - Madison, Department of Radiology, Madison, WI (United States); University of Wisconsin - Madison, Department of Medical Physics, Madison, WI (United States); University of Wisconsin Carbone Cancer Center, Madison, WI (United States)

    2017-08-15

    Human epidermal growth factor receptor 2 (HER2) is over-expressed in over 30% of ovarian cancer cases, playing an essential role in tumorigenesis and metastasis. Non-invasive imaging of HER2 is of great interest for physicians as a mean to better detect and monitor the progression of ovarian cancer. In this study, HER2 was assessed as a biomarker for ovarian cancer imaging using {sup 64}Cu-labeled pertuzumab for immunoPET imaging. HER2 expression and binding were examined in three ovarian cancer cell lines (SKOV3, OVCAR3, Caov3) using in vitro techniques, including western blot and saturation binding assays. PET imaging and biodistribution studies in subcutaneous models of ovarian cancer were performed for non-invasive in vivo evaluation of HER2 expression. Additionally, orthotopic models were employed to further validate the imaging capability of {sup 64}Cu-NOTA-pertuzumab. HER2 expression was highest in SKOV3 cells, while OVCAR3 and Caov3 displayed lower HER2 expression. {sup 64}Cu-NOTA-pertuzumab showed high specificity for HER2 (K{sub a} = 3.1 ± 0.6 nM) in SKOV3. In subcutaneous tumors, PET imaging revealed tumor uptake of 41.8 ± 3.8, 10.5 ± 3.9, and 12.1 ± 2.3%ID/g at 48 h post-injection for SKOV3, OVCAR3, and Caov3, respectively (n = 3). In orthotopic models, PET imaging with {sup 64}Cu-NOTA-pertuzumab allowed for rapid and clear delineation of both primary and small peritoneal metastases in HER2-expressing ovarian cancer. {sup 64}Cu-NOTA-pertuzumab is an effective PET tracer for the non-invasive imaging of HER2 expression in vivo, rendering it a potential tracer for treatment monitoring and improved patient stratification. (orig.)

  1. Correlation of human epidermal growth factor receptor protein expression and colorectal cancer.

    Science.gov (United States)

    Yang, Wen-Juan; Shen, Xing-Jie; Ma, Xiao-Xia; Tan, Zhi-Gang; Song, Yan; Guo, Yi-Tong; Yuan, Mei

    2015-07-28

    To investigate the correlation between human epidermal growth factor receptor (HER-2) protein expression and colorectal cancer (CRC) using a case-control study and meta-analysis. Tumor tissue specimens from 162 CRC patients were selected for the case group. Fifty cases were randomly selected, and normal CRC tissue at least 10 cm away from the tumor margins of these cases was used to generate the control group. The expression of the HER-2 protein in the 162 CRC tissue samples and the 50 adjacent normal mucosa tissue samples was detected via immunohistochemistry. The experimental data were analyzed using SPSS 18.0 software, and R software version 3.1.0 was utilized for further verification. The expression of HER-2 protein in the 162 CRC tissue samples was significantly higher than in the normal tissue specimens. The data showed that the expression of HER-2 in CRC was related to the Dukes' stage, the depth of invasion and lymph node metastasis. The HER-2-positive patients had lower 3- and 5-year OS rates than the HER-2-negative patients, but there was no significant difference. However, there was a statistically significant difference in the 3- and 5-year disease-free survival (DFS) rates of HER-2-positive and HER-2-negative patients. The results of the meta-analysis showed that the expression of HER-2 in CRC patients was statistically significantly increased over that of healthy people. The 3-year DFS rate in HER-2-positive patients was markedly lower than that in HER-2-negative patients. Down-regulation of HER-2 expression might be a dependable strategy for CRC therapy.

  2. Biological interactions of quantum dot nanoparticles in skin and in human epidermal keratinocytes

    International Nuclear Information System (INIS)

    Zhang, Leshuai W.; Yu, William W.; Colvin, Vicki L.; Monteiro-Riviere, Nancy A.

    2008-01-01

    Quantum dots nanoparticles have novel optical properties for biomedical applications and electronics, but little is known about their skin permeability and interaction with cells. QD621 are nail-shaped nanoparticles that contain a cadmium/selenide core with a cadmium sulfide shell coated with polyethylene glycol (PEG) and are soluble in water. QD were topically applied to porcine skin flow-through diffusion cells to assess penetration at 1 μM, 2 μM and 10 μM for 24 h. QD were also studied in human epidermal keratinocytes (HEK) to determine cellular uptake, cytotoxicity and inflammatory potential. Confocal microscopy depicted the penetration of QD621 through the uppermost stratum corneum (SC) layers of the epidermis and fluorescence was found primarily in the SC and near hair follicles. QD were found in the intercellular lipid bilayers of the SC by transmission electron microscopy (TEM). Inductively coupled plasma-optical emission spectroscopy (ICP-OES) analysis for cadmium (Cd) and fluorescence for QD both did not detect Cd nor fluorescence signal in the perfusate at any time point or concentration. In HEK, viability decreased significantly (p < 0.05) from 1.25 nM to 10nM after 24 h and 48 h. There was a significant increase in IL-6 at 1.25 nM to 10 nM, while IL-8 increased from 2.5nM to 10nM after 24 h and 48 h. TEM of HEK treated with 10 nM of QD621 at 24 h depicted QD in cytoplasmic vacuoles and at the periphery of the cell membranes. These results indicate that porcine skin penetration of QD621 is minimal and limited primarily to the outer SC layers, yet if the skin were damaged allowing direct QD exposure to skin or keratinocytes, an inflammatory response could be initiated

  3. Cellular processes involved in human epidermal cells exposed to extremely low frequency electric fields.

    Science.gov (United States)

    Collard, J-F; Hinsenkamp, M

    2015-05-01

    We observed on different tissues and organisms a biological response after exposure to pulsed low frequency and low amplitude electric or electromagnetic fields but the precise mechanism of cell response remains unknown. The aim of this publication is to understand, using bioinformatics, the biological relevance of processes involved in the modification of gene expression. The list of genes analyzed was obtained after microarray protocol realized on cultures of human epidermal explants growing on deepidermized human skin exposed to a pulsed low frequency electric field. The directed acyclic graph on a WebGestalt Gene Ontology module shows six categories under the biological process root: "biological regulation", "cellular process", "cell proliferation", "death", "metabolic process" and "response to stimulus". Enriched derived categories are coherent with the type of in vitro culture, the stimulation protocol or with the previous results showing a decrease of cell proliferation and an increase of differentiation. The Kegg module on WebGestalt has highlighted "cell cycle" and "p53 signaling pathway" as significantly involved. The Kegg website brings out interactions between FoxO, MAPK, JNK, p53, p38, PI3K/Akt, Wnt, mTor or NF-KappaB. Some genes expressed by the stimulation are known to have an exclusive function on these pathways. Analyses performed with Pathway Studio linked cell proliferation, cell differentiation, apoptosis, cell cycle, mitosis, cell death etc. with our microarrays results. Medline citation generated by the software and the fold change variation confirms a diminution of the proliferation, activation of the differentiation and a less well-defined role of apoptosis or wound healing. Wnt and DKK functional classes, DKK1, MACF1, ATF3, MME, TXNRD1, and BMP-2 genes proposed in previous publications after a manual analysis are also highlighted with other genes after Pathway Studio automatic procedure. Finally, an analysis conducted on a list of genes

  4. In vivo UVB irradiation induces clustering of Fas (CD95) on human epidermal cells

    DEFF Research Database (Denmark)

    Bang, Bo; Gniadecki, Robert; Larsen, Jørgen K

    2003-01-01

    a single dose of UVB irradiation. Normal healthy individuals were irradiated with three minimal erythema doses (MED) of UVB on forearm or buttock skin. Suction blisters from unirradiated and irradiated skin were raised, and Fas, FasL, and apoptosis of epidermal cells quantified by flow cytometry...

  5. Functional effects of proinflammatory factors present in Sjögren's syndrome salivary microenvironment in an in vitro model of human salivary gland.

    Science.gov (United States)

    Arce-Franco, Mayte; Dominguez-Luis, María; Pec, Martina K; Martínez-Gimeno, Carlos; Miranda, Pablo; Alvarez de la Rosa, Diego; Giraldez, Teresa; García-Verdugo, José María; Machado, José David; Díaz-González, Federico

    2017-09-19

    Primary Sjögren's syndrome (pSS) is an autoimmune exocrinopathy in which the role that the immune response plays in reducing exocrine gland function, including the glandular microenvironment of cytokines, has not been fully understood. Epithelial cells from biopsies of human parotid gland (HPG) were used to establish a model of human salivary gland in vitro. In this model, the functional consequences of several proinflammatory soluble factors present in the pSS glandular microenvironment were assessed. Stimulation with isoproterenol and calcium produced a significant increase in the basal activity of amylase in the HPG cell supernatants. Under these conditions, the presence of TNF-α and CXCL12 increased amylase mRNA cellular abundance, but reduced the amylase activity in the cell-free supernatant in a dose-dependent manner. IL-1β and IFN-γ, but not TGF-β, also diminished amylase secretion by HPG cells. These results suggest that the glandular microenvironment of cytokine, by acting post-transcriptionally, may be responsible, at least in part, for the reduced exocrine function observed in pSS patients. These data may help to a better understanding of the pathogenesis of SS, which in turn would facilitate the identification of new therapeutic targets for this disorder.

  6. Characterization and immunohistochemical localization of rat salivary cobalamin-binding protein and comparison with human salivary haptocorrin

    DEFF Research Database (Denmark)

    Nexø, Ebba; Poulsen, Steen Seier

    1985-01-01

    Rat saliva contains a cobalamin-binding protein that binds cobalamin as well as cobinamide. The protein binds cobalamin with an affinity constant of 8 X 10(10) l X mol-1, and it binds cobalamin over a more narrow pH range (pH 7.5-10) than does human haptocorrin. It has a Stokes radius of 2.45 nm...

  7. Differences in human skin between the epidermal growth factor receptor distribution detected by EGF binding and monoclonal antibody recognition

    DEFF Research Database (Denmark)

    Green, M R; Couchman, J R

    1985-01-01

    , the eccrine sweat glands, capillary system, and the hair follicle outer root sheath, generally similar in pattern to that previously reported for full-thickness rat skin and human epidermis. The same areas also bound EGF-R1 but in addition the monoclonal antibody recognized a cone of melanin containing......Two methods have been used to examine epidermal growth factor (EGF) receptor distribution in human scalp and foreskin. The first employed [125I]EGF viable explants and autoradiography to determine the EGF binding pattern while the second used a monoclonal antibody to the human EGF receptor to map...... whether EGF-R1 could recognize molecules unrelated to the EGF receptor, the EGF binding and EGF-R1 recognition profiles were compared on cultures of SVK14 cells, a SV40 transformed human keratinocyte cell line. EGF binding and EGF-R1 monoclonal antibody distribution on these cells was found to be similar...

  8. Repair of ultraviolet light damage to the DNA of cultured human epidermal keratinocytes and fibroblasts

    International Nuclear Information System (INIS)

    Taichman, L.B.; Setlow, R.B.

    1979-01-01

    Pure cultures of dermal fibroblasts and epidermal keroatinocytes have been obtained from a single biopsy of newborn foreskin. The cells were labeled, exposed to several doses of uv light, and allowed to repair in the dark for 16 h. The number of pyrimidine dimers before and after repair was assessed by measuring the numbers of sites in the DNA sensitive to a specific uv endonuclease. At all doses used, the extent of repair was similar in the cultured keratinocytes and cultured fibroblasts

  9. Repeated short climatic change affects the epidermal differentiation program and leads to matrix remodeling in a human organotypic skin model.

    Science.gov (United States)

    Boutrand, Laetitia-Barbollat; Thépot, Amélie; Muther, Charlotte; Boher, Aurélie; Robic, Julie; Guéré, Christelle; Vié, Katell; Damour, Odile; Lamartine, Jérôme

    2017-01-01

    Human skin is subject to frequent changes in ambient temperature and humidity and needs to cope with these environmental modifications. To decipher the molecular response of human skin to repeated climatic change, a versatile model of skin equivalent subject to "hot-wet" (40°C, 80% relative humidity [RH]) or "cold-dry" (10°C, 40% RH) climatic stress repeated daily was used. To obtain an exhaustive view of the molecular mechanisms elicited by climatic change, large-scale gene expression DNA microarray analysis was performed and modulated function was determined by bioinformatic annotation. This analysis revealed several functions, including epidermal differentiation and extracellular matrix, impacted by repeated variations in climatic conditions. Some of these molecular changes were confirmed by histological examination and protein expression. Both treatments (hot-wet and cold-dry) reduced the expression of genes encoding collagens, laminin, and proteoglycans, suggesting a profound remodeling of the extracellular matrix. Strong induction of the entire family of late cornified envelope genes after cold-dry exposure, confirmed at protein level, was also observed. These changes correlated with an increase in epidermal differentiation markers such as corneodesmosin and a thickening of the stratum corneum, indicating possible implementation of defense mechanisms against dehydration. This study for the first time reveals the complex pattern of molecular response allowing adaption of human skin to repeated change in its climatic environment.

  10. An Ixodes ricinus Tick Salivary Lectin Pathway Inhibitor Protects Borrelia burgdorferi sensu lato from Human Complement.

    Science.gov (United States)

    Wagemakers, Alex; Coumou, Jeroen; Schuijt, Tim J; Oei, Anneke; Nijhof, Ard M; van 't Veer, Cornelis; van der Poll, Tom; Bins, Adriaan D; Hovius, Joppe W R

    2016-04-01

    We previously identified tick salivary lectin pathway inhibitor (TSLPI) in Ixodes scapularis, a vector for Borrelia burgdorferi sensu stricto (s.s.) in North America. TSLPI is a salivary protein facilitating B. burgdorferi s.s. transmission and acquisition by inhibiting the host lectin complement pathway through interference with mannose binding lectin (MBL) activity. Since Ixodes ricinus is the predominant vector for Lyme borreliosis in Europe and transmits several complement sensitive B. burgdorferi sensu lato (s.l.) strains, we aimed to identify, describe, and characterize the I. ricinus ortholog of TSLPI. We performed (q)PCRs on I. ricinus salivary gland cDNA to identify a TSLPI ortholog. Next, we generated recombinant (r)TSLPI in a Drosophila expression system and examined inhibition of the MBL complement pathway and complement-mediated killing of B. burgdorferi s.l. in vitro. We identified a TSLPI ortholog in I. ricinus salivary glands with 93% homology at the RNA and 89% at the protein level compared to I. scapularis TSLPI, which was upregulated during tick feeding. In silico analysis revealed that TSLPI appears to be part of a larger family of Ixodes salivary proteins among which I. persulcatus basic tail salivary proteins and I. scapularis TSLPI and Salp14. I. ricinus rTSLPI inhibited the MBL complement pathway and protected B. burgdorferi s.s. and Borrelia garinii from complement-mediated killing. We have identified a TSLPI ortholog, which protects B. burgdorferi s.l. from complement-mediated killing in I. ricinus, the major vector for tick-borne diseases in Europe.

  11. Characterization of the cell penetrating properties of a human salivary proline-rich peptide.

    Science.gov (United States)

    Radicioni, Giorgia; Stringaro, Annarita; Molinari, Agnese; Nocca, Giuseppina; Longhi, Renato; Pirolli, Davide; Scarano, Emanuele; Iavarone, Federica; Manconi, Barbara; Cabras, Tiziana; Messana, Irene; Castagnola, Massimo; Vitali, Alberto

    2015-11-01

    Saliva contains hundreds of small proline-rich peptides most of which derive from the post-translational and post-secretory processing of the acidic and basic salivary proline-rich proteins. Among these peptides we found that a 20 residue proline-rich peptide (p1932), commonly present in human saliva and patented for its antiviral activity, was internalized within cells of the oral mucosa. The cell-penetrating properties of p1932 have been studied in a primary gingival fibroblast cell line and in a squamous cancer cell line, and compared to its retro-inverso form. We observed by mass-spectrometry, flow cytometry and confocal microscopy that both peptides were internalized in the two cell lines on a time scale of minutes, being the natural form more efficient than the retro-inverso one. The cytosolic localization was dependent on the cell type: both peptide forms were able to localize within nuclei of tumoral cells, but not in the nuclei of gingival fibroblasts. The uptake was shown to be dependent on the culture conditions used: peptide internalization was indeed effective in a complete medium than in a serum-free one allowing the hypothesis that the internalization could be dependent on the cell cycle. Both peptides were internalized likely by a lipid raft-mediated endocytosis mechanism as suggested by the reduced uptake in the presence of methyl-ß-cyclodextrin. These results suggest that the natural peptide may play a role within the cells of the oral mucosa after its secretion and subsequent internalization. Furthermore, lack of cytotoxicity of both peptide forms highlights their possible application as novel drug delivery agents.

  12. Human Salivary Protein Histatin 5 Has Potent Bactericidal Activity against ESKAPE Pathogens.

    Science.gov (United States)

    Du, Han; Puri, Sumant; McCall, Andrew; Norris, Hannah L; Russo, Thomas; Edgerton, Mira

    2017-01-01

    ESKAPE ( Enterococcus faecium , Staphylococcus aureus , Klebsiella pneumoniae , Acinetobacter baumanni , Pseudomonas aeruginosa , and Enterobacter species) pathogens have characteristic multiple-drug resistance and cause an increasing number of nosocomial infections worldwide. Peptide-based therapeutics to treat ESKAPE infections might be an alternative to conventional antibiotics. Histatin 5 (Hst 5) is a salivary cationic histidine-rich peptide produced only in humans and higher primates. It has high antifungal activity against Candida albicans through an energy-dependent, non-lytic process; but its bactericidal effects are less known. We found Hst 5 has bactericidal activity against S. aureus (60-70% killing) and A. baumannii (85-90% killing) in 10 and 100 mM sodium phosphate buffer (NaPB), while killing of >99% of P. aeruginosa , 60-80% E. cloacae and 20-60% of E. faecium was found in 10 mM NaPB. Hst 5 killed 60% of biofilm cells of P. aeruginosa , but had reduced activity against biofilms of S. aureus and A. baumannii . Hst 5 killed 20% of K. pneumonia biofilm cells but not planktonic cells. Binding and uptake studies using FITC-labeled Hst 5 showed E. faecium and E. cloacae killing required Hst 5 internalization and was energy dependent, while bactericidal activity was rapid against P. aeruginosa and A. baumannii suggesting membrane disruption. Hst 5-mediated killing of S. aureus was both non-lytic and energy independent. Additionally, we found that spermidine conjugated Hst 5 (Hst5-Spd) had improved killing activity against E. faecium, E. cloacae , and A. baumannii . Hst 5 or its derivative has antibacterial activity against five out of six ESKAPE pathogens and may be an alternative treatment for these infections.

  13. Comparisons of clustered regularly interspaced short palindromic repeats and viromes in human saliva reveal bacterial adaptations to salivary viruses.

    Science.gov (United States)

    Pride, David T; Salzman, Julia; Relman, David A

    2012-09-01

    Explorations of human microbiota have provided substantial insight into microbial community composition; however, little is known about interactions between various microbial components in human ecosystems. In response to the powerful impact of viral predation, bacteria have acquired potent defences, including an adaptive immune response based on the clustered regularly interspaced short palindromic repeats (CRISPRs)/Cas system. To improve our understanding of the interactions between bacteria and their viruses in humans, we analysed 13 977 streptococcal CRISPR sequences and compared them with 2 588 172 virome reads in the saliva of four human subjects over 17 months. We found a diverse array of viruses and CRISPR spacers, many of which were specific to each subject and time point. There were numerous viral sequences matching CRISPR spacers; these matches were highly specific for salivary viruses. We determined that spacers and viruses coexist at the same time, which suggests that streptococcal CRISPR/Cas systems are under constant pressure from salivary viruses. CRISPRs in some subjects were just as likely to match viral sequences from other subjects as they were to match viruses from the same subject. Because interactions between bacteria and viruses help to determine the structure of bacterial communities, CRISPR-virus analyses are likely to provide insight into the forces shaping the human microbiome. © 2012 Society for Applied Microbiology and Blackwell Publishing Ltd.

  14. UVA-induced immune suppression in human skin: protective effect of vitamin E in human epidermal cells in vitro

    International Nuclear Information System (INIS)

    Clement-Lacroix, P.; Michel, L.; Moysan, A.; Morliere, P.; Dubertret, L.

    1996-01-01

    UVA (320-400 nm) radiation damage to membranes, proteins, DNA and other cellular targets is predominantly related to oxidative processes. In the present study, we demonstrated that cutaneous UVA-induced immunosuppression can be related, at least in part, to the appearance of these oxidative processes. The UVA-induced oxidative processes in freshly isolated epidermal cells were monitored by measuring the thiobarbituric acid reactive substances (TBARS) as an index of peroxidation. The in vitro immunosuppressive effects of UVA were demonstrated by measuring the allogenic lymphocyte proliferation induced by epidermal cells or purified Langerhans cells in the mixed epidermal cell-lymphocyte reaction (MECLR). In addition, the effects of a potent antioxidant (vitamin E) on these two UVA-induced processes were analysed. (author)

  15. A nomogram for predicting pathological complete response in patients with human epidermal growth factor receptor 2 negative breast cancer

    International Nuclear Information System (INIS)

    Jin, Xi; Jiang, Yi-Zhou; Chen, Sheng; Yu, Ke-Da; Ma, Ding; Sun, Wei; Shao, Zhi-Min; Di, Gen-Hong

    2016-01-01

    The response to neoadjuvant chemotherapy has been proven to predict long-term clinical benefits for patients. Our research is to construct a nomogram to predict pathological complete response of human epidermal growth factor receptor 2 negative breast cancer patients. We enrolled 815 patients who received neoadjuvant chemotherapy from 2003 to 2015 and divided them into a training set and a validation set. Univariate logistic regression was performed to screen for predictors and construct the nomogram; multivariate logistic regression was performed to identify independent predictors. After performing the univariate logistic regression analysis in the training set, tumor size, hormone receptor status, regimens of neoadjuvant chemotherapy and cycles of neoadjuvant chemotherapy were the final predictors for the construction of the nomogram. The multivariate logistic regression analysis demonstrated that T4 status, hormone receptor status and receiving regimen of paclitaxel and carboplatin were independent predictors of pathological complete response. The area under the receiver operating characteristic curve of the training set and the validation set was 0.779 and 0.701, respectively. We constructed and validated a nomogram to predict pathological complete response in human epidermal growth factor receptor 2 negative breast cancer patients. We also identified tumor size, hormone receptor status and paclitaxel and carboplatin regimen as independent predictors of pathological complete response. The online version of this article (doi:10.1186/s12885-016-2652-z) contains supplementary material, which is available to authorized users

  16. Effect of age, gender and exercise on salivary dehydroepiandrosterone circadian rhythm profile in human volunteers.

    Science.gov (United States)

    Al-Turk, Walid; Al-Dujaili, Emad A S

    2016-02-01

    There has been a lot of effort by scientists to elucidate the multi functions of the naturally occurring hormone, dehydroepiandrosterone (DHEA). However, to plan research experiments optimally, it is important first to characterize the diurnal rhythm in healthy individuals. The aim of this research was to investigate the daily circadian rhythms of DHEA among the 2 genders, and the effect of age and exercise on salivary DHEA circadian rhythms. Volunteers (20-39 and 40-60 years) were recruited for 2 studies investigating the salivary DHEA circadian rhythm. The first study looked at the effect of gender and age on DHEA levels on 2 non-consecutive days, and the second study explored the effect of exercise on DHEA circadian rhythm in males. DHEA levels were estimated by a sensitive and specific ELISA method. The results showed a clear daily circadian rhythm in salivary DHEA in all participants groups, however the profile was flatter in the older female group. There was a significant difference between age and gender groups particularly at 8.00 h. In young males DHEA reduced from 541.1 ± 101.3 (mean ± sd) at 8.00 h to 198.9 ± 90.7 pg/mL at 18.00 h; pcircadian rhythm in salivary DHEA in all participants was observed, but the profile was flatter in the older groups. Copyright © 2016. Published by Elsevier Inc.

  17. Factors affecting antimicrobial activity of MUC7 12-mer, a human salivary mucin-derived peptide

    Directory of Open Access Journals (Sweden)

    Bobek Libuse A

    2007-11-01

    Full Text Available Abstract Background MUC7 12-mer (RKSYKCLHKRCR, a cationic antimicrobial peptide derived from the human low-molecular-weight salivary mucin MUC7, possesses potent antimicrobial activity in vitro. In order to evaluate the potential therapeutic application of the MUC7 12-mer, we examined the effects of mono- and divalent cations, EDTA, pH, and temperature on its antimicrobial activity. Methods Minimal Inhibitory Concentrations (MICs were determined using a liquid growth inhibition assay in 96-well microtiter plates. MUC7 12-mer was added at concentrations of 1.56–50 μM. MICs were determined at three endpoints: MIC-0, MIC-1, and MIC-2 (the lowest drug concentration showing 10%, 25% and 50% of growth, respectively. To examine the effect of salts or EDTA, a checkerboard microdilution technique was used. Fractional inhibitory concentration index (FICi was calculated on the basis of MIC-0. The viability of microbial cells treated with MUC7 12-mer in the presence of sodium or potassium was also determined by killing assay or flow cytometry. Results The MICs of MUC7 12-mer against organisms tested ranged from 6.25–50 μM. For C. albicans, antagonism (FICi 4.5 was observed for the combination of MUC7 12-mer and calcium; however, there was synergism (FICi 0.22 between MUC7 12-mer and EDTA, and the synergism was retained in the presence of calcium at its physiological concentration (1–2 mM. No antagonism but additivity or indifference (FICi 0.55–2.5 was observed for the combination of MUC7 12-mer and each K+, Na+, Mg2+, or Zn2+. MUC7 12-mer peptide (at 25 μM also exerted killing activity in the presence of NaCl, (up to 25 mM for C. albicans and up to 150 mM for E. coli, a physiological concentration of sodium in the oral cavity and serum, respectively and retained candidacidal activity in the presence of KCl (up to 40 mM. The peptide exhibited higher inhibitory activity against C. albicans at pH 7, 8, and 9 than at pH 5 and 6, and temperature up to

  18. Salivary scintigraphy

    International Nuclear Information System (INIS)

    Sabri, P.J.

    1988-01-01

    Salivary gland scintigraphy with technetium 99m ( 99m Tc) in the form pertechnetate ion is a relatively simple procedure, which can provide a unique and sensitive means for investigating salivary gland physiologic function and its derangements. However, salivary scintigraphy is poorly suited for the detection and characterization of masses in and around the salivary glands. Computed tomography (CT) has, therefore, largely supplanted scintigraphy for the evaluation of masses and is the method of choice because it can provide exquisite anatomic detail. Consequently, CT is more sensitive for mass detection and can also provide useful information as to whether a mass has arisen from within or from outside of a salivary gland or whether a mass is circumscribed or invasive. It also can disclose the relationship of the mass to the facial nerve and occasionally can provide histologic characterization of such masses as cysts, lipomas, and masseter muscle hypertrophy

  19. Changes in human parotid salivary protein and sialic acid levels during pregnancy.

    Science.gov (United States)

    D'Alessandro, S; Curbelo, H M; Tumilasci, O R; Tessler, J A; Houssay, A B

    1989-01-01

    Saliva was collected with a Carlson-Crittenden device, under citric acid stimulation, in 107 pregnant women, 9 puerperal and 7 non-pregnant controls. No significant changes were found in salivary flow rate, pH and amylase levels. The total protein levels were decreased during pregnancy and the puerperium. The sialic acid levels decreased gradually but markedly during pregnancy, returning to normal levels in the puerperium. These changes in parotid saliva may be related to the hormonal changes of pregnancy.

  20. Salivary Mucin 19 Glycoproteins

    Science.gov (United States)

    Culp, David J.; Robinson, Bently; Cash, Melanie N.; Bhattacharyya, Indraneel; Stewart, Carol; Cuadra-Saenz, Giancarlo

    2015-01-01

    Saliva functions in innate immunity of the oral cavity, protecting against demineralization of teeth (i.e. dental caries), a highly prevalent infectious disease associated with Streptococcus mutans, a pathogen also linked to endocarditis and atheromatous plaques. Gel-forming mucins are a major constituent of saliva. Because Muc19 is the dominant salivary gel-forming mucin in mice, we studied Muc19−/− mice for changes in innate immune functions of saliva in interactions with S. mutans. When challenged with S. mutans and a cariogenic diet, total smooth and sulcal surface lesions are more than 2- and 1.6-fold higher in Muc19−/− mice compared with wild type, whereas the severity of lesions are up to 6- and 10-fold higher, respectively. Furthermore, the oral microbiota of Muc19−/− mice display higher levels of indigenous streptococci. Results emphasize the importance of a single salivary constituent in the innate immune functions of saliva. In vitro studies of S. mutans and Muc19 interactions (i.e. adherence, aggregation, and biofilm formation) demonstrate Muc19 poorly aggregates S. mutans. Nonetheless, aggregation is enhanced upon adding Muc19 to saliva from Muc19−/− mice, indicating Muc19 assists in bacterial clearance through formation of heterotypic complexes with salivary constituents that bind S. mutans, thus representing a novel innate immune function for salivary gel-forming mucins. In humans, expression of salivary MUC19 is unclear. We find MUC19 transcripts in salivary glands of seven subjects and demonstrate MUC19 glycoproteins in glandular mucous cells and saliva. Similarities and differences between mice and humans in the expression and functions of salivary gel-forming mucins are discussed. PMID:25512380

  1. BK virus has tropism for human salivary gland cells in vitro: Implications for transmission

    International Nuclear Information System (INIS)

    Jeffers, Liesl K.; Madden, Vicki; Webster-Cyriaque, Jennifer

    2009-01-01

    Background: In this study, it was determined that BKV is shed in saliva and an in vitro model system was developed whereby BKV can productively infect both submandibular (HSG) and parotid (HSY) salivary gland cell lines. Results: BKV was detected in oral fluids using quantitative real-time PCR (QRTPCR). BKV infection was determined using quantitative RT-PCR, immunofluorescence and immunoblotting assays. The infectivity of BKV was inhibited by pre-incubation of the virus with gangliosides that saturated the major capsid protein, VP1, halting receptor mediated BKV entry into salivary gland cells. Examination of infected cultures by transmission electron microscopy revealed 45-50 nm BK virions clearly visible within the cells. Subsequent to infection, encapsidated BK virus was detected in the supernatant. Conclusion: We thus demonstrated that BKV was detected in oral fluids and that BK infection and replication occur in vitro in salivary gland cells. These data collectively suggest the potential for BKV oral route of transmission and oral pathogenesis.

  2. A Premature Termination of Human Epidermal Growth Factor Receptor Transcription in Escherichia coli

    Directory of Open Access Journals (Sweden)

    Jihene Elloumi-Mseddi

    2014-01-01

    Full Text Available Our success in producing an active epidermal growth factor receptor (EGFR tyrosine kinase in Escherichia coli encouraged us to express the full-length receptor in the same host. Despite its large size, we were successful at producing the full-length EGFR protein fused to glutathione S-transferase (GST that was detected by Western blot analysis. Moreover, we obtained a majoritarian truncated GST-EGFR form detectable by gel electrophoresis and Western blot. This truncated protein was purified and confirmed by MALDI-TOF/TOF analysis to belong to the N-terminal extracellular region of the EGFR fused to GST. Northern blot analysis showed two transcripts suggesting the occurrence of a transcriptional arrest.

  3. Phase III randomized study comparing docetaxel plus trastuzumab with vinorelbine plus trastuzumab as first-line therapy of metastatic or locally advanced human epidermal growth factor receptor 2-positive breast cancer: the HERNATA study

    DEFF Research Database (Denmark)

    Andersson, Michael; Lidbrink, Elisabeth; Bjerre, Karsten

    2011-01-01

    To evaluate docetaxel or vinorelbine, both with trastuzumab, as first-line therapy of human epidermal growth factor receptor 2-positive advanced breast cancer.......To evaluate docetaxel or vinorelbine, both with trastuzumab, as first-line therapy of human epidermal growth factor receptor 2-positive advanced breast cancer....

  4. Epidermal growth factor receptor antibody plus recombinant human endostatin in treatment of hepatic metastases after remnant gastric cancer resection

    Institute of Scientific and Technical Information of China (English)

    2007-01-01

    We report a 55-year-old male who developed advanced hepatic metastasis and peritoneal carcinomatosis after resection of remnant gastric cancer resection 3 mo ago. The patient only received epidermal growth factor (EGF) receptor antibody (Cetuximab) plus recombinant human endostatin (Endostar).Anti-tumor activity was assessed by 18F-fluorodeoxyglucose (18F-FDG)positron emission tomography/computer tomography (PET/CT) at baseline and then every 4 wk. The case illustrates that 18FDG-PET/CT could make an early prediction of the response to Cetuximab plus Endostar in such clinical situations. 18FDG-PET/CT is a useful molecular imaging modality to evaluate the biological response advanced hepatic metastasis and peritoneal carcinomatosis to Cetuximab plus Endostar in patients after remnant gastric cancer resection.

  5. Direct astatination of a tumour-binding protein, human epidermal growth factor, using nido-carborane as a prosthetic group

    International Nuclear Information System (INIS)

    Sjoestroem, A.; Carlsson, J.; Lundqvist, H.; Koziorowski, J.

    2003-01-01

    A method for direct astatine labeling of proteins has been investigated. Binding sites for astatine were created by coupling of a nido-carborane derivative to a protein, the human epidermal growth factor (hEGF), using two different conjugation methods - by glutaraldehyde cross-linking or by introduction of sulfohydryl groups by Traut's reagent with subsequent linking of ANC-1 with m-maleimidobenzoyl-N-hydroxysulfosuccinimide ester. The conjugates were astatinated using the Chloramine-T method in high yield. The best labeling was obtained by the glutaraldehyde conjugate with an average yield of 68 ± 9%. In vitro stability tests indicated that the glutaraldehyde conjugated label was as stable as hEGF labeled with astatobenzoate. (author)

  6. Protein kinase C is differentially regulated by thrombin, insulin, and epidermal growth factor in human mammary tumor cells

    Energy Technology Data Exchange (ETDEWEB)

    Gomez, M.L.; Tellez-Inon, M.T. (Instituto de Ingenieria Genetica y Biologia Molecular, Buenos Aires (Argentina)); Medrano, E.E.; Cafferatta, E.G.A. (Instituto de Investigaciones Bioquimicas Fundacion Campomar, Buenos Aires (Argentina))

    1988-03-01

    The exposure of serum-deprived mammary tumor cells MCF-7 and T-47D to insulin, thrombin, and epidermal growth factor (EGF) resulted in dramatic modifications in the activity and in the translocation capacity of protein kinase C from cytosol to membrane fractions. Insulin induces a 600% activation of the enzyme after 5 h of exposure to the hormone in MCF-7 cells; thrombin either activates (200% in MCF-7) or down-regulates (in T-47D), and EGF exerts only a moderate effect. Thus, the growth factors studied modulate differentially the protein kinase C activity in human mammary tumor cells. The physiological significance of the results obtained are discussed in terms of the growth response elicited by insulin, thrombin, and EGF.

  7. Harnessing Integrative Omics to Facilitate Molecular Imaging of the Human Epidermal Growth Factor Receptor Family for Precision Medicine.

    Science.gov (United States)

    Pool, Martin; de Boer, H Rudolf; Hooge, Marjolijn N Lub-de; van Vugt, Marcel A T M; de Vries, Elisabeth G E

    2017-01-01

    Cancer is a growing problem worldwide. The cause of death in cancer patients is often due to treatment-resistant metastatic disease. Many molecularly targeted anticancer drugs have been developed against 'oncogenic driver' pathways. However, these treatments are usually only effective in properly selected patients. Resistance to molecularly targeted drugs through selective pressure on acquired mutations or molecular rewiring can hinder their effectiveness. This review summarizes how molecular imaging techniques can potentially facilitate the optimal implementation of targeted agents. Using the human epidermal growth factor receptor (HER) family as a model in (pre)clinical studies, we illustrate how molecular imaging may be employed to characterize whole body target expression as well as monitor drug effectiveness and the emergence of tumor resistance. We further discuss how an integrative omics discovery platform could guide the selection of 'effect sensors' - new molecular imaging targets - which are dynamic markers that indicate treatment effectiveness or resistance.

  8. Thermal analysis of epidermal electronic devices integrated with human skin considering the effects of interfacial thermal resistance

    Science.gov (United States)

    Li, Yuhang; Zhang, Jianpeng; Xing, Yufeng; Song, Jizhou

    2018-05-01

    Epidermal electronic devices (EEDs) have similar mechanical properties as those of human skin such that they can be integrated with human skin for potential applications in monitoring of human vital signs for diagnostic, therapeutic or surgical functions. Thermal management is critical for EEDs in these applications since excessive heating may cause discomfort. Comprehensive analytical studies, finite element analysis and experiments are carried out to study the effects of interfacial thermal resistance between EEDs and human skin on thermal properties of the EED/skin system in this paper. The coupling between the Fourier heat transfer in EEDs and the bio-heat transfer in human skin is accounted in the analytical model based on the transfer matrix method to give accurate predictions on temperatures, which agree well with finite element analysis and experimental measurements. It is shown that the maximum temperature increase of the EED for the case of imperfect bonding between EED and skin is much higher than that of perfect bonding. These results may help the design of EEDs in bi-integrated applications and suggest a valuable route to evaluate the bonding condition between EEDs and biological tissues.

  9. American Society of Clinical Oncology/College of American Pathologists guideline recommendations for human epidermal growth factor receptor 2 testing in breast cancer

    NARCIS (Netherlands)

    Wolff, Antonio C.; Hammond, M. Elizabeth H.; Schwartz, Jared N.; Hagerty, Karen L.; Allred, D. Craig; Cote, Richard J.; Dowsett, Mitchell; Fitzgibbons, Patrick L.; Hanna, Wedad M.; Langer, Amy; McShane, Lisa M.; Paik, Soonmyung; Pegram, Mark D.; Perez, Edith A.; Press, Michael F.; Rhodes, Anthony; Sturgeon, Catharine; Taube, Sheila E.; Tubbs, Raymond; Vance, Gail H.; van de Vijver, Marc; Wheeler, Thomas M.; Hayes, Daniel F.

    2007-01-01

    PURPOSE: To develop a guideline to improve the accuracy of human epidermal growth factor receptor 2 (HER2) testing in invasive breast cancer and its utility as a predictive marker. METHODS: The American Society of Clinical Oncology and the College of American Pathologists convened an expert panel,

  10. Experimental radioimmunotherapy of a xenografted human glioma using [sup 131]I-labeled monoclonal antibody to epidermal growth factor receptor

    Energy Technology Data Exchange (ETDEWEB)

    Takahashi, Hiroshi; Nakazawa, Shozo [Nippon Medical School, Tokyo (Japan); Herlyn, D

    1993-09-01

    [sup 131]I-labeled F (ab')[sub 2] fragments of murine monoclonal antibodies (MAb) 425 specific to the epidermal growth factor receptor expressed on human gliomas were used in experimental human malignant glioma immunotherapy. Two injections of 150 [mu]Ci [sup 131]I-labeled 425 F(ab')[sub 2] achieved growth inhibition of U-87MG human malignant glioma xenografts in nude mice. This radiolabeled specific MAb F(ab')[sub 2] was significantly superior to radiolabeled fragments of an anti-hepatitis virus control MAb A5C3 in influencing tumor growth. However, similar treatment of established human malignant glioma xenografts did not inhibit progressive tumor growth significantly. No clear tumor inhibition was produced by unlabeled MAb 425F(ab')[sub 2]. These studies suggest that [sup 131]I-labeled MAbs have a significant antitumor effect where unmodified antibody is ineffective. Multiple doses of antibody may achieve an increase in labeled MAb concentration in tumors. (author).

  11. Expression of the epidermal growth factor receptor in human small cell lung cancer cell lines

    DEFF Research Database (Denmark)

    Damstrup, L; Rygaard, K; Spang-Thomsen, M

    1992-01-01

    of EGF receptor mRNA in all 10 cell lines that were found to be EGF receptor-positive and in one cell line that was found to be EGF receptor-negative in the radioreceptor assay and affinity labeling. Our results provide, for the first time, evidence that a large proportion of a broad panel of small cell......Epidermal growth factor (EGF) receptor expression was evaluated in a panel of 21 small cell lung cancer cell lines with radioreceptor assay, affinity labeling, and Northern blotting. We found high-affinity receptors to be expressed in 10 cell lines. Scatchard analysis of the binding data...... demonstrated that the cells bound between 3 and 52 fmol/mg protein with a KD ranging from 0.5 x 10(-10) to 2.7 x 10(-10) M. EGF binding to the receptor was confirmed by affinity-labeling EGF to the EGF receptor. The cross-linked complex had a M(r) of 170,000-180,000. Northern blotting showed the expression...

  12. Rho A Regulates Epidermal Growth Factor-Induced Human Osteosarcoma MG63 Cell Migration

    Directory of Open Access Journals (Sweden)

    Jinyang Wang

    2018-05-01

    Full Text Available Osteosarcoma, the most common primary bone tumor, occurs most frequently in children and adolescents and has a 5-year survival rate, which is unsatisfactory. As epidermal growth factor receptor (EGFR positively correlates with TNM (tumor-node-metastasis stage in osteosarcoma, EGFR may play an important role in its progression. The purpose of this study was to explore potential mechanisms underlying this correlation. We found that EGF promotes MG63 cell migration and invasion as well as stress fiber formation via Rho A activation and that these effects can be reversed by inhibiting Rho A expression. In addition, molecules downstream of Rho A, including ROCK1, LIMK2, and Cofilin, are activated by EGF in MG63 cells, leading to actin stress fiber formation and cell migration. Moreover, inhibition of ROCK1, LIMK2, or Cofilin in MG63 cells using known inhibitors or short hairpin RNA (shRNA prevents actin stress fiber formation and cell migration. Thus, we conclude that Rho A/ROCK1/LIMK2/Cofilin signaling mediates actin microfilament formation in MG63 cells upon EGFR activation. This novel pathway provides a promising target for preventing osteosarcoma progression and for treating this cancer.

  13. Niclosamide inhibits epithelial-mesenchymal transition and tumor growth in lapatinib-resistant human epidermal growth factor receptor 2-positive breast cancer.

    Science.gov (United States)

    Liu, Junjun; Chen, Xiaosong; Ward, Toby; Mao, Yan; Bockhorn, Jessica; Liu, Xiaofei; Wang, Gen; Pegram, Mark; Shen, Kunwei

    2016-02-01

    Acquired resistance to lapatinib, a human epidermal growth factor receptor 2 kinase inhibitor, remains a clinical problem for women with human epidermal growth factor receptor 2-positive advanced breast cancer, as metastasis is commonly observed in these patients. Niclosamide, an anti-helminthic agent, has recently been shown to exhibit cytotoxicity to tumor cells with stem-like characteristics. This study was designed to identify the mechanisms underlying lapatinib resistance and to determine whether niclosamide inhibits lapatinib resistance by reversing epithelial-mesenchymal transition. Here, two human epidermal growth factor receptor 2-positive breast cancer cell lines, SKBR3 and BT474, were exposed to increasing concentrations of lapatinib to establish lapatinib-resistant cultures. Lapatinib-resistant SKBR3 and BT474 cells exhibited up-regulation of the phenotypic epithelial-mesenchymal transition markers Snail, vimentin and α-smooth muscle actin, accompanied by activation of nuclear factor-кB and Src and a concomitant increase in stem cell marker expression (CD44(high)/CD24(low)), compared to naive lapatinib-sensitive SKBR3 and BT474 cells, respectively. Interestingly, niclosamide reversed epithelial-mesenchymal transition, induced apoptosis and inhibited cell growth by perturbing aberrant signaling pathway activation in lapatinib-resistant human epidermal growth factor receptor 2-positive cells. The ability of niclosamide to alleviate stem-like phenotype development and invasion was confirmed. Collectively, our results demonstrate that lapatinib resistance correlates with epithelial-mesenchymal transition and that niclosamide inhibits lapatinib-resistant cell viability and epithelial-mesenchymal transition. These findings suggest a role of niclosamide or derivatives optimized for more favorable bioavailability not only in reversing lapatinib resistance but also in reducing metastatic potential during the treatment of human epidermal growth factor receptor

  14. Effects of recombinant human epidermal growth factor (rhEGF) on experimental radiation-induced oral mucositis in rats

    International Nuclear Information System (INIS)

    Jung, Kwon Il; Kim, Sun Hee; Moon, Soo Young; Kim, Yeon Wha; Hong, Joon Pio; Lee, Sang Wook; Kim, Hyun Sook

    2006-01-01

    Oral mucositis is a common toxicity of radiation or chemotherapy, which is used a treatment for head and neck cancer. We investigated effects of recombinant human epidermal growth factor (rhEGF) on radiation-induced oral mucositis in rat model. Spraque-Dawley rats (7 per group) exposed to a single dose of 25 Gy (day 0) on their head, except for one group, were randomly divided into un-treated, vehicle-treated, and two rhEGF-treated groups. Rats were topically applied with rhEGF (15 or 30 μ g/oral cavity/day) or vehicle to their oral mucosa. Survival rate of rats, weight changes, and food intakes were examined from day 0 to 18 after radiation. Histology study was performed from oral mucosa of rats at day 7 and 18 after radiation. rhEGF-treated groups (15 or 30 μ g/day) showed all survival rate 33%, whereas un-treated and vehicle-treated groups showed all survival rate 0% at the end of experiment. rhEGF-treated groups statistically had less weight loss compared to vehicle-treated group from day 2 to 7 after radiation. Food intake of rats with rhEGF treatment turned to increase at day 14 after radiation. At 7 day after radiation, un-treated and vehicle-treated groups showed severe pseudomembraneous of ulcerative oral mucositis. On the other hand, rhEGF-treated groups had no more than cellular swelling and degeneration of epidermal cells in oral mucosa of rats. These results suggest that rhEGF has significantly positive effects on radiation-induced oral mucositis in rats. rhEGF display a therapeutic potential on a clinical level

  15. Cytogenetic evaluation of human glial tumors: correlation of overexpression of epidermal growth factor receptor (EGFB) with abnormalities of chromosome 7

    International Nuclear Information System (INIS)

    Bell, C.W.

    1987-01-01

    Chromosome banding analysis of human glial tumors were performed using G- and Q-banding techniques in an attempt to establish recurring sites of chromosome change. Results revealed a nonrandom karyotypic profile including aneuploidy and considerable variation in chromosome number (range 40 → 200). All tumors examined displayed numerical abnormalities, with the most common numeric change being a gain of chromosome 7. An attempt was then made to correlate the observed chromosome 7 changes with activation of the cellular proto-oncogene c-erb-B, whose produce is the epidermal growth factor receptor (EGFR). Six human glial tumors were analyzed for 125 I-EGF binding, EGFR gene copy number, EGFR gene rearrangement, mRNA expression, and karyotypic profile. Saturation analysis at 4 0 C revealed significant numbers of EGFR's in all 6 tumors. Southern blotting analysis utilizing cDNA probes for the EGFR failed to demonstrate significant amplification or structural rearrangement of the EFGR gene. The results suggest that overexpression of the EGFR may be related to an alternative mechanism, other than gene amplification and elevated mRNA levels, such as the regulation of receptor biosynthesis and degradation. In summary, findings indicate that alterations of chromosome 7 are the most prevalent chromosomal change in human glial tumors, and that these alterations may lead to overexpression of the protooncogene c-erb-B

  16. Assessment of Epidermal Growth Factor Receptor (EGFR expression in human meningioma

    Directory of Open Access Journals (Sweden)

    Perry Arie

    2010-05-01

    Full Text Available Abstract Purpose This study explores whether meningioma expresses epidermal growth factor receptor (EGFR and determines if there is a correlation between the WHO grade of this tumor and the degree of EGFR expression. Methods Following institutional review board approval, 113 meningioma specimens from 89 patients were chosen. Of these, 85 were used for final analysis. After a blinded review, immunohistochemical stains for EGFR were performed. Staining intensity (SI was scored on a scale 0-3 (from no staining to strong staining. Staining percentage of immunoreactive cells (SP was scored 1-5 (from the least to the maximum percent of the specimen staining. Immunohistochemical score (IHS was calculated as the product of SI and SP. Results Eighty-five samples of meningioma were classified in accordance with World Health Organization (WHO criteria: benign 57/85 (67%, atypical 23/85 (27%, and malignant 5/85 (6%. The majority of samples demonstrated a moderate SI for EGFR. IHS for EGFR demonstrated a significant association between SI and histopathologic subtype. Also, there was a correlation between the SP and histopathologic subtype (p = 0.029. A significant association was determined when the benign and the atypical samples were compared to the malignant with respect to the SP (p = 0.009. While there was a range of the IHS for the benign and the atypical histologic subtypes, malignant tumors exhibited the lowest score and were statistically different from the benign and the atypical specimens (p Conclusions To our knowledge, this represents the largest series of meningioma samples analyzed for EGFR expression reported in the literature. EGFR expression is greatest in benign meningiomas and may serve a potential target for therapeutic intervention with selective EGFR inhibitors.

  17. Protective effect of Juglans regia L. against ultraviolet B radiation induced inflammatory responses in human epidermal keratinocytes.

    Science.gov (United States)

    Muzaffer, Umar; Paul, V I; Prasad, Nagarajan Rajendra; Karthikeyan, Ramasamy; Agilan, Balupillai

    2018-03-15

    Juglans regia L. has a history of traditional medicinal use for the treatment of various maladies and have been documented with significant antioxidant and antiinflammatory properties. Although all parts of the plant are medicinally important, but male the flower of the plant has not been yet investigated against the photo-damage. The present study, we sought to determine the photoprotective effect of the male flower of J. regia L. against ultraviolet-B radiation-induced inflammatory responses in human skin cells. The profile of pharmacological active compounds present in the male flower of J. regia was analyzed by GC-MS. Then, the antioxidant property of methanolic extract of J. regia (MEJR) was analyzed by in vitro free radical scavenging assays. Further, we analyzed the sun protection factor of this extract by spectrophotometry. Moreover, we investigated the photoprotective effect of MEJR against UVB induced inflammatory signaling in human epidermal cells. Human skin epidermal keratinocytes (HaCaT) were pretreated with the MEJR (80 µg/ml), 30 min prior to UVB-irradiation at a dose of 20 mJ/cm 2 and were investigated for lipid peroxidation, enzymatic antioxidants activity, apoptosis and inflammatory markers expression level. The GC-MS results showed the presence of good amount of pharmacologically active compounds in the MEJR. We observed that the MEJR possess significant free radical scavenging activity and it was comparable with standard antioxidants. Further, the MEJR exhibits 8.8 sun-protection-factor (SPF) value. Pretreatment with MEJR, 30 min prior to UVB-irradiation, prevented ROS generation, lipid peroxidation and restored the activity of antioxidant status in HaCaT cells. Moreover, MEJR pretreatment significantly prevented UVB activated inflammatory markers like TNF-α, IL-1, IL-6, NF-κB, COX-2 in HaCaT. The present findings suggest that MEJR exhibit photoprotective effects and hence it may be useful for the treatment of inflammation related

  18. EMMPRIN contributes to the in vitro invasion of human salivary adenoid cystic carcinoma cells

    Science.gov (United States)

    YANG, XINJIE; ZHANG, PU; MA, QIN; KONG, LIANG; LI, YUAN; LIU, BAOLIN; LEI, DELIN

    2012-01-01

    Extracellular matrix metalloproteinase inducer (EMMPRIN) is a transmembrane glycoprotein that is involved in tumor invasion by stimulating matrix metalloproteinase (MMP) expression. Our previous immunohistochemical study found that the expression of EMMPRIN in salivary adenoid cystic carcinoma (SACC) was positively correlated with tumor perineural and perivascular invasion. The present study was designed to further investigate the role of EMMPRIN in the invasion of SACC. Western blot results showed that EMMPRIN was upregulated in the highly metastatic SACC cell line SACC-LM, compared to SACC-83, a SACC cell line with low metastatic ability. Blocking of EMMPRIN by its antibody significantly decreased the adhesion, secretion of MMP-2 and MMP-9, and invasion activity of SACC-LM cells in vitro (PEMMPRIN may play an important role in the invasion of SACC by stimulating the expression of MMP-2 and MMP-9 in tumor and stromal cells. PMID:22200897

  19. Establishment of H2Mab-119, an Anti-Human Epidermal Growth Factor Receptor 2 Monoclonal Antibody, Against Pancreatic Cancer.

    Science.gov (United States)

    Yamada, Shinji; Itai, Shunsuke; Nakamura, Takuro; Chang, Yao-Wen; Harada, Hiroyuki; Suzuki, Hiroyoshi; Kaneko, Mika K; Kato, Yukinari

    2017-12-01

    Human epidermal growth factor receptor 2 (HER2) is overexpressed in breast cancer and is associated with poor clinical outcomes. In addition, HER2 expression has been reported in other cancers, such as gastric, colorectal, lung, and pancreatic cancers. An anti-HER2 humanized antibody, trastuzumab, leads to significant survival benefits in patients with HER2-overexpressing breast cancers and gastric cancers. Herein, we established a novel anti-HER2 monoclonal antibody (mAb), H 2 Mab-119 (IgG 1 , kappa), and characterized its efficacy against pancreatic cancers using flow cytometry, Western blot, and immunohistochemical analyses. H 2 Mab-119 reacted with pancreatic cancer cell lines, such as KLM-1, Capan-2, and MIA PaCa-2, but did not react with PANC-1 in flow cytometry analysis. Western blot analysis also revealed a moderate signal for KLM-1 and a weak signal for MIA PaCa-2, although H 2 Mab-119 reacted strongly with LN229/HER2 cells. Finally, immunohistochemical analyses with H 2 Mab-119 revealed sensitive and specific reactions against breast and colon cancers but did not react with pancreatic cancers, indicating that H 2 Mab-119 is useful for detecting HER2 overexpression in pancreatic cancers using flow cytometry and Western blot analyses.

  20. New Whitening Constituents from Taiwan-Native Pyracantha koidzumii: Structures and Tyrosinase Inhibitory Analysis in Human Epidermal Melanocytes

    Directory of Open Access Journals (Sweden)

    Rong-Dih Lin

    2015-12-01

    Full Text Available Nontoxic natural products useful in skin care cosmetics are of considerable interest. Tyrosinase is a rate-limiting enzyme for which its inhibitor is useful in developing whitening cosmetics. Pyracantha koidzumii (Hayata Rehder is an endemic species in Taiwan that exhibits tyrosinase-inhibitory activity. To find new active natural compounds from P. koidzumii, we performed bioguided isolation and studied the related activity in human epidermal melanocytes. In total, 13 compounds were identified from P. koidzumii in the present study, including two new compounds, 3,6-dihydroxy-2,4-dimethoxy-dibenzofuran (9 and 3,4-dihydroxy-5-methoxybiphenyl-2ʹ-O-β-d-glucopyranoside (13, as well as 11 known compounds. The new compound 13 exhibited maximum potency in inhibiting cellular tyrosinase activity, the protein expression of cellular tyrosinase and tyrosinase-related protein-2, as well as the mRNA expression of Paired box 3 and microphthalmia-associated transcription factor in a concentration-dependent manner. In the enzyme kinetic assay, the new compound 13 acted as an uncompetitive mixed-type inhibitor against the substrate l-3,4-dihydroxyphenylalanine and had a Km value against this substrate of 0.262 mM, as calculated using the Lineweaver–Burk plots. Taken together, our findings show compound 13 exhibits tyrosinase inhibition in human melanocytes and compound 13 may be a potential candidate for use in cosmetics.

  1. Trichloroethylene-mediated cytotoxicity in human epidermal keratinocytes is mediated by the rapid accumulation of intracellular calcium: Interception by naringenin.

    Science.gov (United States)

    Ali, F; Khan, A Q; Khan, R; Sultana, S

    2016-02-01

    Industrial solvents pose a significant threat to the humankind. The mechanisms of their toxicity still remain in debate. Trichloroethylene (TCE) is a widespread industrial solvent responsible for severe liver dysfunction, cutaneous toxicity in occupationally exposed humans. We utilized an in vitro system of human epidermal keratinocyte (HaCaT) cells in this study to avoid complex cell and extracellular interactions. We report the cytotoxicity of organic solvent TCE in HaCaT and its reversal by a natural flavanone, naringenin (Nar). The cytotoxicity was attributed to the rapid intracellular free calcium (Ca(2+)) release, which might lead to the elevation of protein kinase C along with robust free radical generation, instability due to energy depletion, and sensitization of intracellular stress signal transducer nuclear factor κB. These effects were actually seen to induce significant amount of genomic DNA fragmentation. Furthermore, all these effects of TCE were effectively reversed by the treatment of Nar, a natural flavanone. Our studies identify intracellular Ca as a unique target used by organic solvents in the cytotoxicity and highlight the Ca(2+) ion stabilizer properties of Nar. © The Author(s) 2015.

  2. 125I-human epidermal growth factor specific binding to placentas and fetal membranes from varoius pregnancy states

    International Nuclear Information System (INIS)

    Hofmann, G.E.; Siddiqi, T.A.; Rao, Ch. V.; Carman, F.R.

    1988-01-01

    Specific binding of 125 I-human epidermal growth factor (hEGF) to homogenates of term human placentas and fetal membranes from normal and appropriate for gestational age (N = 20), intrauterine growth retarded (N = 9), twin (N = 11), White class A/B diabetic (N = 12), and large for gestational age (N = 13) pregnancies was measured. In all pregnancy states, placentas bound approximately four times more 125 I-hEGF than did fetal membranes (P 125 I-hEGF binding to fetal membranes from the various pregnancy states (P 125 I-hEGF specific binding to placentas from intrauterine growth retarded or twin pregnancies was significantly greater compared with placentas from normal and appropriate for gestational age pregnancies (P 125 I-hEGF specific binding did not differ between placentas from intrauterine growth retarded or twin pregnancies (P 125 I-hEGF binding did not vary with fetal sex, maternal race, placental weight, or gestational age between 37 to 42 weeks (P 125 I-hEGF binding increased with increasing infant weight when appropriate for gestational age and large for gestational age infants were included (P<0.05, r = 0.38, N = 32) but not for intrauterine growth retarded, appropriate for gestational age, or large for gestational age infants alone. (author)

  3. New Whitening Constituents from Taiwan-Native Pyracantha koidzumii: Structures and Tyrosinase Inhibitory Analysis in Human Epidermal Melanocytes

    Science.gov (United States)

    Lin, Rong-Dih; Chen, Mei-Chuan; Liu, Yan-Ling; Lin, Yi-Tzu; Lu, Mei-Kuang; Hsu, Feng-Lin; Lee, Mei-Hsien

    2015-01-01

    Nontoxic natural products useful in skin care cosmetics are of considerable interest. Tyrosinase is a rate-limiting enzyme for which its inhibitor is useful in developing whitening cosmetics. Pyracantha koidzumii (Hayata) Rehder is an endemic species in Taiwan that exhibits tyrosinase-inhibitory activity. To find new active natural compounds from P. koidzumii, we performed bioguided isolation and studied the related activity in human epidermal melanocytes. In total, 13 compounds were identified from P. koidzumii in the present study, including two new compounds, 3,6-dihydroxy-2,4-dimethoxy-dibenzofuran (9) and 3,4-dihydroxy-5-methoxybiphenyl-2ʹ-O-β-d-glucopyranoside (13), as well as 11 known compounds. The new compound 13 exhibited maximum potency in inhibiting cellular tyrosinase activity, the protein expression of cellular tyrosinase and tyrosinase-related protein-2, as well as the mRNA expression of Paired box 3 and microphthalmia-associated transcription factor in a concentration-dependent manner. In the enzyme kinetic assay, the new compound 13 acted as an uncompetitive mixed-type inhibitor against the substrate l-3,4-dihydroxyphenylalanine and had a Km value against this substrate of 0.262 mM, as calculated using the Lineweaver–Burk plots. Taken together, our findings show compound 13 exhibits tyrosinase inhibition in human melanocytes and compound 13 may be a potential candidate for use in cosmetics. PMID:26633381

  4. Comparison of rat epidermal keratinocyte organotypic culture (ROC) with intact human skin

    DEFF Research Database (Denmark)

    Pappinen, Sari; Hermansson, Martin; Kuntsche, Judith

    2008-01-01

    study was to compare the stratum corneum lipid content of ROC with the corresponding material from human skin. The lipid composition was determined by thin-layer chromatography (TLC) and mass-spectrometry, and the thermal phase transitions of stratum corneum were studied by differential scanning...... calorimetry (DSC). All major lipid classes of the stratum corneum were present in ROC in a similar ratio as found in human stratum corneum. Compared to human skin, the level of non-hydroxyacid-sphingosine ceramide (NS) was increased in ROC, while alpha-hydroxyacid-phytosphingosine ceramide (AP) and non...... compared to human skin, in agreement with the results from DSC. ROC underwent a lipid lamellar order to disorder transition (T2) at a slightly lower temperature (68 degrees C) than human skin (74 degrees C). These differences in stratum corneum lipid composition and the thermal phase transitions may...

  5. Inhibition of iodine-125-labeled human follitropin binding to testicular receptor by epidermal growth factor and synthetic peptides

    International Nuclear Information System (INIS)

    Sluss, P.M.; Krystek, S.R. Jr.; Andersen, T.T.; Melson, B.E.; Huston, J.S.; Ridge, R.; Reichert, L.E. Jr.

    1986-01-01

    Two tetrapeptide sequence homologies between mouse epidermal growth factor precursor (mEGFP) and human follitropin (FSH) were revealed by a computer program that identifies identical residues among polypeptide sequences. The two tetrapeptides, Lys-Thr-Cys-Thr (KTCT) and Thr-Arg-Asp-Leu (TRDL), are present in the hormone-specific beta subunit of FSH from all species studied. These tetrapeptides are not present in the alpha subunit, which is common to all pituitary glycoprotein hormones. Both tetrapeptides are also found in mEGFP, and one tetrapeptide, TRDL, is located within the 53-residue form of mEGF purified from mouse submaxillary glands. Computer-generated hydropathy profiles predicted that both tetrapeptides are located in hydrophilic portions of the FSH beta subunit and that TRDL is in a hydrophilic portion of commercially available mEGF. Therefore, the tetrapeptides might be accessible to receptor binding sites for FSH. We report that mEGF inhibits binding of 125 I-labeled human FSH to receptors in testis by 50% (I50) at a concentration of 1.8 X 10(-5) M. No binding inhibition was observed by GnRH or arginine-vasopressin at 10(-4) M, neither of which contain the tetrapeptide sequences. FSH beta subunit, which contains both tetrapeptides, also inhibited binding (I50 = 9 X 10(-8) M) of 125 I-labeled human FSH to testis receptor. Thus, it appears that FSH beta subunit and mEGF are capable of inhibiting binding of FSH to testicular FSH receptors, presumably through interactions that include the homologous tetrapeptides. This presumption was supported by the observation that the synthetic tetrapeptides (KTCT or TRDL) were also active in inhibiting binding of 125 I-labeled human FSH to testis receptor

  6. Development of an affinity-matured humanized anti-epidermal growth factor receptor antibody for cancer immunotherapy.

    Science.gov (United States)

    Nakanishi, Takeshi; Maru, Takamitsu; Tahara, Kazuhiro; Sanada, Hideaki; Umetsu, Mitsuo; Asano, Ryutaro; Kumagai, Izumi

    2013-02-01

    We showed previously that humanization of 528, a murine anti-epidermal growth factor receptor (EGFR) antibody, causes reduced affinity for its target. Here, to improve the affinity of the humanized antibody for use in cancer immunotherapy, we constructed phage display libraries focused on the complementarity-determining regions (CDRs) of the antibody and carried out affinity selection. Two-step selections using libraries constructed in a stepwise manner enabled a 32-fold affinity enhancement of humanized 528 (h528). Thermodynamic analysis of the interactions between the variable domain fragment of h528 (h528Fv) mutants and the soluble extracellular domain of EGFR indicated that the h528Fv mutants obtained from the first selection showed a large increase in negative enthalpy change due to binding, resulting in affinity enhancement. Furthermore, mutants from the second selection showed a decrease in entropy loss, which led to further affinity maturation. These results suggest that a single mutation in the heavy chain variable domain (i.e. Tyr(52) to Trp) enthalpically contributed for overcoming the energetic barrier to the antigen-antibody interaction, which was a major hurdle for the in vitro affinity maturation of h528. We reported previously that the humanized bispecific diabody hEx3 Db, which targets EGFR and CD3, shows strong anti-tumor activity. hEx3 Db mutants, in which the variable domains of h528 were replaced with those of the affinity-enhanced mutants, were prepared and characterized. In a growth inhibition assay of tumor cells, the hEx3 Db mutants showed stronger anti-tumor activity than that of hEx3 Db, suggesting that affinity enhancement of h528Fv enhances the anti-tumor activity of the bispecific diabody.

  7. Homeobox A7 increases cell proliferation by up-regulation of epidermal growth factor receptor expression in human granulosa cells

    Directory of Open Access Journals (Sweden)

    Yanase Toshihiko

    2010-06-01

    Full Text Available Abstract Background Homeobox (HOX genes encode transcription factors, which regulate cell proliferation, differentiation, adhesion, and migration. The deregulation of HOX genes is frequently associated with human reproductive system disorders. However, knowledge regarding the role of HOX genes in human granulosa cells is limited. Methods To determine the role of HOXA7 in the regulation and associated mechanisms of cell proliferation in human granulosa cells, HOXA7 and epidermal growth factor receptor (EGFR expressions were examined in primary granulosa cells (hGCs, an immortalized human granulosa cell line, SVOG, and a granulosa tumor cell line, KGN, by real-time PCR and Western blotting. To manipulate the expression of HOXA7, the HOXA7 specific siRNA was used to knockdown HOXA7 in KGN. Conversely, HOXA7 was overexpressed in SVOG by transfection with the pcDNA3.1-HOAX7 vector. Cell proliferation was measured by the MTT assay. Results Our results show that HOXA7 and EGFR were overexpressed in KGN cells compared to hGCs and SVOG cells. Knockdown of HOXA7 in KGN cells significantly decreased cell proliferation and EGFR expression. Overexpression of HOXA7 in SVOG cells significantly promoted cell growth and EGFR expression. Moreover, the EGF-induced KGN proliferation was abrogated, and the activation of downstream signaling was diminished when HOXA7 was knocked down. Overexpression of HOXA7 in SVOG cells had an opposite effect. Conclusions Our present study reveals a novel mechanistic role for HOXA7 in modulating granulosa cell proliferation via the regulation of EGFR. This finding contributes to the knowledge of the pro-proliferation effect of HOXA7 in granulosa cell growth and differentiation.

  8. Chemometric analysis of the consumption of oral rinse chlorite (ClO2-) by human salivary biomolecules.

    Science.gov (United States)

    Chang, Hubert; Blackburn, John; Grootveld, Martin

    2013-12-01

    Oral rinse formulations containing chlorite anion (ClO(2)(-)) as an active agent exert a range of valuable oral healthcare activities. However, salivary biomolecules which chemically react with this oxidant can, at least in principle, serve as potentially significant barriers to these therapeutic properties in the oral environment. Therefore, in this investigation, we have explored the extent of ClO(2)(-) consumption by biomolecules which scavenge this agent in human salivary supernatants (HSSs) in vitro. HSS samples were equilibrated with oral rinse formulations containing this active agent (30 s at 35 °C in order to mimic oral rinsing episodes). Differential spectrophotometric and ion-pair reversed-phase high-performance liquid chromatographic analyses were employed to determine residual ClO(2)(-) in these admixtures. Bioanalytical data acquired revealed the rapid consumption of ClO(2)(-) by biomolecular electron donors and/or antioxidants present in HSS samples. Mean ± 95 % confidence interval (CI) consumption levels of 7.14 ± 0.69 and 5.34 ± 0.69 % of the total ClO(2)(-) available were found for oral rinse products containing 0.10 and 0.40 % (w/v) ClO(2)(-), respectively. A mixed model analysis-of-variance performed on experimental data acquired demonstrated highly-significant differences between oral rinse ClO(2)(-) contents (p biomolecules for both oral rinse formulations investigated. These observations are of much clinical significance in view of the retention of these products' active agent, i.e. biomolecules within recommended 30 s oral rinsing episodes, and hence, the bulk of this oxyhalogen oxidant (>90 %) may effectively exert its essential microbicidal, anti-periodontal and oral malodour-neutralising actions.

  9. Human papillomavirus E6/E7 oncogenes promote mouse ear regeneration by increasing the rate of wound re-epithelization and epidermal growth.

    Science.gov (United States)

    Valencia, Concepción; Bonilla-Delgado, José; Oktaba, Katarzyna; Ocádiz-Delgado, Rodolfo; Gariglio, Patricio; Covarrubias, Luis

    2008-12-01

    Mammals have limited regeneration capacity. We report here that, in transgenic mice (Tg(bK6-E6/E7)), the expression of the E6/E7 oncogenes of human papilloma virus type 16 (HPV16) under the control of the bovine keratin 6 promoter markedly improves the mouse's capacity to repair portions of the ear after being wounded. Increased repair capacity correlates with an increased number of epidermal proliferating cells. In concordance with the expected effects of the E6 and E7 oncogenes, levels of p53 decreased and those of p16 in epidermal cells increased. In addition, we observed that wound re-epithelization proceeded faster in transgenic than in wild-type animals. After the initial re-epithelization, epidermal cell migration from the intact surrounding tissue appears to be a major contributor to the growing epidermis, especially in the repairing tissue of transgenic mice. We also found that there is a significantly higher number of putative epidermal stem cells in Tg(bK6-E6/E7) than in wild-type mice. Remarkably, hair follicles and cartilage regenerated within the repaired ear tissue, without evidence of tumor formation. We propose that the ability to regenerate ear portions is limited by the capacity of the epidermis to repair itself and grow.

  10. Structural model for the interaction of a designed Ankyrin Repeat Protein with the human epidermal growth factor receptor 2.

    Directory of Open Access Journals (Sweden)

    V Chandana Epa

    Full Text Available Designed Ankyrin Repeat Proteins are a class of novel binding proteins that can be selected and evolved to bind to targets with high affinity and specificity. We are interested in the DARPin H10-2-G3, which has been evolved to bind with very high affinity to the human epidermal growth factor receptor 2 (HER2. HER2 is found to be over-expressed in 30% of breast cancers, and is the target for the FDA-approved therapeutic monoclonal antibodies trastuzumab and pertuzumab and small molecule tyrosine kinase inhibitors. Here, we use computational macromolecular docking, coupled with several interface metrics such as shape complementarity, interaction energy, and electrostatic complementarity, to model the structure of the complex between the DARPin H10-2-G3 and HER2. We analyzed the interface between the two proteins and then validated the structural model by showing that selected HER2 point mutations at the putative interface with H10-2-G3 reduce the affinity of binding up to 100-fold without affecting the binding of trastuzumab. Comparisons made with a subsequently solved X-ray crystal structure of the complex yielded a backbone atom root mean square deviation of 0.84-1.14 Ångstroms. The study presented here demonstrates the capability of the computational techniques of structural bioinformatics in generating useful structural models of protein-protein interactions.

  11. EPIDERMAL GROWTH FACTOR RECEPTOR (EGFR AND HUMAN PAPILLOMAVIRUS (HPV L1 CAPSID PROTEIN IN CERVICAL SQUAMOUS INTRAEPITHELIAL LESIONS

    Directory of Open Access Journals (Sweden)

    Balan Raluca

    2010-09-01

    Full Text Available We analyzed the immunohistochemical pattern of epidermal growth factor receptor (EGFR in cervical squamous intraepithelial lesions (SILs in correlation with L1 HPV capsid protein, in order to determine the relationship between EGFR expression and the infection status of human papillomavirus (HPV. The study included 40 cases, 24 LSIL (low grade SIL (CIN1, cervical intraepithelial neoplasia and 16 HSIL (high grade SIL (6 cases of CIN2 and 10 cases of CIN3. The immunoexpression of L1 HPV protein was assessed on conventional cervico-vaginal smears and EGFR was immunohistochemically evaluated on the corresponding cervical biopsies. The HPV L1 capsid protein was expressed in 45.83% of LSIL and 25% of HSIL. EGFR was overexpressed in 62,4% of HSIL (58,4% CIN2 and 41,6% CIN3 and 37,6% LSIL. The immunoexpression of L1 HPV has clinical application in the progression assessment of the cervical precancerous lesions without a correlation to the grade of the cervical SIL. EGFR is expressed by all proliferating squamous epithelial cells, thus corresponding with the grade of SIL. The evaluation of EGFR status, correlated with L1 HPV protein expression, can provide useful data of progression risk of cervical squamous intraepithelial lesions

  12. Evolving landscape of human epidermal growth factor receptor 2-positive breast cancer treatment and the future of biosimilars.

    Science.gov (United States)

    Jackisch, Christian; Lammers, Philip; Jacobs, Ira

    2017-04-01

    Human epidermal growth factor receptor 2-positive (HER2+) breast cancer comprises approximately 15%-20% of all breast cancers and is associated with a poor prognosis. The introduction of anti-HER2 therapy has significantly improved clinical outcomes for patients with HER2+ breast cancer, and multiple HER2-directed agents (ie, trastuzumab, pertuzumab, lapatinib, and ado-trastuzumab emtansine [T-DM1]) are approved for clinical use in various settings. The treatment landscape for patients with HER2+ breast cancer is continuing to evolve. While novel agents and therapeutic strategies are emerging, biologic therapies, particularly trastuzumab, are likely to remain a mainstay of treatment. However, access issues create barriers to the use of biologics, and there is evidence for underuse of trastuzumab worldwide. A biosimilar is a biologic product that is highly similar to a licensed biologic in terms of product safety and effectiveness. Biosimilars of trastuzumab are in development and may soon become available. The introduction of biosimilars may improve access to anti-HER2 therapies by providing additional treatment options and lower-cost alternatives. Because HER2-targeted drugs may be administered for extended periods of time and in combination with other systemic therapies, biosimilars have the potential to result in significant savings for healthcare systems. Herein we review current and emerging treatment options for, and discuss the possible role of biosimilars in, treating patients with HER2+ breast cancer. Copyright © 2017 Authors, Pfizer Inc. Published by Elsevier Ltd.. All rights reserved.

  13. Association of Polymorphisms in Connective Tissue Growth Factor and Epidermal Growth Factor Receptor Genes With Human Longevity.

    Science.gov (United States)

    Donlon, Timothy A; Morris, Brian J; He, Qimei; Chen, Randi; Masaki, Kamal H; Allsopp, Richard C; Willcox, D Craig; Tranah, Gregory J; Parimi, Neeta; Evans, Daniel S; Flachsbart, Friederike; Nebel, Almut; Kim, Duk-Hwan; Park, Joobae; Willcox, Bradley J

    2017-08-01

    Growth pathways play key roles in longevity. The present study tested single-nucleotide polymorphisms (SNPs) in the connective tissue growth factor gene (CTGF) and the epidermal growth factor receptor gene (EGFR) for association with longevity. Comparison of allele and genotype frequencies of 12 CTGF SNPs and 41 EGFR SNPs between 440 American men of Japanese ancestry aged ≥95 years and 374 men of average life span revealed association with longevity at the p cases, consistent with heterozygote advantage in living to extreme old age. No associations of the most significant SNPs were observed in whites or Koreans. In conclusion, the present findings indicate that genetic variation in CTGF and EGFR may contribute to the attainment of extreme old age in Japanese. More research is needed to confirm that genetic variation in CTGF and EGFR contributes to the attainment of extreme old age across human populations. © The Author 2016. Published by Oxford University Press on behalf of The Gerontological Society of America. All rights reserved. For permissions, please e-mail: journals.permissions@oup.com.

  14. Study of human salivary proline-rich proteins interaction with food tannins.

    Science.gov (United States)

    Soares, Susana; García-Estévez, Ignacio; Ferrer-Galego, Raúl; Brás, Natércia F; Brandão, Elsa; Silva, Mafalda; Teixeira, Natércia; Fonseca, Fátima; Sousa, Sérgio F; Ferreira-da-Silva, Frederico; Mateus, Nuno; de Freitas, Victor

    2018-03-15

    In this work, saturation transfer difference-NMR, isothermal microcalorimetry and molecular dynamics simulations have been used to study the individual interactions between basic, glycosylated and acidic proline-rich proteins (bPRPS, gPRPs, aPRPs) and P-B peptide with some representative food tannins [procyanidin B2, procyanidin B2 3'-O-gallate (B2g) and procyanidin trimer (catechin-4-8-catechin-4-8-catechin)]. Results showed that P-B peptide was in general the salivary protein (SP) with higher affinity whereas aPRPs showed lower affinity to the studied procyanidins. Moreover, B2g was the procyanidin with higher affinity for all SP. Hydrophobic and hydrogen bonds were present in all interactions but the major driving force depended on the procyanidin-SP pair. Furthermore, proline clusters or residues in their vicinity were identified as the probable sites of proteins for interaction with procyanidins. For bPRP and aPRP a significant change to less extended conformations was observed, while P-B peptide did not display any structural rearrangement upon procyanidins binding. Copyright © 2017. Published by Elsevier Ltd.

  15. Correlation between salivary secretion and salivary AQP5 levels in health and disease.

    Science.gov (United States)

    Wang, Di; Iwata, Fusako; Muraguchi, Masahiro; Ooga, Keiko; Ohmoto, Yasukazu; Takai, Masaaki; Mori, Toyoki; Ishikawa, Yasuko

    2009-01-01

    Saliva samples are useful for noninvasive diagnosis of oral and systemic diseases. The water channel protein aquaporin-5 (AQP5) is released into human saliva. Salivary AQP5 levels show a diurnal variation with the secretion of high levels during the waking hours. An age-related decrease in salivary AQP5 levels parallels a decrease in the volume of saliva. Cevimeline, a muscarinic acetylcholine receptor (mAChR) agonist, induces the release of AQP5. Changes in salivary AQP5 levels after cevimeline administration occur simultaneously with changes in saliva flow rate. AQP5 and lipid rafts are released separately from human salivary glands upon M(3) mAChR stimulation. In patients with diabetes mellitus or Sjögren's syndrome, a decrease in salivary secretion occurs concomitantly with low salivary AQP5 levels. Salivary AQP5 levels correlate with salivary secretion in both healthy and disease states, suggesting that changes in salivary AQP5 levels can be used as an indicator of salivary flow rate and the effect of M(3) mAChR agonists on human salivary glands.

  16. Pattern of distribution of blood group antigens on human epidermal cells during maturation

    DEFF Research Database (Denmark)

    Dabelsteen, Erik; Buschard, Karsten; Hakomori, Sen-Itiroh

    1984-01-01

    The distribution in human epidermis of A, B, and H blood group antigens and of a precursor carbohydrate chain, N-acetyl-lactosamine, was examined using immunofluorescence staining techniques. The material included tissue from 10 blood group A, 4 blood group B, and 9 blood group O persons. Murine...... on the lower spinous cells whereas H antigen was seen predominantly on upper spinous cells or on the granular cells. Epithelia from blood group A or B persons demonstrated A or B antigens, respectively, but only if the tissue sections were trypsinized before staining. In such cases A or B antigens were found...... monoclonal antibodies were used to identify H antigen (type 2 chain) and N-acetyl-lactosamine. Human antisera were used to identify A and B antigens. In all groups N-acetyl-lactosamine and H antigen were found on the cell membranes of the spinous cell layer. N-acetyl-lactosamine was present mainly...

  17. Lipidomic analysis of epidermal lipids: a tool to predict progression of inflammatory skin disease in humans.

    Science.gov (United States)

    Li, Shan; Ganguli-Indra, Gitali; Indra, Arup K

    2016-05-01

    Lipidomics is the large-scale profiling and characterization of lipid species in a biological system using mass spectrometry. The skin barrier is mainly comprised of corneocytes and a lipid-enriched extracellular matrix. The major skin lipids are ceramides, cholesterol and free fatty acids (FFA). Lipid compositions are altered in inflammatory skin disorders with disrupted skin barrier such as atopic dermatitis (AD). Here we discuss some of the recent applications of lipidomics in human skin biology and in inflammatory skin diseases such as AD, psoriasis and Netherton syndrome. We also review applications of lipidomics in human skin equivalent and in pre-clinical animal models of skin diseases to gain insight into the pathogenesis of the skin disease. Expert commentary: Skin lipidomics analysis could be a fast, reliable and noninvasive tool to characterize the skin lipid profile and to monitor the progression of inflammatory skin diseases such as AD.

  18. Materials and optimized designs for human-machine interfaces via epidermal electronics.

    Science.gov (United States)

    Jeong, Jae-Woong; Yeo, Woon-Hong; Akhtar, Aadeel; Norton, James J S; Kwack, Young-Jin; Li, Shuo; Jung, Sung-Young; Su, Yewang; Lee, Woosik; Xia, Jing; Cheng, Huanyu; Huang, Yonggang; Choi, Woon-Seop; Bretl, Timothy; Rogers, John A

    2013-12-17

    Thin, soft, and elastic electronics with physical properties well matched to the epidermis can be conformally and robustly integrated with the skin. Materials and optimized designs for such devices are presented for surface electromyography (sEMG). The findings enable sEMG from wide ranging areas of the body. The measurements have quality sufficient for advanced forms of human-machine interface. © 2013 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim.

  19. Linking γ-aminobutyric acid A receptor to epidermal growth factor receptor pathways activation in human prostate cancer.

    Science.gov (United States)

    Wu, Weijuan; Yang, Qing; Fung, Kar-Ming; Humphreys, Mitchell R; Brame, Lacy S; Cao, Amy; Fang, Yu-Ting; Shih, Pin-Tsen; Kropp, Bradley P; Lin, Hsueh-Kung

    2014-03-05

    Neuroendocrine (NE) differentiation has been attributed to the progression of castration-resistant prostate cancer (CRPC). Growth factor pathways including the epidermal growth factor receptor (EGFR) signaling have been implicated in the development of NE features and progression to a castration-resistant phenotype. However, upstream molecules that regulate the growth factor pathway remain largely unknown. Using androgen-insensitive bone metastasis PC-3 cells and androgen-sensitive lymph node metastasis LNCaP cells derived from human prostate cancer (PCa) patients, we demonstrated that γ-aminobutyric acid A receptor (GABA(A)R) ligand (GABA) and agonist (isoguvacine) stimulate cell proliferation, enhance EGF family members expression, and activate EGFR and a downstream signaling molecule, Src, in both PC-3 and LNCaP cells. Inclusion of a GABA(A)R antagonist, picrotoxin, or an EGFR tyrosine kinase inhibitor, Gefitinib (ZD1839 or Iressa), blocked isoguvacine and GABA-stimulated cell growth, trans-phospohorylation of EGFR, and tyrosyl phosphorylation of Src in both PCa cell lines. Spatial distributions of GABAAR α₁ and phosphorylated Src (Tyr416) were studied in human prostate tissues by immunohistochemistry. In contrast to extremely low or absence of GABA(A)R α₁-positive immunoreactivity in normal prostate epithelium, elevated GABA(A)R α₁ immunoreactivity was detected in prostate carcinomatous glands. Similarly, immunoreactivity of phospho-Src (Tyr416) was specifically localized and limited to the nucleoli of all invasive prostate carcinoma cells, but negative in normal tissues. Strong GABAAR α₁ immunoreactivity was spatially adjacent to the neoplastic glands where strong phospho-Src (Tyr416)-positive immunoreactivity was demonstrated, but not in adjacent to normal glands. These results suggest that the GABA signaling is linked to the EGFR pathway and may work through autocrine or paracine mechanism to promote CRPC progression. Copyright © 2013 Elsevier

  20. /sup 125/I-human epidermal growth factor specific binding to placentas and fetal membranes from varoius pregnancy states

    Energy Technology Data Exchange (ETDEWEB)

    Hofmann, G.E.; Siddiqi, T.A.; Rao, Ch. V.; Carman, F.R.

    1988-01-01

    Specific binding of /sup 125/I-human epidermal growth factor (hEGF) to homogenates of term human placentas and fetal membranes from normal and appropriate for gestational age (N = 20), intrauterine growth retarded (N = 9), twin (N = 11), White class AB diabetic (N = 12), and large for gestational age (N = 13) pregnancies was measured. In all pregnancy states, placentas bound approximately four times more /sup 125/I-hEGF than did fetal membranes (P<0.0001). There was no significant differnce in /sup 125/I-hEGF binding to fetal membranes from the various pregnancy states (P<0.05). /sup 125/I-hEGF specific binding to placentas from intrauterine growth retarded or twin pregnancies was significantly greater compared with placentas from normal and appropriate for gestational age pregnancies (P<0.05). The binding to placentas from pregnancies complicated by White class AB diabetes or large for gestational age infants, on the other hand, was not significantly different from that to placentas from normal and appropriate for gestational age pregnancies. /sup 125/I-hEGF specific binding did not differ between placentas from intrauterine growth retarded or twin pregnancies (P<0.05). Placental and fetal membrane /sup 125/I-hEGF binding did not vary with fetal sex, maternal race, placental weight, or gestational age between 37 to 42 weeks (P<0.05). Placental but not fetal membrane /sup 125/I-hEGF binding increased with increasing infant weight when appropriate for gestational age and large for gestational age infants were included (P<0.05, r = 0.38, N = 32) but not for intrauterine growth retarded, appropriate for gestational age, or large for gestational age infants alone.

  1. A role for the epidermal growth factor receptor signaling in development of intestinal serrated polyps in mice and humans.

    Science.gov (United States)

    Bongers, Gerold; Muniz, Luciana R; Pacer, Michelle E; Iuga, Alina C; Thirunarayanan, Nanthakumar; Slinger, Erik; Smit, Martine J; Reddy, E Premkumar; Mayer, Lloyd; Furtado, Glaucia C; Harpaz, Noam; Lira, Sergio A

    2012-09-01

    Epithelial cancers can be initiated by activating mutations in components of the mitogen-activated protein kinase signaling pathway such as v-raf murine sarcoma viral oncogene homolog B1 (BRAF), v-Ki-ras2 Kirsten rat sarcoma viral oncogene homolog (KRAS), or epidermal growth factor receptor (EGFR). Human intestinal serrated polyps are a heterogeneous group of benign lesions, but some progress to colorectal cancer. Tumors that arise from these polyps frequently contain activating mutations in BRAF or KRAS, but little is known about the role of EGFR activation in their development. Polyp samples were obtained from adults during screening colonoscopies at Mount Sinai Hospital in New York. We measured levels of EGFR protein and phosphorylation in human serrated polyps by immunohistochemical and immunoblot analyses. We generated transgenic mice that express the ligand for EGFR, Heparin-binding EGF-like growth factor (HB-EGF), in the intestine. EGFR and the extracellular-regulated kinases (ERK)1/2 were phosphorylated in serrated areas of human hyperplastic polyps (HPPs), sessile serrated adenomas, and traditional serrated adenomas. EGFR and ERK1/2 were phosphorylated in the absence of KRAS or BRAF activating mutations in a subset of HPP. Transgenic expression of the EGFR ligand HB-EGF in the intestines of mice promoted development of small cecal serrated polyps. Mice that expressed a combination of HB-EGF and US28 (a constitutively active, G-protein-coupled receptor that increases processing of HB-EGF from the membrane) rapidly developed large cecal serrated polyps. These polyps were similar to HPPs and had increased phosphorylation of EGFR and ERK1/2 within the serrated epithelium. Administration of pharmacologic inhibitors of EGFR or MAPK to these transgenic mice significantly reduced polyp development. Activation of EGFR signaling in the intestine of mice promotes development of serrated polyps. EGFR signaling also is activated in human HPPs, sessile serrated adenomas

  2. Circulating chromatin-anti-chromatin antibody complexes bind with high affinity to dermo-epidermal structures in murine and human lupus nephritis

    DEFF Research Database (Denmark)

    Fismen, S; Hedberg, A; Fenton, K A

    2009-01-01

    Murine and human lupus nephritis are characterized by glomerular deposits of electron-dense structures (EDS). Dominant components of EDS are chromatin fragments and IgG antibodies. Whether glomerular EDS predispose for similar deposits in skin is unknown. We analysed (i) whether dermo-epidermal i......Murine and human lupus nephritis are characterized by glomerular deposits of electron-dense structures (EDS). Dominant components of EDS are chromatin fragments and IgG antibodies. Whether glomerular EDS predispose for similar deposits in skin is unknown. We analysed (i) whether dermo......-epidermal immune complex deposits have similar molecular composition as glomerular deposits, (ii) whether chromatin fragments bind dermo-epidermal structures, and (iii) whether deposits in nephritic glomeruli predispose for accumulation of similar deposits in skin. Paired skin and kidney biopsies from nephritic...... (NZBxNZW)F1 and MRL-lpr/lpr mice and from five patients with lupus nephritis were analysed by immunofluorescence, immune electron microscopy (IEM) and co-localization TUNEL IEM. Affinity of chromatin fragments for membrane structures was determined by surface plasmon resonance. Results demonstrated (i...

  3. Differential regulation of type I interferon and epidermal growth factor pathways by a human Respirovirus virulence factor.

    Directory of Open Access Journals (Sweden)

    Grégory Caignard

    2009-09-01

    Full Text Available A number of paramyxoviruses are responsible for acute respiratory infections in children, elderly and immuno-compromised individuals, resulting in airway inflammation and exacerbation of chronic diseases like asthma. To understand the molecular pathogenesis of these infections, we searched for cellular targets of the virulence protein C of human parainfluenza virus type 3 (hPIV3-C. We found that hPIV3-C interacts directly through its C-terminal domain with STAT1 and GRB2, whereas C proteins from measles or Nipah viruses failed to do so. Binding to STAT1 explains the previously reported capacity of hPIV3-C to block type I interferon signaling, but the interaction with GRB2 was unexpected. This adaptor protein bridges Epidermal Growth Factor (EGF receptor to MAPK/ERK pathway, a signaling cascade recently found to be involved in airway inflammatory response. We report that either hPIV3 infection or transient expression of hPIV3-C both increase cellular response to EGF, as assessed by Elk1 transactivation and phosphorylation levels of ERK1/2, 40S ribosomal subunit protein S6 and translation initiation factor 4E (eIF4E. Furthermore, inhibition of MAPK/ERK pathway with U0126 prevented viral protein expression in infected cells. Altogether, our data provide molecular basis to explain the role of hPIV3-C as a virulence factor and determinant of pathogenesis and demonstrate that Paramyxoviridae have evolved a single virulence factor to block type I interferon signaling and to boost simultaneous cellular response to growth factors.

  4. Human epidermal growth factor receptor 2 status of gastric cancer patients in Asia: results from a large, multicountry study.

    Science.gov (United States)

    Pathmanathan, Nirmala; Geng, Jing-Shu; Li, Wencai; Nie, Xiu; Veloso, Januario; Wang, John; Hill, Julie; Mccloud, Philip; Bilous, Michael

    2017-06-01

    Current estimates of the human epidermal growth factor receptor 2 (HER2)-positivity rate in gastric cancer vary widely in the literature, and there are limited data from countries in Asia. The primary aim of this study was to conduct a clinical audit of laboratories across seven countries in Asia to determine the incidence of HER2-positive gastric cancer in this region. Pathologists were asked to collect data on patient gender, age, cancer site, specimen type, tumor spread, type and grade, HER2 test results, including protein and/or gene copy enumeration, and final HER2 status on consecutive gastric cancer cases tested for HER2 in their laboratory over a 2-year period. HER2 results from 5,301 gastric cancers were submitted by 50 laboratories. The overall HER2-positivity rate was 9.7% which, after the exclusion of China, increased to 18.1%. The rate between countries ranged from 0% to 23.1%, and from 0% to 50.0% between laboratories. An equivocal HER2 result was recorded in 19.5% of cases. Despite the lack of centralized testing to confirm the accuracy of HER2 diagnoses, the incidence of HER2-positive gastric cancer observed here was comparable to that reported in the literature. Nevertheless, rates were highly variable between countries and laboratories, which suggests a lack of HER2 testing expertise in gastric cancer. Given that the mortality rates for gastric cancer in Eastern Asia are the highest in the world, efforts should focus on improving HER2 testing expertise in the region so that patients receive the appropriate treatment early in their disease. © 2016 The Authors. Asia-Pacific Journal of Clinical Oncology Published by John Wiley & Sons Australia, Ltd.

  5. Profiling of Human Acquired Immunity Against the Salivary Proteins of Phlebotomus papatasi Reveals Clusters of Differential Immunoreactivity

    Science.gov (United States)

    2014-03-10

    leishmaniasis.56 Pre-exposure of PROFILING OF SAND FLY SALIVARY PROTEINS 935 murine cells to L. intermedia salivary sonicates resulted in decreased IP-10...Thompson JD, Higgins DG, 2011. Fast, scalable generation of high-quality protein multiple sequence alignments using Clustal Omega. Mol Syst Biol 7...Brodskyn C, Barral A, de Oliveira CI, 2010. Immunity to Lutzomyia intermedia saliva modulates the inflammatory environ- ment induced by Leishmania

  6. Salivary Glands Proteins Expression of Anopheles dirus A Fed on Plasmodium vivax- and Plasmodium falciparum-Infected Human Blood

    Directory of Open Access Journals (Sweden)

    Saowanee Cotama

    2013-01-01

    Full Text Available Mosquitoes are able to adapt to feed on blood by the salivary glands which created a protein that works against the haemostasis process. This study aims to investigate the salivary glands proteins expression of 50 adult female An. dirus A mosquitoes, a main vector of malaria in Thailand, each group with an age of 5 days which were artificial membrane fed on sugar, normal blood, blood infected with P. vivax, and blood infected with P. falciparum. Then mosquito salivary gland proteins were analyzed by SDS-PAGE on days 0, 1, 2, 3, and 4 after feeding. The findings revealed that the major salivary glands proteins had molecular weights of 62, 58, 43, 36, 33, 30, and 18 kDa. One protein band of approximately 13 kDa was found in normal blood and blood infected with P. vivax fed on day 0. A stronger protein band, 65 kDa, was expressed from the salivary glands of mosquitoes fed with P. vivax- or P. falciparum-infected blood on only day 0, but none on days 1 to 4. The study shows that salivary glands proteins expression of An. dirus may affect the malaria parasite life cycle and the ability of mosquitoes to transmit malaria parasites in post-24-hour disappearance observation.

  7. Epidermal changes following application of 7,12-dimethylbenz(a)anthracene and 12-O-tetradecanoylphorbol-13-acetate to human skin transplanted to nude mice studied with histological species markers

    International Nuclear Information System (INIS)

    Graem, N.

    1986-01-01

    Effects of the tumor initiator 7,12-dimethylbenz(a)anthracene (DMBA) and of the tumor promoter 12-O-tetradecanoylphorbol-13-acetate (TPA) on epidermis of human fetal and adult skin were studied in the nude mouse/human skin model. Human skin grafts on NC nude mice were exposed to two topical applications of 1 mg of DMBA in 50 microliter of acetone with an interval of 3 days and/or to applications of 10 micrograms of TPA in 50 microliter of acetone twice weekly. In some animals, it was attempted to augment the susceptibility of the grafts to the tumor-initiating effect of DMBA by pretreatment with TPA or ultraviolet light. The mice were sacrificed 8-32 wk after the initial treatment. Tumors did not appear in the central portions of any of the grafts, but epidermal tumors were seen at the graft border in 34.9% of the DMBA-treated animals. To identify human epidermis on the grafts and to determine the species origin of the induced tumors, two independently working histological marker methods were applied. (a) The first is detection of a human Blood Group B-like antigen present in mouse epidermis and in chemically induced murine epidermal tumors. This antigen cannot be demonstrated in human epidermis and in epidermal tumors of human patients. (b) The second is histological staining with the DNA-specific fluorochrome, bisbenzimide, displaying a characteristic pattern of 5-10 intranuclear fluorescent bodies in murine nonneoplastic epidermal cells and in murine epidermal tumor cells. Such a pattern is not seen in human epidermis and in epidermal tumors of human patients. The studies showed that TPA treatment resulted in epidermal hyperplasia in both the human epidermis and the adjacent mouse epidermis and that the induced tumors were derived from murine tissue

  8. Synthetic inhibitors of matrix metalloproteinases prevent sulfur mustard-induced epidermal-dermal separation in human skin pieces

    NARCIS (Netherlands)

    Mol, M.A.E.; Alblas, S.W.; Hammer, A.; Benschop, H.P.

    2000-01-01

    Degradation of proteins of the basement membrane zone (BMZ) in the skin depends on the activity of proteolytic enzymes, particularly those belonging to the group of matrix metalloproteinases (MMPs). In the present study we have investigated the contribution of these enzymes to the epidermal-dermal

  9. The Human Salivary Microbiome Is Shaped by Shared Environment Rather than Genetics: Evidence from a Large Family of Closely Related Individuals.

    Science.gov (United States)

    Shaw, Liam; Ribeiro, Andre L R; Levine, Adam P; Pontikos, Nikolas; Balloux, Francois; Segal, Anthony W; Roberts, Adam P; Smith, Andrew M

    2017-09-12

    The human microbiome is affected by multiple factors, including the environment and host genetics. In this study, we analyzed the salivary microbiomes of an extended family of Ashkenazi Jewish individuals living in several cities and investigated associations with both shared household and host genetic similarities. We found that environmental effects dominated over genetic effects. While there was weak evidence of geographical structuring at the level of cities, we observed a large and significant effect of shared household on microbiome composition, supporting the role of the immediate shared environment in dictating the presence or absence of taxa. This effect was also seen when including adults who had grown up in the same household but moved out prior to the time of sampling, suggesting that the establishment of the salivary microbiome earlier in life may affect its long-term composition. We found weak associations between host genetic relatedness and microbiome dissimilarity when using family pedigrees as proxies for genetic similarity. However, this association disappeared when using more-accurate measures of kinship based on genome-wide genetic markers, indicating that the environment rather than host genetics is the dominant factor affecting the composition of the salivary microbiome in closely related individuals. Our results support the concept that there is a consistent core microbiome conserved across global scales but that small-scale effects due to a shared living environment significantly affect microbial community composition. IMPORTANCE Previous research shows that the salivary microbiomes of relatives are more similar than those of nonrelatives, but it remains difficult to distinguish the effects of relatedness and shared household environment. Furthermore, pedigree measures may not accurately measure host genetic similarity. In this study, we include genetic relatedness based on genome-wide single nucleotide polymorphisms (SNPs) (rather than

  10. Use of a collagen-elastin matrix as transport carrier system to transfer proliferating epidermal cells to human dermis in vitro.

    Science.gov (United States)

    Waaijman, Taco; Breetveld, Melanie; Ulrich, Magda; Middelkoop, Esther; Scheper, Rik J; Gibbs, Susan

    2010-01-01

    This in vitro study describes a novel cell culture, transport, and transfer protocol that may be highly suitable for delivering cultured proliferating keratinocytes and melanocytes to large open skin wounds (e.g., burns). We have taken into account previous limitations identified using other keratinocyte transfer techniques, such as regulatory issues, stability of keratinocytes during transport (single cell suspensions undergo terminal differentiation), ease of handling during application, and the degree of epidermal blistering resulting after transplantation (both related to transplanting keratinocyte sheets). Large numbers of proliferating epidermal cells (EC) (keratinocytes and melanocytes) were generated within 10-14 days and seeded onto a three-dimensional matrix composed of elastin and collagen types I, III, and V (Matriderm®), which enabled easy and stable transport of the EC for up to 24 h under ambient conditions. All culture conditions were in accordance with the regulations set by the Dutch Central Committee on Research Involving Human Subjects (CCMO). As an in vitro model system for clinical in vivo transfer, the EC were then transferred from Matriderm onto human acellular dermis during a period of 3 days. After transfer the EC maintained the ability to regenerate into a fully differentiated epidermis containing melanocytes on the human dermis. Proliferating keratinocytes were located in the basal layer and keratin-10 expression was located in differentiating suprabasal layers similar to that found in human epidermis. No blistering was observed (separation of the epidermis from the basement membrane). Keratin-6 expression was strongly upregulated in the regenerating epidermis similar to normal wound healing. In summary, we show that EC-Matriderm contains viable, metabolically active keratinocytes and melanocytes cultured in a manner that permits easy transportation and contains epidermal cells with the potential to form a pigmented reconstructed

  11. Salivary Gland Secretion.

    Science.gov (United States)

    Dorman, H. L.; And Others

    1981-01-01

    Describes materials and procedures for an experiment utilizing a live dog to demonstrate: (1) physiology of the salivary gland; (2) parasympathetic control of the salivary gland; (3) influence of varying salivary flow rates on sodium and potassium ions, osmolarity and pH; and (4) salivary secretion as an active process. (DS)

  12. Pharmacokinetics, biodistribution and dosimetry of {sup 99m}Tc-labeled anti-human epidermal growth factor receptor humanized monoclonal antibody R3 in rats

    Energy Technology Data Exchange (ETDEWEB)

    Escobar, Normando Iznaga; Morales, Alejo Morales; Duconge, Jorge; Torres, Idania Caballero; Fernandez, Eduardo; Gomez, Jose A

    1998-01-01

    The pharmacokinetics, biodistribution and dosimetry of {sup 99m}Tc-labeled anti-human epidermal growth factor receptor (anti-hEGF-r) humanized monoclonal antibody (MAb) R3 was investigated following intravenous injection in normal Wistar rats. Serum disappearance curves were best fit by a two-compartment model having a mean distribution half-life (t{sub (1(2{alpha}}{sub ))}) of 0.250 h and a mean elimination (t{sub (1(2{beta}}{sub ))}) of 13.89 h. Among the various organs, a little accumulation of the radiolabeled antibody was found only in kidneys. Biodistribution and dosimetry studies in humans were performed by extrapolation of the animal data to humans. Absorbed dose to normal organs and the remainder of the whole body were estimated using the medical internal radiation dose formula, and dose contributions from radioactivity in transit through the gastrointestinal tract were estimated using a compartment model. Extrapolated values of radiation absorbed dose to normal organs in rads per millicurie administered were whole body, 0.0085; lower large intestine wall, 0.0898; small intestine, 0.0530; upper large intestine wall, 0.0731; and kidneys, 0.0455. The effective dose equivalent predicted was 0.0162 rem/mCi and the effective dose was found to be 0.015 rem/mCi. On the basis of the pharmacokinetics, biodistribution and internal radiation dosimetry information obtained in this study, a diagnostic phase I clinical trial with {sup 99m}Tc-labeled humanized MAb R3 conjugate in patients should be supported.

  13. Pharmacokinetics, biodistribution and dosimetry of 99mTc-labeled anti-human epidermal growth factor receptor humanized monoclonal antibody R3 in rats

    International Nuclear Information System (INIS)

    Escobar, Normando Iznaga; Morales, Alejo Morales; Duconge, Jorge; Torres, Idania Caballero; Fernandez, Eduardo; Gomez, Jose A.

    1998-01-01

    The pharmacokinetics, biodistribution and dosimetry of 99m Tc-labeled anti-human epidermal growth factor receptor (anti-hEGF-r) humanized monoclonal antibody (MAb) R3 was investigated following intravenous injection in normal Wistar rats. Serum disappearance curves were best fit by a two-compartment model having a mean distribution half-life (t (1(2α)) ) of 0.250 h and a mean elimination (t (1(2β)) ) of 13.89 h. Among the various organs, a little accumulation of the radiolabeled antibody was found only in kidneys. Biodistribution and dosimetry studies in humans were performed by extrapolation of the animal data to humans. Absorbed dose to normal organs and the remainder of the whole body were estimated using the medical internal radiation dose formula, and dose contributions from radioactivity in transit through the gastrointestinal tract were estimated using a compartment model. Extrapolated values of radiation absorbed dose to normal organs in rads per millicurie administered were whole body, 0.0085; lower large intestine wall, 0.0898; small intestine, 0.0530; upper large intestine wall, 0.0731; and kidneys, 0.0455. The effective dose equivalent predicted was 0.0162 rem/mCi and the effective dose was found to be 0.015 rem/mCi. On the basis of the pharmacokinetics, biodistribution and internal radiation dosimetry information obtained in this study, a diagnostic phase I clinical trial with 99m Tc-labeled humanized MAb R3 conjugate in patients should be supported

  14. Impact of palbociclib combinations on treatment of advanced estrogen receptor-positive/human epidermal growth factor 2-negative breast cancer

    Directory of Open Access Journals (Sweden)

    Boér K

    2016-10-01

    Full Text Available Katalin Boér Department of Medical Oncology, Szent Margit Hospital, Budapest, Hungary Abstract: Breast cancer is a heterogeneous disease with multiple subgroups based on clinical and molecular characteristics. For the largest subgroup of breast cancers, hormone receptor-positive/human epidermal growth factor 2 (HER2-negative tumors, hormone treatment is the mainstay of therapy and is likely to result in significant improvement in disease outcomes. However, some of these cancers demonstrate de novo or acquired resistance to endocrine therapy. Despite intensive research to develop new strategies to enhance the efficacy of currently available treatment options for hormone receptor-positive breast cancer, progress has been slow, and there were few advances for a period of 10 years. In 2012, a new molecularly targeted therapeutic strategy, inhibition of mammalian target of rapamycin with everolimus, was introduced into clinical practice. Everolimus, in combination with a steroidal aromatase inhibitor, exemestane, resulted in an increase in progression-free survival, but not overall survival in patients with estrogen receptor (ER+ve advanced disease who had progressed on hormone therapy. In 2015, the first cyclin-dependent kinases 4/6 (CDK4/6 inhibitor, palbociclib, received accelerated US Food and Drug Administration approval for use in combination with letrozole for the treatment of postmenopausal ER+ve/HER2-ve advanced breast cancer as initial, endocrine-based therapy. The addition of palbociclib to endocrine therapy resulted in longer progression-free survival than letrozole alone. One year later, palbociclib received a new indication, use in combination with fulvestrant, in both premenopausal and postmenopausal females with advanced breast cancer of the same subtype with disease progression following endocrine therapy. Adding palbociclib to fulvestrant resulted in a significantly increased median progression-free survival compared to fulvestrant

  15. Human epidermal growth factor receptor 2-positive breast cancer: which cytotoxic agent best complements trastuzumab's efficacy in vitro?

    Directory of Open Access Journals (Sweden)

    Hurrell T

    2013-06-01

    Full Text Available Tracey Hurrell, Kim OuthoffDepartment of Pharmacology, University of Pretoria, Pretoria, South AfricaIntroduction: Despite trastuzumab having enhanced selectivity for human epidermal growth factor receptor 2 (HER-2 overexpressing breast cancer cells, treatment is hampered by interindividual variation and tumors with high mitogenic potential. The lack of significant clinical benefit in certain patient cohorts suggests that HER-2 expression is ineffective as a sole prognostic indicator of response to therapy. Therefore, optimizing the clinical role of trastuzumab in drug combinations remains critical for clinical success.Aim: To investigate the effects of trastuzumab in combination with either doxorubicin or geldanamycin on in vitro cell viability, cell cycling, apoptosis and relative HER-2 expression in HER-2-positive (SK-BR-3 and estrogen receptor-positive (MCF-7 breast adenocarcinoma models.Results: HER-2-rich SK-BR-3 cells demonstrated a greater sensitivity to the effects of doxorubicin than MCF-7 cells. Concurrent trastuzumab exposure resulted in a further reduction in cell viability. This decreased cell viability induced by doxorubicin was associated with activation of executioner caspases as well as with alterations in cell-cycle kinetics, primarily promoting S-phase accumulation. Doxorubicin had no effect on surface HER-2 density expression. Geldanamycin reduced cell viability significantly greater in SK-BR-3 than MCF-7 cells, and was associated with G2 cell-cycle accumulation. The addition of trastuzumab did not augment these effects. Geldanamycin promoted substantial reductions in relative surface HER-2 density in SK-BR-3 cells.Conclusion: The in vitro data supported the rationale for using doxorubicin in trastuzumab-based therapies. Therefore, despite the incidence of cardiotoxicity, doxorubicin could retain a fundamental role in treating HER-2-positive breast cancer. While geldanamycin is a potent cytotoxic agent, its concurrent use

  16. Targeted delivery of polyamidoamine-paclitaxel conjugate functionalized with anti-human epidermal growth factor receptor 2 trastuzumab

    Directory of Open Access Journals (Sweden)

    Ma P

    2015-03-01

    Full Text Available Pengkai Ma,1 Xuemei Zhang,1 Ling Ni,2 Jinming Li,2 Fengpu Zhang,1 Zheng Wang,1 Shengnan Lian,1 Kaoxiang Sun1 1School of Pharmacy, Yantai University, Yantai, Shandong Province, People’s Republic of China; 2State Key Laboratory of Long-acting and Targeting Drug Delivery System, Yantai, Shandong Province, People’s Republic of China Background: Antibody-dendrimer conjugates have the potential to improve the targeting and release of chemotherapeutic drugs at the tumor site while reducing adverse side effects caused by drug accumulation in healthy tissues. In this study, trastuzumab (TMAB, which binds to human epidermal growth factor receptor 2 (HER2, was used as a targeting agent in a TMAB-polyamidoamine (PAMAM conjugate carrying paclitaxel (PTX specifically to cells overexpressing HER2. Methods: TMAB was covalently linked to a PAMAM dendrimer via bifunctional polyethylene glycol (PEG. PTX was conjugated to PAMAM using succinic anhydride as a cross-linker, yielding TMAB-PEG-PAMAM-PTX. Dynamic light scattering and transmission electron microscopy were used to characterize the conjugates. The cellular uptake and in vivo biodistribution were studied by fluorescence microscopy, flow cytometry, and Carestream In Vivo FX, respectively. Results: Nuclear magnetic resonance spectroscopy demonstrated that PEG, PTX, fluorescein isothiocyanate, and cyanine7 were conjugated to PAMAM. Ultraviolet-visible spectroscopy and sodium dodecyl sulfate polyacrylamide gel electrophoresis demonstrated that TMAB was conjugated to PEG-PAMAM. Dynamic light scattering and transmission electron microscopy measurements revealed that the different conjugates ranged in size between 10 and 35 nm and had a spherical shape. In vitro cellular uptake demonstrated that the TMAB-conjugated PAMAM was taken up by HER2-overexpressing BT474 cells more efficiently than MCF-7 cells that expressed lower levels of HER2. Co-localization experiments indicated that TMAB-conjugated PAMAM was

  17. Effects of recombinant human epidermal growth factor on the proliferation and radiation survival of human fibroblast cell lines in vitro

    International Nuclear Information System (INIS)

    Kim, Hyun Sook; Kang, Ki Mun; Na, Jae Boem; Chai, Gyu Young; Lee, Sang Wook

    2006-01-01

    To explore the effect of recombinant human EGF on the proliferation and survival of human fibroblast cell lines following irradiation. Fibroblast was originated human skin and primary cultured. The trypan blue stain assay and MTT assay were used to study the proliferative effects of EGF on human fibroblast cell lines in vitro. An incubation of fibroblasts with rhEGF for 24 hours immediately after irradiation was counted everyday. Cell cycle distributions were analyzed by FACS analysis. Number of fibroblast was significant more increased rhEGF (1.0 nM, 10 nM, 100 nM, 1,000 nM) treated cell than control after 8 Gy irradiation. Most effective dose of rhEGF was at 160 nM. These survival differences were maintained at 1 week later. Proportion of S phase was significantly increased on rhEGF treated cells. rhEGF cause increased fibroblast proliferation following irradiation. We expect that rhEGF was effective for radiation induced wound healing

  18. Salivary bacterial fingerprints of established oral disease revealed by the Human Oral Microbe Identification using Next Generation Sequencing (HOMINGS) technique

    DEFF Research Database (Denmark)

    Belstrøm, Daniel; Paster, Bruce J; Fiehn, Nils-Erik

    2016-01-01

    Identification using Next Generation Sequencing) for comparison of the salivary microbiota in patients with periodontitis, patients with dental caries, and orally healthy individuals. The hypothesis was that this method could add on to the existing knowledge on salivary bacterial profiles in oral health...... and disease. DESIGN: Stimulated saliva samples (n=30) were collected from 10 patients with untreated periodontitis, 10 patients with untreated dental caries, and 10 orally healthy individuals. Salivary microbiota was analyzed using HOMINGS and statistical analysis was performed using Kruskal-Wallis test...... with Benjamini-Hochberg's correction. RESULTS: From a total of 30 saliva samples, a mean number of probe targets of 205 (range 120-353) were identified, and a statistically significant higher mean number of targets was registered in samples from patients with periodontitis (mean 220, range 143-306) and dental...

  19. Human IgG Antibody Response to Aedes Nterm-34kDa Salivary Peptide, an Epidemiological Tool to Assess Vector Control in Chikungunya and Dengue Transmission Area.

    Science.gov (United States)

    Elanga Ndille, Emmanuel; Doucoure, Souleymane; Poinsignon, Anne; Mouchet, François; Cornelie, Sylvie; D'Ortenzio, Eric; DeHecq, Jean Sébastien; Remoue, Franck

    2016-12-01

    Arboviral diseases are an important public health concerns. Vector control remains the sole strategy to fight against these diseases. Because of the important limits of methods currently used to assess human exposure to Aedes mosquito bites, much effort is being devoted to develop new indicators. Recent studies have reported that human antibody (Ab) responses to Aedes aegypti Nterm-34kDa salivary peptide represent a promising biomarker tool to evaluate the human-Aedes contact. The present study aims investigate whether such biomarker could be used for assessing the efficacy of vector control against Aedes. Specific human IgG response to the Nterm-34kDa peptide was assessed from 102 individuals living in urban area of Saint-Denis at La Reunion Island, Indian Ocean, before and after the implementation of vector control against Aedes mosquitoes. IgG response decreased after 2 weeks (P Aedes mosquito density, as estimated by entomological parameters and closely correlated to vector control implementation and was not associated with the use of individual protection, daily commuting outside of the house, sex and age. Our findings indicate a probable short-term decrease of human exposure to Aedes bites just after vector control implementation. Results provided in the present study indicate that IgG Ab response to Aedes aegypti Nterm-34kDa salivary peptide could be a relevant short-time indicator for evaluating the efficacy of vector control interventions against Aedes species.

  20. Autophagy participates in isoliquiritigenin-induced melanin degradation in human epidermal keratinocytes through PI3K/AKT/mTOR signaling.

    Science.gov (United States)

    Yang, Zhibo; Zeng, Biyun; Pan, Yi; Huang, Pan; Wang, Chang

    2018-01-01

    Melanin is the pigment responsible for the color of human skin and hair. Melanin serves as a double-edge sword which can exert both protective and spot-causing effects on skin. Although melanin has an important role in protecting the skin against UV damage, an excessive or uneven melanin production can lead to the formation of freckles and age spots. Isoliquiritigenin (ISL) has been reported to inhibit melanin synthesis; however, its role in melanin degradation remains unclear. In the present study, we evaluated the detailed function of ISL in melanin degradation in human epidermal keratinocytes. Since autophagy has been reported to be related to melanin degradation, we also examined the activation of autophagy by ISL treatment in keratinocytes by measurement of autophagy-related proteins, ATG7, LC3 and p62. Moreover, si-ATG7-induced ATG7 knockdown and autophagy inhibitor 3-MA decreased LC3 II protein levels and increased PMEL17, p62 and melanin levels in HaCaT cells, which could be partially reversed by ISL treatment, indicating that autophagy participated in melanin degradation. The decreased p-AKT and p-mTOR proteins upon ISL treatment indicated the involvement of PI3K/AKT/mTOR signaling in ISL-induced melanin degradation. Taken together, we demonstrated that autophagy participates in ISL-induced melanin degradation in human epidermal keratinocytes through PI3K/AKT/mTOR signaling. Copyright © 2017. Published by Elsevier Masson SAS.

  1. Estimation and comparison of salivary secretory leukocyte protease inhibitor in human immunodeficiency virus patients and healthy individuals

    Directory of Open Access Journals (Sweden)

    Kumar Pushpanshu

    2014-01-01

    Conclusion: The salivary anti-HIV factor, SLPI, is not only preserved in HIV infection but its concentration may even get enhanced in the infection. However, the clinical significance of SLPI levels and disease severity should be investigated further with a larger sample of patients.

  2. Evaluation of Salivary Uric Acid and pH in Human Immunodeficiency Virus Infected Patients: A Historical Cohort Study.

    Science.gov (United States)

    Ahmadi-Motamayel, Fatemeh; Amjad, Samaneh Vaziri; Goodarzi, Mohammad Taghi; Poorolajal, Jalal

    2018-01-01

    Antioxidants protect the body against cellular damage. Saliva has immunological, enzymatic and antioxidant defense systems. Uric acid is the main and predominant salivary antioxidant. The aim of this study was to evaluate salivary uric acid levels and pH in HIV-infected patients in the west of Iran. HIV-infected patients were selected from behavioral advisory centers of Hamadan and Kermanshah Provinces, west of Iran. Saliva was collected between 8 and10 in the morning. Five mL of whole unstimulated saliva was collected in 5 minutes by spitting into sterilized Falcon tubes based on Navazesh method; pH was measured with a pH meter and uric acid was assessed with spectrophotometric method. Data were analyzed with STATA 12. Salivary pH in the HIV-positive group was lower (6.99±0.46) than the healthy controls (7.14±1.03) but the difference was not statistically significant (P=380). Uric acid concentrations in HIV-infected patients (2.94±2.14) were significantly lower in comparison to the healthy controls (5.21±2.30). The results showed a statistically significant decrease in the case group (P=0.001). Mean age and DMFT index of the case group were higher than the control group. Uric acid, the main antioxidant of saliva, was significantly lower in HIVinfected individuals; pH also was lower in these patients. HIV can alter salivary antioxidant status, which can influence patients' oral health status. Diet with antioxidant properties might be helpful in these patients. More research is necessary to discover true antioxidant and salivary changes and their relation with HIV consequences in future. Copyright© Bentham Science Publishers; For any queries, please email at epub@benthamscience.org.

  3. Human epidermal growth factor receptor 2/neu overexpression in urothelial carcinoma of the bladder and its prognostic significance: Is it worth hype?

    Directory of Open Access Journals (Sweden)

    Santosh Kumar

    2015-01-01

    Full Text Available Aims: In urothelial tumors of the urinary bladder, human epidermal growth factor receptor 2 (HER-2/neu expression has been reported over 10 years, but there is no clear correlation between prognosis and recurrence rate. The present study evaluates prognostic implication of HER-2/neu expression. Subjects and Methods: In this study, 100 formalin-fixed paraffin-embedded specimens of primary transitional cell carcinoma of the bladder were processed. HER-2/neu monoclonal antibody immunohistochemistry staining procedure used for the study. Results: A total of 70 (70% patients were positive for overexpression of HER-2/neu. HER-2/neu was positive in patients with 42 (70% superficial tumor, 28 (70% muscle invasive tumor, 41 (75.9% high-grade tumor, 29 (63% low grade tumor, 31 (68.9% recurrent tumor, and 6 (66.6% had positive lymph nodes. Conclusions: Human epidermal growth factor receptor 2/neu over expression was not correlated with the tumor stage, lymphnode metastasis or recurrence of the disease. HER-2/neu overexpression was statistically insignificantly correlated with the differentiation grade (P < 0.161 as compared to previous studies. Future studies on HER-2 expression with chemo-sensitivity and efficacy of HER-2-targeted therapies in urothelial carcinomas is needed.

  4. Evaluation of dermal-epidermal skin equivalents ('composite-skin') of human keratinocytes in a collagen-glycosaminoglycan matrix(Integra artificial skin).

    Science.gov (United States)

    Kremer, M; Lang, E; Berger, A C

    2000-09-01

    Integra artificial skin (Integra LifeSciences Corp., Plainsboro, NJ, USA) is a dermal template consisting of bovine collagen, chondroitin-6-sulphate and a silastic membrane manufactured as Integra. This product has gained widespread use in the clinical treatment of third degree burn wounds and full thickness skin defects of different aetiologies. The product was designed to significantly reduce the time needed to achieve final wound closure in the treatment of major burn wounds, to optimise the sparse autologous donor skin resources and to improve the durable mechanical quality of the skin substitute. The clinical procedure requires two stages. The first step creates a self neodermis, the second creates a self epidermis on the neodermis. However, it is desirable to cover major burn wounds early in a single step by a skin substitute consisting of a dermal equivalent seeded in vitro with autologous keratinocytes ('composite-skin') out of which a full thickness skin develops in vivo.The goal of this experimental study was to develop a method to integrate human keratinocytes in homogeneous distribution and depth into Integra Artificial Skin. The seeded cell-matrix composites were grafted onto athymic mice in order to evaluate their potential to reconstitute a human epidermis in vivo. We were able to demonstrate that the inoculated human keratinocytes reproducibly displayed a homogeneous pattern of distribution, adherence, proliferation and confluence. The cell-matrix composites grafted in this model exhibited good wound adherence, complete healing, minor wound contraction and had the potential to reconstitute an elastic, functional and durable human skin. Histologically we were able to show that the inoculated human keratinocytes in vivo colonised the matrix in a histomorphologically characteristic epidermal pattern (keratomorula, keratinocyte bubbling) and developed a persisting, stratified, keratinising epidermis which immunohistologically proved to be of human

  5. Functional imaging of human epidermal growth factor receptor 2-positive metastatic breast cancer using (64)Cu-DOTA-trastuzumab PET.

    Science.gov (United States)

    Mortimer, Joanne E; Bading, James R; Colcher, David M; Conti, Peter S; Frankel, Paul H; Carroll, Mary I; Tong, Shan; Poku, Erasmus; Miles, Joshua K; Shively, John E; Raubitschek, Andrew A

    2014-01-01

    Women with human epidermal growth factor receptor 2 (HER2)-positive breast cancer are candidates for treatment with the anti-HER2 antibody trastuzumab. Assessment of HER2 status in recurrent disease is usually made by core needle biopsy of a single lesion, which may not represent the larger tumor mass or other sites of disease. Our long-range goal is to develop PET of radiolabeled trastuzumab for systemically assessing tumor HER2 expression and identifying appropriate use of anti-HER2 therapies. The purpose of this study was to evaluate PET/CT of (64)Cu-DOTA-trastuzumab for detecting and measuring tumor uptake of trastuzumab in patients with HER2-positive metastatic breast cancer. Eight women with biopsy-confirmed HER2-positive metastatic breast cancer and no anti-HER2 therapy for 4 mo or longer underwent complete staging, including (18)F-FDG PET/CT. For 6 of the 8 patients, (64)Cu-DOTA-trastuzumab injection (364-512 MBq, 5 mg of trastuzumab) was preceded by trastuzumab infusion (45 mg). PET/CT (PET scan duration 1 h) was performed 21-25 (day 1) and 47-49 (day 2) h after (64)Cu-DOTA-trastuzumab injection. Scan fields of view were chosen on the basis of (18)F-FDG PET/CT. Tumor detection sensitivity and uptake analyses were limited to lesions identifiable on CT; lesions visualized relative to adjacent tissue on PET were considered PET-positive. Radiolabel uptake in prominent lesions was measured as maximum single-voxel standardized uptake value (SUVmax). Liver uptake of (64)Cu was reduced approximately 75% with the 45-mg trastuzumab predose, without significant effect on tumor uptake. The study included 89 CT-positive lesions. Detection sensitivity was 77%, 89%, and 93% for day 1, day 2, and (18)F-FDG, respectively. On average, tumor uptake was similar for (64)Cu-DOTA-trastuzumab and (18)F-FDG (SUVmax and range, 8.1 and 3.0-22.5 for day 1 [n = 48]; 8.9 and 0.9-28.9 for day 2 [n = 38]; 9.7 and 3.3-25.4 for (18)F-FDG [n = 56]), but same-lesion SUVmax was not correlated

  6. Activation of histamine H4 receptor inhibits TNFα/IMD-0354-induced apoptosis in human salivary NS-SV-AC cells.

    Science.gov (United States)

    Stegajev, Vasili; Kouri, Vesa-Petteri; Salem, Abdelhakim; Rozov, Stanislav; Stark, Holger; Nordström, Dan C E; Konttinen, Yrjö T

    2014-12-01

    Apoptosis is involved in the pathogenesis of Sjögren's syndrome (SS), an autoimmune disease affecting exocrine glands. Our recent studies revealed diminished histamine H4 receptor (H₄R) expression and impaired histamine transport in the salivary gland epithelial cells in SS. The aim was now to test if nanomolar histamine and high-affinity H₄R signaling affect apoptosis of human salivary gland epithelial cell. Simian virus 40-immortalized acinar NS-SV-AC cells were cultured in serum-free keratinocyte medium ± histamine H₄R agonist HST-10. Expression and internalization of H₄R were studied by immunofluorescence staining ± clathrin inhibitor methyl-β-cyclodextrin (MβCD). Apoptosis induced using tumor necrosis factor-α with nuclear factor-κB inhibitor IMD-0354 was studied using phase contrast microscopy, Western blot, flow cytometry and polymerase chain reaction (qRT-PCR). HST-10-stimulated H₄R internalization was inhibited by MβCD. Western blotting revealed diminished phosphorylated c-Jun N-terminal kinase JNK, but unchanged levels of phosphorylated extracellular signal regulated kinase pERK1/2 in H₄R-stimulated samples compared to controls. qRT-PCR showed up-regulated expression of anti-apoptotic B cell lymphoma-extra large/Bcl-xL mRNAs and proteins, whereas pro-apoptotic Bcl-2-associated X protein/BAX remained unchanged in H4R-stimulated samples. H₄R stimulation diminished cleavage of PARP and flow cytometry showed significant dose-dependent inhibitory effect of H₄R stimulation on apoptosis. As far as we know this is the first study showing inhibitory effect of H₄R activation on apoptosis of human salivary gland cells. Diminished H₄R-mediated activation may contribute to loss of immune tolerance in autoimmune diseases and in SS in particular.

  7. Human salivary agglutinin binds to lung surfactant protein-D and is identical with scavenger receptor protein gp-340

    DEFF Research Database (Denmark)

    Ligtenberg, T J; Bikker, F J; Groenink, J

    2001-01-01

    bound in a similar way to Streptococcus mutans and surfactant protein-D. Histochemically, the distribution of gp-340 in the submandibular salivary glands was identical with the agglutinin distribution, as shown in a previous paper [Takano, Bogert, Malamud, Lally and Hand (1991) Anat. Rec. 230, 307......-318]. We conclude that agglutinin is identical with gp-340, and that this molecule interacts with S. mutans and surfactant protein-D....

  8. Influences of pH and Iron Concentration on the Salivary Microbiome in Individual Humans with and without Caries.

    Science.gov (United States)

    Zhou, Jianye; Jiang, Nan; Wang, Zhenzhen; Li, Longqing; Zhang, Jumei; Ma, Rui; Nie, Hongbing; Li, Zhiqiang

    2017-02-15

    This study aimed to identify the differences in the oral microbial communities in saliva from patients with and without caries by performing sequencing with the Illumina MiSeq platform, as well as to further assess their relationships with environmental factors (salivary pH and iron concentration). Forty-three volunteers were selected, including 21 subjects with and 22 without caries, from one village in Gansu, China. Based on 966,255 trimmed sequences and clustering at the 97% similarity level, 1,303 species-level operational taxonomic units were generated. The sequencing data for the two groups revealed that (i) particular distribution patterns (synergistic effects or competition) existed in the subjects with and without caries at both the genus and species levels and (ii) both the salivary pH and iron concentration had significant influences on the microbial community structure. The significant influences of the oral environment observed in this study increase the current understanding of the salivary microbiome in caries. These results will be useful for expanding research directions and for improving disease diagnosis, prognosis, and therapy. Copyright © 2017 Zhou et al.

  9. Lundep, a sand fly salivary endonuclease increases Leishmania parasite survival in neutrophils and inhibits XIIa contact activation in human plasma.

    Directory of Open Access Journals (Sweden)

    Andrezza C Chagas

    2014-02-01

    Full Text Available Neutrophils are the host's first line of defense against infections, and their extracellular traps (NET were recently shown to kill Leishmania parasites. Here we report a NET-destroying molecule (Lundep from the salivary glands of Lutzomyia longipalpis. Previous analysis of the sialotranscriptome of Lu. longipalpis showed the potential presence of an endonuclease. Indeed, not only was the cloned cDNA (Lundep shown to encode a highly active ss- and dsDNAse, but also the same activity was demonstrated to be secreted by salivary glands of female Lu. longipalpis. Lundep hydrolyzes both ss- and dsDNA with little sequence specificity with a calculated DNase activity of 300000 Kunitz units per mg of protein. Disruption of PMA (phorbol 12 myristate 13 acetate- or parasite-induced NETs by treatment with recombinant Lundep or salivary gland homogenates increases parasite survival in neutrophils. Furthermore, co-injection of recombinant Lundep with metacyclic promastigotes significantly exacerbates Leishmania infection in mice when compared with PBS alone or inactive (mutagenized Lundep. We hypothesize that Lundep helps the parasite to establish an infection by allowing it to escape from the leishmanicidal activity of NETs early after inoculation. Lundep may also assist blood meal intake by lowering the local viscosity caused by the release of host DNA and as an anticoagulant by inhibiting the intrinsic pathway of coagulation.

  10. Cultivation and irradiation of human fibroblasts in a medium enriched with platelet lysate for obtaining feeder layer in epidermal cell culture

    International Nuclear Information System (INIS)

    Yoshito, Daniele

    2011-01-01

    For over 30 years, the use of culture medium, enriched with bovine serum, and murines fibroblasts, with the rate of proliferation controlled by irradiation or by share anticarcinogenic drugs, has been playing successfully its role in assisting in the development of keratinocytes in culture, for clinical purposes. However, currently there is a growing concern about the possibility of transmitting prions and animals viruses to transplanted patients. Taking into account this concern, the present work aims to cultivate human fibroblasts in a medium enriched with human platelets lysate and determine the irradiation dose of these cells, for obtaining feeder layer in epidermal cell culture. For carrying out the proposed objective, platelets lysis has standardized, this lysate was used for human fibroblasts cultivation and the irradiation dose enough to inhibit its duplication was evaluated. Human keratinocytes were cultivated in these feeder layers, in culture medium enriched with the lysate. With these results we conclude that the 10% platelets lysate promoted a better adhesion and proliferation of human fibroblasts and in all dose levels tested (60 to 300 Gy), these had their mitotic activity inactivated by ionizing irradiation, being that the feeder layers obtained with doses from 70 to 150 Gy were those that provided the best development of keratinocytes in medium containing 2.5% of human platelet lysate. Therefore, it was possible to standardize both the cultivation of human fibroblasts as its inactivation for use as feeder layer in culture of keratinocytes, so as to eliminate xenobiotics components. (author)

  11. Up-regulation of Store-operated Ca2+ Entry and Nuclear Factor of Activated T Cells Promote the Acinar Phenotype of the Primary Human Salivary Gland Cells.

    Science.gov (United States)

    Jang, Shyh-Ing; Ong, Hwei Ling; Liu, Xibao; Alevizos, Ilias; Ambudkar, Indu S

    2016-04-15

    The signaling pathways involved in the generation and maintenance of exocrine gland acinar cells have not yet been established. Primary human salivary gland epithelial cells, derived from salivary gland biopsies, acquired an acinar-like phenotype when the [Ca(2+)] in the serum-free medium (keratinocyte growth medium, KGM) was increased from 0.05 mm (KGM-L) to 1.2 mm (KGM-H). Here we examined the mechanism underlying this Ca(2+)-dependent generation of the acinar cell phenotype. Compared with cells in KGM-L, those in KGM-H display enhancement of Orai1, STIM1, STIM2, and nuclear factor of activated T cells 1 (NFAT1) expression together with an increase in store-operated Ca(2+) entry (SOCE), SOCE-dependent nuclear translocation of pGFP-NFAT1, and NFAT-dependent but not NFκB-dependent gene expression. Importantly, AQP5, an acinar-specific protein critical for function, is up-regulated in KGM-H via SOCE/NFAT-dependent gene expression. We identified critical NFAT binding motifs in the AQP5 promoter that are involved in Ca(2+)-dependent up-regulation of AQP5. These important findings reveal that the Ca(2+)-induced switch of salivary epithelial cells to an acinar-like phenotype involves remodeling of SOCE and NFAT signaling, which together control the expression of proteins critically relevant for acinar cell function. Our data provide a novel strategy for generating and maintaining acinar cells in culture. © 2016 by The American Society for Biochemistry and Molecular Biology, Inc.

  12. Up-regulation of Store-operated Ca2+ Entry and Nuclear Factor of Activated T Cells Promote the Acinar Phenotype of the Primary Human Salivary Gland Cells*

    Science.gov (United States)

    Jang, Shyh-Ing; Ong, Hwei Ling; Liu, Xibao; Alevizos, Ilias; Ambudkar, Indu S.

    2016-01-01

    The signaling pathways involved in the generation and maintenance of exocrine gland acinar cells have not yet been established. Primary human salivary gland epithelial cells, derived from salivary gland biopsies, acquired an acinar-like phenotype when the [Ca2+] in the serum-free medium (keratinocyte growth medium, KGM) was increased from 0.05 mm (KGM-L) to 1.2 mm (KGM-H). Here we examined the mechanism underlying this Ca2+-dependent generation of the acinar cell phenotype. Compared with cells in KGM-L, those in KGM-H display enhancement of Orai1, STIM1, STIM2, and nuclear factor of activated T cells 1 (NFAT1) expression together with an increase in store-operated Ca2+ entry (SOCE), SOCE-dependent nuclear translocation of pGFP-NFAT1, and NFAT-dependent but not NFκB-dependent gene expression. Importantly, AQP5, an acinar-specific protein critical for function, is up-regulated in KGM-H via SOCE/NFAT-dependent gene expression. We identified critical NFAT binding motifs in the AQP5 promoter that are involved in Ca2+-dependent up-regulation of AQP5. These important findings reveal that the Ca2+-induced switch of salivary epithelial cells to an acinar-like phenotype involves remodeling of SOCE and NFAT signaling, which together control the expression of proteins critically relevant for acinar cell function. Our data provide a novel strategy for generating and maintaining acinar cells in culture. PMID:26903518

  13. Structure and function of the Juxta membrane domain of the human epidermal growth factor receptor by NMR spectroscopy

    International Nuclear Information System (INIS)

    Choowongkomon, Kiattawee; Carlin, Cathleen; Sonnichsen, Frank D.

    2005-10-01

    The epidermal growth factor receptor (EGFR) is a member of the receptor tyrosine kinase family involved in the regulation of cellular proliferation and differentiation. Its juxta membrane domain (JX), the region located between the transmembrane and kinase domains, plays important roles in receptor trafficking since both basolateral sorting in polarized epithelial cells and lysosomal sorting signals are identified in this region. In order to understand the regulation of these signals, we characterized the structural properties of recombinant JX domain in dodecyl phosphocholine detergent (DPC) by nuclear magnetic resonance (NMR) spectroscopy. In DPC micelles, structures derived from NMR data showed three amphipathic, helical segments. Two equivalent average structural models on the surface of micelles were obtained that differ only in the relative orientation between the first and second helices. Our data suggests that the activity of sorting signals may be regulated by their membrane association and restricted accessibility in the intact receptor

  14. The biological activity of the human epidermal growth factor receptor is positively regulated by its C-terminal tyrosines

    DEFF Research Database (Denmark)

    Helin, K; Velu, T; Martin, P

    1991-01-01

    mutants in the full length receptor. EGF-dependent transforming ability of the single point mutants is similar to that of the wild type, while that of double mutants is decreased and an even lower activity is present in the triple mutant. In each bioassay, including EGF-dependent focal transformation...... biologically. The EGF-R kinase activity is affected by tyrosine substitution since in vitro phosphorylation of exogenous substrates is reduced in the double and triple mutants. Autophosphorylation, in vivo and in vitro, is also reduced, but not totally abolished in the triple point mutant and Dc123 indicating......The epidermal growth factor receptor (EGF-R) C-terminus contains three conserved tyrosines (Y-1068, Y-1148, Y-1173) which are phosphorylated upon EGF activation. To clarify the functional role of these tyrosines, each has been mutated to phenylalanine and studied as single, double and triple...

  15. Toxic epidermal necrolysis successfully treated with etanercept.

    Science.gov (United States)

    Gubinelli, Emanuela; Canzona, Flora; Tonanzi, Tiziano; Raskovic, Desanka; Didona, Biagio

    2009-03-01

    Toxic epidermal necrolysis (TEN) is a rare and acute severe adverse reaction to drugs, characterised by massive apoptosis and widespread epidermal and mucosal detachment. Although no gold standard therapy exists, human i.v. immunoglobulins have recently been described as an effective treatment for this disease. We report a case of phenobarbital-induced TEN in a 59-year-old white woman where the epidermal detachment stopped 48 h after beginning the etanercept treatment with complete healing after 20 days. To the best of our knowledge, this is only the second reported case of TEN successfully treated with etanercept.

  16. Treatment challenges for community oncologists treating postmenopausal women with endocrine-resistant, hormone receptor-positive, human epidermal growth factor receptor 2-negative advanced breast cancer

    International Nuclear Information System (INIS)

    Gradishar, William J

    2016-01-01

    Community-based oncologists are faced with challenges and opportunities when delivering quality patient care, including high patient volumes and diminished resources; however, there may be the potential to deliver increased patient education and subsequently improve outcomes. This review discusses the treatment of postmenopausal women with endocrine-resistant, hormone receptor-positive, human epidermal growth factor receptor 2- negative advanced breast cancer in order to illustrate considerations in the provision of pertinent quality education in the treatment of these patients and the management of therapy-related adverse events. An overview of endocrine-resistant breast cancer and subsequent treatment challenges is also provided. Approved treatment options for endocrine-resistant breast cancer include hormonal therapies and mammalian target of rapamycin inhibitors. Compounds under clinical investigation are also discussed

  17. Establishment and characterization of a new cell line, FPS-1, derived from human undifferentiated pleomorphic sarcoma, overexpressing epidermal growth factor receptor and cyclooxygenase-2.

    Science.gov (United States)

    Hakozaki, Michiyuki; Hojo, Hiroshi; Sato, Michiko; Tajino, Takahiro; Yamada, Hitoshi; Kikuchi, Shinichi; Abe, Masafumi

    2006-01-01

    Undifferentiated pleomorphic sarcoma (UPS) is among the most common soft tissue sarcomas in adults. In order to improve its aggressive course or prognosis and establish new therapeutic methods, molecular genetic and biological characterizations of UPS are required. A new human UPS cell line (FPS-1) was established from UPS of the upper arm of a 79-year-old man. The cell line has been maintained for over 14 months with more than 60 passages. FPS-1 cells were characterized using molecular biological methods. FPS-1 cells showed the same morphological and immunophenotypical characteristics as the primary tumor. Cytogenetic and molecular analyses revealed a nonsense mutation in exon 6 of the p53 gene. Epidermal growth factor receptor (EGFR) and cyclooxygenase-2 (COX-2) were expressed in FPS-1 cells. FPS-1 cells might be useful for investigating biological behavior and developing new molecular targeting antitumor drugs for UPS with EGFR or COX-2 expression.

  18. Response to Therapy and Outcomes in Oropharyngeal Cancer Are Associated With Biomarkers Including Human Papillomavirus, Epidermal Growth Factor Receptor, Gender, and Smoking

    International Nuclear Information System (INIS)

    Kumar, Bhavna; Cordell, Kitrina G.; Lee, Julia S.; Prince, Mark E.; Tran, Huong H.; Wolf, Gregory T.; Urba, Susan G.; Worden, Francis P.; Chepeha, Douglas B.; Teknos, Theodoros N.; Eisbruch, Avraham; Tsien, Christina I.; Taylor, Jeremy; D'Silva, Nisha J.; Yang, Kun; Kurnit, David M.; Bradford, Carol R.

    2007-01-01

    Induction chemotherapy and concurrent chemoradiation for responders or immediate surgery for non-responders is an effective treatment strategy head and neck squamous cell carcinoma (HNSCC) of the larynx and oropharynx. Biomarkers that predict outcome would be valuable in selecting patients for therapy. In this study, the presence and titer of high risk human papilloma virus (HPV) and expression of epidermal growth factor receptor (EGFR) in pre-treatment biopsies, as well as smoking and gender were examined in oropharynx cancer patients enrolled in an organ sparing trial. HPV16 copy number was positively associated with response to therapy and with overall and disease specific survival, whereas EGFR expression, current or former smoking behavior, and female gender (in this cohort) were associated with poor response and poor survival in multivariate analysis. Smoking cessation and strategies to target EGFR may be useful adjuncts for therapy to improve outcome in the cases with the poorest biomarker profile

  19. Trastuzumab beyond progression in human epidermal growth factor receptor 2-positive advanced breast cancer: a german breast group 26/breast international group 03-05 study

    DEFF Research Database (Denmark)

    von Minckwitz, Gunter; du Bois, Andreas; Schmidt, Marcus

    2009-01-01

    PURPOSE: Trastuzumab shows clinical activity in human epidermal growth factor receptor 2 (HER-2)-positive early and advanced breast cancer. In the German Breast Group 26/Breast International Group 03-05 trial, we investigated if trastuzumab treatment should be continued beyond progression. METHODS......: Patients with HER-2-positive breast cancer that progresses during treatment with trastuzumab were randomly assigned to receive capecitabine (2,500 mg/m(2) body-surface area on days 1 through 14 [1,250 mg/m(2) semi-daily]) alone or with continuation of trastuzumab (6 mg/kg body weight) in 3-week cycles....... The primary end point was time to progression. RESULTS: We randomly assigned 78 patients to capecitabine and 78 patients to capecitabine plus trastuzumab. Sixty-five events and 38 deaths in the capecitabine group and 62 events and 33 deaths in the capecitabine-plus-trastuzumab group occurred during 15...

  20. Prognostic significance of equivocal human epidermal growth factor receptor 2 results and clinical utility of alternative chromosome 17 genes in patients with invasive breast cancer: A cohort study.

    Science.gov (United States)

    Sneige, Nour; Hess, Kenneth R; Multani, Asha S; Gong, Yun; Ibrahim, Nuhad K

    2017-04-01

    The 2013 testing guidelines for determining the human epidermal growth factor receptor 2 (HER2) status include new cutoff points for the HER2/chromosome enumeration probe 17 (CEP17) ratio and the average HER2 copy number per cell, and they recommend using a reflex test with alternative chromosome 17 probes (Ch17Ps) to resolve equivocal HER2 results. This study sought to determine the clinical utility of alternative Ch17Ps in equivocal cases and the effects of equivocal results and/or a change in the HER2 status on patients' outcomes. The University of Texas MD Anderson Cancer Center database of HER2 dual-probe fluorescence in situ hybridization results from 2000 to 2010 was searched for cases of invasive breast cancer with HER2/CEP17 ratios Cancer 2017;123:1115-1123. © 2016 American Cancer Society. © 2016 American Cancer Society.

  1. Gemcitabine Plus Docetaxel Versus Docetaxel in Patients With Predominantly Human Epidermal Growth Factor Receptor 2-Negative Locally Advanced or Metastatic Breast Cancer: A Randomized, Phase III Study by the Danish Breast Cancer Cooperative Group

    DEFF Research Database (Denmark)

    Nielsen, Dorte L; Bjerre, Karsten D; Jakobsen, Erik H

    2011-01-01

    PURPOSE The objective of this phase III study was to compare the efficacy of gemcitabine plus docetaxel (GD) versus docetaxel in patients with advanced breast cancer. PATIENTS AND METHODS Predominantly human epidermal growth factor receptor 2 (HER2) -negative patients were randomly assigned...

  2. A comprehensive two-dimensional gel protein database of noncultured unfractionated normal human epidermal keratinocytes: towards an integrated approach to the study of cell proliferation, differentiation and skin diseases

    DEFF Research Database (Denmark)

    Celis, J E; Madsen, Peder; Rasmussen, H H

    1991-01-01

    A two-dimensional (2-D) gel database of cellular proteins from noncultured, unfractionated normal human epidermal keratinocytes has been established. A total of 2651 [35S]methionine-labeled cellular proteins (1868 isoelectric focusing, 783 nonequilibrium pH gradient electrophoresis) were resolved...

  3. Herceptin Enhances the Antitumor Effect of Natural Killer Cells on Breast Cancer Cells Expressing Human Epidermal Growth Factor Receptor-2

    Directory of Open Access Journals (Sweden)

    Xiao Tian

    2017-10-01

    Full Text Available Optimal adoptive cell therapy (ACT should contribute to effective cancer treatment. The unique ability of natural killer (NK cells to kill cancer cells independent of major histocompatibility requirement makes them suitable as ACT tools. Herceptin, an antihuman epidermal growth factor receptor-2 (anti-HER2 monoclonal antibody, is used to treat HER2+ breast cancer. However, it has limited effectiveness and possible severe cardiotoxicity. Given that Herceptin may increase the cytotoxicity of lymphocytes, we explored the possible augmentation of NK cell cytotoxicity against HER2+ breast cancer cells by Herceptin. We demonstrated that Herceptin could interact with CD16 on NK cells to expand the cytotoxic NK (specifically, CD56dim cell population. Additionally, Herceptin increased NK cell migration and cytotoxicity against HER2+ breast cancer cells. In a pilot study, Herceptin-treated NK cells shrunk lung nodular metastasis in a woman with HER2+ breast cancer who could not tolerate the cardiotoxic side effects of Herceptin. Our findings support the therapeutic potential of Herceptin-treated NK cells in patients with HER2+ and Herceptin-intolerant breast cancer.

  4. Ultra-weak photon emission as a non-invasive tool for monitoring of oxidative processes in the epidermal cells of human skin: comparative study on the dorsal and the palm side of the hand.

    Science.gov (United States)

    Rastogi, Anshu; Pospísil, Pavel

    2010-08-01

    All living organisms emit spontaneous ultra-weak photon emission as a result of cellular metabolic processes. Exposure of living organisms to exogenous factors results in oxidative processes and enhancement in ultra-weak photon emission. Here, hydrogen peroxide (H(2)O(2)), as a strongly oxidizing molecule, was used to induce oxidative processes and enhance ultra-weak photon emission in human hand skin. The presented work intends to compare both spontaneous and peroxide-induced ultra-weak photon emission from the epidermal cells on the dorsal and the palm side of the hand. A highly sensitive photomultiplier tube and a charge-coupled device camera were used to detect ultra-weak photon emission from human hand skin. Spontaneous ultra-weak photon emission from the epidermal cells on the dorsal side of the hand was 4 counts/s. Topical application of 500 mM H(2)O(2) to the dorsal side of the hand caused enhancement in ultra-weak photon emission to 40 counts/s. Interestingly, both spontaneous and peroxide-induced ultra-weak photon emission from the epidermal cells on the palm side of the hand were observed to increase twice their values, i.e. 8 and 80 counts/s, respectively. Similarly, the two-dimensional image of ultra-weak photon emission observed after topical application of H(2)O(2) to human skin reveals that photon emission from the palm side exceeds the photon emission from the dorsal side of the hand. The results presented indicate that the ultra-weak photon emission originating from the epidermal cells on the dorsal and the palm side of the hand is related to the histological structure of the human hand skin. Ultra-weak photon emission is shown as a non-destructive technique for monitoring of oxidative processes in the epidermal cells of the human hand skin and as a diagnostic tool for skin diseases.

  5. Salivary expression of soluble HER2 in breast cancer patients with positive and negative HER2 status

    Directory of Open Access Journals (Sweden)

    Laidi F

    2014-07-01

    Full Text Available Fatna Laidi,1 Amal Bouziane,2 Amina Lakhdar,3 Samira Khabouze,3 Brahim Rhrab,3 Fatima Zaoui1 1Oral Biomechanics and Biotechnology Research Unit, Faculty of Dental Medicine, 2Department of Periodontology, Faculty of Dental Medicine, Biostatistical, Clinical and Epidemiological Research Laboratory, Faculty of Medicine and Pharmacy, 3Department of Obstetrics and Gynecology, Ibn Sina University Hospital, Rabat, Morocco Background: The aim of this study was to investigate the relationship between salivary concentration of the soluble fragment of the HER2 (human epidermal growth factor receptor protein and its status in mammary tissues. Methods: This case-control study was done in 27 breast cancer patients with no visible metastatic disease treated at the gynecology service, Maternity Souissi Hospital, Rabat, Morocco. Two groups were selected, ie, patients with positive and negative HER2 status in mammary tissue. The salivary HER2 protein concentration was assessed by enzyme-linked immunosorbent assay. The salivary HER2 concentration was compared between the HER2-positive and HER2-negative groups using the Mann-Whitney U test. A P-value <0.05 was considered to be statistically significant. Results: No statistically significant difference in salivary HER2 protein expression was found between the case and control groups. There was also no significant difference in clinical characteristics according to positive and negative HER2 status (P>0.05, except for the progesterone hormone receptor which was statistically significant in both the case and control groups (P=0.047. Conclusion: According to our data, salivary expression of the HER2 receptor may not be a reliable alternative to tissue assessment. Keywords: breast cancer, HER2, saliva, diagnosis

  6. Effects of sucrose on salivary flow and composition: differences between real and sham intake

    NARCIS (Netherlands)

    Harthoorn, L.F.; Brattinga, C.R.; Kekem, van C.; Neyraud, E.; Dransfield, E.

    2009-01-01

    Human saliva contains numerous salivary components that are fundamental for a healthy oral environment and the oral processing of foods. To study a possible differential influence of orosensory stimulation and metabolic activation on salivary composition, human parotid salivary flow, pH, A280, and

  7. Effects of sucrose on salivary flow and composition: Differences between real and sham intake

    NARCIS (Netherlands)

    Harthoorn, L.F.; Brattinga, C.; Kekem, K. van; Neyraud, E.; Dransfield, E.

    2009-01-01

    Human saliva contains numerous salivary components that are fundamental for a healthy oral environment and the oral processing of foods. To study a possible differential influence of orosensory stimulation and metabolic activation on salivary composition, human parotid salivary flow, pH, A280, and

  8. Triggering Apoptotic Death of Human Epidermal Keratinocytes by Malic Acid: Involvement of Endoplasmic Reticulum Stress- and Mitochondria-Dependent Signaling Pathways

    Directory of Open Access Journals (Sweden)

    Yu-Ping Hsiao

    2015-01-01

    Full Text Available Malic acid (MA has been commonly used in cosmetic products, but the safety reports in skin are sparse. To investigate the biological effects of MA in human skin keratinocytes, we investigated the potential cytotoxicity and apoptotic effects of MA in human keratinocyte cell lines (HaCaT. The data showed that MA induced apoptosis based on the observations of DAPI staining, DNA fragmentation, and sub-G1 phase in HaCaT cells and normal human epidermal keratinocytes (NHEKs. Flow cytometric assays also showed that MA increased the production of mitochondrial superoxide (mito-SOX but decreased the mitochondrial membrane potential. Analysis of bioenergetics function with the XF 24 analyzer Seahorse extracellular flux analyzer demonstrated that oxygen consumption rate (OCR was significantly decreased whereas extracellular acidification rate (ECAR was increased in MA-treated keratinocytes. The occurrence of apoptosis was proved by the increased expressions of FasL, Fas, Bax, Bid, caspases-3, -8, -9, cytochrome c, and the declined expressions of Bcl-2, PARP. MA also induced endoplasmic reticulum stress associated protein expression such as GRP78, GADD153, and ATF6α. We demonstrated that MA had anti-proliferative effect in HaCaT cell through the inhibition of cell cycle progression at G0/G1, and the induction of programmed cell death through endoplasmic reticulum stress- and mitochondria-dependent pathways.

  9. Suppression of the epidermal growth factor receptor inhibits epithelial-mesenchymal transition in human pancreatic cancer PANC-1 cells.

    Science.gov (United States)

    Chang, Zhi-Gang; Wei, Jun-Min; Qin, Chang-Fu; Hao, Kun; Tian, Xiao-Dong; Xie, Kun; Xie, Xue-Hai; Yang, Yin-Mo

    2012-05-01

    Aberrant expression of epidermal growth factor receptor (EGFR) has been detected in pancreatic cancer; however, the mechanisms of EGFR in inducing pancreatic cancer development have not been adequately elucidated. The objective of this study was to determine the role of EGFR in mediating epithelial-mesenchymal transition (EMT) in pancreatic cancer cells. Pancreatic cancer cell line PANC-1 was transfected with small interfering RNA of EGFR by use of a lentiviral expression vector to establish an EGFR-knockdown cell line (si-PANC-1). PANC-1 cells transfected with lentiviral vector expressing negative control sequence were used as negative control (NC-PANC-1). Scratch assay and transwell study were used to analyze cell migration and invasion. Real-time PCR and Western blotting were used to detect the expression of EMT markers E-cadherin, N-cadherin, vimentin, and fibronectin and transcription factors snail, slug, twist1, and sip1 in PANC-1, NC-PANC-1, and si-PANC-1 cells. Immunofluorescent staining with these antibodies and confocal microscopy were used to observe their cellular location and morphologic changes. After RNA interference of EGFR, the migration and invasion ability of si-PANC-1 cells decreased significantly. The expression of epithelial phenotype marker E-cadherin increased and the expression of mesenchymal phenotype markers N-cadherin, vimentin, and fibronectin decreased, indicating reversion of EMT. We also observed intracellular translocation of E-cadherin. Expression of transcription factors snail and slug in si-PANC-1 cells decreased significantly. Suppression of EGFR expression can significantly inhibit EMT of pancreatic cancer PANC-1 cells. The mechanism may be related with the down-regulation of the expression of transcription factors snail and slug.

  10. Biodistribution of 99mTc-labeled anti-human epidermal growth factor receptor (EGF-R) humanized monoclonal antibody h-R3 in a xenograft model of human lung adenocarcinoma

    International Nuclear Information System (INIS)

    Morales-Morales, Alejo; Duconge, Jorge; Caballero-Torres, Idania; Nunez-Gandolff, Gilda; Fernandez, Eduardo; Iznaga-Escobar, Normando

    1999-01-01

    The anti-human epidermal growth factor receptor (EGF-R) humanized monoclonal antibody (MAb) h-R3 is an (IgG 1 ), which binds to an extracellular domain of EGF-R. It was used to evaluate the biodistribution on nude mice xenografted with H-125 human lung adenocarcinoma cell line. Results were compared with its murine version of the MAb ior-egf/r3. Twenty-one athymic female 4NMRI nu/nu mice were injected intraperitoneally with 10 μg/100 μCi of 99m Tc-labeled MAbs. Immunoreactivity of 99m Tc-labeled MAbs were measured by enzyme-linked immunosorbent assay (ELISA) on H-125 cell line and the immunoreactive fractions was determined by the Lindmo method. Among all organs, significant accumulation was found in serum (27.05 ± 2.08 %ID/g) and tumor (3.903 ± 0.89 %ID/g) at 4 h after injection. These values decreased to 5.03 ± 0.50 %ID/g and 2.19 ± 0.56 %ID/g for serum and tumor, respectively. The immunoreactive fraction was found to be 0.70, with a correlation coefficient r=0.9984. With the good biodistribution and tumor uptake of the 99m Tc-labeled humanized antibody h-R3, a phase I diagnostic clinical trial of tumor with epithelial origin should be pursued

  11. Biodistribution of {sup 99m}Tc-labeled anti-human epidermal growth factor receptor (EGF-R) humanized monoclonal antibody h-R3 in a xenograft model of human lung adenocarcinoma

    Energy Technology Data Exchange (ETDEWEB)

    Morales-Morales, Alejo; Duconge, Jorge; Caballero-Torres, Idania; Nunez-Gandolff, Gilda; Fernandez, Eduardo; Iznaga-Escobar, Normando E-mail: normando@ict.cim.sld.cu

    1999-04-01

    The anti-human epidermal growth factor receptor (EGF-R) humanized monoclonal antibody (MAb) h-R3 is an (IgG{sub 1}), which binds to an extracellular domain of EGF-R. It was used to evaluate the biodistribution on nude mice xenografted with H-125 human lung adenocarcinoma cell line. Results were compared with its murine version of the MAb ior-egf/r3. Twenty-one athymic female 4NMRI nu/nu mice were injected intraperitoneally with 10 {mu}g/100 {mu}Ci of {sup 99m}Tc-labeled MAbs. Immunoreactivity of {sup 99m}Tc-labeled MAbs were measured by enzyme-linked immunosorbent assay (ELISA) on H-125 cell line and the immunoreactive fractions was determined by the Lindmo method. Among all organs, significant accumulation was found in serum (27.05 {+-} 2.08 %ID/g) and tumor (3.903 {+-} 0.89 %ID/g) at 4 h after injection. These values decreased to 5.03 {+-} 0.50 %ID/g and 2.19 {+-} 0.56 %ID/g for serum and tumor, respectively. The immunoreactive fraction was found to be 0.70, with a correlation coefficient r=0.9984. With the good biodistribution and tumor uptake of the {sup 99m}Tc-labeled humanized antibody h-R3, a phase I diagnostic clinical trial of tumor with epithelial origin should be pursued.

  12. Rapid Visualization of Human Tumor Xenografts through Optical Imaging with a Near-Infrared Fluorescent Anti–Epidermal Growth Factor Receptor Nanobody

    Directory of Open Access Journals (Sweden)

    Sabrina Oliveira

    2012-01-01

    Full Text Available Given that overexpression of the epidermal growth factor receptor (EGFR is found in many types of human epithelial cancers, noninvasive molecular imaging of this receptor is of great interest. A number of studies have employed monoclonal antibodies as probes; however, their characteristic long half-life in the bloodstream has encouraged the development of smaller probes. In this study, an anti-EGFR nanobody-based probe was developed and tested in comparison with cetuximab for application in optical molecular imaging. To this aim, the anti-EGFR nanobody 7D12 and cetuximab were conjugated to the near-infrared fluorophore IRDye800CW. 7D12-IR allowed the visualization of tumors as early as 30 minutes postinjection, whereas with cetuximab-IR, no signal above background was observed at the tumor site. Quantification of the IR-conjugated proteins in the tumors revealed ≈ 17% of injected dose per gram 2 hours after injection of 7D12-IR, which was significantly higher than the tumor uptake obtained 24 hours after injection of cetuximab-IR. This difference is associated with the superior penetration and distribution of 7D12-IR within the tumor. These results demonstrate that this anti-EGFR nanobody conjugated to the NIR fluorophore has excellent properties for rapid preclinical optical imaging, which holds promise for its future use as a complementary diagnostic tool in humans.

  13. Kinetic and biophysical investigation of the inhibitory effect of caffeine on human salivary aldehyde dehydrogenase: Implications in oral health and chemotherapy

    Science.gov (United States)

    Laskar, Amaj Ahmed; Alam, Md Fazle; Ahmad, Mohammad; Younus, Hina

    2018-04-01

    Human salivary aldehyde dehydrogenase (hsALDH) is primarily a class 3 ALDH (ALDH3A1), and is an important antioxidant enzyme present in the saliva which maintains healthy oral cavity. It detoxifies toxic aldehydes into non-toxic carboxylic acids in the oral cavity. Reduced level of hsALDH activity is a risk factor for oral cancer development. It is involved in the resistance of certain chemotherapeutic drugs. Coffee has been reported to affect the activity of salivary ALDH. In this study, the effect of caffeine on the activity (dehydrogenase and esterase) of hsALDH was investigated. The binding of caffeine to hsALDH was studied using different biophysical methods and molecular docking analysis. Caffeine was found to inhibit both crude and purified hsALDH. The Km increased and the Vmax decreased showing a mixed type of inhibition. Caffeine decreased the nucleophilicity of the catalytic cysteine residue. It binds to the active site of ALDH3A1 by forming a complex through non-covalent interactions with some highly conserved amino acid residues. It partially alters the secondary structure of the enzyme. Therefore, it is very likely that caffeine binds and inhibits the activity of hsALDH by decreasing substrate binding affinity and the catalytic efficiency of the enzyme. The study indicates that oral intake of caffeine may have a harmful effect on the oral health and may increase the risk of carcinogenesis through the inhibition of this important enzyme. Further, the inactivation of oxazaphosphorine based chemotherapeutic drugs by ALDH3A1 may be prevented by using caffeine as an adjuvant during medication which is expected to increase the sensitivity of these drugs through its inhibitory effect on the enzyme.

  14. Systemic transplantation of human adipose tissue-derived mesenchymal stem cells for the regeneration of irradiation-induced salivary gland damage.

    Directory of Open Access Journals (Sweden)

    Jae-Yol Lim

    Full Text Available OBJECTIVES: Cell-based therapy has been reported to repair or restore damaged salivary gland (SG tissue after irradiation. This study was aimed at determining whether systemic administration of human adipose-derived mesenchymal stem cells (hAdMSCs can ameliorate radiation-induced SG damage. METHODS: hAdMSCs (1 × 10(6 were administered through a tail vein of C3H mice immediately after local irradiation, and then this infusion was repeated once a week for 3 consecutive weeks. At 12 weeks after irradiation, functional evaluations were conducted by measuring salivary flow rates (SFRs and salivation lag times, and histopathologic and immunofluorescence histochemistry studies were performed to assay microstructural changes, apoptosis, and proliferation indices. The engraftment and in vivo differentiation of infused hAdMSCs were also investigated, and the transdifferentiation of hAdMSCs into amylase-producing SG epithelial cells (SGCs was observed in vitro using a co-culture system. RESULTS: The systemic administration of hAdMSCs exhibited improved SFRs at 12 weeks after irradiation. hAdMSC-transplanted SGs showed fewer damaged and atrophied acinar cells and higher mucin and amylase production levels than untreated irradiated SGs. Immunofluorescence TUNEL assays revealed fewer apoptotic cells in the hAdMSC group than in the untreated group. Infused hAdMSCs were detected in transplanted SGs at 4 weeks after irradiation and some cells were found to have differentiated into SGCs. In vitro, a low number of co-cultured hAdMSCs (13%-18% were observed to transdifferentiate into SGCs. CONCLUSION: The findings of this study indicate that hAdMSCs have the potential to protect against irradiation-induced cell loss and to transdifferentiate into SGCs, and suggest that hAdMSC administration should be viewed as a candidate therapy for the treatment of radiation-induced SG damage.

  15. Modifications of the acidic soluble salivary proteome in human children from birth to the age of 48months investigated by a top-down HPLC-ESI-MS platform.

    Science.gov (United States)

    Manconi, B; Cabras, T; Pisano, E; Sanna, M T; Olianas, A; Fanos, V; Faa, G; Nemolato, S; Iavarone, F; Castagnola, M; Messana, I

    2013-10-08

    During the first year of life the infant oral environment undergoes dramatic changes. To investigate how the salivary proteome of human children evolves during infant development we have analyzed whole saliva of 88 children aged between 0 and 48months by a top-down platform based on RP-HPLC-ESI-MS. Children were divided according to their age into five groups (A, 0-6months, N=17; B, 7-12months, N=14; C, 13-24months, N=32; D, 25-36months, N=16; E, 37-48months, N=9). The proteins and peptides analyzed were histatins (histatin-1, histatin-3 1/24), acidic proline-rich proteins, statherin, P-B peptide, and salivary cystatins. Protein and peptide quantification based on the area of the RP-HPLC-ESI-MS extracted ion current peak evidenced that: (i) concentrations of the major salivary proteins/peptides showed a minimum in the 0-6-month-old group and increased with age; (ii) the level of histatin-1 reached a maximum in the 7-12-month-old group, a minimum in the 13-24-month-aged babies and it increased again in the 25-36-month-old group; (iii) S-type cystatins were almost undetectable in the 0-6-month-old group; (iv) P-B peptide concentration greatly increased with age; (v) histatin-3 1/24 and statherin concentrations did not show any age-related variation. The top-down proteomic approach undertaken in this work reveals that the salivary proteome of human children from birth to 48months of age shows important quantitative modifications. The concentrations of the major salivary proteins, with the exception of statherin and histatin-3 1/24, showed a minimum in the 0-6-month-old group when the expression in salivary glands is probably not fully activated. Concentrations of the salivary proteins slowly increased with age, with different trends. Only histatin-1 showed the highest concentration in the 7-12-month-old group, followed by a decrease in the 13-24-month-aged children. This particular trend could be related to the phenomenon of eruption of primary dentition. This study

  16. Salivary Gland Cancer

    Science.gov (United States)

    ... contains antibodies that can kill germs. Salivary gland cancer is a type of head and neck cancer. It is rare. It may not cause any ... pain in your face Doctors diagnose salivary gland cancer using a physical exam, imaging tests, and a ...

  17. Upregulated epidermal growth factor receptor expression following near-infrared irradiation simulating solar radiation in a three-dimensional reconstructed human corneal epithelial tissue culture model.

    Science.gov (United States)

    Tanaka, Yohei; Nakayama, Jun

    2016-01-01

    Humans are increasingly exposed to near-infrared (NIR) radiation from both natural (eg, solar) and artificial (eg, electrical appliances) sources. Although the biological effects of sun and ultraviolet (UV) exposure have been extensively investigated, the biological effect of NIR radiation is still unclear. We previously reported that NIR as well as UV induces photoaging and standard UV-blocking materials, such as sunglasses, do not sufficiently block NIR. The objective of this study was to investigate changes in gene expression in three-dimensional reconstructed corneal epithelial tissue culture exposed to broad-spectrum NIR irradiation to simulate solar NIR radiation that reaches human tissues. DNA microarray and quantitative real-time polymerase chain reaction analysis were used to assess gene expression levels in a three-dimensional reconstructed corneal epithelial model composed of normal human corneal epithelial cells exposed to water-filtered broad-spectrum NIR irradiation with a contact cooling (20°C). The water-filter allowed 1,000-1,800 nm wavelengths and excluded 1,400-1,500 nm wavelengths. A DNA microarray with >62,000 different probes showed 25 and 150 genes that were up- or downregulated by at least fourfold and twofold, respectively, after NIR irradiation. In particular, epidermal growth factor receptor (EGFR) was upregulated by 19.4-fold relative to control cells. Quantitative real-time polymerase chain reaction analysis revealed that two variants of EGFR in human corneal epithelial tissue were also significantly upregulated after five rounds of 10 J/cm(2) irradiation (Psolar energy reaching the Earth is in the NIR region, which cannot be adequately blocked by eyewear and thus can induce eye damage with intensive or long-term exposure, protection from both UV and NIR radiation may prevent changes in gene expression and in turn eye damage.

  18. In vivo production of novel vitamin D2 hydroxy-derivatives by human placentas, epidermal keratinocytes, Caco-2 colon cells and the adrenal gland

    Science.gov (United States)

    Slominski, Andrzej T.; Kim, Tae-Kang; Shehabi, Haleem Z.; Tang, Edith; Benson, Heather A. E.; Semak, Igor; Lin, Zongtao; Yates, Charles R.; Wang, Jin; Li, Wei; Tuckey, Robert C.

    2014-01-01

    We investigated the metabolism of vitamin D2 to hydroxyvitamin D2 metabolites ((OH)D2) by human placentas ex-utero, adrenal glands ex-vivo and cultured human epidermal keratinocytes and colonic Caco-2 cells, and identified 20(OH)D2, 17,20(OH)2D2, 1,20(OH)2D2, 25(OH)D2 and 1,25(OH)2D2 as products. Inhibition of product formation by 22R-hydroxycholesterol indicated involvement of CYP11A1 in 20- and 17-hydroxylation of vitamin D2, while use of ketoconazole indicated involvement of CYP27B1 in 1α-hydroxylation of products. Studies with purified human CYP11A1 confirmed the ability of this enzyme to convert vitamin D2 to 20(OH)D2 and 17,20(OH)2D2. In placentas and Caco-2 cells, production of 20(OH)D2 was higher than 25(OH)D2 while in human keratinocytes the production of 20(OH)D2 and 25(OH)D2 were comparable. HaCaT keratinocytes showed high accumulation of 1,20(OH)2D2 relative to 20(OH)D2 indicating substantial CYP27B1 activity. This is the first in vivo evidence for a novel pathway of vitamin D2 metabolism initiated by CYP11A1 and modified by CYP27B1, with the product profile showing tissue- and cell-type specificity. PMID:24382416

  19. Epidermal cell-shape regulation and subpopulation kinetics during butyrate-induced terminal maturation of normal and SV40-transformed human keratinocytes: epithelial models of differentiation therapy.

    Science.gov (United States)

    Staiano-Coico, L; Steinberg, M; Higgins, P J

    1990-10-15

    Recent data indicate that malignant human epidermal cells may be appropriate targets for sodium butyrate (NaB)-mediated differentiation therapy. The response of pre- and post-crisis populations of SV40-transformed human keratinocytes (SVKs) to this differentiation-inducing agent was assessed, therefore, within the framework of NaB-directed normal human keratinocyte (NHK) maturation. NaB augmented cornified envelope (CE) production in NHK and pre-crisis SVK cultures; the time-course and efficiency of induced maturation were similar in the 2 cell systems. In NHKs, the percentage of amplifying ("B" substate) cells decreased with time in NaB correlating with increases in both "C" stage keratinocytes and CEs. The latter formed over one or 2 layers of nucleated basal-like cells. Inductions were accompanied by immediate cell cycle blocks (in both the G1 and G2/M phases), reorganization within the actin cytoskeleton, and transient early increases in cellular actin content. Increased NHK and pre-crisis SVK cytoskeletal-associated actin reached a maximum approximately 48 hr after NaB addition and preceded development of CEs. The CE precursors, thus, probably reside in the "B" substate. Post-crisis SVKs, in contrast, were refractive to NaB-induced terminal maturation or cell-cycle perturbation, failed to initiate actin filament rearrangements, and retained a basal cell-like phenotype. Stable transformation of human SVKs in post-crisis phase, therefore, appears to be associated with loss of maturation "competence" within the "B" keratinocyte subpopulation.

  20. Epidermal growth factor and insulin-like growth factor I upregulate the expression of the epidermal growth factor system in rat liver

    DEFF Research Database (Denmark)

    Bor, M V; Sørensen, B S; Vinter-Jensen, L

    2000-01-01

    BACKGROUND/AIM: Both epidermal growth factor and insulin-like growth factor I play a role in connection with the liver. In the present study, the possible interaction of these two growth factor systems was studied by investigating the effect of epidermal growth factor or insulin-like growth factor...... I treatment on the expression of the epidermal growth factor receptor, and its activating ligands, transforming growth factor-alpha and epidermal growth factor. METHODS: Fifty-five male rats received no treatment, human recombinant epidermal growth factor or human recombinant insulin-like growth.......8+/-1.6 fmol/mg protein epidermal growth factor and 144+/-22 fmol/mg protein transforming growth factor-alpha. Both epidermal growth factor and insulin-like growth factor I treatment increased the expression of mRNA for transforming growth factor-alpha and epidermal growth factor receptor, as well...

  1. Effects of Thermal Resistance on One-Dimensional Thermal Analysis of the Epidermal Flexible Electronic Devices Integrated with Human Skin

    Science.gov (United States)

    Li, He; Cui, Yun

    2017-12-01

    Nowadays, flexible electronic devices are increasingly used in direct contact with human skin to monitor the real-time health of human body. Based on the Fourier heat conduction equation and Pennes bio-heat transfer equation, this paper deduces the analytical solutions of one - dimensional heat transfer for flexible electronic devices integrated with human skin under the condition of a constant power. The influence of contact thermal resistance between devices and skin is considered as well. The corresponding finite element model is established to verify the correctness of analytical solutions. The results show that the finite element analysis agrees well with the analytical solution. With bigger thermal resistance, temperature increase of skin surface will decrease. This result can provide guidance for the design of flexible electronic devices to reduce the negative impact that exceeding temperature leave on human skin.

  2. INHIBITION OF PROTEIN TYROSINE PHOSPHATASE ACTIVITY MEDIATES EPIDERMAL GROWTH FACTOR RECEPTOR SIGNALING IN HUMAN AIRWAY EPITHELIAL CELLS

    Science.gov (United States)

    Epidemiological studies have implicated zinc in the toxicity of ambient particulate matter (PM) inhalation. We previously showed that exposure to metal-laden PM inhibits protein tyrosine phosphatase (PTP) activity in human primary bronchial epithelial cells (HAEC) and leads t...

  3. Epidermal growth factor receptor signalling in human breast cancer cells operates parallel to estrogen receptor α signalling and results in tamoxifen insensitive proliferation

    International Nuclear Information System (INIS)

    Moerkens, Marja; Zhang, Yinghui; Wester, Lynn; Water, Bob van de; Meerman, John HN

    2014-01-01

    Tamoxifen resistance is a major problem in the treatment of estrogen receptor (ER) α -positive breast cancer patients. Although the mechanisms behind tamoxifen resistance are still not completely understood, clinical data suggests that increased expression of receptor tyrosine kinases is involved. Here, we studied the estrogen and anti-estrogen sensitivity of human breast cancer MCF7 cells that have a moderate, retroviral-mediated, ectopic expression of epidermal growth factor receptor (MCF7-EGFR). Proliferation of MCF7-EGFR and parental cells was induced by 17β-estradiol (E2), epidermal growth factor (EGF) or a combination of these. Inhibition of proliferation under these conditions was investigated with 4-hydroxy-tamoxifen (TAM) or fulvestrant at 10 -12 to 10 -6 M. Cells were lysed at different time points to determine the phosphorylation status of EGFR, MAPK 1/3 , AKT and the expression of ERα. Knockdown of target genes was established using smartpool siRNAs. Transcriptomics analysis was done 6 hr after stimulation with growth factors using Affymetrix HG-U133 PM array plates. While proliferation of parental MCF7 cells could only be induced by E2, proliferation of MCF7-EGFR cells could be induced by either E2 or EGF. Treatment with TAM or fulvestrant did significantly inhibit proliferation of MCF7-EGFR cells stimulated with E2 alone. EGF treatment of E2/TAM treated cells led to a marked cell proliferation thereby overruling the anti-estrogen-mediated inhibition of cell proliferation. Under these conditions, TAM however did still inhibit ERα- mediated transcription. While siRNA-mediated knock-down of EGFR inhibited the EGF- driven proliferation under TAM/E2/EGF condition, knock down of ERα did not. The TAM resistant cell proliferation mediated by the conditional EGFR-signaling may be dependent on the PI3K/Akt pathway but not the MEK/MAPK pathway, since a MEK inhibitor (U0126), did not block the proliferation. Transcriptomic analysis under the various E2/TAM

  4. Radionecrosis skin model induced an athymic mouse nude (Nu/Nu) for development of dermal-epidermal human substitute based regenerative therapy

    International Nuclear Information System (INIS)

    Mosca, Rodrigo Crespo

    2014-01-01

    The neoplasms incidence has increased significantly in recent years and continued population growth and aging will increase the statistics of this illness in the world's diseases. The cancer treatment usually consists in individual or combined use of chemotherapy, surgery and radiotherapy depending on the etiology of the tumor. In cases where radiotherapy is used in addition to the therapeutic effects of radiation, specific complications can occur, and in the skin, these complications can be present with a clinical expression ranging from erythema to radionecrosis, and this latter being the adverse effect with greater severity. The radionecrosis treatment consists in debridement necrotic areas and covering the surgical wounds. Autologous grafts are most commonly used for this covering, however when large areas are affected, allografts can be used for occlusive treatment and the keratinocytes and adipose derived stem cells (ADSC) addition becomes an alternative, due to the knowing for immunomodulatory and regenerative response. For that reason, aiming to simulate the radionecrosis adverse effects, an animal model of induced cutaneous radionecrosis was created, in athymic mouse Nude (Nu/Nu), for developing regenerative therapies based on human dermal-epidermal substitutes containing keratinocytes and ADSC, which proved occlusive as an efficient treatment, furthermore, having this radionecrosis animal model established, new possibilities for treatment of diseases involving dermal regeneration, can be tested. (author)

  5. Altered growth, differentiation, and responsiveness to epidermal growth factor of human embryonic mesenchymal cells of palate by persistent rubella virus infection

    International Nuclear Information System (INIS)

    Yoneda, T.; Urade, M.; Sakuda, M.; Miyazaki, T.

    1986-01-01

    We previously demonstrated that human embryonic mesenchymal cells derived from the palate (HEMP cells) retain alkaline phosphatase (ALP) content and capacity for collagen synthesis after long-term culture, and their growth is markedly stimulated by epidermal growth factor (EGF). There was a dramatic decrease in ALP content and capacity to synthesize collagen in HEMP cells (HEMP-RV cells) persistently infected with rubella virus (RV). EGF increased ALP activity and decreased collagen synthesis in HEMP cells, whereas EGF showed no effect on these activities in HEMP-RV cells. Growth of HEMP-RV cells was slightly reduced compared with that of HEMP cells. EGF stimulated growth of HEMP cells and to a lesser extent of HEMP-RV cells. Binding of 125 I-EGF to cell-surface receptors in HEMP-RV cells was, to our surprise, twice as much as that in HEMP cells. However, internalization of bound 125 I-EGF in HEMP-RV cells was profoundly diminished. Thus, persistent RV infection causes not only changes in HEMP cell growth and differentiation but a decrease in or loss of HEMP cell responsiveness to EGF. The effects of persistent RV infection on palatal cell differentiation as well as growth may be responsible for the pathogenesis of congenital rubella. Furthermore, since HEMP cells appear to be closely related to osteoblasts, these results suggest a mechanism for RV-induced osseous abnormalities manifested in congenital rubella patients

  6. Comet assay in reconstructed 3D human epidermal skin models—investigation of intra- and inter-laboratory reproducibility with coded chemicals

    Science.gov (United States)

    Pfuhler, Stefan

    2013-01-01

    Reconstructed 3D human epidermal skin models are being used increasingly for safety testing of chemicals. Based on EpiDerm™ tissues, an assay was developed in which the tissues were topically exposed to test chemicals for 3h followed by cell isolation and assessment of DNA damage using the comet assay. Inter-laboratory reproducibility of the 3D skin comet assay was initially demonstrated using two model genotoxic carcinogens, methyl methane sulfonate (MMS) and 4-nitroquinoline-n-oxide, and the results showed good concordance among three different laboratories and with in vivo data. In Phase 2 of the project, intra- and inter-laboratory reproducibility was investigated with five coded compounds with different genotoxicity liability tested at three different laboratories. For the genotoxic carcinogens MMS and N-ethyl-N-nitrosourea, all laboratories reported a dose-related and statistically significant increase (P 30% cell loss), and the overall response was comparable in all laboratories despite some differences in doses tested. The results of the collaborative study for the coded compounds were generally reproducible among the laboratories involved and intra-laboratory reproducibility was also good. These data indicate that the comet assay in EpiDerm™ skin models is a promising model for the safety assessment of compounds with a dermal route of exposure. PMID:24150594

  7. Recommendations on disease management for patients with advanced human epidermal growth factor receptor 2-positive breast cancer and brain metastases: American Society of Clinical Oncology clinical practice guideline.

    Science.gov (United States)

    Ramakrishna, Naren; Temin, Sarah; Chandarlapaty, Sarat; Crews, Jennie R; Davidson, Nancy E; Esteva, Francisco J; Giordano, Sharon H; Gonzalez-Angulo, Ana M; Kirshner, Jeffrey J; Krop, Ian; Levinson, Jennifer; Modi, Shanu; Patt, Debra A; Perez, Edith A; Perlmutter, Jane; Winer, Eric P; Lin, Nancy U

    2014-07-01

    To provide formal expert consensus-based recommendations to practicing oncologists and others on the management of brain metastases for patients with human epidermal growth factor receptor 2 (HER2) -positive advanced breast cancer. The American Society of Clinical Oncology (ASCO) convened a panel of medical oncology, radiation oncology, guideline implementation, and advocacy experts and conducted a systematic review of the literature. When that failed to yield sufficiently strong quality evidence, the Expert Panel undertook a formal expert consensus-based process to produce these recommendations. ASCO used a modified Delphi process. The panel members drafted recommendations, and a group of other experts joined them for two rounds of formal ratings of the recommendations. No studies or existing guidelines met the systematic review criteria; therefore, ASCO conducted a formal expert consensus-based process. Patients with brain metastases should receive appropriate local therapy and systemic therapy, if indicated. Local therapies include surgery, whole-brain radiotherapy, and stereotactic radiosurgery. Treatments depend on factors such as patient prognosis, presence of symptoms, resectability, number and size of metastases, prior therapy, and whether metastases are diffuse. Other options include systemic therapy, best supportive care, enrollment onto a clinical trial, and/or palliative care. Clinicians should not perform routine magnetic resonance imaging (MRI) to screen for brain metastases, but rather should have a low threshold for MRI of the brain because of the high incidence of brain metastases among patients with HER2-positive advanced breast cancer. © 2014 by American Society of Clinical Oncology.

  8. From bench to bedside: What do we know about hormone receptor-positive and human epidermal growth factor receptor 2-positive breast cancer?

    Science.gov (United States)

    Wu, Victoria Shang; Kanaya, Noriko; Lo, Chiao; Mortimer, Joanne; Chen, Shiuan

    2015-09-01

    Breast cancer is a heterogeneous disease. Thanks to extensive efforts from research scientists and clinicians, treatment for breast cancer has advanced into the era of targeted medicine. With the use of several well-established biomarkers, such as hormone receptors (HRs) (i.e., estrogen receptor [ER] and progesterone receptor [PgR]) and human epidermal growth factor receptor-2 (HER2), breast cancer patients can be categorized into multiple subgroups with specific targeted treatment strategies. Although therapeutic strategies for HR-positive (HR+) HER2-negative (HER2-) breast cancer and HR-negative (HR-) HER2-positive (HER2+) breast cancer are well-defined, HR+ HER2+ breast cancer is still an overlooked subgroup without tailored therapeutic options. In this review, we have summarized the molecular characteristics, etiology, preclinical tools and therapeutic options for HR+ HER2+ breast cancer. We hope to raise the attention of both the research and the medical community on HR+ HER2+ breast cancer, and to advance patient care for this subtype of disease. Copyright © 2015 Elsevier Ltd. All rights reserved.

  9. Characteristics and treatment of human epidermal growth factor receptor 2 positive breast cancer: 43,485 cases from the National Cancer Database treated in 2010 and 2011.

    Science.gov (United States)

    Killelea, Brigid K; Chagpar, Anees B; Horowitz, Nina R; Lannin, Donald R

    2017-02-01

    Although identification of human epidermal growth factor receptor 2 (Her2) positive breast cancer represents one of the greatest advances over the past 3 decades, it has not been studied extensively on a national level. The National Cancer Database is a joint project of the American Cancer Society and the American College of Surgeons and contains data on about 70% of the cancer cases in the United States. Data on Her2 have been collected since 2010 and was used for this study. Of 298,937 cases of invasive breast cancer with known Her2 status diagnosed in 2010 and 2011, 43,485 (14.5%) were Her2 positive. Her2 positivity was greatest in Asian/Pacific Islanders and least in non-Hispanic Whites and was markedly more common in younger women. The incidence of Her2 positive tumors ranged from a low of 13.9% in the Mountain West region to a high of 16.0% in the West South Central region (P breast preservation (odds ratio = .78, confidence interval = .76 to .80). Her2 positive tumors have distinct epidemiologic, clinical, and treatment characteristics. Copyright © 2016 Elsevier Inc. All rights reserved.

  10. Human epidermal growth factor receptor 2 testing in invasive breast cancer: should histological grade, type and oestrogen receptor status influence the decision to repeat testing?

    Science.gov (United States)

    Rakha, Emad A; Pigera, Marian; Shin, Sandra J; D'Alfonso, Timothy; Ellis, Ian O; Lee, Andrew H S

    2016-07-01

    The recent American Society of Clinical Oncology/College of American Pathologists guidelines for human epidermal growth factor receptor 2 (HER2) testing in breast cancer recommend repeat testing based on tumour grade, tumour type, and hormone receptor status. The aim of this study was to test the value of these criteria. HER2 status was concordant in the core biopsies and excision specimens in 392 of 400 invasive carcinomas. The major reasons for discordance were amplification around the cut-off for positivity and tumour heterogeneity. Of 116 grade 3 carcinomas that were HER2-negative in the core biopsy, four were HER2-positive in the excision specimen. Three of these four either showed borderline negative amplification in the core biopsy or were heterogeneous. None of the 55 grade 1 carcinomas were HER2-positive. Review of repeat testing of HER2 in routine practice suggested that it may also be of value for multifocal tumours and if recommended by the person assessing the in-situ hybridization. Mandatory repeat HER2 testing of grade 3 HER2-negative carcinomas is not appropriate. This is particularly true if repeat testing is performed after borderline negative amplification in the core biopsy or in HER2-negative heterogeneous carcinomas. © 2015 John Wiley & Sons Ltd.

  11. Punicalagin and (-)-Epigallocatechin-3-Gallate Rescue Cell Viability and Attenuate Inflammatory Responses of Human Epidermal Keratinocytes Exposed to Airborne Particulate Matter PM10.

    Science.gov (United States)

    Seok, Jin Kyung; Lee, Jeong-Won; Kim, Young Mi; Boo, Yong Chool

    2018-01-01

    Airborne particulate matter with a diameter of < 10 µm (PM10) causes oxidative damage, inflammation, and premature skin aging. In this study, we evaluated whether polyphenolic antioxidants attenuate the inflammatory responses of PM10-exposed keratinocytes. Primary human epidermal keratinocytes were exposed in vitro to PM10 in the absence or presence of punicalagin and (-)-epigallocatechin-3-gallate (EGCG), which are the major polyphenolic antioxidants found in pomegranate and green tea, respectively. Assays were performed to determine cell viability, production of reactive oxygen species (ROS), and expression of NADPH oxidases (NOX), proinflammatory cytokines, and matrix metalloproteinase (MMP)-1. PM10 decreased cell viability and increased ROS production in a dose-dependent manner. It also increased the expression levels of NOX-1, NOX-2, tumor necrosis factor-α (TNF-α), interleukin (IL)-1β, IL-6, IL-8, and MMP-1. Punicalagin was not cytotoxic up to 300 μM, and (-)-EGCG was cytotoxic above 30 μM, respectively. Further, punicalagin (3-30 μM) and EGCG (3-10 μM) rescued the viability of PM10-exposed cells. They also attenuated ROS production and the expression of NOX-1, NOX-2, TNF-α, IL-1β, IL-6, IL-8, and MMP-1 stimulated by PM10. This study demonstrates that polyphenolic antioxidants, such as punicalagin and (-)-EGCG, rescue keratinocyte viability and attenuate the inflammatory responses of these cells due to airborne particles. © 2018 S. Karger AG, Basel.

  12. Real world cost of human epidermal receptor 2-positive metastatic breast cancer patients: a longitudinal incidence-based observational costing study in the Netherlands and Belgium.

    Science.gov (United States)

    Frederix, G W J; Severens, J L; Hövels, A M; van Hasselt, J G C; Hooiveld, M J J; Neven, P; Raaijmakers, J A M; Schellens, J H M

    2015-05-01

    Currently, no country-specific metastatic breast cancer (MBC) observational costing data are available for the Netherlands and Belgium. Our aim is to describe country-specific resource use and costs of human epidermal receptor 2 (HER-2)-positive MBC in the Netherlands and Belgium, making use of real-world data. The eligibility period for patient selection was from April 2004 to April 2010. Inclusion and retrospective data collection begins at the time of first diagnosis of HER-2-positive MBC during the eligibility period and ends 24 months post-index diagnosis of MBC or at patient death. We identified 88 eligible patients in the Netherlands and 44 patients in Belgium. The total costs of medical treatment and other resource use utilisation per patient was €48,301 in the Netherlands and €37,431 in Belgium. Majority of costs was related to the use of trastuzumab in both countries, which was 50% of the total costs in the Netherlands and 56% in Belgium respectively. Our study provides estimates of resource use and costs for HER-2-positive MBC in the Netherlands and Belgium. We noticed various differences in resource use patterns between both countries demonstrating caution is needed when transferring cost estimates between countries. © 2014 John Wiley & Sons Ltd.

  13. Effect of Standardized Boesenbergia pandurata Extract and Its Active Compound Panduratin A on Skin Hydration and Barrier Function in Human Epidermal Keratinocytes.

    Science.gov (United States)

    Woo, Seon Wook; Rhim, Dong-Bin; Kim, Changhee; Hwang, Jae-Kwan

    2015-03-01

    The skin plays a key role in protecting the body from the environment and from water loss. Cornified envelope (CE) and natural moisturizing factor (NMF) are considered as the primary regulators of skin hydration and barrier function. The CE prevents loss of water from the body and is formed by cross-linking of several proteins. Among these proteins, filaggrin is an important protein because NMF is produced by the degradation of filaggrin. Proteases, including matriptase and prostasin, stimulate the generation of filaggrin from profilaggrin and caspase-14 plays a role in the degradation of filaggrin. This study elucidated the effects of an ethanol extract of Boesenbergia pandurata (Roxb.) Schltr., known as fingerroot, and its active compound panduratin A on CE formation and filaggrin processing in HaCaT, human epidermal keratinocytes. B. pandurata extract (BPE) and panduratin A significantly stimulated not only CE formation but also the expression of CE proteins, such as loricrin, involucrin, and transglutaminase, which were associated with PPARα expression. The mRNA and protein levels of filaggrin and filaggrin-related enzymes, such as matriptase, prostasin, and caspase-14 were also up-regulated by BPE and panduratin A treatment. These results suggest that BPE and panduratin A are potential nutraceuticals which can enhance skin hydration and barrier function based on their CE formation and filaggrin processing.

  14. Specific receptors for epidermal growth factor in human bone tumour cells and its effect on synthesis of prostaglandin E2 by cultured osteosarcoma cell line

    International Nuclear Information System (INIS)

    Hirata, Y.; Uchihashi, M.; Nakashima, H.; Fujita, T.; Matsukura, S.; Matsui, K.

    1984-01-01

    Using tumour cell lines derived from human bone tumours, specific binding sites for epidermal growth factor (EGF), a potent growth stimulator in many tissues, and its effect on synthesis of prostaglandin (PG) E 2 , a potent bone-resorbing factor, by cultured osteosarcoma cell line were studied. Three tumour cell lines, one osteosarcoma (HOSO) and two giant cell tumours of the bone (G-1 and G-2), all possessed specific binding sites for 125 I-labelled EGF: the apparent dissociation constant was approximately 4-10 x 10 -10 M and the maximal binding capacity was 50 000-80 000 sites/cell. EGF had no mitogenic effect in these cell lines. However, these cell lines did not have specific binding sites for 125 I-labelled parathyroid hormone (PTH) or calcitonin. HOSO line produced and secreted PGE 2 into medium, while no significant amount of PGE 2 was demonstrated in G-1 or G-2 line. EGF significantly stimulated PGE 2 production in HOSO line in a dose-dependent manner (0.5-50 ng/ml); its stimulatory effect was completely abolished by indomethacin, an inhibitor of PG biosynthesis. Exogenous PGE 1 significantly stimulated cyclic AMP formation in HOSO line, whereas PGFsub(2α) PTH, calcitonin, or EGF had no effect. None of these calcium-regulating hormones affected cyclic AMP generation in either G-1 of G-2 line. These data indicate that human bone tumour cells have specific EGF receptors unrelated to cell growth, and suggest that EGF may be involved in bone resorption through a PGE 2 -mediated process in human osseous tissues. (author)

  15. Elevated p16ink4a Expression in Human Labial Salivary Glands as a Potential Correlate of Cognitive Aging in Late Midlife.

    Directory of Open Access Journals (Sweden)

    Christiane Elisabeth Sørensen

    Full Text Available The cell-cycle inhibitor and tumor suppressor cyclin dependent kinase inhibitor, p16ink4a, is one of the two gene products of the ink4a/ARF (cdkn2a locus on chromosome 9q21. Up-regulation of p16ink4a has been linked to cellular senescence, and findings from studies on different mammalian tissues suggest that p16ink4a may be a biomarker of organismal versus chronological age.The aim of this study was to examine the immunolocalization pattern of p16ink4a in human labial salivary gland (LSG tissue, and to analyze whether its expression level in LSGs is a peripheral correlate of cognitive decline in late midlife.The present study was a part of a study of causes and predictors of cognitive decline in middle-aged men in a Danish birth cohort. It is based on data from 181 male participants from the Danish Metropolit birth cohort, born in 1953, who were examined for age-associated alterations in cognition, dental health, and morphological and autonomic innervation characteristics of the LSGs. The participants were allocated to two groups based on the relative change in cognitive performance from young adulthood to late midlife. LSG biopsies were analyzed by qRT-PCR for the expression level of p16ink4a. Immunohistochemistry was performed on formalin-fixed, paraffin-embedded sections of LSGs.p16ink4a immunoreactivity was observed in LSG ductal, myoepithelial, and stromal cells, but not in acinar cells. The mean relative expression of p16ink4a in LSGs was higher in the group of participants with decline in cognitive performance. A logistic regression analysis revealed that the relative p16 expression was predictive of the participant's group assignment. A negative correlation was found between relative p16ink4a expression and the participant's standardized regression residuals from early adulthood to late midlife cognitive performance scores.p16ink4a expression in human LSGs may constitute a potential peripheral correlate of cognitive decline. Human labial

  16. Inhibitory effects of silibinin on proliferation and lung metastasis of human high metastasis cell line of salivary gland adenoid cystic carcinoma via autophagy induction

    Directory of Open Access Journals (Sweden)

    Jiang C

    2016-10-01

    Full Text Available Canhua Jiang,1 Shufang Jin,1 Zhisheng Jiang,1 Jie Wang2 1Department of Oral and Maxillofacial Surgery, Xiangya Hospital, 2Department of Immunology, Xiangya School of Medicine, Central South University, Changsha, Hunan, People’s Republic of China Objective: To investigate the possible mechanisms and effects of silibinin (SIL on the proliferation and lung metastasis of human lung high metastasis cell line of salivary gland adenoid cystic carcinoma (ACC-M.Methods: A methyl thiazolyl tetrazolium assay was performed to detect the inhibitory effects of SIL on the proliferation of ACC-M cells in vitro. Fluorescence microscopy and transmission electron microscopy were used to observe the autophagic process. Western blot was performed to detect the expression of microtube-related protein 1 light-chain 3 (LC3. An experimental adenoid cystic carcinoma (ACC lung metastasis model was established in nude mice to detect the impacts of SIL on lung weight and lung cancer nodules. Immunohistochemistry was used to detect the expressions of LC3 in human ACC samples and normal salivary gland tissue samples.Results: SIL inhibited the proliferation of ACC-M cells in a dose- and time-dependent manner, and inductively increased the autophagic bodies in ACC-M cells. Furthermore, SIL could increase the expression of LC3 in ACC-M cells and promote the conversion of LC3-I into LC3-II in a dose- and time-dependent manner. In the ACC lung metastasis model, the lung weight and left and right lung nodules in the SIL-treated group were significantly less than those in the control group (P<0.05. The expressions of LC3-I and LC3-II as well as the positive expression rate of LC3 (80% significantly increased, but the positive expression of LC3 in human ACC (42.22% reduced significantly.Conclusion: SIL could inhibit the proliferation and lung metastasis of ACC-M cells by possibly inducing tumor cells autophagy. Keywords: silibinin, adenoid cystic carcinoma, ACC-M cells, autophagy

  17. The epidermal growth factor-like domains of the human EMR2 receptor mediate cell attachment through chondroitin sulfate glycosaminoglycans

    NARCIS (Netherlands)

    Stacey, Martin; Chang, Gin-Wen; Davies, John Q.; Kwakkenbos, Mark J.; Sanderson, Ralph D.; Hamann, Jörg; Gordon, Siamon; Lin, Hsi-Hsien

    2003-01-01

    Using multivalent protein probes, an evolutionarily conserved endogenous ligand for EMR2, a human myeloid cell-restricted EGF-TM7 receptor, was identified on the surface of a number of adherent cell lines. In addition, in situ staining of the ligand has revealed specific in vivo patterns consistent

  18. A variety of human monoclonal antibodies against epidermal growth factor receptor isolated from a phage antibody library.

    Science.gov (United States)

    Kurosawa, Gene; Kondo, Mariko; Kurosawa, Yoshikazu

    2016-11-04

    When the technology for constructing human antibody (Ab) libraries using a phage-display system was developed, many researchers in Ab-related fields anticipated that it would be widely applied to the development of pharmaceutical drugs against various diseases, including cancers. However, successful examples of such applications are very limited. Moreover, researchers who utilize phage-display technology now show divergent ways of thinking about phage Ab libraries. For example, there is debate about what should be the source of V H and V L genes for the construction of libraries to cover the whole repertoire of Abs present in the human body. In the immune system, the introduction of mutations into V genes followed by selection based on binding activity, termed Ab maturation, is required for the production of Abs exhibiting high affinity to the antigen (Ag). Therefore, introduction of mutations and selection are required for isolation of Abs with high affinity after isolation of clones from phage Ab libraries. We constructed a large human Ab library termed AIMS, developed a screening method termed ICOS, and succeeded in isolating many human monoclonal Abs (mAbs) that specifically and strongly bind to various tumor-associated Ags. Eight anti-EGFR mAbs were included, which we characterized. These mAbs showed various different activities against EGFR-expressing cancer cells. In this paper, we describe these data and discuss the possibility and necessity that the mAbs isolated from the AIMS library might be developed as therapeutic drugs against cancers without introduction of mutations. Copyright © 2016 The Authors. Published by Elsevier Inc. All rights reserved.

  19. Upregulated epidermal growth factor receptor expression following near-infrared irradiation simulating solar radiation in a three-dimensional reconstructed human corneal epithelial tissue culture model

    Directory of Open Access Journals (Sweden)

    Tanaka Y

    2016-08-01

    Full Text Available Yohei Tanaka,1,2 Jun Nakayama2 1Department of Plastic Surgery, Clinica Tanaka Plastic, Reconstructive Surgery and Anti-aging Center, 2Department of Molecular Pathology, Shinshu University Graduate School of Medicine, Matsumoto, Nagano, Japan Background and objective: Humans are increasingly exposed to near-infrared (NIR radiation from both natural (eg, solar and artificial (eg, electrical appliances sources. Although the biological effects of sun and ultraviolet (UV exposure have been extensively investigated, the biological effect of NIR radiation is still unclear. We previously reported that NIR as well as UV induces photoaging and standard UV-blocking materials, such as sunglasses, do not sufficiently block NIR. The objective of this study was to investigate changes in gene expression in three-dimensional reconstructed corneal epithelial tissue culture exposed to broad-spectrum NIR irradiation to simulate solar NIR radiation that reaches human tissues.Materials and methods: DNA microarray and quantitative real-time polymerase chain reaction analysis were used to assess gene expression levels in a three-dimensional reconstructed corneal epithelial model composed of normal human corneal epithelial cells exposed to water-filtered broad-spectrum NIR irradiation with a contact cooling (20°C. The water-filter allowed 1,000–1,800 nm wavelengths and excluded 1,400–1,500 nm wavelengths.Results: A DNA microarray with >62,000 different probes showed 25 and 150 genes that were up- or downregulated by at least fourfold and twofold, respectively, after NIR irradiation. In particular, epidermal growth factor receptor (EGFR was upregulated by 19.4-fold relative to control cells. Quantitative real-time polymerase chain reaction analysis revealed that two variants of EGFR in human corneal epithelial tissue were also significantly upregulated after five rounds of 10 J/cm2 irradiation (P<0.05.Conclusion: We found that NIR irradiation induced the

  20. Urinary transforming growth factors in neoplasia: separation of 125I-labeled transforming growth factor-alpha from epidermal growth factor in human urine

    International Nuclear Information System (INIS)

    Stromberg, K.; Hudgins, W.R.

    1986-01-01

    Purified human epidermal growth factor (hEGF) from urine promotes anchorage-independent cell growth in soft agar medium. This growth is enhanced by transforming growth factor-beta (TGF-beta), and is specifically inhibited by hEGF antiserum. Transforming growth factors of the alpha type (TGF-alpha), potentially present in normal human urine or urine from tumor-bearing patients, also promote anchorage-independent cell growth and compete with EGF for membrane receptor binding. Consequently, TGF-alpha cannot be distinguished from urinary hEGF by these two functional assays. Therefore, a technique for separation of TGF-alpha and related peptides from urinary EGF based on biochemical characteristics would be useful. Radioiodination of characterized growth factors [mouse EGF (mEGF), hEGF, and rat TGF-alpha (rTGF-alpha)], which were then separately added to human urine, was used to evaluate a resolution scheme that separates TGF-alpha from the high level of background hEGF present in human urine. Methyl bonded microparticulate silica efficiently adsorbed the 125 I-labeled mEGF, 125 I-labeled hEGF, and 125 I-labeled rTGF-alpha that were added to 24-h human urine samples. Fractional elution with acetonitrile (MeCN) of the adsorbed silica released approximately 70 to 80% of the 125 I-labeled mEGF and 125 I-labeled hEGF between 25 and 30% MeCN, and over 80% of the 125 I-labeled rTGF-alpha between 15 and 25% MeCN, with retention after dialysis of less than 0.2 and 1.7% of the original urinary protein, respectively. A single-step enrichment of about 400-fold for mEGF and hEGF, and 50-fold for rTGF-alpha were achieved rapidly. 125 I-labeled mEGF and 125 I-labeled hEGF eluted later than would be predicted on the basis of their reported molecular weight of approximately 6000, whereas 125 I-labeled rTGF-alpha eluted from Bio-Gel P-10 at an approximate molecular weight of 8000 to 9000

  1. Concurrent Autophagy Inhibition Overcomes the Resistance of Epidermal Growth Factor Receptor Tyrosine Kinase Inhibitors in Human Bladder Cancer Cells.

    Science.gov (United States)

    Kang, Minyong; Lee, Kyoung-Hwa; Lee, Hye Sun; Jeong, Chang Wook; Kwak, Cheol; Kim, Hyeon Hoe; Ku, Ja Hyeon

    2017-02-04

    Despite the potential therapeutic efficacy of epithelial growth factor receptor (EGFR) inhibitors in the treatment of advanced stage bladder cancer, there currently is no clear evidence to support this hypothesis. In this study, we investigate whether the concurrent treatment of autophagy-blocking agents with EGFR inhibitors exerts synergistic anti-cancer effects in T24 and J82 human bladder cancer cells. Lapatinib and gefitinib were used as EGFR inhibitors, and bafilomycin A1 (BFA1), chloroquine (CQ) and 3-methyladenine (3-MA) were used as the pharmacologic inhibitors of autophagy activities. To assess the proliferative and self-renewal capabilities, the Cell Counting Kit-8 (CCK-8) assay and a clonogenic assay were performed, respectively. To examine apoptotic cell death, flow cytometry using annexin-V/propidium iodide (PI) was used. To measure the autophagy activities, the expression levels of LC3I and II was determined by Western blot analysis. To validate the synergistic effects of autophagy inhibition with EGFR inhibitors, we specifically blocked key autophagy regulatory gene ATG12 by transfection of small interference RNA and examined the phenotypic changes. Of note, lapatinib and gefitinib triggered autophagy activities in T24 and J82 human bladder cancer cells, as indicated by upregulation of LC3II. More importantly, inhibiting autophagy activities with pharmacologic inhibitors (BFA1, CQ or 3-MA) remarkably reduced the cell viabilities and clonal proliferation of T24 and J82 cells, compared to those treated with either of the agents alone. We also obtained similar results of the enhanced anti-cancer effects of EGFR inhibitors by suppressing the expression of ATG12. Notably, the apoptotic assay showed that synergistic anti-cancer effects were induced via the increase of apoptotic cell death. In summary, concomitant inhibition of autophagy activities potentiated the anti-cancer effects of EGFR inhibitors in human bladder cancer cells, indicating a novel

  2. Concurrent Autophagy Inhibition Overcomes the Resistance of Epidermal Growth Factor Receptor Tyrosine Kinase Inhibitors in Human Bladder Cancer Cells

    Directory of Open Access Journals (Sweden)

    Minyong Kang

    2017-02-01

    Full Text Available Despite the potential therapeutic efficacy of epithelial growth factor receptor (EGFR inhibitors in the treatment of advanced stage bladder cancer, there currently is no clear evidence to support this hypothesis. In this study, we investigate whether the concurrent treatment of autophagy-blocking agents with EGFR inhibitors exerts synergistic anti-cancer effects in T24 and J82 human bladder cancer cells. Lapatinib and gefitinib were used as EGFR inhibitors, and bafilomycin A1 (BFA1, chloroquine (CQ and 3-methyladenine (3-MA were used as the pharmacologic inhibitors of autophagy activities. To assess the proliferative and self-renewal capabilities, the Cell Counting Kit-8 (CCK-8 assay and a clonogenic assay were performed, respectively. To examine apoptotic cell death, flow cytometry using annexin-V/propidium iodide (PI was used. To measure the autophagy activities, the expression levels of LC3I and II was determined by Western blot analysis. To validate the synergistic effects of autophagy inhibition with EGFR inhibitors, we specifically blocked key autophagy regulatory gene ATG12 by transfection of small interference RNA and examined the phenotypic changes. Of note, lapatinib and gefitinib triggered autophagy activities in T24 and J82 human bladder cancer cells, as indicated by upregulation of LC3II. More importantly, inhibiting autophagy activities with pharmacologic inhibitors (BFA1, CQ or 3-MA remarkably reduced the cell viabilities and clonal proliferation of T24 and J82 cells, compared to those treated with either of the agents alone. We also obtained similar results of the enhanced anti-cancer effects of EGFR inhibitors by suppressing the expression of ATG12. Notably, the apoptotic assay showed that synergistic anti-cancer effects were induced via the increase of apoptotic cell death. In summary, concomitant inhibition of autophagy activities potentiated the anti-cancer effects of EGFR inhibitors in human bladder cancer cells, indicating

  3. Hypoxia changes the expression of the epidermal growth factor (EGF) system in human hearts and cultured cardiomyocytes

    DEFF Research Database (Denmark)

    Munk, Mathias; Memon, Ashfaque Ahmed; Goetze, Jens Peter

    2012-01-01

    by treatment with trastuzumab (20 nM). This resulted in inhibition of cardiomyocyte proliferation, but interestingly only in hypoxic cells. Co-treatment of HL-1 cells with HB-EGF (10 nM) but not with NRG-1 (5 ng/ml) rescued the cardiomyocytes from HER2 inhibition. HL-1 cardiomyocytes exposed to hypoxia...... revealed nuclear translocation of activated MAPK and the activity of this downstream signaling molecule was decreased by HER2 inhibition (20 nM trastuzumab), and re-established by HB-EGF (10 nM). CONCLUSIONS/SIGNIFICANCE: Hypoxia in the human heart alters the expression of the EGF system. Mimicking the HER...

  4. Ginsenosides Rb1 and Rg1 Stimulate Melanogenesis in Human Epidermal Melanocytes via PKA/CREB/MITF Signaling

    Directory of Open Access Journals (Sweden)

    Mao Lin

    2014-01-01

    Full Text Available Reduced or defective melanin skin pigmentation may cause many hypopigmentation disorders and increase the risk of damage to the skin triggered by UV irradiation. Ginsenosides Rb1 and Rg1 have many molecular targets including the cAMP-response element-binding protein (CREB, which is involved in melanogenesis. This study aimed to investigate the effects of ginsenosides Rb1 and Rg1 on melanogenesis in human melanocytes and their related mechanisms. The effects of Rb1 and Rg1 on cell viability, tyrosinase activity, cellular melanin content and protein levels of tyrosinase, microphthalmia-associated transcription factor (MITF, and activation of CREB in melanocytes were assessed. Results showed that Rb1 or Rg1 significantly increased cellular melanin content and tyrosinase activity in a dose-dependent manner. By contrast, the cell viability of melanocytes remained unchanged. After exposure to Rb1 or Rg1, the protein levels of tyrosinase, MITF, and phosphorylated CREB were significantly increased. Furthermore, pretreatment with the selective PKA inhibitor H-89 significantly blocked the Rb1- or Rg1-induced increase of melanin content. These findings indicated that Rb1 and Rg1 increased melanogenesis and tyrosinase activity in human melanocytes, which was associated with activation of PKA/CREB/MITF signaling. The effects and mechanisms of Rb1 or Rg1 on skin pigmentation deserve further study.

  5. Human antibody fragments specific for the epidermal growth factor receptor selected from large non-immunised phage display libraries.

    Science.gov (United States)

    Souriau, Christelle; Rothacker, Julie; Hoogenboom, Hennie R; Nice, Edouard

    2004-09-01

    Antibodies to EGFR have been shown to display anti-tumour effects mediated in part by inhibition of cellular proliferation and angiogenesis, and by enhancement of apoptosis. Humanised antibodies are preferred for clinical use to reduce complications with HAMA and HAHA responses frequently seen with murine and chimaeric antibodies. We have used depletion and subtractive selection strategies on cells expressing the EGFR to sample two large antibody fragment phage display libraries for the presence of human antibodies which are specific for the EGFR. Four Fab fragments and six scFv fragments were identified, with affinities of up to 2.2nM as determined by BIAcore analysis using global fitting of the binding curves to obtain the individual rate constants (ka and kd). This overall approach offers a generic screening method for the identification of growth factor specific antibodies and antibody fragments from large expression libraries and has potential for the rapid development of new therapeutic and diagnostic reagents.

  6. Long-Term Quality of Life After Swallowing and Salivary-Sparing Chemo–Intensity Modulated Radiation Therapy in Survivors of Human Papillomavirus–Related Oropharyngeal Cancer

    Energy Technology Data Exchange (ETDEWEB)

    Vainshtein, Jeffrey M. [Department of Radiation Oncology, University of Michigan, Ann Arbor, Michigan (United States); Moon, Dominic H. [University of Michigan Medical School, Ann Arbor, Michigan (United States); Feng, Felix Y. [Department of Radiation Oncology, University of Michigan, Ann Arbor, Michigan (United States); Chepeha, Douglas B. [Department of Otolaryngology—Head and Neck Surgery, University of Michigan, Ann Arbor, Michigan (United States); Eisbruch, Avraham, E-mail: eisbruch@umich.edu [Department of Radiation Oncology, University of Michigan, Ann Arbor, Michigan (United States); Stenmark, Matthew H. [Department of Radiation Oncology, University of Michigan, Ann Arbor, Michigan (United States)

    2015-04-01

    Purpose: To evaluate long-term health-related quality of life (HRQOL) in 2 prospective studies of chemo–intensity modulated radiation therapy (chemo-IMRT) for oropharyngeal cancer (OPC). Methods and Materials: Of 93 patients with stage III/IV OPC treated on prospective studies of swallowing and salivary organ-sparing chemo-IMRT, 69 were eligible for long-term HRQOL assessment. Three validated patient-reported instruments, the Head and Neck QOL (HNQOL) questionnaire, the University of Washington quality of life (UWQOL) questionnaire, and the Xerostomia Questionnaire (XQ), previously administered from baseline through 2 years in the parent studies, were readministered at long-term follow-up, along with the Short-Form 36. Long-term changes in HRQOL from before treatment and 2 years were evaluated. Results: Forty patients (58%) with a median follow-up of 6.5 years participated, 39 of whom (97.5%) had confirmed human papillomavirus–positive OPC. Long term, no clinically significant worsening was detected in mean HRQOL scores compared with 2 years, with stable or improved HRQOL from before treatment in nearly all domains. “Moderate” or greater severity problems were uncommon, reported by 5% of patients for eating, 5% for swallowing, and 2.5% and 5% by HNQOL and UWQOL summary scores, respectively. Freedom from percutaneous endoscopic gastrostomy tube dependence and stricture dilation beyond 2 years was 97.5% and 95%, respectively. Eleven percent and 14% of patients reported “moderate” or “severe” long-term worsening in HNQOL Pain and Overall Bother domains, respectively, which were associated with mean dose to the cervical esophagus, larynx, and pharyngeal constrictors. Conclusions: At more than 6 years' median follow-up, OPC patients treated with swallowing and salivary organ-sparing chemo-IMRT reported stable or improved HRQOL in nearly all domains compared with both before treatment and 2-year follow-up. New late toxicity after 2 years was

  7. Elevated p16ink4a Expression in Human Labial Salivary Glands as a Potential Correlate of Cognitive Aging in Late Midlife

    DEFF Research Database (Denmark)

    Sørensen, Christiane Elisabeth; Tritsaris, Katerina; Reibel, Jesper

    2016-01-01

    BACKGROUND: The cell-cycle inhibitor and tumor suppressor cyclin dependent kinase inhibitor, p16ink4a, is one of the two gene products of the ink4a/ARF (cdkn2a) locus on chromosome 9q21. Up-regulation of p16ink4a has been linked to cellular senescence, and findings from studies on different...... mammalian tissues suggest that p16ink4a may be a biomarker of organismal versus chronological age. OBJECTIVE: The aim of this study was to examine the immunolocalization pattern of p16ink4a in human labial salivary gland (LSG) tissue, and to analyze whether its expression level in LSGs is a peripheral...... correlate of cognitive decline in late midlife. METHODS: The present study was a part of a study of causes and predictors of cognitive decline in middle-aged men in a Danish birth cohort. It is based on data from 181 male participants from the Danish Metropolit birth cohort, born in 1953, who were examined...

  8. Flujo y concentración de proteínas en saliva total humana Salivary flow rate and protein concentration in human whole saliva

    Directory of Open Access Journals (Sweden)

    JOSÉ ANTONIO BANDERAS-TARABAY

    1997-09-01

    Full Text Available Objetivo. Determinar los promedios de flujo salival y la concentración de proteínas totales en una población joven del Estado de México. Material y métodos. Se seleccionaron 120 sujetos a quienes se les colectó saliva total humana (STH no estimulada y estimulada, la cual se analizó por medio de gravimetría y espectrofotometría (LV/LU; se calcularon medidas de tendencia central y de dispersión; posteriormente, se correlacionaron estos datos con los índices CPOD y CPITN. Resultados. Los sujetos estudiados mostraron un promedio de flujo salival (ml/min ± DE en STH no estimulada de 0.397±.26, y en STH estimulada, de 0.973±.53. El promedio en la concentración de proteínas (mg/ml ± DE fue de 1.374±.45 en STH no estimulada y de 1.526±.44 en STH estimulada. Las mujeres presentaron un menor porcentaje de flujo salival y mayor concentración de proteínas. No se observaron correlaciones entre el flujo y la concentración de proteínas totales y el CPOD y CPITN; sin embargo, sí las hubo con otras variables. Conclusiones. Estos hallazgos podrían estar asociados con el grado de nutrición, las características genéticas y los niveles de salud bucal en nuestra población. El presente estudio representa la fase inicial de la creación de una base de datos en sialoquímica, cuya meta será identificar los parámetros que indiquen el riesgo de enfermedades sistémicas o bucodentales.Objective. To determine the average salivary flow rates and total protein concentrations in a population of the State of Mexico. Material and methods. A gravimetric and spectrophotometric analysis was applied to 120 subjects in total resting and stimulated whole saliva and results were correlated with the DMFT and CPITN indexes. Results. Subjects allowed average salivary flow rate (ml/min ± SD in non-stimulated human whole saliva (HWS of 0.397±.26 and in stimulated HWS of 0.973±.53. Average protein concentration was (mg/ml ± SD 1.374±.45 in non

  9. Everolimus Plus Endocrine Therapy for Postmenopausal Women With Estrogen Receptor-Positive, Human Epidermal Growth Factor Receptor 2-Negative Advanced Breast Cancer: A Clinical Trial.

    Science.gov (United States)

    Royce, Melanie; Bachelot, Thomas; Villanueva, Cristian; Özgüroglu, Mustafa; Azevedo, Sergio J; Cruz, Felipe Melo; Debled, Marc; Hegg, Roberto; Toyama, Tatsuya; Falkson, Carla; Jeong, Joon; Srimuninnimit, Vichien; Gradishar, William J; Arce, Christina; Ridolfi, Antonia; Lin, Chinjune; Cardoso, Fatima

    2018-03-22

    Cotargeting the mammalian target of rapamycin pathway and estrogen receptor may prevent or delay endocrine resistance in patients receiving first-line treatment for advanced breast cancer. To investigate the combination of everolimus plus endocrine therapy in first-line and second-line treatment settings for postmenopausal women with estrogen receptor-positive, human epidermal growth receptor 2-negative advanced breast cancer. In the multicenter, open-label, single-arm, phase 2 BOLERO-4 (Breast Cancer Trials of Oral Everolimus) clinical trial, 245 patients were screened for eligibility; 202 were enrolled between March 7, 2013, and December 17, 2014. A median follow-up of 29.5 months had been achieved by the data cutoff date (December 17, 2016). Patients received first-line treatment with everolimus, 10 mg/d, plus letrozole, 2.5 mg/d. Second-line treatment with everolimus, 10 mg/d, plus exemestane, 25 mg/d, was offered at the investigator's discretion upon initial disease progression. The primary end point was investigator-assessed progression-free survival in the first-line setting per Response Evaluation Criteria in Solid Tumors, version 1.0. Safety was assessed in patients who received at least 1 dose of study medication and at least 1 postbaseline safety assessment. A total of 202 women treated in the first-line setting had a median age of 64.0 years (interquartile range, 58.0-70.0 years) with metastatic (194 [96.0%]) or locally advanced (8 [4.0%]) breast cancer. Median progression-free survival was 22.0 months (95% CI, 18.1-25.1 months) with everolimus and letrozole. Median overall survival was not reached; 24-month estimated overall survival rate was 78.7% (95% CI, 72.1%-83.9%). Fifty patients started second-line treatment; median progression-free survival was 3.7 months (95% CI, 1.9-7.4 months). No new safety signals were observed. In the first-line setting, the most common all-grade adverse event was stomatitis (139 [68.8%]); the most common grade 3 to 4

  10. Obesity, starch digestion and amylase: association between copy number variants at human salivary (AMY1) and pancreatic (AMY2) amylase genes.

    Science.gov (United States)

    Carpenter, Danielle; Dhar, Sugandha; Mitchell, Laura M; Fu, Beiyuan; Tyson, Jess; Shwan, Nzar A A; Yang, Fengtang; Thomas, Mark G; Armour, John A L

    2015-06-15

    The human salivary amylase genes display extensive copy number variation (CNV), and recent work has implicated this variation in adaptation to starch-rich diets, and in association with body mass index. In this work, we use paralogue ratio tests, microsatellite analysis, read depth and fibre-FISH to demonstrate that human amylase CNV is not a smooth continuum, but is instead partitioned into distinct haplotype classes. There is a fundamental structural distinction between haplotypes containing odd or even numbers of AMY1 gene units, in turn coupled to CNV in pancreatic amylase genes AMY2A and AMY2B. Most haplotypes have one copy each of AMY2A and AMY2B and contain an odd number of copies of AMY1; consequently, most individuals have an even total number of AMY1. In contrast, haplotypes carrying an even number of AMY1 genes have rearrangements leading to CNVs of AMY2A/AMY2B. Read-depth and experimental data show that different populations harbour different proportions of these basic haplotype classes. In Europeans, the copy numbers of AMY1 and AMY2A are correlated, so that phenotypic associations caused by variation in pancreatic amylase copy number could be detected indirectly as weak association with AMY1 copy number. We show that the quantitative polymerase chain reaction (qPCR) assay previously applied to the high-throughput measurement of AMY1 copy number is less accurate than the measures we use and that qPCR data in other studies have been further compromised by systematic miscalibration. Our results uncover new patterns in human amylase variation and imply a potential role for AMY2 CNV in functional associations. © The Author 2015. Published by Oxford University Press.

  11. Obesity, starch digestion and amylase: association between copy number variants at human salivary (AMY1) and pancreatic (AMY2) amylase genes

    Science.gov (United States)

    Carpenter, Danielle; Dhar, Sugandha; Mitchell, Laura M.; Fu, Beiyuan; Tyson, Jess; Shwan, Nzar A.A.; Yang, Fengtang; Thomas, Mark G.; Armour, John A.L.

    2015-01-01

    The human salivary amylase genes display extensive copy number variation (CNV), and recent work has implicated this variation in adaptation to starch-rich diets, and in association with body mass index. In this work, we use paralogue ratio tests, microsatellite analysis, read depth and fibre-FISH to demonstrate that human amylase CNV is not a smooth continuum, but is instead partitioned into distinct haplotype classes. There is a fundamental structural distinction between haplotypes containing odd or even numbers of AMY1 gene units, in turn coupled to CNV in pancreatic amylase genes AMY2A and AMY2B. Most haplotypes have one copy each of AMY2A and AMY2B and contain an odd number of copies of AMY1; consequently, most individuals have an even total number of AMY1. In contrast, haplotypes carrying an even number of AMY1 genes have rearrangements leading to CNVs of AMY2A/AMY2B. Read-depth and experimental data show that different populations harbour different proportions of these basic haplotype classes. In Europeans, the copy numbers of AMY1 and AMY2A are correlated, so that phenotypic associations caused by variation in pancreatic amylase copy number could be detected indirectly as weak association with AMY1 copy number. We show that the quantitative polymerase chain reaction (qPCR) assay previously applied to the high-throughput measurement of AMY1 copy number is less accurate than the measures we use and that qPCR data in other studies have been further compromised by systematic miscalibration. Our results uncover new patterns in human amylase variation and imply a potential role for AMY2 CNV in functional associations. PMID:25788522

  12. Filaggrin silencing by shRNA directly impairs the skin barrier function of normal human epidermal keratinocytes and then induces an immune response

    Energy Technology Data Exchange (ETDEWEB)

    Dang, N.N. [Department of Dermatology, Jinan Central Hospital Affiliated to Shandong University, Jinan, Shandong Province (China); College of Life Science, Shandong Normal University, Jinan, Shandong Province (China); Pang, S.G. [Department of Endocrinology, Jinan Central Hospital Affiliated to Shandong University, Jinan, Shandong Province (China); Song, H.Y. [Department of Dermatology, Jinan Central Hospital Affiliated to Shandong University, Jinan, Shandong Province (China); An, L.G. [College of Life Science, Shandong Normal University, Jinan, Shandong Province (China); Ma, X.L. [Central Laboratory, Jinan Central Hospital Affiliated to Shandong University, Jinan, Shandong Province (China)

    2014-11-14

    The objective of this study was to investigate whether a single defect in skin barrier function simulated by filaggrin silencing could induce Th2-predominant inflammation. Filaggrin gene expression was silenced in cultured normal human epidermal keratinocytes (NHEKs) using small hairpin RNA (shRNA, GTTGGCTCAAGCATATTATTT). The efficacy of silencing was confirmed by polymerase chain reaction (PCR) and Western blotting. Filaggrin-silenced cells (LV group), shRNA control cells (NC group), and noninfected cells (Blank group) were evaluated. The expression of cornified cell envelope-related proteins, including cytokeratin (CK)-5, -10, -14, loricrin, involucrin, and transglutaminase (TGM)-1, was detected by Western blotting. Interleukins (IL)-2, IL-4, IL-5, IL-12p70, IL-13, and interferon-gamma (IFN-γ) were detected by enzyme-linked immunosorbent assay (ELISA). After filaggrin was successfully silenced by shRNA, the expressions of CK-5, -10, -14, involucrin, and TGM-1 in NHEKs were significantly downregulated compared to the Blank and NC groups (P<0.05 or P<0.01); only loricrin expression was markedly upregulated (P<0.01). Filaggrin silencing also resulted in significant increases of IL-2, IL-4, IL-5, and IL-13 (P<0.05 or P<0.01), and significant decreases of IL-12p70 and IFN-γ (P<0.01) compared with cells in the Blank and NC groups. Filaggrin silencing impaired normal skin barrier function mainly by targeting the cornified cell envelope. The immune response after filaggrin silencing was characterized by Th2 cells, mainly because of the inhibition of IFN-γ expression. Lack of filaggrin may directly impair skin barrier function and then further induce the immune response.

  13. Phase II study of paclitaxel given once per week along with trastuzumab and pertuzumab in patients with human epidermal growth factor receptor 2-positive metastatic breast cancer.

    Science.gov (United States)

    Dang, Chau; Iyengar, Neil; Datko, Farrah; D'Andrea, Gabriella; Theodoulou, Maria; Dickler, Maura; Goldfarb, Shari; Lake, Diana; Fasano, Julie; Fornier, Monica; Gilewski, Theresa; Modi, Shanu; Gajria, Devika; Moynahan, Mary Ellen; Hamilton, Nicola; Patil, Sujata; Jochelson, Maxine; Norton, Larry; Baselga, Jose; Hudis, Clifford

    2015-02-10

    The CLEOPATRA (Clinical Evaluation of Trastuzumab and Pertuzumab) study demonstrated superior progression-free survival (PFS) and overall survival when pertuzumab was added to trastuzumab and docetaxel. Paclitaxel given once per week is effective and less toxic than docetaxel. We performed a phase II study to evaluate the efficacy and safety of pertuzumab and trastuzumab with paclitaxel given once per week. Patients with metastatic human epidermal growth factor receptor 2-positive breast cancer with zero to one prior therapy were enrolled. Treatment consisted of paclitaxel 80 mg/m(2) once per week plus trastuzumab (8 mg/kg loading dose → 6 mg/kg) once every 3 weeks plus pertuzumab (840 mg loading dose → 420 mg) once every 3 weeks, all given intravenously. The primary end point was 6-month PFS assessed by Kaplan-Meier methods. From January 2011 to December 2013, we enrolled 69 patients: 51 (74%) and 18 (26%) treated in first- and second-line metastatic settings, respectively. At a median follow-up of 21 months (range, 3 to 38 months), 6-month PFS was 86% (95% CI, 75% to 92%). The median PFS was 19.5 months (95% CI, 14 to 26 months) overall. PFS was 24.2 months (95% CI, 14 months to not reached [NR]) and 16.4 months (95% CI, 8.5 months to NR) for those without and with prior treatment, respectively. At 1 year, Kaplan-Meier PFS was 70% (95% CI, 56% to 79%) overall, 71% (95% CI, 55% to 82%) for those without prior therapy, and 66% (95% CI, 40% to 83%) for those with prior therapy. Treatment was well-tolerated; there was no febrile neutropenia or symptomatic left ventricular systolic dysfunction. Paclitaxel given once per week with trastuzumab and pertuzumab is highly active and well tolerated and seems to be an effective alternative to docetaxel-based combination therapy. © 2014 by American Society of Clinical Oncology.

  14. Suppression of the Epidermal Growth Factor-like Domain 7 and Inhibition of Migration and Epithelial-Mesenchymal Transition in Human Pancreatic Cancer PANC-1 Cells.

    Science.gov (United States)

    Wang, Yun-Liang; Dong, Feng-Lin; Yang, Jian; Li, Zhi; Zhi, Qiao-Ming; Zhao, Xin; Yang, Yong; Li, De-Chun; Shen, Xiao-Chun; Zhou, Jin

    2015-01-01

    Epidermal growth factor-like domain multiple 7 (EGFL7), a secreted protein specifically expressed by endothelial cells during embryogenesis, recently was identified as a critical gene in tumor metastasis. Epithelial-mesenchymal transition (EMT) was found to be closely related with tumor progression. Accordingly, it is important to investigate the migration and EMT change after knock-down of EGFL7 gene expression in human pancreatic cancer cells. EGFL7 expression was firstly testified in 4 pancreatic cancer cell lines by real-time polymerase chain reaction (Real-time PCR) and western blot, and the highest expression of EGFL7 was found in PANC-1 cell line. Then, PANC-1 cells transfected with small interference RNA (siRNA) of EGFL7 using plasmid vector were named si-PANC-1, while transfected with negative control plasmid vector were called NC-PANC-1. Transwell assay was used to analyze the migration of PANC-1 cells. Real-time PCR and western blotting were used to detect the expression change of EGFL7 gene, EMT markers like E-Cadherin, N-Cadherin, Vimentin, Fibronectin and transcription factors like snail, slug in PANC-1, NC- PANC-1, and si-PANC-1 cells, respectively. After successful plasmid transfection, EGFL7 gene were dramatically knock-down by RNA interference in si-PANC-1 group. Meanwhile, migration ability decreased significantly, compared with PANC-1 and NC-PANC-1 group. Meanwhile, the expression of epithelial phenotype marker E-Cadherin increased and that of mesenchymal phenotype markers N-Cadherin, Vimentin, Fibronectin dramatically decreased in si-PANC-1 group, indicating a reversion of EMT. Also, transcription factors snail and slug decreased significantly after RNA interference. Current study suggested that highly-expressed EGFL7 promotes migration of PANC-1 cells and acts through transcription factors snail and slug to induce EMT, and further study is needed to confirm this issue.

  15. Molecular subclassification determined by human papillomavirus and epidermal growth factor receptor status is associated with the prognosis of oropharyngeal squamous cell carcinoma.

    Science.gov (United States)

    Nakano, Takafumi; Yamamoto, Hidetaka; Nakashima, Torahiko; Nishijima, Toshimitsu; Satoh, Masanobu; Hatanaka, Yui; Shiratsuchi, Hideki; Yasumatsu, Ryuji; Toh, Satoshi; Komune, Shizuo; Oda, Yoshinao

    2016-04-01

    Human papillomavirus (HPV) infection is an indicator of good response to chemoradiotherapy in oropharyngeal squamous cell carcinoma (OPSCC), and epidermal growth factor receptor (EGFR) is a molecular-therapeutic target in head and neck squamous cell carcinoma. Here we investigated the prevalence and prognostic significance of HPV infection and EGFR alteration in OPSCC. We analyzed the presence of high-risk HPV using in situ hybridization, protein expressions of p16 and EGFR using immunohistochemistry, and the EGFR gene copy number gain using chromogenic in situ hybridization (CISH) in 105 cases of OPSCC. The biopsy specimens before chemoradiotherapy were used for these analyses. HPV infection and p16 protein overexpression were detected in 53.3% and 52.4% of the OPSCCs, and each factor was associated with better overall survival (P = .0026 and P = .0026) and nonkeratinizing histology (P = .0002 and P = .0004), respectively. EGFR gene copy number gain (high polysomy or amplification) was detected in 12.4% of the OPSCCs and was correlated with EGFR protein overexpression (P = .0667) and worse overall survival (P CISH positive) were mutually exclusive. The HPV-negative/EGFR CISH-positive OPSCCs had significantly worse overall survival than did the HPV-positive/EGFR CISH-negative OPSCCs and HPV-negative/EGFR CISH-negative OPSCCs (P CISH-negative OPSCCs had favorable prognosis irrespective of HPV infection. Our results suggest that EGFR gene copy number gain-positive tumors represent an HPV-negative, aggressive subgroup of OPSCCs. The molecular subclassification of OPSCCs based on HPV infection and EGFR status may serve as important information for appropriate therapeutic strategy. Copyright © 2015 Elsevier Inc. All rights reserved.

  16. The curative effects of radiotherapy-based therapies for human epidermal growth factor receptor 2-positive breast cancer: A meta-analysis.

    Science.gov (United States)

    Shao, Minghai; Zhang, Chi; Qin, Qin; Zhang, Zhaoyue; Zhu, Hongcheng; Di, Xiaoke; Sun, Xinchen

    2017-09-01

    This meta-analysis was designed to fully assess the curative effects of radiotherapy-based therapies for human epidermal growth factor receptor 2-positive (HER2+) breast cancer (BC). English articles were retrieved through searching Cochrane library, PubMed, and Embase databases updated to February 2017. Studies were selected based on the inclusion and exclusion criteria. The curative effects of radiotherapy-based therapies forHER2+ BC patients were assessed using hazard rates (HRs) or odds ratios (ORs), as well as their 95% confidence intervals (CIs). In addition, Egger test was used to assess publication bias, followed by sensitivity analysis. All statistic methods were conducted using R 3.12 software. A total of 9 eligible studies were included into this meta-analysis, which involved 2236 HER2+ BC patients. Egger test showed that the eligible studies had no publication bias (t = 2.198, P = .05918). Sensitivity analysis demonstrated that the results were stable. HER2+ BC patients in radiotherapy group had lower locoregional recurrences than those in other groups. Moreover, meta-analysis showed that no significant difference was found between HER2+ BC patients in radiotherapy group and other groups on the 1-year overall survival (P = 0.5263, I = 65.4%), 3-year overall survival (P = 0.4591, I = 0), and 5-year overall survival (P = 0.06277, I = 0). Radiotherapy-based therapies might have certain advantages in treating HER2+ BC patients.

  17. Disease management patterns for postmenopausal women in Europe with hormone-receptor-positive, human epidermal growth factor receptor-2 negative advanced breast cancer.

    Science.gov (United States)

    André, Fabrice; Neven, Patrick; Marinsek, Nina; Zhang, Jie; Baladi, Jean-Francois; Degun, Ravi; Benelli, Giancarlo; Saletan, Stephen; Jerusalem, Guy

    2014-06-01

    International guidelines for hormone-receptor-positive (HR(+)), human epidermal growth factor receptor-2 negative (HER2(-)) advanced breast cancer (BC) recommend sequential lines of hormonal therapy (HT), and only recommend chemotherapy for patients with extensive visceral involvement or rapidly progressive disease. This study evaluated actual physician-reported treatments for advanced BC in Europe. We conducted a retrospective chart review of 355 postmenopausal women with HR(+), HER2(-) advanced BC who progressed on ≥1 line of HT (adjuvant or advanced) and completed ≥1 line of chemotherapy (advanced). Treatment choice was evaluated for each line of therapy. Of 355 patients, 111 (31%) received first-line chemotherapy, whereas 218 (61%) and 26 (7%) switched from HT to chemotherapy in second and third line, respectively. More patients receiving first-line HT had bone metastases (73% vs 27% chemotherapy). Patients treated with first-line chemotherapy had more brain (12% vs 3% HT) or extensive liver (13% vs 6% HT) metastases. Subgroup analysis of 188 patients who received first-line HT and had de novo advanced BC or relapsed/recurrent disease more than 1 year after adjuvant therapy found that the majority (89%; n = 167) of these patients switched to chemotherapy in second line. However, among these 167 patients, 27% had no significant changes in metastases between first and second line. Among the 73% of patients who had significant changes in metastases, 20% had no brain metastases or extensive visceral disease. Our study suggests that the guideline-recommended use of multiple HT lines is open to interpretation and that optimal treatment for European postmenopausal women with HR(+), HER2(-) advanced BC who responded to HT may not be achieved.

  18. Patterns of resource utilization and cost for postmenopausal women with hormone-receptor–positive, human epidermal growth factor receptor-2–negative advanced breast cancer in Europe

    International Nuclear Information System (INIS)

    Jerusalem, Guy; Neven, Patrick; Marinsek, Nina; Zhang, Jie; Degun, Ravi; Benelli, Giancarlo; Saletan, Stephen; Ricci, Jean-François; Andre, Fabrice

    2015-01-01

    Healthcare resource utilization in breast cancer varies by disease characteristics and treatment choices. However, lack of clarity in guidelines can result in varied interpretation and heterogeneous treatment management and costs. In Europe, the extent of this variability is unclear. Therefore, evaluation of chemotherapy use and costs versus hormone therapy across Europe is needed. This retrospective chart review (N = 355) examined primarily direct costs for chemotherapy versus hormone therapy in postmenopausal women with hormone-receptor–positive (HR+), human epidermal growth factor receptor-2–negative (HER2–) advanced breast cancer across 5 European countries (France, Germany, The Netherlands, Belgium, and Sweden). Total direct costs across the first 3 treatment lines were approximately €10 000 to €14 000 lower for an additional line of hormone therapy-based treatment versus switching to chemotherapy-based treatment. Direct cost difference between chemotherapy-based and hormone therapy-based regimens was approximately €1900 to €2500 per month. Chemotherapy-based regimens were associated with increased resource utilization (managing side effects; concomitant targeted therapy use; and increased frequencies of hospitalizations, provider visits, and monitoring tests). The proportion of patients taking sick leave doubled after switching from hormone therapy to chemotherapy. These results suggest chemotherapy is associated with increased direct costs and potentially with increased indirect costs (lower productivity of working patients) versus hormone therapy in HR+, HER2– advanced breast cancer. The online version of this article (doi:10.1186/s12885-015-1762-3) contains supplementary material, which is available to authorized users

  19. GEP100/Arf6 is required for epidermal growth factor-induced ERK/Rac1 signaling and cell migration in human hepatoma HepG2 cells.

    Directory of Open Access Journals (Sweden)

    ZhenZhen Hu

    Full Text Available BACKGROUND: Epidermal growth factor (EGF signaling is implicated in the invasion and metastasis of hepatoma cells. However, the signaling pathways for EGF-induced motility of hepatoma cells remain undefined. METHODOLOGY/PRINCIPAL FINDINGS: We found that EGF dose-dependently stimulated the migration of human hepatoma cells HepG2, with the maximal effect at 10 ng/mL. Additionally, EGF increased Arf6 activity, and ectopic expression of Arf6 T27N, a dominant negative Arf6 mutant, largely abolish EGF-induced cell migration. Blocking GEP100 with GEP100 siRNA or GEP100-△PH, a pleckstrin homology (PH domain deletion mutant of GEP100, blocked EGF-induced Arf6 activity and cell migration. EGF also increased ERK and Rac1 activity. Ectopic expression GEP100 siRNA, GEP100-△PH, or Arf6-T27N suppressed EGF-induced ERK and Rac1 activity. Furthermore, blocking ERK signaling with its inhibitor U0126 remarkably inhibited both EGF-induced Rac1 activation as well as cell migration, and ectopic expression of inactive mutant form of Rac1 (Rac1-T17N also largely abolished EGF-induced cell migration. CONCLUSIONS/SIGNIFICANCE: Taken together, this study highlights the function of the PH domain of GEP100 and its regulated Arf6/ERK/Rac1 signaling cascade in EGF-induced hepatoma cell migration. These findings could provide a rationale for designing new therapy based on inhibition of hepatoma metastasis.

  20. Evaluation of human epidermal growth factor receptor 2 (HER2) single nucleotide polymorphisms (SNPs) in normal and breast tumor tissues and their link with breast cancer prognostic factors.

    Science.gov (United States)

    Furrer, Daniela; Lemieux, Julie; Côté, Marc-André; Provencher, Louise; Laflamme, Christian; Barabé, Frédéric; Jacob, Simon; Michaud, Annick; Diorio, Caroline

    2016-12-01

    Amplification of the human epidermal growth factor receptor 2 (HER2) gene is associated with worse prognosis and decreased overall survival in breast cancer patients. The HER2 gene contains several polymorphisms; two of the best-characterized HER2 polymorphisms are Ile655Val and Ala1170Pro. The aim of this study was to evaluate the association between these two HER2 polymorphisms in normal breast and breast cancer tissues and known breast cancer prognostic factors in a retrospective cohort study of 73 women with non-metastatic HER2-positive breast cancer. HER2 polymorphisms were assessed in breast cancer tissue and normal breast tissue using TaqMan assay. Ala1170Pro polymorphism in normal breast tissue was associated with age at diagnosis (p = 0.007), tumor size (p = 0.004) and lymphovascular invasion (p = 0.06). Similar significant associations in cancer tissues were observed. No association between the Ile655Val polymorphism and prognostic factors were observed. However, we found significant differences in the distribution of Ile655Val (p = 0.03) and Ala1170Pro (p = 0.01) genotypes between normal breast and breast tumor tissues. This study demonstrates that only the Ala1170Pro polymorphism is associated with prognostic factors in HER2-positive breast cancer patients. Moreover, our results suggest that both HER2 polymorphisms could play a significant role in carcinogenesis in non-metastatic HER2-positive breast cancer women. Copyright © 2016 Elsevier Ltd. All rights reserved.

  1. Gene expression profiling of histologically normal breast tissue in females with human epidermal growth factor receptor 2‑positive breast cancer.

    Science.gov (United States)

    Zubor, Pavol; Hatok, Jozef; Moricova, Petra; Kapustova, Ivana; Kajo, Karol; Mendelova, Andrea; Sivonova, Monika Kmetova; Danko, Jan

    2015-02-01

    Gene expression profile‑based taxonomy of breast cancer (BC) has been described as a significant breakthrough in comprehending the differences in the origin and behavior of cancer to allow individually tailored therapeutic approaches. In line with this, we hypothesized that the gene expression profile of histologically normal epithelium (HNEpi) could harbor certain genetic abnormalities predisposing breast tissue cells to develop human epidermal growth factor receptor 2 (HER2)‑positive BC. Thus, the aim of the present study was to assess gene expression in normal and BC tissue (BCTis) from patients with BC in order to establish its value as a potential diagnostic marker for cancer development. An array study evaluating a panel of 84 pathway‑ and disease‑specific genes in HER2‑positive BC and tumor‑adjacent HNEpi was performed using quantitative polymerase chain reaction in 12 patients using microdissected samples from frozen tissue. Common prognostic and predictive parameters of BC were assessed by immunohistochemistry and in situ hybridization. In the BCTis and HNEpi samples of 12 HER2‑positive subjects with BC, the expression of 2,016 genes was assessed. A total of 39.3% of genes were deregulated at a minimal two‑fold deregulation rate and 10.7% at a five‑fold deregulation rate in samples of HNEpi or BCTis. Significant differences in gene expression between BCTis and HNEpi samples were revealed for BCL2L2, CD44, CTSD, EGFR, ERBB2, ITGA6, NGFB, RPL27, SCBG2A1 and SCGB1D2 genes (Pbreast tissue revealed gene expression abnormalities that may represent potential markers of increased risk for HER2‑positive malignant transformation of breast tissue, and may be able to be employed as predictors of prognosis.

  2. Suppressors for Human Epidermal Growth Factor Receptor 2/4 (HER2/4): A New Family of Anti-Toxoplasmic Agents in ARPE-19 Cells.

    Science.gov (United States)

    Kim, Yeong Hoon; Bhatt, Lokraj; Ahn, Hye-Jin; Yang, Zhaoshou; Lee, Won-Kyu; Nam, Ho-Woo

    2017-10-01

    The effects of tyrosine kinase inhibitors (TKIs) were evaluated on growth inhibition of intracellular Toxoplasma gondii in host ARPE-19 cells. The number of tachyzoites per parasitophorous vacuolar membrane (PVM) was counted after treatment with TKIs. T. gondii protein expression was assessed by western blot. Immunofluorescence assay was performed using Programmed Cell Death 4 (PDCD4) and T. gondii GRA3 antibodies. The TKIs were divided into 3 groups; non-epidermal growth factor receptor (non-EGFR), anti-human EGFR 2 (anti-HER2), and anti-HER2/4 TKIs, respectively. Group I TKIs (nintedanib, AZD9291, and sunitinib) were unable to inhibit proliferation without destroying host cells. Group II TKIs (lapatinib, gefitinib, erlotinib, and AG1478) inhibited proliferation up to 98% equivalent to control pyrimethamine (5 μM) at 20 μM and higher, without affecting host cells. Group III TKIs (neratinib, dacomitinib, afatinib, and pelitinib) inhibited proliferation up to 98% equivalent to pyrimethamine at 1-5 μM, but host cells were destroyed at 10-20 μM. In Group I, TgHSP90 and SAG1 inhibitions were weak, and GRA3 expression was moderately inhibited. In Group II, TgHSP90 and SAG1 expressions seemed to be slightly enhanced, while GRA3 showed none to mild inhibition; however, AG1478 inhibited all proteins moderately. Protein expression was blocked in Group III, comparable to pyrimethamine. PDCD4 and GRA3 were well localized inside the nuclei in Group I, mildly disrupted in Group II, and were completely disrupted in Group III. This study suggests the possibility of a vital T. gondii TK having potential HER2/4 properties, thus anti-HER2/4 TKIs may inhibit intracellular parasite proliferation with minimal adverse effects on host cells.

  3. Phase I study of neratinib in combination with temsirolimus in patients with human epidermal growth factor receptor 2-dependent and other solid tumors.

    Science.gov (United States)

    Gandhi, Leena; Bahleda, Rastislav; Tolaney, Sara M; Kwak, Eunice L; Cleary, James M; Pandya, Shuchi S; Hollebecque, Antoine; Abbas, Richat; Ananthakrishnan, Revathi; Berkenblit, Anna; Krygowski, Mizue; Liang, Yali; Turnbull, Kathleen W; Shapiro, Geoffrey I; Soria, Jean-Charles

    2014-01-10

    Human epidermal growth factor (HER) -mediated signaling is critical in many cancers, including subsets of breast and lung cancer. HER family members signal via the phosphatidylinositide 3-kinase (PI3K) -AKT/protein kinase B-mammalian target of rapamycin (mTOR) cascade; mTOR activation is critical for the expression of multiple contributors to tumor growth and invasion. On the basis of preclinical data suggesting synergy of HER2 inhibition and mTOR inhibition in breast and lung cancer models, we conducted a phase I combination study of neratinib, a small-molecule irreversible pan-HER tyrosine kinase inhibitor, and temsirolimus, an mTOR inhibitor, in patients with advanced solid tumors. This study enrolled patients to dosing combinations of neratinib and temsirolimus. The primary objective was to estimate the toxicity contour of the combination and establish recommended phase II doses. Sixty patients were treated on 12 of 16 possible dosing combinations. Diarrhea was the most common drug-related (93%) and dose-limiting toxicity (DLT), constituting four of 10 DLTs. Dose-limiting grade 3 metabolic abnormalities were also observed. Other frequent drug-related toxicities included nausea, stomatitis (both 53%), and anemia (48%). Two maximum-tolerated dose combinations were identified: 200 mg of neratinib/25 mg of temsirolimus and 160 mg of neratinib/50 mg of temsirolimus. Responses were noted in patients with HER2-amplified breast cancer resistant to trastuzumab, HER2-mutant non-small-cell lung cancer, and tumor types without identified mutations in the HER-PI3K-mTOR pathway. The combination of neratinib and temsirolimus was tolerable and demonstrated antitumor activity in multiple tumor types, warranting further evaluation.

  4. Gene protein detection platform--a comparison of a new human epidermal growth factor receptor 2 assay with conventional immunohistochemistry and fluorescence in situ hybridization platforms.

    Science.gov (United States)

    Stålhammar, Gustav; Farrajota, Pedro; Olsson, Ann; Silva, Cristina; Hartman, Johan; Elmberger, Göran

    2015-08-01

    Human epidermal growth factor receptor 2 (HER2) immunohistochemistry (IHC) and fluorescence in situ hybridization (FISH) are widely used semiquantitative assays for selecting breast cancer patients for HER2 antibody therapy. However, both techniques have been shown to have disadvantages. Our aim was to test a recent automated technique of combined IHC and brightfield dual in situ hybridization-gene protein detection platform (GPDP)-in breast cancer HER2 protein, gene, and chromosome 17 centromere status evaluations, comparing the results in accordance to the American Society of Clinical Oncology/College of American Pathologists recommendations for HER2 testing in breast cancer from both 2007 and 2013. The GPDP technique performance was evaluated on 52 consecutive whole slide invasive breast cancer cases with HER2 IHC 2/3+ scoring results. Applying in turns the American Society of Clinical Oncology/College of American Pathologists recommendations for HER2 testing in breast cancer from 2007 and 2013 to both FISH and GPDP DISH assays, the HER2 gene amplification results showed 100% concordance among amplified/nonamplified cases, but there was a shift in 4 cases toward positive from equivocal results and toward equivocal from negative results. This might be related to the emphasis on the average HER2 copy number in the 2013 criteria. HER2 expression by IVD market IHC kit (Pathway®) has a strong correlation with GPDP HER2 protein, including a full concordance for all cases scored as 3+ and a reduction from 2+ to 1+ in 7 cases corresponding to nonamplified cases. Gene protein detection platform HER2 protein "solo" could have spared the need for 7 FISH studies. In addition, the platform offered advantages on interpretation reassurance including selecting areas for counting gene signals paralleled with protein IHC expression, on heterogeneity detection, interpretation time, technical time, and tissue expense. Copyright © 2015 Elsevier Inc. All rights reserved.

  5. Toxicity of jet fuel aliphatic and aromatic hydrocarbon mixtures on human epidermal Keratinocytes: evaluation based on in vitro cytotoxicity and interleukin-8 release

    Energy Technology Data Exchange (ETDEWEB)

    Yang, Jen-Hung (Chung-Shan Medical University Hospital, Department of Dermatology, Taichung, Taiwan, R.O.C); Lee, Chia-Hue; Tsang, Chau-Loong [National Chung-Hsing University, College of Veterinary Medicine, Taichung (Taiwan); Monteiro-Riviere, Nancy A.; Riviere, Jim E. [North Carolina State University, Center for Chemical Toxicology Research and Pharmacokinetics (CCTRP), Raleigh, NC (United States); Chou, Chi-Chung [National Chung-Hsing University, College of Veterinary Medicine, Taichung (Taiwan); National Chung-Hsing University, College of Veterinary Medicine, Taichung (Taiwan)

    2006-08-15

    Jet fuels are complex mixtures of aliphatic (ALI) and aromatic (ARO) hydrocarbons that vary significantly in individual cytotoxicity and proinflammatory activity in human epidermal keratinocytes (HEK). In order to delineate the toxicological interactions among individual hydrocarbons in a mixture and their contributions to cutaneous toxicity, nine ALI and five ARO hydrocarbons were each divided into five (high/medium/low cytotoxic and strong/weak IL-8 induction) groups and intra/inter-mixed to assess for their mixture effects on HEK mortality and IL-8 release. Addition of single hydrocarbon to JP-8 fuel was also evaluated for their changes in fuel dermatotoxicity. The results indicated that when hydrocarbons were mixed, HEK mortality and IL-8 release were not all predictable by their individual ability affecting these two parameters. The lowest HEK mortality (7%) and the highest IL-8 production were induced with mixtures including high cytotoxic and weak IL-8 inductive ARO hydrocarbons. Antagonistic reactions not consistently correlated with ALI carbon chain length and ARO structure were evident and carried different weight in the overall mixture toxicities. Single addition of benzene, toluene, xylene or ethylbenzene for up to tenfold in JP-8 did not increase HEK mortality while single addition of ALI hydrocarbons exhibited dose-related differential response in IL-8. In an all ALI environment, no single hydrocarbon is the dominating factor in the determination of HEK cytotoxicity while deletion of hexadecane resulted in a 2.5-fold increase in IL-8 production. Overall, decane, undecane and dodecane were the major hydrocarbons associated with high cytotoxicity while tetradecane, pentadecane and hexadecane were those which had the greatest buffering effect attenuating dermatotoxicity. The mixture effects must be considered when evaluating jet fuel toxicity to HEK. (orig.)

  6. Safety and efficacy of neratinib in combination with capecitabine in patients with metastatic human epidermal growth factor receptor 2-positive breast cancer.

    Science.gov (United States)

    Saura, Cristina; Garcia-Saenz, Jose A; Xu, Binghe; Harb, Wael; Moroose, Rebecca; Pluard, Timothy; Cortés, Javier; Kiger, Corinne; Germa, Caroline; Wang, Kongming; Martin, Miguel; Baselga, José; Kim, Sung-Bae

    2014-11-10

    Neratinib is a potent irreversible pan-tyrosine kinase inhibitor with antitumor activity and acceptable tolerability in patients with human epidermal growth factor receptor 2 (HER2) -positive breast cancer. A multinational, open-label, phase I/II trial was conducted to determine the maximum-tolerated dose (MTD) of neratinib plus capecitabine in patients with solid tumors (part one) and to evaluate the safety and efficacy of neratinib plus capecitabine in patients with HER2-positive metastatic breast cancer (part two). Part one was a 3 + 3 dose-escalation study in which patients with advanced solid tumors received oral neratinib once per day continuously plus capecitabine twice per day on days 1 to 14 of a 21-day cycle at predefined dose levels. In part two, patients with trastuzumab-pretreated HER2-positive metastatic breast cancer received neratinib plus capecitabine at the MTD. The primary end point in part two was objective response rate (ORR). In part one (n = 33), the combination of neratinib 240 mg per day plus capecitabine 1,500 mg/m(2) per day was defined as the MTD, which was further evaluated in part 2 (n = 72). The most common drug-related adverse events were diarrhea (88%) and palmar-plantar erythrodysesthesia syndrome (48%). In part two, the ORR was 64% (n = 39 of 61) in patients with no prior lapatinib exposure and 57% (n = 4 of 7) in patients previously treated with lapatinib. Median progression-free survival was 40.3 and 35.9 weeks, respectively. Neratinib in combination with capecitabine had a manageable toxicity profile and showed promising antitumor activity in patients with HER2-positive metastatic breast cancer pretreated with trastuzumab and lapatinib. © 2014 by American Society of Clinical Oncology.

  7. Human Papillomavirus and Epidermal Growth Factor Receptor in Oral Cavity and Oropharyngeal Squamous Cell Carcinoma: Correlation With Dynamic Contrast-Enhanced MRI Parameters.

    Science.gov (United States)

    Choi, Yoon Seong; Park, Mina; Kwon, Hyeong Ju; Koh, Yoon Woo; Lee, Seung-Koo; Kim, Jinna

    2016-02-01

    The objective of this study was to investigate differences in dynamic contrast-enhanced MRI (DCE-MRI) parameters on the basis of the status of human papillomavirus (HPV) and epidermal growth factor receptor (EGFR) biomarkers in patients with squamous cell carcinoma (SCC) of the oral cavity and oropharynx by use of histogram analysis. A total of 22 consecutive patients with oral cavity and oropharyngeal SCC underwent DCE-MRI before receiving treatment. DCE parameter maps of the volume transfer constant (K(trans)), the flux rate constant (kep), and the extravascular extracellular volume fraction (ve) were obtained. The histogram parameters were calculated using the entire enhancing tumor volume and were compared between the patient subgroups on the basis of HPV and EGFR biomarker statuses. The cumulative histogram parameters of K(trans) and kep showed lower values in the HPV-negative and EFGR-overexpression group than in the HPV-positive EGFR-negative group. These differences were statistically significant for the mean (p = 0.009), 25th, 50th, and 75th percentile values of K(trans) and for the 25th percentile value of kep when correlated with HPV status in addition to the mean K(trans) value (p = 0.047) and kep value (p = 0.004) when correlated with EGFR status. No statistically significant difference in ve was found on the basis of HPV and EGFR status. DCE-MRI is useful for the assessment of the tumor microenvironment associated with HPV and EGFR biomarkers before treatment of patients with oral cavity and oropharyngeal SCC.

  8. Detection of Alpha-Toxin and Other Virulence Factors in Biofilms of Staphylococcus aureus on Polystyrene and a Human Epidermal Model.

    Science.gov (United States)

    den Reijer, P M; Haisma, E M; Lemmens-den Toom, N A; Willemse, J; Koning, R I; Koning, R A; Demmers, J A A; Dekkers, D H W; Rijkers, E; El Ghalbzouri, A; Nibbering, P H; van Wamel, W

    2016-01-01

    The ability of Staphylococcus aureus to successfully colonize (a)biotic surfaces may be explained by biofilm formation and the actions of virulence factors. The aim of the present study was to establish the presence of 52 proteins, including virulence factors such as alpha-toxin, during biofilm formation of five different (methicillin resistant) S. aureus strains on Leiden human epidermal models (LEMs) and polystyrene surfaces (PS) using a competitive Luminex-based assay. All five S. aureus strains formed biofilms on PS, whereas only three out of five strains formed biofilms on LEMs. Out of the 52 tested proteins, six functionally diverse proteins (ClfB, glucosaminidase, IsdA, IsaA, SACOL0688 and nuclease) were detected in biofilms of all strains on both PS and LEMs. At the same time, four toxins (alpha-toxin, gamma-hemolysin B and leukocidins D and E), two immune modulators (formyl peptide receptor-like inhibitory protein and Staphylococcal superantigen-like protein 1), and two other proteins (lipase and LytM) were detectable in biofilms by all five S. aureus strains on LEMs, but not on PS. In contrast, fibronectin-binding protein B (FnbpB) was detectable in biofilms by all S. aureus biofilms on PS, but not on LEMs. These data were largely confirmed by the results from proteomic and transcriptomic analyses and in case of alpha-toxin additionally by GFP-reporter technology. Functionally diverse virulence factors of (methicillin-resistant) S. aureus are present during biofilm formation on LEMs and PS. These results could aid in identifying novel targets for future treatment strategies against biofilm-associated infections.

  9. Utility of the CPS+EG staging system in hormone receptor-positive, human epidermal growth factor receptor 2-negative breast cancer treated with neoadjuvant chemotherapy.

    Science.gov (United States)

    Marmé, Frederik; Lederer, Bianca; Blohmer, Jens-Uwe; Costa, Serban Dan; Denkert, Carsten; Eidtmann, Holger; Gerber, Bernd; Hanusch, Claus; Hilfrich, Jörn; Huober, Jens; Jackisch, Christian; Kümmel, Sherko; Loibl, Sibylle; Paepke, Stefan; Untch, Michael; von Minckwitz, Gunter; Schneeweiss, Andreas

    2016-01-01

    Pathologic complete response after neoadjuvant chemotherapy (NACT) correlates with overall survival (OS) in primary breast cancer. A recently described staging system based on pre-treatment clinical stage (CS), final pathological stage (PS), estrogen receptor (ER) status and nuclear grade (NG) leads to a refined estimation of prognosis in unselected patients. Its performance in luminal type breast cancers has not been determined. This study investigates the clinical utility of this CPS+EG score when restricted to hormone receptor-positive (HR+)/human epidermal growth factor receptor 2-negative (HER2-) patients and compares the results to a cohort of unselected patients. The CPS+EG score was calculated for 6637 unselected patients and 2454 patients with HR+/HER2- tumours who received anthracycline/taxane-based NACT within 8 prospective German trials. Five-year disease-free survival (DFS) and OS were 75.6% and 84.1% for the unselected cohort and 80.6% and 87.8% for the HR+/HER2- subgroup, respectively. The CPS+EG system distinguished different prognostic groups with 5-year DFS ranging from 0% to 91%. The CPS+EG system leads to an improved categorisation of patients by outcome compared to CS, PS, ER or NG alone. When applying the CPS+EG score to the HR+/HER2- subgroup, a shift to lower scores was observed compared to the overall population, but 5-year DFS and OS for the individual scores were identical to that observed in the overall population. In HR+/HER2- patients, the CPS+EG staging system retains its ability to facilitate a refined stratification of patients according to outcome. It can help to select candidates for post-neoadjuvant clinical trials in luminal breast cancer. Copyright © 2015 Elsevier Ltd. All rights reserved.

  10. The Effect of Adjuvant Trastuzumab on Locoregional Recurrence of Human Epidermal Growth Factor Receptor 2-Positive Breast Cancer Treated with Mastectomy.

    Science.gov (United States)

    Lanning, Ryan M; Morrow, Monica; Riaz, Nadeem; McArthur, Heather L; Dang, Chau; Moo, Tracy-Ann; El-Tamer, Mahmoud; Krause, Kate; Siu, Chun; Hsu, Meier; Zhang, Zhigang; Pei, Xin; McCormick, Beryl; Powell, Simon N; Ho, Alice

    2015-08-01

    Human epidermal growth factor receptor 2 (HER2) overexpression was associated with locoregional recurrence (LRR) in the preadjuvant trastuzumab era. This study aimed to examine the effect of trastuzumab on LRR in mastectomy patients and whether it varied with postmastectomy radiation (PMRT). From the authors' institutional database, 501 women with stages I-III HER2-positive breast cancer who underwent mastectomy from 1998 to 2007 were identified. A landmark analysis was performed to compare two cohorts: 170 women who received trastuzumab and 281 who did not. Kaplan-Meier methods were used to estimate locoregional recurrence-free survival (LRRFS). A propensity score analysis was used to balance the treatment groups with respect to multiple covariates. Analogous methods were used to study the effect of PMRT. The women in the trastuzumab group were more likely to be node positive and to receive systemic therapy or PMRT (p < 0.01). The 5-year LRRFS was 98 % in the trastuzumab troup versus 94 % in the no trastuzumab group [hazard ratio (HR) 0.31; 95 % confidence interval (CI) 0.09-1.09; p = 0.07]. After adjustment for multiple covariates, including receipt of chemotherapy and PMRT, trastuzumab decreased LRR rates (HR 0.21; 95 % CI 0.04-0.94; p = 0.04). Among the women who received PMRT, trastuzumab reduced the 5-year LRR rate (0 vs 5 %; p = 0.06). Among those who did not receive PMRT, trastuzumab did not significantly decrease LRR (3 vs 6 %; p = 0.26). High rates of locoregional control (5-year rate, 98 %) were observed among patients who received trastuzumab and mastectomy ± PMRT. Trastuzumab decreased LRR in HER2-positive women who received mastectomy and PMRT, suggesting that the largest benefit is seen in a higher-risk subset of patients.

  11. Strain-dependent augmentation of tight-junction barrier function in human primary epidermal keratinocytes by Lactobacillus and Bifidobacterium lysates.

    Science.gov (United States)

    Sultana, Reshma; McBain, Andrew J; O'Neill, Catherine A

    2013-08-01

    In this study, we investigated whether probiotic lysates can modify the tight-junction function of human primary keratinocytes. The keratinocytes were grown on cell culture inserts and treated with lysates from Bifidobacterium longum, Lactobacillus plantarum, Lactobacillus reuteri, Lactobacillus fermentum, or Lactobacillus rhamnosus GG. With the exception of L. fermentum (which decreased cell viability), all strains markedly enhanced tight-junction barrier function within 24 h, as assessed by measurements of transepithelial electrical resistance (TEER). However, B. longum and L. rhamnosus GG were the most efficacious, producing dose-dependent increases in resistance that were maintained for 4 days. These increases in TEER correlated with elevated expression of tight-junction protein components. Neutralization of Toll-like receptor 2 abolished both the increase in TEER and expression of tight-junction proteins induced by B. longum, but not L. rhamnosus GG. These data suggest that some bacterial strains increase tight-junction function via modulation of protein components but the different pathways involved may vary depending on the bacterial strain.

  12. Reactive oxygen species-mediated DNA damage and apoptosis in human skin epidermal cells after exposure to nickel nanoparticles.

    Science.gov (United States)

    Alarifi, Saud; Ali, Daoud; Alakhtani, Saad; Al Suhaibani, Entissar S; Al-Qahtani, Ahmed A

    2014-01-01

    Nickel nanoparticles (NiNPs) are increasingly used in various applications due to their unique properties. However, there is little information concerning the toxicity of NiNPs in the human skin cell (A431). The present study was designed to investigate the cytotoxicity, apoptosis, and DNA damage due to NiNPs in A431 cells. A cellular proliferative capacity test showed that NiNPs induce significant cytotoxicity in a dose- and time-dependent manner. NiNPs were also found to induce oxidative stress evidenced by the generation of reactive oxygen species (ROS) and depletion of glutathione (GSH). Further, co-treatment with the antioxidant N-acetylcysteine (NAC) mitigated the ROS generation due to NiNPs, suggesting the potential mechanism of oxidative stress. NiNPs also induced significant elevation of lipid peroxidation, catalase, and superoxide dismutase and caspase-3 activity in A431 cells. In addition, NAC suppressed NiNP-induced caspase-3 activity. DNA fragmentation analysis using the comet assay showed that the NiNPs cause genotoxicity in a dose- and time-dependent manner. Therefore, the study points out the capability of the NiNPs to induce oxidative stress resulting in apoptosis and genotoxicity. This study warrants more careful assessment of NiNPs before their industrial applications.

  13. Expression and Prognostic Significance of Human Epidermal Growth Factor Receptors 1, 2 and 3 in Periampullary Adenocarcinoma.

    Directory of Open Access Journals (Sweden)

    Jacob Elebro

    Full Text Available Periampullary adenocarcinoma, including pancreatic cancer, is a heterogeneous group of tumours with dismal prognosis, for which there is an urgent need to identify novel treatment strategies. The human epithelial growth factor receptors EGFR, HER2 and HER3 have been studied in several tumour types, and HER-targeting drugs have a beneficial effect on survival in selected types of cancer. However, these effects have not been evident in pancreatic cancer, and remain unexplored in other types of periampullary cancer. The prognostic impact of HER-expression in these cancers also remains unclear. The aim of this study was therefore to examine the expression and prognostic value of EGFR, HER2 and HER3 in periampullary cancer, with particular reference to histological subtype. To this end, protein expression of EGFR, HER2 and HER3, and HER2 gene amplification was assessed by immunohistochemistry and silver in situ hybridization, respectively, on tissue microarrays with tumours from 175 periampullary adenocarcinomas, with follow-up data on recurrence-free survival (RFS and overall survival (OS for up to 5 years. EGFR expression was similar in pancreatobiliary (PB and intestinal (I type tumours, but high HER2 and HER3 expression was significantly more common in I-type tumours. In PB-type cases receiving adjuvant gemcitabine, but not in untreated cases, high EGFR expression was significantly associated with a shorter OS and RFS, with a significant treatment interaction in relation to OS (pinteraction = 0.042. In I-type cases, high EGFR expression was associated with a shorter OS and RFS in univariable, but not in multivariable, analysis. High HER3 expression was associated with a prolonged RFS in univariable, but not in multivariable, analysis. Neither HER2 protein expression nor gene amplification was prognostic. The finding of a potential interaction between the expression of EGFR and response to adjuvant chemotherapy in PB-type tumours needs validation

  14. In vitro human epidermal permeation of nicotine from electronic cigarette refill liquids and implications for dermal exposure assessment.

    Science.gov (United States)

    Frasch, H Frederick; Barbero, Ana M

    2017-11-01

    Nicotine plus flavorings in a propylene glycol (PG) vehicle are the components of electronic cigarette liquids (e-liquids), which are vaporized and inhaled by the user. Dermal exposure to nicotine and e-liquids may occur among workers in mixing and filling of e-cigarettes in the manufacturing process. Inadvertent skin contact among consumers is also a concern. In vitro nicotine permeation studies using heat-separated human epidermis were performed with surrogate and two commercial e-liquids, neat and aqueous nicotine donor formulations. Steady-state fluxes (J ss ), and lag times (t lag ) were measured for each formulation. In addition, transient (4 h) exposure and finite dose (1-10 μl/cm 2 ) experiments were undertaken using one commercial e-liquid. Average J ss (μg/cm 2 /h) from formulations were: nicotine in PG (24 mg/ml): 3.97; commercial e-liquid containing menthol (25 mg/ml nicotine): 10.2; commercial e-liquid containing limonene (25 mg/ml nicotine): 23.7; neat nicotine: 175. E-liquid lag times ranged from 5 to 10 h. Absorbed fraction of nicotine from finite doses was ≈0.3 at 48 h. The data were applied to transient exposure and finite dose dermal exposure assessment models and to a simple pharmacokinetic model. Three illustrative exposure scenarios demonstrate use of the data to predict systemic uptake and plasma concentrations from dermal exposure. The data demonstrate the potential for significant nicotine absorption through skin contact with e-cigarette refill solutions and the neat nicotine used to mix them.

  15. Effects of radiation on parotid salivary function

    International Nuclear Information System (INIS)

    Marks, J.E.; Davis, C.C.; Gottsman, V.L.

    1981-01-01

    Postoperative electron beam irradiation of patients with parotid cancer has been used regularly at the Mallinckrodt Institute of Radiology to spare the opposite parotid and to preserve salivary function. Only anecdotal reports of amount of radiation required to ablate salivary function exist. To establish a dose-response curve for the human parotid, selective measurements of right and left parotid salivary flow were done for 15 age-matched control patients whose parotids were not irradiated, 17 patients who had both parotids irradiated, and 12 whose parotids were irradiated by unilateral electron beam technique. Point calculations of absorbed dose 1 cm below the surface were done for all 88 parotids and correlated with stimulated parotid salivary flow, pH, and secretory IgA (SIgA). Increasing doses of radiation resulted in progressive reduction of parotid salivary flow, pH, and SIgA. The technique, dosimetry, and clinical application of unilateral electron beam irradiation to spare the opposite parotid will be discussed

  16. Transcriptional activation of cyclin-dependent kinase inhibitor, p21waf1 gene by treatment with a differentiation inducing agent, vesnarinone in a human salivary gland cancer cell line.

    Science.gov (United States)

    Omotehara, F; Nakashiro, K; Uchida, D; Hino, S; Fujimori, T; Kawamata, H

    2003-03-01

    Recently, a new concept for cancer therapy termed "tumor dormancy therapy" has been proposed. The concept of this therapy is to prolong the survival time of cancer patients while maintaining their quality of life. We have been developing a differentiation-inducing therapy, which is included in the tumor dormancy therapy, for salivary gland cancer. In this study, we examined the effect of a differentiation-inducing drug, Vesnarinone on the growth of several cancer cells, and examined the molecular mechanism by which Vesnarinone induces the cyclin dependent kinase inhibitor, p21waf1 in the cancer cells. Vesnarinone significantly suppressed the growth of TYS (salivary gland cancer cells), PC3 (prostate cancer cells), and A431 (squamous cell cancer cells). Furthermore, Vesnarinone dose-dependently enhanced the expression of p21waf1 mRNA in TYS cells. Using the luciferase reporter assay it was found that the enhancement of p21waf1 mRNA expression by Vesnarinone was through direct transcriptional activation of the p21waf1 promoter. Thus, analyzing the molecular mechanisms of differentiation inducing drugs may lead to the development of a new therapeutic strategy for several human malignancies, including salivary gland cancer.

  17. Amplification and high-level expression of heat shock protein 90 marks aggressive phenotypes of human epidermal growth factor receptor 2 negative breast cancer.

    Science.gov (United States)

    Cheng, Qing; Chang, Jeffrey T; Geradts, Joseph; Neckers, Leonard M; Haystead, Timothy; Spector, Neil L; Lyerly, H Kim

    2012-04-17

    Although human epidermal growth factor receptor 2 (HER2) positive or estrogen receptor (ER) positive breast cancers are treated with clinically validated anti-HER2 or anti-estrogen therapies, intrinsic and acquired resistance to these therapies appears in a substantial proportion of breast cancer patients and new therapies are needed. Identification of additional molecular factors, especially those characterized by aggressive behavior and poor prognosis, could prioritize interventional opportunities to improve the diagnosis and treatment of breast cancer. We compiled a collection of 4,010 breast tumor gene expression data derived from 23 datasets that have been posted on the National Center for Biotechnology Information (NCBI) Gene Expression Omnibus (GEO) database. We performed a genome-scale survival analysis using Cox-regression survival analyses, and validated using Kaplan-Meier Estimates survival and Cox Proportional-Hazards Regression survival analyses. We conducted a genome-scale analysis of chromosome alteration using 481 breast cancer samples obtained from The Cancer Genome Atlas (TCGA), from which combined expression and copy number data were available. We assessed the correlation between somatic copy number alterations and gene expression using analysis of variance (ANOVA). Increased expression of each of the heat shock protein (HSP) 90 isoforms, as well as HSP transcriptional factor 1 (HSF1), was correlated with poor prognosis in different subtypes of breast cancer. High-level expression of HSP90AA1 and HSP90AB1, two cytoplasmic HSP90 isoforms, was driven by chromosome coding region amplifications and were independent factors that led to death from breast cancer among patients with triple-negative (TNBC) and HER2-/ER+ subtypes, respectively. Furthermore, amplification of HSF1 was correlated with higher HSP90AA1 and HSP90AB1 mRNA expression among the breast cancer cells without amplifications of these two genes. A collection of HSP90AA1, HSP90AB1 and HSF

  18. Characterization of hormonal receptors and human epidermal growth factor receptor-2 in tissues of women with breast cancer at Muhimbili National Hospital, Dar es salaam, Tanzania.

    Science.gov (United States)

    Mwakigonja, Amos Rodger; Lushina, Nyanda Elias; Mwanga, Ally

    2017-01-01

    Breast cancer is a leading cause of morbidity and deaths among women worldwide. In Tanzania there is no published data on human epidermal growth receptor-2 (HER2/neu) expression in breast carcinoma. Hormonal receptors and HER2/neu status reportedly influence post-mastectomy adjuvant therapy and predict treatment outcome and prognosis. Here we evaluate hormonal receptors and HER-2 status in biopsies of women with breast cancer at Muhimbili National Hospital (MNH). A cross-sectional study of female breast post-modified radical mastectomy (MRM)/incisional biopsies confirmed to be carcinoma at the Histopathology Unit (January-December 2013). Tissue blocks having poor morphology, without tumor, secondary tumors, cases outside the study period and male patients were excluded. Routine staining was done followed by immunohistochemistry for estrogen (ER), and progesterone (PgR) receptors and HER2. Data analyzed using Statistical Package for Social Sciences (SPSS). A total of 218 cases were confirmed to be carcinoma including 70 meeting inclusion criteria. Age at diagnosis ranged 18-75 years and mean age was 48.36 years. Majority (64.3%) were in the 36-55 years age-group. Histologically, most (88.6%) women had invasive ductal carcinoma including 43.1% of intermediate grade. A great majority (78%) were stage three. Due to logistical constrains, 75.7% ( n  = 53/70) cases where immunostained for hormones including 43.4% (ER+), 26.4% (PgR+), and 28% (ER+/PgR+). Furthermore, 65.7% ( n  = 46/70) cases were immunostained for HER-2 and 15.2% ( n  = 7/46) were positive, 45.6% were triple negative (ER-,PgR-,HER2-), 23.9% (ER+,PgR+,HER2-) or luminal B, 2.2% (ER+,PgR-,HER2+),13% (ER-,PgR-,HER2+) and 15% (ER+,PgR-,HER2-) with none being triple positive. Hormonal receptors and HER2 expression at MNH appears to be comparable to previous Africans/African Americans reports but not with studies among Caucasians and the current proportion of triple negative breast carcinomas (TNBC) is

  19. Characterization of hormonal receptors and human epidermal growth factor receptor-2 in tissues of women with breast cancer at Muhimbili National Hospital, Dar es salaam, Tanzania

    Directory of Open Access Journals (Sweden)

    Amos Rodger Mwakigonja

    2017-11-01

    Full Text Available Abstract Background Breast cancer is a leading cause of morbidity and deaths among women worldwide. In Tanzania there is no published data on human epidermal growth receptor-2 (HER2/neu expression in breast carcinoma. Hormonal receptors and HER2/neu status reportedly influence post-mastectomy adjuvant therapy and predict treatment outcome and prognosis. Here we evaluate hormonal receptors and HER-2 status in biopsies of women with breast cancer at Muhimbili National Hospital (MNH. Methods A cross-sectional study of female breast post-modified radical mastectomy (MRM/incisional biopsies confirmed to be carcinoma at the Histopathology Unit (January–December 2013. Tissue blocks having poor morphology, without tumor, secondary tumors, cases outside the study period and male patients were excluded. Routine staining was done followed by immunohistochemistry for estrogen (ER, and progesterone (PgR receptors and HER2. Data analyzed using Statistical Package for Social Sciences (SPSS. Results A total of 218 cases were confirmed to be carcinoma including 70 meeting inclusion criteria. Age at diagnosis ranged 18–75 years and mean age was 48.36 years. Majority (64.3% were in the 36–55 years age-group. Histologically, most (88.6% women had invasive ductal carcinoma including 43.1% of intermediate grade. A great majority (78% were stage three. Due to logistical constrains, 75.7% (n = 53/70 cases where immunostained for hormones including 43.4% (ER+, 26.4% (PgR+, and 28% (ER+/PgR+. Furthermore, 65.7% (n = 46/70 cases were immunostained for HER-2 and 15.2% (n = 7/46 were positive, 45.6% were triple negative (ER-,PgR-,HER2-, 23.9% (ER+,PgR+,HER2- or luminal B, 2.2% (ER+,PgR-,HER2+,13% (ER-,PgR-,HER2+ and 15% (ER+,PgR-,HER2- with none being triple positive. Conclusions Hormonal receptors and HER2 expression at MNH appears to be comparable to previous Africans/African Americans reports but not with studies among Caucasians and the current proportion

  20. Budget impact analysis of everolimus for the treatment of hormone receptor positive, human epidermal growth factor receptor-2 negative (HER2-) advanced breast cancer in the United States.

    Science.gov (United States)

    Xie, Jipan; Diener, Melissa; De, Gourab; Yang, Hongbo; Wu, Eric Q; Namjoshi, Madhav

    2013-01-01

    To estimate the budget impact of everolimus as the first and second treatment option after letrozole or anastrozole (L/A) failure for post-menopausal women with hormone receptor positive (HR+), human epidermal growth factor receptor-2 negative (HER2-) advanced breast cancer (ABC). Pharmacy and medical budget impacts (2011 USD) were estimated over the first year of everolimus use in HR+, HER2- ABC from a US payer perspective. Epidemiology data were used to estimate target population size. Pre-everolimus entry treatment options included exemestane, fulvestrant, and tamoxifen. Pre- and post-everolimus entry market shares were estimated based on market research and assumptions. Drug costs were based on wholesale acquisition cost. Patients were assumed to be on treatment until progression or death. Annual medical costs were calculated as the average of pre- and post-progression medical costs weighted by the time in each period, adjusted for survival. One-way and two-way sensitivity analyses were conducted to assess the model robustness. In a hypothetical 1,000,000 member plan, 72 and 159 patients were expected to be candidates for everolimus treatment as first and second treatment option, respectively, after L/A failure. The total budget impact for the first year post-everolimus entry was $0.044 per member per month [PMPM] (pharmacy budget: $0.058 PMPM; medical budget: -$0.014 PMPM), assuming 10% of the target population would receive everolimus. The total budget impacts for the first and second treatment options after L/A failure were $0.014 PMPM (pharmacy budget: $0.018; medical budget: -$0.004) and $0.030 PMPM (pharmacy budget: $0.040; medical budget: -$0.010), respectively. Results remained robust in sensitivity analyses. Assumptions about some model input parameters were necessary and may impact results. Increased pharmacy costs for HR+, HER2- ABC following everolimus entry are expected to be partially offset by reduced medical service costs. Pharmacy and total

  1. Relationship between body mass index and the expression of hormone receptors or human epidermal growth factor receptor 2 with respect to breast cancer survival

    International Nuclear Information System (INIS)

    Jeon, Ye Won; Kang, Su Hwan; Park, Min Ho; Lim, Woosung; Cho, Se Heun; Suh, Young Jin

    2015-01-01

    The association between body mass index (BMI) at the time of breast cancer diagnosis and the prognosis of breast cancer patients remains controversial. Furthermore, the association between BMI and prognosis with respect to different breast cancer subtypes is not clearly defined. We analyzed data from 41,021 invasive breast cancer patients between January 1988 and February 2008 from the Korean Breast Cancer Registry (KBCR) database. Overall survival (OS) and breast cancer-specific survival (BCSS) were analyzed using the Kaplan-Meier method and Cox’s proportional hazard regression model among all patients and specific breast cancer subtypes with respect to BMI categories. A U-shaped association between BMI and mortality was observed in the total cohort. Underweight and obese individuals exhibited worse OS (hazard ratio, 1.23 [95 % confidence interval {CI}, 1.05 to 1.44] and 1.29 [1.13 to 1.48], respectively) and BCSS (1.26 [1.03 to 1.54] and 1.21 [1.02 to 1.43], respectively) than normal-weight individuals. In the estrogen receptor (ER) and/or progesterone receptor (PR)+/human epidermal growth factor receptor 2 (HER2) - subgroup, obese individuals exhibited worse OS (1.48 [1.18 to 1.85]) and BCSS (1.31 [1.13 to 1.52]) than normal-weight individuals. Conversely, in the ER and PR-/HER2+ subgroup, underweight individuals exhibited worse OS (1.68 [1.12 to 2.47]) and BCSS (1.79 [1.11 to 2.90]) than normal-weight individuals. We observed a U-shaped relationship between BMI at diagnosis and poor OS and BCSS among all breast cancer patients. However, obesity in the ER and/or PR+/HER2- subgroup and underweight in the ER and PR-/HER2+ subgroup were poor prognostic factors. Therefore, BMI at diagnosis and breast cancer subtype should be considered simultaneously in various treatment decision processes and surveillance schedules

  2. Keratin 17 is overexpressed and predicts poor survival in estrogen receptor-negative/human epidermal growth factor receptor-2-negative breast cancer.

    Science.gov (United States)

    Merkin, Ross D; Vanner, Elizabeth A; Romeiser, Jamie L; Shroyer, A Laurie W; Escobar-Hoyos, Luisa F; Li, Jinyu; Powers, Robert S; Burke, Stephanie; Shroyer, Kenneth R

    2017-04-01

    Clinicopathological features of breast cancer have limited accuracy to predict survival. By immunohistochemistry (IHC), keratin 17 (K17) expression has been correlated with triple-negative status (estrogen receptor [ER]/progesterone receptor/human epidermal growth factor receptor-2 [HER2] negative) and decreased survival, but K17 messenger RNA (mRNA) expression has not been evaluated in breast cancer. K17 is a potential prognostic cancer biomarker, targeting p27, and driving cell cycle progression. This study compared K17 protein and mRNA expression to ER/progesterone receptor/HER2 receptor status and event-free survival. K17 IHC was performed on 164 invasive breast cancers and K17 mRNA was evaluated in 1097 breast cancers. The mRNA status of other keratins (16/14/9) was evaluated in 113 ER - /HER2 - ductal carcinomas. IHC demonstrated intense cytoplasmic and membranous K17 localization in myoepithelial cells of benign ducts and lobules and tumor cells of ductal carcinoma in situ. In ductal carcinomas, K17 protein was detected in most triple-negative tumors (28/34, 82%), some non-triple-negative tumors (52/112, 46%), but never in lobular carcinomas (0/15). In ductal carcinomas, high K17 mRNA was associated with reduced 5-year event-free survival in advanced tumor stage (n = 149, hazard ratio [HR] = 3.68, P = .018), and large (n = 73, HR = 3.95, P = .047), triple-negative (n = 103, HR = 2.73, P = .073), and ER - /HER2 - (n = 113, HR = 2.99, P = .049) tumors. There were significant correlations among keratins 17, 16, 14, and 9 mRNA levels suggesting these keratins (all encoded on chromosome 17) could be coordinately expressed in breast cancer. Thus, K17 is expressed in a subset of triple-negative breast cancers, and is a marker of poor prognosis in patients with advanced stage and ER - /HER2 - breast cancer. Copyright © 2016 Elsevier Inc. All rights reserved.

  3. Translational Breast Cancer Research Consortium (TBCRC) 022: A Phase II Trial of Neratinib for Patients With Human Epidermal Growth Factor Receptor 2-Positive Breast Cancer and Brain Metastases.

    Science.gov (United States)

    Freedman, Rachel A; Gelman, Rebecca S; Wefel, Jeffrey S; Melisko, Michelle E; Hess, Kenneth R; Connolly, Roisin M; Van Poznak, Catherine H; Niravath, Polly A; Puhalla, Shannon L; Ibrahim, Nuhad; Blackwell, Kimberly L; Moy, Beverly; Herold, Christina; Liu, Minetta C; Lowe, Alarice; Agar, Nathalie Y R; Ryabin, Nicole; Farooq, Sarah; Lawler, Elizabeth; Rimawi, Mothaffar F; Krop, Ian E; Wolff, Antonio C; Winer, Eric P; Lin, Nancy U

    2016-03-20

    Evidence-based treatments for metastatic, human epidermal growth factor receptor 2 (HER2)-positive breast cancer in the CNS are limited. Neratinib is an irreversible inhibitor of erbB1, HER2, and erbB4, with promising activity in HER2-positive breast cancer; however, its activity in the CNS is unknown. We evaluated the efficacy of treatment with neratinib in patients with HER2-positive breast cancer brain metastases in a multicenter, phase II open-label trial. Eligible patients were those with HER2-positive brain metastases (≥ 1 cm in longest dimension) who experienced progression in the CNS after one or more line of CNS-directed therapy, such as whole-brain radiotherapy, stereotactic radiosurgery, and/or surgical resection. Patients received neratinib 240 mg orally once per day, and tumors were assessed every two cycles. The primary endpoint was composite CNS objective response rate (ORR), requiring all of the following: ≥ 50% reduction in volumetric sum of target CNS lesions and no progression of non-target lesions, new lesions, escalating corticosteroids, progressive neurologic signs/symptoms, or non-CNS progression--the threshold for success was five of 40 responders. Forty patients were enrolled between February 2012 and June 2013; 78% of patients had previous whole-brain radiotherapy. Three women achieved a partial response (CNS objective response rate, 8%; 95% CI, 2% to 22%). The median number of cycles received was two (range, one to seven cycles), with a median progression-free survival of 1.9 months. Five women received six or more cycles. The most common grade ≥ 3 event was diarrhea (occurring in 21% of patients taking prespecified loperamide prophylaxis and 28% of those without prophylaxis). Patients in the study experienced a decreased quality of life over time. Although neratinib had low activity and did not meet our threshold for success, 12.5% of patients received six or more cycles. Studies combining neratinib with chemotherapy in patients

  4. Lapatinib or Trastuzumab Plus Taxane Therapy for Human Epidermal Growth Factor Receptor 2-Positive Advanced Breast Cancer: Final Results of NCIC CTG MA.31.

    Science.gov (United States)

    Gelmon, Karen A; Boyle, Frances M; Kaufman, Bella; Huntsman, David G; Manikhas, Alexey; Di Leo, Angelo; Martin, Miguel; Schwartzberg, Lee S; Lemieux, Julie; Aparicio, Samuel; Shepherd, Lois E; Dent, Susan; Ellard, Susan L; Tonkin, Katia; Pritchard, Kathleen I; Whelan, Timothy J; Nomikos, Dora; Nusch, Arnd; Coleman, Robert E; Mukai, Hirofumi; Tjulandin, Sergei; Khasanov, Rustem; Rizel, Shulamith; Connor, Anne P; Santillana, Sergio L; Chapman, Judith-Anne W; Parulekar, Wendy R

    2015-05-10

    The efficacy of lapatinib versus trastuzumab combined with taxanes in the first-line setting of human epidermal growth factor receptor 2 (HER2) -positive metastatic breast cancer (BC) is unknown. The MA.31 trial compared a combination of first-line anti-HER2 therapy (lapatinib or trastuzumab) and taxane therapy for 24 weeks, followed by the same anti-HER2 monotherapy until progression. Stratification was by prior (neo)adjuvant anti-HER2 therapy, prior (neo)adjuvant taxane, planned taxane, and liver metastases. The primary end point was intention-to-treat (ITT) progression-free survival (PFS), defined as time from random assignment to progression by RECIST (version 1.0) criteria, or death for patients with locally assessed HER2-positive tumors. The primary test statistic was a stratified log-rank test for noninferiority. PFS was also assessed for patients with centrally confirmed HER2-positive tumors. From July 17, 2008, to December 1, 2011, 652 patients were accrued from 21 countries, resulting in 537 patients with centrally confirmed HER2-positive tumors. Median follow-up was 21.5 months. Median ITT PFS was 9.0 months with lapatinib and 11.3 months with trastuzumab. By ITT analysis, PFS was inferior for lapatinib compared with trastuzumab, with a stratified hazard ratio (HR) of 1.37 (95% CI, 1.13 to 1.65; P = .001). In patients with centrally confirmed HER2-positive tumors, median PFS was 9.1 months with lapatinib and 13.6 months with trastuzumab (HR, 1.48; 95% CI, 1.20 to 1.83; P < .001). More grade 3 or 4 diarrhea and rash were observed with lapatinib (P < .001). PFS results were supported by the secondary end point of overall survival, with an ITT HR of 1.28 (95% CI, 0.95 to 1.72; P = .11); in patients with centrally confirmed HER2-positive tumors, the HR was 1.47 (95% CI, 1.03 to 2.09; P = .03). As first-line therapy for HER2-positive metastatic BC, lapatinib combined with taxane was associated with shorter PFS and more toxicity compared with trastuzumab

  5. Induction of interleukin-6 production by ultraviolet radiation in normal human epidermal keratinocytes and in a human keratinocyte cell line is mediated by DNA damage

    NARCIS (Netherlands)

    Petit-Frère, C.; Clingen, P.H.; Grewe, M.; Krutmann, J.; Roza, L.; Arlett, C.F.; Green, M.H.L.

    1998-01-01

    The sunburn reaction is the most common consequence of human exposure to ultraviolet radiation (UVR), and is mediated at least in part by interleukin- 6 (IL-6). The aim of this study was to determine if DNA is a major chromophore involved in the induction of IL-6 following UV irradiation of a human

  6. Cultivation and irradiation of human fibroblasts in a medium enriched with platelet lysate for obtaining feeder layer in epidermal cell culture; Cultivo e irradiacao de fibroblastos humanos em meio enriquecido com lisado de plaquetas para obtencao de camada de sustentacao em culturas de celulas da epiderme

    Energy Technology Data Exchange (ETDEWEB)

    Yoshito, Daniele

    2011-07-01

    For over 30 years, the use of culture medium, enriched with bovine serum, and murines fibroblasts, with the rate of proliferation controlled by irradiation or by share anticarcinogenic drugs, has been playing successfully its role in assisting in the development of keratinocytes in culture, for clinical purposes. However, currently there is a growing concern about the possibility of transmitting prions and animals viruses to transplanted patients. Taking into account this concern, the present work aims to cultivate human fibroblasts in a medium enriched with human platelets lysate and determine the irradiation dose of these cells, for obtaining feeder layer in epidermal cell culture. For carrying out the proposed objective, platelets lysis has standardized, this lysate was used for human fibroblasts cultivation and the irradiation dose enough to inhibit its duplication was evaluated. Human keratinocytes were cultivated in these feeder layers, in culture medium enriched with the lysate. With these results we conclude that the 10% platelets lysate promoted a better adhesion and proliferation of human fibroblasts and in all dose levels tested (60 to 300 Gy), these had their mitotic activity inactivated by ionizing irradiation, being that the feeder layers obtained with doses from 70 to 150 Gy were those that provided the best development of keratinocytes in medium containing 2.5% of human platelet lysate. Therefore, it was possible to standardize both the cultivation of human fibroblasts as its inactivation for use as feeder layer in culture of keratinocytes, so as to eliminate xenobiotics components. (author)

  7. Secretion of human epidermal growth factor (EGF) in autotrophic culture by a recombinant hydrogen-utilizing bacterium, Pseudomonas pseudoflava, carrying broad-host-range EGF secretion vector pKSEGF2.

    OpenAIRE

    Hayase, N; Ishiyama, A; Niwano, M

    1994-01-01

    We constructed the broad-host-range human epidermal growth factor (EGF) secretion plasmid pKSEGF2 by inserting the Escherichia coli tac promoter, the signal sequence of Pseudomonas stutzeri amylase, and the synthesized EGF gene into the broad-host-range vector pKT230. E. coli JM109 carrying pKSEGF2 secreted EGF into the periplasm and the culture medium under the control of the tac promoter. Pseudomonas aeruginosa PAO1161 carrying pKSEGF2 and Pseudomonas putida AC10 carrying pKSEGF2 secreted E...

  8. [Effect of low-energy 633 nm red light stimulation on proliferation and reactive oxygen species level of human epidermal cell line HaCaT].

    Science.gov (United States)

    Chen, Z Y; Li, D L; Duan, X D; Peng, D Z

    2016-09-20

    To investigate the changes of proliferative activity and reactive oxygen species level of human epidermal cell line HaCaT after being irradiated with low-energy 633 nm red light. Irradiation distance was determined through preliminary experiment. HaCaT cells were conventionally sub-cultured with RPMI 1640 culture medium containing 10% fetal calf serum, 100 U/mL penicillin, and 100 μg/mL streptomycin. Cells of the third passage were used in the following experiments. (1) Cells were divided into blank control group and 0.082, 0.164, 0.245, 0.491, 1.472, 2.453, 4.910, and 9.810 J/cm(2) irradiation groups according to the random number table, with 3 wells in each group. Cells in blank control group were not irradiated, while cells in the latter 8 irradiation groups were irradiated with 633 nm red light for 10, 20, 30, 60, 180, 300, 600, and 1 200 s in turn. Cells were reirradiated once every 8 hours. After being irradiated for 48 hours (6 times) in irradiation groups, the proliferative activity of cells in 9 groups was determined with cell counting kit 8 and microplate reader (denoted as absorbance value). (2) Another batch of cells were grouped and irradiated as in experiment (1). After being irradiated for once in irradiation groups, cells in 9 groups were conventionally cultured for 60 min with detection reagent of reactive oxygen species. At post culture minute (PCM) 0 (immediately), 30, 60, and 120, reactive oxygen species level of cells was determined with microplate reader (denoted as absorbance value). (3) Another batch of cells were divided into blank control group, 0.082, 0.491, 2.453, and 9.810 J/cm(2) irradiation groups, and positive control group. Cells in blank control group and positive control group were not irradiated (positive control reagent of reactive oxygen species was added to cells in positive control group), and cells in irradiation groups were irradiated as in experiment (1) for once. The expression of reactive oxygen species in cells of each

  9. Inhibition of Epidermal Growth Factor Receptor and Vascular Endothelial Growth Factor Receptor Phosphorylation on Tumor-Associated Endothelial Cells Leads to Treatment of Orthotopic Human Colon Cancer in Nude Mice

    Directory of Open Access Journals (Sweden)

    Takamitsu Sasaki

    2007-12-01

    Full Text Available The purpose of our study was to determine whether the dual inhibition of epidermal growth factor receptor (EGFR and vascular endothelial growth factor receptor (VEGFR signaling pathways in tumor-associated endothelial cells can inhibit the progressive growth of human colon carcinoma in the cecum of nude mice. SW620CE2 human colon cancer cells growing in culture and orthotopically in the cecum of nude mice expressed a high level of transforming growth factor alpha (TGF-α and vascular endothelial growth factor (VEGF but were negative for EGFR, human epidermal growth factor receptor 2 (HER2, VEGFR. Double immunofluorescence staining revealed that tumorassociated endothelial cells expressed EGFR, VEGFR2, phosphorylated EGFR (pEGFR, phosphorylated VEGFR (pVEGFR. Treatment of mice with either 7H-pyrrolo [2,3-d]-pyrimidine lead scaffold (AEE788; an inhibitor of EGFR and VEGFR tyrosine kinase or CPT-11 as single agents significantly inhibited the growth of cecal tumors (P < .01; this decrease was even more pronounced with AEE788 combined with CPT-11 (P < .001. AEE788 alone or combined with CPT-11 also inhibited the expression of pEGFR and pVEGFR on tumor-associated endothelial cells, significantly decreased vascularization and tumor cell proliferation, increased the level of apoptosis in both tumorassociated endothelial cells and tumor cells. These data demonstrate that targeting EGFR and VEGFR signaling on tumor-associated endothelial cells provides a viable approach for the treatment of colon cancer.

  10. Radionuclide salivary gland imaging

    Energy Technology Data Exchange (ETDEWEB)

    Mishkin, F.S.

    1981-10-01

    Salivary gland imaging with 99mTc as pertechnetate provides functional information concerning trapping and excretion of the parotid and submandibular glands. Anatomic information gained often adds little to clinical evaluation. On the other hand, functional information may detect subclinical involvement, which correlates well with biopsy of the minor labial salivary glands. Salivary gland abnormalities in systemic disease such as sarcoidosis, rheumatoid arthritis, lupus erythematosus, and other collagenvascular disorders may be detected before they result in the clinical manifestaions of Sjoegren's syndrome. Such glands, after initially demonstrating increased trapping in the acute phase, tend to have decreased trapping and failure to discharge pertechnetate in response to an appropriate physiologic stimulus. Increased uptake of gallium-67 citrate often accompanies these findings. Inflammatory parotitis can be suspected when increased perfusion is evident on radionuclide angiography with any agent. The ability of the salivary gland image to detect and categorize mass lesions, which result in focal areas of diminished activity such as tumors, cysts, and most other masses, is disappointing, while its ability to detect and categorize Warthin's tumor, which concentrates pertechnetate, is much more valuable, although not specific.

  11. Radionuclide salivary gland imaging

    International Nuclear Information System (INIS)

    Mishkin, F.S.

    1981-01-01

    Salivary gland imaging with 99mTc as pertechnetate provides functional information concerning trapping and excretion of the parotid and submandibular glands. Anatomic information gained often adds little to clinical evaluation. On the other hand, functional information may detect subclinical involvement, which correlates well with biopsy of the minor labial salivary glands. Salivary gland abnormalities in systemic disease such as sarcoidosis, rheumatoid arthritis, lupus erythematosus, and other collagenvascular disorders may be detected before they result in the clinical manifestaions of Sjoegren's syndrome. Such glands, after initially demonstrating increased trapping in the acute phase, tend to have decreased trapping and failure to discharge pertechnetate in response to an appropriate physiologic stimulus. Increased uptake of gallium-67 citrate often accompanies these findings. Inflammatory parotitis can be suspected when increased perfusion is evident on radionuclide angiography with any agent. The ability of the salivary gland image to detect and categorize mass lesions, which result in focal areas of diminished activity such as tumors, cysts, and most other masses, is disappointing, while its ability to detect and categorize Warthin's tumor, which concentrates pertechnetate, is much more valuable, although not specific

  12. Human cellular and humoral immune responses to Phlebotomus papatasi salivary gland antigens in endemic areas differing in prevalence of Leishmania major infection.

    Directory of Open Access Journals (Sweden)

    Wafa Kammoun-Rebai

    2017-10-01

    Full Text Available Sand fly saliva compounds are able to elicit specific immune responses that have a significant role in Leishmania parasite establishment and disease outcome. Characterizing anti-saliva immune responses in individuals living in well defined leishmaniasis endemic areas would provide valuable insights regarding their effect on parasite transmission and establishment in humans.We explored the cellular and humoral immune responses to Phlebotomus (P. papatasi salivary gland extracts (SGE in individuals living in cutaneous leishmaniasis (CL old or emerging foci (OF, EF. OF was characterized by a higher infection prevalence as assessed by higher proportions of leishmanin skin test (LST positive individuals compared to EF. Subjects were further subdivided into healed, asymptomatic or naïve groups. We showed anti-SGE proliferation in less than 30% of the individuals, regardless of the immune status, in both foci. IFN-γ production was higher in OF and only observed in immune individuals from OF and naïve subjects from EF. Although IL-10 was not detected, addition of anti-human IL-10 antibodies revealed an increase in proliferation and IFN-γ production only in individuals from OF. The percentage of seropositive individuals was similar in immune and naïves groups but was significantly higher in OF. No correlation was observed between anti-saliva immune responses and LST response. High anti-SGE-IgG responses were associated with an increased risk of developing ZCL. No differences were observed for anti-SGE humoral or cellular responses among naïve individuals who converted or not their LST response or developed or not ZCL after the transmission season.These data suggest that individuals living in an old focus characterized by a frequent exposure to sand fly bites and a high prevalence of infection, develop higher anti-saliva IgG responses and IFN-γ levels and a skew towards a Th2-type cellular response, probably in favor of parasite establishment

  13. Multiplexed salivary protein profiling for patients with respiratory diseases using fiber-optic bundles and fluorescent antibody-based microarrays.

    Science.gov (United States)

    Nie, Shuai; Benito-Peña, Elena; Zhang, Huaibin; Wu, Yue; Walt, David R

    2013-10-01

    Over the past 40 years, the incidence and prevalence of respiratory diseases have increased significantly throughout the world, damaging economic productivity and challenging health care systems. Current diagnoses of different respiratory diseases generally involve invasive sampling methods such as induced sputum or bronchoalveolar lavage that are uncomfortable, or even painful, for the patient. In this paper, we present a platform incorporating fiber-optic bundles and antibody-based microarrays to perform multiplexed protein profiling of a panel of six salivary biomarkers for asthma and cystic fibrosis (CF) diagnosis. The platform utilizes an optical fiber bundle containing approximately 50,000 individual 4.5 μm diameter fibers that are chemically etched to create microwells in which modified microspheres decorated with monoclonal capture antibodies can be deposited. On the basis of a sandwich immunoassay format, the array quantifies human vascular endothelial growth factor (VEGF), interferon gamma-induced protein 10 (IP-10), interleukin-8 (IL-8), epidermal growth factor (EGF), matrix metalloproteinase 9 (MMP-9), and interleukin-1 beta (IL-1β) salivary biomarkers in the subpicomolar range. Saliva supernatants collected from 291 individuals (164 asthmatics, 71 CF patients, and 56 healthy controls (HC)) were analyzed on the platform to profile each group of patients using this six-analyte suite. It was found that four of the six proteins were observed to be significantly elevated (p < 0.01) in asthma and CF patients compared with HC. These results demonstrate the potential to use the multiplexed protein array platform for respiratory disease diagnosis.

  14. Salivary PYY: a putative bypass to satiety.

    Directory of Open Access Journals (Sweden)

    Andres Acosta

    Full Text Available Peptide YY(3-36 is a satiation hormone released postprandially into the bloodstream from L-endocrine cells in the gut epithelia. In the current report, we demonstrate PYY(3-36 is also present in murine as well as in human saliva. In mice, salivary PYY(3-36 derives from plasma and is also synthesized in the taste cells in taste buds of the tongue. Moreover, the cognate receptor Y2R is abundantly expressed in the basal layer of the progenitor cells of the tongue epithelia and von Ebner's gland. The acute augmentation of salivary PYY(3-36 induced stronger satiation as demonstrated in feeding behavioral studies. The effect is mediated through the activation of the specific Y2 receptor expressed in the lingual epithelial cells. In a long-term study involving diet-induced obese (DIO mice, a sustained increase in PYY(3-36 was achieved using viral vector-mediated gene delivery targeting salivary glands. The chronic increase in salivary PYY(3-36 resulted in a significant long-term reduction in food intake (FI and body weight (BW. Thus this study provides evidence for new functions of the previously characterized gut peptide PYY(3-36 suggesting a potential simple and efficient alternative therapeutic approach for the treatment of obesity.

  15. Antisense imaging of epidermal growth factor-induced p21{sup WAF-1/CIP-1} gene expression in MDA-MB-468 human breast cancer xenografts

    Energy Technology Data Exchange (ETDEWEB)

    Wang, Judy; Chen, Paul; Mrkobrada, Marko [Leslie Dan Faculty of Pharmacy, University of Toronto, 19 Russell Street, M5S 2S2, Toronto, Ontario (Canada); Hu, Meiduo [Leslie Dan Faculty of Pharmacy, University of Toronto, 19 Russell Street, M5S 2S2, Toronto, Ontario (Canada); Department of Pharmaceutical Sciences, University of Toronto, Toronto, Ontario (Canada); Vallis, Katherine A. [Department of Radiation Oncology, Princess Margaret Hospital, University Health Network, 610 University Avenue, Toronto, Ontario (Canada); Department of Radiation Oncology, University of Toronto, Toronto, Ontario (Canada); Department of Medical Biophysics, University of Toronto, Toronto, Ontario (Canada); Reilly, Raymond M. [Department of Medical Imaging, University of Toronto, Toronto, Ontario (Canada)

    2003-09-01

    Molecular imaging of the expression of key genes which determine the response to DNA damage following cancer treatment may predict the effectiveness of a particular treatment strategy. A prominent early response gene for DNA damage is the gene encoding p21{sup WAF-1/CIP-1}, a cyclin-dependent kinase inhibitor that regulates progression through the cell cycle. In this study, we explored the feasibility of imaging p21{sup WAF-1/CIP-1} gene expression at the mRNA level using an 18-mer phosphorothioated antisense oligodeoxynucleotide (ODN) labeled with {sup 111}In. The known induction of the p21{sup WAF-1/CIP-1} gene in MDA-MB-468 human breast cancer cells following exposure to epidermal growth factor (EGF) was used as an experimental tool. Treatment of MDA-MB-468 cells in vitro with EGF (20 nM) increased the ratio of p21{sup WAF-1/CIP-1} mRNA/{beta}-actin mRNA threefold within 2 h as measured by the reverse transcription polymerase chain reaction (RT-PCR). A concentration-dependent inhibition of EGF-induced p21{sup WAF-1/CIP-1} protein expression was achieved in MDA-MB-468 cells by treatment with antisense ODNs with up to a tenfold decrease observed at 1 {mu}M. There was a fourfold lower inhibition of p21{sup WAF-1/CIP-1} protein expression by control sense or random sequence ODNs. Intratumoral injections of EGF (15 {mu}g/day x 3 days) were employed to induce p21{sup WAF-1/CIP-1} gene expression in MDA-MB-468 xenografts implanted subcutaneously into athymic mice. RT-PCR of explanted tumors showed a threefold increased level of p21{sup WAF-1/CIP-1} mRNA compared with normal saline-treated tumors. Successful imaging of EGF-induced p21{sup WAF-1/CIP-1} gene expression in MDA-MB-468 xenografts was achieved at 48 h post injection of {sup 111}In-labeled antisense ODNs (3.7 MBq; 2 {mu}g). Tumors displaying basal levels of p21{sup WAF-1/CIP-1} gene expression in the absence of EGF treatment could not be visualized. Biodistribution studies showed a significantly higher tumor

  16. [The pathology of salivary glands. Tumors of the salivary glands].

    Science.gov (United States)

    Mahy, P; Reychler, H

    2006-01-01

    The management of benign and malignant neoplasms of the salivary glands requires precise knowledge of tumor histogenesis and classification as well as surgical skills. Pleomorphic adenoma and Whartin's tumor are the most frequent tumors in parotid glands while the probability for malignant tumors is higher in other glands, especially in sublingual and minor salivary glands. Those malignant salivary glands tumors are rare and necessitate multidisciplinar staging and management in close collaboration with the pathologist and the radiation oncologist.

  17. Epidermal stem cells: location, potential and contribution to cancer.

    Science.gov (United States)

    Ambler, C A; Määttä, A

    2009-01-01

    Epidermal stem cells have been classically characterized as slow-cycling, long-lived cells that reside in discrete niches in the skin. Gene expression studies of niche-resident cells have revealed a number of stem cell markers and regulators, including the Wnt/beta-catenin, Notch, p63, c-Myc and Hedgehog pathways. A new study challenges the traditional developmental paradigm of slow-cycling stem cells and rapid-cycling transit amplifying cells in some epidermal regions, and there is mounting evidence to suggest that multi-lineage epidermal progenitors can be isolated from highly proliferative, non-niche regions. Whether there is a unique microenvironment surrounding these progenitors remains to be determined. Interestingly, cancer stem cells derived from epidermal tumours exist independent of the classic skin stem cell niche, yet also have stem cell properties, including multi-lineage differentiation. This review summarizes recent studies identifying the location and regulators of mouse and human epidermal stem cells and highlights the strategies used to identify cancer stem cells, including expression of normal epidermal stem cell markers, expression of cancer stem cell markers identified in other epidermal tumours and characterization of side-population tumour cells.

  18. Sialography And Salivary Scan Study Of Salivary Diseases

    International Nuclear Information System (INIS)

    Park, Yun Kyung; Lee, Sang Rae; Hwang, Eui Hwan

    1999-01-01

    The purpose of this study was to established the characteristic radiographic features in salivary gland diseases by means of sialography and scintigraphy. Sialograms and scintigrams with diseases of salivary gland were examined. In this group were 5 salivary stones, 14 sialadenitis, 17 Sjogren's syndromes and 8 benign tumors. The obtained results were as follows;1. In the configuration of the shape of main duct, those revealed that modified curvilinear and curvilinear types were predominant in Sjogren's syndromes but reverse sigmoid and angular types were in sialolithiasis and sialadenitis combined with sialodochitis. 2. In the configuration of the course of main duct, those revealed that smooth types were predominant in sialadenitis and irregular types were predominant in Sjogren's syndromes and benign tumors and irregular types were seen in all salivary stones and sialadenitis combined with sialodochitis. 3. In the type of intraglandular pattern, those revealed that destructive changes of salivary duct system and parenchyma were severe in sialadenitis and salivary stones and predominantly severe in Sjogren's syndromes. 4. The function of salivary gland was decreased severely in Sjogren's syndrome. and also decrease in salivary stone and sialadenitis. In benign tumor, the uptake of radioisotope was not seen in lesion and the function of salivary gland decreased in its remaining normal parenchyma.

  19. Sialography And Salivary Scan Study Of Salivary Diseases

    Energy Technology Data Exchange (ETDEWEB)

    Park, Yun Kyung; Lee, Sang Rae; Hwang, Eui Hwan [Dept. of Oral and Maxillofacial Radiology, College of Dentistry, Kyunghee University, Seoul (Korea, Republic of)

    1999-02-15

    The purpose of this study was to established the characteristic radiographic features in salivary gland diseases by means of sialography and scintigraphy. Sialograms and scintigrams with diseases of salivary gland were examined. In this group were 5 salivary stones, 14 sialadenitis, 17 Sjogren's syndromes and 8 benign tumors. The obtained results were as follows;1. In the configuration of the shape of main duct, those revealed that modified curvilinear and curvilinear types were predominant in Sjogren's syndromes but reverse sigmoid and angular types were in sialolithiasis and sialadenitis combined with sialodochitis. 2. In the configuration of the course of main duct, those revealed that smooth types were predominant in sialadenitis and irregular types were predominant in Sjogren's syndromes and benign tumors and irregular types were seen in all salivary stones and sialadenitis combined with sialodochitis. 3. In the type of intraglandular pattern, those revealed that destructive changes of salivary duct system and parenchyma were severe in sialadenitis and salivary stones and predominantly severe in Sjogren's syndromes. 4. The function of salivary gland was decreased severely in Sjogren's syndrome. and also decrease in salivary stone and sialadenitis. In benign tumor, the uptake of radioisotope was not seen in lesion and the function of salivary gland decreased in its remaining normal parenchyma.

  20. The "trouble" with salivary testosterone.

    Science.gov (United States)

    Granger, Douglas A; Shirtcliff, Elizabeth A; Booth, Alan; Kivlighan, Katie T; Schwartz, Eve B

    2004-11-01

    In a series of studies, we identify several specific issues that can limit the value of integrating salivary testosterone in biosocial research. Salivary testosterone measurements can be substantially influenced during the process of sample collection, are susceptible to interference effects caused by the leakage of blood (plasma) into saliva, and are sensitive to storage conditions when samples have been archived. There are gender differences in salivary testosterone levels and variance, the serum-saliva association, the relationship of salivary testosterone to age and pubertal development, and the stability of individual differences in salivary testosterone levels over time. The findings have important implications at several levels of analysis for research that aims to test biosocial models of testosterone--behavior relationships. Recommendations are provided to steer investigators around these "troubles" with salivary testosterone.

  1. [Progress in epidermal stem cells].

    Science.gov (United States)

    Wang, Li-Juan; Wang, You-Liang; Yang, Xiao

    2010-03-01

    Mammalian skin epidermis contains different epidermal stem cell pools which contribute to the homeostasis and repair of skin epithelium. Epidermal stem cells possess two essential features common to all stem cells: self-renewal and differentiation. Disturbing the balance between self-renewal and differentiation of epidermal stem cell often causes tumors or other skin diseases. Epidermal stem cell niches provide a special microenvironment that maintains a balance of stem cell quiescence and activity. This review primarily concentrates on the following points of the epidermal stem cells: the existing evidences, the self-renewal and differentiation, the division pattern, the signal pathways regulating self-renewal and differentiation, and the microenvironment (niche) and macroenvironment maintaining the homeostasis of stem cells.

  2. Malignant salivary gland tumours

    International Nuclear Information System (INIS)

    Thompson, S.H.

    1982-01-01

    The most frequent malignant salivary gland tumours are the mucoepidermoid tumour, adenoid cystic carcinoma and adenocarcinoma. The major salivary glands and the minor glands of the mouth and upper respiratory tract may potentially develop any of these malignant lesions. Malignant lesions most frequently present as a palpable mass and tend to enlarge more rapidly than benign neoplasms. Pain, paresthesia, muscle paralysis and fixation to surrounding tissue are all ominous signs and symptoms. The only reliable means of differential diagnosis of these lesions is biopsy and histologic analysis. Therapy involves surgery or a combination of surgery and radiation therapy. The ultimate prognosis is governed by the intrinsic biologic behaviour of the neoplasms, the extent of disease and adequate clinical therapy

  3. Malignant salivary gland tumours

    Energy Technology Data Exchange (ETDEWEB)

    Thompson, S.H. (University of the Witwatersrand, Johannesburg (South Africa). Dept. of Oral Pathology)

    1982-08-01

    The most frequent malignant salivary gland tumours are the mucoepidermoid tumour, adenoid cystic carcinoma and adenocarcinoma. The major salivary glands and the minor glands of the mouth and upper respiratory tract may potentially develop any of these malignant lesions. Malignant lesions most frequently present as a palpable mass and tend to enlarge more rapidly than benign neoplasms. Pain, paresthesia, muscle paralysis and fixation to surrounding tissue are all ominous signs and symptoms. The only reliable means of differential diagnosis of these lesions is biopsy and histologic analysis. Therapy involves surgery or a combination of surgery and radiation therapy. The ultimate prognosis is governed by the intrinsic biologic behaviour of the neoplasms, the extent of disease and adequate clinical therapy.

  4. Protein structure of fetal antigen 1 (FA1). A novel circulating human epidermal-growth-factor-like protein expressed in neuroendocrine tumors and its relation to the gene products of dlk and pG2

    DEFF Research Database (Denmark)

    Jensen, Charlotte Harken; Krogh, Thomas N; Højrup, Peter

    1994-01-01

    The present paper describes the primary structure, glycosylation and tissue localization of fetal antigen 1 (FA1) isolated from second-trimester human amniotic fluid. FA1 is a single-chained, heterogeneous glycoprotein of 225-262 amino acid residues. FA1 has six well conserved epidermal...... extends with minor corrections to the human adrenal-specific mRNA, pG2 as well. Immunohistochemical analysis demonstrated the presence of FA1 in 10 out of 14 lung tumors containing neuroendocrine elements, and in the placental villi where FA1 was exclusively seen in stromal cells in close contact...... to the vascular structure. In the pancreas, FA1 co-localized with insulin in the insulin secretory granules of the beta cells within the islets of Langerhans. Our findings suggest that FA1 is synthesized as a membrane anchored protein and released into the circulation after enzymic cleavage, and that circulating...

  5. Oral vs. salivary diagnostics

    Science.gov (United States)

    Marques, Joana; Corby, Patricia M.; Barber, Cheryl A.; Abrams, William R.; Malamud, Daniel

    2015-05-01

    The field of "salivary diagnostics" includes studies utilizing samples obtained from a variety of sources within the oral cavity. These samples include; whole unstimulated saliva, stimulated whole saliva, duct saliva collected directly from the parotid, submandibular/sublingual glands or minor salivary glands, swabs of the buccal mucosa, tongue or tonsils, and gingival crevicular fluid. Many publications state "we collected saliva from subjects" without fully describing the process or source of the oral fluid. Factors that need to be documented in any study include the time of day of the collection, the method used to stimulate and collect the fluid, and how much fluid is being collected and for how long. The handling of the oral fluid during and post-collection is also critical and may include addition of protease or nuclease inhibitors, centrifugation, and cold or frozen storage prior to assay. In an effort to create a standard protocol for determining a biomarker's origin we carried out a pilot study collecting oral fluid from 5 different sites in the mouth and monitoring the concentrations of pro- and anti-inflammatory cytokines detected using MesoScaleDiscovery (MSD) electrochemiluminesence assays. Our data suggested that 3 of the cytokines are primarily derived from the submandibular gland, while 7 of the cytokines come from a source other than the major salivary glands such as the minor salivary glands or cells in the oral mucosae. Here we review the literature on monitoring biomarkers in oral samples and stress the need for determining the blood/saliva ratio when a quantitative determination is needed and suggest that the term oral diagnostic be used if the source of an analyte in the oral cavity is unknown.

  6. Immunohistochemical and quantitative changes in salivary EGF, amylase and haptocorrin following radiotherapy for oral cancer

    DEFF Research Database (Denmark)

    Christensen, M E; Hansen, H S; Poulsen, Steen Seier

    1996-01-01

    Epidermal growth factor (EGF), amylase and haptocorrin are molecules produced in the salivary glands. The aim of the present study was to determine immunohistochemical and quantitative alterations in EGF as compared with haptocorrin and amylase following radiotherapy for oral cancer. Changes in t...... a reduction in the mitogenic peptide EGF both immunohistochemically and quantitatively following irradiation for oral cancer, results which may contribute to the understanding of the clinical signs of mucositis.......Epidermal growth factor (EGF), amylase and haptocorrin are molecules produced in the salivary glands. The aim of the present study was to determine immunohistochemical and quantitative alterations in EGF as compared with haptocorrin and amylase following radiotherapy for oral cancer. Changes....... The concentration of EGF in saliva before treatment was significantly higher in patients than in the control group (p oral tumors contribute with EGF to the saliva. In conclusion we have demonstrated...

  7. "Cut-and-paste" manufacture of multiparametric epidermal electronic systems

    Science.gov (United States)

    Lu, Nanshu; Yang, Shixuan; Wang, Pulin

    2016-05-01

    Epidermal electronics is a class of noninvasive and unobstructive skin-mounted, tattoo-like sensors and electronics capable of vital sign monitoring and establishing human-machine interface. The high cost of manpower, materials, vacuum equipment, and photolithographic facilities associated with its manufacture greatly hinders the widespread use of disposable epidermal electronics. Here we report a cost and time effective, completely dry, benchtop "cut-and-paste" method for the freeform and portable manufacture of multiparametric epidermal sensor systems (ESS) within minutes. This versatile method works for all types of thin metal and polymeric sheets and is compatible with any tattoo adhesives or medical tapes. The resulting ESS are multimaterial and multifunctional and have been demonstrated to noninvasively but accurately measure electrophysiological signals, skin temperature, skin hydration, as well as respiratory rate. In addition, planar stretchable coils exploiting double-stranded serpentine design have been successfully applied as wireless, passive epidermal strain sensors.

  8. Epidermal Growth Factor and Intestinal Barrier Function

    Directory of Open Access Journals (Sweden)

    Xiaopeng Tang

    2016-01-01

    Full Text Available Epidermal growth factor (EGF is a 53-amino acid peptide that plays an important role in regulating cell growth, survival, migration, apoptosis, proliferation, and differentiation. In addition, EGF has been established to be an effective intestinal regulator helping to protect intestinal barrier integrity, which was essential for the absorption of nutrients and health in humans and animals. Several researches have demonstrated that EGF via binding to the EGF receptor and subsequent activation of Ras/MAPK, PI3K/AKT, PLC-γ/PKC, and STATS signal pathways regulates intestinal barrier function. In this review, the relationship between epidermal growth factor and intestinal development and intestinal barrier is described, to provide a better understanding of the effects of EGF on intestine development and health.

  9. Salivary gland proteins of the human malaria vector, Anopheles dirus B (Diptera: Culicidae Proteínas das glândulas salivares do Anopheles dirus B (Diptera: Culicidae, vetor da malária humana

    Directory of Open Access Journals (Sweden)

    Narissara Jariyapan

    2007-02-01

    Full Text Available Salivary gland proteins of the human malaria vector, Anopheles dirus B were determined and analyzed. The amount of salivary gland proteins in mosquitoes aged between 3 - 10 days was approximately 1.08 ± 0.04 µg/female and 0.1 ± 0.05 µg/male. The salivary glands of both sexes displayed the same morphological organization as that of other anopheline mosquitoes. In females, apyrase accumulated in the distal regions, whereas alpha-glucosidase was found in the proximal region of the lateral lobes. This differential distribution of the analyzed enzymes reflects specialization of different regions for sugar and blood feeding. SDS-PAGE analysis revealed that at least seven major proteins were found in the female salivary glands, of which each morphological region contained different major proteins. Similar electrophoretic protein profiles were detected comparing unfed and blood-fed mosquitoes, suggesting that there is no specific protein induced by blood. Two-dimensional polyacrylamide gel analysis showed the most abundant salivary gland protein, with a molecular mass of approximately 35 kilodaltons and an isoelectric point of approximately 4.0. These results provide basic information that would lead to further study on the role of salivary proteins of An. dirus B in disease transmission and hematophagy.Proteínas das glândulas salivares do Anopheles dirus B (Diptera: Culicidae, vetor da malária humana foram determinadas e analisadas. A quantidade de proteínas das glândulas salivares em mosquitos com três a 10 dias de idade foi de aproximadamente 1,08 ± 0,04 µg/ fêmea e de 0,1 ± 0,05 µg/macho. As glândulas salivares de ambos os sexos mostraram organização morfológica semelhante à de outros mosquitos anofelinos. Em fêmeas, apirase acumula-se nas regiões distais, enquanto alfa-glucosidase foi encontrada na região proximal dos lóbulos laterais. Esta distribuição diferencial das enzimas analisadas reflete a especialização de

  10. Inhibition of Epidermal Growth Factor Receptor and PI3K/Akt Signaling Suppresses Cell Proliferation and Survival through Regulation of Stat3 Activation in Human Cutaneous Squamous Cell Carcinoma

    International Nuclear Information System (INIS)

    Bito, T.; Sumita, N.; Ashida, M.; Budiyanto, A.; Ueda, M.; Ichihashi, M.; Nishigori, C.; Tokura, Y.; Bito, T.

    2011-01-01

    Recent studies have emphasized the important role of Stat3 activation in a number of human tumors from the viewpoint of its oncogenic and anti apoptotic activity. In this study, we examined the role and related signaling molecules of Stat3 in the carcinogenesis of human cutaneous squamous cell carcinoma (SCC). In 35 human cutaneous SCC samples, 86% showed overexpression of phosphorylated (p)-Stat3, and most of those simultaneously over expressed p-EGFR or p-Akt. Constitutive activation of EGFR and Stat3 was observed in three SCC cell lines and four of five SCC tissues. AG1478, an inhibitor of the EGFR, down regulated Stat3 activation in HSC-1 human SCC cells. AG1478 inhibited cell proliferation and induced apoptosis of HSC-1 cells but did not inhibit the growth of normal human epidermal keratinocytes that did not show Stat3 activation. Furthermore, a PI3K inhibitor also suppressed Stat3 activation in HSC-1 cells to some degree. Combined treatment with the PI3K inhibitor and AG1478 strongly suppressed Stat3 activity and dramatically induced apoptosis of HSC-1 cells. These data suggest that Stat3 activation through EGFR and/or PI3K/Akt activation plays a critical role in the proliferation and survival of human cutaneous SCC.

  11. Faster DNA Repair of Ultraviolet-Induced Cyclobutane Pyrimidine Dimers and Lower Sensitivity to Apoptosis in Human Corneal Epithelial Cells than in Epidermal Keratinocytes.

    Directory of Open Access Journals (Sweden)

    Justin D Mallet

    Full Text Available Absorption of UV rays by DNA generates the formation of mutagenic cyclobutane pyrimidine dimers (CPD and pyrimidine (6-4 pyrimidone photoproducts (6-4PP. These damages are the major cause of skin cancer because in turn, they can lead to signature UV mutations. The eye is exposed to UV light, but the cornea is orders of magnitude less prone to UV-induced cancer. In an attempt to shed light on this paradox, we compared cells of the corneal epithelium and the epidermis for UVB-induced DNA damage frequency, repair and cell death sensitivity. We found similar CPD levels but a 4-time faster UVB-induced CPD, but not 6-4PP, repair and lower UV-induced apoptosis sensitivity in corneal epithelial cells than epidermal. We then investigated levels of DDB2, a UV-induced DNA damage recognition protein mostly impacting CPD repair, XPC, essential for the repair of both CPD and 6-4PP and p53 a protein upstream of the genotoxic stress response. We found more DDB2, XPC and p53 in corneal epithelial cells than in epidermal cells. According to our results analyzing the protein stability of DDB2 and XPC, the higher level of DDB2 and XPC in corneal epithelial cells is most likely due to an increased stability of the protein. Taken together, our results show that corneal epithelial cells have a better efficiency to repair UV-induced mutagenic CPD. On the other hand, they are less prone to UV-induced apoptosis, which could be related to the fact that since the repair is more efficient in the HCEC, the need to eliminate highly damaged cells by apoptosis is reduced.

  12. Responsiveness to 6-n-propylthiouracil (PROP is associated with salivary levels of two specific basic proline-rich proteins in humans.

    Directory of Open Access Journals (Sweden)

    Tiziana Cabras

    Full Text Available Thiourea tasting can be predictive of individual differences in bitter taste responses, general food preferences and eating behavior, and could be correlated with saliva chemical composition. We investigated the possible relationship between PROP bitter taste responsiveness and the salivary proteome in subjects genotyped for TAS2R38 and gustin gene polymorphisms. Taste perception intensity evoked by PROP and NaCl solutions was measured in sixty-three volunteers (21 males, 42 females, age 25±3 y to establish their PROP taster status, and 24 PROP super-tasters and 21 nontasters were selected to participate in the study. TAS2R38 and gustin gene molecular analysis were performed using PCR techniques. Qualitative and quantitative determination of salivary proteins was performed by HPLC-ESI-MS before and after PROP taste stimulation. PROP super-tastings was strongly associated with the 'taster' variant (PAV haplotype of TAS2R38 and the A allele of rs2274333 polymorphism in the gustin gene and nontasting was associated with the minor alleles at both loci. ANOVA revealed that basal levels of II-2 and Ps-1 proteins, belonging to the basic proline-rich protein (bPRPs family, were significantly higher in PROP super-taster than in nontaster un-stimulated saliva, and that PROP stimulation elicited a rapid increase in the levels of these same proteins only in PROP super-taster saliva. These data show for the first time that responsiveness to PROP is associated with salivary levels of II-2 peptide and Ps-1 protein, which are products of the PRB1 gene. These findings suggest that PRB1, in addition to TAS2R38 and gustin, could contribute to individual differences in thiourea sensitivity, and the expression of the PROP phenotype as a complex genetic trait.

  13. Responsiveness to 6-n-propylthiouracil (PROP) is associated with salivary levels of two specific basic proline-rich proteins in humans.

    Science.gov (United States)

    Cabras, Tiziana; Melis, Melania; Castagnola, Massimo; Padiglia, Alessandra; Tepper, Beverly J; Messana, Irene; Tomassini Barbarossa, Iole

    2012-01-01

    Thiourea tasting can be predictive of individual differences in bitter taste responses, general food preferences and eating behavior, and could be correlated with saliva chemical composition. We investigated the possible relationship between PROP bitter taste responsiveness and the salivary proteome in subjects genotyped for TAS2R38 and gustin gene polymorphisms. Taste perception intensity evoked by PROP and NaCl solutions was measured in sixty-three volunteers (21 males, 42 females, age 25±3 y) to establish their PROP taster status, and 24 PROP super-tasters and 21 nontasters were selected to participate in the study. TAS2R38 and gustin gene molecular analysis were performed using PCR techniques. Qualitative and quantitative determination of salivary proteins was performed by HPLC-ESI-MS before and after PROP taste stimulation. PROP super-tastings was strongly associated with the 'taster' variant (PAV haplotype) of TAS2R38 and the A allele of rs2274333 polymorphism in the gustin gene and nontasting was associated with the minor alleles at both loci. ANOVA revealed that basal levels of II-2 and Ps-1 proteins, belonging to the basic proline-rich protein (bPRPs) family, were significantly higher in PROP super-taster than in nontaster un-stimulated saliva, and that PROP stimulation elicited a rapid increase in the levels of these same proteins only in PROP super-taster saliva. These data show for the first time that responsiveness to PROP is associated with salivary levels of II-2 peptide and Ps-1 protein, which are products of the PRB1 gene. These findings suggest that PRB1, in addition to TAS2R38 and gustin, could contribute to individual differences in thiourea sensitivity, and the expression of the PROP phenotype as a complex genetic trait.

  14. Salivary DNA and markers of oxidative stress in patients with chronic periodontitis.

    Science.gov (United States)

    Baňasová, Lenka; Kamodyová, Natália; Janšáková, Katarína; Tóthová, Ľubomíra; Stanko, Peter; Turňa, Ján; Celec, Peter

    2015-03-01

    Previous observational studies have shown that periodontal status is associated with salivary markers of oxidative damage. A direct comparison of periodontitis patients and controls using a wide palette of salivary markers of oxidative stress is lacking. Characteristics of salivary DNA in periodontitis are unknown. The aim of this study was to compare the salivary markers of oxidative stress and characteristics of salivary DNA between patients with chronic periodontitis and periodontitis-free controls. Saliva was collected from 23 patients with chronic periodontitis and 19 periodontitis-free controls. All participants underwent a clinical periodontal examination. Markers of oxidative and carbonyl stress were measured in saliva. Human and bacterial DNA was quantified, and human DNA integrity was assessed. Salivary thiobarbituric acid-reacting substances were higher in patients than in controls; at least in men, the difference was significant (p periodontitis patients. The results confirmed the association of salivary thiobarbituric acid-reacting substances with periodontitis. Lipid peroxidation in periodontitis seems to be caused by increased production of reactive oxygen species in men and by decreased antioxidant status in women. Whether lower salivary DNA integrity is involved in the pathogenesis of periodontitis remains to be elucidated. Salivary thiobarbituric acid-reacting substances are associated with periodontitis at least on a population level. Sex-specific causes of lipid peroxidation might point towards different pathogenic mechanisms.

  15. Association between salivary serotonin and the social sharing of happiness.

    Directory of Open Access Journals (Sweden)

    Masahiro Matsunaga

    Full Text Available Although human saliva contains the monoamine serotonin, which plays a key role in the modulation of emotional states, the association between salivary serotonin and empathic ability remains unclear. In order to elucidate the associations between salivary serotonin levels, trait empathy, and the sharing effect of emotions (i.e., sharing emotional experiences with others, we performed a vignette-based study. Participants were asked to evaluate their happiness when they experience several hypothetical life events, whereby we manipulated the valence of the imagined event (positive, neutral, or negative, as well as the presence of a friend (absent, positive, or negative. Results indicated that the presence of a happy friend significantly enhanced participants' happiness. Correlation analysis demonstrated that salivary serotonin levels were negatively correlated with happiness when both the self and friend conditions were positive. Correlation analysis also indicated a negative relationship between salivary serotonin levels and trait empathy (particularly in perspective taking, which was measured by the Interpersonal Reactivity Index. Furthermore, an exploratory multiple regression analysis suggested that mothers' attention during childhood predicted salivary serotonin levels. Our findings indicate that empathic abilities and the social sharing of happiness decreases as a function of salivary serotonin levels.

  16. Dengue virus replicates and accumulates in Aedes aegypti salivary glands

    Energy Technology Data Exchange (ETDEWEB)

    Raquin, Vincent, E-mail: vincent.raquin@univ-lyon1.fr [Insect-Virus Interactions Group, Department of Genomes and Genetics, Institut Pasteur, 75015 Paris (France); Centre National de la Recherche Scientifique, Unité de Recherche Associée 3012, 75015 Paris (France); Lambrechts, Louis, E-mail: louis.lambrechts@pasteur.fr [Insect-Virus Interactions Group, Department of Genomes and Genetics, Institut Pasteur, 75015 Paris (France); Centre National de la Recherche Scientifique, Unité de Recherche Associée 3012, 75015 Paris (France)

    2017-07-15

    Dengue virus (DENV) is an RNA virus transmitted among humans by mosquito vectors, mainly Aedes aegypti. DENV transmission requires viral dissemination from the mosquito midgut to the salivary glands. During this process the virus undergoes several population bottlenecks, which are stochastic reductions in population size that restrict intra-host viral genetic diversity and limit the efficiency of natural selection. Despite the implications for virus transmission and evolution, DENV replication in salivary glands has not been directly demonstrated. Here, we used a strand-specific quantitative RT-PCR assay to demonstrate that negative-strand DENV RNA is produced in Ae. aegypti salivary glands, providing conclusive evidence that viral replication occurs in this tissue. Furthermore, we showed that the concentration of DENV genomic RNA in salivary glands increases significantly over time, indicating that active replication likely replenishes DENV genetic diversity prior to transmission. These findings improve our understanding of the biological determinants of DENV fitness and evolution. - Highlights: •Strand-specific RT-qPCR allows accurate quantification of DENV (-) RNA in mosquito tissues. •Detection of DENV (-) RNA in salivary glands provides evidence of viral replication in this tissue. •Viral replication in salivary glands likely replenishes DENV genetic diversity prior to transmission.

  17. Dengue virus replicates and accumulates in Aedes aegypti salivary glands

    International Nuclear Information System (INIS)

    Raquin, Vincent; Lambrechts, Louis

    2017-01-01

    Dengue virus (DENV) is an RNA virus transmitted among humans by mosquito vectors, mainly Aedes aegypti. DENV transmission requires viral dissemination from the mosquito midgut to the salivary glands. During this process the virus undergoes several population bottlenecks, which are stochastic reductions in population size that restrict intra-host viral genetic diversity and limit the efficiency of natural selection. Despite the implications for virus transmission and evolution, DENV replication in salivary glands has not been directly demonstrated. Here, we used a strand-specific quantitative RT-PCR assay to demonstrate that negative-strand DENV RNA is produced in Ae. aegypti salivary glands, providing conclusive evidence that viral replication occurs in this tissue. Furthermore, we showed that the concentration of DENV genomic RNA in salivary glands increases significantly over time, indicating that active replication likely replenishes DENV genetic diversity prior to transmission. These findings improve our understanding of the biological determinants of DENV fitness and evolution. - Highlights: •Strand-specific RT-qPCR allows accurate quantification of DENV (-) RNA in mosquito tissues. •Detection of DENV (-) RNA in salivary glands provides evidence of viral replication in this tissue. •Viral replication in salivary glands likely replenishes DENV genetic diversity prior to transmission.

  18. Caveolin-1 overexpression in benign and malignant salivary gland tumors.

    Science.gov (United States)

    Jaafari-Ashkavandi, Zohreh; Ashraf, Mohammad Javad; Nazhvani, Ali Dehghani; Azizi, Zahra

    2016-02-01

    Caveolin-1, a tyrosine-phosphorylated protein, is supposed to have different regulatory roles as promoter or suppressor in many human cancers. However, no published study concerned its expression in benign and malignant salivary gland tumors. The aim of this study was to evaluate and compare the expression of Cav-1 in the most common benign and malignant salivary gland tumors and evaluate its correlation with proliferation activity. In this cross-sectional retrospective study, immunohistochemical expression of caveolin-1 and Ki67 were evaluated in 49 samples, including 11 normal salivary glands, 15 cases of pleomorphic adenoma (PA), 13 adenoid cystic carcinomas (AdCC), and 10 mucoepidermoid carcinomas (MEC). The expression of Cav-1 was seen in 18 % of normal salivary glands and 85 % of tumors. The immunoreaction in the tumors was significantly higher than normal tissues (P = 0.001), but the difference between benign and malignant tumors was not significant (P = 0.07). Expression of Cav-1 was correlated with Ki67 labeling index in PAs, but not in malignant tumors. Cav-1 expression was not in association with tumor size and stage. Overexpression of Cav-1 was found in salivary gland tumors in comparison with normal tissues, but no significant difference was observed between benign and malignant tumors. Cav-1 was inversely correlated with proliferation in PA. Therefore, this marker may participate in tumorigenesis of salivary gland tumors and may be a potential biomarker for cancer treatments.

  19. Association between salivary serotonin and the social sharing of happiness.

    Science.gov (United States)

    Matsunaga, Masahiro; Ishii, Keiko; Ohtsubo, Yohsuke; Noguchi, Yasuki; Ochi, Misaki; Yamasue, Hidenori

    2017-01-01

    Although human saliva contains the monoamine serotonin, which plays a key role in the modulation of emotional states, the association between salivary serotonin and empathic ability remains unclear. In order to elucidate the associations between salivary serotonin levels, trait empathy, and the sharing effect of emotions (i.e., sharing emotional experiences with others), we performed a vignette-based study. Participants were asked to evaluate their happiness when they experience several hypothetical life events, whereby we manipulated the valence of the imagined event (positive, neutral, or negative), as well as the presence of a friend (absent, positive, or negative). Results indicated that the presence of a happy friend significantly enhanced participants' happiness. Correlation analysis demonstrated that salivary serotonin levels were negatively correlated with happiness when both the self and friend conditions were positive. Correlation analysis also indicated a negative relationship between salivary serotonin levels and trait empathy (particularly in perspective taking), which was measured by the Interpersonal Reactivity Index. Furthermore, an exploratory multiple regression analysis suggested that mothers' attention during childhood predicted salivary serotonin levels. Our findings indicate that empathic abilities and the social sharing of happiness decreases as a function of salivary serotonin levels.

  20. Epidermal CYP2 family cytochromes P450

    International Nuclear Information System (INIS)

    Du Liping; Hoffman, Susan M.G.; Keeney, Diane S.

    2004-01-01

    Skin is the largest and most accessible drug-metabolizing organ. In mammals, it is the competent barrier that protects against exposure to harmful stimuli in the environment and in the systemic circulation. Skin expresses many cytochromes P450 that have critical roles in exogenous and endogenous substrate metabolism. Here, we review evidence for epidermal expression of genes from the large CYP2 gene family, many of which are expressed preferentially in extrahepatic tissues or specifically in epithelia at the environmental interface. At least 13 CYP2 genes (CYP2A6, 2A7, 2B6, 2C9, 2C18, 2C19, 2D6, 2E1, 2J2, 2R1, 2S1, 2U1, and 2W1) are expressed in skin from at least some human individuals, and the majority of these genes are expressed in epidermis or cultured keratinocytes. Where epidermal expression has been localized in situ by hybridization or immunocytochemistry, CYP2 transcripts and proteins are most often expressed in differentiated keratinocytes comprising the outer (suprabasal) cell layers of the epidermis and skin appendages. The tissue-specific transcriptional regulation of CYP2 genes in the epidermis, and in other epithelia that interface with the environment, suggests important roles for at least some CYP2 gene products in the production and disposition of molecules affecting competency of the epidermal barrier

  1. Adjuvant Lapatinib and Trastuzumab for Early Human Epidermal Growth Factor Receptor 2–Positive Breast Cancer: Results From the Randomized Phase III Adjuvant Lapatinib and/or Trastuzumab Treatment Optimization Trial

    Science.gov (United States)

    Holmes, Eileen; Baselga, José; de Azambuja, Evandro; Dueck, Amylou C.; Viale, Giuseppe; Zujewski, Jo Anne; Goldhirsch, Aron; Armour, Alison; Pritchard, Kathleen I.; McCullough, Ann E.; Dolci, Stella; McFadden, Eleanor; Holmes, Andrew P.; Tonghua, Liu; Eidtmann, Holger; Dinh, Phuong; Di Cosimo, Serena; Harbeck, Nadia; Tjulandin, Sergei; Im, Young-Hyuck; Huang, Chiun-Sheng; Diéras, Véronique; Hillman, David W.; Wolff, Antonio C.; Jackisch, Christian; Lang, Istvan; Untch, Michael; Smith, Ian; Boyle, Frances; Xu, Binghe; Gomez, Henry; Suter, Thomas; Gelber, Richard D.; Perez, Edith A.

    2016-01-01

    Background Lapatinib (L) plus trastuzumab (T) improves outcomes for metastatic human epidermal growth factor 2–positive breast cancer and increases the pathologic complete response in the neoadjuvant setting, but their role as adjuvant therapy remains uncertain. Methods In the Adjuvant Lapatinib and/or Trastuzumab Treatment Optimization trial, patients with centrally confirmed human epidermal growth factor 2–positive early breast cancer were randomly assigned to 1 year of adjuvant therapy with T, L, their sequence (T→L), or their combination (L+T). The primary end point was disease-free survival (DFS), with 850 events required for 80% power to detect a hazard ratio (HR) of 0.8 for L+T versus T. Results Between June 2007 and July 2011, 8,381 patients were enrolled. In 2011, due to futility to demonstrate noninferiority of L versus T, the L arm was closed, and patients free of disease were offered adjuvant T. A protocol modification required P ≤ .025 for the two remaining pairwise comparisons. At a protocol-specified analysis with a median follow-up of 4.5 years, a 16% reduction in the DFS hazard rate was observed with L+T compared with T (555 DFS events; HR, 0.84; 97.5% CI, 0.70 to 1.02; P = .048), and a 4% reduction was observed with T→L compared with T (HR, 0.96; 97.5% CI, 0.80 to 1.15; P = .61). L-treated patients experienced more diarrhea, cutaneous rash, and hepatic toxicity compared with T-treated patients. The incidence of cardiac toxicity was low in all treatment arms. Conclusion Adjuvant treatment that includes L did not significantly improve DFS compared with T alone and added toxicity. One year of adjuvant T remains standard of care. PMID:26598744

  2. Adjuvant Lapatinib and Trastuzumab for Early Human Epidermal Growth Factor Receptor 2-Positive Breast Cancer: Results From the Randomized Phase III Adjuvant Lapatinib and/or Trastuzumab Treatment Optimization Trial.

    Science.gov (United States)

    Piccart-Gebhart, Martine; Holmes, Eileen; Baselga, José; de Azambuja, Evandro; Dueck, Amylou C; Viale, Giuseppe; Zujewski, Jo Anne; Goldhirsch, Aron; Armour, Alison; Pritchard, Kathleen I; McCullough, Ann E; Dolci, Stella; McFadden, Eleanor; Holmes, Andrew P; Tonghua, Liu; Eidtmann, Holger; Dinh, Phuong; Di Cosimo, Serena; Harbeck, Nadia; Tjulandin, Sergei; Im, Young-Hyuck; Huang, Chiun-Sheng; Diéras, Véronique; Hillman, David W; Wolff, Antonio C; Jackisch, Christian; Lang, Istvan; Untch, Michael; Smith, Ian; Boyle, Frances; Xu, Binghe; Gomez, Henry; Suter, Thomas; Gelber, Richard D; Perez, Edith A

    2016-04-01

    Lapatinib (L) plus trastuzumab (T) improves outcomes for metastatic human epidermal growth factor 2-positive breast cancer and increases the pathologic complete response in the neoadjuvant setting, but their role as adjuvant therapy remains uncertain. In the Adjuvant Lapatinib and/or Trastuzumab Treatment Optimization trial, patients with centrally confirmed human epidermal growth factor 2-positive early breast cancer were randomly assigned to 1 year of adjuvant therapy with T, L, their sequence (T→L), or their combination (L+T). The primary end point was disease-free survival (DFS), with 850 events required for 80% power to detect a hazard ratio (HR) of 0.8 for L+T versus T. Between June 2007 and July 2011, 8,381 patients were enrolled. In 2011, due to futility to demonstrate noninferiority of L versus T, the L arm was closed, and patients free of disease were offered adjuvant T. A protocol modification required P ≤ .025 for the two remaining pairwise comparisons. At a protocol-specified analysis with a median follow-up of 4.5 years, a 16% reduction in the DFS hazard rate was observed with L+T compared with T (555 DFS events; HR, 0.84; 97.5% CI, 0.70 to 1.02; P = .048), and a 4% reduction was observed with T→L compared with T (HR, 0.96; 97.5% CI, 0.80 to 1.15; P = .61). L-treated patients experienced more diarrhea, cutaneous rash, and hepatic toxicity compared with T-treated patients. The incidence of cardiac toxicity was low in all treatment arms. Adjuvant treatment that includes L did not significantly improve DFS compared with T alone and added toxicity. One year of adjuvant T remains standard of care. © 2015 by American Society of Clinical Oncology.

  3. Toxic epidermal necrolysis.

    Science.gov (United States)

    Pereira, Frederick A; Mudgil, Adarsh Vijay; Rosmarin, David M

    2007-02-01

    Toxic epidermal necrolysis (TEN) is an unpredictable, life-threatening drug reaction associated with a 30% mortality. Massive keratinocyte apoptosis is the hallmark of TEN. Cytotoxic T lymphocytes appear to be the main effector cells and there is experimental evidence for involvement of both the Fas-Fas ligand and perforin/granzyme pathways. Optimal treatment for these patients remains to be clarified. Discontinuation of the offending drug and prompt referral to a burn unit are generally agreed upon steps. Beyond that, however, considerable controversy exists. Evidence both pro and con exists for the use of IVIG, systemic corticosteroid, and other measures. There is also evidence suggesting that combination therapies may be of value. All the clinical data, however, is anecdotal or based on observational or retrospective studies. Definitive answers are not yet available. Given the rarity of TEN and the large number of patients required for a study to be statistically meaningful, placebo controlled trials are logistically difficult to accomplish. The absence of an animal model further hampers research into this condition. This article reviews recent data concerning clinical presentation, pathogenesis and treatment of TEN. At the conclusion of this learning activity, participants should have acquired a more comprehensive knowledge of our current understanding of the classification, clinical presentation, etiology, pathophysiology, prognosis, and treatment of TEN.

  4. Tight junction regulates epidermal calcium ion gradient and differentiation

    International Nuclear Information System (INIS)

    Kurasawa, Masumi; Maeda, Tetsuo; Oba, Ai; Yamamoto, Takuya; Sasaki, Hiroyuki

    2011-01-01

    Research highlights: → We disrupted epidermal tight junction barrier in reconstructed epidermis. → It altered Ca 2+ distribution and consequentially differentiation state as well. → Tight junction should affect epidermal homeostasis by maintaining Ca 2+ gradient. -- Abstract: It is well known that calcium ions (Ca 2+ ) induce keratinocyte differentiation. Ca 2+ distributes to form a vertical gradient that peaks at the stratum granulosum. It is thought that the stratum corneum (SC) forms the Ca 2+ gradient since it is considered the only permeability barrier in the skin. However, the epidermal tight junction (TJ) in the granulosum has recently been suggested to restrict molecular movement to assist the SC as a secondary barrier. The objective of this study was to clarify the contribution of the TJ to Ca 2+ gradient and epidermal differentiation in reconstructed human epidermis. When the epidermal TJ barrier was disrupted by sodium caprate treatment, Ca 2+ flux increased and the gradient changed in ion-capture cytochemistry images. Alterations of ultrastructures and proliferation/differentiation markers revealed that both hyperproliferation and precocious differentiation occurred regionally in the epidermis. These results suggest that the TJ plays a crucial role in maintaining epidermal homeostasis by controlling the Ca 2+ gradient.

  5. Relation between salivary amylase and cortisol respnses to different stress tasks: Impact of sex

    NARCIS (Netherlands)

    van Stegeren, A.H.; Wolf, O.T.; Kindt, M.

    2008-01-01

    Neuro-endocrine markers such as salivary alpha amylase (sAA) and cortisol (CORT) play an important role in establishing human responses to stressful events. Whereas sAA levels reflect sympathetic system activity, salivary cortisol appears to be a valid measure for HPA axis activity. Although many

  6. Anti-Ro and anti-La autoantibodies induce TNF-α production by human salivary gland cells: an in vitro study

    Directory of Open Access Journals (Sweden)

    V. Mitolo

    2011-09-01

    Full Text Available Obiettivo: Lo scopo di questo studio è stato valutare la produzione di TNF-α, induttore della via estrinseca del processo apoptotico, in seguito al trattamento con gli autoanticorpi anti-Ro ed anti-La isolati da pazienti con sindrome di Sjögren primaria in un modello sperimentale rappresentato dalla linea cellulare di ghiandole salivari umane, A- 253. È stata, inoltre, valutata la presenza sulla superficie di tali cellule di recettori specifici per tale induttore, TNFR1 e TNFR2. Materiali e metodi: Gli autoanticorpi anti-La ed anti-Ro sono stati purificati su una colonna cromatografia ad alta affinità. Le metodiche utilizzate per la valutazione della produzione di TNF-α e lo studio dei recettori di superficie sono state immunofluorescenza, RT-PCR e saggi immunoenzimatici. Risultati: I nostri risultati hanno dimostrato che le cellule A-253 esprimono in superficie i recettori TNFR1 e TNFR2 e che gli autoanticorpi anti-Ro e anti-La sono in grado di indurre la produzione di TNF-α nelle stesse cellule. Conclusioni: Il trattamento con gli autoanticorpi anti-Ro ed anti-La induce la produzione di TNF-α in cellule di ghiandole salivari umane e questo potrebbe spiegare la attivazione della via estrinseca della apoptosi.

  7. Bottom-up assembly of salivary gland microtissues for assessing myoepithelial cell function.

    Science.gov (United States)

    Ozdemir, Tugba; Srinivasan, Padma Pradeepa; Zakheim, Daniel R; Harrington, Daniel A; Witt, Robert L; Farach-Carson, Mary C; Jia, Xinqiao; Pradhan-Bhatt, Swati

    2017-10-01

    Myoepithelial cells are flat, stellate cells present in exocrine tissues including the salivary glands. While myoepithelial cells have been studied extensively in mammary and lacrimal gland tissues, less is known of the function of myoepithelial cells derived from human salivary glands. Several groups have isolated tumorigenic myoepithelial cells from cancer specimens, however, only one report has demonstrated isolation of normal human salivary myoepithelial cells needed for use in salivary gland tissue engineering applications. Establishing a functional organoid model consisting of myoepithelial and secretory acinar cells is therefore necessary for understanding the coordinated action of these two cell types in unidirectional fluid secretion. Here, we developed a bottom-up approach for generating salivary gland microtissues using primary human salivary myoepithelial cells (hSMECs) and stem/progenitor cells (hS/PCs) isolated from normal salivary gland tissues. Phenotypic characterization of isolated hSMECs confirmed that a myoepithelial cell phenotype consistent with that from other exocrine tissues was maintained over multiple passages of culture. Additionally, hSMECs secreted basement membrane proteins, expressed adrenergic and cholinergic neurotransmitter receptors, and released intracellular calcium [Ca 2+ i ] in response to parasympathetic agonists. In a collagen I contractility assay, activation of contractile machinery was observed in isolated hSMECs treated with parasympathetic agonists. Recombination of hSMECs with assembled hS/PC spheroids in a microwell system was used to create microtissues resembling secretory complexes of the salivary gland. We conclude that the engineered salivary gland microtissue complexes provide a physiologically relevant model for both mechanistic studies and as a building block for the successful engineering of the salivary gland for restoration of salivary function in patients suffering from hyposalivation. Copyright © 2017

  8. Near Infrared Optical Visualization of Epidermal Growth Factor Receptors Levels in COLO205 Colorectal Cell Line, Orthotopic Tumor in Mice and Human Biopsies

    Directory of Open Access Journals (Sweden)

    Philip Lazarovici

    2013-07-01

    Full Text Available In this study, we present the applicability of imaging epidermal growth factor (EGF receptor levels in preclinical models of COLO205 carcinoma cells in vitro, mice with orthotopic tumors and ex vivo colorectal tumor biopsies, using EGF-labeled with IRDye800CW (EGF-NIR. The near infrared (NIR bio-imaging of COLO205 cultures indicated specific and selective binding, reflecting EGF receptors levels. In vivo imaging of tumors in mice showed that the highest signal/background ratio between tumor and adjacent tissue was achieved 48 hours post-injection. Dissected colorectal cancer tissues from different patients demonstrated ex vivo specific imaging using the NIR bio-imaging platform of the heterogeneous distributed EGF receptors. Moreover, in the adjacent gastrointestinal tissue of the same patients, which by Western blotting was demonstrated as EGF receptor negative, no labeling with EGF-NIR probe was detected. Present results support the concept of tumor imaging by measuring EGF receptor levels using EGF-NIR probe. This platform is advantageous for EGF receptor bio-imaging of the NCI-60 recommended panel of tumor cell lines including 6–9 colorectal cell lines, since it avoids radioactive probes and is appropriate for use in the clinical setting using NIR technologies in a real-time manner.

  9. Resveratrol modulates MED28 (Magicin/EG-1) expression and inhibits epidermal growth factor (EGF)-induced migration in MDA-MB-231 human breast cancer cells.

    Science.gov (United States)

    Lee, Ming-Fen; Pan, Min-Hsiung; Chiou, Yi-Siou; Cheng, An-Chin; Huang, Han

    2011-11-09

    Resveratrol and pterostilbene exhibit diverse biological activities. MED28, a subunit of the mammalian Mediator complex for transcription, was also identified as magicin, an actin cytoskeleton Grb2-associated protein, and as endothelial-derived gene (EG-1). Several tumors exhibit aberrant MED28 expression, whereas the underlying mechanism is unclear. Triple-negative breast cancers, often expressing epidermal growth factor (EGF) receptor (EGFR), are associated with metastasis and poor survival. The objective of this study is to compare the effect of resveratrol and pterostilbene and to investigate the role of MED28 in EGFR-overexpressing MDA-MB-231 breast cancer cells. Pretreatment of resveratrol, but not pterostlbene, suppressed EGF-mediated migration and expression of MED28 and matrix metalloproteinase (MMP)-9 in MDA-MB-231 cells. Moreover, overexpression of MED28 increased migration, and the addition of EGF further enhanced migration. Our data indicate that resveratrol modulates the effect of MED28 on cellular migration, presumably through the EGFR/phosphatidylinositol 3-kinase (PI3K) signaling pathway, in breast cancer cells.

  10. Targeted Approaches Applied to Uncommon Diseases: A Case of Salivary Duct Carcinoma Metastatic to the Brain Treated with the Multikinase Inhibitor Neratinib

    Directory of Open Access Journals (Sweden)

    Karl R. Sorenson

    2017-08-01

    Full Text Available Salivary duct carcinoma is a rare malignancy associated with hormone receptor and human epidermal growth factor receptor 2 (HER2 overexpression. Local surgical control is the cornerstone of therapy, but a subset of patients develops metastatic disease portending a poor prognosis and limited management options. Intracranial metastases are an uncommon manifestation and present a therapeutic challenge. We report the case of a 31-year-old male who presented with facial pain and swelling subsequently diagnosed with salivary duct carcinoma. Our patient underwent extensive locoregional resection and analysis of the tumor tissue demonstrated evidence of androgen receptor expression and HER2 overexpression. His course was complicated by metastatic extra- and intracranial recurrence despite combined modality treatment with radiation and chemotherapy followed by anti-HER2 monoclonal antibody therapy and androgen deprivation therapy. After exhausting standard treatment options, he received experimental therapy with a new small-molecule tyrosine kinase inhibitor, neratinib, with evidence of a transient clinical response and no significant adverse effects. This case exemplifies the potential and limitations of targeted therapy, particularly when applied to patients with rare diseases and presentations.

  11. Targeted Approaches Applied to Uncommon Diseases: A Case of Salivary Duct Carcinoma Metastatic to the Brain Treated with the Multikinase Inhibitor Neratinib.

    Science.gov (United States)

    Sorenson, Karl R; Piovezani Ramos, Guilherme; Villasboas Bisneto, Jose Caetano; Price, Katharine

    2017-01-01

    Salivary duct carcinoma is a rare malignancy associated with hormone receptor and human epidermal growth factor receptor 2 (HER2) overexpression. Local surgical control is the cornerstone of therapy, but a subset of patients develops metastatic disease portending a poor prognosis and limited management options. Intracranial metastases are an uncommon manifestation and present a therapeutic challenge. We report the case of a 31-year-old male who presented with facial pain and swelling subsequently diagnosed with salivary duct carcinoma. Our patient underwent extensive locoregional resection and analysis of the tumor tissue demonstrated evidence of androgen receptor expression and HER2 overexpression. His course was complicated by metastatic extra- and intracranial recurrence despite combined modality treatment with radiation and chemotherapy followed by anti-HER2 monoclonal antibody therapy and androgen deprivation therapy. After exhausting standard treatment options, he received experimental therapy with a new small-molecule tyrosine kinase inhibitor, neratinib, with evidence of a transient clinical response and no significant adverse effects. This case exemplifies the potential and limitations of targeted therapy, particularly when applied to patients with rare diseases and presentations.

  12. Salivary flow and composition in diabetic and non-diabetic subjects.

    Science.gov (United States)

    Lasisi, T J; Fasanmade, A A

    2012-06-07

    The study investigated the effects of type 2 diabetes mellitus on salivary flow and composition in humans compared to healthy sex and age matched controls. Forty adult human subjects divided into 20 diabetic and 20 non-diabetic healthy subjects were included. Saliva samples were collected and analysed for glucose, total protein, calcium, sodium, potassium, chloride and bicarbonate. Salivary flow rate was also determined. The results showed that salivary glucose and potassium levels were significantly higher (p = 0.01 and 0.002 respectively) in diabetic patients compared with non-diabetic participants. It was also found that the diabetic patients had significant reduction in salivary flow rate when compared with non-diabetic individuals. In contrast, there was no significant difference in levels of total protein, Na+, Ca++, Cl- and HCO3- between the two groups. These results suggest that some oral diseases associated with diabetes mellitus may be due to altered levels of salivary glucose, potassium and flow.

  13. Isolation of a human anti-epidermal growth factor receptor Fab antibody, EG-19-11, with subnanomolar affinity from naïve immunoglobulin repertoires using a hierarchical antibody library system.

    Science.gov (United States)

    Hur, Byung-ung; Yoon, Jae-bong; Liu, Li-Kun; Cha, Sang-hoon

    2010-11-30

    Specific antibodies that possess a subnanomolar affinity are very difficult to obtain from human naïve immunoglobulin repertoires without the use of lengthy affinity optimization procedures. Here, we designed a hierarchical phage-displayed antibody library system to generate an enormous diversity of combinatorial Fab fragments (6×10(17)) and attempted to isolate high-affinity Fabs against the human epidermal growth factor receptor (EGFR). A primary antibody library, designated HuDVFab-8L, comprising 4.5×10(9) human naïve heavy chains and eight unspecified human naïve light chains was selected against the EGFR-Fc protein by biopanning, and four anti-EGFR Fab clones were isolated. Because one of the Fab clones, denoted EG-L2-11, recognized a native EGFR expressed on A431 cells, the heavy chain of the Fab was shuffled with a human naïve light chain repertoire with a diversity of 1.4×10(8) and selected a second time against the EGFR-Fc protein again. One EG-L2-11 variant, denoted EG-19-11, recognized an EGFR epitope that was almost the same as that bound by cetuximab and had a K(D) of approximately 540 pM for soluble EGFR, which is about 7-fold higher than that of the FabC225 derived from cetuximab. This variant was also internalized by A431 cells, likely via receptor-mediated endocytosis, and it efficiently inhibited EGF-mediated tyrosine phosphorylation of the EGFR. These results demonstrate that the use of our hierarchical antibody library system is advantageous in generating fully human antibodies especially with a therapeutic purpose. Copyright © 2010 Elsevier B.V. All rights reserved.

  14. Epidermal growth factor and growth in vivo

    International Nuclear Information System (INIS)

    Rhodes, J.A.

    1986-01-01

    Epidermal growth factor (EGF) causes a dose-dependent thickening of the epidermis in suckling mice. The cellular mechanisms underlying this thickening were analyzed by measuring the effect of EGF on the cell-cycle. Neonatal mice were given daily injections of either 2ug EGF/g body weight/day or an equivalent volume of saline, and on the seventh day received a single injection of 3 H-thymidine. At various times the mice were perfused with fixative; 1um sections of skin were stained with a modification of Harris' hematoxylin and were autoradiographed. The sections were analyzed using three methods based on the dependence on time after injection of 3 H-thymidine of: frequency of labelled mitoses, labelling index, and reciprocal grains/nucleus. It was found that EGF caused a two-fold increase in the cell production rate. The effect of exogenous EGF on the morphology of gastric mucosa and incisors of suckling mice was also studied. The gastric mucosa appeared thicker in EGF-treated animals, but the effect was not statistically significant. In contrast to its effect on epidermis and gastric mucosa, EGF caused a significant, dose-dependent decrease in the size of the incisors. Because the mouse submandibular salivary gland is the major source of EGF the effect of sialoadenectomy on female reproductive functions was examined. Ablation of the submandibular gland had no effect on: length of estrus cycle, ability of the female to produce litters, length of the gestation period, litter size, and weight of the litter at birth. There was also no effect on survival of the offspring or on age at which the eyelids separated

  15. Salivary pH, calcium, phosphorus and selected enzymes in healthy dogs: a pilot study.

    Science.gov (United States)

    Iacopetti, Ilaria; Perazzi, Anna; Badon, Tamara; Bedin, Silvia; Contiero, Barbara; Ricci, Rebecca

    2017-11-10

    Saliva in dogs, as in humans, is a complex fluid secreted by different salivary glands in the oral cavity to protect the oral mucosa and teeth. The use of saliva as a substitute for blood in diagnosing and prognosticating disease in humans is widely accepted. Salivary biochemistry has also been used as a marker for periodontal disease in humans. No studies have as yet investigated the relation between salivary biochemistry and periodontal disease in dogs, however; neither has the salivary composition of healthy dogs with no oral disease been assessed. The purpose of this study was to obtain an overview on pH distribution and a set of salivary biochemical analytes (calcium, phosphorus, lactate dehydrogenase, lysozyme and amylase) commonly related to oral health in humans in a subset population of healthy young dogs with no periodontal disease or previous oral disease. Data were analyzed to gather salivary reference ranges for pH and each parameter and to assess a possible correlation between salivary and serum analytes. Twenty-nine adult client-owned dogs were recruited for the study. Lactate dehydrogenase and lysozyme showed higher concentrations in saliva than in serum, whereas amylase showed the contrary. Salivary biochemistry values did not differ between males and females or between non-neutered and neutered individuals. No significant correlations between salivary and serum calcium, phosphorus, lactate dehydrogenase, amylase and lysozyme were identified in this study. Data allowed intervals for the salivary pH and other analytes investigated to be obtained from healthy dogs with healthy oral conditions. These preliminary data can contribute to enlarge our understanding of the functional role of saliva and its relation to oral health in dogs.

  16. Nanobacteria: An Infectious Cause for Salivary Stone Formation and Recurrence

    Directory of Open Access Journals (Sweden)

    Amr A El Badry

    2010-01-01

    Full Text Available Nanobacteria (NB contribute to pathological calcification in the human and animal body. It has been isolated from salivary stones and suggested that it may act as a nucleus for the initiation of these stones. In the present study, we examined its role in the recurrent salivary gland stones using immunodetection with NB-specific monoclonal antibodies and scanning electron microscopy (SEM hoping to provide a method for preventing the recurrence of these stones in the patient that has suffered from salivary stones. Our study comprised 30 patients with recurrent salivary gland stones (group I and 30 patients with salivary gland stones for the first time (group II, in addition to 30 normal controls (group III. We could detect 100–500 nm nanoparticles in 24/30 (80% cases in group I with significant difference <0.05 and <0.01 when compared with group II and group III in which they were detected in 19/30 (63.3% and 6/30 (20% respectively. Also there was a significant difference <0.05 between group II and group III. We proposed that salivary stone formation is a nanobacterial disease initiated by bacterial infection. This bacteria may play an important role in the recurrence of salivary stone. So the use of calcium chelator, ethylene diamine tetra acetic acid (EDTA, before or in combination with the suitable antibiotic that is given in an amount effective to inhibit or prevent the growth and development of nanobacteria may eradicate these stones and prevent their recurrence.

  17. Estimation of salivary glucose, salivary amylase, salivary total protein and salivary flow rate in diabetics in India.

    Science.gov (United States)

    Panchbhai, Arati S; Degwekar, Shirish S; Bhowte, Rahul R

    2010-09-01

    Diabetes is known to influence salivary composition and function, eventually affecting the oral cavity. We thus evaluated saliva samples for levels of glucose, amylase and total protein, and assessed salivary flow rate in diabetics and healthy non-diabetics. We also analyzed these parameters with regard to duration and type of diabetes mellitus and gender, and aimed to assess the interrelationships among the variables included in the study. A total of 120 age- and sex-matched participants were divided into 3 groups of 40 each; the uncontrolled diabetic group, the controlled diabetic group and the healthy non-diabetic group. Salivary investigations were performed using unstimulated whole saliva. Mean salivary glucose levels were found to be significantly elevated in both uncontrolled and controlled diabetics, as compared to healthy non-diabetics. There were significant decreases in mean salivary amylase levels in controlled diabetics when compared to healthy non-diabetics. Other than salivary glucose, no other parameters were found to be markedly affected in diabetes mellitus. Further research is needed to explore the clinical implications of these study results.

  18. Co-inhibition of epidermal growth factor receptor and insulin-like growth factor receptor 1 enhances radiosensitivity in human breast cancer cells

    International Nuclear Information System (INIS)

    Li, Ping; Veldwijk, Marlon R; Zhang, Qing; Li, Zhao-bin; Xu, Wen-cai; Fu, Shen

    2013-01-01

    Over-expression of epidermal growth factor receptor (EGFR) or insulin-like growth factor-1 receptor (IGF-1R) have been shown to closely correlate with radioresistance of breast cancer cells. This study aimed to investigate the impact of co-inhibition of EGFR and IGF-1R on the radiosensitivity of two breast cancer cells with different profiles of EGFR and IGF-1R expression. The MCF-7 (EGFR +/−, IGF-1R +++) and MDA-MB-468 (EGFR +++, IGF-1R +++) breast cancer cell lines were used. Radiosensitizing effects were determined by colony formation assay. Apoptosis and cell cycle distribution were measured by flow cytometry. Phospho-Akt and phospho-Erk1/2 were quantified by western blot. In vivo studies were conducted using MDA-MB-468 cells xenografted in nu/nu mice. In MDA-MB-468 cells, the inhibition of IGF-1R upregulated the p-EGFR expression. Either EGFR (AG1478) or IGF-1R inhibitor (AG1024) radiosensitized MDA-MB-468 cells. In MCF-7 cells, radiosensitivity was enhanced by AG1024, but not by AG1478. Synergistical radiosensitizing effect was observed by co-inhibition of EGFR and IGF-1R only in MDA-MB-468 cells with a DMF 10% of 1.90. The co-inhibition plus irradiation significantly induced more apoptosis and arrested the cells at G0/G1 phase in MDA-MB-468 cells. Only co-inhibition of EGFR and IGF-1R synergistically diminished the expression of p-Akt and p-Erk1/2 in MDA-MB-468 cells. In vivo studies further verified the radiosensitizing effects by co-inhibition of both pathways in a MDA-MB-468 xenograft model. Our data suggested that co-inhibition of EGFR and IGF-1R synergistically radiosensitized breast cancer cells with both EGFR and IGF-1R high expression. The approach may have an important therapeutic implication in the treatment of breast cancer patients with high expression of EGFR and IGF-1R

  19. AUTOIMMUNE EPIDERMAL BLISTERING DISEASES

    Directory of Open Access Journals (Sweden)

    Ana Maria Abreu Velez

    2013-11-01

    Full Text Available Autoimmune bullous skin diseases (ABDs are uncommon, potentially fatal diseases of skin and mucous membranes which are associated with deposits of autoantibodies and complement against distinct molecules of the epidermis and dermal/epidermal basement membrane zone (BMZ. These autoantibodies lead to a loss in skin molecular integrity, which manifests clinically as formation of blisters or erosions. In pemphigus vulgaris, loss of adhesion occurs within the epidermis. The pioneering work of Ernst H. Beutner, Ph.D. and Robert E. Jordon, M.D. confirmed the autoimmune nature of these diseases. Walter F. Lever, M.D. contributed significantly to our understanding of the histopathologic features of these diseases. Walter Lever, M.D. and Ken Hashimoto, M.D. contributed electron microscopic studies of these diseases, especially in pemphigus vulgaris and bullous pemphigoid. In bullous pemphigoid (BP, linear IgA bullous dermatosis, epidermolysis bullosa acquisita (EBA and dermatitis herpetiformis (DH, loss of adhesion takes place within or underneath the BMZ. Classic EBA demonstrates extensive skin fragility; DH is commonly associated with gluten-sensitive enteropathy, and manifests clinically with pruritic papulovesicles on the extensor surfaces of the extremities and the lumbosacral area. The clinical spectrum of bullous pemphigoid includes tense blisters, urticarial plaques, and prurigo-like eczematous lesions. Pemphigoid gestationis mostly occurs during the last trimester of pregnancy, and mucous membrane pemphigoid primarily involves the oral mucosa and conjunctivae and leads to scarring. Linear IgA bullous dermatosis manifests with tense blisters in a „cluster of jewels”-like pattern in childhood (chronic bullous disease of childhood and is more clinically heterogeneous in adulthood. Many of the autoantigens in these disorders are known and have been well characterized. ABDs may be influenced by both genetic and exogenous factors. The diagnoses of

  20. Salivary cytokine levels in early gingival inflammation

    DEFF Research Database (Denmark)

    Belstrøm, Daniel; Damgaard, Christian; Könönen, Eija

    2017-01-01

    Salivary protein levels have been studied in periodontitis. However, there is lack of information on salivary cytokine levels in early gingival inflammation. The aim of this study was to determine salivary levels of vascular endothelial growth factor (VEGF), interleukin (IL)-8, monocyte chemoattr......Salivary protein levels have been studied in periodontitis. However, there is lack of information on salivary cytokine levels in early gingival inflammation. The aim of this study was to determine salivary levels of vascular endothelial growth factor (VEGF), interleukin (IL)-8, monocyte...

  1. Oral mucosa: an alternative epidermic cell source to develop autologous dermal-epidermal substitutes from diabetic subjects

    Directory of Open Access Journals (Sweden)

    Daniela GUZMÁN-URIBE

    Full Text Available Abstract Oral mucosa has been highlighted as a suitable source of epidermal cells due to its intrinsic characteristics such as its higher proliferation rate and its obtainability. Diabetic ulcers have a worldwide prevalence that is variable (1%-11%, meanwhile treatment of this has been proven ineffective. Tissue-engineered skin plays an important role in wound care focusing on strategies such autologous dermal-epidermal substitutes. Objective The aim of this study was to obtain autologous dermal-epidermal skin substitutes from oral mucosa from diabetic subjects as a first step towards a possible clinical application for cases of diabetic foot. Material and Methods Oral mucosa was obtained from diabetic and healthy subjects (n=20 per group. Epidermal cells were isolated and cultured using autologous fibrin to develop dermal-epidermal in vitro substitutes by the air-liquid technique with autologous human serum as a supplement media. Substitutes were immunocharacterized with collagen IV and cytokeratin 5-14 as specific markers. A Student´s t- test was performed to assess the differences between both groups. Results It was possible to isolate epidermal cells from the oral mucosa of diabetic and healthy subjects and develop autologous dermal-epidermal skin substitutes using autologous serum as a supplement. Differences in the expression of specific markers were observed and the cytokeratin 5-14 expression was lower in the diabetic substitutes, and the collagen IV expression was higher in the diabetic substitutes when compared with the healthy group, showing a significant difference. Conclusion Cells from oral mucosa could be an alternative and less invasive source for skin substitutes and wound healing. A difference in collagen production of diabetic cells suggests diabetic substitutes could improve diabetic wound healing. More research is needed to determine the crosstalk between components of these skin substitutes and damaged tissues.

  2. Phase II Study of Neoadjuvant Anthracycline-Based Regimens Combined With Nanoparticle Albumin-Bound Paclitaxel and Trastuzumab for Human Epidermal Growth Factor Receptor 2-Positive Operable Breast Cancer.

    Science.gov (United States)

    Tanaka, Satoru; Iwamoto, Mitsuhiko; Kimura, Kosei; Matsunami, Nobuki; Morishima, Hirotaka; Yoshidome, Katsuhide; Nomura, Takashi; Morimoto, Takashi; Yamamoto, Daigo; Tsubota, Yu; Kobayashi, Toshihiro; Uchiyama, Kazuhisa

    2015-06-01

    We treated patients with operable human epidermal growth factor receptor 2-positive breast cancer with neoadjuvant anthracycline regimens followed by nanoparticle albumin-bound paclitaxel plus trastuzumab. Of the 44 patients, 49% achieved a pathologic complete response (pCR). The pCR rate was 36% and 71% in the patients with estrogen receptor-positive and -negative cancer, respectively. Neoadjuvant therapy using this combination appears to be effective and safe. Introduction: Neoadjuvant chemotherapy plus trastuzumab. Neoadjuvant chemotherapy plus trastuzumab results in a 30% to 50% pathologic complete response (pCR) rate in human epidermal growth factor receptor 2 (HER2)-positive breast cancer and has been associated with improved therapeutic outcomes. Thus, the pCR rate can be useful in evaluating novel agents in this patient population. Nanoparticle albumin-bound (nab)-paclitaxel (PTX) can reduce the toxicity of PTX while maintaining its efficacy. The present study evaluated the activity and safety of nab-PTX as a neoadjuvant treatment of HER2(+) breast cancer. We treated patients with stage I to IIIA breast cancer using neoadjuvant epirubicin/cyclophosphamide (EC) or 5-fluorouracil/epirubicin/cyclophosphamide every 3 weeks (q3w) for 4 cycles, followed by nab-PTX (260 mg/m(2)) plus trastuzumab q3w for 4 cycles. The primary endpoint was the pCR rate. The secondary endpoints included the clinical response rate, disease-free survival, pathologic response rate (defined as pCR or minimal residual invasive disease only in the breast), breast-conserving surgery rate, and safety. Forty-six patients were enrolled. One patient met the exclusion criteria because of the coexistence of another malignant disease; therefore, we evaluated 45 patients in the entire study. One patient experienced rapid disease progression during EC therapy, leaving 44 patients evaluable for nab-PTX treatment. Of the 45 patients, 49% achieved a pCR. The pCR rate was 36% and 71% in those with

  3. Temporal Stability of the Salivary Microbiota in Oral Health

    DEFF Research Database (Denmark)

    Belstrøm, Daniel; Holmstrup, Palle; Jensen, Allan Bardow

    2016-01-01

    OBJECTIVES: Saliva is a biological fluid suitable for biomarker analysis, and differences in the salivary microbiota in oral health and disease have been reported. For such comparative analyses, time of sampling is critical since the bacterial composition may vary throughout the day, i.e., diurnal...... person, n = 12, total number of samples, n = 60). Salivary microbiota was analyzed using the Human Oral Microbe Identification using Next Generation Sequencing (HOMINGS), and statistical analysis was performed using the Kruskal-Wallis test with Benjamini-Hochberg's correction for multiple comparisons...

  4. Impact of Oral Hygiene Discontinuation on Supragingival and Salivary Microbiomes

    DEFF Research Database (Denmark)

    Belstrøm, D; Sembler-Møller, M L; Grande, M A

    2018-01-01

    of oral hygiene. Supragingival and salivary microbiotas were processed by next-generation sequencing (Human Oral Microbe Identification using Next Generation Sequencing) and microbial community profiles were compared. Microbial composition of supragingival plaque samples collected after 4, 7, and 10 d......The purpose of the present study was to characterize and compare supragingival and salivary microbiotas during a 10-d period of oral hygiene discontinuation. We tested the hypothesis that the composition of the salivary microbiota will reflect local microbial changes associated with accumulated...... biofilm formation and maturation. Pooled supragingival plaque (n = 145) and stimulated saliva (n = 145) samples were collected and plaque and gingival indices were recorded from 29 orally healthy individuals at baseline, during oral hygiene discontinuation (days 4, 7, and 10), and 14 d after resumption...

  5. Influence of periodontal treatment on subgingival and salivary microbiotas

    DEFF Research Database (Denmark)

    Belstrøm, Daniel; Grande, Maria Anastasia; Sembler-Møller, Maria Lynn

    2018-01-01

    BACKGROUND: The purpose of this study was to characterize and compare subgingival and salivary microbiotas before and after periodontal treatment to learn if any changes of the subgingival microbiota were reflected in saliva. We tested the hypothesis that salivary levels of specific periopathogens...... correlate with corresponding subgingival levels before and after periodontal treatment. METHODS: Twenty-five patients with generalized chronic periodontitis completed the study. Stimulated saliva samples and subgingival plaque samples were collected at baseline and 2, 6 and 12 weeks after non......-surgical periodontal therapy. Subgingival and salivary microbiotas were processed by means of the Human Oral Microbe Next Generation Sequencing (HOMINGS) technique, and characterized based on relative abundance. Spearman signed rank test was used to test correlation of periopathogens in subgingival and saliva samples...

  6. Neonatal hyperthyroidism impairs epinephrine-provoked secretion of nerve growth factor and epidermal growth factor in mouse saliva.

    Science.gov (United States)

    Lakshmanan, J; Landel, C P

    1986-07-01

    We examined long-term effects of neonatal hyperthyroidism on salivary secretions of nerve growth factor and epidermal growth factor in male and female mice at the age of 31 days. Hyperthyroidism was induced by thyroxine (T4) injections (0.4 microgram/g body weight/day) during days 0-6. Littermate control mice were treated with vehicle. T4 treatment did not alter the amounts of protein secreted into saliva but hormone administration induced alteration in the types of protein secreted. T4 treatment decreased the contents of both nerve growth factor and epidermal growth factor secreted into the saliva. A Sephadex G-200 column chromatographic profile revealed the presence of two distinct nerve growth factor immunoreactive peaks, while epidermal growth factor immunoreactivity predominantly eluted as a single low molecular weight form. T4 treatment did not alter the molecular nature of their secretion, but the treatment decreased their contents. These results indicate an impairment in salivary secretion of nerve growth factor and epidermal growth factor long after T4 treatment has been discontinued.

  7. New Approaches towards the Elucidation of Epidermal-Dermal Separation in Sulfur Mustard-Exposed Human Skin and Directions for Therapy

    National Research Council Canada - National Science Library

    Mol, Marijke

    2005-01-01

    .... Results of experiments with a human skin ex vivo model show that apoptosis and metalloprotease activity are key elements in HD-induced skin pathogenesis, and that intervention in these two processes...

  8. The cell-penetrating peptide domain from human heparin-binding epidermal growth factor-like growth factor (HB-EGF) has anti-inflammatory activity in vitro and in vivo

    International Nuclear Information System (INIS)

    Lee, Jue-Yeon; Seo, Yoo-Na; Park, Hyun-Jung; Park, Yoon-Jeong; Chung, Chong-Pyoung

    2012-01-01

    Highlights: ► HBP sequence identified from HB-EGF has cell penetration activity. ► HBP inhibits the NF-κB dependent inflammatory responses. ► HBP directly blocks phosphorylation and degradation of IκBα. ► HBP inhibits nuclear translocation of NF-κB p65 subunit. -- Abstract: A heparin-binding peptide (HBP) sequence from human heparin-binding epidermal growth factor-like growth factor (HB-EGF) was identified and was shown to exhibit cell penetration activity. This cell penetration induced an anti-inflammatory reaction in lipopolysaccharide (LPS)-treated RAW 264.7 macrophages. HBP penetrated the cell membrane during the 10 min treatment and reduced the LPS-induced production of nitric oxide (NO), inducible nitric oxide synthase (iNOS), and cytokines (TNF-α and IL-6) in a concentration-dependent manner. Additionally, HBP inhibited the LPS-induced upregulation of cytokines, including TNF-α and IL-6, and decreased the interstitial infiltration of polymorphonuclear leukocytes in a lung inflammation model. HBP inhibited NF-κB-dependent inflammatory responses by directly blocking the phosphorylation and degradation of IκBα and by subsequently inhibiting the nuclear translocation of the p65 subunit of NF-κB. Taken together, this novel HBP may be potentially useful candidate for anti-inflammatory treatments and can be combined with other drugs of interest to transport attached molecules into cells.

  9. Clinical Usefulness of a One-Tube Nested Reverse Transcription Quantitative Polymerase Chain Reaction Assay for Evaluating Human Epidermal Growth Factor Receptor 2 mRNA Overexpression in Formalin-Fixed and Paraffin-Embedded Breast Cancer Tissue Samples.

    Science.gov (United States)

    Wang, Hye-Young; Ahn, Sungwoo; Park, Sunyoung; Kim, SeungIl; Lee, Hyeyoung

    2017-01-01

    Currently, the two main methods used to analyze human epidermal growth factor receptor 2 (HER2) amplification or overexpression have a limited accuracy and high costs. These limitations can be overcome by the development of complementary quantitative methods. In this study, we analyzed HER2 mRNA expression in clinical formalin-fixed and paraffin-embedded (FFPE) samples using a one-tube nested reverse transcription quantitative polymerase chain reaction (RT-qPCR) assay. We measured expression relative to 3 reference genes and compared the results to those obtained by conventional immunohistochemistry (IHC) and fluorescence in situ hybridization (FISH) assays with 226 FFPE breast cancer tissue samples. The one-tube nested RT-qPCR assay proved to be highly sensitive and specific based on comparisons with IHC (96.9 and 97.7%, respectively) and FISH (92.4 and 92.9%, respectively) obtained with the validation set. Comparisons with clinicopathological data revealed significant associations between HER2 overexpression and TNM stage (p < 0.01), histological type (p < 0.01), ER status (p < 0.001), PR status (p < 0.05), HER2 status (p < 0.001), and molecular subtypes (p < 0.001). Based on these findings, our one-tube nested RT-qPCR assay is a potentially useful and complementary screening tool for the detection of HER2 mRNA overexpression. © 2016 S. Karger AG, Basel.

  10. Ultraviolet B, melanin and mitochondrial DNA: Photo-damage in human epidermal keratinocytes and melanocytes modulated by alpha-melanocyte-stimulating hormone [version 1; referees: 2 approved

    Directory of Open Access Journals (Sweden)

    Markus Böhm

    2016-05-01

    Full Text Available Alpha-melanocyte-stimulating hormone (alpha-MSH increases melanogenesis and protects from UV-induced DNA damage. However, its effect on mitochondrial DNA (mtDNA damage is unknown. We have addressed this issue in a pilot study using human epidermal keratinocytes and melanocytes incubated with alpha-MSH and irradiated with UVB. Real-time touchdown PCR was used to quantify total and deleted mtDNA. The deletion detected encompassed the common deletion but was more sensitive to detection. There were 4.4 times more mtDNA copies in keratinocytes than in melanocytes. Irradiation alone did not affect copy numbers. Alpha-MSH slightly increased copy numbers in both cell types in the absence of UVB and caused a similar small decrease in copy number with dose in both cell types. Deleted copies were nearly twice as frequent in keratinocytes as in melanocytes. Alpha-MSH reduced the frequency of deleted copies by half in keratinocytes but not in melanocytes. UVB dose dependently led to an increase in the deleted copy number in alpha-MSH-treated melanocytes. UVB irradiation had little effect on deleted copy number in alpha-MSH-treated keratinocytes. In summary, alpha-MSH enhances mtDNA damage in melanocytes presumably by increased melanogenesis, while α-MSH is protective in keratinocytes, the more so in the absence of irradiation.

  11. Prospective study of the impact of the Prosigna assay on adjuvant clinical decision-making in unselected patients with estrogen receptor positive, human epidermal growth factor receptor negative, node negative early-stage breast cancer.

    Science.gov (United States)

    Martín, Miguel; González-Rivera, Milagros; Morales, Serafín; de la Haba-Rodriguez, Juan; González-Cortijo, Lucía; Manso, Luis; Albanell, Joan; González-Martín, Antonio; González, Sónia; Arcusa, Angels; de la Cruz-Merino, Luis; Rojo, Federico; Vidal, María; Galván, Patricia; Aguirre, Elena; Morales, Cristina; Ferree, Sean; Pompilio, Kristen; Casas, Maribel; Caballero, Rosalía; Goicoechea, Uxue; Carrasco, Eva; Michalopoulos, Steven; Hornberger, John; Prat, Aleix

    2015-06-01

    Improved understanding of risk of recurrence (ROR) is needed to reduce cases of recurrence and more effectively treat breast cancer patients. The purpose of this study was to examine how a gene-expression profile (GEP), identified by Prosigna, influences physician adjuvant treatment selection for early breast cancer (EBC) and the effects of this influence on optimizing adjuvant treatment recommendations in clinical practice. A prospective, observational, multicenter study was carried out in 15 hospitals across Spain. Participating medical oncologists completed pre-assessment, post-assessment, and follow-up questionnaires recording their treatment recommendations and confidence in these recommendations, before and after knowing the patient's ROR. Patients completed questionnaires on decision-making, anxiety, and health status. Between June 2013 and January 2014, 217 patients enrolled and a final 200 were included in the study. Patients were postmenopausal, estrogen receptor positive, human epidermal growth hormone factor negative, and node negative with either stage 1 or stage 2 tumors. After receiving the GEP results, treatment recommendations were changed for 40 patients (20%). The confidence of medical oncologists in their treatment recommendations increased in 41.6% and decreased in 6.5% of total cases. Patients reported lower anxiety after physicians made treatment recommendations based on the GEP results (p anxiety about the selected adjuvant therapy decreased with use of the GEP.

  12. Night work and breast cancer risk defined by human epidermal growth factor receptor-2 (HER2) and hormone receptor status: A population-based case-control study in France.

    Science.gov (United States)

    Cordina-Duverger, Emilie; Koudou, Yves; Truong, Thérèse; Arveux, Patrick; Kerbrat, Pierre; Menegaux, Florence; Guénel, Pascal

    Night work has been associated with risk of breast cancer but this association needs to be confirmed. Because breast cancer is an etiologically heterogeneous disease, we explored the association of night work with breast cancer subtypes defined by tumor status (positive of negative) for estrogen-receptor (ER), progesterone-receptor (PR) and human epidermal growth factor-receptor 2 (HER2). Using the data from a case-control study in France including 975 cases and 1317 controls, we found that the odds ratios for ER+, PR+ or HER2+ breast cancers subtypes were significantly elevated, while no association with night shift work was observed for ER, PR or HER2-negative tumors. After stratification by menopausal status, the associations of night work with receptor-positive breast tumor subtypes were clearly seen in premenopausal women (odds ratios 2.04, 1.98 and 2.80, respectively) but did not appear in postmenopausal women. This study provides evidence that working at night may increase risk of ER, PR and HER2-positive subtypes of breast cancer particularly among premenopausal women.

  13. Biological Markers and Salivary Cortisol

    DEFF Research Database (Denmark)

    Hansen, Åse Marie; Gunnarsson, Lars-Gunnar; Harris, Anette

    2011-01-01

    This chapter focuses on salivary cortisol in relation to biological markers. Specifically, associations with conventional cardiovascular risk factors and metabolic abnormalities (body mass index, waist circumference, waist/hip ratio, lipid status, glucose, blood pressure, heart rate and heart rate...... variations and pharmacological interventions were also excluded. After meeting all exclusion criteria, 42 papers remained. In total, 273 associations between salivary cortisol and any of the markers mentioned were studied, comprising 241 associations on metabolic abnormalities, 30 on inflammation, and 2...... on stress hormones. Of the salivary cortisol measures reported for evaluations of all markers tested were 136 (49%) single time points, 100 (37%) deviations, 36 (13%) AUC, and 1 (1%) dexamethasone test. Of these, 72 (26%) were statistically significant, and 201 (74%) indicated non-significant findings...

  14. Cortactin overexpression results in sustained epidermal growth factor receptor signaling by preventing ligand-induced receptor degradation in human carcinoma cells

    NARCIS (Netherlands)

    van Rossum, AGSH; Gibcus, J; van der Wal, J; Schuuring, E

    2005-01-01

    The chromosome 11q13 region is frequently amplified in human carcinomas and results in an increased expression of various genes including cortactin, and is also associated with an increased invasive potential. Cortactin acts as an important regulator of the actin cytoskeleton. It is therefore very

  15. Curative Metatarsal Bone Surgery Combined with Intralesional Administration of Recombinant Human Epidermal Growth Factor in Diabetic Neuropathic Ulceration of the Forefoot: A Prospective, Open, Uncontrolled, Nonrandomized, Observational Study

    Directory of Open Access Journals (Sweden)

    Aristides L. Garcia Herrera, MD, PhD

    2017-01-01

    Conclusions: The combination of curative metatarsal bone surgery with intralesional administration of recombinant human EGF resulted in a significant reduction in the re-epithelization time, recidivism, and development of new diabetic lesions. The safety profile was appropriate. However, more randomized, triple-blind, and placebo trials are needed to evaluate the efficacy and safety of this new therapy.

  16. Evolution of dinosaur epidermal structures.

    Science.gov (United States)

    Barrett, Paul M; Evans, David C; Campione, Nicolás E

    2015-06-01

    Spectacularly preserved non-avian dinosaurs with integumentary filaments/feathers have revolutionized dinosaur studies and fostered the suggestion that the dinosaur common ancestor possessed complex integumentary structures homologous to feathers. This hypothesis has major implications for interpreting dinosaur biology, but has not been tested rigorously. Using a comprehensive database of dinosaur skin traces, we apply maximum-likelihood methods to reconstruct the phylogenetic distribution of epidermal structures and interpret their evolutionary history. Most of these analyses find no compelling evidence for the appearance of protofeathers in the dinosaur common ancestor and scales are usually recovered as the plesiomorphic state, but results are sensitive to the outgroup condition in pterosaurs. Rare occurrences of ornithischian filamentous integument might represent independent acquisitions of novel epidermal structures that are not homologous with theropod feathers. © 2015 The Author(s) Published by the Royal Society. All rights reserved.

  17. Epidermal Growth Factor Cytoplasmic Domain Affects ErbB Protein Degradation by the Lysosomal and Ubiquitin-Proteasome Pathway in Human Cancer Cells

    Directory of Open Access Journals (Sweden)

    Aleksandra Glogowska

    2012-05-01

    Full Text Available The cytoplasmic domains of EGF-like ligands, including EGF cytoplasmic domain (EGFcyt, have important biological functions. Using specific constructs and peptides of human EGF cytoplasmic domain, we demonstrate that EGFcyt facilitates lysosomal and proteasomal protein degradation, and this coincided with growth inhibition of human thyroid and glioma carcinoma cells. EGFcyt and exon 22–23-encoded peptide (EGF22.23 enhanced procathepsin B (procathB expression and procathB-mediated lysosomal degradation of EGFR/ErbB1 as determined by inhibitors for procathB and the lysosomal ATPase inhibitor BafA1. Presence of mbEGFctF, EGFcyt, EGF22.23, and exon 23-encoded peptides suppressed the expression of the deubiqitinating enzyme ubiquitin C-terminal hydrolase-L1 (UCH-L1. This coincided with hyperubiquitination of total cellular proteins and ErbB1/2 and reduced proteasome activity. Upon small interfering RNA-mediated silencing of endogenously expressed UCH-L1, a similar hyperubiquitinylation phenotype, reduced ErbB1/2 content, and attenuated growth was observed. The exon 23-encoded peptide region of EGFcyt was important for these biologic actions. Structural homology modeling of human EGFcyt showed that this molecular region formed an exposed surface loop. Peptides derived from this EGFcyt loop structure may aid in the design of novel peptide therapeutics aimed at inhibiting growth of cancer cells.

  18. Ultrastructure of the salivary glands in Lithobius forficatus (Myriapoda, Chilopoda, Lithobiidae) according to seasonal and circadian rhythms.

    Science.gov (United States)

    Kamińska, K; Włodarczyk, A; Sonakowska, L; Ostróżka, A; Marchewka, A; Rost-Roszkowska, M

    2016-11-01

    The salivary glands (mandibular epidermal glands) of adult males and females of Lithobius forficatus (Myriapoda, Chilopoda) were isolated during spring, summer and autumn. In addition, the organs were isolated at different times of the day - at about 12:00 (noon) and about 00:00 (midnight). The ultrastructure of these organs depending on seasonal and circadian rhythms was analyzed using transmission and scanning electron microscopy and histochemical methods. The paired salivary glands of L. forficatus are situated in the vicinity of the foregut and they are formed by numerous acini that are surrounded by the fat body, hemocytes and tracheolae. The salivary glands are composed of a terminal acinar component and a system of tubular ducts that are lined with a cuticle. The glandular part is composed of secretory epithelial cells that are at various stages of their secretory activity. The saliva that is produced by the secretory cells of the acini is secreted into the salivary ducts, which are lined with a simple epithelium that is based on the non-cellular basal lamina. The ultrastructural variations suggest that salivary glands function differently depending on seasonal rhythms and prepare the animal for overwintering. Therefore, the salivary glands of the centipedes that were analyzed participate in the accumulation of proteins, lipids and polysaccharides during the spring, summer and autumn. Subtle differences in the ultrastructure of the secretory cells of the salivary glands during the circadian cycle must be related to the physiological reactions of the organism. The salivary ducts showed no differences in the specimens that were analyzed during the day/night cycle or during the seasonal cycle. Copyright © 2016 Elsevier Ltd. All rights reserved.

  19. Biochemistry of epidermal stem cells.

    Science.gov (United States)

    Eckert, Richard L; Adhikary, Gautam; Balasubramanian, Sivaprakasam; Rorke, Ellen A; Vemuri, Mohan C; Boucher, Shayne E; Bickenbach, Jackie R; Kerr, Candace

    2013-02-01

    The epidermis is an important protective barrier that is essential for maintenance of life. Maintaining this barrier requires continuous cell proliferation and differentiation. Moreover, these processes must be balanced to produce a normal epidermis. The stem cells of the epidermis reside in specific locations in the basal epidermis, hair follicle and sebaceous glands and these cells are responsible for replenishment of this tissue. A great deal of effort has gone into identifying protein epitopes that mark stem cells, in identifying stem cell niche locations, and in understanding how stem cell populations are related. We discuss these studies as they apply to understanding normal epidermal homeostasis and skin cancer. An assortment of stem cell markers have been identified that permit assignment of stem cells to specific regions of the epidermis, and progress has been made in understanding the role of these cells in normal epidermal homeostasis and in conditions of tissue stress. A key finding is the multiple stem cell populations exist in epidermis that give rise to different structures, and that multiple stem cell types may contribute to repair in damaged epidermis. Understanding epidermal stem cell biology is likely to lead to important therapies for treating skin diseases and cancer, and will also contribute to our understanding of stem cells in other systems. This article is part of a Special Issue entitled Biochemistry of Stem Cells. Copyright © 2012 Elsevier B.V. All rights reserved.

  20. Biochemistry of epidermal stem cells☆

    Science.gov (United States)

    Eckert, Richard L.; Adhikary, Gautam; Balasubramanian, Sivaprakasam; Rorke, Ellen A.; Vemuri, Mohan C.; Boucher, Shayne E.; Bickenbach, Jackie R.; Kerr, Candace

    2014-01-01

    Background The epidermis is an important protective barrier that is essential for maintenance of life. Maintaining this barrier requires continuous cell proliferation and differentiation. Moreover, these processes must be balanced to produce a normal epidermis. The stem cells of the epidermis reside in specific locations in the basal epidermis, hair follicle and sebaceous glands and these cells are responsible for replenishment of this tissue. Scope of review A great deal of effort has gone into identifying protein epitopes that mark stem cells, in identifying stem cell niche locations, and in understanding how stem cell populations are related. We discuss these studies as they apply to understanding normal epidermal homeostasis and skin cancer. Major conclusions An assortment of stem cell markers have been identified that permit assignment of stem cells to specific regions of the epidermis, and progress has been made in understanding the role of these cells in normal epidermal homeostasis and in conditions of tissue stress. A key finding is the multiple stem cell populations exist in epidermis that give rise to different structures, and that multiple stem cell types may contribute to repair in damaged epidermis. General significance Understanding epidermal stem cell biology is likely to lead to important therapies for treating skin diseases and cancer, and will also contribute to our understanding of stem cells in other systems. This article is part of a Special Issue entitled Biochemistry of Stem Cells. PMID:22820019

  1. Chewing behavior and salivary secretion

    NARCIS (Netherlands)

    Gaviao, MBD; Engelen, L

    We determined the salivary flow rate in 16 healthy subjects in rest and while chewing artificial and natural foods (Parafilm, Melba toast with and without margarine, and three different volumes of breakfast cake and cheese). We also determined the duration of a chewing cycle, the number of chewing

  2. Chitosan adsorption to salivary pellicles

    NARCIS (Netherlands)

    van der Mei, Henderina; Engels, Eefje; de Vries, Jacob; Dijkstra, Rene JB; Busscher, Hendrik

    The salivary pellicle is a negatively charged protein film, to which oral bacteria readily adhere. Chitosans are cationic biomolecules with known antimicrobial properties that can be modified in different ways to enhance its antimicrobial activity. Here, we determined the changes in surface chemical

  3. Epidermal Growth Factor Receptor in Pancreatic Cancer

    International Nuclear Information System (INIS)

    Oliveira-Cunha, Melissa; Newman, William G.; Siriwardena, Ajith K.

    2011-01-01

    Pancreatic cancer is the fourth leading cause of cancer related death. The difficulty in detecting pancreatic cancer at an early stage, aggressiveness and the lack of effective therapy all contribute to the high mortality. Epidermal growth factor receptor (EGFR) is a transmembrane glycoprotein, which is expressed in normal human tissues. It is a member of the tyrosine kinase family of growth factors receptors and is encoded by proto-oncogenes. Several studies have demonstrated that EGFR is over-expressed in pancreatic cancer. Over-expression correlates with more advanced disease, poor survival and the presence of metastases. Therefore, inhibition of the EGFR signaling pathway is an attractive therapeutic target. Although several combinations of EGFR inhibitors with chemotherapy demonstrate inhibition of tumor-induced angiogenesis, tumor cell apoptosis and regression in xenograft models, these benefits remain to be confirmed. Multimodality treatment incorporating EGFR-inhibition is emerging as a novel strategy in the treatment of pancreatic cancer

  4. In vivo anticancer evaluation of the hyperthermic efficacy of anti-human epidermal growth factor receptor-targeted PEG-based nanocarrier containing magnetic nanoparticles

    Directory of Open Access Journals (Sweden)

    Baldi G

    2014-06-01

    Full Text Available Giovanni Baldi,1 Costanza Ravagli,1 Filippo Mazzantini,1 George Loudos,2 Jaume Adan,3 Marc Masa,3 Dimitrios Psimadas,2 Eirini A Fragogeorgi,2 Erica Locatelli,4 Claudia Innocenti,5,6 Claudio Sangregorio,5,7 Mauro Comes Franchini4 1CERICOL, Sovigliana-Vinci, Italy; 2Technological Educational Institute of Athens, Athens, Greece; 3Leitat Technological Center, Barcelona, Spain; 4Department of Industrial Chemistry Toso Montanari, University of Bologna, Bologna, 5Consorzio Interuniversitario Nazionale per la Scienza e Tecnologia dei Materiali (INSTM, 6Dipartimento di Chimica U Schiff, Università di Firenze, Firenze, 7Centro Nazionale delle Ricerche (ICCOM – CNR, Firenze, Italy Abstract: Polymeric nanoparticles with targeting moieties containing magnetic nanoparticles as theranostic agents have considerable potential for the treatment of cancer. Here we report the chemical synthesis and characterization of a poly(D,L-lactide-co-glycolide-b-poly(ethylene glycol-based nanocarrier containing iron oxide nanoparticles and human epithelial growth factor receptor on the outer shell. The nanocarrier was also radiolabeled with 99mTc and tested as a theranostic nanomedicine, ie, it was investigated for both its diagnostic ability in vivo and its therapeutic hyperthermic effects in a standard A431 human tumor cell line. Following radiolabeling with 99mTc, the biodistribution and therapeutic hyperthermic effects of the nanosystem were studied noninvasively in vivo in tumor-bearing mice. A substantial decrease in tumor size correlated with an increase in both nanoparticle concentration and local temperature was achieved, confirming the possibility of using this multifunctional nanosystem as a therapeutic tool for epidermoid carcinoma. Keywords: magnetic nanoparticles, polymeric nanocarriers, skin cancer, hyperthermia, single-photon emission computed tomography, imaging

  5. Clinical effects of prior trastuzumab on combination eribulin mesylate plus trastuzumab as first-line treatment for human epidermal growth factor receptor 2 positive locally recurrent or metastatic breast cancer: results from a Phase II, single-arm, multicenter study

    Directory of Open Access Journals (Sweden)

    Puhalla S

    2016-12-01

    Full Text Available Shannon Puhalla,1 Sharon Wilks,2 Adam M Brufsky,1 Joyce O’Shaughnessy,3 Lee S Schwartzberg,4 Erhan Berrak,5 James Song,5 Linda Vahdat6 1Department of Hematology and Oncology, University of Pittsburgh Medical Center, Pittsburgh, PA, 2Department of Hematology Oncology, US Oncology-Cancer Care Centers of South Texas, San Antonio, TX, 3Department of Medical Oncology, Texas Oncology-Baylor Charles A. Sammons Cancer Center US Oncology, Dallas, TX, 4Department of Hematology/Oncology, West Cancer Center, University of Tennessee Health Science Center, Memphis, TN, 5Department of Medical Affairs, Formerly of Eisai Inc., Woodcliff Lake, NJ, 6Department of Medicine, Weill Cornell Medical College, New York, NY, USA Abstract: Eribulin mesylate, a novel nontaxane microtubule dynamics inhibitor in the halichondrin class of antineoplastic drugs, is indicated for the treatment of patients with metastatic breast cancer who previously received ≥2 chemotherapy regimens in the metastatic setting. Primary data from a Phase II trial for the first-line combination of ­eribulin plus trastuzumab in human epidermal growth factor receptor 2 positive patients showed a 71% objective response rate and tolerability consistent with the known profile of these agents. Here, we present prespecified analyses of efficacy of this combination based on prior trastuzumab use. Patients received eribulin mesylate 1.4 mg/m2 (equivalent to 1.23 mg/m2 eribulin [expressed as free base] intravenously on days 1 and 8 plus trastuzumab (8 mg/kg intravenously/cycle 1, then 6 mg/kg on day 1 of each 21-day cycle. Objective response rates, progression-free survival, and tolerability were assessed in patients who had and had not received prior adjuvant or neoadjuvant (neo/adjuvant trastuzumab treatment. Fifty-two patients (median age: 59.5 years received eribulin/trastuzumab for a median treatment duration of ~31 weeks; 40.4% (n=21 had been previously treated with neo/adjuvant trastuzumab prior to

  6. Dengue viruses binding proteins from Aedes aegypti and Aedes polynesiensis salivary glands

    Directory of Open Access Journals (Sweden)

    Cao-Lormeau Van-Mai

    2009-03-01

    Full Text Available Abstract Dengue virus (DENV, the etiological agent of dengue fever, is transmitted to the human host during blood uptake by an infective mosquito. Infection of vector salivary glands and further injection of infectious saliva into the human host are key events of the DENV transmission cycle. However, the molecular mechanisms of DENV entry into the mosquito salivary glands have not been clearly identified. Otherwise, although it was demonstrated for other vector-transmitted pathogens that insect salivary components may interact with host immune agents and impact the establishment of infection, the role of mosquito saliva on DENV infection in human has been only poorly documented. To identify salivary gland molecules which might interact with DENV at these key steps of transmission cycle, we investigated the presence of proteins able to bind DENV in salivary gland extracts (SGE from two mosquito species. Using virus overlay protein binding assay, we detected several proteins able to bind DENV in SGE from Aedes aegypti (L. and Aedes polynesiensis (Marks. The present findings pave the way for the identification of proteins mediating DENV attachment or entry into mosquito salivary glands, and of saliva-secreted proteins those might be bound to the virus at the earliest step of human infection. The present findings might contribute to the identification of new targets for anti-dengue strategies.

  7. Phase II Study of Paclitaxel Given Once per Week Along With Trastuzumab and Pertuzumab in Patients With Human Epidermal Growth Factor Receptor 2–Positive Metastatic Breast Cancer

    Science.gov (United States)

    Dang, Chau; Iyengar, Neil; Datko, Farrah; D'Andrea, Gabriella; Theodoulou, Maria; Dickler, Maura; Goldfarb, Shari; Lake, Diana; Fasano, Julie; Fornier, Monica; Gilewski, Theresa; Modi, Shanu; Gajria, Devika; Moynahan, Mary Ellen; Hamilton, Nicola; Patil, Sujata; Jochelson, Maxine; Norton, Larry; Baselga, Jose; Hudis, Clifford

    2015-01-01

    Purpose The CLEOPATRA (Clinical Evaluation of Trastuzumab and Pertuzumab) study demonstrated superior progression-free survival (PFS) and overall survival when pertuzumab was added to trastuzumab and docetaxel. Paclitaxel given once per week is effective and less toxic than docetaxel. We performed a phase II study to evaluate the efficacy and safety of pertuzumab and trastuzumab with paclitaxel given once per week. Patients and Methods Patients with metastatic human epidermal growth factor receptor 2–positive breast cancer with zero to one prior therapy were enrolled. Treatment consisted of paclitaxel 80 mg/m2 once per week plus trastuzumab (8 mg/kg loading dose → 6 mg/kg) once every 3 weeks plus pertuzumab (840 mg loading dose → 420 mg) once every 3 weeks, all given intravenously. The primary end point was 6-month PFS assessed by Kaplan-Meier methods. Results From January 2011 to December 2013, we enrolled 69 patients: 51 (74%) and 18 (26%) treated in first- and second-line metastatic settings, respectively. At a median follow-up of 21 months (range, 3 to 38 months), 6-month PFS was 86% (95% CI, 75% to 92%). The median PFS was 19.5 months (95% CI, 14 to 26 months) overall. PFS was 24.2 months (95% CI, 14 months to not reached [NR]) and 16.4 months (95% CI, 8.5 months to NR) for those without and with prior treatment, respectively. At 1 year, Kaplan-Meier PFS was 70% (95% CI, 56% to 79%) overall, 71% (95% CI, 55% to 82%) for those without prior therapy, and 66% (95% CI, 40% to 83%) for those with prior therapy. Treatment was well-tolerated; there was no febrile neutropenia or symptomatic left ventricular systolic dysfunction. Conclusion Paclitaxel given once per week with trastuzumab and pertuzumab is highly active and well tolerated and seems to be an effective alternative to docetaxel-based combination therapy. PMID:25547504

  8. Quantification of human epidermal growth factor receptor 2 immunohistochemistry using the Ventana Image Analysis System: correlation with gene amplification by fluorescence in situ hybridization: the importance of instrument validation for achieving high (>95%) concordance rate.

    Science.gov (United States)

    Dennis, Jake; Parsa, Rezvaneh; Chau, Donnie; Koduru, Prasad; Peng, Yan; Fang, Yisheng; Sarode, Venetia Rumnong

    2015-05-01

    The use of computer-based image analysis for scoring human epidermal growth factor receptor 2 (HER2) immunohistochemistry (IHC) has gained a lot of interest recently. We investigated the performance of the Ventana Image Analysis System (VIAS) in HER2 quantification by IHC and its correlation with fluorescence in situ hybridization (FISH). We specifically compared the 3+ IHC results using the manufacturer's machine score cutoffs versus laboratory-defined cutoffs with the FISH assay. Using the manufacturer's 3+ cutoff (VIAS score; 2.51 to 3.5), 181/536 (33.7%) were scored 3+, and FISH was positive in 147/181 (81.2%), 2 (1.1%) were equivocal, and 32 (17.6%) were FISH (-). Using the laboratory-defined 3+ cutoff (VIAS score 3.5), 52 (28.7%) cases were downgraded to 2+, of which 29 (55.7%) were FISH (-), and 23 (44.2%) were FISH (+). With the revised cutoff, there were improvements in the concordance rate from 89.1% to 97.0% and in the positive predictive value from 82.1% to 97.6%. The false-positive rate for 3+ decreased from 9.0% to 0.8%. Six of 175 (3.4%) IHC (-) cases were FISH (+). Three cases with a VIAS score 3.5 showed polysomy of chromosome 17. In conclusion, the VIAS may be a valuable tool for assisting pathologists in HER2 scoring; however, the positive cutoff defined by the manufacturer is associated with a high false-positive rate. This study highlights the importance of instrument validation/calibration to reduce false-positive results.

  9. Differences in expression of the cancer stem cell marker aldehyde dehydrogenase 1 among estrogen receptor-positive/human epidermal growth factor receptor type 2-negative breast cancer cases with early, late, and no recurrence.

    Science.gov (United States)

    Miyoshi, Yuichiro; Shien, Tadahiko; Ogiya, Akiko; Ishida, Naoko; Yamazaki, Kieko; Horii, Rie; Horimoto, Yoshiya; Masuda, Norikazu; Yasojima, Hiroyuki; Inao, Touko; Osako, Tomofumi; Takahashi, Masato; Tomioka, Nobumoto; Endo, Yumi; Hosoda, Mitsuchika; Doihara, Hiroyoshi; Miyoshi, Shinichiro; Yamashita, Hiroko

    2016-07-02

    The significance of the expression of aldehyde dehydrogenase 1 (ALDH1), a cancer stem cell marker, for predicting the recurrence of estrogen receptor (ER)-positive/human epidermal growth factor receptor type 2 (HER2)-negative breast cancer is still poorly understood. The value of ALDH1 in predicting the time of recurrence remains unknown. In total, 184 patients with early distant recurrence, 134 patients with late distant recurrence, and 321 control patients without recurrence for more than 10 years after starting initial treatment for ER-positive/HER2-negative breast cancer, registered in 9 institutions, were analyzed. We assessed relationships between ALDH1 and other clinicopathological features, and ALDH1 expression was compared among the three groups. The relationship between ALDH1 expression and overall survival after recurrence was also evaluated in each group. The rates of ALDH1 expression positivity (more than 1 %) in the early, late, and no recurrence groups were 18.4 %, 13.4 %, and 8.4 %, respectively. ALDH1 expression correlated significantly with lymph node metastases (p = 0.048) and the Ki-67 labeling index (p factor independently predicting overall survival after the detection of recurrence (adjusted OR 1.451, 95 % CI 0.985-2.085, p = 0.059). Among patients with ER-positive/HER2-negative breast cancer, ALDH1 expression was more common in those with early recurrence, and this expression was found to be associated with a more aggressive breast cancer phenotype than that in the patients without recurrence. Further study is needed to clarify the prognostic significance of the heterogeneity of cancer stem cells and to confirm their role in resistance to chemotherapy.

  10. The relationship between quantitative human epidermal growth factor receptor 2 gene expression by the 21-gene reverse transcriptase polymerase chain reaction assay and adjuvant trastuzumab benefit in Alliance N9831.

    Science.gov (United States)

    Perez, Edith A; Baehner, Frederick L; Butler, Steven M; Thompson, E Aubrey; Dueck, Amylou C; Jamshidian, Farid; Cherbavaz, Diana; Yoshizawa, Carl; Shak, Steven; Kaufman, Peter A; Davidson, Nancy E; Gralow, Julie; Asmann, Yan W; Ballman, Karla V

    2015-10-01

    The N9831 trial demonstrated the efficacy of adjuvant trastuzumab for patients with human epidermal growth factor receptor 2 (HER2) locally positive tumors by protein or gene analysis. We used the 21-gene assay to examine the association of quantitative HER2 messenger RNA (mRNA) gene expression and benefit from trastuzumab. N9831 tested the addition of trastuzumab to chemotherapy in stage I-III HER2-positive breast cancer. For two of the arms of the trial, doxorubicin and cyclophosphamide followed by paclitaxel (AC-T) and doxorubicin and cyclophosphamide followed by paclitaxel and trastuzumab concurrent chemotherapy-trastuzumab (AC-TH), recurrence score (RS) and HER2 mRNA expression were determined by the 21-gene assay (Oncotype DX®) (negative 10 % positive cells = positive), 91 % for RT-PCR versus central fluorescence in situ hybridization (FISH) (≥2.0 = positive) and 94 % for central IHC versus central FISH. In the primary analysis, the association of HER2 expression by 21-gene assay with trastuzumab benefit was marginally nonsignificant (nonlinear p = 0.057). In hormone receptor-positive patients (local IHC) the association was significant (p = 0.002). The association was nonlinear with the greatest estimated benefit at lower and higher HER2 expression levels. Concordance among HER2 assessments by central IHC, FISH, and RT-PCR were similar and high. Association of HER2 mRNA expression with trastuzumab benefit as measured by time to distant recurrence was nonsignificant. A consistent benefit of trastuzumab irrespective of mHER2 levels was observed in patients with either IHC-positive or FISH-positive tumors. Trend for benefit was observed also for the small groups of patients with negative results by any or all of the central assays. Clinicaltrials.gov NCT00005970 . Registered 5 July 2000.

  11. Patient-reported outcomes from EMILIA, a randomized phase 3 study of trastuzumab emtansine (T-DM1) versus capecitabine and lapatinib in human epidermal growth factor receptor 2-positive locally advanced or metastatic breast cancer.

    Science.gov (United States)

    Welslau, Manfred; Diéras, Veronique; Sohn, Joo-Hyuk; Hurvitz, Sara A; Lalla, Deepa; Fang, Liang; Althaus, Betsy; Guardino, Ellie; Miles, David

    2014-03-01

    This report describes the results of an analysis of patient-reported outcomes from EMILIA (TDM4370g/BO21977), a randomized phase 3 study of the antibody-drug conjugate trastuzumab emtansine (T-DM1) versus capecitabine and lapatinib in human epidermal growth factor receptor 2 (HER2)-positive locally advanced or metastatic breast cancer. A secondary endpoint of the EMILIA study was time to symptom worsening (time from randomization to the first documentation of a ≥ 5-point decrease from baseline) as measured by the Trial Outcome Index Physical/Functional/Breast (TOI-PFB) subset of the Functional Assessment of Cancer Therapy-Breast questionnaire. Predefined exploratory patient-reported outcome endpoints included proportion of patients with a clinically significant improvement in symptoms (per TOI-PFB) and proportion of patients with diarrhea symptoms (per Diarrhea Assessment Scale). In the T-DM1 arm, 450 of 495 patients had a baseline and ≥ 1 postbaseline TOI-PFB score versus 445 of 496 patients in the capecitabine-plus-lapatinib arm. Time to symptom worsening was delayed in the T-DM1 arm versus the capecitabine-plus-lapatinib arm (7.1 months versus 4.6 months, respectively; hazard ratio = 0.796; P = .0121). In the T-DM1 arm, 55.3% of patients developed clinically significant improvement in symptoms from baseline versus 49.4% in the capecitabine-plus-lapatinib arm (P = .0842). Although similar at baseline, the number of patients reporting diarrhea symptoms increased 1.5- to 2-fold during treatment with capecitabine and lapatinib but remained near baseline levels in the T-DM1 arm. Together with the EMILIA primary data, these results support the concept that T-DM1 has greater efficacy and tolerability than capecitabine plus lapatinib, which may translate into improvements in health-related quality of life. © 2013 American Cancer Society.

  12. Laboratory compliance with the American Society of Clinical Oncology/college of American Pathologists guidelines for human epidermal growth factor receptor 2 testing: a College of American Pathologists survey of 757 laboratories.

    Science.gov (United States)

    Nakhleh, Raouf E; Grimm, Erin E; Idowu, Michael O; Souers, Rhona J; Fitzgibbons, Patrick L

    2010-05-01

    To ensure quality human epidermal growth receptor 2 (HER2) testing in breast cancer, the American Society of Clinical Oncology/College of American Pathologists guidelines were introduced with expected compliance by 2008. To assess the effect these guidelines have had on pathology laboratories and their ability to address key components. In late 2008, a survey was distributed with the HER2 immunohistochemistry (IHC) proficiency testing program. It included questions regarding pathology practice characteristics and assay validation using fluorescence in situ hybridization or another IHC laboratory assay and assessed pathologist HER2 scoring competency. Of the 907 surveys sent, 757 (83.5%) were returned. The median laboratory accessioned 15 000 cases and performed 190 HER2 tests annually. Quantitative computer image analysis was used by 33% of laboratories. In-house fluorescence in situ hybridization was performed in 23% of laboratories, and 60% of laboratories addressed the 6- to 48-hour tissue fixation requirement by embedding tissue on the weekend. HER2 testing was performed on the initial biopsy in 40%, on the resection specimen in 6%, and on either in 56% of laboratories. Testing was validated with only fluorescence in situ hybridization in 47% of laboratories, whereas 10% of laboratories used another IHC assay only; 13% used both assays, and 12% and 15% of laboratories had not validated their assays or chose "not applicable" on the survey question, respectively. The 90% concordance rate with fluorescence in situ hybridization results was achieved by 88% of laboratories for IHC-negative findings and by 81% of laboratories for IHC-positive cases. The 90% concordance rate for laboratories using another IHC assay was achieved by 80% for negative findings and 75% for positive cases. About 91% of laboratories had a pathologist competency assessment program. This survey demonstrates the extent and characteristics of HER2 testing. Although some American Society of

  13. E3B1, a human homologue of the mouse gene product Abi-1, sensitizes activation of Rap1 in response to epidermal growth factor

    International Nuclear Information System (INIS)

    Jenei, Veronika; Andersson, Tommy; Jakus, Judit; Dib, Karim

    2005-01-01

    E3B1, a human homologue of the mouse gene product Abi-1, has been implicated in growth-factor-mediated regulation of the small GTPases p21 Ras and Rac. E3b1 is a regulator of Rac because it can form a complex with Sos-1 and eps8, and such a Sos-1-e3B1-eps8 complex serves as a guanine nucleotide exchange factor for Rac. In the present study, we found that overexpression of e3B1 in NIH3T3/EGFR cells sensitized EGF-induced activation of Rac1, whereas it had no impact on EGF-induced activation of p21 Ras . Remarkably, we found that EGF-induced activation of the p21 Ras -related GTPase Rap1 was also sensitized in NIH3T3/EGFR-e3B1 cells. Thus, in NIH3T3/EGFR-e3B1 cells, maximal EGF-induced activation of Rap1 occurs with a dose of EGF much lower than in NIH3T3/EGFR cells. We also report that overexpression of e3B1 in NIH3T3/EGFR cells renders EGF-induced activation of Rap1 completely dependent on Src tyrosine kinases but not on c-Abl. However, EGF-induced tyrosine phosphorylation of the Rap GEF C3G occurred regardless of whether e3B1 was overexpressed or not, and this did not involve Src tyrosine kinases. Accordingly, we propose that overexpression of e3B1 in NIH3T3/EGFR cells leads to mobilization of Src tyrosine kinases that participate in EGF-induced activation of Rap1 and inhibition of cell proliferation

  14. Epidermal Overexpression of Xenobiotic Receptor PXR Impairs the Epidermal Barrier and Triggers Th2 Immune Response.

    Science.gov (United States)

    Elentner, Andreas; Schmuth, Matthias; Yannoutsos, Nikolaos; Eichmann, Thomas O; Gruber, Robert; Radner, Franz P W; Hermann, Martin; Del Frari, Barbara; Dubrac, Sandrine

    2018-01-01

    The skin is in daily contact with environmental pollutants, but the long-term effects of such exposure remain underinvestigated. Many of these toxins bind and activate the pregnane X receptor (PXR), a ligand-activated transcription factor that regulates genes central to xenobiotic metabolism. The objective of this work was to investigate the effect of constitutive activation of PXR in the basal layer of the skin to mimic repeated skin exposure to noxious molecules. We designed a transgenic mouse model that overexpresses the human PXR gene linked to the herpes simplex VP16 domain under the control of the keratin 14 promoter. We show that transgenic mice display increased transepidermal water loss and elevated skin pH, abnormal stratum corneum lipids, focal epidermal hyperplasia, activated keratinocytes expressing more thymic stromal lymphopoietin, a T helper type 2/T helper type 17 skin immune response, and increased serum IgE. Furthermore, the cutaneous barrier dysfunction precedes development of the T helper type 2/T helper type 17 inflammation in transgenic mice, thereby mirroring the time course of atopic dermatitis development in humans. Moreover, further experiments suggest increased PXR signaling in the skin of patients with atopic dermatitis when compared with healthy skin. Thus, PXR activation by environmental pollutants may compromise epidermal barrier function and favor an immune response resembling atopic dermatitis. Copyright © 2017 The Authors. Published by Elsevier Inc. All rights reserved.

  15. Clinical Translation and Validation of a Predictive Biomarker for Patritumab, an Anti-human Epidermal Growth Factor Receptor 3 (HER3) Monoclonal Antibody, in Patients With Advanced Non-small Cell Lung Cancer.

    Science.gov (United States)

    Mendell, Jeanne; Freeman, Daniel J; Feng, Wenqin; Hettmann, Thore; Schneider, Matthias; Blum, Sabine; Ruhe, Jens; Bange, Johannes; Nakamaru, Kenji; Chen, Shuquan; Tsuchihashi, Zenta; von Pawel, Joachim; Copigneaux, Catherine; Beckman, Robert A

    2015-03-01

    During early clinical development, prospective identification of a predictive biomarker and validation of an assay method may not always be feasible. Dichotomizing a continuous biomarker measure to classify responders also leads to challenges. We present a case study of a prospective-retrospective approach for a continuous biomarker identified after patient enrollment but defined prospectively before the unblinding of data. An analysis of the strengths and weaknesses of this approach and the challenges encountered in its practical application are also provided. HERALD (NCT02134015) was a double-blind, phase 2 study in patients with non-small cell lung cancer (NSCLC) randomized to erlotinib with placebo or with high or low doses of patritumab, a monoclonal antibody targeted against human epidermal growth factor receptor 3 (HER3). While the primary objective was to assess safety and progression-free survival (PFS), a secondary objective was to determine a single predictive biomarker hypothesis to identify subjects most likely to benefit from the addition of patritumab. Although not identified as the primary biomarker in the study protocol, on the basis of preclinical results from 2 independent laboratories, expression levels of the HER3 ligand heregulin (HRG) were prospectively declared the predictive biomarker before data unblinding but after subject enrollment. An assay to measure HRG mRNA was developed and validated. Other biomarkers, such as epidermal growth factor receptor (EGFR) mutation status, were also evaluated in an exploratory fashion. The cutoff value for high vs. low HRG mRNA levels was set at the median delta threshold cycle. A maximum likelihood analysis was performed to evaluate the provisional cutoff. The relationship of HRG values to PFS hazard ratios (HRs) was assessed as a measure of internal validation. Additional NSCLC samples were analyzed to characterize HRG mRNA distribution. The subgroup of patients with high HRG mRNA levels ("HRG

  16. Immunohistochemical localization of epidermal growth factor in rat and man

    DEFF Research Database (Denmark)

    Poulsen, Steen Seier; Nexø, Ebba

    1986-01-01

    Epidermal growth factor (EGF) is a peptide which stimulates cell mitotic activity and differentiation, has a cytoprotective effect on the gastroduodenal mucosa, and inhibits gastric acid secretion. The immunohistochemical localization of EGF in the Brunner's glands and the submandibular glands is...... antisera against human urinary EGF worked in rat as well as man. EGF was found only in cells with an exocrine function.......Epidermal growth factor (EGF) is a peptide which stimulates cell mitotic activity and differentiation, has a cytoprotective effect on the gastroduodenal mucosa, and inhibits gastric acid secretion. The immunohistochemical localization of EGF in the Brunner's glands and the submandibular glands...... is well documented. The localization of EGF in other tissues is still unclarified. In the present study, the immunohistochemical localization of EGF in tissues from rat, man and a 20 week human fetus were investigated. In man and rat, immunoreaction was found in the submandibular glands, the serous glands...

  17. Salivary antimicrobial proteins associate with age-related changes in streptococcal composition in dental plaque.

    Science.gov (United States)

    Malcolm, J; Sherriff, A; Lappin, D F; Ramage, G; Conway, D I; Macpherson, L M D; Culshaw, S

    2014-12-01

    Secretion of antimicrobial proteins (AMPs) and salivary antibodies can modify biofilm formation at host body surfaces. In adolescents, associations have been reported between dental caries and salivary AMPs. AMPs demonstrate direct antimicrobial effects at high concentrations, and at lower more physiological concentrations they mediate changes in host cell defenses, which may alter the local environment and indirectly shape local biofilm formation. The expression of salivary AMPs in preschool children, at an age when the oral bacteria are known to change, has not been investigated. We sought to investigate salivary AMP expression in the context of previously well-documented changes in the oral cavities of this age group including salivary immunoglobulin A (IgA), oral bacteria and dental caries. Dental plaque and saliva were collected from 57 children aged 12-24 months at baseline, of whom 23 children were followed-up at 3 years of age. At each time, saliva was assessed for LL37, human neutrophil peptides 1-3, calprotectin, lactoferrin, salivary IgA, total plaque bacteria and Streptococcus mutans. Over time, concentrations of AMPs, S. mutans and bacteria-specific salivary IgA increased. Caries experience was also recorded when children were 3 years old. Concentrations of AMPs were highest in the saliva of 3-year-old children with the greatest burden of S. mutans. These data suggest that salivary AMPs are variable over time and between individuals, and are linked with bacterial colonization. At follow up, the majority of children remained caries free. Larger longitudinal studies are required to confirm whether salivary AMP levels are predictive of caries and whether their modulation offers therapeutic benefit. © 2014 John Wiley & Sons A/S. Published by John Wiley & Sons Ltd.

  18. Endothelin B Receptors on Primary Chicken Müller Cells and the Human MIO-M1 Müller Cell Line Activate ERK Signaling via Transactivation of Epidermal Growth Factor Receptors.

    Directory of Open Access Journals (Sweden)

    Mohammad Harun-Or-Rashid

    Full Text Available Injury to the eye or retina triggers Müller cells, the major glia cell of the retina, to dedifferentiate and proliferate. In some species they attain retinal progenitor properties and have the capacity to generate new neurons. The epidermal growth factor receptor (EGFR system and extracellular signal-regulated kinase (ERK signaling are key regulators of these processes in Müller cells. The extracellular signals that modulate and control these processes are not fully understood. In this work we studied whether endothelin receptor signaling can activate EGFR and ERK signaling in Müller cells. Endothelin expression is robustly upregulated at retinal injury and endothelin receptors have been shown to transactivate EGFRs in other cell types. We analyzed the endothelin signaling system in chicken retina and cultured primary chicken Müller cells as well as the human Müller cell line MIO-M1. The Müller cells were stimulated with receptor agonists and treated with specific blockers to key enzymes in the signaling pathway or with siRNAs. We focused on endothelin receptor mediated transactivation of EGFRs by using western blot analysis, quantitative reverse transcriptase PCR and immunocytochemistry. The results showed that chicken Müller cells and the human Müller cell line MIO-M1 express endothelin receptor B. Stimulation by the endothelin receptor B agonist IRL1620 triggered phosphorylation of ERK1/2 and autophosphorylation of (Y1173 EGFR. The effects could be blocked by Src-kinase inhibitors (PP1, PP2, EGFR-inhibitor (AG1478, EGFR-siRNA and by inhibitors to extracellular matrix metalloproteinases (GM6001, consistent with a Src-kinase mediated endothelin receptor response that engage ligand-dependent and ligand-independent EGFR activation. Our data suggest a mechanism for how injury-induced endothelins, produced in the retina, may modulate the Müller cell responses by Src-mediated transactivation of EGFRs. The data give support to a view in

  19. Intrasellar Symptomatic Salivary Gland Rest

    Directory of Open Access Journals (Sweden)

    Chih-Hao Chen

    2007-05-01

    Full Text Available Ectopic salivary gland tissue in sellar turcica is frequently observed in microscopic examination at autopsy. This tissue is considered clinically silent. Only 2 symptomatic cases have been previously reported. Here we report a 28-year-old woman presenting with galactorrhea and hyperprolactinemia. Magnetic resonance imaging revealed a 6×5-mm nodule in the posterior aspect of the pituitary gland. This nodule showed isointensity on T1- and T2-weighted images and less enhancement on post-contrast T1-weighted images. Transsphenoidal exploration revealed a cystic lesion within the pituitary gland, which consisted of a grayish gelatinous content. The pathologic examination confirmed the diagnosis of salivary gland rest.

  20. Parotid salivary duct stenosis following caudal maxillectomy.

    Science.gov (United States)

    Mestrinho, Lisa A; Faísca, Pedro B; Niza, Maria M R E

    2014-01-01

    Parotid salivary duct dilation was diagnosed in a 9-year-old male dog. The dog had undergone caudal maxillectomy on the ipsilateral side 2-years prior to presentation. Treatment consisted of parotid salivary duct excision and superficial parotidectomy that lead to the resolution of clinical signs. Transient facial neuropraxia was observed immediately after surgery and resolved spontaneously after 2-weeks. Parotid salivary duct dilation should be considered as a chronic postoperative complication following caudal maxillectomy.

  1. Salivary gland dysfunction following radioactive iodine therapy

    International Nuclear Information System (INIS)

    Wiesenfeld, D.; Webster, G.; Cameron, F.; Ferguson, M.M.; MacFadyen, E.E.; MacFarlane, T.W.

    1983-01-01

    Radioactive iodine is used extensively for the treatment of thyrotoxicosis and thyroid carcinoma. Iodine is actively taken up by the salivary glands and, following its use, salivary dysfunction may result as a consequence of radiation damage. The literature is reviewed and a case is reported in which a patient presented with a significant increase in caries rate attributed to salivary dysfunction following radioactive iodine therapy for a thyroid carcinoma

  2. Salivary gammagraphy in Sjogren Syndrome

    Energy Technology Data Exchange (ETDEWEB)

    Cano, R. (Instituto Peruano de Energia Nuclear, Lima)

    1983-05-01

    Bearing in mind that the Tc-99m pertechnetate is taken up by the active glandular tissues of the salivary glands, we evaluate and objectivate the decrease of this captation in the case of chronic inflammation of distinct evolution of the parotid. Our results are encouraging in that sense that the experiment is not invasive and thus there are no risks for the patient nor for the doctor.

  3. Salivary gammagraphy in Sjogren Syndrome

    International Nuclear Information System (INIS)

    Cano, R.

    1983-01-01

    Bearing in mind that the Tc-99m pertecnate is taken up by the active glandular tissues of the salivary glands, we evaluate and objectivate the decrease of this captation in the case of chronic inflammation of distinct evolution of the parotid. Our results are encouraging in that sense that the experiment is not invasive and thus there are no risks for the patient nor for the doctor

  4. Maternal and Paternal Plasma, Salivary, and Urinary Oxytocin and Parent-Infant Synchrony: Considering Stress and Affiliation Components of Human Bonding

    Science.gov (United States)

    Feldman, Ruth; Gordon, Ilanit; Zagoory-Sharon, Orna

    2011-01-01

    Studies in mammals have implicated the neuropeptide oxytocin (OT) in processes of bond formation and stress modulation, yet the involvement of OT in human bonding throughout life remains poorly understood. We assessed OT in the plasma, saliva, and urine of 112 mothers and fathers interacting with their 4-6-month-old infants. Parent-infant…

  5. Salivary characteristics of diabetic children

    Directory of Open Access Journals (Sweden)

    López María Elena

    2003-01-01

    Full Text Available Salivary components may suffer variations that can be detected by chemical determinations. The aim of this work was to determine physical and biochemical characteristics of the saliva of a group of diabetic children compared to those of a control group. Relation to oral health indices was also determined. Twenty diabetic children (3-15-years-old and 21 control children (5-12-years-old were included in this study. Total proteins, sugars and calcium were determined by colorimetric methods, and glucose, urea, alpha-amylase and acid phosphatase by enzymatic methods. Our results demonstrated that acidic pH, diminished salivary flow rate and excess foam are usually present in saliva of diabetic children. Total sugars, glucose, urea and total proteins were greater in diabetic patients than controls, while calcium values were decreased. These differences were confirmed by the discrimination test. Diabetic children have higher DMFT-dmft-deft and DMFS-dmfs-defs values compared to those of the control children despite their lower sugar intake. Some salivary components in addition to the diminished flow rate could be involved in the characterization of the oral health state of diabetic children.

  6. Clinical management of salivary deficiency: A review article

    International Nuclear Information System (INIS)

    AlSaif, K. M

    1991-01-01

    The physical, chemical and antibacterial properties of saliva provide protection to human dentition against dental diseases, Therefore, salivary deficiency has to be managed carefully. The causes of saliva deficiency are many and varied. It is worth mentioning that saliva flow rate is normally affected by physiologic condition, such as eating, resting, sleeping, cold or hot season etc. In this paper the protective role of saliva, etiologiy of saliva deficiency and its clinical management are discussed. (author

  7. Functional transcriptomics of wild-caught Lutzomyia intermedia salivary glands: identification of a protective salivary protein against Leishmania braziliensis infection.

    Science.gov (United States)

    de Moura, Tatiana R; Oliveira, Fabiano; Carneiro, Marcia W; Miranda, José Carlos; Clarêncio, Jorge; Barral-Netto, Manoel; Brodskyn, Cláudia; Barral, Aldina; Ribeiro, José M C; Valenzuela, Jesus G; de Oliveira, Camila I

    2013-01-01

    Leishmania parasites are transmitted in the presence of sand fly saliva. Together with the parasite, the sand fly injects salivary components that change the environment at the feeding site. Mice immunized with Phlebotomus papatasi salivary gland (SG) homogenate are protected against Leishmania major infection, while immunity to Lutzomyia intermedia SG homogenate exacerbated experimental Leishmania braziliensis infection. In humans, antibodies to Lu. intermedia saliva are associated with risk of acquiring L. braziliensis infection. Despite these important findings, there is no information regarding the repertoire of Lu. intermedia salivary proteins. A cDNA library from the Salivary Glands (SGs) of wild-caught Lu. intermedia was constructed, sequenced, and complemented by a proteomic approach based on 1D SDS PAGE and mass/mass spectrometry to validate the transcripts present in this cDNA library. We identified the most abundant transcripts and proteins reported in other sand fly species as well as novel proteins such as neurotoxin-like proteins, peptides with ML domain, and three small peptides found so far only in this sand fly species. DNA plasmids coding for ten selected transcripts were constructed and used to immunize BALB/c mice to study their immunogenicity. Plasmid Linb-11--coding for a 4.5-kDa protein--induced a cellular immune response and conferred protection against L. braziliensis infection. This protection correlated with a decreased parasite load and an increased frequency of IFN-γ-producing cells. We identified the most abundant and novel proteins present in the SGs of Lu. intermedia, a vector of cutaneous leishmaniasis in the Americas. We also show for the first time that immunity to a single salivary protein from Lu. intermedia can protect against cutaneous leishmaniasis caused by L. braziliensis.

  8. Wide cross-reactivity between Anopheles gambiae and Anopheles funestus SG6 salivary proteins supports exploitation of gSG6 as a marker of human exposure to major malaria vectors in tropical Africa

    Directory of Open Access Journals (Sweden)

    Petrarca Vincenzo

    2011-07-01

    Full Text Available Abstract Background The Anopheles gambiae gSG6 is an anopheline-specific salivary protein which helps female mosquitoes to efficiently feed on blood. Besides its role in haematophagy, gSG6 is immunogenic and elicits in exposed individuals an IgG response, which may be used as indicator of exposure to the main African malaria vector A. gambiae. However, malaria transmission in tropical Africa is sustained by three main vectors (A. gambiae, Anopheles arabiensis and Anopheles funestus and a general marker, reflecting exposure to at least these three species, would be especially valuable. The SG6 protein is highly conserved within the A. gambiae species complex whereas the A. funestus homologue, fSG6, is more divergent (80% identity with gSG6. The aim of this study was to evaluate cross-reactivity of human sera to gSG6 and fSG6. Methods The A. funestus SG6 protein was expressed/purified and the humoral response to gSG6, fSG6 and a combination of the two antigens was compared in a population from a malaria hyperendemic area of Burkina Faso where both vectors were present, although with a large A. gambiae prevalence (>75%. Sera collected at the beginning and at the end of the high transmission/rainy season, as well as during the following low transmission/dry season, were analysed. Results According to previous observations, both anti-SG6 IgG level and prevalence decreased during the low transmission/dry season and showed a typical age-dependent pattern. No significant difference in the response to the two antigens was found, although their combined use yielded in most cases higher IgG level. Conclusions Comparative analysis of gSG6 and fSG6 immunogenicity to humans suggests the occurrence of a wide cross-reactivity, even though the two proteins carry species-specific epitopes. This study supports the use of gSG6 as reliable indicator of exposure to the three main African malaria vectors, a marker which may be useful to monitor malaria transmission

  9. Computer-assisted assessment of the Human Epidermal Growth Factor Receptor 2 immunohistochemical assay in imaged histologic sections using a membrane isolation algorithm and quantitative analysis of positive controls

    International Nuclear Information System (INIS)

    Hall, Bonnie H; Ianosi-Irimie, Monica; Javidian, Parisa; Chen, Wenjin; Ganesan, Shridar; Foran, David J

    2008-01-01

    Breast cancers that overexpress the human epidermal growth factor receptor 2 (HER2) are eligible for effective biologically targeted therapies, such as trastuzumab. However, accurately determining HER2 overexpression, especially in immunohistochemically equivocal cases, remains a challenge. Manual analysis of HER2 expression is dependent on the assessment of membrane staining as well as comparisons with positive controls. In spite of the strides that have been made to standardize the assessment process, intra- and inter-observer discrepancies in scoring is not uncommon. In this manuscript we describe a pathologist assisted, computer-based continuous scoring approach for increasing the precision and reproducibility of assessing imaged breast tissue specimens. Computer-assisted analysis on HER2 IHC is compared with manual scoring and fluorescence in situ hybridization results on a test set of 99 digitally imaged breast cancer cases enriched with equivocally scored (2+) cases. Image features are generated based on the staining profile of the positive control tissue and pixels delineated by a newly developed Membrane Isolation Algorithm. Evaluation of results was performed using Receiver Operator Characteristic (ROC) analysis. A computer-aided diagnostic approach has been developed using a membrane isolation algorithm and quantitative use of positive immunostaining controls. By incorporating internal positive controls into feature analysis a greater Area Under the Curve (AUC) in ROC analysis was achieved than feature analysis without positive controls. Evaluation of HER2 immunostaining that utilized membrane pixels, controls, and percent area stained showed significantly greater AUC than manual scoring, and significantly less false positive rate when used to evaluate immunohistochemically equivocal cases. It has been shown that by incorporating both a membrane isolation algorithm and analysis of known positive controls a computer-assisted diagnostic algorithm was

  10. Alterations of the genes involved in the PI3K and estrogen-receptor pathways influence outcome in human epidermal growth factor receptor 2-positive and hormone receptor-positive breast cancer patients treated with trastuzumab-containing neoadjuvant chemotherapy

    International Nuclear Information System (INIS)

    Takada, Mamoru; Miyazaki, Masaru; Sato-Otsubo, Aiko; Ogawa, Seishi; Kaneko, Yasuhiko; Higuchi, Toru; Tozuka, Katsunori; Takei, Hiroyuki; Haruta, Masayuki; Watanabe, Junko; Kasai, Fumio; Inoue, Kenichi; Kurosumi, Masafumi

    2013-01-01

    Chemotherapy with trastuzumab is widely used for patients with human epidermal growth factor receptor 2-positive (HER2+) breast cancer, but a significant number of patients with the tumor fail to respond, or relapse. The mechanisms of recurrence and biomarkers that indicate the response to the chemotherapy and outcome are not fully investigated. Genomic alterations were analyzed using single-nucleotide polymorphism arrays in 46 HER2 immunohistochemistry (IHC) 3+ or 2+/fluorescent in situ hybridization (FISH)+ breast cancers that were treated with neoadjuvant chemotherapy with paclitaxel, cyclophosphamid, epirubicin, fluorouracil, and trastuzumab. Patients were classified into two groups based on presence or absence of alterations of 65 cancer-associated genes, and the two groups were further classified into four groups based on genomic HER2 copy numbers or hormone receptor status (HR+/−). Pathological complete response (pCR) and relapse-free survival (RFS) rates were compared between any two of the groups. The pCR rate was 54% in 37 patients, and the RFS rate at 3 years was 72% (95% CI, 0.55-0.89) in 42 patients. The analysis disclosed 8 tumors with nonamplified HER2 and 38 tumors with HER2 amplification, indicating the presence of discordance in tumors diagnosed using current HER2 testing. The 8 patients showed more difficulty in achieving pCR (P=0.019), more frequent relapse (P=0.018), and more frequent alterations of genes in the PI3K pathway (P=0.009) than the patients with HER2 amplification. The alterations of the PI3K and estrogen receptor (ER) pathway genes generally indicated worse RFS rates. The prognostic significance of the alterations was shown in patients with a HR+ tumor, but not in patients with a HR- tumor when divided. Alterations of the PI3K and ER pathway genes found in patients with a HR+ tumor with poor outcome suggested that crosstalk between the two pathways may be involved in resistance to the current chemotherapy with trastuzumab. We

  11. Randomized Phase III Trial of Trastuzumab Plus Capecitabine With or Without Pertuzumab in Patients With Human Epidermal Growth Factor Receptor 2-Positive Metastatic Breast Cancer Who Experienced Disease Progression During or After Trastuzumab-Based Therapy.

    Science.gov (United States)

    Urruticoechea, Ander; Rizwanullah, Mohammed; Im, Seock-Ah; Ruiz, Antonio Carlos Sánchez; Láng, István; Tomasello, Gianluca; Douthwaite, Hannah; Badovinac Crnjevic, Tanja; Heeson, Sarah; Eng-Wong, Jennifer; Muñoz, Montserrat

    2017-09-10

    Purpose To assess the efficacy and safety of trastuzumab plus capecitabine with or without pertuzumab in patients with human epidermal growth factor receptor 2-positive metastatic breast cancer who experienced disease progression during or after trastuzumab-based therapy and received a prior taxane. Patients and Methods Patients were randomly assigned to arm A: trastuzumab 8 mg/kg → 6 mg/kg once every 3 weeks plus capecitabine 1,250 mg/m 2 twice a day (2 weeks on, 1 week off, every 3 weeks); or arm B: pertuzumab 840 mg → 420 mg once every 3 weeks plus trastuzumab at the same dose and schedule as arm A plus capecitabine 1,000 mg/m 2 on the same schedule as arm A. The primary end point was independent review facility-assessed progression-free survival (IRF PFS). Secondary end points included overall survival (OS) and safety. Hierarchical testing procedures were used to control type I error for statistical testing of IRF PFS, OS, and objective response rate. Results Randomly assigned (intent-to-treat) populations were 224 and 228 patients in arms A and B, respectively. Median IRF PFS at 28.6 and 25.3 months' median follow-up was 9.0 v 11.1 months (hazard ratio, 0.82; 95% CI, 0.65 to 1.02; P = .0731) and interim OS was 28.1 v 36.1 months (hazard ratio, 0.68; 95% CI, 0.51 to 0.90). The most common adverse events (all grades; incidence of ≥ 10% in either arm and ≥ 5% difference between arms) were hand-foot syndrome, nausea, and neutropenia in arm A, and diarrhea, rash, and nasopharyngitis in arm B. Conclusion The addition of pertuzumab to trastuzumab and capecitabine did not significantly improve IRF PFS. An 8-month increase in median OS to 36.1 months with pertuzumab was observed. Statistical significance for OS cannot be claimed because of the hierarchical testing of OS after the primary PFS end point; however, the magnitude of OS difference is in keeping with prior experience of pertuzumab in metastatic breast cancer. No new safety signals were identified.

  12. Translational Breast Cancer Research Consortium (TBCRC) 022: A Phase II Trial of Neratinib for Patients With Human Epidermal Growth Factor Receptor 2–Positive Breast Cancer and Brain Metastases

    Science.gov (United States)

    Gelman, Rebecca S.; Wefel, Jeffrey S.; Melisko, Michelle E.; Hess, Kenneth R.; Connolly, Roisin M.; Van Poznak, Catherine H.; Niravath, Polly A.; Puhalla, Shannon L.; Ibrahim, Nuhad; Blackwell, Kimberly L.; Moy, Beverly; Herold, Christina; Liu, Minetta C.; Lowe, Alarice; Agar, Nathalie Y.R.; Ryabin, Nicole; Farooq, Sarah; Lawler, Elizabeth; Rimawi, Mothaffar F.; Krop, Ian E.; Wolff, Antonio C.; Winer, Eric P.; Lin, Nancy U.

    2016-01-01

    Purpose Evidence-based treatments for metastatic, human epidermal growth factor receptor 2 (HER2)–positive breast cancer in the CNS are limited. Neratinib is an irreversible inhibitor of erbB1, HER2, and erbB4, with promising activity in HER2-positive breast cancer; however, its activity in the CNS is unknown. We evaluated the efficacy of treatment with neratinib in patients with HER2-positive breast cancer brain metastases in a multicenter, phase II open-label trial. Patients and Methods Eligible patients were those with HER2-positive brain metastases (≥ 1 cm in longest dimension) who experienced progression in the CNS after one or more line of CNS-directed therapy, such as whole-brain radiotherapy, stereotactic radiosurgery, and/or surgical resection. Patients received neratinib 240 mg orally once per day, and tumors were assessed every two cycles. The primary endpoint was composite CNS objective response rate (ORR), requiring all of the following: ≥50% reduction in volumetric sum of target CNS lesions and no progression of non-target lesions, new lesions, escalating corticosteroids, progressive neurologic signs/symptoms, or non-CNS progression—the threshold for success was five of 40 responders. Results Forty patients were enrolled between February 2012 and June 2013; 78% of patients had previous whole-brain radiotherapy. Three women achieved a partial response (CNS objective response rate, 8%; 95% CI, 2% to 22%). The median number of cycles received was two (range, one to seven cycles), with a median progression-free survival of 1.9 months. Five women received six or more cycles. The most common grade ≥ 3 event was diarrhea (occurring in 21% of patients taking prespecified loperamide prophylaxis and 28% of those without prophylaxis). Patients in the study experienced a decreased quality of life over time. Conclusion Although neratinib had low activity and did not meet our threshold for success, 12.5% of patients received six or more cycles. Studies

  13. Computer-assisted assessment of the Human Epidermal Growth Factor Receptor 2 immunohistochemical assay in imaged histologic sections using a membrane isolation algorithm and quantitative analysis of positive controls

    Directory of Open Access Journals (Sweden)

    Ianosi-Irimie Monica

    2008-06-01

    Full Text Available Abstract Background Breast cancers that overexpress the human epidermal growth factor receptor 2 (HER2 are eligible for effective biologically targeted therapies, such as trastuzumab. However, accurately determining HER2 overexpression, especially in immunohistochemically equivocal cases, remains a challenge. Manual analysis of HER2 expression is dependent on the assessment of membrane staining as well as comparisons with positive controls. In spite of the strides that have been made to standardize the assessment process, intra- and inter-observer discrepancies in scoring is not uncommon. In this manuscript we describe a pathologist assisted, computer-based continuous scoring approach for increasing the precision and reproducibility of assessing imaged breast tissue specimens. Methods Computer-assisted analysis on HER2 IHC is compared with manual scoring and fluorescence in situ hybridization results on a test set of 99 digitally imaged breast cancer cases enriched with equivocally scored (2+ cases. Image features are generated based on the staining profile of the positive control tissue and pixels delineated by a newly developed Membrane Isolation Algorithm. Evaluation of results was performed using Receiver Operator Characteristic (ROC analysis. Results A computer-aided diagnostic approach has been developed using a membrane isolation algorithm and quantitative use of positive immunostaining controls. By incorporating internal positive controls into feature analysis a greater Area Under the Curve (AUC in ROC analysis was achieved than feature analysis without positive controls. Evaluation of HER2 immunostaining that utilized membrane pixels, controls, and percent area stained showed significantly greater AUC than manual scoring, and significantly less false positive rate when used to evaluate immunohistochemically equivocal cases. Conclusion It has been shown that by incorporating both a membrane isolation algorithm and analysis of known

  14. Human epidermal growth factor receptor 2 assessment in a case-control study: comparison of fluorescence in situ hybridization and quantitative reverse transcription polymerase chain reaction performed by central laboratories.

    Science.gov (United States)

    Baehner, Frederick L; Achacoso, Ninah; Maddala, Tara; Shak, Steve; Quesenberry, Charles P; Goldstein, Lynn C; Gown, Allen M; Habel, Laurel A

    2010-10-01

    The optimal method to assess human epidermal growth factor receptor 2 (HER2) status remains highly controversial. Before reporting patient HER2 results, American Society of Clinical Oncology (ASCO)/College of American Pathologists (CAP) guidelines mandate that laboratories demonstrate ≥ 95% concordance to another approved laboratory or methodology. Here, we compare central laboratory HER2 assessed by fluorescence in situ hybridization (FISH) and quantitative reverse transcriptase polymerase chain reaction (RT-PCR) using Oncotype DX in lymph node-negative, chemotherapy-untreated patients from a large Kaiser Permanente case-control study. Breast cancer specimens from the Kaiser-Genomic Health study were examined. Central FISH assessment of HER2 amplification and polysomy 17 was conducted by PhenoPath Laboratories (ratios > 2.2, 1.8 to 2.2, and < 1.8 define HER2 positive, HER2 equivocal, and HER2 negative, respectively). HER2 expression by RT-PCR was conducted using Oncotype DX by Genomic Health (normalized expression units ≥ 11.5, 10.7 to < 11.5, and < 10.7 define HER2 positive, HER2 equivocal, and HER2 negative, respectively). Concordance analyses followed ASCO/CAP guidelines. HER2 concordance by central FISH and central RT-PCR was 97% (95% CI, 96% to 99%). Twelve percent (67 of 568 patients) and 11% (60 of 568 patients) of patients were HER2 positive by RT-PCR and FISH, respectively. HER2-positive patients had increased odds of dying from breast cancer compared with HER2-negative patients. Polysomy 17 was demonstrated in 12.5% of all patients and 33% of FISH-positive patients. Nineteen of 20 FISH-positive patients with polysomy 17 were also RT-PCR HER2 positive. Although not statistically significantly different, HER2-positive/polysomy 17 patients tended to have the worst prognosis, followed by HER2-positive/eusomic, HER2-negative/polysomy 17, and HER2-negative/eusomic patients. There is a high degree of concordance between central FISH and quantitative RT

  15. A Retrospective Survival Analysis of Anatomic and Prognostic Stage Group Based on the American Joint Committee on Cancer 8th Edition Cancer Staging Manual in Luminal B Human Epidermal Growth Factor Receptor 2-negative Breast Cancer.

    Science.gov (United States)

    Xu, Ling; Li, Jiang-Hong; Ye, Jing-Ming; Duan, Xue-Ning; Cheng, Yuan-Jia; Xin, Ling; Liu, Qian; Zhou, Bin; Liu, Yin-Hua

    2017-08-20

    Current understanding of tumor biology suggests that breast cancer is a group of diseases with different intrinsic molecular subtypes. Anatomic staging system alone is insufficient to provide future outcome information. The American Joint Committee on Cancer (AJCC) expert panel updated the 8th edition of the staging manual with prognostic stage groups by incorporating biomarkers into the anatomic stage groups. In this study, we retrospectively analyzed the data from our center in China using the anatomic and prognostic staging system based on the AJCC 8th edition staging manual. We reviewed the data from January 2008 to December 2014 for cases with Luminal B Human Epidermal Growth Factor Receptor 2 (HER2)-negative breast cancer in our center. All cases were restaged using the AJCC 8th edition anatomic and prognostic staging system. The Kaplan-Meier method and log-rank test were used to compare the survival differences between different subgroups. SPSS software version 19.0 (IBM Corp., Armonk, NY, USA) was used for the statistical analyses. This study consisted of 796 patients with Luminal B HER-negative breast cancer. The 5-year disease-free survival (DFS) of 769 Stage I-III patients was 89.7%, and the 5-year overall survival (OS) of all 796 patients was 91.7%. Both 5-year DFS and 5-year OS were significantly different in the different anatomic and prognostic stage groups. There were 372 cases (46.7%) assigned to a different group. The prognostic Stage II and III patients restaged from anatomic Stage III had significant differences in 5-year DFS (χ2 = 11.319, P= 0.001) and 5-year OS (χ2 = 5.225, P= 0.022). In addition, cases restaged as prognostic Stage I, II, or III from the anatomic Stage II group had statistically significant differences in 5-year DFS (χ2 = 6.510, P= 0.039) but no significant differences in 5-year OS (χ2 = 5.087, P= 0.079). However, the restaged prognostic Stage I and II cases from anatomic Stage I had no statistically significant

  16. Benefit of adjuvant chemotherapy with or without trastuzumab in pT1ab node-negative human epidermal growth factor receptor 2-positive breast carcinomas: results of a national multi-institutional study.

    Science.gov (United States)

    de Nonneville, Alexandre; Gonçalves, Anthony; Zemmour, Christophe; Classe, Jean M; Cohen, Monique; Lambaudie, Eric; Reyal, Fabien; Scherer, Christophe; Muracciole, Xavier; Colombo, Pierre E; Giard, Sylvia; Rouzier, Roman; Villet, Richard; Chopin, Nicolas; Darai, Emile; Garbay, Jean R; Gimbergues, Pierre; Sabiani, Laura; Coutant, Charles; Sabatier, Renaud; Bertucci, François; Boher, Jean M; Houvenaeghel, Gilles

    2017-04-01

    Benefit of adjuvant trastuzumab-based chemotherapy for node-positive and/or >1 cm human epidermal growth factor receptor 2-positive (HER2+) breast carcinomas has been clearly demonstrated in randomized clinical trials. Yet, evidence that adjuvant chemotherapy with or without trastuzumab is effective in pT1abN0 HER2+ tumors is still limited. The primary objective of this study was to investigate the impact of adjuvant chemotherapy ± trastuzumab on outcome in this subpopulation. A total of 356 cases of pT1abN0M0 HER2 + breast cancers were retrospectively identified from a large cohort of 22,334 patients, including 1248 HER2+ patients who underwent primary surgery at 17 French centers, between December 1994 and January 2014. The primary end point was disease-free survival (DFS). A multivariate Cox model was built, including adjuvant chemotherapy, tumor size, hormone receptor status, and Scarff Bloom Richardson (SBR) grade. A total of 138 cases (39%) were treated with trastuzumab-based chemotherapy, 29 (8%) with chemotherapy alone, and 189 (53%) received neither trastuzumab nor chemotherapy. Adjuvant chemotherapy ± trastuzumab was associated with a significant DFS benefit (3-year 99 vs. 90%, and 5-year 96 vs. 84%, Hazard ratio, HR 0.26 [0.10-0.67]; p = 0.003, logrank test) which was maintained in multivariate analysis (HR 0.19 [0.07-0.52]; p = 0.001). Metastasis-free survival was also increased (HR 0.25 [0.07-0.86]; p = 0.018, logrank test) at 3-year (99 vs. 95%) and 5-year (98 vs. 89%) censoring. Exploratory subgroup analysis found DFS benefit to be significant in hormone receptor-negative, hormone receptor-positive, and pT1b tumors, but not in pT1a tumors. Adjuvant chemotherapy ± trastuzumab is associated with a significantly reduced risk of recurrence in subcentimeter node-negative HER2+ breast cancers. Most of the benefit may be driven by pT1b tumors.

  17. The SystHERs registry: an observational cohort study of treatment patterns and outcomes in patients with human epidermal growth factor receptor 2–positive metastatic breast cancer

    International Nuclear Information System (INIS)

    Tripathy, Debu; Lai, Catherine; Masaquel, Anthony; Hurvitz, Sara; Rugo, Hope S; Kaufman, Peter A; Swain, Sandra; O’Shaughnessy, Joyce; Jahanzeb, Mohammad; Mason, Ginny; Beattie, Mary; Yoo, Bongin

    2014-01-01

    Amplification of the human epidermal growth factor receptor 2 (HER2) gene occurs in approximately 20% of invasive breast cancer cases and is associated with a more aggressive disease course than HER2-negative breast cancer. HER2-targeted therapies have altered the natural history of HER2-positive breast cancer, a trend that will likely further improve with the recent approval of new agents. A prospective, observational cohort study was designed and initiated to provide real-world insights into current treatment patterns, long-term survival, and patients’ experiences with initial and subsequent treatments for HER2-positive metastatic breast cancer (MBC). The Systematic Therapies for HER2-positive Metastatic Breast Cancer Study (SystHERs) is a US-based prospective observational cohort study enrolling patients ≥18 years of age with recently diagnosed HER2-positive MBC not previously treated with systemic therapy in the metastatic setting. The primary objective of the study is to identify treatment patterns and clinical outcomes in recently diagnosed patients in a variety of practice settings. Secondary objectives include comparative efficacy, safety, and patient-reported outcomes (PROs). Healthcare resource utilization is an exploratory end point. Tumor tissue and blood sample collection is optional. The SystHERs registry will enroll approximately 1000 patients over a 3-year period, after which the study will continue for ≥5 years, allowing for a maximum follow-up of 8 years. The treating physician will determine all care and the frequency of visits. PRO measures will be completed at study enrollment and every 90 days. Clinical data will be abstracted quarterly from patient records. The first patient was enrolled in June 2012, and preliminary descriptive data based on 25% to 30% of the final study population are expected at the end of 2013, and as of April 25, 2014, 386 patients are enrolled. SystHERs is expected to provide in-depth data on demographic

  18. Epidermal growth factor receptor expression in urinary bladder cancer

    Directory of Open Access Journals (Sweden)

    Dayalu S.L. Naik

    2011-01-01

    Full Text Available Objective : To evaluate the expression pattern of epidermal growth factor receptor (EGFR in urinary bladder cancer and its association with human epidermal growth factor receptor 2 (HER2, epidermal growth factor (EGF, interleukin-6 (IL-6, and high risk human papilloma virus (HPV types 16 and 18. Materials and Methods : Thirty cases of urothelial carcinoma were analyzed. EGFR, HER2, EGF, and IL-6 expressions in the tissue were evaluated by immunohistochemical staining. For HPV, DNA from tissue samples was extracted and detection of HPV was done by PCR technique. Furthermore, evaluation of different intracellular molecules associated with EGFR signaling pathways was performed by the western blot method using lysates from various cells and tissues. Results : In this study, the frequencies of immunopositivity for EGFR, HER2, EGF, and IL-6 were 23%, 60%, 47%, and 80%, respectively. No cases were positive for HPV-18, whereas HPV-16 was detected in 10% cases. Overall, expression of EGFR did not show any statistically significant association with the studied parameters. However, among male patients, a significant association was found only between EGFR and HER2. Conclusions : Overexpression of EGFR and/or HER2, two important members of the same family of growth factor receptors, was observed in a considerable proportion of cases. Precise knowledge in this subject would be helpful to formulate a rational treatment strategy in patients with urinary bladder cancer.

  19. Cholera toxin B subunit-binding and ganglioside GM1 immuno-expression are not necessarily correlated in human salivary glands

    DEFF Research Database (Denmark)

    Kirkeby, Svend

    2014-01-01

    human submandibular, parotid and palatinal glands using cholera toxin sub-unit B and two polyclonal antibodies against ganglioside GM1 as biomarkers. RESULTS: Immunofluorescence microscopy showed that the toxin and antibodies were co-localized in some acini but not in others. The cholera toxin mainly...... reacted with the cell membranes of the mucous acini in the submandibular gland, while incubation with the antibody against GM1 gave rise to a staining of the cytoplasm. The cytoplasm in some secretory acinar cells in the parotid gland was stained by the cholera toxin, whereas only small spots...... on the plasma membranes reacted with anti-GM1. The plasma membranes in the parotid excretory ducts appeared to react to anti-GM1, but not to cholera toxin. CONCLUSIONS: Cholera toxin induces the expression of ion channels and carriers in the small intestine and increases the production of secretory mucins...

  20. Imaging of the major salivary glands

    DEFF Research Database (Denmark)

    Afzelius, Pia; Nielsen, Ming-Yuan; Ewertsen, Caroline

    2016-01-01

    The major salivary glands, submandibular, parotid and sublingual glands play an important role in preserving the oral cavity and dental health. Patients with problems of the major salivary glands may present with symptoms such as dry mouth, dysphagia and obstruction of duct, inflammation, severe...

  1. Cetuximab in the treatment of metastatic mucoepidermoid carcinoma of the salivary glands: A case report and review of literature

    Directory of Open Access Journals (Sweden)

    Grisanti Salvatore

    2008-09-01

    Full Text Available Abstract Introduction Patients with metastatic mucoepidermoid carcinoma of salivary glands have a poor outcome. The epidermal growth factor receptor protein is overexpressed in approximately 70% of mucoepidermoid carcinoma patients and may represent a therapeutic target. However, whether treatment with anti-epidermal growth factor receptor agents is effective is unclear and clinical trials are difficult due to the rarity of the disease. Here we assessed the activity of cetuximab in mucoepidermoid carcinoma on a molecular basis. Case presentation We present the case of a 40-year old Caucasian man with a mucoepidermoid carcinoma of the major salivary glands who developed distant bone and visceral metastases despite platinum-based chemotherapy. Epidermal growth factor receptor was overexpressed and fluorescence in situ hybridization analysis demonstrated a chromosome 7 polysomy. The patient was treated with the monoclonal antibody cetuximab in combination with cisplatin. After 11 doses of cetuximab, the patient developed brain metastases but evidence of response was documented at all extracranial metastatic sites. Conclusion This case report indicates that cetuximab can be active in mucoepidermoid carcinoma and may restore sensitivity to cisplatin in platinum-treated patients. Cetuximab does not cross the blood brain barrier and may select a metastatic clone to home the central nervous system while responding at other sites.

  2. Characterization of salivary alpha-amylase binding to Streptococcus sanguis

    International Nuclear Information System (INIS)

    Scannapieco, F.A.; Bergey, E.J.; Reddy, M.S.; Levine, M.J.

    1989-01-01

    The purpose of this study was to identify the major salivary components which interact with oral bacteria and to determine the mechanism(s) responsible for their binding to the bacterial surface. Strains of Streptococcus sanguis, Streptococcus mitis, Streptococcus mutans, and Actinomyces viscosus were incubated for 2 h in freshly collected human submandibular-sublingual saliva (HSMSL) or parotid saliva (HPS), and bound salivary components were eluted with 2% sodium dodecyl sulfate. By sodium dodecyl sulfate-polyacrylamide gel electrophoresis and Western transfer, alpha-amylase was the prominent salivary component eluted from S. sanguis. Studies with 125 I-labeled HSMSL or 125 I-labeled HPS also demonstrated a component with an electrophoretic mobility identical to that of alpha-amylase which bound to S. sanguis. Purified alpha-amylase from human parotid saliva was radiolabeled and found to bind to strains of S. sanguis genotypes 1 and 3 and S. mitis genotype 2, but not to strains of other species of oral bacteria. Binding of [ 125 I]alpha-amylase to streptococci was saturable, calcium independent, and inhibitable by excess unlabeled alpha-amylases from a variety of sources, but not by secretory immunoglobulin A and the proline-rich glycoprotein from HPS. Reduced and alkylated alpha-amylase lost enzymatic and bacterial binding activities. Binding was inhibited by incubation with maltotriose, maltooligosaccharides, limit dextrins, and starch

  3. Consistent absence of BRAF mutations in salivary gland carcinomas

    Directory of Open Access Journals (Sweden)

    Nooshin Mohtasham

    2017-06-01

    Full Text Available Introduction: Malignant salivary gland tumors are rare entities. Despite advances in surgery, radiation therapy and chemotherapy, the rate of the mortality and five-year survival has not been improved markedly over the last few decades. The activation of EGFR- RAS-RAF signaling pathway contributes to the initiation and progression of many human cancers, promising a key pathway for therapeutic molecules. Thus, the objective of this study was to evaluate BRAF mutations in salivary gland carcinomas. Methods: We designed PCR- RFLP (Polymerase Chain Reaction -Restriction Fragment Length Polymorphism and screened 50 salivary gland carcinomas (SGCs including mucoepidermoid carcinoma (MEC, adenoid cystic carcinoma (AdCC and polymorphous low grade adenocarcinoma (PLGA for the BRAF V600E mutation. Results: PCR-RFLP analyses demonstrated no mutation in BRAF exon 15 for SGC samples at position V600, which is the most commonly mutated site for BRAF in human cancer. Conclusions: According to our results SGCs didn’t acquire BRAF mutations that result in a constitutive activation of the signaling cascade downstream of EGFR, hence SGCs can be a good candidate for anti EGFR therapies.

  4. Evaluation of Salivary Vitamin C and Catalase in HIV Positive and Healthy HIV Negative Control Group.

    Science.gov (United States)

    Ahmadi-Motamayel, Fatemeh; Vaziri-Amjad, Samaneh; Goodarzi, Mohammad Taghi; Poorolajal, Jalal

    2017-01-01

    Saliva is a complex oral biologic fluid secreted by major and minor salivary glands. Saliva has immunological, enzymatic and antioxidant defense mechanisms. Infection with human immunodeficiency virus (HIV) is a life-threatening disease. The aim of this study was to evaluate salivary vitamin C and catalase levels in HIV-positive patients in comparison to a healthy control group. Forty-nine HIV-infected individuals and 49 healthy subjects were selected. Five mL of unstimulated saliva was collected in 5 minutes using a sterilized Falcon tube with Navazesh method. Catalase and vitamin C levels were assessed by spectrophotometric assay. Data were analyzed with STATA 12. Salivary catalase levels were 7.99±2.40 and 8.37±1.81 in the case and control groups, respectively. Catalase level was lower in the case group but the difference was not statistically significant (P=0.380). Salivary vitamin C levels in the case and control groups were 3.76±1.92 and 4.87±2.20, respectively (P=0.009). HIV can alter salivary antioxidant capacity as well as vitamin C and catalase levels. Saliva may reflect serum antioxidative changes in these patients. Therefore, further research is necessary on salivary and serum oxidants and the antioxidant changes. Copyright© Bentham Science Publishers; For any queries, please email at epub@benthamscience.org.

  5. Clonal proliferation of multipotent stem/progenitor cells in the neonatal and adult salivary glands

    International Nuclear Information System (INIS)

    Kishi, Teruki; Takao, Tukasa; Fujita, Kiyohide; Taniguchi, Hideki

    2006-01-01

    Salivary gland stem/progenitor cells are thought to be present in intercalated ductal cells, but the fact is unclear. In this study, we sought to clarify if stem/progenitor cells are present in submandibular glands using colony assay, which is one of the stem cell assay methods. Using a low-density culture of submandibular gland cells of neonatal rats, we developed a novel culture system that promotes single cell colony formation. Average doubling time for the colony-forming cells was 24.7 (SD = ±7.02) h, indicating high proliferative potency. When epidermal growth factor (EGF) and hepatocyte growth factor (HGF) were added to the medium, the number of clonal colonies increased greater than those cultured without growth factors (13.2 ± 4.18 vs. 4.5 ± 1.73). The RT-PCR and immunostaining demonstrated expressing acinar, ductal, and myoepithelial cell lineage markers. This study demonstrated the presence of the salivary gland stem/progenitor cells that are highly proliferative and multipotent in salivary glands

  6. Double emulsion electrospun nanofibers as a growth factor delivery vehicle for salivary gland regeneration

    Science.gov (United States)

    Foraida, Zahraa I.; Sharikova, Anna; Peerzada, Lubna N.; Khmaladze, Alexander; Larsen, Melinda; Castracane, James

    2017-08-01

    Sustained delivery of growth factors, proteins, drugs and other biologically active molecules is necessary for tissue engineering applications. Electrospun fibers are attractive tissue engineering scaffolds as they partially mimic the topography of the extracellular matrix (ECM). However, they do not provide continuous nourishment to the tissue. In search of a biomimetic scaffold for salivary gland tissue regeneration, we previously developed a blend nanofiber scaffold composed of the protein elastin and the synthetic polymer polylactic-co-glycolic acid (PLGA). The nanofiber scaffold promoted in vivo-like salivary epithelial cell tissue organization and apicobasal polarization. However, in order to enhance the salivary cell proliferation and biomimetic character of the scaffold, sustained growth factor delivery is needed. The composite nanofiber scaffold was optimized to act as a growth factor delivery system using epidermal growth factor (EGF) as a model protein. The nanofiber/EGF hybrid nanofibers were synthesized by double emulsion electrospinning where EGF is emulsified within a water/oil/water (w/o/w) double emulsion system. Successful incorporation of EGF was confirmed using Raman spectroscopy. EGF release profile was characterized using enzyme-linked immunosorbent assay (ELIZA) of the EGF content. Double emulsion electrospinning resulted in slower release of EGF. We demonstrated the potential of the proposed double emulsion electrospun nanofiber scaffold for the delivery of growth factors and/or drugs for tissue engineering and pharmaceutical applications.

  7. An Epidermal Biosensor for Carcinoembryonic Antigen

    National Research Council Canada - National Science Library

    Schwartz, Pauline

    2001-01-01

    ...). An epidermal biosensor is a new approach for the early continuous, in vivo detection of the onset of disease by the using genetically modified skin cells to respond to molecules secreted by tumor cells...

  8. An Epidermal Biosensor for Carcinoembryonic Antigen

    National Research Council Canada - National Science Library

    Schwartz, Pauline

    2003-01-01

    ...) An epidermal biosensor was conceived as a new approach for the early continuous, in vivo detection of the onset of disease by the using genetically modified skin cells to respond to molecules secreted by tumor cells...

  9. Epidermal growth in the bottlenose dolphin, Tursiops truncatus

    International Nuclear Information System (INIS)

    Hicks, B.D.; St Aubin, D.J.; Geraci, J.R.; Brown, W.R.

    1985-01-01

    Epidermal growth in two mature female bottlenose dolphins, Tursiops truncatus, was investigated by following the movement of a cohort of tritiated thymidine-labeled epidermal cells for 59 days. The majority of the cells migrated in a cluster which was estimated to reach the skin surface in 73 days. The authors calculate that the outermost cell layer is sloughed 12 times per day. Turnover time and sloughing rate are estimated to be 1.7 times longer and 8.5 times faster than the respective values for epidermal cell kinetics in humans. This apparent inconsistency of slow transit time and rapid sloughing rate is reconciled by the convoluted structure of the stratum germinativum in the dolphin which results in a ratio of germinatival to superficial cells of 876:1. The stratum germinativum of dolphin epidermis appears to lack morphologically distinct, spatially segregated subpopulations of anchoring and stem cells. Dolphin epidermis has a large capacity for cell population, relatively long turnover time, and rapid sloughing rate. The adaptive advantages of these characteristics are discussed

  10. Epidermal growth in the bottlenose dolphin, Tursiops truncatus

    Energy Technology Data Exchange (ETDEWEB)

    Hicks, B.D.; St. Aubin, D.J.; Geraci, J.R.; Brown, W.R.

    1985-07-01

    Epidermal growth in two mature female bottlenose dolphins, Tursiops truncatus, was investigated by following the movement of a cohort of tritiated thymidine-labeled epidermal cells for 59 days. The majority of the cells migrated in a cluster which was estimated to reach the skin surface in 73 days. The authors calculate that the outermost cell layer is sloughed 12 times per day. Turnover time and sloughing rate are estimated to be 1.7 times longer and 8.5 times faster than the respective values for epidermal cell kinetics in humans. This apparent inconsistency of slow transit time and rapid sloughing rate is reconciled by the convoluted structure of the stratum germinativum in the dolphin which results in a ratio of germinatival to superficial cells of 876:1. The stratum germinativum of dolphin epidermis appears to lack morphologically distinct, spatially segregated subpopulations of anchoring and stem cells. Dolphin epidermis has a large capacity for cell population, relatively long turnover time, and rapid sloughing rate. The adaptive advantages of these characteristics are discussed.

  11. Epidermal growth factor in the rat prostate

    DEFF Research Database (Denmark)

    Tørring, Niels; Jørgensen, P E; Poulsen, Steen Seier

    1998-01-01

    Epidermal growth factor (EGF) induces proliferation in prostate epithelial and stromal cells in primary culture. This investigation was set up to characterize the time and spatial expression of EGF in the rat prostate.......Epidermal growth factor (EGF) induces proliferation in prostate epithelial and stromal cells in primary culture. This investigation was set up to characterize the time and spatial expression of EGF in the rat prostate....

  12. Foliar Epidermal Studies of Plants in Euphorbiaceae

    Directory of Open Access Journals (Sweden)

    H. A. Thakur

    2014-03-01

    Full Text Available This paper describes foliar epidermal structure in 17 species belonging to 17 genera of the family Euphoprbiaceae. Anomocytic stomata is predominant, rarely they are anisocytic, paracytic on the same foliar surface with different combinations. Leaves are hypostomatic and rarely amphistomatic. The foliar surface is smooth, rarely striated. The foliar epidermal cell walls are straight or undulate. Distribution of stomata, stomatal index, stomatal frequency, stomatal size and other cell wall contours are described in detail.

  13. Epidermal Inclusion Cysts of The Breast

    Directory of Open Access Journals (Sweden)

    Amir R. Motabar

    2009-02-01

    Full Text Available Epidermal inclusion cysts are uncommon in the breast, but the consequences can besevere when these cysts occur in the breast parenchyma. Here,we report two suchcases. The patient in case 1 was an 37-year-old woman with a 3-cm palpable mass inthe right breast. Mammography revealed a round and smoothly outlined mass, whichindicated a benign tumor, and sonography showed an irregularly shaped and heterogeneoushypoechoic mass, fibroadenoma was suspected on the basis of clinical andimage findings, but excisional biopsy revealed an epidermal inclusion cyst. The patientin case 2 was a 50-year-old woman with a 2.5-cm lesion in the left breast. Mammographyrevealed a round, dense, smoothly outlined mass, and sonography showeda well-defined, central hyperechoic mass. . Breast cancer was suspected on the basisof the sonographic findings and the age of the patient, but the resected specimen revealedan epidermal inclusion cyst. Although epidermal inclusion cysts are benign,occasionally they may play a role in the origin of squamous carcinoma of the breast. .Mammographic and sonographic features of an epidermal cyst may mimic a malignantlesion. Malignant change appears to occur more frequently in epidermal inclusioncysts in the mammary gland, compared to common epidermal inclusion cysts,and this may be associated with origination of mammary epidermal inclusion cystsfrom squamous metaplasia of the mammary duct epithelium.Epidermmoid inclusion cyst of the breast is potentially serious, although such cystsare rare, and differentiation from a malignant or benign breast tumor is required. Excisionis probably the most appropriate treatment, and can eliminate the possible riskof malignant transformation.

  14. A review of toxic epidermal necrolysis management in Japan

    Directory of Open Access Journals (Sweden)

    Yuri Kinoshita

    2017-01-01

    Full Text Available Toxic epidermal necrolysis (TEN is a severe adverse drug reaction characterized by necrosis of the epidermis. Its incidence is approximately 1 per million a year and average mortality rate is high at 25–50%. TEN has a flu-like prodrome, followed by atypical, targetoid erythematous or purpuric macules on the skin. These macules coalesce to form flaccid blisters that slough off as areas of epidermal necrosis. Drugs such as allopurinol, sulfonamides, and carbamazepine are the most common causes. The human leukocyte antigen (HLA-B*15:02 in Asians being administered carbamazepine and the HLA-B*58:01 antigen in patients of all ethnicities being administered allopurinol are known to be high-risk factors. Rapid diagnosis, discontinuation of the causative drug, and supportive treatment are essential for better prognosis and improvement of sequelae. Till now, systemic corticosteroids and intravenous immunoglobulins have been used as the most common active interventions; however, no gold standard has been established. In Japan, physicians follow a unique diagnostic criteria and treatment guideline to improve the diagnosis rate and streamline treatments. This may be a contributing factor for the lower mortality rate (14.3%. The efficacy of systemic corticosteroids, immunoglobulins, and plasmapheresis may have been beneficial as well. In Japan, TEN is defined as an epidermal detachment of over 10% of the body surface area (BSA, while the globally accepted definition established by Bastuji-Garin describes it as an epidermal detachment of over 30% of the BSA. In Japanese individuals, HLA-A*02:06, HLA-A*02:07, HLA-A*31:01 and HLA-B*51:01 may be linked to higher risks of TEN.

  15. Commonly Employed African Neonatal Skin Care Products Compromise Epidermal Function in Mice.

    Science.gov (United States)

    Man, Mao-Qiang; Sun, Richard; Man, George; Lee, Dale; Hill, Zelee; Elias, Peter M

    2016-09-01

    Neonatal mortality is much higher in the developing world than in developed countries. Infections are a major cause of neonatal death, particularly in preterm infants, in whom defective epidermal permeability barrier function facilitates transcutaneous pathogen invasion. The objective was to determine whether neonatal skin care products commonly used in Africa benefit or compromise epidermal functions in murine skin. After twice-daily treatment of 6- to 8-week-old hairless mice with each skin care product for 3 days, epidermal permeability barrier function, skin surface pH, stratum corneum hydration, and barrier recovery were measured using a multiprobe adapter system physiology monitor. For products showing some benefits in these initial tests, the epidermal permeability barrier homeostasis was assessed 1 and 5 hours after a single application to acutely disrupted skin. All of the skin care products compromised basal permeability barrier function and barrier repair kinetics. Moreover, after 3 days of treatment, most of the products also reduced stratum corneum hydration while elevating skin surface pH to abnormal levels. Some neonatal skin care products that are widely used in Africa perturb important epidermal functions, including permeability barrier homeostasis in mice. Should these products have similar effects on newborn human skin, they could cause a defective epidermal permeability barrier, which can increase body fluid loss, impair thermoregulation, and contribute to the high rates of neonatal morbidity and mortality seen in Africa. Accordingly, alternative products that enhance permeability barrier function should be identified, particularly for use in preterm infants. © 2016 Wiley Periodicals, Inc.

  16. Iatrogenic causes of salivary gland dysfunction

    International Nuclear Information System (INIS)

    Schubert, M.M.; Izutsu, K.T.

    1987-01-01

    Saliva is important for maintaining oral health and function. There are instances when medical therapy is intended to decrease salivary flow, such as during general anesthesia, but most instances of iatrogenic salivary gland dysfunction represent untoward or unavoidable side-effects. The clinical expression of the salivary dysfunction can range from very minor transient alteration in saliva flow to a total loss of salivary function. The most common forms of therapy that interfere with salivation are drug therapies, cancer therapies (radiation or chemotherapy), and surgical therapy. These therapies can affect salivation by a number of different mechanisms that include: disruption of autonomic nerve function related to salivation, interference with acinar or ductal cell functions related to salivation, cytotoxicity, indirect effects (vasoconstriction/dilation, fluid and electrolyte balance, etc.), and physical trauma to salivary glands and nerves. A wide variety of drugs is capable of increasing or decreasing salivary flow by mimicking autonomic nervous system actions or by directly acting on cellular processes necessary for salivation: drugs can also indirectly affect salivation by altering fluid and electrolyte balance or by affecting blood flow to the glands. Ionizing radiation can cause permanent damage to salivary glands, damage that is manifest as acinar cell destruction with subsequent atrophy and fibrosis of the glands. Cancer chemotherapy can cause changes in salivation, but the changes are usually much less severe and only transient. Finally, surgical and traumatic injuries interfere with salivation because of either disruption of gland innervation or gross physical damage (or removal) of glandular tissue (including ducts)

  17. K5/K14-positive cells contribute to salivary gland-like breast tumors with myoepithelial differentiation

    DEFF Research Database (Denmark)

    Boecker, Werner; Stenman, Goeran; Loening, Thomas

    2013-01-01

    different cell lineages and define their cellular hierarchy in tumors with myoepithelial differentiation. isTILT analysis of a series of 28 breast, salivary, and lacrimal gland tumors, including pleomorphic adenomas (n=8), epithelial-myoepithelial tumors (n=9), and adenoid cystic carcinomas (n=11) revealed...... heterologeous cell differentiations such as squamous and mesenchymal progenies. p63 was co-expressed with K5/K14 in basal-like progenitor cells, myoepithelial, and squamous cells but not in glandular cells. Our results show that the corresponding counterpart tumors of breast and salivary/lacrimal glands have....... For that reason, we performed an in situ triple immunofluorescence lineage/differentiation tracing (isTILT) and qRT-PCR study of basal (K5/K14), glandular (K7/K8/18), and epidermal-specific squamous (K10) keratins, p63, and smooth muscle actin (SMA; myoepithelial marker) with the aim to construct and trace...

  18. [Salivary gland drainage into the thyroglossal duct].

    Science.gov (United States)

    Siem, G; Natvig, K; Kolbenstvedt, A; Lømo, J

    2001-01-20

    Failure in regression of the thyroglossal duct is one of the most common reasons for midline swellings in the neck. Several authors have described recurrent thyroglossal duct remnants with persisting draining sinuses. However, few have described accessory salivary glands that drain into the thyroglossal duct. In this article we report two such cases with midline salivary glands in the floor of the mouth. These two patients were subsequently successfully treated with radical tissue resection in the area between the hyoid bone and foramen cecum. Preoperative fistulography or sinography was useful to demonstrate the ductal ramification of the salivary glands, and use of methylene blue during surgery proved of significant value for the result.

  19. Seasonal Variation in Human Salivary Cortisol Concentration

    DEFF Research Database (Denmark)

    Persson, Roger; Garde, Anne Helene; Hansen, Åse Marie

    2008-01-01

    Measurement of cortisol concentration can contribute important information about an individual's ability to adjust to various environmental demands of both physical and psychosocial origin. However, one uncertainty that affects the possibilities of correctly interpreting and designing field studies...... is the lack of observations of the impact of seasonal changes on cortisol excretion. For this reason, the month-to-month changes in diurnal cortisol concentration, the awakening cortisol response (ACR), maximum morning concentration, and fall during the day were studied in a group of 24 healthy men and women...... 32 to 61 yrs of age engaged in active work. On one workday for 12 consecutive months, participants collected saliva at four time points for determination of cortisol: at awakening, +30 min, +8 h, and at 21:00 h. Data were analyzed by a repeated measures design with month (12 levels) and time...

  20. Hybrid Enhanced Epidermal SpaceSuit Design Approaches

    Science.gov (United States)

    Jessup, Joseph M.

    A Space suit that does not rely on gas pressurization is a multi-faceted problem that requires major stability controls to be incorporated during design and construction. The concept of Hybrid Epidermal Enhancement space suit integrates evolved human anthropomorphic and physiological adaptations into its functionality, using commercially available bio-medical technologies to address shortcomings of conventional gas pressure suits, and the impracticalities of MCP suits. The prototype HEE Space Suit explored integumentary homeostasis, thermal control and mobility using advanced bio-medical materials technology and construction concepts. The goal was a space suit that functions as an enhanced, multi-functional bio-mimic of the human epidermal layer that works in attunement with the wearer rather than as a separate system. In addressing human physiological requirements for design and construction of the HEE suit, testing regimes were devised and integrated into the prototype which was then subject to a series of detailed tests using both anatomical reproduction methods and human subject.

  1. Automated-immunosensor with centrifugal fluid valves for salivary cortisol measurement

    Directory of Open Access Journals (Sweden)

    Masaki Yamaguchi

    2014-08-01

    Full Text Available Point-of-care measurement of the stress hormone cortisol will greatly facilitate the timely diagnosis and management of stress-related disorders. We describe an automated salivary cortisol immunosensor, incorporating centrifugal fluid valves and a disposable disc-chip that allows for truncated reporting of cortisol levels (<15 min. The performance characteristics of the immunosensor are optimized through select blocking agents to prevent the non-specific adsorption of proteins; immunoglobulin G (IgG polymer for the pad and milk protein for the reservoirs and the flow channels. Incorporated centrifugal fluid valves allow for rapid and repeat washings to remove impurities from the saliva samples. An optical reader and laptop computer automate the immunoassay processes and provide easily accessible digital readouts of salivary cortisol measurements. Linear regression analysis of the calibration curve for the cortisol immunosensor showed 0.92 of coefficient of multiple determination, R2, and 38.7% of coefficient of variation, CV, for a range of salivary cortisol concentrations between 0.4 and 11.3 ng/mL. The receiver operating characteristic (ROC curve analysis of human saliva samples indicate potential utility for discriminating stress disorders and underscore potential application of the biosensor in stress disorders. The performance of our salivary cortisol immunosensor approaches laboratory based tests and allows noninvasive, quantitative, and automated analysis of human salivary cortisol levels with reporting times compatible with point-of-care applications. Keywords: Immunosensor, Centrifugal fluid valve, Automation, Cortisol, Saliva

  2. ADVANCES IN SALIVARY GLAND GENE THERAPY – ORAL AND SYSTEMIC IMPLICATIONS

    Science.gov (United States)

    Baum, Bruce J.; Alevizos, Ilias; Chiorini, John A.; Cotrim, Ana P.; Zheng, Changyu

    2016-01-01

    Introduction Much research demonstrates the feasibility and efficacy of gene transfer to salivary glands. Recently, the first clinical trial targeting a salivary gland was completed, yielding positive safety and efficacy results. Areas covered There are two major disorders affecting salivary glands; radiation damage following treatment for head and neck cancers and Sjögren’s syndrome. Salivary gland gene transfer has also been employed in preclinical studies using transgenic secretory proteins for exocrine (upper gastrointestinal tract) and endocrine (systemic) applications. Expert opinion Salivary gland gene transfer is safe and can be beneficial in humans. Applications to treat and prevent radiation damage show considerable promise. A first-in-human clinical trial for the former was recently successfully completed. Studies on Sjögren’s syndrome suffer from an inadequate understanding of its etiology. Proof of concept in animal models has been shown for exocrine and endocrine disorders. Currently, the most promising exocrine application is for the management of obesity. Endocrine applications are limited, as it is currently impossible to predict if systemically required transgenic proteins will be efficiently secreted into the bloodstream. This results from not understanding of how secretory proteins are sorted. Future studies will likely employ ultrasound assisted and pseudotyped adenoassociated viral vector-mediated gene. PMID:26149284

  3. Immunochromatographic assay using gold nanoparticles for measuring salivary secretory IgA in dogs as a stress marker

    Directory of Open Access Journals (Sweden)

    Aki Takahashi, Shigeru Uchiyama, Yuya Kato, Teruko Yuhi, Hiromi Ushijima, Makoto Takezaki, Toshihiro Tominaga, Yoshiko Moriyama, Kunio Takeda, Toshiro Miyahara and Naoki Nagatani

    2009-01-01

    Full Text Available The concentration of salivary secretory immunoglobulin A (sIgA is a well-known stress marker for humans. The concentration of salivary sIgA in dogs has also been reported as a useful stress marker. In addition, salivary sIgA in dogs has been used to determine the adaptive ability of dogs for further training. There are conventional procedures based on enzyme-linked immunosorbent assay (ELISA for measuring salivary sIgA in dogs. However, ELISA requires long assay time, complicated operations and is costly. In the present study, we developed an immunochromatographic assay for measuring salivary sIgA in dogs using a dilution buffer containing a non-ionic surfactant. We determined 2500-fold dilution as the optimum condition for dog saliva using a phosphate buffer (50 mM, pH 7.2 containing non-ionic surfactant (3 wt% Tween 20. The results obtained from the saliva samples of three dogs using immunochromatographic assay were compared with those obtained from ELISA. It was found that the immunochromatographic assay is applicable to judge the change in salivary sIgA in each dog. The immunochromatographic assay for salivary sIgA in dogs is a promising tool, which should soon become commercially available for predicting a dog's psychological condition and estimating adaptive ability for training as guide or police dogs.

  4. Ixeris dentata extract regulates salivary secretion through the activation of aquaporin-5 and prevents diabetes-induced xerostomia.

    Science.gov (United States)

    Bhattarai, Kashi Raj; Lee, Sang-Won; Kim, Seung Hyun; Kim, Hyung-Ryong; Chae, Han-Jung

    2017-01-01

    The aim of this study was to investigate the effects of Ixeris dentata (IXD) extract to improve the salivation rate in dry mouth induced by diabetes. Both control and diabetic rats were treated with a sublingual spray of either water or IXD extract to determine the effects of IXD on salivation. During the study, we observed that IXD extract treatment increased the salivary flow rate in diabetic rats. The expression of α-amylase was increased significantly in both saliva and glandular tissue lysates of IXD-treated diabetic rats. Aquaporin-5 protein expression was abnormally low in the salivary glands of diabetic rats, which increased hyposalivation and led to salivary dysfunction. However, a single oral spray of IXD extract drastically increased the expression of aquaporin-5 in salivary gland acinar and ductal cells in diabetic rats. Moreover, IXD extract induced expression of Na + /H + exchangers in the salivary gland, which suggests that Na + /H + exchangers modulate salivary secretions and aid in the fluid-secretion mechanism. Furthermore, transient treatment with IXD extract increased the intracellular calcium in human salivary gland cells. Taken together, these results suggest the potential value of an IXD extract for the treatment of diabetes-induced hyposalivation and xerostomia.

  5. Immunochromatographic assay using gold nanoparticles for measuring salivary secretory IgA in dogs as a stress marker

    International Nuclear Information System (INIS)

    Takahashi, Aki; Kato, Yuya; Takezaki, Makoto; Tominaga, Toshihiro; Moriyama, Yoshiko; Takeda, Kunio; Miyahara, Toshiro; Nagatani, Naoki; Uchiyama, Shigeru; Yuhi, Teruko; Ushijima, Hiromi

    2009-01-01

    The concentration of salivary secretory immunoglobulin A (sIgA) is a well-known stress marker for humans. The concentration of salivary sIgA in dogs has also been reported as a useful stress marker. In addition, salivary sIgA in dogs has been used to determine the adaptive ability of dogs for further training. There are conventional procedures based on enzyme-linked immunosorbent assay (ELISA) for measuring salivary sIgA in dogs. However, ELISA requires long assay time, complicated operations and is costly. In the present study, we developed an immunochromatographic assay for measuring salivary sIgA in dogs using a dilution buffer containing a non-ionic surfactant. We determined 2500-fold dilution as the optimum condition for dog saliva using a phosphate buffer (50 mM, pH 7.2) containing non-ionic surfactant (3 wt% Tween 20). The results obtained from the saliva samples of three dogs using immunochromatographic assay were compared with those obtained from ELISA. It was found that the immunochromatographic assay is applicable to judge the change in salivary sIgA in each dog. The immunochromatographic assay for salivary sIgA in dogs is a promising tool, which should soon become commercially available for predicting a dog's psychological condition and estimating adaptive ability for training as guide or police dogs.

  6. Immunochromatographic assay using gold nanoparticles for measuring salivary secretory IgA in dogs as a stress marker

    Science.gov (United States)

    Takahashi, Aki; Uchiyama, Shigeru; Kato, Yuya; Yuhi, Teruko; Ushijima, Hiromi; Takezaki, Makoto; Tominaga, Toshihiro; Moriyama, Yoshiko; Takeda, Kunio; Miyahara, Toshiro; Nagatani, Naoki

    2009-06-01

    The concentration of salivary secretory immunoglobulin A (sIgA) is a well-known stress marker for humans. The concentration of salivary sIgA in dogs has also been reported as a useful stress marker. In addition, salivary sIgA in dogs has been used to determine the adaptive ability of dogs for further training. There are conventional procedures based on enzyme-linked immunosorbent assay (ELISA) for measuring salivary sIgA in dogs. However, ELISA requires long assay time, complicated operations and is costly. In the present study, we developed an immunochromatographic assay for measuring salivary sIgA in dogs using a dilution buffer containing a non-ionic surfactant. We determined 2500-fold dilution as the optimum condition for dog saliva using a phosphate buffer (50 mM, pH 7.2) containing non-ionic surfactant (3 wt% Tween 20). The results obtained from the saliva samples of three dogs using immunochromatographic assay were compared with those obtained from ELISA. It was found that the immunochromatographic assay is applicable to judge the change in salivary sIgA in each dog. The immunochromatographic assay for salivary sIgA in dogs is a promising tool, which should soon become commercially available for predicting a dog's psychological condition and estimating adaptive ability for training as guide or police dogs.

  7. Immunochromatographic assay using gold nanoparticles for measuring salivary secretory IgA in dogs as a stress marker

    Energy Technology Data Exchange (ETDEWEB)

    Takahashi, Aki; Kato, Yuya; Takezaki, Makoto; Tominaga, Toshihiro; Moriyama, Yoshiko; Takeda, Kunio; Miyahara, Toshiro; Nagatani, Naoki [Department of Applied Chemistry, Graduate School of Engineering, Okayama University of Science, 1-1 Ridai-cho, Kita-ku, Okayama 700-0005 (Japan); Uchiyama, Shigeru [Okayama University of Science Specialized Training College, 8-3 Handa-cho, Kita-ku, Okayama 700-0003 (Japan); Yuhi, Teruko; Ushijima, Hiromi, E-mail: nagatani@dac.ous.ac.j [Biodevicetechnology Ltd. 2-13 Asahidai, Nomi-City, Ishikawa 923-1211 (Japan)

    2009-06-15

    The concentration of salivary secretory immunoglobulin A (sIgA) is a well-known stress marker for humans. The concentration of salivary sIgA in dogs has also been reported as a useful stress marker. In addition, salivary sIgA in dogs has been used to determine the adaptive ability of dogs for further training. There are conventional procedures based on enzyme-linked immunosorbent assay (ELISA) for measuring salivary sIgA in dogs. However, ELISA requires long assay time, complicated operations and is costly. In the present study, we developed an immunochromatographic assay for measuring salivary sIgA in dogs using a dilution buffer containing a non-ionic surfactant. We determined 2500-fold dilution as the optimum condition for dog saliva using a phosphate buffer (50 mM, pH 7.2) containing non-ionic surfactant (3 wt% Tween 20). The results obtained from the saliva samples of three dogs using immunochromatographic assay were compared with those obtained from ELISA. It was found that the immunochromatographic assay is applicable to judge the change in salivary sIgA in each dog. The immunochromatographic assay for salivary sIgA in dogs is a promising tool, which should soon become commercially available for predicting a dog's psychological condition and estimating adaptive ability for training as guide or police dogs.

  8. Adrenergic effects on exocrine secretion of rat submandibular epidermal growth factor

    DEFF Research Database (Denmark)

    Poulsen, Steen Seier; Nexø, Ebba

    1984-01-01

    The present study was undertaken to investigate the effect of alpha- and beta-adrenergic agonists on secretion of epidermal growth factor (EGF) from the rat submandibular glands and to test the possibility of intestinal absorption of EGF. Alpha-adrenergic agonists increased the concentration...... of salivary EGF by approximately a hundred times, while the serum concentration of EGF was unchanged. The contents of EGF in the submandibular glands decreased upon administration of the alpha-adrenergic agonist noradrenaline, and this was confirmed on immunohistochemical investigation of the glands. Beta-adrenergic....... This study shows that alpha-adrenergic agonists stimulate exocrine secretion of submandibular EGF and that EGF in physiological amounts are not absorbed in the gastrointestinal tract....

  9. Salivary biomarkers for dental caries.

    Science.gov (United States)

    Gao, Xiaoli; Jiang, Shan; Koh, David; Hsu, Chin-Ying Stephen

    2016-02-01

    As a highly prevalent multifactorial disease, dental caries afflicts a large proportion of the world's population. As teeth are constantly bathed in saliva, the constituents and properties of this oral fluid play an essential role in the occurrence and progression of dental caries. Various inorganic (water and electrolytes) and organic (proteins and peptides) components may protect teeth from dental caries. This occurs via several functions, such as clearance of food debris and sugar, aggregation and elimination of microorganisms, buffering actions to neutralize acid, maintaining supersaturation with respect to tooth mineral, participation in formation of the acquired pellicle and antimicrobial defense. Modest evidence is available on the associations between dental caries and several salivary parameters, including flow rate, buffering capacity and abundance of mutans streptococci. Despite some controversial findings, the main body of the literature supports an elevated caries prevalence and/or incidence among people with a pathologically low saliva flow rate, compromised buffering capacity and early colonization or high titer of mutans streptococci in saliva. The evidence remains weak and/or inconsistent on the association between dental caries and other saliva parameters, such as other possible cariogenic species (Lactobacillus spp., Streptococcus sanguis group, Streptococcus salivarius, Actinomyces spp. and Candida albicans), diversity of saliva microbiomes, inorganic and organic constituents (electrolytes, immunoglobulins, other proteins and peptides) and some functional properties (sugar clearance rate, etc.). The complex interactions between salivary components and functions suggest that saliva has to be considered in its entirety to account for its total effects on teeth. © 2015 John Wiley & Sons A/S. Published by John Wiley & Sons Ltd.

  10. Cancer of the thyroid and salivary glands

    International Nuclear Information System (INIS)

    Ezaki, H.; Hayashi, Y.; Ishimaru, Toranosuke; Takeichi, N.

    1986-01-01

    The relationship of atomic bomb exposure to tumors of the head and neck has been studied in detail for the thyroid and salivary gland. It has been deomonstrated by animal experiments and studies conducted on those undergoing radiation therapy of the neck during childhood, and on those exposed to radioactive fallout from hydrogen-bomb tests in the Marshall Islands, that thyroid neoplasms can be induced by radiation. Although it was assumed that radiation would ahve a similar effect on the salivary gland located near the thyroid gland, it was in the 1970s that studies were commenced on the salivary gland. A study of the Adult Health Study population presented data which show that the incidence of salivary gland tumors was 9.3-fold higher in the group exposed to 300+ rad than in the control group and when confined only to malignant tumors the incidence was 21.8-fold higher

  11. Salivary gland enlargement during oesophageal stricture dilatation.

    OpenAIRE

    Martin, D.

    1980-01-01

    A case of recurrent salivary gland enlargement occurring during fibreoptic oesophagoscopy and oesophageal stricture dilatation with Eder-Puestow dilators is described. The genesis of this condition is discussed and its transient and usually benign nature emphasized.

  12. Osteopontin expression in salivary gland carcinomas

    DEFF Research Database (Denmark)

    Bjørndal, Kristine; Larsen, Stine R; Godballe, Christian

    2011-01-01

    J Oral Pathol Med (2010) Background:  In several cancer types, osteopontin (OPN) expression has been correlated with tumor progression and prognosis. Two earlier studies have examined OPN expression in salivary gland carcinomas with contradictory results. Methods:  One hundred and seventy......:  Osteopontin was expressed in all salivary gland carcinomas. Adenoid cystic carcinomas had the highest mean sum score (7.3) and a significantly higher proportion of carcinomas with high OPN sum score than both mucoepidermoid carcinoma and acinic cell carcinoma. Correlation of OPN expression with known...... prognostic factors in salivary gland carcinomas was insignificant. Conclusions:  Salivary gland carcinomas express OPN. The expression does not correlate with known prognostic factors....

  13. Salivary pH: A diagnostic biomarker

    OpenAIRE

    Baliga, Sharmila; Muglikar, Sangeeta; Kale, Rahul

    2013-01-01

    Objectives: Saliva contains a variety of host defense factors. It influences calculus formation and periodontal disease. Different studies have been done to find exact correlation of salivary biomarkers with periodontal disease. With a multitude of biomarkers and complexities in their determination, the salivary pH may be tried to be used as a quick chairside test. The aim of this study was to analyze the pH of saliva and determine its relevance to the severity of periodontal disease. Study D...

  14. Salivary exoglycosidases as markers of alcohol dependence.

    Science.gov (United States)

    Waszkiewicz, Napoleon; Chojnowska, Sylwia; Zalewska, Anna; Zwierz, Krzysztof; Szulc, Agata; Szajda, Sławomir Dariusz

    2014-01-01

    Some salivary markers of alcohol abuse/dependence have been proposed so far: aminotransferases, gamma-glutamyltransferase, ethanol, ethyl glucuronide, ethyl sulfate, sialic acid, β-hexosaminidase A, oral peroxidase, methanol, diethylene/ethylene glycol, α-amylase, clusterin, haptoglobin, heavy/light chains of immunoglobulins and transferrin. To investigate the effect of chronic alcohol drinking and smoking on the activity (pKat/ml) and output (pKat/min) of salivary lysosomal exoglycosidases: α-fucosidase (FUC), α-mannosidase (MAN), β-galactosidase (GAL), and β-glucuronidase (GLU), and their applicability as markers of alcohol dependence. The activity of FUC, MAN, GAL and GLU was measured colorimetrically in the saliva of healthy social drinkers, alcohol-dependent non-smokers and alcohol-dependent smokers. We observed an increased salivary activity of FUC, GAL, GLU and MAN, as well as an increased output of GAL and GLU, in comparison with controls. The highest increase in the activity/output was found in salivary GLU and MAN (GLU, even 7- to 18-fold), and the least in GAL. We found an excellent sensitivity and specificity and a high accuracy (measured by the area under the ROC curve) for salivary FUC, GLU and MAN activities. The salivary GLU activity positively correlated with the number of days of last alcohol intoxication. Salivary activity of FUC, GAL and MAN, but not GLU, positively correlated with the periodontal parameters such as gingival index and papilla bleeding index. Although we found an excellent sensitivity and specificity as well as a high accuracy for the salivary activity of FUC, GLU and MAN, the GLU activity seems to be mostly applicable as a marker of chronic alcohol drinking (alcohol dependence). © The Author 2014. Medical Council on Alcohol and Oxford University Press. All rights reserved.

  15. Effect of childhood malnutrition on salivary flow and pH.

    Science.gov (United States)

    Psoter, Walter J; Spielman, Andrew L; Gebrian, Bette; St Jean, Rudolph; Katz, Ralph V

    2008-03-01

    While protein-energy malnutrition may have multiple effects on oral tissues and subsequent disease development, reports of the effect of malnutrition on the human salivary glands are sparse. A retrospective cohort study of the effect of early childhood protein-energy malnutrition (EC-PEM) and adolescent nutritional status on salivary flow and pH was conducted with rural Haitian children, ages 11-19 years (n=1017). Malnutrition strata exposure cohorts were based on 1988-1996 weight-for-age records which covered the birth through 5-year-old period for all subjects. Then, data on current anthropometrical defined nutritional status categories, stimulated and unstimulated salivary flow rates, and salivary pH were collected for the same subjects of 11-19 years old during field examinations in the summer of 2005. Multivariate analysis of variance (MANOVA) was used for the analyses. Stimulated and unstimulated salivary flow rates were reduced at statistically significant levels in subjects who had experienced severe malnutrition in their early childhood or who had continuing nutrition stress which resulted in delayed growth, as measured at ages 11-19 years. Salivary pH demonstrated little clinically meaningful variability between malnourished and nonmalnourished groups. This study is the first to report of a continuing effect on diminished salivary gland function into adolescence as a result of early childhood malnutrition (EC-PEM) and suggests that exocrine glandular systems may be compromised for extended periods following EC-PEM, which may have important implications for the body's systemic antimicrobial defences.

  16. TAT-Mediated Delivery of Tousled Protein to Salivary Glands Protects Against Radiation-Induced Hypofunction

    Energy Technology Data Exchange (ETDEWEB)

    Sunavala-Dossabhoy, Gulshan, E-mail: gsunav@lsuhsc.edu [Department of Biochemistry and Molecular Biology, Louisiana State University Health Sciences Center, Shreveport, LA (United States); Palaniyandi, Senthilnathan; Richardson, Charles; De Benedetti, Arrigo [Department of Biochemistry and Molecular Biology, Louisiana State University Health Sciences Center, Shreveport, LA (United States); Schrott, Lisa [Department of Pharmacology, Toxicology, and Neuroscience, Louisiana State University Health Sciences Center, Shreveport, LA (United States); Caldito, Gloria [Department of Bioinformatics and Computational Biology, Louisiana State University Health Sciences Center, Shreveport, LA (United States)

    2012-09-01

    Purpose: Patients treated with radiotherapy for head-and-neck cancer invariably suffer its deleterious side effect, xerostomia. Salivary hypofunction ensuing from the irreversible destruction of glands is the most common and debilitating oral complication affecting patients undergoing regional radiotherapy. Given that the current management of xerostomia is palliative and ineffective, efforts are now directed toward preventive measures to preserve gland function. The human homolog of Tousled protein, TLK1B, facilitates chromatin remodeling at DNA repair sites and improves cell survival against ionizing radiation (IR). Therefore, we wanted to determine whether a direct transfer of TLK1B protein to rat salivary glands could protect against IR-induced salivary hypofunction. Methods: The cell-permeable TAT-TLK1B fusion protein was generated. Rat acinar cell line and rat salivary glands were pretreated with TAT peptide or TAT-TLK1B before IR. The acinar cell survival in vitro and salivary function in vivo were assessed after radiation. Results: We demonstrated that rat acinar cells transduced with TAT-TLK1B were more resistant to radiation (D{sub 0} = 4.13 {+-} 1.0 Gy; {alpha}/{beta} = 0 Gy) compared with cells transduced with the TAT peptide (D{sub 0} = 4.91 {+-} 1.0 Gy; {alpha}/{beta} = 20.2 Gy). Correspondingly, retroductal instillation of TAT-TLK1B in rat submandibular glands better preserved salivary flow after IR (89%) compared with animals pretreated with Opti-MEM or TAT peptide (31% and 39%, respectively; p < 0.01). Conclusions: The results demonstrate that a direct transfer of TLK1B protein to the salivary glands effectively attenuates radiation-mediated gland dysfunction. Prophylactic TLK1B-protein therapy could benefit pat