
Sample records for human n-methylpurine-dna glycosylase

  1. Metal inhibition of human N-methylpurine-DNA glycosylase activity in base excision repair. (United States)

    Wang, Ping; Guliaev, Anton B; Hang, Bo


    Cadmium (Cd2+), nickel (Ni2+) and cobalt (Co2+) are human and/or animal carcinogens. Zinc (Zn2+) is not categorized as a carcinogen, and rather an essential element to humans. Metals were recently shown to inhibit DNA repair proteins that use metals for their function and/or structure. Here we report that the divalent ions Cd2+, Ni2+, and Zn2+ can inhibit the activity of a recombinant human N-methylpurine-DNA glycosylase (MPG) toward a deoxyoligonucleotide with ethenoadenine (varepsilonA). MPG removes a variety of toxic/mutagenic alkylated bases and does not require metal for its catalytic activity or structural integrity. At concentrations starting from 50 to 1,000 microM, both Cd2+ and Zn2+ showed metal-dependent inhibition of the MPG catalytic activity. Ni2+ also inhibited MPG, but to a lesser extent. Such an effect can be reversed with EDTA addition. In contrast, Co2+ and Mg2+ did not inhibit the MPG activity in the same dose range. Experiments using HeLa cell-free extracts demonstrated similar patterns of inactivation of the varepsilonA excision activity by the same metals. Binding of MPG to the substrate was not significantly affected by Cd2+, Zn2+, and Ni2+ at concentrations that show strong inhibition of the catalytic function, suggesting that the reduced catalytic activity is not due to altered MPG binding affinity to the substrate. Molecular dynamics (MD) simulations with Zn2+ showed that the MPG active site has a potential binding site for Zn2+, formed by several catalytically important and conserved residues. Metal binding to such a site is expected to interfere with the catalytic mechanism of this protein. These data suggest that inhibition of MPG activity may contribute to metal genotoxicity and depressed repair of alkylation damage by metals in vivo.

  2. Discrimination of Lesion Removal of N-Methylpurine-DNA Glycosylase Revealed by a Potent Neutralizing Monoclonal Antibody (United States)

    Adhikari, Sanjay; Kennel, Stephen J.; Roy, Gargi; Mitra, Partha S; Mitra, Sankar; Roy, Rabindra


    N-methylpurine-DNA glycosylase (MPG), a ubiquitous DNA repair enzyme, initiates excision repair of several N-alkylpurine adducts, induced by alkylating chemotherapeutics, and deaminated and lipid peroxidation-induced purine adducts. We have generated monoclonal antibodies (moAbs) against human MPG. Twelve independent hybridoma clones were characterized, which, except 520-16A, are identical based on epitope exclusion assay. Four moAbs, including 520-2A, 520-3A, 520-16A, and 520-26A, have high affinity (KD∼0.3-1.6 nM), and their subtypes were IgG2a, IgG1, IgG2a, and IgG2b, respectively. moAb 520-3A recognizes the sequence 52AQAPCPRERCLGPP66T, an epitope exclusively present in the N-terminal extension of human MPG. We found that moAb 520-3A significantly inhibited MPG's enzymatic activity towards different substrates, such as hypoxanthine, 1,N6ethenoadenine and methylated bases, which represent different classes of DNA damage, however, with different efficiencies. Real-time binding experiments using surface plasmon resonance (SPR) spectroscopy showed that the pronounced inhibition of activity was not in the substrate binding step. Single turnover kinetics (STO) revealed that the inhibition was at the catalytic step. Since we found that this antibody has an epitope in the N-terminal tail, the latter appears to have an important role in substrate discrimination, however, with a differential effect on different substrates. PMID:17768096

  3. N-methylpurine DNA glycosylase and DNA polymerase beta modulate BER inhibitor potentiation of glioma cells to temozolomide. (United States)

    Tang, Jiang-bo; Svilar, David; Trivedi, Ram N; Wang, Xiao-hong; Goellner, Eva M; Moore, Briana; Hamilton, Ronald L; Banze, Lauren A; Brown, Ashley R; Sobol, Robert W


    Temozolomide (TMZ) is the preferred chemotherapeutic agent in the treatment of glioma following surgical resection and/or radiation. Resistance to TMZ is attributed to efficient repair and/or tolerance of TMZ-induced DNA lesions. The majority of the TMZ-induced DNA base adducts are repaired by the base excision repair (BER) pathway and therefore modulation of this pathway can enhance drug sensitivity. N-methylpurine DNA glycosylase (MPG) initiates BER by removing TMZ-induced N3-methyladenine and N7-methylguanine base lesions, leaving abasic sites (AP sites) in DNA for further processing by BER. Using the human glioma cell lines LN428 and T98G, we report here that potentiation of TMZ via BER inhibition [methoxyamine (MX), the PARP inhibitors PJ34 and ABT-888 or depletion (knockdown) of PARG] is greatly enhanced by over-expression of the BER initiating enzyme MPG. We also show that methoxyamine-induced potentiation of TMZ in MPG expressing glioma cells is abrogated by elevated-expression of the rate-limiting BER enzyme DNA polymerase β (Polβ), suggesting that cells proficient for BER readily repair AP sites in the presence of MX. Further, depletion of Polβ increases PARP inhibitor-induced potentiation in the MPG over-expressing glioma cells, suggesting that expression of Polβ modulates the cytotoxic effect of combining increased repair initiation and BER inhibition. This study demonstrates that MPG overexpression, together with inhibition of BER, sensitizes glioma cells to the alkylating agent TMZ in a Polβ-dependent manner, suggesting that the expression level of both MPG and Polβ might be used to predict the effectiveness of MX and PARP-mediated potentiation of TMZ in cancer treatment.

  4. Metal inhibition of human alkylpurine-DNA-N-glycosylase activityin base excision repair

    Energy Technology Data Exchange (ETDEWEB)

    Wang, Ping; Guliaev, Anton B.; Hang, Bo


    Cadmium (Cd{sup 2+}), nickel (Ni{sup 2+}) and cobalt (Co{sup 2+}) are human and/or animal carcinogens. Zinc (Zn{sup 2+}) is not categorized as a carcinogen, and rather an essential element to humans. Metals were recently shown to inhibit DNA repair proteins that use metals for their function and/or structure. Here we report that the divalent ions Cd{sup 2+}, Ni{sup 2+}, and Zn{sup 2+} can inhibit the activity of a recombinant human N-methylpurine-DNA glycosylase (MPG) toward a deoxyoligonucleotide with ethenoadenine (var epsilonA). MPG removes a variety of toxic/mutagenic alkylated bases and does not require metal for its catalytic activity or structural integrity. At concentrations starting from 50 to 1000 {micro}M, both Cd{sup 2+} and Zn{sup 2+} showed metal-dependent inhibition of the MPG catalytic activity. Ni{sup 2+} also inhibited MPG, but to a lesser extent. Such an effect can be reversed with EDTA addition. In contrast, Co{sup 2+} and Mg{sup 2+} did not inhibit the MPG activity in the same dose range. Experiments using HeLa cell-free extracts demonstrated similar patterns of inactivation of the var epsilonA excision activity by the same metals. Binding of MPG to the substrate was not significantly affected by Cd{sup 2+}, Zn{sup 2+}, and Ni{sup 2+} at concentrations that show strong inhibition of the catalytic function, suggesting that the reduced catalytic activity is not due to altered MPG binding affinity to the substrate. Molecular dynamics (MD) simulations with Zn{sup 2+} showed that the MPG active site has a potential binding site for Zn{sup 2+}, formed by several catalytically important and conserved residues. Metal binding to such a site is expected to interfere with the catalytic mechanism of this protein. These data suggest that inhibition of MPG activity may contribute to metal genotoxicity and depressed repair of alkylation damage by metals in vivo.

  5. Human NEIL3 is mainly a monofunctional DNA glycosylase removing spiroiminohydantoin and guanidinohydantoin


    Krokeide, Silje Z.; Laerdahl, Jon K.; Salah, Medya; Luna, Luisa; Cederkvist, F. Henning; Fleming, Aaron M.; Burrows, Cynthia J.; Dalhus, Bjørn; Bjørås, Magnar


    Base excision repair is the major pathway for removal of oxidative DNA base damage. This pathway is initiated by DNA glycosylases, which recognize and excise damaged bases from DNA. In this work, we have purified the glycosylase domain (GD) of human DNA glycosylase NEIL3. The substrate specificity has been characterized and we have elucidated the catalytic mechanisms. GD NEIL3 excised the hydantoin lesions spiroiminodihydantoin (Sp) and guanidinohydantoin (Gh) in single-stranded (ss) and doub...

  6. Cadmium(II) inhibition of human uracil-DNA glycosylase by catalytic water supplantation (United States)

    Gokey, Trevor; Hang, Bo; Guliaev, Anton B.


    Toxic metals are known to inhibit DNA repair but the underlying mechanisms of inhibition are still not fully understood. DNA repair enzymes such as human uracil-DNA glycosylase (hUNG) perform the initial step in the base excision repair (BER) pathway. In this work, we showed that cadmium [Cd(II)], a known human carcinogen, inhibited all activity of hUNG at 100 μM. Computational analyses based on 2 μs equilibrium, 1.6 μs steered molecular dynamics (SMD), and QM/MM MD determined that Cd(II) ions entered the enzyme active site and formed close contacts with both D145 and H148, effectively replacing the catalytic water normally found in this position. Geometry refinement by density functional theory (DFT) calculations showed that Cd(II) formed a tetrahedral structure with D145, P146, H148, and one water molecule. This work for the first time reports Cd(II) inhibition of hUNG which was due to replacement of the catalytic water by binding the active site D145 and H148 residues. Comparison of the proposed metal binding site to existing structural data showed that D145:H148 followed a general metal binding motif favored by Cd(II). The identified motif offered structural insights into metal inhibition of other DNA repair enzymes and glycosylases.

  7. Search for DNA damage by human alkyladenine DNA glycosylase involves early intercalation by an aromatic residue. (United States)

    Hendershot, Jenna M; O'Brien, Patrick J


    DNA repair enzymes recognize and remove damaged bases that are embedded in the duplex. To gain access, most enzymes use nucleotide flipping, whereby the target nucleotide is rotated 180° into the active site. In human alkyladenine DNA glycosylase (AAG), the enzyme that initiates base excision repair of alkylated bases, the flipped-out nucleotide is stabilized by intercalation of the side chain of tyrosine 162 that replaces the lesion nucleobase. Previous kinetic studies provided evidence for the formation of a transient complex that precedes the stable flipped-out complex, but it is not clear how this complex differs from nonspecific complexes. We used site-directed mutagenesis and transient-kinetic approaches to investigate the timing of Tyr 162 intercalation for AAG. The tryptophan substitution (Y162W) appeared to be conservative, because the mutant protein retained a highly favorable equilibrium constant for flipping the 1, N 6 -ethenoadenine (ϵA) lesion, and the rate of N -glycosidic bond cleavage was identical to that of the wild-type enzyme. We assigned the tryptophan fluorescence signal from Y162W by removing two native tryptophan residues (W270A/W284A). Stopped-flow experiments then demonstrated that the change in tryptophan fluorescence of the Y162W mutant is extremely rapid upon binding to either damaged or undamaged DNA, much faster than the lesion-recognition and nucleotide flipping steps that were independently determined by monitoring the ϵA fluorescence. These observations suggest that intercalation by this aromatic residue is one of the earliest steps in the search for DNA damage and that this interaction is important for the progression of AAG from nonspecific searching to specific-recognition complexes. © 2017 by The American Society for Biochemistry and Molecular Biology, Inc.

  8. Synthetic Routes to N-9 Alkylated 8-Oxoguanines; Weak Inhibitors of the Human DNA Glycosylase OGG1

    Directory of Open Access Journals (Sweden)

    Tushar R. Mahajan


    Full Text Available The human 8-oxoguanine DNA glycosylase OGG1 is involved in base excision repair (BER, one of several DNA repair mechanisms that may counteract the effects of chemo- and radiation therapy for the treatment of cancer. We envisage that potent inhibitors of OGG1 may be found among the 9-alkyl-8-oxoguanines. Thus we explored synthetic routes to 8-oxoguanines and examined these as OGG1 inhibitors. The best reaction sequence started from 6-chloroguanine and involved N-9 alkylation, C-8 bromination, and finally simultaneous hydrolysis of both halides. Bromination before N-alkylation should only be considered when the N-substituent is not compatible with bromination conditions. The 8-oxoguanines were found to be weak inhibitors of OGG1. 6-Chloro-8-oxopurines, byproducts in the hydrolysis of 2,6-halopurines, turned out to be slightly better inhibitors than the corresponding 8-oxoguanines.

  9. Synthetic Routes to N-9 Alkylated 8-Oxoguanines; Weak Inhibitors of the Human DNA Glycosylase OGG1. (United States)

    Mahajan, Tushar R; Ytre-Arne, Mari Eknes; Strøm-Andersen, Pernille; Dalhus, Bjørn; Gundersen, Lise-Lotte


    The human 8-oxoguanine DNA glycosylase OGG1 is involved in base excision repair (BER), one of several DNA repair mechanisms that may counteract the effects of chemo- and radiation therapy for the treatment of cancer. We envisage that potent inhibitors of OGG1 may be found among the 9-alkyl-8-oxoguanines. Thus we explored synthetic routes to 8-oxoguanines and examined these as OGG1 inhibitors. The best reaction sequence started from 6-chloroguanine and involved N-9 alkylation, C-8 bromination, and finally simultaneous hydrolysis of both halides. Bromination before N-alkylation should only be considered when the N-substituent is not compatible with bromination conditions. The 8-oxoguanines were found to be weak inhibitors of OGG1. 6-Chloro-8-oxopurines, byproducts in the hydrolysis of 2,6-halopurines, turned out to be slightly better inhibitors than the corresponding 8-oxoguanines.

  10. Oxidative DNA glycosylases: recipes from cloning to characterization. (United States)

    Bandaru, Viswanath; Blaisdell, Jeffrey O; Wallace, Susan S


    As new organisms are being sequenced on a daily basis, new DNA glycosylases that recognize DNA damage can be easily identified in an effort to understand both their phylogenetics and substrate specificities. As a practical matter, existing bacterial and human homologs need to be readily available as laboratory reagents in order to compare the activities of the novel enzymes to existing enzymes. This chapter attempts to provide a primer for cloning, expression, and assay procedures for bacterial and human DNA glycosylases that recognize oxidative DNA damages. These methodologies can be translated readily to novel DNA glycosylases or to DNA glycosylases that recognize other types of DNA damages.

  11. Human 8-oxoguanine DNA glycosylase gene polymorphism (Ser326Cys) and cancer risk: updated meta-analysis (United States)

    Park, Hae Jeong; Chung, Joo-Ho; Ban, Ju Yeon


    Genetic polymorphism of human 8-oxoguanine glycosylase 1 (hOGG1) has been reported to have a relationship with the risk of the development of various cancers. Many studies have described the influence of Ser326Cys polymorphism of the hOGG1 gene on cancer susceptibility. However, the results have remained inconclusive and controversial. Therefore, we performed a meta-analysis to more precisely determine the relationship between the hOGG1 polymorphism and the development of cancer. Electronic databases including PubMed, Embase, Google Scholar, and the Korean Studies Information Service System (KISS) were searched. The odds ratio (OR), 95% confidence interval (CI), and p value were calculated to assess the strength of the association with the risk of cancer using Comprehensive Meta-analysis software (Corporation, NJ, USA). The 127 studies including 38,757 cancer patients and 50,177 control subjects were analyzed for the meta-analysis. Our meta-analysis revealed that G allele of Ser326Cys polymorphism of the hOGG1 gene statistically increased the susceptibility of cancer (all population, OR = 1.092, 95% CI = 1.051-1.134, p polymorphism may be a candidate marker of cancer. PMID:28415770

  12. Structural and biophysical analysis of interactions between cod and human uracil-DNA N-glycosylase (UNG) and UNG inhibitor (Ugi)

    Energy Technology Data Exchange (ETDEWEB)

    Assefa, Netsanet Gizaw [UiT The Arctic University of Norway, 9037 Tromsø (Norway); Niiranen, Laila [UiT The Arctic University of Norway, 9037 Tromsø (Norway); University of Turku, FIN-20014 Turku (Finland); Johnson, Kenneth A.; Leiros, Hanna-Kirsti Schrøder; Smalås, Arne Oskar; Willassen, Nils Peder [UiT The Arctic University of Norway, 9037 Tromsø (Norway); Moe, Elin, E-mail: [UiT The Arctic University of Norway, 9037 Tromsø (Norway); Universidade Nova de Lisboa, Avenida da Republica (EAN), 2780-157 Oeiras (Portugal)


    A structural and biophysical study of the interactions between cod and human uracil-DNA N-glycosylase (UNG) and their inhibitor Ugi is presented. The stronger interaction between cod UNG and Ugi can be explained by a greater positive electrostatic surface potential. Uracil-DNA N-glycosylase from Atlantic cod (cUNG) shows cold-adapted features such as high catalytic efficiency, a low temperature optimum for activity and reduced thermal stability compared with its mesophilic homologue human UNG (hUNG). In order to understand the role of the enzyme–substrate interaction related to the cold-adapted properties, the structure of cUNG in complex with a bacteriophage encoded natural UNG inhibitor (Ugi) has been determined. The interaction has also been analyzed by isothermal titration calorimetry (ITC). The crystal structure of cUNG–Ugi was determined to a resolution of 1.9 Å with eight complexes in the asymmetric unit related through noncrystallographic symmetry. A comparison of the cUNG–Ugi complex with previously determined structures of UNG–Ugi shows that they are very similar, and confirmed the nucleotide-mimicking properties of Ugi. Biophysically, the interaction between cUNG and Ugi is very strong and shows a binding constant (K{sub b}) which is one order of magnitude larger than that for hUNG–Ugi. The binding of both cUNG and hUNG to Ugi was shown to be favoured by both enthalpic and entropic forces; however, the binding of cUNG to Ugi is mainly dominated by enthalpy, while the entropic term is dominant for hUNG. The observed differences in the binding properties may be explained by an overall greater positive electrostatic surface potential in the protein–Ugi interface of cUNG and the slightly more hydrophobic surface of hUNG.

  13. Accelerated repair and reduced mutagenicity of DNA damage induced by cigarette smoke in human bronchial cells transfected with E.coli formamidopyrimidine DNA glycosylase.

    Directory of Open Access Journals (Sweden)

    Mara Foresta

    Full Text Available Cigarette smoke (CS is associated to a number of pathologies including lung cancer. Its mutagenic and carcinogenic effects are partially linked to the presence of reactive oxygen species and polycyclic aromatic hydrocarbons (PAH inducing DNA damage. The bacterial DNA repair enzyme formamidopyrimidine DNA glycosylase (FPG repairs both oxidized bases and different types of bulky DNA adducts. We investigated in vitro whether FPG expression may enhance DNA repair of CS-damaged DNA and counteract the mutagenic effects of CS in human lung cells. NCI-H727 non small cell lung carcinoma cells were transfected with a plasmid vector expressing FPG fused to the Enhanced Green Fluorescent Protein (EGFP. Cells expressing the fusion protein EGFP-FPG displayed accelerated repair of adducts and DNA breaks induced by CS condensate. The mutant frequencies induced by low concentrations of CS condensate to the Na(+K(+-ATPase locus (oua(r were significantly reduced in cells expressing EGFP-FPG. Hence, expression of the bacterial DNA repair protein FPG stably protects human lung cells from the mutagenic effects of CS by improving cells' capacity to repair damaged DNA.

  14. Human DNA Glycosylase NEIL1’s Interactions with Downstream Repair Proteins Is Critical for Efficient Repair of Oxidized DNA Base Damage and Enhanced Cell Survival

    Directory of Open Access Journals (Sweden)

    Istvan Boldogh


    Full Text Available NEIL1 is unique among the oxidatively damaged base repair-initiating DNA glycosylases in the human genome due to its S phase-specific activation and ability to excise substrate base lesions from single-stranded DNA. We recently characterized NEIL1’s specific binding to downstream canonical repair and non-canonical accessory proteins, all of which involve NEIL1’s disordered C-terminal segment as the common interaction domain (CID. This domain is dispensable for NEIL1’s base excision and abasic (AP lyase activities, but is required for its interactions with other repair proteins. Here, we show that truncated NEIL1 lacking the CID is markedly deficient in initiating in vitro repair of 5-hydroxyuracil (an oxidative deamination product of C in a plasmid substrate compared to the wild-type NEIL1, thus suggesting a critical role of CID in the coordination of overall repair. Furthermore, while NEIL1 downregulation significantly sensitized human embryonic kidney (HEK 293 cells to reactive oxygen species (ROS, ectopic wild-type NEIL1, but not the truncated mutant, restored resistance to ROS. These results demonstrate that cell survival and NEIL1-dependent repair of oxidative DNA base damage require interactions among repair proteins, which could be explored as a cancer therapeutic target in order to increase the efficiency of chemo/radiation treatment.

  15. Islet expression of the DNA repair enzyme 8-oxoguanosine DNA glycosylase (Ogg1 in human type 2 diabetes

    Directory of Open Access Journals (Sweden)

    Yoon Kun-Ho


    Full Text Available Abstract Background It has become increasingly clear that β-cell failure plays a critical role in the pathogenesis of type 2 diabetes. Free-radical mediated β-cell damage has been intensively studied in type 1 diabetes, but not in human type 2 diabetes. Therefore, we studied the protein expression of the DNA repair enzyme Ogg1 in pancreases from type 2 diabetics. Ogg1 was studied because it is the major enzyme involved in repairing 7,8-dihydro-8-oxoguanosine DNA adducts, a lesion previously observed in a rat model of type 2 diabetes. Moreover, in a gene expression screen, Ogg1 was over-expressed in islets from a human type 2 diabetic. Methods Immunofluorescent staining of Ogg1 was performed on pancreatic specimens from healthy controls and patients with diabetes for 2–23 years. The intensity and islet area stained for Ogg1 was evaluated by semi-quantitative scoring. Results Both the intensity and the area of islet Ogg1 staining were significantly increased in islets from the type 2 diabetic subjects compared to the healthy controls. A correlation between increased Ogg1 fluorescent staining intensity and duration of diabetes was also found. Most of the staining observed was cytoplasmic, suggesting that mitochondrial Ogg1 accounts primarily for the increased Ogg1 expression. Conclusion We conclude that oxidative stress related DNA damage may be a novel important factor in the pathogenesis of human type 2 diabetes. An increase of Ogg1 in islet cell mitochondria is consistent with a model in which hyperglycemia and consequent increased β-cell oxidative metabolism lead to DNA damage and the induction of Ogg1 expression.

  16. Downregulation of Cockayne syndrome B protein reduces human 8-oxoguanine DNA glycosylase-1 expression and repair of UV radiation-induced 8-oxo-7,8-dihydro-2'-deoxyguanine. (United States)

    Javeri, Arash; Lyons, James Guy; Huang, Xiao X; Halliday, Gary M


    Human 8-oxoguanine DNA glycosylase-1 (hOGG1) is the key DNA repair enzyme responsible for initiating repair of UV radiation-induced 8-oxo-7,8-dihydro-2'-deoxyguanosine (8-oxo-dG). Previously we have shown that basal cells in human epidermis are particularly sensitive to UVA-mediated DNA damage probably due to low expression of hOGG1. Here we investigate some aspects of the regulatory role of Cockayne syndrome B (CSB) on hOGG1 expression and function. Cockayne syndrome B and hOGG1 genes were knocked down by miRNA technology in the HaCaT human keratinocyte cell line. Loss of the CSB gene decreased hOGG1 mRNA, and loss of hOGG1 increased CSB, indicating that they influence each other's expression. Protein levels were assessed in cells grown into engineered human skin using immunohistochemistry. This confirmed that CSB knockdown with miRNA reduced hOGG1 protein levels, but hOGG1 knockdown did not influence expression of CSB protein. Using comet assay we found that both hOGG1 and CSB knockdown reduced repair of both UVA- and UVB-induced 8-oxo-dG, consistent with CSB downregulation of hOGG1 mRNA and protein. In contrast, CSB but not hOGG1 knockdown reduced repair of UVB- and UVA-induced cyclobutane pyrimidine dimer photolesions. In engineered human skin, repair of UVA-induced 8-oxo-dG was inhibited by both hOGG1 and CSB knockdown, confirming the functional role of both proteins in cells with 3-D cellular contacts. These findings directly indicate that hOGG1 and CSB influence each other's expression. CSB is required for maintaining hOGG1 enzyme levels and function. Cockayne syndrome B could therefore be required for 8-oxo-dG repair due to its regulatory effect on hOGG1 expression. Cockayne syndrome B but not hOGG1 is also required for efficient repair of cyclobutane pyrimidine dimers. Cockayne syndrome B regulation of DNA repair could contribute to the effect of UVA in causing mutations that lead to skin cancer in humans. © 2011 Japanese Cancer Association.

  17. Recent Advances in the Structural Mechanisms of DNA Glycosylases (United States)

    Brooks, Sonja C.; Adhikary, Suraj; Rubinson, Emily H.; Eichman, Brandt F.


    DNA glycosylases safeguard the genome by locating and excising a diverse array of aberrant nucleobases created from oxidation, alkylation, and deamination of DNA. Since the discovery 28 years ago that these enzymes employ a base flipping mechanism to trap their substrates, six different protein architectures have been identified to perform the same basic task. Work over the past several years has unraveled details for how the various DNA glycosylases survey DNA, detect damage within the duplex, select for the correct modification, and catalyze base excision. Here, we provide a broad overview of these latest advances in glycosylase mechanisms gleaned from structural enzymology, highlighting features common to all glycosylases as well as key differences that define their particular substrate specificities. PMID:23076011

  18. Interaction of apurinic/apyrimidinic endonuclease 2 (Apn2) with Myh1 DNA glycosylase in fission yeast. (United States)

    Jin, Jin; Hwang, Bor-Jang; Chang, Po-Wen; Toth, Eric A; Lu, A-Lien


    Oxidative DNA damage is repaired primarily by the base excision repair (BER) pathway in a process initiated by removal of base lesions or mismatched bases by DNA glycosylases. MutY homolog (MYH, MUTYH, or Myh1) is a DNA glycosylase which excises adenine paired with the oxidative lesion 8-oxo-7,8-dihydroguanine (8-oxoG, or G°), thus reducing G:C to T:A mutations. The resulting apurinic/apyrimidinic (AP) site is processed by an AP-endonuclease or a bifunctional glycosylase/lyase. We show here that the major Schizosaccharomyces pombe AP endonuclease, Apn2, binds to the inter-domain connector located between the N- and C-terminal domains of Myh1. This Myh1 inter-domain connector also interacts with the Hus1 subunit of the Rad9-Rad1-Hus1 checkpoint clamp. Mutagenesis studies indicate that Apn2 and Hus1 bind overlapping but different sequence motifs on Myh1. Mutation on I(261) of Myh1 reduces its interaction with Hus1, but only slightly attenuates its interaction with Apn2. However, E(262) of Myh1 is a key determinant for both Apn2 and Hus1 interactions. Like human APE1, Apn2 has 3'-phosphodiesterase activity. However, unlike hAPE1, Apn2 has a weak AP endonuclease activity which cleaves the AP sites generated by Myh1 glycosylase. Functionally, Apn2 stimulates Myh1 glycosylase activity and Apn2 phosphodiesterase activity is stimulated by Myh1. The cross stimulation of Myh1 and Apn2 enzymatic activities is dependent on their physical interaction. Thus, Myh1 and Apn2 constitute an initial BER complex. Copyright © 2014 Elsevier B.V. All rights reserved.

  19. Base excision repair deficient mice lacking the Aag alkyladenine DNA glycosylase.

    NARCIS (Netherlands)

    B.P. Engelward (Bevin); G. Weeda (Geert); M.D. Wyatt; J.L.M. Broekhof (Jose'); J. de Wit (Jan); I. Donker (Ingrid); J.M. Allan (James); B. Gold (Bert); J.H.J. Hoeijmakers (Jan); L.D. Samson (Leona)


    textabstract3-methyladenine (3MeA) DNA glycosylases remove 3MeAs from alkylated DNA to initiate the base excision repair pathway. Here we report the generation of mice deficient in the 3MeA DNA glycosylase encoded by the Aag (Mpg) gene. Alkyladenine DNA glycosylase turns out to be the major DNA

  20. Tungsten disulfide nanosheet and exonuclease III co-assisted amplification strategy for highly sensitive fluorescence polarization detection of DNA glycosylase activity

    Energy Technology Data Exchange (ETDEWEB)

    Zhao, Jingjin; Ma, Yefei [Key Laboratory for the Chemistry and Molecular Engineering of Medicinal Resources of Education Ministry, Guangxi Normal University, Guilin, 541004 (China); Kong, Rongmei [The Key Laboratory of Life-Organic Analysis, College of Chemistry and Chemical Engineering, Qufu Normal University, Qufu, Shandong 273165 (China); Zhang, Liangliang, E-mail: [Key Laboratory for the Chemistry and Molecular Engineering of Medicinal Resources of Education Ministry, Guangxi Normal University, Guilin, 541004 (China); Yang, Wen; Zhao, Shulin [Key Laboratory for the Chemistry and Molecular Engineering of Medicinal Resources of Education Ministry, Guangxi Normal University, Guilin, 541004 (China)


    Herein, we introduced a tungsten disulfide (WS{sub 2}) nanosheet and exonuclease III (Exo III) co-assisted signal amplification strategy for highly sensitive fluorescent polarization (FP) assay of DNA glycosylase activity. Two DNA glycosylases, uracil-DNA glycosylase (UDG) and human 8-oxoG DNA glycosylase 1 (hOGG1), were tested. A hairpin-structured probe (HP) which contained damaged bases in the stem was used as the substrate. The removal of damaged bases from substrate by DNA glycosylase would lower the melting temperature of HP. The HP was then opened and hybridized with a FAM dye-labeled single strand DNA (DP), generating a duplex with a recessed 3′-terminal of DP. This design facilitated the Exo III-assisted amplification by repeating the hybridization and digestion of DP, liberating numerous FAM fluorophores which could not be adsorbed on WS{sub 2} nanosheet. Thus, the final system exhibited a small FP signal. However, in the absence of DNA glycosylases, no hybridization between DP and HP was occurred, hampering the hydrolysis of DP by Exo III. The intact DP was then adsorbed on the surface of WS{sub 2} nanosheet that greatly amplified the mass of the labeled-FAM fluorophore, resulting in a large FP value. With the co-assisted amplification strategy, the sensitivity was substantially improved. In addition, this method was applied to detect UDG activity in cell extracts. The study of the inhibition of UDG was also performed. Furthermore, this method is simple in design, easy in implementation, and selective, which holds potential applications in the DNA glycosylase related mechanism research and molecular diagnostics. - Highlights: • A fluorescence polarization strategy for DNA glycosylase activity detection was developed. • The present method was based on WS{sub 2} nanosheet and exonuclease III co-assisted signal amplification. • A high sensitivity and desirable selectivity were achieved. • This method provides a promising universal platform for DNA

  1. Structural Basis for the Lesion-scanning Mechanism of the MutY DNA Glycosylase

    Energy Technology Data Exchange (ETDEWEB)

    Wang, Lan; ChakravarthyS, Srinivas; Verdine, Gregory L. (Harvard); (IIT)


    The highly mutagenic A:8-oxoguanine (oxoG) base pair is generated mainly by misreplication of the C:oxoG base pair, the oxidation product of the C:G base pair. The A:oxoG base pair is particularly insidious because neither base in it carries faithful information to direct the repair of the other. The bacterial MutY (MUTYH in humans) adenine DNA glycosylase is able to initiate the repair of A:oxoG by selectively cleaving the A base from the A:oxoG base pair. The difference between faithful repair and wreaking mutagenic havoc on the genome lies in the accurate discrimination between two structurally similar base pairs: A:oxoG and A:T. Here we present two crystal structures of the MutY N-terminal domain in complex with either undamaged DNA or DNA containing an intrahelical lesion. These structures have captured for the first time a DNA glycosylase scanning the genome for a damaged base in the very first stage of lesion recognition and the base extrusion pathway. The mode of interaction observed here has suggested a common lesion-scanning mechanism across the entire helix-hairpin-helix superfamily to which MutY belongs. In addition, small angle X-ray scattering studies together with accompanying biochemical assays have suggested a possible role played by the C-terminal oxoG-recognition domain of MutY in lesion scanning.

  2. Base-Excision-Repair-Induced Construction of a Single Quantum-Dot-Based Sensor for Sensitive Detection of DNA Glycosylase Activity. (United States)

    Wang, Li-Juan; Ma, Fei; Tang, Bo; Zhang, Chun-Yang


    DNA glycosylase is an initiating enzyme of cellular base excision repair pathway which is responsible for the repair of various DNA lesions and the maintenance of genomic stability, and the dysregulation of DNA glycosylase activity is associated with a variety of human pathology. Accurate detection of DNA glycosylase activity is critical to both clinical diagnosis and therapeutics, but conventional methods for the DNA glycosylase assay are usually time-consuming with poor sensitivity. Here, we demonstrate the base-excision-repair-induced construction of a single quantum dot (QD)-based sensor for highly sensitive measurement of DNA glycosylase activity. We use human 8-oxoguanine-DNA glycosylase 1 (hOGG1), which is responsible for specifically repairing the damaged 8-hydroxyguanine (8-oxoG, one of the most abundant and widely studied DNA damage products), as a model DNA glycosylase. In the presence of biotin-labeled DNA substrate, the hOGG1 may catalyze the removal of 8-oxo G from 8-oxoG·C base pairs to generate an apurinic/apyrimidinic (AP) site. With the assistance of apurinic/apyrimidinic endonuclease (APE1), the cleavage of the AP site results in the generation of a single-nucleotide gap. Subsequently, DNA polymerase β incorporates a Cy5-labeled dGTP into the DNA substrate to fill the gap. With the addition of streptavidin-coated QDs, a QD-DNA-Cy5 nanostructure is formed via specific biotin-streptavidin binding, inducing the occurrence of fluorescence resonance energy transfer (FRET) from the QD to Cy5. The resulting Cy5 signal can be simply monitored by total internal reflection fluorescence (TIRF) imaging. The proposed method enables highly sensitive measurement of hOGG1 activity with a detection limit of 1.8 × 10(-6) U/μL. Moreover, it can be used to measure the enzyme kinetic parameters and detect the hOGG1 activity in crude cell extracts, offering a powerful tool for biomedical research and clinical diagnosis.

  3. Restriction glycosylases: involvement of endonuclease activities in the restriction process. (United States)

    Zhang, Yingbiao; Matsuzaka, Tomoyuki; Yano, Hirokazu; Furuta, Yoshikazu; Nakano, Toshiaki; Ishikawa, Ken; Fukuyo, Masaki; Takahashi, Noriko; Suzuki, Yutaka; Sugano, Sumio; Ide, Hiroshi; Kobayashi, Ichizo


    All restriction enzymes examined are phosphodiesterases generating 3΄-OH and 5΄-P ends, but one restriction enzyme (restriction glycosylase) excises unmethylated bases from its recognition sequence. Whether its restriction activity involves endonucleolytic cleavage remains unclear. One report on this enzyme, R.PabI from a hyperthermophile, ascribed the breakage to high temperature while another showed its weak AP lyase activity generates atypical ends. Here, we addressed this issue in mesophiles. We purified R.PabI homologs from Campylobacter coli (R.CcoLI) and Helicobacter pylori (R.HpyAXII) and demonstrated their DNA cleavage, DNA glycosylase and AP lyase activities in vitro at 37°C. The AP lyase activity is more coupled with glycosylase activity in R.CcoLI than in R.PabI. R.CcoLI/R.PabI expression caused restriction of incoming bacteriophage/plasmid DNA and endogenous chromosomal DNA within Escherichia coli at 37°C. The R.PabI-mediated restriction was promoted by AP endonuclease action in vivo or in vitro. These results reveal the role of endonucleolytic DNA cleavage in restriction and yet point to diversity among the endonucleases. The cleaved ends are difficult to repair in vivo, which may indicate their biological significance. These results support generalization of the concept of restriction–modification system to the concept of self-recognizing epigenetic system, which combines any epigenetic labeling and any DNA damaging.

  4. Poxvirus uracil-DNA glycosylase-An unusual member of the family I uracil-DNA glycosylases: Poxvirus Uracil-DNA Glycosylase

    Energy Technology Data Exchange (ETDEWEB)

    Schormann, Norbert [Department of Medicine, University of Alabama at Birmingham, Birmingham Alabama 35294; Zhukovskaya, Natalia [Department of Microbiology, School of Dental Medicine, University of Pennsylvania, Philadelphia Pennsylvania 19104; Bedwell, Gregory [Department of Microbiology, University of Alabama at Birmingham, Birmingham Alabama 35294; Nuth, Manunya [Department of Microbiology, School of Dental Medicine, University of Pennsylvania, Philadelphia Pennsylvania 19104; Gillilan, Richard [MacCHESS (Macromolecular Diffraction Facility at CHESS) Cornell University, Ithaca New York 14853; Prevelige, Peter E. [Department of Microbiology, University of Alabama at Birmingham, Birmingham Alabama 35294; Ricciardi, Robert P. [Department of Microbiology, School of Dental Medicine, University of Pennsylvania, Philadelphia Pennsylvania 19104; Abramson Cancer Center, School of Medicine, University of Pennsylvania, Philadelphia Pennsylvania 19104; Banerjee, Surajit [Department of Chemistry and Chemical Biology, Cornell University, and NE-CAT Argonne Illinois 60439; Chattopadhyay, Debasish [Department of Medicine, University of Alabama at Birmingham, Birmingham Alabama 35294


    We report that uracil-DNA glycosylases are ubiquitous enzymes, which play a key role repairing damages in DNA and in maintaining genomic integrity by catalyzing the first step in the base excision repair pathway. Within the superfamily of uracil-DNA glycosylases family I enzymes or UNGs are specific for recognizing and removing uracil from DNA. These enzymes feature conserved structural folds, active site residues and use common motifs for DNA binding, uracil recognition and catalysis. Within this family the enzymes of poxviruses are unique and most remarkable in terms of amino acid sequences, characteristic motifs and more importantly for their novel non-enzymatic function in DNA replication. UNG of vaccinia virus, also known as D4, is the most extensively characterized UNG of the poxvirus family. D4 forms an unusual heterodimeric processivity factor by attaching to a poxvirus-specific protein A20, which also binds to the DNA polymerase E9 and recruits other proteins necessary for replication. D4 is thus integrated in the DNA polymerase complex, and its DNA-binding and DNA scanning abilities couple DNA processivity and DNA base excision repair at the replication fork. In conclusion, the adaptations necessary for taking on the new function are reflected in the amino acid sequence and the three-dimensional structure of D4. We provide an overview of the current state of the knowledge on the structure-function relationship of D4.

  5. Factors that influence telomeric oxidative base damage and repair by DNA glycosylase OGG1

    DEFF Research Database (Denmark)

    Rhee, David B; Ghosh, Avik; Lu, Jian


    Telomeres are nucleoprotein complexes at the ends of linear chromosomes in eukaryotes, and are essential in preventing chromosome termini from being recognized as broken DNA ends. Telomere shortening has been linked to cellular senescence and human aging, with oxidative stress as a major...... contributing factor. 7,8-Dihydro-8-oxogaunine (8-oxodG) is one of the most abundant oxidative guanine lesions, and 8-oxoguanine DNA glycosylase (OGG1) is involved in its removal. In this study, we examined if telomeric DNA is particularly susceptible to oxidative base damage and if telomere-specific factors...... affect the incision of oxidized guanines by OGG1. We demonstrated that telomeric TTAGGG repeats were more prone to oxidative base damage and repaired less efficiently than non-telomeric TG repeats in vivo. We also showed that the 8-oxodG-incision activity of OGG1 is similar in telomeric and non...

  6. The hepatitis B virus x protein inhibits thymine DNA glycosylase initiated base excision repair.

    Directory of Open Access Journals (Sweden)

    Maarten A A van de Klundert

    Full Text Available The hepatitis B virus (HBV genome encodes the X protein (HBx, a ubiquitous transactivator that is required for HBV replication. Expression of the HBx protein has been associated with the development of HBV infection-related hepatocellular carcinoma (HCC. Previously, we generated a 3D structure of HBx by combined homology and ab initio in silico modelling. This structure showed a striking similarity to the human thymine DNA glycosylase (TDG, a key enzyme in the base excision repair (BER pathway. To further explore this finding, we investigated whether both proteins interfere with or complement each other's functions. Here we show that TDG does not affect HBV replication, but that HBx strongly inhibits TDG-initiated base excision repair (BER, a major DNA repair pathway. Inhibition of the BER pathway may contribute substantially to the oncogenic effect of HBV infection.

  7. Endonuclease VIII-like 3 (Neil3) DNA glycosylase promotes neurogenesis induced by hypoxia-ischemia


    Sejersted, Yngve; Hildrestrand, Gunn A.; Kunke, David; Rolseth, Veslemøy; Krokeide, Silje Z.; Neurauter, Christine G.; Suganthan, Rajikala; Atneosen-Åsegg, Monica; Fleming, Aaron M.; Saugstad, Ola D.; Burrows, Cynthia J.; Luna, Luisa; Bjørås, Magnar


    Neural stem/progenitor cell proliferation and differentiation are required to replace damaged neurons and regain brain function after hypoxic-ischemic events. DNA base lesions accumulating during hypoxic-ischemic stress are removed by DNA glycosylases in the base-excision repair pathway to prevent cytotoxicity and mutagenesis. Expression of the DNA glycosylase endonuclease VIII-like 3 (Neil3) is confined to regenerative subregions in the embryonic and perinatal brains. Here we show profound n...

  8. Functional characterization of 8-oxoguanine DNA glycosylase of Trypanosoma cruzi.

    Directory of Open Access Journals (Sweden)

    Carolina Furtado

    Full Text Available The oxidative lesion 8-oxoguanine (8-oxoG is removed during base excision repair by the 8-oxoguanine DNA glycosylase 1 (Ogg1. This lesion can erroneously pair with adenine, and the excision of this damaged base by Ogg1 enables the insertion of a guanine and prevents DNA mutation. In this report, we identified and characterized Ogg1 from the protozoan parasite Trypanosoma cruzi (TcOgg1, the causative agent of Chagas disease. Like most living organisms, T. cruzi is susceptible to oxidative stress, hence DNA repair is essential for its survival and improvement of infection. We verified that the TcOGG1 gene encodes an 8-oxoG DNA glycosylase by complementing an Ogg1-defective Saccharomyces cerevisiae strain. Heterologous expression of TcOGG1 reestablished the mutation frequency of the yeast mutant ogg1(-/- (CD138 to wild type levels. We also demonstrate that the overexpression of TcOGG1 increases T. cruzi sensitivity to hydrogen peroxide (H(2O(2. Analysis of DNA lesions using quantitative PCR suggests that the increased susceptibility to H(2O(2 of TcOGG1-overexpressor could be a consequence of uncoupled BER in abasic sites and/or strand breaks generated after TcOgg1 removes 8-oxoG, which are not rapidly repaired by the subsequent BER enzymes. This hypothesis is supported by the observation that TcOGG1-overexpressors have reduced levels of 8-oxoG both in the nucleus and in the parasite mitochondrion. The localization of TcOgg1 was examined in parasite transfected with a TcOgg1-GFP fusion, which confirmed that this enzyme is in both organelles. Taken together, our data indicate that T. cruzi has a functional Ogg1 ortholog that participates in nuclear and mitochondrial BER.

  9. Structure determination of uracil-DNA N-glycosylase from Deinococcus radiodurans in complex with DNA. (United States)

    Pedersen, Hege Lynum; Johnson, Kenneth A; McVey, Colin E; Leiros, Ingar; Moe, Elin


    Uracil-DNA N-glycosylase (UNG) is a DNA-repair enzyme in the base-excision repair (BER) pathway which removes uracil from DNA. Here, the crystal structure of UNG from the extremophilic bacterium Deinococcus radiodurans (DrUNG) in complex with DNA is reported at a resolution of 1.35 Å. Prior to the crystallization experiments, the affinity between DrUNG and different DNA oligonucleotides was tested by electrophoretic mobility shift assays (EMSAs). As a result of this analysis, two 16 nt double-stranded DNAs were chosen for the co-crystallization experiments, one of which (16 nt AU) resulted in well diffracting crystals. The DNA in the co-crystal structure contained an abasic site (substrate product) flipped into the active site of the enzyme, with no uracil in the active-site pocket. Despite the high resolution, it was not possible to fit all of the terminal nucleotides of the DNA complex into electron density owing to disorder caused by a lack of stabilizing interactions. However, the DNA which was in contact with the enzyme, close to the active site, was well ordered and allowed detailed analysis of the enzyme-DNA interaction. The complex revealed that the interaction between DrUNG and DNA is similar to that in the previously determined crystal structure of human UNG (hUNG) in complex with DNA [Slupphaug et al. (1996). Nature (London), 384, 87-92]. Substitutions in a (here defined) variable part of the leucine loop result in a shorter loop (eight residues instead of nine) in DrUNG compared with hUNG; regardless of this, it seems to fulfil its role and generate a stabilizing force with the minor groove upon flipping out of the damaged base into the active site. The structure also provides a rationale for the previously observed high catalytic efficiency of DrUNG caused by high substrate affinity by demonstrating an increased number of long-range electrostatic interactions between the enzyme and the DNA. Interestingly, specific interactions between residues

  10. Destabilization of the PCNA trimer mediated by its interaction with the NEIL1 DNA glycosylase

    Energy Technology Data Exchange (ETDEWEB)

    Prakash, Aishwarya; Moharana, Kedar; Wallace, Susan S.; Doublié, Sylvie


    The base excision repair (BER) pathway repairs oxidized lesions in the DNA that result from reactive oxygen species generated in cells. If left unrepaired, these damaged DNA bases can disrupt cellular processes such as replication. NEIL1 is one of the 11 human DNA glycosylases that catalyze the first step of the BER pathway, i.e. recognition and excision of DNA lesions. NEIL1 interacts with essential replication proteins such as the ring-shaped homotrimeric proliferating cellular nuclear antigen (PCNA). We isolated a complex formed between NEIL1 and PCNA (±DNA) using size exclusion chromatography (SEC). This interaction was confirmed using native gel electrophoresis and mass spectrometry. Stokes radii measured by SEC hinted that PCNA in complex with NEIL1 (±DNA) was no longer a trimer. Height measurements and images obtained by atomic force microscopy also demonstrated the dissociation of the PCNA homotrimer in the presence of NEIL1 and DNA, while small-angle X-ray scattering analysis confirmed the NEIL1 mediated PCNA trimer dissociation and formation of a 1:1:1 NEIL1-DNA-PCNA(monomer) complex. Furthermore, ab initio shape reconstruction provides insights into the solution structure of this previously unreported complex. Together, these data point to a potential mechanistic switch between replication and BER.

  11. Crystal structure of mimivirus uracil-DNA glycosylase. (United States)

    Kwon, Eunju; Pathak, Deepak; Chang, Hyeun Wook; Kim, Dong Young


    Cytosine deamination induced by stresses or enzymatic catalysis converts deoxycytidine into deoxyuridine, thereby introducing a G to A mutation after DNA replication. Base-excision repair to correct uracil to cytosine is initiated by uracil-DNA glycosylase (UDG), which recognizes and eliminates uracil from DNA. Mimivirus, one of the largest known viruses, also encodes a distinctive UDG gene containing a long N-terminal domain (N-domain; residues 1-130) and a motif-I (residues 327-343), in addition to the canonical catalytic domain of family I UDGs (also called UNGs). To understand the structural and functional features of the additional segments, we have determined the crystal structure of UNG from Acanthamoeba polyphaga mimivirus (mvUNG). In the crystal structure of mvUNG, residues 95-130 in the N-domain bind to a hydrophobic groove in the catalytic domain, and motif-I forms a short β-sheet with a positively charged surface near the active site. Circular dichroism spectra showed that residues 1-94 are in a random coil conformation. Deletion of the three additional fragments reduced the activity and thermal stability, compared to full-length mvUNG. The results suggested that the mvUNG N-domain and motif-I are required for its structural and functional integrity.

  12. Alkyladenine DNA glycosylase (AAG) localizes to mitochondria and interacts with mitochondrial single-stranded binding protein (mtSSB). (United States)

    van Loon, Barbara; Samson, Leona D


    Due to a harsh environment mitochondrial genomes accumulate high levels of DNA damage, in particular oxidation, hydrolytic deamination, and alkylation adducts. While repair of alkylated bases in nuclear DNA has been explored in detail, much less is known about the repair of DNA alkylation damage in mitochondria. Alkyladenine DNA glycosylase (AAG) recognizes and removes numerous alkylated bases, but to date AAG has only been detected in the nucleus, even though mammalian mitochondria are known to repair DNA lesions that are specific substrates of AAG. Here we use immunofluorescence to show that AAG localizes to mitochondria, and we find that native AAG is present in purified human mitochondrial extracts, as well as that exposure to alkylating agent promotes AAG accumulation in the mitochondria. We identify mitochondrial single-stranded binding protein (mtSSB) as a novel interacting partner of AAG; interaction between mtSSB and AAG is direct and increases upon methyl methanesulfonate (MMS) treatment. The consequence of this interaction is specific inhibition of AAG glycosylase activity in the context of a single-stranded DNA (ssDNA), but not a double-stranded DNA (dsDNA) substrate. By inhibiting AAG-initiated processing of damaged bases, mtSSB potentially prevents formation of DNA breaks in ssDNA, ensuring that base removal primarily occurs in dsDNA. In summary, our findings suggest the existence of AAG-initiated BER in mitochondria and further support a role for mtSSB in DNA repair. Copyright © 2012. Published by Elsevier B.V.

  13. Crystal Structure of the Vaccinia Virus Uracil-DNA Glycosylase in Complex with DNA* (United States)

    Burmeister, Wim P.; Tarbouriech, Nicolas; Fender, Pascal; Contesto-Richefeu, Céline; Peyrefitte, Christophe N.; Iseni, Frédéric


    Vaccinia virus polymerase holoenzyme is composed of the DNA polymerase catalytic subunit E9 associated with its heterodimeric co-factor A20·D4 required for processive genome synthesis. Although A20 has no known enzymatic activity, D4 is an active uracil-DNA glycosylase (UNG). The presence of a repair enzyme as a component of the viral replication machinery suggests that, for poxviruses, DNA synthesis and base excision repair is coupled. We present the 2.7 Å crystal structure of the complex formed by D4 and the first 50 amino acids of A20 (D4·A201–50) bound to a 10-mer DNA duplex containing an abasic site resulting from the cleavage of a uracil base. Comparison of the viral complex with its human counterpart revealed major divergences in the contacts between protein and DNA and in the enzyme orientation on the DNA. However, the conformation of the dsDNA within both structures is very similar, suggesting a dominant role of the DNA conformation for UNG function. In contrast to human UNG, D4 appears rigid, and we do not observe a conformational change upon DNA binding. We also studied the interaction of D4·A201–50 with different DNA oligomers by surface plasmon resonance. D4 binds weakly to nonspecific DNA and to uracil-containing substrates but binds abasic sites with a Kd of DNA complex structure of a family I UNG gives new insight into the role of D4 as a co-factor of vaccinia virus DNA polymerase and allows a better understanding of the structural determinants required for UNG action. PMID:26045555

  14. Crystal Structure of the Vaccinia Virus Uracil-DNA Glycosylase in Complex with DNA. (United States)

    Burmeister, Wim P; Tarbouriech, Nicolas; Fender, Pascal; Contesto-Richefeu, Céline; Peyrefitte, Christophe N; Iseni, Frédéric


    Vaccinia virus polymerase holoenzyme is composed of the DNA polymerase catalytic subunit E9 associated with its heterodimeric co-factor A20·D4 required for processive genome synthesis. Although A20 has no known enzymatic activity, D4 is an active uracil-DNA glycosylase (UNG). The presence of a repair enzyme as a component of the viral replication machinery suggests that, for poxviruses, DNA synthesis and base excision repair is coupled. We present the 2.7 Å crystal structure of the complex formed by D4 and the first 50 amino acids of A20 (D4·A201-50) bound to a 10-mer DNA duplex containing an abasic site resulting from the cleavage of a uracil base. Comparison of the viral complex with its human counterpart revealed major divergences in the contacts between protein and DNA and in the enzyme orientation on the DNA. However, the conformation of the dsDNA within both structures is very similar, suggesting a dominant role of the DNA conformation for UNG function. In contrast to human UNG, D4 appears rigid, and we do not observe a conformational change upon DNA binding. We also studied the interaction of D4·A201-50 with different DNA oligomers by surface plasmon resonance. D4 binds weakly to nonspecific DNA and to uracil-containing substrates but binds abasic sites with a Kd of DNA complex structure of a family I UNG gives new insight into the role of D4 as a co-factor of vaccinia virus DNA polymerase and allows a better understanding of the structural determinants required for UNG action. © 2015 by The American Society for Biochemistry and Molecular Biology, Inc.

  15. Interaction of apurinic/apyrimidinic endonuclease 2 (Apn2) with Myh1 DNA glycosylase in fission yeast


    Jin, Jin; Hwang, Bor-Jang; Chang, Po-Wen; Toth, Eric A.; Lu, A-Lien


    Oxidative DNA damage is repaired primarily by the base excision repair (BER) pathway in a process initiated by removal of base lesions or mismatched bases by DNA glycosylases. MutY homolog (MYH, MUTYH, or Myh1) is a DNA glycosylase which excises adenine paired with the oxidative lesion 8-oxo-7,8-dihydroguanine (8-oxoG, or Go), thus reducing G:C to T:A mutations. The resulting apurinic/apyrimidinic (AP) site is processed by an AP-endonuclease or a bifunctional glycosylase/lya...

  16. The NEIL glycosylases remove oxidized guanine lesions from telomeric and promoter quadruplex DNA structures. (United States)

    Zhou, Jia; Fleming, Aaron M; Averill, April M; Burrows, Cynthia J; Wallace, Susan S


    G-quadruplex is a four-stranded G-rich DNA structure that is highly susceptible to oxidation. Despite the important roles that G-quadruplexes play in telomere biology and gene transcription, neither the impact of guanine lesions on the stability of quadruplexes nor their repair are well understood. Here, we show that the oxidized guanine lesions 8-oxo-7,8-dihydroguanine (8-oxoG), guanidinohydantoin (Gh) and spiroiminodihydantoin (Sp) reduce the thermostability and alter the folding of telomeric quadruplexes in a location-dependent manner. Also, the NEIL1 and NEIL3 DNA glycosylases can remove hydantoin lesions but none of the glycosylases, including OGG1, are able to remove 8-oxoG from telomeric quadruplexes. Interestingly, a hydantoin lesion at the site most prone to oxidation in quadruplex DNA is not efficiently removed by NEIL1 or NEIL3. However, NEIL1, NEIL2 and NEIL3 remove hydantoins from telomeric quadruplexes formed by five TTAGGG repeats much more rapidly than the commonly studied four-repeat quadruplex structures. We also show that APE1 cleaves furan in selected positions in Na(+)-coordinated telomeric quadruplexes. In promoter G-quadruplex DNA, the NEIL glycosylases primarily remove Gh from Na(+)-coordinated antiparallel quadruplexes but not K(+)-coordinated parallel quadruplexes containing VEGF or c-MYC promoter sequences. Thus, the NEIL DNA glycosylases may be involved in both telomere maintenance and in gene regulation. © The Author(s) 2015. Published by Oxford University Press on behalf of Nucleic Acids Research.

  17. Structure of a DNA glycosylase that unhooks interstrand cross-links

    Energy Technology Data Exchange (ETDEWEB)

    Mullins, Elwood A.; Warren, Garrett M.; Bradley, Noah P.; Eichman, Brandt F. (Vanderbilt)


    DNA glycosylases are important editing enzymes that protect genomic stability by excising chemically modified nucleobases that alter normal DNA metabolism. These enzymes have been known only to initiate base excision repair of small adducts by extrusion from the DNA helix. However, recent reports have described both vertebrate and microbial DNA glycosylases capable of unhooking highly toxic interstrand cross-links (ICLs) and bulky minor groove adducts normally recognized by Fanconi anemia and nucleotide excision repair machinery, although the mechanisms of these activities are unknown. Here we report the crystal structure of Streptomyces sahachiroi AlkZ (previously Orf1), a bacterial DNA glycosylase that protects its host by excising ICLs derived from azinomycin B (AZB), a potent antimicrobial and antitumor genotoxin. AlkZ adopts a unique fold in which three tandem winged helix-turn-helix motifs scaffold a positively charged concave surface perfectly shaped for duplex DNA. Through mutational analysis, we identified two glutamine residues and a β-hairpin within this putative DNA-binding cleft that are essential for catalytic activity. Additionally, we present a molecular docking model for how this active site can unhook either or both sides of an AZB ICL, providing a basis for understanding the mechanisms of base excision repair of ICLs. Given the prevalence of this protein fold in pathogenic bacteria, this work also lays the foundation for an emerging role of DNA repair in bacteria-host pathogenesis.

  18. Expression and characterization of thymine-DNA glycosylase from Aeropyrum pernix. (United States)

    Liu, Xi-Peng; Li, Chun-Peng; Hou, Jing-Li; Liu, Yu-Fen; Liang, Ru-Bing; Liu, Jian-Hua


    The recombinant thymine-DNA glycosylase (TDG) from Aeropyrum pernix (A. pernix) was expressed in Escherichia coli. The enzymatic activity of recombinant A. pernix TDG (ApeTDG) was characterized using oligonucleotides containing a thymine/uracil base as substrate. ApeTDG had distinct glycosylase activity on T/G mismatch. The optimal temperature and pH for thymine removal were 65-70 degrees C and pH 7.0-8.5, respectively. High concentration of NaCl inhibited the thymine removal. Divalent ions had different influence on the thymine removal by ApeTDG. Ca(2+) and Mg(2+) had no inhibition on the enzymic activity, but Ni(2+), Co(2+), Cu(2+), Mn(2+), and Zn(2+) completely inhibited the excision reaction. As derived from a hyperthermophilic archaea, ApeTDG protein was heat-resistant at 75 degrees C. ApeTDG also had a relatively weak DNA glycosylase activity on uracil base, with the following order: U/C>U/G approximately U/T>U/U approximately U/I approximately U/AP approximately U/->U/A. Additional mismatch located at 3' of T/G had less inhibition on the thymine removal than that located at 5' of T/G, and two additional mismatches located at each side of T/G completely inhibited the excision of thymine. Together, these data suggest that ApeTDG is a TDG protein with weak UDG activity. (c) 2009 Elsevier Inc. All rights reserved.

  19. Repair of 8-oxo-7,8-dihydroguanine in prokaryotic and eukaryotic cells: Properties and biological roles of the Fpg and OGG1 DNA N-glycosylases. (United States)

    Boiteux, Serge; Coste, Franck; Castaing, Bertrand


    Oxidatively damaged DNA results from the attack of sugar and base moieties by reactive oxygen species (ROS), which are formed as byproducts of normal cell metabolism and during exposure to endogenous or exogenous chemical or physical agents. Guanine, having the lowest redox potential, is the DNA base the most susceptible to oxidation, yielding products such as 8-oxo-7,8-dihydroguanine (8-oxoG) and 2-6-diamino-4-hydroxy-5-formamidopyrimidine (FapyG). In DNA, 8-oxoG was shown to be mutagenic yielding GC to TA transversions upon incorporation of dAMP opposite this lesion by replicative DNA polymerases. In prokaryotic and eukaryotic cells, 8-oxoG is primarily repaired by the base excision repair pathway (BER) initiated by a DNA N-glycosylase, Fpg and OGG1, respectively. In Escherichia coli, Fpg cooperates with MutY and MutT to prevent 8-oxoG-induced mutations, the "GO-repair system". In Saccharomyces cerevisiae, OGG1 cooperates with nucleotide excision repair (NER), mismatch repair (MMR), post-replication repair (PRR) and DNA polymerase η to prevent mutagenesis. Human and mouse cells mobilize all these pathways using OGG1, MUTYH (MutY-homolog also known as MYH), MTH1 (MutT-homolog also known as NUDT1), NER, MMR, NEILs and DNA polymerases η and λ, to prevent 8-oxoG-induced mutations. In fact, mice deficient in both OGG1 and MUTYH develop cancer in different organs at adult age, which points to the critical impact of 8-oxoG repair on genetic stability in mammals. In this review, we will focus on Fpg and OGG1 proteins, their biochemical and structural properties as well as their biological roles. Other DNA N-glycosylases able to release 8-oxoG from damaged DNA in various organisms will be discussed. Finally, we will report on the role of OGG1 in human disease and the possible use of 8-oxoG DNA N-glycosylases as therapeutic targets. Copyright © 2017 Elsevier Inc. All rights reserved.

  20. A 5-methylcytosine DNA glycosylase/lyase demethylates the retrotransposon Tos17 and promotes its transposition in rice

    KAUST Repository

    La, Honggui


    DNA 5-methylcytosine (5-meC) is an important epigenetic mark for transcriptional gene silencing in many eukaryotes. In Arabidopsis, 5-meC DNA glycosylase/lyases actively remove 5-meC to counter-act transcriptional gene silencing in a locus-specific manner, and have been suggested to maintain the expression of transposons. However, it is unclear whether plant DNA demethylases can promote the transposition of transposons. Here we report the functional characterization of the DNA glycosylase/lyase DNG701 in rice. DNG701 encodes a large (1,812 amino acid residues) DNA glycosylase domain protein. Recombinant DNG701 protein showed 5-meC DNA glycosylase and lyase activities in vitro. Knockout or knockdown of DNG701 in rice plants led to DNA hypermethylation and reduced expression of the retrotransposon Tos17. Tos17 showed less transposition in calli derived from dng701 knockout mutant seeds compared with that in wild-type calli. Overexpression of DNG701 in both rice calli and transgenic plants substantially reduced DNA methylation levels of Tos17 and enhanced its expression. The overexpression also led to more frequent transposition of Tos17 in calli. Our results demonstrate that rice DNG701 is a 5-meC DNA glycosylase/lyase responsible for the demethylation of Tos17 and this DNA demethylase plays a critical role in promoting Tos17 transposition in rice calli.

  1. Induction of NEIL1 and NEIL2 DNA glycosylases in aniline-induced splenic toxicity (United States)

    Ma, Huaxian; Wang, Jianling; Abdel-Rahman, Sherif Z.; Hazra, Tapas K.; Boor, Paul J.; Khan, M. Firoze


    The mechanisms by which aniline exposure elicits splenotoxic response, especially the tumorigenic response, are not well-understood. Earlier, we have shown that aniline-induced oxidative stress is associated with increased oxidative DNA damage in rat spleen. The base excision repair (BER) pathway is the major mechanism for the repair of oxidative DNA base lesions, and we have shown an up-regulation of 8-oxoguanine glycosylase 1 (OGG1), a specific DNA glycosylase involved in the removal of 8-hydroxy-2′-deoxyguanosine (8-OHdG) adducts, following aniline exposure. Nei-like DNA glycosylases (NEIL1/2) belong to a family of BER proteins that are distinct from other DNA glycosylases, including OGG1. However, contribution of NEIL1/2 in the repair of aniline-induced oxidative DNA damage in the spleen is not known. This study was, therefore, focused on evaluating if NEILs also contribute to the repair of oxidative DNA lesions in the spleen following aniline exposure. To achieve that, male SD rats were subchronically exposed to aniline (0.5 mmol/kg/day via drinking water for 30 days), while controls received drinking water only. The BER activity of NEIL1/2 was assayed using a bubble structure substrate containing 5-OHU (preferred substrates for NEIL1 and NEIL2) and by quantitating the cleavage products. Aniline treatment led to a 1.25-fold increase in the NEIL1/2-associated BER activity in the nuclear extracts of spleen compared to the controls. Real-time PCR analysis for NEIL1 and NEIL2 mRNA expression in the spleen revealed 2.7- and 3.9-fold increases, respectively, in aniline-treated rats compared to controls. Likewise, Western blot analysis showed that protein expression of NEIL1 and NEIL2 in the nuclear extract of spleens from aniline-treated rats was 2.0- and 3.8-fold higher than controls, respectively. Aniline treatment also led to stronger immunoreactivity for NEIL1 and NEIL2 in the spleens, confined to the red pulp areas. These studies, thus, show that aniline

  2. Cockayne Syndrome group B protein stimulates NEIL2 DNA glycosylase activity. (United States)

    Aamann, Maria D; Hvitby, Christina; Popuri, Venkateswarlu; Muftuoglu, Meltem; Lemminger, Lasse; Skeby, Cecilie K; Keijzers, Guido; Ahn, Byungchan; Bjørås, Magnar; Bohr, Vilhelm A; Stevnsner, Tinna


    Cockayne Syndrome is a segmental premature aging syndrome, which can be caused by loss of function of the CSB protein. CSB is essential for genome maintenance and has numerous interaction partners with established roles in different DNA repair pathways including transcription coupled nucleotide excision repair and base excision repair. Here, we describe a new interaction partner for CSB, the DNA glycosylase NEIL2. Using both cell extracts and recombinant proteins, CSB and NEIL2 were found to physically interact independently of DNA. We further found that CSB is able to stimulate NEIL2 glycosylase activity on a 5-hydroxyl uracil lesion in a DNA bubble structure substrate in vitro. A novel 4,6-diamino-5-formamidopyrimidine (FapyA) specific incision activity of NEIL2 was also stimulated by CSB. To further elucidate the biological role of the interaction, immunofluorescence studies were performed, showing an increase in cytoplasmic CSB and NEIL2 co-localization after oxidative stress. Additionally, stalling of the progression of the transcription bubble with α-amanitin resulted in increased co-localization of CSB and NEIL2. Finally, CSB knockdown resulted in reduced incision of 8-hydroxyguanine in a DNA bubble structure using whole cell extracts. Taken together, our data supports a biological role for CSB and NEIL2 in transcription associated base excision repair. Copyright © 2014 Elsevier Ireland Ltd. All rights reserved.

  3. Correlated Mutation in the Evolution of Catalysis in Uracil DNA Glycosylase Superfamily (United States)

    Xia, Bo; Liu, Yinling; Guevara, Jose; Li, Jing; Jilich, Celeste; Yang, Ye; Wang, Liangjiang; Dominy, Brian N.; Cao, Weiguo


    Enzymes in Uracil DNA glycosylase (UDG) superfamily are essential for the removal of uracil. Family 4 UDGa is a robust uracil DNA glycosylase that only acts on double-stranded and single-stranded uracil-containing DNA. Based on mutational, kinetic and modeling analyses, a catalytic mechanism involving leaving group stabilization by H155 in motif 2 and water coordination by N89 in motif 3 is proposed. Mutual Information analysis identifies a complexed correlated mutation network including a strong correlation in the EG doublet in motif 1 of family 4 UDGa and in the QD doublet in motif 1 of family 1 UNG. Conversion of EG doublet in family 4 Thermus thermophilus UDGa to QD doublet increases the catalytic efficiency by over one hundred-fold and seventeen-fold over the E41Q and G42D single mutation, respectively, rectifying the strong correlation in the doublet. Molecular dynamics simulations suggest that the correlated mutations in the doublet in motif 1 position the catalytic H155 in motif 2 to stabilize the leaving uracilate anion. The integrated approach has important implications in studying enzyme evolution and protein structure and function.

  4. Finding and Producing Probiotic Glycosylases for the Biocatalysis of Ginsenosides: A Mini Review

    Directory of Open Access Journals (Sweden)

    Seockmo Ku


    Full Text Available Various microorganisms have been widely applied in nutraceutical industries for the processing of phytochemical conversion. Specifically, in the Asian food industry and academia, notable attention is paid to the biocatalytic process of ginsenosides (ginseng saponins using probiotic bacteria that produce high levels of glycosyl-hydrolases. Multiple groups have conducted experiments in order to determine the best conditions to produce more active and stable enzymes, which can be applicable to produce diverse types of ginsenosides for commercial applications. In this sense, there are various reviews that cover the biofunctional effects of multiple types of ginsenosides and the pathways of ginsenoside deglycosylation. However, little work has been published on the production methods of probiotic enzymes, which is a critical component of ginsenoside processing. This review aims to investigate current preparation methods, results on the discovery of new glycosylases, the application potential of probiotic enzymes and their use for biocatalysis of ginsenosides in the nutraceutical industry.

  5. DNA glycosylase activity and cell proliferation are key factors in modulating homologous recombination in vivo. (United States)

    Kiraly, Orsolya; Gong, Guanyu; Roytman, Megan D; Yamada, Yoshiyuki; Samson, Leona D; Engelward, Bevin P


    Cancer susceptibility varies between people, affected by genotoxic exposures, genetic makeup and physiological state. Yet, how these factors interact among each other to define cancer risk is largely unknown. Here, we uncover the interactive effects of genetical, environmental and physiological factors on genome rearrangements driven by homologous recombination (HR). Using FYDR mice to quantify HR-driven rearrangements in pancreas tissue, we show that DNA methylation damage (induced by methylnitrosourea) and cell proliferation (induced by thyroid hormone) each induce HR and together act synergistically to induce HR-driven rearrangements in vivo. These results imply that developmental or regenerative proliferation as well as mitogenic exposures may sensitize tissues to DNA damaging exposures. We exploited mice genetically deficient in alkyl-adenine DNA glycosylase (Aag) to analyse the relative contributions of unrepaired DNA base lesions versus intermediates formed during base excision repair (BER). Remarkably, results show that, in the pancreas, Aag is a major driver of spontaneous HR, indicating that BER intermediates (including abasic sites and single strand breaks) are more recombinogenic than the spontaneous base lesions removed by Aag. Given that mammals have about a dozen DNA glycosylases, these results point to BER as a major source of pressure on the HR pathway in vivo. Taken together, methylation damage, cell proliferation and Aag interact to define the risk of HR-driven sequence rearrangements in vivo. These data identify important sources of sequence changes in a cancer-relevant organ, and advance the effort to identify populations at high-risk for cancer. © The Author 2014. Published by Oxford University Press. All rights reserved. For Permissions, please email:

  6. A combinatorial role for MutY and Fpg DNA glycosylases in mutation avoidance in Mycobacterium smegmatis

    Energy Technology Data Exchange (ETDEWEB)

    Hassim, Farzanah; Papadopoulos, Andrea O.; Kana, Bavesh D.; Gordhan, Bhavna G., E-mail:


    Highlights: • We studied the combined role of MutY and Fpg DNA glycosylases in M. smegmatis. • Loss of MutY showed increased sensitivity to oxidative damage. • Loss of MutY together with the Fpg glycosylases showed increased mutation rates. • Our data indicate interplay between these enzymes to control mutagenesis. - Abstract: Hydroxyl radical (·OH) among reactive oxygen species cause damage to nucleobases with thymine being the most susceptible, whilst in contrast, the singlet oxygen ({sup 1}0{sub 2}) targets only guanine bases. The high GC content of mycobacterial genomes predisposes these organisms to oxidative damage of guanine. The exposure of cellular DNA to ·OH and one-electron oxidants results in the formation of two main degradation products, the pro-mutagenic 8-oxo-7,8-dihydroguanine (8-oxoGua) and the cytotoxic 2,6-diamino-4-hydroxy-5-formamidopyrimidine (FapyGua). These lesions are repaired through the base excision repair (BER) pathway and we previously, demonstrated a combinatorial role for the mycobacterial Endonuclease III (Nth) and the Nei family of DNA glycosylases in mutagenesis. In addition, the formamidopyrimidine (Fpg/MutM) and MutY DNA glycosylases have also been implicated in mutation avoidance and BER in mycobacteria. In this study, we further investigate the combined role of MutY and the Fpg/Nei DNA glycosylases in Mycobacterium smegmatis and demonstrate that deletion of mutY resulted in enhanced sensitivity to oxidative stress, an effect which was not exacerbated in Δfpg1 Δfpg2 or Δnei1 Δnei2 double mutant backgrounds. However, combinatorial loss of the mutY, fpg1 and fpg2 genes resulted in a significant increase in mutation rates suggesting interplay between these enzymes. Consistent with this, there was a significant increase in C → A mutations with a corresponding change in cell morphology of rifampicin resistant mutants in the Δfpg1 Δfpg2 ΔmutY deletion mutant. In contrast, deletion of mutY together with the nei

  7. Evidence that OGG1 glycosylase protects neurons against oxidative DNA damage and cell death under ischemic conditions

    DEFF Research Database (Denmark)

    Liu, Dong; Croteau, Deborah L; Souza-Pinto, Nadja


    to ischemic and oxidative stress. After exposure of cultured neurons to oxidative and metabolic stress levels of OGG1 in the nucleus were elevated and mitochondria exhibited fragmentation and increased levels of the mitochondrial fission protein dynamin-related protein 1 (Drp1) and reduced membrane potential......7,8-Dihydro-8-oxoguanine DNA glycosylase (OGG1) is a major DNA glycosylase involved in base-excision repair (BER) of oxidative DNA damage to nuclear and mitochondrial DNA (mtDNA). We used OGG1-deficient (OGG1(-/-)) mice to examine the possible roles of OGG1 in the vulnerability of neurons....... Cortical neurons isolated from OGG1(-/-) mice were more vulnerable to oxidative insults than were OGG1(+/+) neurons, and OGG1(-/-) mice developed larger cortical infarcts and behavioral deficits after permanent middle cerebral artery occlusion compared with OGG1(+/+) mice. Accumulations of oxidative DNA...

  8. The DNA glycosylases OGG1 and NEIL3 influence differentiation potential, proliferation, and senescence-associated signs in neural stem cells

    Energy Technology Data Exchange (ETDEWEB)

    Reis, Amilcar [Linnaeus Center in Developmental Biology for Regenerative Medicine (DBRM), Department of Neuroscience, Karolinska Institutet, SE 17177 Stockholm (Sweden); Hermanson, Ola, E-mail: [Linnaeus Center in Developmental Biology for Regenerative Medicine (DBRM), Department of Neuroscience, Karolinska Institutet, SE 17177 Stockholm (Sweden)


    Highlights: Black-Right-Pointing-Pointer DNA glycosylases OGG1 and NEIL3 are required for neural stem cell state. Black-Right-Pointing-Pointer No effect on cell viability by OGG1 or NEIL3 knockdown in neural stem cells. Black-Right-Pointing-Pointer OGG1 or NEIL3 RNA knockdown result in decreased proliferation and differentiation. Black-Right-Pointing-Pointer Increased HP1{gamma} immunoreactivity after NEIL3 knockdown suggests premature senescence. -- Abstract: Embryonic neural stem cells (NSCs) exhibit self-renewal and multipotency as intrinsic characteristics that are key parameters for proper brain development. When cells are challenged by oxidative stress agents the resulting DNA lesions are repaired by DNA glycosylases through the base excision repair (BER) pathway as a means to maintain the fidelity of the genome, and thus, proper cellular characteristics. The functional roles for DNA glycosylases in NSCs have however remained largely unexplored. Here we demonstrate that RNA knockdown of the DNA glycosylases OGG1 and NEIL3 decreased NSC differentiation ability and resulted in decreased expression of both neuronal and astrocytic genes after mitogen withdrawal, as well as the stem cell marker Musashi-1. Furthermore, while cell survival remained unaffected, NEIL3 deficient cells displayed decreased cell proliferation rates along with an increase in HP1{gamma} immunoreactivity, a sign of premature senescence. Our results suggest that DNA glycosylases play multiple roles in governing essential neural stem cell characteristics.

  9. Uracil-DNA glycosylase: Structural, thermodynamic and kinetic aspects of lesion search and recognition

    Energy Technology Data Exchange (ETDEWEB)

    Zharkov, Dmitry O., E-mail: [SB RAS Institute of Chemical Biology and Fundamental Medicine, 8 Lavrentieva Ave., Novosibirsk 630090 (Russian Federation); Department of Molecular Biology, Faculty of Natural Sciences, Novosibirsk State University, 2 Pirogova St., Novosibirsk 630090 (Russian Federation); Mechetin, Grigory V. [SB RAS Institute of Chemical Biology and Fundamental Medicine, 8 Lavrentieva Ave., Novosibirsk 630090 (Russian Federation); Nevinsky, Georgy A., E-mail: [SB RAS Institute of Chemical Biology and Fundamental Medicine, 8 Lavrentieva Ave., Novosibirsk 630090 (Russian Federation); Department of Molecular Biology, Faculty of Natural Sciences, Novosibirsk State University, 2 Pirogova St., Novosibirsk 630090 (Russian Federation)


    Uracil appears in DNA as a result of cytosine deamination and by incorporation from the dUTP pool. As potentially mutagenic and deleterious for cell regulation, uracil must be removed from DNA. The major pathway of its repair is initiated by uracil-DNA glycosylases (UNG), ubiquitously found enzymes that hydrolyze the N-glycosidic bond of deoxyuridine in DNA. This review describes the current understanding of the mechanism of uracil search and recognition by UNG. The structure of UNG proteins from several species has been solved, revealing a specific uracil-binding pocket located in a DNA-binding groove. DNA in the complex with UNG is highly distorted to allow the extrahelical recognition of uracil. Thermodynamic studies suggest that UNG binds with appreciable affinity to any DNA, mainly due to the interactions with the charged backbone. The increase in the affinity for damaged DNA is insufficient to account for the exquisite specificity of UNG for uracil. This specificity is likely to result from multistep lesion recognition process, in which normal bases are rejected at one or several pre-excision stages of enzyme-substrate complex isomerization, and only uracil can proceed to enter the active site in a catalytically competent conformation. Search for the lesion by UNG involves random sliding along DNA alternating with dissociation-association events and partial eversion of undamaged bases for initial sampling.

  10. Thymine DNA Glycosylase Gene Knockdown Can Affect the Differentiation of Pig Preadipocytes

    Directory of Open Access Journals (Sweden)

    Lian-Jiang Zhang


    Full Text Available Aims: To study the effect of thymine DNA glycosylase (TDG gene knockdown on the differentiation of pig preadipocytes. Methods: Preadipocytes were obtained from subcutaneous adipose tissue from the neck of 1- to 7-day-old pigs. The TDG gene was knocked down using siRNA, and cell differentiation was induced. The mRNA expression level was measured using fluorescence quantitative PCR, and the protein expression level was determined using Western blot analysis. The DNA methylation levels in promoter regions of differentiation-related genes were also evaluated. Results: TDG gene knockdown decreased the mRNA expression levels of the peroxisome proliferator-activated receptorγ (PPARγ and Fatty acid binding proteins 4(FABP4 Also known as aP2 genes (PP>0.05. In addition, after induced differentiation, the lipid droplet production significantly decreased, and the percentages of methylation in the promoter regions of C/EBPα, PPARγ, and aP2 genes were 0.9%, 80%, and 76%, respectively. In contrast, the percentages of methylation in the negative control groups were 0.5%, 67.5%, and 58%, respectively. Conclusion: TDG gene knockdown could inhibit the differentiation of pig preadipocytes and affect the DNA methylation levels of some transcription factors.

  11. Analysis of substrate specificity of Schizosaccharomyces pombe Mag1 alkylpurine DNA glycosylase

    Energy Technology Data Exchange (ETDEWEB)

    Adhikary, Suraj; Eichman, Brandt F. (Vanderbilt)


    DNA glycosylases specialized for the repair of alkylation damage must identify, with fine specificity, a diverse array of subtle modifications within DNA. The current mechanism involves damage sensing through interrogation of the DNA duplex, followed by more specific recognition of the target base inside the active site pocket. To better understand the physical basis for alkylpurine detection, we determined the crystal structure of Schizosaccharomyces pombe Mag1 (spMag1) in complex with DNA and performed a mutational analysis of spMag1 and the close homologue from Saccharomyces cerevisiae (scMag). Despite strong homology, spMag1 and scMag differ in substrate specificity and cellular alkylation sensitivity, although the enzymological basis for their functional differences is unknown. We show that Mag preference for 1,N{sup 6}-ethenoadenine ({var_epsilon}A) is influenced by a minor groove-interrogating residue more than the composition of the nucleobase-binding pocket. Exchanging this residue between Mag proteins swapped their {var_epsilon}A activities, providing evidence that residues outside the extrahelical base-binding pocket have a role in identification of a particular modification in addition to sensing damage.

  12. Architecturally diverse proteins converge on an analogous mechanism to inactivate Uracil-DNA glycosylase. (United States)

    Cole, Ambrose R; Ofer, Sapir; Ryzhenkova, Ksenia; Baltulionis, Gediminas; Hornyak, Peter; Savva, Renos


    Uracil-DNA glycosylase (UDG) compromises the replication strategies of diverse viruses from unrelated lineages. Virally encoded proteins therefore exist to limit, inhibit or target UDG activity for proteolysis. Viral proteins targeting UDG, such as the bacteriophage proteins ugi, and p56, and the HIV-1 protein Vpr, share no sequence similarity, and are not structurally homologous. Such diversity has hindered identification of known or expected UDG-inhibitory activities in other genomes. The structural basis for UDG inhibition by ugi is well characterized; yet, paradoxically, the structure of the unbound p56 protein is enigmatically unrevealing of its mechanism. To resolve this conundrum, we determined the structure of a p56 dimer bound to UDG. A helix from one of the subunits of p56 occupies the UDG DNA-binding cleft, whereas the dimer interface forms a hydrophobic box to trap a mechanistically important UDG residue. Surprisingly, these p56 inhibitory elements are unexpectedly analogous to features used by ugi despite profound architectural disparity. Contacts from B-DNA to UDG are mimicked by residues of the p56 helix, echoing the role of ugi's inhibitory beta strand. Using mutagenesis, we propose that DNA mimicry by p56 is a targeting and specificity mechanism supporting tight inhibition via hydrophobic sequestration.

  13. A combinatorial role for MutY and Fpg DNA glycosylases in mutation avoidance in Mycobacterium smegmatis. (United States)

    Hassim, Farzanah; Papadopoulos, Andrea O; Kana, Bavesh D; Gordhan, Bhavna G


    Hydroxyl radical (OH) among reactive oxygen species cause damage to nucleobases with thymine being the most susceptible, whilst in contrast, the singlet oxygen ((1)02) targets only guanine bases. The high GC content of mycobacterial genomes predisposes these organisms to oxidative damage of guanine. The exposure of cellular DNA to OH and one-electron oxidants results in the formation of two main degradation products, the pro-mutagenic 8-oxo-7,8-dihydroguanine (8-oxoGua) and the cytotoxic 2,6-diamino-4-hydroxy-5-formamidopyrimidine (FapyGua). These lesions are repaired through the base excision repair (BER) pathway and we previously, demonstrated a combinatorial role for the mycobacterial Endonuclease III (Nth) and the Nei family of DNA glycosylases in mutagenesis. In addition, the formamidopyrimidine (Fpg/MutM) and MutY DNA glycosylases have also been implicated in mutation avoidance and BER in mycobacteria. In this study, we further investigate the combined role of MutY and the Fpg/Nei DNA glycosylases in Mycobacterium smegmatis and demonstrate that deletion of mutY resulted in enhanced sensitivity to oxidative stress, an effect which was not exacerbated in Δfpg1 Δfpg2 or Δnei1 Δnei2 double mutant backgrounds. However, combinatorial loss of the mutY, fpg1 and fpg2 genes resulted in a significant increase in mutation rates suggesting interplay between these enzymes. Consistent with this, there was a significant increase in C → A mutations with a corresponding change in cell morphology of rifampicin resistant mutants in the Δfpg1 Δfpg2 ΔmutY deletion mutant. In contrast, deletion of mutY together with the nei homologues did not result in any growth/survival defects or changes in mutation rates. Taken together these data indicate that the mycobacterial mutY, in combination with the Fpg DNA N-glycosylases, plays an important role in controlling mutagenesis under oxidative stress. Copyright © 2015 Elsevier B.V. All rights reserved.

  14. Elevated N3-methylpurine-DNA glycosylase DNA repair activity is associated with lung cancer

    Energy Technology Data Exchange (ETDEWEB)

    Crosbie, Philip A.J. [Cancer Research UK Carcinogenesis Group, Paterson Institute for Cancer Research, University of Manchester, Manchester (United Kingdom); North West Lung Centre, University Hospital of South Manchester, Manchester (United Kingdom); Centre for Occupational and Environmental Health, Faculty of Medical and Human Sciences, University of Manchester, Manchester (United Kingdom); Watson, Amanda J. [Cancer Research UK Carcinogenesis Group, Paterson Institute for Cancer Research, University of Manchester, Manchester (United Kingdom); Agius, Raymond [Centre for Occupational and Environmental Health, Faculty of Medical and Human Sciences, University of Manchester, Manchester (United Kingdom); Barber, Philip V. [North West Lung Centre, University Hospital of South Manchester, Manchester (United Kingdom); Margison, Geoffrey P. [Cancer Research UK Carcinogenesis Group, Paterson Institute for Cancer Research, University of Manchester, Manchester (United Kingdom); Povey, Andrew C., E-mail: [Centre for Occupational and Environmental Health, Faculty of Medical and Human Sciences, University of Manchester, Manchester (United Kingdom)


    Tobacco smoke contains a range of chemical agents that can alkylate DNA. DNA repair proteins such as N3-methylpurine-DNA glycosylase (MPG) provide protection against cell killing and mutagenicity by removing lesions such as N7-methylguanine and N3-methyladenine. However, high levels of MPG activity in transfected mammalian cells in vitro have also been associated with increased genotoxicity. The aim of this study was to examine to what extent inter-individual differences in MPG activity modify susceptibility to lung cancer. Incident cases of lung cancer (n = 51) and cancer free controls (n = 88) were recruited from a hospital bronchoscopy unit. Repair activity was determined in a nuclear extract of peripheral blood mononuclear cells, using a [{sup 32}P]-based oligonucleotide cleavage assay (MPG substrate 5 Prime -CCGCT{epsilon}AGCGGGTACCGAGCTCGAAT; {epsilon}A = ethenoadenine). MPG activity was not related to sex or smoking status but was significantly higher in cases compared to controls (4.21 {+-} 1.67 fmol/{mu}g DNA/h vs 3.47 {+-} 1.35 fmol/{mu}g DNA/h, p = 0.005). After adjustment for age, sex, presence of chronic respiratory disease and smoking duration, patients in the highest tertile of MPG activity had a three fold increased probability of lung cancer (OR 3.00, 95% CI 1.16-7.75) when compared to those patients in the lowest tertile. These results suggest that elevated MPG activity is associated with lung cancer, possibly by creating an imbalance in the base excision repair pathway.

  15. Crystal structure of vaccinia virus uracil-DNA glycosylase reveals dimeric assembly

    Directory of Open Access Journals (Sweden)

    DeLucas Lawrence


    Full Text Available Abstract Background Uracil-DNA glycosylases (UDGs catalyze excision of uracil from DNA. Vaccinia virus, which is the prototype of poxviruses, encodes a UDG (vvUDG that is significantly different from the UDGs of other organisms in primary, secondary and tertiary structure and characteristic motifs. It adopted a novel catalysis-independent role in DNA replication that involves interaction with a viral protein, A20, to form the processivity factor. UDG:A20 association is essential for assembling of the processive DNA polymerase complex. The structure of the protein must have provisions for such interactions with A20. This paper provides the first glimpse into the structure of a poxvirus UDG. Results Results of dynamic light scattering experiments and native size exclusion chromatography showed that vvUDG is a dimer in solution. The dimeric assembly is also maintained in two crystal forms. The core of vvUDG is reasonably well conserved but the structure contains one additional β-sheet at each terminus. A glycerol molecule is found in the active site of the enzyme in both crystal forms. Interaction of this glycerol molecule with the protein possibly mimics the enzyme-substrate (uracil interactions. Conclusion The crystal structures reveal several distinctive features of vvUDG. The new structural features may have evolved for adopting novel functions in the replication machinery of poxviruses. The mode of interaction between the subunits in the dimers suggests a possible model for binding to its partner and the nature of the processivity factor in the polymerase complex.

  16. Thymine DNA glycosylase exhibits negligible affinity for nucleobases that it removes from DNA. (United States)

    Malik, Shuja S; Coey, Christopher T; Varney, Kristen M; Pozharski, Edwin; Drohat, Alexander C


    Thymine DNA Glycosylase (TDG) performs essential functions in maintaining genetic integrity and epigenetic regulation. Initiating base excision repair, TDG removes thymine from mutagenic G ·: T mispairs caused by 5-methylcytosine (mC) deamination and other lesions including uracil (U) and 5-hydroxymethyluracil (hmU). In DNA demethylation, TDG excises 5-formylcytosine (fC) and 5-carboxylcytosine (caC), which are generated from mC by Tet (ten-eleven translocation) enzymes. Using improved crystallization conditions, we solved high-resolution (up to 1.45 Å) structures of TDG enzyme-product complexes generated from substrates including G·U, G·T, G·hmU, G·fC and G·caC. The structures reveal many new features, including key water-mediated enzyme-substrate interactions. Together with nuclear magnetic resonance experiments, the structures demonstrate that TDG releases the excised base from its tight product complex with abasic DNA, contrary to previous reports. Moreover, DNA-free TDG exhibits no significant binding to free nucleobases (U, T, hmU), indicating a Kd > 10 mM. The structures reveal a solvent-filled channel to the active site, which might facilitate dissociation of the excised base and enable caC excision, which involves solvent-mediated acid catalysis. Dissociation of the excised base allows TDG to bind the beta rather than the alpha anomer of the abasic sugar, which might stabilize the enzyme-product complex. © The Author(s) 2015. Published by Oxford University Press on behalf of Nucleic Acids Research.

  17. Fluorodeoxyuridine modulates cellular expression of the DNA base excision repair enzyme uracil-DNA glycosylase. (United States)

    Fischer, Jennifer A; Muller-Weeks, Susan; Caradonna, Salvatore J


    The thymidylate synthase inhibitor 5-fluorouracil (5-FU) continues to play a pivotal role in the treatment of cancer. A downstream event of thymidylate synthase inhibition involves the induction of a self-defeating base excision repair process. With the depletion of TTP pools, there is also an increase in dUMP. Metabolism of dUMP to the triphosphate dUTP results in elevated pools of this atypical precursor for DNA synthesis. Under these conditions, there is a destructive cycle of dUMP incorporation into DNA, removal of uracil by the base excision repair enzyme uracil-DNA glycosylase (UDG), and reincorporation of dUMP during the synthesis phase of DNA repair. The end point is DNA strand breaks and loss of DNA integrity, which contributes to cell death. Evidence presented here indicates that both the nuclear and the mitochondrial isoforms of UDG are modulated by FdUrd (and 5-FU) treatment in certain cell lines but not in others. Modulation occurs at the transcriptional and post-translational levels. Under normal conditions, nUDG protein appears in G(1) and is degraded during the S to G(2) phase transition. The present study provides evidence that, in certain cell lines, FdUrd mediates an atypical turnover of nUDG. Additional data indicate that, for cell lines that do not down-regulate nUDG, small interfering RNA-mediated knockdown of nUDG significantly increases resistance to the cytotoxic effects of FdUrd. Results from these studies show that nUDG is an additional determinant in FdUrd-mediated cytotoxicity and bolster the notion that the self-defeating base excision repair pathway, instigated by elevated dUTP (FdUTP) pools, contributes to the cytotoxic consequences of 5-FU chemotherapy.

  18. Structure-function analysis of human enzymes initiating nucleobase repair in DNA and RNA


    Sundheim, Ottar


    In humans, there are four known glycosylases that initiate repair of uracils in DNA. These are UNG, TDG, SMUG1, and MBD4. It was proposed that the replication independent SMUG1 was the main enzyme initiating removal of deaminated cytosine, whereas UNG2 was responsible for replication associated repair of mis-incorporated dUTP (Nilsen et al., 2001). We aimed at elucidating the specific function of the two main human uracil-DNA glycosylases in vitro and in vivo to further clarify their distinct...

  19. Substrate specific stimulation of NEIL1 by WRN but not the other human RecQ helicases

    DEFF Research Database (Denmark)

    Popuri, Venkateswarlu; Croteau, Deborah L; Bohr, Vilhelm A


    NEIL1, the mammalian homolog of Escherichia coli endonuclease VIII, is a DNA glycosylase that repairs ring-fragmented purines, saturated pyrimidines and several oxidative lesions like 5-hydroxyuracil, 5-hydroxycytosine, etc. Previous studies from our laboratory have shown that Werner Syndrome...... protein (WRN), one of the five human RecQ helicases, stimulates NEIL1 DNA glycosylase activity on oxidative DNA lesions. The goal of this study was to extend this observation and analyze the interaction between NEIL1 and all five human RecQ helicases. The DNA substrate specificity of the interaction...... between WRN and NEIL1 was also analyzed. The results indicate that WRN is the only human RecQ helicase that stimulates NEIL1 DNA glycosylase activity, and that this stimulation requires a double-stranded DNA substrate....

  20. Selective base excision repair of DNA damage by the non-base-flipping DNA glycosylase AlkC

    Energy Technology Data Exchange (ETDEWEB)

    Shi, Rongxin; Mullins, Elwood A.; Shen, Xing; #8208; Xing; Lay, Kori T.; Yuen, Philip K.; David, Sheila S.; Rokas, Antonis; Eichman, Brandt F. (UCD); (Vanderbilt)


    DNA glycosylases preserve genome integrity and define the specificity of the base excision repair pathway for discreet, detrimental modifications, and thus, the mechanisms by which glycosylases locate DNA damage are of particular interest. Bacterial AlkC and AlkD are specific for cationic alkylated nucleobases and have a distinctive HEAT-like repeat (HLR) fold. AlkD uses a unique non-base-flipping mechanism that enables excision of bulky lesions more commonly associated with nucleotide excision repair. In contrast, AlkC has a much narrower specificity for small lesions, principally N3-methyladenine (3mA). Here, we describe how AlkC selects for and excises 3mA using a non-base-flipping strategy distinct from that of AlkD. A crystal structure resembling a catalytic intermediate complex shows how AlkC uses unique HLR and immunoglobulin-like domains to induce a sharp kink in the DNA, exposing the damaged nucleobase to active site residues that project into the DNA. This active site can accommodate and excise N3-methylcytosine (3mC) and N1-methyladenine (1mA), which are also repaired by AlkB-catalyzed oxidative demethylation, providing a potential alternative mechanism for repair of these lesions in bacteria.

  1. Uracil DNa-glycosylase from HeLa cells: general properties, substrate specificity and effect of uracil analogs. (United States)

    Krokan, H; Wittwer, C U


    Uracil-DNA glycosylase was partially purified from HeLa cells. Various substrates containing [3H]dUMP residues were prepared by nick-translation of calf thymus DNA. The standard substrate was double-stranded DNA with [3H]dUMP located internally in the chain. Compared to the release of uracil from this substrate, a 3-fold increase in the rate was seen with single-stranded DNA, and a 20-fold reduction in the rate was observed when the [3H]dUMP-residue was located at the 3'end. The rate of [3H]uracil release decreased progressively when one, two or three of the dNMP residues were replaced by the corresponding rNMP; in the extreme case when the substrate contained [3H]dUMP in addition to rCMP, rGMP, and rAMP, the rate of [3H]uracil release was less than 3% of that of the control. The enzyme was inhibited to the same extent by uracil and the uracil analogs 6-aminouracil and 5-azauracil, but very weakly, or not at all, by 5 other analogs. Our results suggest strongly that uracil-DNA glycosylase has a high degree of selectivity for uracil in dUMP residues located internally in DNA chains and that the recognition of the correct substrate also depends on the residues flanking dUMP being deoxyribonucleotides.

  2. 8-oxoguanine DNA glycosylase (OGG1 deficiency elicits coordinated changes in lipid and mitochondrial metabolism in muscle.

    Directory of Open Access Journals (Sweden)

    Vladimir Vartanian

    Full Text Available Oxidative stress resulting from endogenous and exogenous sources causes damage to cellular components, including genomic and mitochondrial DNA. Oxidative DNA damage is primarily repaired via the base excision repair pathway that is initiated by DNA glycosylases. 8-oxoguanine DNA glycosylase (OGG1 recognizes and cleaves oxidized and ring-fragmented purines, including 8-oxoguanine, the most commonly formed oxidative DNA lesion. Mice lacking the OGG1 gene product are prone to multiple features of the metabolic syndrome, including high-fat diet-induced obesity, hepatic steatosis, and insulin resistance. Here, we report that OGG1-deficient mice also display skeletal muscle pathologies, including increased muscle lipid deposition and alterations in genes regulating lipid uptake and mitochondrial fission in skeletal muscle. In addition, expression of genes of the TCA cycle and of carbohydrate and lipid metabolism are also significantly altered in muscle of OGG1-deficient mice. These tissue changes are accompanied by marked reductions in markers of muscle function in OGG1-deficient animals, including decreased grip strength and treadmill endurance. Collectively, these data indicate a role for skeletal muscle OGG1 in the maintenance of optimal tissue function.

  3. Restoration of Cognitive Performance in Mice Carrying a Deficient Allele of 8-Oxoguanine DNA Glycosylase by X-ray Irradiation. (United States)

    Hofer, Tim; Duale, Nur; Muusse, Martine; Eide, Dag Marcus; Dahl, Hildegunn; Boix, Fernando; Andersen, Jannike M; Olsen, Ann Karin; Myhre, Oddvar


    Environmental stressors inducing oxidative stress such as ionizing radiation may influence cognitive function and neuronal plasticity. Recent studies have shown that transgenic mice deficient of DNA glycosylases display unexpected cognitive deficiencies related to changes in gene expression in the hippocampus. The main objectives of the present study were to determine learning and memory performance in C57BL/6NTac 8-oxoguanine DNA glycosylase 1 (Ogg1)+/- (heterozygote) and Ogg1+/+ (wild type, WT) mice, to study whether a single acute X-ray challenge (0.5 Gy, dose rate 0.457 Gy/min) influenced the cognitive performance in the Barnes maze, and if such differences were related to changes in gene expression levels in the hippocampus. We found that the Ogg1+/- mice exhibited poorer early-phase learning performance compared to the WT mice. Surprisingly, X-ray exposure of the Ogg1+/- animals improved their early-phase learning performance. No persistent effects on memory in the late-phase (6 weeks after irradiation) were observed. Our results further suggest that expression of 3 (Adrb1, Il1b, Prdx6) out of in total 35 genes investigated in the Ogg1+/- hippocampus is correlated to spatial learning in the Barnes maze.

  4. Pms2 and uracil-DNA glycosylases act jointly in the mismatch repair pathway to generate Ig gene mutations at A-T base pairs. (United States)

    Girelli Zubani, Giulia; Zivojnovic, Marija; De Smet, Annie; Albagli-Curiel, Olivier; Huetz, François; Weill, Jean-Claude; Reynaud, Claude-Agnès; Storck, Sébastien


    During somatic hypermutation (SHM) of immunoglobulin genes, uracils introduced by activation-induced cytidine deaminase are processed by uracil-DNA glycosylase (UNG) and mismatch repair (MMR) pathways to generate mutations at G-C and A-T base pairs, respectively. Paradoxically, the MMR-nicking complex Pms2/Mlh1 is apparently dispensable for A-T mutagenesis. Thus, how detection of U:G mismatches is translated into the single-strand nick required for error-prone synthesis is an open question. One model proposed that UNG could cooperate with MMR by excising a second uracil in the vicinity of the U:G mismatch, but it failed to explain the low impact of UNG inactivation on A-T mutagenesis. In this study, we show that uracils generated in the G1 phase in B cells can generate equal proportions of A-T and G-C mutations, which suggests that UNG and MMR can operate within the same time frame during SHM. Furthermore, we show that Ung-/-Pms2-/- mice display a 50% reduction in mutations at A-T base pairs and that most remaining mutations at A-T bases depend on two additional uracil glycosylases, thymine-DNA glycosylase and SMUG1. These results demonstrate that Pms2/Mlh1 and multiple uracil glycosylases act jointly, each one with a distinct strand bias, to enlarge the immunoglobulin gene mutation spectrum from G-C to A-T bases. © 2017 Girelli Zubani et al.

  5. Expression and occurrence of uracil-DNA glycosylase in higher plants. (United States)

    Bones, Atle M


    Uracil-DNA glycosylase (UDG) is the first enzyme in the base excision repair pathway for removal of uracil in DNA. DNA repair capacity is likely to be a critical factor in mutagenesis and thereby in the capacity to prevent genetic damage and unwanted variation. We have studied expression of UDG in 9 higher plant species. The highest expression of UDG was measured in Solanum tuberosum. A comparison of 6 Solanum tuberosum cultivars showed that the specific activity ranged from 30 pmol mg1 protein min-1 in the cultivar Laila to 80 pmol mg-1 protein min-1 in the cultivar Ostara. Measurement of UDG in Begonia X cheimantha gave no indications of enzyme activity. The possible effects of no or low UDG activity is discussed. In vitro cultures of Solanum tuberosum and Thymus vulgaris were used to examine the effect of auxin and cytokinin on the UDG activity. Axillary shoots of Solanum tuberosum were cultured on medium including 20 variations in hormone concentration. Auxin (1-naphtaleneacetic acid) increased the expression of UDG. Plants cultured on medium supplemented with 3 mg 1-1 1-naphtaleneacetic acid showed a specific UDG activity which was approximately 3-fold higher than the activity in controls. The cytokinin benzyladenine reduced the specific UDG activity at concentrations in the range 0.25-10 mg 1-1 . In vitro cultured Saintpaulia ionantha was used to examine UDG activity during initiation, conditioning and multiplication cycles. In general, highest expression of UDG was measured in the conditioning cycle on hormone free medium. Measurement of UDG expression during single subculture periods, clearly showed that UDG expression may vary over one culture period. Expression of UDG was in general highest three weeks after transfer to fresh medium. Of different seedling organs from 0- to 15-day-old Brassica napus L., roots and hypocotyls showed the highest UDG activities. In cotyledons a very low and nearly constant specific activity was observed. In 12-day

  6. Régulation de la methylation de l'ADN par les glycosylases MBD4 et TDG


    Ibrahim, Abdulkhaleg


    In mammals, methylation is an epigenetic mark targeting cytosine mainly in a CpG context, producing 5mC. 5mC is highly sensitive to a spontaneous or enzymatic deamination leading to G/Tmismatch. 5mC can also be oxidized to 5- 5hmC, 5fC and 5caC. These modifications of 5mC participate in the active demethylation processes. In mammals, the thymine in G/T mismatch is cleaved by TDG and MBD4 glycosylases. TDG is able also to excise the 5fC and 5caC.This thesis was to clarify the function of TDG a...

  7. Human OGG1 activity in nucleosomes is facilitated by transient unwrapping of DNA and is influenced by the local histone environment. (United States)

    Bilotti, Katharina; Kennedy, Erin E; Li, Chuxuan; Delaney, Sarah


    If unrepaired, damage to genomic DNA can cause mutations and/or be cytotoxic. Single base lesions are repaired via the base excision repair (BER) pathway. The first step in BER is the recognition and removal of the nucleobase lesion by a glycosylase enzyme. For example, human oxoguanine glycosylase 1 (hOGG1) is responsible for removal of the prototypic oxidatively damaged nucleobase, 8-oxo-7,8-dihydroguanine (8-oxoG). To date, most studies of glycosylases have used free duplex DNA substrates. However, cellular DNA is packaged as repeating nucleosome units, with 145 base pair segments of DNA wrapped around histone protein octamers. Previous studies revealed inhibition of hOGG1 at the nucleosome dyad axis and in the absence of chromatin remodelers. In this study, we reveal that even in the absence of chromatin remodelers or external cofactors, hOGG1 can initiate BER at positions off the dyad axis and that this activity is facilitated by spontaneous and transient unwrapping of DNA from the histones. Additionally, we find that solution accessibility as determined by hydroxyl radical footprinting is not fully predictive of glycosylase activity and that histone tails can suppress hOGG1 activity. We therefore suggest that local nuances in the nucleosome environment and histone-DNA interactions can impact glycosylase activity. Copyright © 2017 Elsevier B.V. All rights reserved.

  8. Deletion of the MAG1 DNA glycosylase gene suppresses alkylation-induced killing and mutagenesis in yeast cells lacking AP endonucleases. (United States)

    Xiao, W; Chow, B L; Hanna, M; Doetsch, P W


    DNA base excision repair (BER) is initiated by DNA glycosylases that recognize and remove damaged bases. The phosphate backbone adjacent to the resulting apurinic/apyrimidinic (AP) site is then cleaved by an AP endonuclease or glycosylase-associated AP lyase to invoke subsequent BER steps. We have used a genetic approach in Saccharomyces cerevisiae to address whether AP sites are blocks to DNA replication and the biological consequences if AP sites persist in the genome. We found that yeast cells deficient in the two AP endonucleases (apn1 apn2 double mutant) are extremely sensitive to killing by methyl methanesulfonate (MMS), a model DNA alkylating agent. Interestingly, this sensitivity can be reduced up to 2500-fold by deleting the MAG1 3-methyladenine DNA glycosylase gene, suggesting that Mag1 not only removes lethal base lesions, but also benign lesions and possibly normal bases, and that the resulting AP sites are highly toxic to the cells. This rescuing effect appears to be specific for DNA alkylation damage, since the mag1 mutation reduces killing effects of two other DNA alkylating agents, but does not alter the sensitivity of apn cells to killing by UV, gamma-ray or H(2)O(2). Our mutagenesis assays indicate that nearly half of spontaneous and almost all MMS-induced mutations in the AP endonuclease-deficient cells are due to Mag1 DNA glycosylase activity. Although the DNA replication apparatus appears to be incapable of replicating past AP sites, Polzeta-mediated translesion synthesis is able to bypass AP sites, and accounts for all spontaneous and MMS-induced mutagenesis in the AP endonuclease-deficient cells. These results allow us to delineate base lesion flow within the BER pathway and link AP sites to other DNA damage repair and tolerance pathways.

  9. A general role of the DNA glycosylase Nth1 in the abasic sites cleavage step of base excision repair in Schizosaccharomyces pombe


    Alseth, Ingrun; Korvald, Hanne; Osman, Fekret; Seeberg, Erling; Bjørås, Magnar


    One of the most frequent lesions formed in cellular DNA are abasic (apurinic/apyrimidinic, AP) sites that are both cytotoxic and mutagenic, and must be removed efficiently to maintain genetic stability. It is generally believed that the repair of AP sites is initiated by the AP endonucleases; however, an alternative pathway seems to prevail in Schizosaccharomyces pombe. A mutant lacking the DNA glycosylase/AP lyase Nth1 is very sensitive to the alkylating agent methyl methanesulfonate (MMS), ...

  10. Opinion: uracil DNA glycosylase (UNG) plays distinct and non-canonical roles in somatic hypermutation and class switch recombination. (United States)

    Yousif, Ashraf S; Stanlie, Andre; Begum, Nasim A; Honjo, Tasuku


    Activation-induced cytidine deaminase (AID) is essential to class switch recombination (CSR) and somatic hypermutation (SHM). Uracil DNA glycosylase (UNG), a member of the base excision repair complex, is required for CSR. The role of UNG in CSR and SHM is extremely controversial. AID deficiency in mice abolishes both CSR and SHM, while UNG-deficient mice have drastically reduced CSR but augmented SHM raising a possibility of differential functions of UNG in CSR and SHM. Interestingly, UNG has been associated with a CSR-specific repair adapter protein Brd4, which interacts with acetyl histone 4, γH2AX and 53BP1 to promote non-homologous end joining during CSR. A non-canonical scaffold function of UNG, but not the catalytic activity, can be attributed to the recruitment of essential repair proteins associated with the error-free repair during SHM, and the end joining during CSR. © The Japanese Society for Immunology. 2014. All rights reserved. For permissions, please e-mail:

  11. DNA methylation patterns of candidate genes regulated by thymine DNA glycosylase in patients with TP53 germline mutations

    Energy Technology Data Exchange (ETDEWEB)

    Fortes, F.P. [CIPE, Laboratrio de Oncogentica Molecular, A.C. Camargo Cancer Center, São Paulo, SP (Brazil); Kuasne, H. [CIPE, Laboratrio NeoGene, A.C. Camargo Cancer Center, São Paulo, SP (Brazil); Departamento de Urologia, Faculdade de Medicina, Universidade Estadual Paulista, Botucatu, SP (Brazil); Marchi, F.A. [CIPE, Laboratrio NeoGene, A.C. Camargo Cancer Center, São Paulo, SP (Brazil); Programa Inter-Institucional em Bioinformtica, Instituto de Matemtica e Estatstica, Universidade So Paulo, So Paulo, SP (Brazil); Miranda, P.M. [CIPE, Laboratrio NeoGene, A.C. Camargo Cancer Center, São Paulo, SP (Brazil); Rogatto, S.R. [CIPE, Laboratrio NeoGene, A.C. Camargo Cancer Center, São Paulo, SP (Brazil); Departamento de Urologia, Faculdade de Medicina, Universidade Estadual Paulista, Botucatu, SP (Brazil); Achatz, M.I. [CIPE, Laboratrio de Oncogentica Molecular, A.C. Camargo Cancer Center, São Paulo, SP (Brazil); Departamento de Oncogentica, A.C. Camargo Cancer Center, So Paulo, SP (Brazil)


    Li-Fraumeni syndrome (LFS) is a rare, autosomal dominant, hereditary cancer predisposition disorder. In Brazil, the p.R337H TP53 founder mutation causes the variant form of LFS, Li-Fraumeni-like syndrome. The occurrence of cancer and age of disease onset are known to vary, even in patients carrying the same mutation, and several mechanisms such as genetic and epigenetic alterations may be involved in this variability. However, the extent of involvement of such events has not been clarified. It is well established that p53 regulates several pathways, including the thymine DNA glycosylase (TDG) pathway, which regulates the DNA methylation of several genes. This study aimed to identify the DNA methylation pattern of genes potentially related to the TDG pathway (CDKN2A, FOXA1, HOXD8, OCT4, SOX2, and SOX17) in 30 patients with germline TP53mutations, 10 patients with wild-type TP53, and 10 healthy individuals. We also evaluated TDG expression in patients with adrenocortical tumors (ADR) with and without the p.R337H TP53 mutation. Gene methylation patterns of peripheral blood DNA samples assessed by pyrosequencing revealed no significant differences between the three groups. However, increased TDG expression was observed by quantitative reverse transcription PCR in p.R337H carriers with ADR. Considering the rarity of this phenotype and the relevance of these findings, further studies using a larger sample set are necessary to confirm our results.

  12. DNA methylation patterns of candidate genes regulated by thymine DNA glycosylase in patients with TP53 germline mutations

    Directory of Open Access Journals (Sweden)

    F.P. Fortes


    Full Text Available Li-Fraumeni syndrome (LFS is a rare, autosomal dominant, hereditary cancer predisposition disorder. In Brazil, the p.R337H TP53 founder mutation causes the variant form of LFS, Li-Fraumeni-like syndrome. The occurrence of cancer and age of disease onset are known to vary, even in patients carrying the same mutation, and several mechanisms such as genetic and epigenetic alterations may be involved in this variability. However, the extent of involvement of such events has not been clarified. It is well established that p53 regulates several pathways, including the thymine DNA glycosylase (TDG pathway, which regulates the DNA methylation of several genes. This study aimed to identify the DNA methylation pattern of genes potentially related to the TDG pathway (CDKN2A, FOXA1, HOXD8, OCT4, SOX2, and SOX17 in 30 patients with germline TP53 mutations, 10 patients with wild-type TP53, and 10 healthy individuals. We also evaluated TDG expression in patients with adrenocortical tumors (ADR with and without the p.R337H TP53 mutation. Gene methylation patterns of peripheral blood DNA samples assessed by pyrosequencing revealed no significant differences between the three groups. However, increased TDG expression was observed by quantitative reverse transcription PCR in p.R337H carriers with ADR. Considering the rarity of this phenotype and the relevance of these findings, further studies using a larger sample set are necessary to confirm our results.

  13. DNA glycosylases involved in base excision repair may be associated with cancer risk in BRCA1 and BRCA2 mutation carriers.

    Directory of Open Access Journals (Sweden)

    Ana Osorio


    Full Text Available Single Nucleotide Polymorphisms (SNPs in genes involved in the DNA Base Excision Repair (BER pathway could be associated with cancer risk in carriers of mutations in the high-penetrance susceptibility genes BRCA1 and BRCA2, given the relation of synthetic lethality that exists between one of the components of the BER pathway, PARP1 (poly ADP ribose polymerase, and both BRCA1 and BRCA2. In the present study, we have performed a comprehensive analysis of 18 genes involved in BER using a tagging SNP approach in a large series of BRCA1 and BRCA2 mutation carriers. 144 SNPs were analyzed in a two stage study involving 23,463 carriers from the CIMBA consortium (the Consortium of Investigators of Modifiers of BRCA1 and BRCA2. Eleven SNPs showed evidence of association with breast and/or ovarian cancer at p<0.05 in the combined analysis. Four of the five genes for which strongest evidence of association was observed were DNA glycosylases. The strongest evidence was for rs1466785 in the NEIL2 (endonuclease VIII-like 2 gene (HR: 1.09, 95% CI (1.03-1.16, p = 2.7 × 10(-3 for association with breast cancer risk in BRCA2 mutation carriers, and rs2304277 in the OGG1 (8-guanine DNA glycosylase gene, with ovarian cancer risk in BRCA1 mutation carriers (HR: 1.12 95%CI: 1.03-1.21, p = 4.8 × 10(-3. DNA glycosylases involved in the first steps of the BER pathway may be associated with cancer risk in BRCA1/2 mutation carriers and should be more comprehensively studied.

  14. DNA Glycosylases Involved in Base Excision Repair May Be Associated with Cancer Risk in BRCA1 and BRCA2 Mutation Carriers (United States)

    Osorio, Ana; Milne, Roger L.; Kuchenbaecker, Karoline; Vaclová, Tereza; Pita, Guillermo; Alonso, Rosario; Peterlongo, Paolo; Blanco, Ignacio; de la Hoya, Miguel; Duran, Mercedes; Díez, Orland; Ramón y Cajal, Teresa; Konstantopoulou, Irene; Martínez-Bouzas, Cristina; Andrés Conejero, Raquel; Soucy, Penny; McGuffog, Lesley; Barrowdale, Daniel; Lee, Andrew; SWE-BRCA; Arver, Brita; Rantala, Johanna; Loman, Niklas; Ehrencrona, Hans; Olopade, Olufunmilayo I.; Beattie, Mary S.; Domchek, Susan M.; Nathanson, Katherine; Rebbeck, Timothy R.; Arun, Banu K.; Karlan, Beth Y.; Walsh, Christine; Lester, Jenny; John, Esther M.; Whittemore, Alice S.; Daly, Mary B.; Southey, Melissa; Hopper, John; Terry, Mary B.; Buys, Saundra S.; Janavicius, Ramunas; Dorfling, Cecilia M.; van Rensburg, Elizabeth J.; Steele, Linda; Neuhausen, Susan L.; Ding, Yuan Chun; Hansen, Thomas v. O.; Jønson, Lars; Ejlertsen, Bent; Gerdes, Anne-Marie; Infante, Mar; Herráez, Belén; Moreno, Leticia Thais; Weitzel, Jeffrey N.; Herzog, Josef; Weeman, Kisa; Manoukian, Siranoush; Peissel, Bernard; Zaffaroni, Daniela; Scuvera, Giulietta; Bonanni, Bernardo; Mariette, Frederique; Volorio, Sara; Viel, Alessandra; Varesco, Liliana; Papi, Laura; Ottini, Laura; Tibiletti, Maria Grazia; Radice, Paolo; Yannoukakos, Drakoulis; Garber, Judy; Ellis, Steve; Frost, Debra; Platte, Radka; Fineberg, Elena; Evans, Gareth; Lalloo, Fiona; Izatt, Louise; Eeles, Ros; Adlard, Julian; Davidson, Rosemarie; Cole, Trevor; Eccles, Diana; Cook, Jackie; Hodgson, Shirley; Brewer, Carole; Tischkowitz, Marc; Douglas, Fiona; Porteous, Mary; Side, Lucy; Walker, Lisa; Morrison, Patrick; Donaldson, Alan; Kennedy, John; Foo, Claire; Godwin, Andrew K.; Schmutzler, Rita Katharina; Wappenschmidt, Barbara; Rhiem, Kerstin; Engel, Christoph; Meindl, Alfons; Ditsch, Nina; Arnold, Norbert; Plendl, Hans Jörg; Niederacher, Dieter; Sutter, Christian; Wang-Gohrke, Shan; Steinemann, Doris; Preisler-Adams, Sabine; Kast, Karin; Varon-Mateeva, Raymonda; Gehrig, Andrea; Stoppa-Lyonnet, Dominique; Sinilnikova, Olga M.; Mazoyer, Sylvie; Damiola, Francesca; Poppe, Bruce; Claes, Kathleen; Piedmonte, Marion; Tucker, Kathy; Backes, Floor; Rodríguez, Gustavo; Brewster, Wendy; Wakeley, Katie; Rutherford, Thomas; Caldés, Trinidad; Nevanlinna, Heli; Aittomäki, Kristiina; Rookus, Matti A.; van Os, Theo A. M.; van der Kolk, Lizet; de Lange, J. L.; Meijers-Heijboer, Hanne E. J.; van der Hout, A. H.; van Asperen, Christi J.; Gómez Garcia, Encarna B.; Hoogerbrugge, Nicoline; Collée, J. Margriet; van Deurzen, Carolien H. M.; van der Luijt, Rob B.; Devilee, Peter; HEBON; Olah, Edith; Lázaro, Conxi; Teulé, Alex; Menéndez, Mireia; Jakubowska, Anna; Cybulski, Cezary; Gronwald, Jacek; Lubinski, Jan; Durda, Katarzyna; Jaworska-Bieniek, Katarzyna; Johannsson, Oskar Th.; Maugard, Christine; Montagna, Marco; Tognazzo, Silvia; Teixeira, Manuel R.; Healey, Sue; Investigators, kConFab; Olswold, Curtis; Guidugli, Lucia; Lindor, Noralane; Slager, Susan; Szabo, Csilla I.; Vijai, Joseph; Robson, Mark; Kauff, Noah; Zhang, Liying; Rau-Murthy, Rohini; Fink-Retter, Anneliese; Singer, Christian F.; Rappaport, Christine; Geschwantler Kaulich, Daphne; Pfeiler, Georg; Tea, Muy-Kheng; Berger, Andreas; Phelan, Catherine M.; Greene, Mark H.; Mai, Phuong L.; Lejbkowicz, Flavio; Andrulis, Irene; Mulligan, Anna Marie; Glendon, Gord; Toland, Amanda Ewart; Bojesen, Anders; Pedersen, Inge Sokilde; Sunde, Lone; Thomassen, Mads; Kruse, Torben A.; Jensen, Uffe Birk; Friedman, Eitan; Laitman, Yael; Shimon, Shani Paluch; Simard, Jacques; Easton, Douglas F.; Offit, Kenneth; Couch, Fergus J.; Chenevix-Trench, Georgia; Antoniou, Antonis C.; Benitez, Javier


    Single Nucleotide Polymorphisms (SNPs) in genes involved in the DNA Base Excision Repair (BER) pathway could be associated with cancer risk in carriers of mutations in the high-penetrance susceptibility genes BRCA1 and BRCA2, given the relation of synthetic lethality that exists between one of the components of the BER pathway, PARP1 (poly ADP ribose polymerase), and both BRCA1 and BRCA2. In the present study, we have performed a comprehensive analysis of 18 genes involved in BER using a tagging SNP approach in a large series of BRCA1 and BRCA2 mutation carriers. 144 SNPs were analyzed in a two stage study involving 23,463 carriers from the CIMBA consortium (the Consortium of Investigators of Modifiers of BRCA1 and BRCA2). Eleven SNPs showed evidence of association with breast and/or ovarian cancer at pgenes for which strongest evidence of association was observed were DNA glycosylases. The strongest evidence was for rs1466785 in the NEIL2 (endonuclease VIII-like 2) gene (HR: 1.09, 95% CI (1.03–1.16), p = 2.7×10−3) for association with breast cancer risk in BRCA2 mutation carriers, and rs2304277 in the OGG1 (8-guanine DNA glycosylase) gene, with ovarian cancer risk in BRCA1 mutation carriers (HR: 1.12 95%CI: 1.03–1.21, p = 4.8×10−3). DNA glycosylases involved in the first steps of the BER pathway may be associated with cancer risk in BRCA1/2 mutation carriers and should be more comprehensively studied. PMID:24698998

  15. DNA glycosylases involved in base excision repair may be associated with cancer risk in BRCA1 and BRCA2 mutation carriers. (United States)

    Osorio, Ana; Milne, Roger L; Kuchenbaecker, Karoline; Vaclová, Tereza; Pita, Guillermo; Alonso, Rosario; Peterlongo, Paolo; Blanco, Ignacio; de la Hoya, Miguel; Duran, Mercedes; Díez, Orland; Ramón Y Cajal, Teresa; Konstantopoulou, Irene; Martínez-Bouzas, Cristina; Andrés Conejero, Raquel; Soucy, Penny; McGuffog, Lesley; Barrowdale, Daniel; Lee, Andrew; Swe-Brca; Arver, Brita; Rantala, Johanna; Loman, Niklas; Ehrencrona, Hans; Olopade, Olufunmilayo I; Beattie, Mary S; Domchek, Susan M; Nathanson, Katherine; Rebbeck, Timothy R; Arun, Banu K; Karlan, Beth Y; Walsh, Christine; Lester, Jenny; John, Esther M; Whittemore, Alice S; Daly, Mary B; Southey, Melissa; Hopper, John; Terry, Mary B; Buys, Saundra S; Janavicius, Ramunas; Dorfling, Cecilia M; van Rensburg, Elizabeth J; Steele, Linda; Neuhausen, Susan L; Ding, Yuan Chun; Hansen, Thomas V O; Jønson, Lars; Ejlertsen, Bent; Gerdes, Anne-Marie; Infante, Mar; Herráez, Belén; Moreno, Leticia Thais; Weitzel, Jeffrey N; Herzog, Josef; Weeman, Kisa; Manoukian, Siranoush; Peissel, Bernard; Zaffaroni, Daniela; Scuvera, Giulietta; Bonanni, Bernardo; Mariette, Frederique; Volorio, Sara; Viel, Alessandra; Varesco, Liliana; Papi, Laura; Ottini, Laura; Tibiletti, Maria Grazia; Radice, Paolo; Yannoukakos, Drakoulis; Garber, Judy; Ellis, Steve; Frost, Debra; Platte, Radka; Fineberg, Elena; Evans, Gareth; Lalloo, Fiona; Izatt, Louise; Eeles, Ros; Adlard, Julian; Davidson, Rosemarie; Cole, Trevor; Eccles, Diana; Cook, Jackie; Hodgson, Shirley; Brewer, Carole; Tischkowitz, Marc; Douglas, Fiona; Porteous, Mary; Side, Lucy; Walker, Lisa; Morrison, Patrick; Donaldson, Alan; Kennedy, John; Foo, Claire; Godwin, Andrew K; Schmutzler, Rita Katharina; Wappenschmidt, Barbara; Rhiem, Kerstin; Engel, Christoph; Meindl, Alfons; Ditsch, Nina; Arnold, Norbert; Plendl, Hans Jörg; Niederacher, Dieter; Sutter, Christian; Wang-Gohrke, Shan; Steinemann, Doris; Preisler-Adams, Sabine; Kast, Karin; Varon-Mateeva, Raymonda; Gehrig, Andrea; Stoppa-Lyonnet, Dominique; Sinilnikova, Olga M; Mazoyer, Sylvie; Damiola, Francesca; Poppe, Bruce; Claes, Kathleen; Piedmonte, Marion; Tucker, Kathy; Backes, Floor; Rodríguez, Gustavo; Brewster, Wendy; Wakeley, Katie; Rutherford, Thomas; Caldés, Trinidad; Nevanlinna, Heli; Aittomäki, Kristiina; Rookus, Matti A; van Os, Theo A M; van der Kolk, Lizet; de Lange, J L; Meijers-Heijboer, Hanne E J; van der Hout, A H; van Asperen, Christi J; Gómez Garcia, Encarna B; Hoogerbrugge, Nicoline; Collée, J Margriet; van Deurzen, Carolien H M; van der Luijt, Rob B; Devilee, Peter; Hebon; Olah, Edith; Lázaro, Conxi; Teulé, Alex; Menéndez, Mireia; Jakubowska, Anna; Cybulski, Cezary; Gronwald, Jacek; Lubinski, Jan; Durda, Katarzyna; Jaworska-Bieniek, Katarzyna; Johannsson, Oskar Th; Maugard, Christine; Montagna, Marco; Tognazzo, Silvia; Teixeira, Manuel R; Healey, Sue; Investigators, Kconfab; Olswold, Curtis; Guidugli, Lucia; Lindor, Noralane; Slager, Susan; Szabo, Csilla I; Vijai, Joseph; Robson, Mark; Kauff, Noah; Zhang, Liying; Rau-Murthy, Rohini; Fink-Retter, Anneliese; Singer, Christian F; Rappaport, Christine; Geschwantler Kaulich, Daphne; Pfeiler, Georg; Tea, Muy-Kheng; Berger, Andreas; Phelan, Catherine M; Greene, Mark H; Mai, Phuong L; Lejbkowicz, Flavio; Andrulis, Irene; Mulligan, Anna Marie; Glendon, Gord; Toland, Amanda Ewart; Bojesen, Anders; Pedersen, Inge Sokilde; Sunde, Lone; Thomassen, Mads; Kruse, Torben A; Jensen, Uffe Birk; Friedman, Eitan; Laitman, Yael; Shimon, Shani Paluch; Simard, Jacques; Easton, Douglas F; Offit, Kenneth; Couch, Fergus J; Chenevix-Trench, Georgia; Antoniou, Antonis C; Benitez, Javier


    Single Nucleotide Polymorphisms (SNPs) in genes involved in the DNA Base Excision Repair (BER) pathway could be associated with cancer risk in carriers of mutations in the high-penetrance susceptibility genes BRCA1 and BRCA2, given the relation of synthetic lethality that exists between one of the components of the BER pathway, PARP1 (poly ADP ribose polymerase), and both BRCA1 and BRCA2. In the present study, we have performed a comprehensive analysis of 18 genes involved in BER using a tagging SNP approach in a large series of BRCA1 and BRCA2 mutation carriers. 144 SNPs were analyzed in a two stage study involving 23,463 carriers from the CIMBA consortium (the Consortium of Investigators of Modifiers of BRCA1 and BRCA2). Eleven SNPs showed evidence of association with breast and/or ovarian cancer at p<0.05 in the combined analysis. Four of the five genes for which strongest evidence of association was observed were DNA glycosylases. The strongest evidence was for rs1466785 in the NEIL2 (endonuclease VIII-like 2) gene (HR: 1.09, 95% CI (1.03-1.16), p = 2.7 × 10(-3)) for association with breast cancer risk in BRCA2 mutation carriers, and rs2304277 in the OGG1 (8-guanine DNA glycosylase) gene, with ovarian cancer risk in BRCA1 mutation carriers (HR: 1.12 95%CI: 1.03-1.21, p = 4.8 × 10(-3)). DNA glycosylases involved in the first steps of the BER pathway may be associated with cancer risk in BRCA1/2 mutation carriers and should be more comprehensively studied.

  16. Deficiency in the DNA glycosylases UNG1 and OGG1 does not potentiate c-Myc-induced B-cell lymphomagenesis

    DEFF Research Database (Denmark)

    Green, Blerta; Martin, Alberto; Belcheva, Antoaneta


    C-Myc overexpression mediates lymphomagenesis, however, secondary genetic lesions are required for its full oncogenic potential. The origin and the mechanism of formation of these mutations are unclear. Here we investigated the role of Ogg1 and UNG glycosylases in c-Myc driven lymphomagenesis...... but found that their deficiencies did not influence the disease outcome in the Eµ c-Myc model. We also found that Rag proteins do not contribute to this process. Instead, our work suggests that secondary mutations that potentiate C-Myc lymphomagenesis arise early in B-cell ontogeny, occur at C:G basepairs...

  17. Triphlorethol-A from Ecklonia cava Up-Regulates the Oxidant Sensitive 8-Oxoguanine DNA Glycosylase 1

    Directory of Open Access Journals (Sweden)

    Ki Cheon Kim


    Full Text Available This study investigated the protective mechanisms of triphlorethol-A, isolated from Ecklonia cava, against oxidative stress-induced DNA base damage, especially 8-oxoguanine (8-oxoG, in Chinese hamster lung fibroblast V79-4 cells. 8-Oxoguanine DNA glycosylase-1 (OGG1 plays an important role in the removal of 8-oxoG during the cellular response to DNA base damage. Triphlorethol-A significantly decreased the levels of 8-oxoG induced by H2O2, and this correlated with increases in OGG1 mRNA and OGG1 protein levels. Furthermore, siOGG1-transfected cell attenuated the protective effect of triphlorethol-A against H2O2 treatment. Nuclear factor erythroid 2–related factor 2 (Nrf2 is a transcription factor for OGG1, and Nrf2 combines with small Maf proteins in the nucleus to bind to antioxidant response elements (ARE in the upstream promoter region of the OGG1 gene. Triphlorethol-A restored the expression of nuclear Nrf2, small Maf protein, and the Nrf2-Maf complex, all of which were reduced by oxidative stress. Furthermore, triphlorethol-A increased Nrf2 binding to ARE sequences and the resulting OGG1 promoter activity, both of which were also reduced by oxidative stress. The levels of the phosphorylated forms of Akt kinase, downstream of phosphatidylinositol 3-kinase (PI3K, and Erk, which are regulators of OGG1, were sharply decreased by oxidative stress, but these decreases were prevented by triphlorethol-A. Specific PI3K, Akt, and Erk inhibitors abolished the cytoprotective effects of triphlorethol-A, suggesting that OGG1 induction by triphlorethol-A involves the PI3K/Akt and Erk pathways. Taken together, these data indicate that by activating the DNA repair system, triphlorethol-A exerts protective effects against DNA base damage induced by oxidative stress.

  18. Integrating DNA structure switch with branched hairpins for the detection of uracil-DNA glycosylase activity and inhibitor screening. (United States)

    Zhu, Jing; Hao, Qijie; Liu, Yi; Guo, Zhaohui; Rustam, Buayxigul; Jiang, Wei


    The detection of uracil-DNA glycosylase (UDG) activity is pivotal for its biochemical studies and the development of drugs for UDG-related diseases. Here, we explored an integrated DNA structure switch for high sensitive detection of UDG activity. The DNA structure switch containing two branched hairpins was employed to recognize UDG enzyme and generate fluorescent signal. Under the action of UDG, one branched hairpin was impelled folding into a close conformation after the excision of the single uracil. This reconfigured hairpin could immediately initiate the polymerization/nicking amplification reaction of another branched hairpin accompanying with the release of numerous G-quadruplexes (G4s). In the absence of UDG, the DNA structure switch kept its original configuration, and thus the subsequent polymerization/nicking reaction was inhibited, resulting in the release of few G4 strands. In this work, Thioflavin T was used as signal reporter to target G4s. By integrating the DNA structure switch, the quick response and high sensitivity for UDG determination was achieved and a low detection limit of 0.0001U/mL was obtained, which was superior to the most fluorescent methods for UDG assay. The repeatability of the as-proposed strategy was demonstrated under the concentration of 0.02U/mL and 0.002U/mL, the relative standard deviation obtained from 5 successive samples were 1.7% and 2.8%, respectively. The integrated DNA structure switch strategy proposed here has the potential application for the study of mechanism and function of UDG enzyme and the screening the inhibitors as potential drugs and biochemical tools. Copyright © 2017 Elsevier B.V. All rights reserved.

  19. Loop-mediated isothermal amplification using self-avoiding molecular recognition systems and antarctic thermal sensitive uracil-DNA-glycosylase for detection of nucleic acid with prevention of carryover contamination. (United States)

    Wang, Yi; Liu, Dongxin; Deng, Jianping; Wang, Yan; Xu, Jianguo; Ye, Changyun


    Loop-mediated isothermal amplification (LAMP) is the most popular technique to amplify nucleic acid sequence without the use of temperature cycling. However, LAMP is often confounded by false-positive results, arising from interactions between (hetero-dimer) or within (self-dimerization) primers, off-target hybrids and carryover contaminants. Here, we devised a new LAMP technique that is self-avoiding molecular recognition system (SAMRS) components and antarctic thermal sensitive uracil-DNA-glycosylase (AUDG) enzyme-assisted, termed AUDG-SAMRS-LAMP. Incorporating SAMRS components into 3'-ends of LAMP primers can improve assay's specificity, which completely prevents the non-specific amplification yielding from off-target hybrids and undesired interactions between or within primers. Adding AUDG into reaction mixtures can effectively eliminate the false-positive results arising from carryover contamination, thus the genuine positive reactions are generated from the amplification of target templates. Furthermore, AUDG-SAMRS-LAMP results are confirmed using a new analysis strategy, which is developed for detecting LAMP amplicons by lateral flow biosensor (LFB). Only a single labeled primer is required in the analysis system, thus the false positive results arising from hybridization (the labeled primer and probe, or between two labeled primers) are avoided. Hence, the SAMRS components, AUDG and LFB convert traditional LAMP from a technique suited for the research laboratory into one that has practical value in the field of diagnosis. Human Tuberculosis (TB) is caused by infection with members of Mycobacterium tuberculosis complex (MTC), which are detected by the AUDG-SAMRS-LAMP technique to demonstrate the availability of target analysis. The proof-of-concept method can be reconfigured to detect various nucleic acids by redesigning the specific primers. Copyright © 2017 Elsevier B.V. All rights reserved.

  20. Uracil DNA glycosylase BKRF3 contributes to Epstein-Barr virus DNA replication through physical interactions with proteins in viral DNA replication complex. (United States)

    Su, Mei-Tzu; Liu, I-Hua; Wu, Chia-Wei; Chang, Shu-Ming; Tsai, Ching-Hwa; Yang, Pei-Wen; Chuang, Yu-Chia; Lee, Chung-Pei; Chen, Mei-Ru


    Epstein-Barr virus (EBV) BKRF3 shares sequence homology with members of the uracil-N-glycosylase (UNG) protein family and has DNA glycosylase activity. Here, we explored how BKRF3 participates in the DNA replication complex and contributes to viral DNA replication. Exogenously expressed Flag-BKRF3 was distributed mostly in the cytoplasm, whereas BKRF3 was translocated into the nucleus and colocalized with the EBV DNA polymerase BALF5 in the replication compartment during EBV lytic replication. The expression level of BKRF3 increased gradually during viral replication, coupled with a decrease of cellular UNG2, suggesting BKRF3 enzyme activity compensates for UNG2 and ensures the fidelity of viral DNA replication. In immunoprecipitation-Western blotting, BKRF3 was coimmuno-precipitated with BALF5, the polymerase processivity factor BMRF1, and the immediate-early transactivator Rta. Coexpression of BMRF1 appeared to facilitate the nuclear targeting of BKRF3 in immunofluorescence staining. Residues 164 to 255 of BKRF3 were required for interaction with Rta and BALF5, whereas residues 81 to 166 of BKRF3 were critical for BMRF1 interaction in glutathione S-transferase (GST) pulldown experiments. Viral DNA replication was defective in cells harboring BKRF3 knockout EBV bacmids. In complementation assays, the catalytic mutant BKRF3(Q90L,D91N) restored viral DNA replication, whereas the leucine loop mutant BKRF3(H213L) only partially rescued viral DNA replication, coupled with a reduced ability to interact with the viral DNA polymerase and Rta. Our data suggest that BKRF3 plays a critical role in viral DNA synthesis predominantly through its interactions with viral proteins in the DNA replication compartment, while its enzymatic activity may be supplementary for uracil DNA glycosylase (UDG) function during virus replication. Catalytic activities of both cellular UDG UNG2 and viral UDGs contribute to herpesviral DNA replication. To ensure that the enzyme activity executes at

  1. Uracil DNA Glycosylase BKRF3 Contributes to Epstein-Barr Virus DNA Replication through Physical Interactions with Proteins in Viral DNA Replication Complex (United States)

    Su, Mei-Tzu; Liu, I-Hua; Wu, Chia-Wei; Chang, Shu-Ming; Tsai, Ching-Hwa; Yang, Pei-Wen; Chuang, Yu-Chia; Lee, Chung-Pei


    ABSTRACT Epstein-Barr virus (EBV) BKRF3 shares sequence homology with members of the uracil-N-glycosylase (UNG) protein family and has DNA glycosylase activity. Here, we explored how BKRF3 participates in the DNA replication complex and contributes to viral DNA replication. Exogenously expressed Flag-BKRF3 was distributed mostly in the cytoplasm, whereas BKRF3 was translocated into the nucleus and colocalized with the EBV DNA polymerase BALF5 in the replication compartment during EBV lytic replication. The expression level of BKRF3 increased gradually during viral replication, coupled with a decrease of cellular UNG2, suggesting BKRF3 enzyme activity compensates for UNG2 and ensures the fidelity of viral DNA replication. In immunoprecipitation-Western blotting, BKRF3 was coimmunoprecipitated with BALF5, the polymerase processivity factor BMRF1, and the immediate-early transactivator Rta. Coexpression of BMRF1 appeared to facilitate the nuclear targeting of BKRF3 in immunofluorescence staining. Residues 164 to 255 of BKRF3 were required for interaction with Rta and BALF5, whereas residues 81 to 166 of BKRF3 were critical for BMRF1 interaction in glutathione S-transferase (GST) pulldown experiments. Viral DNA replication was defective in cells harboring BKRF3 knockout EBV bacmids. In complementation assays, the catalytic mutant BKRF3(Q90L,D91N) restored viral DNA replication, whereas the leucine loop mutant BKRF3(H213L) only partially rescued viral DNA replication, coupled with a reduced ability to interact with the viral DNA polymerase and Rta. Our data suggest that BKRF3 plays a critical role in viral DNA synthesis predominantly through its interactions with viral proteins in the DNA replication compartment, while its enzymatic activity may be supplementary for uracil DNA glycosylase (UDG) function during virus replication. IMPORTANCE Catalytic activities of both cellular UDG UNG2 and viral UDGs contribute to herpesviral DNA replication. To ensure that the enzyme

  2. Crystal structure of family 4 uracil-DNA glycosylase from Sulfolobus tokodaii and a function of tyrosine 170 in DNA binding. (United States)

    Kawai, Akito; Higuchi, Shigesada; Tsunoda, Masaru; Nakamura, Kazuo T; Yamagata, Yuriko; Miyamoto, Shuichi


    Uracil-DNA glycosylases (UDGs) excise uracil from DNA by catalyzing the N-glycosidic bond hydrolysis. Here we report the first crystal structures of an archaeal UDG (stoUDG). Compared with other UDGs, stoUDG has a different structure of the leucine-intercalation loop, which is important for DNA binding. The stoUDG-DNA complex model indicated that Leu169, Tyr170, and Asn171 in the loop are involved in DNA intercalation. Mutational analysis showed that Tyr170 is critical for substrate DNA recognition. These results indicate that Tyr170 occupies the intercalation site formed after the structural change of the leucine-intercalation loop required for the catalysis. Copyright © 2015 Federation of European Biochemical Societies. Published by Elsevier B.V. All rights reserved.

  3. Uracil-DNA glycosylase-treated reverse transcription loop-mediated isothermal amplification for rapid detection of avian influenza virus preventing carry-over contamination. (United States)

    Kim, Eun-Mi; Jeon, Hyo-Sung; Kim, Ji-Jung; Shin, Yeun-Kyung; Lee, Youn-Jeong; Yeo, Sang-Geon; Park, Choi-Kyu


    Here, we describe a uracil-DNA glycosylase (UNG)-treated reverse transcription loop-mediated isothermal amplification (uRT-LAMP) for the visual detection of all subtypes of avian influenza A virus (AIV). The uRT-LAMP assay can prevent unwanted amplification by carryover contamination of the previously amplified DNA, although the detection limit of the uRT-LAMP assay is 10-fold lower than that of the RT-LAMP without a UNG treatment. To the best of our knowledge, this is the first successful application of deoxyuridine triphosphate/UNG strategy in RT-LAMP for AIV detection, and the assay can be applied for the rapid, and reliable diagnosis of AIVs, even in contaminated samples.

  4. 8-oxoG DNA Glycosylase-1 Inhibition Sensitizes Neuro-2a Cells to Oxidative DNA Base Damage Induced by 900 MHz Radiofrequency Electromagnetic Radiation

    Directory of Open Access Journals (Sweden)

    Xiaoya Wang


    Full Text Available Background/Aims: The purpose of this study was to explore the in vitro putative genotoxicity during exposure of Neuro-2a cells to radiofrequency electromagnetic fields (RF-EMFs with or without silencing of 8-oxoG DNA glycosylase-1 (OGG1. Methods: Neuro-2a cells treated with or without OGG1 siRNA were exposed to 900 MHz Global System for Mobile Communication (GSM Talk signals continuously at a specific absorption rate (SAR of 0, 0.5, 1 or 2 W/kg for 24 h. DNA strand breakage and DNA base damage were measured by the alkaline comet assay and a modified comet assay using formamidopyrimidine DNA glycosylase (FPG, respectively. Reactive oxygen species (ROS levels and cell viability were monitored using the non-fluorescent probe 2, 7-dichlorofluorescein diacetate (DCFH-DA and CCK-8 assay. Results: Exposure to 900 MHz RF-EMFs with insufficient energy could induce oxidative DNA base damage in Neuro-2a cells. These increases were concomitant with similar increases in the generation of reactive oxygen species (ROS. Without OGG1 siRNA, 2 W/kg RF-EMFs induced oxidative DNA base damage in Neuro-2a cells. Interestingly, with OGG1 siRNA, RF-EMFs could cause DNA base damage in Neuro-2a cells as low as 1 W/kg. However, neither DNA strand breakage nor altered cell viability was observed. Conclusion: Even if further studies remain conducted we support the hypothesis that OGG1 is involved in the process of DNA base repair and may play a pivotal role in protecting DNA bases from RF-EMF induced oxidative damage.

  5. 8-oxoG DNA glycosylase-1 inhibition sensitizes Neuro-2a cells to oxidative DNA base damage induced by 900 MHz radiofrequency electromagnetic radiation. (United States)

    Wang, Xiaoya; Liu, Chuan; Ma, Qinglong; Feng, Wei; Yang, Lingling; Lu, Yonghui; Zhou, Zhou; Yu, Zhengping; Li, Wei; Zhang, Lei


    The purpose of this study was to explore the in vitro putative genotoxicity during exposure of Neuro-2a cells to radiofrequency electromagnetic fields (RF-EMFs) with or without silencing of 8-oxoG DNA glycosylase-1 (OGG1). Neuro-2a cells treated with or without OGG1 siRNA were exposed to 900 MHz Global System for Mobile Communication (GSM) Talk signals continuously at a specific absorption rate (SAR) of 0, 0.5, 1 or 2 W/kg for 24 h. DNA strand breakage and DNA base damage were measured by the alkaline comet assay and a modified comet assay using formamidopyrimidine DNA glycosylase (FPG), respectively. Reactive oxygen species (ROS) levels and cell viability were monitored using the non-fluorescent probe 2, 7-dichlorofluorescein diacetate (DCFH-DA) and CCK-8 assay. Exposure to 900 MHz RF-EMFs with insufficient energy could induce oxidative DNA base damage in Neuro-2a cells. These increases were concomitant with similar increases in the generation of reactive oxygen species (ROS). Without OGG1 siRNA, 2 W/kg RF-EMFs induced oxidative DNA base damage in Neuro-2a cells. Interestingly, with OGG1 siRNA, RF-EMFs could cause DNA base damage in Neuro-2a cells as low as 1 W/kg. However, neither DNA strand breakage nor altered cell viability was observed. Even if further studies remain conducted we support the hypothesis that OGG1 is involved in the process of DNA base repair and may play a pivotal role in protecting DNA bases from RF-EMF induced oxidative damage. © 2015 The Author(s) Published by S. Karger AG, Basel.

  6. A general role of the DNA glycosylase Nth1 in the abasic sites cleavage step of base excision repair in Schizosaccharomyces pombe. (United States)

    Alseth, Ingrun; Korvald, Hanne; Osman, Fekret; Seeberg, Erling; Bjørås, Magnar


    One of the most frequent lesions formed in cellular DNA are abasic (apurinic/apyrimidinic, AP) sites that are both cytotoxic and mutagenic, and must be removed efficiently to maintain genetic stability. It is generally believed that the repair of AP sites is initiated by the AP endonucleases; however, an alternative pathway seems to prevail in Schizosaccharomyces pombe. A mutant lacking the DNA glycosylase/AP lyase Nth1 is very sensitive to the alkylating agent methyl methanesulfonate (MMS), suggesting a role for Nth1 in base excision repair (BER) of alkylation damage. Here, we have further evaluated the role of Nth1 and the second putative S.pombe AP endonuclease Apn2, in abasic site repair. The deletion of the apn2 open reading frame dramatically increased the sensitivity of the yeast cells to MMS, also demonstrating that the Apn2 has an important function in the BER pathway. The deletion of nth1 in the apn2 mutant strain partially relieves the MMS sensitivity of the apn2 single mutant, indicating that the Apn2 and Nth1 act in the same pathway for the repair of abasic sites. Analysis of the AP site cleavage in whole cell extracts of wild-type and mutant strains showed that the AP lyase activity of Nth1 represents the major AP site incision activity in vitro. Assays with DNA substrates containing base lesions removed by monofunctional DNA glycosylases Udg and MutY showed that Nth1 will also cleave the abasic sites formed by these enzymes and thus act downstream of these enzymes in the BER pathway. We suggest that the main function of Apn2 in BER is to remove the resulting 3'-blocking termini following AP lyase cleavage by Nth1.

  7. Abundance of BER-related proteins depends on cell proliferation status and the presence of DNA polymerase β. (United States)

    Yamamoto, Mizuki; Yamamoto, Ryohei; Takenaka, Shigeo; Matsuyama, Satoshi; Kubo, Kihei


    In mammalian cells, murine N-methylpurine DNA glycosylase (MPG) removes bases damaged spontaneously or by chemical agents through the process called base excision repair (BER). In this study, we investigated the influence of POL β deficiency on MPG-initiated BER efficiency and the expression levels of BER-related proteins in log-phase and growth-arrested (G(0)) mouse embryonic fibroblasts (MEFs). G(0) wild-type (WT) or POL β-deficient (Pol β-KO) cells showed greater resistance to methyl methanesulfonate than did log-phase cells, and repair of methylated bases was less efficient in the G(0) cells. Apex1 mRNA expression was significantly lower in Pol β-KO or G(0) WT MEFs than in log-phase WT MEFs. Moreover, although Mpg mRNA levels did not differ significantly among cell types, MPG protein levels were significantly higher in log-phase WT cells than in log-phase Pol β-KO cells or either type of G(0) cells. Additionally, proliferating cell nuclear antigen protein levels were also reduced in log-phase Pol β-KO cells or either type of G(0) cells. These results indicated that MPG-initiated BER functions mainly in proliferating cells, but less so in G(0) cells, and that POL β may be involved in regulation of the amount of intracellular repair proteins. © The Author 2015. Published by Oxford University Press on behalf of The Japan Radiation Research Society and Japanese Society for Radiation Oncology.

  8. Repair of 8-oxodeoxyguanosine lesions in mitochondrial DNA depends on the oxoguanine DNA glycosylase (OGG1) gene and 8- oxoguanine accumulates in the mitochondrial DNA of OGG1- defective mice

    DEFF Research Database (Denmark)

    Souza-Pinto, N.C.; Eide, L.; Hogue, B.A.


    Mitochondria are not only the major site for generation of reactive oxygen species, but also one of the main targets of oxidative damage. One of the major products of DNA oxidation, 8-oxodeoxyguanosine (8-oxodC), accumulates in mitochondrial DNA (mtDNA) at levels three times higher than in nuclear......-oxoguanine (8- oxodG) DNA glycosylase/apurinic DNA lyase activity. In the present study, we demonstrated that the mitochondrial 8-oxodG DNA glycosylase/apurinic DNA lyase activity is the mitochondrial isoform of OGG1, Using mouse liver mitochondria isolated from ogg1(-/-) mice, we showed that the OGG1 gene...... encodes for the mitochondrial 8-oxodG glycosylase because these extracts have no incision activity toward an oligonucleotide containing a single 8-oxodG DNA base lesion, Consistent with an important role for the OGG1 protein in the removal of 8-oxodC from the mitochondrial genome, we found that mtDNA...

  9. Exercise-Induced Neuroprotection of Hippocampus in APP/PS1 Transgenic Mice via Upregulation of Mitochondrial 8-Oxoguanine DNA Glycosylase

    Directory of Open Access Journals (Sweden)

    Hai Bo


    Full Text Available Improving mitochondrial function has been proposed as a reasonable therapeutic strategy to reduce amyloid-β (Aβ load and to modify the progression of Alzheimer’s disease (AD. However, the relationship between mitochondrial adaptation and brain neuroprotection caused by physical exercise in AD is poorly understood. This study was undertaken to investigate the effects of long-term treadmill exercise on mitochondrial 8-oxoguanine DNA glycosylase-1 (OGG1 level, mtDNA oxidative damage, and mitochondrial function in the hippocampus of APP/PS1 transgenic mouse model of AD. In the present study, twenty weeks of treadmill training significantly improved the cognitive function and reduced the expression of Aβ-42 in APP/PS1 transgenic (Tg mice. Training also ameliorated mitochondrial respiratory function by increasing the complexes I, and IV and ATP synthase activities, whereas it attenuated ROS generation and mtDNA oxidative damage in Tg mice. Furthermore, the impaired mitochondrial antioxidant enzymes and mitochondrial OGG1 activities seen in Tg mice were restored with training. Acetylation level of mitochondrial OGG1 and MnSOD was markedly suppressed in Tg mice after exercise training, in parallel with increased level of SIRT3. These findings suggest that exercise training could increase mtDNA repair capacity in the mouse hippocampus, which in turn would result in protection against AD-related mitochondrial dysfunction and phenotypic deterioration.

  10. A colorimetric and smartphone readable method for uracil-DNA glycosylase detection based on the target-triggered formation of G-quadruplex. (United States)

    Nie, Huaijun; Wang, Wei; Li, Wang; Nie, Zhou; Yao, Shouzhuo


    A simple, visible and smartphone readable strategy for the sensitive detection of uracil-DNA glycosylase (UDG) activity has been developed. This is based on the UDG-catalyzed removal of uracil bases, which induces the formation of a G-quadruplex-cofactor complex. The guanine-rich DNA probe can form a special G-quadruplex structure with hemin to display peroxidase activity and catalyze the H2O2-mediated oxidation of ABTS(2-) to the colored ABTS˙(-), providing a visible signal for UDG detection. The proposed sensing platform exhibits a good linear response to UDG concentrations ranging from 0.008 to 0.2 U mL(-1), with a low detection limit of 0.008 U mL(-1). Based on the theory of chromatics, we can directly read out the color value using a smartphone app to reflect the content of UDG with high resolution, providing a new vision for the portable assay strategy. Furthermore, the utility of this method for screening potential UDG inhibitors has also been demonstrated.

  11. Defective repair of 5-hydroxy-2'-deoxycytidine in Cockayne syndrome cells and its complementation by Escherichia coli formamidopyrimidine DNA glycosylase and endonuclease III. (United States)

    Foresta, Mara; Ropolo, Monica; Degan, Paolo; Pettinati, Ilaria; Kow, Yoke W; Damonte, Gianluca; Poggi, Alessandro; Frosina, Guido


    Repair of the oxidized purine 8-oxo-7,8-dihydro-2'-deoxyguanosine is inefficient in cells belonging to both complementation groups A and B of Cockayne syndrome (CS), a developmental and neurological disorder characterized by defective transcription-coupled repair. We show here that both CS-A and CS-B cells are also defective in the repair of 5-hydroxy-2'-deoxycytidine (5-OHdC), an oxidized pyrimidine with cytotoxic and mutagenic properties. The defect in the repair of oxidatively damaged DNA in CS cells thus extends to oxidized pyrimidines, indicating a general flaw in the repair of oxidized lesions in this syndrome. The defect could not be reproduced in in vitro repair experiments on oligonucleotide substrates, suggesting a role for both CS-A and CS-B proteins in chromatin remodeling during 5-OHdC repair. Expression of Escherichia coli formamidopyrimidine DNA glycosylase (FPG) or endonuclease III complemented the 5-OHdC repair deficiency. Hence, the expression of a single enzyme, FPG from E. coli, stably corrects the delayed removal of both oxidized purines and oxidized pyrimidines in CS cells. (c) 2009 Elsevier Inc. All rights reserved.

  12. Advanced loop-mediated isothermal amplification method for sensitive and specific detection of Tomato chlorosis virus using a uracil DNA glycosylase to control carry-over contamination. (United States)

    Kil, Eui-Joon; Kim, Sunhoo; Lee, Ye-Ji; Kang, Eun-Ha; Lee, Minji; Cho, Sang-Ho; Kim, Mi-Kyeong; Lee, Kyeong-Yeoll; Heo, Noh-Youl; Choi, Hong-Soo; Kwon, Suk-Tae; Lee, Sukchan


    In 2013, Tomato chlorosis virus (ToCV) was identified in symptomatic tomato plants in Korea. In the present study, a loop-mediated isothermal amplification (LAMP) method was developed using four specific primers designed against ORF6 in ToCV RNA2 to detect ToCV rapidly and with high sensitivity. The optimized reaction involved incubation of a reaction mixture containing 2U Bst DNA polymerase and 4mM MgSO4 for 1h at 60-62 °C. Although specific and rapid detection of ToCV by LAMP was confirmed, false-positive reactions caused by carry-over contamination sometimes occurred because of the high sensitivity of LAMP compared with other detection methods. To prevent false-positive reactions, dUTP was substituted for dTTP and uracil-DNA glycosylase (UDG) was added to the LAMP reaction. First, the LAMP reaction was conducted successfully with substitution of dUTP for dTTP. Before the next reaction, LAMP products with incorporated dUTP were cleaved selectively by UDG without any effect on thymine-containing DNA (template DNA). This modified LAMP method complemented with UDG treatment to prevent carry-over contamination offers a potentially powerful method for detecting plant viruses. Copyright © 2014 Elsevier B.V. All rights reserved.

  13. [Over-expression of uracil DNA glycosylase 2 (UNG2) enhances the resistance to oxidative damage in HepG2 cells]. (United States)

    Cao, Liyan; Cheng, Shan; Du, Juan; Guo, Yanhai; Huang, Xiaofeng


    Objective To investigate the uracil glycosidic enzyme activity of uracil DNA glycosylase 2 (UNG2) and study the role of UNG2 in the resistance of antioxidant stress of HepG2 cells. Methods The UNG2-expressing vector was built. Western blotting was used to detect the expression of UNG2. Immunofluorescence staining was performed to observe the cellular location of UNG2. Oligonucleotide was used as substrate for the determination of the UNG2 glycosidic enzyme activity. H 2 O 2 toxicity assay was done to study the function of UNG2 in the antioxidant resistance of hepatocellular carcinoma HepG2 cells. Results UNG2 was successfully over-expressed in HEK293FT cells, and UNG2 was found to be mainly located in nucleus. Enzyme activity assay showed that UNG2 had significant oligonucleotide dU glycosidic enzyme activity. H 2 O 2 toxicity assay showed that over-expressed UNG2 could remarkably increase the survival of HepG2 cells after exposed to H 2 O 2 . Conclusion UNG2 possesses specific DNA glycosidic enzyme activity, and it can protect HepG2 cells against oxidative stress damage.

  14. The efficacy of uracil DNA glycosylase pretreatment in amplicon-based massively parallel sequencing with DNA extracted from archived formalin-fixed paraffin-embedded esophageal cancer tissues. (United States)

    Serizawa, Masakuni; Yokota, Tomoya; Hosokawa, Ayumu; Kusafuka, Kimihide; Sugiyama, Toshiro; Tsubosa, Yasuhiro; Yasui, Hirofumi; Nakajima, Takashi; Koh, Yasuhiro


    Advances in mutation testing for molecular-targeted cancer therapies have led to the increased use of archived formalin-fixed paraffin-embedded (FFPE) tumors. However, DNA extracted from FFPE tumors (FFPE DNA) is problematic for mutation testing, especially for amplicon-based massively parallel sequencing (MPS), owing to DNA fragmentation and artificial C:G > T:A single nucleotide variants (SNVs) caused by deamination of cytosine to uracil. Therefore, to reduce artificial C:G > T:A SNVs in amplicon-based MPS using FFPE DNA, we evaluated the efficacy of uracil DNA glycosylase (UDG) pretreatment, which can eliminate uracil-containing DNA molecules, with 126 archived FFPE esophageal cancer specimens. We also examined the association between the frequency of C:G > T:A SNVs and DNA quality, as assessed by a quantitative PCR (qPCR)-based assay. UDG pretreatment significantly lowered the frequency of C:G > T:A SNVs in highly fragmented DNA (by approximately 60%). This effect was not observed for good- to moderate-quality DNA, suggesting that a predictive assay (i.e., DNA quality assessment) needs to be performed prior to UDG pretreatment. These results suggest that UDG pretreatment is efficacious for mutation testing by amplicon-based MPS with fragmented DNA from FFPE samples. Copyright © 2015 The Authors. Published by Elsevier Inc. All rights reserved.

  15. Combining H/D exchange mass spectroscopy and computational docking reveals extended DNA-binding surface on uracil-DNA glycosylase (United States)

    Roberts, Victoria A.; Pique, Michael E.; Hsu, Simon; Li, Sheng; Slupphaug, Geir; Rambo, Robert P.; Jamison, Jonathan W.; Liu, Tong; Lee, Jun H.; Tainer, John A.; Ten Eyck, Lynn F.; Woods, Virgil L.


    X-ray crystallography provides excellent structural data on protein–DNA interfaces, but crystallographic complexes typically contain only small fragments of large DNA molecules. We present a new approach that can use longer DNA substrates and reveal new protein–DNA interactions even in extensively studied systems. Our approach combines rigid-body computational docking with hydrogen/deuterium exchange mass spectrometry (DXMS). DXMS identifies solvent-exposed protein surfaces; docking is used to create a 3-dimensional model of the protein–DNA interaction. We investigated the enzyme uracil-DNA glycosylase (UNG), which detects and cleaves uracil from DNA. UNG was incubated with a 30 bp DNA fragment containing a single uracil, giving the complex with the abasic DNA product. Compared with free UNG, the UNG–DNA complex showed increased solvent protection at the UNG active site and at two regions outside the active site: residues 210–220 and 251–264. Computational docking also identified these two DNA-binding surfaces, but neither shows DNA contact in UNG–DNA crystallographic structures. Our results can be explained by separation of the two DNA strands on one side of the active site. These non-sequence-specific DNA-binding surfaces may aid local uracil search, contribute to binding the abasic DNA product and help present the DNA product to APE-1, the next enzyme on the DNA-repair pathway. PMID:22492624

  16. Quantitative assessment of the effect of uracil-DNA glycosylase on amplicon DNA degradation and RNA amplification in reverse transcription-PCR

    Directory of Open Access Journals (Sweden)

    Kleiboeker Steven B


    Full Text Available Abstract Although PCR and RT-PCR provided a valuable approach for detection of pathogens, the high level of sensitivity of these assays also makes them prone to false positive results. In addition to cross-contamination with true positive samples, false positive results are also possible due to "carry-over" contamination of samples with amplicon DNA generated by previous reactions. To reduce this source of false positives, amplicon generated by reactions in which dUTP was substituted for dTTP can be degraded by uracil DNA glycosylase (UNG. UNG does not degrade RNA but will cleave contaminating uracil-containing DNA while leaving thymine-containing DNA intact. The availability of heat-labile UNG makes use of this approach feasible for RT-PCR. In this study, real-time RT-PCR was used to quantify UNG degradation of amplicon DNA and the effect of UNG on RNA detection. Using the manufacturers' recommended conditions, complete degradation of DNA was not observed for samples containing 250 copies of amplicon DNA. Doubling the UNG concentration resulted in degradation of the two lowest concentrations of DNA tested, but also resulted in an increase of 1.94 cycles in the CT for RNA detection. To improve DNA degradation while minimizing the effect on RNA detection, a series of time, temperature and enzyme concentrations were evaluated. Optimal conditions were found to be 0.25 U UNG per 25 μl reaction with a 20 min, 30°C incubation prior to RT-PCR. Under these conditions, high concentrations of amplicon DNA could be degraded while the CT for RNA detection was increased by 1.2 cycles.

  17. Whole transcriptome analysis reveals an 8-oxoguanine DNA glycosylase-1-driven DNA repair-dependent gene expression linked to essential biological processes. (United States)

    Aguilera-Aguirre, Leopoldo; Hosoki, Koa; Bacsi, Attila; Radák, Zsolt; Wood, Thomas G; Widen, Steven G; Sur, Sanjiv; Ameredes, Bill T; Saavedra-Molina, Alfredo; Brasier, Allan R; Ba, Xueqing; Boldogh, Istvan


    Reactive oxygen species inflict oxidative modifications on various biological molecules, including DNA. One of the most abundant DNA base lesions, 8-oxo-7,8-dihydroguanine (8-oxoG) is repaired by 8-oxoguanine DNA glycosylase-1 (OGG1) during DNA base excision repair (OGG1-BER). 8-OxoG accumulation in DNA has been associated with various pathological and aging processes, although its role is unclear. The lack of OGG1-BER in Ogg1(-/-) mice resulted in decreased inflammatory responses and increased susceptibility to infections and metabolic disorders. Therefore, we proposed that OGG1 and/or 8-oxoG base may have a role in immune and homeostatic processes. To test our hypothesis, we challenged mouse lungs with OGG1-BER product 8-oxoG base and changes in gene expression were determined by RNA sequencing and data were analyzed by Gene Ontology and statistical tools. RNA-Seq analysis identified 1592 differentially expressed (≥ 3-fold change) transcripts. The upregulated mRNAs were related to biological processes, including homeostatic, immune-system, macrophage activation, regulation of liquid-surface tension, and response to stimulus. These processes were mediated by chemokines, cytokines, gonadotropin-releasing hormone receptor, integrin, and interleukin signaling pathways. Taken together, these findings point to a new paradigm showing that OGG1-BER plays a role in various biological processes that may benefit the host, but when in excess could be implicated in disease and/or aging processes. Copyright © 2015 Elsevier Inc. All rights reserved.

  18. Solution-state NMR investigation of DNA binding interactions in Escherichia coli formamidopyrimidine-DNA glycosylase (Fpg): a dynamic description of the DNA/protein interface. (United States)

    Buchko, Garry W; McAteer, Kathleen; Wallace, Susan S; Kennedy, Michael A


    Formamidopyrimidine-DNA glycosylase (Fpg) is a base excision repair (BER) protein that removes oxidative DNA lesions. Recent crystal structures of Fpg bound to DNA revealed residues involved in damage recognition and enzyme catalysis, but failed to shed light on the dynamic nature of the processes. To examine the structural and dynamic changes that occur in solution when Fpg binds DNA, NMR spectroscopy was used to study Escherichia coli Fpg free in solution and bound to a double-stranded DNA oligomer containing 1,3-propanediol (13-PD), a non-hydrolyzable abasic-site analogue. Only 209 out of a possible 251 (83%) free-precession 15N/1H HSQC cross peaks were observed and 180 of these were assignable, indicating that approximately 30% of the residues undergo intermediate motion on the NMR timescale, broadening the resonances beyond detection or making them intractable in backbone assignment experiments. The majority of these affected residues were in the polypeptide linker region and the interface between the N- and C-terminal domains. DNA titration experiments revealed line broadening and chemical shift perturbations for backbone amides nearby and distant from the DNA binding surface, but failed to quench the intermediate timescale motion observed for free Fpg, including those residues directly involved in DNA binding, notwithstanding a nanomolar dissociation constant for 13-PD binding. Indeed, after binding to 13-PD, at least approximately 40% of the Fpg residues undergo intermediate timescale motion even though all other residues exhibit tight DNA binding characteristic of slow exchange. CPMG-HSQC experiments revealed millisecond to microsecond motion for the backbone amides of D91 and H92 that were quenched upon binding 13-PD. In free Fpg, heteronuclear 1H-15N NOE experiments detected picosecond timescale backbone motion in the alphaF-beta9 loop, the region primarily responsible for chemically discriminating 8-oxoguanine (8-oxoG) over normal guanine, that was

  19. Overexpression of transcription factor AP-2 stimulates the PA promoter of the human uracil-DNA glycosylase (UNG) gene through a mechanism involving derepression

    DEFF Research Database (Denmark)

    Aas, Per Arne; Pena Diaz, Javier; Liabakk, Nina Beate


    RNA. Chromatin immunoprecipitation with AP-2 antibody demonstrated that endogenous AP-2 binds to the PA promoter in vivo. Overexpression of AP-2alpha, -beta or -gamma all stimulated expression from a PA-luciferase reporter gene construct approximately 3- to 4-fold. Interestingly, an N-terminally truncated AP-2...... within the region of DNA marked by PA. Footprinting analysis and electrophoretic mobility shift assays of PA and putative AP-2 binding regions with HeLa cell nuclear extract and recombinant AP-2alpha protein indicate that AP-2 transcription factors are central in the regulated expression of UNG2 m......alpha, lacking the activation domain but retaining the DNA binding and dimerization domains, stimulated PA to a level approaching that of full-length AP-2, suggesting that AP-2 overexpression stimulates PA activity by a mechanism involving derepression rather than activation, possibly by neutralizing...

  20. Aag Hypoxanthine-DNA Glycosylase Is Synthesized in the Forespore Compartment and Involved in Counteracting the Genotoxic and Mutagenic Effects of Hypoxanthine and Alkylated Bases in DNA during Bacillus subtilis Sporulation. (United States)

    Ayala-García, Víctor M; Valenzuela-García, Luz I; Setlow, Peter; Pedraza-Reyes, Mario


    Aag from Bacillus subtilis has been implicated in in vitro removal of hypoxanthine and alkylated bases from DNA. The regulation of expression of aag in B. subtilis and the resistance to genotoxic agents and mutagenic properties of an Aag-deficient strain were studied here. A strain with a transcriptional aag-lacZ fusion expressed low levels of β-galactosidase during growth and early sporulation but exhibited increased transcription during late stages of this developmental process. Notably, aag-lacZ expression was higher inside the forespore than in the mother cell compartment, and this expression was abolished in a sigG-deficient background, suggesting a forespore-specific mechanism of aag transcription. Two additional findings supported this suggestion: (i) expression of an aag-yfp fusion was observed in the forespore, and (ii) in vivo mapping of the aag transcription start site revealed the existence of upstream regulatory sequences possessing homology to σ G -dependent promoters. In comparison with the wild-type strain, disruption of aag significantly reduced survival of sporulating B. subtilis cells following nitrous acid or methyl methanesulfonate treatments, and the Rif r mutation frequency was significantly increased in an aag strain. These results suggest that Aag protects the genome of developing B. subtilis sporangia from the cytotoxic and genotoxic effects of base deamination and alkylation. In this study, evidence is presented revealing that aag, encoding a DNA glycosylase implicated in processing of hypoxanthine and alkylated DNA bases, exhibits a forespore-specific pattern of gene expression during B. subtilis sporulation. Consistent with this spatiotemporal mode of expression, Aag was found to protect the sporulating cells of this microorganism from the noxious and mutagenic effects of base deamination and alkylation. Copyright © 2016, American Society for Microbiology. All Rights Reserved.

  1. Advanced uracil DNA glycosylase-supplemented real-time reverse transcription loop-mediated isothermal amplification (UDG-rRT-LAMP) method for universal and specific detection of Tembusu virus. (United States)

    Tang, Yi; Chen, Hao; Diao, Youxiang


    Tembusu virus (TMUV) is a mosquito-borne flavivirus which threatens both poultry production and public health. In this study we developed a complete open reading frame alignment-based rRT-LAMP method for the universal detection of TUMV. To prevent false-positive results, the reaction was supplemented with uracil DNA glycosylase (UDG) to eliminate carryover contamination. The detection limit of the newly developed UDG-rRT-LAMP for TMUV was as low as 100 copies/reaction of viral RNA and 1 × 10(0.89) - 1 × 10(1.55) tissue culture infectious dose/100 μL of viruses. There were no cross-reactions with other viruses, and the reproducibility of the assay was confirmed by intra- and inter-assay tests with variability ranging from 0.22-3.33%. The new UDG-rRT-LAMP method for TMUV produced the same results as viral isolation combined with RT-PCR as the "gold standard" in 96.88% of cases for 81 clinical samples from subjects with suspected TMUV infection. The addition of UDG can eliminate as much as 1 × 10(-16) g/reaction of contaminants, which can significantly reduce the likelihood of false-positive results during the rRT-LAMP reaction. Our result indicated that our UDG-rRT-LAMP is a rapid, sensitive, specific, and reliable method that can effectively prevent carryover contamination in the detection of TMUV.

  2. Age and metabolic risk factors associated with oxidatively damaged DNA in human peripheral blood mononuclear cells

    DEFF Research Database (Denmark)

    Løhr, Mille; Jensen, Annie; Eriksen, Louise


    Aging is associated with oxidative stress-generated damage to DNA and this could be related to metabolic disturbances. This study investigated the association between levels of oxidatively damaged DNA in peripheral blood mononuclear cells (PBMCs) and metabolic risk factors in 1,019 subjects, aged...... 18-93 years. DNA damage was analyzed as strand breaks by the comet assay and levels of formamidopyrimidine (FPG-) and human 8-oxoguanine DNA glycosylase 1 (hOGG1)-sensitive sites There was an association between age and levels of FPG-sensitive sites for women, but not for men. The same tendency...... was observed for the level of hOGG1-sensitive sites, whereas there was no association with the level of strand breaks. The effect of age on oxidatively damaged DNA in women disappeared in multivariate models, which showed robust positive associations between DNA damage and plasma levels of triglycerides...

  3. Seasonal variations of DNA damage in human lymphocytes: Correlation with different environmental variables

    Energy Technology Data Exchange (ETDEWEB)

    Giovannelli, Lisa [Dipartimento di Farmacologia Preclinica e Clinica, Universita di Firenze, Viale Pieraccini 6, 50139 Florence (Italy)]. E-mail:; Pitozzi, Vanessa [Dipartimento di Farmacologia Preclinica e Clinica, Universita di Firenze, Viale Pieraccini 6, 50139 Florence (Italy); Moretti, Silvia [Department of Dermatological Sciences, University of Florence, Florence (Italy); Boddi, Vieri [Department of Public Health, University of Florence, Florence (Italy); Dolara, Piero [Dipartimento di Farmacologia Preclinica e Clinica, Universita di Firenze, Viale Pieraccini 6, 50139 Florence (Italy)


    Several types of DNA damage, including DNA breaks and DNA base oxidation, display a seasonal trend. In the present work, a sample of 79 healthy subjects living in the city of Florence, Italy, was used to analyse this effect. Three possible causative agents were taken into consideration: solar radiation, air temperature and air ozone level. DNA damage was measured in isolated human lymphocytes at different times during the year and the observed damage was correlated with the levels of these three agents in the days preceding blood sampling. Three time windows were chosen: 3, 7 and 30 days before blood sampling. DNA strand breaks and the oxidized purinic bases cleaved by the formamidopyrimidine glycosylase (FPG sites) were measured by means of the comet assay. The results of multivariate regression analysis showed a positive correlation between lymphocyte DNA damage and air temperature, and a less strong correlation with global solar radiation and air ozone levels.

  4. Oxidative damage to DNA and repair induced by Norwegian wood smoke particles in human A549 and THP-1 cell lines

    DEFF Research Database (Denmark)

    Danielsen, Pernille Høgh; Loft, Steffen; Kocbach, Anette


    Genotoxic effects of traffic-generated particulate matter (PM) are well described, whereas little data are available on PM from combustion of biomass and wood, which contributes substantially to air pollution world wide. The aim of this study was to compare the genotoxicity of wood smoke...... particulate matter (WSPM), authentic traffic-generated particles, mineral PM and standard reference material (SRM2975) of diesel exhaust particles in human A549 lung epithelial and THP-1 monocytic cell lines. DNA damage was measured as strand breaks (SB) and formamidopyrimidine DNA glycosylase (FPG) sites......, 60% of the DNA lesions generated by WSPM were removed. In conclusion, WSPM generated more DNA damage than traffic-generated PM per unit mass in human cell lines, possibly due to the high level of polycyclic aromatic hydrocarbons in WSPM. This suggests that exposure to WSPM might be more hazardous...

  5. Highly mutagenic exocyclic DNA adducts are substrates for the human nucleotide incision repair pathway.

    Directory of Open Access Journals (Sweden)

    Paulina Prorok

    Full Text Available BACKGROUND: Oxygen free radicals induce lipid peroxidation (LPO that damages and breaks polyunsaturated fatty acids in cell membranes. LPO-derived aldehydes and hydroxyalkenals react with DNA leading to the formation of etheno(ε-bases including 1,N(6-ethenoadenine (εA and 3,N(4-ethenocytosine (εC. The εA and εC residues are highly mutagenic in mammalian cells and eliminated in the base excision repair (BER pathway and/or by AlkB family proteins in the direct damage reversal process. BER initiated by DNA glycosylases is thought to be the major pathway for the removal of non-bulky endogenous base damage. Alternatively, in the nucleotide incision repair (NIR pathway, the apurinic/apyrimidinic (AP endonucleases can directly incise DNA duplex 5' to a damaged base in a DNA glycosylase-independent manner. METHODOLOGY/PRINCIPAL FINDINGS: Here we have characterized the substrate specificity of human major AP endonuclease 1, APE1, towards εA, εC, thymine glycol (Tg and 7,8-dihydro-8-oxoguanine (8oxoG residues when present in duplex DNA. APE1 cleaves oligonucleotide duplexes containing εA, εC and Tg, but not those containing 8oxoG. Activity depends strongly on sequence context. The apparent kinetic parameters of the reactions suggest that APE1 has a high affinity for DNA containing ε-bases but cleaves DNA duplexes at an extremely slow rate. Consistent with this observation, oligonucleotide duplexes containing an ε-base strongly inhibit AP site nicking activity of APE1 with IC(50 values in the range of 5-10 nM. MALDI-TOF MS analysis of the reaction products demonstrated that APE1-catalyzed cleavage of εA•T and εC•G duplexes generates, as expected, DNA fragments containing 5'-terminal ε-base residue. CONCLUSIONS/SIGNIFICANCE: The fact that ε-bases and Tg in duplex DNA are recognized and cleaved by APE1 in vitro, suggests that NIR may act as a backup pathway to BER to remove a large variety of genotoxic base lesions in human cells.

  6. More Human than Human. (United States)

    Lawrence, David


    Within the literature surrounding nonhuman animals on the one hand and cognitively disabled humans on the other, there is much discussion of where beings that do not satisfy the criteria for personhood fit in our moral deliberations. In the future, we may face a different but related problem: that we might create (or cause the creation of) beings that not only satisfy but exceed these criteria. The question becomes whether these are minimal criteria, or hierarchical, such that those who fulfill them to greater degree should be afforded greater consideration. This article questions the validity and necessity of drawing divisions among beings that satisfy the minimum requirements for personhood; considering how future beings-intelligent androids, synthezoids, even alternate-substrate sentiences-might fit alongside the "baseline" human. I ask whether these alternate beings ought to be considered different to us, and why this may or may not matter in terms of a notion of "human community." The film Blade Runner, concerned in large part with humanity and its key synthezoid antagonist Roy Batty, forms a framing touchstone for my discussion. Batty is stronger, faster, more resilient, and more intelligent than Homo sapiens. His exploits, far beyond the capability of normal humans, are contrasted with his frailty and transient lifespan, his aesthetic appreciation of the sights he has seen, and his burgeoning empathy. Not for nothing does his creator within the mythos term him "more human than human."

  7. Potent protection of gallic acid against DNA oxidation: Results of human and animal experiments

    Energy Technology Data Exchange (ETDEWEB)

    Ferk, Franziska; Chakraborty, Asima [Institute of Cancer Research, Department of Medicine I, Medical University of Vienna, A-1090 Vienna (Austria); Jaeger, Walter [Department of Clinical Pharmacy and Diagnostic, University of Vienna, Vienna (Austria); Kundi, Michael [Institute of Environmental Health, Center for Public Health, Medical University of Vienna, A-1090 Vienna (Austria); Bichler, Julia; Misik, Miroslav [Institute of Cancer Research, Department of Medicine I, Medical University of Vienna, A-1090 Vienna (Austria); Wagner, Karl-Heinz [Department of Nutritional Sciences, University of Vienna, 1090 Vienna (Austria); Grasl-Kraupp, Bettina; Sagmeister, Sandra [Institute of Cancer Research, Department of Medicine I, Medical University of Vienna, A-1090 Vienna (Austria); Haidinger, Gerald [Department of Epidemiology, Center for Public Health, Medical University of Vienna, A-1090 Vienna (Austria); Hoelzl, Christine; Nersesyan, Armen [Institute of Cancer Research, Department of Medicine I, Medical University of Vienna, A-1090 Vienna (Austria); Dusinska, Maria [Health Effect Laboratory, Center for Ecological Economics, Norwegian Institute for Air Research, NO-2027 Kjeller (Norway); Simic, Tatjana [Institute of Cancer Research, Department of Medicine I, Medical University of Vienna, A-1090 Vienna (Austria); Knasmueller, Siegfried, E-mail: [Institute of Cancer Research, Department of Medicine I, Medical University of Vienna, A-1090 Vienna (Austria)


    Gallic acid (3,4,5-trihydroxybenzoic acid, GA) is a constituent of plant derived foods, beverages and herbal remedies. We investigated its DNA protective properties in a placebo controlled human intervention trial in single cell gel electrophoresis experiments. Supplementation of drinking water with GA (12.8 mg/person/d) for three days led to a significant reduction of DNA migration attributable to oxidised pyrimidines (endonuclease III sensitive sites) and oxidised purines (formamidopyrimidine glycosylase sensitive sites) in lymphocytes of healthy individuals by 75% and 64% respectively. Also DNA damage caused by treatment of the cells with reactive oxygen species (ROS) was reduced after GA consumption (by 41%). These effects were paralleled by an increase of the activities of antioxidant enzymes (superoxide dismutase, glutathione peroxidase and glutathion-S-transferase-{pi}) and a decrease of intracellular ROS concentrations in lymphocytes, while no alterations of the total antioxidant capacity (TAC), of malondialdehyde levels in serum and of the urinary excretion of isoprostanes were found. Experiments with rats showed that GA reduces oxidatively damaged DNA in lymphocytes, liver, colon and lungs and protects these organs against {gamma}-irradiation-induced strand breaks and formation of oxidatively damaged DNA-bases. Furthermore, the number of radiation-induced preneoplastic hepatic foci was decreased by 43% after oral administration of the phenolic. Since we did not find alterations of the TAC in plasma and lipid peroxidation of cell membranes but intracellular effects it is likely that the antioxidant properties of GA seen in vivo are not due to direct scavenging of radicals but rather to indirect mechanisms (e.g. protection against ROS via activation of transcription factors). As the amount of GA used in the intervention trial is similar to the daily intake in Middle Europe (18 mg/person/day), our findings indicate that it may contribute to prevention of

  8. NEIL2 protects against oxidative DNA damage induced by sidestream smoke in human cells.

    Directory of Open Access Journals (Sweden)

    Altaf H Sarker

    Full Text Available Secondhand smoke (SHS is a confirmed lung carcinogen that introduces thousands of toxic chemicals into the lungs. SHS contains chemicals that have been implicated in causing oxidative DNA damage in the airway epithelium. Although DNA repair is considered a key defensive mechanism against various environmental attacks, such as cigarette smoking, the associations of individual repair enzymes with susceptibility to lung cancer are largely unknown. This study investigated the role of NEIL2, a DNA glycosylase excising oxidative base lesions, in human lung cells treated with sidestream smoke (SSS, the main component of SHS. To do so, we generated NEIL2 knockdown cells using siRNA-technology and exposed them to SSS-laden medium. Representative SSS chemical compounds in the medium were analyzed by mass spectrometry. An increased production of reactive oxygen species (ROS in SSS-exposed cells was detected through the fluorescent detection and the induction of HIF-1α. The long amplicon-quantitative PCR (LA-QPCR assay detected significant dose-dependent increases of oxidative DNA damage in the HPRT gene of cultured human pulmonary fibroblasts (hPF and BEAS-2B epithelial cells exposed to SSS for 24 h. These data suggest that SSS exposure increased oxidative stress, which could contribute to SSS-mediated toxicity. siRNA knockdown of NEIL2 in hPF and HEK 293 cells exposed to SSS for 24 h resulted in significantly more oxidative DNA damage in HPRT and POLB than in cells with control siRNA. Taken together, our data strongly suggest that decreased repair of oxidative DNA base lesions due to an impaired NEIL2 expression in non-smokers exposed to SSS would lead to accumulation of mutations in genomic DNA of lung cells over time, thus contributing to the onset of SSS-induced lung cancer.

  9. Atmospheric-Pressure Cold Plasma Induces Transcriptional Changes in Ex Vivo Human Corneas.

    Directory of Open Access Journals (Sweden)

    Umberto Rosani

    Full Text Available Atmospheric pressure cold plasma (APCP might be considered a novel tool for tissue disinfection in medicine since the active chemical species produced by low plasma doses, generated by ionizing helium gas in air, induces reactive oxygen species (ROS that kill microorganisms without substantially affecting human cells.In this study, we evaluated morphological and functional changes in human corneas exposed for 2 minutes (min to APCP and tested if the antioxidant n-acetyl l-cysteine (NAC was able to inhibit or prevent damage and cell death.Immunohistochemistry and western blotting analyses of corneal tissues collected at 6 hours (h post-APCP treatment demonstrated no morphological tissue changes, but a transient increased expression of OGG1 glycosylase that returned to control levels in 24 h. Transcriptome sequencing and quantitative real time PCR performed on different corneas revealed in the treated corneas many differentially expressed genes: namely, 256 and 304 genes showing expression changes greater than ± 2 folds in the absence and presence of NAC, respectively. At 6 h post-treatment, the most over-expressed gene categories suggested an active or enhanced cell functioning, with only a minority of genes specifically concerning oxidative DNA damage and repair showing slight over-expression values (<2 folds. Moreover, time-related expression analysis of eight genes up-regulated in the APCP-treated corneas overall demonstrated the return to control expression levels after 24 h.These findings of transient oxidative stress accompanied by wide-range transcriptome adjustments support the further development of APCP as an ocular disinfectant.

  10. Genomic uracil and human disease

    DEFF Research Database (Denmark)

    Hagen, Lars; Pena Diaz, Javier; Kavli, Bodil


    , mutations resulting from uracil in DNA are prevented by error-free base excision repair. However, in B-cells uracil in DNA is also a physiological intermediate in acquired immunity. Here, activation-induced cytosine deaminase (AID) introduces template uracils that give GC to AT transition mutations...... in the Ig locus after replication. When uracil-DNA glycosylase (UNG2) removes uracil, error-prone translesion synthesis over the abasic site causes other mutations in the Ig locus. Together, these processes are central to somatic hypermutation (SHM) that increases immunoglobulin diversity. AID and UNG2......Uracil is present in small amounts in DNA due to spontaneous deamination of cytosine and incorporation of dUMP during replication. While deamination generates mutagenic U:G mismatches, incorporated dUMP results in U:A pairs that are not directly mutagenic, but may be cytotoxic. In most cells...

  11. Induction and repair of DNA damage measured by the comet assay in human T lymphocytes separated by immunomagnetic cell sorting. (United States)

    Bausinger, Julia; Speit, Günter


    The comet assay is widely used in human biomonitoring to measure DNA damage in whole blood or isolated peripheral blood mononuclear cells (PBMC) as a marker of exposure to genotoxic agents. Cytogenetic assays with phytohemagglutinin (PHA)-stimulated cultured T lymphocytes are also frequently performed in human biomonitoring. Cytogenetic effects (micronuclei, chromosome aberrations, sister chromatid exchanges) may be induced in vivo but also occur ex vivo during the cultivation of lymphocytes as a consequence of DNA damage present in lymphocytes at the time of sampling. To better understand whether DNA damage measured by the comet assay in PBMC is representative for DNA damage in T cells, we comparatively investigated DNA damage and its repair in PBMC and T cells obtained by immunomagnetic cell sorting. PBMC cultures and T cell cultures were exposed to mutagens with different modes of genotoxic action and DNA damage was measured by the comet assay after the end of a 2h exposure and after 18h post-incubation. The mutagens tested were methyl methanesulfonate (MMS), (±)-anti-B[a]P-7,8-dihydrodiol-9,10-epoxide (BPDE), 4-nitroquinoline-1-oxide (4NQO), styrene oxide and potassium bromate. MMS and potassium bromate were also tested by the modified comet assay with formamido pyrimidine glycosylase (FPG) protein. The results indicate that the mutagens tested induce DNA damage in PBMC and T cells in the same range of concentrations and removal of induced DNA lesions occurs to a comparable extent. Based on these results, we conclude that the comet assay with PBMC is suited to predict DNA damage and its removal in T cells. Copyright © 2014 Elsevier B.V. All rights reserved.

  12. Human rights

    NARCIS (Netherlands)

    Gaay Fortman, B. de


    Human rights reflect a determined effort to protect the dignity of each and every human being against abuse of power. This endeavour is as old as human history. What is relatively new is the international venture for the protection of human dignity through internationally accepted legal standards

  13. Human Rights, Human Needs, Human Development, Human Security


    Gasper, D.R.


    Human rights, human development and human security form increasingly important, partly interconnected, partly competitive and misunderstood ethical and policy discourses. Each tries to humanize a pre-existing and unavoidable major discourse of everyday life, policy and politics; each has emerged within the United Nations world; each relies implicitly on a conceptualisation of human need; each has specific strengths. Yet mutual communication, understanding and co-operation are deficient, espec...

  14. Evaluation of the mutagenicity and genotoxic potential of carvacrol and thymol using the Ames Salmonella test and alkaline, Endo III- and FPG-modified comet assays with the human cell line Caco-2. (United States)

    LLana-Ruiz-Cabello, Maria; Maisanaba, Sara; Puerto, Maria; Prieto, Ana I; Pichardo, Silvia; Jos, Ángeles; Cameán, Ana M


    Currently, direct antimicrobial and antioxidant additives derived from essential oils are used in food packaging and are perceived by consumers as low-health-risk compounds. In this study, we investigated the potential mutagenicity and genotoxicity of carvacrol and thymol, major compounds in several essential oils, using the Ames Salmonella test and the alkaline, Endo III- and formamidopyrimidine glycosylase (FPG)-modified comet assays, respectively. Thymol did not show any mutagenic activity at any concentration assayed (0-250 μM), whereas carvacrol exhibited mutagenic potential, displaying greater activity in presence of the metabolic fraction (29-460 μM). The genotoxic effects were evaluated in the human colon carcinoma cell line Caco-2, and the standard comet assay revealed that neither carvacrol (0-460 μM) nor thymol (0-250 μM) had any affects at 24 and 48 h. The FPG-modified comet assay showed that the highest concentration of carvacrol (460 μM) caused DNA damage, indicating damage to the purine bases. These results should be used to identify the appropriate concentrations of carvacrol and thymol as additives in food packaging. Moreover, further studies are necessary to explore the safety and/or the toxicity mechanisms of these compounds. Copyright © 2014 Elsevier Ltd. All rights reserved.

  15. Human Monkeypox

    National Research Council Canada - National Science Library

    Wilson, Mary E; Hughes, James M; McCollum, Andrea M; Damon, Inger K


    Human monkeypox is found primarily in forested areas of Central Africa. This article provides a basic review of the clinical, epidemiological, and biological factors that contribute to human disease...

  16. Human microbiomics


    Rajendhran, J.; Gunasekaran, P.


    The sequencing of the human genome has driven the study of human biology in a significant way and enabled the genome-wide study to elucidate the molecular basis of complex human diseases. Recently, the role of microbiota on human physiology and health has received much attention. The influence of gut microbiome (the collective genomes of the gut microbiota) in obesity has been demonstrated, which may pave the way for new prophylactic and therapeutic strategies such as bacteriotherapy. The sig...

  17. Human Development

    NARCIS (Netherlands)

    D.R. Gasper (Des)


    textabstract‘Human development’ language spread gradually in circles of national and international development policy and planning from the 1970s and acquired a definitive form in the 1990s in the United Nations Development Programme’s Human Development Reports (HDRs). Human development was defined

  18. Human Smuggling

    NARCIS (Netherlands)

    Siegel - Rozenblit, Dina|info:eu-repo/dai/nl/152524096; Zaitch, Damian|info:eu-repo/dai/nl/183348486


    Human smuggling is based on a consensus between smuggler, smuggled, and his/her family (which usually guarantees or effectuates payment). However, unauthorized immigrants are violating immigration laws and human smugglers are profiting from enabling illegal immigration. Both human smuggling and its

  19. Specific Inhibition of NEIL-initiated Repair of Oxidized Base Damage in Human Genome by Copper and Iron (United States)

    Hegde, Muralidhar L.; Hegde, Pavana M.; Holthauzen, Luis M. F.; Hazra, Tapas K.; Rao, K. S. Jagannatha; Mitra, Sankar


    Dyshomeostasis of transition metals iron and copper as well as accumulation of oxidative DNA damage have been implicated in multitude of human neurodegenerative diseases, including Alzheimer disease and Parkinson disease. These metals oxidize DNA bases by generating reactive oxygen species. Most oxidized bases in mammalian genomes are repaired via the base excision repair pathway, initiated with one of four major DNA glycosylases: NTH1 or OGG1 (of the Nth family) or NEIL1 or NEIL2 (of the Nei family). Here we show that Fe(II/III) and Cu(II) at physiological levels bind to NEIL1 and NEIL2 to alter their secondary structure and strongly inhibit repair of mutagenic 5-hydroxyuracil, a common cytosine oxidation product, both in vitro and in neuroblastoma (SH-SY5Y) cell extract by affecting the base excision and AP lyase activities of NEILs. The specificity of iron/copper inhibition of NEILs is indicated by a lack of similar inhibition of OGG1, which also indicated that the inhibition is due to metal binding to the enzymes and not DNA. Fluorescence and surface plasmon resonance studies show submicromolar binding of copper/iron to NEILs but not OGG1. Furthermore, Fe(II) inhibits the interaction of NEIL1 with downstream base excision repair proteins DNA polymerase β and flap endonuclease-1 by 4–6-fold. These results indicate that iron/copper overload in the neurodegenerative diseases could act as a double-edged sword by both increasing oxidative genome damage and preventing their repair. Interestingly, specific chelators, including the natural chemopreventive compound curcumin, reverse the inhibition of NEILs both in vitro and in cells, suggesting their therapeutic potential. PMID:20622253

  20. Human Technology and Human Affects

    DEFF Research Database (Denmark)

    Fausing, Bent


    Human Technology and Human Affects  This year Samsung introduced a mobile phone with "Soul". It was made with a human touch and included itself a magical touch. Which function does technology and affects get in everyday aesthetics like this, its images and interactions included this presentation...... will ask and try to answer. The mobile phone and its devices are depicted as being able to make a unique human presence, interaction, and affect. The medium, the technology is a necessary helper to get towards this very special and lost humanity. Without the technology, no special humanity - soul...... - is the prophecy. This personification or anthropomorphism is important for the branding of new technology. The technology is seen as creating a technotranscendens towards a more qualified humanity, which is in contact with the fundamental human values like intuition, vision, and sensing; all the qualities...

  1. Human Parvoviruses. (United States)

    Qiu, Jianming; Söderlund-Venermo, Maria; Young, Neal S


    Parvovirus B19 (B19V) and human bocavirus 1 (HBoV1), members of the large Parvoviridae family, are human pathogens responsible for a variety of diseases. For B19V in particular, host features determine disease manifestations. These viruses are prevalent worldwide and are culturable in vitro, and serological and molecular assays are available but require careful interpretation of results. Additional human parvoviruses, including HBoV2 to -4, human parvovirus 4 (PARV4), and human bufavirus (BuV) are also reviewed. The full spectrum of parvovirus disease in humans has yet to be established. Candidate recombinant B19V vaccines have been developed but may not be commercially feasible. We review relevant features of the molecular and cellular biology of these viruses, and the human immune response that they elicit, which have allowed a deep understanding of pathophysiology. Copyright © 2016 American Society for Microbiology.

  2. Human Rights/Human Needs. (United States)

    Canning, Cynthia


    The faculty of Holy Names High School developed an interdisciplinary human rights program with school-wide activities focusing on three selected themes: the United Nations Universal Declaration of Human Rights, in conjunction with Human Rights Week; Food; and Women. This article outlines major program activities. (SJL)

  3. Oxidative damage to DNA and repair induced by Norwegian wood smoke particles in human A549 and THP-1 cell lines. (United States)

    Danielsen, Pernille Høgh; Loft, Steffen; Kocbach, Anette; Schwarze, Per E; Møller, Peter


    Genotoxic effects of traffic-generated particulate matter (PM) are well described, whereas little data are available on PM from combustion of biomass and wood, which contributes substantially to air pollution world wide. The aim of this study was to compare the genotoxicity of wood smoke particulate matter (WSPM), authentic traffic-generated particles, mineral PM and standard reference material (SRM2975) of diesel exhaust particles in human A549 lung epithelial and THP-1 monocytic cell lines. DNA damage was measured as strand breaks (SB) and formamidopyrimidine DNA glycosylase (FPG) sites by the comet assay, whereas cell cytotoxicity was determined as lactate dehydrogenase release. The exposure to WSPM generated SB and FPG sites in both cell lines at concentrations from 2.5 or 25 microg/ml, which were not cytotoxic. Compared to all other studied particles, WSPM generated greater responses in terms of both SB and FPG sites. Organic extracts of WSPM and SRM2975 elicited higher levels of SB than native and washed PM at 25 and 100 microg/ml, whereas assay saturation precluded reliable assessment of FPG sites. During a 6h post-exposure period, in which the medium with PM had been replaced by fresh medium, 60% of the DNA lesions generated by WSPM were removed. In conclusion, WSPM generated more DNA damage than traffic-generated PM per unit mass in human cell lines, possibly due to the high level of polycyclic aromatic hydrocarbons in WSPM. This suggests that exposure to WSPM might be more hazardous than PM collected from vehicle exhaust with respect to development of lung cancer.

  4. Digital Humanities

    DEFF Research Database (Denmark)

    Brügger, Niels


    Digital humanities is an umbrella term for theories, methodologies, and practices related to humanities scholarship that use the digital computer as an integrated and essential part of its research and teaching activities. The computer can be used for establishing, finding, collecting......, and preserving material to study, as an object of study in its own right, as an analytical tool, or for collaborating, and for disseminating results. The term "digital humanities" was coined around 2001, and gained currency within academia in the following years. However, computers had been used within...... the humanities for decades, starting with research fields such as humanities computing or computational linguistics in the 1950s, and later new media studies and internet studies. The historical development of digital humanities has been characterized by a focus on three successive, but co-existing types...

  5. Human evolution

    DEFF Research Database (Denmark)

    Llamas, Bastien; Willerslev, Eske; Orlando, Ludovic Antoine Alexandre


    The field of human ancient DNA (aDNA) has moved from mitochondrial sequencing that suffered from contamination and provided limited biological insights, to become a fully genomic discipline that is changing our conception of human history. Recent successes include the sequencing of extinct hominins......, and true population genomic studies of Bronze Age populations. Among the emerging areas of aDNA research, the analysis of past epigenomes is set to provide more new insights into human adaptation and disease susceptibility through time. Starting as a mere curiosity, ancient human genetics has become...

  6. Human Rights, Human Needs, Human Development, Human Security - Relationships between four international human discourses.

    NARCIS (Netherlands)

    D.R. Gasper (Des)


    markdownabstractAbstract: Human rights, human development and human security form increasingly important, partly interconnected, partly competitive and misunderstood ethical and policy discourses. Each tries to humanize a pre-existing and unavoidable major discourse of everyday life, policy and

  7. Human Rights and Human Nature

    Directory of Open Access Journals (Sweden)

    Vittorio Possenti


    Full Text Available There seems to be two different versions of human rights in Western tradition: say Rationalistic and Christian; the former adopted in revolutionary France, the latter highly developed in Renaissance Spain. Current relativistic criticisms attempt to deny the universality of human rights alleging that this theory has been created in Western countries or it has no strong justification, and therefore cannot have universal approach; but this objection can be dismissed with an alternative justification of human rights.

  8. Think Human

    DEFF Research Database (Denmark)

    Nielsen, Charlotte Marie Bisgaard


    years' campaigns suggests that the theory of communication underlying the campaign has its basis in mechanical action rather than in human communication. The practice of 'Communication design' is investigated in relation to this metaphorical 'machine thinking' model of communication and contrasted...... with the human-centered theory of communication advocated by integrationism....

  9. Human trichuriasis

    DEFF Research Database (Denmark)

    Betson, Martha; Søe, Martin Jensen; Nejsum, Peter


    Human trichuriasis is a neglected tropical disease which affects hundreds of millions of people worldwide and is particularly prevalent among children living in areas where sanitation is poor. This review examines the current knowledge on the taxonomy, genetics and phylogeography of human Trichuris...

  10. Human kapital

    DEFF Research Database (Denmark)

    Grosen, Anders; Nielsen, Peder Harbjerg


    finansiel og human kapital. Den traditionelle rådgivnings snævre synsvinkel kan føre til forkerte investeringsråd. Der skal derfor opfordres til, at de finansielle virksomheder i tilrettelæggelsen af deres rådgivning af private kunder systematisk inddrager den humane kapitals størrelse og karakteristika i...

  11. Determination of TiO2, ZrO2, and Al2O3 nanoparticles on genotoxic responses in human peripheral blood lymphocytes and cultured embyronic kidney cells. (United States)

    Demir, Eşref; Burgucu, Durmuş; Turna, Fatma; Aksakal, Sezgin; Kaya, Bülent


    In this study a genotoxic evaluation of titanium dioxide (TiO2, 2.3 nm), zirconium oxide (ZrO2, 6 nm), aluminum oxide (Al2O3, 16.7 nm) nanoparticles (NP) and their ionic forms was conducted using human peripheral blood lymphocytes and cultured human embryonic kidney (HEK293) cells by means of a modified alkaline comet assay with/without the formamidopyrimidine-DNA glycosylase (Fpg) and endonuclease III (Endo III) enzymes. Modifications to the comet assay by using lesion-specific endonucleases, such as Endo III and Fpg, detect DNA bases with oxidative damage. Both human peripheral blood lymphocytes and cultured embryonic kidney cells were incubated with TiO2, ZrO2, or Al2O3 NP at concentrations of 1, 10, or 100 μg/ml. Our results showed no significant induction in DNA damage by the comet assay with/without the Endo III and Fpg enzymes at all concentrations of ZrO2 and Al2O3. In the case of TiO2 NP only the highest concentration of 100 μg/ml significantly induced a genotoxic response. Data thus indicate that both ZrO2 and Al2O3 NP were not genotoxic in our system and in the case of TiO2 the lowest-observed-adverse-effect level (LOAEL) for genotoxicity was 100 μg/ml. Evidence indicates that these metallic NP are considered safe in light of the fact that no genotoxicity was noted with ZrO2 and Al2O3 and that the highest TiO2 concentration is not environmentally relevant.

  12. Environmental exposure to human carcinogens in teenagers and the association with DNA damage. (United States)

    Franken, Carmen; Koppen, Gudrun; Lambrechts, Nathalie; Govarts, Eva; Bruckers, Liesbeth; Den Hond, Elly; Loots, Ilse; Nelen, Vera; Sioen, Isabelle; Nawrot, Tim S; Baeyens, Willy; Van Larebeke, Nicolas; Boonen, Francis; Ooms, Daniëlla; Wevers, Mai; Jacobs, Griet; Covaci, Adrian; Schettgen, Thomas; Schoeters, Greet


    We investigated whether human environmental exposure to chemicals that are labeled as (potential) carcinogens leads to increased (oxidative) damage to DNA in adolescents. Six hundred 14-15-year-old youngsters were recruited all over Flanders (Belgium) and in two areas with important industrial activities. DNA damage was assessed by alkaline and formamidopyrimidine DNA glycosylase (Fpg) modified comet assays in peripheral blood cells and analysis of urinary 8-hydroxydeoxyguanosine (8-OHdG) levels. Personal exposure to potentially carcinogenic compounds was measured in urine, namely: chromium, cadmium, nickel, 1-hydroxypyrene as a proxy for exposure to other carcinogenic polycyclic aromatic hydrocarbons (PAHs), t,t-muconic acid as a metabolite of benzene, 2,5-dichlorophenol (2,5-DCP), organophosphate pesticide metabolites, and di(2-ethylhexyl) phthalate (DEHP) metabolites. In blood, arsenic, polychlorinated biphenyl (PCB) congeners 118 and 156, hexachlorobenzene (HCB), dichlorodiphenyltrichloroethane (DDT) and perfluorooctanoic acid (PFOA) were analyzed. Levels of methylmercury (MeHg) were measured in hair. Multiple linear regression models were used to establish exposure-response relationships. Biomarkers of exposure to PAHs and urinary chromium were associated with higher levels of both 8-OHdG in urine and DNA damage detected by the alkaline comet assay. Concentrations of 8-OHdG in urine increased in relation with increasing concentrations of urinary t,t-muconic acid, cadmium, nickel, 2,5-DCP, and DEHP metabolites. Increased concentrations of PFOA in blood were associated with higher levels of DNA damage measured by the alkaline comet assay, whereas DDT was associated in the same direction with the Fpg-modified comet assay. Inverse associations were observed between blood arsenic, hair MeHg, PCB 156 and HCB, and urinary 8-OHdG. The latter exposure biomarkers were also associated with higher fish intake. Urinary nickel and t,t-muconic acid were inversely associated

  13. Human Computation

    CERN Multimedia

    CERN. Geneva


    What if people could play computer games and accomplish work without even realizing it? What if billions of people collaborated to solve important problems for humanity or generate training data for computers? My work aims at a general paradigm for doing exactly that: utilizing human processing power to solve computational problems in a distributed manner. In particular, I focus on harnessing human time and energy for addressing problems that computers cannot yet solve. Although computers have advanced dramatically in many respects over the last 50 years, they still do not possess the basic conceptual intelligence or perceptual capabilities...

  14. Human phantom

    CERN Multimedia

    CERN PhotoLab


    This human phantom has been received by CERN on loan from the State Committee of the USSR for the Utilization of Atomic Energy. It is used by the Health Physics Group to study personel radiation doses near the accelerators.

  15. Human expunction (United States)

    Klee, Robert


    Thomas Nagel in `The Absurd' (Nagel 1971) mentions the future expunction of the human species as a `metaphor' for our ability to see our lives from the outside, which he claims is one source of our sense of life's absurdity. I argue that the future expunction (not to be confused with extinction) of everything human - indeed of everything biological in a terran sense - is not a mere metaphor but a physical certainty under the laws of nature. The causal processes by which human expunction will take place are presented in some empirical detail, so that philosophers cannot dismiss it as merely speculative. I also argue that appeals to anthropic principles or to forms of mystical cosmology are of no plausible avail in the face of human expunction under the laws of physics.

  16. Human brucellosis

    NARCIS (Netherlands)

    Franco, María Pía; Mulder, Maximilian; Gilman, Robert H.; Smits, Henk L.


    Human brucellosis still presents scientists and clinicians with several challenges, such as the understanding of pathogenic mechanisms of Brucella spp, the identification of markers for disease severity, progression, and treatment response, and the development of improved treatment regimens.

  17. Human Toxicity

    DEFF Research Database (Denmark)

    Jolliet, Olivier; Fantke, Peter


    This chapter reviews the human toxicological impacts of chemicals and how to assess these impacts in life cycle impact assessment (LCIA), in order to identify key processes and pollutants. The complete cause-effect pathway – from emissions of toxic substances up to damages on human health...... on characterisation factors means that results should by default be reported and interpreted in log scales when comparing scenarios or substance contribution! We conclude by outlining future trends in human toxicity modelling for LCIA, with promising developments for (a) better estimates of degradation halflives, (b......) the inclusion of ionization of chemicals in human exposure including bioaccumulation, (c) metal speciation, (d) spatialised models to differentiate the variability associated with spatialisation from the uncertainty, and (e) the assessment of chemical exposure via consumer products and occupational settings...

  18. Human ehrlichiosis

    Directory of Open Access Journals (Sweden)

    Đokić Milomir


    Full Text Available Background. Human ehrlichiosis is a newly recognized disease. It is a tick-borne disease caused by several bacterial species of the genhus Erlichia. These are small gram-negative pleomorphic cocci, that are obligatory intracellular bacteria. Tick Ixodes is the principle vector in Europe, and Amblyomma americanum in the United States. Bacterial organisms replicate in a tick, and are transmited from infected cells in a vector to the blood cells of animals or humans. Human ehrlichiosis is a name for a group of diseases caused by different species of Ehrlichia. One of them is the disease named human monocytic ehrlichiosis, caused by Ehrlichia chaffeensis, and the other is a human granulocytic ehrlichiosis caused by Anaplasma phagocytophilia. Case report. We reported a 23-year-old patient admitted for the clinical treatment with the symptoms of high febrility (above 40 °C, headache, vomiting, general weakness and exhaustion, but without data on a tick bite. The patient was treated with trimetoprim-sulfamethoxazole for a week when Ehrlichia chaffeensis was confirmed by the immunofluoroscence test, and the therapy contimed with doxacyclin. Conclusion. Human ehrlichiosis is also present in our country, so this disease should be considered everyday, especially in infectology practice.

  19. In vitro evaluation of baseline and induced DNA damage in human sperm exposed to benzo[a]pyrene or its metabolite benzo[a]pyrene-7,8-diol-9,10-epoxide, using the comet assay. (United States)

    Sipinen, V; Laubenthal, J; Baumgartner, A; Cemeli, E; Linschooten, J O; Godschalk, R W L; Van Schooten, F J; Anderson, D; Brunborg, G


    Exposure to genotoxins may compromise DNA integrity in male reproductive cells, putting future progeny at risk for developmental defects and diseases. To study the usefulness of sperm DNA damage as a biomarker for genotoxic exposure, we have investigated cellular and molecular changes induced by benzo[a]pyrene (B[a]P) in human sperm in vitro, and results have been compared for smokers and non-smokers. Sperm DNA obtained from five smokers was indeed more fragmented than sperm of six non-smokers (mean % Tail DNA 26.5 and 48.8, respectively), as assessed by the alkaline comet assay (P sperm cells to B[a]P (10 or 25 microM) caused moderate increases in DNA fragmentation which was independent of addition of human liver S9 mix for enzymatic activation of B[a]P, suggesting some unknown metabolism of B[a]P in ejaculates. In vitro exposure of samples to various doses of B[a]P (with or without S9) did not reveal any significant differences in sensitivity to DNA fragmentation between smokers and non-smokers. Incubations with the proximate metabolite benzo[a]pyrene-r-7,t-8-dihydrodiol-t9,10-epoxide (BPDE) produced DNA fragmentation in a dose-dependent manner (20 or 50 microM), but only when formamidopyrimidine DNA glycosylase treatment was included in the comet assay. These levels of DNA fragmentation were, however, low in relation to very high amounts of BPDE-DNA adducts as measured with (32)P postlabelling. We conclude that sperm DNA damage may be useful as a biomarker of direct exposure of sperm using the comet assay adapted to sperm, and as such the method may be applicable to cohort studies. Although the sensitivity is relatively low, DNA damage induced in earlier stages of spermatogenesis may be detected with higher efficiencies.

  20. [Humanized childbirth]. (United States)

    Kuo, Su-Chen


    Childbirth is a major event in a family. The expectant parent's perception of the childbirth experience influences his or her development as a parent. Making childbirth a positive and satisfying experience for women is the responsibility of health care providers. Women want to have physical and emotional privacy during labor and delivery, and to experience both in a friendly, comfortable environment. For women expected to undergo normal deliveries, humanized childbirth is one accessible approach. This article explores the definition and evolution of humanized childbirth and the care practice that it involves. It also explores birth plans and birth experiences, and the improvements necessary to routine labor practices to enable women to participate in decision making about their childbirth experiences. The author emphasizes that when health-care providers recognize the value of humanized childbirth and make changes accordingly, the dignity of women's childbirth experiences will be enhanced.

  1. Human monkeypox. (United States)

    McCollum, Andrea M; Damon, Inger K


    Human monkeypox is a zoonotic Orthopoxvirus with a presentation similar to smallpox. Clinical differentiation of the disease from smallpox and varicella is difficult. Laboratory diagnostics are principal components to identification and surveillance of disease, and new tests are needed for a more precise and rapid diagnosis. The majority of human infections occur in Central Africa, where surveillance in rural areas with poor infrastructure is difficult but can be accomplished with evidence-guided tools and educational materials to inform public health workers of important principles. Contemporary epidemiological studies are needed now that populations do not receive routine smallpox vaccination. New therapeutics and vaccines offer hope for the treatment and prevention of monkeypox; however, more research must be done before they are ready to be deployed in an endemic setting. There is a need for more research in the epidemiology, ecology, and biology of the virus in endemic areas to better understand and prevent human infections.

  2. DNA damage in wounded, hypoxic and acidotic human skin fibroblast cell cultures after low laser irradiation (United States)

    Hawkins Evans, D.; Mbene, A.; Zungu, I.; Houreld, N.; Abrahamse, H.


    Phototherapy has become more popular and widely used in the treatment of a variety of medical conditions. To ensure sound results as evidence of its effectiveness, well designed experiments must be conducted when determining the effect of phototherapy. Cell culture models such as hypoxic, acidotic and wounded cell cultures simulating different disease conditions including ischemic heart disease, diabetes and wound healing were used to determine the effect of laser irradiation on the genetic integrity of the cell. Even though phototherapy has been found to be beneficial in a wide spectrum of conditions, it has been shown to induce DNA damage. However, this damage appears to be repairable. The risk lies in the fact that phototherapy may help the medical condition initially but damage DNA at the same time leaving undetected damage that may result in late onset, more severe, induced medical conditions including cancer. Human skin fibroblasts were cultured and used to induce a wound (by the central scratch model), hypoxic (by incubation in an anaerobic jar, 95% N2 and 5% O2) and acidotic (reducing the pH of the media to 6.7) conditions. Different models were irradiated using a Helium-Neon (632.8 nm) laser with a power density of 2.07 mW/cm2 and a fluence of 5 J/cm2 or 16 J/cm2. The effect of the irradiation was determined using the Comet assay 1 and 24 h after irradiation. In addition, the Comet assay was performed with the addition of formamidopyrimidine glycosylase (FPG) obviating strand brakes in oxidized bases at a high fluence of 16 J/cm2. A significant increase in DNA damage was seen in all three injured models at both 1 and 24 h post-irradiation when compared to the normal un-injured cells. However, when compared to non-irradiated controls the acidotic model showed a significant decrease in DNA damage 24 h after irradiation indicating the possible induction of cellular DNA repair mechanisms. When wounded cells were irradiated with higher fluences of 16 J/cm2

  3. Human mimicry

    NARCIS (Netherlands)

    Chartrand, T.L.; Baaren, R.B. van


    Human mimicry is ubiquitous, and often occurs without the awareness of the person mimicking or the person being mimicked. First, we briefly describe some of the major types of nonconscious mimicry—verbal, facial, emotional, and behavioral—and review the evidence for their automaticity. Next, we

  4. Practicing Humanities

    DEFF Research Database (Denmark)

    Gimmler, Antje


    and self-reflective democracy. Contemporary humanities have adopted a new orientation towards practices, and it is not clear how this fits with the ideals of ‘Bildung’ and ‘pure science’. A possible theoretical framework for this orientation towards practices could be found in John Dewey’s pragmatic...

  5. Human waste

    NARCIS (Netherlands)

    Amin, Md Nurul; Kroeze, Carolien; Strokal, Maryna


    Many people practice open defecation in south Asia. As a result, lot of human waste containing nutrients such as nitrogen (N) and phosphorus (P) enter rivers. Rivers transport these nutrients to coastal waters, resulting in marine pollution. This source of nutrient pollution is, however, ignored in

  6. Human Parasites


    Davis, Ryan S.; Hodgson, Erin W.


    Entomologists often get “bug” samples for identification, including those that accidentally infest residences. In the United States, we are fortunate to have very few arthropods (e.g., insects, spiders, mites, ticks, etc.) that actually infest or feed on humans.

  7. Human steroidogenesis

    DEFF Research Database (Denmark)

    Andersen, Claus Y; Ezcurra, Diego


    reviews current knowledge of the regulation of progesterone in the human ovary during the follicular phase and highlights areas where knowledge remains limited. In this review, we provide in-depth information outlining the regulation and function of gonadotropins in the complicated area of steroidogenesis...

  8. Human Parechoviruses

    DEFF Research Database (Denmark)

    Fischer, Thea Kølsen; Harvala, Heli; Midgley, Sofie


    Infections with human parechoviruses (HPeV) are highly prevalent, particularly in neonates, where they may cause substantial morbidity and mortality. The clinical presentation of HPeV infection is often indistinguishable from that of enterovirus (EV) infection and may vary from mild disease...

  9. Nothing Human (United States)

    Wharram, C. C.


    In this essay C. C. Wharram argues that Terence's concept of translation as a form of "contamination" anticipates recent developments in philosophy, ecology, and translation studies. Placing these divergent fields of inquiry into dialogue enables us read Terence's well-known statement "I am a human being--I deem nothing…

  10. Human Trafficking (United States)

    Wilson, David McKay


    The shadowy, criminal nature of human trafficking makes evaluating its nature and scope difficult. The U.S. State Department and anti-trafficking groups estimate that worldwide some 27 million people are caught in a form of forced servitude today. Public awareness of modern-day slavery is gaining momentum thanks to new abolitionist efforts. Among…

  11. Human monkeypox. (United States)

    Jezek, Z; Gromyko, A I; Szczeniowski, M V


    Human monkeypox, occurring in the tropical rainforest of west and central Africa, is regarded as the most important orthopoxvirus infection for epidemiological surveillance during the post-smallpox era. This disease, first recognized in Zaïre in 1970 resembles smallpox clinically but differs epidemiologically. Clinical features, their evolution and sequelae of monkeypox could be compared with discrete ordinary or modified type of smallpox. A case-fatality rate of 14% has been observed but some cases can be exceedingly mild or atypical and may easily remain undetected and unreported. Pronounced lymphadenopathy has been the only clinical feature found commonly in monkeypox but not in smallpox. Fifty-seven cases of human monkeypox have occurred since 1970, in the tropical rainforests in six west and central African countries, the majority of them (45) being reported from Zaïre. The disease appears to be more frequent in dry season. Children below ten years of age comprise 84% of the cases. Smallpox vaccination protects against monkeypox. Clusters of cases have been observed in certain areas within countries and within affected households. Human-to-human spread has possibly occurred seven times. No cases of possible tertiary spread were observed. The secondary attack rate among susceptible close household contacts was 10%, among all susceptible contacts 5%. This is much lower than that occurring with smallpox, which is between 25-40%. The limited avidity of monkeypox virus for human beings indicates that monkeypox is probably a zoonosis, although the animal reservoir(s) have not yet been identified. The low transmissibility, resulting in low frequency of disease in man indicates that monkeypox is not a public health problem. Human monkeypox has been a relatively newly recognized disease. Studies are in progress to identify the natural cycle of monkeypox virus and to define better its clinical and epidemiological characteristics. Special surveillance is maintained in

  12. Human Rights, Human Needs, Human Development, Human Security : Relationships between four international 'human' discourses

    NARCIS (Netherlands)

    D.R. Gasper (Des)


    textabstractHuman rights, human development and human security form increasingly important, partly interconnected, partly competitive and misunderstood ethical and policy discourses. Each tries to humanize a pre-existing and unavoidable major discourse of everyday life, policy and politics; each

  13. Human Development Report 2000: Human Rights and Human Development


    United Nations Development Programme, UNDP


    The Human Development Report 2000 looks at human rights as an intrinsic part of development—and at development as a means to realizing human rights. It shows how human rights bring principles of accountability and social justice to the process of human development.

  14. Human Rights in the Humanities (United States)

    Harpham, Geoffrey


    Human rights are rapidly entering the academic curriculum, with programs appearing all over the country--including at Duke, Harvard, Northeastern, and Stanford Universities; the Massachusetts Institute of Technology; the Universities of Chicago, of Connecticut, of California at Berkeley, and of Minnesota; and Trinity College. Most of these…

  15. Human Protothecosis (United States)

    Lass-Flörl, Cornelia; Mayr, Astrid


    Human protothecosis is a rare infection caused by members of the genus Prototheca. Prototheca species are generally considered to be achlorophyllic algae and are ubiquitous in nature. The occurrence of protothecosis can be local or disseminated and acute or chronic, with the latter being more common. Diseases have been classified as (i) cutaneous lesions, (ii) olecranon bursitis, or (iii) disseminated or systemic manifestations. Infections can occur in both immunocompetent and immunosuppressed patients, although more severe and disseminated infections tend to occur in immunocompromised individuals. Prototheca wickerhamii and Prototheca zopfii have been associated with human disease. Usually, treatment involves medical and surgical approaches; treatment failure is not uncommon. Antifungals such as ketoconazole, itraconazole, fluconazole, and amphotericin B are the most commonly used drugs to date. Among them, amphotericin B displays the best activity against Prototheca spp. Diagnosis is largely made upon detection of characteristic structures observed on histopathologic examination of tissue. PMID:17428884

  16. Human paleoneurology

    CERN Document Server


    The book presents an integrative review of paleoneurology, the study of endocranial morphology in fossil species. The main focus is on showing how computed methods can be used to support advances in evolutionary neuroanatomy, paleoanthropology and archaeology and how they have contributed to creating a completely new perspective in cognitive neuroscience. Moreover, thanks to its multidisciplinary approach, the book addresses students and researchers approaching human paleoneurology from different angles and for different purposes, such as biologists, physicians, anthropologists, archaeologists

  17. Human Cloning (United States)


    research group, headed by Douglas Melton and Kevin Eggan, submitted their proposal to a Harvard committee composed of ethicists, scientists and public...United States. Although the company offered no proof of its claim, Dr . Brigette Boisselier, Managing Director of Clonaid, stated that genetic tests would...a year of the Dolly announcement, concerns over human cloning were heightened when Dr . Richard Seed, a Chicago scientist, announced on January 7

  18. Human universe

    CERN Document Server

    Cox, Brian


    Human life is a staggeringly strange thing. On the surface of a ball of rock falling around a nuclear fireball in the blackness of a vacuum the laws of nature conspired to create a naked ape that can look up at the stars and wonder where it came from. What is a human being? Objectively, nothing of consequence. Particles of dust in an infinite arena, present for an instant in eternity. Clumps of atoms in a universe with more galaxies than people. And yet a human being is necessary for the question itself to exist, and the presence of a question in the universe - any question - is the most wonderful thing. Questions require minds, and minds bring meaning. What is meaning? I don't know, except that the universe and every pointless speck inside it means something to me. I am astonished by the existence of a single atom, and find my civilisation to be an outrageous imprint on reality. I don't understand it. Nobody does, but it makes me smile. This book asks questions about our origins, our destiny, and our place i...

  19. Human Being Human: Culture and the Soul


    Hauke, Chris


    Human Being Human explores the classical question 'What is a human being?'\\ud \\ud In examining our human being, Christopher Hauke challenges the notion of human nature, questions the assumed superiority of human consciousness and rational thinking and pays close attention to the contradiction of living simultaneously as an autonomous individual and a member of the collective community. The main chapters include:\\ud \\ud who's in charge here?\\ud knowledge power and human being\\ud that thinking ...

  20. Introduction: Digital Humanities, Public Humanities

    Directory of Open Access Journals (Sweden)

    Alex Christie


    Full Text Available NANO: New American Notes Online: An Interdisciplinary Academic Journal for Big Ideas in a Small World. This special issue shows how both public and digital humanities research can be rendered more persuasive through engagement with cultures beyond the academy. More specifically, the aim of this special issue is to demonstrate how investments in technologies and computation are not necessarily antithetical to investments in critical theory and social justice.

  1. Human Computing, Virtual Humans and Artificial Imperfection

    NARCIS (Netherlands)

    Ruttkay, Z.M.; Reidsma, Dennis; Nijholt, Antinus; Quek, F.; Yang, Y.


    In this paper we raise the issue whether imperfections, characteristic of human-human communication, should be taken into account when developing virtual humans. We argue that endowing virtual humans with the imperfections of humans can help making them more ‘comfortable’ to interact with. That is,

  2. Human Capital, (Human) Capabilities and Higher Education (United States)

    Le Grange, L.


    In this article I initiate a debate into the (de)merits of human capital theory and human capability theory and discuss implications of the debate for higher education. Human capital theory holds that economic growth depends on investment in education and that economic growth is the basis for improving the quality of human life. Human capable…

  3. Humanizing Architecture

    DEFF Research Database (Denmark)

    Toft, Tanya Søndergaard


    The article proposes the urban digital gallery as an opportunity to explore the relationship between ‘human’ and ‘technology,’ through the programming of media architecture. It takes a curatorial perspective when proposing an ontological shift from considering media facades as visual spectacles...... agency and a sense of being by way of dematerializing architecture. This is achieved by way of programming the symbolic to provide new emotional realizations and situations of enlightenment in the public audience. This reflects a greater potential to humanize the digital in media architecture....

  4. Think Human

    DEFF Research Database (Denmark)

    Nielsen, Charlotte Marie Bisgaard


    The paper probes the background of the dire rhetoric of the Danish National Health Board’s 40 week anti-alcohol consumption campaign, in particular the model of communication implied by the campaign's strategy. Contrasting the campaign's strategy in 2011 with the results of evaluations of previous...... years' campaigns suggests that the theory of communication underlying the campaign has its basis in mechanical action rather than in human communication. The practice of 'Communication design' is investigated in relation to this metaphorical 'machine thinking' model of communication and contrasted...

  5. Human Factors Planning Guidelines (United States)


    To ensure human factors considerations are fully incorporated in the system : development, the Integrated Product Team (IPT) or Program Manager initiates a : Human Factors Program (HFP) that addresses the human performance and human : resource parame...

  6. The Digital Humanities as a Humanities Project (United States)

    Svensson, Patrik


    This article argues that the digital humanities can be seen as a humanities project in a time of significant change in the academy. The background is a number of scholarly, educational and technical challenges, the multiple epistemic traditions linked to the digital humanities, the potential reach of the field across and outside the humanities,…

  7. NATO Human View Architecture and Human Networks (United States)

    Handley, Holly A. H.; Houston, Nancy P.


    The NATO Human View is a system architectural viewpoint that focuses on the human as part of a system. Its purpose is to capture the human requirements and to inform on how the human impacts the system design. The viewpoint contains seven static models that include different aspects of the human element, such as roles, tasks, constraints, training and metrics. It also includes a Human Dynamics component to perform simulations of the human system under design. One of the static models, termed Human Networks, focuses on the human-to-human communication patterns that occur as a result of ad hoc or deliberate team formation, especially teams distributed across space and time. Parameters of human teams that effect system performance can be captured in this model. Human centered aspects of networks, such as differences in operational tempo (sense of urgency), priorities (common goal), and team history (knowledge of the other team members), can be incorporated. The information captured in the Human Network static model can then be included in the Human Dynamics component so that the impact of distributed teams is represented in the simulation. As the NATO militaries transform to a more networked force, the Human View architecture is an important tool that can be used to make recommendations on the proper mix of technological innovations and human interactions.

  8. Digital Humanities

    DEFF Research Database (Denmark)

    Nielsen, Hans Jørn


    overgangen fra trykkekultur til digital kultur. For det første problemstillingen omkring digitalisering af litterær kulturarv med fokus på kodning og tagging af teksten samt organisering i hypertekststrukturer. For det andet reorganiseringen af det digitale dokument i dataelementer og database. For det......Artiklen præsenterer først nogle generelle problemstillinger omkring Digital Humanities (DH) med det formål at undersøge dem nærmere i relation til konkrete eksempler på forskellige digitaliseringsmåder og ændringer i dokumentproduktion. I en nærmere afgrænsning vælger artiklen den tendens i DH......, der betragter DH som forbundet med "making" og "building" af digitale objekter og former. Dette kan også karakteriseres som DH som praktisk-produktiv vending. Artiklen har valgt tre typer af digitalisering. De er valgt ud fra, at de skal repræsentere forskellige måder at håndtere digitaliseringen på...

  9. Human Rhinoviruses (United States)

    Lamson, Daryl M.; St. George, Kirsten; Walsh, Thomas J.


    Human rhinoviruses (HRVs), first discovered in the 1950s, are responsible for more than one-half of cold-like illnesses and cost billions of dollars annually in medical visits and missed days of work. Advances in molecular methods have enhanced our understanding of the genomic structure of HRV and have led to the characterization of three genetically distinct HRV groups, designated groups A, B, and C, within the genus Enterovirus and the family Picornaviridae. HRVs are traditionally associated with upper respiratory tract infection, otitis media, and sinusitis. In recent years, the increasing implementation of PCR assays for respiratory virus detection in clinical laboratories has facilitated the recognition of HRV as a lower respiratory tract pathogen, particularly in patients with asthma, infants, elderly patients, and immunocompromised hosts. Cultured isolates of HRV remain important for studies of viral characteristics and disease pathogenesis. Indeed, whether the clinical manifestations of HRV are related directly to viral pathogenicity or secondary to the host immune response is the subject of ongoing research. There are currently no approved antiviral therapies for HRVs, and treatment remains primarily supportive. This review provides a comprehensive, up-to-date assessment of the basic virology, pathogenesis, clinical epidemiology, and laboratory features of and treatment and prevention strategies for HRVs. PMID:23297263

  10. Human Factors in Human-Systems Integration (United States)

    Fitts, David J.; Sandor, Aniko; Litaker, Harry L., Jr.; Tillman, Barry


    Any large organization whose mission is to design and develop systems for humans, and train humans needs a well-developed integration and process plan to deal with the challenges that arise from managing multiple subsystems. Human capabilities, skills, and needs must be considered early in the design and development process, and must be continuously considered throughout the development lifecycle. This integration of human needs within system design is typically formalized through a Human-Systems Integration (HSI) program. By having an HSI program, an institution or organization can reduce lifecycle costs and increase the efficiency, usability, and quality of its products because human needs have been considered from the beginning.

  11. Humane Education: An Overview. (United States)

    Whitlock, Eileen S.; Westerlund, Stuart R.

    This booklet traces the historical development of human education as it has been instilled into the young people of America from colonial times to the present and provides a future prognosis of humaneness in the schools. Humane education promotes humane behavior and is an important part of the humane movement in the United States, although until…

  12. Cockayne Syndrome group B protein stimulates NEIL2 DNA glycosylase activity

    DEFF Research Database (Denmark)

    Aamann, Maria Diget; Hvitby, Christina Poulsen; Popuri, Venkateswarlu


    Cockayne Syndrome is a segmental premature aging syndrome, which can be caused by loss of function of the CSB protein. CSB is essential for genome maintenance and has numerous interaction partners with established roles in different DNA repair pathways including transcription coupled nucleotide...

  13. Cockayne syndrome group B protein stimulates repair of formamidopyrimidines by NEIL1 DNA glycosylase

    DEFF Research Database (Denmark)

    Muftuoglu, Meltem; de Souza-Pinto, Nadja C; Dogan, Arin


    Cockayne syndrome (CS) is a premature aging condition characterized by sensitivity to UV radiation. However, this phenotype does not explain the progressive neurodegeneration in CS patients. It could be due to the hypersensitivity of CSB-deficient cells to oxidative stress. So far most studies...

  14. Listeria monocytogenes DNA glycosylase AdiP affects flagellar motility, biofilm formation, virulence, and stress responses (United States)

    The temperature-dependent alteration of flagellar motility gene expression is critical for the foodborne pathogen Listeria monocytogenes to respond to a changing environment. In this study, a genetic determinant, L. monocytogenes f2365_0220 (lmof2365_0220), encoding a putative protein that is struct...

  15. The NEIL glycosylases remove oxidized guanine lesions from telomeric and promoter quadruplex DNA structures


    Zhou, Jia; Fleming, Aaron M.; Averill, April M.; Burrows, Cynthia J.; Wallace, Susan S.


    G-quadruplex is a four-stranded G-rich DNA structure that is highly susceptible to oxidation. Despite the important roles that G-quadruplexes play in telomere biology and gene transcription, neither the impact of guanine lesions on the stability of quadruplexes nor their repair are well understood. Here, we show that the oxidized guanine lesions 8-oxo-7,8-dihydroguanine (8-oxoG), guanidinohydantoin (Gh) and spiroiminodihydantoin (Sp) reduce the thermostability and alter the folding of telomer...

  16. IVI human factors strategy (United States)


    This document focuses on human factors research that supports the Intelligent Vehicle Initiative (IVI). The status of the problem areas within categories used often by the human factors community to organize human factors process is discussed. A simi...

  17. Human Factors Job Aid (United States)


    The purpose of this Human Factors Job Aid is to serve as a desk reference for : human factors integration during system acquisition. The first chapter contains : an overview of the FAA human factors process in system acquisitions. The : remaining eig...

  18. The golden triangle of human dignity: human security, human development and human rights

    NARCIS (Netherlands)

    Gaay Fortman, B. de


    The success or failure of processes of democratization cannot be detached from processes of development related to the aspirations of people at the grassroots. Human rights, in a more theoretical terminology, require human development in order to enhance human security.

  19. Human-machine interactions (United States)

    Forsythe, J Chris [Sandia Park, NM; Xavier, Patrick G [Albuquerque, NM; Abbott, Robert G [Albuquerque, NM; Brannon, Nathan G [Albuquerque, NM; Bernard, Michael L [Tijeras, NM; Speed, Ann E [Albuquerque, NM


    Digital technology utilizing a cognitive model based on human naturalistic decision-making processes, including pattern recognition and episodic memory, can reduce the dependency of human-machine interactions on the abilities of a human user and can enable a machine to more closely emulate human-like responses. Such a cognitive model can enable digital technology to use cognitive capacities fundamental to human-like communication and cooperation to interact with humans.

  20. The human POLH gene is not mutated, and is expressed in a cohort of patients with basal or squamous cell carcinoma of the skin.

    LENUS (Irish Health Repository)

    Flanagan, Annabelle M


    Skin cancer, the most common cancer in the general population, is strongly associated with exposure to the ultraviolet component of sunlight. To investigate the relationship between DNA damage processing and skin tumour development, we determined the POLH status of a cohort of skin cancer patients. The human POLH gene encodes DNA polymerase eta (poleta), which normally carries out accurate translesion synthesis past the major UV-induced photoproduct, the dithymine cyclobutane dimer. In the absence of active poleta in xeroderma pigmentosum variant (XPV) patients, mutations accumulate at sites of UV-induced DNA damage, providing the initiating step in skin carcinogenesis. Forty patients diagnosed with skin cancer were genotyped for polymorphisms in the POLH protein-coding sequence, using glycosylase-mediated polymorphism detection (GMPD) and direct DNA sequencing of POLH PCR products derived from white blood cell genomic DNA. All individuals carried the wild-type POLH sequence. No POLH mutations were identified in genomic DNA from skin tumours derived from 15 of these patients. As determined by RT-PCR, POLH mRNA was expressed in all normal and skin tumour tissue examined. Poleta protein was also detectable by Western blotting, in two matched normal and skin tumour extracts. An alternatively spliced form of POLH mRNA, lacking exon 2, was more readily detected in skin tissue than in white blood cells from the same patient. Real-time PCR was used to quantify POLH expression in matched normal and skin tumour-derived mRNA from a series of patients diagnosed with either basal or squamous cell carcinoma. Compared to matched normal skin tissue from the same patient, 1 of 7 SCC, and 4 of 10 BCC tumours examined showed at least a 2-fold reduction in POLH expression, while 1 of 7 SCC, and 3 of 10 BCC tumours showed at least a 2-fold increase in POLH expression. Differences in gene expression, rather than sequence changes may be the main mechanism by which POLH status varies

  1. Special Section: Human Rights (United States)

    Frydenlund, Knut; And Others


    Eleven articles examine human rights in Europe. Topics include unemployment, human rights legislation, role of the Council of Europe in promoting human rights, labor unions, migrant workers, human dignity in industralized societies, and international violence. Journal available from Council of Europe, Directorate of Press and Information, 67006…

  2. ISS Payload Human Factors (United States)

    Ellenberger, Richard; Duvall, Laura; Dory, Jonathan


    The ISS Payload Human Factors Implementation Team (HFIT) is the Payload Developer's resource for Human Factors. HFIT is the interface between Payload Developers and ISS Payload Human Factors requirements in SSP 57000. ? HFIT provides recommendations on how to meet the Human Factors requirements and guidelines early in the design process. HFIT coordinates with the Payload Developer and Astronaut Office to find low cost solutions to Human Factors challenges for hardware operability issues.

  3. Human Dignity, Three Human Rights, and Pedagogy. (United States)

    Vandenberg, Donald


    A general theory of value is outlined to show that moral agency is necessary to human dignity and that liberty, equality, and fraternity are necessary to moral agency. These ideals can be implemented in schools and human dignity can be at the core of the professional ethics of teaching. (MT)

  4. Human dignity, bioethics, and human rights. (United States)

    Häyry, Matti; Takala, Tuija


    The authors analyse and assess the Universal Draft Declaration on Bioethics and Human Rights published by UNESCO. They argue that the Draft has two main weaknesses. It unnecessarily confines the scope of bioethics to life sciences and their practical applications. And it fails to spell out the intended role of human dignity in international ethical regulation.

  5. [Humanization in health care]. (United States)

    Oliveira, Beatriz Rosana Gonçalves de; Collet, Neusa; Viera, Cláudia Silveira


    This study aims to reflect on humanization in health care, recovering the history of understanding about mankind, the human and humanity, until humanization in humanity and health. We discuss the national humanization program in hospital care and reflect on this proposal and on the issue of humanization in Brazilian health care nowadays. Communication is indispensable to establish humanization, as well as technical and material conditions. Both users and health professionals need to be heard, building a network of dialogues to think and promote singular humanization actions. For this process to take effect, there is a need to involve the whole that makes up the health service. This group involves different professionals, such as managers, public policy makers, professional councils and education institutions.

  6. Metformin inhibits 7,12-dimethylbenz[a]anthracene-induced breast carcinogenesis and adduct formation in human breast cells by inhibiting the cytochrome P4501A1/aryl hydrocarbon receptor signaling pathway

    Energy Technology Data Exchange (ETDEWEB)

    Maayah, Zaid H. [Department of Pharmacology and Toxicology, College of Pharmacy, King Saud University, Riyadh 11451 (Saudi Arabia); Ghebeh, Hazem [Stem Cell & Tissue Re-Engineering, King Faisal Specialist Hospital and Research Center, Riyadh 11211 (Saudi Arabia); Alhaider, Abdulqader A. [Department of Pharmacology and Toxicology, College of Pharmacy, King Saud University, Riyadh 11451 (Saudi Arabia); Camel Biomedical Research Unit, College of Pharmacy and Medicine, King Saud University, Riyadh 11451 (Saudi Arabia); El-Kadi, Ayman O.S. [Faculty of Pharmacy & Pharmaceutical Sciences, University of Alberta, Edmonton (Canada); Soshilov, Anatoly A.; Denison, Michael S. [Department of Environmental Toxicology, University of California at Davis, Davis, CA 95616 (United States); Ansari, Mushtaq Ahmad [Department of Pharmacology and Toxicology, College of Pharmacy, King Saud University, Riyadh 11451 (Saudi Arabia); Korashy, Hesham M., E-mail: [Department of Pharmacology and Toxicology, College of Pharmacy, King Saud University, Riyadh 11451 (Saudi Arabia)


    Recent studies have established that metformin (MET), an oral anti-diabetic drug, possesses antioxidant activity and is effective against different types of cancer in several carcinogen-induced animal models and cell lines. However, whether MET can protect against breast cancer has not been reported before. Therefore, the overall objectives of the present study are to elucidate the potential chemopreventive effect of MET in non-cancerous human breast MCF10A cells and explore the underlying mechanism involved, specifically the role of cytochrome P4501A1 (CYP1A1)/aryl hydrocarbon receptor (AhR) pathway. Transformation of the MCF10A cells into initiated breast cancer cells with DNA adduct formation was conducted using 7,12-dimethylbenz[a]anthracene (DMBA), an AhR ligand. The chemopreventive effect of MET against DMBA-induced breast carcinogenesis was evidenced by the capability of MET to restore the induction of the mRNA levels of basic excision repair genes, 8-oxoguanine DNA glycosylase (OGG1) and apurinic/apyrimidinic endonuclease1 (APE1), and the level of 8-hydroxy-2-deoxyguanosine (8-OHdG). Interestingly, the inhibition of DMBA-induced DNA adduct formation was associated with proportional decrease in CYP1A1 and in NAD(P)H:quinone oxidoreductase 1 (NQO1) gene expression. Mechanistically, the involvements of AhR and nuclear factor erythroid 2-related factor-2 (Nrf2) in the MET-mediated inhibition of DMBA-induced CYP1A1 and NQO1 gene expression were evidenced by the ability of MET to inhibit DMBA-induced xenobiotic responsive element and antioxidant responsive element luciferase reporter gene expression which suggests an AhR- and Nrf2-dependent transcriptional control. However, the inability of MET to bind to AhR suggests that MET is not an AhR ligand. In conclusion, the present work shows a strong evidence that MET inhibits the DMBA-mediated carcinogenicity and adduct formation by inhibiting the expression of CYP1A1 through an AhR ligand-independent mechanism

  7. Global Law: Humanism and Human Rights

    Directory of Open Access Journals (Sweden)

    Leilane Serratine Grubba


    Full Text Available This article discusses the ideal of human rights before globalizatórios inflows. It begins with a general statement about the legal globalization, comparing it with the Global Law in the political and economic implications. Later, it approaches the ideal predicted with transnationalism. Proposes a reflection on the present Human Rights. Also, rethinks the lines of the complex web of Global Law, its institutions and its actors, which circulate between the public and private plans. There is no sense in space maintenance of the ideal of human rights only in the state or territory in international treaties originally linked to the states.

  8. Human Resource Accounting System (United States)

    Cerullo, Michael J.


    Main objectives of human resource accounting systems are to satisfy the informational demands made by investors and by operating managers. The paper's main concern is with the internal uses of a human asset system. (Author)

  9. Telling the Human Story. (United States)

    Richardson, Miles


    Proposes that one of the fundamental human attributes is telling stories. Explores the debate on whether Neanderthals possessed language ability. Discusses the role of the "human story" in teaching anthropology. (DH)

  10. Human Use Index (Future) (United States)

    U.S. Environmental Protection Agency — Human land uses may have major impacts on ecosystems, affecting biodiversity, habitat, air and water quality. The human use index (also known as U-index) is the...

  11. Human Use Index (United States)

    U.S. Environmental Protection Agency — Human land uses may have major impacts on ecosystems, affecting biodiversity, habitat, air and water quality. The human use index (also known as U-index) is the...

  12. Immunology Taught by Humans


    Davis, Mark M


    After a half-century of mouse-dominated research, human immunology is making a comeback. Informed by mouse studies and powered by new techniques, human immune research is both advancing disease treatment and providing new insights into basic biology.

  13. Human Papillomavirus (HPV) Screening (United States)

    ... Search Form Controls Cancel Submit Search The CDC Human Papillomavirus (HPV) Note: Javascript is disabled or is ... 6348 Email CDC-INFO U.S. Department of Health & Human Services HHS/Open TOP

  14. Human Papillomavirus (HPV) (United States)

    ... Listen Español Text Size Email Print Share HPV (Human Papillomavirus) Vaccine: What You Need to Know (VIS) ... Why get vaccinated? HPV vaccine prevents infection with human papillomavirus (HPV) types that are associated with many ...

  15. Human Papillomavirus (HPV) Vaccine (United States)

    Why get vaccinated?HPV vaccine prevents infection with human papillomavirus (HPV) types that are associated with cause ... at HPV Vaccine (Human Papillomavirus) Information Statement. U.S. Department of Health and ...

  16. Human Parainfluenza Viruses (United States)

    ... Search Form Controls Cancel Submit Search The CDC Human Parainfluenza Viruses (HPIVs) Note: Javascript is disabled or ... . Recommend on Facebook Tweet Share Compartir Human parainfluenza viruses (HPIVs) commonly cause respiratory illnesses in ...

  17. Human bites (image) (United States)

    Human bites present a high risk of infection. Besides the bacteria which can cause infection, there is ... the wound extends below the skin. Anytime a human bite has broken the skin, seek medical attention.

  18. HPV (Human Papillomavirus) (United States)

    ... Consumers Consumer Information by Audience For Women HPV (human papillomavirus) Share Tweet Linkedin Pin it More sharing ... Español In Chamorro In Urdu In Vietnamese HPV (human papillomavirus) is a sexually transmitted virus. It is ...

  19. Humane Education in Action. (United States)

    Savesky, Kathy


    Provides a brief history and description of a field test in the United States and Canada of the National Association for the Advancement of Humane Education's humane education curriculum guide for grades 1-6. (CS)

  20. The major role of human AP-endonuclease homolog Apn2 in repair of abasic sites in Schizosaccharomyces pombe


    Ribar, Balazs; Izumi, Tadahide; Mitra, Sankar


    The abasic (AP) sites, the major mutagenic and cytotoxic genomic lesions, induced directly by oxidative stress and indirectly after excision of damaged bases by DNA glycosylases, are repaired by AP-endonucleases (APEs). Among two APEs in Saccharomyces cerevisiae, Apn1 provides the major APE activity, and Apn2, the ortholog of the mammalian APE, provides back-up activity. We have cloned apn1 and apn2 genes of Schizosaccharomyces pombe, and have shown that inactivation of Apn2 and not Apn1 sens...

  1. Human papillomavirus molecular biology. (United States)

    Harden, Mallory E; Munger, Karl

    Human papillomaviruses are small DNA viruses with a tropism for squamous epithelia. A unique aspect of human papillomavirus molecular biology involves dependence on the differentiation status of the host epithelial cell to complete the viral lifecycle. A small group of these viruses are the etiologic agents of several types of human cancers, including oral and anogenital tract carcinomas. This review focuses on the basic molecular biology of human papillomaviruses. Copyright © 2016 Elsevier B.V. All rights reserved.

  2. Human Resource Management System


    Navaz, A. S. Syed; Fiaz, A. S. Syed; Prabhadevi, C.; Sangeetha, V.; Gopalakrishnan, S.


    The paper titled HUMAN RESOURCE MANAGEMENT SYSTEM is basically concerned with managing the Administrator of HUMAN RESOURCE Department in a company. A Human Resource Management System, refers to the systems and processes at the intersection between human resource management and information technology. It merges HRM as a discipline and in particular its basic HR activities and processes with the information technology field, whereas the programming of data processing systems evolved into standa...

  3. Has Human Evolution Stopped?

    Directory of Open Access Journals (Sweden)

    Alan R. Templeton


    Full Text Available It has been argued that human evolution has stopped because humans now adapt to their environment via cultural evolution and not biological evolution. However, all organisms adapt to their environment, and humans are no exception. Culture defines much of the human environment, so cultural evolution has actually led to adaptive evolution in humans. Examples are given to illustrate the rapid pace of adaptive evolution in response to cultural innovations. These adaptive responses have important implications for infectious diseases, Mendelian genetic diseases, and systemic diseases in current human populations. Moreover, evolution proceeds by mechanisms other than natural selection. The recent growth in human population size has greatly increased the reservoir of mutational variants in the human gene pool, thereby enhancing the potential for human evolution. The increase in human population size coupled with our increased capacity to move across the globe has induced a rapid and ongoing evolutionary shift in how genetic variation is distributed within and among local human populations. In particular, genetic differences between human populations are rapidly diminishing and individual heterozygosity is increasing, with beneficial health effects. Finally, even when cultural evolution eliminates selection on a trait, the trait can still evolve due to natural selection on other traits. Our traits are not isolated, independent units, but rather are integrated into a functional whole, so selection on one trait can cause evolution to occur on another trait, sometimes with mildly maladaptive consequences.

  4. International Human Rights Kit. (United States)

    Woito, Robert, Ed.

    Designed for students, educators, and citizens interested in human rights, the booklet presents resources for learning about the facts, perspectives, and existing procedures and institutions to promote human rights. Chapter one explores the relationship between human rights and war. Chapter two presents a self-survey to help readers clarify…

  5. Human Machine Learning Symbiosis (United States)

    Walsh, Kenneth R.; Hoque, Md Tamjidul; Williams, Kim H.


    Human Machine Learning Symbiosis is a cooperative system where both the human learner and the machine learner learn from each other to create an effective and efficient learning environment adapted to the needs of the human learner. Such a system can be used in online learning modules so that the modules adapt to each learner's learning state both…

  6. Humanities Review Journal

    African Journals Online (AJOL)

    Humanities Review Journal is published in June and December by Humanities Research Forum. The Journal publishes original, well-researched papers, review essays, interviews, resume, and commentaries, which offer new insights into the various disciplines in the Humanities. The focus is on issues about Africa.

  7. A Human Rights Glossary. (United States)

    Flowers, Nancy


    Presents a human rights glossary that includes definitions of basic terms, treaties, charters, and groups/organizations that have been featured in previous articles in this edition of "Update on Law-Related Education"; the human rights terms have been compiled as part of the celebration of the Universal Declaration of Human Rights…

  8. Esprit: A Humanities Magazine. (United States)

    Parker, Donald G.; Capella, Barry John

    In March 1984, the first issue of "Esprit," a semi-annual humanities magazine for the 56 two-year colleges in New York State, was published. The magazine seeks to confront the apparent decline of student interest in the humanities, community doubts about the relevance of the humanities, and the seeming indifference to the special truths…

  9. Visible Human Project (United States)

    ... NLM Mobile Gallery Site Navigation Home The Visible Human Project ® Overview The Visible Human Project ® is an outgrowth of the NLM's 1986 ... dimensional representations of the normal male and female human bodies. Acquisition of transverse CT, MR and cryosection ...

  10. Modeling Human Leukemia Immunotherapy in Humanized Mice

    Directory of Open Access Journals (Sweden)

    Jinxing Xia


    Full Text Available The currently available human tumor xenograft models permit modeling of human cancers in vivo, but in immunocompromised hosts. Here we report a humanized mouse (hu-mouse model made by transplantation of human fetal thymic tissue plus hematopoietic stem cells transduced with a leukemia-associated fusion gene MLL-AF9. In addition to normal human lymphohematopoietic reconstitution as seen in non-leukemic hu-mice, these hu-mice showed spontaneous development of B-cell acute lymphoblastic leukemia (B-ALL, which was transplantable to secondary recipients with an autologous human immune system. Using this model, we show that lymphopenia markedly improves the antitumor efficacy of recipient leukocyte infusion (RLI, a GVHD-free immunotherapy that induces antitumor responses in association with rejection of donor chimerism in mixed allogeneic chimeras. Our data demonstrate the potential of this leukemic hu-mouse model in modeling leukemia immunotherapy, and suggest that RLI may offer a safe treatment option for leukemia patients with severe lymphopenia.

  11. From Human Past to Human Future

    Directory of Open Access Journals (Sweden)

    Robert G. Bednarik


    Full Text Available This paper begins with a refutation of the orthodox model of final Pleistocene human evolution, presenting an alternative, better supported account of this crucial phase. According to this version, the transition from robust to gracile humans during that period is attributable to selective breeding rather than natural selection, rendered possible by the exponential rise of culturally guided volitional choices. The rapid human neotenization coincides with the development of numerous somatic and neural detriments and pathologies. Uniformitarian reasoning based on ontogenic homology suggests that the cognitive abilities of hominins are consistently underrated in the unstable orthodoxies of Pleistocene archaeology. A scientifically guided review establishes developmental trajectories defining recent changes in the human genome and its expressions, which then form the basis of attempts to extrapolate from them into the future. It is suggested that continuing and perhaps accelerating unfavorable genetic changes to the human species, rather than existential threats such as massive disasters, pandemics, or astrophysical events, may become the ultimate peril of humanity.

  12. Human Beings And Water


    Pakpahan, Putra Andika


    The writer of this paper on this writing is talking about the human beings and water. Water is one of the very fundamentally things that human beings need to keep their lives. Human beings sometimes do not realise that the water is very important for them because they actually cannot live their lives without the present of water. Human beings can keep their lives without rice, but cannot without water. For instances the use of water for human beings are domestic use, cooking, washing, bathing...

  13. Rethinking medical humanities. (United States)

    Chiapperino, Luca; Boniolo, Giovanni


    This paper questions different conceptions of Medical Humanities in order to provide a clearer understanding of what they are and why they matter. Building upon former attempts, we defend a conception of Medical Humanities as a humanistic problem-based approach to medicine aiming at influencing its nature and practice. In particular, we discuss three main conceptual issues regarding the overall nature of this discipline: (i) a problem-driven approach to Medical Humanities; (ii) the need for an integration of Medical Humanities into medicine; (iii) the methodological requirements that could render Medical Humanities an effective framework for medical decision-making.

  14. Situating Human Sexual Conditioning. (United States)

    Hoffmann, Heather


    Conditioning is often thought of as a basic, automatic learning process that has limited applicability to higher-level human behavior. In addition, conditioning is seen as separable from, and even secondary to, "innate" processes. These ideas involve some misconceptions. The aim of this article is to provide a clearer, more refined sense of human sexual conditioning. After providing some background information and reviewing what is known from laboratory conditioning studies, human sexual conditioning is compared to sexual conditioning in nonhumans, to "innate" sexual responding, and to other types of human learning processes. Recommendations for moving forward in human sexual conditioning research are included.

  15. Integrated Environmental Modelling: human decisions, human challenges (United States)

    Glynn, Pierre D.


    Integrated Environmental Modelling (IEM) is an invaluable tool for understanding the complex, dynamic ecosystems that house our natural resources and control our environments. Human behaviour affects the ways in which the science of IEM is assembled and used for meaningful societal applications. In particular, human biases and heuristics reflect adaptation and experiential learning to issues with frequent, sharply distinguished, feedbacks. Unfortunately, human behaviour is not adapted to the more diffusely experienced problems that IEM typically seeks to address. Twelve biases are identified that affect IEM (and science in general). These biases are supported by personal observations and by the findings of behavioural scientists. A process for critical analysis is proposed that addresses some human challenges of IEM and solicits explicit description of (1) represented processes and information, (2) unrepresented processes and information, and (3) accounting for, and cognizance of, potential human biases. Several other suggestions are also made that generally complement maintaining attitudes of watchful humility, open-mindedness, honesty and transparent accountability. These suggestions include (1) creating a new area of study in the behavioural biogeosciences, (2) using structured processes for engaging the modelling and stakeholder communities in IEM, and (3) using ‘red teams’ to increase resilience of IEM constructs and use.

  16. Oxytocin and Human Evolution. (United States)

    Carter, C Sue


    A small, but powerful neuropeptide, oxytocin coordinates processes that are central to both human reproduction and human evolution. Also embedded in the evolution of the human nervous system are unique pathways necessary for modern human sociality and cognition. Oxytocin is necessary for facilitating the birth process, especially in light of anatomical restrictions imposed by upright human locomotion, which depends on a fixed pelvis. Oxytocin, by facilitating birth, allowed the development of a large cortex and a protective bony cranium. The complex human brain in turn permitted the continuing emergence of social sensitivity, complex thinking, and language. After birth is complete, oxytocin continues to support human development by providing direct nutrition, in the form of human milk, and emotional and intellectual support through high levels of maternal behavior and selective attachment. Oxytocin also encourages social sensitivity and reciprocal attunement, on the part of both the mother and child, which are necessary for human social behavior and for rearing an emotionally healthy human child. Oxytocin supports growth during development, resilience, and healing across the lifespan. Oxytocin dynamically moderates the autonomic nervous system, and effects of oxytocin on vagal pathways allowing high levels of oxygenation and digestion necessary to support adaptation in a complex environment. Finally, oxytocin has anti-oxidant and anti-inflammatory effects, helping to explain the pervasive adaptive consequences of social behavior for emotional and physical health.

  17. Human Capital and Sustainability

    Directory of Open Access Journals (Sweden)

    Garry Jacobs


    Full Text Available A study of sustainability needs to consider the role of all forms of capital—natural, biological, social, technological, financial, cultural—and the complex ways in which they interact. All forms of capital derive their value, utility and application from human mental awareness, creativity and social innovation. This makes human capital, including social capital, the central determinant of resource productivity and sustainability. Humanity has entered the Anthropocene Epoch in which human changes have become the predominant factor in evolution. Humanity is itself evolving from animal physicality to social vitality to mental individuality. This transition has profound bearing on human productive capabilities, adaptability, creativity and values, the organization of economy, public policy, social awareness and life styles that determine sustainability. This article examines the linkages between population, economic development, employment, education, health, social equity, cultural values, energy intensity and sustainability in the context of evolving human consciousness. It concludes that development of human capital is the critical determinant of long-term sustainability and that efforts to accelerate the evolution of human consciousness and emergence of mentally self-conscious individuals will be the most effective approach for ensuring a sustainable future. Education is the primary lever. Human choice matters.

  18. Humanities, Digital Humanities, Media studies, Internet studies

    DEFF Research Database (Denmark)

    Brügger, Niels

    Todays expanding digital landscape constitutes an important research object as well as the research environment for the Humanities at the beginning of the 21st century. Taking this state of affairs as a starting point this inaugural lecture presents a vision for how the digital affects the interp......Todays expanding digital landscape constitutes an important research object as well as the research environment for the Humanities at the beginning of the 21st century. Taking this state of affairs as a starting point this inaugural lecture presents a vision for how the digital affects...... the interplay between four areas which until now to a certain extent have been separated: Traditional Hu- manities, Digital Humanities, Media studies, and Internet studies. The vision is followed by an outline of how it can be unfolded in concrete activities, in the form of research projects, research...

  19. Human Performance in Space (United States)

    Jones, Patricia M.; Fiedler, Edna


    Human factors is a critical discipline for human spaceflight. Nearly every human factors research area is relevant to space exploration -- from the ergonomics of hand tools used by astronauts, to the displays and controls of a spacecraft cockpit or mission control workstation, to levels of automation designed into rovers on Mars, to organizational issues of communication between crew and ground. This chapter focuses more on the ways in which the space environment (especially altered gravity and the isolated and confined nature of long-duration spaceflight) affects crew performance, and thus has specific novel implications for human factors research and practice. We focus on four aspects of human performance: neurovestibular integration, motor control and musculo-skeletal effects, cognitive effects, and behavioral health. We also provide a sampler of recent human factors studies from NASA.

  20. Bursty human dynamics

    CERN Document Server

    Karsai, Márton; Kaski, Kimmo


    This book provides a comprehensive overview on emergent bursty patterns in the dynamics of human behaviour. It presents common and alternative understanding of the investigated phenomena, and points out open questions worthy of further investigations. The book is structured as follows. In the introduction the authors discuss the motivation of the field, describe bursty phenomena in case of human behaviour, and relate it to other disciplines. The second chapter addresses the measures commonly used to characterise heterogeneous signals, bursty human dynamics, temporal paths, and correlated behaviour. These definitions are first introduced to set the basis for the discussion of the third chapter about the observations of bursty human patterns in the dynamics of individuals, dyadic interactions, and collective behaviour. The subsequent fourth chapter discusses the models of bursty human dynamics. Various mechanisms have been proposed about the source of the heterogeneities in human dynamics, which leads to the in...

  1. Outsourcing in Human Resource


    Oliver Pamelan


    The research paper aimed to contribute to the literature of Human Resource Management Planning and employment through the widely used function of the outsourcing human resource. The research paper is based on the description of the process of outsourcing with the reference to the theories of outsourcing management activities. It also explained the effects of this function through measuring the benefits and drawbacks of the outsourcing human resource while planning the employment strategies. T...

  2. The Humanities Matter! Infographic


    Terras, M. M.; Priego, E.; Liu, A.; Rockwell, G.; Sinclair, S.; Henseler, C.; Thomas, L.


    The Humanities are academic disciplines that seek to understand and interpret the human experience, from individuals to entire cultures, engaging in the discovery, preservation, and communication of the past and present record to enable a deeper understanding of contemporary society. The Humanities encompass literature, classics, ancient and modern languages, history, philoso - phy, media studies, the fine and performing arts, and other related subjects. It can be a challenge to show the bene...

  3. Human Resource Planning


    Lache Cãtãlina


    The objective of human resource planning is to adapt the human capital needed to develop the enterprises’ activities and to accomplish their priority objectives on the medium and/or short term. Human resource planning is a dynamic activity, time being an essential variable, both in what regards the quantitative side (adapting the number of jobs according to the organisation’s evolution in time) and the qualitative side (harmonising the jobs’ complexity with technological changes). The quantit...

  4. Crimes against humanity


    Podlahová, Veronika


    57 Resumé "Crimes against humanity" (the thesis title) Crimes against humanity constitute one of the three integral parts of "crimes under international law." At the same time they represent the most severe form of infringement of fundamental human rights that are as the principle value protected by the international community and its peremptory rules. Although these crimes have not emerged during the 20th century for the first time, it was the World War II., which established the term "crime...

  5. Modern Human Capital Management


    Feldberger, Madita


    Title: Modern Human Capital Management Seminar date: 30th of May 2008 Course: Master thesis in Business Administration, 15 ECTS Authors: Madita Feldberger Supervisor: Lars Svensson Keywords: Human capital, SWOT Analysis, Strategic Map, Balanced Scorecard Research Problem: Despite of the success of Human Capital Management (HCM) in research it did not arrive yet in the HR departments of many companies. Numerous firms even have problems to set their strategic goals with focus on HR. The HR Bala...

  6. Human hemoglobin genetics

    Energy Technology Data Exchange (ETDEWEB)

    Honig, G.R.; Adams, J.G.


    This book contains the following 10 chapters: Introduction; The Human Hemoglobins; The Human Globin Genes; Hemoglobin Synthesis and Globin Gene Expression; The Globin Gene Mutations - A. Mechanisms and Classification; The Globin Gene Mutations - B. Their Phenotypes and Clinical Expression; The Genetics of the Human Globin Gene Loci: Formal Genetics and Gene Linkage; The Geographic Distribution of Globin Gene Variation; Labortory Identification, Screening, Education, and Counseling for Abnormal Hemoglobins and Thalassemias; and Approaches to the Treatment of the Hemoglobin Disorders.

  7. Human Performance Research Center (United States)

    Federal Laboratory Consortium — Biochemistry:Improvements in energy metabolism, muscular strength and endurance capacity have a basis in biochemical and molecular adaptations within the human body....

  8. Human cloning 2001. (United States)

    Healy, David L; Weston, Gareth; Pera, Martin F; Rombauts, Luk; Trounson, Alan O


    This review summaries human cloning from a clinical perspective. Natural human clones, that is, monozygotic twins, are increasing in the general community. Iatrogenic human clones have been produced for decades in infertile couples given fertility treatment such as ovulation induction. A clear distinction must be made between therapeutic cloning using embryonic stem cells and reproductive cloning attempts. Unlike the early clinical years of in vitro fertilization, with cloning there is no animal model that is safe and dependable. Until there is such a model, 'Dolly'-style human cloning is medically unacceptable.

  9. Robotics for Human Exploration (United States)

    Fong, Terrence; Deans, Mathew; Bualat, Maria


    Robots can do a variety of work to increase the productivity of human explorers. Robots can perform tasks that are tedious, highly repetitive or long-duration. Robots can perform precursor tasks, such as reconnaissance, which help prepare for future human activity. Robots can work in support of astronauts, assisting or performing tasks in parallel. Robots can also perform "follow-up" work, completing tasks designated or started by humans. In this paper, we summarize the development and testing of robots designed to improve future human exploration of space.

  10. [Human physiology: kidney]. (United States)

    Natochin, Iu V


    The content of human physiology as an independent part of current physiology is discussed. Substantiated is the point that subjects of human physiology are not only special sections of physiology where functions are inherent only in human (physiology of intellectual activity, speech, labor, sport), but also in peculiarities of functions, specificity of regulation of each of physiological systems. By the example of physiology of kidney and water-salt balance there are shown borders of norm, peculiarities of regulation in human, new chapters of renal physiology which have appeared in connection with achievements of molecular physiology.

  11. Challenges for Virtual Humans in Human Computing

    NARCIS (Netherlands)

    Reidsma, Dennis; Ruttkay, Z.M.; Huang, T; Nijholt, Antinus; Pantic, Maja; Pentland, A.

    The vision of Ambient Intelligence (AmI) presumes a plethora of embedded services and devices that all endeavor to support humans in their daily activities as unobtrusively as possible. Hardware gets distributed throughout the environment, occupying even the fabric of our clothing. The environment


    African Journals Online (AJOL)

    Objectives To determine whether raised levels of serum Beta -HCG) are associated with higher grade and Human Chorionic Gonadotrophin ( -HCG in higher category tumors and whether in patients with raised levels of -HCG their sera the rise (above normal range) and the fall (to normal) in levels would correspond with ...

  13. Developing Human Resources through Actualizing Human Potential (United States)

    Clarken, Rodney H.


    The key to human resource development is in actualizing individual and collective thinking, feeling and choosing potentials related to our minds, hearts and wills respectively. These capacities and faculties must be balanced and regulated according to the standards of truth, love and justice for individual, community and institutional development,…

  14. Skin and the non-human human

    DEFF Research Database (Denmark)

    Rösing, Lilian Munk


    ) article 'Visualizing the mind: Looking at Titian's Flaying of Marsyas', addressing features of the painting not commented on by Hart, and supplementing Hart's (Kleinian) theoretical frame by involving Didier Anzieu's 'skin ego', Slavoj Zizek's concept of the 'non-human', Giorgio Agamben's term...

  15. Human Resource Accounting (United States)

    Woodruff, Robert L., Jr.


    An interview is reported which discussed the implications for the hiring, recruiting, screening and development of employees in the light of human resource accounting, here defined as the identification, accumulation and dissemination of information about human resources in dollar terms. (SA)

  16. Human-centred Governance

    DEFF Research Database (Denmark)

    Bason, Christian


    Design approaches are now being applied all over the world as a powerful approach to innovating public policies and services. Christian Bason, author of Leading public design: Discovering human-centred governance, argues that by bringing design methods into play, public managers can lead change...... with citizens at the centre, and discover a new model for steering public organisations: human-centred governance....

  17. Human Mind Maps (United States)

    Glass, Tom


    When students generate mind maps, or concept maps, the maps are usually on paper, computer screens, or a blackboard. Human Mind Maps require few resources and little preparation. The main requirements are space where students can move around and a little creativity and imagination. Mind maps can be used for a variety of purposes, and Human Mind…

  18. Dynamics of human movement

    NARCIS (Netherlands)

    Koopman, Hubertus F.J.M.


    The part of (bio)mechanics that studies the interaction of forces on the human skeletal system and its effect on the resulting movement is called rigid body dynamics. Some basic concepts are presented: A mathematical formulation to describe human movement and how this relates on the mechanical loads

  19. Biodemography of human ageing

    DEFF Research Database (Denmark)

    Vaupel, James W


    Human senescence has been delayed by a decade. This finding, documented in 1994 and bolstered since, is a fundamental discovery about the biology of human ageing, and one with profound implications for individuals, society and the economy. Remarkably, the rate of deterioration with age seems...

  20. the human genome project

    African Journals Online (AJOL)


    have resulted in the biological diversity, both past and present, on this planet. RAJ RAMESAR. MSc, PhD. Professor and Head. Division of Human Genetics. Faculty of Health Sciences. University of Cape Town. Raj Ramesar serves as Director of the MRC. Human Genetics Research Unit and. CANSA's Colorectal Cancer ...

  1. Translating the human microbiome

    NARCIS (Netherlands)

    Brown, J.; Vos, de W.M.; Distefano, P.S.; Doré, J.; Huttenhower, C.; Knight, R.; Lawley, T.D.; Raes, J.; Turnbaugh, P.


    Over the past decade, an explosion of descriptive analyses from initiatives, such as the Human Microbiome Project (HMP) and the MetaHIT project, have begun to delineate the human microbiome. Inhabitants of the intestinal tract, nasal passages, oral cavities, skin, gastrointestinal tract and

  2. Damping Effect of Humans

    DEFF Research Database (Denmark)

    Pedersen, Lars

    Passive humans (sitting or standing) might well be present on flooring-systems, footbridges or other structures that carry humans. An active croud of people might generate structural vibrations, and these might be problematic. The passive crowd of people, however, will interact with the structura...

  3. Evaluating the Humanities (United States)

    Brody, Howard


    How can one measure the value of teaching the humanities? The problem of assessment and accountability is prominent today, of course, in secondary and higher education. It is perhaps even more acute for those who teach the humanities in nontraditional settings, such as medical and other professional schools. The public assumes that academes can…

  4. The Humanities' Value (United States)

    Harpham, Geoffrey Galt


    Why should society support the humanities when so many people are suffering from the effects of the economic crisis? What claim do the humanities, or scholarship generally, have on increasingly limited resources? Shouldn't such pursuits be considered luxuries at a time when people should be focusing on essentials? The alleviation of human…

  5. Manage "Human Capital" Strategically (United States)

    Odden, Allan


    To strategically manage human capital in education means restructuring the entire human resource system so that schools not only recruit and retain smart and capable individuals, but also manage them in ways that support the strategic directions of the organization. These management practices must be aligned with a district's education improvement…

  6. Incorporating Human Interindividual Biotransformation ... (United States)

    The protection of sensitive individuals within a population dictates that measures other than central tendencies be employed to estimate risk. The refinement of human health risk assessments for chemicals metabolized by the liver to reflect data on human variability can be accomplished through (1) the characterization of enzyme expression in large banks of human liver samples, (2) the employment of appropriate techniques for the quantification and extrapolation of metabolic rates derived in vitro, and (3) the judicious application of physiologically based pharmacokinetic (PBPK) modeling. While in vitro measurements of specific biochemical reactions from multiple human samples can yield qualitatively valuable data on human variance, such measures must be put into the perspective of the intact human to yield the most valuable predictions of metabolic differences among humans. For quantitative metabolism data to be the most valuable in risk assessment, they must be tied to human anatomy and physiology, and the impact of their variance evaluated under real exposure scenarios. For chemicals metabolized in the liver, the concentration of parent chemical in the liver represents the substrate concentration in the MichaelisMenten description of metabolism. Metabolic constants derived in vitro may be extrapolated to the intact liver, when appropriate conditions are met. Metabolic capacity Vmax; the maximal rate of the reaction) can be scaled directly to the concentration

  7. Damping Effect of Humans

    DEFF Research Database (Denmark)

    Pedersen, Lars

    Passive humans (sitting or standing) might well be present on flooring-systems, footbridges or other structures that carry humans. An active croud of people might generate structural vibrations, and these might be problematic. The passive crowd of people, however, will interact with the structural...


    African Journals Online (AJOL)

    Emmanuel Ameh

    Abstract. An up-to-date review on human paragonimiasis in Africa was carried out to determine the current geographical distribution of human cases and analyze the animal reservoir, snails and crustaceans which intervene in the local life cycle of Paragonimus species. Two countries, i.e., Cameroon and. Nigeria, were ...

  9. Human Rights, History of

    NARCIS (Netherlands)

    de Baets, Antoon; Wright, James


    In this article, six basic debates about human rights are clarified from a historical perspective: the origin of human rights as moral rights connected to the natural law doctrine and opposed to positive rights; the wave of criticism of their abstract and absolute character by nineteenth-century

  10. Modeling human color categorization

    NARCIS (Netherlands)

    van den Broek, Egon; Schouten, Th.E.; Kisters, P.M.F.

    A unique color space segmentation method is introduced. It is founded on features of human cognition, where 11 color categories are used in processing color. In two experiments, human subjects were asked to categorize color stimuli into these 11 color categories, which resulted in markers for a

  11. Fungi that Infect Humans. (United States)

    Köhler, Julia R; Hube, Bernhard; Puccia, Rosana; Casadevall, Arturo; Perfect, John R


    Fungi must meet four criteria to infect humans: growth at human body temperatures, circumvention or penetration of surface barriers, lysis and absorption of tissue, and resistance to immune defenses, including elevated body temperatures. Morphogenesis between small round, detachable cells and long, connected cells is the mechanism by which fungi solve problems of locomotion around or through host barriers. Secretion of lytic enzymes, and uptake systems for the released nutrients, are necessary if a fungus is to nutritionally utilize human tissue. Last, the potent human immune system evolved in the interaction with potential fungal pathogens, so few fungi meet all four conditions for a healthy human host. Paradoxically, the advances of modern medicine have made millions of people newly susceptible to fungal infections by disrupting immune defenses. This article explores how different members of four fungal phyla use different strategies to fulfill the four criteria to infect humans: the Entomophthorales, the Mucorales, the Ascomycota, and the Basidiomycota. Unique traits confer human pathogenic potential on various important members of these phyla: pathogenic Onygenales comprising thermal dimorphs such as Histoplasma and Coccidioides; the Cryptococcus spp. that infect immunocompromised as well as healthy humans; and important pathogens of immunocompromised patients-Candida, Pneumocystis, and Aspergillus spp. Also discussed are agents of neglected tropical diseases important in global health such as mycetoma and paracoccidiomycosis and common pathogens rarely implicated in serious illness such as dermatophytes. Commensalism is considered, as well as parasitism, in shaping genomes and physiological systems of hosts and fungi during evolution.

  12. Businesses’ human rights responsibilities

    Directory of Open Access Journals (Sweden)

    Corinne Lewis


    Full Text Available There is no international human rights law standard that expresslyprohibits businesses’ arbitrary displacement of persons. Businessesdo, however, have the responsibility to avoid infringements of humanrights that could lead to displacement and also to take actions toremedy their human rights violations that might lead to displacement.

  13. Global Journal of Humanities

    African Journals Online (AJOL)

    Journal Homepage Image. Global Journal of Humanities is aimed at promoting reasearch in all areas of Humanities including philosophy, languages, linguistics, literature, history, fine/applied arts, theater arts, architecture, etc. Visit the Global Journal Series website here: ...

  14. Human Granulocytic Anaplasmosis, Japan (United States)

    Gaowa; Wuritu; Kawamori, Fumihiko; Wu, Dongxing; Yoshikawa, Yuko; Chiya, Seizou; Fukunaga, Kazutoshi; Funato, Toyohiko; Shiojiri, Masaaki; Nakajima, Hideki; Hamauzu, Yoshiji; Takano, Ai; Kawabata, Hiroki; Ando, Shuji; Kishimoto, Toshio


    We retrospectively confirmed 2 cases of human Anaplasma phagocytophilum infection. Patient blood samples contained unique p44/msp2 for the pathogen, and antibodies bound to A. phagocytophilum antigens propagated in THP-1 rather than HL60 cells. Unless both cell lines are used for serodiagnosis of rickettsiosis-like infections, cases of human granulocytic anaplasmosis could go undetected. PMID:23460988

  15. Humane Education Projects Handbook. (United States)

    Junior League of Ogden, UT.

    This handbook was developed to promote interest in humane education and to encourage the adoption of humane education projects. Although specifically designed to assist Junior Leagues in developing such projects, the content should prove valuable to animal welfare organizations, zoos, aquariums, nature centers, and other project-oriented groups…

  16. Human migraine models

    DEFF Research Database (Denmark)

    Iversen, Helle Klingenberg


    , which is a human experience. A set-up for investigations of experimental headache and migraine in humans, has been evaluated and headache mechanisms explored by using nitroglycerin and other headache-inducing agents. Nitric oxide (NO) or other parts of the NO activated cascade seems to be responsible...

  17. Overophedning af det humane

    DEFF Research Database (Denmark)

    Larsen, Steen Nepper


    Anmelder Marius Gudmand-Høyer, Sverre Raffnsøe og Morten Raffnsøe-Møller (red.): "Den humane vending. En antologi", Aarhus Universitetsforlag......Anmelder Marius Gudmand-Høyer, Sverre Raffnsøe og Morten Raffnsøe-Møller (red.): "Den humane vending. En antologi", Aarhus Universitetsforlag...

  18. Cell cycle-specific UNG2 phosphorylations regulate protein turnover, activity and association with RPA

    DEFF Research Database (Denmark)

    Hagen, Lars; Kavli, Bodil; Sousa, Mirta M L


    Human UNG2 is a multifunctional glycosylase that removes uracil near replication forks and in non-replicating DNA, and is important for affinity maturation of antibodies in B cells. How these diverse functions are regulated remains obscure. Here, we report three new phosphoforms of the non-cataly...

  19. The Human Technology

    DEFF Research Database (Denmark)

    Fausing, Bent

     Bent Fausing  "The Humane Technology", abstract (for The Two Cultures: Balancing Choices and Effects Oxford University July 20-26, 2008). The paper will investigate the use of technology in everyday aesthetics such as TV-commercials for mobile phones for Nokia, which slogan is, as it is well known...... for as a better humanity.      The paper will investigate how the two cultures are combined in this way in a TV-commercial. Technology points, is the conclusion, towards a forgotten pre-human and not to the often-motioned post-human condition.    ......, "Nokia - connecting people". Which function does this technology get in narratives, images, interactions and affects here?      The mobile phone and its digital camera are depicted as being able to make a unique human presence and interaction. The medium, the technology is a necessary helper to get...

  20. Humanity at the Edge

    DEFF Research Database (Denmark)

    Svendsen, Mette N.; Gjødsbøl, Iben M.; Dam, Mie S.


    At the heart of anthropology and the social sciences lies a notion of human existence according to which humans and animals share the basic need for food, but only humans have the capacity for morality. Based on fieldwork in a pig laboratory, a neonatal intensive care unit (NICU), and a dementia...... nursing home, we follow practices of feeding precarious lives lacking most markers of human personhood, including the exercise of moral judgment. Despite the absence of such markers, laboratory researchers and caregivers in these three sites do not abstain from engaging in questions about the moral status...... of the piglets, infants, and people with dementia in their care. They continually negotiate how their charges belong to the human collectivity and thereby challenge the notion of ‘the human’ that is foundational to anthropology. Combining analytical approaches that do not operate with a fixed boundary between...

  1. Refractoriness in human atria

    DEFF Research Database (Denmark)

    Skibsbye, Lasse; Jespersen, Thomas; Christ, Torsten


    rhythm and chronic atrial fibrillation tissues and was neither affected by changes in frequency (1 vs. 3Hz). CONCLUSIONS: Our results suggest a preferentially voltage-dependent, rather than time-dependent, effect with respect to refractoriness at physiologically relevant rates in human atria. However...... drugs. Cardiomyocyte excitability depends on availability of sodium channels, which involves both time- and voltage-dependent recovery from inactivation. This study therefore aims to characterise how sodium channel inactivation affects refractoriness in human atria. METHODS AND RESULTS: Steady......-state activation and inactivation parameters of sodium channels measured in vitro in isolated human atrial cardiomyocytes were used to parameterise a mathematical human atrial cell model. Action potential data were acquired from human atrial trabeculae of patients in either sinus rhythm or chronic atrial...

  2. Human gliomas contain morphine

    DEFF Research Database (Denmark)

    Olsen, Peter; Rasmussen, Mads; Zhu, Wei


    BACKGROUND: Morphine has been found in cancer cell lines originating from human and animal cells. Thus, it became important to demonstrate whether or not actual tumours contain this opiate alkaloid. MATERIAL/METHODS: Human glioma tissues were biochemically treated to isolate and separate endogeno...... of the solutions used in the study nor was it present as a residual material in blank HPLC runs. CONCLUSIONS: Morphine is present in human gliomas, suggesting that it may exert an action that effects tumour physiology/pathology.......BACKGROUND: Morphine has been found in cancer cell lines originating from human and animal cells. Thus, it became important to demonstrate whether or not actual tumours contain this opiate alkaloid. MATERIAL/METHODS: Human glioma tissues were biochemically treated to isolate and separate endogenous...

  3. The human cell atlas

    DEFF Research Database (Denmark)

    Regev, Aviv; Teichmann, Sarah A.; Lander, Eric S.


    The recent advent of methods for high-throughput single-cell molecular profiling has catalyzed a growing sense in the scientific community that the time is ripe to complete the 150-year-old effort to identify all cell types in the human body. The Human Cell Atlas Project is an international...... collaborative effort that aims to define all human cell types in terms of distinctive molecular profiles (such as gene expression profiles) and to connect this information with classical cellular descriptions (such as location and morphology). An open comprehensive reference map of the molecular state of cells...... in healthy human tissues would propel the systematic study of physiological states, developmental trajectories, regulatory circuitry and interactions of cells, and also provide a framework for understanding cellular dysregulation in human disease. Here we describe the idea, its potential utility, early...

  4. Designing Human Technologies

    DEFF Research Database (Denmark)

    Simonsen, Jesper

    Design is increasingly becoming a part of the university curriculum and research agenda. The keynote present and discuss Designing Human Technologies – an initiative aiming at establishing a design oriented main subject area alongside traditional main subject areas such as Natural Science......, the Humanities, and Social Science. The initiative broadens the perspective of IS and recognize reflections on aesthetics, ethics, values, connections to politics, and strategies for enabling a better future as legitimate parts of the research agenda. Designing Human Technologies is a design-oriented Strategic...... Research Initiative supporting Roskilde University’s new Humanities and Technology bachelor programme (‘HumTek’), and its three dimensions: Design, Humanities, and Technology. The research initiative involves 70 researchers from different departments and research groups at Roskilde University through...

  5. Human Milk Banking. (United States)

    Haiden, Nadja; Ziegler, Ekhard E


    Human milk banks play an essential role by providing human milk to infants who would otherwise not be able to receive human milk. The largest group of recipients are premature infants who derive very substantial benefits from it. Human milk protects premature infants from necrotizing enterocolitis and from sepsis, two devastating medical conditions. Milk banks collect, screen, store, process, and distribute human milk. Donating women usually nurse their own infants and have a milk supply that exceeds their own infants' needs. Donor women are carefully selected and are screened for HIV-1, HIV-2, human T-cell leukemia virus 1 and 2, hepatitis B, hepatitis C, and syphilis. In the milk bank, handling, storing, processing, pooling, and bacterial screening follow standardized algorithms. Heat treatment of human milk diminishes anti-infective properties, cellular components, growth factors, and nutrients. However, the beneficial effects of donor milk remain significant and donor milk is still highly preferable in comparison to formula. © 2017 S. Karger AG, Basel.

  6. Human Power Empirically Explored

    Energy Technology Data Exchange (ETDEWEB)

    Jansen, A.J.


    Harvesting energy from the users' muscular power to convert this into electricity is a relatively unknown way to power consumer products. It nevertheless offers surprising opportunities for product designers; human-powered products function independently from regular power infrastructure, are convenient and can be environmentally and economically beneficial. This work provides insight into the knowledge required to design human-powered energy systems in consumer products from a scientific perspective. It shows the developments of human-powered products from the first introduction of the BayGen Freeplay radio in 1995 till current products and provides an overview and analysis of 211 human-powered products currently on the market. Although human power is generally perceived as beneficial for the environment, this thesis shows that achieving environmental benefit is only feasible when the environmental impact of additional materials in the energy conversion system is well balanced with the energy demands of the products functionality. User testing with existing products showed a preference for speeds in the range of 70 to 190 rpm for crank lengths from 32 to 95 mm. The muscular input power varied from 5 to 21 W. The analysis of twenty graduation projects from the Faculty of Industrial Design Engineering in the field of human-powered products, offers an interesting set of additional practice based design recommendations. The knowledge based approach of human power is very powerful to support the design of human-powered products. There is substantial potential for improvements in the domains energy conversion, ergonomics and environment. This makes that human power, when applied properly, is environmentally and economically competitive over a wider range of applications than thought previously.

  7. Genetics of human hydrocephalus. (United States)

    Zhang, Jun; Williams, Michael A; Rigamonti, Daniele


    Human hydrocephalus is a common medical condition that is characterized by abnormalities in the flow or resorption of cerebrospinal fluid (CSF), resulting in ventricular dilatation. Human hydrocephalus can be classified into two clinical forms, congenital and acquired. Hydrocephalus is one of the complex and multifactorial neurological disorders.A growing body of evidence indicates that genetic factors play a major role in the pathogenesis of hydrocephalus. An understanding of the genetic components and mechanism of this complex disorder may offer us significant insights into the molecular etiology of impaired brain development and an accumulation of the cerebrospinal fluid in cerebral compartments during the pathogenesis of hydrocephalus. Genetic studies in animal models have started to open the way for understanding the underlying pathology of hydrocephalus. At least 43 mutants/loci linked to hereditary hydrocephalus have been identified in animal models and humans. Up to date, 9 genes associated with hydrocephalus have been identified in animal models. In contrast, only one such gene has been identified in humans. Most of known hydrocephalus gene products are the important cytokines, growth factors or related molecules in the cellular signal pathways during early brain development. The current molecular genetic evidence from animal models indicate that in the early development stage, impaired and abnormal brain development caused by abnormal cellular signaling and functioning, all these cellular and developmental events would eventually lead to the congenital hydrocephalus. Owing to our very primitive knowledge of the genetics and molecular pathogenesis of human hydrocephalus, it is difficult to evaluate whether data gained from animal models can be extrapolated to humans. Initiation of a large population genetics study in humans will certainly provide invaluable information about the molecular and cellular etiology and the developmental mechanisms of human

  8. Human exposure to aluminium. (United States)

    Exley, Christopher


    Human activities have circumvented the efficient geochemical cycling of aluminium within the lithosphere and therewith opened a door, which was previously only ajar, onto the biotic cycle to instigate and promote the accumulation of aluminium in biota and especially humans. Neither these relatively recent activities nor the entry of aluminium into the living cycle are showing any signs of abating and it is thus now imperative that we understand as fully as possible how humans are exposed to aluminium and the future consequences of a burgeoning exposure and body burden. The aluminium age is upon us and there is now an urgent need to understand how to live safely and effectively with aluminium.

  9. Aluminium in human sweat. (United States)

    Minshall, Clare; Nadal, Jodie; Exley, Christopher


    It is of burgeoning importance that the human body burden of aluminium is understood and is measured. There are surprisingly few data to describe human excretion of systemic aluminium and almost no reliable data which relate to aluminium in sweat. We have measured the aluminium content of sweat in 20 healthy volunteers following mild exercise. The concentration of aluminium ranged from 329 to 5329μg/L. These data equate to a daily excretion of between 234 and 7192μg aluminium and they strongly suggest that perspiration is the major route of excretion of systemic aluminium in humans. Copyright © 2013 Elsevier GmbH. All rights reserved.

  10. Wear in human knees

    Directory of Open Access Journals (Sweden)

    M.L. Wang


    Full Text Available Wear occurs in natural knee joints and plays a pivotal factor in causing articular cartilage degradation in osteoarthritis (OA processes. Wear particles are produced in the wear process and get involved in inflammation of human knees. This review presents progresses in the mechanical and surface morphological studies of articular cartilages, wear particles analysis techniques for wear studies and investigations of human knee synovial fluid in wear of human knees. Future work is also included for further understanding of OA symptoms and their relations which may shed light on OA causes.

  11. Human Genome Project

    Energy Technology Data Exchange (ETDEWEB)

    Block, S. [The MITRE Corporation, McLean, VA (US). JASON Program Office; Cornwall, J. [The MITRE Corporation, McLean, VA (US). JASON Program Office; Dally, W. [The MITRE Corporation, McLean, VA (US). JASON Program Office; Dyson, F. [The MITRE Corporation, McLean, VA (US). JASON Program Office; Fortson, N. [The MITRE Corporation, McLean, VA (US). JASON Program Office; Joyce, G. [The MITRE Corporation, McLean, VA (US). JASON Program Office; Kimble, H. J. [The MITRE Corporation, McLean, VA (US). JASON Program Office; Lewis, N. [The MITRE Corporation, McLean, VA (US). JASON Program Office; Max, C. [The MITRE Corporation, McLean, VA (US). JASON Program Office; Prince, T. [The MITRE Corporation, McLean, VA (US). JASON Program Office; Schwitters, R. [The MITRE Corporation, McLean, VA (US). JASON Program Office; Weinberger, P. [The MITRE Corporation, McLean, VA (US). JASON Program Office; Woodin, W. H. [The MITRE Corporation, McLean, VA (US). JASON Program Office


    The study reviews Department of Energy supported aspects of the United States Human Genome Project, the joint National Institutes of Health/Department of Energy program to characterize all human genetic material, to discover the set of human genes, and to render them accessible for further biological study. The study concentrates on issues of technology, quality assurance/control, and informatics relevant to current effort on the genome project and needs beyond it. Recommendations are presented on areas of the genome program that are of particular interest to and supported by the Department of Energy.

  12. Human Capital and Development


    Rodolfo E. Manuelli


    Perhaps no question has attracted as much attention in the economics literature as “Why are some countries richer than others?” In this article, the author revisits the “development problem” and provides some estimates of the importance of human capital in accounting for cross-country differences in output per worker. His results suggest that human capital has a central role in determining the wealth of nations and that the quality of human capital varies systematically with the level of deve...

  13. Human pancreas development. (United States)

    Jennings, Rachel E; Berry, Andrew A; Strutt, James P; Gerrard, David T; Hanley, Neil A


    A wealth of data and comprehensive reviews exist on pancreas development in mammals, primarily mice, and other vertebrates. By contrast, human pancreatic development has been less comprehensively reviewed. Here, we draw together those studies conducted directly in human embryonic and fetal tissue to provide an overview of what is known about human pancreatic development. We discuss the relevance of this work to manufacturing insulin-secreting β-cells from pluripotent stem cells and to different aspects of diabetes, especially permanent neonatal diabetes, and its underlying causes. © 2015. Published by The Company of Biologists Ltd.

  14. Human dignity and bioethics

    Directory of Open Access Journals (Sweden)

    Marjanović Miloš


    Full Text Available By opening the field of bioethics followed a new wave of intense debate on the theological, philosophical and legal significance of the concept of human dignity . Exactly ten years ago (December 2003 American bioethicist Ruth Maclin has proposed to divest ourselves of the concept of human dignity because it is vague, useless and redundant and that, without any loss, we can replace it by the ethical principle of personal autonomy. Her article was followed by harsh reactions and opposite views. What is this term in so broad, almost inflationary and opposite use is not a reason to deprive him, but, on the contrary, it shows how important it is and that it should be determined at least outline. As universal values and general concept, the human dignity has no pre-defined and narrow, precise meaning. It is more an evaluation horizon, the guiding principle and regulatory ideas that must constantly define and codify by many guaranted human rights and fundamental freedoms. As generic notion of each reasonable law, it is their foundation and a common denominator, legitimising basis of natural but also of positive law. As intrinsic and static value which means the humaneness, the humanity it is absolute, inherent to every human being without distinction and conditioning, as a unique and unrepeatable creation. In this meaning, the dignity is the obligation and limitation of the state, society and each of us. As an ethical and dynamic category, it is not given to us, but it is assign to us, and it is not in us, but always before us, as a guide of our actions in accordance with virtues, to treat ourselves, each other and the nature in a human way. The century in which we live is named the century of molecular biology and genetic engineering because of the enormous potential but also risks to human dignity. Because of that human dignity has become a central principle in all international documents relating to the human genome, genetics and bioethics, adopted

  15. Sulfatases and human disease. (United States)

    Diez-Roux, Graciana; Ballabio, Andrea


    Sulfatases are a highly conserved family of proteins that cleave sulfate esters from a wide range of substrates. The importance of sulfatases in human metabolism is underscored by the presence of at least eight human monogenic diseases caused by the deficiency of individual sulfatases. Sulfatase activity requires a unique posttranslational modification, which is impaired in patients with multiple sulfatase deficiency (MSD) due to a mutation of the sulfatase modifying factor 1 (SUMF1). Here we review current knowledge and future perspectives on the evolution of the sulfatase gene family, on the role of these enzymes in human metabolism, and on new developments in the therapy of sulfatase deficiencies.

  16. Propelling medical humanities in China. (United States)

    Tang, Wei


    Advances in the study of the medical humanities and medical humanities education have been made over the past few decades. Many influential journals have published articles examining the role of medical humanities and medical humanities education, the development and evaluation of medical humanities, and the design of a curriculum for medical humanities education in Western countries. However, most articles related to medical humanities in China were published in Chinese, moreover, researchers have worked in relative isolation and published in disparate journals, so their work has not been systematically presented to and evaluated by international readers. The six companion articles featured in this issue describe the current status and challenge of medical humanities and medical humanities education in China in the hope of providing international readers with a novel and meaningful glimpse into medical humanities in China. This Journal is calling for greater publication of research on medical humanities and medical humanities education to propel medical humanities in China.

  17. Human Research Program (United States)

    National Aeronautics and Space Administration — Strategically, the HRP conducts research and technology development that: 1) enables the development or modification of Agency-level human health and performance...

  18. The human urine metabolome

    National Research Council Canada - National Science Library

    Bouatra, Souhaila; Aziat, Farid; Mandal, Rupasri; Guo, An Chi; Wilson, Michael R; Knox, Craig; Bjorndahl, Trent C; Krishnamurthy, Ramanarayan; Saleem, Fozia; Liu, Philip; Dame, Zerihun T; Poelzer, Jenna; Huynh, Jessica; Yallou, Faizath S; Psychogios, Nick; Dong, Edison; Bogumil, Ralf; Roehring, Cornelia; Wishart, David S


    .... Many of these compounds are poorly characterized and poorly understood. In an effort to improve our understanding of this biofluid we have undertaken a comprehensive, quantitative, metabolome-wide characterization of human urine...

  19. The bionic human


    Francalanza, Emmanuel;


    Faster, fitter and flawless? What would it take to build a Bionic Human? Emmanuel Francalanza delved into research at the Faculty of Engineering to see how Malta could contribute. 3D Art by Jean Claude Vancell.

  20. Human Resource Planning (United States)

    Hoffman, W. H.; Wyatt, L. L.


    By using the total resource approach, we have focused attention on the need to integrate human resource planning with other business plans and highlighted the importance of a productivity strategy. (Author)

  1. Human factors in aviation

    National Research Council Canada - National Science Library

    Salas, Eduardo; Maurino, Daniel E


    .... HFA offers a comprehensive overview of the topic, taking readers from the general to the specific, first covering broad issues, then the more specific topics of pilot performance, human factors...

  2. Extraterritorial Human Rights Obligations

    DEFF Research Database (Denmark)

    Amsinck Boie, Hans Nikolaj; Torp, Kristian

    The book addresses the issue of corporate respect for human rights by examining if and how states are obligated to ensure that corporations originating from their jurisdiction respect human rights when they operate abroad. The existence of such a duty is much debated by academics at national...... and international level, and in an attempt to bring something new to the table, the book examines both if states have extraterritorial obligations in regard to their corporations and what can be required of states under such an obligation. The complex issue of states and corporate respect for human rights cannot...... adequately be addressed without including the approach to the problem taken in practice; Corporate Social Responsibility, CSR. The book therefore draws upon the concept of CSR and the approaches developed here and discusses whether states may utilize the CSR-based concept of human rights due diligence...

  3. Aerospace Human Factors (United States)

    Jordan, Kevin


    The following contains the final report on the activities related to the Cooperative Agreement between the human factors research group at NASA Ames Research Center and the Psychology Department at San Jose State University. The participating NASA Ames division has been, as the organization has changed, the Aerospace Human Factors Research Division (ASHFRD and Code FL), the Flight Management and Human Factors Research Division (Code AF), and the Human Factors Research and Technology Division (Code IH). The inclusive dates for the report are November 1, 1984 to January 31, 1999. Throughout the years, approximately 170 persons worked on the cooperative agreements in one capacity or another. The Cooperative Agreement provided for research personnel to collaborate with senior scientists in ongoing NASA ARC research. Finally, many post-MA/MS and post-doctoral personnel contributed to the projects. It is worth noting that 10 former cooperative agreement personnel were hired into civil service positions directly from the agreements.

  4. Journal of Humanities: Contact

    African Journals Online (AJOL)

    Principal Contact. Dr. Japhet Bakuwa Copy and Production Editor Chancellor College Publications Journal of Humanities Chancellor College Publications PO Box 280 Zomba Malawi Email: ...

  5. Business and Human Rights

    DEFF Research Database (Denmark)

    Buhmann, Karin

    This article analyses the United Nations (UN) Guidelines on Business and Human Rights adopted in 2011 by the UN Human Rights Council from the perspective of Transnational Business Governance Interactions (TBGI) analytical framework (Eberlein et al. 2014). The article identifies and discusses dime...... business governance suggests that this form of governance offers prospects for public institutions as a means towards regulating global sustainability concerns.......This article analyses the United Nations (UN) Guidelines on Business and Human Rights adopted in 2011 by the UN Human Rights Council from the perspective of Transnational Business Governance Interactions (TBGI) analytical framework (Eberlein et al. 2014). The article identifies and discusses...... that the UN Guiding Principles are unique in several respects of relevance to transnational business governance interaction and indicate the relevance of the TBGI approach to public regulatory transnational business governance initiatives. The analysis of the Guiding Principles as interactional transnational...

  6. Human Reliability Program Overview

    Energy Technology Data Exchange (ETDEWEB)

    Bodin, Michael


    This presentation covers the high points of the Human Reliability Program, including certification/decertification, critical positions, due process, organizational structure, program components, personnel security, an overview of the US DOE reliability program, retirees and academia, and security program integration.

  7. Human Bond Communication

    DEFF Research Database (Denmark)

    Prasad, Ramjee


    Modern dexterous communication technology is progressively enabling humans to communicate their information through them with speech (aural) and media (optical) as underpinning essence. Humans realize this kind of aural and optical information by their optical and auditory senses. However, due...... to certain constraints, the ability to incorporate the other three sensory features namely, olfactory, gustatory, and tactile are still far from reality. Human bond communication is a novel concept that incorporates olfactory, gustatory, and tactile that will allow more expressive and holistic sensory...... information exchange through communication techniques for more human sentiment centric communication. This concept endorses the need of inclusion of other three senses and proposes an innovative approach of holistic communication for future communication network....

  8. Strategic Human Resources Management

    National Research Council Canada - National Science Library

    Marta Muqaj


    Strategic Human Resources Management (SHRM) represents an important and sensitive aspect of the functioning and development of a company, business, institution, state, public or private agency of a country...


    Directory of Open Access Journals (Sweden)

    Željko Kaluđerović


    Full Text Available In this paper the authors analyze the process of negotiating and beginning of the United Nations Declaration on Human Cloning as well as the paragraphs of the very Declaration. The negotiation was originally conceived as a clear bioethical debate that should have led to a general agreement to ban human cloning. However, more often it had been discussed about human rights, cultural, civil and religious differences between people and about priorities in case of eventual conflicts between different value systems. In the end, a non-binding Declaration on Human Cloning had been adopted, full of numerous compromises and ambiguous formulations, that relativized the original intention of proposer states. According to authors, it would have been better if bioethical discussion and eventual regulations on cloning mentioned in the following text had been left over to certain professional bodies, and only after the public had been fully informed about it should relevant supranational organizations have taken that into consideration.

  10. Science and Humanism (United States)

    Auger, Pierre


    Science and humanism are separated so completely as to bring about the creation of two cultures quite distinct from each other within contemporary civilization. Pragmatic, rational attitudes are needed on both sides to bring them together. (DF)

  11. Human Capital Tracking Tool - (United States)

    Department of Transportation — AVS is now required to collect, track, and report on data from the following Flight, Business and Workforce Plan. The Human Resource Management’s Performance Target...

  12. Human Factors Laboratory (United States)

    Federal Laboratory Consortium — Purpose: The purpose of the Human Factors Laboratory is to further the understanding of highway user needs so that those needs can be incorporated in roadway design,...

  13. Human Power Empirically Explored

    NARCIS (Netherlands)

    Jansen, A.J.


    Harvesting energy from the users’ muscular power to convert this into electricity is a relatively unknown way to power consumer products. It nevertheless offers surprising opportunities for product designers; human-powered products function independently from regular power infrastructure, are


    Directory of Open Access Journals (Sweden)

    Ph. D. Student Ioana - Julieta Josan


    Full Text Available Once with the development of the human capital theory, the education received an economic value. Leading theorists and specialists in the field have shown that the remarkable economic effects of the investments in education influence the chances of acquiring a job and earnings, demonstrating how the theory justifies such an investment. At the hand, the allocation of resources in human capital brings performance and benefits to companies investing in their employees. Also, the investment in human capital is strategic for any country that seeks to create a knowledge economy. Considering the above arguments, the aim of this paper is to highlight the characteristics of investment in human capital, the types of investment, the factors of education investment and the entities interested in investing and their benefits.

  15. Human female meiosis revised

    DEFF Research Database (Denmark)

    Capalbo, Antonio; Hoffmann, Eva R.; Cimadomo, Danilo


    in the female germline is a crucial step towards the development of new diagnostic approaches and, possibly, for the development of therapeutic targets and molecules. Here, we have reviewed emerging mechanisms that may drive human aneuploidy, in particular the maternal age effect. SEARCH METHODS We conducted...... a systematic search in PubMed Central of the primary literature from 1990 through 2016 following the PRISMA guidelines, using MeSH terms related to human aneuploidy. For model organism research, we conducted a literature review based on references in human oocytes manuscripts and general reviews related...... to chromosome segregation in meiosis and mitosis. OUTCOMES Advances in genomic and imaging technologies are allowing unprecedented insight into chromosome segregation in human oocytes. This includes the identification of a novel chromosome segregation error, termed reverse segregation, as well as sister...

  16. Human Assisted Assembly Processes

    Energy Technology Data Exchange (ETDEWEB)



    Automatic assembly sequencing and visualization tools are valuable in determining the best assembly sequences, but without Human Factors and Figure Models (HFFMs) it is difficult to evaluate or visualize human interaction. In industry, accelerating technological advances and shorter market windows have forced companies to turn to an agile manufacturing paradigm. This trend has promoted computerized automation of product design and manufacturing processes, such as automated assembly planning. However, all automated assembly planning software tools assume that the individual components fly into their assembled configuration and generate what appear to be a perfectly valid operations, but in reality the operations cannot physically be carried out by a human. Similarly, human figure modeling algorithms may indicate that assembly operations are not feasible and consequently force design modifications; however, if they had the capability to quickly generate alternative assembly sequences, they might have identified a feasible solution. To solve this problem HFFMs must be integrated with automated assembly planning to allow engineers to verify that assembly operations are possible and to see ways to make the designs even better. Factories will very likely put humans and robots together in cooperative environments to meet the demands for customized products, for purposes including robotic and automated assembly. For robots to work harmoniously within an integrated environment with humans the robots must have cooperative operational skills. For example, in a human only environment, humans may tolerate collisions with one another if they did not cause much pain. This level of tolerance may or may not apply to robot-human environments. Humans expect that robots will be able to operate and navigate in their environments without collisions or interference. The ability to accomplish this is linked to the sensing capabilities available. Current work in the field of cooperative

  17. Pushing Human Frontiers (United States)

    Zubrin, Robert


    With human colonization of Mars, I think you will see a higher standard of civilization, just as America set a higher standard of civilization which then promulgated back into Europe. I think that if you want to maximize human potential, you need a higher standard of civilization, and that becomes an example that benefits everyone. Without an open frontier, closed world ideologies, such as the Malthus Theory, tend to come to the forefront. It is that there are limited resources; therefore, we are all in deadly competition with each other for the limited pot. The result is tyrannical and potentially genocidal regimes, and we've already seen this in the twentieth century. There s no truth in the Malthus Theory, because human beings are the creators of their resources. With every mouth comes a pair of hands and a brain. But if it seems to be true, you have a vector in this direction, and it is extremely unfortunate. It is only in a universe of infinite resources that all humans can be brothers and sisters. The fundamental question which affects humanity s sense of itself is whether the world is changeable or fixed. Are we the makers of our world or just its inhabitants? Some people have a view that they re living at the end of history within a world that s already defined, and there is no fundamental purpose to human life because there is nothing humans can do that matters. On the other hand, if humans understand their own role as the creators of their world, that s a much more healthy point of view. It raises the dignity of humans. Indeed, if we do establish a new branch of human civilization on Mars that grows in time and potency to the point where it cannot really settle Mars, but transforms Mars, and brings life to Mars, we will prove to everyone and for all time the precious and positive nature of the human species and every member of it.

  18. Human-Robot Biodynamics


    Ivancevic, Vladimir G.


    This paper presents the scientific body of knowledge behind the Human Biodynamics Engine (HBE), a human motion simulator developed on the concept of Euclidean motion group SE(3), with 270 active degrees of freedom, force-velocity-time muscular mechanics and two-level neural control - formulated in the fashion of nonlinear humanoid robotics. The following aspects of the HBE development are described: geometrical, dynamical, control, physiological, AI, behavioral and complexity, together with s...

  19. Reclaiming human machine nature


    Fass, Didier


    International audience; Extending and modifying his domain of life by artifact production is one of the main characteristics of humankind. From the first hominid, who used a wood stick or a stone for extending his upper limbs and augmenting his gesture strength, to current systems engineers who used technologies for augmenting human cognition, perception and action, extending human body capabilities remains a big issue. From more than fifty years cybernetics, computer and cog-nitive sciences ...

  20. Genetics of human hydrocephalus


    Zhang, Jun; Michael A. Williams; Rigamonti, Daniele


    Human hydrocephalus is a common medical condition that is characterized by abnormalities in the flow or resorption of cerebrospinal fluid (CSF), resulting in ventricular dilatation. Human hydrocephalus can be classified into two clinical forms, congenital and acquired. Hydrocephalus is one of the complex and multifactorial neurological disorders. A growing body of evidence indicates that genetic factors play a major role in the pathogenesis of hydrocephalus. An understanding of the genetic co...

  1. Human ocular anatomy. (United States)

    Kels, Barry D; Grzybowski, Andrzej; Grant-Kels, Jane M


    We review the normal anatomy of the human globe, eyelids, and lacrimal system. This contribution explores both the form and function of numerous anatomic features of the human ocular system, which are vital to a comprehensive understanding of the pathophysiology of many oculocutaneous diseases. The review concludes with a reference glossary of selective ophthalmologic terms that are relevant to a thorough understanding of many oculocutaneous disease processes. Copyright © 2015 Elsevier Inc. All rights reserved.

  2. Evolution and human sexuality. (United States)

    Gray, Peter B


    The aim of this review is to put core features of human sexuality in an evolutionary light. Toward that end, I address five topics concerning the evolution of human sexuality. First, I address theoretical foundations, including recent critiques and developments. While much traces back to Darwin and his view of sexual selection, more recent work helps refine the theoretical bases to sex differences and life history allocations to mating effort. Second, I consider central models attempting to specify the phylogenetic details regarding how hominin sexuality might have changed, with most of those models honing in on transitions from a possible chimpanzee-like ancestor to the slightly polygynous and long-term bonded sociosexual partnerships observed among most recently studied hunter-gatherers. Third, I address recent genetic and physiological data contributing to a refined understanding of human sexuality. As examples, the availability of rapidly increasing genomic information aids comparative approaches to discern signals of selection in sexuality-related phenotypes, and neuroendocrine studies of human responses to sexual stimuli provide insight into homologous and derived mechanisms. Fourth, I consider some of the most recent, large, and rigorous studies of human sexuality. These provide insights into sexual behavior across other national samples and on the Internet. Fifth, I discuss the relevance of a life course perspective to understanding the evolution of human sexuality. Most research on the evolution of human sexuality focuses on young adults. Yet humans are sexual beings from gestation to death, albeit in different ways across the life course, and in ways that can be theoretically couched within life history theory. Copyright © 2013 Wiley Periodicals, Inc.



    Dr. M. Panneerselvam


    Electronic Human Resource Management is an essence the revolution of human resource functions to management and employees. These functions are typically used via intranet and web technology. This helps the organization to improve their standards where they can able to review and forward. All those documents can be viewed within a fraction of second with help of client and server links. The phenomenon of E- HRM deserves closer and more fundamental roots to HR activity. The E-HRM develops and b...

  4. Human motricity and health

    Directory of Open Access Journals (Sweden)

    Manuel Sérgio Vieira e Cunha


    Full Text Available If human motricity science intends to study motor conduct (or actions in which the human being pursues transcendence (or surmounting, it inevitably relates to the large realm of health. What are the aspects it evinces? Transdisciplinarity, solidarity among the various knowledge types (including poetical, complexity, (where the physical is integrated but surmounted and the firm belief that to be healthy is to have in ourselves, alive and working, the capacity for surmounting anything.

  5. Human Germline Genome Editing. (United States)

    Ormond, Kelly E; Mortlock, Douglas P; Scholes, Derek T; Bombard, Yvonne; Brody, Lawrence C; Faucett, W Andrew; Garrison, Nanibaa' A; Hercher, Laura; Isasi, Rosario; Middleton, Anna; Musunuru, Kiran; Shriner, Daniel; Virani, Alice; Young, Caroline E


    With CRISPR/Cas9 and other genome-editing technologies, successful somatic and germline genome editing are becoming feasible. To respond, an American Society of Human Genetics (ASHG) workgroup developed this position statement, which was approved by the ASHG Board in March 2017. The workgroup included representatives from the UK Association of Genetic Nurses and Counsellors, Canadian Association of Genetic Counsellors, International Genetic Epidemiology Society, and US National Society of Genetic Counselors. These groups, as well as the American Society for Reproductive Medicine, Asia Pacific Society of Human Genetics, British Society for Genetic Medicine, Human Genetics Society of Australasia, Professional Society of Genetic Counselors in Asia, and Southern African Society for Human Genetics, endorsed the final statement. The statement includes the following positions. (1) At this time, given the nature and number of unanswered scientific, ethical, and policy questions, it is inappropriate to perform germline gene editing that culminates in human pregnancy. (2) Currently, there is no reason to prohibit in vitro germline genome editing on human embryos and gametes, with appropriate oversight and consent from donors, to facilitate research on the possible future clinical applications of gene editing. There should be no prohibition on making public funds available to support this research. (3) Future clinical application of human germline genome editing should not proceed unless, at a minimum, there is (a) a compelling medical rationale, (b) an evidence base that supports its clinical use, (c) an ethical justification, and (d) a transparent public process to solicit and incorporate stakeholder input. Copyright © 2017 American Society of Human Genetics. All rights reserved.



    Ph. D. Student Ioana - Julieta Josan


    Once with the development of the human capital theory, the education received an economic value. Leading theorists and specialists in the field have shown that the remarkable economic effects of the investments in education influence the chances of acquiring a job and earnings, demonstrating how the theory justifies such an investment. At the hand, the allocation of resources in human capital brings performance and benefits to companies investing in their employees. Also, the investment in hu...

  7. Deuteronomy and Human Rights

    Directory of Open Access Journals (Sweden)

    G. Braulik


    Full Text Available If one compares the articles of the "Universal Declaration of Human Rights" dated December 10th, 1948, with the regulations of the book of Deuteronomy, one detects a surprising abundance of correspondences, or at least of similar tendencies, between them. As the social theorists of the seventeenth and eighteenth centuries, the architects of the catalogue of Human Rights, knew the Scripture very well. References to Deuteronomy are historically well probable and factually hardly coincidental. Deuteronomy rightly boasts about its social laws (4:8 that are unique in the Ancient Near East. The paper orientates itself to the short formula of Human Rights and at the same time to the normative basic character of each human right, as it is formulated in the first article of the declaration: "liberty", "equality", "fraternity". Each of these basic categories are concretised in terms of several Deuteronomic regulations and prove themselves to be central matters of concern within the YHWH religion. Finally, it is outlined how the connection between Deuteronomy and modem expressions of human rights might be explained, and further it is shown what actually makes up the peculiarity of biblical thinking on human rights.

  8. Proteomics of human mitochondria. (United States)

    Palmfeldt, Johan; Bross, Peter


    Proteomics have passed through a tremendous development in the recent years by the development of ever more sensitive, fast and precise mass spectrometry methods. The dramatically increased research in the biology of mitochondria and their prominent involvement in all kinds of diseases and ageing has benefitted from mitochondrial proteomics. We here review substantial findings and progress of proteomic analyses of human cells and tissues in the recent past. One challenge for investigations of human samples is the ethically and medically founded limited access to human material. The increased sensitivity of mass spectrometry technology aids in lowering this hurdle and new approaches like generation of induced pluripotent cells from somatic cells allow to produce patient-specific cellular disease models with great potential. We describe which human sample types are accessible, review the status of the catalog of human mitochondrial proteins and discuss proteins with dual localization in mitochondria and other cellular compartments. We describe the status and developments of pertinent mass spectrometric strategies, and the use of databases and bioinformatics. Using selected illustrative examples, we draw a picture of the role of proteomic analyses for the many disease contexts from inherited disorders caused by mutation in mitochondrial proteins to complex diseases like cancer, type 2 diabetes and neurodegenerative diseases. Finally, we speculate on the future role of proteomics in research on human mitochondria and pinpoint fields where the evolving technologies will be exploited. Copyright © 2016. Published by Elsevier B.V.

  9. Cytokines in human milk. (United States)

    Garofalo, Roberto


    Epidemiologic studies conducted in the past 30 years to investigate the protective functions of human milk strongly support the notion that breastfeeding prevents infantile infections, particularly those affecting the gastrointestinal and respiratory tracts. However, more recent clinical and experimental observations also suggest that human milk not only provides passive protection, but also can directly modulate the immunological development of the recipient infant. The study of this remarkable defense system in human milk has been difficult because of its biochemical complexity, the small concentration of certain bioactive components, the compartmentalization of some of these agents, the dynamic quantitative and qualitative changes of milk during lactation, and the lack of specific reagents to quantify these agents. However, a host of bioactive substances, including hormones, growth factors, and immunological factors such as cytokines, have been identified in human milk. Cytokines are pluripotent polypeptides that act in autocrine/paracrine fashions by binding to specific cellular receptors. They operate in networks and orchestrate the development and functions of immune system. Several different cytokines and chemokines have been discovered in human milk in the past years, and the list is growing very rapidly. This article will review the current knowledge about the increasingly complex network of chemoattractants, activators, and anti-inflammatory cytokines present in human milk and their potential role in compensating for the developmental delay of the neonate immune system. Copyright 2010. Published by Mosby, Inc.

  10. Human Factors Review Plan

    Energy Technology Data Exchange (ETDEWEB)

    Paramore, B.; Peterson, L.R. (eds.)


    ''Human Factors'' is concerned with the incorporation of human user considerations into a system in order to maximize human reliability and reduce errors. This Review Plan is intended to assist in the assessment of human factors conditions in existing DOE facilities. In addition to specifying assessment methodologies, the plan describes techniques for improving conditions which are found to not adequately support reliable human performance. The following topics are addressed: (1) selection of areas for review describes techniques for needs assessment to assist in selecting and prioritizing areas for review; (2) human factors engineering review is concerned with optimizing the interfaces between people and equipment and people and their work environment; (3) procedures review evaluates completeness and accuracy of procedures, as well as their usability and management; (4) organizational interface review is concerned with communication and coordination between all levels of an organization; and (5) training review evaluates training program criteria such as those involving: trainee selection, qualification of training staff, content and conduct of training, requalification training, and program management.


    Directory of Open Access Journals (Sweden)

    David Abram


    Full Text Available From an initial project to investigate the relationship between magic and traditional medicine as practiced by shamans in Southern rural Asia, the focus of attention gradually shifted to an awareness of the negotiation traditional medicine people or shamans exert between the human community and the larger community of beings. This attentiveness to a more-than-human world does not occur at a supernatural domain above nature or inside her personal self but is the result of the shaman’s special ability to project her consciousness horizontally to other forms of sensibility with which human existence is interwoven. The ecological function of the shaman is to maintain a constant balance between what is taken and what is given from the human community to the larger community. The spirits of indigenous cultures are not defined in opposition to materiality but are essentially those modes of intelligence or awareness that do not possess a human form. By exploring different landscapes, and the sensibility living in them, a new sensitivity is awoken that allows for communication with those intelligences. However, the drowning of these other voices in Western culture, which reduces otherness to an object, creates an uneasiness that is hardly perceived except as an inability to interact with anything more-than-human and its dire consequences in the form of “civilization’s” destructive behavior.

  12. Habitability and Human Factors Contributions to Human Space Flight (United States)

    Sumaya, Jennifer Boyer


    This slide presentation reviews the work of the Habitability and Human Factors Branch in support of human space flight in two main areas: Applied support to major space programs, and Space research. The field of Human Factors applies knowledge of human characteristics for the design of safer, more effective, and more efficient systems. This work is in several areas of the human space program: (1) Human-System Integration (HSI), (2) Orion Crew Exploration Vehicle, (3) Extravehicular Activity (EVA), (4) Lunar Surface Systems, (5) International Space Station (ISS), and (6) Human Research Program (HRP). After detailing the work done in these areas, the facilities that are available for human factors work are shown.

  13. Testing for Human Immunodeficiency Virus (United States)

    ... education Fact Sheet PFS005: Testing for Human Immunodeficiency Virus AUGUST 2015 • Reasons for Getting Tested • Who Should ... For More Information • Glossary Testing for Human Immunodeficiency Virus Human immunodeficiency virus (HIV) is the virus that ...

  14. Human bites - self-care (United States)

    Bites - human - self-care ... Human bites can occur in 2 ways: If someone bites you If your hand comes into contact ... bite to express anger or other negative feelings. Human bites may be more dangerous than animal bites. ...

  15. Developing Human Performance Measures

    Energy Technology Data Exchange (ETDEWEB)

    Jeffrey Joe; Bruce Hallbert; Larry Blackwood; Donald Dudehoeffer; Kent Hansen


    Through the reactor oversight process (ROP), the U.S. Nuclear Regulatory Commission (NRC) monitors the performance of utilities licensed to operate nuclear power plants. The process is designed to assure public health and safety by providing reasonable assurance that licensees are meeting the cornerstones of safety and designated crosscutting elements. The reactor inspection program, together with performance indicators (PIs), and enforcement activities form the basis for the NRC’s risk-informed, performance based regulatory framework. While human performance is a key component in the safe operation of nuclear power plants and is a designated cross-cutting element of the ROP, there is currently no direct inspection or performance indicator for assessing human performance. Rather, when human performance is identified as a substantive cross cutting element in any 1 of 3 categories (resources, organizational or personnel), it is then evaluated for common themes to determine if follow-up actions are warranted. However, variability in human performance occurs from day to day, across activities that vary in complexity, and workgroups, contributing to the uncertainty in the outcomes of performance. While some variability in human performance may be random, much of the variability may be attributed to factors that are not currently assessed. There is a need to identify and assess aspects of human performance that relate to plant safety and to develop measures that can be used to successfully assure licensee performance and indicate when additional investigation may be required. This paper presents research that establishes a technical basis for developing human performance measures. In particular, we discuss: 1) how historical data already gives some indication of connection between human performance and overall plant performance, 2) how industry led efforts to measure and model human performance and organizational factors could serve as a data source and basis for a

  16. Interaction Between Humans and Structures

    DEFF Research Database (Denmark)

    Pedersen, Lars


    On structures two types of humans may be present. (1) Active humans and (2) passive humans (sitting or standing on the structure). The active humans can excite the structure and cause structural vibrations. The mass of the passive humans will interact with the structure and basically it changes...... the structural system (modal characteristics and structural vibration levels). The paper addresses this subject and explores the implications of having passive humans present on the structure....

  17. Towards a better understanding of human smuggling


    Heckmann, Friedrich


    Contents: What is human smuggling?; How can we know about human smuggling?; Human smuggling as a migration phenomenon; Human smuggling as a business; The social organizing of human smuggling; Fighting against human smuggling.

  18. Why Geo-Humanities (United States)

    Graells, Robert Casals i.; Sibilla, Anna; Bohle, Martin


    Anthropogenic global change is a composite process. It consists of societal processes (in the 'noosphere') and natural processes (in the 'bio-geosphere'). The 'noosphere' is the ensemble of social, cultural or political insights ('shared subjective mental concepts') of people. Understanding the composite of societal and natural processes ('human geo-biosphere intersections'), which shapes the features of anthropogenic global change, would benefit from a description that draws equally on natural sciences, social sciences and humanities. To that end it is suggested to develop a concept of 'geo-humanities': This essay presents some aspects of its scope, discussing "knowledge that is to manage", "intentions that are to shape", "choices that are to justify" and "complexity that is to handle". Managing knowledge: That people understand anthropogenic global change requires their insights into how 'human geosphere intersections' function. Insights are formed ('processed') in the noosphere by means of interactions between people. Understanding how 'human geosphere intersections' functions combines scientific, engineering and economic studies with studies of the dynamics of the noosphere. Shaping intentions: During the last century anthropogenic global change developed as the collateral outcome of humankind's accumulated actions. It is caused by the number of people, the patterns of their consumption of resources, and the alterations of their environments. Nowadays, anthropogenic global chance is either an intentional negligence or a conscious act. Justifying choices: Humanity has alternatives how to alter Earth at planetary scale consciously. For example, there is a choice to alter the geo-biosphere or to adjust the noosphere. Whatever the choice, it will depend on people's world-views, cultures and preferences. Thus beyond issues whether science and technology are 'sound' overarching societal issues are to tackle, such as: (i) how to appropriate and distribute natural

  19. Humanity and Sustainability

    Directory of Open Access Journals (Sweden)

    Shu-Kun Lin


    Full Text Available So far our open access publishing company MDPI (Multidisciplinary Digital Publishing Institute has published mainly science, medicine and technology journals. To become a multidisciplinary publisher, we launched the journal Sustainability [1]. More recently, we started to run several social science journals, including Societies [2], Religions [3], Administrative Sciences [4] and Behavioral Sciences [5]. Today we published the first paper [6] of the inaugural issue of Humanities (ISSN 2076-0787. This will be an international open access journal, publishing scholarly papers of high quality across all humanities disciplines. As a publisher, I would like to publish journals surrounding the topics of sustainability and I believe the humanities as a discipline of academic studies are very important. As a scientist, I believed science and technology will only benefit human beings. I was raised in a small village, living a very primitive life in a peasant family: no electricity, no machines, of course no TV and no refrigerator. Now, the life of my children is completely different. Even my own life has completely changed. I have witnessed very rapid changes: more and more machines are used to consume mineral resources and energy and to pollute the environment, in order to produce more and more powerful machines (we are also launching a journal titled Machines, in which the relationship between Man and machine should be an interesting topic.. Machines are more and more like human individuals consuming resources themselves (we are launching a journal titled Resources. [...

  20. Human milk banking guidelines. (United States)

    Bharadva, Ketan; Tiwari, Satish; Mishra, Sudhir; Mukhopadhyay, Kanya; Yadav, Balraj; Agarwal, R K; Kumar, Vishesh


    WHO and UNICEF state that the use of human milk from other sources should be the first alternative when it is not possible for the mother to breastfeed. Human milk banks should be made available in appropriate situations. The IYCF Chapter is actively concerned about the compelling use of formula feeds in the infants because of the non availability of human breast milk banks. A National Consultative Meet for framing guidelines was summoned by the IYCF Chapter and the Ministry of Health and Family Welfare, Government of India on 30th June, 2013, with representations from various stakeholders. The guidelines were drafted after an extensive literature review and discussions. Though these guidelines are based on the experiences and guidelines from other countries, changes have been made to suit the Indian setup, culture and needs, without compromising scientific evidence. To ensure quality of donated breast milk as a safe end product. Human Milk Banking Association should be constituted, and human milk banks should be established across the country. National coordination mechanism should be developed with a secretariat and technical support to follow-up on action in States. Budgetary provisions should be made available for the activities.

  1. The human serum metabolome.

    Directory of Open Access Journals (Sweden)

    Nikolaos Psychogios


    Full Text Available Continuing improvements in analytical technology along with an increased interest in performing comprehensive, quantitative metabolic profiling, is leading to increased interest pressures within the metabolomics community to develop centralized metabolite reference resources for certain clinically important biofluids, such as cerebrospinal fluid, urine and blood. As part of an ongoing effort to systematically characterize the human metabolome through the Human Metabolome Project, we have undertaken the task of characterizing the human serum metabolome. In doing so, we have combined targeted and non-targeted NMR, GC-MS and LC-MS methods with computer-aided literature mining to identify and quantify a comprehensive, if not absolutely complete, set of metabolites commonly detected and quantified (with today's technology in the human serum metabolome. Our use of multiple metabolomics platforms and technologies allowed us to substantially enhance the level of metabolome coverage while critically assessing the relative strengths and weaknesses of these platforms or technologies. Tables containing the complete set of 4229 confirmed and highly probable human serum compounds, their concentrations, related literature references and links to their known disease associations are freely available at

  2. Philosophical foundations of human rights

    CERN Document Server

    Liao, Matthew S


    What makes something a human right? What is the relationship between the moral foundations of human rights and human rights law? What are the difficulties of appealing to human rights? This book offers the first comprehensive survey of current thinking on the philosophical foundations of human rights. Divided into four parts, this book focusses firstly on the moral grounds of human rights, for example in our dignity, agency, interests or needs. 'Secondly, it looks at the implications that different moral perspectives on human rights bear for human rights law and politics. Thirdly, it discusses specific and topical human rights including freedom of expression and religion, security, health and more controversial rights such as a human right to subsistence. The final part discusses nuanced critical and reformative views on human rights from feminist, Kantian and relativist perspectives among others. The essays represent new and canonical research by leading scholars in the field. Each part is comprised of a set...

  3. Infants' Responses to Real Humans and Representations of Humans (United States)

    Heron, Michelle; Slaughter, Virginia


    Infants' responses to typical and scrambled human body shapes were assessed in relation to the realism of the human body stimuli presented. In four separate experiments, infants were familiarized to typical human bodies and then shown a series of scrambled human bodies on the test. Looking behaviour was assessed in response to a range of different…

  4. Medical practice, human experimentation and the sanctity of human ...

    African Journals Online (AJOL)

    ... human health and the sanctity of human life. In checkmating these dangers, the paper recommends and canvasses for the adoption of the ethical principles of the Nuremberg code of 1947 in properly regulating human experimentation so as to maximize its benefits and at the same time respect the sanctity of human life.

  5. Movement coordination in applied human-human and human-robot interaction

    DEFF Research Database (Denmark)

    Schubö, Anna; Vesper, Cordula; Wiesbeck, Mathey


    and describing human-human interaction in terms of goal-oriented movement coordination is considered an important and necessary step for designing and describing human-robot interaction. In the present scenario, trajectories of hand and finger movements were recorded while two human participants performed......The present paper describes a scenario for examining mechanisms of movement coordination in humans and robots. It is assumed that coordination can best be achieved when behavioral rules that shape movement execution in humans are also considered for human-robot interaction. Investigating...... coordination were affected. Implications for human-robot interaction are discussed....

  6. [Diagnosis of human toxocarosis]. (United States)

    Roldán, William H; Espinoza, Yrma A; Huapaya, Pedro E; Jiménez, Susana


    Human toxocarosis is an important parasitic zoonosis caused by larval stages of Toxocara species, the roundworms from dogs and cats. Larval migration through different soft tissues in the human generates several clinical entities in the patient, such as visceral larva migrans, ocular toxocarosis, and neurotoxocarosis. Definitive diagnosis by histopathological methods is very difficult or almost impossible and, nowadays, the diagnosis is usually made by clinical signs/symptoms, epidemiological background of the patient and the use of hematological and immunological tests which finally help to confirm the clinical suspicion of the illness. The purpose of this paper was to update the available knowledge on the use of different tools for both the diagnosis and following up of human toxocarosis.

  7. Social cognition in humans

    DEFF Research Database (Denmark)

    Frith, Christopher; Frith, Uta


    We review a diversity of studies of human social interaction and highlight the importance of social signals. We also discuss recent findings from social cognitive neuroscience that explore the brain basis of the capacity for processing social signals. These signals enable us to learn about...... the world from others, to learn about other people, and to create a shared social world. Social signals can be processed automatically by the receiver and may be unconsciously emitted by the sender. These signals are non-verbal and are responsible for social learning in the first year of life. Social...... signals can also be processed consciously and this allows automatic processing to be modulated and overruled. Evidence for this higher-level social processing is abundant from about 18 months of age in humans, while evidence is sparse for non-human animals. We suggest that deliberate social signalling...

  8. Philanthropy and Human Rights

    DEFF Research Database (Denmark)

    Larsen, Øjvind


    in Germany, England, France and USA. In each tradition is developed special features of the concept of philanthropy. The four traditions are summarized in the UN universal human rights, which has become the common normative reference for global philanthropy. In this way philanthropy has become, in a modern......, and normally utilized to promote one’s own prestige in the city-state. In Roman context, universal humanism, humanitas, was invented. This universal perspective was also supported by Christianity. It is this universal concept of philanthropy which is the foundation for the different philanthropic traditions...... sense, a charitable act with the aim to promote human happiness independent of gender, class, race, etc. This is the genealogy of the modern understanding of philanthropy, which will be developed in this paper....

  9. Human Systems Design Criteria

    DEFF Research Database (Denmark)

    Rasmussen, Jens


    This paper deals with the problem of designing more humanised computer systems. This problem can be formally described as the need for defining human design criteria, which — if used in the design process - will secure that the systems designed get the relevant qualities. That is not only...... the necessary functional qualities but also the needed human qualities. The author's main argument is, that the design process should be a dialectical synthesis of the two points of view: Man as a System Component, and System as Man's Environment. Based on a man's presentation of the state of the art a set...... of design criteria is suggested and their relevance discussed. The point is to focus on the operator rather than on the computer. The crucial question is not to program the computer to work on its own conditions, but to “program” the operator to function on human conditions....

  10. Abortion and human rights. (United States)

    Shaw, Dorothy


    Abortion has been a reality in women's lives since the beginning of recorded history, typically with a high risk of fatal consequences, until the last century when evolutions in the field of medicine, including techniques of safe abortion and effective methods of family planning, could have ended the need to seek unsafe abortion. The context of women's lives globally is an important but often ignored variable, increasingly recognised in evolving human rights especially related to gender and reproduction. International and regional human rights instruments are being invoked where national laws result in violations of human rights such as health and life. The individual right to conscientious objection must be respected and better understood, and is not absolute. Health professional organisations have a role to play in clarifying responsibilities consistent with national laws and respecting reproductive rights. Seeking common ground using evidence rather than polarised opinion can assist the future focus. Copyright 2010 Elsevier Ltd. All rights reserved.

  11. Whither medical humanities? (United States)

    Singh, Navjeevan


    Understanding the medical humanities (MH) and their role in medical education is in its infancy in India. Students are initiated into professional (medical) education too early in life, usually at the expense of a basic grounding in the humanities, resulting in warped intellectual growth. The author, arguing against the wholesale import of foreign systems, advocates free inquiry by medical educators to evolve a humanities programme for medical students derived from our own cultural context. This essay describes the early experiences of efforts to make a beginning at the University College of Medical Sciences, Delhi. The author reviews the various strategies used and the challenges of introducing the subject to the current generation of medical students.

  12. Medical humanities ... almost. (United States)

    Dangayach, Neha


    Brought up in the traditional education system in a large teaching hospital in Mumbai, India, I moved on to do specialisation in neurology in the United States of America. The Indian system of pre-medical education mandates early choices between the humanities and the sciences and thus precludes a more well-rounded development of a student. Though medical humanities is not taught as a subject as part of the medical curriculum in India, listening to inspiring and learned teachers and the daily interaction with scores of patients who are willing to submit themselves to examination "in the cause of medical education" is a humbling experience to a sensitive student. I see similar willingness in patients in the United States. However, a formal course in the medical humanities, including arts, literature, and philosophy will surely enrich the experience of a larger number of undergraduates and postgraduates learning the core subjects and help in moulding a more rounded physician.

  13. Human-Robot Interaction (United States)

    Rochlis-Zumbado, Jennifer; Sandor, Aniko; Ezer, Neta


    Risk of Inadequate Design of Human and Automation/Robotic Integration (HARI) is a new Human Research Program (HRP) risk. HRI is a research area that seeks to understand the complex relationship among variables that affect the way humans and robots work together to accomplish goals. The DRP addresses three major HRI study areas that will provide appropriate information for navigation guidance to a teleoperator of a robot system, and contribute to the closure of currently identified HRP gaps: (1) Overlays -- Use of overlays for teleoperation to augment the information available on the video feed (2) Camera views -- Type and arrangement of camera views for better task performance and awareness of surroundings (3) Command modalities -- Development of gesture and voice command vocabularies

  14. Humanities under Pressure

    Directory of Open Access Journals (Sweden)

    Jürgen Mittelstrass


    Full Text Available The Humanities have a problem with visibility both in the public sphere and in the academic system itself, and they have an organisational problem when compared with other sections of the academic system. They also have a funding problem, particularly in a European context, i.e., in the framework of the European research policy. The topic of this position paper is the essential role of the Humanities when dealing with the European project, the framing of Europe. In this respect, in contrast to the natural and social sciences, the Humanities need specific models of research funding, more individualised and of more interdisciplinary character. Additionally, they may need more multi-national centres for advanced studies on a European level, thus also solving their visibility and organisational problems.


    Directory of Open Access Journals (Sweden)

    Suzana Miovska Spaseva


    Full Text Available The article examines the complex role and great responsibility of the education today in development of the moral strength and human values of the children and youth. At the beginning of the article the author reconsiders the pedagogical ideas of Maria Montessori and her concept of education for peace as an instrument for reconstruction of the society and for improvement of the human living. Than the analysis of the moral values in the contemporary society is made and several issues and dilemmas are discussed referring the value disorientation of the youth and the importance of the models of adult’s moral behavior in their search for personal identity. On the basis of this analysis, the human dimension of the education is elaborated enhancing the need for its understanding as support of development, which is based on several crucial elements: love, freedom and spirit of community.

  16. Human Relations-skolen

    DEFF Research Database (Denmark)

    Scheuer, Steen


    Human Relations-skolen er en samlebetegnelse for to forskningsretninger, som tilsammen bidrog som nogle af de første til at indkredse og belyse de mellemmenneskelige relationers betydning for motivation og trivsel i arbejdslivet, og som skulle få stor ind"ydelse ikke bare på organisationsteorien......, men også arbejdssociologien, arbejdspsykologien og human resource development. Den første retning udsprang af de såkaldte Hawthorne-eksperimenter og psykologen Elton Mayos bearbejdelse af resultaterne derfra. Den anden er en løsere gruppering bestående af navne som Abraham Maslow og Frederick Herzberg......, som formulerede en række teorier og modeller om menneskets motivation, trivsel og behov i arbejdslivet. Selvom de ikke nødvendigvis relaterede sig til hinandens arbejde, er de forskellige bidragsydere i dag kendt som repræsentanter for den paradigmatiske betegnelse Human Relations. Undertiden skelnes...

  17. Defining Human Enhancement

    DEFF Research Database (Denmark)

    Nordberg, Ana


    Emerging technologies open the prospect of extraordinary interventions on the human body. These may go beyond what is strictly necessary to sustain health and well-being. While responding to social and ethical challenges of such advances, the Law simultaneously faces the challenge of reflecting...... on the legitimacy to legislate and on whether the existing legal framework is appropriate to address the various concerns. In order to do so, it is crucial to establish clear legal definitions. Precise distinctions between interventions on the human body are intrinsically difficult to formulate. However, subject......-matter definitions are vital legal tools to determine what is currently regulated in established fields of law and whether there is room for a new legal field – Enhancement Law. This paper provides a reflection on the relevance of establishing a legal definition of human enhancement and to what extent different...

  18. The Human Centrifuge (United States)

    van Loon, Jack J. W. A.


    Life on Earth has developed at unit gravity, 9.81 m/s2, which was a major factor especially when vertebrates emerged from water onto land in the late Devonian, some 375 million years ago. But how would nature have evolved on a larger planet? We are able to address this question simply in experiments using centrifuges. Based on these studies we have gained valuable insights in the physiological process in plants and animals. They adapt to a new steady state suitable for the high-g environments applied. Information on mammalian adaptations to hyper-g is interesting or may be even vital for human space exploration programs. It has been shown in long duration animal hypergravity studies, ranging from snails, rats to primates, that various structures like muscles, bones, neuro-vestibular, or the cardio-vascular system are affected. However, humans have never been exposed to a hyper-g environment for long durations. Centrifuge studies involving humans are mostly in the order of hours. The current work on human centrifuges are all focused on short arm systems to apply short periods of artificial gravity in support of long duration space missions in ISS or to Mars. In this paper we will address the possible usefulness of a large human centrifuge on Earth. In such a centrifuge a group of humans can be exposed to hypergravity for, in principle, an unlimited period of time like living on a larger planet. The input from a survey under scientists working in the field of gravitational physiology, but also other disciplines, will be discussed.

  19. Handbook of human computation

    CERN Document Server

    Michelucci, Pietro


    This volume addresses the emerging area of human computation, The chapters, written by leading international researchers, explore existing and future opportunities to combine the respective strengths of both humans and machines in order to create powerful problem-solving capabilities. The book bridges scientific communities, capturing and integrating the unique perspective and achievements of each. It coalesces contributions from industry and across related disciplines in order to motivate, define, and anticipate the future of this exciting new frontier in science and cultural evolution. Reade

  20. We Are Human Beings (United States)

    McGee, Andrew


    In this paper, I examine Jeff McMahan’s arguments for his claim that we are not human organisms, and the arguments of Derek Parfit to the same effect in a recent paper. McMahan uses these arguments to derive conclusions concerning the moral status of embryos and permanent vegetative state (PVS) patients. My claim will be that neither thinker has successfully shown that we are not human beings, and therefore these arguments do not establish the ethical conclusions that McMahan has sought to draw from the arguments in respect of the moral status of embryos and PVS patients. PMID:26810918

  1. Human Body Exergy Metabolism


    Mady, Carlos


    The exergy analysis of the human body is a tool that can provide indicators of health and life quality. To perform the exergy balance it is necessary to calculate the metabolism on an exergy basis, or metabolic exergy, although there is not yet consensus in its calculation procedure. Hence, the aim of this work is to provide a general method to evaluate this physical quantity for human body based on indirect calorimetry data. To calculate the metabolism on an exergy basis it is necessary to d...

  2. Business and Human Rights

    DEFF Research Database (Denmark)

    Buhmann, Karin


    This article analyses the United Nations (UN) Guidelines on Business and Human Rights adopted in 2011 by the UN Human Rights Council from the perspective of transnational business governance interactions (TBGI) analytical framework.1 The article identifies and discusses dimensions of interaction...... in several areas of relevance to transnational business governance interaction and indicates the relevance of the TBGI approach to public regulatory transnational business governance initiatives. The analysis of the Guiding Principles as interactional transnational business governance suggests that this form...... of governance offers prospects for public institutions as a means towards regulating global sustainability concerns....

  3. Ayahuasca and human destiny. (United States)

    McKenna, Dennis J


    In this essay, the author shares his personal reflections gleaned from a lifetime of research with ayahuasca, and speculates on the societal, political, planetary, and evolutionary implications of humanity's aeons-old symbiosis with this shamanic plant. The thesis is developed that at this critical historical juncture, ayahuasca has developed a strategy to broadcast its message to a wider world--a reflection of the urgent need to avert global ecological catastrophe. While ayahuasca has much to teach us, the critical question is, will humanity hear it, and heed it, in time?

  4. When computers were human

    CERN Document Server

    Grier, David Alan


    Before Palm Pilots and iPods, PCs and laptops, the term ""computer"" referred to the people who did scientific calculations by hand. These workers were neither calculating geniuses nor idiot savants but knowledgeable people who, in other circumstances, might have become scientists in their own right. When Computers Were Human represents the first in-depth account of this little-known, 200-year epoch in the history of science and technology. Beginning with the story of his own grandmother, who was trained as a human computer, David Alan Grier provides a poignant introduction to the wider wo

  5. Human Environmental Disease Network

    DEFF Research Database (Denmark)

    Taboureau, Olivier; Audouze, Karine


    During the past decades, many epidemiological, toxicological and biological studies have been performed to assess the role of environmental chemicals as potential toxicants for diverse human disorders. However, the relationships between diseases based on chemical exposure have been rarely studied...... by computational biology. We developed a human environmental disease network (EDN) to explore and suggest novel disease-disease and chemical-disease relationships. The presented scored EDN model is built upon the integration on systems biology and chemical toxicology using chemical contaminants information...

  6. Experimental headache in humans

    DEFF Research Database (Denmark)

    Iversen, Helle Klingenberg


    The need for valid human experimental models of headache is obvious. Several compounds have been proposed as headache-inducing agents, but only the nitroglycerin (NTG) model has been validated. In healthy subjects, intravenous infusions of the nitric oxide (NO) donor NTG induce a dose-dependent h......The need for valid human experimental models of headache is obvious. Several compounds have been proposed as headache-inducing agents, but only the nitroglycerin (NTG) model has been validated. In healthy subjects, intravenous infusions of the nitric oxide (NO) donor NTG induce a dose...

  7. On human health. (United States)

    van Spijk, Piet


    If it is true that health is a priority objective of medicine, then medical practice can only be successful if the meaning of the term "health" is known. Various attempts have been made over the years to define health. This paper proposes a new definition. In addition to current health concepts, it also takes into account the distinction between specifically human (great) health and health as the absence of disease and illness-i.e. small health. The feeling of leading a life that makes sense plays a key role in determining specifically human great health.

  8. The Humanities, Human Rights, and the Comparative Imagination


    McClennen, Sophia A.


    In her paper "The Humanities, Human Rights, and the Comparative Imagination" Sophia A. McClennen argues that understanding the relationship between culture and human rights depends on humanist perspectives attentive to the relationship between storytelling and identity, mass culture and ideology, text and audience, critical thinking and engaged citizenship. After briefly considering how the divide between the humanities and human rights advocates developed and how it might best be overcome, s...

  9. Human Modeling for Ground Processing Human Factors Engineering Analysis (United States)

    Stambolian, Damon B.; Lawrence, Brad A.; Stelges, Katrine S.; Steady, Marie-Jeanne O.; Ridgwell, Lora C.; Mills, Robert E.; Henderson, Gena; Tran, Donald; Barth, Tim


    There have been many advancements and accomplishments over the last few years using human modeling for human factors engineering analysis for design of spacecraft. The key methods used for this are motion capture and computer generated human models. The focus of this paper is to explain the human modeling currently used at Kennedy Space Center (KSC), and to explain the future plans for human modeling for future spacecraft designs

  10. Human Modeling For Ground Processing Human Factors Engineering Analysis (United States)

    Tran, Donald; Stambolian, Damon; Henderson, Gena; Barth, Tim


    There have been many advancements and accomplishments over that last few years using human modeling for human factors engineering analysis for design of spacecraft and launch vehicles. The key methods used for this are motion capture and computer generated human models. The focus of this paper is to explain the different types of human modeling used currently and in the past at Kennedy Space Center (KSC) currently, and to explain the future plans for human modeling for future spacecraft designs.

  11. Human Rights: The Essential Reference. (United States)

    Devine, Carol; Hansen, Carol Rae; Wilde, Ralph; Bronkhorst, Daan; Moritz, Frederic A.; Rolle, Baptiste; Sherman, Rebecca; Southard, Jo Lynn; Wilkinson, Robert; Poole, Hilary, Ed.

    This reference work documents the history of human rights theory, explains each article of the Universal Declaration of Human Rights, explores the contemporary human rights movement, and examines the major human rights issues facing the world today. This book is the first to combine historical and contemporary perspectives on these critical…

  12. Making IBM's Computer, Watson, Human (United States)

    Rachlin, Howard


    This essay uses the recent victory of an IBM computer (Watson) in the TV game, "Jeopardy," to speculate on the abilities Watson would need, in addition to those it has, to be human. The essay's basic premise is that to be human is to behave as humans behave and to function in society as humans function. Alternatives to this premise are considered…

  13. Humane Education and Global Education. (United States)

    Selby, David


    Presents and explains model representing four dimensions of global education: temporal, spatial, issues, and inner. Presents six principal areas covered by humane curricula; the relationships between humane education, environmental education, and human rights education; and two humane education activities for the secondary and elementary/secondary…

  14. Humanism in Education (United States)

    Armstrong, Michael


    This is the text of Michael Armstrong's address to the Brian Simon Centenary conference, held at the Institute of Education on 26 March 2015. Michael Armstrong celebrates the humanism that underlay Brian's belief in a common system of education, democratic and non-selective, and finds its counterpart in the creative practice of school children.

  15. Hauntings of Human Nature

    DEFF Research Database (Denmark)

    Clasen, Mathias


    The central conflicts of Stephen King’s horror novel The Shining are rooted in human nature and reflect evolutionarily recurrent adaptive problems—the problem of balancing conflicting evolved motives, such as motives for selfish status striving versus motives for affiliative nurturing behavior...

  16. Human Resource Outsourcing Success


    Hasliza Abdul-Halim; Elaine Ee; T. Ramayah; Noor Hazlina Ahmad


    The existing literature on partnership seems to take the relationship between partnership quality and outsourcing success for granted. Therefore, this article aims at examining the role of service quality in strengthening the relationship between partnership quality and human resource (HR) outsourcing success. The samples were obtained from 96 manufacturing organizations in Penang, Malaysia. The results showed that par...

  17. Computational human body models

    NARCIS (Netherlands)

    Wismans, J.S.H.M.; Happee, R.; Dommelen, J.A.W. van


    Computational human body models are widely used for automotive crashsafety research and design and as such have significantly contributed to a reduction of traffic injuries and fatalities. Currently crash simulations are mainly performed using models based on crash-dummies. However crash dummies

  18. Human mesenchymal stem cells

    DEFF Research Database (Denmark)

    Abdallah, Basem; Kassem, Moustapha


    introduced into clinical medicine in variety of applications and through different ways of administration. Here, we discuss approaches for isolation, characterization and directing differentiation of human mesenchymal stem cells (hMSC). An update of the current clinical use of the cells is also provided....

  19. Animal and human influenzas. (United States)

    Peiris, M; Yen, H-L


    Influenza type A viruses affect humans and other animals and cause significant morbidity, mortality and economic impact. Influenza A viruses are well adapted to cross species barriers and evade host immunity. Viruses that cause no clinical signs in wild aquatic birds may adapt in domestic poultry to become highly pathogenic avian influenza viruses which decimate poultry flocks. Viruses that cause asymptomatic infection in poultry (e.g. the recently emerged A/H7N9 virus) may cause severe zoonotic disease and pose a major pandemic threat. Pandemic influenza arises at unpredictable intervals from animal viruses and, in its global spread, outpaces current technologies for making vaccines against such novel viruses. Confronting the threat of influenza in humans and other animals is an excellent example of a task that requires a One Health approach. Changes in travel, trade in livestock and pets, changes in animal husbandry practices, wet markets and complex marketing chains all contribute to an increased risk of the emergence of novel influenza viruses with the ability to cross species barriers, leading to epizootics or pandemics. Coordinated surveillance at the animal- human interface for pandemic preparedness, risk assessment, risk reduction and prevention at source requires coordinated action among practitioners in human and animal health and the environmental sciences. Implementation of One Health in the field can be challenging because of divergent short-term objectives. Successful implementation requires effort, mutual trust, respect and understanding to ensure that long-term goals are achieved without adverse impacts on agricultural production and food security.

  20. Human social genomics. (United States)

    Cole, Steven W


    A growing literature in human social genomics has begun to analyze how everyday life circumstances influence human gene expression. Social-environmental conditions such as urbanity, low socioeconomic status, social isolation, social threat, and low or unstable social status have been found to associate with differential expression of hundreds of gene transcripts in leukocytes and diseased tissues such as metastatic cancers. In leukocytes, diverse types of social adversity evoke a common conserved transcriptional response to adversity (CTRA) characterized by increased expression of proinflammatory genes and decreased expression of genes involved in innate antiviral responses and antibody synthesis. Mechanistic analyses have mapped the neural "social signal transduction" pathways that stimulate CTRA gene expression in response to social threat and may contribute to social gradients in health. Research has also begun to analyze the functional genomics of optimal health and thriving. Two emerging opportunities now stand to revolutionize our understanding of the everyday life of the human genome: network genomics analyses examining how systems-level capabilities emerge from groups of individual socially sensitive genomes and near-real-time transcriptional biofeedback to empirically optimize individual well-being in the context of the unique genetic, geographic, historical, developmental, and social contexts that jointly shape the transcriptional realization of our innate human genomic potential for thriving.

  1. Assessment of human exposures

    Energy Technology Data Exchange (ETDEWEB)

    Lebret, E. [RIVM-National Inst. of Public Health and Environmental Protection (Netherlands)


    This article describes some of the features of the assessment of human exposure to environmental pollutants in epidemiological studies. Since exposure assessment in air pollution epidemiology studies typically involve professionals from various backgrounds, interpretation of a concepts like `exposure` may vary. A brief descriptions is therefore given by way of introduction

  2. Humanities Review Journal: Submissions

    African Journals Online (AJOL)

    Author Guidelines. Papers for Humanities Review Journal should be submitted in English and should not exceed 25 pages typed double-spaced on A4 paper. References should be listed alphabetically at the end of the paper. Two copies of the paper, plus a 3_ diskette in Microsoft Word should be submitted. Neither ...

  3. Human Learning and Memory (United States)

    Lieberman, David A.


    This innovative textbook is the first to integrate learning and memory, behaviour, and cognition. It focuses on fascinating human research in both memory and learning (while also bringing in important animal studies) and brings the reader up to date with the latest developments in the subject. Students are encouraged to think critically: key…

  4. Human Memory: The Basics (United States)

    Martinez, Michael E.


    The human mind has two types of memory: short-term and long-term. In all types of learning, it is best to use that structure rather than to fight against it. One way to do that is to ensure that learners can fit new information into patterns that can be stored in and more easily retrieved from long-term memory.

  5. Home heating & human health

    NARCIS (Netherlands)

    Jongeneel, Sophie


    Human health is influenced by pollutants in the air. Since people spend over 80% of their time indoors, indoor air quality may be more related to health problems than outdoor air qual-ity. Indoor air quality is deteriorating because of energy conservation

  6. Children Are Human Beings (United States)

    Bossard, James H. S.


    The basic assumption underlying this article is that the really significant changes in human history are those that occur, not in the mechanical gadgets which men use nor in the institutionalized arrangements by which they live, but in their attitudes and in the values which they accept. The revolutions of the past that have had the greatest…

  7. Is human fecundity changing?

    DEFF Research Database (Denmark)

    Smarr, Melissa M; Sapra, Katherine J; Gemmill, Alison


    Fecundity, the biologic capacity to reproduce, is essential for the health of individuals and is, therefore, fundamental for understanding human health at the population level. Given the absence of a population (bio)marker, fecundity is assessed indirectly by various individual-based (e.g. semen ...

  8. The Humanization of Science. (United States)

    Larson, James H.


    Describes an exercise which focuses on the ethical and human aspects of science. Outlines the approach and components of a writing assignment based on a literary and humanistic analysis of "The Double Helix" by James Watson. Provides sample questions and examples of integrative literary works. (ML)

  9. Dermatophilus congolensis human infection. (United States)

    Towersey, L; Martins, E de C; Londero, A T; Hay, R J; Soares Filho, P J; Takiya, C M; Martins, C C; Gompertz, O F


    Four cases of human dermatophilosis observed in Rio de Janeiro, Brazil, are reported. Data that suggest nail infection by Dermatophilus congolensis are presented. The clinical spectrum of the disease ranged from an asymptomatic infection to a pustular eruption. Our findings suggest that epidermal Langerhans cells play a role in the pathogenesis of the infection.

  10. Marketing Human Resource Development. (United States)

    Frank, Eric, Ed.


    Describes three human resource development activities: training, education, and development. Explains marketing from the practitioners's viewpoint in terms of customer orientation; external and internal marketing; and market analysis, research, strategy, and mix. Shows how to design, develop, and implement strategic marketing plans and identify…

  11. Human Work Interaction Design

    DEFF Research Database (Denmark)

    Lopes, Arminda; Ørngreen, Rikke

    This book constitutes the thoroughly refereed post-conference proceedings of the Third IFIP WG 13.6 Working Conference on Human Work Interaction Design, HWID 2012, held in Copenhagen, Denmark, in December 2012. The 16 revised papers presented were carefully selected for inclusion in this volume...

  12. Lessons in Human Relations. (United States)

    Glenn, Joanne Lozar


    Explores the importance of relationship literacy--the ability to create good relationships with others--in the next economy and offers perspectives on how business education instructors can help students develop and improve their human relations skills for business success. (Author/JOW)

  13. Journal of Humanities

    African Journals Online (AJOL)

    The Journal of Humanities is a theoretical journal which aims to challenge, provoke and excite thinking in the areas of the classics, fine performing arts, literature and orature, linguistics, theology and philosophy. The journal appears annually and is sponsored by the Research and Publications Committee of the Univeristy of ...

  14. Human paragonimiasis in Africa. (United States)

    Aka, N'Da A; Adoubryn, Koffi; Rondelaud, Daniel; Dreyfuss, Gilles


    An up-to-date review on human paragonimiasis in Africa was carried out to determine the current geographical distribution of human cases and analyze the animal reservoir, snails and crustaceans which intervene in the local life cycle of Paragonimus species. Two countries, i.e., Cameroon and Nigeria, were mainly affected by this disease, while the distribution of human cases in the other eight states of the intertropical zone was scattered. Infected patients were currently few in number and two Poragonimus species: P. africanus and P. uterobilateralis, were found. The animal reservoir is mainly constituted by crab-eating mammals. The identity of the host snail remains doubtful and was either a prosobranch, or a land snail. Seven crab species belonging to Callinectes, Liberonautes and Sudononautes genera are able to harbour paragonimid metacercariae. Due to the current low prevalence of human paragonimiasis recorded in Africa and the high cost of wide-scale screenings for this disease, training of technicians in anti-tuberculosis centers would be the most realistic attitude to detect mycobacteria and/or Paragonimus eggs during the same sputum examination.

  15. Oxytocin promotes human ethnocentrism

    NARCIS (Netherlands)

    de Dreu, C.K.W.; Greer, L.L.; van Kleef, G.A.; Shalvi, S.; Handgraaf, M.J.J.


    Human ethnocentrism—the tendency to view one's group as centrally important and superior to other groups—creates intergroup bias that fuels prejudice, xenophobia, and intergroup violence. Grounded in the idea that ethnocentrism also facilitates within-group trust, cooperation, and coordination, we

  16. Biotechnologies and Human Dignity (United States)

    Sweet, William; Masciulli, Joseph


    In this article, the authors review some contemporary cases where biotechnologies have been employed, where they have had global implications, and where there has been considerable debate. The authors argue that the concept of dignity, which lies at the center of such documents as the 2005 Universal Declaration on Bioethics and Human Rights, the…

  17. Radar: Human Safety Net (United States)

    Ritz, John M.


    Radar is a technology that can be used to detect distant objects not visible to the human eye. A predecessor of radar, called the telemobiloscope, was first used to detect ships in the fog in 1904 off the German coast. Many scientists have worked on the development and refinement of radar (Hertz with electromagnetic waves; Popov with determining…

  18. Superintelligence, Humans, and War (United States)


    artificial intelligence. “The Navy’s Aegis Combat System is a computerized command, decision, and weapon-control program conceived because humans were no...continues to invest in highly technological weapons systems ...perform tasks that were only imagined 10 years ago. For example, Apple’s Siri will provide answers to verbally asked questions. There are driving

  19. Antihumanism in the Humanities. (United States)

    Schwartz, Joel


    Analyzes the antihumanistic elements of Jacques Derrida's theory of deconstruction. Argues that the modern French intellectuals, including Foucault, Derrida, and Lacan, have had an antihumanistic effect on the American social sciences and humanities by rejecting the existence of truth, morality, and rationality. (FMW)

  20. Human Actions Made Tangible

    DEFF Research Database (Denmark)

    Buur, Jacob; Caglio, Agnese; Jensen, Lars Christian


    , a method developed to engage people from different backgrounds in collaboratively analysing videos with the help of physical objects. We will present one of these tools, Action Scrabble, for analysing temporal organisation of human actions. We work with a case of skilled forklift truck driving...

  1. Human-Centered Aspects

    NARCIS (Netherlands)

    Kulyk, Olga Anatoliyivna; Kosara, R.; Urquiza, J.; Wassink, I.; Kerren, A.; Ebert, A.; Meyer, J.


    Humans have remarkable perceptual capabilities. These capabilities are heavily underestimated in current visualizations. Often, this is due to the lack of an in-depth user study to set the requirements for optimal visualizations. The designer does not understand what kind of information should be

  2. Soil Borne Human Diseases

    NARCIS (Netherlands)

    Jeffery, Simon; Van der Putten, Wim H.


    Soils are home to a remarkable array of biodiversity with some estimates stating that 25% of the Earth’s species find their home in the soil. Of these organisms, the vast majority are not of any threat to human health, but rather function to provide numerous ecosystem services which emerge through

  3. Disability and Human Supports

    Directory of Open Access Journals (Sweden)

    Jeff McNair


    Full Text Available This article provides a brief overview of models of disability growing out of the field of disability studies and leading to a call for interventions going beyond a simply medical model approach. A brief discussion of human supports/services is provided such that readers engaged in the development of services/supports can base them on best principles.

  4. Structurally abnormal human autosomes

    Energy Technology Data Exchange (ETDEWEB)



    Chapter 25, discusses structurally abnormal human autosomes. This discussion includes: structurally abnormal chromosomes, chromosomal polymorphisms, pericentric inversions, paracentric inversions, deletions or partial monosomies, cri du chat (cat cry) syndrome, ring chromosomes, insertions, duplication or pure partial trisomy and mosaicism. 71 refs., 8 figs.

  5. Humane Treatment of Animals. (United States)

    Dawson, Joan Smithey

    This booklet is designed to give teachers resource information about the humane treatment of and care for animals. The topics are presented as springboards for discussion and class activity. Topics include the care of dogs, cats, birds, horses, and fish; wildlife and ecological relationships; and careers with animals. Illustrations on some pages…


    African Journals Online (AJOL)

    These researchers tested the effect of. Hallucinogenic ... stories illustrating human cruelty as well as strong advocacy for the ... Experiments must be strictly beneficial to individuals,their communities, or the society in general. Same experiments previously conducted on animals and the natural history of the disease must be ...

  7. "Healthy" Human Development Indices (United States)

    Engineer, Merwan; Roy, Nilanjana; Fink, Sari


    In the Human Development Index (HDI), life expectancy is the only indicator used in modeling the dimension "a long and healthy life". Whereas life expectancy is a direct measure of quantity of life, it is only an indirect measure of healthy years lived. In this paper we attempt to remedy this omission by introducing into the HDI the morbidity…

  8. Haptocorrin in humans

    DEFF Research Database (Denmark)

    Mørkbak, Anne Louise; Nexo, Ebba; Poulsen, Steen Seier


    knowledge concerning its function and its distribution in adult and foetal life is limited. In this study, we present data on the tissue expression of haptocorrin and on the relation between analogues on haptocorrin and vitamin B(12) status in humans. Methods: Polyclonal antibodies towards haptocorrin were...

  9. Cobalamin analogues in humans

    DEFF Research Database (Denmark)

    Hardlei, Tore Forsingdal; Obeid, Rima; Herrmann, Wolfgang


    BACKGROUND: Haptocorrin (HC) carries cobalamin analogues (CorA), but whether CorA are produced in the body is unknown. All cobalamins (Cbl) to the foetus are delivered by the Cbl-specific protein transcobalamin (TC), and therefore analysis of cord serum for CorA may help to clarify the origin of ......A in the human body are derived from Cbl....

  10. Studying Human Origins

    NARCIS (Netherlands)

    Corbey, Raymond; Roebroeks, Wil


    This history of human origin studies covers a wide range of disciplines. This important new study analyses a number of key episodes from palaeolithic archaeology, palaeoanthropology, primatology and evolutionary theory in terms of various ideas on how one should go about such reconstructions and

  11. Human memory search

    NARCIS (Netherlands)

    Davelaar, E.J.; Raaijmakers, J.G.W.; Hills, T.T.; Robbins, T.W.; Todd, P.M.


    The importance of understanding human memory search is hard to exaggerate: we build and live our lives based on what whe remember. This chapter explores the characteristics of memory search, with special emphasis on the use of retrieval cues. We introduce the dependent measures that are obtained

  12. Inconvenient Human Rights (United States)

    Ryan, Natasha


    Abstract Following an increase in Roma migration under the European “freedom of movement” laws, Swedish municipalities initiated more than 80 evictions of informal Roma settlements on the grounds of poor sanitation between 2013 and 2016. These evictions echo policies from earlier in the 20th century, when Roma living in Sweden were often marginalized through the denial of access to water and sanitation facilities. The recent Swedish evictions also follow similar government actions across Europe, where Roma settlements are controlled through the denial of access to water and sanitation. However, access to water and sanitation—central aspects of human health—are universal human rights that must be available to all people present in a jurisdiction, regardless of their legal status. The evictions described here violated Sweden’s obligations under both European and international human rights law. More positive government responses are required, such as providing shelters or camping sites, setting up temporary facilities, and directly engaging with communities to address water and sanitation issues. The authors conclude by providing guidance on how states and municipalities can meet their human rights obligations with respect to water and sanitation for vulnerable Roma individuals and informal settlements in their communities. PMID:29302163

  13. Selenium and Human Health

    Directory of Open Access Journals (Sweden)

    M Abedi


    Full Text Available Introduction: Selenium is an essential element for human health and it is toxic at high concentrations. Selenium is a constituent component of selenoproteins that have enzymatic and structural roles in human biochemistry. Selenium is a best antioxidant and catalyst for production of thyroid hormone. This element has the key role in the immune function; prevention of AIDS progression and the deactivity of toxins. Furthermore, selenium is essential for sperm motility and can reduce abortions. Selenium deficiency was also associated with adverse mood states. The findings regarding cardiovascular disease risk related to selenium deficiency is unclear, though other conditions such as vascular inflammation, oxidative stress and selenium deficiency can cause this disease too. Moreover, consuming of 60 mg of selenium per day may be associated with reduction of cancer risk. In this study, a review of studies has been performed on the biochemical function of selenium toxicity, and its effects on human health. Furthermore, certain identified cancers associated with selenium have been discussed to absorb more attention to the status of this element and also as a guide for further studies. Selenium plays the dual character (useful and harmful in human health, and then it is necessary to determine the concentration of this element in body fluids and tissues. An appropriate method for routine measurement of selenium in clinical laboratories is electro thermal atomic absorption spectrometry (ETAAS with very low detection limit and good precision.

  14. Cultivating human nature

    NARCIS (Netherlands)

    Derksen, Maarten


    Evolutionary psychology claims to offer a unified perspective on human nature and culture, which can serve to further the integration of psychology and the social sciences. I describe four approaches to evolutionary psychology, and note increasing attention to the agency of the individual in

  15. Pesticides and Human Health (United States)

    ... types of pesticides Disponible en español Pesticides and Human Health Pesticides have a specific purpose in society. Pesticides are ... aging populations may be more sensitive to the effects of pesticides than others. To reduce the risk of health problems from pesticides there are several things you ...

  16. Human oocyte cryopreservation. (United States)

    Tao, Tao; Zhang, Wenling; Del Valle, Alfonso


    This review summarized the clinical breakthroughs in the human oocyte cryopreservation field in the past 2 years and gave special emphasis on the role of vitrification method. Human oocyte cryopreservation is an attractive strategy to preserve female fertility, as it offers more opportunities to the future destination of the female gametes and also raises fewer legal and ethical questions compared with embryo cryopreservation. It became promising in recent years because of dramatic improvement in cryopreservation technologies. Human oocyte cryopreservation would not become a clinical routine until the availability of reliable cryopreservation methods and long-term follow-up results of the babies born by this technique. Oocyte cryopreservation produced very exciting results with pregnancy and implantation rates comparable to embryo cryopreservation and in some cases comparable to fresh in-vitro fertilization cycles with both modified slow-freezing and vitrification methods. A cancer patient conceived and delivered her own babies by this technology after recovery from the disease. Oocyte cryopreservation became a new focus in assisted reproductive technology. We witnessed the advanced development of human oocyte cryopreservation in the past years because of increasing demand, medically, legally and ethically, and also because of the dramatic improvement of the freezing technique. There is still a long way to go to integrate it into a routine clinical procedure to benefit more patients and encourage clinicians to follow the standard protocols.

  17. Human perspectives in horticulture (United States)

    Charles A. Lewis


    Gardening produces not only vegetables and flowers, but also social and behavioral benefits. In low-income housing sites in New York, Philadelphia, and Chicago, gardening programs have resulted in reduced vandalism, new neighborliness, cleaned and painted buildings and streets, and other improvements. The human response to plants, and the qualities of plants that...

  18. Human social genomics.

    Directory of Open Access Journals (Sweden)

    Steven W Cole


    Full Text Available A growing literature in human social genomics has begun to analyze how everyday life circumstances influence human gene expression. Social-environmental conditions such as urbanity, low socioeconomic status, social isolation, social threat, and low or unstable social status have been found to associate with differential expression of hundreds of gene transcripts in leukocytes and diseased tissues such as metastatic cancers. In leukocytes, diverse types of social adversity evoke a common conserved transcriptional response to adversity (CTRA characterized by increased expression of proinflammatory genes and decreased expression of genes involved in innate antiviral responses and antibody synthesis. Mechanistic analyses have mapped the neural "social signal transduction" pathways that stimulate CTRA gene expression in response to social threat and may contribute to social gradients in health. Research has also begun to analyze the functional genomics of optimal health and thriving. Two emerging opportunities now stand to revolutionize our understanding of the everyday life of the human genome: network genomics analyses examining how systems-level capabilities emerge from groups of individual socially sensitive genomes and near-real-time transcriptional biofeedback to empirically optimize individual well-being in the context of the unique genetic, geographic, historical, developmental, and social contexts that jointly shape the transcriptional realization of our innate human genomic potential for thriving.

  19. Human health and groundwater (United States)

    The high quality of most groundwaters, consequent upon the self-purification capacity of subsurface strata, has long been a key factor in human health and wellbeing. More than 50% of the world’s population now rely on groundwater for their supply of drinking water – and in most circumstances a prope...

  20. Haptic Physical Human Assistance

    NARCIS (Netherlands)

    Keemink, Arvid Quintijn Leon


    This dissertation covers three aspects of upper-extremity exoskeleton design: 1) Kinematics & motion: How to support the full range of motion of the human shoulder? We present a 2D visualization method that can show coupling between the range of motion (ROM) of rotations of the glenohumeral joint.

  1. Human Rights in Prisons

    DEFF Research Database (Denmark)

    Jefferson, Andrew M.; Gaborit, Liv Stoltze

    Drawing on participatory action research conducted in Sierra Leone, Kosovo and the Philippines, Human Rights in Prisons analyses encounters between rights-based non-governmental organisations and prisons. It explores the previously under-researched perspectives of prison staff and prisoners...

  2. Animal and Human Communication. (United States)

    Rummel, Lynda

    Several misconceptions regarding the status of human communication systems relative to the systems of other animals are discussed in this paper. Arguments are offered supporting the expansion of the communication discipline to include the study of the communication systems of other species. The "communicative continuity" view which ranks…

  3. Humane Education in Kindergarten (United States)

    Montgomery, Charlotte Baker


    Describes objectives and activities of a humane education program to teach kindergarten students to respect animals. Activities include daily manners practice, observation of nature, bringing animals to the classroom, field trips, and organizing a be kind to animals week. For journal availability, see SO 505 454. (Author/DB)

  4. Human Babesiosis, Bolivia, 2013. (United States)

    Gabrielli, Simona; Totino, Valentina; Macchioni, Fabio; Zuñiga, Freddy; Rojas, Patricia; Lara, Yuni; Roselli, Mimmo; Bartoloni, Alessandro; Cancrini, Gabriella


    To investigate human babesiosis in the Bolivian Chaco, in 2013 we tested blood samples from 271 healthy persons living in 2 rural communities in this region. Microscopy and PCR indicated that 3.3% of persons were positive for Babesia microti parasites (US lineage); seroprevalence was 45.7%. Appropriate screening should mitigate the risk for transfusion-associated babesiosis.

  5. Human-Robot Interaction (United States)

    Sandor, Aniko; Cross, E. Vincent, II; Chang, Mai Lee


    Human-robot interaction (HRI) is a discipline investigating the factors affecting the interactions between humans and robots. It is important to evaluate how the design of interfaces affect the human's ability to perform tasks effectively and efficiently when working with a robot. By understanding the effects of interface design on human performance, workload, and situation awareness, interfaces can be developed to appropriately support the human in performing tasks with minimal errors and with appropriate interaction time and effort. Thus, the results of research on human-robot interfaces have direct implications for the design of robotic systems. For efficient and effective remote navigation of a rover, a human operator needs to be aware of the robot's environment. However, during teleoperation, operators may get information about the environment only through a robot's front-mounted camera causing a keyhole effect. The keyhole effect reduces situation awareness which may manifest in navigation issues such as higher number of collisions, missing critical aspects of the environment, or reduced speed. One way to compensate for the keyhole effect and the ambiguities operators experience when they teleoperate a robot is adding multiple cameras and including the robot chassis in the camera view. Augmented reality, such as overlays, can also enhance the way a person sees objects in the environment or in camera views by making them more visible. Scenes can be augmented with integrated telemetry, procedures, or map information. Furthermore, the addition of an exocentric (i.e., third-person) field of view from a camera placed in the robot's environment may provide operators with the additional information needed to gain spatial awareness of the robot. Two research studies investigated possible mitigation approaches to address the keyhole effect: 1) combining the inclusion of the robot chassis in the camera view with augmented reality overlays, and 2) modifying the camera

  6. Cosmic Humanity: Utopia, Realities, Prospects


    Sergey Krichevsky


    The philosophical foundations of the theory and practice of the creation of cosmic humanity as a process of the evolution of human civilization, the emergence into space, with the prospect of resettlement outside the Earth are considered. There is a connection between myths, fantasies, ideas, concepts and projects aimed at the exploration of outer space, the creation of cosmic humanity. A new and voluminous definition of cosmic humanity in the evolutionary paradigm is given. Cosmic humanity i...

  7. Pragmatic Challenges to Human Rights

    DEFF Research Database (Denmark)

    Schaumburg-Müller, Sten


    Pragmatism offers a platform for posing relevant questions. This article uses a pragmatic point of departure to question a natural law conception of human rights and to take a closer look at three pressing human rights problems: The human rights situation in states with little or no state capacity......; the revision and adaptation of human rights law; and the not straightforward relationship betweemn human rights and democracy....

  8. International terrorism and human rights


    Gurská, Zuzana


    Summary: International Terrorism and Human Rights Key words: international terrorism, antiterrorist measures, human rights First part of the thesis is centered on characteristics of international terrorism, concept of human rights and three aspects of their mutual relationship: the immediate impact of terrorist attacks on human rights of their direct victims and the society as a whole and aspects linked to the states' response consisting of human rights breaches of suspects during repressive ...

  9. Human mammary microenvironment better regulates the biology of human breast cancer in humanized mouse model. (United States)

    Zheng, Ming-Jie; Wang, Jue; Xu, Lu; Zha, Xiao-Ming; Zhao, Yi; Ling, Li-Jun; Wang, Shui


    During the past decades, many efforts have been made in mimicking the clinical progress of human cancer in mouse models. Previously, we developed a human breast tissue-derived (HB) mouse model. Theoretically, it may mimic the interactions between "species-specific" mammary microenvironment of human origin and human breast cancer cells. However, detailed evidences are absent. The present study (in vivo, cellular, and molecular experiments) was designed to explore the regulatory role of human mammary microenvironment in the progress of human breast cancer cells. Subcutaneous (SUB), mammary fat pad (MFP), and HB mouse models were developed for in vivo comparisons. Then, the orthotopic tumor masses from three different mouse models were collected for primary culture. Finally, the biology of primary cultured human breast cancer cells was compared by cellular and molecular experiments. Results of in vivo mouse models indicated that human breast cancer cells grew better in human mammary microenvironment. Cellular and molecular experiments confirmed that primary cultured human breast cancer cells from HB mouse model showed a better proliferative and anti-apoptotic biology than those from SUB to MFP mouse models. Meanwhile, primary cultured human breast cancer cells from HB mouse model also obtained the migratory and invasive biology for "species-specific" tissue metastasis to human tissues. Comprehensive analyses suggest that "species-specific" mammary microenvironment of human origin better regulates the biology of human breast cancer cells in our humanized mouse model of breast cancer, which is more consistent with the clinical progress of human breast cancer.

  10. 8-Oxoguanine DNA glycosylase 1 (ogg1) maintains the function of cardiac progenitor cells during heart formation in zebrafish

    Energy Technology Data Exchange (ETDEWEB)

    Yan, Lifeng [State Key Laboratory of Reproductive Medicine, Institute of Toxicology, Nanjing Medical University, Nanjing 210029 (China); Key Laboratory of Modern Toxicology of Ministry of Education, School of Public Health, Nanjing Medical University, Nanjing 210029 (China); Zhou, Yong [Key Laboratory of Stem Cell Biology, Institute of Health Sciences, Shanghai Institutes for Biological Sciences, Chinese Academy of Sciences and Shanghai Jiao Tong University School of Medicine, Shanghai 200025 (China); Yu, Shanhe [Shanghai Institute of Hematology, RuiJin Hospital, Shanghai Jiao Tong University, School of Medicine, Shanghai 200025 (China); Ji, Guixiang [Nanjing Institute of Environmental Sciences/Key Laboratory of Pesticide Environmental Assessment and Pollution Control, Ministry of Environmental Protection, Nanjing 210042 (China); Wang, Lei [Key Laboratory of Stem Cell Biology, Institute of Health Sciences, Shanghai Institutes for Biological Sciences, Chinese Academy of Sciences and Shanghai Jiao Tong University School of Medicine, Shanghai 200025 (China); Liu, Wei [State Key Laboratory of Reproductive Medicine, Institute of Toxicology, Nanjing Medical University, Nanjing 210029 (China); Key Laboratory of Modern Toxicology of Ministry of Education, School of Public Health, Nanjing Medical University, Nanjing 210029 (China); Gu, Aihua, E-mail: [State Key Laboratory of Reproductive Medicine, Institute of Toxicology, Nanjing Medical University, Nanjing 210029 (China); Key Laboratory of Modern Toxicology of Ministry of Education, School of Public Health, Nanjing Medical University, Nanjing 210029 (China)


    Genomic damage may devastate the potential of progenitor cells and consequently impair early organogenesis. We found that ogg1, a key enzyme initiating the base-excision repair, was enriched in the embryonic heart in zebrafish. So far, little is known about DNA repair in cardiogenesis. Here, we addressed the critical role of ogg1 in cardiogenesis for the first time. ogg1 mainly expressed in the anterior lateral plate mesoderm (ALPM), the primary heart tube, and subsequently the embryonic myocardium by in situ hybridisation. Loss of ogg1 resulted in severe cardiac morphogenesis and functional abnormalities, including the short heart length, arrhythmia, decreased cardiomyocytes and nkx2.5{sup +} cardiac progenitor cells. Moreover, the increased apoptosis and repressed proliferation of progenitor cells caused by ogg1 deficiency might contribute to the heart phenotype. The microarray analysis showed that the expression of genes involved in embryonic heart tube morphogenesis and heart structure were significantly changed due to the lack of ogg1. Among those, foxh1 is an important partner of ogg1 in the cardiac development in response to DNA damage. Our work demonstrates the requirement of ogg1 in cardiac progenitors and heart development in zebrafish. These findings may be helpful for understanding the aetiology of congenital cardiac deficits. - Highlights: • A key DNA repair enzyme ogg1 is expressed in the embryonic heart in zebrafish. • We found that ogg1 is essential for normal cardiac morphogenesis in zebrafish. • The production of embryonic cardiomyocytes requires appropriate ogg1 expression. • Ogg1 critically regulated proliferation of cardiac progenitor cells in zebrafish. • foxh1 is a partner of ogg1 in the cardiac development in response to DNA damage.

  11. Protein X of hepatitis B virus: origin and structure similarity with the central domain of DNA glycosylase

    NARCIS (Netherlands)

    van Hemert, Formijn J.; van de Klundert, Maarten A. A.; Lukashov, Vladimir V.; Kootstra, Neeltje A.; Berkhout, Ben; Zaaijer, Hans L.


    Orthohepadnavirus (mammalian hosts) and avihepadnavirus (avian hosts) constitute the family of Hepadnaviridae and differ by their capability and inability for expression of protein X, respectively. Origin and functions of X are unclear. The evolutionary analysis at issue of X indicates that present

  12. The Universal Declaration on the Human Genome and Human Rights. (United States)

    Mayor, Federico


    Since 1985, UNESCO studies ethical questions arising in genetics. In 1992, I established the International Bioethics Committee at UNESCO with the mission to draft the Universal Declaration on the Human Genome and Human Rights, which was adopted by UNESCO in 1997 and the United Nations in 1998. The Declaration relates the human genome with human dignity, deals with the rights of the persons concerned by human genome research and provides a reference legal framework for both stimulating the ethical debate and the harmonization of the law worldwide, favouring useful developments that respect human dignity.

  13. Digitalization of the human mind

    Directory of Open Access Journals (Sweden)

    Mr.Sc. Drita Mehmeti


    Full Text Available The human faces with various problems already in its first steps in live, and carriers of such life situations are found in various ages which bring new currents in the way of life. Starting from the ancient Greek thought, the human and its mind made the centre of the world, already orienting the Western thought towards the study of the human mind (namely human reason, since it made the key tool for human survival. Although human problems have been discussed throughout various ages, they have not been able to resolve in full the human problems, and therefore, the same issues were taken by the representatives of the socalled “critical theory”, who used the theory to criticize the way of live Western civilization was offering, known as digitalization of the human mind. The human problems are addressed in a poly-dimensional manner. The factors affecting the human mind are: industrial civilization, technical progress, automation, overtly influence of machinery on humans, substitution of cultural values, which in sum have developed a new World Order, where the ruler is technology. In the modern world, the human fails to recognize himself, since he is out of himself and lives according to the rules set forth by the “remote control”. In the flow of this kind of livelihood, human alienates, or in other words, the human goes out of himself, trying to adapt maximally to the requirements of the new way of life.

  14. Human Integration Design Processes (HIDP) (United States)

    Boyer, Jennifer


    The purpose of the Human Integration Design Processes (HIDP) document is to provide human-systems integration design processes, including methodologies and best practices that NASA has used to meet human systems and human rating requirements for developing crewed spacecraft. HIDP content is framed around human-centered design methodologies and processes in support of human-system integration requirements and human rating. NASA-STD-3001, Space Flight Human-System Standard, is a two-volume set of National Aeronautics and Space Administration (NASA) Agency-level standards established by the Office of the Chief Health and Medical Officer, directed at minimizing health and performance risks for flight crews in human space flight programs. Volume 1 of NASA-STD-3001, Crew Health, sets standards for fitness for duty, space flight permissible exposure limits, permissible outcome limits, levels of medical care, medical diagnosis, intervention, treatment and care, and countermeasures. Volume 2 of NASASTD- 3001, Human Factors, Habitability, and Environmental Health, focuses on human physical and cognitive capabilities and limitations and defines standards for spacecraft (including orbiters, habitats, and suits), internal environments, facilities, payloads, and related equipment, hardware, and software with which the crew interfaces during space operations. The NASA Procedural Requirements (NPR) 8705.2B, Human-Rating Requirements for Space Systems, specifies the Agency's human-rating processes, procedures, and requirements. The HIDP was written to share NASA's knowledge of processes directed toward achieving human certification of a spacecraft through implementation of human-systems integration requirements. Although the HIDP speaks directly to implementation of NASA-STD-3001 and NPR 8705.2B requirements, the human-centered design, evaluation, and design processes described in this document can be applied to any set of human-systems requirements and are independent of reference

  15. Rendering Humanities Sustainable

    Directory of Open Access Journals (Sweden)

    Robert G. Bednarik


    Full Text Available Launching a journal intended to cover the entire humanities is certainly an audacious project, for two reasons at least. Firstly, this journal will be expected to cover much academic diversity, particularly by including the “social sciences.” However, in this time of rampant overspecialization, perhaps it is precisely such wholeness and breadth of vision that could become a journal’s strength. Secondly, since the viability of the humanities has been questioned from a number of perspectives it seems essential to meet these challenges by reinventing the discipline in response to issues raised—also a major task. It involves justifying the continuation of humanistic traditions. For this, humanists need to consider the nature of these challenges, understand and analyze them, and respond to them. It is therefore inevitable that a forward-looking, new journal in this discipline will deem it relevant to review these matters. [...

  16. Human biology of taste. (United States)

    Gravina, Stephen A; Yep, Gregory L; Khan, Mehmood


    Taste or gustation is one of the 5 traditional senses including hearing, sight, touch, and smell. The sense of taste has classically been limited to the 5 basic taste qualities: sweet, salty, sour, bitter, and umami or savory. Advances from the Human Genome Project and others have allowed the identification and determination of many of the genes and molecular mechanisms involved in taste biology. The ubiquitous G protein-coupled receptors (GPCRs) make up the sweet, umami, and bitter receptors. Although less clear in humans, transient receptor potential ion channels are thought to mediate salty and sour taste; however, other targets have been identified. Furthermore, taste receptors have been located throughout the body and appear to be involved in many regulatory processes. An emerging interplay is revealed between chemical sensing in the periphery, cortical processing, performance, and physiology and likely the pathophysiology of diseases such as diabetes.

  17. Human corneal epithelial subpopulations

    DEFF Research Database (Denmark)

    Søndergaard, Chris Bath


    subpopulations in human corneal epithelium using a combination of laser capture microdissection and RNA sequencing for global transcriptomic profiling. We compared dissociation cultures, using either expansion on γ-irradiated NIH/3T3 feeder cells in serum-rich medium or expansion directly on plastic in serum......-free EpiLife medium, using a range of physiologically relevant oxygen concentrations (2%, 5%, 10%, 15% and 20%). Using immunocytochemistry and advanced fluorescence microscopy, cells were characterized regarding growth, cell cycle distribution, colony-forming efficiency (CFE), phenotypes...... was not dependent on the system used for propagation (Bath et al. 2013a). Laser capture microdissection was used to isolate cellular subpopulations in situ from the spatially defined differentiation pathway in human corneal epithelium according to an optimized protocol for maintenance of expression profiles...

  18. Human spinal motor control

    DEFF Research Database (Denmark)

    Nielsen, Jens Bo


    interneurons and exert a direct (willful) muscle control with the aid of a context-dependent integration of somatosensory and visual information at cortical level. However, spinal networks also play an important role. Sensory feedback through spinal circuitries is integrated with central motor commands...... and contributes importantly to the muscle activity underlying voluntary movements. Regulation of spinal interneurons is used to switch between motor states such as locomotion (reciprocal innervation) and stance (coactivation pattern). Cortical regulation of presynaptic inhibition of sensory afferents may focus...... the central motor command by opening or closing sensory feedback pathways. In the future, human studies of spinal motor control, in close collaboration with animal studies on the molecular biology of the spinal cord, will continue to document the neural basis for human behavior. Expected final online...

  19. Sleep and Human Aging. (United States)

    Mander, Bryce A; Winer, Joseph R; Walker, Matthew P


    Older adults do not sleep as well as younger adults. Why? What alterations in sleep quantity and quality occur as we age, and are there functional consequences? What are the underlying neural mechanisms that explain age-related sleep disruption? This review tackles these questions. First, we describe canonical changes in human sleep quantity and quality in cognitively normal older adults. Second, we explore the underlying neurobiological mechanisms that may account for these human sleep alterations. Third, we consider the functional consequences of age-related sleep disruption, focusing on memory impairment as an exemplar. We conclude with a discussion of a still-debated question: do older adults simply need less sleep, or rather, are they unable to generate the sleep that they still need? Copyright © 2017. Published by Elsevier Inc.

  20. Posthumanism: beyond humanism? (United States)

    Valera, Luca


    The focal point of posthumanism consists not as such in an a-critical acceptance of the technological promises - like there is for transhumanism - but in a total contamination and hybridization of human beings with other living beings and machines (these are the two main forms of contamination). The change of perspective untaken by posthumanism would be, thus, a paradigmatic shift in anthropology. As with ecologism, posthumanism, in order to obtain total contamination and man's openness to otherness, proposes the elimination and the fluidification of boundaries, thus even denying man's identity, and, with it, the very possibility of openness. However, by denying the identity, one denies the condition of possibility of thought, just as it has been manifested in history until now: hence we understand how, primarily, posthumanism is not configured as an adequate philosophical reflection, but as a narrative that takes origin from certain requirements, which are eminently human, and that discloses its deeply anthropogenic roots.

  1. Human freedom and enhancement. (United States)

    Heilinger, Jan-Christoph; Crone, Katja


    Ideas about freedom and related concepts like autonomy and self-determination play a prominent role in the moral debate about human enhancement interventions. However, there is not a single understanding of freedom available, and arguments referring to freedom are simultaneously used to argue both for and against enhancement interventions. This gives rise to misunderstandings and polemical arguments. The paper attempts to disentangle the different distinguishable concepts, classifies them and shows how they relate to one another in order to allow for a more structured and clearer debate. It concludes in identifying the individual underpinnings and the social conditions of choice and decision-making as particularly salient dimensions of freedom in the ethical debate about human enhancement.

  2. Human Cytomegalovirus Persistence


    Goodrum, Felicia; Caviness, Katie; Zagallo, Patricia


    Viral persistence is the rule following infection with all herpesviruses. The β-herpesvirus, human cytomegalovirus (HCMV), persists through chronic and latent states of infection. Both the chronic and latent states of infection contribute to HCMV persistence and to the high HCMV seroprevalence worldwide. The chronic infection is poorly defined molecularly, but clinically manifests as low-level virus shedding over extended periods of time and often in the absence of symptoms. Latency requires ...

  3. Neanderthals and Modern Humans (United States)

    Finlayson, Clive


    The Neanderthals were a people native to Europe during the Pleistocene period, who became extinct between forty and thirty thousand years ago. Challenging the commonly held view that extinction was caused by the arrival of our ancestors, Clive Finlayson provides evidence that their extinction actually occurred because the Neanderthals could not adapt fast enough to changing ecological and environmental conditions, not their relationship with modern humans.

  4. The Human Body Sword

    Directory of Open Access Journals (Sweden)

    Kris Borer


    Full Text Available The human body shield problem involves an apparent dilemma for a libertarian, forcing him to choose between his own death and the death of an innocent person. This paper argues that the non-aggression principle permits a forceful response against the property of innocent individuals when a conflict is initiated with that property. In other words, a libertarian may shoot the hostage in order to save himself.

  5. Wilhelm Roepke: Economic humanism

    Directory of Open Access Journals (Sweden)

    Stojanović Božo


    Full Text Available The paper presents the basic ideas of the great German thinker Wilhelm Roepke advocated a free market acting in a particular social context (comprising of market insti­tutions, and a particular system of values created within the society and not by the market itself. He substantiated why free market economy has to be supplemented with a particular social ethics. He argued in favor of a society that defends and advances human liberty.

  6. Glycogen metabolism in humans ? ??


    Adeva-Andany, María M.; González-Lucán, Manuel; Donapetry-García, Cristóbal; Fernández-Fernández, Carlos; Ameneiros-Rodríguez, Eva


    In the human body, glycogen is a branched polymer of glucose stored mainly in the liver and the skeletal muscle that supplies glucose to the blood stream during fasting periods and to the muscle cells during muscle contraction. Glycogen has been identified in other tissues such as brain, heart, kidney, adipose tissue, and erythrocytes, but glycogen function in these tissues is mostly unknown. Glycogen synthesis requires a series of reactions that include glucose entrance into the cell through...

  7. Decoding the human genome

    CERN Multimedia

    CERN. Geneva. Audiovisual Unit; Antonerakis, S E


    Decoding the Human genome is a very up-to-date topic, raising several questions besides purely scientific, in view of the two competing teams (public and private), the ethics of using the results, and the fact that the project went apparently faster and easier than expected. The lecture series will address the following chapters: Scientific basis and challenges. Ethical and social aspects of genomics.

  8. Human Hearing Loss


    Ware, Stacy Lee


    Hearing loss affects as much as 5% of the global human population and its negative consequences, often exacerbated by cultural bias or distributive injustice, include delayed cognitive and language development, learning deficits and poor academic performance, chronic unemployment and dependency, poverty, elevated risk of harm and poor health. This paper is based on a review of the academic literature as well as other credible published resources to identify the principal causes of hearing los...

  9. Post-human Viewing

    DEFF Research Database (Denmark)

    Blaagaard, Bolette


    This article discusses the relationship between theories of photography and mobile phone footage. In doing so, it asks if theories of photography still apply in a technologically saturated world of imagery. Technology is an increasingly important part of viewing imagery today and enables imagery ...... implications. The author takes photojournalism and, in particular, mobile phone footage as a starting point for an exploration of the (post-human) body as evidence and sign of authenticity in the modern age of digital communications and journalism....

  10. Human resource management


    Balážová, Barbora


    Human resource management is currently regarded as one of the most important areas of management of the organization. Its task is to ensure and maintain sufficient number of skilled and motivated employees and their optimum use to achieve the planned prosperity and competitiveness of the organization. This task is pursued through partial personnel activities (the creation and analysis of jobs, personnel planning, acquisition, selection, recruitment and orientation of staff, evaluation and com...

  11. Human Resource Management Roles


    Tamara R. Mitchell


    The roles of Human Resource and Management play a vital role in the success of the organization. Internal recruitment is more valuable than external recruitment because it is less expensive, the employee’s skills are well known and companies that do internal recruitment have an important tool to boost morale in the organization. Performance management is an important part of an organization. The most important thing is that it strengthens the supervisor and employee relationship and promotes ...

  12. Human health and groundwater


    Candela Lledó, Lucila


    Strategic overview series of the International Association of Hydrogeologists-IAH. This Series is designed both to inform professionals in other sectors of key interactions with groundwater resources and hydrogeological science, and to guide IAH members in their outreach to related sectors. The naturally high microbiological and chemical quality of groundwater, captured at springheads and in shallow galleries and dugwells, has been vital for human survival, wellbeing and development from o...

  13. The effects of human resource flexibility on human resources development

    Directory of Open Access Journals (Sweden)

    SeidMehdi Veise


    Full Text Available Human resources are the primary factor for development of competitiveness and innovation and reaching competitive advantage and they try to improve corporate capabilities through various characteristics such as value creation, scarcity and difficulty of imitation. This paper investigates the effect of human resource flexibility and its dimensions on human resource development and its dimensions. The survey was conducted using descriptive-correlation method that intended to describe how human resource flexibility was effective on human resource development. Questionnaire was tool of data collection. The statistical population included one hundred employees of the Electric Company in Ilam province, thus census method was used. Reliability of the questionnaire was measured via Cronbach's alpha equal to 0.96. The findings revealed that flexibility and its dimensions were effective on human resource development and dimensions of it. As a result, human resource flexibility should be considered for development of human resources and employees with the highest flexibility should be selected.

  14. Human parasitology worldwide research. (United States)

    Garrido-Cardenas, Jose Antonio; Mesa-Valle, Concepción; Manzano-Agugliaro, Francisco


    In this article, the trends in human parasitology have been studied through the analysis of the number of publications in this area. The parameters studied were: number of articles, language, countries and institutions with the highest number of publications, and keywords with greater presence in the articles of human parasitology. The results of the analysis confirm the growing interest in this area, observing an exponential growth in the number of publications in the last decades. We also verified that the main country in terms of scientific production is the USA, although among the most important institutions, we find non-US centres such as the Oswaldo Cruz Foundation and the London School of Hygiene and Tropical Medicine. For observing the relative importance of the journals that publish articles in this specific topic, an index has been created based on the h-index of the journal with publications related to human parasitology and divided by every 100 items. This rank is led fist by 'Journal of Medical Entomology' closely followed by 'Parasitology'. The analysis of the keywords allows to draw conclusions about the great importance of malaria in the current world research. A change in analytical methodology is also observed, and molecular techniques are now being imposed. These techniques, in the near future, have to influence in an improvement in the treatments and prevention of the diseases caused by parasites. Finally, it can be seen that diseases traditionally studied as helminthiasis and amebiasis are currently as well studied as others such as toxoplasmosis or leishmaniasis.

  15. Mapping the human genome

    Energy Technology Data Exchange (ETDEWEB)

    Cantor, Charles R.


    The following pages aim to lay a foundation for understanding the excitement surrounding the ''human genome project,'' as well as to convey a flavor of the ongoing efforts and plans at the Human Genome Center at the Lawrence Berkeley Laboratory. Our own work, of course, is only part of a broad international effort that will dramatically enhance our understanding of human molecular genetics before the end of this century. In this country, the bulk of the effort will be carried out under the auspices of the Department of Energy and the National Institutes of Health, but significant contributions have already been made both by nonprofit private foundations and by private corporation. The respective roles of the DOE and the NIH are being coordinated by an inter-agency committee, the aims of which are to emphasize the strengths of each agency, to facilitate cooperation, and to avoid unnecessary duplication of effort. The NIH, for example, will continue its crucial work in medical genetics and in mapping the genomes of nonhuman species. The DOE, on the other hand, has unique experience in managing large projects, and its national laboratories are repositories of expertise in physics, engineering, and computer science, as well as the life sciences. The tools and techniques the project will ultimately rely on are thus likely to be developed in multidisciplinary efforts at laboratories like LBL. Accordingly, we at LBL take great pride in this enterprise -- an enterprise that will eventually transform our understanding of ourselves.

  16. Human Melia azedarach poisoning. (United States)

    Phua, Dong Haur; Tsai, Wei-Jen; Ger, Jiin; Deng, Jou-Fang; Yang, Chen-Chang


    In traditional Chinese medicine, Melia azedarach (Ku-lian) is used orally and topically as an antiparasitic and antifungal agent. Although toxicity of this plant has been widely described in veterinary literature, human poisoning is rarely reported. We describe five patients with M. azedarach poisoning who recovered with supportive care. Five patients were identified retrospectively from the database of the Taiwan National Poison Center at the Taipei Veterans General Hospital. Three cases were on-site patients, and two were telephone consultations from outside hospitals. Neurological symptoms were the major manifestation in four cases: weakness, myalgia, numbness, and ptosis. Treatment was symptomatic and supportive; all patients recovered without sequelae. It is not known which limonoids are responsible for human toxicity. In the Chinese medical literature, human M. azedarach poisoning is said to occur if six to nine fruits, 30 to 40 seeds, or 400 g of the bark is consumed. Onset of symptoms typically occurs within 4-6 h, but as short as 0.5 h had been documented. In our patients, the onset of M. azedarach poisoning was variable, ranging from a few hours to up to 3 weeks after consumption of the herb. M. azedarach poisoning may result in gastrointestinal, cardiovascular, respiratory, or neurological effects, and death in severe cases.

  17. Human innate lymphoid cells. (United States)

    Mjösberg, Jenny; Spits, Hergen


    Innate lymphoid cells (ILCs) are increasingly acknowledged as important mediators of immune homeostasis and pathology. ILCs act as early orchestrators of immunity, responding to epithelium-derived signals by expressing an array of cytokines and cell-surface receptors, which shape subsequent immune responses. As such, ILCs make up interesting therapeutic targets for several diseases. In patients with allergy and asthma, group 2 innate lymphoid cells produce high amounts of IL-5 and IL-13, thereby contributing to type 2-mediated inflammation. Group 3 innate lymphoid cells are implicated in intestinal homeostasis and psoriasis pathology through abundant IL-22 production, whereas group 1 innate lymphoid cells are accumulated in chronic inflammation of the gut (inflammatory bowel disease) and lung (chronic obstructive pulmonary disease), where they contribute to IFN-γ-mediated inflammation. Although the ontogeny of mouse ILCs is slowly unraveling, the development of human ILCs is far from understood. In addition, the growing complexity of the human ILC family in terms of previously unrecognized functional heterogeneity and plasticity has generated confusion within the field. Here we provide an updated view on the function and plasticity of human ILCs in tissue homeostasis and disease. Copyright © 2016 American Academy of Allergy, Asthma & Immunology. Published by Elsevier Inc. All rights reserved.

  18. Psychophysics of human echolocation. (United States)

    Schörnich, Sven; Wallmeier, Ludwig; Gessele, Nikodemus; Nagy, Andreas; Schranner, Michael; Kish, Daniel; Wiegrebe, Lutz


    The skills of some blind humans orienting in their environment through the auditory analysis of reflections from self-generated sounds have received only little scientific attention to date. Here we present data from a series of formal psychophysical experiments with sighted subjects trained to evaluate features of a virtual echo-acoustic space, allowing for rigid and fine-grain control of the stimulus parameters. The data show how subjects shape both their vocalisations and auditory analysis of the echoes to serve specific echo-acoustic tasks. First, we show that humans can echo-acoustically discriminate target distances with a resolution of less than 1 m for reference distances above 3.4 m. For a reference distance of 1.7 m, corresponding to an echo delay of only 10 ms, distance JNDs were typically around 0.5 m. Second, we explore the interplay between the precedence effect and echolocation. We show that the strong perceptual asymmetry between lead and lag is weakened during echolocation. Finally, we show that through the auditory analysis of self-generated sounds, subjects discriminate room-size changes as small as 10%.In summary, the current data confirm the practical efficacy of human echolocation, and they provide a rigid psychophysical basis for addressing its neural foundations.

  19. Human viruses and cancer. (United States)

    Morales-Sánchez, Abigail; Fuentes-Pananá, Ezequiel M


    The first human tumor virus was discovered in the middle of the last century by Anthony Epstein, Bert Achong and Yvonne Barr in African pediatric patients with Burkitt's lymphoma. To date, seven viruses -EBV, KSHV, high-risk HPV, MCPV, HBV, HCV and HTLV1- have been consistently linked to different types of human cancer, and infections are estimated to account for up to 20% of all cancer cases worldwide. Viral oncogenic mechanisms generally include: generation of genomic instability, increase in the rate of cell proliferation, resistance to apoptosis, alterations in DNA repair mechanisms and cell polarity changes, which often coexist with evasion mechanisms of the antiviral immune response. Viral agents also indirectly contribute to the development of cancer mainly through immunosuppression or chronic inflammation, but also through chronic antigenic stimulation. There is also evidence that viruses can modulate the malignant properties of an established tumor. In the present work, causation criteria for viruses and cancer will be described, as well as the viral agents that comply with these criteria in human tumors, their epidemiological and biological characteristics, the molecular mechanisms by which they induce cellular transformation and their associated cancers.

  20. Human Viruses and Cancer

    Directory of Open Access Journals (Sweden)

    Abigail Morales-Sánchez


    Full Text Available The first human tumor virus was discovered in the middle of the last century by Anthony Epstein, Bert Achong and Yvonne Barr in African pediatric patients with Burkitt’s lymphoma. To date, seven viruses -EBV, KSHV, high-risk HPV, MCPV, HBV, HCV and HTLV1- have been consistently linked to different types of human cancer, and infections are estimated to account for up to 20% of all cancer cases worldwide. Viral oncogenic mechanisms generally include: generation of genomic instability, increase in the rate of cell proliferation, resistance to apoptosis, alterations in DNA repair mechanisms and cell polarity changes, which often coexist with evasion mechanisms of the antiviral immune response. Viral agents also indirectly contribute to the development of cancer mainly through immunosuppression or chronic inflammation, but also through chronic antigenic stimulation. There is also evidence that viruses can modulate the malignant properties of an established tumor. In the present work, causation criteria for viruses and cancer will be described, as well as the viral agents that comply with these criteria in human tumors, their epidemiological and biological characteristics, the molecular mechanisms by which they induce cellular transformation and their associated cancers.

  1. Science and Human Experience (United States)

    Cooper, Leon N.


    Part I. Science and Society: 1. Science and human experience; 2. Does science undermine our values?; 3. Can science serve mankind?; 4. Modern science and contemporary discomfort: metaphor and reality; 5. Faith and science; 6. Art and science; 7. Fraud in science; 8. Why study science? The keys to the cathedral; 9. Is evolution a theory? A modest proposal; 10. The silence of the second; 11. Introduction to Copenhagen; 12. The unpaid debt; Part II. Thought and Consciousness: 13. Source and limits of human intellect; 14. Neural networks; 15. Thought and mental experience: the Turing test; 16. Mind as machine: will we rubbish human experience?; 17. Memory and memories: a physicist's approach to the brain; 18. On the problem of consciousness; Part III. On the Nature and Limits of Science: 19. What is a good theory?; 20. Shall we deconstruct science?; 21. Visible and invisible in physical theory; 22. Experience and order; 23. The language of physics; 24. The structure of space; 25. Superconductivity and other insoluble problems; 26. From gravity to light and consciousness: does science have limits?

  2. Human prion diseases. (United States)

    Thakur, Rajeev; Vincent, Yasmeen Marbaniang; Chaturvedi, Sujata


    Prion diseases is another name for a group of 'transmissible spongiform encephalopathies'. Creutzfeldt-Jakob disease, the first prion disease described in humans, occurs in sporadic, familial or iatrogenic form. Other transmissible spongiform encephalopathies in humans such as familial Creutzfeldt-]akob disease, Gerstmann-Sträussler-Scheinker disease and fatal familial Insomnia have been shown to be associated with specific prion protein gene mutations. In 1996, a new variant of Creutzfeldt-Jakob disease was reported in the United Kingdom among young patients with unusual clinical features and unique neuropathological findings. This new form could be due to transmission to humans of the agent causing bovine spongiform encephalopathy. While examination of brain tissue is the key to making a diagnosis, it is not always possible antemortem. Immunological tests such as ELISA or western blot assays along with tests for 1 4-3-3 protein in the cerebrospinal fluid remain the main tools of diagnosis. Conventional disinfection and sterilization practices are Ineffective for these agents. The unusual properties of prions pose a challenge for treatment, surveillance and control of these diseases.

  3. Computing human image annotation. (United States)

    Channin, David S; Mongkolwat, Pattanasak; Kleper, Vladimir; Rubin, Daniel L


    An image annotation is the explanatory or descriptive information about the pixel data of an image that is generated by a human (or machine) observer. An image markup is the graphical symbols placed over the image to depict an annotation. In the majority of current, clinical and research imaging practice, markup is captured in proprietary formats and annotations are referenced only in free text radiology reports. This makes these annotations difficult to query, retrieve and compute upon, hampering their integration into other data mining and analysis efforts. This paper describes the National Cancer Institute's Cancer Biomedical Informatics Grid's (caBIG) Annotation and Image Markup (AIM) project, focusing on how to use AIM to query for annotations. The AIM project delivers an information model for image annotation and markup. The model uses controlled terminologies for important concepts. All of the classes and attributes of the model have been harmonized with the other models and common data elements in use at the National Cancer Institute. The project also delivers XML schemata necessary to instantiate AIMs in XML as well as a software application for translating AIM XML into DICOM S/R and HL7 CDA. Large collections of AIM annotations can be built and then queried as Grid or Web services. Using the tools of the AIM project, image annotations and their markup can be captured and stored in human and machine readable formats. This enables the inclusion of human image observation and inference as part of larger data mining and analysis activities.

  4. Human Provenancing: It's Elemental… (United States)

    Meier-Augenstein, Wolfram; Kemp


    Forensic science already uses a variety of methods often in combination to determine a deceased person's identity if neither personal effects nor next of kin (or close friends) can positively identify the victim. While disciplines such as forensic anthropology are able to work from a blank canvass as it were and can provide information on age, gender and ethnical grouping, techniques such as DNA profiling do rely on finding a match either in a database or a comparative sample presumed to be an ante-mortem sample of the victim or from a putative relation. Chances for either to succeed would be greatly enhanced if information gained from a forensic anthropological examination and, circumstances permitting a facial reconstruction could be linked to another technique that can work from a blank canvass or at least does not require comparison to a subject specific database. With the help of isotope ratio mass spectrometry even the very atoms from which a body is made can be used to say something about a person that will help to focus human identification using traditional techniques such as DNA, fingerprints and odontology. Stable isotope fingerprinting works on the basis that almost all chemical elements and in particular the so-called light elements such as carbon (C) that comprise most of the human body occur naturally in different forms, namely isotopes. 2H isotope abundance values recorded by the human body through food and drink ultimately reflect averaged isotopic composition of precipitation or ground water. Stable isotope analysis of 2H isotopic composition in different human tissue such as hair, nails, bone and teeth enables us to construct a time resolved isotopic profile or ‘fingerprint' that may not necessarily permit direct identification of a murder victim or mass disaster victim but in conjunction with forensic anthropological information will provide sufficient intelligence to construct a profile for intelligence lead identification stating where a

  5. Human bite and human immune deficiency virus (HIV) transmission ...

    African Journals Online (AJOL)

    Background: The concentration of human immune deficiency virus (HIV) in the saliva of a carrier is low. As a result, human bite is not considered the traditional route of HIV infection transmission. Aim: To report a case of HIV sero-positivity following a human bite. Setting: University of Port Harcourt Teaching Hospital, Port ...

  6. Animal continuities. Arguments against human/non-human animal dichotomy

    Directory of Open Access Journals (Sweden)

    Javier Ignacio Vernal


    Full Text Available At present, there is still a deep need to differentiate the members of the species Homo sapiens from the individuals belonging to the rest of the animal kingdom. As a consequence of this need arises the dichotomy human/non-human animal based on artificial and groundless differences that leads to actions always harmful to the non-human animals. In this work we want to show, on the one hand, that many of the characteristics proposed as specifically human are shared by at least some non-human animal species, and on the other hand, that specifically human characteristics do exist, but from this fact does not follow that we should draw a sharp line between human and non-human animals. We reject the speciesist and segregationist perspective that establishes that only human beings possess a singular position in nature. Every animal species has its own characteristics and, therefore, there would be no place for a human exception, but there would be as many exceptions as animal species exist in the nature. Instead of the abyss established between human animals and non-human animals, we defend the perspective of the animal continuum, which allows recognizing the characteristics that we share with other animal species and, therefore, promotes the end of the speciesism.

  7. Victim and the victor: Humanism and new humanism in Chris ...

    African Journals Online (AJOL)

    On New Humanism and Broken Chains, the paper affirms that Humanity's dualism is the central tenet of New Humanism. The chains of fornication and adultery of victims like Dr Imasuen, Dr Osaze, Blossom, Daisy and Tonia were only broken and they became victors when they repented of their sins and accepted God's ...

  8. Human to human transmission of arthropod-borne pathogens

    NARCIS (Netherlands)

    Martina, Byron E.; Barzon, Luisa; Pijlman, Gorben P.; Fuente, de la José; Rizzoli, Annapaola; Wammes, Linda J.; Takken, Willem; Rij, van Ronald P.; Papa, Anna


    Human-to-human (H2H) transmitted arthropod-borne pathogens are a growing burden worldwide, with malaria and dengue being the most common mosquito-borne H2H transmitted diseases. The ability of vectors to get infected by humans during a blood meal to further propel an epidemic depends on complex

  9. Human to human transmission of arthropod-borne pathogens

    NARCIS (Netherlands)

    Martina, B.E.; Barzon, L.; Pijlman, G.P.; Fuente, J. de la; Rizzoli, A.; Wammes, L.J.; Takken, W.; Rij, R.P. van; Papa, A.


    Human-to-human (H2H) transmitted arthropod-borne pathogens are a growing burden worldwide, with malaria and dengue being the most common mosquito-borne H2H transmitted diseases. The ability of vectors to get infected by humans during a blood meal to further propel an epidemic depends on complex

  10. Human Resource Management and Human Resource Development: Evolution and Contributions (United States)

    Richman, Nicole


    Research agrees that a high performance organization (HPO) cannot exist without an elevated value placed on human resource management (HRM) and human resource development (HRD). However, a complementary pairing of HRM and HRD has not always existed. The evolution of HRD from its roots in human knowledge transference to HRM and present day HRD…

  11. Human dignity according to international instruments on human rights

    Directory of Open Access Journals (Sweden)

    José Pablo Alzina de Aguilar


    Full Text Available According to international instruments on human rights, the dignity of the human person is the foundation of human rights, and both human dignity and human rights are inherent to the human being, universal and inviolable. This understanding of human dignity is not a fruitless truism, but the solid foundation on which to build a world community under the rule of the new ius gentium: the International Law for Humankind. Moreover, it is the clue to answer many questions raised by the new world of globalization and of the exponential growth of international rules.Consequently, there is a need to a common doctrine on a notion of human dignity which will allow the implementation and adjudication of the aforementioned instruments, at the service of the human person and in conformity with the juridical conscience which they reflect. Philosophy of Law concepts which can be traced back to Aristotle provide that notion. According to these concepts, the demanding nature of “human dignity” sustains the notion of “legal personhood”, and both notions pertain to the realm of Law and Right, not of Morale and Values. Thus, human dignity and human rights are and must be, respectively, a basic principle and a necessary part of any Law system, including international law

  12. Human-Centered Computing: Toward a Human Revolution


    Jaimes, Alejandro; Gatica-Perez, Daniel; Sebe, Nicu; Huang, Thomas S.


    Human-centered computing studies the design, development, and deployment of mixed-initiative human-computer systems. HCC is emerging from the convergence of multiple disciplines that are concerned both with understanding human beings and with the design of computational artifacts.

  13. The Humanization of Information Science (United States)

    Elman, Stanley A.


    Information science is presently a mechanistic discipline which needs to be humanized. There must be more communication between librarians and information scientists, perhaps through seminars and exchanges, to bring the advantages of computerization to bear on human needs. (LS)

  14. Administrative Aspects of Human Experimentation. (United States)

    Irvine, George W.


    The following administrative aspects of scientific experimentation with human subjects are discussed: the definition of human experimentation; the distinction between experimentation and treatment; investigator responsibility; documentation; the elements and principles of informed consent; and the administrator's role in establishing and…

  15. Human Exposure Database System (HEDS) (United States)

    U.S. Environmental Protection Agency — The Human Exposure Database System (HEDS) provides public access to data sets, documents, and metadata from EPA on human exposure. It is primarily intended for...

  16. Fire Control and Human Evolution. (United States)

    Russell, Claire


    Briefly outlines some aspects of the discovery of fire control by primitive people, such as the preadaptation for speech, the evolution of the human brain, and natural selection for human nakedness or loss of hair. (CS)

  17. Human Health at the Beach (United States)

    ... Agency Search Search Beaches Contact Us Share LEARN: Human Health at the Beach Swimming at beaches with ... water pollution, there are other potential threats to human health at the beach to be aware of. ...

  18. Humane Education: A Forgotten Mandate (United States)

    Quinn, Peter J.


    Discusses the importance of humane education (i.e., the teaching of the principles of justice, goodwill, and respect for all living creatures) and offers suggestions for integrating humane education in the elementary school curriculum. (JG)

  19. Humane Education and Some Implications (United States)

    Carding, Tony


    The article explores some of the relationships between the value of humane education and those of education concerning the environment and education for international understanding and respect of human rights. (Author)

  20. Humane Education: A Curriculum Approach. (United States)

    Pearce, Robert W.


    Describes a curriculum-based approach to humane education and addresses the role of humane education in the school curriculum as well as the relationship's of education to other facets of animal welfare work. (Author/DS)

  1. Picasso: (in)human face


    Cox, Neil


    Rejecting the notion that Picasso's representations of faces should always be considered in a biographical context as portraits, it is argued that in considering them as human faces we encounter a crisis in the idea of an essential humanity. The essay then discusses Picasso's faces relation to Georges Bataille's treatment of vernacular portrait photography and of animality in human emotional expression, arguing that Picasso's human faces court the inhuman. This inhuman countenance, bred so ef...

  2. Sex differences in human gregariousness


    Benenson, Joyce F.; Sandra Stella; Anthony Ferranti


    Research on human sociality rarely includes kinship, social structure, sex, and familiarity, even though these variables influence sociality in non-human primates. However, cross-cultural ethnographic and observational studies with humans indicate that, beginning after age 5 years, males and females form differing social structures with unrelated individuals in a community. Specifically, compared with females, human males exhibit greater tolerance for and form larger, interconnected groups of...

  3. Human Milk-Treatment and Quality of Banked Human Milk. (United States)

    Picaud, Jean-Charles; Buffin, Rachel


    The aim of human milk banks is to deliver safe and high quality donor human milk. Treatment of human milk has to destroy most microorganisms while preserving immunological and nutrient components, which is obtained when using low time low temperature pasteurization. However it destroys bile-simulated lipase, reduces lactoferrin, lysozyme, immunoglobulins, and bactericidal capacity of human milk. New methods are under investigation such as high temperature short time pasteurization, high pressure processing, or ultraviolet irradiation. They have been tested in experimental conditions and there are promising results, but they have to be tested in real conditions in human milk bank. Copyright © 2016 Elsevier Inc. All rights reserved.

  4. Human Rights, Anti-Metaphysics and Legal Humanism


    Oliveira, Lauro Ericksen Cavalcanti de


    It discusses the philosophical and ethical perspective of human rights and points its framming on post-modern and anti-metaphysical nowadays tendencies. It scopes in general, to explain the  concept  and  foundations  of  human  rights  under  the  historical  premisses  of  legal humanism. Specifically, it aims to shows the historical evolution of human rights to the posr- modernity, and to analyze how the methaphysical entwining of the man reflects on human rights interpretation. Methodolog...

  5. Rejecting medical humanism: medical humanities and the metaphysics of medicine. (United States)

    Bishop, Jeffrey P


    The call for a narrative medicine has been touted as the cure-all for an increasingly mechanical medicine. It has been claimed that the humanities might create more empathic, reflective, professional and trustworthy doctors. In other words, we can once again humanise medicine through the addition of humanities. In this essay, I explore how the humanities, particularly narrative medicine, appeals to the metaphysical commitments of the medical institution in order to find its justification, and in so doing, perpetuates a dualism of humanity that would have humanism as the counterpoint to the biopsychosociologisms of our day.

  6. Humanity and Human Rights: The Contours of International Law

    Directory of Open Access Journals (Sweden)

    Eyassu Gayim


    Full Text Available Laws regulate conducts by responding to social and political requirements. This holds true for the law of nations as well. Contemporary international law follows two separate tracks when it comes to regulating human rights and humanitarian questions. If international human rights law and international humanitarian law are intended to protect the dignity and worth of human beings, as it is often said, why follow separate tracks? Does humanity really exist? If it does, how does it relate to human rights? If the two are distinct, where do they converge? This article highlights these questions by revisiting the contours of international law.

  7. Anti-humanism of the human rights ideology

    Directory of Open Access Journals (Sweden)

    Ćirić Jovan


    Full Text Available How can we say that the ideology of human rights is not human? Yes, we can say that, because the human rights of one person usually stay in confrontation with the human rights of some other person. There is no social conflict and the law deals with social conflicts, which could be arranged by respecting the human rights of both sides. SomeoneÆs human right always has to be refused in some way. The author talks about that in this article. He talks about criminal law for example and that the human rights of an accused and convicted offender stay in confrontation with the human rights of a victim. If we respect the human rights of the accused and the convicted person it does mean that we do not respect enough the human rights of the victim. Because of that, the human rights are not a good concept to build-up the law system. Something that is more objective then 'my' or 'his', (individual understanding of what is the human right, what is the justice has to exist. TodayÆs concept of human rights is based on reducing the state regulation, but it does mean that there is no criteria which is above our individual points of view. In that situation of total individualism no oneÆs human right could be respected well. That is the second name for the anarchy, where we can not speak about the law and the human rights. On the other side, the problem of human rights is very much connected with the problem of understanding what is normal, what is moral, what is justice and the answer to those questions is very different in different societies and different cultures. If we are trying to build one global law system, in fact we are reducing the human right of people from different civilizations to have their own different answer on what is moral. That is also one very interesting paradox of the ideology of human rights which we can express in a very strange sentence: 'there is no human rights for those who are against human rights!',

  8. Human factors in network security


    Jones, Francis B.


    Human factors, such as ethics and education, are important factors in network information security. This thesis determines which human factors have significant influence on network security. Those factors are examined in relation to current security devices and procedures. Methods are introduced to evaluate security effectiveness by incorporating the appropriate human factors into network security controls

  9. Human capital and career success

    DEFF Research Database (Denmark)

    Frederiksen, Anders; Kato, Takao

    formal schooling and subsequent human capital obtained informally on the job are found to be complements in the production of career success. Fourth, though there is a large body of the literature on the relationship between firm-specific human capital and wages, the relative value of firm-specific human...

  10. Legon Journal of the Humanities

    African Journals Online (AJOL)

    Founded in 1974, Legon Journal of the Humanities (LJH) is a peer-reviewed periodical published by the College of Humanities, University of Ghana. LJH welcomes the following types of contributions in the humanities from scholars in all countries: research articles; reviews of new and particularly noteworthy books and ...

  11. Human Rights and Public Education (United States)

    Bowring, Bill


    This article attempts a contrast to the contribution by Hugh Starkey. Rather than his account of the inexorable rise of human rights discourse, and of the implementation of human rights standards, human rights are here presented as always and necessarily scandalous and highly contested. First, I explain why the UK has lagged so far behind its…

  12. A Hierarchy of Human Rights. (United States)

    Brockett, Charles

    To establish an objective conception of human rights, one must first identify basic needs intrinsic to all people and then determine whether these needs are or can be hierarchically ordered. Many scholars have conducted research on the concept of human needs, particularly in the area of human rights. Among these scholars are Abraham H. Maslow…

  13. The human and fire connection (United States)

    Theresa B. Jain


    We refer to fire as a natural disturbance, but unlike other disturbances such as forest insects and diseases, fire has had an intimate relationship with humans. Fire facilitated human evolution over two million years ago when our ancestors began to use fire to cook. Fire empowered our furbearers to adapt to cold climates, allowing humans to disperse and settle into...

  14. Leadership in a Humane Organization (United States)

    Dimitrov, Danielle


    Purpose: The purpose of this paper is to explore the way leadership influences an organization to become humane through its features and behaviors; as well as the organizational circumstances in which humane leadership can be nurtured. The first empirical case study, in the fields of Human Resource Development (HRD) and hospitality management, to…

  15. Human Rights and the Statistician. (United States)

    Spirer, Herbert F.

    Statisticians can help to improve human rights reporting. The statistician's approach to measurement, summary, and interpretation is needed to understand and help reduce human rights violations. Statistical problems in the measurement and analysis of human rights violations include: lack of agreement on the definition; great difficulties in…

  16. Human memory B cells. (United States)

    Seifert, M; Küppers, R


    A key feature of the adaptive immune system is the generation of memory B and T cells and long-lived plasma cells, providing protective immunity against recurring infectious agents. Memory B cells are generated in germinal center (GC) reactions in the course of T cell-dependent immune responses and are distinguished from naive B cells by an increased lifespan, faster and stronger response to stimulation and expression of somatically mutated and affinity matured immunoglobulin (Ig) genes. Approximately 40% of human B cells in adults are memory B cells, and several subsets were identified. Besides IgG(+) and IgA(+) memory B cells, ∼50% of peripheral blood memory B cells express IgM with or without IgD. Further smaller subpopulations have additionally been described. These various subsets share typical memory B cell features, but likely also fulfill distinct functions. IgM memory B cells appear to have the propensity for refined adaptation upon restimulation in additional GC reactions, whereas reactivated IgG B cells rather differentiate directly into plasma cells. The human memory B-cell pool is characterized by (sometimes amazingly large) clonal expansions, often showing extensive intraclonal IgV gene diversity. Moreover, memory B-cell clones are frequently composed of members of various subsets, showing that from a single GC B-cell clone a variety of memory B cells with distinct functions is generated. Thus, the human memory B-cell compartment is highly diverse and flexible. Several B-cell malignancies display features suggesting a derivation from memory B cells. This includes a subset of chronic lymphocytic leukemia, hairy cell leukemia and marginal zone lymphomas. The exposure of memory B cells to oncogenic events during their generation in the GC, the longevity of these B cells and the ease to activate them may be key determinants for their malignant transformation.

  17. Human due diligence. (United States)

    Harding, David; Rouse, Ted


    Most companies do a thorough job of financial due diligence when they acquire other companies. But all too often, deal makers simply ignore or underestimate the significance of people issues in mergers and acquisitions. The consequences are severe. Most obviously, there's a high degree of talent loss after a deal's announcement. To make matters worse, differences in decision-making styles lead to infighting; integration stalls; and productivity declines. The good news is that human due diligence can help companies avoid these problems. Done early enough, it helps acquirers decide whether to embrace or kill a deal and determine the price they are willing to pay. It also lays the groundwork for smooth integration. When acquirers have done their homework, they can uncover capability gaps, points of friction, and differences in decision making. Even more important, they can make the critical "people" decisions-who stays, who goes, who runs the combined business, what to do with the rank and file-at the time the deal is announced or shortly thereafter. Making such decisions within the first 30 days is critical to the success of a deal. Hostile situations clearly make things more difficult, but companies can and must still do a certain amount of human due diligence to reduce the inevitable fallout from the acquisition process and smooth the integration. This article details the steps involved in conducting human due diligence. The approach is structured around answering five basic questions: Who is the cultural acquirer? What kind of organization do you want? Will the two cultures mesh? Who are the people you most want to retain? And how will rank-and-file employees react to the deal? Unless an acquiring company has answered these questions to its satisfaction, the acquisition it is making will be very likely to end badly.

  18. Humanizing the Information Revolution

    Directory of Open Access Journals (Sweden)

    James H. Billington


    Full Text Available Provides a brief historical perspective on the role of books and libraries in the United States and asks whether the impact of electronic media will result in the loss of the ’values of the book culture that made democracy and the responsible use of freedom possible’. Describes the efforts of the Library of Congress to create a National Digital Library of American history and culture, to make free and reliable educational content accessible on the Web and develop human mediators who can help integrate new online knowledge with the older wisdom in books.

  19. Human - Robot Proximity

    DEFF Research Database (Denmark)

    Nickelsen, Niels Christian Mossfeldt

    The media and political/managerial levels focus on the opportunities to re-perform Denmark through digitization. Feeding assistive robotics is a welfare technology, relevant to citizens with low or no function in their arms. Despite national dissemination strategies, it proves difficult to recruit...... the study that took place as multi-sited ethnography at different locations in Denmark and Sweden. Based on desk research, observation of meals and interviews I examine socio-technological imaginaries and their practical implications. Human - robotics interaction demands engagement and understanding...

  20. Magnetic human body communication. (United States)

    Park, Jiwoong; Mercier, Patrick P


    This paper presents a new human body communication (HBC) technique that employs magnetic resonance for data transfer in wireless body-area networks (BANs). Unlike electric field HBC (eHBC) links, which do not necessarily travel well through many biological tissues, the proposed magnetic HBC (mHBC) link easily travels through tissue, offering significantly reduced path loss and, as a result, reduced transceiver power consumption. In this paper the proposed mHBC concept is validated via finite element method simulations and measurements. It is demonstrated that path loss across the body under various postures varies from 10-20 dB, which is significantly lower than alternative BAN techniques.

  1. Human Genome Program

    Energy Technology Data Exchange (ETDEWEB)


    The DOE Human Genome program has grown tremendously, as shown by the marked increase in the number of genome-funded projects since the last workshop held in 1991. The abstracts in this book describe the genome research of DOE-funded grantees and contractors and invited guests, and all projects are represented at the workshop by posters. The 3-day meeting includes plenary sessions on ethical, legal, and social issues pertaining to the availability of genetic data; sequencing techniques, informatics support; and chromosome and cDNA mapping and sequencing.

  2. Structure of human adenovirus

    Energy Technology Data Exchange (ETDEWEB)

    Nemerow, Glen R.; Stewart, Phoebe L.; Reddy, Vijay S. (Scripps); (Vanderbilt)


    A detailed structural analysis of the entire human adenovirus capsid has been stymied by the complexity and size of this 150 MDa macromolecular complex. Over the past 10 years, the steady improvements in viral genome manipulation concomitant with advances in crystallographic techniques and data processing software has allowed structure determination of this virus by X-ray diffraction at 3.5 {angstrom} resolution. The virus structure revealed the location, folds, and interactions of major and minor (cement proteins) on the inner and outer capsid surface. This new structural information sheds further light on the process of adenovirus capsid assembly and virus-host cell interactions.

  3. [Human brown adipose tissue]. (United States)

    Virtanen, Kirsi A; Nuutila, Pirjo


    Adult humans have heat-producing and energy-consuming brown adipose tissue in the clavicular region of the neck. There are two types of brown adipose cells, the so-called classic and beige adipose cells. Brown adipose cells produce heat by means of uncoupler protein 1 (UCP1) from fatty acids and sugar. By applying positron emission tomography (PET) measuring the utilization of sugar, the metabolism of brown fat has been shown to multiply in the cold, presumably influencing energy consumption. Active brown fat is most likely present in young adults, persons of normal weight and women, least likely in obese persons.

  4. Human Transposon Tectonics (United States)

    Burns, Kathleen H.; Boeke, Jef D.


    Mobile DNAs have had a central role in shaping our genome. More than half of our DNA is comprised of interspersed repeats resulting from replicative copy and paste events of retrotransposons. Although most are fixed, incapable of templating new copies, there are important exceptions to retrotransposon quiescence. De novo insertions cause genetic diseases and cancers, though reliably detecting these occurrences has been difficult. New technologies aimed at uncovering polymorphic insertions reveal that mobile DNAs provide a substantial and dynamic source of structural variation. Key questions going forward include the how and how much new transposition events affect human health and disease. PMID:22579280


    Energy Technology Data Exchange (ETDEWEB)

    William R. Hamel; Spivey Douglass; Sewoong Kim; Pamela Murray; Yang Shou; Sriram Sridharan; Ge Zhang; Scott Thayer; Rajiv V. Dubey


    The remediation and deactivation and decommissioning (D&D) of nuclear waste storage tanks using telerobotics is one of the most challenging tasks faced in environmental cleanup. Since a number of tanks have reached the end of their design life and some of them have leaks, the unstructured, uncertain and radioactive environment makes the work inefficient and expensive. However, the execution time of teleoperation consumes ten to hundred times that of direct contact with an associated loss in quality. Thus, a considerable effort has been expended to improve the quality and efficiency of telerobotics by incorporating into teleoperation and robotic control functions such as planning, trajectory generation, vision, and 3-D modeling. One example is the Robot Task Space Analyzer (RTSA), which has been developed at the Robotics and Electromechanical Systems Laboratory (REMSL) at the University of Tennessee in support of the D&D robotic work at the Oak Ridge National Laboratory and the National Energy Technology Laboratory. This system builds 3-D models of the area of interest in task space through automatic image processing and/or human interactive manual modeling. The RTSA generates a task plan file, which describes the execution of a task including manipulator and tooling motions. The high level controller of the manipulator interprets the task plan file and executes the task automatically. Thus, if the environment is not highly unstructured, a tooling task, which interacts with environment, will be executed in the autonomous mode. Therefore, the RTSA not only increases the system efficiency, but also improves the system reliability because the operator will act as backstop for safe operation after the 3-D models and task plan files are generated. However, unstructured conditions of environment and tasks necessitate that the telerobot operates in the teleoperation mode for successful execution of task. The inefficiency in the teleoperation mode led to the research

  6. Human adaptation to smog

    Energy Technology Data Exchange (ETDEWEB)

    Evans, G.W. (Univ. of California, Irvine) Jacobs, S.V.; Frager, N.B.


    This study examined the health effects of human adaptation to photochemical smog. A group of recent arrivals to the Los Angeles air basin were compared to long-term residents of the basin. Evidence for adaptation included greater irritation and respiratory problems among the recent arrivals and desensitization among the long-term residents in their judgments of the severity of the smog problem to their health. There was no evidence for biochemical adaptation as measured by hemoglobin response to oxidant challenge. The results were discussed in terms of psychological adaption to chronic environmental stressors.

  7. Strength of human pulleys. (United States)

    Manske, P R; Lesker, P A


    The length, breaking stength, and tensile strength of each of the annular fibroosseous pulleys of digital flexor sheath in ten fresh human cadaver specimens were measured. The first annular pulley and the fourth annular pulley were found to be the strongest, while the second annular pulley was the weakest. The design of artificial pulleys should reproduce the strength of the first annular and fourth annular pulleys. Suggested minimum requirements for the breaking strength of artificial implant pulleys may be made based on these studies.

  8. Human Islet Amyloid Polypeptide

    DEFF Research Database (Denmark)

    Kosicka, Iga


    Diabetes mellitus type II is a metabolic disease affecting millions of people worldwide. The disease is associated with occurence of insoluble, fibrillar, protein aggregates in islets of Langerhans in the pancreas - islet amyloid. The main constituent of these protein fibers is the human islet...... amyloid polypeptide, which has a propensity to form oligomeric and fibrillar aggregates consisting of stable beta-sheets. These aggregates are toxic to the pancreatic cells. In-depth knowledge of the mechanisms of islet amyloid formation is an important step towards better understanding of the etiology...... of diabetes type II, while revealing the structure(s) of islet amyloid fibrils is necessary for potential design of therapeutic agents....

  9. Human Ressource Management


    Larsen, Camilla


    Projektet undersøger hvordan den engelske virksomhed The Body Shop anvender Human Ressource management i deres organisation. Jeg har selv arbejdet i firmaet i 6 år, hvilket selvfølgelig har givet mig en del problematikker. Jeg har ved brug af Kvale og Brinkmanns interview teori lavet to interviews med hhv. HR-assistenten Nanna Broholm og Retail Academy Træneren Susan Chahrour. De har givet mig en indsigt i deres arbejde, og hvordan The Body Shop forholder sig til forskellige faktorer. I proje...

  10. Human Work Interaction Design

    DEFF Research Database (Denmark)

    Gonçalves, Frederica; Campos, Pedro; Clemmensen, Torkil


    In this paper, we review research in the emerging practice and research field of Human Work Interaction Design (HWID). We present a HWID framework, and a sample of 54 HWID related papers from workshops, conferences and journals from the period 2009–2014. We group the papers into six topical groups....... Furthermore, much focus has been on studying design sketching or implemented systems-in-use, while little attention has been paid to mature design (prototypes) or early implementation (content templates). In conclusion, we recommend an update to the framework so that it can be also useful for research...

  11. Human Work Interaction Design

    DEFF Research Database (Denmark)

    Gonçalves, Frederica; Campos, Pedro; Clemmensen, Torkil


    In this paper, we review research in the emerging practice and research field of Human Work Interaction Design (HWID). We present a HWID frame-work, and a sample of 54 papers from workshops, conferences and journals from the period 2009-2014. We group the papers into six topical groups, and then at....... Furthermore, much focus has been on studying design sketching or implemented systems-in-use, while little attention has been paid to mature design (prototypes) or early implementation (content templates). In conclusion, we recommend an update to the framework so that it can be also useful for research...

  12. Machines Imitating Humans (United States)

    Zia-Ul-Haque, Qazi S. M.; Wang, Zhiliang; Zhang, Xueyuan

    The authors have synthesized the emotion in the speech of robot. The modeling of emotion in speech relies on a number of parameters among others, fundamental frequency (F0) level, voice quality, or articulation precision etc. As an initial work for synthesizing emotion in speech, we utilized the three voice features provided by the TTS engine of Microsoft Speech SDK i.e. pitch, rate and volume. Speech with these parameters controlled, was generated randomly with 20 sentences for each emotion and perception by human hearers were collected.

  13. Visual Analysis of Humans

    CERN Document Server

    Moeslund, Thomas B


    This unique text/reference provides a coherent and comprehensive overview of all aspects of video analysis of humans. Broad in coverage and accessible in style, the text presents original perspectives collected from preeminent researchers gathered from across the world. In addition to presenting state-of-the-art research, the book reviews the historical origins of the different existing methods, and predicts future trends and challenges. This title: features a Foreword by Professor Larry Davis; contains contributions from an international selection of leading authorities in the field; includes

  14. Human Work Interaction Design

    DEFF Research Database (Denmark)

    This book constitutes the thoroughly refereed post-conference proceedings of the Third IFIP WG 13.6 Working Conference on Human Work Interaction Design, HWID 2012, held in Copenhagen, Denmark, in December 2012. The 16 revised papers presented were carefully selected for inclusion in this volume....... The papers reflect many different areas and address many complex and diverse work domains, ranging from medical user interfaces, work and speech interactions at elderly care facilities, greenhouse climate control, navigating through large oil industry engineering models, crisis management, library usability...

  15. More Than Human Politics

    DEFF Research Database (Denmark)


    In this episode of AnthroPod, guest producers Stine Krøijer and Astrid Oberborbeck Andersen take up a debate that is central to current environmental and political anthropology: namely, how ethnographers can identify and describe the political when earth beings, spirits, or nonhuman others become...... part of the ethnographic equation? How can we methodologically and theoretically engage with these beings as they become entwined in political processes? The episode is built around a recording of a workshop on “More than Human Politics,” which was held in the Department of Anthropology...



    Shashank Shekhar Tiwari*, Shivani Joshi, Tanvi Mittal, Shruti Jain


    This project deals with the nervous system and its function in brain. Here connectome means the microscopic neural connectivity and its mapping between all the neurons present in the brain which further represents their graphical representation on the visual screen also which will further help us to zoom into a region to explore the cells and the functions depending on it and taking this one step ahead the memory implementation in human brain so it will be used as a memory unit except the fac...





    This paper presents the most representative approaches to concepts of human resources, human resource management and strategic human resource management in the last two decades, based on purely theoretical analysis of the concepts mentioned above. The purpose of this paper is to demonstrate through a critical analysis of concepts, that in this era of change and uncertainty, attention to human resources of an organization has changed radically. It can be seen by analyzing the definitions, evol...





    This paper presents the most representative approaches to concepts of human resources, human resource management and strategic human resource management in the last two decades, based on purely theoretical analysis of the concepts mentioned above. The purpose of this paper is to demonstrate through a critical analysis of concepts, that in this era of change and uncertainty, attention to human resources of an organization has changed radically. It can be seen by analyzing the definitions, e...

  19. The Specificity of Human Aesthetics

    DEFF Research Database (Denmark)

    Bouchet, Dominique


    Today, humankind is being reintroduced within nature. Humankind is no longer presented as supernatural to nature. There is no longer a clear divide between animal and human. What makes us human is neither culture, nor language nor labor, nor art, but the degree of complexity those products......, and the craving to make sense of all kinds of relations that characterizes humans. Being able to produce artworks as external representations aimed at “the other,” made of internal representations is thus essential to humanity. Human aesthetics is not so much an issue of beauty but of imagination and social...

  20. [Terrorism and human behavior]. (United States)

    Leistedt, S J


    Theories of religion are essential for understanding current trends in terrorist activities. The aim of this work is to clarify religion's role in facilitating terror and outline in parallel with recent theoretical developments on terrorism and human behaviour. Several databases were used such as PubCentral, Scopus, Medline and Science Direct. The search terms "terrorism", "social psychology", "religion", "evolution", and "cognition" were used to identify relevant studies in the databases. This work examines, in a multidimensional way, how terrorists employ these features of religion to achieve their goals. In the same way, it describes how terrorists use rituals to conditionally associate emotions with sanctified symbols that are emotionally evocative and motivationally powerful, fostering group solidarity, trust, and cooperation. Religious beliefs, including promised rewards in the afterlife, further serve to facilitate cooperation by altering the perceived payoffs of costly actions, including suicide bombing. The adolescent pattern of brain development is unique, and young adulthood presents an ideal developmental stage to attract recruits and enlist them in high-risk behaviors. This work offers insights, based on this translational analysis, concerning the links between religion, terrorism and human behavior. Copyright © 2017 L'Encéphale, Paris. Published by Elsevier Masson SAS. All rights reserved.