Myopathy in acute hypothyroidism.

OpenAIRE

Kung, A. W.; Ma, J. T.; Yu, Y. L.; Wang, C. C.; Woo, E. K.; Lam, K. S.; Huang, C. Y.; Yeung, R. T.

1987-01-01

Hypothyroid myopathy has so far been reported in long standing cases of hypothyroidism. We describe two adult patients with myopathy associated with acute transient hypothyroidism. Both presented with severe muscle aches and cramps, stiffness and spasms. Muscle enzymes were markedly elevated and electromyography in one patient showed myopathic features. Histological changes were absent in muscle biopsy, probably because of the short duration of metabolic disturbance. The myopathy subsided pro...

Congenital myopathy is caused by mutation of HACD1.

Science.gov (United States)

Muhammad, Emad; Reish, Orit; Ohno, Yusuke; Scheetz, Todd; Deluca, Adam; Searby, Charles; Regev, Miriam; Benyamini, Lilach; Fellig, Yakov; Kihara, Akio; Sheffield, Val C; Parvari, Ruti

2013-12-20

Congenital myopathies are heterogeneous inherited diseases of muscle characterized by a range of distinctive histologic abnormalities. We have studied a consanguineous family with congenital myopathy. Genome-wide linkage analysis and whole-exome sequencing identified a homozygous non-sense mutation in 3-hydroxyacyl-CoA dehydratase 1 (HACD1) in affected individuals. The mutation results in non-sense mediated decay of the HACD1 mRNA to 31% of control levels in patient muscle and completely abrogates the enzymatic activity of dehydration of 3-hydroxyacyl-CoA, the third step in the elongation of very long-chain fatty acids (VLCFAs). We describe clinical findings correlated with a deleterious mutation in a gene not previously known to be associated with congenital myopathy in humans. We suggest that the mutation in the HACD1 gene causes a reduction in the synthesis of VLCFAs, which are components of membrane lipids and participants in physiological processes, leading to congenital myopathy. These data indicate that HACD1 is necessary for muscle function.

Muscle regeneration in mitochondrial myopathies

DEFF Research Database (Denmark)

Krag, T O; Hauerslev, S; Jeppesen, T D

2013-01-01

Mitochondrial myopathies cover a diverse group of disorders in which ragged red and COX-negative fibers are common findings on muscle morphology. In contrast, muscle degeneration and regeneration, typically found in muscular dystrophies, are not considered characteristic features of mitochondrial...... myopathies. We investigated regeneration in muscle biopsies from 61 genetically well-defined patients affected by mitochondrial myopathy. Our results show that the perturbed energy metabolism in mitochondrial myopathies causes ongoing muscle regeneration in a majority of patients, and some were even affected...

Evidence-based treatment of metabolic myopathy

Directory of Open Access Journals (Sweden)

Yan LIN

2014-05-01

Full Text Available Objective To evaluate the current treatments and possible adverse reactions of metabolic myopathy, and to develop the best solution for evidence-based treatment.  Methods Taking metabolic myopathy, mitochondrial myopathy, lipid storage myopathy, glycogen storage diseases, endocrine myopathy, drug toxicity myopathy and treatment as search terms, retrieve in databases such as PubMed, Cochrane Library, ClinicalKey database, National Science and Technology Library (NSTL, in order to collect the relevant literature database including clinical guidelines, systematic reviews (SR, randomized controlled trials (RCT, controlled clinical trials, retrospective case analysis and case study. Jadad Scale was used to evaluate the quality of literature.  Results Twenty-eight related articles were selected, including 6 clinical guidelines, 5 systematic reviews, 10 randomized controlled trials and 7 clinical controlled trials. According to Jadad Scale, 23 articles were evaluated as high-quality literature (≥ 4, and the remaining 5 were evaluated as low-quality literature (< 4. Treatment principles of these clinical trials, efficacy of different therapies and drug safety evaluation suggest that: 1 Acid α-glycosidase (GAA enzyme replacement therapy (ERT is the main treatment for glycogen storage diseases, with taking a high-protein diet, exercising before taking a small amount of fructose orally and reducing the patient's physical activity gradually. 2 Carnitine supplementation is used in the treatment of lipid storage myopathy, with carbohydrate and low fat diet provided before exercise or sports. 3 Patients with mitochondrial myopathy can take coenzyme Q10, vitamin B, vitamin K, vitamin C, etc. Proper aerobic exercise combined with strength training is safe, and it can also enhance the exercise tolerance of patients effectively. 4 The first choice to treat the endocrine myopathy is treating primary affection. 5 Myopathies due to drugs and toxins should

Stepwise approach to myopathy in systemic disease.

Science.gov (United States)

Chawla, Jasvinder

2011-01-01

Muscle diseases can constitute a large variety of both acquired and hereditary disorders. Myopathies in systemic disease results from several different disease processes including endocrine, inflammatory, paraneoplastic, infectious, drug- and toxin-induced, critical illness myopathy, metabolic, and myopathies with other systemic disorders. Patients with systemic myopathies often present acutely or sub acutely. On the other hand, familial myopathies or dystrophies generally present in a chronic fashion with exceptions of metabolic myopathies where symptoms on occasion can be precipitated acutely. Most of the inflammatory myopathies can have a chance association with malignant lesions; the incidence appears to be specifically increased only in patients with dermatomyositis. In dealing with myopathies associated with systemic illnesses, the focus will be on the acquired causes. Management is beyond the scope of this chapter. Prognosis is based upon the underlying cause and, most of the time, carries a good prognosis. In order to approach a patient with suspected myopathy from systemic disease, a stepwise approach is utilized.

STATINS AND MYOPATHY: MOLECULAR MECHANISMS

Directory of Open Access Journals (Sweden)

O. M. Drapkina

2012-01-01

Full Text Available The safety of statin therapy is considered. In particular the reasons of a complication such as myopathy are discussed in detail. The molecular mechanisms of statin myopathy , as well as its risk factors are presented. The role of coenzyme Q10 in the myopathy development and coenzyme Q10 application for the prevention of this complication are considered. 

Skeletal muscle repair in a mouse model of nemaline myopathy

OpenAIRE

Sanoudou, Despina; Corbett, Mark A.; Han, Mei; Ghoddusi, Majid; Nguyen, Mai-Anh T.; Vlahovich, Nicole; Hardeman, Edna C.; Beggs, Alan H.

2006-01-01

Nemaline myopathy (NM), the most common non-dystrophic congenital myopathy, is a variably severe neuromuscular disorder for which no effective treatment is available. Although a number of genes have been identified in which mutations can cause NM, the pathogenetic mechanisms leading to the phenotypes are poorly understood. To address this question, we examined gene expression patterns in an NM mouse model carrying the human Met9Arg mutation of alpha-tropomyosin slow (Tpm3). We assessed five d...

Genetics Home Reference: Miyoshi myopathy

Science.gov (United States)

... links) Centers for Disease Control and Prevention: Muscular Dystrophy Cincinnati Children's Hospital: Molkentin Lab: Mechanisms of Duchenne and Miyoshi Myopathy Disease InfoSearch: Miyoshi myopathy Jain ...

[Descending ocular myopathy].

Science.gov (United States)

de Freitas, M R; Nascimento, O J

1975-06-01

The case of a 23 years old female patient, with primary involvement of the extraocular and faringeal muscles without familiar history is reported. Electromyographic and muscular biopsy studies proved the myogenic nature of the process. A clinical comparison between the ocular myopathy and the descending ocular myopathy is made, the authors thinking that both of them would be variants of the same muscle disease.

A diagnostic algorithm for metabolic myopathies.

Science.gov (United States)

Berardo, Andres; DiMauro, Salvatore; Hirano, Michio

2010-03-01

Metabolic myopathies comprise a clinically and etiologically diverse group of disorders caused by defects in cellular energy metabolism, including the breakdown of carbohydrates and fatty acids to generate adenosine triphosphate, predominantly through mitochondrial oxidative phosphorylation. Accordingly, the three main categories of metabolic myopathies are glycogen storage diseases, fatty acid oxidation defects, and mitochondrial disorders due to respiratory chain impairment. The wide clinical spectrum of metabolic myopathies ranges from severe infantile-onset multisystemic diseases to adult-onset isolated myopathies with exertional cramps. Diagnosing these diverse disorders often is challenging because clinical features such as recurrent myoglobinuria and exercise intolerance are common to all three types of metabolic myopathy. Nevertheless, distinct clinical manifestations are important to recognize as they can guide diagnostic testing and lead to the correct diagnosis. This article briefly reviews general clinical aspects of metabolic myopathies and highlights approaches to diagnosing the relatively more frequent subtypes (Fig. 1). Fig. 1 Clinical algorithm for patients with exercise intolerance in whom a metabolic myopathy is suspected. CK-creatine kinase; COX-cytochrome c oxidase; CPT-carnitine palmitoyl transferase; cyt b-cytochrome b; mtDNA-mitochondrial DNA; nDNA-nuclear DNA; PFK-phosphofructokinase; PGAM-phosphoglycerate mutase; PGK-phosphoglycerate kinase; PPL-myophosphorylase; RRF-ragged red fibers; TFP-trifunctional protein deficiency; VLCAD-very long-chain acyl-coenzyme A dehydrogenase.

Congenital Muscle Disease Study of Patient and Family Reported Medical Information

Science.gov (United States)

2017-05-05

Congenital Muscular Dystrophy (Including Unspecified/Undiagnosed); Dystroglycanopathy; Congenital Fiber Type Disproportion; Rigid Spine Muscular Dystrophy; Congenital Myopathy (Including Unspecified/Undiagnosed); Collagen VI CMD (Ullrich CMD, Intermediate, Bethlem Myopathy); Laminin Alpha 2 Related Congenital Muscular Dystrophy; LAMA2-CMD/Merosin Deficient/MDC1A; Walker-Warburg Syndrome; Muscle-Eye-Brain Disease; Fukuyama/Fukutin Related Muscular Dystrophy; Integrin Alpha 7 Deficiency; Integrin Alpha 9 Deficiency; LMNA-CMD/Lamin A/C/Laminopathy; SEPN1-Related Myopathy; Bethlem Myopathy; Actin Aggregation Myopathy; Cap Disease; Central Core Disease; Centronuclear Myopathy; Core Rod Myopathy; Hyaline Body Myopathy; Multiminicore Myopathy; Myotubular Myopathy; Nemaline Myopathy; Tubular Aggregate Myopathy; Zebra Body Myopathy; Reducing Body Myopathy; Spheroid Body Myopathy; LGMD1B (LMNA); LGMD1E (DES); LGMD2G (TCAP); LGMD2H (TRIM32); LGMD2I (FKRP); LGMD2J (TTN); LGMD2K (POMT1); LGMD2M (FKTN); LGMD2N (POMT2); LGMD2O (POMGnT1); LGMD2P (DAG1); LGMD2Q (PLEC1); LGMD2R (DES); LGMD2S (TRAPPC11); LGMD2T (GMPPB); LGMD2U (ISPD); LGMD2V (GAA); Ullrich Congenital Muscular Dystrophy; Titinopathy; Choline Kinase B Receptor; Emery-Dreifuss Muscular Dystrophy; RYR1 Related Myopathy; SYNE1/Nesprin Related Muscular Dystrophy; Telethonin Related Muscular Dystrophy (TCAP/Titin-Cap); Congenital Myasthenic Syndrome; Escobar Syndrome; Myofibrillar Myopathy; Malignant Hyperthermia; Alpha-Dystroglycan Related Muscular Dystrophy (DAG1, DPM1, DPM2, DPM3, FKRP, FKTN); Alpha-Dystroglycan Related Muscular Dystrophy (GAA, ISPD, LARGE, POMT1, POMT2, POMGnT1); Alpha-Dystroglycan Related Muscular Dystrophy (Unspecified/Undiagnosed/Other)

Hereditary myopathies with early respiratory insufficiency in adults.

Science.gov (United States)

Naddaf, Elie; Milone, Margherita

2017-11-01

Hereditary myopathies with early respiratory insufficiency as a predominant feature of the clinical phenotype are uncommon and underestimated in adults. We reviewed the clinical and laboratory data of patients with hereditary myopathies who demonstrated early respiratory insufficiency before the need for ambulatory assistance. Only patients with disease-causing mutations or a specific histopathological diagnosis were included. Patients with cardiomyopathy were excluded. We identified 22 patients; half had isolated respiratory symptoms at onset. The diagnosis of the myopathy was often delayed, resulting in delayed ventilatory support. The most common myopathies were adult-onset Pompe disease, myofibrillar myopathy, multi-minicore disease, and myotonic dystrophy type 1. Single cases of laminopathy, MELAS (mitochondrial encephalomyopathy with lactic acidosis and strokelike events), centronuclear myopathy, and cytoplasmic body myopathy were identified. We highlighted the most common hereditary myopathies associated with early respiratory insufficiency as the predominant clinical feature, and underscored the importance of a timely diagnosis for patient care. Muscle Nerve 56: 881-886, 2017. © 2017 Wiley Periodicals, Inc.

Localized scleroderma and regional inflammatory myopathy.

Science.gov (United States)

Zivković, Saša A; Freiberg, William; Lacomis, David; Domsic, Robyn T; Medsger, Thomas A

2014-05-01

Inflammatory myopathy is rare in localized scleroderma. We report 2 new cases of regional inflammatory myopathy associated with localized scleroderma and review 10 reported cases of localized scleroderma associated with an inflammatory myopathy with regional muscle involvement, more often in the upper extremities. Serum creatine kinase was mildly elevated or normal. Histopathology often showed perimysial inflammation and plasma cell infiltration. These cases demonstrate that inflammatory myopathy should be considered in patients with localized scleroderma and regional muscle weakness, pain or atrophy. Muscle biopsy can confirm the diagnosis of myositis, which if identified, will require anti-inflammatory and/or immunosuppressive therapy. Published by Elsevier B.V.

Exercise training in metabolic myopathies

DEFF Research Database (Denmark)

Vissing, J

2016-01-01

metabolic adaptations, such as increased dependence on glycogen use and a reduced capacity for fatty acid oxidation, which is detrimental in GSDs. Training has not been studied systematically in any FAODs and in just a few GSDs. However, studies on single bouts of exercise in most metabolic myopathies show......Metabolic myopathies encompass muscle glycogenoses (GSD) and disorders of muscle fat oxidation (FAOD). FAODs and GSDs can be divided into two main clinical phenotypes; those with static symptoms related to fixed muscle weakness and atrophy, and those with dynamic, exercise-related symptoms...... that are brought about by a deficient supply of ATP. Together with mitochondrial myopathies, metabolic myopathies are unique among muscle diseases, as the limitation in exercise performance is not solely caused by structural damage of muscle, but also or exclusively related to energy deficiency. ATP consumption...

Mitochondrial myopathies.

Science.gov (United States)

DiMauro, Salvatore

2006-11-01

Our understanding of mitochondrial diseases (defined restrictively as defects of the mitochondrial respiratory chain) is expanding rapidly. In this review, I will give the latest information on disorders affecting predominantly or exclusively skeletal muscle. The most recently described mitochondrial myopathies are due to defects in nuclear DNA, including coenzyme Q10 deficiency and mutations in genes controlling mitochondrial DNA abundance and structure, such as POLG, TK2, and MPV17. Barth syndrome, an X-linked recessive mitochondrial myopathy/cardiopathy, is associated with decreased amount and altered structure of cardiolipin, the main phospholipid of the inner mitochondrial membrane, but a secondary impairment of respiratory chain function is plausible. The role of mutations in protein-coding genes of mitochondrial DNA in causing isolated myopathies has been confirmed. Mutations in tRNA genes of mitochondrial DNA can also cause predominantly myopathic syndromes and--contrary to conventional wisdom--these mutations can be homoplasmic. Defects in the mitochondrial respiratory chain impair energy production and almost invariably involve skeletal muscle, causing exercise intolerance, cramps, recurrent myoglobinuria, or fixed weakness, which often affects extraocular muscles and results in droopy eyelids (ptosis) and progressive external ophthalmoplegia.

Inherited myopathies and muscular dystrophies

NARCIS (Netherlands)

Cardamone, Michael; Darras, Basil T.; Ryan, Monique M.

The inherited myopathies and muscular dystrophies are a diverse group of muscle diseases presenting with common complaints and physical signs: weakness, motor delay, and respiratory and bulbar dysfunction. The myopathies are caused by genetic defects in the contractile apparatus of muscle, and

Myopathy

Science.gov (United States)

... alternating episodes of twitching and stiffness; and stiff-man syndrome: characterized by episodes of rigidity and reflex spasms common muscle cramps and stiffness, and tetany: characterized by prolonged spasms of the arms and legs × Definition The myopathies are neuromuscular disorders in which the ...

Adult-onset nemaline myopathy presenting as respiratory failure.

LENUS (Irish Health Repository)

Kelly, Emer

2008-11-01

Nemaline myopathy is a rare congenital myopathy that generally presents in childhood. We report a case of a 44-year-old man who presented with severe hypoxic hypercapnic respiratory failure as the initial manifestation of nemaline myopathy. After starting noninvasive ventilation, his pulmonary function test results improved substantially, and over the 4 years since diagnosis his respiratory function remained stable. There are few reported cases of respiratory failure in patients with adult-onset nemaline myopathy, and the insidious onset in this case is even more unusual. This case highlights the varied presenting features of adult-onset nemaline myopathy and that noninvasive ventilation improves respiratory function.

Amyloid myopathy: a diagnostic challenge

Directory of Open Access Journals (Sweden)

Heli Tuomaala

2009-08-01

Full Text Available Amyloid myopathy (AM is a rare manifestation of primary systemic amyloidosis (AL. Like inflammatory myopathies, it presents with proximal muscle weakness and an increased creatine kinase level. We describe a case of AL with severe, rapidly progressive myopathy as the initial symptom. The clinical manifestation and muscle biopsy were suggestive of inclusion body myositis. AM was not suspected until amyloidosis was seen in the gastric mucosal biopsy. The muscle biopsy was then re-examined more specifically, and Congo red staining eventually showed vascular and interstitial amyloid accumulation, which led to a diagnosis of AM. The present case illustrates the fact that the clinical picture of AM can mimic that of inclusion body myositis.

Bethlem myopathy: An autosomal dominant myopathy with flexion contractures, keloids, and follicular hyperkeratosis.

Science.gov (United States)

Saroja, Aralikatte Onkarappa; Naik, Karkal Ravishankar; Nalini, Atcharayam; Gayathri, Narayanappa

2013-10-01

Bethlem myopathy and Ullrich congenital muscular dystrophy form a spectrum of collagenopathies caused by genetic mutations encoding for any of the three subunits of collagen VI. Bethlem phenotype is relatively benign and is characterized by proximal dominant myopathy, keloids, contractures, distal hyperextensibility, and follicular hyperkeratosis. Three patients from a single family were diagnosed to have Bethlem myopathy based on European Neuromuscular Centre Bethlem Consortium criteria. Affected father and his both sons had slowly progressive proximal dominant weakness and recurrent falls from the first decade. Both children aged 18 and 20 years were ambulant at presentation. All had flexion contractures, keloids, and follicular hyperkeratosis without muscle hypertrophy. Creatinine kinase was mildly elevated and electromyography revealed myopathic features. Muscle imaging revealed severe involvement of glutei and vasti with "central shadow" in rectus femoris. Muscle biopsy in the father showed dystrophic changes with normal immmunostaining for collagen VI, sarcoglycans, and dysferlin.

Bethlem myopathy: An autosomal dominant myopathy with flexion contractures, keloids, and follicular hyperkeratosis

Directory of Open Access Journals (Sweden)

Aralikatte Onkarappa Saroja

2013-01-01

Full Text Available Bethlem myopathy and Ullrich congenital muscular dystrophy form a spectrum of collagenopathies caused by genetic mutations encoding for any of the three subunits of collagen VI. Bethlem phenotype is relatively benign and is characterized by proximal dominant myopathy, keloids, contractures, distal hyperextensibility, and follicular hyperkeratosis. Three patients from a single family were diagnosed to have Bethlem myopathy based on European Neuromuscular Centre Bethlem Consortium criteria. Affected father and his both sons had slowly progressive proximal dominant weakness and recurrent falls from the first decade. Both children aged 18 and 20 years were ambulant at presentation. All had flexion contractures, keloids, and follicular hyperkeratosis without muscle hypertrophy. Creatinine kinase was mildly elevated and electromyography revealed myopathic features. Muscle imaging revealed severe involvement of glutei and vasti with "central shadow" in rectus femoris. Muscle biopsy in the father showed dystrophic changes with normal immmunostaining for collagen VI, sarcoglycans, and dysferlin.

Myopathies of endocrine disorders: A prospective clinical and biochemical study

Directory of Open Access Journals (Sweden)

Vikas Sharma

2014-01-01

Full Text Available Introduction: Major categories of endocrine myopathy include those associated with: Adrenal dysfunction (as in Cushing′s disease or steroid myopathy; thyroid dysfunction (as in myxedema coma or thyrotoxic myopathy; vitamin D deficiency; parathyroid dysfunction; and pituitary dysfunction. Steroid myopathy is the most common endocrine myopathy. Objective: To study the etiology, varied presentations, and outcome after therapy of patients with endocrine myopathies. Materials and Methods: Myopathy was evaluated by the standard clinical procedures: Detailed clinical history, manual muscle strength testing, and creatine phosphokinase (CPK. Endocrine disorders were diagnosed as per clinical features and biochemical parameters. The treatment was given to patients as per underlying endocrine disease. Myopathy was assessed before and after treatment. Results: Out of the 37 patients who were diagnosed with endocrine myopathies, thyroid dysfunction was the most common cause (17 cases, followed by vitamin D deficiency in nine, adrenal dysfunction in six, parathyroid dysfunction in three, and pituitary dysfunction in two. Some patients had atypical presentation (repeated falls in one, tongue fasciculations in one, neck weakness in five, one with ptosis and facial weakness, asymmetrical onset in one, and calf hypertrophy in one. The serum creatine kinase (CK concentration did not correlate with muscle weakness. Following the treatment regimen which was specific for a given myopathy, 26 patients recovered fully. Conclusion: We found varied clinical presentations of endocrine myopathies. All the patients with neuromuscular complaints should be investigated for endocrine causes because significant number of them recovers fully with specific treatment.

Systemic calciphylaxis presenting as a painful, proximal myopathy.

OpenAIRE

Edelstein, C. L.; Wickham, M. K.; Kirby, P. A.

1992-01-01

A renal transplant patient who presented with a painful, proximal myopathy due to systemic calciphylaxis is described. The myopathy preceded the characteristic skin and soft tissue necrosis. Systemic calciphylaxis should be considered in a dialysis or a renal transplant patient presenting with a painful proximal myopathy even in the absence of necrotic skin lesions.

Efficient and reproducible myogenic differentiation from human iPS cells: prospects for modeling Miyoshi Myopathy in vitro.

Directory of Open Access Journals (Sweden)

Akihito Tanaka

Full Text Available The establishment of human induced pluripotent stem cells (hiPSCs has enabled the production of in vitro, patient-specific cell models of human disease. In vitro recreation of disease pathology from patient-derived hiPSCs depends on efficient differentiation protocols producing relevant adult cell types. However, myogenic differentiation of hiPSCs has faced obstacles, namely, low efficiency and/or poor reproducibility. Here, we report the rapid, efficient, and reproducible differentiation of hiPSCs into mature myocytes. We demonstrated that inducible expression of myogenic differentiation1 (MYOD1 in immature hiPSCs for at least 5 days drives cells along the myogenic lineage, with efficiencies reaching 70-90%. Myogenic differentiation driven by MYOD1 occurred even in immature, almost completely undifferentiated hiPSCs, without mesodermal transition. Myocytes induced in this manner reach maturity within 2 weeks of differentiation as assessed by marker gene expression and functional properties, including in vitro and in vivo cell fusion and twitching in response to electrical stimulation. Miyoshi Myopathy (MM is a congenital distal myopathy caused by defective muscle membrane repair due to mutations in DYSFERLIN. Using our induced differentiation technique, we successfully recreated the pathological condition of MM in vitro, demonstrating defective membrane repair in hiPSC-derived myotubes from an MM patient and phenotypic rescue by expression of full-length DYSFERLIN (DYSF. These findings not only facilitate the pathological investigation of MM, but could potentially be applied in modeling of other human muscular diseases by using patient-derived hiPSCs.

Efficient and Reproducible Myogenic Differentiation from Human iPS Cells: Prospects for Modeling Miyoshi Myopathy In Vitro

Science.gov (United States)

Tanaka, Akihito; Woltjen, Knut; Miyake, Katsuya; Hotta, Akitsu; Ikeya, Makoto; Yamamoto, Takuya; Nishino, Tokiko; Shoji, Emi; Sehara-Fujisawa, Atsuko; Manabe, Yasuko; Fujii, Nobuharu; Hanaoka, Kazunori; Era, Takumi; Yamashita, Satoshi; Isobe, Ken-ichi; Kimura, En; Sakurai, Hidetoshi

2013-01-01

The establishment of human induced pluripotent stem cells (hiPSCs) has enabled the production of in vitro, patient-specific cell models of human disease. In vitro recreation of disease pathology from patient-derived hiPSCs depends on efficient differentiation protocols producing relevant adult cell types. However, myogenic differentiation of hiPSCs has faced obstacles, namely, low efficiency and/or poor reproducibility. Here, we report the rapid, efficient, and reproducible differentiation of hiPSCs into mature myocytes. We demonstrated that inducible expression of myogenic differentiation1 (MYOD1) in immature hiPSCs for at least 5 days drives cells along the myogenic lineage, with efficiencies reaching 70–90%. Myogenic differentiation driven by MYOD1 occurred even in immature, almost completely undifferentiated hiPSCs, without mesodermal transition. Myocytes induced in this manner reach maturity within 2 weeks of differentiation as assessed by marker gene expression and functional properties, including in vitro and in vivo cell fusion and twitching in response to electrical stimulation. Miyoshi Myopathy (MM) is a congenital distal myopathy caused by defective muscle membrane repair due to mutations in DYSFERLIN. Using our induced differentiation technique, we successfully recreated the pathological condition of MM in vitro, demonstrating defective membrane repair in hiPSC-derived myotubes from an MM patient and phenotypic rescue by expression of full-length DYSFERLIN (DYSF). These findings not only facilitate the pathological investigation of MM, but could potentially be applied in modeling of other human muscular diseases by using patient-derived hiPSCs. PMID:23626698

Zidovudine-induced myopathy: A study in Indian patients.

Science.gov (United States)

Sagar, Amitabh; Mohanty, Ambika P; Bahal, Ashish

2010-07-01

Literature is replete with studies on zidovudine-induced myopathy after prolonged use (use beyond 270 days on an average). However, all these studies have been done on patients of Caucasian, American and African ethnic origin. No such study has been carried out in Indian patients to our knowledge. To determine the correlation of zidovudine usage with serum creatine phosphokinase (CK) levels, clinical muscular weakness and muscle histology in Indian patients, we studied 147 physically active, Human Immunodeficiency Virus infected men on prolonged zidovudine-based antiretroviral therapy (ART). Cross-sectional study on hospital follow-up patients of HIV infection. All cases on ART who reported to our canter during a period of 18 months were evaluated for symptoms (muscle fatigue, myalgia), objective muscle strength (testing clinically) and serum CK levels, and a select group was evaluated by muscle biopsy. These patients were on zidovudine for 1 to 7 years. None of the patients studied had significant symptoms or objective muscle weakness and only a small fraction (10.8% of cases) had marginally raised serum CK levels. All muscle biopsies were normal on light microscopy. Zidovudine myopathy may be a constraint for use of the drug in the western population; however, it is a well-tolerated drug as regards myopathy in our study on Indian patients.

Idiopathic Inflammatory Myopathies: An update

Directory of Open Access Journals (Sweden)

Bulent KURT

2016-06-01

Full Text Available Idiopathic inflammatory myopathies (IIM are a heterogeneous group of disease with complex clinical features. It has been sub-classified as: (1 Dermatomyositis, (2 Polymyositis, and (3 Inclusion body myositis (IBM. Nowadays, there are some studies in literature suggest necrotizing autoimmune myopathy and immune-mediated necrotizing myopathy should also be added to this group of disease. There is a debate in the diagnosis of IIMs and up until now, about 12 criteria systems have been proposed. Some of the criteria systems have been used widely such as Griggs et al.'s proposal for IBM. Clinical findings, autoantibodies, enzymes, electrophysiological, and muscle biopsy findings are diagnostic tools. Because of diseases' complexity, none of the findings are diagnostic alone. In this study, we discussed the diagnostic criteria of IMMs and described detailed morphological features. [J Interdiscipl Histopathol 2016; 4(2.000: 41-45

Spectrum of metabolic myopathies.

Science.gov (United States)

Angelini, Corrado

2015-04-01

Metabolic myopathies are disorders of utilization of carbohydrates or fat in muscles. The acute nature of energy failure is manifested either by a metabolic crisis with weakness, sometimes associated with respiratory failure, or by myoglobinuria. A typical disorder where permanent weakness occurs is glycogenosis type II (GSDII or Pompe disease) both in infantile and late-onset forms, where respiratory insufficiency is manifested by a large number of cases. In GSDII the pathogenetic mechanism is still poorly understood, and has to be attributed more to structural muscle alterations, possibly in correlation to macro-autophagy, rather than to energetic failure. This review is focused on recent advances about GSDII and its treatment, and the most recent notions about the management and treatment of other metabolic myopathies will be briefly reviewed, including glycogenosis type V (McArdle disease), glycogenosis type III (debrancher enzyme deficiency or Cori disease), CPT-II deficiency, and ETF-dehydrogenase deficiency (also known as riboflavin-responsive multiple acyl-CoA dehydrogenase deficiency or RR-MADD). The discovery of the genetic defect in ETF dehydrogenase confirms the etiology of this syndrome. Other metabolic myopathies with massive lipid storage and weakness are carnitine deficiency, neutral lipid storage-myopathy (NLSD-M), besides RR-MADD. Enzyme replacement therapy is presented with critical consideration and for each of the lipid storage disorders, representative cases and their response to therapy is included. This article is part of a Special Issue entitled: Neuromuscular Diseases: Pathology and Molecular Pathogenesis. Copyright © 2014. Published by Elsevier B.V.

Muscle spindles exhibit core lesions and extensive degeneration of intrafusal fibers in the Ryr1I4895T/wt mouse model of core myopathy

International Nuclear Information System (INIS)

Zvaritch, Elena; MacLennan, David H.

2015-01-01

Muscle spindles from the hind limb muscles of adult Ryr1 I4895T/wt (IT/+) mice exhibit severe structural abnormalities. Up to 85% of the spindles are separated from skeletal muscle fascicles by a thick layer of connective tissue. Many intrafusal fibers exhibit degeneration, with Z-line streaming, compaction and collapse of myofibrillar bundles, mitochondrial clumping, nuclear shrinkage and pyknosis. The lesions resemble cores observed in the extrafusal myofibers of this animal model and of core myopathy patients. Spindle abnormalities precede those in extrafusal fibers, indicating that they are a primary pathological feature in this murine Ryr1-related core myopathy. Muscle spindle involvement, if confirmed for human core myopathy patients, would provide an explanation for an array of devastating clinical features characteristic of these diseases and provide novel insights into the pathology of RYR1-related myopathies. - Highlights: • Muscle spindles exhibit structural abnormalities in a mouse model of core myopathy. • Myofibrillar collapse and mitochondrial clumping is observed in intrafusal fibers. • Myofibrillar degeneration follows a pattern similar to core formation in extrafusal myofibers. • Muscle spindle abnormalities are a part of the pathological phenotype in the mouse model of core myopathy. • Direct involvement of muscle spindles in the pathology of human RYR1-related myopathies is proposed

Mitochondrial myopathy presenting as fibromyalgia: a case report

Directory of Open Access Journals (Sweden)

Abdullah Mishal

2012-02-01

Full Text Available Abstract Introduction To the best of our knowledge, we describe for the first time the case of a woman who met the diagnostic criteria for fibromyalgia, did not respond to therapy for that disorder, and was subsequently diagnosed by biochemical and genetic studies with a mitochondrial myopathy. Treatment of the mitochondrial myopathy resulted in resolution of symptoms. This case demonstrates that mitochondrial myopathy may present in an adult with a symptom complex consistent with fibromyalgia. Case presentation Our patient was a 41-year-old Caucasian woman with symptoms of fatigue, exercise intolerance, headache, and multiple trigger points. Treatment for fibromyalgia with a wide spectrum of medications including non-steroidal anti-inflammatory drugs, antidepressants, gabapentin and pregabalin had no impact on her symptoms. A six-minute walk study demonstrated an elevated lactic acid level (5 mmol/L; normal Conclusions This case demonstrates that adults diagnosed with fibromyalgia may have their symptom complex related to an adult onset mitochondrial myopathy. This is an important finding since treatment of mitochondrial myopathy resulted in resolution of symptoms.

Statin-associated immune-mediated myopathy: biology and clinical implications.

Science.gov (United States)

Christopher-Stine, Lisa; Basharat, Pari

2017-04-01

In the last 6 years, our understanding of statin-associated myopathy expanded to include not only a toxic myopathy with limited and reversible side-effects but also an autoimmune variety in which statins likely induce an autoimmune myopathy that is both associated with a specific autoantibody and responsive to immunosuppression and immune modulation. This review widens the reader's understanding of statin myopathy to include an autoimmune process. Statin-associated immune-mediated myopathy provides an example of an environmental trigger (statins) directly implicated in an autoimmune disease associated with a genetic predisposition as well as potential risk factors including concomitant diseases and specific statins. Given a median exposure to statins of 38 months, providers should be aware that anti-3-hydroxy-3-methyl-glutaryl-coenzyme A reductase (HMGCR) myopathy may occur even after several years of statin exposure. It is important for the reader to understand the clinical presentation of statin-associated immune-mediated myopathy and the difference in its clinical presentation to that of statins as direct myotoxins. Prompt recognition of such an entity allows the clinician to immediately stop the offending agent if it has not already been discontinued as well as to recognize that statin rechallenge is not a likely option, and that prompt treatment with immunosuppression and/or immunomodulation is usually of enormous benefit to the patient in restoring muscle strength and physical function. VIDEO ABSTRACT.

Mitochondrial Myopathy: A Rare Cause of Early-Onset Vocal Fold Atrophy

Science.gov (United States)

Kelly, Elizabeth A.; Bock, Jonathan M.; Peltier, Amanda C.; Oh, Shin J.; Garrett, C. Gaelyn

2014-01-01

Objectives We present the second published case of laryngeal involvement in mitochondrial myopathy. Methods A patient with laryngeal involvement of mitochondrial myopathy is presented, together with a literature review. Results A 41-year-old man presented with progressive breathy dysphonia. His brother had mitochondrial myopathy. Biopsy of the biceps muscle demonstrated cytochrome C oxidase–negative ragged blue fibers confirming mitochondrial myopathy. Videostroboscopy showed marked vocal fold atrophy, but subsequent injection laryngoplasty did not significantly improve the patient’s voice, despite improved postoperative glottic closure. Conclusions Mitochondrial myopathy should be considered in the differential diagnosis of severe early-onset vocal fold atrophy. PMID:23577570

An integrated diagnosis strategy for congenital myopathies.

Directory of Open Access Journals (Sweden)

Johann Böhm

Full Text Available Congenital myopathies are severe muscle disorders affecting adults as well as children in all populations. The diagnosis of congenital myopathies is constrained by strong clinical and genetic heterogeneity. Moreover, the majority of patients present with unspecific histological features, precluding purposive molecular diagnosis and demonstrating the need for an alternative and more efficient diagnostic approach. We used exome sequencing complemented by histological and ultrastructural analysis of muscle biopsies to identify the causative mutations in eight patients with clinically different skeletal muscle pathologies, ranging from a fatal neonatal myopathy to a mild and slowly progressive myopathy with adult onset. We identified RYR1 (ryanodine receptor mutations in six patients and NEB (nebulin mutations in two patients. We found novel missense and nonsense mutations, unraveled small insertions/deletions and confirmed their impact on splicing and mRNA/protein stability. Histological and ultrastructural findings of the muscle biopsies of the patients validated the exome sequencing results. We provide the evidence that an integrated strategy combining exome sequencing with clinical and histopathological investigations overcomes the limitations of the individual approaches to allow a fast and efficient diagnosis, accelerating the patient's access to a better healthcare and disease management. This is of particular interest for the diagnosis of congenital myopathies, which involve very large genes like RYR1 and NEB as well as genetic and phenotypic heterogeneity.

Acute steroid myopathy: a highly overlooked entity.

Science.gov (United States)

Haran, Michal; Schattner, Ami; Kozak, Natasha; Mate, Andras; Berrebi, Alain; Shvidel, Lev

2018-02-15

Myopathy in patients being treated with corticosteroids is known primarily among chronically-treated patients or in critically ill and mechanically-ventilated patients receiving corticosteroids, often in high doses. To highlight the entity of acute, early-onset corticosteroid-treatment-associated myopathy and its characteristics. Reporting our experience with four patients and reviewing all published reports of myopathy developing ≤14 days of initiating corticosteroid-treatment. Acute corticosteroid myopathy (ASM) exists, though the syndrome appears to be rare. It is characterized by unpredictability and heterogeneity, sometimes developing within 1-3 days, after a single dose, which may not be high and administered by varied routes. Proximal limb muscle weakness is the most common form, but distal limb, bulbar and respiratory muscles may be involved. Steroid cessation often leads to improvement/resolution, but irreversibility may occur. A high index of suspicion for the possibility of ASM is necessary, to ensure drug discontinuation and recovery. This is particularly true since the entity is not widely recognized and its symptoms are often erroneously interpreted as due to the patient's underlying disease.

Statin Induced Myopathy a Patient with Multiple Systemic Diseases

Directory of Open Access Journals (Sweden)

Özgül Uçar

2011-04-01

Full Text Available Hydroxymethylglutaryl-coenzyme A reductase inhibitors (statins are the most successful class of drugs for the treatment of hypercholesterolaemia and dyslipidaemia. However, the popular profile of statins in terms of efficacy has been maligned by theiradverse effects. Statin induced myopathy, which can be seen at any time during the course of therapy, is a clinically important cause of statin intolerance and discontinuation. When a patient with multiple systemic diseases who use numerous medications represent with myalgia and muscle cramps, statin induced myopathy may not be remembered at first. We present a patient with multiple systemic diseases, alcohol and morphine abuse in whom myopathy developed. After exclusion of other etiologies, we concluded that myopathy was related to statin therapy.

Is Vitamin D Deficiency a Confounder in Alcoholic Skeletal Muscle Myopathy?

NARCIS (Netherlands)

Wijnia, J.W.; Wielders, J.P.M.; Lips, P.T.A.M.; van der Wiel, A.; Mulder, C.L.; Nieuwenhuis, K.G.A.

2013-01-01

Background: Excessive intake of alcohol is often associated with low or subnormal levels of vitamin D even in the absence of active liver disease. As vitamin D deficiency is a well-recognized cause of myopathy, alcoholic myopathy might be related to vitamin D deficiency. Chronic alcoholic myopathy

Immune-mediated statin myopathy.

Science.gov (United States)

Loganathan, Priyadarshini; Oddis, Chester V; Aggarwal, Rohit

2016-01-01

Statin-induced necrotizing autoimmune myopathy (SINAM) is associated with a unique clinical 5 phenotype of severe proximal muscle weakness during or after exposure to statins in patients with high creatine kinase (CK) levels. Electromyography (EMG) and muscle biopsy reveal features of a necrotizing myopathy and the anti-HMGCR autoantibody is frequently detected. Treatment requires a combination of statin discontinuation as well as immunomodulatory or immunosuppressive therapy. HLA typing (HLADRB1*1101) is strongly associated with anti-10 HMGCR autoantibody positivity in statin-exposed patients. It is well documented that statin triggers autoimmune disease in those with a genetic susceptibility. With the commercial availability of an accurate ELISA test, the natural history of the disease and its phenotypic features are becoming increasingly understood.

Bethlem myopathy is not allelic to limb-girdle muscular dystrophy type 1A

Energy Technology Data Exchange (ETDEWEB)

Speer, M.C.; Yamaoka, L.H.; Stajich, J.; Lewis, K. [and others

1995-08-28

The Bethlem myopathy, an autosomal-dominant myopathy, shows a distribution of proximal muscle weakness similar to that observed in dominant limb-girdle muscular dystrophy (LGMD). Yet the Bethlem myopathy differs from most limb-girdle dystrophies in two important regards. First, the Bethlem myopathy presents with joint contractures most commonly observed at the elbows, ankles, and neck. Secondly, disease onset in the Bethlem myopathy is in early childhood, while most dominant LGMDs present with adult onset. 6 refs., 1 fig.

Association between statin-associated myopathy and skeletal muscle damage.

Science.gov (United States)

Mohaupt, Markus G; Karas, Richard H; Babiychuk, Eduard B; Sanchez-Freire, Verónica; Monastyrskaya, Katia; Iyer, Lakshmanan; Hoppeler, Hans; Breil, Fabio; Draeger, Annette

2009-07-07

Many patients taking statins often complain of muscle pain and weakness. The extent to which muscle pain reflects muscle injury is unknown. We obtained biopsy samples from the vastus lateralis muscle of 83 patients. Of the 44 patients with clinically diagnosed statin-associated myopathy, 29 were currently taking a statin, and 15 had discontinued statin therapy before the biopsy (minimal duration of discontinuation 3 weeks). We also included 19 patients who were taking statins and had no myopathy, and 20 patients who had never taken statins and had no myopathy. We classified the muscles as injured if 2% or more of the muscle fibres in a biopsy sample showed damage. Using reverse transcriptase polymerase chain reaction, we evaluated the expression levels of candidate genes potentially related to myocyte injury. Muscle injury was observed in 25 (of 44) patients with myopathy and in 1 patient without myopathy. Only 1 patient with structural injury had a circulating level of creatine phosphokinase that was elevated more than 1950 U/L (10x the upper limit of normal). Expression of ryanodine receptor 3 was significantly upregulated in patients with biopsy evidence of structural damage (1.7, standard error of the mean 0.3). Persistent myopathy in patients taking statins reflects structural muscle damage. A lack of elevated levels of circulating creatine phosphokinase does not rule out structural muscle injury. Upregulation of the expression of ryanodine receptor 3 is suggestive of an intracellular calcium leak.

Meeting the challenges in the diagnosis of inflammatory myopathies ...

African Journals Online (AJOL)

Conditions that mimic IM include other causes of myopathy such as endocrine disorders, adverse effects of medication, metabolic myopathies and muscle dystrophies. Atypical features suggesting an alternative diagnosis are acute onset, severe pain, assymmetrical involvement, distal weakness and wasting. Appropriate ...

Atypical presentation of GNE myopathy with asymmetric hand weakness

Science.gov (United States)

de Dios, John Karl L.; Shrader, Joseph A.; Joe, Galen O.; McClean, Jeffrey C.; Williams, Kayla; Evers, Robert; Malicdan, May Christine V.; Ciccone, Carla; Mankodi, Ami; Huizing, Marjan; McKew, John C.; Bluemke, David A.; Gahl, William A.; Carrillo-Carrasco, Nuria

2014-01-01

GNE myopathy is a rare autosomal recessive muscle disease caused by mutations in GNE, the gene encoding the rate-limiting enzyme in sialic acid biosynthesis. GNE myopathy usually manifests in early adulthood with distal myopathy that progresses slowly and symmetrically, first involving distal muscles of the lower extremities, followed by proximal muscles with relative sparing of the quadriceps. Upper extremities are typically affected later in the disease. We report a patient with GNE myopathy who presented with asymmetric hand weakness. He had considerably decreased left grip strength, atrophy of the left anterior forearm and fibro-fatty tissue replacement of left forearm flexor muscles on T1-weighted magnetic resonance imaging. The patient was an endoscopist and thus the asymmetric hand involvement may be associated with left hand overuse in daily repetitive pinching and gripping movements, highlighting the possible impact of environmental factors on the progression of genetic muscle conditions. PMID:25182749

Autosomal dominant distal myopathy: Linkage to chromosome 14

Energy Technology Data Exchange (ETDEWEB)

Laing, N.G.; Laing, B.A.; Wilton, S.D.; Dorosz, S.; Mastaglia, F.L.; Kakulas, B.A. [Australian Neuromuscular Research Institute, Perth (Australia); Robbins, P.; Meredith, C.; Honeyman, K.; Kozman, H.

1995-02-01

We have studied a family segregating a form of autosomal dominant distal myopathy (MIM 160500) and containing nine living affected individuals. The myopathy in this family is closest in clinical phenotype to that first described by Gowers in 1902. A search for linkage was conducted using microsatellite, VNTR, and RFLP markers. In total, 92 markers on all 22 autosomes were run. Positive linkage was obtained with 14 of 15 markers tested on chromosome 14, with little indication of linkage elsewhere in the genome. Maximum two-point LOD scores of 2.60 at recombination fraction .00 were obtained for the markers MYH7 and D14S64 - the family structure precludes a two-point LOD score {ge} 3. Recombinations with D14S72 and D14S49 indicate that this distal myopathy locus, MPD1, should lie between these markers. A multipoint analysis assuming 100% penetrance and using the markers D14S72, D14S50, MYH7, D14S64, D14S54, and D14S49 gave a LOD score of exactly 3 at MYH7. Analysis at a penetrance of 80% gave a LOD score of 2.8 at this marker. This probable localization of a gene for distal myopathy, MPD1, on chromosome 14 should allow other investigators studying distal myopathy families to test this region for linkage in other types of the disease, to confirm linkage or to demonstrate the likely genetic heterogeneity. 24 refs., 3 figs., 1 tab.

Centronuclear myopathy: histopathological aspects in ten patients with chilfhood onset Miopatia centronuclear: aspectos histopatológicos em dez pacientes com a forma clínica de início na infância

Directory of Open Access Journals (Sweden)

EDMAR ZANOTELI

1998-03-01

Full Text Available Centronuclear myopathy is a rare congenital myopathy. According to the period of onset of signs and symptoms and the degree of muscular involvement three clinical forms are distinguished: severe neonatal; childhood onset; and adult onset. We describe herein the muscle biopsy findings of ten patients with the childhood onset form of the disease including three cases with ultrastructural study. The biopsies disclosed increased nuclear centralization that varied from 25 to 90% of the fibers, type 1 predominance, great variability in fiber diameters, involvement in the internal fiber's architecture, and focal areas of myofilament disorganization. The main histopathologic differential diagnoses included type I fiber predominance, congenital fiber type disproportion, and myotonic dystrophy. The histologic abnormalities in centronuclear myopathy may be due to an arrest of maturation on the fetal myotubular stage. The cause of this arrest remains elusive.A miopatia centronuclear (MCN é uma forma rara de miopatia congênita. De acordo com a época do início dos sinais e sintomas e com o grau de envolvimento muscular são distinguidas três formas clínicas: forma neonatal severa; forma de início na infância; e de início na vida adulta. São apresentados neste estudo os achados histopatológicos de dez pacientes portadores da forma de início na infância da MCN. Os fragmentos musculares foram processados através de colorações de rotina e histoquímica, e em três casos foi realizado estudo ultraestrutural. Dentre os resultados obtidos, destacou-se o aumento da centralização nuclear na fibra muscular, que variou de 25 a 90%. Adicionalmente, foram observadas predominância de fibras do tipo I, variabilidade entre o diâmetro das fibras musculares, alterações da arquitetura interna das fibras musculares e presença de áreas focais de desorganização dos miofilamentos. Devido a estes aspectos, os principais diagnósticos diferenciais

The expanding phenotype of mitochondrial myopathy.

Science.gov (United States)

DiMauro, Salvatore; Gurgel-Giannetti, Juliana

2005-10-01

Our understanding of mitochondrial diseases (defined restrictively as defects in the mitochondrial respiratory chain) continues to progress apace. In this review we provide an update of information regarding disorders that predominantly or exclusively affect skeletal muscle. Most recently described mitochondrial myopathies are due to defects in nuclear DNA, including coenzyme Q10 deficiency, and mutations in genes that control mitochondrial DNA (mtDNA) abundance and structure such as POLG and TK2. Barth syndrome, an X-linked recessive mitochondrial myopathy/cardiopathy, is associated with altered lipid composition of the inner mitochondrial membrane, but a putative secondary impairment of the respiratory chain remains to be documented. Concerning the 'other genome', the role played by mutations in protein encoding genes of mtDNA in causing isolated myopathies has been confirmed. It has also been confirmed that mutations in tRNA genes of mtDNA can cause predominantly myopathic syndromes and - contrary to conventional wisdom - these mutations can be homoplasmic. Defects in the mitochondrial respiratory chain impair energy production and almost invariably involve skeletal muscle, causing exercise intolerance, myalgia, cramps, or fixed weakness, which often affects extraocular muscles and results in droopy eyelids (ptosis) and progressive external ophthalmoplegia.

Refractory Hyperlactatemia with Organ Insufficiency in Lipid Storage Myopathy.

Science.gov (United States)

Xu, Yuanda; Zhou, Li; Liang, Weibo; He, Weiqun; Liu, Xiaoqing; Liang, Xiuling; Zhong, Nanshan; Li, Yimin

2015-08-01

Lipid storage myopathy is a metabolic disorder characterized by abnormal lipid accumulation in muscle fibers and progressive muscle weakness. Here, we report the case of a 17-year-old woman with progressive muscle weakness, refractory hyperlactatemia, and multiple organ insufficiency. Severe pneumonia was the initial diagnosis. After anti-infective treatment, fluid resuscitation, and mechanical ventilation, the patient's symptoms improved but hyperlactatemia and muscle weakness persisted. She was empirically treated with carnitine. Biochemical tests, electromyography, and muscle biopsy confirmed lipid storage myopathy. After 7 weeks of treatment, the patient resumed normal daily life. An empirical treatment with carnitine may be beneficial for patients before an accurate diagnosis of lipid storage myopathy is made.

A Case Report of Inflammatory Myopathy and Sideroblastic Anemia

Directory of Open Access Journals (Sweden)

F Binesh

2007-01-01

Full Text Available Mitochondrial myopathy, lactic acidosis, and siderobastic anemia (MLA SA syndrome is one of the newly reported mitochondrial diseases, seven cases of which have been reported. We report a child with inflammatory myopathy, sideroblastic anemia and lactic acidosis .The patient is a 8.5 year old boy with normal cognitive function suffering from chronic progressive weakness in lower extremities, inability to walk since four months and pallor. In paraclinical evaluation, sideroblastic anemia, mild lactic acidosis and elevated muscle enzymes were seen. Inflammatory myopathy (myositis in muscle biopsy was detected as well .The patient was administered oral prednisolone, folic acid, B6 and underwent regular physiotherapy. He ambulated after four months and resumed education and schooling.

Evaluating the Atrial Myopathy Underlying Atrial Fibrillation: Identifying the Arrhythmogenic and Thrombogenic Substrate

Science.gov (United States)

Goldberger, Jeffrey J.; Arora, Rishi; Green, David; Greenland, Philip; Lee, Daniel C.; Lloyd-Jones, Donald M.; Markl, Michael; Ng, Jason; Shah, Sanjiv J.

2015-01-01

Atrial disease or myopathy forms the substrate for atrial fibrillation (AF) and underlies the potential for atrial thrombus formation and subsequent stroke. Current diagnostic approaches in patients with AF focus on identifying clinical predictors with evaluation of left atrial size by echocardiography serving as the sole measure specifically evaluating the atrium. Although the atrial substrate underlying AF is likely developing for years prior to the onset of AF, there is no current evaluation to identify the pre-clinical atrial myopathy. Atrial fibrosis is one component of the atrial substrate that has garnered recent attention based on newer MRI techniques that have been applied to visualize atrial fibrosis in humans with prognostic implications regarding success of treatment. Advanced ECG signal processing, echocardiographic techniques, and MRI imaging of fibrosis and flow provide up-to-date approaches to evaluate the atrial myopathy underlying AF. While thromboembolic risk is currently defined by clinical scores, their predictive value is mediocre. Evaluation of stasis via imaging and biomarkers associated with thrombogenesis may provide enhanced approaches to assess risk for stroke in patients with AF. Better delineation of the atrial myopathy that serves as the substrate for AF and thromboembolic complications might improve treatment outcomes. Furthermore, better delineation of the pathophysiologic mechanisms underlying the development of the atrial substrate for AF, particularly in its earlier stages, could help identify blood and imaging biomarkers that could be useful to assess risk for developing new onset AF and suggest specific pathways that could be targeted for prevention. PMID:26216085

Mutation Spectrum of GNE Myopathy in the Indian Sub-Continent.

Science.gov (United States)

Bhattacharya, Sudha; Khadilkar, Satish V; Nalini, Atchayaram; Ganapathy, Aparna; Mannan, Ashraf U; Majumder, Partha P; Bhattacharya, Alok

GNE myopathy is an adult onset recessive genetic disorder that affects distal muscles sparing the quadriceps. GNE gene mutations have been identified in GNE myopathy patients all over the world. Homozygosity is a common feature in GNE myopathy patients worldwide. The major objective of this study was to investigate the mutation spectrum of GNE myopathy in India in relation to the population diversity in the country. We have collated GNE mutation data of Indian GNE myopathy patients from published literature and from recently identified patients. We also used data of people of Indian subcontinent from 1000 genomes database, South Asian Genome database and Strand Life Science database to determine frequency of GNE mutations in the general population. A total of 67 GNE myopathy patients were studied, of whom 21% were homozygous for GNE variants, while the rest were compound heterozygous. Thirty-five different mutations in the GNE gene were recorded, of which 5 have not been reported earlier. The most frequent mutation was p.Val727Met (65%) found mainly in the heterozygous form. Another mutation, p.Ile618Thr was also common (16%) but was found mainly in patients from Rajasthan, while p.Val727Met was more widely distributed. The latter was also seen at a high frequency in general population of Indian subcontinent in all the databases. It was also present in Thailand but was absent in general population elsewhere in the world. p.Val727Met is likely to be a founder mutation of Indian subcontinent.

Cerebrovascular Accidents In Myopathies

Directory of Open Access Journals (Sweden)

Farzad Fatehi

2017-02-01

Full Text Available Several types of stroke in myopathies are described: ischemic, metabolic, or cryptogenic. Ischemic stroke may be categorized as cardioembolic, angiopathic, hemodynamic, or thrombophilic. Cardiac involvement in the form of atrial fibrillation/flutter, dilated cardiomyopathy, or non-compaction Cardioembolic could ensue in stroke. Angiopathic stroke occurs provided that there is atherosclerosis or mitochondrial disorders. Thrombophilic stroke may happen in polymyositis or dermatomyositis along with anti-phospholipid syndrome. Metabolic stroke usually manifests as stroke-like episode and is a distinct feature of various mitochondrial disorders, principally MELAS syndrome. The clinical manifestations are as a result of a vasogenic edema, demonstrating as hyperintensity on T2, DWI, and apparent diffusion coefficient mapping. Differentiation between ischemic and metabolic stroke is essential in terms of diagnosis, therapy, and prognosis. In conclusion, ischemic stroke attributable to cardioembolism, arteriopathy, or thrombophilia are occasional events in myopathies, but metabolic stroke is a frequent feature of mitochondrial disorders.

Genetics Home Reference: nemaline myopathy

Science.gov (United States)

... deformities, abnormal curvature of the spine ( scoliosis ), and joint deformities (contractures). Most people with nemaline myopathy are ... Centre for Rare Diseases Washington University, St. Louis: Neuromuscular Disease Center Patient Support and Advocacy Resources (3 ...

Myopathy With SQSTM1 and TIA1 Variants: Clinical and Pathological Features

Directory of Open Access Journals (Sweden)

Zhiyv Niu

2018-03-01

Full Text Available ObjectiveThe aim of this study is to identify the molecular defect of three unrelated individuals with late-onset predominant distal myopathy; to describe the spectrum of phenotype resulting from the contributing role of two variants in genes located on two different chromosomes; and to highlight the underappreciated complex forms of genetic myopathies.Patients and methodsClinical and laboratory data of three unrelated probands with predominantly distal weakness manifesting in the sixth-seventh decade of life, and available affected and unaffected family members were reviewed. Next-generation sequencing panel, whole exome sequencing, and targeted analyses of family members were performed to elucidate the genetic etiology of the myopathy.ResultsGenetic analyses detected two contributing variants located on different chromosomes in three unrelated probands: a heterozygous pathogenic mutation in SQSTM1 (c.1175C>T, p.Pro392Leu and a heterozygous variant in TIA1 (c.1070A>G, p.Asn357Ser. The affected fraternal twin of one proband also carries both variants, while the unaffected family members harbor one or none. Two unrelated probands (family 1, II.3, and family 3, II.1 have a distal myopathy with rimmed vacuoles that manifested with index extensor weakness; the other proband (family 2, I.1 has myofibrillar myopathy manifesting with hypercapnic respiratory insufficiency and distal weakness.ConclusionThe findings indicate that all the affected individuals have a myopathy associated with both variants in SQSTM1 and TIA1, respectively, suggesting that the two variants determine the phenotype and likely functionally interact. We speculate that the TIA1 variant is a modifier of the SQSTM1 mutation. We identify the combination of SQSTM1 and TIA1 variants as a novel genetic defect associated with myofibrillar myopathy and suggest to consider sequencing both genes in the molecular investigation of myopathy with rimmed vacuoles and myofibrillar myopathy

Myopathy With SQSTM1 and TIA1 Variants: Clinical and Pathological Features.

Science.gov (United States)

Niu, Zhiyv; Pontifex, Carly Sabine; Berini, Sarah; Hamilton, Leslie E; Naddaf, Elie; Wieben, Eric; Aleff, Ross A; Martens, Kristina; Gruber, Angela; Engel, Andrew G; Pfeffer, Gerald; Milone, Margherita

2018-01-01

The aim of this study is to identify the molecular defect of three unrelated individuals with late-onset predominant distal myopathy; to describe the spectrum of phenotype resulting from the contributing role of two variants in genes located on two different chromosomes; and to highlight the underappreciated complex forms of genetic myopathies. Clinical and laboratory data of three unrelated probands with predominantly distal weakness manifesting in the sixth-seventh decade of life, and available affected and unaffected family members were reviewed. Next-generation sequencing panel, whole exome sequencing, and targeted analyses of family members were performed to elucidate the genetic etiology of the myopathy. Genetic analyses detected two contributing variants located on different chromosomes in three unrelated probands: a heterozygous pathogenic mutation in SQSTM1 (c.1175C>T, p.Pro392Leu) and a heterozygous variant in TIA1 (c.1070A>G, p.Asn357Ser). The affected fraternal twin of one proband also carries both variants, while the unaffected family members harbor one or none. Two unrelated probands (family 1, II.3, and family 3, II.1) have a distal myopathy with rimmed vacuoles that manifested with index extensor weakness; the other proband (family 2, I.1) has myofibrillar myopathy manifesting with hypercapnic respiratory insufficiency and distal weakness. The findings indicate that all the affected individuals have a myopathy associated with both variants in SQSTM1 and TIA1 , respectively, suggesting that the two variants determine the phenotype and likely functionally interact. We speculate that the TIA1 variant is a modifier of the SQSTM1 mutation. We identify the combination of SQSTM1 and TIA1 variants as a novel genetic defect associated with myofibrillar myopathy and suggest to consider sequencing both genes in the molecular investigation of myopathy with rimmed vacuoles and myofibrillar myopathy although additional studies are needed to investigate the

Statin-Associated Autoimmune Myopathy: A Systematic Review of 100 Cases.

Science.gov (United States)

Nazir, Salik; Lohani, Saroj; Tachamo, Niranjan; Poudel, Dilliram; Donato, Anthony

2017-04-01

Statins are a group of drugs that reduce the levels of triglycerides and cholesterol in blood by inhibiting HMG-CoA reductase, an enzyme involved in rate limiting step in cholesterol synthesis. About 2-20% patients on statins develop toxic myopathies, which usually resolve on discontinuation of statin. More recently, an immune-mediated necrotizing myopathy has been found to be associated with statin use which in most cases requires treatment with immunosuppressants. To perform a systematic review on published case reports and case series of statin-associated autoimmune myopathy. A comprehensive search of PUBMED, EMBASE, Cochrane library and ClinicalTrials.gov databases was performed for relevant articles from inception until March 19, 2016 to identify cases of statin-associated necrotizing myopathy and characterize their symptoms, evaluation and response to treatment. A total of 16 articles describing 100 patients with statin-associated autoimmune myopathy were identified. The mean age of presentation was 64.72 years, and 54.44% were males. The main presenting clinical feature was proximal muscle weakness, which was symmetric in 83.33% of patients. The mean creatine kinase (CK) was 6853 IU/l. Anti-HMG-CoA reductase antibody was positive in all cases tested (n = 57/57, 100%). In patients with no anti-HMG-CoA antibody results, diagnosis was established by findings of necrotizing myopathy on biopsy. Among the 83 cases where muscle biopsy information was available, 81.48% had necrosis, while 18.51% had combination of necrosis and inflammation. Most (83.82%) patients received two or more immunosuppressants to induce remission. Ninety-one percent had resolution of symptoms after treatment. Statin-associated necrotizing myopathy is a symmetric proximal muscle weakness associated with extreme elevations of CK. It is common in males and can occur after months of statin use. It is associated with necrosis on muscle biopsy and the presence of anti-HMG-CoA reductase antibodies

White striping and woody breast myopathies in the modern poultry industry: a review.

Science.gov (United States)

Kuttappan, V A; Hargis, B M; Owens, C M

2016-11-01

Myopathies are gaining the attention of poultry meat producers globally. White Striping (WS) is a condition characterized by the occurrence of white striations parallel to muscle fibers on breast, thigh, and tender muscles of broilers, while Woody Breast (WB) imparts tougher consistency to raw breast fillets. Histologically, both conditions have been characterized with myodegeneration and necrosis, fibrosis, lipidosis, and regenerative changes. The occurrence of these modern myopathies has been associated with increased growth rate in birds. The severity of the myopathies can adversely affect consumer acceptance of raw cut up parts and/or quality of further processed poultry meat products, resulting in huge economic loss to the industry. Even though gross and/or histologic characteristics of modern myopathies are similar to some of the known conditions, such as hereditary muscular dystrophy, nutritional myopathy, toxic myopathies, and marbling, WS and WB could have a different etiology. As a result, there is a need for future studies to identify markers for WS and WB in live birds and genetic, nutritional, and/or management strategies to alleviate the condition. © 2016 Poultry Science Association Inc.

Absence of anti-HMG-CoA reductase autoantibodies in severe self-limited statin-related myopathy.

Science.gov (United States)

Floyd, James S; Brody, Jennifer A; Tiniakou, Eleni; Psaty, Bruce M; Mammen, Andrew

2016-06-01

Patients with self-limited statin-related myopathy improve spontaneously when statins are stopped. In contrast, patients with statin-associated autoimmune myopathy have autoantibodies recognizing 3-hydroxy-3-methyl-glutaryl-coenzyme A reductase (HMGCR) and usually require immunosuppressive therapy to control their disease. On initial presentation, it can sometimes be difficult to distinguish between these 2 diseases, as both present with muscle pain, weakness, and elevated serum creatine kinase (CK) levels. The goal of this study was to determine whether patients with severe self-limited statin-related myopathy also make anti-HMGCR autoantibodies. We screened 101 subjects with severe self-limited cerivastatin-related myopathy for anti-HMGCR autoantibodies. No patient with severe self-limited cerivastatin-related myopathy had anti-HMGCR autoantibodies. Anti-HMGCR autoantibody testing can be used to help differentiate whether a patient has self-limited myopathy due to cerivastatin or autoimmune statin-associated myopathy; these findings may apply to other statins as well. Muscle Nerve 54: 142-144, 2016. © 2016 Wiley Periodicals, Inc.

REV-ERB and ROR: therapeutic targets for treating myopathies

Science.gov (United States)

Welch, Ryan D.; Flaveny, Colin A.

2017-08-01

Muscle is primarily known for its mechanical roles in locomotion, maintenance of posture, and regulation of cardiac and respiratory function. There are numerous medical conditions that adversely affect muscle, myopathies that disrupt muscle development, regeneration and protein turnover to detrimental effect. Skeletal muscle is also a vital secretory organ that regulates thermogenesis, inflammatory signaling and directs context specific global metabolic changes in energy substrate preference on a daily basis. Myopathies differ in the causative factors that drive them but share common features including severe reduction in quality of life and significantly increased mortality all due irrefutably to the loss of muscle mass. Thus far clinically viable approaches for preserving muscle proteins and stimulating new muscle growth without unwanted side effects or limited efficacy has been elusive. Over the last few decades, evidence has emerged through in vitro and in vivo studies that suggest the nuclear receptors REV-ERB and ROR might modulate pathways involved in myogenesis and mitochondrial biogenesis. Hinting that REV-ERB and ROR might be targeted to treat myopathies. However there is still a need for substantial investigation into the roles of these nuclear receptors in in vivo rodent models of degenerative muscle diseases and acute injury. Although exciting, REV-ERB and ROR have somewhat confounding roles in muscle physiology and therefore more studies utilizing in vivo models of skeletal muscle myopathies are needed. In this review we highlight the molecular forces driving some of the major degenerative muscular diseases and showcase two promising molecular targets that may have the potential to treat myopathies: ROR and REV-ERB.

[Metabolic myopathies].

Science.gov (United States)

Papazian, Óscar; Rivas-Chacón, Rafael

2013-09-06

To review the metabolic myopathies manifested only by crisis of myalgias, cramps and rigidity of the muscles with decreased voluntary contractions and normal inter crisis neurologic examination in children and adolescents. These metabolic myopathies are autosomic recessive inherited enzymatic deficiencies of the carbohydrates and lipids metabolisms. The end result is a reduction of intra muscle adenosine triphosphate, mainly through mitochondrial oxidative phosphorylation, with decrease of available energy for muscle contraction. The one secondary to carbohydrates intra muscle metabolism disorders are triggered by high intensity brief (fatty acids metabolism disorders are triggered by low intensity prolonged (> 10 min) exercises. The conditions in the first group in order of decreasing frequency are the deficiencies of myophosforilase (GSD V), muscle phosphofructokinase (GSD VII), phosphoglycerate mutase 1 (GSD X) and beta enolase (GSD XIII). The conditions in the second group in order of decreasing frequency are the deficiencies of carnitine palmitoyl transferase II and very long chain acyl CoA dehydrogenase. The differential characteristics of patients in each group and within each group will allow to make the initial presumptive clinical diagnosis in the majority and then to order only the necessary tests to achieve the final diagnosis. Treatment during the crisis includes hydration, glucose and alkalinization of urine if myoglobin in blood and urine are elevated. Prevention includes avoiding exercise which may induce the crisis and fasting. The prognosis is good with the exception of rare cases of acute renal failure due to hipermyoglobinemia because of severe rabdomyolisis.

Myofibrillar myopathies: State of the art, present and future challenges.

Science.gov (United States)

Béhin, A; Salort-Campana, E; Wahbi, K; Richard, P; Carlier, R-Y; Carlier, P; Laforêt, P; Stojkovic, T; Maisonobe, T; Verschueren, A; Franques, J; Attarian, S; Maues de Paula, A; Figarella-Branger, D; Bécane, H-M; Nelson, I; Duboc, D; Bonne, G; Vicart, P; Udd, B; Romero, N; Pouget, J; Eymard, B

2015-10-01

Myofibrillar myopathies (MFM) have been described in the mid-1990s as a group of diseases sharing common histological features, including an abnormal accumulation of intrasarcoplasmic proteins, the presence of vacuoles and a disorganization of the intermyofibrillar network beginning at the Z-disk. The boundaries of this concept are still uncertain, and whereas six genes (DES, CRYAB, LDB3/ZASP, MYOT, FLNC and BAG3) are now classically considered as responsible for MFM, other entities such as FHL1 myopathy or Hereditary Myopathy with Early Respiratory Failure linked to mutations of titin can now as well be included in this group. The diagnosis of MFM is not always easy; as histological lesions can be focal, and muscle biopsy may be disappointing; this has led to a growing importance of muscle imaging, and the selectivity of muscle involvement has now been described in several disorders. Due to the rarity of these myopathies, if some clinical patterns (such as distal myopathy associated with cardiomyopathy due to desmin mutations) are now well known, surprises remain possible and should lead to systematic testing of the known genes in case of a typical histological presentation. In this paper, we aim at reviewing the data acquired on the six main genes listed above as well as presenting the experience from two French reference centres, Paris and Marseilles. Copyright © 2015 Elsevier Masson SAS. All rights reserved.

Evidence for marsh mallow (Malva parviflora) toxicosis causing myocardial disease and myopathy in four horses.

Science.gov (United States)

Bauquier, J; Stent, A; Gibney, J; Jerrett, I; White, J; Tennent-Brown, B; Pearce, A; Pitt, J

2017-05-01

Investigation of toxicosis caused by Malva parviflora was required after 4 horses from the same farm developed severe muscle fasciculations, tachycardia, sweating and periods of recumbency leading to death or euthanasia after ingesting the plant. To describe historical, clinical, clinicopathological and pathological findings of 4 horses with suspected M. parviflora toxicosis. The role of cyclopropene fatty acids (found in M. parviflora) and mechanism for toxicosis are proposed. Case series. Historical, physical examination, clinicopathological and pathological findings are reported. Due to similarities with atypical myopathy or seasonal pasture myopathy acyl carnitine profiles were performed on sera from 2 cases and equine controls. Presence of cyclopropene fatty acids was also examined in sera of 2 cases. M. parviflora had been heavily grazed by the horses with little other feed available. Horse 1 deteriorated rapidly and was subjected to euthanasia. Horse 2 was referred to hospital where severe myocardial disease and generalised myopathy was determined; this horse was subjected to euthanasia 36 h after admission. Horse 3 died rapidly and Horse 4 was subjected to euthanasia at onset of clinical signs. Post-mortem examinations performed on 3 horses revealed acute, multifocal cardiac and skeletal myonecrosis. Myocyte glycogen accumulation was absent when examined in Horse 2. Acyl carnitine profiles revealed increased C14-C18 acyl carnitine concentrations in cases relative to controls. Cyclopropene fatty acids were detected in sera of cases but not controls. These findings suggest aetiology different to that of atypical myopathy or seasonal pasture myopathy. We hypothesise that cyclopropene fatty acids in M. parviflora interfere with fatty acid β-oxidation in horses in negative energy balance, causing the clinical signs and abnormal acyl carnitine profiles. These equine cases suggest a pathophysiological course that closely mimics the human genetic condition very

Prevalence and phenotypes of congenital myopathy due to α-actin 1 gene mutations

DEFF Research Database (Denmark)

Witting, Nanna; Werlauff, Ulla; Duno, Morten

2016-01-01

airway pressure. Limb flexor/extensor muscles and upper and lower extremities were affected equally. Pronounced neck flexor weakness was noted. CONCLUSIONS: Congenital myopathy caused by ACTA1 mutations is fatal in infancy in most cases. This study shows that the prevalence of α-actin myopathy in older...... patients with congenital myopathy is not negligible and that phenotypes can be quite mild....

Morphologic imaging in muscular dystrophies and inflammatory myopathies

International Nuclear Information System (INIS)

Degardin, Adrian; Lacour, Arnaud; Vermersch, Patrick; Morillon, David; Cotten, Anne; Stojkovic, Tanya

2010-01-01

To determine if magnetic resonance imaging (MR imaging) is useful in the diagnostic workup of muscular dystrophies and idiopathic inflammatory myopathies for describing the topography of muscle involvement. MR imaging was performed in 31 patients: 8 with dystrophic myotony types 1 (n = 4) or 2 (n = 4); 11 with limb-girdle muscular dystrophy, including dysferlinopathy, calpainopathy, sarcoglycanopathy, and dystrophy associated with fukutin-related protein mutation; 3 with Becker muscular dystrophy; and 9 with idiopathic inflammatory myopathies, including polymyositis, dermatomyositis, and sporadic inclusion body myositis. Analysis of T1 images enabled us to describe the most affected muscles and the muscles usually spared for each muscular disease. In particular, examination of pelvis, thigh, and leg muscles demonstrated significant differences between the muscular diseases. On STIR images, hyperintensities were present in 62% of our patients with muscular dystrophies. A specific pattern of muscular involvement was established for each muscular disease. Hyperintensities observed on STIR images precede fatty degeneration and are not specific for inflammatory myopathies. (orig.)

Morphologic imaging in muscular dystrophies and inflammatory myopathies

Energy Technology Data Exchange (ETDEWEB)

Degardin, Adrian; Lacour, Arnaud; Vermersch, Patrick [CHU de Lille, Clinique neurologique, Lille (France); Morillon, David; Cotten, Anne [CHRU de Lille, Service de Radiologie Osteoarticulaire, Hopital Roger Salengro, Lille (France); Stojkovic, Tanya [G-H Pitie-Salpetriere, Institut de Myologie, Paris (France)

2010-12-15

To determine if magnetic resonance imaging (MR imaging) is useful in the diagnostic workup of muscular dystrophies and idiopathic inflammatory myopathies for describing the topography of muscle involvement. MR imaging was performed in 31 patients: 8 with dystrophic myotony types 1 (n = 4) or 2 (n = 4); 11 with limb-girdle muscular dystrophy, including dysferlinopathy, calpainopathy, sarcoglycanopathy, and dystrophy associated with fukutin-related protein mutation; 3 with Becker muscular dystrophy; and 9 with idiopathic inflammatory myopathies, including polymyositis, dermatomyositis, and sporadic inclusion body myositis. Analysis of T1 images enabled us to describe the most affected muscles and the muscles usually spared for each muscular disease. In particular, examination of pelvis, thigh, and leg muscles demonstrated significant differences between the muscular diseases. On STIR images, hyperintensities were present in 62% of our patients with muscular dystrophies. A specific pattern of muscular involvement was established for each muscular disease. Hyperintensities observed on STIR images precede fatty degeneration and are not specific for inflammatory myopathies. (orig.)

A Rare Manifestation of Hypothyroid Myopathy: Hoffmann's Syndrome

Directory of Open Access Journals (Sweden)

Kang Won Lee

2015-12-01

Full Text Available Hypothyroid myopathy is observed frequently and the resolution of the clinical manifestations of myopathy following thyroid hormone replacement is well known. However, a specific subtype of hypothyroid myopathy, Hoffmann's syndrome, characterized by increased muscular mass (pseudohypertrophy, proximal muscle weakness, muscle stiffness and cramps, is rarely reported. Herein, we describe a 34-year-old male who presented with proximal muscle weakness and non-pitting edema of the lower extremities. He initially visited the neurology department where he was suspected of having polymyositis. Additional laboratory evaluation revealed profound autoimmune hypothyroidism and elevated muscle enzymes including creatine kinase. The patient was started on levothyroxine treatment and, subsequently, clinical symptoms and biochemical parameters resolved with the treatment. The present case highlights that hypothyroidism should be considered in the differential diagnosis of musculoskeletal symptoms even in the absence of overt manifestations of hypothyroidism. To our knowledge, this is the first case reported in Korea.

Study of cognitive sphere in children and adolescents with congenital myopathy (theoretical review

Directory of Open Access Journals (Sweden)

V. A. Erokhina

2013-08-01

Full Text Available This paper presents an analysis of current approaches to the study of states of higher mental functions in children and adolescents suffering from various forms of hereditary myopathies. The aim of this work is to study the theoretical rationale and the possibility of specific disorders of mental function in children and adolescents with congenital myopathies. To achieve this objective during the study it was necessary to solve the following problems: give a description of the various groups and forms of congenital myopathies, their clinical characteristics; justify the possibility of considering the hereditary myopathies as a factor in the formation of changes in visual-spatial activities and thinking; evaluate the possibility to use complex neuropsychological psycho-diagnostic techniques for investigating the state of the higher mental functions of children with congenital myopathies. The possibility of neuropsychological correction for this category of patients is discussed also.

Glucocorticoid-induced myopathy in the intensive care unit

DEFF Research Database (Denmark)

Eddelien, Heidi Shil; Hoffmeyer, Henrik Westy; Lund, Eva Charlotte Løbner

2015-01-01

Glucocorticoids (GC) are used for intensive care unit (ICU) patients on several indications. We present a patient who was admitted to the ICU due to severe respiratory failure caused by bronchospasm requiring mechanical ventilation and treated with methylprednisolone 240 mg/day in addition...... to antibiotics and bronchiolytics. When the sedation was lifted on day 10, the patient was awake but quadriplegic. Blood samples revealed elevated muscle enzymes, electromyography showed myopathy, and a muscle biopsy was performed. Glucocorticoid-induced myopathy was suspected, GC treatment was tapered...

Genetics Home Reference: myopathy with deficiency of iron-sulfur cluster assembly enzyme

Science.gov (United States)

... Myopathy with deficiency of iron-sulfur cluster assembly enzyme Printable PDF Open All Close All Enable Javascript ... Myopathy with deficiency of iron-sulfur cluster assembly enzyme is an inherited disorder that primarily affects muscles ...

Whole-body muscle MRI to detect myopathies in non-extrapyramidal bent spine syndrome

International Nuclear Information System (INIS)

Ohana, Mickael; Durand, Marie-Christine; Marty, Catherine; Lazareth, Jean-Philippe; Maisonobe, Thierry; Mompoint, Dominique; Carlier, Robert-Yves

2014-01-01

Bent spine syndrome (BSS), defined as an abnormal forward flexion of the trunk resolving in supine position, is usually related to parkinsonism, but can also be encountered in myopathies. This study evaluates whole-body muscle MRI (WB-mMRI) as a tool for detecting underlying myopathy in non-extrapyramidal BSS. Forty-three patients (90 % women; 53-86 years old) with a non-extrapyramidal BSS were prospectively included. All underwent a 1.5-T WB-mMRI and a nerve conduction study. Muscle biopsy was performed if a myopathy could not be eliminated based on clinical examination and all tests. Systematic MRI interpretation focused on peripheral and axial muscle injury; spinal posture and incidental findings were also reported. WB-mMRI was completed for all patients, with 13 muscle biopsies ultimately needed and myopathy revealed as the final etiological diagnosis in five cases (12 %). All biopsy-proven myopathies were detected by the WB-mMRI. Relevant incidental MRI findings were made in seven patients. This study supports WB-mMRI as a sensitive and feasible tool for detecting myopathy in BSS patients. Associated with electroneuromyography, it can better indicate when a muscle biopsy is needed and guide it when required. Rigorous radiological interpretation is mandatory, so as not to miss incidental findings of clinical consequence. (orig.)

Whole-body muscle MRI to detect myopathies in non-extrapyramidal bent spine syndrome

Energy Technology Data Exchange (ETDEWEB)

Ohana, Mickael [Nouvel Hopital Civil - Hopitaux Universitaires de Strasbourg, Service de Radiologie B, Strasbourg (France); Durand, Marie-Christine [AP-HP - Hopital Raymond Poincare, Service de Neurologie, Garches (France); Marty, Catherine; Lazareth, Jean-Philippe [AP-HP - Hopital Raymond Poincare, Service de Rhumatologie, Garches (France); Maisonobe, Thierry [APH-HP - Hopital de la Pitie-Salpetriere, Service de Neuropathologie, Paris (France); Mompoint, Dominique; Carlier, Robert-Yves [AP-HP - Hopital Raymond Poincare, Service de Radiologie, Garches (France)

2014-08-15

Bent spine syndrome (BSS), defined as an abnormal forward flexion of the trunk resolving in supine position, is usually related to parkinsonism, but can also be encountered in myopathies. This study evaluates whole-body muscle MRI (WB-mMRI) as a tool for detecting underlying myopathy in non-extrapyramidal BSS. Forty-three patients (90 % women; 53-86 years old) with a non-extrapyramidal BSS were prospectively included. All underwent a 1.5-T WB-mMRI and a nerve conduction study. Muscle biopsy was performed if a myopathy could not be eliminated based on clinical examination and all tests. Systematic MRI interpretation focused on peripheral and axial muscle injury; spinal posture and incidental findings were also reported. WB-mMRI was completed for all patients, with 13 muscle biopsies ultimately needed and myopathy revealed as the final etiological diagnosis in five cases (12 %). All biopsy-proven myopathies were detected by the WB-mMRI. Relevant incidental MRI findings were made in seven patients. This study supports WB-mMRI as a sensitive and feasible tool for detecting myopathy in BSS patients. Associated with electroneuromyography, it can better indicate when a muscle biopsy is needed and guide it when required. Rigorous radiological interpretation is mandatory, so as not to miss incidental findings of clinical consequence. (orig.)

Genetics Home Reference: idiopathic inflammatory myopathy

Science.gov (United States)

... stumble while walking and find it difficult to grasp items. As in dermatomyositis and polymyositis, swallowing can ... and development? More about Mutations and Health Inheritance Pattern Most cases of idiopathic inflammatory myopathy are sporadic, ...

Acute liver failure after recommended doses of acetaminophen in patients with myopathies

NARCIS (Netherlands)

I. Ceelie (Ilse); L.P. James (Laura); V.M.G.J. Gijsen (Violette); R.A.A. Mathôt (Ron); S. Ito (Shinya); C.D. Tesselaar (Coranne); D. Tibboel (Dick); G. Koren (Gideon); S.N. de Wildt (Saskia)

2011-01-01

textabstractObjective: To determine the likelihood that recommended doses of acetaminophen are associated with acute liver failure in patients with myopathies. Design: Retrospective analysis. Setting: Level III pediatric intensive care unit. Patients: Two pediatric patients with myopathies and acute

Acute liver failure after recommended doses of acetaminophen in patients with myopathies

NARCIS (Netherlands)

Ceelie, Ilse; James, Laura P.; Gijsen, Violette; Mathot, Ron A. A.; Ito, Shinya; Tesselaar, Coranne D.; Tibboel, Dick; Koren, Gideon; de Wildt, Saskia N.

2011-01-01

To determine the likelihood that recommended doses of acetaminophen are associated with acute liver failure in patients with myopathies. Retrospective analysis. Level III pediatric intensive care unit. Two pediatric patients with myopathies and acute liver failure. CLINICAL INVESTIGATIONS: We

Congenital myopathy is caused by mutation of HACD1

OpenAIRE

Muhammad, Emad; Reish, Orit; Ohno, Yusuke; Scheetz, Todd; DeLuca, Adam; Searby, Charles; Regev, Miriam; Benyamini, Lilach; Fellig, Yakov; Kihara, Akio; Sheffield, Val C.; Parvari, Ruti

2013-01-01

Congenital myopathies are heterogeneous inherited diseases of muscle characterized by a range of distinctive histologic abnormalities. We have studied a consanguineous family with congenital myopathy. Genome-wide linkage analysis and whole-exome sequencing identified a homozygous non-sense mutation in 3-hydroxyacyl-CoA dehydratase 1 (HACD1) in affected individuals. The mutation results in non-sense mediated decay of the HACD1 mRNA to 31% of control levels in patient muscle and completely abro...

Fulminant lipid storage myopathy due to multiple acyl-coenzyme a dehydrogenase deficiency.

Science.gov (United States)

Whitaker, Charles H; Felice, Kevin J; Silvers, David; Wu, Qian

2015-08-01

The lipid storage myopathies, primary carnitine deficiency, neutral lipid storage disease, and multiple acyl coenzyme A dehydrogenase deficiency (MADD), are progressive disorders that cause permanent weakness. These disorders of fatty acid metabolism and intracellular triglyceride degradation cause marked fat deposition and damage to muscle cells. We describe a rapidly progressive myopathy in a previously healthy 33-year-old woman. Over 4 months, she developed a proximal and axial myopathy associated with diffuse myalgia and dysphagia, ultimately leading to respiratory failure and death. Muscle biopsy showed massive accumulation of lipid. Plasma acylcarnitine and urine organic acid analysis was consistent with MADD. This was confirmed by molecular genetic testing, which revealed 2 pathogenic mutations in the ETFDH gene. This report illustrates a late-onset case of MADD and reviews the differential diagnosis and evaluation of patients with proximal myopathy and excessive accumulation of lipid on muscle biopsy. © 2014 Wiley Periodicals, Inc.

CT and the diagnosis of myopathies. Preliminary findings in 42 cases

Energy Technology Data Exchange (ETDEWEB)

Calgo, M; Crisi, G; Martinelli, C; Colombo, A; Schoenhuber, R; Gibertoni, M

1986-01-01

A total of 42 patients with myopathies underwent CT scans in order to study the relationship between CT images and clinical findings. CT is a valuable diagnostic aid to distinguish primary from neurogenic myopathies, to facilitate directed biopsy and finally to classify the disease according to the degree and extent of the muscular lesion. (orig.).

Autosomal dominant distal myopathy due to a novel ACTA1 mutation.

Science.gov (United States)

Liewluck, Teerin; Sorenson, Eric J; Walkiewicz, Magdalena A; Rumilla, Kandelaria M; Milone, Margherita

2017-08-01

Mutations in skeletal muscle α-actin 1-encoding gene (ACTA1) cause autosomal dominant or recessive myopathies with marked clinical and pathological heterogeneity. Patients typically develop generalized or limb-girdle pattern of weakness, but recently a family with scapuloperoneal myopathy was reported. We describe a father and 2 children with childhood-to-juvenile onset distal myopathy, carrying a novel dominant ACTA1 variant, c.757G>C (p.Gly253Arg). Father had delayed motor development and developed significant proximal weakness later in life; he was initially misdiagnosed as having spinal muscular atrophy based on electromyographic findings. His children had predominant anterior distal leg and finger extensor involvement. Nemaline rods were abundant on the daughter's biopsy, absent on the father's initial biopsy, and extremely rare on the father's subsequent biopsy a decade later. The father's second biopsy also showed myofibrillar pathology and rare fibers with actin filament aggregates. The present family expands the spectrum of actinopathy to include a distal myopathy. Copyright © 2017 Elsevier B.V. All rights reserved.

Genetics Home Reference: hereditary fibrosing poikiloderma with tendon contractures, myopathy, and pulmonary fibrosis

Science.gov (United States)

... Hereditary fibrosing poikiloderma with tendon contractures, myopathy, and pulmonary fibrosis Printable PDF Open All Close All Enable Javascript ... Fibrosing Poikiloderma with Tendon Contractures, Myopathy, and Pulmonary ... Lung, and Blood Institute (NHLBI): Pulmonary Function Tests National ...

Characterization of DLK1+ cells emerging during skeletal muscle remodeling in response to myositis, myopathies, and acute injury

DEFF Research Database (Denmark)

Andersen, Ditte C; Petersson, Stine J; Jørgensen, Louise H

2009-01-01

, DLK1 was upregulated in all human myopathies analyzed, including Duchenne- and Becker muscular dystrophies. Substantial numbers of DLK1(+) satellite cells were observed in normal neonatal and Duchenne muscle, and furthermore, myogenic DLK1(+) cells were identified during muscle regeneration in animal...

GNE Myopathy in Turkish Sisters with a Novel Homozygous Mutation

Science.gov (United States)

Diniz, Gulden; Secil, Yaprak; Ceylaner, Serdar; Tokucoglu, Figen; Türe, Sabiha; Celebisoy, Mehmet; İncesu, Tülay Kurt; Akhan, Galip

2016-01-01

Background. Hereditary inclusion body myopathy is caused by biallelic defects in the GNE gene located on chromosome 9p13. It generally affects adults older than 20 years of age. Methods and Results. In this study, we present two Turkish sisters with progressive myopathy and describe a novel mutation in the GNE gene. Both sisters had slightly higher levels of creatine kinase (CK) and muscle weakness. The older sister presented at 38 years of age with an inability to climb steps, weakness, and a steppage gait. Her younger sister was 36 years old and had similar symptoms. The first symptoms of the disorder were seen when the sisters were 30 and 34 years old, respectively. The muscle biopsy showed primary myopathic features and presence of rimmed vacuoles. DNA analysis demonstrated the presence of previously unknown homozygous mutations [c.2152 G>A (p.A718T)] in the GNE genes. Conclusion. Based on our literature survey, we believe that ours is the first confirmed case of primary GNE myopathy with a novel missense mutation in Turkey. These patients illustrate that the muscle biopsy is still an important method for the differential diagnosis of vacuolar myopathies in that the detection of inclusions is required for the definitive diagnosis. PMID:27298745

Fibrous Myopathy as a Complication of Repeated Intramuscular Injections for Chronic Headache

Directory of Open Access Journals (Sweden)

R Burnham

2006-01-01

Full Text Available Two cases of fibrous myopathy associated with repeated, long-term intramuscular injections for treatment of chronic temporomandibular joint pain and chronic headache, respectively, are described. Both patients developed severe, function-limiting contractures in upper and lower extremity muscles used as injection sites. In one of the cases, the contractures were painful. Electrophysiological testing, magnetic resonance imaging and muscle biopsy results were all consistent with myopathy and replacement of skeletal muscle with noncontractile fibrous tissue. These cases are presented to increase awareness of fibrous myopathy and to promote surveillance for this serious potential complication of long-term intramuscular injections in chronic headache and other pain patients.

Myopathy and hepatic lipidosis in weaned lambs due to vitamin E deficiency.

Science.gov (United States)

Menzies, Paula; Langs, Lisa; Boermans, Herman; Martin, John; McNally, John

2004-03-01

A sheep flock experienced losses in weaned lambs from myopathy and hepatic lipidosis. Investigation revealed painful ambulation, illthrift, and unexpected death in lambs with normal selenium levels, deficient vitamin E levels, and elevated muscle and liver enzyme levels. Vitamin E deficiency should be considered when investigating myopathy and illthrift in lambs.

Myopathy and hepatic lipidosis in weaned lambs due to vitamin E deficiency

OpenAIRE

Menzies, Paula; Langs, Lisa; Boermans, Herman; Martin, John; McNally, John

2004-01-01

A sheep flock experienced losses in weaned lambs from myopathy and hepatic lipidosis. Investigation revealed painful ambulation, illthrift, and unexpected death in lambs with normal selenium levels, deficient vitamin E levels, and elevated muscle and liver enzyme levels. Vitamin E deficiency should be considered when investigating myopathy and illthrift in lambs.

ColVI myopathies: where do we stand, where do we go?

Directory of Open Access Journals (Sweden)

Allamand Valérie

2011-09-01

Full Text Available Abstract Collagen VI myopathies, caused by mutations in the genes encoding collagen type VI (ColVI, represent a clinical continuum with Ullrich congenital muscular dystrophy (UCMD and Bethlem myopathy (BM at each end of the spectrum, and less well-defined intermediate phenotypes in between. ColVI myopathies also share common features with other disorders associated with prominent muscle contractures, making differential diagnosis difficult. This group of disorders, under-recognized for a long time, has aroused much interest over the past decade, with important advances made in understanding its molecular pathogenesis. Indeed, numerous mutations have now been reported in the COL6A1, COL6A2 and COL6A3 genes, a large proportion of which are de novo and exert dominant-negative effects. Genotype-phenotype correlations have also started to emerge, which reflect the various pathogenic mechanisms at play in these disorders: dominant de novo exon splicing that enables the synthesis and secretion of mutant tetramers and homozygous nonsense mutations that lead to premature termination of translation and complete loss of function are associated with early-onset, severe phenotypes. In this review, we present the current state of diagnosis and research in the field of ColVI myopathies. The past decade has provided significant advances, with the identification of altered cellular functions in animal models of ColVI myopathies and in patient samples. In particular, mitochondrial dysfunction and a defect in the autophagic clearance system of skeletal muscle have recently been reported, thereby opening potential therapeutic avenues.

Dietary nitrate does not reduce oxygen cost of exercise or improve muscle mitochondrial function in patients with mitochondrial myopathy

NARCIS (Netherlands)

Nabben, M.; Schmitz, J.P.J.; Ciapaite, J.; le Clercq, C.M.P.; van Riel, N.A.; Haak, H.R.; Nicolay, K.; de Coo, I.F.M.; Smeets, H.; Praet, S.F.; van Loon, L.J.; Prompers, J.J.

2017-01-01

Muscle weakness and exercise intol erance negatively affect the quality of life of patients with mitochondrial myopathy. Short-term dietary nitrate supplementation has been shown to improve exercise performance and reduce oxygen cost of exercise in healthy humans and trained athletes. We

Genetics Home Reference: inclusion body myopathy with early-onset Paget disease and frontotemporal dementia

Science.gov (United States)

... Share: Email Facebook Twitter Home Health Conditions IBMPFD Inclusion body myopathy with early-onset Paget disease and ... Javascript to view the expand/collapse boxes. Description Inclusion body myopathy with early-onset Paget disease and ...

The Impact of Exercise on Statin-Associated Skeletal Muscle Myopathy

Science.gov (United States)

Chung, Hae R.; Vakil, Mayand; Munroe, Michael; Parikh, Alay; Meador, Benjamin M.; Wu, Pei T.; Jeong, Jin H.; Woods, Jeffrey A.; Wilund, Kenneth R.; Boppart, Marni D.

2016-01-01

HMG-CoA reductase inhibitors (statins) are the most effective pharmacological means of reducing cardiovascular disease risk. The most common side effect of statin use is skeletal muscle myopathy, which may be exacerbated by exercise. Hypercholesterolemia and training status are factors that are rarely considered in the progression of myopathy. The purpose of this study was to determine the extent to which acute and chronic exercise can influence statin-induced myopathy in hypercholesterolemic (ApoE-/-) mice. Mice either received daily injections of saline or simvastatin (20 mg/kg) while: 1) remaining sedentary (Sed), 2) engaging in daily exercise for two weeks (novel, Nov), or 3) engaging in daily exercise for two weeks after a brief period of training (accustomed, Acct) (2x3 design, n = 60). Cholesterol, activity, strength, and indices of myofiber damage and atrophy were assessed. Running wheel activity declined in both exercise groups receiving statins (statin x time interaction, pstatin treatment (statin main effect, pstatin x exercise interaction, pstatin treatment. Exercise (Acct and Nov) increased atrogin-1 mRNA in combination with statin treatment, yet enhanced fiber damage or atrophy was not observed. The results from this study suggest that exercise (Nov, Acct) does not exacerbate statin-induced myopathy in ApoE-/- mice, yet statin treatment reduces activity in a manner that prevents muscle from mounting a beneficial adaptive response to training. PMID:27936249

Severe polysaccharide storage myopathy in Belgian and Percheron draught horses.

Science.gov (United States)

Valentine, B A; Credille, K M; Lavoie, J P; Fatone, S; Guard, C; Cummings, J F; Cooper, B J

1997-05-01

A severe myopathy leading to death or euthanasia was identified in 4 Belgian and 4 Percheron draught horses age 2-21 years. Clinical signs ranged from overt weakness and muscle atrophy in 2 horses age 2 and 3 years, to recumbency with inability to rise in 6 horses age 4-21 years. In 5 horses there was mild to severe increases in muscle enzyme levels. Clinical diagnoses included equine motor neuron disease (2 horses), post anaesthetic myopathy (2 horses), exertional myopathy (2 horses), myopathy due to unknown (one horse), and equine protozoal myelitis (one horse). Characteristic histopathology of muscle from affected horses was the presence of excessive complex polysaccharide and/or glycogen, revealed by periodic acid-Schiff staining in all cases and by electron microscopy in one case. Evaluation of frozen section histochemistry performed on 2 cases indicated that affected fibres were Type 2 glycolytic fibres. Subsarcolemmal and intracytoplasmic vacuoles were most prominent in 3 horses age 2-4 years, and excessive glycogen, with little or no complex polysaccharide, was the primary compound stored in affected muscle in these young horses. Myopathic changes, including fibre size variation, fibre hypertrophy, internal nuclei, and interstitial fat infiltration, were most prominent in 5 horses age 6-21 years, and the accumulation of complex polysaccharide appeared to increase with age. Mild to moderate segmental myofibre necrosis was present in all cases.

Search for Pompe disease among patients with undetermined myopathies.

Science.gov (United States)

Lindberg, C; Anderson, B; Engvall, M; Hult, M; Oldfors, A

2015-07-20

Pompe disease is a rare treatable glycogen storage disease with in adults - a limb-girdle muscle weakness. Muscle biopsy may fail to show the typical vacuolar myopathy. We asked if we had un-diagnosed patients with Pompe disease in western Sweden. We searched the muscle biopsy registry during the time period 1986 until 2006 including 3665 biopsies and included patients at our Neuromuscular Center with unspecified myopathy or limb-girdle muscular dystrophy. The dry blood spot test was used to identify patients with Pompe disease. A total of 82 patients (46 from the biopsy register and 36 from our center) were seen and dry blood spot test was obtained. No patient with Pompe disease was found. The dry blood spot test was low in three cases (11, 16, and 18% of normal) but a second blood sample showed a normal result based on GAA enzyme activity in lymphocytes in all three patients. In one patient with low normal result of the analysis in lymphocytes a genetic test showed no pathogenic mutations. Further investigation gave a definite diagnose of another myopathy in 12 patients. The prevalence of Pompe disease in western Sweden (3 in 1.27 million or 0.24 per 100.000 inhabitants) is lower than in the Netherlands and New York. Re-evaluation of patients with myopathies but without definite diagnosis is rewarding since 12 of 82 patients in our study had a definite molecular diagnosis after workup. © 2015 John Wiley & Sons A/S. Published by John Wiley & Sons Ltd.

[Biologic therapy in idiopathic inflammatory myopathy].

Science.gov (United States)

Selva-O'Callaghan, Albert; Ramos Casals, Manel; Grau Junyent, Josep M

2014-09-15

The aim of this article is to study the evidence-based knowledge related to the use of biological therapies in patients diagnosed with idiopathic inflammatory myopathy (dermatomyositis, polymyositis and inclusion body myositis). In this review the leading published studies related to the use of biological therapy in patients with myositis are analysed; mainly those with high methodological standards, that means randomized and controlled studies. Methodological drawbacks due to the rarity and heterogeneity of these complex diseases are also addressed. Up to now is not possible to ascertain the biologics as a recommended therapy in patients with myositis, at least based in the current evidence-based knowledge, although it can not be neglected as a therapeutic option in some clinical situations, taking into account the scarce of effective treatments in those patients, especially in refractory myositis. Future studies probably will help to better define the role of biological therapies in patients with idiopathic inflammatory myopathy. Copyright © 2013 Elsevier España, S.L.U. All rights reserved.

Hoffmann's disease: MR imaging of hypothyroid myopathy

Energy Technology Data Exchange (ETDEWEB)

Chung, Jeewon; Ahn, Kyung-Sik; Kang, Chang Ho [Korea University Anam Hospital, Korea University College of Medicine, Department of Radiology, Seoul (Korea, Republic of); Hong, Suk-Joo [Korea University Guro Hospital, Korea University College of Medicine, Department of Radiology, Seoul (Korea, Republic of); Kim, Beak Hyun [Korea University Ansan Hospital, Korea University College of Medicine, Department of Radiology, Gyeonggi-do (Korea, Republic of)

2015-11-15

Hoffmann's syndrome is a hypothyroid myopathy presenting as muscle stiffness and hypertrophy. It is a rare complication of hypothyroidism. MRI features of this syndrome have seldom been described in the literature. We present a case of Hoffmann's syndrome in a 34-year-old man who underwent lower extremity contrast-enhanced MRI. MRI can demonstrate the hypertrophic configuration, T2 hyperintensity, and enhancement of the involved muscles in Hoffmann's syndrome. Along with clinical, laboratory, and electromyography findings, MRI may be helpful in distinguishing between inflammatory myopathy, myonecrosis, subacute muscle denervation, and infectious myositis. (orig.)

Hoffmann's disease: MR imaging of hypothyroid myopathy

International Nuclear Information System (INIS)

Chung, Jeewon; Ahn, Kyung-Sik; Kang, Chang Ho; Hong, Suk-Joo; Kim, Beak Hyun

2015-01-01

Hoffmann's syndrome is a hypothyroid myopathy presenting as muscle stiffness and hypertrophy. It is a rare complication of hypothyroidism. MRI features of this syndrome have seldom been described in the literature. We present a case of Hoffmann's syndrome in a 34-year-old man who underwent lower extremity contrast-enhanced MRI. MRI can demonstrate the hypertrophic configuration, T2 hyperintensity, and enhancement of the involved muscles in Hoffmann's syndrome. Along with clinical, laboratory, and electromyography findings, MRI may be helpful in distinguishing between inflammatory myopathy, myonecrosis, subacute muscle denervation, and infectious myositis. (orig.)

A study of acute muscle dysfunction with particular reference to dengue myopathy

Directory of Open Access Journals (Sweden)

Rajesh Verma

2017-01-01

Full Text Available Background: Acute myopathy is a common cause of acute motor quadriparesis which has various etiologies with different courses of illness and prognosis depending on the cause. Understanding this diversity helps us in proper approach toward diagnosis, predicting the prognosis, and possible complications and in improving the treatments that are being provided. This study was planned to study the clinical, electrophysiological, and etiological profile of patients presenting with acute myopathy. We also studied how dengue-related acute myopathy differs from other causes and also difference between myopathy due to myositis and hypokalemia in cases of dengue. Materials and Methods: This was a prospective, observational study involving all clinically suspected cases of acute myopathy of not more than 4 weeks duration with raised serum creatine kinase (CK level. They were subjected to detailed clinical evaluation along with hematological, biochemical, microbiological, and electrophysiological studies and followed-up for outcome at 1 and 3 months. Muscle biopsy and histopathological examination were done in selected patients after taking informed consent. Statistical analysis was performed by appropriate methods using SPSS version 16.0 (Chicago, IL, USA. Results: We evaluated thirty patients of acute myopathy with raised CK level. Seventeen patients had fever, 11 had myalgia, and 5 had skin lesions. All presented with symmetric weakness, 17 (56.7% patients having predominantly proximal weakness, neck or truncal weakness in 6 (20%, hyporeflexia in 12 (40%, with mean Medical Research Council (MRC sum score of 46.67 ± 6.0. Eight (mean modified Barthel index [MBI] at presentation - 15 ± 3.7 patients had poor functional status according to MBI and 15 according to modified Rankin scale (MRS (mean MRS score - 2.5 ± 1.2. Etiology was dengue viral infection in 14 patients; hypokalemia due to various causes other than dengue in 8; pyomyositis in 3

Leiomodin-3-deficient mice display nemaline myopathy with fast-myofiber atrophy

Directory of Open Access Journals (Sweden)

Lei Tian

2015-06-01

Full Text Available Nemaline myopathy (NM is one of the most common forms of congenital myopathy, and affects either fast myofibers, slow myofibers, or both. However, an animal model for congenital myopathy with fast-myofiber-specific atrophy is not available. Furthermore, mutations in the leiomodin-3 (LMOD3 gene have recently been identified in a group of individuals with NM. However, it is not clear how loss of LMOD3 leads to NM. Here, we report a mouse mutant in which the piggyBac (PB transposon is inserted into the Lmod3 gene and disrupts its expression. Lmod3PB/PB mice show severe muscle weakness and postnatal growth retardation. Electron microscopy and immunofluorescence studies of the mutant skeletal muscles revealed the presence of nemaline bodies, a hallmark of NM, and disorganized sarcomeric structures. Interestingly, Lmod3 deficiency caused muscle atrophy specific to the fast fibers. Together, our results show that Lmod3 is required in the fast fibers for sarcomere integrity, and this study offers the first NM mouse model with muscle atrophy that is specific to fast fibers. This model could be a valuable resource for interrogating myopathy pathogenesis and developing therapeutics for NM as well as other pathophysiological conditions with preferential atrophy of fast fibers, including cancer cachexia and sarcopenia.

Identification of methylenecyclopropyl acetic acid in serum of European horses with atypical myopathy.

Science.gov (United States)

Votion, D-M; van Galen, G; Sweetman, L; Boemer, F; de Tullio, P; Dopagne, C; Lefère, L; Mouithys-Mickalad, A; Patarin, F; Rouxhet, S; van Loon, G; Serteyn, D; Sponseller, B T; Valberg, S J

2014-03-01

It is hypothesised that European atypical myopathy (AM) has a similar basis as seasonal pasture myopathy in North America, which is now known to be caused by ingestion of hypoglycin A contained in seeds from the tree Acer negundo. Serum from horses with seasonal pasture myopathy contained the conjugated toxic metabolite of hypoglycin A, methylenecyclopropyl acetic acid (MCPA). Retrospective study on archived samples. 1) To determine whether MCPA-carnitine was present in serum of European horses confirmed to have AM; 2) to determine whether Acer negundo or related Acer species were present on AM pastures in Europe. Concentrations of MCPA-carnitine were analysed in banked serum samples of 17 AM horses from Europe and 3 diseased controls (tetanus, neoplasia and exertional rhabdomyolysis) using tandem mass spectrometry. Atypical myopathy was diagnosed by characteristic serum acylcarnitine profiles. Pastures of 12 AM farms were visited by experienced botanists and plant species were documented. Methylenecyclopropyl acetic acid-carnitine at high concentrations (20.39 ± 17.24 nmol/l; range 0.95-57.63 nmol/l; reference: <0.01 nmol/l) was identified in serum of AM but not disease controls (0.00 ± 0.00 nmol/l). Acer pseudoplatanus but not Acer negundo was present on all AM farms. Atypical myopathy in Europe, like seasonal pasture myopathy in North America, is highly associated with the toxic metabolite of hypoglycin A, MCPA-carnitine. This finding coupled with the presence of a tree of which seeds are known to also contain hypoglycin A indicates that ingestion of Acer pseudoplatanus is the probable cause of AM. This finding has major implications for the prevention of AM. © 2013 EVJ Ltd.

Myopathy in hyperthyroidism as a consequence of rapid reduction of thyroid hormone

Science.gov (United States)

Li, Qianrui; Liu, Yuping; Zhang, Qianying; Tian, Haoming; Li, Jianwei; Li, Sheyu

2017-01-01

Abstract Rationale: Myalgia and elevated creatine kinase (CK) are occasionally observed during the treatment of hyperthyroid patients. Relative hypothyroidism resulted from rapid thyroid hormone reduction had been promoted as a plausible cause of these myopathic changes, however rarely reported. Patient concerns: We hereby presented a 20-year-old female with Grave's disease, who developed myopathy and elevated CK during rapid correction of thyroid hormone. Diagnoses: Relative hypothyroidism-induced myopathy. Interventions: Antithyroid drug (ATD) dosage was reduced without levothyroxine replacement. Outcomes: The muscular symptoms were recovered with CK level returned to normal after adoption of the euthyroid status. Lessons: Differentiation of relative hypothyroidism from other causes of myopathy, especially with the effect of ATD, is important for clinical practice, although difficult in many cases. PMID:28746208

Role of Autophagy in Glycogen Breakdown and Its Relevance to Chloroquine Myopathy

Science.gov (United States)

Zirin, Jonathan; Nieuwenhuis, Joppe; Perrimon, Norbert

2013-01-01

Several myopathies are associated with defects in autophagic and lysosomal degradation of glycogen, but it remains unclear how glycogen is targeted to the lysosome and what significance this process has for muscle cells. We have established a Drosophila melanogaster model to study glycogen autophagy in skeletal muscles, using chloroquine (CQ) to simulate a vacuolar myopathy that is completely dependent on the core autophagy genes. We show that autophagy is required for the most efficient degradation of glycogen in response to starvation. Furthermore, we show that CQ-induced myopathy can be improved by reduction of either autophagy or glycogen synthesis, the latter possibly due to a direct role of Glycogen Synthase in regulating autophagy through its interaction with Atg8. PMID:24265594

Elucidation of the mechanism of atorvastatin-induced myopathy in a rat model.

Science.gov (United States)

El-Ganainy, Samar O; El-Mallah, Ahmed; Abdallah, Dina; Khattab, Mahmoud M; Mohy El-Din, Mahmoud M; El-Khatib, Aiman S

2016-06-01

Myopathy is among the well documented and the most disturbing adverse effects of statins. The underlying mechanism is still unknown. Mitochondrial dysfunction related to coenzyme Q10 decline is one of the proposed theories. The present study aimed to investigate the mechanism of atorvastatin-induced myopathy in rats. In addition, the mechanism of the coenzyme Q10 protection was investigated with special focus of mitochondrial alterations. Sprague-Dawely rats were treated orally either with atorvastatin (100mg/kg) or atorvastatin and coenzyme Q10 (100mg/kg). Myopathy was assessed by measuring serum creatine kinase (CK) and myoglobin levels together with examination of necrosis in type IIB fiber muscles. Mitochondrial dysfunction was evaluated by measuring muscle lactate/pyruvate ratio, ATP level, pAkt as well as mitochondrial ultrastructure examination. Atorvastatin treatment resulted in a rise in both CK (2X) and myoglobin (6X) level with graded degrees of muscle necrosis. Biochemical determinations showed prominent increase in lactate/pyruvate ratio and a decline in both ATP (>80%) and pAkt (>50%) levels. Ultrastructure examination showed mitochondrial swelling with disrupted organelle membrane. Co-treatment with coenzyme Q10 induced reduction in muscle necrosis as well as in CK and myoglobin levels. In addition, coenzyme Q10 improved all mitochondrial dysfunction parameters including mitochondrial swelling and disruption. These results presented a model for atorvastatin-induced myopathy in rats and proved that mitochondrial dysfunction is the main contributor in statin-myopathy pathophysiology. Copyright © 2016 Elsevier Ireland Ltd. All rights reserved.

Stac3 is a component of the excitation-contraction coupling machinery and mutated in Native American myopathy

Science.gov (United States)

Horstick, Eric J.; Linsley, Jeremy W.; Dowling, James J.; Hauser, Michael A.; McDonald, Kristin K.; Ashley-Koch, Allison; Saint-Amant, Louis; Satish, Akhila; Cui, Wilson W.; Zhou, Weibin; Sprague, Shawn M.; Stamm, Demetra S.; Powell, Cynthia M.; Speer, Marcy C.; Franzini-Armstrong, Clara; Hirata, Hiromi; Kuwada, John Y.

2013-01-01

Excitation-contraction coupling, the process that regulates contractions by skeletal muscles, transduces changes in membrane voltage by activating release of Ca2+ from internal stores to initiate muscle contraction. Defects in EC coupling are associated with muscle diseases. Here we identify Stac3 as a novel component of the EC coupling machinery. Using a zebrafish genetic screen, we generate a locomotor mutation that is mapped to stac3. We provide electrophysiological, Ca2+ imaging, immunocytochemical and biochemical evidence that Stac3 participates in excitation-contraction coupling in muscles. Furthermore, we reveal that a mutation in human STAC3 as the genetic basis of the debilitating Native American myopathy (NAM). Analysis of NAM stac3 in zebrafish shows that the NAM mutation decreases excitation-contraction coupling. These findings enhance our understanding of both excitation-contraction coupling and the pathology of myopathies. PMID:23736855

Flaccid quadriplegia due to thyrotoxic myopathy.

Science.gov (United States)

Couillard, Philippe; Wijdicks, Eelco F M

2014-04-01

Acute flaccid paralysis is an important clinical problem in neurological critical care. After implementing life-supporting measures, it is imperative to identify the correct diagnosis to provide timely appropriate care. Thyrotoxicosis is a recognized cause of myopathy, but rarely of quadriplegia. Here, we report a case of hyperthyroidism with severe weakness. Case report and video demonstration of clinical examination. We describe a case of a 59-year-old woman with Grave's disease who presented to the hospital with progressive shortness of breath secondary to atrial fibrillation with rapid ventricular response. Following contrast administration, she had a pulseless electrical activity arrest from which she recovered without cognitive sequelae, but with flaccid quadriplegia, facial diplegia, and hypophonia. CK was mildly elevated and electrolytes were essentially normal. Nerve conduction studies and electromyography demonstrated features supporting an acute myopathy without evidence of neuromuscular junction conduction abnormality. Normalization of thyroid hormones resulted in slow, but steady improvement over months after which she regained ambulation. Acute flaccid quadriplegia can result from thyrotoxicosis. With normalization of thyroid function, recovery can be expected.

Analysis of lipid profile in lipid storage myopathy.

Science.gov (United States)

Aguennouz, M'hammed; Beccaria, Marco; Purcaro, Giorgia; Oteri, Marianna; Micalizzi, Giuseppe; Musumesci, Olimpia; Ciranni, Annmaria; Di Giorgio, Rosa Maria; Toscano, Antonio; Dugo, Paola; Mondello, Luigi

2016-09-01

Lipid dysmetabolism disease is a condition in which lipids are stored abnormally in organs and tissues throughout the body, causing muscle weakness (myopathy). Usually, the diagnosis of this disease and its characterization goes through dosage of Acyl CoA in plasma accompanied with evidence of droplets of intra-fibrils lipids in the patient muscle biopsy. However, to understand the pathophysiological mechanisms of lipid storage diseases, it is useful to identify the nature of lipids deposited in muscle fiber. In this work fatty acids and triglycerides profile of lipid accumulated in the muscle of people suffering from myopathies syndromes was characterized. In particular, the analyses were carried out on the muscle biopsy of people afflicted by lipid storage myopathy, such as multiple acyl-coenzyme A dehydrogenase deficiency, and neutral lipid storage disease with myopathy, and by the intramitochondrial lipid storage dysfunctions, such as deficiencies of carnitine palmitoyltransferase II enzyme. A single step extraction and derivatization procedure was applied to analyze fatty acids from muscle tissues by gas chromatography with a flame ionization detector and with an electronic impact mass spectrometer. Triglycerides, extracted by using n-hexane, were analyzed by high performance liquid chromatography coupled to mass spectrometer equipped with an atmospheric pressure chemical ionization interface. The most representative fatty acids in all samples were: C16:0 in the 13-24% range, C18:1n9 in the 20-52% range, and C18:2n6 in the 10-25% range. These fatty acids were part of the most representative triglycerides in all samples. The data obtained was statistically elaborated performing a principal component analysis. A satisfactory discrimination was obtained among the different diseases. Using component 1 vs component 3 a 43.3% of total variance was explained. Such results suggest the important role that lipid profile characterization can have in supporting a correct

Technological quality, mineral profile, and sensory attributes of broiler chicken breasts affected by White Striping and Wooden Breast myopathies.

Science.gov (United States)

Tasoniero, G; Cullere, M; Cecchinato, M; Puolanne, E; Dalle Zotte, A

2016-11-01

The aim of the research was to study the impact of white striping and wooden breast myopathies on the technological quality, mineral, and sensory profile of poultry meat. With this purpose, a total of 138 breasts were selected for a control group with normal breasts (N), a group of breasts characterised by white striping (WS) myopathy, and a group of breasts having both white striping and wooden breast myopathies (WSWB). Data revealed that the simultaneous presence of the two myopathies, with respect to the WS lesion individually considered, had a further detrimental effect on pH (6.04 vs. 5.96; P white striping and wooden breast myopathies. © 2016 Poultry Science Association Inc.

Acquired multiple Acyl-CoA dehydrogenase deficiency in 10 horses with atypical myopathy.

Science.gov (United States)

Westermann, C M; Dorland, L; Votion, D M; de Sain-van der Velden, M G M; Wijnberg, I D; Wanders, R J A; Spliet, W G M; Testerink, N; Berger, R; Ruiter, J P N; van der Kolk, J H

2008-05-01

The aim of the current study was to assess lipid metabolism in horses with atypical myopathy. Urine samples from 10 cases were subjected to analysis of organic acids, glycine conjugates, and acylcarnitines revealing increased mean excretion of lactic acid, ethylmalonic acid, 2-methylsuccinic acid, butyrylglycine, (iso)valerylglycine, hexanoylglycine, free carnitine, C2-, C3-, C4-, C5-, C6-, C8-, C8:1-, C10:1-, and C10:2-carnitine as compared with 15 control horses (12 healthy and three with acute myopathy due to other causes). Analysis of plasma revealed similar results for these predominantly short-chain acylcarnitines. Furthermore, measurement of dehydrogenase activities in lateral vastus muscle from one horse with atypical myopathy indeed showed deficiencies of short-chain acyl-CoA dehydrogenase (0.66 as compared with 2.27 and 2.48 in two controls), medium-chain acyl-CoA dehydrogenase (0.36 as compared with 4.31 and 4.82 in two controls) and isovaleryl-CoA dehydrogenase (0.74 as compared with 1.43 and 1.61 nmol min(-1) mg(-1) in two controls). A deficiency of several mitochondrial dehydrogenases that utilize flavin adenine dinucleotide as cofactor including the acyl-CoA dehydrogenases of fatty acid beta-oxidation, and enzymes that degrade the CoA-esters of glutaric acid, isovaleric acid, 2-methylbutyric acid, isobutyric acid, and sarcosine was suspected in 10 out of 10 cases as the possible etiology for a highly fatal and prevalent toxic equine muscle disease similar to the combined metabolic derangements seen in human multiple acyl-CoA dehydrogenase deficiency also known as glutaric acidemia type II.

Sarcoidosis Presenting as Löfgren’s Syndrome with Myopathy

Directory of Open Access Journals (Sweden)

Şenol Kobak

2013-01-01

Full Text Available A 34-year-old female patient, who had proximal muscle weakness for 8 months, presented with erythema nodosum lesions on the pretibial region in addition to pain, swelling, and movement restriction in both ankles for the last one month. Thoracic CT demonstrated hilar and mediastinal lymphadenopathy. She underwent mediastinoscopic lymph node biopsy; biopsy result was consistent with noncaseating granuloma. Serum angiotensin converting enzyme level and muscle enzymes have been elevated. Muscular MRI and EMG findings were consistent with myositis. Muscle biopsy was done, and myopathy was found. The patient was diagnosed with sarcoidosis, Löfgren's syndrome, and sarcoid myopathy. The patient displayed remarkable clinical and radiological regression after 6-month corticosteroid and MTX therapy.

Becker muscular dystrophy-like myopathy regarded as so-called "fatty muscular dystrophy" in a pig: a case report and its diagnostic method.

Science.gov (United States)

Horiuchi, Noriyuki; Aihara, Naoyuki; Mizutani, Hiroshi; Kousaka, Shinichi; Nagafuchi, Tsuneyuki; Ochiai, Mariko; Ochiai, Kazuhiko; Kobayashi, Yoshiyasu; Furuoka, Hidefumi; Asai, Tetsuo; Oishi, Koji

2014-03-01

We describe a case of human Becker muscular dystrophy (BMD)-like myopathy that was characterized by the declined stainability of dystrophin at sarcolemma in a pig and the immunostaining for dystrophin on the formalin-fixed, paraffin-embedded (FFPE) tissue. The present case was found in a meat inspection center. The pig looked appeared healthy at the ante-mortem inspection. Muscular abnormalities were detected after carcass dressing as pale, discolored skeletal muscles with prominent fat infiltrations and considered so-called "fatty muscular dystrophy". Microscopic examination revealed following characteristics: diffused fat infiltration into the skeletal muscle and degeneration and regeneration of the remaining skeletal muscle fibers. Any lesions that were suspected of neurogenic atrophy, traumatic muscular degeneration, glycogen storage disease or other porcine muscular disorders were not observed. The immunostaining for dystrophin was conducted and confirmed to be applicable on FFPE porcine muscular tissues and revealed diminished stainability of dystrophin at the sarcolemma in the present case. Based on the histological observations and immunostaining results, the present case was diagnosed with BMD-like myopathy associated with dystrophin abnormality in a pig. Although the genetic properties were not clear, the present BMD-like myopathy implied the occurrence of dystrophinopathy in pigs. To the best of our knowledge, this is the first report of a natural case of myopathy associated with dystrophin abnormalities in a pig.

Ileocolonic transfer of solid chyme in small intestinal neuropathies and myopathies

Energy Technology Data Exchange (ETDEWEB)

Greydanus, M.P.; Camilleri, M.; Colemont, L.J.; Phillips, S.F.; Brown, M.L.; Thomforde, G.M. (Mayo Clinic and Foundation, Rochester, MN (USA))

1990-07-01

The aims of this study were to assess gastric emptying, small bowel transit and colonic filling in patients with motility disorders, with particular attention to the patterns of colonic filling. Gastrointestinal transit was assessed using a previously validated radiolabeled mixed meal. Fourteen patients with clinical and manometric features of chronic intestinal pseudoobstruction classified as intestinal neuropathy and 6 as intestinal myopathy, were studied. The results were compared with those from 10 healthy controls studied similarly. Gastric emptying and small bowel transit of solids were significantly slower in both groups of patients than in healthy controls (P less than 0.05). In health, the ileocolonic transit of solid chyme was characterized by intermittent bolus transfers. The mean size of boluses transferred to the colon (expressed as a percentage of ingested radiolabel) was significantly less (P less than 0.05) in patients with intestinal myopathy (10% +/- 4% (SEM)) than in healthy controls (25% +/- 4%) or in patients with intestinal neuropathy (25% +/- 4%). The intervals between bolus transfer of solids (plateaus in the colonic filling curve) were longer (P less than 0.05) in myopathies (212 +/- 89 minutes) than in health (45 +/- 7 minutes) or neuropathies (53 +/- 11 minutes). Thus, gastric emptying and small bowel transit were delayed in small bowel neuropathies and myopathies. Bolus filling of the colon was less frequent and less effective in patients with myopathic intestinal pseudoobstruction, whereas bolus transfer was preserved in patients with neuropathic intestinal pseudoobstruction.

Treatment of critical illness polyneuropathy and/or myopathy - a systematic review

DEFF Research Database (Denmark)

Ydemann, Mogens; Eddelien, Heidi Shil; Lauritsen, Anne Øberg

2012-01-01

The objective was to search the literature with a view to providing a general description of critical illness myopathy/polyneuropathy (CIM/CIP), including its genesis and prevention. Furthermore, it was our aim to determine whether new treatments have occurred in the past five years.......The objective was to search the literature with a view to providing a general description of critical illness myopathy/polyneuropathy (CIM/CIP), including its genesis and prevention. Furthermore, it was our aim to determine whether new treatments have occurred in the past five years....

Myopathy in Childhood Muscle-Specific Kinase Myasthenia Gravis.

Science.gov (United States)

Kirzinger, Lukas; Khomenko, Andrei; Schulte-Mattler, Wilhelm; Backhaus, Roland; Platen, Sabine; Schalke, Berthold

2016-12-01

Adult and pediatric patients suffering from MuSK (muscle-specific kinase) -antibody positive myasthenia gravis exhibit similar features to individuals with acetylcholine receptor (AChR) antibodies, but they differ in several characteristics such as a predominant bulbar, respiratory and neck weakness, a generally worse disease severity and a tendency to develop muscle atrophy. Muscle atrophy is a rare phenomenon that is usually restricted to the facial muscles. We describe a girl with MuSK-antibody positive myasthenia gravis who developed a myopathy with severe generalized muscular weakness, muscle atrophy, and myopathic changes on electromyography. This is the first published example of a generalized myopathic syndrome in myasthenia gravis. We review the relevant literature and discuss the hypothesis of a mitochondrial myopathy as a pathogenic mechanism in MuSK-antibody positive myasthenia gravis. Copyright © 2016 Elsevier Inc. All rights reserved.

The genetic basis of pectoralis major myopathies in modern broiler chicken lines

OpenAIRE

Bailey, Richard A.; Watson, Kellie A.; Bilgili, S. F.; Avendano, Santiago

2015-01-01

This is the first report providing estimates of the genetic basis of breast muscle myopathies (BMM) and their relationship with growth and yield in broiler chickens. In addition, this paper addresses the hypothesis that genetic selection for increase breast yield has contributed to the onset of BMM. Data were analyzed from ongoing recording of BMM within the Aviagen breeding program. This study focused on three BMM: deep pectoral myopathy (DPM; binary trait), white striping (WS; 4 categories)...

Evaluation of ubiquinone concentration and mitochondrial function relative to cerivastatin-induced skeletal myopathy in rats

International Nuclear Information System (INIS)

Schaefer, William H.; Lawrence, Jeffery W.; Loughlin, Amy F.; Stoffregen, Dana A.; Mixson, Lori A.; Dean, Dennis C.; Raab, Conrad E.; Yu, Nathan X.; Lankas, George R.; Frederick, Clay B.

2004-01-01

As a class, hydroxymethylglutaryl-coenzyme A (HMG-CoA) reductase inhibitors can potentially cause skeletal myopathy. One statin, cerivastatin, has recently been withdrawn from the market due to an unacceptably high incidence of rhabdomyolysis. The mechanism underlying statin-induced myopathy is unknown. This paper sought to investigate the relationship among statin-induced myopathy, mitochondrial function, and muscle ubiquinone levels. Rats were administered cerivastatin at 0.1, 0.5, and 1.0 (mg/kg)/day or dose vehicle (controls) by oral gavage for 15 days. Samples of type I-predominant skeletal muscle (soleus) and type II-predominant skeletal muscle [quadriceps and extensor digitorum longus (EDL)], and blood were collected on study days 5, 10, and 15 for morphological evaluation, clinical chemistry, mitochondrial function tests, and analysis of ubiquinone levels. No histological changes were observed in any of the animals on study days 5 or 10, but on study day 15, mid- and high-dose animals had necrosis and inflammation in type II skeletal muscle. Elevated creatine kinase (CK) levels in blood (a clinical marker of myopathy) correlated with the histopathological diagnosis of myopathy. Ultrastructural characterization of skeletal muscle revealed disruption of the sarcomere and altered mitochondria only in myofibers with degeneration, while adjacent myofibers were unaffected and had normal mitochondria. Thus, mitochondrial effects appeared not to precede myofiber degeneration. Mean coenzyme Q9 (CoQ9) levels in all dose groups were slightly decreased relative to controls in type II skeletal muscle, although the difference was not significantly different in most cases. Mitochondrial function in skeletal muscle was not affected by the changes in ubiquinone levels. The ubiquinone levels in high-dose-treated animals exhibiting myopathy were not significantly different from low-dose animals with no observable toxic effects. Furthermore, ubiquinone levels did not correlate

Skeletal muscle repair in a mouse model of nemaline myopathy.

Science.gov (United States)

Sanoudou, Despina; Corbett, Mark A; Han, Mei; Ghoddusi, Majid; Nguyen, Mai-Anh T; Vlahovich, Nicole; Hardeman, Edna C; Beggs, Alan H

2006-09-01

Nemaline myopathy (NM), the most common non-dystrophic congenital myopathy, is a variably severe neuromuscular disorder for which no effective treatment is available. Although a number of genes have been identified in which mutations can cause NM, the pathogenetic mechanisms leading to the phenotypes are poorly understood. To address this question, we examined gene expression patterns in an NM mouse model carrying the human Met9Arg mutation of alpha-tropomyosin slow (Tpm3). We assessed five different skeletal muscles from affected mice, which are representative of muscles with differing fiber-type compositions, different physiological specializations and variable degrees of pathology. Although these same muscles in non-affected mice showed marked variation in patterns of gene expression, with diaphragm being the most dissimilar, the presence of the mutant protein in nemaline muscles resulted in a more similar pattern of gene expression among the muscles. This result suggests a common process or mechanism operating in nemaline muscles independent of the variable degrees of pathology. Transcriptional and protein expression data indicate the presence of a repair process and possibly delayed maturation in nemaline muscles. Markers indicative of satellite cell number, activated satellite cells and immature fibers including M-Cadherin, MyoD, desmin, Pax7 and Myf6 were elevated by western-blot analysis or immunohistochemistry. Evidence suggesting elevated focal repair was observed in nemaline muscle in electron micrographs. This analysis reveals that NM is characterized by a novel repair feature operating in multiple different muscles.

Suspected myofibrillar myopathy in Arabian horses with a history of exertional rhabdomyolysis.

Science.gov (United States)

Valberg, S J; McKenzie, E C; Eyrich, L V; Shivers, J; Barnes, N E; Finno, C J

2016-09-01

Although exertional rhabdomyolysis (ER) is common in Arabian horses, there are no dedicated studies describing histopathological characteristics of muscle from Arabian horses with ER. To prospectively identify distinctive histopathological features of muscle from Arabian endurance horses with a history of ER (pro-ER) and to retrospectively determine their prevalence in archived samples from Arabian horses with exertional myopathies (retro-ER). Prospective and retrospective histopathological description. Middle gluteal muscle biopsies obtained from Arabian controls (n = 14), pro-ER (n = 13) as well as archived retro-ER (n = 25) muscle samples previously classified with type 2 polysaccharide storage myopathy (15/25), recurrent exertional rhabdomyolysis (7/25) and no pathology (3/25) were scored for histopathology and immunohistochemical staining of cytoskeletal proteins. Glutaraldehyde-fixed samples (2 pro-ER, one control) were processed for electron microscopy. Pro-ER and retro-ER groups were compared with controls using Mann-Whitney U and Fisher's exact tests. Centrally located myonuclei in mature myofibres were found in significantly more (Prhabdomyolysis, ectopic accumulation of cytoskeletal proteins and Z-disc degeneration bear a strong resemblance to a myofibrillar myopathy. While many of these horses were previously diagnosed with type 2 polysaccharide storage myopathy, pools of glycogen forming within disrupted myofibrils appeared to give the false appearance of a glycogen storage disorder. © 2015 EVJ Ltd.

Mutation update and genotype-phenotype correlations of novel and previously described mutations in TPM2 and TPM3 causing congenital myopathies

NARCIS (Netherlands)

Marttila, Minttu; Lehtokari, Vilma-Lotta; Marston, Steven; Nyman, Tuula A.; Barnerias, Christine; Beggs, Alan H.; Bertini, Enrico; Ceyhan-Birsoy, Ozge; Cintas, Pascal; Gerard, Marion; Gilbert-Dussardier, Brigitte; Hogue, Jacob S.; Longman, Cheryl; Eymard, Bruno; Frydman, Moshe; Kang, Peter B.; Klinge, Lars; Kolski, Hanna; Lochmüller, Hans; Magy, Laurent; Manel, Véronique; Mayer, Michèle; Mercuri, Eugenio; North, Kathryn N.; Peudenier-Robert, Sylviane; Pihko, Helena; Probst, Frank J.; Reisin, Ricardo; Stewart, Willie; Taratuto, Ana Lia; de Visser, Marianne; Wilichowski, Ekkehard; Winer, John; Nowak, Kristen; Laing, Nigel G.; Winder, Tom L.; Monnier, Nicole; Clarke, Nigel F.; Pelin, Katarina; Grönholm, Mikaela; Wallgren-Pettersson, Carina

2014-01-01

Mutations affecting skeletal muscle isoforms of the tropomyosin genes may cause nemaline myopathy, cap myopathy, core-rod myopathy, congenital fiber-type disproportion, distal arthrogryposes, and Escobar syndrome. We correlate the clinical picture of these diseases with novel (19) and previously

Mutation-specific effects on thin filament length in thin filament myopathy.

Science.gov (United States)

Winter, Josine M de; Joureau, Barbara; Lee, Eun-Jeong; Kiss, Balázs; Yuen, Michaela; Gupta, Vandana A; Pappas, Christopher T; Gregorio, Carol C; Stienen, Ger J M; Edvardson, Simon; Wallgren-Pettersson, Carina; Lehtokari, Vilma-Lotta; Pelin, Katarina; Malfatti, Edoardo; Romero, Norma B; Engelen, Baziel G van; Voermans, Nicol C; Donkervoort, Sandra; Bönnemann, C G; Clarke, Nigel F; Beggs, Alan H; Granzier, Henk; Ottenheijm, Coen A C

2016-06-01

Thin filament myopathies are among the most common nondystrophic congenital muscular disorders, and are caused by mutations in genes encoding proteins that are associated with the skeletal muscle thin filament. Mechanisms underlying muscle weakness are poorly understood, but might involve the length of the thin filament, an important determinant of force generation. We investigated the sarcomere length-dependence of force, a functional assay that provides insights into the contractile strength of muscle fibers as well as the length of the thin filaments, in muscle fibers from 51 patients with thin filament myopathy caused by mutations in NEB, ACTA1, TPM2, TPM3, TNNT1, KBTBD13, KLHL40, and KLHL41. Lower force generation was observed in muscle fibers from patients of all genotypes. In a subset of patients who harbor mutations in NEB and ACTA1, the lower force was associated with downward shifted force-sarcomere length relations, indicative of shorter thin filaments. Confocal microscopy confirmed shorter thin filaments in muscle fibers of these patients. A conditional Neb knockout mouse model, which recapitulates thin filament myopathy, revealed a compensatory mechanism; the lower force generation that was associated with shorter thin filaments was compensated for by increasing the number of sarcomeres in series. This allowed muscle fibers to operate at a shorter sarcomere length and maintain optimal thin-thick filament overlap. These findings might provide a novel direction for the development of therapeutic strategies for thin filament myopathy patients with shortened thin filament lengths. Ann Neurol 2016;79:959-969. © 2016 American Neurological Association.

Unfolded protein response and activated degradative pathways regulation in GNE myopathy.

Directory of Open Access Journals (Sweden)

Honghao Li

Full Text Available Although intracellular beta amyloid (Aβ accumulation is known as an early upstream event in the degenerative course of UDP-N-acetylglucosamine 2-epimerase/N-acetylmannosamine kinase (GNE myopathy, the process by which Aβdeposits initiate various degradative pathways, and their relationship have not been fully clarified. We studied the possible secondary responses after amyloid beta precursor protein (AβPP deposition including unfolded protein response (UPR, ubiquitin proteasome system (UPS activation and its correlation with autophagy system. Eight GNE myopathy patients and five individuals with normal muscle morphology were included in this study. We performed immunofluorescence and immunoblotting to investigate the expression of AβPP, phosphorylated tau (p-tau and endoplasmic reticulum molecular chaperones. Proteasome activities were measured by cleavage of fluorogenic substrates. The expression of proteasome subunits and linkers between proteasomal and autophagy systems were also evaluated by immunoblotting and relative quantitative real-time RT-PCR. Four molecular chaperones, glucose-regulated protein 94 (GRP94, glucose-regulated protein 78 (GRP78, calreticulin and calnexin and valosin containing protein (VCP were highly expressed in GNE myopathy. 20S proteasome subunits, three main proteasome proteolytic activities, and the factors linking UPS and autophagy system were also increased. Our study suggests that AβPP deposition results in endoplasmic reticulum stress (ERS and highly expressed VCP deliver unfolded proteins from endoplasmic reticulum to proteosomal system which is activated in endoplasmic reticulum associated degradation (ERAD in GNE myopathy. Excessive ubiquitinated unfolded proteins are exported by proteins that connect UPS and autophagy to autophagy system, which is activated as an alternative pathway for degradation.

Lipid storage myopathy with clinical markers of Marfan syndrome: A rare association

Directory of Open Access Journals (Sweden)

Subasree Ramakrishnan

2012-01-01

Full Text Available Disorders of lipid metabolism can cause variable clinical presentations, often involving skeletal muscle, alone or together with other tissues. A 19-year-old boy presented with a 2-year history of muscle pain, cramps, exercise intolerance and progressive weakness of proximal lower limbs. Examination revealed skeletal markers of Marfan syndrome in the form of increased arm span compared with height, Kyphoscoliois, moderate pectus excavatum, high arched palate and wrist sign. He also had mild neck flexor weakness and proximal lower limb weakness with areflexia. Pathologic findings revealed lipid-laden fine vacuoles in the muscle fibers. Possibility of carnitine deficiency myopathy was considered and the patient was started on carnitine and Co Q. The patient made remarkable clinical improvement over the next 2 months. This case is reported for rarity of the association of clinical markers of Marfan syndrome and lipid storage myopathy and sparse literature on lipid storage myopathy in the Indian context.

Hypothyroid myopathy. A clinical and pathologaical study.

Science.gov (United States)

McKeran, R O; Slavin, G; Ward, P; Paul, E; Mair, W G

1980-09-01

Ten patients with varying degrees of hypothroid myopathy were studied clinically and by serial percutaneous needle muscle biopsies before and during treatment with L-thyroxine. The biochemical evidence of hypothyroidism was related to the severity of the myopathic and signs before treatment. The severity of myopathic symptoms before and during treatment correlated with the biochemical evidence of hypothyrodism, a type II fibre atrophy and increased central nuclear counts. Likewise, the clinical evidence of a myopathy before and during treatment was correlated with both a type II fibre atrophy and loss and increased central nuclear counts but was not related to the biochemical parameters of hypothyroidism, except the level of thyroid stimulating hormone. In the muscle, before and during treatment, of the two most severely affected patients, intracellular glycogen inclusions were seen in scattered muscle fibres. On light microscopy and on electronmicroscopy, numerous mitochondria were seen responding to L-thyroxine with accumulations of subsarcolemmal honey-combing. Vesicular abnormalities, an electron dense matrix or occasional crystalline deposits were seen in muscle mitochondria from less severely azffected patients. Severely myopathic muscle contained excessive glycogen, membrane bound glycogen and excess lipid in a mainly perinuclear distribution. Occasional myelin and membranous bodies were seen and satellite cells during the recovery phase. A group of patients with hypothyroid myopathy who are likely to have a delayed recovery of full muscle strength on L-thyroxine may be recognised by the presence of severe proximal muscle weakness and characteristic changes on histochemical and electronmicroscopic examination of muscle. The spectrum of histochemical and electronmicroscopic abnormalities of muscle revealed with increasing degree of hypothyrodism, suggests that a generally reversible acquired glycogen storage and mictochondrial disorder is an important feature

Genetics Home Reference: early-onset myopathy with fatal cardiomyopathy

Science.gov (United States)

... in childhood, people with EOMFC may also develop joint deformities called contractures that restrict the movement of ... Home Edition for Patients and Caregivers: Dilated Cardiomyopathy Neuromuscular Disease Center, Washington University Orphanet: Early-onset myopathy ...

Statin induced myopathy presenting as mechanical musculoskeletal pain observed in two chiropractic patients

OpenAIRE

Rodine, Robert J; Tibbles, Anthony C; Kim, Peter SY; Alikhan, Neetan

2010-01-01

Lipid lowering drugs, such as statins, are commonly used to treat approximately 10 million Canadians affected by hypercholesterolemia. The most commonly experienced side-effect of statin medication is muscle pain. Statin induced myopathy consists of a spectrum of myopathic disorders ranging from mild myalgia to fatal rhabdomyolysis. The following is a presentation of 2 cases of statin induced myopathy in patients presenting in a chiropractic setting. In addition, discussion will surround the ...

Eosinophilic fasciitis in a child mimicking a myopathy.

NARCIS (Netherlands)

Pillen, S.; Engelen, B.G.M. van; Hoogen, F.H.J. van den; Fiselier, T.J.W.; Vossen, P. van der; Drost, G.

2006-01-01

A 14-year-old boy was suspected of having a myopathy with joint contractures. He presented with progressive painless joint contractures of his right wrist and fingers, and reduced muscle strength of his right arm, without obvious skin changes. Laboratory investigation showed a normal CK,

Genetics Home Reference: CAV3-related distal myopathy

Science.gov (United States)

... gene causes a peculiar form of distal myopathy. Neurology. 2002 Jan 22;58(2):323-5. Erratum in: Neurology 2002 Mar 12;58(5):839. Itoyoma Y [ ... 3 cause four distinct autosomal dominant muscle diseases. Neurology. 2004 Feb 24;62(4):538-43. Review. ...

Myopathy in hyperthyroidism as a consequence of rapid reduction of thyroid hormone: A case report.

Science.gov (United States)

Li, Qianrui; Liu, Yuping; Zhang, Qianying; Tian, Haoming; Li, Jianwei; Li, Sheyu

2017-07-01

Myalgia and elevated creatine kinase (CK) are occasionally observed during the treatment of hyperthyroid patients. Relative hypothyroidism resulted from rapid thyroid hormone reduction had been promoted as a plausible cause of these myopathic changes, however rarely reported. We hereby presented a 20-year-old female with Grave's disease, who developed myopathy and elevated CK during rapid correction of thyroid hormone. Relative hypothyroidism-induced myopathy. Antithyroid drug (ATD) dosage was reduced without levothyroxine replacement. The muscular symptoms were recovered with CK level returned to normal after adoption of the euthyroid status. Differentiation of relative hypothyroidism from other causes of myopathy, especially with the effect of ATD, is important for clinical practice, although difficult in many cases.

A novel mutation in PNPLA2 leading to neutral lipid storage disease with myopathy.

Science.gov (United States)

Ash, Daniel B; Papadimitriou, Dimitra; Hays, Arthur P; Dimauro, Salvatore; Hirano, Michio

2012-09-01

Mutations in PNPLA2, a gene encoding adipose triglyceride lipase, lead to neutral lipid storage disease with myopathy. To report the clinical and molecular features of a case of neutral lipid storage disease with myopathy resulting from a novel mutation in PNPLA2. Case report. University hospital. A 65-year-old man with progressive muscle weakness and high serum creatine kinase levels. Direct sequencing of the PNPLA2 gene. Identification of a novel homozygous mutation in the patient's PNPLA2 gene confirmed the suspected diagnosis of neutral lipid storage disease with myopathy. Screening of the PNPLA2 gene should be considered for patients presenting with high levels of creatine kinase, progressive muscle weakness, and systemic lipid accumulation. The presence of Jordans anomaly can be a strong diagnostic clue.

[Value of MRI in the treatment of Grave's disease orbital myopathy].

Science.gov (United States)

Oğuz, V; Yolar, M; Yetik, H; Cakirer, D; Uysal, O; Pazarli, H

2001-10-01

In order to evaluate the predictability of the results in the treatment of myopathy in cases with the clinical signs of muscle involvement, 177 extraocular muscles of 27 cases whose oedematous status was detected by MRI and who were given antiinflammatory treatment according to the data of this method, were studied. The nature of involvement was detected in respect with the signal intensity and thickness of each rectus muscle prior to the treatment and at the end of the sixth month following a three months' application of combined treatment of steroids and irradiation of 2000 rads. When the initial and final results were compared, the signal intensities of four involved recti showed significant decrease at the end of the treatment, as they were evaluated separately or together. Besides the thicknesses of these groups of involved recti which were evaluated separately showed significant decrease. The evaluation of the signal intensities by MRI is a way that enables noninvasive detection of the edema and prediction of the anti-inflammatory treatment's results of dysthyroid myopathy. Therefore a systematic follow up by MRI is recommended for the treatment choice in dysthyroid myopathy.

Miopatia ocular descendente Descending ocular myopathy: a case report

Directory of Open Access Journals (Sweden)

Marcos R. G. de Freitas

1975-06-01

Full Text Available Os autores apresentam caso de paciente jovem, do sexo feminino, com afecção muscular primária ocular e faríngea sem caráter familial. Foram feitos estudos eletromiográficos e histopatológicos musculares que confirmam o caráter miogênico do processo. É feita comparação entre a miopatia ocular e a miopatia ocular descendente, acreditando os autores que seriam variantesThe case of a 23 years old female patient, with primary involvement of the extraocular and faringeal muscles without familiar history is reported. Electromyographic and muscular biopsy studies proved the myogenic nature of the process. A clinical comparison between the ocular myopathy and the descending ocular myopathy is made, the authors thinking that both of them would be variants of the same muscle disease.

Opposed-phase MR imaging of lipid storage myopathy in a case of Chanarin-Dorfman disease

International Nuclear Information System (INIS)

Gaeta, Michele; Celona, Antonio; Racchiusa, Sergio; Mazziotti, Silvio; Minutoli, Fabio; Toscano, Antonio; Musumeci, Olimpia

2008-01-01

Chanarin-Dorfman disease (CDD) is a rare genetic disorder characterized by ichthyosis, myopathy, central nervous system disturbances, and intracellular lipid storage in muscle fibers, hepatocytes, and granulocytes. We describe skeletal muscle magnetic resonance imaging findings in a case of CDD, outlining the potential role of GE T1-weighted opposed-phase sequence (chemical shift imaging) in the evaluation of lipid storage myopathies. (orig.)

Opposed-phase MR imaging of lipid storage myopathy in a case of Chanarin-Dorfman disease

Energy Technology Data Exchange (ETDEWEB)

Gaeta, Michele; Celona, Antonio; Racchiusa, Sergio; Mazziotti, Silvio [University of Messina, Department of Radiological Sciences, Messina (Italy); Minutoli, Fabio [University of Messina, Department of Radiological Sciences, Messina (Italy); A.O.U. ' ' Policlinico G. Martino' ' , Dipartimento di Scienze Radiologiche, Messina (Italy); Toscano, Antonio; Musumeci, Olimpia [University of Messina, Department of Neurosciences, Psychiatry and Anaesthesiology, Messina (Italy)

2008-11-15

Chanarin-Dorfman disease (CDD) is a rare genetic disorder characterized by ichthyosis, myopathy, central nervous system disturbances, and intracellular lipid storage in muscle fibers, hepatocytes, and granulocytes. We describe skeletal muscle magnetic resonance imaging findings in a case of CDD, outlining the potential role of GE T1-weighted opposed-phase sequence (chemical shift imaging) in the evaluation of lipid storage myopathies. (orig.)

Whole-body MRI for full assessment and characterization of diffuse inflammatory myopathy

Directory of Open Access Journals (Sweden)

Saleh Saleh Elessawy

2016-09-01

Full Text Available Background Conventional magnetic resonance imaging (MRI is a highly valuable tool for full assessment of the extent of bilateral symmetrical diffuse inflammatory myopathy, owing to its high sensitivity in the detection of edema which correlates with, and sometimes precedes, clinical findings. Purpose To evaluate the use of whole-body (WB-MRI in characterization and full assessment of the extent and distribution of diffuse inflammatory myopathy. Material and Methods A prospective study on 15 patients presenting with clinical evidence of inflammatory myopathy. It included 4 boys/men and 11 girls/women (age range, 6–44 years; mean age, 25.5 years. 1.5 T WB-MRI was performed and the distribution and extent of disease severity was assessed according to muscle edema on STIR images. Results Four cases of dermatomyositis showed lower limb disease predilection with edema in gluteal, thigh, and calf muscles. The same finding was seen in one case with recurrent polymyositis and three cases with overlap myositis with systemic lupus erythematosus (SLE. Bilateral upper and lower limb myositis was demonstrated in three cases of polymyositis and one case of overlap myositis with scleroderma. Bilateral edema involving all scanned muscle groups was detected in three cases of polymyositis with paraneoplastic syndrome, SLE, and severe active dermatomyositis (including the neck muscles. Conclusion WB-MRI is the diagnostic modality of choice for cases of inflammatory myopathy. It accurately detects the most severely affected muscles candidate for biopsy and provides a reliable baseline study for follow-up of disease progression as well as response to treatment.

Mild trifunctional protein deficiency is associated with progressive neuropathy and myopathy and suggests a novel genotype-phenotype correlation.

OpenAIRE

Ibdah, J A; Tein, I; Dionisi-Vici, C; Bennett, M J; IJlst, L; Gibson, B; Wanders, R J; Strauss, A W

1998-01-01

Human mitochondrial trifunctional protein (TFP) is a heterooctamer of four alpha- and four beta-subunits that catalyzes three steps in the beta-oxidation spiral of long-chain fatty acids. TFP deficiency causes a Reye-like syndrome, cardiomyopathy, or sudden, unexpected death. We delineated the molecular basis for TFP deficiency in two patients with a unique phenotype characterized by chronic progressive polyneuropathy and myopathy without hepatic or cardiac involvement. Single-stranded confor...

The effect of coenzyme Q10 in statin myopathy.

Science.gov (United States)

Zlatohlavek, Lukas; Vrablik, Michal; Grauova, Barbora; Motykova, Eva; Ceska, Richard

2012-01-01

Statins significantly reduce CV morbidity and mortality. Unfortunately, one of the side effects of statins is myopathy, for which statins cannot be administered in sufficient doses or administered at all. The aim of this study was to demonstrate the effect of coenzyme Q10 in patients with statin myopathy. Twenty eight patients aged 60.6±10.7 years were monitored (18 women and 10 men) and treated with different types and doses of statin. Muscle weakness and pain was monitored using a scale of one to ten, on which patients expressed the degree of their inconvenience. Examination of muscle problems was performed prior to administration of CQ10 and after 3 and 6 months of dosing. Statistical analysis was performed using Friedman test, Annova and Students t-test. Pain decreased on average by 53.8% (pmuscle weakness by 44.4% (pmuscle pain and sensitivity statistically significantly decreased.

Aerobic Training in Patients with Congenital Myopathy

DEFF Research Database (Denmark)

Hedermann, Gitte; Vissing, Christoffer Rasmus; Jensen, Karen

2016-01-01

INTRODUCTION: Congenital myopathies (CM) often affect contractile proteins of the sarcomere, which could render patients susceptible to exercise-induced muscle damage. We investigated if exercise is safe and beneficial in patients with CM. METHODS: Patients exercised on a stationary bike for 30......: The Regional Committee on Health Research Ethics of the Capital Region of Denmark H-2-2013-066 and ClinicalTrials.gov H2-2013-066....

Muscle imaging in patients with tubular aggregate myopathy caused by mutations in STIM1

DEFF Research Database (Denmark)

Tasca, Giorgio; D'Amico, Adele; Monforte, Mauro

2015-01-01

Tubular aggregate myopathy is a genetically heterogeneous disease characterized by tubular aggregates as the hallmark on muscle biopsy. Mutations in STIM1 have recently been identified as one genetic cause in a number of tubular aggregate myopathy cases. To characterize the pattern of muscle...... involvement in this disease, upper and lower girdles and lower limbs were imaged in five patients with mutations in STIM1, and the scans were compared with two patients with tubular aggregate myopathy not caused by mutations in STIM1. A common pattern of involvement was found in STIM1-mutated patients...... of thigh and posterior leg with sparing of gracilis, tibialis anterior and, to a lesser extent, short head of biceps femoris. Mutations in STIM1 are associated with a homogeneous involvement on imaging despite variable clinical features. Muscle imaging can be useful in identifying STIM1-mutated patients...

Radiological features of Paget disease of bone associated with VCP myopathy

Energy Technology Data Exchange (ETDEWEB)

Farpour, Farzin [University of California, Department of Radiology, VA Long Beach Health Care, Irvine, CA (United States); Queens Hospital Center, Mount Sinai School of Medicine, New York, NY (United States); Tehranzadeh, Jamshid [University of California, Department of Radiology, VA Long Beach Health Care, Irvine, CA (United States); Donkervoort, Sandra; Vanjara, Pari [University of California, Division of Genetics and Metabolism, Department of Pediatrics, Irvine, CA (United States); Smith, Charles [University of Kentucky, Department of Neurology and Sanders-Brown Center on Aging, Lexington, KY (United States); Martin, Barbara [University of Kentucky, Lexington, KY (United States); Osann, Kathryn [University of California, Department of Medicine, Division of Hematology/Oncology, Irvine, CA (United States); Kimonis, Virginia E. [University of California, Division of Genetics and Metabolism, Department of Pediatrics, Irvine, CA (United States); UC Irvine Medical Center, Division of Genetics and Metabolism, Orange, CA (United States)

2012-03-15

Mutations in the Valosin-containing protein (VCP) gene cause a unique disorder characterized by classic Paget disease of bone (PDB), inclusion body myopathy, and frontotemporal dementia (IBMPFD). Our objective was to analyze the radiographic features of PDB associated with VCP mutations since there is a dearth of literature on the PDB component of VCP disease. Radiographic bone surveys were examined in 23 individuals with VCP mutation and compared with their unaffected relatives. Laboratory testing relevant for VCP disease was performed in all individuals. Of the 17 affected individuals with clinical manifestations of VCP disease, 16 of whom had myopathy, radiographic analysis revealed classic PDB in 11 individuals (65%). The mean age of diagnosis for myopathy was 43.8 years and for PDB was 38.1 years of age. Radiological evidence of PDB was seen in one individual (16%) amongst six clinically asymptomatic VCP mutation carriers. Alkaline phosphatase was a useful marker for diagnosing PDB in VCP disease. Radiographic findings of classic PDB are seen in 52% of individuals carrying VCP mutations at a significantly younger age than conventional PDB. Screening for PDB is warranted in at-risk individuals because of the benefit of early treatment with the new powerful bisphosphonates that hold the potential for prevention of disease. (orig.)

Dietary intervention rescues myopathy associated with neurofibromatosis type 1.

Science.gov (United States)

Summers, Matthew A; Rupasinghe, Thusitha; Vasiljevski, Emily R; Evesson, Frances J; Mikulec, Kathy; Peacock, Lauren; Quinlan, Kate GR; Cooper, Sandra T; Roessner, Ute; Stevenson, David A; Little, David G; Schindeler, Aaron

2018-02-15

Neurofibromatosis type 1 (NF1) is an autosomal dominant genetic disorder with complex symptomology. In addition to a predisposition to tumors, children with NF1 can present with reduced muscle mass, global muscle weakness, and impaired motor skills, which can have a significant impact on quality of life. Genetic mouse models have shown a lipid storage disease phenotype may underlie muscle weakness in NF1. Herein we confirm that biopsy specimens from six individuals with NF1 similarly manifest features of a lipid storage myopathy, with marked accumulation of intramyocellular lipid, fibrosis, and mononuclear cell infiltrates. Intramyocellular lipid was also correlated with reductions in neurofibromin protein expression by western analysis. An RNASeq profile of Nf1null muscle from a muscle-specific Nf1 knockout mouse (Nf1MyoD-/-) revealed alterations in genes associated with glucose regulation and cell signaling. Comparison by lipid mass spectrometry demonstrated that Nf1null muscle specimens were enriched for long chain fatty acid (LCFA) containing neutral lipids, such as cholesterol esters and triacylglycerides, suggesting fundamentally impaired LCFA metabolism. The subsequent generation of a limb-specific Nf1 knockout mouse (Nf1Prx1-/-) recapitulated all observed features of human NF1 myopathy, including lipid storage, fibrosis, and muscle weakness. Collectively, these insights led to the evaluation of a dietary intervention of reduced LCFAs, and enrichment of medium-chain fatty acids (MCFAs) with L-carnitine. Following 8-weeks of dietary treatment, Nf1Prx1-/- mice showed a 45% increase in maximal grip strength, and a 71% reduction in intramyocellular lipid staining compared with littermates fed standard chow. These data link NF1 deficiency to fundamental shifts in muscle metabolism, and provide strong proof of principal that a dietary intervention can ameliorate symptoms. © The Author(s) 2017. Published by Oxford University Press. All rights reserved. For

Hereditary vacuolar internal anal sphincter myopathy causing proctalgia fugax and constipation: a new case contribution.

Science.gov (United States)

de la Portilla, Fernando; Borrero, Juan José; Rafel, Enrique

2005-03-01

Hereditary anal sphincter myopathy is rare. We present a family with one affected member with proctalgia fugax, constipation and internal anal sphincter hypertrophy. Ultrastructural findings show vacuolization of smooth muscle cells without the characteristic polyglucosan inclusion. Further relief of symptoms was obtained using an oral calcium antagonist. Based on clinical presentation, endosonography and morphological findings, we consider our case is a histological variant of the vacuolar myopathy originally described.

Whole-body MRI in adult inflammatory myopathies: Do we need imaging of the trunk?

International Nuclear Information System (INIS)

Filli, Lukas; Manoliu, Andrei; Andreisek, Gustav; Guggenberger, Roman; Maurer, Britta

2015-01-01

To evaluate whether imaging of the trunk could be omitted in patients with inflammatory myopathies without losing diagnostic accuracy using a restricted whole-body magnetic resonance imaging (rWB-MRI) protocol. After approval by the institutional review board, this study was performed in 63 patients (male/female, 13/50; median age, 52 years; range, 20-81 years) with new-onset myopathic symptoms (group 1, n = 41) or previously diagnosed inflammatory myopathy (group 2, n = 22). After performing whole-body MRI (WB-MRI) at 3.0 Tesla, myositis and fatty atrophy were evaluated in different muscles by two independent radiologists. The intra-class correlation coefficient (ICC) was calculated to evaluate inter-observer reliability. Acquisition time was 56:01 minutes for WB-MRI and 37:37 minutes (32.8 % shorter) for rWB-MRI. In group 1, 14 patients were diagnosed with inflammatory myopathy based on muscle biopsy. rWB-MRI and WB-MRI showed equal sensitivity (42.9 %) and specificity (100 %) for myositis, and showed equal sensitivity (71.4 %) and similar specificity (63.0 % and 48.1 %, respectively) for fatty atrophy. No myositis was found in the body trunk in any patient. Inter-observer reliability was between substantial and perfect (ICC, 0.77-1.00). rWB-MRI showed diagnostic accuracy similar to WB-MRI for inflammatory myopathy at markedly reduced overall acquisition time. (orig.)

Whole-body MRI in adult inflammatory myopathies: Do we need imaging of the trunk?

Energy Technology Data Exchange (ETDEWEB)

Filli, Lukas; Manoliu, Andrei; Andreisek, Gustav; Guggenberger, Roman [University Hospital Zurich, University of Zurich, Institute of Diagnostic and Interventional Radiology, Zurich (Switzerland); Maurer, Britta [University Hospital Zurich, University of Zurich, Division of Rheumatology, Zurich (Switzerland)

2015-12-15

To evaluate whether imaging of the trunk could be omitted in patients with inflammatory myopathies without losing diagnostic accuracy using a restricted whole-body magnetic resonance imaging (rWB-MRI) protocol. After approval by the institutional review board, this study was performed in 63 patients (male/female, 13/50; median age, 52 years; range, 20-81 years) with new-onset myopathic symptoms (group 1, n = 41) or previously diagnosed inflammatory myopathy (group 2, n = 22). After performing whole-body MRI (WB-MRI) at 3.0 Tesla, myositis and fatty atrophy were evaluated in different muscles by two independent radiologists. The intra-class correlation coefficient (ICC) was calculated to evaluate inter-observer reliability. Acquisition time was 56:01 minutes for WB-MRI and 37:37 minutes (32.8 % shorter) for rWB-MRI. In group 1, 14 patients were diagnosed with inflammatory myopathy based on muscle biopsy. rWB-MRI and WB-MRI showed equal sensitivity (42.9 %) and specificity (100 %) for myositis, and showed equal sensitivity (71.4 %) and similar specificity (63.0 % and 48.1 %, respectively) for fatty atrophy. No myositis was found in the body trunk in any patient. Inter-observer reliability was between substantial and perfect (ICC, 0.77-1.00). rWB-MRI showed diagnostic accuracy similar to WB-MRI for inflammatory myopathy at markedly reduced overall acquisition time. (orig.)

Statin myopathy: the fly in the ointment for the prevention of cardiovascular disease in the 21st century?

Science.gov (United States)

Keen, Helen I; Krishnarajah, Janakan; Bates, Timothy R; Watts, Gerald F

2014-09-01

Cardiovascular disease (CVD) remains the leading cause of death in industrialized nations. Despite clear evidence of CVD risk reduction with HMG-CoA reductase inhibitors (statins), the side effects of these medications, particularly myopathy, limit their effectiveness. Studies into the mechanisms, aetiology and management of statin myopathy are limited by lack of an internationally agreed clinical definition and tools for assessing outcomes. Currently there is a paucity of evidence to guide the management of patients affected by statin myopathy; with the exception of dose reduction, there is little evidence that other strategies can improve statin tolerance, and even less evidence to suggest these alternate dosing strategies reduce cardiovascular risk. This review will cover current definitions, clinical presentations, risk factors, pathogenesis and management. PubMed was searched (English language, to 2014) for key articles pertaining to statin myopathy. This review then briefly describes our experience of managing this condition in a tertiary lipid disorders clinic, in the setting of limited guiding evidence. Knowledge gaps in the field of statin myopathy are identified and future research directions are suggested. We urge the need for international attention to address this important, but largely neglected clinical problem, that if unresolved will remain an impediment to the effective prevention and treatment of CVD.

Actin Nemaline Myopathy Mouse Reproduces Disease, Suggests Other Actin Disease Phenotypes and Provides Cautionary Note on Muscle Transgene Expression

Science.gov (United States)

Ravenscroft, Gianina; Jackaman, Connie; Sewry, Caroline A.; McNamara, Elyshia; Squire, Sarah E.; Potter, Allyson C.; Papadimitriou, John; Griffiths, Lisa M.; Bakker, Anthony J.; Davies, Kay E.; Laing, Nigel G.; Nowak, Kristen J.

2011-01-01

Mutations in the skeletal muscle α-actin gene (ACTA1) cause congenital myopathies including nemaline myopathy, actin aggregate myopathy and rod-core disease. The majority of patients with ACTA1 mutations have severe hypotonia and do not survive beyond the age of one. A transgenic mouse model was generated expressing an autosomal dominant mutant (D286G) of ACTA1 (identified in a severe nemaline myopathy patient) fused with EGFP. Nemaline bodies were observed in multiple skeletal muscles, with serial sections showing these correlated to aggregates of the mutant skeletal muscle α-actin-EGFP. Isolated extensor digitorum longus and soleus muscles were significantly weaker than wild-type (WT) muscle at 4 weeks of age, coinciding with the peak in structural lesions. These 4 week-old mice were ∼30% less active on voluntary running wheels than WT mice. The α-actin-EGFP protein clearly demonstrated that the transgene was expressed equally in all myosin heavy chain (MHC) fibre types during the early postnatal period, but subsequently became largely confined to MHCIIB fibres. Ringbinden fibres, internal nuclei and myofibrillar myopathy pathologies, not typical features in nemaline myopathy or patients with ACTA1 mutations, were frequently observed. Ringbinden were found in fast fibre predominant muscles of adult mice and were exclusively MHCIIB-positive fibres. Thus, this mouse model presents a reliable model for the investigation of the pathobiology of nemaline body formation and muscle weakness and for evaluation of potential therapeutic interventions. The occurrence of core-like regions, internal nuclei and ringbinden will allow analysis of the mechanisms underlying these lesions. The occurrence of ringbinden and features of myofibrillar myopathy in this mouse model of ACTA1 disease suggests that patients with these pathologies and no genetic explanation should be screened for ACTA1 mutations. PMID:22174871

A Nonsense Variant in the ACADVL Gene in German Hunting Terriers with Exercise Induced Metabolic Myopathy.

Science.gov (United States)

Lepori, Vincent; Mühlhause, Franziska; Sewell, Adrian C; Jagannathan, Vidhya; Janzen, Nils; Rosati, Marco; Alves de Sousa, Filipe Miguel Maximiano; Tschopp, Aurélie; Schüpbach, Gertraud; Matiasek, Kaspar; Tipold, Andrea; Leeb, Tosso; Kornberg, Marion

2018-05-04

Several enzymes are involved in fatty acid oxidation, which is a key process in mitochondrial energy production. Inherited defects affecting any step of fatty acid oxidation can result in clinical disease. We present here an extended family of German Hunting Terriers with 10 dogs affected by clinical signs of exercise induced weakness, muscle pain, and suspected rhabdomyolysis. The combination of clinical signs, muscle histopathology and acylcarnitine analysis with an elevated tetradecenoylcarnitine (C14:1) peak suggested a possible diagnosis of acyl-CoA dehydrogenase very long chain deficiency (ACADVLD). Whole genome sequence analysis of one affected dog and 191 controls revealed a nonsense variant in the ACADVL gene encoding acyl-CoA dehydrogenase very long chain, c.1728C>A or p.(Tyr576*). The variant showed perfect association with the phenotype in the 10 affected and more than 500 control dogs of various breeds. Pathogenic variants in the ACADVL gene have been reported in humans with similar myopathic phenotypes. We therefore considered the detected variant to be the most likely candidate causative variant for the observed exercise induced myopathy. To our knowledge, this is the first description of this disease in dogs, which we propose to name exercise induced metabolic myopathy (EIMM), and the identification of the first canine pathogenic ACADVL variant. Our findings provide a large animal model for a known human disease and will enable genetic testing to avoid the unintentional breeding of affected offspring. Copyright © 2018 Lepori et al.

A Nonsense Variant in the ACADVL Gene in German Hunting Terriers with Exercise Induced Metabolic Myopathy

Directory of Open Access Journals (Sweden)

Vincent Lepori

2018-05-01

Full Text Available Several enzymes are involved in fatty acid oxidation, which is a key process in mitochondrial energy production. Inherited defects affecting any step of fatty acid oxidation can result in clinical disease. We present here an extended family of German Hunting Terriers with 10 dogs affected by clinical signs of exercise induced weakness, muscle pain, and suspected rhabdomyolysis. The combination of clinical signs, muscle histopathology and acylcarnitine analysis with an elevated tetradecenoylcarnitine (C14:1 peak suggested a possible diagnosis of acyl-CoA dehydrogenase very long chain deficiency (ACADVLD. Whole genome sequence analysis of one affected dog and 191 controls revealed a nonsense variant in the ACADVL gene encoding acyl-CoA dehydrogenase very long chain, c.1728C>A or p.(Tyr576*. The variant showed perfect association with the phenotype in the 10 affected and more than 500 control dogs of various breeds. Pathogenic variants in the ACADVL gene have been reported in humans with similar myopathic phenotypes. We therefore considered the detected variant to be the most likely candidate causative variant for the observed exercise induced myopathy. To our knowledge, this is the first description of this disease in dogs, which we propose to name exercise induced metabolic myopathy (EIMM, and the identification of the first canine pathogenic ACADVL variant. Our findings provide a large animal model for a known human disease and will enable genetic testing to avoid the unintentional breeding of affected offspring.

Phenotypes, genotypes, and prevalence of congenital myopathies older than 5 years in Denmark

DEFF Research Database (Denmark)

Witting, Nanna; Werlauff, Ulla; Duno, Morten

2017-01-01

.3% NEB mutations. Less than 5% had mutations in ACTA1, TPM2/3, MTM1, TTN, SEPN1, or SC4NA. A genetic cause was established in 83% with specific histology (cores/rods/centronuclear myopathy) vs 29% with unspecific histology. The detailed clinical examination found gene-dependent discrepancies...... in the pattern of muscle affection and walking ability. Although walking ability was delayed in patients with ACTA1, TPM2/3, and RYR1 mutations, it was within normal limits in patients with NEB and DNM2 mutations. CONCLUSIONS: We found that overall, genetic and histologic prevalence of congenital myopathy...

Rapid diagnosis of hypoglycin A intoxication in atypical myopathy of horses.

Science.gov (United States)

Sander, Johannes; Cavalleri, Jessika-M V; Terhardt, Michael; Bochnia, Mandy; Zeyner, Annette; Zuraw, Aleksandra; Sander, Stefanie; Peter, Michael; Janzen, Nils

2016-03-01

Hypoglycin A (2-amino-3-(2-methylidenecyclopropyl)propanoic acid) is the plant toxin shown to cause atypical myopathy in horses. It is converted in vivo to methylenecyclopropyl acetic acid, which is transformed to a coenzyme A ester that subsequently blocks beta oxidation of fatty acids. Methylenecyclopropyl acetic acid is also conjugated with carnitine and glycine. Acute atypical myopathy may be diagnosed by quantifying the conjugates of methylenecyclopropyl acetic acid plus a selection of acyl conjugates in urine and serum. We describe a new mass spectrometric method for sample volumes of acid in urine, the coefficients of variation for intraday quantification were 2.9% and 3.0%, respectively. The respective values for interday were 9.3% and 8.0%. Methylenecyclopropyl acetyl carnitine was detected as high as 1.18 µmol/L in serum (median: 0.46 µmol/L) and 1.98 mmol/mol creatinine in urine (median: 0.79 mmol/mol creatinine) of diseased horses, while the glycine derivative accumulated up to 1.97 mmol/mol creatinine in urine but was undetectable in most serum samples. In serum samples from horses with atypical myopathy, the intraday coefficients of variation for C4-C8 carnitines and glycines were ≤4.5%. Measured concentrations exceeded those in healthy horses by ~10 to 1,400 times. © 2015 The Author(s).

Differential effect of the rs4149056 variant in SLCO1B1 on myopathy associated with simvastatin and atorvastatin

NARCIS (Netherlands)

Brunham, L. R.; Lansberg, P. J.; Zhang, L.; Miao, F.; Carter, C.; Hovingh, G. K.; Visscher, H.; Jukema, J. W.; Stalenhoef, A. F.; Ross, C. J. D.; Carleton, B. C.; Kastelein, J. J. P.; Hayden, M. R.

2012-01-01

Statins reduce cardiovascular morbidity and mortality in appropriately selected patients. However, statin-associated myopathy is a significant risk associated with these agents. Recently, variation in the SLCO1B1 gene was reported to predict simvastatin-associated myopathy. The aim of this study was

Free radicals in alcoholic myopathy: indices of damage and preventive studies.

Science.gov (United States)

Preedy, Victor R; Adachi, Junko; Asano, Migiwa; Koll, Michael; Mantle, David; Niemela, Onni; Parkkila, Seppo; Paice, Alistair G; Peters, Timothy; Rajendram, Rajkumar; Seitz, Helmut; Ueno, Yasuhiro; Worrall, Simon

2002-04-15

Chronic alcoholic myopathy affects up to two-thirds of all alcohol misusers and is characterized by selective atrophy of Type II (glycolytic, fast-twitch, anaerobic) fibers. In contrast, the Type I fibers (oxidative, slow-twitch, aerobic) are relatively protected. Alcohol increases the concentration of cholesterol hydroperoxides and malondialdehyde-protein adducts, though protein-carbonyl concentration levels do not appear to be overtly increased and may actually decrease in some studies. In alcoholics, plasma concentrations of alpha-tocopherol may be reduced in myopathic patients. However, alpha-tocopherol supplementation has failed to prevent either the loss of skeletal muscle protein or the reductions in protein synthesis in alcohol-dosed animals. The evidence for increased oxidative stress in alcohol-exposed skeletal muscle is thus inconsistent. Further work into the role of ROS in alcoholic myopathy is clearly warranted.

Insulin resistance and increased muscle cytokine levels in patients with mitochondrial myopathy.

Science.gov (United States)

Rue, Nana; Vissing, John; Galbo, Henrik

2014-10-01

Mitochondrial dysfunction has been proposed to cause insulin resistance and that might stimulate cytokine production. The objective of the study was to elucidate the association between mitochondrial myopathy, insulin sensitivity, and cytokine levels in muscle. This was an experimental, controlled study in outpatients. Eight overnight-fasted patients (P) with various inherited mitochondrial myopathies and eight healthy subjects (C) matched for sex, age, weight, height, and physical activity participated in the study. The intervention included a 120-minute hyperinsulinemic, euglycemic clamp. Another morning, microdialysis of both vastus lateralis muscles for 4 hours, including one-legged, knee extension exercise for 30 minutes, was performed. Glucose infusion rate during 90-120 minutes of insulin infusion was measured. Cytokine concentrations in dialysate were also measured. Muscle strength, percentage fat mass, and creatine kinase in plasma did not differ between groups. The maximal oxygen uptake was 21 ± 3 (SE) (P) and 36 ± 3(C) mL/kg·min (2P fatty acids and glycerol at 120 minutes were higher in P vs C (2P myopathies, insulin sensitivity of muscle, adipose tissue, and pancreatic A cells is reduced, supporting that mitochondrial function influences insulin action. Furthermore, a local, low-grade inflammation of potential clinical importance exists in the muscle of these patients.

Diagnosis of myocardial involvement in patients with systemic myopathies with 15-(p-[I-123]iodophenyl) pentadecanoic acid (IPPA) SPECT

Energy Technology Data Exchange (ETDEWEB)

Kropp, J.; Briele, B.; Smekal, A.V.; Hotze, A.L.; Biersack, H.J.; Koehler, U.; Zierz, St. [Bonn Univ. (Germany); Knapp, F.F. [Oak Ridge National Lab., TN (United States)

1992-03-01

Involvement of the myocardium in non-infectious myopathies presents in most cases as systolic dysfunction or a disturbed cardiac rhythm. We are interested in exploring how often cardiac involvement can be evaluated with various diagnostic techniques in patients with proven myopathy. We investigated 41 patients with myopathies of various etiology, including mitochondrial and congenital myopathies, Curshmann-Steinert disease, muscular dystrophy, and others. Myopathy was proven by muscular biopsy usually from the bicep. Fatty acid imaging was performed with 15-(p-[I-123]iodophenyl)pentadecanoic acid (IP-PA) and sequential SPECT-scintigraphy with a 180 deg. rotation starting at the 45 deg. RAO position. 190 MBq were injected at the maximal stage of a submaximal exercise. Filtered backprojection and reorientation of the slices were achieved by standard techniques. The quantitative comparison of the oblique slices (bulls-eye technique) of the SPECT-studies revealed turnover-rates as a qualitative measure of {beta}-oxidation. Serum levels of lactate (L), pyruvate (P), glucose (G) and triglycerides (TG) were measured at rest and stress. Ventricular function was investigated by radionuclide ventriculography (MUGA) at rest and under stress with Tc-99m labeled red blood cells. In addition, ECG, 24 hour-ECG, and echocardiography were also performed with standard techniques.

Diagnosis of myocardial involvement in patients with systemic myopathies with 15-(p-(I-123)iodophenyl) pentadecanoic acid (IPPA) SPECT

Energy Technology Data Exchange (ETDEWEB)

Kropp, J.; Briele, B.; Smekal, A.V.; Hotze, A.L.; Biersack, H.J.; Koehler, U.; Zierz, St. (Bonn Univ. (Germany)); Knapp, F.F. (Oak Ridge National Lab., TN (United States))

1992-01-01

Involvement of the myocardium in non-infectious myopathies presents in most cases as systolic dysfunction or a disturbed cardiac rhythm. We are interested in exploring how often cardiac involvement can be evaluated with various diagnostic techniques in patients with proven myopathy. We investigated 41 patients with myopathies of various etiology, including mitochondrial and congenital myopathies, Curshmann-Steinert disease, muscular dystrophy, and others. Myopathy was proven by muscular biopsy usually from the bicep. Fatty acid imaging was performed with 15-(p-(I-123)iodophenyl)pentadecanoic acid (IP-PA) and sequential SPECT-scintigraphy with a 180 deg. rotation starting at the 45 deg. RAO position. 190 MBq were injected at the maximal stage of a submaximal exercise. Filtered backprojection and reorientation of the slices were achieved by standard techniques. The quantitative comparison of the oblique slices (bulls-eye technique) of the SPECT-studies revealed turnover-rates as a qualitative measure of {beta}-oxidation. Serum levels of lactate (L), pyruvate (P), glucose (G) and triglycerides (TG) were measured at rest and stress. Ventricular function was investigated by radionuclide ventriculography (MUGA) at rest and under stress with Tc-99m labeled red blood cells. In addition, ECG, 24 hour-ECG, and echocardiography were also performed with standard techniques.

Diagnosis of myocardial involvement in patients with systemic myopathies with 15-(p-[I-123]iodophenyl) pentadecanoic acid (IPPA) SPECT

International Nuclear Information System (INIS)

Kropp, J.; Briele, B.; Smekal, A.V.; Hotze, A.L.; Biersack, H.J.; Koehler, U.; Zierz, St.; Knapp, F.F.

1992-01-01

Involvement of the myocardium in non-infectious myopathies presents in most cases as systolic dysfunction or a disturbed cardiac rhythm. We are interested in exploring how often cardiac involvement can be evaluated with various diagnostic techniques in patients with proven myopathy. We investigated 41 patients with myopathies of various etiology, including mitochondrial and congenital myopathies, Curshmann-Steinert disease, muscular dystrophy, and others. Myopathy was proven by muscular biopsy usually from the bicep. Fatty acid imaging was performed with 15-(p-[I-123]iodophenyl)pentadecanoic acid (IP-PA) and sequential SPECT-scintigraphy with a 180 deg. rotation starting at the 45 deg. RAO position. 190 MBq were injected at the maximal stage of a submaximal exercise. Filtered backprojection and reorientation of the slices were achieved by standard techniques. The quantitative comparison of the oblique slices (bulls-eye technique) of the SPECT-studies revealed turnover-rates as a qualitative measure of β-oxidation. Serum levels of lactate (L), pyruvate (P), glucose (G) and triglycerides (TG) were measured at rest and stress. Ventricular function was investigated by radionuclide ventriculography (MUGA) at rest and under stress with Tc-99m labeled red blood cells. In addition, ECG, 24 hour-ECG, and echocardiography were also performed with standard techniques

Clinical, serologic, and immunogenetic features of familial idiopathic inflammatory myopathy

NARCIS (Netherlands)

Rider, L. G.; Gurley, R. C.; Pandey, J. P.; Garcia de la Torre, I.; Kalovidouris, A. E.; O'Hanlon, T. P.; Love, L. A.; Hennekam, R. C.; Baumbach, L. L.; Neville, H. E.; Garcia, C. A.; Klingman, J.; Gibbs, M.; Weisman, M. H.; Targoff, I. N.; Miller, F. W.

1998-01-01

OBJECTIVE: To describe the clinical, serologic, and immunogenetic features of familial idiopathic inflammatory myopathy (IIM) and to compare these with the features of sporadic IIM. METHODS: Clinical signs and symptoms, autoantibodies, HLA-DRB1 and DQA1 alleles, and GM/KM phenotypes were compared

Lipid myopathy associated with renal tubular acidosis and spastic diplegia in two brothers.

Science.gov (United States)

Tung, Y C; Tsau, Y K; Chu, L W; Young, C; Shen, Y Z

2001-07-01

Lipid myopathy is a group of disorders involving mitochondrial fatty acid oxidation. We describe two brothers, 3 years 8 months old and 2 years 9 months old, respectively, with progressive spastic diplegia, developmental delay, failure to thrive, and chronic metabolic acidosis who had lipid myopathy and renal tubular acidosis. Brain magnetic resonance imaging revealed demyelinating changes in the periventricular white matter, which was compatible with spastic diplegia. These symptoms may be related to errors in fatty acid metabolism. Cerebral palsy had been misdiagnosed in both of these patients at another hospital. Therefore, for patients with late-onset and progressive spastic diplegia, detailed investigations for underlying diseases are warranted.

Collagen XII myopathy with rectus femoris atrophy and collagen XII retention in fibroblasts

DEFF Research Database (Denmark)

Witting, Nanna; Krag, Thomas; Werlauff, Ulla

2018-01-01

INTRODUCTION: Mutation in the collagen XII gene (COL12A1) was recently reported to induce Bethlem myopathy. We describe a family affected by collagen XII-related myopathy in 3 generations. METHODS: Systematic interview, clinical examination, skin biopsies, and MRI of muscle were used. RESULTS...... affection and abnormal collagen XII retention in fibroblasts. MRI disclosed a selective wasting of the rectus femoris muscle. DISCUSSION: COL12A1 mutations should be considered in patients with a mild Bethlem phenotype who present with selective wasting of the rectus femoris, absence of the outside......-in phenomenon on MRI, and abnormal collagen XII retention in fibroblasts. Muscle Nerve, 2018....

DNAJB6 myopathies: Focused review on an emerging and expanding group of myopathies

Directory of Open Access Journals (Sweden)

Alessandra Ruggieri

2016-09-01

Full Text Available Mutations in the DNAJB6 gene have been associated with the autosomal dominant limb girdle muscular dystrophy type 1D (LGMD1D, a disorder characterized by abnormal protein aggregates and rimmed vacuoles in muscle fibers. DNAJB6 is a ubiquitously expressed Hsp40 co-chaperone characterized by a J domain that specifies Hsp70 functions in the cellular environment. DNAJB6 is also a potent inhibitor of expanded polyglutamine (polyQ aggregation preventing aggregate toxicity in cells. In DNAJB6-mutated patients this anti-aggregation property is significantly reduced, albeit not completely lost. To elucidate the pathogenetic mechanisms underlying the DNAJB6-related myopathy, animal models have been created showing that, indeed, conditional muscular expression of a DNAJB6 mutant in the mouse causes a LGMD1D myofibrillary muscle tissue phenotype. Both mutations and phenotypes reported until recently were rather homogeneous, being exclusively missense mutations of a few amino acids of the protein G/F domain, and with a phenotype characterized by adult-onset slowly progressive muscular dystrophy predominantly affecting proximal muscles. Lately, several novel mutations and new phenotypes of DNAJB6 have been described. These mutations once more affect the G/F domain of DNAJB6 with missense changes and a splice site mutation; and the phenotypes include childhood onset and distal involvement of muscles, or childhood-onset LGMD1D with loss of ambulation in early adulthood and respiratory involvement. Thus, the spectrum of DNAJB6-related phenotypes is widening. Although our knowledge about the role of DNAJB6 in the pathogenesis of muscle diseases has made great progression, several questions remain unsolved, including why a ubiquitous protein affects only, or predominantly, skeletal muscle; why only the G/F domain is involved; and what is the possible role of the DNAJB6a isoform. Clarification of these issues will provide clues to implement possible therapeutic

Evaluation of inflammatory biomarkers associated with oxidative stress and histological assessment of magnetic therapy on experimental myopathy in rats.

Science.gov (United States)

Vignola, María Belén; Dávila, Soledad; Cremonezzi, David; Simes, Juan C; Palma, José A; Campana, Vilma R

2012-12-01

The effect of pulsed electromagnetic field (PEMF) therapy, also called magnetic therapy, upon inflammatory biomarkers associated with oxidative stress plasma fibrinogen, nitric oxide (NO), L-citrulline, carbonyl groups, and superoxide dismutase (SOD) was evaluated through histological assessment, in rats with experimental myopathy. The groups studied were: (A) control (intact rats that received PEMF sham exposures); (B) rats with myopathy and sacrificed 24 h later; (C) rats with myopathy; (D) rats with myopathy and treated with PEMF; and (E) intact rats treated with PEMF. Groups A, C, D, and E were sacrificed 8 days later. Myopathy was induced by injecting 50 μl of 1% carrageenan λ (type IV) once sub-plantar. Treatment was carried out with PEMF emitting equipment with two flat solenoid disks for 8 consecutive days in groups D and E, at 20 mT and 50 Hz for 30 min/day/rat. The biomarkers were determined by spectrophotometry. The muscles (5/8) were stained with Hematoxylin-Eosin and examined by optic microscopy. Quantitative variables were statistically analyzed by the Fisher test, and categorical applying Pearson's Chi Squared test at p < 0.05 for all cases. In Groups B and C, the biomarkers were significantly increased compared to A, D, and E groups: fibrinogen (p < 0.001); NO, L-citrulline and carbonyl groups (p < 0.05); SOD (p < 0.01) as well as the percentage of area with inflammatory infiltration (p < 0.001). PEMF caused decreased levels of fibrinogen, L-citrulline, NO, SOD, and carbonyl groups and significant muscle recovery in rats with experimental myopathies.

Novel duplication mutation in the patatin domain of adipose triglyceride lipase (PNPLA2) in neutral lipid storage disease with severe myopathy.

Science.gov (United States)

Akiyama, Masashi; Sakai, Kaori; Ogawa, Masaya; McMillan, James R; Sawamura, Daisuke; Shimizu, Hiroshi

2007-12-01

Recently, mutations in PNPLA2 encoding adipose triglyceride lipase (ATGL) were reported to underlie a neutral lipid storage disease (NLSD) subgroup characterized by mild myopathy and the absence of ichthyosis. In the present study a novel homozygous PNPLA2 mutation c.475_478dupCTCC (p.Gln160ProfsX19) in the patatin domain, the ATGL active site, was detected in a woman with NLSD and severe myopathy. The present results suggest that a premature truncation mutation in the patatin domain causes NLSD with severe myopathy.

Treatment Opportunities in Patients With Metabolic Myopathies

DEFF Research Database (Denmark)

Ørngreen, Mette Cathrine; Vissing, John

2017-01-01

the development of new therapeutic options. Enzyme replacement therapy with rGAA has revolutionized treatment of early onset Pompe disease. Supplements of riboflavin, carnitine, and sucrose show promise in patients with respectively riboflavin-responsive multiple acyl-CoA dehydrogenase deficiency, primary...... carnitine deficiency, and McArdle disease. Treatment with citric acid cycle intermediates supply by triheptanoin seems promising in patients with glucogenoses, and studies are ongoing in patients with McArdle disease. Summary Treatment of metabolic myopathies primarily relies on avoiding precipitating...

Diagnostic value of MHC class I staining in idiopathic inflammatory myopathies.

NARCIS (Netherlands)

Pas, J. van der; Hengstman, G.J.D.; Laak, H.J. ter; Borm, G.F.; Engelen, B.G.M. van

2004-01-01

BACKGROUND: Identification of mononuclear cellular infiltrates in skeletal muscle tissue is the histological cornerstone of the diagnosis of idiopathic inflammatory myopathy (IIM). However, these infiltrates are not always present. OBJECTIVE: To determine whether MHC class I antigen expression on

Diagnosis and treatment of the idiopathic inflammatory myopathies

OpenAIRE

Gazeley, David J.; Cronin, Mary E.

2011-01-01

The idiopathic inflammatory myopathies (IIMs) are rare disorders with the unifying feature of proximal muscle weakness. These diseases include polymyositis(PM), dermatomyositis (DM) and inclusion body myositis (IBM) as the most common. The diagnosis is based on the finding of weakness on exam, elevated muscles enzymes, characteristic histopathology of muscle biopsies, electromyography abnormalities and rash in DM. Myositis-specific antibodies have been helpful in defining subsets of patients ...

Cardiovascular magnetic resonance imaging (CMR) reveals characteristic pattern of myocardial damage in patients with mitochondrial myopathy.

Science.gov (United States)

Yilmaz, Ali; Gdynia, Hans-Jürgen; Ponfick, Matthias; Rösch, Sabine; Lindner, Alfred; Ludolph, Albert C; Sechtem, Udo

2012-04-01

Mitochondrial myopathy comprises various clinical subforms of neuromuscular disorders that are characterised by impaired mitochondrial energy metabolism due to dysfunction of the mitochondrial respiratory chain. No comprehensive and targeted cardiovascular magnetic resonance (CMR) studies have been performed so far in patients with mitochondrial disorders. The present study aimed at characterising cardiac disease manifestations in patients with mitochondrial myopathy and elucidating the in vivo cardiac damage pattern of patients with different subforms of mitochondrial disease by CMR studies. In a prospective study, 37 patients with mitochondrial myopathy underwent comprehensive neurological and cardiac evaluations including physical examination, resting ECG and CMR. The CMR studies comprised cine-CMR, T2-weighted "edema" imaging and T1-weighted late-gadolinium-enhancement (LGE) imaging. Various patterns and degrees of skeletal myopathy were present in the participants of this study, whereas clinical symptoms such as chest pain symptoms (in eight (22%) patients) and various degrees of dyspnea (in 16 (43%) patients) were less frequent. Pathological ECG findings were documented in eight (22%) patients. T2-weighted "edema" imaging was positive in one (3%) patient with MELAS (mitochondrial encephalomyopathy with lactic acidosis and stroke-like episodes) only. LGE imaging demonstrated the presence of non-ischemic LGE in 12 (32%) patients: 10 out of 24 (42%) patients with CPEO (chronic progressive external ophthalmoplegia) or KSS (Kearns-Sayre syndrome) and 2 of 3 (67%) patients with MELAS were LGE positive. All 10 LGE-positive patients with CPEO or KSS demonstrated a potentially typical pattern of diffuse intramural LGE in the left-ventricular (LV) inferolateral segments. Cardiac involvement is a frequent finding in patients with mitochondrial myopathy. A potentially characteristic pattern of diffuse intramural LGE in the LV inferolateral segments was identified in

Atypical myopathy in Denmark confirmed with the aTRAQ assay

DEFF Research Database (Denmark)

Høffer, Sofie Esbjørn; Votion, Dominique-Marie; Anderberg, Marie

2016-01-01

Atypical myopathy is a severe form of rhabdomyolysis that occurs in grazing horses. Over the past decades, the disease has been emerging in Europe. The disease is widespread in Europe and has been suspected in Denmark since 2000, yet no cases have been confirmed. The objective of this study...

[Rhabdomyolysis - may it be a metabolic myopathy? Case report and diagnostic algorithm].

Science.gov (United States)

Sebők, Ágnes; Pál, Endre; Molnár, Gergő Attila; Wittmann, István; Berenténé Bene, Judit; Melegh, Béla; Komoly, Sámuel; Hidvégi, Tibor; Balogh, Lídia; Szabó, Attila; Zsidegh, Petra

2017-11-01

We report the case of a 46-year-old female patient with recurrent rhabdomyolysis. In the background of her metabolic myopathy an inherited metabolic disorder of the fatty acid oxidation, very long-chain acyl-coenzyme A-dehydrogenase deficiency was diagnosed. The diagnosis was based on abnormal acyl-carnitine- and urine organic-acid profile in addition to low residual enzyme activity, and was confirmed by genetic testing. After introduction of dietotherapy metabolic crisis necessitating hospital admission has not occurred neither have fixed myopathic changes developed. We present here the differential diagnosis of rhabdomyolysis and exertional muscle complaints, with the metabolic myopathies in focus. The main features of fatty acid oxidation disorders are highlighted, acute and chronic managements of very long-chain acyl-coenzyme A-dehydrogenase deficiency are discussed. Metabolic myopathies respond well to treatment, so good quality of life can be achieved. However, especially in fatty acid oxidation disorders, a metabolic crisis may develop quickly and can be fatal, albeit rarely. Some of these disorders can be identified by newborn screening, but occasionally the symptoms may manifest only in adulthood. With the presentation of this case we would like to point out that in the differential diagnosis of recurrent rhabdomyolysis inherited metabolic disorders should be considered regardless of the patient's age. Orv Hetil. 2017; 158(46): 1873-1882.

RYR1-related myopathies: a wide spectrum of phenotypes throughout life

NARCIS (Netherlands)

Snoeck, M.; Engelen, B.G.M. van; Kusters, B.; Lammens, M.M.; Meijer, R.; Molenaar, J.P.F.; Raaphorst, J.; Verschuuren-Bemelmans, C.C.; Straathof, C.S.; Sie, L.T.L.; Coo, I.F.M. de; Pol, W.L. van der; Visser, M de; Scheffer, H.; Treves, S.; Jungbluth, H.; Voermans, N.C.; Kamsteeg, E.J.

2015-01-01

BACKGROUND AND PURPOSE: Although several recent studies have implicated RYR1 mutations as a common cause of various myopathies and the malignant hyperthermia susceptibility (MHS) trait, many of these studies have been limited to certain age groups, confined geographical regions or specific

Organophosphate-induced intermediate syndrome: aetiology and relationships with myopathy.

Science.gov (United States)

Karalliedde, Lakshman; Baker, David; Marrs, Timothy C

2006-01-01

human cases of the IMS, in general, parallels the distribution of the myopathy observed in a number of studies in experimental animals. This has led to speculation that myopathy is involved in the causation of the IMS. However, while myopathy and the IMS have a common origin in acetylcholine accumulation, they are not causally related to one another.

Statin-associated myopathy: from genetic predisposition to clinical management.

Science.gov (United States)

Vrablik, M; Zlatohlavek, L; Stulc, T; Adamkova, V; Prusikova, M; Schwarzova, L; Hubacek, J A; Ceska, R

2014-01-01

Statin-associated myopathy (SAM) represents a broad spectrum of disorders from insignificant myalgia to fatal rhabdomyolysis. Its frequency ranges from 1-5 % in clinical trials to 15-20 % in everyday clinical practice. To a large extent, these variations can be explained by the definition used. Thus, we propose a scoring system to classify statin-induced myopathy according to clinical and biochemical criteria as 1) possible, 2) probable or 3) definite. The etiology of this disorder remains poorly understood. Most probably, an underlying genetic cause is necessary for overt SAM to develop. Variants in a few gene groups that encode proteins involved in: i) statin metabolism and distribution (e.g. membrane transporters and enzymes; OATP1B1, ABCA1, MRP, CYP3A4), ii) coenzyme Q10 production (e.g. COQ10A and B), iii) energy metabolism of muscle tissue (e.g. PYGM, GAA, CPT2) and several others have been proposed as candidates which can predispose to SAM. Pharmacological properties of individual statin molecules (e.g. lipophilicity, excretion pathways) and patients´ characteristics influence the likelihood of SAM development. This review summarizes current data as well as our own results.

Effects of ubiquinone (coenzyme Q10) on myopathy in statin users.

NARCIS (Netherlands)

Schaars, C.F.; Stalenhoef, A.F.H.

2008-01-01

PURPOSE OF REVIEW: Statins are associated with muscle complaints, including myositis. The mechanism through which statin use causes muscle toxicity is unknown. One of the theories is that statin therapy reduces coenzyme Q10 levels in muscle mitochondria, which leads to muscle injury and myopathy.

Two novel MYH7 proline substitutions cause Laing Distal Myopathy-like phenotypes with variable expressivity and neck extensor contracture.

Science.gov (United States)

Feinstein-Linial, Miora; Buvoli, Massimo; Buvoli, Ada; Sadeh, Menachem; Dabby, Ron; Straussberg, Rachel; Shelef, Ilan; Dayan, Daniel; Leinwand, Leslie Anne; Birk, Ohad S

2016-08-12

Human skeletal muscles express three major myosin heavy chain (MyHC) isoforms: MyHCIIx (MYH1) in fast type 2B muscle fibers, MyHCIIa (MYH2) in fast type 2A fibers and MyHCI/β-cardiac MyHC (MYH7) in slow type I skeletal fibers and cardiac ventricles. In line with its expression pattern, MYH7 mutations have been reported in association with hypertrophic or dilated cardiomyopathy, skeletal myopathies or a combination of both. We analyzed the clinical and molecular phenotype of two unrelated families of Jewish Moroccan ancestry that presented with apparently autosomal dominant inheritance of progressive Laing-like distal myopathy with non-specific myopathic changes, but uncommon marked contractures and wasting of the neck extensors. Clinical phenotyping, whole exome sequencing and restriction analysis, generation of mutants followed by cell culture transfection and imaging. Using whole exome sequencing we identified in both families two novel heterozygous proline substitutions located in exon 31 of MYH7 within its rod domain: c.4309G>C (p.Ala1437Pro) and c.4301G>C (p.Arg1434Pro). Here we show that the phenotype caused by these mutations includes marked cervical muscle contracture, and report that the severity of the phenotype varies significantly, to the extent of non-penetrance in one of the families. Finally, we provide evidence that both proline substitutions impair myosin self-assembly in non-muscle cells transfected with β-myosin constructs carrying the mutations, but do not prevent incorporation of the mutant molecules into the sarcomere. This study expands our clinical and molecular knowledge of MYH7 rod mutations causing skeletal myopathies, and underscores the importance of discussing disease penetrance during genetic counseling.

Skeletal muscle-specific HMG-CoA reductase knockout mice exhibit rhabdomyolysis: A model for statin-induced myopathy.

Science.gov (United States)

Osaki, Yoshinori; Nakagawa, Yoshimi; Miyahara, Shoko; Iwasaki, Hitoshi; Ishii, Akiko; Matsuzaka, Takashi; Kobayashi, Kazuto; Yatoh, Shigeru; Takahashi, Akimitsu; Yahagi, Naoya; Suzuki, Hiroaki; Sone, Hirohito; Ohashi, Ken; Ishibashi, Shun; Yamada, Nobuhiro; Shimano, Hitoshi

2015-10-23

HMG-CoA reductase (HMGCR) catalyzes the conversion of HMG-CoA to mevalonic acid (MVA); this is the rate-limiting enzyme of the mevalonate pathway that synthesizes cholesterol. Statins, HMGCR inhibitors, are widely used as cholesterol-reducing drugs. However, statin-induced myopathy is the most adverse side effect of statins. To eludicate the mechanisms underlying statin the myotoxicity and HMGCR function in the skeletal muscle, we developed the skeletal muscle-specific HMGCR knockout mice. Knockout mice exhibited postnatal myopathy with elevated serum creatine kinase levels and necrosis. Myopathy in knockout mice was completely rescued by the oral administration of MVA. These results suggest that skeletal muscle toxicity caused by statins is dependent on the deficiencies of HMGCR enzyme activity and downstream metabolites of the mevalonate pathway in skeletal muscles rather than the liver or other organs. Copyright © 2015 Elsevier Inc. All rights reserved.

[Cardiac myopathy due to overt hypothyroidism].

Science.gov (United States)

Harbeck, B; Berndt, M J; Lehnert, H

2014-03-01

A 51-year-old man presented with progressive tiredness, proximal muscle weakness, hair loss and weight gain for months. The patient showed mild pretibial myxedema and dry skin. Laboratory findings revealed strongly elevated cardiac enzymes as well as marked hypothyroidism. The electrocardiogram, echocardiography, abdominal sonography and chest X-ray were unremarkable. Thyroid ultrasound demonstrated features of Hashimoto thyroiditis. The findings supported the diagnosis of an overt hypothyroidism with myxedema and rhabdomyolysis. After starting levothyroxine and volume substitution laboratory parameters and clinical condition slowly normalized. Severe overt hypothyroidism may rarely present primarily as myopathy with myositis and cardiac involvement. © Georg Thieme Verlag KG Stuttgart · New York.

[Insight into the training of patients with idiopathic inflammatory myopathy].

Science.gov (United States)

Váncsa, Andrea

2016-09-01

Using current recommended treatment, a majority of patients with idiopathic inflammatory myopathy develop muscle impairment and poor health. Beneficial effects of exercise have been reported on muscle performance, aerobic capacity and health in chronic polymyositis and dermatomyositis, as well as in active disease and inclusion body myositis to some extent. Importantly, randomized controlled trials indicate that improved health and decreased clinical disease activity could be mediated through increased aerobic capacity. Recently, reports seeking pathomechanisms of the underlying effects of exercise on skeletal muscle indicate increased aerobic capacity (i.e. increased mitochondrial capacity and capillary density, reduced lactate levels), activation of genes of aerobic phenotype and muscle growth programs and down regulation of genes related to inflammation. Exercise contributes to both systemic and within-muscle adaptations demonstrating that it is fundamental for improving muscle performance and health in patients with idiopathic inflammatory myopathy. There is a need for randomized controlled trials to study the effects of exercise in patients with active disease and inclusion body myositis. Orv. Hetil., 2016, 157(39), 1557-1562.

The genetic basis of pectoralis major myopathies in modern broiler chicken lines.

Science.gov (United States)

Bailey, Richard A; Watson, Kellie A; Bilgili, S F; Avendano, Santiago

2015-12-01

This is the first report providing estimates of the genetic basis of breast muscle myopathies (BMM) and their relationship with growth and yield in broiler chickens. In addition, this paper addresses the hypothesis that genetic selection for increase breast yield has contributed to the onset of BMM. Data were analyzed from ongoing recording of BMM within the Aviagen breeding program. This study focused on three BMM: deep pectoral myopathy (DPM; binary trait), white striping (WS; 4 categories) and wooden breast (WB; 3 categories). Data from two purebred commercial broiler lines (A and B) were utilized providing greater than 40,000 meat quality records per line. The difference in selection history between these two lines has resulted in contrasting breast yield (BY): 29% for Line A and 21% for Line B. Data were analyzed to estimate genetic parameters using a multivariate animal model including six traits: body weight (BW), processing body weight (PW), BY, DPM, WB, and WS, in addition to the appropriate fixed effects and permanent environmental effect of the dam. Results indicate similar patterns of heritability and genetic correlations for the two lines. Heritabilities (h2) of BW, PW and BY ranged from 0.271-0.418; for DPM and WB h2white striping of breast muscle and more than 90% of the variance of the incidence of wooden breast and deep pectoral myopathy in broiler chickens. © The Author 2015. Published by Oxford University Press on behalf of Poultry Science Association.

The heart in Becker muscular dystrophy, facioscapulohumeral dystrophy, and Bethlem myopathy

NARCIS (Netherlands)

de Visser, M.; de Voogt, W. G.; la Rivière, G. V.

1992-01-01

We report a study, assessing involvement of the heart in 33 familial cases of Becker muscular dystrophy (BMD), 31 familiar cases of facioscapulohumeral (FSH) dystrophy, and 27 familial cases of Bethlem myopathy. In the patients with BMD, correlations of myocardial involvement with age and extent of

Mutations in the satellite cell gene MEGF10 cause a recessive congenital myopathy with minicores.

Science.gov (United States)

Boyden, Steven E; Mahoney, Lane J; Kawahara, Genri; Myers, Jennifer A; Mitsuhashi, Satomi; Estrella, Elicia A; Duncan, Anna R; Dey, Friederike; DeChene, Elizabeth T; Blasko-Goehringer, Jessica M; Bönnemann, Carsten G; Darras, Basil T; Mendell, Jerry R; Lidov, Hart G W; Nishino, Ichizo; Beggs, Alan H; Kunkel, Louis M; Kang, Peter B

2012-05-01

We ascertained a nuclear family in which three of four siblings were affected with an unclassified autosomal recessive myopathy characterized by severe weakness, respiratory impairment, scoliosis, joint contractures, and an unusual combination of dystrophic and myopathic features on muscle biopsy. Whole genome sequence from one affected subject was filtered using linkage data and variant databases. A single gene, MEGF10, contained nonsynonymous mutations that co-segregated with the phenotype. Affected subjects were compound heterozygous for missense mutations c.976T > C (p.C326R) and c.2320T > C (p.C774R). Screening the MEGF10 open reading frame in 190 patients with genetically unexplained myopathies revealed a heterozygous mutation, c.211C > T (p.R71W), in one additional subject with a similar clinical and histological presentation as the discovery family. All three mutations were absent from at least 645 genotyped unaffected control subjects. MEGF10 contains 17 atypical epidermal growth factor-like domains, each of which contains eight cysteine residues that likely form disulfide bonds. Both the p.C326R and p.C774R mutations alter one of these residues, which are completely conserved in vertebrates. Previous work showed that murine Megf10 is required for preserving the undifferentiated, proliferative potential of satellite cells, myogenic precursors that regenerate skeletal muscle in response to injury or disease. Here, knockdown of megf10 in zebrafish by four different morpholinos resulted in abnormal phenotypes including unhatched eggs, curved tails, impaired motility, and disorganized muscle tissue, corroborating the pathogenicity of the human mutations. Our data establish the importance of MEGF10 in human skeletal muscle and suggest satellite cell dysfunction as a novel myopathic mechanism.

BAG3-related myopathy, polyneuropathy and cardiomyopathy with long QT syndrome.

Science.gov (United States)

Kostera-Pruszczyk, Anna; Suszek, Małgorzata; Płoski, Rafał; Franaszczyk, Maria; Potulska-Chromik, Anna; Pruszczyk, Piotr; Sadurska, Elżbieta; Karolczak, Justyna; Kamińska, Anna M; Rędowicz, Maria Jolanta

2015-12-01

BAG3 belongs to BAG family of molecular chaperone regulators interacting with HSP70 and anti-apoptotic protein Bcl-2. It is ubiquitously expressed with strong expression in skeletal and cardiac muscle, and is involved in a panoply of cellular processes. Mutations in BAG3 and aberrations in its expression cause fulminant myopathies, presenting with progressive limb and axial muscle weakness, and respiratory insufficiency and neuropathy. Herein, we report a sporadic case of a 15-years old girl with symptoms of myopathy, demyelinating polyneuropathy and asymptomatic long QT syndrome. Genetic testing demonstrated heterozygous mutation Pro209Leu (c.626C > T) in exon 3 of BAG3 gene causing severe myopathy and neuropathy, often associated with restrictive cardiomyopathy. We did not find a mutation in any known LQT syndrome genes. Analysis of muscle biopsy revealed profound disintegration of Z-discs with extensive accumulation of granular debris and large inclusions within fibers. We demonstrated profound alterations in BAG3 distribution as the protein localized to long filamentous structures present across the fibers that were positively stained not only for α-actinin but also for desmin and filamin indicating that those disintegrated Z-disc regions contained also other sarcomeric proteins. The mutation caused a decrease in the content of BAG3 and HSP70, and also of α-actinin desmin, filamin and fast myosin heavy chain, confirming its severe effect on the muscle fiber morphology and thus function. We provide further evidence that BAG3 is associated with Z-disc maintenance, and the Pro209Leu mutation may occur worldwide. We also provide a summary of cases associated with this mutation reported so far.

Resveratrol and Myopathy

Science.gov (United States)

Bastin, Jean; Djouadi, Fatima

2016-01-01

Resveratrol is a natural polyphenolic compound produced by plants under various stress conditions. Resveratrol has been reported to exhibit antioxidant, anti-inflammatory, and anti-proliferative properties in mammalian cells and animal models, and might therefore exert pleiotropic beneficial effects in different pathophysiological states. More recently, resveratrol has also been shown to potentially target many mitochondrial metabolic pathways, including fatty acid β-oxidation or oxidative phosphorylation, leading to the up-regulation of the energy metabolism via signaling pathways involving PGC-1α, SIRT1, and/or AMP-kinase, which are not yet fully delineated. Some of resveratrol beneficial effects likely arise from its cellular effects in the skeletal muscle, which, surprisingly, has been given relatively little attention, compared to other target tissues. Here, we review the potential for resveratrol to ameliorate or correct mitochondrial metabolic deficiencies responsible for myopathies, due to inherited fatty acid β-oxidation or to respiratory chain defects, for which no treatment exists to date. We also review recent data supporting therapeutic effects of resveratrol in the Duchenne Muscular Dystrophy, a fatal genetic disease affecting the production of muscle dystrophin, associated to a variety of mitochondrial dysfunctions, which likely contribute to disease pathogenesis. PMID:27136581

A Case of Myopathy, Encephalopathy, Lactic Acidosis and Stroke-Like Episodes (MELAS) Syndrome with Intracardiac Thrombus [corrected].

Science.gov (United States)

Joo, Jung-Chul; Seol, Myung Do; Yoon, Jin Won; Lee, Young Soo; Kim, Dong-Keun; Choi, Yong Hoon; Ahn, Hyo Seong; Cho, Wook Hyun

2013-03-01

Myopathy, encephalopathy, lactic acidosis and stroke-like episodes (MELAS) is a multisystem clinical syndrome manifested by mitochondrial myopathy, encephalopathy, lactic acidosis and recurrent stroke-like episodes. A 27-year-old female with MELAS syndrome presented with cerebral infarction. Echocardiography revealed a thrombus attached to the apex of the hypertrophied left ventricle, with decreased systolic function. The embolism of the intracardiac thrombus might have been the cause of stroke. There should be more consideration given to the increased possibility of intracardiac thrombus formation when a MELAS patient with cardiac involvement is encountered.

Genetic factors affecting statin concentrations and subsequent myopathy: a HuGENet systematic review

Science.gov (United States)

Canestaro, William J.; Austin, Melissa A.; Thummel, Kenneth E.

2015-01-01

Statins, 3-hydroxy-3-methyl-glutaryl-coenzyme A reductase inhibitors, have proven efficacy in both lowering low-density-lipoprotein levels and preventing major coronary events, making them one of the most commonly prescribed drugs in the United States. Statins exhibit a class-wide side effect of muscle toxicity and weakness, which has led regulators to impose both dosage limitations and a recall. This review focuses on the best-characterized genetic factors associated with increased statin muscle concentrations, including the genes encoding cytochrome P450 enzymes (CYP2D6, CYP3A4, and CYP3A5), a mitochondrial enzyme (GATM), an influx transporter (SLCO1B1), and efflux transporters (ABCB1 and ABCG2). A systematic literature review was conducted to identify relevant research evaluating the significance of genetic variants predictive of altered statin concentrations and subsequent statin-related myopathy. Studies eligible for inclusion must have incorporated genotype information and must have associated it with some measure of myopathy, either creatine kinase levels or self-reported muscle aches and pains. After an initial review, focus was placed on seven genes that were adequately characterized to provide a substantive review: CYP2D6, CYP3A4, CYP3A5, GATM, SLCO1B1, ABCB1, and ABCG2. All statins were included in this review. Among the genetic factors evaluated, statin-related myopathy appears to be most strongly associated with variants in SLCO1B1. PMID:24810685

Nuclear actin aggregation is a hallmark of anti-synthetase syndrome-induced dysimmune myopathy

NARCIS (Netherlands)

Stenzel, Werner; Preuße, Corinna; Allenbach, Yves; Pehl, Debora; Junckerstorff, Reimar; Heppner, Frank L.; Nolte, Kay; Aronica, Eleonora; Kana, Veronika; Rushing, Elisabeth; Schneider, Udo; Claeys, Kristl G.; Benveniste, Olivier; Weis, Joachim; Goebel, Hans H.

2015-01-01

To analyze antisynthetase syndrome-associated myositis by modern myopathologic methods and to define its place in the spectrum of idiopathic inflammatory myopathies (IIMs). Skeletal muscle biopsies from antisynthetase syndrome-associated myositis and other IIMs from different institutions worldwide

Apparent diffusion coefficient (ADC) does not correlate with different serological parameters in myositis and myopathy.

Science.gov (United States)

Meyer, Hans-Jonas; Ziemann, Oliver; Kornhuber, Malte; Emmer, Alexander; Quäschling, Ulf; Schob, Stefan; Surov, Alexey

2018-06-01

Background Magnetic resonance imaging (MRI) is widely used in several muscle disorders. Diffusion-weighted imaging (DWI) is an imaging modality, which can reflect microstructural tissue composition. The apparent diffusion coefficient (ADC) is used to quantify the random motion of water molecules in tissue. Purpose To investigate ADC values in patients with myositis and non-inflammatory myopathy and to analyze possible associations between ADC and laboratory parameters in these patients. Material and Methods Overall, 17 patients with several myositis entities, eight patients with non-inflammatory myopathies, and nine patients without muscle disorder as a control group were included in the study (mean age = 55.3 ± 14.3 years). The diagnosis was confirmed by histopathology in every case. DWI was obtained in a 1.5-T scanner using two b-values: 0 and 1000 s/mm 2 . In all patients, the blood sample was acquired within three days to the MRI. The following serological parameters were estimated: C-reactive protein, lactate dehydrogenase, alanine aminotransferase, aspartate aminotransferase, creatine kinase, and myoglobine. Results The estimated mean ADC value for the myositis group was 1.89 ± 0.37 × 10 -3  mm 2 /s and for the non-inflammatory myopathy group was 1.79 ± 0.33 × 10 -3  mm 2 /s, respectively. The mean ADC values (1.15 ± 0.37 × 10 -3  mm 2 /s) were significantly higher to unaffected muscles (vs. myositis P = 0.0002 and vs. myopathy P = 0.0021). There were no significant correlations between serological parameters and ADC values. Conclusion Affected muscles showed statistically significantly higher ADC values than normal muscles. No linear correlations between ADC and serological parameters were identified.

Elevated Cardiac Troponin T in Patients With Skeletal Myopathies.

Science.gov (United States)

Schmid, Johannes; Liesinger, Laura; Birner-Gruenberger, Ruth; Stojakovic, Tatjana; Scharnagl, Hubert; Dieplinger, Benjamin; Asslaber, Martin; Radl, Roman; Beer, Meinrad; Polacin, Malgorzata; Mair, Johannes; Szolar, Dieter; Berghold, Andrea; Quasthoff, Stefan; Binder, Josepha S; Rainer, Peter P

2018-04-10

Cardiac troponins are often elevated in patients with skeletal muscle disease who have no evidence of cardiac disease. The goal of this study was to characterize cardiac troponin concentrations in patients with myopathies and derive insights regarding the source of elevated troponin T measurements. Cardiac troponin T (cTnT) and cardiac troponin I (cTnI) concentrations were determined by using high sensitivity assays in 74 patients with hereditary and acquired skeletal myopathies. Patients underwent comprehensive cardiac evaluation, including 12-lead electrocardiogram, 24-h electrocardiogram, cardiac magnetic resonance imaging, and coronary artery computed tomography. cTnT and cTnI protein expression was determined in skeletal muscle samples of 9 patients and in control tissues derived from autopsy using antibodies that are used in commercial assays. Relevant Western blot bands were subjected to liquid chromatography tandem mass spectrometry for protein identification. Levels of cTnT (median: 24 ng/l; interquartile range: 11 to 54 ng/l) were elevated (>14 ng/l) in 68.9% of patients; cTnI was elevated (>26 ng/l) in 4.1% of patients. Serum cTnT levels significantly correlated with creatine kinase and myoglobin (r = 0.679 and 0.786, respectively; both p < 0.001). Based on cTnT serial testing, 30.1% would have fulfilled current rule-in criteria for myocardial infarction. Noncoronary cardiac disease was present in 23%. Using cTnT antibodies, positive bands were found in both diseased and healthy skeletal muscle at molecular weights approximately 5 kDa below cTnT. Liquid chromatography tandem mass spectrometry identified the presence of skeletal troponin T isoforms in these bands. Measured cTnT concentrations were chronically elevated in the majority of patients with skeletal myopathies, whereas cTnI elevation was rare. Our data indicate that cross-reaction of the cTnT immunoassay with skeletal muscle troponin isoforms was the likely cause. Copyright © 2018 The

Aerobic Training in Patients with Congenital Myopathy.

Directory of Open Access Journals (Sweden)

Gitte Hedermann

Full Text Available Congenital myopathies (CM often affect contractile proteins of the sarcomere, which could render patients susceptible to exercise-induced muscle damage. We investigated if exercise is safe and beneficial in patients with CM.Patients exercised on a stationary bike for 30 minutes, three times weekly, for 10 weeks at 70% of their maximal oxygen uptake (VO2max. Creatine kinase (CK was monitored as a marker of muscle damage. VO2max, functional tests, and questionnaires evaluated efficacy.Sixteen patients with CM were included in a controlled study. VO2max increased by 14% (range, 6-25%; 95% CI 7-20; p < 0.001 in the seven patients who completed training, and tended to decrease in a non-intervention group (n = 7; change -3.5%; range, -11-3%, p = 0.083. CK levels were normal and remained stable during training. Baseline Fatigue Severity Scale scores were high, 4.9 (SE 1.9, and tended to decrease (to 4.4 (SE 1.7; p = 0.08 with training. Nine patients dropped out of the training program. Fatigue was the major single reason.Ten weeks of endurance training is safe and improves fitness in patients with congenital myopathies. The training did not cause sarcomeric injury, even though sarcomeric function is affected by the genetic abnormalities in most patients with CM. Severe fatigue, which characterizes patients with CM, is a limiting factor for initiating training in CM, but tends to improve in those who train.The Regional Committee on Health Research Ethics of the Capital Region of Denmark H-2-2013-066 and ClinicalTrials.gov H2-2013-066.

Association between statin-associated myopathy and skeletal muscle damage.

OpenAIRE

Mohaupt Markus G; Karas Richard H; Babiychuk Eduard B; Sanchez-Freire Verónica; Monastyrskaya Katia; Iyer Lakshmanan; Hoppeler Hans; Breil Fabio; Draeger Annette

2009-01-01

BACKGROUND Many patients taking statins often complain of muscle pain and weakness. The extent to which muscle pain reflects muscle injury is unknown. METHODS We obtained biopsy samples from the vastus lateralis muscle of 83 patients. Of the 44 patients with clinically diagnosed statin associated myopathy 29 were currently taking a statin and 15 had discontinued statin therapy before the biopsy (minimal duration of discontinuation 3 weeks). We also included 19 patients who were taking stat...

Cardiac involvement in adult and juvenile idiopathic inflammatory myopathies

DEFF Research Database (Denmark)

Schwartz, TThomas W; Diederichsen, L. P.; Lundberg, Ingrid E.

2016-01-01

Idiopathic inflammatory myopathies (IIM) include the main subgroups polymyositis (PM), dermatomyositis (DM), inclusion body myositis (IBM) and juvenile DM ( JDM). The mentioned subgroups are characterised by inflammation of skeletal muscles leading to muscle weakness and other organs can also...... that statins might worsen muscle symptoms mimicking myositis relapse. On the basis of recent studies, we recommend a low threshold for cardiac workup and follow-up in patients with IIM. © 2016 Published by the BMJ Publishing Group Limited....

Congenital myotonic myopathy in the miniature schnauzer: an autosomal recessive trait.

Science.gov (United States)

Vite, C H; Melniczek, J; Patterson, D; Giger, U

1999-01-01

Myotonia is a clinical sign characterized by a delay in skeletal muscle relaxation following electrical or mechanical stimulation. A series of related miniature schnauzer dogs with congenital myotonic myopathy were studied. A composite pedigree of six affected litters and the results of a planned breeding between two affected animals are consistent with an autosomal recessive mode of inheritance.

Miopatia por corpos esferóides: relato de caso Spheroid body myopathy: case report

Directory of Open Access Journals (Sweden)

Rosana Hermínia Scola

2005-06-01

Full Text Available A miopatia por corpos esferóides é doença rara, classificada no grupo das miopatias congênitas relacionadas aos distúrbios da desmina; apresenta, em geral, origem autossômica dominante e com início dos sintomas na fase adulta. Relatamos o caso de menina de sete anos, com diparesia facial, hipotrofia e hipotonia muscular generalizadas, arreflexia profunda generalizada, força muscular proximal nos membros superiores e inferiores e distal dos membros superiores grau 3 e distal nos membros inferiores grau 1. A eletromiografia de agulha evidenciou recrutamento aumentado e potenciais de unidade motora de curta duração e baixa amplitude, caracterizando um padrão miopático. A biópsia muscular revelou padrão misto para miopatia e desinervação e presença de corpos esferóides intracitoplasmáticos compatíveis com a miopatia por corpos esferóides. No presente caso, a paciente apresentou precocemente o início dos sintomas e não há relatos de casos semelhantes na família.Spheroid body myopathy is a rare illness classified in the group of the congenital myopathies as a desmin-related neuromuscular disorder, presenting dominant autosomical origin with the beginning of the symptoms in the adult phase. We report on a seven years old girl with facial paresia, generalized muscular hypotrophy and hypotony, generalized deep areflexia, proximal upper and lower limbs muscular strengh and distal upper limbs grade 3 and distal lower limbs grade 1. Needle electromyography evidenced increased conscription and potentials of motor unit of short duration and low amplitude, characterizing a myopathic standard. The muscle biopsy disclosed mixed standard to myopathy, denervation and inclusion bodies that are consistent to spheroid body myopathy. In this case, the patient presented, in advance, early beginning of the symptoms and there are no similar cases in the family.

Acute quadriplegia caused by necrotizing myopathy in a renal transplant recipient with severe pneumonia: acute onset and complete recovery.

Science.gov (United States)

Tu, Guo-Wei; Song, Jie-Qiong; Ting, Simon Kang Seng; Ju, Min-Jie; He, Hong-Yu; Dong, Ji-Hong; Luo, Zhe

2015-02-03

Critical illness polyneuropathy and myopathy are multifaceted complications that follow severe illnesses involving the sensorimotor axons and proximal skeletal muscles. These syndromes have rarely been reported among renal transplant recipients. In this paper, we report a case of acute quadriplegia caused by necrotizing myopathy in a renal transplant recipient with severe pneumonia. The muscle strength in the patient's extremities improved gradually after four weeks of comprehensive treatment, and his daily life activities were normal a year after being discharged.

Fatigue in patients with spinal muscular atrophy type II and congenital myopathies

DEFF Research Database (Denmark)

Werlauff, Ulla; Højberg, A; Firla-Holme, R

2014-01-01

PURPOSE: The aim of this study was to evaluate whether the fatigue severity scale (FSS) is an appropriate instrument to assess fatigue in patients with spinal muscular atrophy type II (SMA II) and congenital myopathies (CM). METHODS: FSS and visual analog scale (VAS) were administered to 33 SMA II...

Progressive Structural Defects in Canine Centronuclear Myopathy Indicate a Role for HACD1 in Maintaining Skeletal Muscle Membrane Systems.

Science.gov (United States)

Walmsley, Gemma L; Blot, Stéphane; Venner, Kerrie; Sewry, Caroline; Laporte, Jocelyn; Blondelle, Jordan; Barthélémy, Inès; Maurer, Marie; Blanchard-Gutton, Nicolas; Pilot-Storck, Fanny; Tiret, Laurent; Piercy, Richard J

2017-02-01

Mutations in HACD1/PTPLA cause recessive congenital myopathies in humans and dogs. Hydroxyacyl-coA dehydratases are required for elongation of very long chain fatty acids, and HACD1 has a role in early myogenesis, but the functions of this striated muscle-specific enzyme in more differentiated skeletal muscle remain unknown. Canine HACD1 deficiency is histopathologically classified as a centronuclear myopathy (CNM). We investigated the hypothesis that muscle from HACD1-deficient dogs has membrane abnormalities in common with CNMs with different genetic causes. We found progressive changes in tubuloreticular and sarcolemmal membranes and mislocalized triads and mitochondria in skeletal muscle from animals deficient in HACD1. Furthermore, comparable membranous abnormalities in cultured HACD1-deficient myotubes provide additional evidence that these defects are a primary consequence of altered HACD1 expression. Our novel findings, including T-tubule dilatation and disorganization, associated with defects in this additional CNM-associated gene provide a definitive pathophysiologic link with these disorders, confirm that dogs deficient in HACD1 are relevant models, and strengthen the evidence for a unifying pathogenesis in CNMs via defective membrane trafficking and excitation-contraction coupling in muscle. These results build on previous work by determining further functional roles of HACD1 in muscle and provide new insight into the pathology and pathogenetic mechanisms of HACD1 CNM. Consequently, alterations in membrane properties associated with HACD1 mutations should be investigated in humans with related phenotypes. Copyright © 2017 American Society for Investigative Pathology. Published by Elsevier Inc. All rights reserved.

Serum and tissue markers of myopathy in patients with colorectal cancer

Directory of Open Access Journals (Sweden)

Nicoletta Adami

2012-09-01

Full Text Available Skeletal muscles in patients with cancer undergo many changes due to immuno-inflammatory factors of tumor origin, or to chemotherapy and irradiation. Aim of the present study is to identify serological biomarkers and early myopathic features in skeletal muscle biopsies from weight stable patients bearing colorectal cancer at the onset of disease. Morphometric analyses by histochemistry and immunohistochemistry were performed on intraoperative muscle biopsies from patients with early colorectal cancer and from weight stable patients undergoing surgery for benign non-inflammatory conditions. Serological analyses for testing markers of inflammation (C Reactive Protein, CRP, muscle enzymes, (Creatin Kinase, CK, soluble isoforms of adhesion molecules (Neural Cell Adhesion Molecule, NCAM, and a marker of protein turnover (prealbumin, a typical indicator of caloric and protein malnutrition were also performed. Fifty oncologic patients (28 male/22 female and 25 non oncologic patients (18 male/7 female (p=N.S. were studied. In muscles from cancer patients we observed a subclinical myopathy characterized by an abnormal distribution of myonuclei. The percentage of myofibers with internalized nuclei was significantly higher in oncologic (median= 13.1%, IQR= 6.0-20.3 than in non oncologic patients (median= 3%, IQR= 2.5-6.1 (p<0.0001. The frequency of these internally nucleated myofibers is even higher in a subgroup of oncologic patients taking myotoxic drugs. In cancer patients, we observed an inverse correlation between the number of internally nucleated fibers and the presence of node metastasis (N+ (ρ=-0.30 (p=0.03. Moreover, in patients with colorectal cancer, low serum levels of preoperative prealbumin (median= 167,7 mg/L, normal range 200-400 mg/L, were detected. The link between the observed early myopathy and long-term cachexia is supported also by the altered expression of sarcolemma associated proteins, in particular laminin and dystrophin

Characterization of sarcoplasmic reticulum Ca(2+) ATPase pumps in muscle of patients with myotonic dystrophy and with hypothyroid myopathy.

Science.gov (United States)

Guglielmi, V; Oosterhof, A; Voermans, N C; Cardani, R; Molenaar, J P; van Kuppevelt, T H; Meola, G; van Engelen, B G; Tomelleri, G; Vattemi, G

2016-06-01

Sarcoplasmic/endoplasmic reticulum Ca(2+) ATPase (SERCA) pumps play the major role in lowering cytoplasmic calcium concentration in skeletal muscle by catalyzing the ATP-dependent transport of Ca(2+) from the cytosol to the lumen of the sarcoplasmic reticulum (SR). Although SERCA abnormalities have been hypothesized to contribute to the dysregulation of intracellular Ca(2+) homeostasis and signaling in muscle of patients with myotonic dystrophy (DM) and hypothyroid myopathy, the characterization of SERCA pumps remains elusive and their impairment is still unclear. We assessed the activity of SR Ca(2+)-ATPase, expression levels and fiber distribution of SERCA1 and SERCA2, and oligomerization of SERCA1 protein in muscle of patients with DM type 1 and 2, and with hypothyroid myopathy. Our data provide evidence that SR Ca(2+) ATPase activity, protein levels and muscle fiber distribution of total SERCA1 and SERCA2, and SERCA1 oligomerization pattern are similar in patients with both DM1 and DM2, hypothyroid myopathy and in control subjects. We prove that SERCA1b, the neonatal isoform of SERCA1, is expressed at protein level in muscle of patients with DM2 and, in lower amount, of patients with DM1. Our present study demonstrates that SERCA function is not altered in muscle of patients with DM and with hypothyroid myopathy. Copyright © 2016 Elsevier B.V. All rights reserved.

Quantitative nailfold video capillaroscopy in patients with idiopathic inflammatory myopathy

OpenAIRE

Mercer, Louise K.; Moore, Tonia L.; Chinoy, Hector; Murray, Andrea K.; Vail, Andy; Cooper, Robert G.; Herrick, Ariane L.

2010-01-01

Objectives. To quantify nailfold capillary density and dimensions in patients with idiopathic inflammatory myopathy (IIM) and compare them with those in healthy controls; to look for associations with microvascular disease in IIM; and to determine whether nailfold capillary density and dimensions change over time. Methods. Nailfold video microscopy (×300 magnification) was performed on 24 patients with IIM and 35 healthy controls. Capillary density and dimensions (total width and apical width...

Lipid storage myopathies.

Science.gov (United States)

Bruno, Claudio; Dimauro, Salvatore

2008-10-01

The aim of this review is to provide an update on disorders of lipid metabolism affecting skeletal muscle exclusively or predominantly and to summarize recent clinical, genetic, and therapeutic studies in this field. Over the past 5 years, new clinical phenotypes and genetic loci have been described, unusual pathogenic mechanisms have been elucidated, and novel pharmacological approaches have been developed. At least one genetic defect responsible for the myopathic form of CoQ10 deficiency has been identified, causing a disorder that is allelic with the late-onset riboflavine-responsive form of multiple acyl-coenzyme A dehydrogenation deficiency. Novel mechanisms involved in the lipolytic breakdown of cellular lipid depots have been described and have led to the identification of genes and mutations responsible for multisystemic neutral lipid storage disorders, characterized by accumulation of triglyceride in multiple tissues, including muscle. Defects in lipid metabolism can affect either the mitochondrial transport and oxidation of exogenous fatty acid or the catabolism of endogenous triglycerides. These disorders impair energy production and almost invariably involve skeletal muscle, causing progressive myopathy with muscle weakness, or recurrent acute episodes of rhabdomyolysis triggered by exercise, fasting, or infections. Clinical and genetic characterization of these disorders has important implications both for accurate diagnostic approach and for development of therapeutic strategies.

Acquired multiple Acyl-CoA dehydrogenase deficiency in 10 horses with atypical myopathy

NARCIS (Netherlands)

Westermann, C. M.; Dorland, L.; Votion, D. M.; de Sain-van der Velden, M. G. M.; Wijnberg, I. D.; Wanders, R. J. A.; Spliet, W. G. M.; Testerink, N.; Berger, R.; Ruiter, J. P. N.; van der Kolk, J. H.

2008-01-01

The aim of the current study was to assess lipid metabolism in horses with atypical myopathy. Urine samples from 10 cases were subjected to analysis of organic acids, glycine conjugates, and acylcarnitines revealing increased mean excretion of lactic acid, ethylmalonic acid, 2-methylsuccinic acid,

A novel mutation in PNPLA2 causes neutral lipid storage disease with myopathy and triglyceride deposit cardiomyovasculopathy: a case report and literature review.

Science.gov (United States)

Kaneko, Kimihiko; Kuroda, Hiroshi; Izumi, Rumiko; Tateyama, Maki; Kato, Masaaki; Sugimura, Koichiro; Sakata, Yasuhiko; Ikeda, Yoshihiko; Hirano, Ken-Ichi; Aoki, Masashi

2014-07-01

Mutations in PNPLA2 cause neutral lipid storage disease with myopathy (NLSDM) or triglyceride deposit cardiomyovasculopathy (TGCV). We report a 59-year-old patient with NLSDM/TGCV presenting marked asymmetric skeletal myopathy and cardiomyovasculopathy. Skeletal muscle and endomyocardial biopsies showed cytoplasmic vacuoles containing neutral lipid. Gene analysis revealed a novel homozygous mutation (c.576delC) in PNPLA2. We reviewed 37 genetically-proven NLSDM/TGCV cases; median age was 30 years; distribution of myopathy was proximal (69%) and distal predominant (16%); asymmetric myopathy (right>left) was reported in 41% of the patients. Frequently-affected muscles were posterior compartment of leg (75%), shoulder girdle to upper arm (50%), and paraspinal (33%). Skeletal muscle biopsies showed lipid accumulation in 100% and rimmed vacuoles in 22%. Frequent comorbidities were cardiomyopathy (44%), hyperlipidemia (23%), diabetes mellitus (24%), and pancreatitis (14%). PNPLA2 mutations concentrated in Exon 4-7 without apparent genotype-phenotype correlations. To know the characteristic features is essential for the early diagnosis of NLSDM/TGCV. Copyright © 2014 Elsevier B.V. All rights reserved.

Schistosomiasis and nutritional myopathy in a Brazilian tapir (Tapirus terrestris).

Science.gov (United States)

Yamini, B; Schillhorn van Veen, T W

1988-10-01

Gross lesions suggestive of severe hepatoenteropathy and myopathy were noted in a 4.5-yr-old Brazilian tapir (Tapirus terrestris) from a zoo in Michigan (USA). The major microscopic lesions were granulomatous hepatitis and hemorrhagic enteritis associated with non-operculated eggs compatible with those of the Schistosomatidae (Digenea). Skeletal muscle and tongue contained foci of severe acute myodegeneration and necrosis. The hepatic vitamin E value of 1.3 ppm dry weight was considered critically low.

Exertional Myopathy in a Juvenile Green Sea Turtle (Chelonia mydas Entangled in a Large Mesh Gillnet

Directory of Open Access Journals (Sweden)

Brianne E. Phillips

2015-01-01

Full Text Available A juvenile female green sea turtle (Chelonia mydas was found entangled in a large mesh gillnet in Pamlico Sound, NC, and was weak upon presentation for treatment. Blood gas analysis revealed severe metabolic acidosis and hyperlactatemia. Plasma biochemistry analysis showed elevated aspartate aminotransferase and creatine kinase, marked hypercalcemia, hyperphosphatemia, and hyperkalemia. Death occurred within 24 hours of presentation despite treatment with intravenous and subcutaneous fluids and sodium bicarbonate. Necropsy revealed multifocal to diffuse pallor of the superficial and deep pectoral muscles. Mild, multifocal, and acute myofiber necrosis was identified by histopathological examination. While histological changes in the examined muscle were modest, the acid-base, mineral, and electrolyte abnormalities were sufficiently severe to contribute to this animal’s mortality. Exertional myopathy in reptiles has not been well characterized. Sea turtle mortality resulting from forced submergence has been attributed to blood gas derangements and seawater aspiration; however, exertional myopathy may also be an important contributing factor. If possible, sea turtles subjected to incidental capture and entanglement that exhibit weakness or dull mentation should be clinically evaluated prior to release to minimize the risk of delayed mortality. Treatment with appropriate fluid therapy and supportive care may mitigate the effects of exertional myopathy in some cases.

The Effect of the Wooden Breast Myopathy on Sarcomere Structure and Organization.

Science.gov (United States)

Velleman, Sandra G; Clark, Daniel L; Tonniges, Jeffrey R

2018-03-01

The wooden breast (WB) has been classically identified by the phenotypic presence of a wood-like pectoralis major (p. major) muscle. The WB-affected p. major muscle is characterized by necrotic muscle fibers and the replacement of muscle with connective tissue, water, and fat. The objective of the current study was to determine the effect of the WB myopathy on sarcomere organization by transmission electron microscopy. Sarcomere structure and organization were examined in two broiler lines with a high incidence of WB (Lines A and B) and another broiler line without WB (Line C). Affected muscle had an increase in smaller myofibers with diameters of 20 μm or less. Sarcomere organization decreased with fiber diameter in both Lines A and B. The structure and organization of sarcomeres in Line C were similar to WB-unaffected muscle in Lines A and B. Taken together, these data demonstrate that the WB myopathy detrimentally affects sarcomere organization in a broiler line-specific manner. Disorganization of sarcomere structure will affect the function of the p. major muscle as well as meat quality.

Anaesthetic management of a paediatric patient with congenital fibre type disproportion myopathy.

Science.gov (United States)

Buisán, F; de la Varga, O; Flores, M; Sánchez-Ruano, J

2018-04-23

Congenital fibre type disproportion (CFTD) is a rare type of myopathy that is characterised by muscle weakness and hypotonia during childhood. Clinical features include motor delay, feeding difficulties, limb weakness, joint contractures, and scoliosis. A report is presented of the anaesthetic management of a 3-year-old girl with CFTD myopathy associated with a mutation of the TPM3 gene, scheduled for adenotonsillectomy because of obstructive sleep apnoea hypopnoea syndrome (OSAHS). The main concerns were the possible susceptibility to malignant hyperthermia, the risk of anaesthesia-induced rhabdomyolysis, a greater sensitivity to non-depolarising muscle relaxants, and the presence of OSAHS. Total intravenous anaesthesia with propofol and the use of rocuronium/sugammadex appear to be safe options. Given the high risk of respiratory compromise and other complications, patients should be closely monitored in the post-operative period. Copyright © 2018 Sociedad Española de Anestesiología, Reanimación y Terapéutica del Dolor. Publicado por Elsevier España, S.L.U. All rights reserved.

A GYS1 gene mutation is highly associated with polysaccharide storage myopathy in Cob Normand draught horses.

Science.gov (United States)

Herszberg, B; McCue, M E; Larcher, T; Mata, X; Vaiman, A; Chaffaux, S; Chérel, Y; Valberg, S J; Mickelson, J R; Guérin, G

2009-02-01

Glycogen storage diseases or glycogenoses are inherited diseases caused by abnormalities of enzymes that regulate the synthesis or degradation of glycogen. Deleterious mutations in many genes of the glyco(geno)lytic or the glycogenesis pathways can potentially cause a glycogenosis, and currently mutations in fourteen different genes are known to cause animal or human glycogenoses, resulting in myopathies and/or hepatic disorders. The genetic bases of two forms of glycogenosis are currently known in horses. A fatal neonatal polysystemic type IV glycogenosis, inherited recessively in affected Quarter Horse foals, is due to a mutation in the glycogen branching enzyme gene (GBE1). A second type of glycogenosis, termed polysaccharide storage myopathy (PSSM), is observed in adult Quarter Horses and other breeds. A severe form of PSSM also occurs in draught horses. A mutation in the skeletal muscle glycogen synthase gene (GYS1) was recently reported to be highly associated with PSSM in Quarter Horses and Belgian draught horses. This GYS1 point mutation appears to cause a gain-of-function of the enzyme and to result in the accumulation of a glycogen-like, less-branched polysaccharide in skeletal muscle. It is inherited as a dominant trait. The aim of this work was to test for possible associations between genetic polymorphisms in four candidate genes of the glycogen pathway or the GYS1 mutation in Cob Normand draught horses diagnosed with PSSM by muscle biopsy.

Oculopharyngeal Weakness, Hypophrenia, Deafness, and Impaired Vision: A Novel Autosomal Dominant Myopathy with Rimmed Vacuoles

Directory of Open Access Journals (Sweden)

Ting Chen

2016-01-01

Conclusions: We reported a novel autosomal dominant myopathy with rimmed vacuoles characterized by dysarthria, dysphagia, external ophthalmoplegia, limb weakness, hypophrenia, deafness, and impaired vision, but the causative gene has not been found and needs further study.

Muscle structural changes in mitochondrial myopathy relate to genotype

DEFF Research Database (Denmark)

Olsen, David B.; Langkilde, Annika Reynberg; Ørngreen, Mette C.

2003-01-01

It is well known that morphological changes at the cellular level occur in muscle of patients with mitochondrial myopathy (MM), but changes in muscle structure with fat infiltration and gross variation of muscle fiber size with giant fibers, normally encountered in the muscular dystrophies, have...... typically not been associated with mitochondrial disease. We investigated gross and microscopic muscle morphology in thigh muscles by muscle biopsy and MRI in 16 patients with MM, and compared findings with those obtained in muscular dystrophy patients and healthy subjects. Changes of muscle architecture...

Management of cases suffering from atypical myopathy: interpretations of descriptive, epidemiological and pathophysiological findings

DEFF Research Database (Denmark)

van Galen Verwilghen, Gaby; Votion, D.-M.

2013-01-01

Atypical myopathy is highly fatal, but about a quarter of affected horses survive. This highlights the need for provision of supportive treatment for these cases. This review is a practical guideline for equine practitioners and includes suggestions for close monitoring of involved organ systems ...

Management of cases suffering from atypical myopathy: interpretations of descriptive, epidemiological and pathophysiological findings

DEFF Research Database (Denmark)

van Galen Verwilghen, Gaby; Votion, D.-M.

2013-01-01

Atypical myopathy is highly fatal, but about a quarter of affected horses survive. This highlights the need for provision of supportive treatment for these patients. This review is a practical guideline for equine practitioners and includes suggestions for close monitoring of involved organ systems...

Mutation in the novel nuclear-encoded mitochondrial protein CHCHD10 in a family with autosomal dominant mitochondrial myopathy.

Science.gov (United States)

Ajroud-Driss, Senda; Fecto, Faisal; Ajroud, Kaouther; Lalani, Irfan; Calvo, Sarah E; Mootha, Vamsi K; Deng, Han-Xiang; Siddique, Nailah; Tahmoush, Albert J; Heiman-Patterson, Terry D; Siddique, Teepu

2015-01-01

Mitochondrial myopathies belong to a larger group of systemic diseases caused by morphological or biochemical abnormalities of mitochondria. Mitochondrial disorders can be caused by mutations in either the mitochondrial or nuclear genome. Only 5% of all mitochondrial disorders are autosomal dominant. We analyzed DNA from members of the previously reported Puerto Rican kindred with an autosomal dominant mitochondrial myopathy (Heimann-Patterson et al. 1997). Linkage analysis suggested a putative locus on the pericentric region of the long arm of chromosome 22 (22q11). Using the tools of integrative genomics, we established chromosome 22 open reading frame 16 (C22orf16) (later designated as CHCHD10) as the only high-scoring mitochondrial candidate gene in our minimal candidate region. Sequence analysis revealed a double-missense mutation (R15S and G58R) in cis in CHCHD10 which encodes a coiled coil-helix-coiled coil-helix protein of unknown function. These two mutations completely co-segregated with the disease phenotype and were absent in 1,481 Caucasian and 80 Hispanic (including 32 Puerto Rican) controls. Expression profiling showed that CHCHD10 is enriched in skeletal muscle. Mitochondrial localization of the CHCHD10 protein was confirmed using immunofluorescence in cells expressing either wild-type or mutant CHCHD10. We found that the expression of the G58R, but not the R15S, mutation induced mitochondrial fragmentation. Our findings identify a novel gene causing mitochondrial myopathy, thereby expanding the spectrum of mitochondrial myopathies caused by nuclear genes. Our findings also suggest a role for CHCHD10 in the morphologic remodeling of the mitochondria.

Performance, meat quality, and pectoral myopathies of broilers fed either corn or sorghum based diets supplemented with guanidinoacetic acid.

Science.gov (United States)

Córdova-Noboa, H A; Oviedo-Rondón, E O; Sarsour, A H; Barnes, J; Ferzola, P; Rademacher-Heilshorn, M; Braun, U

2018-04-13

One experiment was conducted to evaluate the effects of guanidinoacetic acid (GAA) supplementation in broilers fed corn or sorghum-based diets on live performance, carcass and cut up yields, meat quality, and pectoral myopathies. The treatments consisted of corn or sorghum-based diets with or without the addition of GAA (600 g/ton). A total of 800 one-d-old male Ross 708 broiler chicks were randomly placed in 40 floor pens with 10 replicates (20 birds per pen) per each of the four treatments. At hatch, 14, 35, and 50 d, BW and feed intake were recorded. BW gain and FCR were calculated at the end of each phase. Four broilers per pen were selected and slaughtered at 51d and 55d of age to determine carcass and cut up yields, meat quality and myopathies (spaghetti muscle, white striping, and wooden breast) severity in the Pectoralis major. Data were analyzed as a randomized complete block design in a 2 × 2 factorial arrangement with grain type and GAA supplementation as main effects. At 50 d, diets containing GAA improved (P broilers fed corn diets with GAA had higher breast meat yield (P 0.05) by GAA supplementation at any slaughter ages. However, GAA decreased (P broilers supplemented with GAA had double (P broilers fed non-supplemented diets, therefore reducing the severity of this myopathy. In conclusion, GAA supplementation improved broiler live performance in broilers raised up to 50 d independently of grain source, increased breast meat yield in corn-based diets and reduced the severity of wooden breast myopathy.

Neutral lipid-storage disease with myopathy and extended phenotype with novel PNPLA2 mutation.

Science.gov (United States)

Massa, Roberto; Pozzessere, Simone; Rastelli, Emanuele; Serra, Laura; Terracciano, Chiara; Gibellini, Manuela; Bozzali, Marco; Arca, Marcello

2016-04-01

Neutral lipid-storage disease with myopathy is caused by mutations in PNPLA2, which produce skeletal and cardiac myopathy. We report a man with multiorgan neutral lipid storage and unusual multisystem clinical involvement, including cognitive impairment. Quantitative brain MRI with voxel-based morphometry and extended neuropsychological assessment were performed. In parallel, the coding sequences and intron/exon boundaries of the PNPLA2 gene were screened by direct sequencing. Neuropsychological assessment revealed global cognitive impairment, and brain MRI showed reduced gray matter volume in the temporal lobes. Molecular characterization revealed a novel homozygous mutation in exon 5 of PNPLA2 (c.714C>A), resulting in a premature stop codon (p.Cys238*). Some PNPLA2 mutations, such as the one described here, may present with an extended phenotype, including brain involvement. In these cases, complete neuropsychological testing, combined with quantitative brain MRI, may help to characterize and quantify cognitive impairment. © 2016 Wiley Periodicals, Inc.

Craniopharyngioma presenting with severe hyponatremia, hyponatremia-induced myopathy, and panhypopituitarism: a case report.

Science.gov (United States)

Dilrukshi, M D S A; Sandakumari, G V N; Abeysundara, P K; Chang, T

2017-02-05

Craniopharyngiomas are rare intracranial tumors commonly presenting with neurological symptoms. Reports of severe hyponatremia as a presenting manifestation of a craniopharyngioma and hyponatremia-induced myopathy are rare. We report the case of a patient with craniopharyngioma presenting with severe hyponatremia, panhypopituitarism, and hyponatremia-induced myopathy. A 52-year-old Sri Lankan man presented with anorexia, nausea, fatigue, generalized muscle weakness, and cramps for 1 week. The onset of his illness had been preceded by vomiting and diarrhea for 1 day which he attributed to food poisoning. On examination, he had an apathetic disposition with a generalized "sallow complexion." He was not dehydrated. Apart from reduced muscle power (4/5) and hyporeflexia, the neurological examination was normal. His serum sodium was 102 mmol/l; potassium 4.1 mmol/l; chloride 63 mmol/l; plasma osmolality 272 mosm/KgH 2 O; urine osmolality 642 mosm/KgH 2 O; and urine sodium 79 mmol/l. His creatine phosphokinase was 12,400 U/l, lactate dehydrogenase 628 U/l, aspartate aminotransferase 360 U/l, and alanine aminotransferase 64 U/l. His hormone profile revealed panhypopituitarism. An electromyogram showed nonspecific abnormalities while a muscle biopsy did not show any pathology. Magnetic resonance imaging of his brain demonstrated a well-defined craniopharyngioma with suprasellar extension. His pituitary gland was compressed and the pituitary stalk was displaced by the tumor. He had marked improvement in muscle power and rapid reduction of serum creatine phosphokinase levels paralleling the correction of severe hyponatremia, even before the initiation of hormone replacement. This case illustrates the rare presentation of severe hyponatremia and hyponatremia-induced myopathy in patients with craniopharyngioma, awareness of which would facilitate early appropriate investigations and treatment.

Toxic myopathies: muscle biopsy features Miopatia tóxica: biópsia muscular

Directory of Open Access Journals (Sweden)

Rosana Herminia Scola

2007-03-01

Full Text Available Several drugs and toxic substances can cause muscular abnormalities and are frequent causes of acquired myopathies. We present a series of 32 patients, predominance of young adult patients, diagnosed with toxic myopathy. The most common substances inducing myopathy were corticosteroids (56.2% followed by the propoxyphene, neuroleptics, zidovudine and drug-induced hypokalemia. The investigation showed normal serum creatine kinase levels in 65.4%, myopathic pattern of the needle electromyography in 40% and the more frequent histological diagnosis of the muscle biopsy was type 2 fiber atrophy (59.3%. Clinical features, etiology, course of the disease, serum levels of muscular enzymes, electromyographic features and, especially, muscle biopsy features are discussed.Diversos medicamentos e substâncias tóxicas podem causar alterações musculares e são causas freqüentes de miopatia adquirida. Apresentamos uma série de 32 pacientes, predomínio de pacientes adulto jovens, com miopatia tóxica. As substâncias mais relacionadas com a miopatia foram os corticosteróides (56,2% seguidos pelo propoxifeno, neurolépticos, zidovudina e drogas indutoras de hipocalemia. A investigação mostrou níveis normais de creatino quinase sérica em 65,4%, eletromiografia de agulha com padrão miopático em 40% e o mais freqüente diagnóstico histológico da biópsia muscular foi atrofia de fibras do tipo 2 (59,3%. As manifestações clínicas, etiologia, tempo de evolução, nível sérico das enzimas musculares, alterações da eletroneuromiografia e, especialmente, da biópsia muscular são discutidos.

Novel autosomal dominant TNNT1 mutation causing nemaline myopathy.

Science.gov (United States)

Konersman, Chamindra G; Freyermuth, Fernande; Winder, Thomas L; Lawlor, Michael W; Lagier-Tourenne, Clotilde; Patel, Shailendra B

2017-11-01

Nemaline myopathy (NEM) is one of the three major forms of congenital myopathy and is characterized by diffuse muscle weakness, hypotonia, respiratory insufficiency, and the presence of nemaline rod structures on muscle biopsy. Mutations in troponin T1 (TNNT1) is 1 of 10 genes known to cause NEM. To date, only homozygous nonsense mutations or compound heterozygous truncating or internal deletion mutations in TNNT1 gene have been identified in NEM. This extended family is of historical importance as some members were reported in the 1960s as initial evidence that NEM is a hereditary disorder. Proband and extended family underwent Sanger sequencing for TNNT1. We performed RT-PCR and immunoblot on muscle to assess TNNT1 RNA expression and protein levels in proband and father. We report a novel heterozygous missense mutation of TNNT1 c.311A>T (p.E104V) that segregated in an autosomal dominant fashion in a large family residing in the United States. Extensive sequencing of the other known genes for NEM failed to identify any other mutant alleles. Muscle biopsies revealed a characteristic pattern of nemaline rods and severe myofiber hypotrophy that was almost entirely restricted to the type 1 fiber population. This novel mutation alters a residue that is highly conserved among vertebrates. This report highlights not only a family with autosomal dominant inheritance of NEM, but that this novel mutation likely acts via a dominant negative mechanism. © 2017 The Authors. Molecular Genetics & Genomic Medicine published by Wiley Periodicals, Inc.

Triacylglycerol infusion improves exercise endurance in patients with mitochondrial myopathy due to complex I deficiency

NARCIS (Netherlands)

Roef, MJ; de Meer, K; Reijngoud, DJ; Straver, HWHC; de Barse, M; Kalhan, SC; Berger, R

Background: A high-fat diet has been recommended for the treatment of patients with mitochondrial myopathy due to complex I (NADH dehydrogenase) deficiency (CID). Objective: This study evaluated the effects of intravenous infusion of isoenergetic amounts of triacylglycerol or glucose on substrate

Autism in the Son of a Woman with Mitochondrial Myopathy and Dysautonomia: A Case Report.

Science.gov (United States)

Brown, Bradley D; Rais, Theodore

2015-01-01

The relationship between autism spectrum disorders and mitochondrial dysfunction, including mitochondrial myopathies and other mitochondrial diseases, is an area of ongoing research. All autism spectrum disorders are known to be heritable, via genetic and/or epigenetic mechanisms, but specific modes of inheritance are not well characterized. Nevertheless, autism spectrum disorders have been linked to many specific genes associated with mitochondrial function, especially to genes involved in mitochondrial tRNA and the electron transport chain, both particularly vulnerable to point mutations, and clinical research also supports a relationship between the two pathologies. Although only a small minority of patients with autism have a mitochondrial disease, many patients with mitochondrial myopathies have autism spectrum disorder symptoms, and these symptoms may be the presenting symptoms, which presents a diagnostic challenge for clinicians. The authors report the case of a 15-year-old boy with a history of autism spectrum disorder and neurocardiogenic syncope, admitted to the inpatient unit for self-injury, whose young mother, age 35, was discovered to suffer from mitochondrial myopathy, dysautonomia, neurocardiogenic syncope, Ehler-Danlos syndrome, and other uncommon multisystem pathologies likely related to mitochondrial dysfunction. This case illustrates the need for a high index of suspicion for mitochondrial disease in patients with autism, as they have two orders of magnitude greater risk for such diseases than the general population. The literature shows that mitochondrial disease is underdiagnosed in autism spectrum disorder patients and should not be viewed as a "zebra" (i.e., an obscure diagnosis that is made when a more common explanation is more likely).

The myositis autoantibody phenotypes of the juvenile idiopathic inflammatory myopathies.

Science.gov (United States)

Rider, Lisa G; Shah, Mona; Mamyrova, Gulnara; Huber, Adam M; Rice, Madeline Murguia; Targoff, Ira N; Miller, Frederick W

2013-07-01

The juvenile idiopathic inflammatory myopathies (JIIM) are systemic autoimmune diseases characterized by skeletal muscle weakness, characteristic rashes, and other systemic features. In follow-up to our study defining the major clinical subgroup phenotypes of JIIM, we compared demographics, clinical features, laboratory measures, and outcomes among myositis-specific autoantibody (MSA) subgroups, as well as with published data on adult idiopathic inflammatory myopathy patients enrolled in a separate natural history study. In the present study, of 430 patients enrolled in a nationwide registry study who had serum tested for myositis autoantibodies, 374 had either a single specific MSA (n = 253) or no identified MSA (n = 121) and were the subject of the present report. Following univariate analysis, we used random forest classification and exact logistic regression modeling to compare autoantibody subgroups. Anti-p155/140 autoantibodies were the most frequent subgroup, present in 32% of patients with juvenile dermatomyositis (JDM) or overlap myositis with JDM, followed by anti-MJ autoantibodies, which were seen in 20% of JIIM patients, primarily in JDM. Other MSAs, including anti-synthetase, anti-signal recognition particle (SRP), and anti-Mi-2, were present in only 10% of JIIM patients. Features that characterized the anti-p155/140 autoantibody subgroup included Gottron papules, malar rash, "shawl-sign" rash, photosensitivity, cuticular overgrowth, lowest creatine kinase (CK) levels, and a predominantly chronic illness course. The features that differed for patients with anti-MJ antibodies included muscle cramps, dysphonia, intermediate CK levels, a high frequency of hospitalization, and a monocyclic disease course. Patients with anti-synthetase antibodies had higher frequencies of interstitial lung disease, arthralgia, and "mechanic's hands," and had an older age at diagnosis. The anti-SRP group, which had exclusively juvenile polymyositis, was characterized by high

Tc-99m ECD brain SPECT in MELAS syndrome and mitochondrial myopathy: comparison with MR findings

International Nuclear Information System (INIS)

Park, Sang Joon; Ryu, Young Hoon; Jeon, Tae Joo; Kim, Jai Keun; Nam, Ji Eun; Yoon, Pyeong Ho; Yoon, Choon Sik; Lee, Jong Doo

1998-01-01

We evaluated brain perfusion SPECT findings of MELAS syndrome and mitochondrial myopathy in correlation with MR imaging in search of specific imaging features. Subjects were five patients (four females and one male; age range, 1 to 25 year) who presented with repeated stroke like episodes, seizures or developmental delay or asymptomatic but had elevated lactic acid in CSF and serum. Conventional non-contrast MR imaging and Tc-99m-ethyl cysteinate dimer (ECD) brain perfusion SPECT were performed and imaging features were analyzed. MRI demonstrated increased T2 signal intensities in the affected areas of gray and white matters mainly in the parietal (4/5) and occipital lobes (4/5) and in the basal ganglia (1/5), which were not restricted to a specific vascular territory. SPECT demonstrated decreased perfusion in the corresponding regions of MRI lesions. In addition, there were perfusion defects in parietal (1 patient), temporal (2), and frontal (1) lobes and basal ganglia (1) and thalami (2). In a patient with mitochondrial myopathy who had normal MRI, decreased perfusion was noted in left parietal area and bilateral thalami. Tc-99m ECD SPECT imaging in patients with MELAS syndrome and mitochondrial myopathy showed hypoperfusion of parieto-occipital cortex, basal ganglia, thalamus and temporal cortex, which were not restricted to a specific vascular territory. There were no specific imaging features on SPECT. The significance of abnormal perfusion on SPECT without corresponding MR abnormalities needs to be evaluated further in larger number of patients

Role of Exercise Therapy in Prevention of Decline in Aging Muscle Function: Glucocorticoid Myopathy and Unloading

Directory of Open Access Journals (Sweden)

Teet Seene

2012-01-01

Full Text Available Changes in skeletal muscle quantity and quality lead to disability in the aging population. Physiological changes in aging skeletal muscle are associated with a decline in mass, strength, and inability to maintain balance. Glucocorticoids, which are in wide exploitation in various clinical scenarios, lead to the loss of the myofibrillar apparatus, changes in the extracellular matrix, and a decrease in muscle strength and motor activity, particularly in the elderly. Exercise therapy has shown to be a useful tool for the prevention of different diseases, including glucocorticoid myopathy and muscle unloading in the elderly. The purpose of the paper is to discuss the possibilities of using exercise therapy in the prevention of glucocorticoid caused myopathy and unloading in the elderly and to describe relationships between the muscle contractile apparatus and the extracellular matrix in different types of aging muscles.

Myopathy in hyperthyroidism as a consequence of rapid reduction of thyroid hormone

OpenAIRE

Li, Qianrui; Liu, Yuping; Zhang, Qianying; Tian, Haoming; Li, Jianwei; Li, Sheyu

2017-01-01

Abstract Rationale: Myalgia and elevated creatine kinase (CK) are occasionally observed during the treatment of hyperthyroid patients. Relative hypothyroidism resulted from rapid thyroid hormone reduction had been promoted as a plausible cause of these myopathic changes, however rarely reported. Patient concerns: We hereby presented a 20-year-old female with Grave's disease, who developed myopathy and elevated CK during rapid correction of thyroid hormone. Diagnoses: Relative hypothyroidism-i...

Nuclear actin aggregation is a hallmark of anti-synthetase syndrome-induced dysimmune myopathy

OpenAIRE

Stenzel, W; Preusse, C; Allenbach, Y; Pehl, D; Junckerstorff, R; Heppner, F L; Nolte, K; Aronica, E; Kana, V; Rushing, E; Schneider, U; Claeys, K G; Benveniste, O; Weis, J; Goebel, H H

2015-01-01

Objective: To analyze antisynthetase syndrome–associated myositis by modern myopathologic methods and to define its place in the spectrum of idiopathic inflammatory myopathies (IIMs). Methods: Skeletal muscle biopsies from antisynthetase syndrome–associated myositis and other IIMs from different institutions worldwide were analyzed by histopathology, quantitative PCR, and electron microscopy. Results: Myonuclear actin filament inclusions were identified as a unique morphologic hallmark of a...

Uremic myopathy: Is oxidative stress implicated in muscle dysfunction in uremia?

Directory of Open Access Journals (Sweden)

Antonia eKaltsatou

2015-03-01

Full Text Available Renal failure is accompanied by progressive muscle weakness and premature fatigue, in part linked to hypokinesis and in part to uremic toxicity. These changes are associated with various detrimental biochemical and morphological alterations. All of these pathological parameters are collectively termed ureamic myopathy. Various interventions while helpful can’t fully remedy the pathological phenotype. Complex mechanisms that stimulate muscle dysfunction in uremia have been proposed, and oxidative stress could be implicated. Skeletal muscles continuously produce reactive oxygen species (ROS and reactive nitrogen species (RNS at rest and more so during contraction. The aim of this mini review is to provide an update on recent advances in our understanding of how ROS and RNS generation might contribute to muscle dysfunction in uremia. Thus a systematic review was conducted searching PubMed and Scopus by using the Cochrane and PRISMA guidelines. While few studies met our criteria their findings are discussed making reference to other available literature data. Oxidative stress can direct muscle cells into a catabolic state and chronic exposure to it leads to wasting. Moreover, redox disturbances can significantly affect force production per se. We conclude that oxidative stress can be in part responsible for some aspects of uremic myopathy. Further research is needed to discern clear mechanisms and to help efforts to counteract muscle weakness and exercise intolerance in uremic patients.

Loss-of-function mutations in SCN4A> cause severe foetal hypokinesia or 'classical' congenital myopathy

DEFF Research Database (Denmark)

Zaharieva, Irina T; Thor, Michael G; Oates, Emily C

2016-01-01

Congenital myopathies are a clinically and genetically heterogeneous group of muscle disorders characterized by congenital or early-onset hypotonia and muscle weakness, and specific pathological features on muscle biopsy. The phenotype ranges from foetal akinesia resulting in in utero or neonatal...

MYOPATHY AS A SIDE EFFECT OF STATIN THERAPY: MECHANISMS OF DEVELOPMENT AND PROSPECTS FOR TREATMENT

Directory of Open Access Journals (Sweden)

O. M. Drapkina

2015-01-01

Full Text Available Statins are lipid-lowering drugs with proven efficacy that reduce cardiovascular risk and are well tolerated by most patients. Myopathy as a side effect of statin therapy is one of the most common reasons for their withdrawal. Its severity can range from asymptomatic increase of serum CPK to life-threatening rhabdomyolysis. Therefore it is necessary to remember about the possibility of its occurrence.The exact molecular mechanisms of muscle damage by statins are still unknown. Various hypotheses are suggested in this respect: fatty acid oxidation disorders, mitochondrial dysfunction, increased protein degradation in myocytes due to changes in atrogin-1 and ubiquitin activity, activation of autoimmune processes, intracellular depletion of essential metabolites, destabilization of cell membranes, impaired expression of genes involved in apoptosis and protein degradation. The theory that the reduction of intramuscular CoQ10 level is the cause of myopathy prevails. Additional intake of CoQ10 seems promising, but is not evidence-based.

MYOPATHY AS A SIDE EFFECT OF STATIN THERAPY: MECHANISMS OF DEVELOPMENT AND PROSPECTS FOR TREATMENT

Directory of Open Access Journals (Sweden)

O. M. Drapkina

2015-09-01

Full Text Available Statins are lipid-lowering drugs with proven efficacy that reduce cardiovascular risk and are well tolerated by most patients. Myopathy as a side effect of statin therapy is one of the most common reasons for their withdrawal. Its severity can range from asymptomatic increase of serum CPK to life-threatening rhabdomyolysis. Therefore it is necessary to remember about the possibility of its occurrence.The exact molecular mechanisms of muscle damage by statins are still unknown. Various hypotheses are suggested in this respect: fatty acid oxidation disorders, mitochondrial dysfunction, increased protein degradation in myocytes due to changes in atrogin-1 and ubiquitin activity, activation of autoimmune processes, intracellular depletion of essential metabolites, destabilization of cell membranes, impaired expression of genes involved in apoptosis and protein degradation. The theory that the reduction of intramuscular CoQ10 level is the cause of myopathy prevails. Additional intake of CoQ10 seems promising, but is not evidence-based.

Hypothyroid myopathy: A peculiar clinical presentation of thyroid failure. Review of the literature.

Science.gov (United States)

Sindoni, Alessandro; Rodolico, Carmelo; Pappalardo, Maria Angela; Portaro, Simona; Benvenga, Salvatore

2016-12-01

Abnormalities in thyroid function are common endocrine disorders that affect 5-10 % of the general population, with hypothyroidism occurring more frequently than hyperthyroidism. Clinical symptoms and signs are often nonspecific, particularly in hypothyroidism. Muscular symptoms (stiffness, myalgias, cramps, easy fatigability) are mentioned by the majority of patients with frank hypothyroidism. Often underestimated is the fact that muscle symptoms may represent the predominant or the only clinical manifestation of hypothyroidism, raising the issue of a differential diagnosis with other causes of myopathy, which sometimes can be difficult. Elevated serum creatine kinase, which not necessarily correlates with the severity of the myopathic symptoms, is certainly suggestive of muscle impairment, though it does not explain the cause. Rare muscular manifestations, associated with hypothyroidism, are rhabdomyolysis, acute compartment syndrome, Hoffman's syndrome and Kocher-Debré-Sémélaigne syndrome. Though the pathogenesis of hypothyroid myopathy is not entirely known, proposed mechanisms include altered glycogenolytic and oxidative metabolism, altered expression of contractile proteins, and neuro-mediated damage. Correlation studies of haplotype, muscle gene expression and protein characterization, could help understanding the pathophysiological mechanisms of this myopathic presentation of hypothyroidism.

Clinical study on myocardial imaging with β-methyl-p-(123I)-iodophenyl-pentadecanoic acid in patients with mitochondrial myopathy

International Nuclear Information System (INIS)

Kihara, Koichi; Nakajo, Masayuki; Shono, Hirohisa

1992-01-01

Myocardial imaging with β-methyl-p-( 123 I)-iodophenyl-pentadecanoic acid ( 123 I-BMIPP), a new radiopharmaceutical designed to evaluate myocardial fatty acid metabolism, was performed in 7 patients with mitochondrial myopathy to detect their myocardial damages in comparison with 201 Tl myocardial imaging. These patients were divided into 4 chronic progressive external ophthalmoplegia (CPEO) cases, 2 mitochondrial myopathy, encephalopathy, lactic acidosis, and stroke-like episodes (MELAS) cases and 1 myoclonus epilepsy with ragged-red fibers (MERRF). In visual assessment, we observed more myocardial segments with decreased uptake of 123 I-BMIPP compared to 201 Tl in MELAS cases than in CPEO cases. The mean myocardial uptake of 123 I-BMIPP was higher than that of 201 Tl in CPEO cases. On the other hand, in MELAS and MERRF cases, the mean myocardial uptake of 123 I-BMIPP was lower than that of 201 Tl. Abnormal findings suggesting myocardial damages were observed in echocardiogram and/or in electrocardiogram in MELAS and MERRF cases, while no such abnormal findings were observed in CPEO cases. Along with the previously reported experimental result that the impairment of rat myocardial mitochondria decreased myocardial uptake of 123 I-BMIPP, these results suggest that 123 I-BMIPP may be useful to detect myocardial damages in patients with mitochondrial myopathy. (author)

Equine atypical myopathy caused by hypoglycin A intoxication associated with ingestion of sycamore maple tree seeds.

Science.gov (United States)

Żuraw, A; Dietert, K; Kühnel, S; Sander, J; Klopfleisch, R

2016-07-01

Evidence suggest there is a link between equine atypical myopathy (EAM) and ingestion of sycamore maple tree seeds. To further evaluate the hypothesis that the ingestion of hypoglycin A (HGA) containing sycamore maple tree seeds causes acquired multiple acyl-CoA dehydrogenase deficiency and might be associated with the clinical and pathological signs of EAM. Case report. Necropsy and histopathology, using hematoxylin and eosin and Sudan III stains, were performed on a 2.5-year-old mare that died following the development of clinical signs of progressive muscle stiffness and recumbency. Prior to death, the animal ingested sycamore maple tree seeds (Acer pseudoplatanus). Detection of metabolites in blood and urine obtained post mortem was performed by rapid ultra-performance liquid chromatography-tandem mass spectrometry. Data from this case were compared with 3 geldings with no clinical history of myopathy. Macroscopic examination revealed fragments of maple tree seeds in the stomach and severe myopathy of several muscle groups including Mm. intercostales, deltoidei and trapezii. Histologically, the affected muscles showed severe, acute rhabdomyolysis with extensive accumulation of finely dispersed fat droplets in the cytoplasm of degenerated skeletal muscle cells not present in controls. Urine and serum concentrations of several acyl carnitines and acyl glycines were increased, and both contained metabolites of HGA, a toxic amino acid present in sycamore maple tree seeds. The study supports the hypothesis that ingestion of HGA-containing maple tree seeds may cause EAM due to acquired multiple acyl-CoA dehydrogenase deficiency. © 2015 EVJ Ltd.

Metabolic consequences of adipose triglyceride lipase deficiency in humans: an in vivo study in patients with neutral lipid storage disease with myopathy.

Science.gov (United States)

Natali, Andrea; Gastaldelli, Amalia; Camastra, Stefania; Baldi, Simona; Quagliarini, Fabiana; Minicocci, Ilenia; Bruno, Claudio; Pennisi, Elena; Arca, Marcello

2013-09-01

The role of adipose triglyceride lipase (ATGL) in intermediate substrates metabolism has not been fully elucidated in humans. Our objective was to evaluate the consequences of ATGL deficiency on body fat distribution, insulin sensitivity, fatty acids metabolism, and energy substrate utilization. Body composition and organ fat content were measured by bioimpedance and (1)H nuclear magnetic resonance spectroscopy; heart glucose metabolism by [(18)F]deoxyglucose positron emission tomography and insulin sensitivity and β-cell function by oral glucose tolerance and 2-step euglycemic-hyperinsulinemic clamp. Lipolysis ([(2)H5]glycerol turnover) and indirect calorimetry were evaluated at fasting, after oral glucose load, during the clamp, and also during an iv epinephrine infusion. These metabolic investigations were carried out during hospitalization. Three patients affected by neutral lipid storage disease with myopathy (NLSDM) due to homozygosity for loss-of-function mutations in the ATGL gene and 6 sex-, age-, and body mass index-matched controls were studied. As expected, NLSDM patients showed diffuse, although heterogeneous, fat infiltration in skeletal muscles associated with increased visceral fat. Although heart and liver were variably affected, fat content in the pancreas was increased in all patients. Compared with healthy controls, NLSDM patients showed impaired insulin response to glucose possibly related to the severe pancreatic steatosis, preserved whole-body insulin sensitivity, and a shift toward glucose metabolism in the heart. Fasting nonesterified fatty acid concentrations as well as basal lipolytic rates and the antilipolytic effect of insulin were normal in NLSDM patients, whereas the lipolytic effect of norepinephrine was impaired. Finally, no significant abnormality in the respiratory quotient was noted in NLSDM patients. In humans, ATGL has a remarkable effect on cellular lipid droplet handling, and its lack causes both perivisceral, skeletal

c-Kit-positive cardiac stem cells nested in hypoxic niches are activated by stem cell factor reversing the aging myopathy.

Science.gov (United States)

Sanada, Fumihiro; Kim, Junghyun; Czarna, Anna; Chan, Noel Yan-Ki; Signore, Sergio; Ogórek, Barbara; Isobe, Kazuya; Wybieralska, Ewa; Borghetti, Giulia; Pesapane, Ada; Sorrentino, Andrea; Mangano, Emily; Cappetta, Donato; Mangiaracina, Chiara; Ricciardi, Mario; Cimini, Maria; Ifedigbo, Emeka; Perrella, Mark A; Goichberg, Polina; Choi, Augustine M; Kajstura, Jan; Hosoda, Toru; Rota, Marcello; Anversa, Piero; Leri, Annarosa

2014-01-03

Hypoxia favors stem cell quiescence, whereas normoxia is required for stem cell activation, but whether cardiac stem cell (CSC) function is regulated by the hypoxic/normoxic state of the cell is currently unknown. A balance between hypoxic and normoxic CSCs may be present in the young heart, although this homeostatic control may be disrupted with aging. Defects in tissue oxygenation occur in the old myocardium, and this phenomenon may expand the pool of hypoxic CSCs, which are no longer involved in myocyte renewal. Here, we show that the senescent heart is characterized by an increased number of quiescent CSCs with intact telomeres that cannot re-enter the cell cycle and form a differentiated progeny. Conversely, myocyte replacement is controlled only by frequently dividing CSCs with shortened telomeres; these CSCs generate a myocyte population that is chronologically young but phenotypically old. Telomere dysfunction dictates their actual age and mechanical behavior. However, the residual subset of quiescent young CSCs can be stimulated in situ by stem cell factor reversing the aging myopathy. Our findings support the notion that strategies targeting CSC activation and growth interfere with the manifestations of myocardial aging in an animal model. Although caution has to be exercised in the translation of animal studies to human beings, our data strongly suggest that a pool of functionally competent CSCs persists in the senescent heart and that this stem cell compartment can promote myocyte regeneration effectively, partly correcting the aging myopathy.

[Fenofibrate--induced myopathy in a patient with undiagnosed hypothyroidism--case report and a review of the literature].

Science.gov (United States)

Lukjanowicz, Małgorzata; Trzcińska-Butkiewicz, Beata; Brzosko, Marek

2006-01-01

Hypothyroidism is one of the common causes of the secondary hypercholesterolemia. The prevalence of hypothyroidism in the general population is estimated to be as high as about 1.5%. Frequency of the hypothyroidism in patients with hyperlipidemia is high, and can be observed in 4.2-10% in different populations. Most commonly, there is no need to treat the hypothyroid patients with the hypolipidemic drugs. Substitution treatment with the thyroid hormones usually results in either normalization or significant decreasing of the lipid levels. Hypothyroidism with symptoms of involvement of skeletal muscles is referred as to hypothyroid myopathy in English literature, and can be present in 30-80% patients with deficiency of the thyroid hormones. Hypothyroidism is a risk factor of developing of toxic injury of muscles, what is thought to be related to hypolipidemic drug intake. We report a case of a patient with undiagnosed hypothyroidism with muscle involvement manifestation, who was treated with fenofibrate due to accidentally diagnosed hypercholesterolemia. Hypolipidemic management resulted in rapid exacerbation of previously moderate myopathy. High concentrations of muscle enzymes and moderate increasing of creatinine concentration were detected. Improvement was observed after discontinuation of fenofibrate administration, but muscle symptoms and elevation of muscle enzymes and creatinine persisted. After administration of levothyroxin, muscle weakness and laboratory abnormalities were observed no longer. After several months of follow-up we believe that treatment with fenofibrate in our patient was complicated with muscle tissue damage and exacerbated symptoms of myopathy originally related to decompensated hypothyroidism.

Internal anal sphincter myopathy causing proctalgia fugax and constipation: further clinical and radiological characterization in a patient.

Science.gov (United States)

Guy, R J; Kamm, M A; Martin, J E

1997-02-01

We report a case of a distinctive familial internal anal sphincter myopathy with unique histological and radiological features. A 67-year-old woman presented with a 20-year history of proctalgia fugax and outlet obstruction; other family members were similarly affected. Computed tomograpy and magnetic resonance imaging demonstrated a grossly hypertrophied internal anal sphincter. Strip myectomy of the sphincter was carried out with improvement in evacuation but little relief of proctalgia. Further relief of symptoms was obtained using oral and transdermal nitrates and a calcium antagonist. Histological examination of the excised muscle revealed hypertrophy and an abnormal arrangement of fibres in whorls; many fibres contained vacuoles with inclusion bodies positive for periodic acid-Schiff. This description of a specific anal sphincter myopathy illustrates the potential importance of histopathological studies of smooth muscle in functional disorders of the gut.

Hypoglycin A in maple trees in the Netherlands and the risk of equine atypical myopathy

NARCIS (Netherlands)

Westermann, C.M.; van Leeuwen, Robbert; Mol, Hans

2016-01-01

The Acer (maple) genus of trees comprises over 120 species worldwide. Some of these contain the plant-toxin hypoglycin-A which has been proven to be a cause of the highly fatal condition called atypical myopathy (AM) in horses and ponies. In an earlier study of maple-tree samples (leaves and seeds)

[Human myopathy and animal muscular dystrophy].

Science.gov (United States)

Schapira, G; Dreyfus, J C; Schapira, F

1977-08-01

Two hereditary muscular dystrophies similar to human progressive muscular dystrophy (P.M.D. Duchenne type) have been isolated in animals, one in mouse, the other in chicken. The decrease in the activity of glycogenolytic enzymes is similar to that observed in denervated muscle. Isozymic fetal types for several muscular enzymes have been observed as well in chicken as in man, but this fetal type may also be found in neurogenic atrophy. The release in circulation of muscle enzymes seems more specific. But the origin of the genetic lesion is still unknown. We describe here the three different theories about this problem: i.e. neurogenic, vascular, or myogenic. This last theory implies a trouble of membrane permeability.

Homozygous LIPE Mutation in Siblings with Multiple Symmetric Lipomatosis, Partial Lipodystrophy, and Myopathy

OpenAIRE

Zolotov, Sagit; Xing, Chao; Mahamid, Riad; Shalata, Adel; Sheikh-Ahmad, Mohammed; Garg, Abhimanyu

2016-01-01

Despite considerable progress in identifying causal genes for lipodystrophy syndromes, the molecular basis of some peculiar adipose tissue disorders remains obscure. In an Israeli–Arab pedigree with a novel autosomal recessive, multiple symmetric lipomatosis (MSL), partial lipodystrophy and myopathy, we conducted exome sequencing of two affected siblings to identify the disease-causingmutation. The 41-year-old female proband and her 36-year-old brother reported marked accumulation of subcutan...

Muscle MRI in neutral lipid storage disease with myopathy carrying mutation c.187+1G>A.

Science.gov (United States)

Xu, Chunxiao; Zhao, Yawen; Liu, Jing; Zhang, Wei; Wang, Zhaoxia; Yuan, Yun

2015-06-01

We describe the clinical and muscle MRI changes in 2 siblings with neutral lipid storage disease with myopathy (NLSDM) carrying the mutation c.187+1G>A. Peripheral blood smears, genetic tests, and muscle biopsies were performed. Thigh MRI was performed to observe fatty replacement, muscle edema, and muscle bulk from axial sections. Both siblings had similar fatty infiltration and edema. T1-weighted images of the gluteus maximus, adductor magnus, semitendinosus, and semimembranosus revealed marked and diffuse fatty infiltration. There was asymmetric involvement in biceps femoris and quadriceps. There was extensive fatty infiltration in the quadriceps, except for the rectus femoris. Gracilis and sartorius were relatively spared. Thigh muscle volume was decreased, while the gracilis and sartorius appeared to show compensatory hypertrophy. Compared with previous reports in NLSDM, MRI changes in this myopathy tended to be more severe. Asymmetry and relatively selective fatty infiltration were characteristics. © 2014 Wiley Periodicals, Inc.

Restrictive extraocular myopathy: A presenting feature of acromegaly

Directory of Open Access Journals (Sweden)

Steven Heireman

2011-01-01

Full Text Available A 45-year-old man presented with binocular diplopia in primary gaze for 1 year. Orthoptic evaluation showed 10-prism diopter right eye hypotropia and 6-prism diopter right eye esotropia. The elevation and abduction of the right eye were mechanically restricted. This was associated with systemic features suggestive of acromegaly. Magnetic resonance imaging (MRI of the brain demonstrated a pituitary macroadenoma. An elevated serum insulin-like growth factor I level and the failure of growth hormone suppression after an oral glucose load biochemically confirmed the diagnosis of acromegaly. Computed tomography (CT of the orbit demonstrated bilateral symmetrical enlargement of the medial rectus and inferior rectus muscle bellies. All tests regarding Graves-Basedow disease were negative. Although rare, diplopia due to a restrictive extraocular myopathy could be the presenting symptom of acromegaly.

Subclinical myopathy in patients with colorectal cancer: clinical-pathological characterization and search for tissue markers

Directory of Open Access Journals (Sweden)

Massimo Vecchiato

2012-03-01

Full Text Available Skeletal muscle in patients with cancer undergoes many morphological changes due to immuno-inflammatory factors of tumor origin or treatment.T he latest event of these changes is cancer cachexia. Aim of the study is to identify myopathic features in skeletal muscle biopsies from weight stable patients with colorectal cancer and without cachexia or asthenia / weakness, that could possibly provide new diagnostic and prognostic cancer biomarkers. Morphometric analyses and immunohistochemical studies were performed on intraoperative muscle biopsies from patients with colorectal cancer and from weight stable patients undergoing surgery for benign non-inflammatory conditions. A rectus abdominis biopsy was taken in all patients and controls.A correlation between histopathologic findings and clinical characteristics, circulating inflammatory biomarkers and markers of muscle necrosis,surgery data and cancer phenotype were investigated.. Forty four patients (21male/23 female and 17 controls (6 male/11 female (p=NS were studied. In cancer patients’biopsies we observed asubclinical myopathy characterized by an abnormal distribution of myonuclei, which are localized inside the myofiber rather than at the periphery, and by the presence of regenerating muscle fibers. The percentage of myofibers with internalized nuclei is significantly higher in patients (median= 9%, IQR= 3.7-18.8 than in controls (median= 2.7%, IQR= 1.7-3.2 ( p=0.0002. In patients we observed an inverse correlation between the number of centronucleated fibers and the presence of node metastasis (N+(ρ=-0.64 (p=0.002. Patients affected with colorectal cancer display early sign of a myopathy, characterized by centronucleated and regenerating myofibers. This myopathy appears to be associated with an early stage of neoplasia and it could be an adaptive response of muscle to cancer. We hope a future application of these findings as a possible early diagnostic and prognostic biomarker of

Effects of aerobic training on exercise-related oxidative stress in mitochondrial myopathies.

Science.gov (United States)

Siciliano, Gabriele; Simoncini, Costanza; Lo Gerfo, Annalisa; Orsucci, Daniele; Ricci, Giulia; Mancuso, Michelangelo

2012-12-01

In mitochondrial myopathies with respiratory chain deficiency impairment of energy cell production may lead to in excess reactive oxygen species generation with consequent oxidative stress and cell damage. Aerobic training has been showed to increase muscle performance in patients with mitochondrial myopathies. Aim of this study has been to evaluate, in 7 patients (6 F e 1M, mean age 44.9 ± 12.1 years) affected by mitochondrial disease, concomitantly to lactate exercise curve, the occurrence of oxidative stress, as indicated by circulating levels of lipoperoxides, in rest condition and as effect of exercise, and also, to verify if an aerobic training program is able to modify, in these patients, ox-redox balance efficiency. At rest and before training blood level of lipoperoxides was 382.4 ± 37.8 AU, compared to controls (318.7 ± 63.8; Pstress degree according to the adopted scale. During incremental exercise blood level of lipoperoxides did not increase, but maintained significantly higher compared to controls. After an aerobic training of 10 weeks the blood level of lipoperoxides decreased by 13.7% at rest (Pexercise test (P=0.06). These data indicate that, in mitochondrial patients, oxidative stress occurs and that an aerobic training is useful in partially reverting this condition. Copyright © 2012 Elsevier B.V. All rights reserved.

Mutation spectrum in the large GTPase dynamin 2, and genotype-phenotype correlation in autosomal dominant centronuclear myopathy

DEFF Research Database (Denmark)

Böhm, Johann; Biancalana, Valérie; Dechene, Elizabeth T

2012-01-01

Centronuclear myopathy (CNM) is a genetically heterogeneous disorder associated with general skeletal muscle weakness, type I fiber predominance and atrophy, and abnormally centralized nuclei. Autosomal dominant CNM is due to mutations in the large GTPase dynamin 2 (DNM2), a mechanochemical enzym...

Muscle-fiber conduction velocity and electromyography as diagnostic tools in patients with suspected inflammatory myopathy: a prospective study.

NARCIS (Netherlands)

Blijham, P.J.; Hengstman, G.J.D.; Laak, H.J. ter; Engelen, B.G.M. van; Zwarts, M.J.

2004-01-01

Combinations of different techniques can increase the diagnostic yield from neurophysiological examination of muscle. In 25 patients with suspected inflammatory myopathy, we prospectively performed needle electromyography (EMG) and measured muscle-fiber conduction velocity (MFCV) in a single muscle,

Desmin myopathy with severe cardiomyopathy in a Uruguayan family due to a codon deletion in a new location within the desmin 1A rod domain.

Science.gov (United States)

Vernengo, Luis; Chourbagi, Oussama; Panuncio, Ana; Lilienbaum, Alain; Batonnet-Pichon, Sabrina; Bruston, Francine; Rodrigues-Lima, Fernando; Mesa, Rosario; Pizzarossa, Carlos; Demay, Laurence; Richard, Pascale; Vicart, Patrick; Rodriguez, Maria-Mirta

2010-03-01

Desmin myopathy is a heterogeneous neuromuscular disorder characterized by skeletal myopathy and cardiomyopathy, inherited mostly in an autosomal dominant pattern. We report a five generation Uruguayan family with severe cardiomyopathy and skeletal myopathy. Its most striking features are: atrial dilation, arrhythmia, conduction block and sudden death due to conduction impairment. Affected skeletal muscle shows alteration of mitochondria with paracrystallin inclusions and granulofilamentous material scattered in the muscle fibres. This family carries an unusual deletion p.E114del within the 1A rod domain of desmin. Transfected cells expressing the mutated desmin show punctuated and speckled cytoplasmic aggregates. The mutation causes a local conformational change in heptads a/d residues and charge positions. These findings lead to the hypothesis that coiled-coil interactions may be impaired, resulting in severe alterations in the desmin network. This is the first time that a mutation affecting this domain in the desmin molecule is described in a desminopathy. Copyright 2010. Published by Elsevier B.V.

Melanocytes from patients affected by Ullrich congenital muscular dystrophy and Bethlem myopathy have dysfunctional mitochondria that can be rescued with cyclophilin inhibitors

Directory of Open Access Journals (Sweden)

Alessandra eZulian

2014-11-01

Full Text Available Ullrich congenital muscular dystrophy and Bethlem myopathy are caused by mutations in collagen VI genes, which encode an extracellular matrix protein; yet mitochondria play a major role in disease pathogenesis through a short circuit caused by inappropriate opening of the permeability transition pore, a high conductance channel which causes a shortage in ATP production. We find that melanocytes do not produce collagen VI yet they bind it at the cell surface, suggesting that this protein may play a trophic role and that its absence may cause lesions similar to those seen in skeletal muscle. We show that mitochondria in melanocytes of Ullrich congenital muscular dystrophy and Bethlem myooathy patients display increased size, reduced matrix density and disrupted cristae, findings that suggest a functional impairment. In keeping with this hypothesis, mitochondria (i underwent anomalous depolarization after inhibition of the F-ATP synthase with oligomycin, and (ii displayed decreased respiratory reserve capacity. The non-immunosuppressive cyclophilin inhibitor NIM811 prevented mitochondrial depolarization in response to oligomycin in melanocytes from both Ullrich congenital muscular dystrophy and Bethlem myopathy patients, and partially restored the respiratory reserve of melanocytes from one Bethlem myopathy patient. These results match our recent findings on melanocytes from patients affected by Duchenne muscular dystrophy (Pellegrini et al., 2013 Melanocytes--a novel tool to study mitochondrial dysfunction in Duchenne muscular dystrophy. J Cell Physiol 228, 1323-1331, and suggest that skin biopsies may represent a minimally invasive tool to investigate mitochondrial dysfunction and to evaluate drug efficacy in collagen VI-related myopathies and possibly in other muscle wasting conditions like aging sarcopenia.

EULAR/ACR classification criteria for adult and juvenile idiopathic inflammatory myopathies and their major subgroups: a methodology report

NARCIS (Netherlands)

Bottai, Matteo; Tjärnlund, Anna; Santoni, Giola; Werth, Victoria P.; Pilkington, Clarissa; de Visser, Marianne; Alfredsson, Lars; Amato, Anthony A.; Barohn, Richard J.; Liang, Matthew H.; Singh, Jasvinder A.; Aggarwal, Rohit; Arnardottir, Snjolaug; Chinoy, Hector; Cooper, Robert G.; Danko, Katalin; Dimachkie, Mazen M.; Feldman, Brian M.; García-de la Torre, Ignacio; Gordon, Patrick; Hayashi, Taichi; Katz, James D.; Kohsaka, Hitoshi; Lachenbruch, Peter A.; Lang, Bianca A.; Li, Yuhui; Oddis, Chester V.; Olesinka, Marzena; Reed, Ann M.; Rutkowska-Sak, Lidia; Sanner, Helga; Selva-O'Callaghan, Albert; Wook Song, Yeong; Vencovsky, Jiri; Ytterberg, Steven R.; Miller, Frederick W.; Rider, Lisa G.; Lundberg, Ingrid E.; Amoruso, Maria; Andersson, Helena; Bayat, Nastaran; Bhansing, Kavish J.; Bucher, Sara; Champbell, Richard; Charles-Schoeman, Christina; Chaudhry, Vinay; Christopher-Stine, Lisa; Chung, Lorinda; Cronin, Mary; Curry, Theresa; Dahlbom, Kathe; Distler, Oliver; Efthimiou, Petros; van Engelen, Baziel G. M.; Faiq, Abdullah; Farhadi, Payam Noroozi; Fiorentino, David; Hengstman, Gerald; Hoogendijk, Jessica; Huber, Adam; Kataoka, Hiroshi; Katsumata, Yasuhiro; Kim, Susan; Kong-Rosario, Michelle; Kontzias, Apostolos; Krol, Petra; Kurita, Takashi; Li, Zhan-Guo; Lindvall, Björn; Linklater, Helen; Maillard, Sue; Mamyrova, Gulnara; Mantegazza, Renato; Marder, Galina S.; Nagahashi Marie, Suely Kazue; Mathiesen, Pernille; Mavragani, Clio P.; McHugh, Neil J.; Michaels, Mimi; Mohammed, Reem; Morgan, Gabrielle; Moser, David W.; Moutsopoulos, Haralampos M.

2017-01-01

To describe the methodology used to develop new classification criteria for adult and juvenile idiopathic inflammatory myopathies (IIMs) and their major subgroups. An international, multidisciplinary group of myositis experts produced a set of 93 potentially relevant variables to be tested for

Elevated risk of venous thromboembolic events in patients with inflammatory myopathies

Directory of Open Access Journals (Sweden)

Nowak M

2016-06-01

Full Text Available Michał Nowak, Katarzyna Królak-Nowak, Aleksandra Sobolewska-Włodarczyk, Jakub Fichna, Marcin Włodarczyk Department of Biochemistry, Faculty of Medicine, Medical University of Lodz, Lodz, Poland Abstract: Venous thromboembolism (VTE is a multifactorial disease manifesting as either deep vein thrombosis or pulmonary embolism. Its prevalence makes VTE a significant issue for both the individual – as a negative factor influencing the quality of life and prognosis – and the society due to economic burden. VTE is the third most common vascular disorder in Western countries, after myocardial infarction and stroke, making it a major cause of in-hospital mortality, responsible for 5%–10% of hospital deaths. Despite many studies conducted, only 50%–60% provoking factors have been identified, while the remaining 40%–50% have been classified as idiopathic or unprovoked. Chronic inflammatory disorders, with their underlying prothrombotic state, reveal an increased risk of VTE (six to eight times compared with the general population. Among the inflammatory disorders, we can identify inflammatory myopathies – a group of rare, chronic diseases featuring weakness and inflammation of muscles with periods of exacerbation and remission; their main classes are polymyositis and dermatomyositis. The objective of this review is to emphasize the need of VTE prophylaxis in individuals with inflammatory myopathies in order to reduce morbidity and mortality rates among those patients and improve their quality of life and prognosis. Keywords: deep vein thrombosis, pulmonary embolism, inflammation, polymyositis, dermatomyositis, prothrombotic state

Specific binding of Ulex europaeus agglutinin I lectin to sarcolemma of distal myopathy with rimmed vacuole formation.

Science.gov (United States)

Yatabe, K; Kawai, M

1997-08-01

Ulex europaeus agglutinin I (UEA I) binding was studied in 83 patients with various neuromuscular disorders. UEA I labelled endomysial capillaries and endothelial cells of perimysial blood vessels in all the examined muscles. There was no UEA I binding to muscle fibres except for all (9) cases of distal myopathy with rimmed vacuole formation (DMRV), 1 of 5 cases of inclusion body myositis and 1 of 36 cases of inflammatory myopathies. The UEA I binding was completely eliminated by preincubation of UEA I solution with L-fucose. Using electron microscopy, the UEA I binding was localized to sarcolemma and intrasarco-plasmic membranous organelles other than mitochondria. Myosatellite cells were not labelled. These findings revealed the existence of fucosylated proteins or lipids in a subset of skeletal muscles suffering from DMRV. Biochemical identification of the fucosylated substance and further detailed study on subcellular localization of UEA I binding may yield important clues to the unknown pathogenesis of DMRV.

Computed tomography and angiography in MELAS (mitochondrial myopathy, encephalopathy, lactic acidosis and stroke-like episodes)

International Nuclear Information System (INIS)

Hasuo, K.; Tamura, S.; Yasumori, K.; Uchino, A.; Masuda, K.; Goda, S.; Ishimoto, S.; Kamikaseda, K.; Wakuta, Y.; Kishi, M.

1987-01-01

Among mitochondrial encephalomyopathies, MELAS (mitochondrial myopathy, encephalopathy, lactic acidosis and stroke-like episodes, Pavlakis et al., 1983) is recognized as a distinct syndrome characterized by generalized convulsions and recurrrent stroke-like episodes. The neuroradiological findings of three patients with MELAS are reported here. Retrospective review shows that MELAS should be included in the differential diagnosis of infarct-like lesions of the cerebrum. (orig.)

Hereditary internal anal sphincter myopathy causing proctalgia fugax and constipation: further clinical and histological characterization in a patient.

Science.gov (United States)

König, P; Ambrose, N S; Scott, N

2000-01-01

Hereditary internal anal sphincter myopathy is a very rare condition, only three families have so far been described in the literature. In this case report further clinical and histological findings of one affected member of one of the above families are presented.

Clinical study on myocardial imaging with. beta. -methyl-p-( sup 123 I)-iodophenyl-pentadecanoic acid in patients with mitochondrial myopathy

Energy Technology Data Exchange (ETDEWEB)

Kihara, Koichi; Nakajo, Masayuki; Shono, Hirohisa (Kagoshima Univ. (Japan). Faculty of Medicine) (and others)

1992-04-01

Myocardial imaging with {beta}-methyl-p-({sup 123}I)-iodophenyl-pentadecanoic acid ({sup 123}I-BMIPP), a new radiopharmaceutical designed to evaluate myocardial fatty acid metabolism, was performed in 7 patients with mitochondrial myopathy to detect their myocardial damages in comparison with {sup 201}Tl myocardial imaging. These patients were divided into 4 chronic progressive external ophthalmoplegia (CPEO) cases, 2 mitochondrial myopathy, encephalopathy, lactic acidosis, and stroke-like episodes (MELAS) cases and 1 myoclonus epilepsy with ragged-red fibers (MERRF). In visual assessment, we observed more myocardial segments with decreased uptake of {sup 123}I-BMIPP compared to {sup 201}Tl in MELAS cases than in CPEO cases. The mean myocardial uptake of {sup 123}I-BMIPP was higher than that of {sup 201}Tl in CPEO cases. On the other hand, in MELAS and MERRF cases, the mean myocardial uptake of {sup 123}I-BMIPP was lower than that of {sup 201}Tl. Abnormal findings suggesting myocardial damages were observed in echocardiogram and/or in electrocardiogram in MELAS and MERRF cases, while no such abnormal findings were observed in CPEO cases. Along with the previously reported experimental result that the impairment of rat myocardial mitochondria decreased myocardial uptake of {sup 123}I-BMIPP, these results suggest that {sup 123}I-BMIPP may be useful to detect myocardial damages in patients with mitochondrial myopathy. (author)

Mutation in TWINKLE in a Large Iranian Family with Progressive External Ophthalmoplegia, Myopathy, Dysphagia and Dysphonia, and Behavior Change.

Science.gov (United States)

Tafakhori, Abbas; Yu Jin Ng, Alvin; Tohari, Sumanty; Venkatesh, Byrappa; Lee, Hane; Eskin, Ascia; Nelson, Stanley F; Bonnard, Carine; Reversade, Bruno; Kariminejad, Ariana

2016-02-01

TWINKLE (c10orf2) gene is responsible for autosomal dominant progressive external ophthalmoplegia (PEO). In rare cases, additional features such as muscle weakness, peripheral neuropathy, ataxia, cardiomyopathy, dysphagia, dysphonia, cataracts, depression, dementia, parkinsonism, and hearing loss have been reported in association with heterozygous mutations of the TWINKLE gene. We have studied a large Iranian family with myopathy, dysphonia, dysphagia, and behavior change in addition to PEO in affected members. We identified a missense mutation c.1121G > A in the c10orf2 gene in all affected members. Early death is a novel feature seen in affected members of this family that has not been reported to date. The association of PEO, myopathy, dysphonia, dysphagia, behavior change and early death has not been previously reported in the literature or other patients with this mutation.

Nutritional status evaluation in patients affected by bethlem myopathy and ullrich congenital muscular dystrophy.

Science.gov (United States)

Toni, Silvia; Morandi, Riccardo; Busacchi, Marcello; Tardini, Lucia; Merlini, Luciano; Battistini, Nino Carlo; Pellegrini, Massimo

2014-01-01

Collagen VI mutations lead to disabling myopathies like Bethlem myopathy (BM) and Ullrich congenital muscular dystrophy (UCMD). We have investigated the nutritional and metabolic status of one UCMD and seven BM patients (five female, three male, mean age 31 ± 9 years) in order to find a potential metabolic target for nutritional intervention. For this study, we used standard anthropometric tools, such as BMI evaluation and body circumference measurements. All results were compared to dual-energy X-ray absorptiometry (DXA), considered the "gold standard" method. Energy intake of each patient was evaluated through longitudinal methods (7-day food diary) while resting energy expenditure (REE) was predicted using specific equations and measured by indirect calorimetry. Clinical evaluation included general and nutritional blood and urine laboratory analyses and quantitative muscle strength measurement by hand-held dynamometry. BM and UCMD patients showed an altered body composition, characterized by low free fat mass (FFM) and high fat mass (FM), allowing us to classify them as sarcopenic, and all but one as sarcopenic-obese. Another main result was the negative correlation between REE/FFM ratio (basal energy expenditure per kilograms of fat-free mass) and the severity of the disease, as defined by the muscle megascore (correlation coefficient -0.955, P-value nutritional intervention in these patients.

Secreted Protein Acidic and Rich in Cysteine (SPARC) in Human Skeletal Muscle

DEFF Research Database (Denmark)

Jørgensen, Louise H; Petersson, Stine J; Sellathurai, Jeeva

2009-01-01

indicated a function of SPARC in skeletal muscle. We therefore found it of interest to study SPARC expression in human skeletal muscle during development and in biopsies from Duchenne and Becker muscular dystrophy and congenital muscular dystrophy, congenital myopathy, inclusion body myositis...

Flex Sensor Based Biofeedback Monitoring for Post-Stroke Fingers Myopathy Patients

Science.gov (United States)

Garda, Y. R.; Caesarendra, W.; Tjahjowidodo, T.; Turnip, A.; Wahyudati, S.; Nurhasanah, L.; Sutopo, D.

2018-04-01

Hands are one of the crucial parts of the human body in carrying out daily activities. Accidents on the hands decreasing in motor skills of the hand so that therapy is necessary to restore motor function of the hand. In addition to accidents, hand disabilities can be caused by certain diseases, e.g. stroke. Stroke is a partial destruction of the brain. It occurs if the arteries that drain blood to the brain are blocked, or if torn or leak. The purpose of this study to make biofeedback monitoring equipment for post-stroke hands myopathy patients. Biofeedback is an alternative method of treatment that involves measuring body functions measured subjects such as skin temperature, sweat activity, blood pressure, heart rate and hand paralysis due to stroke. In this study, the sensor used for biofeedback monitoring tool is flex sensor. Flex sensor is a passive resistive device that changes its resistance as the sensor is bent. Flex sensor converts the magnitude of the bend into electrical resistance, the greater the bend the greater the resistance value. The monitoring used in this biofeedback monitoring tool uses Graphical User Interface (GUI) in C# programming language. The motivation of the study is to monitor and record the progressive improvement of the hand therapy. Patients who experienced post-stroke can see the therapy progress quantitatively.

Cardiac abnormalities assessed by non-invasive techniques in patients with newly diagnosed idiopathic inflammatory myopathies

DEFF Research Database (Denmark)

Diederichsen, Louise Pyndt; Simonsen, Jane Angel; Diederichsen, Axel Cosmus Pyndt

2015-01-01

inflammatory myopathies (IIM) by means of non-invasive techniques. METHODS: Fourteen patients with IIM (8 polymyositis, 4 dermatomyositis, 2 cancer-associated dermatomyositis) and 14 gender- and age- matched healthy control subjects were investigated. Participant assessments included a cardiac questionnaire...... in 8 (57%) of the patients compared to none of the controls (pgroup (p=0.01). Two patients had systolic dysfunction, and one diastolic dysfunction...

Toxic myopathy in a dog associated with the presence of monensin in dry food.

Science.gov (United States)

Wilson, J S

1980-01-01

This report describes a case of toxic myopathy in a two year old sheltie dog with clinical signs of profound weakness, myoglobinuria, and muscle enzyme elevations. The clinical signs were likely related to the accidental inclusion of monensin sodium in the dog's food. This food was prepared by a small feed milling company that also prepares cattle and chicken rations. A change of dog food resulted in remission of the clinical signs.

Toxic Myopathy in a Dog Associated with the Presence of Monensin in Dry Food

OpenAIRE

Wilson, J. S.

1980-01-01

This report describes a case of toxic myopathy in a two year old sheltie dog with clinical signs of profound weakness, myoglobinuria, and muscle enzyme elevations. The clinical signs were likely related to the accidental inclusion of monensin sodium in the dog's food. This food was prepared by a small feed milling company that also prepares cattle and chicken rations. A change of dog food resulted in remission of the clinical signs.

A Comprehensive Overview on Myositis-Specific Antibodies: New and Old Biomarkers in Idiopathic Inflammatory Myopathy

Science.gov (United States)

Satoh, Minoru; Tanaka, Shin; Ceribelli, Angela; Calise, S. John; Chan, Edward K. L.

2018-01-01

Autoantibodies specific for idiopathic inflammatory myopathy (myositis-specific autoantibodies (MSAs)) are clinically useful biomarkers to help the diagnosis of polymyositis/dermatomyositis (PM/DM). Many of these are also associated with a unique clinical subset of PM/DM, making them useful in predicting and monitoring certain clinical manifestations. Classic MSAs known for over 30 years include antibodies to Jo-1 (histidyl transfer RNA (tRNA) synthetase) and other aminoacyl tRNA synthetases (ARS), anti-Mi-2, and anti-signal recognition particle (SRP). Anti-Jo-1 is the first autoantibodies to ARS detected in 15–25 % of patients. In addition to anti-Jo-1, antibodies to seven other aminoacyl tRNA synthetases (ARS) have been reported with prevalence, usually 1–5 % or lower. Patients with any antiARS antibodies are associated with anti-synthetase syndrome characterized by myositis, interstitial lung disease (ILD), arthritis, Raynaud’s phenomenon, and others. Several recent studies suggested heterogeneity in clinical features among different anti-ARS antibody-positive patients and anti-ARS may also be found in idiopathic ILD without myositis. Anti-Mi-2 is a classic marker for DM and associated with good response to steroid treatment and good prognosis. Anti-SRP is specific for PM and associated with treatment-resistant myopathy histologically characterized as necrotizing myopathy. In addition to classic MSAs, several new autoantibodies with strong clinical significance have been described in DM. Antibodies to transcription intermediary factor 1γ/α (TIF1γ/α, p155/140) are frequently found in DM associated with malignancy while anti-melanoma differentiation-associated gene 5 (MDA5; CADM140) are associated with clinically amyopathic DM (CADM) complicated by rapidly progressive ILD. Also, anti-MJ/nuclear matrix protein 2 (NXP-2) and anti-small ubiquitin-like modifier-1 (SUMO-1) activating enzyme (SAE) are recognized as new DM-specific autoantibodies. Addition of

Understanding mitochondrial myopathies: a review

Directory of Open Access Journals (Sweden)

Abhimanyu S. Ahuja

2018-05-01

Full Text Available Mitochondria are small, energy-producing structures vital to the energy needs of the body. Genetic mutations cause mitochondria to fail to produce the energy needed by cells and organs which can cause severe disease and death. These genetic mutations are likely to be in the mitochondrial DNA (mtDNA, or possibly in the nuclear DNA (nDNA. The goal of this review is to assess the current understanding of mitochondrial diseases. This review focuses on the pathology, causes, risk factors, symptoms, prevalence data, symptomatic treatments, and new research aimed at possible preventions and/or treatments of mitochondrial diseases. Mitochondrial myopathies are mitochondrial diseases that cause prominent muscular symptoms such as muscle weakness and usually present with a multitude of symptoms and can affect virtually all organ systems. There is no cure for these diseases as of today. Treatment is generally supportive and emphasizes symptom management. Mitochondrial diseases occur infrequently and hence research funding levels tend to be low in comparison with more common diseases. On the positive side, quite a few genetic defects responsible for mitochondrial diseases have been identified, which are in turn being used to investigate potential treatments. Speech therapy, physical therapy, and respiratory therapy have been used in mitochondrial diseases with variable results. These therapies are not curative and at best help with maintaining a patient’s current abilities to move and function.

Lactate disposal via gluconeogenesis is increased during exercise in patients with mitochondrial myopathy due to complex I deficiency

NARCIS (Netherlands)

Roef, MJ; Kalhan, SC; Reijngoud, DJ; De Meer, K; Berger, Ruud

This study evaluated lactate disposal via gluconeogenesis as well as effects of FFA availability on gluconeogenesis via pyruvate (GNG(PYR)) in patients with mitochondrial myopathy due to complex I deficiency (CID). The rates of GNG(PYR) were measured in three CID patients and six healthy controls at

Hypoglycin A Concentrations in Maple Tree Species in the Netherlands and the Occurrence of Atypical Myopathy in Horses

NARCIS (Netherlands)

Westermann, C.M.; Van Leeuwen, Robbert; Van Raamsdonk, L.W.D.; Mol, H.G.J.

BACKGROUND: Atypical myopathy (AM) in horses is caused by the plant toxin hypoglycin A, which in Europe typically is found in the sycamore maple tree (Acer pseudoplatanus). Owners are concerned about whether their horses are in danger if they graze near maple trees. HYPOTHESIS/OBJECTIVES: To measure

Hypoglycin A Concentrations in Maple Tree Species in the Netherlands and the Occurrence of Atypical Myopathy in Horses

NARCIS (Netherlands)

Westermann, C.M.; Leeuwen, van R.; Raamsdonk, van L.W.D.; Mol, H.G.J.

2016-01-01

Background: Atypical myopathy (AM) in horses is caused by the plant toxin hypoglycin A, which in Europe typically is found in the sycamore maple tree (Acer pseudoplatanus). Owners are concerned about whether their horses are in danger if they graze near maple trees. Hypothesis/Objectives: To

A novel Ile1455Thr variant in the skeletal muscle sodium channel alpha-subunit in a patient with a severe adult-onset proximal myopathy with electrical myotonia and a patient with mild paramyotonia phenotype

NARCIS (Netherlands)

Bednarz, M.; Stunnenberg, B.C.; Kusters, B.; Kamsteeg, E.J.; Saris, C.G.J.; Groome, J.; Winston, V.; Meola, G.; Jurkat-Rott, K.; Voermans, N.C.

2017-01-01

In sodium channelopathies, a severe fixed myopathy caused by a dominant mutation is rare. We describe two unrelated patients with a novel variant, p.Ile1455Thr, with phenotypes of paramyotonia in one case and fixed proximal myopathy with latent myotonia in another. In-vitro whole cell patch-clamp

Detection of hypoglycin A in the seeds of sycamore (Acer pseudoplatanus) and box elder (A. negundo) in New Zealand; the toxin associated with cases of equine atypical myopathy.

Science.gov (United States)

McKenzie, R K; Hill, F I; Habyarimana, J A; Boemer, F; Votion, D M

2016-05-01

During April and May 2014 four horses aged between 5 months and 9 years, located in the Canterbury, Marlborough and Southland regions, presented with a variety of clinical signs including recumbency, stiffness, lethargy, dehydration, depression, and myoglobinuria suggestive of acute muscle damage. Two horses were subjected to euthanasia and two recovered. In all cases seeds of sycamore maple (Acer pseudoplatanus) or box elder (A. negundo) were present in the area where the horse had been grazing. The samaras (seeds) of some Acer spp. may contain hypoglycin A, that has been associated with cases of atypical myopathy in Europe and North America. To determine if hypoglycin A is present in the samaras of Acer spp. in New Zealand, samples were collected from trees throughout the country that were associated with historical and/or current cases of atypical myopathy, and analysed for hypoglycin A. Serum samples from the four cases and four unaffected horses were analysed for the presence of hypoglycin A, profiles of acylcarnitines (the definitive diagnosis for atypical myopathy) and activities of creatine kinase and aspartate aminotransferase.Markedly elevated serum activities of creatine kinase and aspartate aminotransferase, and increased concentrations of selected acylcarnitines were found in the case horses. Hypoglycin A was detected in the serum of those horses but not in the healthy controls. Hypoglycin A was detected in 10/15 samples of samaras from sycamore maple and box elder from throughout New Zealand. Cases of atypical myopathy were diagnosed on properties where samaras containing hypoglycin A were also found. Sycamore and box elder trees in New Zealand are a source of hypoglycin A associated with the development of atypical myopathy. If pastured horses present with clinical and biochemical signs of severe muscle damage then the environment should be checked for the presence of these trees. Horses should be prevented from grazing samaras from Acer spp. in the

BAG3 myofibrillar myopathy presenting with cardiomyopathy.

Science.gov (United States)

Konersman, Chamindra G; Bordini, Brett J; Scharer, Gunter; Lawlor, Michael W; Zangwill, Steven; Southern, James F; Amos, Louella; Geddes, Gabrielle C; Kliegman, Robert; Collins, Michael P

2015-05-01

Myofibrillar myopathies (MFMs) are a heterogeneous group of neuromuscular disorders distinguished by the pathological hallmark of myofibrillar dissolution. Most patients present in adulthood, but mutations in several genes including BCL2-associated athanogene 3 (BAG3) cause predominantly childhood-onset disease. BAG3-related MFM is particularly severe, featuring weakness, cardiomyopathy, neuropathy, and early lethality. While prior cases reported either neuromuscular weakness or concurrent weakness and cardiomyopathy at onset, we describe the first case in which cardiomyopathy and cardiac transplantation (age eight) preceded neuromuscular weakness by several years (age 12). The phenotype comprised distal weakness and severe sensorimotor neuropathy. Nerve biopsy was primarily axonal with secondary demyelinating/remyelinating changes without "giant axons." Muscle biopsy showed extensive neuropathic changes that made myopathic changes difficult to interpret. Similar to previous cases, a p.Pro209Leu mutation in exon 3 of BAG3 was found. This case underlines the importance of evaluating for MFMs in patients with combined neuromuscular weakness and cardiomyopathy. Copyright © 2015 Elsevier B.V. All rights reserved.

[External progressive ophthalmoplegia secondary to mitochondrial myopathy. Report of a case and review of the literature].

Science.gov (United States)

Calderón-Garcidueñas, A L; Pérez-Loria, O; Alberto-Sagástegui, J; Farías-García, R

2000-01-01

Progressive limitation of occular motility, accompanied by ptosis but usually without diplopia, occurs in many pathologic states, including mitochondrial diseases. A case with chronic progressive external ophthalmoplegia with onset during childhood, associated with proximal myopathy and dysphasia is presented. The muscle biopsy showed a myopathic pattern and abnormal subsarcolemmal mitochondrial deposits. Muscle biopsy for important in the correct diagnosis of this entity.

Autophagy, inflammation and innate immunity in inflammatory myopathies.

Directory of Open Access Journals (Sweden)

Cristina Cappelletti

Full Text Available Autophagy has a large range of physiological functions and its dysregulation contributes to several human disorders, including autoinflammatory/autoimmune diseases such as inflammatory myopathies (IIMs. In order to better understand the pathogenetic mechanisms of these muscular disorders, we sought to define the role of autophagic processes and their relation with the innate immune system in the three main subtypes of IIM, specifically sporadic inclusion body myositis (sIBM, polymyositis (PM, dermatomyositis (DM and juvenile dermatomyositis (JDM. We found that although the mRNA transcript levels of the autophagy-related genes BECN1, ATG5 and FBXO32 were similar in IIM and controls, autophagy activation in all IIM subgroups was suggested by immunoblotting results and confirmed by immunofluorescence. TLR4 and TLR3, two potent inducers of autophagy, were highly increased in IIM, with TLR4 transcripts significantly more expressed in PM and DM than in JDM, sIBM and controls, and TLR3 transcripts highly up-regulated in all IIM subgroups compared to controls. Co-localization between autophagic marker, LC3, and TLR4 and TLR3 was observed not only in sIBM but also in PM, DM and JDM muscle tissues. Furthermore, a highly association with the autophagic processes was observed in all IIM subgroups also for some TLR4 ligands, endogenous and bacterial HSP60, other than the high-mobility group box 1 (HMGB1. These findings indicate that autophagic processes are active not only in sIBM but also in PM, DM and JDM, probably in response to an exogenous or endogenous 'danger signal'. However, autophagic activation and regulation, and also interaction with the innate immune system, differ in each type of IIM. Better understanding of these differences may lead to new therapies for the different IIM types.

Differences in Adipose Tissue and Lean Mass Distribution in Patients with Collagen VI Related Myopathies Are Associated with Disease Severity and Physical Ability.

Science.gov (United States)

Rodríguez, M A; Del Rio Barquero, Luís M; Ortez, Carlos I; Jou, Cristina; Vigo, Meritxell; Medina, Julita; Febrer, Anna; Ramon-Krauel, Marta; Diaz-Manera, Jorge; Olive, Montse; González-Mera, Laura; Nascimento, Andres; Jimenez-Mallebrera, Cecilia

2017-01-01

Mutations in human collagen VI genes cause a spectrum of musculoskeletal conditions in children and adults collectively termed collagen VI-related myopathies (COL6-RM) characterized by a varying degree of muscle weakness and joint contractures and which include Ullrich Congenital Muscular Dystrophy (UCMD) and Bethlem Myopathy (BM). Given that collagen VI is one of the most abundant extracellular matrix proteins in adipose tissue and its emerging role in energy metabolism we hypothesized that collagen VI deficiency might be associated with alterations in adipose tissue distribution and adipokines serum profile. We analyzed body composition by means of dual-energy X-ray absorptiometry in 30 pediatric and adult COL6-RM myopathy patients representing a range of severities (UCMD, intermediate-COL6-RM, and BM). We found a distinctive pattern of regional adipose tissue accumulation which was more evident in children at the most severe end of the spectrum. In particular, the accumulation of fat in the android region was a distinguishing feature of UCMD patients. In parallel, there was a decrease in lean mass compatible with a state of sarcopenia, particularly in ambulant children with an intermediate phenotype. All children and adult patients that were sarcopenic were also obese. These changes were significantly more pronounced in children with collagen VI deficiency than in children with Duchenne Muscular Dystrophy of the same ambulatory status. High molecular weight adiponectin and leptin were significantly increased in sera from children in the intermediate and BM group. Correlation analysis showed that the parameters of fat mass were negatively associated with motor function according to several validated outcome measures. In contrast, lean mass parameters correlated positively with physical performance and quality of life. Leptin and adiponectin circulating levels correlated positively with fat mass parameters and negatively with lean mass and thus may be relevant to

Differences in Adipose Tissue and Lean Mass Distribution in Patients with Collagen VI Related Myopathies Are Associated with Disease Severity and Physical Ability

Directory of Open Access Journals (Sweden)

M. A. Rodríguez

2017-08-01

Full Text Available Mutations in human collagen VI genes cause a spectrum of musculoskeletal conditions in children and adults collectively termed collagen VI-related myopathies (COL6-RM characterized by a varying degree of muscle weakness and joint contractures and which include Ullrich Congenital Muscular Dystrophy (UCMD and Bethlem Myopathy (BM. Given that collagen VI is one of the most abundant extracellular matrix proteins in adipose tissue and its emerging role in energy metabolism we hypothesized that collagen VI deficiency might be associated with alterations in adipose tissue distribution and adipokines serum profile. We analyzed body composition by means of dual-energy X-ray absorptiometry in 30 pediatric and adult COL6-RM myopathy patients representing a range of severities (UCMD, intermediate-COL6-RM, and BM. We found a distinctive pattern of regional adipose tissue accumulation which was more evident in children at the most severe end of the spectrum. In particular, the accumulation of fat in the android region was a distinguishing feature of UCMD patients. In parallel, there was a decrease in lean mass compatible with a state of sarcopenia, particularly in ambulant children with an intermediate phenotype. All children and adult patients that were sarcopenic were also obese. These changes were significantly more pronounced in children with collagen VI deficiency than in children with Duchenne Muscular Dystrophy of the same ambulatory status. High molecular weight adiponectin and leptin were significantly increased in sera from children in the intermediate and BM group. Correlation analysis showed that the parameters of fat mass were negatively associated with motor function according to several validated outcome measures. In contrast, lean mass parameters correlated positively with physical performance and quality of life. Leptin and adiponectin circulating levels correlated positively with fat mass parameters and negatively with lean mass and thus may

High prevalence of impaired glucose homeostasis and myopathy in asymptomatic and oligosymptomatic 3243A>G mitochondrial DNA mutation-positive subjects

DEFF Research Database (Denmark)

Frederiksen, A.L.; Jeppesen, T.D.; Vissing, J.

2009-01-01

controls were subjected to an oral glucose tolerance test. Twenty-six adult 3243A>G carriers with unknown myopathy status and 17 healthy controls had a maximal cycle test and a muscle biopsy performed. The mutation loads were quantified in blood and muscle biopsies and correlated to the clinical......INTRODUCTION: The point mutation of 3243A>G mtDNA is the most frequent cause of mitochondrial diabetes, often presenting as the syndrome maternally inherited diabetes and deafness (MIDD). The mutation may also cause myopathy, ataxia, strokes, ophthalmoplegia, epilepsy, and cardiomyopathy in various...... combinations. Consequently, it is difficult to predict the "phenotypic risk profile" of 3243A>G mutation-positive subjects. The 3243A>G mutation coexists in cells with wild-type mtDNA, a phenomenon called heteroplasmy. The marked variability in mutation loads in different tissues is the main explanation...

Implications of compound heterozygous insulin receptor mutations in congenital muscle fibre type disproportion myopathy for the receptor kinase activation

DEFF Research Database (Denmark)

Klein, H H; Müller, R; Vestergaard, H

1999-01-01

We studied insulin receptor kinase activation in two brothers with congenital muscle fibre type disproportion myopathy and compound heterozygous mutations of the insulin receptor gene, their parents, and their unaffected brother. In the father who has a heterozygote Arg1174-->Gln mutation, in sit...

Homozygous LIPE mutation in siblings with multiple symmetric lipomatosis, partial lipodystrophy, and myopathy.

Science.gov (United States)

Zolotov, Sagit; Xing, Chao; Mahamid, Riad; Shalata, Adel; Sheikh-Ahmad, Mohammed; Garg, Abhimanyu

2017-01-01

Despite considerable progress in identifying causal genes for lipodystrophy syndromes, the molecular basis of some peculiar adipose tissue disorders remains obscure. In an Israeli-Arab pedigree with a novel autosomal recessive, multiple symmetric lipomatosis (MSL), partial lipodystrophy and myopathy, we conducted exome sequencing of two affected siblings to identify the disease-causing mutation. The 41-year-old female proband and her 36-year-old brother reported marked accumulation of subcutaneous fat in the face, neck, axillae, and trunk but loss of subcutaneous fat from the lower extremities and progressive distal symmetric myopathy during adulthood. They had increased serum creatine kinase levels, hypertriglyceridemia and low levels of high-density lipoprotein cholesterol. Exome sequencing identified a novel homozygous NC_000019.9:g.42906092C>A variant on chromosome 19, leading to a NM_005357.3:c.3103G>T nucleotide change in coding DNA and corresponding p.(Glu1035*) protein change in hormone sensitive lipase (LIPE) gene as the disease-causing variant. Sanger sequencing further confirmed the segregation of the mutation in the family. Hormone sensitive lipase is the predominant regulator of lipolysis from adipocytes, releasing free fatty acids from stored triglycerides. The homozygous null LIPE mutation could result in marked inhibition of lipolysis from some adipose tissue depots and thus may induce an extremely rare phenotype of MSL and partial lipodystrophy in adulthood associated with complications of insulin resistance, such as diabetes, hypertriglyceridemia and hepatic steatosis. © 2016 Wiley Periodicals, Inc. © 2016 Wiley Periodicals, Inc.

Morphology of the mitochondria in heat shock protein 60 deficient fibroblasts from mitochondrial myopathy patients : Effects of stress conditions

NARCIS (Netherlands)

Huckriede, A; Heikema, A; Sjollema, K; Briones, P; Agsteribbe, E

1995-01-01

We have described two mitochondrial (mt) myopathy patients with reduced activities of various mt enzymes associated with significantly decreased amounts of heat shock protein 60 (hsp60). Experimental evidence suggested that the lack of hsp60 was the primary defect. Since hsp60 is essential for the

Diagnostic criteria for idiopathic inflammatory myopathies. Problems of their optimization

Directory of Open Access Journals (Sweden)

O. A. Antelava

2014-01-01

Full Text Available The paper deals with the problems of optimizing the diagnostic criteria for idiopathic inflammatory myopathies (IIM, a group of heterogeneous rare autoimmune diseases characterized by inflammatory lesion in the skeletal muscles. The representatives of this group are traditionally considered to be polymyositis (PM, dermatomyositis (DM, and inclusion-body myositis. The authors detail the history of classification criteria for IIM from those proposed by T.A. Medsger et al. (1970 relying on its clinical picture, laboratory data and instrumental findings, as well as the criteria (including the first introduced exclusion ones elaborated by A. Bohan and J.B. Peter in 1975, which remain fundamental in both clinical practice and researches. The basis for the clinical and serological criteria proposed by Y. Troyanov et al. (2005 for IIM is the identification of myositis-overlap syndromes. The classificational (subtype identification and therapeutic value of the criteria based on clinical and serological characteristics was supported by the Hungarian investigators A. Vancsa et al. (2010 who investigated the relationship between the clinical and therapeutic characteristics of IIM and positivity for myositis-specific and myositis-associated antibodies. The criteria developed by M.C. Dalakas (1991, 2003 are based on the specific immunopathological features of a histological pattern, which allow the differentiation of DM, PM, and inclusion-body myositis from other myopathic syndromes. The 2004 European Neuromuscular Center (ENMC criteria first identify necrotizing autoimmune myopathy and nonspecific myositis as individual subtypes. The serological classification of IIM, which is based onthe assessment of autoantibodies that play an important role in the pathogenesis of the disease, is of indubitable interest. There is an obvious need for the correct and timely diagnosis of both IIM as a whole and its subtypes in particular, which is complicated by

Severe insulin-resistant diabetes mellitus in patients with congenital muscle fiber type disproportion myopathy

DEFF Research Database (Denmark)

Vestergaard, H; Klein, H H; Hansen, T

1995-01-01

Congenital muscle fiber type disproportion myopathy (CFTDM) is a chronic, nonprogressive muscle disorder characterized by universal muscle hypotrophy and growth retardation. Histomorphometric examination of muscle shows a preponderance of smaller than normal type 1 fibers and overall fiber size....... Insulin receptor function and glycogen synthase (GS) activity and expression were examined in biopsies of vastus lateralis muscle. Despite a 45-90-fold increase in both fasting and postprandial serum insulin levels, both CFTDM patients had diabetes mellitus. Clamp studies revealed that the oldest boy had...

Case Report: Elevated CPK, an indicator of idiopathic inflammatory myopathy? [version 1; referees: 2 approved

Directory of Open Access Journals (Sweden)

Hina N. Khan

2016-02-01

Full Text Available Polymyositis is a rare disease with incidence rates at about 1 per 100,000 people annually. In this case report we will review a case of proximal muscle weakness with an elevated creatine phosphokinase that was initially misdiagnosed twice as rhabdomyolysis. Therefore, emphasizing that idiopathic inflammatory myopathy is a potential cause of myasthenia that must be considered in the differential. The case will also describe the current treatment and treatment response in polymyositis.

Validation and clinical significance of the childhood myositis assessment scale for assessment of muscle function in the juvenile idiopathic inflammatory myopathies

NARCIS (Netherlands)

Huber, AM; Feldman, BM; Rennebohm, RM; Hicks, JE; Lindsley, CB; Perez, MD; Zemel, LS; Wallace, CA; Ballinger, SH; Passo, MH; Reed, AM; Summers, RM; Katona, IM; Miller, FW; Lachenbruch, PA; Rider, LG; White, P.H.

Objective. To examine the measurement characteristics of the Childhood Myositis Assessment Scale (CMAS) in children with juvenile idiopathic inflammatory myopathy (juvenile IIM), and to obtain preliminary data on the clinical significance of CMAS scores. Methods. One hundred eight children with

Deficiency of long-chain 3-hydroxyacyl-CoA dehydrogenase: a cause of lethal myopathy and cardiomyopathy in early childhood

NARCIS (Netherlands)

Rocchiccioli, F.; Wanders, R. J.; Aubourg, P.; Vianey-Liaud, C.; IJlst, L.; Fabre, M.; Cartier, N.; Bougneres, P. F.

1990-01-01

A child presented in early childhood with episodes of coma and hypoglycemia and a rapidly evolutive myopathy and cardiomyopathy leading to death at 9 mo of age. Ketosis was decreased (blood beta-hydroxybutyrate: 0.07 mmol/L) despite normal plasma levels of fatty acids (0.81 mmol/L). The patient's

Novel duplication mutation of the DYSF gene in a Pakistani family with Miyoshi Myopathy

Directory of Open Access Journals (Sweden)

Muhammad I. Ullah

2017-12-01

Full Text Available Objectives: To identify the underlying gene mutation in a large consanguineous Pakistani family. Methods: This is an observational descriptive study carried out at the Department of Biochemistry, Shifa International Hospital, Quaid-i-Azam University, and Atta-ur-Rahman School of Applied Biosciences, National University of Sciences and Technology, Islamabad, Pakistan from 2013-2016. Genomic DNA of all recruited family members was extracted and the Trusight one sequencing panel was used to assess genes associated with a neuro-muscular phenotype. Comparative modeling of mutated and wild-type protein was carried out by PyMOL tool. Results: Clinical investigations of an affected individual showed typical features of Miyoshi myopathy (MM like elevated serum creatine kinase (CK levels, distal muscle weakness, myopathic changes in electromyography (EMG and muscle histopathology. Sequencing with the Ilumina Trusight one sequencing panel revealed a novel 22 nucleotide duplication (CTTCAACTTGTTTGACTCTCCT in the DYSF gene (NM_001130987.1_c.897-918dup; p.Gly307Leufs5X, which results in a truncating frameshift mutation and perfectly segregated with the disease in this family. Protein modeling studies suggested a disruption in spatial configuration of the putative mutant protein. Conclusion: A novel duplication of 22 bases (c.897_918dup; p.Gly307Leufs5X in the DYSF gene was identified in a family suffering from Miyoshi myopathy. Protein homology analysis proposes a disruptive impact of this mutation on protein function.

Inflammatory myopathies in childhood: correlation between nailfold capillaroscopy findings and clinical and laboratory data.

Science.gov (United States)

Nascif, Ana K S; Terreri, Maria T R A; Len, Cláudio A; Andrade, Luis E C; Hilário, Maria O E

2006-01-01

Nailfold capillaroscopy is an important tool for the diagnosis and follow-up of patients with rheumatic diseases, in particular dermatomyositis and scleroderma. A relationship has been observed in adults between improved capillaroscopic findings and reduced disease activity. Our aim was to correlate disease activity (clinical and laboratory data) and nailfold capillaroscopy findings in 18 patients with inflammatory myopathies. This prospective study included 13 juvenile dermatomyositis patients (Bohan and Peter criteria) (mean age of 8.8 years) and five patients with overlap syndrome (mean age of 15.7 years). We evaluated disease activity (skin abnormalities and muscle weakness, muscle enzymes and acute phase reactants) and its correlation with nailfold capillaroscopy findings (dilatation of isolated loops, dropout of surrounding vessels and giant capillary loops). We used a microscope with special light and magnification of 10 to 16X. Eighteen patients underwent a total of 26 capillaroscopic examinations, seven of them on two or more occasions (13 were performed during the active disease phase and 13 during remission). Twelve of the 13 examinations performed during the active phase exhibited scleroderma pattern and 8 of the 13 examinations performed during remission were normal. Therefore, in 20 of the 26 examinations clinical and laboratory data and nailfold capillaroscopy findings correlated (p = 0.01). Nailfold capillaroscopy is a non-invasive examination that offers satisfactory correlation with disease activity and could be a useful tool for the diagnosis and follow-up of inflammatory myopathies.

Hereditary internal anal sphincter myopathy causing proctalgia fugax and constipation. A newly identified condition.

Science.gov (United States)

Kamm, M A; Hoyle, C H; Burleigh, D E; Law, P J; Swash, M; Martin, J E; Nicholls, R J; Northover, J M

1991-03-01

A newly identified myopathy of the internal anal sphincter is described. In the affected family, at least one member from each of five generations had severe proctalgia fugax; onset was usually in the third to fifth decades of life. Three members of the family have been studied in detail. Each had severe pain intermittently during the day and hourly during the night. Constipation was an associated symptom, in particular difficulty with rectal evacuation. Clinically the internal anal sphincter was thickened and of decreased compliance. The maximum anal canal pressure was usually increased with marked ultraslow wave activity. Anal endosonography confirmed a grossly thickened internal anal sphincter. Two patients were treated by internal anal sphincter strip myectomy; one showed marked improvement and one was relieved of the constipation but had only slight improvement of the pain. The hypertrophied muscle in two of the patients showed unique myopathic changes, consisting of vacuolar changes with periodic acid-Schiff-positive polyglycosan bodies in the smooth muscle fibers and increased endomysial fibrosis. In vitro organ-bath studies showed insensitivity of the muscle to noradrenaline, isoprenaline, carbachol, dimethylpiperazinium, and electrical-field stimulation. Immunohistochemical studies for substance P, calcitonin gene-related peptide, galanin, neuropeptide Y, and vasoactive intestinal peptide showed staining in a similar distribution to that in control tissue. A specific autosomal-dominant inherited myopathy of the internal anal sphincter that causes anal pain and constipation has been identified and characterized.

Treatment options for mitochondrial myopathy, encephalopathy, lactic acidosis, and stroke-like episodes (MELAS) syndrome.

Science.gov (United States)

Santa, Kristin M

2010-11-01

Mitochondrial myopathy, encephalopathy, lactic acidosis, and stroke-like episodes (MELAS) syndrome is a rare neurodegenerative disease caused by the decreased ability of cells to produce sufficient energy in the form of adenosine 5'-triphosphate. Although it is one of the most common maternally inherited mitochondrial disorders, its exact incidence is unknown. Caused most frequently by an A-to-G point mutation at the 3243 position in the mitochondrial DNA, MELAS syndrome has a broad range of clinical manifestations and a highly variable course. The classic neurologic characteristics include encephalopathy, seizures, and stroke-like episodes. In addition to its neurologic manifestations, MELAS syndrome exhibits multisystem effects including cardiac conduction defects, diabetes mellitus, short stature, myopathy, and gastrointestinal disturbances. Unfortunately, no consensus guidelines outlining standard drug regimens exist for this syndrome. Many of the accepted therapies used in treating MELAS syndrome have been identified through a small number of clinical trials or isolated case reports. Currently, the drugs most often used include antioxidants and various vitamins aimed at minimizing the demands on the mitochondria and supporting and maximizing their function. Some of the most frequently prescribed agents include coenzyme Q(10), l-arginine, B vitamins, and levocarnitine. Although articles describing MELAS syndrome are available, few specifically target education for clinical pharmacists. This article will provide pharmacists with a practical resource to enhance their understanding of MELAS syndrome in order to provide safe and effective pharmaceutical care.

Gene expression profiling in equine polysaccharide storage myopathy revealed inflammation, glycogenesis inhibition, hypoxia and mitochondrial dysfunctions

Directory of Open Access Journals (Sweden)

Benech Philippe

2009-08-01

Full Text Available Abstract Background Several cases of myopathies have been observed in the horse Norman Cob breed. Muscle histology examinations revealed that some families suffer from a polysaccharide storage myopathy (PSSM. It is assumed that a gene expression signature related to PSSM should be observed at the transcriptional level because the glycogen storage disease could also be linked to other dysfunctions in gene regulation. Thus, the functional genomic approach could be conducted in order to provide new knowledge about the metabolic disorders related to PSSM. We propose exploring the PSSM muscle fiber metabolic disorders by measuring gene expression in relationship with the histological phenotype. Results Genotypying analysis of GYS1 mutation revealed 2 homozygous (AA and 5 heterozygous (GA PSSM horses. In the PSSM muscles, histological data revealed PAS positive amylase resistant abnormal polysaccharides, inflammation, necrosis, and lipomatosis and active regeneration of fibers. Ultrastructural evaluation revealed a decrease of mitochondrial number and structural disorders. Extensive accumulation of an abnormal polysaccharide displaced and partially replaced mitochondria and myofibrils. The severity of the disease was higher in the two homozygous PSSM horses. Gene expression analysis revealed 129 genes significantly modulated (p Conclusion The main disorders observed in PSSM muscles could be related to mitochondrial dysfunctions, glycogenesis inhibition and the chronic hypoxia of the PSSM muscles.

Idiopathic Inflammatory Myopathies; Association with Overlap Myositis and Syndromes: Classification, Clinical Characteristics, and Associated Autoantibodies

Directory of Open Access Journals (Sweden)

Pari Basharat

2016-07-01

Full Text Available Idiopathic inflammatory myopathies (IIM are traditionally identified as a group of disorders that target skeletal muscle due to autoimmune dysfunction. The IIM can be divided into subtypes based on certain clinical characteristics, and several classification schemes have been proposed. The predominant diagnostic criteria for IIM is the Bohan and Peter criteria, which subdivides IIM into primary polymyositis (PM, primary dermatomyositis (DM, myositis with another connective tissue disease, and myositis associated with cancer. However, this measure has been criticised for several reasons including lack of specific criteria to help distinguish between muscle biopsy findings of PM, DM, and immune-mediated necrotising myopathy, as well as the lack of identification of cases of overlap myositis (OM. Because of this issue, other classification criteria for IIM have been proposed, which include utilising myositis-associated antibodies and myositis-specific antibodies, as well as overlap features such as Raynaud’s phenomenon, polyarthritis, oesophageal abnormalities, interstitial lung disease, small bowel abnormalities such as hypomotility and malabsorption, and renal crises, amongst others. Indeed, the identification of autoantibodies associated with certain clinical phenotypes of myositis, in particular connective tissue disease-myositis overlap, has further helped divide IIM into distinct clinical subsets, which include OM and overlap syndromes (OS. This paper reviews the concepts of OM and OS as they pertain to IIM, including definitions in the literature, clinical characteristics, and overlap autoantibodies.

[Hot spot mutation screening of RYR1 gene in diagnosis of congenital myopathies].

Science.gov (United States)

Chang, Xing-zhi; Jin, Yi-wen; Wang, Jing-min; Yuan, Yun; Xiong, Hui; Wang, Shuang; Qin, Jiong

2014-10-18

To detect hot spot mutation of RYR1 gene in 15 cases of congenital myopathy with different subtypes, and to discuss the value of RYR1 gene hot spot mutation detection in the diagnosis of the disease. Clinical data were collected in all the patients, including clinical manifestations and signs, serum creatine kinase, electromyography. Fourteen of the patients accepted the muscle biopsy. Hot spot mutation in the C-terminal of RYR1 gene (extron 96-106) had been detected in all the 15 patients. All the patients presented with motor development delay, and they could walk at the age of 1 to 3.5 years,but were always easy to fall and could not run or jump. There were no progressive deteriorations. Physical examination showed different degrees of muscle weakness and hypotonia.High arched palates were noted in 3 patients. The serum levels of creatine kinase were mildly elevated in 3 cases, and normal in 12 cases. Electromyography showed "myogenic" features in 11 patients, being normal in the other 4 patients. Muscle biopsy pathologic diagnosis was the central core disease in 3 patients, the central nuclei in 2 patients, the congenital fiber type disproportion in 2 patients, the nameline myopathy in 3 patient, the multiminicore disease in 1 patient, and nonspecific minimal changes in the other 3 patients; one patient was diagnosed with central core disease according to positive family history and gene mutation. In the family case (Patient 2) of central core disease, the c.14678G>A (p.Arg4893Gln) mutation in 102 extron of RYR1 was identified in three members of the family, which had been reported to be a pathogenic mutation. The c.14596A>G(p.Lys4866Gln) mutation in 101 extron was found in one patient with central core disease(Patient 1), and the c.14719G>A(p.Gly4907Ser) mutation in 102 extron was found in another case of the central core disease(Patient 3).The same novel mutation was verified in one of the patients' (Patient 3) asymptomatic father. Congenital myopathies in

Metabolic encephalopathy and lipid storage myopathy associated with a presumptive mitochondrial fatty acid oxidation defect in a dog

Directory of Open Access Journals (Sweden)

Vanessa R Biegen

2015-11-01

Full Text Available A 1-year-old spayed female Shih Tzu presented for episodic abnormalities of posture and mentation. Neurologic examination was consistent with a bilaterally symmetric multifocal encephalopathy. The dog had a waxing-and-waning hyperlactemia and hypoglycemia. Magnetic resonance imaging revealed bilaterally symmetric cavitated lesions of the caudate nuclei with less severe abnormalities in the cerebellar nuclei. Empirical therapy was unsuccessful and the patient was euthanized. Post-mortem histopathology revealed bilaterally symmetric necrotic lesions of the caudate and cerebellar nuclei and multi-organ lipid accumulation, including a lipid storage myopathy. Malonic aciduria and ketonuria were found on urinary organic acid screen. Plasma acylcarnitine analysis suggested a fatty acid oxidation defect. Fatty acid oxidation disorders are inborn errors of metabolism documented in humans, but poorly described in dogs. Although neurologic signs have been described in humans with this group of diseases, descriptions of advanced imaging and histopathology are severely lacking. This report suggests that abnormalities of fatty acid metabolism may cause severe, bilateral gray matter necrosis and lipid accumulation in multiple organs including the skeletal muscles, liver, and kidneys. Veterinarians should be aware that fatty acid oxidation disorders, although potentially fatal, may be treatable. A timely definitive diagnosis is essential in guiding therapy.

Adherence to drug label recommendations for avoiding drug interactions causing statin-induced myopathy--a nationwide register study.

Directory of Open Access Journals (Sweden)

Jennifer Settergren

Full Text Available To investigate the extent to which clinicians avoid well-established drug-drug interactions that cause statin-induced myopathy. We hypothesised that clinicians would avoid combining erythromycin or verapamil/diltiazem respectively with atorvastatin or simvastatin. In patients with statin-fibrate combination therapy, we hypothesised that gemfibrozil was avoided to the preference of bezafibrate or fenofibrate. When combined with verapamil/diltiazem or fibrates, we hypothesized that the dispensed doses of atorvastatin/simvastatin would be decreased.Cross-sectional analysis of nationwide dispensing data. Odds ratios of interacting erythromycin, verapamil/diltiazem versus respective prevalence of comparator drugs doxycycline, amlodipine/felodipine in patients co-dispensed interacting statins simvastatin/atorvastatin versus patients unexposed (pravastatin/fluvastatin/rosuvastatin was calculated. For fibrates, OR of gemfibrozil versus fenofibrate/bezafibrate in patients co-dispensed any statin was assessed.OR of interacting erythromycin versus comparator doxycycline did not differ between patients on interacting and comparator statins either in patients dispensed high or low statin doses (adjusted OR 0.87; 95% CI 0.60-1.25 and 0.92; 95% CI 0.69-1.23. Interacting statins were less common among patients dispensed verapamil/diltiazem as compared to patients on amlodipine/felodipine (OR high dose 0.62; CI 0.56-0.68 and low dose 0.63; CI 0.58-0.68. Patients on any statin were to a lesser extent dispensed gemfibrozil compared to patients not dispensed a statin (OR high dose 0.65; CI 0.55-0.76 and low dose 0.70; CI 0.63-0.78. Mean DDD (SD for any statin was substantially higher in patients co-dispensed gemfibrozil 178 (149 compared to patients on statin monotherapy 127 (93, (p<0.001.Prescribers may to some extent avoid co-prescription of statins with calcium blockers and fibrates with an increased risk of myopathy. We found no evidence for avoiding co

A case of congenital myopathy masquerading as paroxysmal dyskinesia

Directory of Open Access Journals (Sweden)

Harsh Patel

2014-01-01

Full Text Available Gastroesophageal reflux (GER disease is a significant comorbidity of neuromuscular disorders. It may present as paroxysmal dyskinesia, an entity known as Sandifer syndrome. A 6-week-old neonate presented with very frequent paroxysms of generalized stiffening and opisthotonic posture since day 22 of life. These were initially diagnosed as seizures and he was started on multiple antiepileptics which did not show any response. After a normal video electroencephalogram (VEEG was documented, possibility of dyskinesia was kept. However, when he did not respond to symptomatic therapy, Sandifer syndrome was thought of and GER scan was done, which revealed severe GER. After his symptoms got reduced to some extent, a detailed clinical examination revealed abnormal facies with flaccid quadriparesis. Muscle biopsy confirmed the diagnosis of a specific congenital myopathy. On antireflux measures, those episodic paroxysms reduced to some extent. Partial response to therapy in GER should prompt search for an underlying secondary etiology.

Frequency and phenotype of patients carrying TPM2 and TPM3 gene mutations in a cohort of 94 patients with congenital myopathy

DEFF Research Database (Denmark)

Citirak, Gülsenay; Witting, Nanna; Duno, Morten

2014-01-01

, two related female patients and two sporadic, male patients were found to carry mutations in the tropomyosin 2 (TPM2) and tropomyosin 3 (TPM3) genes, respectively. This indicates a low (4.3%) frequency of TPM2 and TPM3 mutations as a cause of congenital myopathy. Compared to previously described...... patients carrying the same mutations as found in our study (c.503G>A, and c.502C>T in TPM3, and c.415_417delGAG in TPM2), clinical presentation and muscle morphological findings differed in our patients. Differences included variation in distribution of muscle weakness, presence of scoliosis and ptosis...... had nemaline myopathy and fiber size disproportion, while three patients had congenital fiber type disproportion (CFTD) on muscle biopsies. TPM2-related CFTD has only been described in two cases, indicating that mutations in TPM2 are rare causes of CFTD....

A novel PNPLA2 mutation causes neutral lipid storage disease with myopathy (NLSDM) presenting muscular dystrophic features with lipid storage and rimmed vacuoles.

Science.gov (United States)

Chen, J; Hong, D; Wang, Z; Yuan, Y

2010-01-01

Neutral lipid storage disease with myopathy (NLSDM) is a type of lipid storage myopathy arising due to a mutation in the PNPLA2 gene encoding an adipose triglyceride lipase responsible for the degradation of intracellular triglycerides. Herein, we report the cases of two siblings manifesting slowly progressive proximal and distal limb weakness in adulthood. One of the patients had dilated cardiomyopathy, hearing loss and short stature. Muscle specimens of the 2 patients revealed muscular dystrophic features with massive lipid droplets and numerous rimmed vacuoles in the fibers. A novel homozygous mutation IVS2+1G > A in the PNPLA2 gene was identified in the 2 cases, but not in the healthy familial individuals. The presence of massive lipid droplets with muscular dystrophic changes and rimmed vacuoles in muscle fibers might be one of the characteristic pathological changes of NLSDM.

Experimental studies on the accumulation of 99mTc-MDP in the bupivacaine hydrochloride induced myopathy

International Nuclear Information System (INIS)

Sone, Shinsuke

1989-01-01

It has recently been demonstrated that several 99m Tc-labeled phosphate compounds accumulate in skeletal muscle in patients with myopathies including Duchenne muscular dystrophy (DMD). However, the mechanism by which these compounds accumulate in skeletal muscles is unknown. In order to analyze the mechanisms of tracer-localization in skeletal muscles of myopathies, the uptake of 99m Tc-methylendiphosphonate ( 99m Tc-MDP) by muscles examined in rats treated by intramuscular injection of a local anesthetic, bupivacaine. At the same time, the histological and biochemical changes of the injured muscles were studied, and findings obtained were correlated with the procedure of 99m Tc-MDP uptake. Intramuscular injection of bupivacaine resulted in markedly increased uptake of 99m Tc-MDP in the injected muscle at 12 and 24 hours after injection. The plasma creatine phosphokinase (CK) concentration increased 2-3 folds during the period from 3 to 24 hours after bupivacaine injection. Four days following injection, the CK isozyme MB activity in muscle increased. Twenty hours after injection of bupivacaine, changes such as hypercontraction and disruptin of myofibrils, Z-band lysis, and swelling of mitochondria occurred. Four days after the injection, myoblasts and myotubes were found in the damaged areas of the muscle. These results show that the increased muscle uptake of 99m Tc-MDP reflects the early degenerative changes of skeletal muscle. (author)

Sporadic late-onset nemaline myopathy with MGUS: long-term follow-up after melphalan and SCT.

Science.gov (United States)

Voermans, Nicol C; Benveniste, Olivier; Minnema, Monique C; Lokhorst, Henk; Lammens, Martin; Meersseman, Wouter; Delforge, Michel; Kuntzer, Thierry; Novy, Jan; Pabst, Thomas; Bouhour, Françoise; Romero, Norma; Leblond, Veronique; Bergh, Peter van den; Vekemans, Marie-Christiane; van Engelen, Baziel G; Eymard, Bruno

2014-12-02

Sporadic late-onset nemaline myopathy (SLONM) is a rare, late-onset myopathy that progresses subacutely. If associated with a monoclonal gammopathy of unknown significance (MGUS), the outcome is unfavorable: the majority of these patients die within 1 to 5 years of respiratory failure. This study aims to qualitatively assess the long-term treatment effect of high-dose melphalan (HDM) followed by autologous stem cell transplantation (SCT) in a series of 8 patients with SLONM-MGUS. We performed a retrospective case series study (n = 8) on the long-term (1-8 years) treatment effect of HDM followed by autologous SCT (HDM-SCT) on survival, muscle strength, and functional capacities. Seven patients showed a lasting moderate-good clinical response, 2 of them after the second HDM-SCT. All of them had a complete, a very good partial, or a partial hematologic response. One patient showed no clinical or hematologic response and died. This case series shows the positive effect of HDM-SCT in this rare disorder. Factors that may portend an unfavorable outcome are a long disease course before the hematologic treatment and a poor hematologic response. Age at onset, level and type of M protein (κ vs λ), and severity of muscle weakness were not associated with a specific outcome. This study provides Class IV evidence that for patients with SLONM-MGUS, HDM-SCT increases the probability of survival and functional improvement. © 2014 American Academy of Neurology.

Late onset of neutral lipid storage disease due to novel PNPLA2 mutations causing total loss of lipase activity in a patient with myopathy and slight cardiac involvement.

Science.gov (United States)

Missaglia, Sara; Maggi, Lorenzo; Mora, Marina; Gibertini, Sara; Blasevich, Flavia; Agostoni, Piergiuseppe; Moro, Laura; Cassandrini, Denise; Santorelli, Filippo Maria; Gerevini, Simonetta; Tavian, Daniela

2017-05-01

Neutral lipid storage disease with myopathy (NLSDM) presents with skeletal muscle myopathy and severe dilated cardiomyopathy in nearly 40% of cases. NLSDM is caused by mutations in the PNPLA2 gene, which encodes the adipose triglyceride lipase (ATGL). Here we report clinical and genetic findings of a patient carrying two novel PNPLA2 mutations (c.696+4A>G and c.553_565delGTCCCCCTTCTCG). She presented at age 39 with right upper limb abduction weakness slowly progressing over the years with asymmetric involvement of proximal upper and lower limb muscles. Cardiological evaluation through ECG and heart echo scan was normal until the age 53, when mild left ventricular diastolic dysfunction was detected. Molecular analysis revealed that only one type of PNPLA2 transcript, with exon 5 skipping, was expressed in patient cells. Such aberrant mRNA causes the production of a shorter ATGL protein, lacking part of the catalytic domain. This is an intriguing case, displaying severe PNPLA2 mutations with clinical presentation characterized by slight cardiac impairment and full expression of severe asymmetric myopathy. Copyright © 2017 The Authors. Published by Elsevier B.V. All rights reserved.

Myopathy Associated with Acute Hypothyroidism following Radioiodine Therapy for Graves Disease in an Adolescent

Directory of Open Access Journals (Sweden)

Rivkees ScottA

2010-08-01

Full Text Available We describe acute myopathy following I-131 treatment for hyperthyroidism due to Graves Disease (GD in an adolescent. A 15 year-old diagnosed with GD required treatment with radioactive iodine (I-131 therapy. Six weeks post I-131, he developed generalized muscle cramps. The CK was 19.800 U/L, the total thyroxine was 2.3 mcg/dL (29.6 nmol/L SI and the estimated free thyroxine (EFT was 0.5 ng/dL (6.4 pmol/L SI. The ALT was 112 U/L and AST was 364 U/L (normal

Neurogenic myopathies and imaging of muscle denervation; Neurogene Myopathien und Bildgebung der Muskeldenervation

Energy Technology Data Exchange (ETDEWEB)

Wolf, M. [Universitaetsklinikum Heidelberg, Abteilung fuer Neuroradiologie, Heidelberg (Germany); Wolf, C. [Reha-Zentrum Gernsbach, Neurologie, Gernsbach (Germany); Weber, M.A. [Universitaetsklinikum Heidelberg, Abteilung fuer Diagnostische und Interventionelle Radiologie, Heidelberg (Germany)

2017-12-15

Neurogenic myopathies are primary diseases of the nervous system, which secondarily result in denervation of the target musculature. The spectrum of potential causes is manifold ranging from acute traumatic injuries and chronic compression to neurodegenerative, inflammatory, metabolic and neoplastic processes. The medical history, clinical neurological examination, and electrophysiological tests including electromyography and nerve conduction studies are crucial in diagnosing neuropathic myopathies. Electromyography is the gold standard for diagnosing muscle denervation. Additional imaging methods and magnetic resonance imaging (MRI) in particular, are capable of contributing valuable information. The MRI examination of denervated musculature shows edema, an increase in the apparent diffusion coefficient (ADC) and hyperperfusion. Chronic denervation results in fatty degeneration and atrophy of affected muscles, which are also detectable by MRI. Although the MRI findings in muscle denervation are relatively unspecific, they show a high sensitivity, comparable to electromyography. Dedicated MR neurography may often visualize the underlying lesion(s) of the innervating nerve(s). Besides high sensitivity, comparable to electromyography, MRI is capable of evaluating muscles which are inaccessible for needle electromyography. Due to its non-invasive character, MRI is ideal for follow-up examinations. The use of MRI is often a meaningful addition to the diagnostics of neurogenic myopathies. The extent and distribution pattern of muscular alterations often provide information on the localization of the causative nerve damage. A correct diagnosis or at least a narrowing down of possible differential diagnoses can often be achieved using MRI. (orig.) [German] Neurogene Myopathien sind Erkrankungen des Nervensystems, die sekundaer zur Denervierung der Zielmuskulatur fuehren. Das Spektrum potenzieller Ursachen ist vielfaeltig und umfasst akute traumatische Verletzungen

Lipid-storage myopathy and respiratory insufficiency due to ETFQO mutations in a patient with late-onset multiple acyl-CoA dehydrogenation deficiency

DEFF Research Database (Denmark)

Olsen, Rikke Katrine Jentoft; Pourfarzam, M; Morris, A A M

2004-01-01

response to treatment, she developed respiratory insufficiency at age 14 years and has required long-term overnight ventilation. Thus, MADD is one of the few conditions that can cause a myopathy with weakness of the respiratory muscles out of proportion to the limb muscles. Udgivelsesdato: 2004-null...

Acylcarnitines profile best predicts survival in horses with atypical myopathy.

Directory of Open Access Journals (Sweden)

François Boemer

Full Text Available Equine atypical myopathy (AM is caused by hypoglycin A intoxication and is characterized by a high fatality rate. Predictive estimation of survival in AM horses is necessary to prevent unnecessary suffering of animals that are unlikely to survive and to focus supportive therapy on horses with a possible favourable prognosis of survival. We hypothesized that outcome may be predicted early in the course of disease based on the assumption that the acylcarnitine profile reflects the derangement of muscle energetics. We developed a statistical model to prognosticate the risk of death of diseased animals and found that estimation of outcome may be drawn from three acylcarnitines (C2, C10:2 and C18 -carnitines with a high sensitivity and specificity. The calculation of the prognosis of survival makes it possible to distinguish the horses that will survive from those that will die despite severe signs of acute rhabdomyolysis in both groups.

Acylcarnitines profile best predicts survival in horses with atypical myopathy

Science.gov (United States)

Detilleux, Johann; Cello, Christophe; Amory, Hélène; Marcillaud-Pitel, Christel; Richard, Eric; van Galen, Gaby; van Loon, Gunther; Lefère, Laurence; Votion, Dominique-Marie

2017-01-01

Equine atypical myopathy (AM) is caused by hypoglycin A intoxication and is characterized by a high fatality rate. Predictive estimation of survival in AM horses is necessary to prevent unnecessary suffering of animals that are unlikely to survive and to focus supportive therapy on horses with a possible favourable prognosis of survival. We hypothesized that outcome may be predicted early in the course of disease based on the assumption that the acylcarnitine profile reflects the derangement of muscle energetics. We developed a statistical model to prognosticate the risk of death of diseased animals and found that estimation of outcome may be drawn from three acylcarnitines (C2, C10:2 and C18 -carnitines) with a high sensitivity and specificity. The calculation of the prognosis of survival makes it possible to distinguish the horses that will survive from those that will die despite severe signs of acute rhabdomyolysis in both groups. PMID:28846683

Are Peripheral Blood Mononuclear Cells Derived from Patients with Certain Myopathies Suitable for Personalized Drug Screening?

Directory of Open Access Journals (Sweden)

Andriy V. Shatillo

2014-12-01

Full Text Available Background: Limb girdle muscular dystrophies (LGMDs and several other disorders which share their specific phenotype are rare, predominantly hereditary conditions with no curative treatment. Differential diagnosis of these myopathies is quite challenging and expensive in many cases. Therefore, a significant proportion of patients remains undiagnosed and untreated for a long time. At the same time there is a huge amount of drugs and supplements potentially able to modify the course of some of these muscular dystrophies. That is why a simple empirical approach able to define a patient’s reaction to a specific compound seems rational. Because most common basic pathogenetic mechanisms for these quite different disorders increase the vulnerability of muscle cells (or decrease ability for reparation during mechanical stress, we propose a simple, noninvasive and inexpensive approach for individualized drug screening based on the drug’s influence on the mechanical vulnerability of peripheral blood mononuclear cells (PBMC. Methods: PBMC derived from 8 patients with Duchenne muscular dystrophy (DMD, 2 patients with LGMD2A, 1 patient with LGMD2B, 1 with MERRF syndrome, 1 with facioscapulohumeral muscular dystrophy (FSHD and 13 matched control subjects were irradiated by ultrasound in the presence of several compounds (lisinopril, vitamin D3, prednisolon, tocopherol, topiramate, glutargin, α-lipoic acid, essentiale, and physiological solution. Then viability indexes of the samples were detected by citotoxic assays based on vital dye (neutral red and resazurin metabolism. Results: In cytotoxicity tests with active transport of neutral red into PBMC derived from DMD patients, the cells showed signs of destruction at 1.06±0.52 minutes of ultrasounding compared to 1.75±0.6 minutes in control. PBMCs from patients with other myopathies have either normal or decreased resistance to ultrasound. The addition of tocopherol significantly changes the PBMC

Experimental studies on the accumulation of /sup 99m/Tc-MDP in the bupivacaine hydrochloride induced myopathy

Energy Technology Data Exchange (ETDEWEB)

Sone, Shinsuke

1989-02-01

It has recently been demonstrated that several /sup 99m/Tc-labeled phosphate compounds accumulate in skeletal muscle in patients with myopathies including Duchenne muscular dystrophy (DMD). However, the mechanism by which these compounds accumulate in skeletal muscles is unknown. In order to analyze the mechanisms of tracer-localization in skeletal muscles of myopathies, the uptake of /sup 99m/Tc-methylendiphosphonate (/sup 99m/Tc-MDP) by muscles examined in rats treated by intramuscular injection of a local anesthetic, bupivacaine. At the same time, the histological and biochemical changes of the injured muscles were studied, and findings obtained were correlated with the procedure of /sup 99m/Tc-MDP uptake. Intramuscular injection of bupivacaine resulted in markedly increased uptake of /sup 99m/Tc-MDP in the injected muscle at 12 and 24 hours after injection. The plasma creatine phosphokinase (CK) concentration increased 2-3 folds during the period from 3 to 24 hours after bupivacaine injection. Four days following injection, the CK isozyme MB activity in muscle increased. Twenty hours after injection of bupivacaine, changes such as hypercontraction and disruptin of myofibrils, Z-band lysis, and swelling of mitochondria occurred. Four days after the injection, myoblasts and myotubes were found in the damaged areas of the muscle. These results show that the increased muscle uptake of /sup 99m/Tc-MDP reflects the early degenerative changes of skeletal muscle.

Role of Myofibrillar Protein Catabolism in Development of Glucocorticoid Myopathy: Aging and Functional Activity Aspects

Directory of Open Access Journals (Sweden)

Teet Seene

2016-05-01

Full Text Available Muscle weakness in corticosteroid myopathy is mainly the result of the destruction and atrophy of the myofibrillar compartment of fast-twitch muscle fibers. Decrease of titin and myosin, and the ratio of nebulin and MyHC in myopathic muscle, shows that these changes of contractile and elastic proteins are the result of increased catabolism of the abovementioned proteins in skeletal muscle. Slow regeneration of skeletal muscle is in good correlation with a decreased number of satellite cells under the basal lamina of muscle fibers. Aging causes a reduction of AMP-activated protein kinase (AMPK activity as the result of the reduced function of the mitochondrial compartment. AMPK activity increases as a result of increased functional activity. Resistance exercise causes anabolic and anticatabolic effects in skeletal muscle: muscle fibers experience hypertrophy while higher myofibrillar proteins turn over. These changes are leading to the qualitative remodeling of muscle fibers. As a result of these changes, possible maximal muscle strength is increasing. Endurance exercise improves capillary blood supply, increases mitochondrial biogenesis and muscle oxidative capacity, and causes a faster turnover rate of sarcoplasmic proteins as well as qualitative remodeling of type I and IIA muscle fibers. The combination of resistance and endurance exercise may be the fastest way to prevent or decelerate muscle atrophy due to the anabolic and anticatabolic effects of exercise combined with an increase in oxidative capacity. The aim of the present short review is to assess the role of myofibrillar protein catabolism in the development of glucocorticoid-caused myopathy from aging and physical activity aspects.

Human skeletal muscle drug transporters determine local exposure and toxicity of statins.

Science.gov (United States)

Knauer, Michael J; Urquhart, Bradley L; Meyer zu Schwabedissen, Henriette E; Schwarz, Ute I; Lemke, Christopher J; Leake, Brenda F; Kim, Richard B; Tirona, Rommel G

2010-02-05

The 3-hydroxy-3-methylglutaryl coenzyme A reductase inhibitors, or statins, are important drugs used in the treatment and prevention of cardiovascular disease. Although statins are well tolerated, many patients develop myopathy manifesting as muscle aches and pain. Rhabdomyolysis is a rare but severe toxicity of statins. Interindividual differences in the activities of hepatic membrane drug transporters and metabolic enzymes are known to influence statin plasma pharmacokinetics and risk for myopathy. Interestingly, little is known regarding the molecular determinants of statin distribution into skeletal muscle and its relevance to toxicity. We sought to identify statin transporters in human skeletal muscle and determine their impact on statin toxicity in vitro. We demonstrate that the uptake transporter OATP2B1 (human organic anion transporting polypeptide 2B1) and the efflux transporters, multidrug resistance-associated protein (MRP)1, MRP4, and MRP5 are expressed on the sarcolemmal membrane of human skeletal muscle fibers and that atorvastatin and rosuvastatin are substrates of these transporters when assessed using a heterologous expression system. In an in vitro model of differentiated, primary human skeletal muscle myoblast cells, we demonstrate basal membrane expression and drug efflux activity of MRP1, which contributes to reducing intracellular statin accumulation. Furthermore, we show that expression of human OATP2B1 in human skeletal muscle myoblast cells by adenoviral vectors increases intracellular accumulation and toxicity of statins and such effects were abrogated when cells overexpressed MRP1. These results identify key membrane transporters as modulators of skeletal muscle statin exposure and toxicity.

Proximal myopathy in lacto-vegetarian Asian patients responding to Vitamin D and calcium supplement therapy - two case reports and review of the literature

LENUS (Irish Health Repository)

Thabit, Hood

2011-05-13

Abstract Introduction Severe proximal myopathy can occasionally be the first presenting complaint of patients with osteomalacia. This may lead to investigations and misdiagnosis of a neuromuscular disease, rather than a metabolic bone disease. Case presentations We present here two cases of severe proximal myopathy in patients who were both of South Asian origin and lacto-vegetarians: a 31-year-old Indian man and a 34-year-old Indian woman. In both cases, their clinical symptoms fully resolved following vitamin D and calcium replacement therapy. These patients were at risk of osteomalacia due to their dietary intake and ethnicity. The role of dietary intake and sunlight exposure in the development of osteomalacia in certain ethnic groups living in Western Europe is reviewed here. Conclusion These two cases emphasize the importance of recognizing osteomalacia in at-risk individuals, as the condition is reversible and easily treated with vitamin D and calcium supplementation. It may also help avoid prolonged and unnecessary investigations of these patients.

Proximal myopathy in lacto-vegetarian Asian patients responding to Vitamin D and calcium supplement therapy - two case reports and review of the literature

Directory of Open Access Journals (Sweden)

Sreenan Seamus

2011-05-01

Full Text Available Abstract Introduction Severe proximal myopathy can occasionally be the first presenting complaint of patients with osteomalacia. This may lead to investigations and misdiagnosis of a neuromuscular disease, rather than a metabolic bone disease. Case presentations We present here two cases of severe proximal myopathy in patients who were both of South Asian origin and lacto-vegetarians: a 31-year-old Indian man and a 34-year-old Indian woman. In both cases, their clinical symptoms fully resolved following vitamin D and calcium replacement therapy. These patients were at risk of osteomalacia due to their dietary intake and ethnicity. The role of dietary intake and sunlight exposure in the development of osteomalacia in certain ethnic groups living in Western Europe is reviewed here. Conclusion These two cases emphasize the importance of recognizing osteomalacia in at-risk individuals, as the condition is reversible and easily treated with vitamin D and calcium supplementation. It may also help avoid prolonged and unnecessary investigations of these patients.

Proximal myopathy in lacto-vegetarian Asian patients responding to Vitamin D and calcium supplement therapy - two case reports and review of the literature.

LENUS (Irish Health Repository)

Thabit, Hood

2012-02-01

INTRODUCTION: Severe proximal myopathy can occasionally be the first presenting complaint of patients with osteomalacia. This may lead to investigations and misdiagnosis of a neuromuscular disease, rather than a metabolic bone disease. CASE PRESENTATIONS: We present here two cases of severe proximal myopathy in patients who were both of South Asian origin and lacto-vegetarians: a 31-year-old Indian man and a 34-year-old Indian woman. In both cases, their clinical symptoms fully resolved following vitamin D and calcium replacement therapy. These patients were at risk of osteomalacia due to their dietary intake and ethnicity. The role of dietary intake and sunlight exposure in the development of osteomalacia in certain ethnic groups living in Western Europe is reviewed here. CONCLUSION: These two cases emphasize the importance of recognizing osteomalacia in at-risk individuals, as the condition is reversible and easily treated with vitamin D and calcium supplementation. It may also help avoid prolonged and unnecessary investigations of these patients.

Myosin Binding Protein-C Slow Phosphorylation is Altered in Duchenne Dystrophy and Arthrogryposis Myopathy in Fast-Twitch Skeletal Muscles.

Science.gov (United States)

Ackermann, Maegen A; Ward, Christopher W; Gurnett, Christina; Kontrogianni-Konstantopoulos, Aikaterini

2015-08-19

Myosin Binding Protein-C slow (sMyBP-C), encoded by MYBPC1, comprises a family of regulatory proteins of skeletal muscles that are phosphorylated by PKA and PKC. MYBPC1 missense mutations are linked to the development of Distal Arthrogryposis-1 (DA-1). Although structure-function details for this myopathy are evolving, function is undoubtedly driven by sequence variations and post-translational modifications in sMyBP-C. Herein, we examined the phosphorylation profile of sMyBP-C in mouse and human fast-twitch skeletal muscles. We used Flexor Digitorum Brevis (FDB) isolated from young (~2-months old) and old (~14-months old) wild type and mdx mice, and human Abductor Hallucis (AH) and gastrocnemious muscles carrying the DA-1 mutations. Our results indicate both constitutive and differential phosphorylation of sMyBP-C in aged and diseased muscles. We report a 7-35% reduction in the phosphorylation levels of select sites in old wild type and young or old mdx FDB mouse muscles, compared to young wild type tissue. Similarly, we observe a 30-70% decrease in the phosphorylation levels of all PKA and PKC phospho-sites in the DA-1 AH, but not gastrocnemius, muscle. Overall, our studies show that the phosphorylation pattern of sMyBP-C is differentially regulated in response to age and disease, suggesting that phosphorylation plays important roles in these processes.

APPLIED ASPECTS OF SLCO1B1 PHARMACOGENETIC TESTING FOR PREDICTING OF STATIN-INDUCED MYOPATHY AND PERSONALIZATION OF STATINS THERAPY

Directory of Open Access Journals (Sweden)

D. A. Sychev

2015-09-01

Full Text Available The clinical significance of the SLCO1B1 gene polymorphism (encoding an organic anion transport polipeptide in the development of statin induced myopathy is considered. Possible tactics of statin dose determination on the basis of pharmacogenetic testing is discussed. Indications for the use of this approach in clinical practice that should increase the efficacy and safety of the statin therapy are also considered.

Masseter muscle myofibrillar protein synthesis and degradation in an experimental critical illness myopathy model.

Directory of Open Access Journals (Sweden)

Hazem Akkad

Full Text Available Critical illness myopathy (CIM is a debilitating common consequence of modern intensive care, characterized by severe muscle wasting, weakness and a decreased myosin/actin (M/A ratio. Limb/trunk muscles are primarily affected by this myopathy while cranial nerve innervated muscles are spared or less affected, but the mechanisms underlying these muscle-specific differences remain unknown. In this time-resolved study, the cranial nerve innervated masseter muscle was studied in a unique experimental rat intensive care unit (ICU model, where animals were exposed to sedation, neuromuscular blockade (NMB, mechanical ventilation, and immobilization for durations varying between 6 h and 14d. Gel electrophoresis, immunoblotting, RT-PCR and morphological staining techniques were used to analyze M/A ratios, myofiber size, synthesis and degradation of myofibrillar proteins, and levels of heat shock proteins (HSPs. Results obtained in the masseter muscle were compared with previous observations in experimental and clinical studies of limb muscles. Significant muscle-specific differences were observed, i.e., in the masseter, the decline in M/A ratio and muscle fiber size was small and delayed. Furthermore, transcriptional regulation of myosin and actin synthesis was maintained, and Akt phosphorylation was only briefly reduced. In studied degradation pathways, only mRNA, but not protein levels of MuRF1, atrogin-1 and the autophagy marker LC3b were activated by the ICU condition. The matrix metalloproteinase MMP-2 was inhibited and protective HSPs were up-regulated early. These results confirm that the cranial nerve innervated masticatory muscles is less affected by the ICU-stress response than limb muscles, in accordance with clinical observation in ICU patients with CIM, supporting the model' credibility as a valid CIM model.

Mutations in the collagen XII gene define a new form of extracellular matrix-related myopathy.

Science.gov (United States)

Hicks, Debbie; Farsani, Golara Torabi; Laval, Steven; Collins, James; Sarkozy, Anna; Martoni, Elena; Shah, Ashoke; Zou, Yaqun; Koch, Manuel; Bönnemann, Carsten G; Roberts, Mark; Lochmüller, Hanns; Bushby, Kate; Straub, Volker

2014-05-01

Bethlem myopathy (BM) [MIM 158810] is a slowly progressive muscle disease characterized by contractures and proximal weakness, which can be caused by mutations in one of the collagen VI genes (COL6A1, COL6A2 and COL6A3). However, there may be additional causal genes to identify as in ∼50% of BM cases no mutations in the COL6 genes are identified. In a cohort of -24 patients with a BM-like phenotype, we first sequenced 12 candidate genes based on their function, including genes for known binding partners of collagen VI, and those enzymes involved in its correct post-translational modification, assembly and secretion. Proceeding to whole-exome sequencing (WES), we identified mutations in the COL12A1 gene, a member of the FACIT collagens (fibril-associated collagens with interrupted triple helices) in five individuals from two families. Both families showed dominant inheritance with a clinical phenotype resembling classical BM. Family 1 had a single-base substitution that led to the replacement of one glycine residue in the triple-helical domain, breaking the Gly-X-Y repeating pattern, and Family 2 had a missense mutation, which created a mutant protein with an unpaired cysteine residue. Abnormality at the protein level was confirmed in both families by the intracellular retention of collagen XII in patient dermal fibroblasts. The mutation in Family 2 leads to the up-regulation of genes associated with the unfolded protein response (UPR) pathway and swollen, dysmorphic rough-ER. We conclude that the spectrum of causative genes in extracellular matrix (ECM)-related myopathies be extended to include COL12A1.

Myopathy in CRPS-I: disuse or neurogenic?

Science.gov (United States)

Hulsman, Natalie M; Geertzen, Jan H B; Dijkstra, Pieter U; van den Dungen, Jan J A M; den Dunnen, Wilfred F A

2009-08-01

The diagnosis Complex Regional Pain Syndrome type I (CRPS-I) is based on clinical symptoms, including motor symptoms. Histological changes in muscle tissue may be present in the chronic phase of CRPS-I. Aim of this study was to analyze skeletal muscle tissue from amputated limbs of patients with CRPS-I, in order to gain more insight in factors that may play a role in changes in muscles in CRPS-I. These changes may be helpful in clarifying the pathophysiology of CRPS-I. Fourteen patients with therapy resistant and longstanding CRPS-I, underwent an amputation of the affected limb. In all patients histological analysis showed extensive changes in muscle tissue, such as fatty degeneration, fibre atrophy and nuclear clumping, which was not related to duration of CRPS-I prior to amputation. In all muscles affected, both type 1 and type 2 fibre atrophy was found, without selective type 2 fibre atrophy. In four patients, type grouping was observed, indicating a sequence of denervation and reinnervation of muscle tissue. In two patients even large group atrophy was present, suggesting new denervation after reinnervation. Comparison between subgroups in arms and legs showed no difference in the number of changes in muscle tissue. Intrinsic and extrinsic muscles were affected equally. Our findings show that in the chronic phase of CRPS-I extensive changes can be seen in muscle tissue, not related to duration of CRPS-I symptoms. Signs of neurogenic myopathy were present in five patients.

Insulin Resistance and Increased Muscle Cytokine Levels in Patients With Mitochondrial Myopathy

DEFF Research Database (Denmark)

Rue, Nana; Vissing, John; Galbo, Henrik

2014-01-01

CONTEXT: Mitochondrial dysfunction has been proposed to cause insulin resistance and that might stimulate cytokine production. OBJECTIVE: The objective of the study was to elucidate the association between mitochondrial myopathy, insulin sensitivity, and cytokine levels in muscle. DESIGN......: The intervention included a 120-minute hyperinsulinemic, euglycemic clamp. Another morning, microdialysis of both vastus lateralis muscles for 4 hours, including one-legged, knee extension exercise for 30 minutes, was performed. MAIN OUTCOME MEASURES: Glucose infusion rate during 90-120 minutes of insulin infusion...... was measured. Cytokine concentrations in dialysate were also measured. RESULTS: Muscle strength, percentage fat mass, and creatine kinase in plasma did not differ between groups. The maximal oxygen uptake was 21 ± 3 (SE) (P) and 36 ± 3(C) mL/kg·min (2P insulin, C-peptide, and glucagon were higher...

Clinical pathological and genetic analysis of 2 cases of mitochondrial myopathy presented as acute motor axonal neuropathy

Directory of Open Access Journals (Sweden)

Hou-min YIN

2014-06-01

Full Text Available Background The main clinical manifestations of mitochondrial myopathy are chronic limb weakness and muscular soreness. Subclinical peripheral nerve injury is also reported, but acute axonal neuropathy.like syndrome concurrent with lactic acidosis is rare. In this paper the clinical features of 2 patients presenting as acute lactic acidosis and sudden muscle weakness were analyzed. Pathological changes and genetic mutations were detected.  Methods Electromyography (EMG and muscle biopsy were performed. Modified Gomori trichrome (MGT and succinodehydrogenase (SDH staining were used to identify pathological changes. Changes of ultra microstructure of muscular tissue were observed under electron microscope. Mitochondrial DNA (mtDNA full length sequencing was performed using 24 pairs of partially overlapping primers.  Results EMG showed a coexistence of neurogenic and myogenic changes. Dramatic decrease of motor nerve amplitude and moderately reduced sensory nerve amplitude were observed but nerve conduction velocity was normal in both patients. Impressive ragged red fibers were seen on MGT staining. Electron microscope showed dramatic mitochondrial abnormalities in Case 1 and paracrystaline inclusions in Case 2. mtDNA sequencing showed 3243A > G mutation in Case 1 and 8344A > G mutation in Case 2. Conclusions Mitochondrial myopathy can present as metabolic crisis like acute lactic acidosis, dyspnea and acute motor axonal neuropathy.like syndrome. It is a life.threatening phenotype that needs more attention. doi: 10.3969/j.issn.1672-6731.2014.06.007

Hypoglycin A concentrations in seeds of Acer pseudoplatanus trees growing on atypical myopathy-affected and control pastures.

Science.gov (United States)

Unger, L; Nicholson, A; Jewitt, E M; Gerber, V; Hegeman, A; Sweetman, L; Valberg, S

2014-01-01

Hypoglycin A, found in seeds of Acer negundo, appears to cause seasonal pasture myopathy (SPM) in North America and is implicated in atypical myopathy (AM) in Europe. Acer negundo is uncommon in Europe. Thus, the potential source of hypoglycin A in Europe is unknown. We hypothesized that seeds of Acer pseudoplatanus were the source of hypoglycin A in Europe. Our objective was to determine the concentration of hypoglycin A in seeds of A. pseudoplatanus trees located in pastures where previous cases of AM had occurred. None. University of Berne records were searched to retrospectively identify 6 farms with 10 AM cases and 11 suspected AM deaths between 2007 and 2011. During October 2012, A. pseudoplatanus seeds were collected from 2 to 6 trees per pasture on 6 AM farms (7 pastures) from trees in or close to 2 pastures on 2 control farms where AM had not been previously reported. Hypoglycin A in seeds was analyzed by GC-MS. Acer pseudoplatanus trees were identified on all AM pastures. Hypoglycin A was detected in all A. pseudoplatanus seeds in highly variable concentrations ranging from 0.04 to 2.81 μg/mg (mean 0.69) on AM farms and 0.10 to 9.12 μg/mg (mean 1.59) on control farms. Preventing horses from grazing pastures containing A. pseudoplatanus seeds during late fall and early spring might be the best means to prevent AM. Copyright © 2014 by the American College of Veterinary Internal Medicine.

Role of TGF-β signaling in inherited and acquired myopathies

Directory of Open Access Journals (Sweden)

Burks Tyesha N

2011-05-01

Full Text Available Abstract The transforming growth factor-beta (TGF-β superfamily consists of a variety of cytokines expressed in many different cell types including skeletal muscle. Members of this superfamily that are of particular importance in skeletal muscle are TGF-β1, mitogen-activated protein kinases (MAPKs, and myostatin. These signaling molecules play important roles in skeletal muscle homeostasis and in a variety of inherited and acquired neuromuscular disorders. Expression of these molecules is linked to normal processes in skeletal muscle such as growth, differentiation, regeneration, and stress response. However, chronic elevation of TGF-β1, MAPKs, and myostatin is linked to various features of muscle pathology, including impaired regeneration and atrophy. In this review, we focus on the aberrant signaling of TGF-β in various disorders such as Marfan syndrome, muscular dystrophies, sarcopenia, and critical illness myopathy. We also discuss how the inhibition of several members of the TGF-β signaling pathway has been implicated in ameliorating disease phenotypes, opening up novel therapeutic avenues for a large group of neuromuscular disorders.

Quantitative nailfold video capillaroscopy in patients with idiopathic inflammatory myopathy.

Science.gov (United States)

Mercer, Louise K; Moore, Tonia L; Chinoy, Hector; Murray, Andrea K; Vail, Andy; Cooper, Robert G; Herrick, Ariane L

2010-09-01

To quantify nailfold capillary density and dimensions in patients with idiopathic inflammatory myopathy (IIM) and compare them with those in healthy controls; to look for associations with microvascular disease in IIM; and to determine whether nailfold capillary density and dimensions change over time. Nailfold video microscopy (x300 magnification) was performed on 24 patients with IIM and 35 healthy controls. Capillary density and dimensions (total width and apical width) were quantified. Patients were clinically assessed and disease activity recorded using the Myositis Disease Activity Assessment Tool. Disease severity and physical function were assessed using the myositis damage index and Stanford HAQ, respectively. Findings were analysed using linear and logistic regression, adjusted for age and sex. In a subgroup of 16 patients with IIM and 27 controls, the process was repeated 6-12 months later and the results were analysed using Student's t-test. Capillary density was lower and dimensions were higher in patients with IIM compared with healthy controls (P nailfold capillaroscopy, suggesting that nailfold capillaroscopy may be useful as an outcome measure of microvascular disease in studies of IIM.

Mitochondrial dysfunction in human skeletal muscle biopsies of lipid storage disorder.

Science.gov (United States)

Debashree, Bandopadhyay; Kumar, Manish; Keshava Prasad, Thottethodi Subrahmanya; Natarajan, Archana; Christopher, Rita; Nalini, Atchayaram; Bindu, Parayil Sankaran; Gayathri, Narayanappa; Srinivas Bharath, Muchukunte Mukunda

2018-02-09

Mitochondria regulate the balance between lipid metabolism and storage in the skeletal muscle. Altered lipid transport, metabolism and storage influence the bioenergetics, redox status and insulin signalling, contributing to cardiac and neurological diseases. Lipid storage disorders (LSDs) are neurological disorders which entail intramuscular lipid accumulation and impaired mitochondrial bioenergetics in the skeletal muscle causing progressive myopathy with muscle weakness. However, the mitochondrial changes including molecular events associated with impaired lipid storage have not been completely understood in the human skeletal muscle. We carried out morphological and biochemical analysis of mitochondrial function in muscle biopsies of human subjects with LSDs (n = 7), compared to controls (n = 10). Routine histology, enzyme histochemistry and ultrastructural analysis indicated altered muscle cell morphology and mitochondrial structure. Protein profiling of the muscle mitochondria from LSD samples (n = 5) (vs. control, n = 5) by high-throughput mass spectrometric analysis revealed that impaired metabolic processes could contribute to mitochondrial dysfunction and ensuing myopathy in LSDs. We propose that impaired fatty acid and respiratory metabolism along with increased membrane permeability, elevated lipolysis and altered cristae entail mitochondrial dysfunction in LSDs. Some of these mechanisms were unique to LSD apart from others that were common to dystrophic and inflammatory muscle pathologies. Many differentially regulated mitochondrial proteins in LSD are linked with other human diseases, indicating that mitochondrial protection via targeted drugs could be a treatment modality in LSD and related metabolic diseases. © 2018 International Society for Neurochemistry.

Nemaline myopathy and heart failure: role of ivabradine; a case report.

Science.gov (United States)

Sarullo, Filippo M; Vitale, Giuseppe; Di Franco, Antonino; Sarullo, Silvia; Salerno, Ylenia; Vassallo, Laura; Baviera, Emanuela Petrona; Marazia, Stefania; Mandalà, Giorgio; Lanza, Gaetano A

2015-01-19

Nemaline myopathy (NM) is a rare congenital myopathy characterized by muscle weakness, hypotonia and the presence in muscle fibers of inclusions known as nemaline bodies and a wide spectrum of clinical phenotypes, ranging from severe forms with neonatal onset to asymptomatic forms. The adult-onset form is heterogeneous in terms of clinical presentation and disease progression. Cardiac involvement occurs in the minority of cases and little is known about medical management in this subgroup of NM patients. We report a rare case of heart failure (HF) in a patient with adult-onset NM in whom ivabradine proved to be able to dramatically improve the clinical picture. We report a case of a 37-year-old man with adult-onset NM, presenting with weakness and hypotonia of the proximal limb muscles and shoulder girdle, severely limiting daily activities. He developed progressive HF over a period of 6 months while attending a rehabilitation program, with reduced left ventricular ejection fraction (LVEF = 20%), manifested by dyspnea and signs of systemic congestion. The patient was started HF therapy with enalapril, carvedilol, spironolactone and loop diuretics. Target HF doses of these drugs (including carvedilol) were not reached because of symptomatic hypotension causing a high resting heart rate (HR) ≥70 beats per minute (bpm). Further deterioration of the clinical picture occurred with several life-threatening arrhythmic episodes requiring external defibrillation. An implantable cardioverter defibrillator (ICD) was then implanted. Persistent high resting HR was successfully treated with ivabradine with HR lowering from 90 bpm to 55 bpm at 1 month follow up, LVEF rising to 50% at 3 month follow up and to 54% at 2,5 year follow up. To date no more hospitalizations for heart failure occurred. A single hospitalization due to aspiration pneumonia required insertion of a tracheostomy tube to protect airways from further aspiration. At present, the patient is attending

Exertional myopathy in a grizzly bear (Ursus arctos) captured by leghold snare.

Science.gov (United States)

Cattet, Marc; Stenhouse, Gordon; Bollinger, Trent

2008-10-01

We diagnosed exertional myopathy (EM) in a grizzly bear (Ursus arctos) that died approximately 10 days after capture by leghold snare in west-central Alberta, Canada, in June 2003. The diagnosis was based on history, post-capture movement data, gross necropsy, histopathology, and serum enzyme levels. We were unable to determine whether EM was the primary cause of death because autolysis precluded accurate evaluation of all tissues. Nevertheless, comparison of serum aspartate aminotransferase and creatine kinase concentrations and survival between the affected bear and other grizzly bears captured by leghold snare in the same research project suggests EM also occurred in other bears, but that it is not generally a cause of mortality. We propose, however, occurrence of nonfatal EM in grizzly bears after capture by leghold snare has potential implications for use of this capture method, including negative effects on wildlife welfare and research data.

Rimmed vacuoles in Becker muscular dystrophy have similar features with inclusion myopathies.

Science.gov (United States)

Momma, Kazunari; Noguchi, Satoru; Malicdan, May Christine V; Hayashi, Yukiko K; Minami, Narihiro; Kamakura, Keiko; Nonaka, Ikuya; Nishino, Ichizo

2012-01-01

Rimmed vacuoles in myofibers are thought to be due to the accumulation of autophagic vacuoles, and can be characteristic in certain myopathies with protein inclusions in myofibers. In this study, we performed a detailed clinical, molecular, and pathological characterization of Becker muscular dystrophy patients who have rimmed vacuoles in muscles. Among 65 Becker muscular dystrophy patients, we identified 12 patients who have rimmed vacuoles and 11 patients who have deletions in exons 45-48 in DMD gene. All patients having rimmed vacuoles showed milder clinical features compared to those without rimmed vacuoles. Interestingly, the rimmed vacuoles in Becker muscular dystrophy muscles seem to represent autophagic vacuoles and are also associated with polyubiquitinated protein aggregates. These findings support the notion that rimmed vacuoles can appear in Becker muscular dystrophy, and may be related to the chronic changes in muscle pathology induced by certain mutations in the DMD gene.

Rimmed vacuoles in Becker muscular dystrophy have similar features with inclusion myopathies.

Directory of Open Access Journals (Sweden)

Kazunari Momma

Full Text Available Rimmed vacuoles in myofibers are thought to be due to the accumulation of autophagic vacuoles, and can be characteristic in certain myopathies with protein inclusions in myofibers. In this study, we performed a detailed clinical, molecular, and pathological characterization of Becker muscular dystrophy patients who have rimmed vacuoles in muscles. Among 65 Becker muscular dystrophy patients, we identified 12 patients who have rimmed vacuoles and 11 patients who have deletions in exons 45-48 in DMD gene. All patients having rimmed vacuoles showed milder clinical features compared to those without rimmed vacuoles. Interestingly, the rimmed vacuoles in Becker muscular dystrophy muscles seem to represent autophagic vacuoles and are also associated with polyubiquitinated protein aggregates. These findings support the notion that rimmed vacuoles can appear in Becker muscular dystrophy, and may be related to the chronic changes in muscle pathology induced by certain mutations in the DMD gene.

Anti-HMGCR antibodies as a biomarker for immune-mediated necrotizing myopathies: A history of statins and experience from a large international multi-center study.

Science.gov (United States)

Musset, Lucile; Allenbach, Yves; Benveniste, Olivier; Boyer, Olivier; Bossuyt, Xavier; Bentow, Chelsea; Phillips, Joe; Mammen, Andrew; Van Damme, Philip; Westhovens, René; Ghirardello, Anna; Doria, Andrea; Choi, May Y; Fritzler, Marvin J; Schmeling, Heinrike; Muro, Yoshinao; García-De La Torre, Ignacio; Ortiz-Villalvazo, Miguel A; Bizzaro, Nicola; Infantino, Maria; Imbastaro, Tiziana; Peng, Qinglin; Wang, Guochun; Vencovský, Jiří; Klein, Martin; Krystufkova, Olga; Franceschini, Franco; Fredi, Micaela; Hue, Sophie; Belmondo, Thibaut; Danko, Katalin; Mahler, Michael

2016-10-01

In an effort to find naturally occurring substances that reduce cholesterol by inhibiting 3-hydroxy-3-methylglutaryl-coenzyme A reductase (HMGCR), statins were first discovered by Endo in 1972. With the widespread prescription and use of statins to decrease morbidity from myocardial infarction and stroke, it was noted that approximately 5% of all statin users experienced muscle pain and weakness during treatment. In a smaller proportion of patients, the myopathy progressed to severe morbidity marked by proximal weakness and severe muscle wasting. Remarkably, Mammen and colleagues were the first to discover that the molecular target of statins, 3-hydroxy-3-methylglutaryl coenzyme A reductase (HMGCR), is an autoantibody target in patients that develop an immune-mediated necrotizing myopathy (IMNM). These observations have been confirmed in a number of studies but, until today, a multi-center, international study of IMNM, related idiopathic inflammatory myopathies (IIM), other auto-inflammatory conditions and controls has not been published. Accordingly, an international, multi-center study investigated the utility of anti-HMGCR antibodies in the diagnosis of statin-associated IMNM in comparison to different forms of IIM and controls. This study included samples from patients with different forms of IIM (n=1250) and patients with other diseases (n=656) that were collected from twelve sites and tested for anti-HMGCR antibodies by ELISA. This study confirmed that anti-HMGCR autoantibodies, when found in conjunction with statin use, characterize a subset of IIM who are older and have necrosis on muscle biopsy. Taken together, the data to date indicates that testing for anti-HMGCR antibodies is important in the differential diagnosis of IIM and might be considered for future classification criteria. Copyright © 2016. Published by Elsevier B.V.

OCULAR ASPECTS OF HYPERTHYROIDISM WITH SPECIAL REFERENCE TO OCULAR MYOPATHY

Directory of Open Access Journals (Sweden)

Mallika O. U

2017-04-01

Full Text Available BACKGROUND Hyperthyroidism can result in ocular manifestations even before systemic signs and symptoms develop. It is seen more in females and severe forms are more common in males. Early detection of ocular involvement can prevent vision threatening complications and troublesome discomforts affecting quality of vision. This clinical study highlights the importance of detailed ocular examination in hyperthyroidism. MATERIALS AND METHODS Fifty consecutive patients with ocular signs of hyperthyroidism were evaluated and followed up for an average period of 1 year. Detailed ocular examination included exophthalmometric measurements, ocular movements and Worth four-dot test. T3, T4, TSH, CT scan and antimicrosomal antibodies and antithyroglobulin antibodies were done along with routine investigations. Study Design- Prospective cohort study. RESULTS Statistical analysis did not reveal any correlation between the level of serum T3 and severity of ocular findings. Majority of the cases were euthyroid with moderate ocular myopathy having multiple muscle involvement. Inferior rectus was affected most. CONCLUSION The ocular signs of hyperthyroidism in the present study seem to be mild. The severe eye changes like corneal involvement and optic nerve changes were less common.

Novel Homozygous Missense Mutation in RYR1 Leads to Severe Congenital Ptosis, Ophthalmoplegia, and Scoliosis in the Absence of Myopathy.

Science.gov (United States)

Dilaver, Nafi; Mazaheri, Neda; Maroofian, Reza; Zeighami, Jawaher; Seifi, Tahere; Zamani, Mina; Sedaghat, Alireza; Shariati, Gholam Reza; Galehdari, Hamid

2017-12-01

Ryanodine receptor 1 ( RYR1 ) is an intracellular calcium receptor primarily expressed in skeletal muscle with a role in excitation contraction. Both dominant and recessive mutations in the RYR1 gene cause a range of RYR1 -related myopathies and/or susceptibility to malignant hyperthermia (MH). Recently, an atypical manifestation of ptosis, variably presenting with ophthalmoplegia, facial paralysis, and scoliosis but without significant muscle weakness, has been reported in 9 cases from 4 families with bialleic variants in RYR1 . Two affected children from a consanguineous family with severe congenital ptosis, ophthalmoplegia, scoliosis, and distinctive long faces but without skeletal myopathy were studied. To identify the cause of the hereditary condition, DNA from the proband was subjected to whole exome sequencing (WES). WES revealed a novel homozygous missense variant in RYR1 (c.14066T>A; p.IIe4689Asn), which segregated within the family. Although the phenotype of the affected siblings in this study was similar to previously described cases, the clinical features were more severely expressed. Our findings contribute to the expansion of phenotypes related to RYR1 dysfunction. Additionally, it supports a new RYR1 -related clinical presentation without musculoskeletal involvement. It is important that individuals with RYR1 mutations are considered susceptible to MH, as 70% of the MH cases are caused by mutations in the RYR1 gene.

Idiopathic inflammatory myopathies in adults: A comparative study of Bohan and Peter and European Neuromuscular Center 2004 criteria.

Science.gov (United States)

Challa, Sundaram; Jakati, Saumya; Uppin, Megha S; Kannan, Meena A; Liza, Rajasekhar; Murthy Jagarlapudi, M K

2018-01-01

Bohan and Peter criteria are widely used for the diagnosis of idiopathic inflammatory myopathies (IIMs). Recently, European Neuromuscular Center (ENMC) formulated criteria to identify subgroups of IIMs. To compare the two diagnostic criteria in adult IIMs. This was a retrospective review of case records of histologically confirmed IIMs in adults between January 2014 and May 2015. Both the Bohan and Peter, and ENMC 2004 criteria were applied in the same group of patients to subgroup the IIMs. Muscle biopsy was evaluated in all the four domains: muscle fiber, inflammatory, connective tissue, and vascular, with the basic panel of histological stains. Sporadic inclusion body myositis (s-IBM) was diagnosed using ENMC IBM diagnostic research criteria 2011. During the study period, 69 patients fulfilled the ENMC criteria for IIMs including 16 patients with s-IBM. The subgrouping as per the ENMC criteria (53) was: dermatomyositis (DM) in 30; polymyositis (PM) in 2; immune-mediated necrotizing myopathy (IMNM) in 9; and nonspecific myositis (NM) in 12 patients, whereas subgrouping by the Bohan and Peter criteria was DM in 9 and PM with and without connective tissue disease (CTD) in 26 patients only. There was underdiagnosis of DM, as perifascicular atrophy is not recognized as a diagnostic histological feature, and overdiagnosis of PM with and without CTD due to poor characterization of histological features in PM by the Bohan and Peter criteria. Systematic evaluation of muscle biopsy according to the ENMC criteria with basic panel of histochemical stains improved the diagnostic yield of IIM significantly when compared to the Bohan and Peter criteria.

Two families with MYH7 distal myopathy associated with cardiomyopathy and core formations.

Science.gov (United States)

Naddaf, Elie; Waclawik, Andrew J

2015-03-01

Laing distal myopathy is caused by MYH7 gene mutations. Multiple families have been reported with varying patterns of skeletal and cardiac involvement as well as histopathological findings. We report 2 families with p.Glu1508del mutation with detailed electrophysiological and muscle pathology findings. All patients displayed the classic phenotype with weakness starting in the anterior compartment of the legs with a "hanging great toe." It was followed by finger extensors involvement, relatively sparing the extensor indicis proprius, giving the appearance of a "pointing index" finger. All the affected individuals had a dilated cardiomyopathy and core formations on muscle biopsy. Unexpectedly, neurogenic changes were also observed in some individuals. Both families were initially misdiagnosed with either central core disease or hereditary neuropathy. Recognizing the classic phenotype, screening for cardiac involvement that may be clinically silent, and determining the mode of inheritance help with selecting the appropriate genetic test.

mtDNA depletion myopathy: elucidation of the tissue specificity in the mitochondrial thymidine kinase (TK2) deficiency.

Science.gov (United States)

Saada, Ann; Shaag, Avraham; Elpeleg, Orly

2003-05-01

Decreased mitochondrial thymidine kinase (TK2) activity is associated with mitochondrial DNA (mtDNA) depletion and respiratory chain dysfunction and is manifested by isolated, fatal skeletal myopathy. Other tissues such as liver, brain, heart, and skin remain unaffected throughout the patients' life. In order to elucidate the mechanism of tissue specificity in the disease we have investigated the expression of the mitochondrial deoxynucleotide carrier, the mtDNA content and the activity of TK2 in mitochondria of various tissues. Our results suggest that low basal TK2 activity combined with a high requirement for mitochondrial encoded proteins in muscle predispose this tissue to the devastating effect of TK2 deficiency.

Onset of white striping and progression into wooden breast as defined by myopathic changes underlying Pectoralis major growth. Estimation of growth parameters as predictors for stage of myopathy progression.

Science.gov (United States)

Griffin, Jacqueline Reedy; Moraes, Luis; Wick, Macdonald; Lilburn, Michael Snell

2018-02-01

The broiler industry has incurred significant economic losses due to two muscle myopathies, white striping (WS) and wooden breast (WB), affecting the Pectoralis major (P. major) of commercial broilers. The present study documented macroscopic changes occurring with age/growth in the P. major and P. minor muscles of commercial broilers from day 2 through day 46 (n = 27/day). Distinct myopathic aberrations observed in both breast muscles corresponded to the onset of WB. These distinct morphological changes were used as determinants in developing a ranking system, defining the ontogeny of WB as the following four stages: (1) WS, (2) petechial epimysium haemorrhages, (3) intramuscular haemorrhages and (4) ischaemia. A cumulative logit proportional odds model was used to relate the rank probabilities with the following growth parameters: body weight, P. major and P. minor weight/yield/length/width/depth. The best-fit model included P. major length/width/depth, P. minor width, P. major and P. minor yield as predictors for rank. Increasing P. major depth, P. minor width and P. major yield increased the odds of falling into higher ranks (more severe myopathy). Conversely, increasing P. major length, P. major width and P. minor yield increased the odds of falling into smaller ranks (less severe myopathy). This study describes the macroscopic changes associated with WB ontogeny in the development of a ranking system and the contribution of growth parameters in the determination of rank (WB severity). Results suggest that physical measurements inherent to selection for high-yielding broiler genotypes are contributing to the occurrence and severity of WS and WB.

Human muscle cells express a B7-related molecule, B7-H1, with strong negative immune regulatory potential: a novel mechanism of counterbalancing the immune attack in idiopathic inflammatory myopathies.

Science.gov (United States)

Wiendl, Heinz; Mitsdoerffer, Meike; Schneider, Dagmar; Chen, Lieping; Lochmüller, Hanns; Melms, Arthur; Weller, Michael

2003-10-01

B7-H1 is a novel B7 family protein attributed to costimulatory and immune regulatory functions. Here we report that human myoblasts cultured from control subjects and patients with inflammatory myopathies as well as TE671 muscle rhabdomyosarcoma cells express high levels of B7-H1 after stimulation with the inflammatory cytokine IFN-gamma. Coculture experiments of MHC class I/II-positive myoblasts with CD4 and CD8 T cells in the presence of antigen demonstrated the functional consequences of muscle-related B7-H1 expression: production of inflammatory cytokines, IFN-gamma and IL-2, by CD4 as well CD8 T cells was markedly enhanced in the presence of a neutralizing anti-B7-H1 antibody. This observation was paralleled by an augmented expression of the T cell activation markers CD25, ICOS, and CD69, thus showing B7-H1-mediated inhibition of T cell activation. Further, we investigated 23 muscle biopsy specimens from patients with polymyositis (PM), inclusion body myositis (IBM), dermatomyositis (DM), and nonmyopathic controls for B7-H1 expression by immunohistochemistry: B7-H1 was expressed in PM, IBM, and DM specimens but not in noninflammatory and nonmyopathic controls. Staining was predominantly localized to areas of strong inflammation and to muscle cells as well as mononuclear cells. These data highlight the immune regulatory properties of muscle cells and suggest that B7-H1 expression represents an inhibitory mechanism induced upon inflammatory stimuli and aimed at protecting muscle fibers from immune aggression.

Transcriptomic profiling of TK2 deficient human skeletal muscle suggests a role for the p53 signalling pathway and identifies growth and differentiation factor-15 as a potential novel biomarker for mitochondrial myopathies

Science.gov (United States)

2014-01-01

Background Mutations in the gene encoding thymidine kinase 2 (TK2) result in the myopathic form of mitochondrial DNA depletion syndrome which is a mitochondrial encephalomyopathy presenting in children. In order to unveil some of the mechanisms involved in this pathology and to identify potential biomarkers and therapeutic targets we have investigated the gene expression profile of human skeletal muscle deficient for TK2 using cDNA microarrays. Results We have analysed the whole transcriptome of skeletal muscle from patients with TK2 mutations and compared it to normal muscle and to muscle from patients with other mitochondrial myopathies. We have identified a set of over 700 genes which are differentially expressed in TK2 deficient muscle. Bioinformatics analysis reveals important changes in muscle metabolism, in particular, in glucose and glycogen utilisation, and activation of the starvation response which affects aminoacid and lipid metabolism. We have identified those transcriptional regulators which are likely to be responsible for the observed changes in gene expression. Conclusion Our data point towards the tumor suppressor p53 as the regulator at the centre of a network of genes which are responsible for a coordinated response to TK2 mutations which involves inflammation, activation of muscle cell death by apoptosis and induction of growth and differentiation factor 15 (GDF-15) in muscle and serum. We propose that GDF-15 may represent a potential novel biomarker for mitochondrial dysfunction although further studies are required. PMID:24484525

Rare myositis-specific autoantibody associations among Hungarian patients with idiopathic inflammatory myopathy.

Science.gov (United States)

Bodoki, L; Nagy-Vincze, M; Griger, Z; Betteridge, Z; Szöllősi, L; Jobanputra, R; Dankó, K

2015-01-01

Idiopathic inflammatory myopathies are systemic, chronic autoimmune diseases characterized by symmetrical, proximal muscle weakness. Homogeneous groups present with similar symptoms. The response to therapy and prognosis could be facilitated by myositis-specific autoantibodies, and in this way, give rise to immunoserological classification. The myositis-specific autoantibodies are directed against specific proteins found in the cytoplasm or in the nucleus of the cells. To date, literature suggests the rarity of the co-existence of two myositis-specific autoantibodies. In this study the authors highlight rare associations of myositis-specific autoantibodies. Three hundred and thirty-seven Hungarian patients with polymyositis or dermatomyositis were studied. Their clinical findings were noted retrospectively. Specific blood tests identified six patients with the rare co-existence of myositis-specific autoantibodies, anti-Jo-1 and anti-SRP, anti-Jo-1 and anti-Mi-2, anti-Mi-2 and anti-PL-12, anti-Mi-2 and anti-SRP, and anti-SRP and anti-PL-7, respectively. This case review aims to identify the clinical importance of these rare associations and their place within the immunoserological classification.

Mutations in GFPT1-related congenital myasthenic syndromes are associated with synaptic morphological defects and underlie a tubular aggregate myopathy with synaptopathy.

Science.gov (United States)

Bauché, Stéphanie; Vellieux, Geoffroy; Sternberg, Damien; Fontenille, Marie-Joséphine; De Bruyckere, Elodie; Davoine, Claire-Sophie; Brochier, Guy; Messéant, Julien; Wolf, Lucie; Fardeau, Michel; Lacène, Emmanuelle; Romero, Norma; Koenig, Jeanine; Fournier, Emmanuel; Hantaï, Daniel; Streichenberger, Nathalie; Manel, Veronique; Lacour, Arnaud; Nadaj-Pakleza, Aleksandra; Sukno, Sylvie; Bouhour, Françoise; Laforêt, Pascal; Fontaine, Bertrand; Strochlic, Laure; Eymard, Bruno; Chevessier, Frédéric; Stojkovic, Tanya; Nicole, Sophie

2017-08-01

Mutations in GFPT1 (glutamine-fructose-6-phosphate transaminase 1), a gene encoding an enzyme involved in glycosylation of ubiquitous proteins, cause a limb-girdle congenital myasthenic syndrome (LG-CMS) with tubular aggregates (TAs) characterized predominantly by affection of the proximal skeletal muscles and presence of highly organized and remodeled sarcoplasmic tubules in patients' muscle biopsies. We report here the first long-term clinical follow-up of 11 French individuals suffering from LG-CMS with TAs due to GFPT1 mutations, of which nine are new. Our retrospective clinical evaluation stresses an evolution toward a myopathic weakness that occurs concomitantly to ineffectiveness of usual CMS treatments. Analysis of neuromuscular biopsies from three unrelated individuals demonstrates that the maintenance of neuromuscular junctions (NMJs) is dramatically impaired with loss of post-synaptic junctional folds and evidence of denervation-reinnervation processes affecting the three main NMJ components. Moreover, molecular analyses of the human muscle biopsies confirm glycosylation defects of proteins with reduced O-glycosylation and show reduced sialylation of transmembrane proteins in extra-junctional area. Altogether, these results pave the way for understanding the etiology of this rare neuromuscular disorder that may be considered as a "tubular aggregates myopathy with synaptopathy".

Muscle biopsies from human muscle diseases with myopathic pathology reveal common alterations in mitochondrial function.

Science.gov (United States)

Sunitha, Balaraju; Gayathri, Narayanappa; Kumar, Manish; Keshava Prasad, Thottethodi Subrahmanya; Nalini, Atchayaram; Padmanabhan, Balasundaram; Srinivas Bharath, Muchukunte Mukunda

2016-07-01

Muscle diseases are clinically and genetically heterogeneous and manifest as dystrophic, inflammatory and myopathic pathologies, among others. Our previous study on the cardiotoxin mouse model of myodegeneration and inflammation linked muscle pathology with mitochondrial damage and oxidative stress. In this study, we investigated whether human muscle diseases display mitochondrial changes. Muscle biopsies from muscle disease patients, represented by dysferlinopathy (dysfy) (dystrophic pathology; n = 43), polymyositis (PM) (inflammatory pathology; n = 24), and distal myopathy with rimmed vacuoles (DMRV) (distal myopathy; n = 31) were analyzed. Mitochondrial damage (ragged blue and COX-deficient fibers) was revealed in dysfy, PM, and DMRV cases by enzyme histochemistry (SDH and COX-SDH), electron microscopy (vacuolation and altered cristae) and biochemical assays (significantly increased ADP/ATP ratio). Proteomic analysis of muscle mitochondria from all three muscle diseases by isobaric tag for relative and absolute quantitation labeling and liquid chromatography-tandem mass spectrometry (LC-MS/MS) analysis demonstrated down-regulation of electron transport chain (ETC) complex subunits, assembly factors and Krebs cycle enzymes. Interestingly, 80 of the under-expressed proteins were common among the three pathologies. Assay of ETC and Krebs cycle enzyme activities validated the MS data. Mitochondrial proteins from muscle pathologies also displayed higher tryptophan (Trp) oxidation and the same was corroborated in the cardiotoxin model. Molecular modeling predicted Trp oxidation to alter the local structure of mitochondrial proteins. Our data highlight mitochondrial alterations in muscle pathologies, represented by morphological changes, altered mitochondrial proteome and protein oxidation, thereby establishing the role of mitochondrial damage in human muscle diseases. We investigated whether human muscle diseases display mitochondrial changes. Muscle biopsies

Impaired Insulin/IGF Signaling in Experimental Alcohol-Related Myopathy

Directory of Open Access Journals (Sweden)

Elizabeth Silbermann

2012-08-01

Full Text Available Alcohol-related myopathy (Alc-M is highly prevalent among heavy drinkers, although its pathogenesis is not well understood. We hypothesize that Alc-M is mediated by combined effects of insulin/IGF resistance and oxidative stress, similar to the effects of ethanol on liver and brain. We tested this hypothesis using an established model in which adult rats were pair-fed for 8 weeks with isocaloric diets containing 0% (N = 8 or 35.5% (N = 13 ethanol by caloric content. Gastrocnemius muscles were examined by histology, morphometrics, qRT-PCR analysis, and ELISAs. Chronic ethanol feeding reduced myofiber size and mRNA expression of IGF-1 polypeptide, insulin, IGF-1, and IGF-2 receptors, IRS-1, and IRS-2. Multiplex ELISAs demonstrated ethanol-associated inhibition of insulin, IRS-1, Akt, and p70S6K signaling, and increased activation of GSK-3β. In addition, ethanol-exposed muscles had increased 4-hydroxy-2-nonenal immunoreactivity, reflecting lipid peroxidation, and reduced levels of mitochondrial Complex IV, Complex V, and acetylcholinesterase. These results demonstrate that experimental Alc-M is associated with inhibition of insulin/IGF/IRS and downstream signaling that mediates metabolism and cell survival, similar to findings in alcoholic liver and brain degeneration. Moreover, the increased oxidative stress, which could be mediated by mitochondrial dysfunction, may have led to inhibition of acetylcholinesterase, which itself is sufficient to cause myofiber atrophy and degeneration.

Adult-onset nemaline myopathy in a dog presenting with persistent atrial standstill and primary hypothyroidism.

Science.gov (United States)

Nakamura, R K; Russell, N J; Shelton, G D

2012-06-01

A nine-year-old neutered female mixed breed dog presented for evaluation following a five-day history of lethargy, inappetence, weakness, abdominal distension and generalised muscle atrophy. Persistent vatrial standstill with a junctional rhythm was identified on electrocardiogram. Echocardiogram identified moderate dilation of all cardiac chambers and mild thickening of the mitral and tricuspid valves. Serology was negative for Neospora caninum and Toxoplasma gondii. Permanent pacemaker implantation was performed in addition to endomyocardial and skeletal muscle biopsies. Cryosections from the biceps femoris muscle showed numerous nemaline rod bodies while endomyocardial biopsies were possibly consistent with end-stage myocarditis. Rod bodies have rarely been reported in the veterinary literature. To the authors' knowledge, this is the first report of adult-onset nemaline rod myopathy and hypothyroidism with concurrent cardiac disease in a dog. © 2012 British Small Animal Veterinary Association.

Derivation of NEM2 affected human embryonic stem cell line Genea079

Directory of Open Access Journals (Sweden)

Biljana Dumevska

2016-03-01

Full Text Available The Genea079 human embryonic stem cell line was derived from a donated, fully commercially consented ART blastocyst, carrying compound heterozygous mutations in the NEB gene, exon 55 deletion & c.15110dupA, indicative of Nemaline Myopathy Type 2 (NEM2. Following ICM outgrowth on inactivated human feeders, karyotype was confirmed as 46, XY and STR analysis demonstrated a male Allele pattern. The hESC line had pluripotent cell morphology, 86% of cells expressed Nanog, 95% Oct4, 54% Tra1-60 and 98% SSEA4 and gave a PluriTest Pluripotency score of 30.25, Novelty of 1.21. The cell line was negative for Mycoplasma and visible contamination.

Effects of coenzyme Q10 on statin-induced myopathy: a meta-analysis of randomized controlled trials.

Science.gov (United States)

Banach, Maciej; Serban, Corina; Sahebkar, Amirhossein; Ursoniu, Sorin; Rysz, Jacek; Muntner, Paul; Toth, Peter P; Jones, Steven R; Rizzo, Manfredi; Glasser, Stephen P; Lip, Gregory Y H; Dragan, Simona; Mikhailidis, Dimitri P

2015-01-01

To evaluate the efficacy of coenzyme Q10 (CoQ10) supplementation on statin-induced myopathy. We searched the MEDLINE, Cochrane Library, Scopus, and EMBASE databases (November 1, 1987, to May 1, 2014) to identify randomized controlled trials investigating the impact of CoQ10 on muscle pain and plasma creatine kinase (CK) activity as 2 measures of statin-induced myalgia. Two independent reviewers extracted data on study characteristics, methods, and outcomes. We included 6 studies with 302 patients receiving statin therapy: 5 studies with 226 participants evaluated the effect of CoQ10 supplementation on plasma CK activity, and 5 studies (4 used in the CK analysis and 1 other study) with 253 participants were included to assess the effect of CoQ10 supplementation on muscle pain. Compared with the control group, plasma CK activity was increased after CoQ10 supplementation, but this change was not significant (mean difference, 11.69 U/L [to convert to μkat/L, multiply by 0.0167]; 95% CI, -14.25 to 37.63 U/L; P=.38). Likewise, CoQ10 supplementation had no significant effect on muscle pain despite a trend toward a decrease (standardized mean difference, -0.53; 95% CI, -1.33 to 0.28; P=.20). No dose-effect association between changes in plasma CK activity (slope, -0.001; 95% CI, -0.004 to 0.001; P=.33) or in the indices of muscle pain (slope, 0.002; 95% CI, -0.005 to 0.010; P=.67) and administered doses of CoQ10 were observed. The results of this meta-analysis of available randomized controlled trials do not suggest any significant benefit of CoQ10 supplementation in improving statin-induced myopathy. Larger, well-designed trials are necessary to confirm the findings from this meta-analysis. Copyright © 2015 Mayo Foundation for Medical Education and Research. Published by Elsevier Inc. All rights reserved.

BAG3 Directly Interacts with Mutated alphaB-Crystallin to Suppress Its Aggregation and Toxicity

NARCIS (Netherlands)

Hishiya, Akinori; Salman, Mortada Najem; Carra, Serena; Kampinga, Harm H.; Takayama, Shinichi

2011-01-01

A homozygous disruption or genetic mutation of the bag3 gene causes progressive myofibrillar myopathy in mouse and human skeletal and cardiac muscle disorder while mutations in the small heat shock protein aB-crystallin gene ( CRYAB) are reported to be responsible for myofibrillar myopathy. Here, we

Human muscle proteins: analysis by two-dimensional electrophoresis

Energy Technology Data Exchange (ETDEWEB)

Giometti, C.S.; Danon, M.J.; Anderson, N.G.

1983-09-01

Proteins from single frozen sections of human muscle were separated by two-dimensional gel electrophoresis and detected by fluorography or Coomassie Blue staining. The major proteins were identical in different normal muscles obtained from either sex at different ages, and in Duchenne and myotonic dystrophy samples. Congenital myopathy denervation atrophy, polymyositis, and Becker's muscular dystrophy samples, however, showed abnormal myosin light chain compositions, some with a decrease of fast-fiber myosin light chains and others with a decrease of slow-fiber light chains. These protein alterations did not correlate with any specific disease, and may be cause by generalized muscle-fiber damage.

Muscle sonography in six patients with hereditary inclusion body myopathy

International Nuclear Information System (INIS)

Adler, Ronald S.; Garolfalo, Giovanna; Paget, Stephen; Kagen, Lawrence

2008-01-01

To evaluate the morphological changes of muscle with sonography in six patients affected by hereditary inclusion body myopathy (HIBM). We studied a group of six Persian Jews diagnosed with HIBM. All were homozygous for the GNE mutation M712T. Ultrasonographic examinations of the quadriceps femoris and hamstring muscle groups were performed. A follow-up ultrasound examination was performed, after an interval of 3 years, in four of these patients. Muscles were assessed subjectively as to echogenicity, determined by gray-scale assessment, and loss of normal muscle morphology. Power Doppler sonography (PDS) was used to assess vascularity. A sonographic finding of central atrophy and peripheral sparing resulting in a target-like appearance was noted in the hamstring compartment of all six patients. The quadriceps compartment also showed involvement of the rectus femoris of all patients, which, in some cases, was the only muscle involved in the quadriceps. Vascularity was markedly reduced in the affected areas, with blood flow demonstrated in the peripherally spared areas. The severity of atrophy increased with disease duration. In this case series, we describe a new sonographic finding as well as document progression of HIBM disease, which has generally been described as quadriceps sparing. The myopathic target lesion, as well as isolated rectus femoris atrophy, may provide a useful adjunct to disease diagnosis. (orig.)

[Statin associated myopathy in clinical practice. Results of DAMA study].

Science.gov (United States)

Millán, Jesús; Pedro-Botet, Juan; Climent, Elisenda; Millán, Joaquín; Rius, Joan

Muscle symptoms, with or without elevation of creatin kinase are one of the main adverse effects of statin therapy, a fact that sometimes limits their use. The aim of this study was to evaluate the clinical characteristics of patients treated with statins who have complained muscle symptoms and to identify possible predictive factors. A cross-sectional one-visit, non-interventional, national multicenter study including patients of both sexes over 18 years of age referred for past or present muscle symptoms associated with statin therapy was conducted. 3,845 patients were recruited from a one-day record from 2,001 physicians. Myalgia was present in 78.2% of patients included in the study, myositis in 19.3%, and rhabdomyolysis in 2.5%. Patients reported muscle pain in 77.5% of statin-treated individuals, general weakness 42.7%, and cramps 28.1%. Kidney failure, intense physical exercise, alcohol consumption (>30g/d in men and 20g/d in women) and abdominal obesity were the clinical situations associated with statin myopathy. Myalgia followed by myositis are the most frequent statin-related side effects. It should be recommended control environmental factors such as intense exercise and alcohol intake as well as abdominal obesity and renal function of the patient treated with statins. Copyright © 2016 Sociedad Española de Arteriosclerosis. Publicado por Elsevier España, S.L.U. All rights reserved.

Ablation of steroid receptor coactivator-3 resembles the human CACT metabolic myopathy.

Science.gov (United States)

York, Brian; Reineke, Erin L; Sagen, Jørn V; Nikolai, Bryan C; Zhou, Suoling; Louet, Jean-Francois; Chopra, Atul R; Chen, Xian; Reed, Graham; Noebels, Jeffrey; Adesina, Adekunle M; Yu, Hui; Wong, Lee-Jun C; Tsimelzon, Anna; Hilsenbeck, Susan; Stevens, Robert D; Wenner, Brett R; Ilkayeva, Olga; Xu, Jianming; Newgard, Christopher B; O'Malley, Bert W

2012-05-02

Oxidation of lipid substrates is essential for survival in fasting and other catabolic conditions, sparing glucose for the brain and other glucose-dependent tissues. Here we show Steroid Receptor Coactivator-3 (SRC-3) plays a central role in long chain fatty acid metabolism by directly regulating carnitine/acyl-carnitine translocase (CACT) gene expression. Genetic deficiency of CACT in humans is accompanied by a constellation of metabolic and toxicity phenotypes including hypoketonemia, hypoglycemia, hyperammonemia, and impaired neurologic, cardiac and skeletal muscle performance, each of which is apparent in mice lacking SRC-3 expression. Consistent with human cases of CACT deficiency, dietary rescue with short chain fatty acids drastically attenuates the clinical hallmarks of the disease in mice devoid of SRC-3. Collectively, our results position SRC-3 as a key regulator of β-oxidation. Moreover, these findings allow us to consider platform coactivators such as the SRCs as potential contributors to syndromes such as CACT deficiency, previously considered as monogenic. Copyright © 2012 Elsevier Inc. All rights reserved.

Gyrate atrophy of choroid and retina with myopia, cataract and systemic proximal myopathy: A rare case report from rural India

Directory of Open Access Journals (Sweden)

Surekha Bangal

2012-12-01

Full Text Available AbstractGyrate atrophy is a rare metabolic disease with autosomal recessive inheritance pattern characterised by hyperornithinemia and typical ocular findings. This report presents a 17-year-old intellectually challenged girl consulting for a progressive fall of visual acuity with night blindness. Fundus examination showed patches of chorioretinal atrophy with typical scalloped borders and peri vascular pigmentation in the equatorial region. Fundus fluroscein angiography revealed characteristic staining pattern. Other ocular associations included myopia and posterior sub capsular cataract. Progressive systemic proximal myopathy was one of the associated features. Dietary supplementation of vitamin B6 was advised.

The spectrum of myopathies in the city of São Paulo

Directory of Open Access Journals (Sweden)

José A. Levy

1976-12-01

Full Text Available A review of all myopathic patients treated at the Neurologic Clinic of the Medical School of the University of São Paulo during the past 15 years is reported. A total of 466 cases were examined and distributed as follows: 56% of progressive muscular dystrophy; 31% of myasthenia gravis; 6% of polymyositis; 4% of myotonic dystrophy; and the remainder of several different diseases (central core disease, Kearns-syndrome, myotonia congenita, adynamia episodica hereditaria, diabetic myopathy and Eaton-Lambert syndrome. Enzymatic dosages, electromyography, muscle biopsy, electrocardiography and genetic counselling are also reported.Os autores fazem uma revisão de todos os casos de miopatias tratados na Clínica Neurológica da F.M.U.S.P. durante os últimos 15 anos. Foram examinados 466 casos, assim distribuídos: 56% de distrofia muscular progressiva; 31% de miastenia grave; 6% de polimiosite; 4% de distrofia miotônica e, o restante, de várias outras moléstias (Central core disease, síndrome de Kearns, miotonia congênita, adinamia episódica hereditária, miopatia diabética e síndrome de Eaton-Lambert. São relatadas também as dosagens enzimáticas, eletromiografia, biópsia muscular, eletrocardiografia e aconselhamento genético.

Effects of reduced dietary energy and amino acid density on Pectoralis major myopathies in broiler chickens at 36 and 49 days of age1.

Science.gov (United States)

Meloche, K J; Fancher, B I; Emmerson, D A; Bilgili, S F; Dozier, W A

2018-05-01

Two experiments (Exp) were conducted to determine if reductions in the incidence and severity of wooden breast (WB) and white striping (WS) may be obtained by reducing dietary nutrient density. In each Exp, Yield Plus × Ross 708 male broiler chicks were placed into 63 pens (22 birds/pen). All birds received an identical prestarter diet until 7 d of age, after which time each pen was randomly assigned to 1 of the following 7 dietary treatments (TRT) for the starter (8 to 14 d), grower (15 to 24 d), finisher 1 (Exp 1: 26 to 35 d; Exp 2: 26 to 42 d), and withdrawal (Exp 2: 43 to 48 d) phases: 1) 100% of primary breeder recommendations for digestible amino acid and metabolizable energy density throughout Exp; 2) 95% of TRT 1 until 14 d of age, then as TRT 1; 3) 95% of TRT 1 until 24 d of age, then as TRT 1; 4) 95% of TRT 1 throughout Exp; 5) 90% of TRT 1 until 14 d of age, then as TRT 1; 6) 90% of TRT 1 until 24 d of age, then as TRT 1; 7) 90% of TRT 1 throughout Exp. At 36 d (Exp 1) and 49 d (Exp 2), 18 birds per pen were processed and evaluated for WS and WB. In Exp 1, reduced dietary density in the starter phase (TRT 2 and TRT 5) resulted in increased (P ≤ 0.05) incidences of severe WB (32.9% and 34.7%) relative to TRT 1 (18.2%). In Exp 2, broilers assigned to TRT 7 had reduced (P 36.5%; WS: 64.5%). In both Exp, plasma creatine kinase and lactate dehydrogenase increased (P ≤ 0.05) with increasing scores for WB and WS. Reducing dietary nutrient density from 8 to 14 d may exacerbate fillet myopathies in broilers reared to 35 d of age. Although reducing dietary energy and amino acid density to 90% of recommendations from 1 to 48 d reduced the severity of myopathies, these reductions occurred with compromises in live performance. Altogether, these results indicated that concurrent manipulation of dietary amino acid and energy density is not a viable practical solution for breast myopathies.

Mild functional differences of dynamin 2 mutations associated to centronuclear myopathy and Charcot-Marie Tooth peripheral neuropathy.

Directory of Open Access Journals (Sweden)

Olga S Koutsopoulos

Full Text Available The large GTPase dynamin 2 is a key player in membrane and cytoskeletal dynamics mutated in centronuclear myopathy (CNM and Charcot-Marie Tooth (CMT neuropathy, two discrete dominant neuromuscular disorders affecting skeletal muscle and peripheral nerves respectively. The molecular basis for the tissue-specific phenotypes observed and the physiopathological mechanisms linked to dynamin 2 mutations are not well established. In this study, we have analyzed the impact of CNM and CMT implicated dynamin 2 mutants using ectopic expression of four CNM and two CMT mutations, and patient fibroblasts harboring two dynamin 2 CNM mutations in established cellular processes of dynamin 2 action. Wild type and CMT mutants were seen in association with microtubules whereas CNM mutants lacked microtubules association and did not disrupt interphase microtubules dynamics. Most dynamin 2 mutants partially decreased clathrin-mediated endocytosis when ectopically expressed in cultured cells; however, experiments in patient fibroblasts suggested that endocytosis is overall not defective. Furthermore, CNM mutants were seen in association with enlarged clathrin stained structures whereas the CMT mutant constructs were associated with clathrin structures that appeared clustered, similar to the structures observed in Dnm1 and Dnm2 double knock-out cells. Other roles of dynamin 2 including its interaction with BIN1 (amphiphysin 2, and its function in Golgi maintenance and centrosome cohesion were not significantly altered. Taken together, these mild functional defects are suggestive of differences between CMT and CNM disease-causing dynamin 2 mutants and suggest that a slight impairment in clathrin-mediated pathways may accumulate over time to foster the respective human diseases.

Comparison of blood aminotransferase methods for assessment of myopathy and hepatopathy in Florida manatees (Trichechus manatus latirostris).

Science.gov (United States)

Harr, Kendal E; Allison, Kathryn; Bonde, Robert K; Murphy, David; Harvey, John W

2008-06-01

Muscle injury is common in Florida manatees (Trichechus manatus latirostris). Plasma aspartate aminotransferase (AST) is frequently used to assess muscular damage in capture myopathy and traumatic injury. Therefore, accurate measurement of AST and alanine aminotransferase (ALT) is important in managed, free-ranging animals, as well as in those rehabilitating from injury. Activities of these enzymes, however, are usually not increased in manatees with either acute or chronic muscle damage, despite marked increases in plasma creatine kinase activity. It is hypothesized that this absence of response is due to apoenzymes in the blood not detected by commonly used veterinary assays. Addition of coenzyme pyridoxal-5-phosphate (P5P or vitamin B6) should, therefore, result in higher measured enzyme activities. The objective of this study was to determine the most accurate, precise, and diagnostically useful method for aminotransferase measurement in manatees that can be used in veterinary practices and diagnostic laboratories. Additionally, appropriate collection and storage techniques were assessed. The use of an optimized commercial wet chemical assay with 100 micromol P5P resulted in a positive bias of measured enzyme activities in a healthy population of animals. However, AST and ALT were still much lower than that typically observed in domestic animals and should not be used alone in the assessment of capture myopathy and muscular trauma. Additionally, the dry chemistry analyzer, typically used in clinics, reported significantly higher and less precise AST and ALT activities with poor correlation to those measured with wet chemical methods found in diagnostic laboratories. Therefore, these results cannot be clinically compared. Overall, the optimized wet chemical method was the most precise and diagnostically useful measurement of aminotransferase in samples. Additionally, there was a statistically significant difference between paired serum and plasma measurement

Hoffman's syndrome: pseudohypertrophic myopathy as initial manifestation of hypothyroidism. Case report Síndrome de Hoffman: miopatia pseudohipertrófica como manifestação inicial de hipotireoidismo. Relato de caso

Directory of Open Access Journals (Sweden)

Luiz Felipe Rocha Vasconcellos

2003-09-01

Full Text Available The frequency of myopathy in hypothyroidism ranges from 30 to 80%. The major symptoms related are weakness, muscular cramps and myalgia. The pseudohyperthrophic form is called Hoffman's syndrome. The electrophysiological study reveals myopathy, neuropathy or mixed pattern. Laboratorial investigation generally shows increased levels of muscle enzymes and low serum thyroid hormones, with thyrotrophic-stimulating hormone (TSH elevated. The treatment consists in hormone replacement and the prognosis is good in most of the cases. We report an adult male who developed muscular cramps, myalgia, weakness, pseudohyperthrophy, associated with facial edema and alteration of his voice. The muscle enzymes were increased and T4 was undetectable with a raised level of TSH. The myopathy was the initial manifestation of hypothyroidism in this case.A frequência de miopatia no hipotireoidismo varia de 30% a 80%. Os sintomas relacionados ao acometimento muscular são fraqueza, cãimbras e mialgias. A forma pseudo-hipertrófica é denominada síndrome de Hoffman. O estudo eletrofisiológico pode revelar padrão miopático, neuropático ou misto. A investigação laboratorial em geral mostra aumento das enzimas musculares e redução dos níveis de hormônio tireoidiano com TSH elevado. O tratamento consiste na reposição oral de hormônio e o prognóstico é bom na maioria dos casos. Relatamos o caso de um adulto que apresentou cãimbras, mialgia, fraqueza com pseudohipertrofia muscular associados a edema facial e alteração da voz. As enzimas musculares estavam elevadas e o nível de T4 foi indetectável com aumento de TSH. A miopatia foi manifestação inicial de hipotireoidismo neste caso.

When should MELAS (Mitochondrial myopathy, Encephalopathy, Lactic Acidosis, and Stroke-like episodes) be the diagnosis?

Science.gov (United States)

Lorenzoni, Paulo José; Werneck, Lineu Cesar; Kay, Cláudia Suemi Kamoi; Silvado, Carlos Eduardo Soares; Scola, Rosana Herminia

2015-11-01

Mitochondrial myopathy, Encephalopathy, Lactic Acidosis, and Stroke-like episodes (MELAS) is a rare mitochondrial disorder. Diagnostic criteria for MELAS include typical manifestations of the disease: stroke-like episodes, encephalopathy, evidence of mitochondrial dysfunction (laboratorial or histological) and known mitochondrial DNA gene mutations. Clinical features of MELAS are not necessarily uniform in the early stages of the disease, and correlations between clinical manifestations and physiopathology have not been fully elucidated. It is estimated that point mutations in the tRNALeu(UUR) gene of the DNAmt, mainly A3243G, are responsible for more of 80% of MELAS cases. Morphological changes seen upon muscle biopsy in MELAS include a substantive proportion of ragged red fibers (RRF) and the presence of vessels with a strong reaction for succinate dehydrogenase. In this review, we discuss mainly diagnostic criterion, clinical and laboratory manifestations, brain images, histology and molecular findings as well as some differential diagnoses and current treatments.

Ablation of Steroid Receptor Coactivator-3 resembles the human CACT metabolic myopathy

OpenAIRE

York, Brian; Reineke, Erin L.; Sagen, Jørn V.; Nikolai, Bryan C.; Zhou, Suoling; Louet, Jean-Francois; Chopra, Atul R.; Chen, Xian; Reed, Graham; Noebels, Jeffrey; Adesina, Adekunle M.; Yu, Hui; Wong, Lee-Jun C.; Tsimelzon, Anna; Hilsenbeck, Susan

2012-01-01

Oxidation of lipid substrates is essential for survival in fasting and other catabolic conditions, sparing glucose for the brain and other glucose-dependent tissues. Here we show Steroid Receptor Coactivator-3 (SRC-3) plays a central role in long chain fatty acid metabolism by directly regulating carnitine/acyl-carnitine translocase (CACT) gene expression. Genetic deficiency of CACT in humans is accompanied by a constellation of metabolic and toxicity phenotypes including hypoketonemia, hypog...

Comparison of Serum rAAV Serotype-Specific Antibodies in Patients with Duchenne Muscular Dystrophy, Becker Muscular Dystrophy, Inclusion Body Myositis, or GNE Myopathy.

Science.gov (United States)

Zygmunt, Deborah A; Crowe, Kelly E; Flanigan, Kevin M; Martin, Paul T

2017-09-01

Recombinant adeno-associated virus (rAAV) is a commonly used gene therapy vector for the delivery of therapeutic transgenes in a variety of human diseases, but pre-existing serum antibodies to viral capsid proteins can greatly inhibit rAAV transduction of tissues. Serum was assayed from patients with Duchenne muscular dystrophy (DMD), Becker muscular dystrophy (BMD), inclusion body myositis (IBM), and GNE myopathy (GNE). These were compared to serum from otherwise normal human subjects to determine the extent of pre-existing serum antibodies to rAAVrh74, rAAV1, rAAV2, rAAV6, rAAV8, and rAAV9. In almost all cases, patients with measurable titers to one rAAV serotype showed titers to all other serotypes tested, with average titers to rAAV2 being highest in all instances. Twenty-six percent of all young normal subjects (18 years old). Fifty percent of all IBM and GNE patients also had antibody titers to all rAAV serotypes, while only 18% of DMD and 0% of BMD patients did. In addition, serum-naïve macaques treated systemically with rAAVrh74 could develop cross-reactive antibodies to all other serotypes tested at 24 weeks post treatment. These data demonstrate that most DMD and BMD patients should be amenable to vascular rAAV-mediated treatment without the concern of treatment blockage by pre-existing serum rAAV antibodies, and that serum antibodies to rAAVrh74 are no more common than those for rAAV6, rAAV8, or rAAV9.

Diabetic Myopathy: Impact of Diabetes Mellitus on Skeletal Muscle Progenitor Cells

Directory of Open Access Journals (Sweden)

Donna M D'Souza

2013-12-01

Full Text Available Diabetes mellitus is defined as a group of metabolic diseases that are associated with the presence of a hyperglycemic state due to impairments in insulin function. While the development of each form of diabetes (Type 1 or Type 2 drastically differs, resultant pathologies often overlap. In each diabetic condition a failure to maintain healthy muscle is often observed, and is termed diabetic myopathy. This significant, but often overlooked, complication is believed to contribute to the progression of additional diabetic pathologies due to the vital importance of skeletal muscle for our physical and metabolic well-being. While studies have investigated the link between changes to skeletal muscle metabolic health following diabetes mellitus onset (particularly Type 2 diabetes mellitus, few have examined the negative impact of diabetes mellitus on the growth and reparative capacities of skeletal muscle that often coincides with disease development. Importantly, evidence is accumulating that the muscle progenitor cell population (particularly the muscle satellite cell population is also negatively affected by the diabetic environment, and as such, likely contributes to the declining skeletal muscle health observed in diabetes mellitus. In this review, we summarize the current knowledge surrounding the influence of diabetes mellitus on skeletal muscle growth and repair, with a particular emphasis on the impact of diabetes mellitus on the progenitor cell population of skeletal muscle.

Mitochondrial myopathy, encephalopathy, lactate acidosis with stroke-like episodes syndrome (MELAS: A case report

Directory of Open Access Journals (Sweden)

Petrović Igor N.

2012-01-01

Full Text Available Introduction. Mitochondrial encephalopathy, lactacidosis and stroke-like episodes (MELAS represent a multisystemic dysfunction due to various mutations in mitochondrial DNA. Here we report a patient with genetically confirmed MELAS. Case Outline. A patient is presented whose clinical features involved short stature, easy tendency to fatigue, recurrent seizures, progressive cognitive decline, myopathy, sensorineural deafness, diabetes mellitus as well as stroke-like episodes. The major clinical feature of migraine type headache was not present. Neuroimaging studies revealed signs of ischemic infarctions localized in the posterior regions of the brain cortex. Electron microscopy of the skeletal muscle biopsy showed subsarcolemmal accumulation of a large number of mitochondria with paracristal inclusions in the skeletal muscle cells. The diagnosis of MELAS was definitively confirmed by the detection of a specific point mutation A to G at nucleotide position 3243 of mitochondrial DNA. Conclusion. When a relatively young patient without common risk factors for ischemic stroke presents with signs of occipitally localized brain infarctions accompanied with multisystemic dysfunction, MELAS syndrome, it is necessary to conduct investigations in order to diagnose the disease.

Hemolysis, myopathy, and cardiac disease associated with hereditary phosphofructokinase deficiency in two Whippets

Science.gov (United States)

Gerber, Karen; Harvey, John W.; D'Agorne, Sara; Wood, Jonathan; Giger, Urs

2009-01-01

Two male castrated Whippet littermates were presented at 1 year of age for pallor, tachycardia, systolic heart murmur, dark yellow to orange feces, intermittent lethargy, pigmenturia, and muscle shivering or cramping after exercise. Persistent macrocytic hypochromic anemia with marked reticulocytosis and metarubricytosis was found when CBC results were compared with reference values for Whippets. Increased serum creatine kinase activity and hyperkalemia also were sometimes present over the 4-year period of evaluation. Progressively increasing serum concentrations of N-terminal prohormone brain natriuretic peptide suggested cardiac disease. Erythrocytes from the whippets were less osmotically fragile but more alkaline fragile than those from control dogs. Erythrocyte phosphofructokinase (PFK) activities and 2,3-diphosphoglycerate concentrations were decreased. Restriction enzyme-based DNA test screening and DNA sequencing revealed the same mutation in the muscle-PFK gene of the Whippets as seen in English Springer Spaniel dogs with PFK deficiency. This is the first report of PFK deficiency in Whippet dogs. In addition to causing hemolysis and exertional myopathy, heart disease may be a prominent clinical component of PFK deficiency in this breed and has not been previously recognized in PFK-deficient English Springer Spaniels. PMID:19228357

Expanding the clinical spectrum of hereditary fibrosing poikiloderma with tendon contractures, myopathy and pulmonary fibrosis due to FAM111B mutations.

Science.gov (United States)

Mercier, Sandra; Küry, Sébastien; Salort-Campana, Emmanuelle; Magot, Armelle; Agbim, Uchenna; Besnard, Thomas; Bodak, Nathalie; Bou-Hanna, Chantal; Bréhéret, Flora; Brunelle, Perrine; Caillon, Florence; Chabrol, Brigitte; Cormier-Daire, Valérie; David, Albert; Eymard, Bruno; Faivre, Laurence; Figarella-Branger, Dominique; Fleurence, Emmanuelle; Ganapathi, Mythily; Gherardi, Romain; Goldenberg, Alice; Hamel, Antoine; Igual, Jeanine; Irvine, Alan D; Israël-Biet, Dominique; Kannengiesser, Caroline; Laboisse, Christian; Le Caignec, Cédric; Mahé, Jean-Yves; Mallet, Stéphanie; MacGowan, Stuart; McAleer, Maeve A; McLean, Irwin; Méni, Cécile; Munnich, Arnold; Mussini, Jean-Marie; Nagy, Peter L; Odel, Jeffrey; O'Regan, Grainne M; Péréon, Yann; Perrier, Julie; Piard, Juliette; Puzenat, Eve; Sampson, Jacinda B; Smith, Frances; Soufir, Nadem; Tanji, Kurenai; Thauvin, Christel; Ulane, Christina; Watson, Rosemarie M; Khumalo, Nonhlanhla P; Mayosi, Bongani M; Barbarot, Sébastien; Bézieau, Stéphane

2015-10-15

Hereditary Fibrosing Poikiloderma (HFP) with tendon contractures, myopathy and pulmonary fibrosis (POIKTMP [MIM 615704]) is a very recently described entity of syndromic inherited poikiloderma. Previously by using whole exome sequencing in five families, we identified the causative gene, FAM111B (NM_198947.3), the function of which is still unknown. Our objective in this study was to better define the specific features of POIKTMP through a larger series of patients. Clinical and molecular data of two families and eight independent sporadic cases, including six new cases, were collected. Key features consist of: (i) early-onset poikiloderma, hypotrichosis and hypohidrosis; (ii) multiple contractures, in particular triceps surae muscle contractures; (iii) diffuse progressive muscular weakness; (iv) pulmonary fibrosis in adulthood and (v) other features including exocrine pancreatic insufficiency, liver impairment and growth retardation. Muscle magnetic resonance imaging was informative and showed muscle atrophy and fatty infiltration. Histological examination of skeletal muscle revealed extensive fibroadipose tissue infiltration. Microscopy of the skin showed a scleroderma-like aspect with fibrosis and alterations of the elastic network. FAM111B gene analysis identified five different missense variants (two recurrent mutations were found respectively in three and four independent families). All the mutations were predicted to localize in the trypsin-like cysteine/serine peptidase domain of the protein. We suggest gain-of-function or dominant-negative mutations resulting in FAM111B enzymatic activity changes. HFP with tendon contractures, myopathy and pulmonary fibrosis, is a multisystemic disorder due to autosomal dominant FAM111B mutations. Future functional studies will help in understanding the specific pathological process of this fibrosing disorder.

Samaras and seedlings of Acer pseudoplatanus are potential sources of hypoglycin A intoxication in atypical myopathy without necessarily inducing clinical signs.

Science.gov (United States)

Baise, E; Habyarimana, J A; Amory, H; Boemer, F; Douny, C; Gustin, P; Marcillaud-Pitel, C; Patarin, F; Weber, M; Votion, D-M

2016-07-01

Ingestion of sycamore seeds (Acer pseudoplatanus) is the likely source of hypoglycin A in atypical myopathy (AM) but ingestion of seedlings in spring might also contribute to intoxication. To test for hypoglycin A in seeds and seedlings collected on pastures where AM cases were reported and compare its concentration in serum of affected and healthy horses. Field investigation of clinical cases. Whenever present, samaras (the winged nuts that each contain one seed) and/or seedlings were collected from pastures of 8 AM cases and 5 unaffected horses from different premises. Two AM cases were each co-grazing with an apparently healthy horse. Acylcarnitines and hypoglycin A were quantified in blood samples of all horses involved in the study. Hypoglycin A was detected in serum of AM (5.47 ± 1.60 μmol/l) but not in healthy controls pasturing where A. pseudoplatanus trees were not present. However, hypoglycin A was detected at high concentrations (7.98 μmol/l) in serum of a clinically healthy horse grazing a pasture with seedlings and samaras and also in the 2 healthy horses co-grazing with AM cases (0.43 ± 0.59 μmol/l). Hypoglycin A was detected in all samples of seeds and spring seedlings of A. pseudoplatanus. Atypical myopathy can be associated with the ingestion of sycamore samaras and also ingestion of seedlings. Hypoglycin A can be detected in the blood of horses with no detectable clinical signs at pasture in which there is A. pseudoplatanus. Determination of hypoglycin A concentration in blood is useful for screening for exposure in suspected cases of AM. © 2015 EVJ Ltd.

Hypocalcemic myopathy without tetany due to idiopathic hypoparathyroidism: case report Miopatia hipocalcêmica secundária a hipoparatireiodismo idiopático sem tetamia: relato de caso

Directory of Open Access Journals (Sweden)

Daniel Bocchese Nora

2004-03-01

Full Text Available Myopathy due to idiopathic hypoparathyroidism is very unusual. We report on a 30 years-old man referred with complaints of sporadic muscle pain and mild global weakness for 10 years. His physical examination showed normal strength in distal muscle and slightly weakness in the pelvic and scapular girdles with no atrophy. Deep muscle reflexes were slightly hypoactive. Trousseau's and Chvostek's signs were absent. He had bilateral cataract and complex partial seizures. His laboratory tests showed decreased ionised and total calcium and parathyroid hormone and increased muscle enzymes. EMG and muscle biopsy was compatible with metabolic myopathy. After treatment with calcium and vitamin D supplementation he showed clinical, neurophisiological and laboratorial improvement. In conclusion: patients with muscle symptoms, even when non-specific and with normal neurological examination, should have serum calcium checked, as myopathy due to idiopathic hypoparathyroidism, even being rare, is treatable and easy to diagnose.Miopatia secundária a hipoparatireidismo idiopático é enfermidade raramente descrita. Relatamos o caso de homem de 30 anos que procurou atendimento médico com queixas de dores musculares e discreta fraqueza há cerca de 10 anos. Ao exame físico apresentava leve diminuição de força na musculatura pélvica e escapular, sem atrofia, ou fraqueza distal. Os reflexos miotáticos fásicos eram hipoativos e não havia sinais de Trousseau ou Chevostek. Havia história de catarata bilateral e crises parciais complexas. Os exames laboratoriais demonstraram hipocalcemia, com diminuição do paratormônio, hiperfosfatemia e enzimas musculares elevadas. A EMG e a biópsia de músculo foram compatíveis com miopatia metabólica. Após reposição de cálcio e vitamina D houve melhora clínica e neurofisiológica. Em conclusão: em pacientes com sintomas musculares, mesmo não específicos para miopatia ou com exame neurológico normal, deve

Muscle protein analysis. II. Two-dimensional electrophoresis of normal and diseased human skeletal muscle

Energy Technology Data Exchange (ETDEWEB)

Giometti, C.S. (Argonne National Lab., IL); Barany, M.; Danon, M.J.; Anderson, N.G.

1980-07-01

High-resolution two-dimensional electrophoresis was used to analyze the major proteins of normal and pathological human-muscle samples. The normal human-muscle pattern contains four myosin light chains: three that co-migrate with the myosin light chains from rabbit fast muscle (extensor digitorum longus), and one that co-migrates with the light chain 2 from rabbit slow muscle (soleus). Of seven Duchenne muscular dystrophy samples, four yielded patterns with decreased amounts of actin and myosin relative to normal muscle, while three samples gave patterns comparable to that for normal muscle. Six samples from patients with myotonic dystrophy also gave normal patterns. In nemaline rod myopathy, in contrast, the pattern was deficient in two of the fast-type myosin light chains.

The myopathy-causing mutation DNM2-S619L leads to defective tubulation in vitro and in developing zebrafish

Directory of Open Access Journals (Sweden)

Elizabeth M. Gibbs

2014-01-01

Full Text Available DNM2 is a ubiquitously expressed GTPase that regulates multiple subcellular processes. Mutations in DNM2 are a common cause of centronuclear myopathy, a severe disorder characterized by altered skeletal muscle structure and function. The precise mechanisms underlying disease-associated DNM2 mutations are unresolved. We examined the common DNM2-S619L mutation using both in vitro and in vivo approaches. Expression of DNM2-S619L in zebrafish led to the accumulation of aberrant vesicular structures and to defective excitation-contraction coupling. Expression of DNM2-S619L in COS7 cells resulted in defective BIN1-dependent tubule formation. These data suggest that DNM2-S619L causes disease, in part, by interfering with membrane tubulation.

A defect in the thymidine kinase 2 gene causing isolated mitochondrial myopathy without mtDNA depletion.

Science.gov (United States)

Leshinsky-Silver, E; Michelson, M; Cohen, S; Ginsberg, M; Sadeh, M; Barash, V; Lerman-Sagie, T; Lev, D

2008-07-01

Isolated mitochondrial myopathies (IMM) are either due to primary defects in mtDNA, in nuclear genes that control mtDNA abundance and structure such as thymidine kinase 2 (TK2), or due to CoQ deficiency. Defects in the TK2 gene have been found to be associated with mtDNA depletion attributed to a depleted mitochondrial dNTP pool in non-dividing cells. We report an unusual case of IMM, homozygous for the H90N mutation in the TK2 gene but unlike other cases with the same mutation, does not demonstrate mtDNA depletion. The patient's clinical course is relatively mild and a muscle biopsy showed ragged red muscle fibers with a mild decrease in complexes I and an increase in complexes IV and II activities. This report extends the phenotypic expression of TK2 defects and suggests that all patients who present with an IMM even with normal quantities of mtDNA should be screened for TK2 mutations.

Ascending paresis as presentation of an unusual association between necrotizing autoimmune myopathy and systemic lupus erythematosus.

Science.gov (United States)

García-Reynoso, Marco Julio; Veramendi-Espinoza, Liz Eliana; Ruiz-Garcia, Henry Jeison

2014-01-01

A 45 year-old man went to the emergency room due to disease duration of 15 days of insidious onset and progressive course. It began with symmetrical weakness and pain in feet and ankles that extends upward to the knees. Later, this progressed to paraparesis with Creatine phosphokinase levels of 44,270 U/L and respiratory failure that required mechanical ventilation. Electromyography and muscle biopsy of quadriceps were made. The patient responded to corticotherapy in pulses and supporting management. The presentation of ascending paresis suggested the diagnosis of Guillain-Barré syndrome. However, the degree of muscle involvement with rhabdomyolysis explains the neurological damage by itself. The biopsy revealed pathological criteria for necrotizing autoimmune myopathy (NAM), as well as other clinical and laboratory evidence. Patient disease continued and reached criteria for systemic lupus erythematosus (SLE). To our best knowledge, this is the first report of the NAM and SLE association. Copyright © 2012 Elsevier España, S.L. All rights reserved.

Novel missense mutations in PNPLA2 causing late onset and clinical heterogeneity of neutral lipid storage disease with myopathy in three siblings.

Science.gov (United States)

Missaglia, Sara; Tasca, Elisabetta; Angelini, Corrado; Moro, Laura; Tavian, Daniela

2015-01-01

Neutral lipid storage disease with myopathy (NLSD-M) is a rare autosomal recessive disorder characterised by an abnormal accumulation of triacylglycerol into cytoplasmic lipid droplets (LDs). NLSD-M patients are mainly affected by progressive myopathy, cardiomyopathy and hepatomegaly. Mutations in the PNPLA2 gene cause variable phenotypes of NLSD-M. PNPLA2 codes for adipose triglyceride lipase (ATGL), an enzyme that hydrolyses fatty acids from triacylglycerol. This report outlines the clinical and genetic findings in a NLSD-M Italian family with three affected members. In our patients, we identified two novel PNPLA2 missense mutations (p.L56R and p.I193F). Functional data analysis demonstrated that these mutations caused the production of ATGL proteins able to bind to LDs, but with decreased lipase activity. The oldest brother, at the age of 38, had weakness and atrophy of the right upper arm and kyphosis. Now he is 61 years old and is unable to raise arms in the horizontal position. The second brother, from the age of 44, had exercise intolerance, cramps and pain in lower limbs. He is currently 50 years old and has an asymmetric distal amyotrophy. One of the two sisters, 58 years old, presents the same PNPLA2 mutations, but she is still oligo-symptomatic on neuromuscular examination with slight triceps muscle involvement. She suffered from diabetes and liver steatosis. This NLSD-M family shows a wide range of intra-familial phenotypic variability in subjects carrying the same mutations, both in terms of target-organs and in terms of rate of disease progression. Copyright © 2015. Published by Elsevier Inc.

Two desmin gene mutations associated with myofibrillar myopathies in Polish families.

Directory of Open Access Journals (Sweden)

Jakub Piotr Fichna

Full Text Available Desmin is a muscle-specific intermediate filament protein which forms a network connecting the sarcomere, T tubules, sarcolemma, nuclear membrane, mitochondria and other organelles. Mutations in the gene coding for desmin (DES cause skeletal myopathies often combined with cardiomyopathy, or isolated cardiomyopathies. The molecular pathomechanisms of the disease remain ambiguous. Here, we describe and comprehensively characterize two DES mutations found in Polish patients with a clinical diagnosis of desminopathy. The study group comprised 16 individuals representing three families. Two mutations were identified: a novel missense mutation (Q348P and a small deletion of nine nucleotides (A357_E359del, previously described by us in the Polish population. A common ancestry of all the families bearing the A357_E359del mutation was confirmed. Both mutations were predicted to be pathogenic using a bioinformatics approach, including molecular dynamics simulations which helped to rationalize abnormal behavior at molecular level. To test the impact of the mutations on DES expression and the intracellular distribution of desmin muscle biopsies were investigated. Elevated desmin levels as well as its atypical localization in muscle fibers were observed. Additional staining for M-cadherin, α-actinin, and myosin heavy chains confirmed severe disruption of myofibrill organization. The abnormalities were more prominent in the Q348P muscle, where both small atrophic fibers as well large fibers with centrally localized nuclei were observed. We propose that the mutations affect desmin structure and cause its aberrant folding and subsequent aggregation, triggering disruption of myofibrils organization.

Two Desmin Gene Mutations Associated with Myofibrillar Myopathies in Polish Families

Science.gov (United States)

Berdynski, Mariusz; Sikorska, Agata; Filipek, Slawomir; Redowicz, Maria Jolanta; Kaminska, Anna; Zekanowski, Cezary

2014-01-01

Desmin is a muscle-specific intermediate filament protein which forms a network connecting the sarcomere, T tubules, sarcolemma, nuclear membrane, mitochondria and other organelles. Mutations in the gene coding for desmin (DES) cause skeletal myopathies often combined with cardiomyopathy, or isolated cardiomyopathies. The molecular pathomechanisms of the disease remain ambiguous. Here, we describe and comprehensively characterize two DES mutations found in Polish patients with a clinical diagnosis of desminopathy. The study group comprised 16 individuals representing three families. Two mutations were identified: a novel missense mutation (Q348P) and a small deletion of nine nucleotides (A357_E359del), previously described by us in the Polish population. A common ancestry of all the families bearing the A357_E359del mutation was confirmed. Both mutations were predicted to be pathogenic using a bioinformatics approach, including molecular dynamics simulations which helped to rationalize abnormal behavior at molecular level. To test the impact of the mutations on DES expression and the intracellular distribution of desmin muscle biopsies were investigated. Elevated desmin levels as well as its atypical localization in muscle fibers were observed. Additional staining for M-cadherin, α-actinin, and myosin heavy chains confirmed severe disruption of myofibrill organization. The abnormalities were more prominent in the Q348P muscle, where both small atrophic fibers as well large fibers with centrally localized nuclei were observed. We propose that the mutations affect desmin structure and cause its aberrant folding and subsequent aggregation, triggering disruption of myofibrils organization. PMID:25541946

Next-generation sequencing for diagnosis of rare diseases in the neonatal intensive care unit

Science.gov (United States)

Daoud, Hussein; Luco, Stephanie M.; Li, Rui; Bareke, Eric; Beaulieu, Chandree; Jarinova, Olga; Carson, Nancy; Nikkel, Sarah M.; Graham, Gail E.; Richer, Julie; Armour, Christine; Bulman, Dennis E.; Chakraborty, Pranesh; Geraghty, Michael; Lines, Matthew A.; Lacaze-Masmonteil, Thierry; Majewski, Jacek; Boycott, Kym M.; Dyment, David A.

2016-01-01

Background: Rare diseases often present in the first days and weeks of life and may require complex management in the setting of a neonatal intensive care unit (NICU). Exhaustive consultations and traditional genetic or metabolic investigations are costly and often fail to arrive at a final diagnosis when no recognizable syndrome is suspected. For this pilot project, we assessed the feasibility of next-generation sequencing as a tool to improve the diagnosis of rare diseases in newborns in the NICU. Methods: We retrospectively identified and prospectively recruited newborns and infants admitted to the NICU of the Children’s Hospital of Eastern Ontario and the Ottawa Hospital, General Campus, who had been referred to the medical genetics or metabolics inpatient consult service and had features suggesting an underlying genetic or metabolic condition. DNA from the newborns and parents was enriched for a panel of clinically relevant genes and sequenced on a MiSeq sequencing platform (Illumina Inc.). The data were interpreted with a standard informatics pipeline and reported to care providers, who assessed the importance of genotype–phenotype correlations. Results: Of 20 newborns studied, 8 received a diagnosis on the basis of next-generation sequencing (diagnostic rate 40%). The diagnoses were renal tubular dysgenesis, SCN1A-related encephalopathy syndrome, myotubular myopathy, FTO deficiency syndrome, cranioectodermal dysplasia, congenital myasthenic syndrome, autosomal dominant intellectual disability syndrome type 7 and Denys–Drash syndrome. Interpretation: This pilot study highlighted the potential of next-generation sequencing to deliver molecular diagnoses rapidly with a high success rate. With broader use, this approach has the potential to alter health care delivery in the NICU. PMID:27241786

Next-generation sequencing for diagnosis of rare diseases in the neonatal intensive care unit.

Science.gov (United States)

Daoud, Hussein; Luco, Stephanie M; Li, Rui; Bareke, Eric; Beaulieu, Chandree; Jarinova, Olga; Carson, Nancy; Nikkel, Sarah M; Graham, Gail E; Richer, Julie; Armour, Christine; Bulman, Dennis E; Chakraborty, Pranesh; Geraghty, Michael; Lines, Matthew A; Lacaze-Masmonteil, Thierry; Majewski, Jacek; Boycott, Kym M; Dyment, David A

2016-08-09

Rare diseases often present in the first days and weeks of life and may require complex management in the setting of a neonatal intensive care unit (NICU). Exhaustive consultations and traditional genetic or metabolic investigations are costly and often fail to arrive at a final diagnosis when no recognizable syndrome is suspected. For this pilot project, we assessed the feasibility of next-generation sequencing as a tool to improve the diagnosis of rare diseases in newborns in the NICU. We retrospectively identified and prospectively recruited newborns and infants admitted to the NICU of the Children's Hospital of Eastern Ontario and the Ottawa Hospital, General Campus, who had been referred to the medical genetics or metabolics inpatient consult service and had features suggesting an underlying genetic or metabolic condition. DNA from the newborns and parents was enriched for a panel of clinically relevant genes and sequenced on a MiSeq sequencing platform (Illumina Inc.). The data were interpreted with a standard informatics pipeline and reported to care providers, who assessed the importance of genotype-phenotype correlations. Of 20 newborns studied, 8 received a diagnosis on the basis of next-generation sequencing (diagnostic rate 40%). The diagnoses were renal tubular dysgenesis, SCN1A-related encephalopathy syndrome, myotubular myopathy, FTO deficiency syndrome, cranioectodermal dysplasia, congenital myasthenic syndrome, autosomal dominant intellectual disability syndrome type 7 and Denys-Drash syndrome. This pilot study highlighted the potential of next-generation sequencing to deliver molecular diagnoses rapidly with a high success rate. With broader use, this approach has the potential to alter health care delivery in the NICU. © 2016 Canadian Medical Association or its licensors.

Neutral lipid storage disease with myopathy: A whole-body nuclear MRI and metabolic study

Energy Technology Data Exchange (ETDEWEB)

Laforet, Pascal; Stojkovic, Tanya; Wahbi, Karim; Eymard, Bruno [AP-HP, Centre de Reference de pathologie neuromusculaire Paris-Est, Groupe Hospitalier Pitie-Salpetriere, Assistance Publique-Hopitaux de Paris, Paris, (France); Bassez, Guillaume [AP-HP, Centre de Reference de Pathologie Neuromusculaire Paris-Ouest, CHU Henri Mondor, Creteil, (France); Carlier, Pierre G. [CEA, I2BM, MIRCen, IdM NMR Laboratory, T-75651 Paris, (France); Clement, Karine [AP-HP, Institute of Cardiometabolism and Nutrition, ICAN, Pitie-Salpetriere Hospital, University Pierre et Marie-Curie Paris6, Paris, INSERM, U872 team 7, Paris, (France); Petit, Francois M. [AP-HP, Molecular Genetics and Metabolic Diseases Laboratory, Antoine Beclere Hospital, Clamart, (France); Carlier, Robert-Yves [AP-HP, Departement d' imagerie Medicale et Centre d' innovation Technologique, CHU Raymond-Poincare, Garches, (France)

2013-07-01

Neutral lipid storage disease with myopathy (NLSDM) is caused by a mutation in the gene encoding adipose triglyceride lipase (ATGL), and is characterized by the presence of numerous triglyceride-containing cytoplasmic droplets in type I muscle fibers. Major clinical manifestations concern the heart and skeletal muscle, and some patients also present diabetes mellitus. We report the clinical, metabolic, and whole-body nuclear magnetic resonance imaging findings of three patients with NLSDM. Muscle MRI study was consistent with previous descriptions, and allowed to show a common pattern of fatty replacement. Muscle changes predominated in the paravertebral muscles, both compartments of legs, and posterior compartment of the thighs. A more variable distribution of muscle involvement was observed on upper limbs, with marked asymmetry in one patient, and alterations predominating on supra and infra spinatus, biceps brachialis and anterior compartment of arms. Cardiac NMR studies revealed anomalies despite normal echocardiography in two patients. Endocrine studies showed low leptin and adiponectine levels, a moderate increase in insulin levels at fasting state, and even greater increase after oral glucose tolerance test in one patient. Two patients had elevated triglycerides and low cholesterol-HDL. Based on these analyses, regular control of cardio-metabolic risks appear mandatory in the clinical follow-up of these subjects. (authors)

Neutral lipid storage disease with myopathy: A whole-body nuclear MRI and metabolic study

International Nuclear Information System (INIS)

Laforet, Pascal; Stojkovic, Tanya; Wahbi, Karim; Eymard, Bruno; Bassez, Guillaume; Carlier, Pierre G.; Clement, Karine; Petit, Francois M.; Carlier, Robert-Yves

2013-01-01

Neutral lipid storage disease with myopathy (NLSDM) is caused by a mutation in the gene encoding adipose triglyceride lipase (ATGL), and is characterized by the presence of numerous triglyceride-containing cytoplasmic droplets in type I muscle fibers. Major clinical manifestations concern the heart and skeletal muscle, and some patients also present diabetes mellitus. We report the clinical, metabolic, and whole-body nuclear magnetic resonance imaging findings of three patients with NLSDM. Muscle MRI study was consistent with previous descriptions, and allowed to show a common pattern of fatty replacement. Muscle changes predominated in the paravertebral muscles, both compartments of legs, and posterior compartment of the thighs. A more variable distribution of muscle involvement was observed on upper limbs, with marked asymmetry in one patient, and alterations predominating on supra and infra spinatus, biceps brachialis and anterior compartment of arms. Cardiac NMR studies revealed anomalies despite normal echocardiography in two patients. Endocrine studies showed low leptin and adiponectine levels, a moderate increase in insulin levels at fasting state, and even greater increase after oral glucose tolerance test in one patient. Two patients had elevated triglycerides and low cholesterol-HDL. Based on these analyses, regular control of cardio-metabolic risks appear mandatory in the clinical follow-up of these subjects. (authors)

Myopathy associated with pigmentary degeneration of the retina and high protein content of cerebrospinal fluid Miopatia associada a degeneração pigmentar da retina e hiperproteinorraquia

Directory of Open Access Journals (Sweden)

José Antonio Levy

1974-06-01

Full Text Available The cases of two brothers suffering from a myopathy associated with pigmentary degeneration of the retina and increase of protein content of the cerebrospinal fluid are reported.Foram estudados dois pacientes, filhos de pais não consanguíneos, com quadro miopático, iniciado na segunda década da vida, com predomínio na musculatura das cinturas e da face. Em ambos os casos havia degeneração pigmentar da retina e aumento da taxa protéica no líquido cefalorraqueano.

Hypoglycin A Content in Blood and Urine Discriminates Horses with Atypical Myopathy from Clinically Normal Horses Grazing on the Same Pasture

Science.gov (United States)

Bochnia, M.; Ziegler, J.; Sander, J.; Uhlig, A.; Schaefer, S.; Vollstedt, S.; Glatter, M.; Abel, S.; Recknagel, S.; Schusser, G. F.; Wensch-Dorendorf, M.; Zeyner, A.

2015-01-01

Hypoglycin A (HGA) in seeds of Acer spp. is suspected to cause seasonal pasture myopathy in North America and equine atypical myopathy (AM) in Europe, fatal diseases in horses on pasture. In previous studies, this suspicion was substantiated by the correlation of seed HGA content with the concentrations of toxic metabolites in urine and serum (MCPA-conjugates) of affected horses. However, seed sampling was conducted after rather than during an outbreak of the disease. The aim of this study was to further confirm the causality between HGA occurrence and disease outbreak by seed sampling during an outbreak and the determination of i) HGA in seeds and of ii) HGA and MCPA-conjugates in urine and serum of diseased horses. Furthermore, cograzing healthy horses, which were present on AM affected pastures, were also investigated. AM-pastures in Germany were visited to identify seeds of Acer pseudoplatanus and serum (n = 8) as well as urine (n = 6) from a total of 16 diseased horses were analyzed for amino acid composition by LC-ESI-MS/MS, with a special focus on the content of HGA. Additionally, the content of its toxic metabolite was measured in its conjugated form in body fluids (UPLC-MS/MS). The seeds contained 1.7–319.8 μg HGA/g seed. The content of HGA in serum of affected horses ranged from 387.8–8493.8 μg/L (controls horses on AM-pastures showed higher serum (108.8 ± 83.76 μg/L) and urine concentrations (26.9 ± 7.39 μg/L) compared to control horses, but lower concentrations compared to diseased horses. The range of MCPA-carnitine and creatinine concentrations found in diseased horses in serum and urine were 0.17–0.65 mmol/L (controls horses were higher compared to controls. Thus, the causal link between HGA intoxication and disease outbreak could be further substantiated, and the early detection of HGA in cograzing horses, which are clinically normal, might be a promising step in prophylaxis. PMID:26378918

A case report: a heterozygous deletion (2791_2805 del) in exon 18 of the filamin C gene causing filamin C-related myofibrillar myopathies in a Chinese family.

Science.gov (United States)

Miao, Jing; Su, Fei-Fei; Liu, Xue-Mei; Wei, Xiao-Jing; Yuan, Yun; Yu, Xue-Fan

2018-06-04

Filamin C-related myofibrillar myopathies (MFM) are progressive skeletal myopathies with an autosomal dominant inheritance pattern. The conditions are caused by mutations of the filamin C gene (FLNC) located in the chromosome 7q32-q35 region. Genetic variations in the FLNC gene result in various clinical phenotypes. We describe a 43-year-old woman who suffered filamin C-related MFM, with symptoms first presenting in the proximal muscles of the lower limbs and eventually spreading to the upper limbs and distal muscles. The patient's serum level of creatine kinase was mildly increased. Mildy myopathic changes in the electromyographic exam and moderate lipomatous alterations in lower limb MRI were found. Histopathological examination revealed increased muscle fiber size variability, disturbances in oxidative enzyme activity, and the presence of abnormal protein aggregates and vacuoles in some muscle fibers. Ultrastructural analysis showed inclusions composed of thin filaments and interspersed granular densities. DNA sequencing analysis detected a novel 15-nucleotide deletion (c.2791_2805del, p.931_935del) in the FLNC gene. The patient's father, sister, brother, three paternal aunts, one paternal uncle, and the uncle's son also had slowly progressive muscle weakness, and thus, we detected an autosomal dominant inheritance pattern of the disorder. A novel heterogeneous 15-nucleotide deletion (c.2791_2805del, p.931_935del) in the Ig-like domain 7 of the FLNC gene was found to cause filamin C-related MFM. This deletion in the FLNC gene causes protein aggregation, abnormalities in muscle structure, and impairment in muscle fiber function, which leads to muscle weakness.

Sagging Eye Syndrome or Nemaline Rod Myopathy? Divergence Insufficiency with Levator Dehiscence as an Overlapping Symptom between Two Diagnoses

Directory of Open Access Journals (Sweden)

Stephanie S. L. Cheung

2017-01-01

Full Text Available A 78-year-old woman complained of gradual, painless onset of horizontal binocular diplopia associated with progressive axial weakness. Physical examination revealed esotropia that was greater at distance than at near vision, bilateral levator dehiscence, and normal abducting saccadic speeds. Given the age of the patient and compatible clinical findings, the diagnosis of Sagging Eye Syndrome (SES was made. However, further work-up with a muscle biopsy suggested Sporadic Late-Onset Nemaline Myopathy (SLONM as the cause of her progressive muscle weakness. Although rare, external ophthalmoplegia has been described in the literature as a presenting symptom in SLONM. To elucidate the pathological mechanism for the patient’s diplopia, an MRI of the orbits was performed, which revealed findings consistent with SES. This case aims to highlight the importance of integrating clinical findings during the diagnostic process and serves as a reminder that diplopia can be a common symptom for an uncommon diagnosis.

Clinical significance of magnetic resonance imaging of skeletal muscles in idiopathic inflammatory myopathies of adults

Energy Technology Data Exchange (ETDEWEB)

Nishikai, Masahiko; Akiya, Kumiko [National Tokyo Medical Center (Japan)

2000-12-01

The purpose of this study was to evaluate the clinical significance of magnetic resonance imaging (MRI) of skeletal muscles in Japanese patients with idiopathic inflammatory myopathies (IIM). MRI was performed in 23 adult patients with IIM, including 10 with polymyositis, 12 with dermatomyositis, and 1 with focal myositis. Seven (73%) of 11 patients with active IIM and 2 (17%) of 12 patients with inactive IIM showed hyperintensity of T2-weighted images and normal intensity of T1-weighted images, indicating 'edema-like abnormalities' (MRI findings for active myositis). Muscle lipomatosis and fibrosis were demonstrated in four patients and 1 patient, respectively. Considerable selectivity of muscles in developing inflammatory disorders was found. In quadriceps muscles, for example, vastus muscles seemed to be more often affected in DM patients, whereas adductors were more often affected in PM patients. Serial examination of muscle MRIs was carried out in 4 patients and the findings paralleled the disease activities. The muscle MRI findings did not necessarily correlate with other findings, such as the presence of muscle weakness, elevated serum creatine kinase levels, myogenic electromyogram, or muscle biopsy findings. The muscle MRI was considered to be an additional useful tool for the diagnosis, evaluation of disease activity, and planning treatment of IIM. (author)

Clinical significance of magnetic resonance imaging of skeletal muscles in idiopathic inflammatory myopathies of adults

International Nuclear Information System (INIS)

Nishikai, Masahiko; Akiya, Kumiko

2000-01-01

The purpose of this study was to evaluate the clinical significance of magnetic resonance imaging (MRI) of skeletal muscles in Japanese patients with idiopathic inflammatory myopathies (IIM). MRI was performed in 23 adult patients with IIM, including 10 with polymyositis, 12 with dermatomyositis, and 1 with focal myositis. Seven (73%) of 11 patients with active IIM and 2 (17%) of 12 patients with inactive IIM showed hyperintensity of T2-weighted images and normal intensity of T1-weighted images, indicating 'edema-like abnormalities' (MRI findings for active myositis). Muscle lipomatosis and fibrosis were demonstrated in four patients and 1 patient, respectively. Considerable selectivity of muscles in developing inflammatory disorders was found. In quadriceps muscles, for example, vastus muscles seemed to be more often affected in DM patients, whereas adductors were more often affected in PM patients. Serial examination of muscle MRIs was carried out in 4 patients and the findings paralleled the disease activities. The muscle MRI findings did not necessarily correlate with other findings, such as the presence of muscle weakness, elevated serum creatine kinase levels, myogenic electromyogram, or muscle biopsy findings. The muscle MRI was considered to be an additional useful tool for the diagnosis, evaluation of disease activity, and planning treatment of IIM. (author)

MiR-320a as a Potential Novel Circulating Biomarker of Arrhythmogenic CardioMyopathy.

Science.gov (United States)

Sommariva, Elena; D'Alessandra, Yuri; Farina, Floriana Maria; Casella, Michela; Cattaneo, Fabio; Catto, Valentina; Chiesa, Mattia; Stadiotti, Ilaria; Brambilla, Silvia; Dello Russo, Antonio; Carbucicchio, Corrado; Vettor, Giulia; Riggio, Daniela; Sandri, Maria Teresa; Barbuti, Andrea; Vernillo, Gianluca; Muratori, Manuela; Dal Ferro, Matteo; Sinagra, Gianfranco; Moimas, Silvia; Giacca, Mauro; Colombo, Gualtiero Ivanoe; Pompilio, Giulio; Tondo, Claudio

2017-07-06

Diagnosis of Arrhythmogenic CardioMyopathy (ACM) is challenging and often late after disease onset. No circulating biomarkers are available to date. Given their involvement in several cardiovascular diseases, plasma microRNAs warranted investigation as potential non-invasive diagnostic tools in ACM. We sought to identify circulating microRNAs differentially expressed in ACM with respect to Healthy Controls (HC) and Idiopathic Ventricular Tachycardia patients (IVT), often in differential diagnosis. ACM and HC subjects were screened for plasmatic expression of 377 microRNAs and validation was performed in 36 ACM, 53 HC, 21 IVT. Variable importance in data partition was estimated through Random Forest analysis and accuracy by Receiver Operating Curves. Plasmatic miR-320a showed 0.53 ± 0.04 fold expression difference in ACM vs. HC (p ACM (n = 13) and HC (n = 17) with athletic lifestyle, a ACM precipitating factor. Importantly, ACM patients miR-320a showed 0.78 ± 0.05 fold expression change vs. IVT (p = 0.03). When compared to non-invasive ACM diagnostic parameters, miR-320a ranked highly in discriminating ACM vs. IVT and it increased their accuracy. Finally, miR-320a expression did not correlate with ACM severity. Our data suggest that miR-320a may be considered a novel potential biomarker of ACM, specifically useful in ACM vs. IVT differentiation.

Vitamin D Receptor Gene Polymorphisms and Haplotypes in Hungarian Patients with Idiopathic Inflammatory Myopathy

Directory of Open Access Journals (Sweden)

Levente Bodoki

2015-01-01

Full Text Available Idiopathic inflammatory myopathies are autoimmune diseases characterized by symmetrical proximal muscle weakness. Our aim was to identify a correlation between VDR polymorphisms or haplotypes and myositis. We studied VDR-BsmI, VDR-ApaI, VDR-TaqI, and VDR-FokI polymorphisms and haplotypes in 89 Hungarian poly-/dermatomyositis patients (69 females and 93 controls (52 females. We did not obtain any significant differences for VDR-FokI, BsmI, ApaI, and TaqI genotypes and allele frequencies between patients with myositis and healthy individuals. There was no association of VDR polymorphisms with clinical manifestations and laboratory profiles in myositis patients. Men with myositis had a significantly different distribution of BB, Bb, and bb genotypes than female patients, control male individuals, and the entire control group. Distribution of TT, Tt, and tt genotypes was significantly different in males than in females in patient group. According to four-marker haplotype prevalence, frequencies of sixteen possible haplotypes showed significant differences between patient and control groups. The three most frequent haplotypes in patients were the fbAt, FBaT, and fbAT. Our findings may reveal that there is a significant association: Bb and Tt genotypes can be associated with myositis in the Hungarian population we studied. We underline the importance of our result in the estimated prevalence of four-marker haplotypes.

A Drosophila model of dominant inclusion body myopathy type 3 shows diminished myosin kinetics that reduce muscle power and yield myofibrillar defects.

Science.gov (United States)

Suggs, Jennifer A; Melkani, Girish C; Glasheen, Bernadette M; Detor, Mia M; Melkani, Anju; Marsan, Nathan P; Swank, Douglas M; Bernstein, Sanford I

2017-06-01

Individuals with inclusion body myopathy type 3 (IBM3) display congenital joint contractures with early-onset muscle weakness that becomes more severe in adulthood. The disease arises from an autosomal dominant point mutation causing an E706K substitution in myosin heavy chain type IIa. We have previously expressed the corresponding myosin mutation (E701K) in homozygous Drosophila indirect flight muscles and recapitulated the myofibrillar degeneration and inclusion bodies observed in the human disease. We have also found that purified E701K myosin has dramatically reduced actin-sliding velocity and ATPase levels. Since IBM3 is a dominant condition, we now examine the disease state in heterozygote Drosophila in order to gain a mechanistic understanding of E701K pathogenicity. Myosin ATPase activities in heterozygotes suggest that approximately equimolar levels of myosin accumulate from each allele. In vitro actin sliding velocity rates for myosin isolated from the heterozygotes were lower than the control, but higher than for the pure mutant isoform. Although sarcomeric ultrastructure was nearly wild type in young adults, mechanical analysis of skinned indirect flight muscle fibers revealed a 59% decrease in maximum oscillatory power generation and an approximately 20% reduction in the frequency at which maximum power was produced. Rate constant analyses suggest a decrease in the rate of myosin attachment to actin, with myosin spending decreased time in the strongly bound state. These mechanical alterations result in a one-third decrease in wing beat frequency and marginal flight ability. With aging, muscle ultrastructure and function progressively declined. Aged myofibrils showed Z-line streaming, consistent with the human heterozygote phenotype. Based upon the mechanical studies, we hypothesize that the mutation decreases the probability of the power stroke occurring and/or alters the degree of movement of the myosin lever arm, resulting in decreased in vitro

A Drosophila model of dominant inclusion body myopathy type 3 shows diminished myosin kinetics that reduce muscle power and yield myofibrillar defects

Directory of Open Access Journals (Sweden)

Jennifer A. Suggs

2017-06-01

Full Text Available Individuals with inclusion body myopathy type 3 (IBM3 display congenital joint contractures with early-onset muscle weakness that becomes more severe in adulthood. The disease arises from an autosomal dominant point mutation causing an E706K substitution in myosin heavy chain type IIa. We have previously expressed the corresponding myosin mutation (E701K in homozygous Drosophila indirect flight muscles and recapitulated the myofibrillar degeneration and inclusion bodies observed in the human disease. We have also found that purified E701K myosin has dramatically reduced actin-sliding velocity and ATPase levels. Since IBM3 is a dominant condition, we now examine the disease state in heterozygote Drosophila in order to gain a mechanistic understanding of E701K pathogenicity. Myosin ATPase activities in heterozygotes suggest that approximately equimolar levels of myosin accumulate from each allele. In vitro actin sliding velocity rates for myosin isolated from the heterozygotes were lower than the control, but higher than for the pure mutant isoform. Although sarcomeric ultrastructure was nearly wild type in young adults, mechanical analysis of skinned indirect flight muscle fibers revealed a 59% decrease in maximum oscillatory power generation and an approximately 20% reduction in the frequency at which maximum power was produced. Rate constant analyses suggest a decrease in the rate of myosin attachment to actin, with myosin spending decreased time in the strongly bound state. These mechanical alterations result in a one-third decrease in wing beat frequency and marginal flight ability. With aging, muscle ultrastructure and function progressively declined. Aged myofibrils showed Z-line streaming, consistent with the human heterozygote phenotype. Based upon the mechanical studies, we hypothesize that the mutation decreases the probability of the power stroke occurring and/or alters the degree of movement of the myosin lever arm, resulting in

Productive infection of human skeletal muscle cells by pandemic and seasonal influenza A(H1N1 viruses.

Directory of Open Access Journals (Sweden)

Marion Desdouits

Full Text Available Besides the classical respiratory and systemic symptoms, unusual complications of influenza A infection in humans involve the skeletal muscles. Numerous cases of acute myopathy and/or rhabdomyolysis have been reported, particularly following the outbreak of pandemic influenza A(H1N1 in 2009. The pathogenesis of these influenza-associated myopathies (IAM remains unkown, although the direct infection of muscle cells is suspected. Here, we studied the susceptibility of cultured human primary muscle cells to a 2009 pandemic and a 2008 seasonal influenza A(H1N1 isolate. Using cells from different donors, we found that differentiated muscle cells (i. e. myotubes were highly susceptible to infection by both influenza A(H1N1 isolates, whereas undifferentiated cells (i. e. myoblasts were partially resistant. The receptors for influenza viruses, α2-6 and α2-3 linked sialic acids, were detected on the surface of myotubes and myoblasts. Time line of viral nucleoprotein (NP expression and nuclear export showed that the first steps of the viral replication cycle could take place in muscle cells. Infected myotubes and myoblasts exhibited budding virions and nuclear inclusions as observed by transmission electron microscopy and correlative light and electron microscopy. Myotubes, but not myoblasts, yielded infectious virus progeny that could further infect naive muscle cells after proteolytic treatment. Infection led to a cytopathic effect with the lysis of muscle cells, as characterized by the release of lactate dehydrogenase. The secretion of proinflammatory cytokines by muscle cells was not affected following infection. Our results are compatible with the hypothesis of a direct muscle infection causing rhabdomyolysis in IAM patients.

Open-label trial and randomized, double-blind, placebo-controlled, crossover trial of hydrogen-enriched water for mitochondrial and inflammatory myopathies

Directory of Open Access Journals (Sweden)

Ito Mikako

2011-10-01

Full Text Available Abstract Background Molecular hydrogen has prominent effects on more than 30 animal models especially of oxidative stress-mediated diseases and inflammatory diseases. In addition, hydrogen effects on humans have been reported in diabetes mellitus type 2, hemodialysis, metabolic syndrome, radiotherapy for liver cancer, and brain stem infarction. Hydrogen effects are ascribed to specific radical-scavenging activities that eliminate hydroxyl radical and peroxynitrite, and also to signal-modulating activities, but the detailed molecular mechanisms still remain elusive. Hydrogen is a safe molecule that is largely produced by intestinal bacteria in rodents and humans, and no adverse effects have been documented. Methods We performed open-label trial of drinking 1.0 liter per day of hydrogen-enriched water for 12 weeks in five patients with progressive muscular dystrophy (PMD, four patients with polymyositis/dermatomyositis (PM/DM, and five patients with mitochondrial myopathies (MM, and measured 18 serum parameters as well as urinary 8-isoprostane every 4 weeks. We next conducted randomized, double-blind, placebo-controlled, crossover trial of 0.5 liter per day of hydrogen-enriched water or placebo water for 8 weeks in 10 patients with DM and 12 patients with MM, and measured 18 serum parameters every 4 weeks. Results In the open-label trial, no objective improvement or worsening of clinical symptoms was observed. We, however, observed significant effects in lactate-to-pyruvate ratios in PMD and MM, fasting blood glucose in PMD, serum matrix metalloproteinase-3 (MMP3 in PM/DM, and serum triglycerides in PM/DM. In the double-blind trial, no objective clinical effects were observed, but a significant improvement was detected in lactate in MM. Lactate-to-pyruvate ratios in MM and MMP3 in DM also exhibited favorable responses but without statistical significance. No adverse effect was observed in either trial except for hypoglycemic episodes in an insulin

Statins induce apoptosis in rat and human myotube cultures by inhibiting protein geranylgeranylation but not ubiquinone

International Nuclear Information System (INIS)

Johnson, Timothy E.; Zhang, Xiaohua; Bleicher, Kimberly B.; Dysart, Gary; Loughlin, Amy F.; Schaefer, William H.; Umbenhauer, Diane R.

2004-01-01

Statins are widely used to treat lipid disorders. These drugs are safe and well tolerated; however, in <1% of patients, myopathy and/or rhabdomyolysis can develop. To better understand the mechanism of statin-induced myopathy, we examined the ability of structurally distinct statins to induce apoptosis in an optimized rat myotube model. Compound A (a lactone) and Cerivastatin (an open acid) induced apoptosis, as measured by TUNEL and active caspase 3 staining, in a concentration- and time-dependent manner. In contrast, an epimer of Compound A (Compound B) exhibited a much weaker apoptotic response. Statin-induced apoptosis was completely prevented by mevalonate or geranylgeraniol, but not by farnesol. Zaragozic acid A, a squalene synthase inhibitor, caused no apoptosis on its own and had no effect on Compound-A-induced myotoxicity, suggesting the apoptosis was not a result of cholesterol synthesis inhibition. The geranylgeranyl transferase inhibitors GGTI-2133 and GGTI-2147 caused apoptosis in myotubes; the farnesyl transferase inhibitor FTI-277 exhibited a much weaker effect. In addition, the prenylation of rap1a, a geranylgeranylated protein, was inhibited by Compound A in myotubes at concentrations that induced apoptosis. A similar statin-induced apoptosis profile was seen in human myotube cultures but primary rat hepatocytes were about 200-fold more resistant to statin-induced apoptosis. Although the statin-induced hepatotoxicity could be attenuated with mevalonate, no effect was found with either geranylgeraniol or farnesol. In studies assessing ubiquinone levels after statin treatment in rat and human myotubes, there was no correlation between ubiquinone levels and apoptosis. Taken together, these observations suggest that statins cause apoptosis in myotube cultures in part by inhibiting the geranylgeranylation of proteins, but not by suppressing ubiquinone concentration. Furthermore, the data from primary hepatocytes suggests a cell-type differential

Biomechanics, diagnosis, and treatment outcome in inflammatory myopathy presenting as oropharyngeal dysphagia

Science.gov (United States)

Williams, R B; Grehan, M J; Hersch, M; Andre, J; Cook, I J

2003-01-01

Aims: In patients with inflammatory myopathy and dysphagia, our aims were to determine: (1) the diagnostic utility of clinical and laboratory indicators; (2) the biomechanical properties of the pharyngo-oesophageal segment; (3) the usefulness of pharyngeal videomanometry in distinguishing neuropathic from myopathic dysphagia; and (4) clinical outcome. Methods: Clinical, laboratory, and videomanometric assessment was performed in 13 patients with myositis and dysphagia, in 17 disease controls with dysphagia (due to proven CNS disease), and in 22 healthy age matched controls. The diagnostic accuracy of creatine kinase (CPK), erythrocyte sedimentation rate, antinuclear antibody, and electromyography (EMG) were compared with the gold standard muscle biopsy. The biomechanical properties of the pharyngo-oesophageal segment were assessed by videomanometry. Results: Mean time from dysphagia onset to the diagnosis of myositis was 55 months (range 1–180). One third had no extrapharyngeal muscle weakness; 25% had normal CPK, and EMG was unhelpful in 28%. Compared with neurogenic controls, myositis patients had more prevalent cricopharyngeal restrictive disorders (69% v 14%; p=0.0003), reduced upper oesophageal sphincter (UOS) opening (p=0.01), and elevated hypopharyngeal intrabolus pressures (p=0.001). Videomanometric features favouring a myopathic over a neuropathic aetiology were: preserved pharyngeal swallow response, complete UOS relaxation, and normal swallow coordination. The 12 month mortality was 31%. Conclusions: The notable lack of supportive clinical signs and significant false negative rates for laboratory tests contribute to the marked delay in diagnosis. The myopathic process is strongly associated with restricted sphincter opening suggesting that cricopharyngeal disruption is a useful adjunct to immunosuppressive therapy. The condition has a poor prognosis. PMID:12631653

Alternative splicing of exon 17 and a missense mutation in exon 20 of the insulin receptor gene in two brothers with a novel syndrome of insulin resistance (congenital fiber-type disproportion myopathy)

DEFF Research Database (Denmark)

Vorwerk, P; Christoffersen, C T; Müller, J

1999-01-01

The insulin receptor (IR) in two brothers with a rare syndrome of congenital muscle fiber type disproportion myopathy (CFTDM) associated with diabetes and severe insulin resistance was studied. By direct sequencing of Epstein-Barr virus-transformed lymphocytes both patients were found...... either of the two mutated receptors lacked basal or stimulated IR beta-subunit autophosphorylation. A third brother who inherited both normal alleles has an normal muscle phenotype and insulin sensitivity, suggesting a direct linkage of these IR mutations with the CFTDM phenotype....

Chronic primary intestinal pseudo-obstruction from visceral myopathy Pseudo-osbtrucción intestinal crónica primaria debida a miopatía visceral

Directory of Open Access Journals (Sweden)

M. T. Muñoz-Yagüe

2006-04-01

Full Text Available Chronic intestinal pseudo-obstruction is an uncommon syndrome characterized by relapsing episodes suggesting intestinal obstruction during which no mechanical causes are identified to account for symptoms. Etiologic factors may be manifold. Among them a number of neurologic conditions, gastrointestinal smooth muscle myopathies, endocrino-metabolic and autoimmune diseases, and the use of selected drugs stand out. We report a case of chronic intestinal pseudo-obstruction originating in a sporadic, primary intestinal myopathy that corresponds to no type thus far described. A histological study of the intestinal wall showed disrupted muscle bundles and the presence of interstitial edema. Myocytes had severe degenerative changes, and no alterations were seen in submucosal and myenteric plexus neurons. The activity of enzyme complexes in the mitochondrial respiratory chain, and of thymidine phosphorylase was normal. No mitochondrial DNA changes were seen.La pseudo-obstrucción intestinal crónica es un síndrome infrecuente caracterizado por episodios recidivantes, sugestivos de obstrucción intestinal, durante los cuales no se detectan causas mecánicas que justifiquen la sintomatología. Los factores etiológicos pueden ser múltiples. Entre ellos destacan diversas enfermedades neurológicas, miopatías de la musculatura lisa gastrointestinal, enfermedades endocrino-metabólicas y autoinmunes y el uso de determinados fármacos. Presentamos un caso de pseudo-obstrucción intestinal crónica originada por una miopatía intestinal primaria y esporádica que no corresponde a ningún tipo descrito hasta el momento. El estudio histológico de la pared intestinal mostró que los haces musculares estaban desestructurados y que existía edema intersticial. Los miocitos presentaban marcados cambios degenerativos y no existían alteraciones en las neuronas de los plexos submucoso y mientérico. La actividad de los complejos enzimáticos de la cadena

Mechanisms of Hyperhomocysteinemia Induced Skeletal Muscle Myopathy after Ischemia in the CBS−/+ Mouse Model

Directory of Open Access Journals (Sweden)

Sudhakar Veeranki

2015-01-01

Full Text Available Although hyperhomocysteinemia (HHcy elicits lower than normal body weights and skeletal muscle weakness, the mechanisms remain unclear. Despite the fact that HHcy-mediated enhancement in ROS and consequent damage to regulators of different cellular processes is relatively well established in other organs, the nature of such events is unknown in skeletal muscles. Previously, we reported that HHcy attenuation of PGC-1α and HIF-1α levels enhanced the likelihood of muscle atrophy and declined function after ischemia. In the current study, we examined muscle levels of homocysteine (Hcy metabolizing enzymes, anti-oxidant capacity and focused on protein modifications that might compromise PGC-1α function during ischemic angiogenesis. Although skeletal muscles express the key enzyme (MTHFR that participates in re-methylation of Hcy into methionine, lack of trans-sulfuration enzymes (CBS and CSE make skeletal muscles more susceptible to the HHcy-induced myopathy. Our study indicates that elevated Hcy levels in the CBS−/+ mouse skeletal muscles caused diminished anti-oxidant capacity and contributed to enhanced total protein as well as PGC-1α specific nitrotyrosylation after ischemia. Furthermore, in the presence of NO donor SNP, either homocysteine (Hcy or its cyclized version, Hcy thiolactone, not only increased PGC-1α specific protein nitrotyrosylation but also reduced its association with PPARγ in C2C12 cells. Altogether these results suggest that HHcy exerts its myopathic effects via reduction of the PGC-1/PPARγ axis after ischemia.

Influence of chain length of pyrene fatty acids on their uptake and metabolism by Epstein-Barr-virus-transformed lymphoid cell lines from a patient with multisystemic lipid storage myopathy and from control subjects.

OpenAIRE

Radom, J; Salvayre, R; Levade, T; Douste-Blazy, L

1990-01-01

The uptake and intracellular metabolism of 4-(1-pyrene)butanoic acid (P4), 10-(1-pyrene)decanoic acid (P10) and 12-(1-pyrene)dodecanoic acid (P12) were investigated in cultured lymphoid cell lines from normal individuals and from a patient with multisystemic lipid storage myopathy (MLSM). The cellular uptake was shown to be dependent on the fatty-acid chain length, but no significant difference in the uptake of pyrene fatty acids was observed between MLSM and control lymphoid cells. After inc...

Presence of the glycogen synthase 1 (GYS1) mutation causing type 1 polysaccharide storage myopathy in continental European draught horse breeds.

Science.gov (United States)

Baird, J D; Valberg, S J; Anderson, S M; McCue, M E; Mickelson, J R

2010-11-13

The purpose of this study was to determine which continental European draught horse breeds harbour a mutation in the glycogen synthase 1 gene (GYS1) that is known to be responsible for type 1 polysaccharide storage myopathy in quarter horses and North American draught horses. Of a non-random selection of continental European draught horses belonging to 13 breeds, 62 per cent (250 of 403) tested were found to carry the mutant allele. The horses were located in Belgium, France, Germany, The Netherlands, Spain and Sweden. The mutation was identified in animals from each of the breeds examined. In the breeds in which more than 15 animals were available for testing, the highest percentages of GYS1-positive horses were found in the Belgian trekpaard (92 per cent; 35 of 38 horses tested), Comtois (80 per cent; 70 of 88), Netherlands trekpaard (74 per cent; 17 of 23), Rheinisch-Deutsches kaltblut (68 per cent; 30 of 44) and Breton (64 per cent; 32 of 51).

Intravenous immune globulin in hereditary inclusion body myopathy: a pilot study

Directory of Open Access Journals (Sweden)

Dorward Heidi

2007-01-01

Full Text Available Abstract Background Hereditary Inclusion Body Myopathy (HIBM is an autosomal recessive, adult onset, non-inflammatory neuromuscular disorder with no effective treatment. The causative gene, GNE, codes for UDP-N-acetylglucosamine 2-epimerase/N-acetylmannosamine kinase, which catalyzes the first two reactions in the synthesis of sialic acid. Reduced sialylation of muscle glycoproteins, such as α-dystroglycan and neural cell adhesion molecule (NCAM, has been reported in HIBM. Methods We treated 4 HIBM patients with intravenous immune globulin (IVIG, in order to provide sialic acid, because IgG contains 8 μmol of sialic acid/g. IVIG was infused as a loading dose of 1 g/kg on two consecutive days followed by 3 doses of 400 mg/kg at weekly intervals. Results For all four patients, mean quadriceps strength improved from 19.0 kg at baseline to 23.2 kg (+22% directly after IVIG loading to 25.6 kg (+35% at the end of the study. Mean shoulder strength improved from 4.1 kg at baseline to 5.9 kg (+44% directly after IVIG loading to 6.0 kg (+46% at the end of the study. The composite improvement for 8 other muscle groups was 5% after the initial loading and 19% by the end of the study. Esophageal motility and lingual strength improved in the patients with abnormal barium swallows. Objective measures of functional improvement gave variable results, but the patients experienced improvements in daily activities that they considered clinically significant. Immunohistochemical staining and immunoblotting of muscle biopsies for α-dystroglycan and NCAM did not provide consistent evidence for increased sialylation after IVIG treatment. Side effects were limited to transient headaches and vomiting. Conclusion The mild benefits in muscle strength experienced by HIBM patients after IVIG treatment may be related to the provision of sialic acid supplied by IVIG. Other sources of sialic acid are being explored as treatment options for HIBM.

BAG3 directly interacts with mutated alphaB-crystallin to suppress its aggregation and toxicity.

Directory of Open Access Journals (Sweden)

Akinori Hishiya

Full Text Available A homozygous disruption or genetic mutation of the bag3 gene causes progressive myofibrillar myopathy in mouse and human skeletal and cardiac muscle disorder while mutations in the small heat shock protein αB-crystallin gene (CRYAB are reported to be responsible for myofibrillar myopathy. Here, we demonstrate that BAG3 directly binds to wild-type αB-crystallin and the αB-crystallin mutant R120G, via the intermediate domain of BAG3. Peptides that inhibit this interaction in an in vitro binding assay indicate that two conserved Ile-Pro-Val regions of BAG3 are involved in the interaction with αB-crystallin, which is similar to results showing BAG3 binding to HspB8 and HspB6. BAG3 overexpression increased αB-crystallin R120G solubility and inhibited its intracellular aggregation in HEK293 cells. BAG3 suppressed cell death induced by αB-crystallin R120G overexpression in differentiating C2C12 mouse myoblast cells. Our findings indicate a novel function for BAG3 in inhibiting protein aggregation caused by the genetic mutation of CRYAB responsible for human myofibrillar myopathy.

BAG3 Directly Interacts with Mutated alphaB-Crystallin to Suppress Its Aggregation and Toxicity

Science.gov (United States)

Hishiya, Akinori; Salman, Mortada Najem; Carra, Serena; Kampinga, Harm H.; Takayama, Shinichi

2011-01-01

A homozygous disruption or genetic mutation of the bag3 gene causes progressive myofibrillar myopathy in mouse and human skeletal and cardiac muscle disorder while mutations in the small heat shock protein αB-crystallin gene (CRYAB) are reported to be responsible for myofibrillar myopathy. Here, we demonstrate that BAG3 directly binds to wild-type αB-crystallin and the αB-crystallin mutant R120G, via the intermediate domain of BAG3. Peptides that inhibit this interaction in an in vitro binding assay indicate that two conserved Ile-Pro-Val regions of BAG3 are involved in the interaction with αB-crystallin, which is similar to results showing BAG3 binding to HspB8 and HspB6. BAG3 overexpression increased αB-crystallin R120G solubility and inhibited its intracellular aggregation in HEK293 cells. BAG3 suppressed cell death induced by αB-crystallin R120G overexpression in differentiating C2C12 mouse myoblast cells. Our findings indicate a novel function for BAG3 in inhibiting protein aggregation caused by the genetic mutation of CRYAB responsible for human myofibrillar myopathy. PMID:21423662

Relationship between work rate and oxygen uptake in mitochondrial myopathy during ramp-incremental exercise

Directory of Open Access Journals (Sweden)

A.C. Gimenes

2011-04-01

Full Text Available We determined the response characteristics and functional correlates of the dynamic relationship between the rate (Δ of oxygen consumption ( O2 and the applied power output (work rate = WR during ramp-incremental exercise in patients with mitochondrial myopathy (MM. Fourteen patients (7 males, age 35.4 ± 10.8 years with biopsy-proven MM and 10 sedentary controls (6 males, age 29.0 ± 7.8 years took a ramp-incremental cycle ergometer test for the determination of the O2 on-exercise mean response time (MRT and the gas exchange threshold (GET. The ΔO2/ΔWR slope was calculated up to GET (S1, above GET (S2 and over the entire linear portion of the response (S T. Knee muscle endurance was measured by isokinetic dynamometry. As expected, peak O2 and muscle performance were lower in patients than controls (P O2/ΔWR than controls, especially the S2 component (6.8 ± 1.5 vs 10.3 ± 0.6 mL·min-1·W-1, respectively; P O2/ΔWR (S T and muscle endurance, MRT-O2, GET and peak O2 in MM patients (P O2/ΔWR below 8 mL·min-1·W-1 had severely reduced peak O2 values (O2 had lower ΔO2/ΔWR (P O2/ΔWR is typically reduced in patients with MM, being related to increased functional impairment and higher cardiopulmonary stress.

Mutation Spectrum in the Large GTPase Dynamin 2, and Genotype–Phenotype Correlation in Autosomal Dominant Centronuclear Myopathy

Science.gov (United States)

Böhm, Johann; Biancalana, Valérie; DeChene, Elizabeth T.; Bitoun, Marc; Pierson, Christopher R.; Schaefer, Elise; Karasoy, Hatice; Dempsey, Melissa A.; Klein, Fabrice; Dondaine, Nicolas; Kretz, Christine; Haumesser, Nicolas; Poirson, Claire; Toussaint, Anne; Greenleaf, Rebecca S.; Barger, Melissa A.; Mahoney, Lane J.; Kang, Peter B.; Zanoteli, Edmar; Vissing, John; Witting, Nanna; Echaniz-Laguna, Andoni; Wallgren-Pettersson, Carina; Dowling, James; Merlini, Luciano; Oldfors, Anders; Ousager, Lilian Bomme; Melki, Judith; Krause, Amanda; Jern, Christina; Oliveira, Acary S. B.; Petit, Florence; Jacquette, Aurélia; Chaussenot, Annabelle; Mowat, David; Leheup, Bruno; Cristofano, Michele; Aldea, Juan José Poza; Michel, Fabrice; Furby, Alain; Llona, Jose E. Barcena; Van Coster, Rudy; Bertini, Enrico; Urtizberea, Jon Andoni; Drouin-Garraud, Valérie; Béroud, Christophe; Prudhon, Bernard; Bedford, Melanie; Mathews, Katherine; Erby, Lori A. H.; Smith, Stephen A.; Roggenbuck, Jennifer; Crowe, Carol A.; Spitale, Allison Brennan; Johal, Sheila C.; Amato, Anthony A.; Demmer, Laurie A.; Jonas, Jessica; Darras, Basil T.; Bird, Thomas D.; Laurino, Mercy; Welt, Selman I.; Trotter, Cynthia; Guicheney, Pascale; Das, Soma; Mandel, Jean-Louis; Beggs, Alan H.; Laporte, Jocelyn

2012-01-01

Centronuclear myopathy (CNM) is a genetically heterogeneous disorder associated with general skeletal muscle weakness, type I fiber predominance and atrophy, and abnormally centralized nuclei. Autosomal dominant CNM is due to mutations in the large GTPase dynamin 2 (DNM2), a mechanochemical enzyme regulating cytoskeleton and membrane trafficking in cells. To date, 40 families with CNM-related DNM2 mutations have been described, and here we report 60 additional families encompassing a broad genotypic and phenotypic spectrum. In total, 18 different mutations are reported in 100 families and our cohort harbors nine known and four new mutations, including the first splice-site mutation. Genotype–phenotype correlation hypotheses are drawn from the published and new data, and allow an efficient screening strategy for molecular diagnosis. In addition to CNM, dissimilar DNM2 mutations are associated with Charcot–Marie–Tooth (CMT) peripheral neuropathy (CMTD1B and CMT2M), suggesting a tissue-specific impact of the mutations. In this study, we discuss the possible clinical overlap of CNM and CMT, and the biological significance of the respective mutations based on the known functions of dynamin 2 and its protein structure. Defects in membrane trafficking due to DNM2 mutations potentially represent a common pathological mechanism in CNM and CMT. PMID:22396310

B-cell depletion is protective against anti-AAV capsid immune response: a human subject case study

Directory of Open Access Journals (Sweden)

M Corti

2014-01-01

Full Text Available Gene therapy strategies for congenital myopathies may require repeat administration of adeno-associated viral (AAV vectors due to aspects of the clinical application, such as: (i administration of doses below therapeutic efficacy in patients enrolled in early phase clinical trials; (ii progressive reduction of the therapeutic gene expression over time as a result of increasing muscle mass in patients treated at a young age; and (iii a possibly faster depletion of pathogenic myofibers in this patient population. Immune response triggered by the first vector administration, and to subsequent doses, represents a major obstacle for successful gene transfer in young patients. Anti-capsid and anti-transgene product related humoral and cell-mediated responses have been previously observed in all preclinical models and human subjects who received gene therapy or enzyme replacement therapy (ERT for congenital myopathies. Immune responses may result in reduced efficacy of the gene transfer over time and/or may preclude for the possibility of re-administration of the same vector. In this study, we evaluated the immune response of a Pompe patient dosed with an AAV1-GAA vector after receiving Rituximab and Sirolimus to modulate reactions against ERT. A key finding of this single subject case report is the observation that B-cell ablation with rituximab prior to AAV vector exposure results in non-responsiveness to both capsid and transgene, therefore allowing the possibility of repeat administration in the future. This observation is significant for future gene therapy studies and establishes a clinically relevant approach to blocking immune responses to AAV vectors.

Hypoglycin A Content in Blood and Urine Discriminates Horses with Atypical Myopathy from Clinically Normal Horses Grazing on the Same Pasture.

Directory of Open Access Journals (Sweden)

M Bochnia

Full Text Available Hypoglycin A (HGA in seeds of Acer spp. is suspected to cause seasonal pasture myopathy in North America and equine atypical myopathy (AM in Europe, fatal diseases in horses on pasture. In previous studies, this suspicion was substantiated by the correlation of seed HGA content with the concentrations of toxic metabolites in urine and serum (MCPA-conjugates of affected horses. However, seed sampling was conducted after rather than during an outbreak of the disease. The aim of this study was to further confirm the causality between HGA occurrence and disease outbreak by seed sampling during an outbreak and the determination of i HGA in seeds and of ii HGA and MCPA-conjugates in urine and serum of diseased horses. Furthermore, cograzing healthy horses, which were present on AM affected pastures, were also investigated. AM-pastures in Germany were visited to identify seeds of Acer pseudoplatanus and serum (n = 8 as well as urine (n = 6 from a total of 16 diseased horses were analyzed for amino acid composition by LC-ESI-MS/MS, with a special focus on the content of HGA. Additionally, the content of its toxic metabolite was measured in its conjugated form in body fluids (UPLC-MS/MS. The seeds contained 1.7-319.8 μg HGA/g seed. The content of HGA in serum of affected horses ranged from 387.8-8493.8 μg/L (controls < 10 μg/L, and in urine from 143.8-926.4 μg/L (controls < 10 μg/L, respectively. Healthy cograzing horses on AM-pastures showed higher serum (108.8 ± 83.76 μg/L and urine concentrations (26.9 ± 7.39 μg/L compared to control horses, but lower concentrations compared to diseased horses. The range of MCPA-carnitine and creatinine concentrations found in diseased horses in serum and urine were 0.17-0.65 mmol/L (controls < 0.01, and 0.34-2.05 μmol/mmoL (controls < 0.001, respectively. MCPA-glycine levels in urine of cograzing horses were higher compared to controls. Thus, the causal link between HGA intoxication and disease outbreak

A knock-in/knock-out mouse model of HSPB8-associated distal hereditary motor neuropathy and myopathy reveals toxic gain-of-function of mutant Hspb8.

Science.gov (United States)

Bouhy, Delphine; Juneja, Manisha; Katona, Istvan; Holmgren, Anne; Asselbergh, Bob; De Winter, Vicky; Hochepied, Tino; Goossens, Steven; Haigh, Jody J; Libert, Claude; Ceuterick-de Groote, Chantal; Irobi, Joy; Weis, Joachim; Timmerman, Vincent

2018-01-01

Mutations in the small heat shock protein B8 gene (HSPB8/HSP22) have been associated with distal hereditary motor neuropathy, Charcot-Marie-Tooth disease, and recently distal myopathy. It is so far not clear how mutant HSPB8 induces the neuronal and muscular phenotypes and if a common pathogenesis lies behind these diseases. Growing evidence points towards a role of HSPB8 in chaperone-associated autophagy, which has been shown to be a determinant for the clearance of poly-glutamine aggregates in neurodegenerative diseases but also for the maintenance of skeletal muscle myofibrils. To test this hypothesis and better dissect the pathomechanism of mutant HSPB8, we generated a new transgenic mouse model leading to the expression of the mutant protein (knock-in lines) or the loss-of-function (functional knock-out lines) of the endogenous protein Hspb8. While the homozygous knock-in mice developed motor deficits associated with degeneration of peripheral nerves and severe muscle atrophy corroborating patient data, homozygous knock-out mice had locomotor performances equivalent to those of wild-type animals. The distal skeletal muscles of the post-symptomatic homozygous knock-in displayed Z-disk disorganisation, granulofilamentous material accumulation along with Hspb8, αB-crystallin (HSPB5/CRYAB), and desmin aggregates. The presence of the aggregates correlated with reduced markers of effective autophagy. The sciatic nerve of the homozygous knock-in mice was characterized by low autophagy potential in pre-symptomatic and Hspb8 aggregates in post-symptomatic animals. On the other hand, the sciatic nerve of the homozygous knock-out mice presented a normal morphology and their distal muscle displayed accumulation of abnormal mitochondria but intact myofiber and Z-line organisation. Our data, therefore, suggest that toxic gain-of-function of mutant Hspb8 aggregates is a major contributor to the peripheral neuropathy and the myopathy. In addition, mutant Hspb8 induces

Radioimmunoassay for human myoglobin

International Nuclear Information System (INIS)

Kondo, Akira

1981-01-01

1 A new radioimmunoassay (RIA) for human myoglobin (Mb) using two antibody technique was developed as a microassay of Mb. This RIA is characterized as follows; 1) Radioiodination of human Mb was successfully done for the first time by chloramine T method, which yielded Iabelled Mb with high specific activities ranging 40 - 60 μCi/μg. 2) Affinity chromatography was used to obtain purified anti-human Mb antibody, which improved the sensitivity of the RIA remarkably, and excluded the effects of serum and urine. 2 The sensitivity of the RIA was 1 ng/ml in sera and 2 ng/ml in urine. The average recovery was 92.7%. Both intra-assay and inter-assay coefficients of variation were below 10%. 3 With this method, Mb purified from skeletal and cardiac muscles was shown to have same immunological nature. 4 Serum concentrations of Mb in normal adults were 13.1 +- 6.1 ng/ml (mean +- S.D.) with a range of 1 - 28 ng/ml. No sex difference was observed. Urinary Mb Ievels in normal adults were less than 4 ng/ml and 24-hour urinary excretions were less than 6 μg. With this method, serum and urinary Mb concentrations were determined in patients with various disorders such as myopathies and myocardial disorders and with anesthesia. Serum Mb concentrations were revealed to be elevated to 50000 ng/ml in malignant hyperthermia, 4000 ng/ml in acute myocardial infarction, 1000 ng/ml in Duchenne muscular dystrophy and 4000 ng/ml in polymyositis. Urinary Mb level was elevated when serum Mb rose to 2000 - 3000 ng/ml. 5 In order to apply RIA of Mb in daily clinical practices, time needed for the assay was shortened by separation of free and antibody-bound Mb by the polyethylene glycol method immediately after incubation was performed at 37 0 C for 2 hours. (author)

Radioimmunoassay for human myoglobin

Energy Technology Data Exchange (ETDEWEB)

Kondo, A. (Tokushima Univ. (Japan). School of Medicine)

1981-04-01

1 A new radioimmunoassay (RIA) for human myoglobin (Mb) using two antibody technique was developed as a microassay of Mb. This RIA is characterized as follows; 1) Radioiodination of human Mb was successfully done for the first time by chloramine T method, which yielded Iabelled Mb with high specific activities ranging 40 - 60 ..mu..Ci/..mu..g. 2) Affinity chromatography was used to obtain purified anti-human Mb antibody, which improved the sensitivity of the RIA remarkably, and excluded the effects of serum and urine. 2 The sensitivity of the RIA was 1 ng/ml in sera and 2 ng/ml in urine. The average recovery was 92.7%. Both intra-assay and inter-assay coefficients of variation were below 10%. 3 With this method, Mb purified from skeletal and cardiac muscles was shown to have same immunological nature. 4 Serum concentrations of Mb in normal adults were 13.1 +- 6.1 ng/ml (mean +- S.D.) with a range of 1 - 28 ng/ml. No sex difference was observed. Urinary Mb Ievels in normal adults were less than 4 ng/ml and 24-hour urinary excretions were less than 6 ..mu..g. With this method, serum and urinary Mb concentrations were determined in patients with various disorders such as myopathies and myocardial disorders and with anesthesia. Serum Mb concentrations were revealed to be elevated to 50000 ng/ml in malignant hyperthermia, 4000 ng/ml in acute myocardial infarction, 1000 ng/ml in Duchenne muscular dystrophy and 4000 ng/ml in polymyositis. Urinary Mb level was elevated when serum Mb rose to 2000 - 3000 ng/ml. 5 In order to apply RIA of Mb in daily clinical practices, time needed for the assay was shortened by separation of free and antibody-bound Mb by the polyethylene glycol method immediately after incubation was performed at 37/sup 0/C for 2 hours.

Computed tomographical findings of skeletal muscles in rimmed vacuole type distal myopathy

International Nuclear Information System (INIS)

Kunimoto, Masanari; Kawai, Mitsuru; Goto, Jun; Nakano, Imaharu

1987-01-01

Skeletal muscle CT scans of three patients with biopsy-proven rimmed vacuole type distal myopathy(RVDM) from two unrelated families showed unique involvement pattern of the lower extremities. Parents of the patients in both families are first cousins. T.Y. is a 36-year-old woman who noticed mild difficulty in walking at 34 years of age. Now she shows waddling but still indpendent gait. Manual muscle test (MMT) revealed the following results: fair (3+/5) for hip flexion, 3 for hip extension, 3 for knee flexion, normal (5/5) for knee extension, poor (2/5) for ankle dorsi-flexion, good (4/5) for ankle plantar flexion. T.M., a 34-year-old younger sister of T.Y., started dragging her feet on gait at age 27. She could walk neither on toes nor heels. At present, she can walk only with support. MMT showed the following: 3- and trace (1/5) for hip flexion and extension, 3- and 4 for knee flexion and extension, 1 for ankle plantar- and dorsiflexion. K.W., a 33-year-old woman, began to drag her foot tips in walk and became unable to walk on toes at age 21. The leg weakness progressed into the wheelchair-ridden state at age 30. MMT gave the following results: 1 for hip flexion and extension, 2 and 4 for knee flexion and extension, zero for plantar- and dorsi-flexion. The most impressive CT findings common to these three patients are prominent contrast between the quadriceps muscles and the adductor- and hamstring-group: the former is markedly well preserved even in the most advanced patient (K.W.) while the latter are diffusely and severely affected even in the least affected patient (T.Y.). This finding well coincides with the results of MMT: the knee extensor (quadriceps muscles) fairly well keeps its strength even in the most advanced patient but the knee flexors (adductors and hamstrings) are definitely affected in the early stage of the condition. (J.P.N.)

Computed tomographical findings of skeletal muscles in rimmed vacuole type distal myopathy

Energy Technology Data Exchange (ETDEWEB)

Kunimoto, Masanari; Kawai, Mitsuru; Goto, Jun; Nakano, Imaharu

1987-03-01

Skeletal muscle CT scans of three patients with biopsy-proven rimmed vacuole type distal myopathy(RVDM) from two unrelated families showed unique involvement pattern of the lower extremities. Parents of the patients in both families are first cousins. T.Y. is a 36-year-old woman who noticed mild difficulty in walking at 34 years of age. Now she shows waddling but still indpendent gait. Manual muscle test (MMT) revealed the following results: fair (3+/5) for hip flexion, 3 for hip extension, 3 for knee flexion, normal (5/5) for knee extension, poor (2/5) for ankle dorsi-flexion, good (4/5) for ankle plantar flexion. T.M., a 34-year-old younger sister of T.Y., started dragging her feet on gait at age 27. She could walk neither on toes nor heels. At present, she can walk only with support. MMT showed the following: 3- and trace (1/5) for hip flexion and extension, 3- and 4 for knee flexion and extension, 1 for ankle plantar- and dorsiflexion. K.W., a 33-year-old woman, began to drag her foot tips in walk and became unable to walk on toes at age 21. The leg weakness progressed into the wheelchair-ridden state at age 30. MMT gave the following results: 1 for hip flexion and extension, 2 and 4 for knee flexion and extension, zero for plantar- and dorsi-flexion. The most impressive CT findings common to these three patients are prominent contrast between the quadriceps muscles and the adductor- and hamstring-group: the former is markedly well preserved even in the most advanced patient (K.W.) while the latter are diffusely and severely affected even in the least affected patient (T.Y.). This finding well coincides with the results of MMT: the knee extensor (quadriceps muscles) fairly well keeps its strength even in the most advanced patient but the knee flexors (adductors and hamstrings) are definitely affected in the early stage of the condition. (J.P.N.).

Noninvasive evaluation of adult onset myopathy from carnitine palmitoyl transferase II deficiency using proton magnetic resonance spectroscopy.

Science.gov (United States)

Videen, J S; Haseler, L J; Karpinski, N C; Terkeltaub, R A

1999-08-01

The adult onset metabolic myopathy of carnitine palmitoyl transferase II (CPT II) deficiency is under-recognized, in part due to variable degrees of enzyme deficiency and symptomatology, as well as limitations in means for noninvasive evaluation. We describe a proton magnetic resonance spectroscopy (MRS) technique, using a standard clinical magnetic resonance imaging scanner, to diagnose and help monitor the response to therapy in adult CPT II deficiency. A 53-year-old woman presented with a long standing history of diffuse aching and fatigue provoked by high fat intake, fasting, or prolonged exertion. Muscle biopsy revealed myopathic features and a deficiency (33% of control) of CPT II activity with elevated palmitoyl carnitine. Proton MRS of the soleus muscle was performed using a 1.5 Tesla scanner before and during dietary therapy. Proton MRS revealed shortening of the transverse relaxation time (T2), consistent with increased acetylation of the carnitine pool. The symptoms resolved completely by treatment with frequent feedings of a high carbohydrate diet low in long chain fatty acids supplemented with medium chain triglycerides and L-carnitine. Recovery of normal muscle MRS and carnitine T2 relaxation was documented by the third month of therapy. Proton MRS is a novel, potentially useful, and readily available adjunct in the diagnosis and therapeutic monitoring of muscle CPT II deficiency.

Effect of Adalimumab on Refractory Arthritis in Juvenile Idiopathic Inflammatory Myopathy with Anti-MDA5 Autoantibody

Directory of Open Access Journals (Sweden)

Takako Miyamae

2018-01-01

Full Text Available A 10-year-old girl manifested persistent fever, skin rash, leg pain, fatigue, and joint pain. Based on muscle weakness, elevated muscle-derived enzymes, magnetic resonance imaging, and skin biopsy results, the diagnosis was juvenile idiopathic inflammatory myopathies (JIIM. Chest CT was normal; the anti-melanoma differentiation-associated protein-5 (anti-MDA5 autoantibody was positive. Initial manifestations subsided after prednisolone (PSL and methotrexate treatment. After the PSL dosage was decreased, the patient presented with metacarpophalangeal (MCP joint pain and swelling in both index fingers, synovial fluid, and signals on power Doppler ultrasound. The arthritis was refractory to cyclosporine and tacrolimus. Radiography showed progressive MCP joint space narrowing and joint erosion. Adalimumab was initiated 14 months after disease onset. There was a mildly increased matrix metalloproteinase-3 (MMP3 level, an erythrocyte sedimentation ratio (ESR, and a normal CRP level. Adalimumab resulted in decreased MCP joint pain and swelling. PSL was discontinued 10 months after adalimumab initiation; after 9 more months of adalimumab, there were no significant ultrasonography findings. MMP3 and ESR levels normalized during treatment. Radiography after 2 years of adalimumab showed further progressive MCP joint space narrowing restricting dorsiflexion. This report clarified that anti-MDA5-positive JIIM joint manifestations were due to active synovitis and that adalimumab is required for severe cases. Further experience is needed to determine the pathology, severity, and prognosis of this type of arthritis.

Influence of erythrocyte oxygenation and intravascular ATP on resting and exercising skeletal muscle blood flow in humans with mitochondrial myopathy

DEFF Research Database (Denmark)

Jeppesen, Tina D; Vissing, John; González-Alonso, José

2012-01-01

Oxygen (O(2)) extraction is impaired in exercising skeletal muscle of humans with mutations of mitochondrial DNA (mtDNA), but the muscle hemodynamic response to exercise has never been directly investigated. This study sought to examine the extent to which human skeletal muscle perfusion can incr...

A rare case report of simultaneous presentation of myopathy, Addison's disease, primary hypoparathyroidism, and Fanconi syndrome in a child diagnosed with Kearns-Sayre syndrome.

Science.gov (United States)

Tzoufi, Meropi; Makis, Alexandros; Chaliasos, Nikolaos; Nakou, Iliada; Siomou, Ekaterini; Tsatsoulis, Agathoklis; Zikou, Anastasia; Argyropoulou, Maria; Bonnefont, Jean Paul; Siamopoulou, Antigone

2013-04-01

Kearns-Sayre syndrome (KSS) is a rare mitochondrial DNA deletion syndrome defined as the presence of ophthalmoplegia, pigmentary retinopathy, onset less than age 20 years, and one of the following: cardiac conduction defects, cerebellar syndrome, or cerebrospinal fluid protein above 100 mg/dl. KSS may affect many organ systems causing endocrinopathies, encephalomyopathy, sensorineural hearing loss, and renal tubulopathy. Clinical presentation at diagnosis is quite heterogeneous and, usually, few organs are affected with progression to generalized disease early in adulthood. We present the case of a boy with KSS presenting at the age of 5 years with myopathy, Addison's disease, primary hypoparathyroidism, and Fanconi syndrome. The proper replacement treatment along with the administration of mitochondrial metabolism-improving agents had a brief ameliorating effect, but gradual severe multisystemic deterioration was inevitable over the next 5 years. This report highlights the fact that in case of simultaneous presentation of polyendocrinopathies and renal disease early in childhood, KSS should be considered.

Novel Variants in Individuals with RYR1-Related Congenital Myopathies: Genetic, Laboratory, and Clinical Findings

Directory of Open Access Journals (Sweden)

Joshua J. Todd

2018-03-01

Full Text Available The ryanodine receptor 1-related congenital myopathies (RYR1-RM comprise a spectrum of slow, rare neuromuscular diseases. Affected individuals present with a mild-to-severe symptomatology ranging from proximal muscle weakness, hypotonia and joint contractures to scoliosis, ophthalmoplegia, and respiratory involvement. Although there is currently no FDA-approved treatment for RYR1-RM, our group recently conducted the first clinical trial in this patient population (NCT02362425. This study aimed to characterize novel RYR1 variants with regard to genetic, laboratory, muscle magnetic resonance imaging (MRI, and clinical findings. Genetic and histopathology reports were obtained from participant’s medical records. Alamut Visual Software was used to determine if participant’s variants had been previously reported and to assess predicted pathogenicity. Physical exams, pulmonary function tests, T1-weighted muscle MRI scans, and blood measures were completed during the abovementioned clinical trial. Six novel variants (two de novo, three dominant, and one recessive were identified in individuals with RYR1-RM. Consistent with established RYR1-RM histopathology, cores were observed in all biopsies, except Case 6 who exhibited fiber-type disproportion. Muscle atrophy and impaired mobility with Trendelenburg gait were the most common clinical symptoms and were identified in all cases. Muscle MRI revealed substantial inter-individual variation in fatty infiltration corroborating the heterogeneity of the disease. Two individuals with dominant RYR1 variants exhibited respiratory insufficiency: a clinical symptom more commonly associated with recessive RYR1-RM cases. This study demonstrates that a genetics-led approach is suitable for the diagnosis of suspected RYR1-RM which can be corroborated through histopathology, muscle MRI and clinical examination.

Diffusion and Perfusion Characteristics of MELAS (Mitochondrial Myopathy, Encephalopathy, Lactic Acidosis, and Stroke-Like Episode) in Thirteen Patients

International Nuclear Information System (INIS)

Kim, Ji Hye; Jeon, Tae Yeon; Eo, Hong; Yoo, So Young; Lim, Myung Kwan; Rha, Jung Ho; Shu, Chang Hae

2011-01-01

We analyzed the diffusion and perfusion characteristics of acute MELAS (mitochondrial myopathy, encephalopathy, lactic acidosis, and stroke-like episode) lesions in a large series to investigate the controversial changes of the apparent diffusion coefficient (ADC) that were reported in prior studies. We analyzed 44 newly appearing lesions during 28 stroke-like episodes in 13 patients with MELAS. We performed a visual assessment of the MR images including the ADC and perfusion maps, comparison of the ADC between the normal and abnormal areas, comparison of % ADC between the 44 MELAS lesions and the 30 acute ischemic infarcts. In addition, the patterns of evolution on follow-up MR images were analyzed. Decreased, increased, and normal ADCs were noted in 16 (36%), 16 (36%), and 12 (27%) lesions, respectively. The mean % ADC was 102 ± 40.9% in the MELAS and 64 ± 17.8% in the acute vascular infarcts (p < 0.001), while perfusion imaging demonstrated hyper-perfusion in six acute MELAS lesions. On follow-up images, resolution, progression, and tissue loss were noted in 10, 4, and 17 lesions, respectively. The cytotoxic edema gradually evolves following an acute stroke-like episode in patients with MELAS, and this may overlap with hyper-perfusion and vasogenic edema. The edematous swelling may be reversible or it may evolve to encephalomalacia, suggesting irreversible damage

Diffusion and Perfusion Characteristics of MELAS (Mitochondrial Myopathy, Encephalopathy, Lactic Acidosis, and Stroke-Like Episode) in Thirteen Patients

Science.gov (United States)

Kim, Ji Hye; Jeon, Tae Yeon; Rha, Jung Ho; Eo, Hong; Yoo, So-Young; Shu, Chang Hae

2011-01-01

Objective We analyzed the diffusion and perfusion characteristics of acute MELAS (mitochondrial myopathy, encephalopathy, lactic acidosis, and stroke-like episode) lesions in a large series to investigate the controversial changes of the apparent diffusion coefficient (ADC) that were reported in prior studies. Materials and Methods We analyzed 44 newly appearing lesions during 28 stroke-like episodes in 13 patients with MELAS. We performed a visual assessment of the MR images including the ADC and perfusion maps, comparison of the ADC between the normal and abnormal areas, comparison of % ADC between the 44 MELAS lesions and the 30 acute ischemic infarcts. In addition, the patterns of evolution on follow-up MR images were analyzed. Results Decreased, increased, and normal ADCs were noted in 16 (36%), 16 (36%), and 12 (27%) lesions, respectively. The mean % ADC was 102 ± 40.9% in the MELAS and 64 ± 17.8% in the acute vascular infarcts (p MELAS lesions. On follow-up images, resolution, progression, and tissue loss were noted in 10, 4, and 17 lesions, respectively. Conclusion The cytotoxic edema gradually evolves following an acute stroke-like episode in patients with MELAS, and this may overlap with hyper-perfusion and vasogenic edema. The edematous swelling may be reversible or it may evolve to encephalomalacia, suggesting irreversible damage. PMID:21228936

GLUT11, but not GLUT8 or GLUT12, is expressed in human skeletal muscle in a fibre type-specific pattern

DEFF Research Database (Denmark)

Gaster, M; Handberg, A; Schürmann, A

2004-01-01

or amyotrophic lateral sclerosis (ALS) were studied. GLUT8 and 12 immunoreactivity was below detection level in both developing and adult muscle fibres. GLUT11 immunoreactivity, however, was present in slow-twitch muscle fibres, but not in fast twitch fibres. Since, in contrast, GLUT4 was expressed in all...... exclusively in slow-twitch muscle fibres and is unaffected by physiological and pathophysiological conditions except in primary myopathy. GLUT8 and GLUT12 do not appear to be of importance in human muscle under physiological and pathophysiological conditions....... to induce GLUT8 or -12 expression. Likewise, the fibre type-dependent pattern of GLUT11 immunoreactivity was unaltered. However, some slow muscle fibres lose their GLUT11 immunoreactivity under regeneration. Our results indicate that GLUT11 immunoreactivity, in contrast to that of GLUT4, is expressed...

Loss of LMOD1 impairs smooth muscle cytocontractility and causes megacystis microcolon intestinal hypoperistalsis syndrome in humans and mice

NARCIS (Netherlands)

D. Halim (Danny); M.P. Wilson (Michael P.); D. Oliver (Daniel); E. Brosens (Erwin); J.B. Verheij (Joke); Y. Han (Yu); V. Nanda (Vivek); Q. Lyu (Qing); M. Doukas (Michael); H.A. Stoop (Hans A.); R.W.W. Brouwer (Rutger); W.F.J. van IJcken (Wilfred); O.J. Slivano (Orazio J.); A.J. Burns (Alan); C.K. Christie (Christine K.); K.L. De Mesy Bentley (Karen L.); A.S. Brooks (Alice); D. Tibboel (Dick); S. Xu (Suowen); Z.G. Jin (Zheng Gen); T. Djuwantono (Tono); W. Yan (Wei); M.M. Alves (Maria); R.M.W. Hofstra (Robert); J.M. Miano (Joseph M.)

2017-01-01

textabstractMegacystis microcolon intestinal hypoperistalsis syndrome (MMIHS) is a congenital visceral myopathy characterized by severe dilation of the urinary bladder and defective intestinal motility. The genetic basis of MMIHS has been ascribed to spontaneous and autosomal dominant mutations in

Mild myopathy is associated with COMP but not MATN3 mutations in mouse models of genetic skeletal diseases.

Directory of Open Access Journals (Sweden)

Katarzyna A Piróg

Full Text Available Pseudoachondroplasia (PSACH and multiple epiphyseal dysplasia (MED are skeletal disorders resulting from mutations in COMP, matrilin-3 or collagen IX and are characterised by short-limbed dwarfism and premature osteoarthritis. Interestingly, recent reports suggest patients can also manifest with muscle weakness. Here we present a detailed analysis of two mouse models of the PSACH/MED disease spectrum; ΔD469 T3-COMP (PSACH and V194D matrilin-3 (MED. In grip test experiments T3-COMP mice were weaker than wild-type littermates, whereas V194D mice behaved as controls, confirming that short-limbed dwarfism alone does not contribute to PSACH/MED-related muscle weakness. Muscles from T3-COMP mice showed an increase in centronuclear fibers at the myotendinous junction. T3-COMP tendons became more lax in cyclic testing and showed thicker collagen fibers when compared with wild-type tissue; matrilin-3 mutant tissues were indistinguishable from controls. This comprehensive study of the myopathy associated with PSACH/MED mutations enables a better understanding of the disease progression, confirms that it is genotype specific and that the limb weakness originates from muscle and tendon pathology rather than short-limbed dwarfism itself. Since some patients are primarily diagnosed with neuromuscular symptoms, this study will facilitate better awareness of the differential diagnoses that might be associated with the PSACH/MED spectrum and subsequent care of PSACH/MED patients.

Detection of differentially expressed genes in broiler pectoralis major muscle affected by White Striping - Wooden Breast myopathies.

Science.gov (United States)

Zambonelli, Paolo; Zappaterra, Martina; Soglia, Francesca; Petracci, Massimiliano; Sirri, Federico; Cavani, Claudio; Davoli, Roberta

2016-12-01

White Striping and Wooden Breast (WS/WB) are abnormalities increasingly occurring in the fillets of high breast yield and growth rate chicken hybrids. These defects lead to consistent economic losses for poultry meat industry, as affected broiler fillets present an impaired visual appearance that negatively affects consumers' acceptability. Previous studies have highlighted in affected fillets a severely damaged muscle, showing profound inflammation, fibrosis, and lipidosis. The present study investigated the differentially expressed genes and pathways linked to the compositional changes observed in WS/WB breast muscles, in order to outline a more complete framework of the gene networks related to the occurrence of this complex pathological picture. The biochemical composition was performed on 20 pectoralis major samples obtained from high breast yield and growth rate broilers (10 affected vs. 10 normal) and 12 out of the 20 samples were used for the microarray gene expression profiling (6 affected vs. 6 normal). The obtained results indicate strong changes in muscle mineral composition, coupled to an increased deposition of fat. In addition, 204 differentially expressed genes (DEG) were found: 102 up-regulated and 102 down-regulated in affected breasts. The gene expression pathways found more altered in WS/WB muscles are those related to muscle development, polysaccharide metabolic processes, proteoglycans synthesis, inflammation, and calcium signaling pathway. On the whole, the findings suggest that a multifactorial and complex etiology is associated with the occurrence of WS/WB muscle abnormalities, contributing to further defining the transcription patterns associated with these myopathies. © 2016 Poultry Science Association Inc.

Loss of LMOD1 impairs smooth muscle cytocontractility and causes megacystis microcolon intestinal hypoperistalsis syndrome in humans and mice

NARCIS (Netherlands)

Halim, Danny; Wilson, Michael P.; Oliver, Daniel; Brosens, Erwin; Verheij, Joke B. G. M.; Han, Yu; Nanda, Vivek; Lyu, Qing; Doukas, Michael; Stoop, Hans; Brouwer, Rutger W. W.; van IJcken, Wilfred F. J.; Slivano, Orazio J.; Burns, Alan J.; Christie, Christine K.; Bentley, Karen L. de Mesy; Brooks, Alice S.; Tibboel, Dick; Xu, Suowen; Jin, Zheng Gen; Djuwantono, Tono; Yan, Wei; Alves, Maria M.; Hofstra, Robert M. W.; Miano, Joseph M.

2017-01-01

Megacystis microcolon intestinal hypoperistalsis syndrome (MMIHS) is a congenital visceral myopathy characterized by severe dilation of the urinary bladder and defective intestinal motility. The genetic basis of MMIHS has been ascribed to spontaneous and autosomal dominant mutations in actin gamma 2

BAG3 (Bcl-2-Associated Athanogene-3) Coding Variant in Mice Determines Susceptibility to Ischemic Limb Muscle Myopathy by Directing Autophagy.

Science.gov (United States)

McClung, Joseph M; McCord, Timothy J; Ryan, Terence E; Schmidt, Cameron A; Green, Tom D; Southerland, Kevin W; Reinardy, Jessica L; Mueller, Sarah B; Venkatraman, Talaignair N; Lascola, Christopher D; Keum, Sehoon; Marchuk, Douglas A; Spangenburg, Espen E; Dokun, Ayotunde; Annex, Brian H; Kontos, Christopher D

2017-07-18

Critical limb ischemia is a manifestation of peripheral artery disease that carries significant mortality and morbidity risk in humans, although its genetic determinants remain largely unknown. We previously discovered 2 overlapping quantitative trait loci in mice, Lsq-1 and Civq-1 , that affected limb muscle survival and stroke volume after femoral artery or middle cerebral artery ligation, respectively. Here, we report that a Bag3 variant (Ile81Met) segregates with tissue protection from hind-limb ischemia. We treated mice with either adeno-associated viruses encoding a control (green fluorescent protein) or 2 BAG3 (Bcl-2-associated athanogene-3) variants, namely Met81 or Ile81, and subjected the mice to hind-limb ischemia. We found that the BAG3 Ile81Met variant in the C57BL/6 (BL6) mouse background segregates with protection from tissue necrosis in a shorter congenic fragment of Lsq-1 (C.B6- Lsq1-3 ). BALB/c mice treated with adeno-associated virus encoding the BL6 BAG3 variant (Ile81; n=25) displayed reduced limb-tissue necrosis and increased limb tissue perfusion compared with Met81- (n=25) or green fluorescent protein- (n=29) expressing animals. BAG3 Ile81 , but not BAG3 Met81 , improved ischemic muscle myopathy and muscle precursor cell differentiation and improved muscle regeneration in a separate, toxin-induced model of injury. Systemic injection of adeno-associated virus-BAG3 Ile81 (n=9), but not BAG3 Met81 (n=10) or green fluorescent protein (n=5), improved ischemic limb blood flow and limb muscle histology and restored muscle function (force production). Compared with BAG3 Met81 , BAG3 Ile81 displayed improved binding to the small heat shock protein (HspB8) in ischemic skeletal muscle cells and enhanced ischemic muscle autophagic flux. Taken together, our data demonstrate that genetic variation in BAG3 plays an important role in the prevention of ischemic tissue necrosis. These results highlight a pathway that preserves tissue survival and muscle

Adult-onset of mitochondrial myopathy, encephalopathy, lactic acidosis, and stroke-like episodes (MELAS) syndrome presenting as acute meningoencephalitis: a case report.

Science.gov (United States)

Hsu, Yu-Chuan; Yang, Fu-Chi; Perng, Cherng-Lih; Tso, An-Chen; Wong, Lee-Jun C; Hsu, Chang-Hung

2012-09-01

Mitochondrial myopathy, encephalopathy, lactic acidosis, and stroke-like episodes (MELAS) syndrome is a rare mitochondrial disorder with a wide range of multisystemic symptoms. Epileptic seizures are common features of both MELAS and meningoencephalitis and are typically treated with anticonvulsants. To provide the reader with a better understanding of MELAS and the adverse effects of valproic acid. A 47-year-old man with a history of diabetes, hearing loss, sinusitis, and otitis media was brought to our emergency department due to acute onset of fever, headache, generalized seizure, and agitation. Because acute meningoencephalitis was suspected, the patient was treated with antibiotics on an empirical basis. The seizure activity was aggravated by valproic acid and abated after its discontinuation. MELAS was suspected and the diagnosis was confirmed by the presence of a nucleotide 3243 A→G mutation in the mitochondrial DNA. Detailed history-taking and systematic review help emergency physicians differentiate MELAS from meningoencephalitis in patients with the common presentation of epileptic seizures. Use of valproic acid to treat epilepsy in patients suspected of having mitochondrial disease should be avoided. Underlying mitochondrial disease should be suspected if seizure activity worsens with valproic acid therapy. Copyright © 2012 Elsevier Inc. All rights reserved.

The occurrence of deep pectoral myopathy in broilers and associated changes in breast meat quality.

Science.gov (United States)

Yalcin, S; Ozkan, S; Acar, M Comert; Meral, O

2018-02-01

1. Two experiments were conducted to determine the effect of slaughter weight on the incidence and intensity of deep pectoral myopathy (DPM) of M. pectoralis minor (p. minor muscle) in commercial conditions in Turkey and to evaluate the impact of DPM on meat quality traits of pectoralis major (p. major) muscle in broilers. 2. In Experiment 1, a total of 116 250 carcasses from 59 Ross-308 broiler flocks, classified according to slaughter weight as 2.0-2.2, 2.2-2.4, 2.4-2.6 and >2.6 kg, were evaluated for occurrence of DPM. In Experiment 2, p. major samples from unaffected broilers and each DPM stage were evaluated for meat quality, oxidant and antioxidant properties, nutritional value and fatty acid profile. DPM was characterised as 1: muscles with coagulative necrosis, 2: muscles with fibrous tissue texture and pink to plumb and 3: muscles with green necrotic area. 3. The average incidence of DPM was found to be 0.73% in Experiment 1 and independent of slaughter weight. 4. In Experiment 2, p. major muscle of broilers with DPM 1 and 2 had higher pH values with higher redness and drip loss. All DPM stages resulted in an increase in lipid content and malondialdehyde activity and lowered ash content of p. major muscle compared with unaffected birds. DPM 2 increased superoxide dismutase and glutathione peroxidase activities in M. p. major. The p. major of broilers with DPM had lower content of C18:2 conjugated linoleic and C20:3n-6 fatty acids than those of unaffected broilers. Lower Δ6 desaturase and thiosterase activities and 18:2n-6 to 18:3n-3 ratio were observed for all DPM stages compared to unaffected. 5. It was concluded that these changes obtained in p. major muscle of broilers with DPM might indicate biochemical characteristics of muscle degenerations.

Case report of exercise and statin-fibrate combination therapy-caused myopathy in a patient with metabolic syndrome: contradictions between the two main therapeutic pathways.

Science.gov (United States)

László, Andrea; Kalabay, László; Nemcsik, János

2013-02-06

Lifestyle modifications including exercise are beneficial and fundamentally part of the therapy of metabolic syndrome, although in most of the cases medical interventions are also required to reach the target values in the laboratory parameters. Statin and fibrate combination therapy is considered to be safe and effective in dyslipidaemia and metabolic syndrome. However, increased physical activity can enhance the statin and fibrate-associated myopathy. Myositis and the rare but life-threatening rhabdomyolysis are causing a conflict between exercise and statin-fibrate therapy, which is yet to be resolved. We present a case of a 43-year-old Caucasian man with metabolic syndrome who had the side-effect of exercise and drug-associated myositis. The patient had only transient moderate complaints and rhabdomyolysis could be avoided with the one-month creatine kinase control, a test which is not recommended routinely by the new guidelines. We would like to turn the spotlight on the possible complications of statin-fibrate therapy and exercise, when strict follow-up is recommended. In this condition high number of patients can be affected and the responsibility of general practitioners is accentuated.

Statin-associated muscle symptoms: impact on statin therapy

DEFF Research Database (Denmark)

Stroes, Erik S; Thompson, Paul D; Corsini, Alberto

2015-01-01

degradation, thereby providing a potential link between statins and muscle symptoms; controlled mechanistic and genetic studies in humans are necessary to further understanding. The Panel proposes to identify SAMS by symptoms typical of statin myalgia (i.e. muscle pain or aching) and their temporal......Statin-associated muscle symptoms (SAMS) are one of the principal reasons for statin non-adherence and/or discontinuation, contributing to adverse cardiovascular outcomes. This European Atherosclerosis Society (EAS) Consensus Panel overviews current understanding of the pathophysiology of statin......-associated myopathy, and provides guidance for diagnosis and management of SAMS. Statin-associated myopathy, with significant elevation of serum creatine kinase (CK), is a rare but serious side effect of statins, affecting 1 per 1000 to 1 per 10 000 people on standard statin doses. Statin-associated muscle symptoms...

Mitochondrial dysfunction in fatty acid oxidation disorders: insights from human and animal studies

OpenAIRE

Wajner, Moacir; Amaral, Alexandre?Umpierrez

2016-01-01

Mitochondrial fatty acid oxidation (FAO) plays a pivotal role in maintaining body energy homoeostasis mainly during catabolic states. Oxidation of fatty acids requires approximately 25 proteins. Inherited defects of FAO have been identified in the majority of these proteins and constitute an important group of inborn errors of metabolism. Affected patients usually present with severe hepatopathy, cardiomyopathy and skeletal myopathy, whereas some patients may suffer acute and/or progressive e...

Hypoglycin A Concentrations in Maple Tree Species in the Netherlands and the Occurrence of Atypical Myopathy in Horses.

Science.gov (United States)

Westermann, C M; van Leeuwen, R; van Raamsdonk, L W D; Mol, H G J

2016-05-01

Atypical myopathy (AM) in horses is caused by the plant toxin hypoglycin A, which in Europe typically is found in the sycamore maple tree (Acer pseudoplatanus). Owners are concerned about whether their horses are in danger if they graze near maple trees. To measure hypoglycin A in the most common maple tree species in the Netherlands, and to determine whether concentration of toxin is a predictor of AM in horses. A total of 278 samples of maple tree leaves, sprouts, and seeds were classified by species. Mean concentrations of hypoglycin A were compared for the type of sample, the season and the occurrence of AM in the pasture (non-AM versus AM). Statistical analysis was performed using generalized a linear model (SPPS22). Almost all Acer pseudoplatanus samples contained hypoglycin A, with concentrations differing significantly among sources (P < .001). Concentrations were significantly higher in seeds from the AM group than in seeds from the non-AM group (856 ± 677 and 456 ± 358 mg/kg, respectively; P = .039). In sprouts and leaves this was not the case. Acer platanoides and Acer campestre samples did not contain detectable concentrations of hypoglycin A. Acer platanoides and campestre seem to be safe around paddocks and pastures, whereas almost all Acer pseudoplatanus samples contained hypoglycin A. In all AM cases, Acer pseudoplatanus was found. Despite significantly higher concentration of hypoglycin A in seeds of pastures where AM has occurred, individual prediction of AM cannot be made by measuring these concentrations because of the high standard deviation. Copyright © 2016 The Authors. Journal of Veterinary Internal Medicine published by Wiley Periodicals, Inc. on behalf of the American College of Veterinary Internal Medicine.

Zebrafish models of BAG3 myofibrillar myopathy suggest a toxic gain of function leading to BAG3 insufficiency.

Science.gov (United States)

Ruparelia, Avnika A; Oorschot, Viola; Vaz, Raquel; Ramm, Georg; Bryson-Richardson, Robert J

2014-12-01

Mutations in the co-chaperone Bcl2-associated athanogene 3 (BAG3) can cause myofibrillar myopathy (MFM), a childhood-onset progressive muscle disease, characterized by the formation of protein aggregates and myofibrillar disintegration. In contrast to other MFM-causing proteins, BAG3 has no direct structural role, but regulates autophagy and the degradation of misfolded proteins. To investigate the mechanism of disease in BAG3-related MFM, we expressed wild-type BAG3 or the dominant MFM-causing BAG3 (BAG3(P209L)) in zebrafish. Expression of the mutant protein results in the formation of aggregates that contain wild-type BAG3. Through the stimulation and inhibition of autophagy, we tested the prevailing hypothesis that impaired autophagic function is responsible for the formation of protein aggregates. Contrary to the existing theory, our studies reveal that inhibition of autophagy is not sufficient to induce protein aggregation. Expression of the mutant protein, however, did not induce myofibrillar disintegration and we therefore examined the effect of knocking down Bag3 function. Loss of Bag3 resulted in myofibrillar disintegration, but not in the formation of protein aggregates. Remarkably, BAG3(P209L) is able to rescue the myofibrillar disintegration phenotype, further demonstrating that its function is not impaired. Together, our knockdown and overexpression experiments identify a mechanism whereby BAG3(P209L) aggregates form, gradually reducing the pool of available BAG3, which eventually results in BAG3 insufficiency and myofibrillar disintegration. This mechanism is consistent with the childhood onset and progressive nature of MFM and suggests that reducing aggregation through enhanced degradation or inhibition of nucleation would be an effective therapy for this disease.

Uremic Toxins Enhance Statin-Induced Cytotoxicity in Differentiated Human Rhabdomyosarcoma Cells

Directory of Open Access Journals (Sweden)

Hitoshi Uchiyama

2014-09-01

Full Text Available The risk of myopathy and rhabdomyolysis is considerably increased in statin users with end-stage renal failure (ESRF. Uremic toxins, which accumulate in patients with ESRF, exert cytotoxic effects that are mediated by various mechanisms. Therefore, accumulation of uremic toxins might increase statin-induced cytotoxicity. The purpose of this study was to determine the effect of four uremic toxins—hippuric acid, 3-carboxy-4-methyl-5-propyl-2-furanpropionate, indole-3-acetic acid, and 3-indoxyl sulfate—on statin-induced myopathy. Differentiated rhabdomyosarcoma cells were pre-treated with the uremic toxins for seven days, and then the cells were treated with pravastatin or simvastatin. Cell viability and apoptosis were assessed by viability assays and flow cytometry. Pre-treatment with uremic toxins increased statin- but not cisplatin-induced cytotoxicity (p < 0.05 vs. untreated. In addition, the pre-treatment increased statin-induced apoptosis, which is one of the cytotoxic factors (p < 0.05 vs. untreated. However, mevalonate, farnesol, and geranylgeraniol reversed the effects of uremic toxins and lowered statin-induced cytotoxicity (p < 0.05 vs. untreated. These results demonstrate that uremic toxins enhance statin-induced apoptosis and cytotoxicity. The mechanism underlying this effect might be associated with small G-protein geranylgeranylation. In conclusion, the increased severity of statin-induced rhabdomyolysis in patients with ESRF is likely due to the accumulation of uremic toxins.

Primary biliary cirrhosis and myopathy: an uncommon association Cirrose biliar primária e miopatia: uma rara associação

Directory of Open Access Journals (Sweden)

Bruno Cupertino Migueletto

1999-10-01

Full Text Available Primary biliary cirrhosis (PBC is a cholestatic liver disease, which is characterized by a chronic inflammatory destruction of intrahepatic bile ducts. It is a rare disorder whose precise etiology is still to be elucidated. Even though the liver is the principal target of PBC, other organ systems also might be affected. Muscular involvement has rarely been described in this disease, and in the majority of cases, muscular weakness has been interpreted as polymyositis. We report the case of a 48-year-old woman suffering from classic PBC, in association with a myopathy whose histological features are distinct from the cases reported before. We also performed a MEDLINE research for PBC and concomitant muscular diseases.A cirrose biliar primária (CBP é uma doença hepática colestática crônica de etiologia desconhecida e rara. Apesar do principal órgão acometido na CBP ser o fígado, outros órgãos podem também ser afetados. O acometimento muscular raramente tem sido relatado em pacientes com CBP e na maioria destes casos, a fraqueza muscular tem sido interpretada como Polimiosite. Nós relatamos o caso de uma mulher de 48 anos com CBP e miopatia com achados histopatológicos distintos dos casos anteriormente descritos e fizemos uma revisão da literatura sobre o acometimento muscular na CBP.

Secreted Protein Acidic and Rich in Cysteine (SPARC) in Human Skeletal Muscle

Science.gov (United States)

Jørgensen, Louise H.; Petersson, Stine J.; Sellathurai, Jeeva; Andersen, Ditte C.; Thayssen, Susanne; Sant, Dorte J.; Jensen, Charlotte H.; Schrøder, Henrik D.

2009-01-01

Secreted protein acidic and rich in cysteine (SPARC)/osteonectin is expressed in different tissues during remodeling and repair, suggesting a function in regeneration. Several gene expression studies indicated that SPARC was expressed in response to muscle damage. Studies on myoblasts further indicated a function of SPARC in skeletal muscle. We therefore found it of interest to study SPARC expression in human skeletal muscle during development and in biopsies from Duchenne and Becker muscular dystrophy and congenital muscular dystrophy, congenital myopathy, inclusion body myositis, and polymyositis patients to analyze SPARC expression in a selected range of inherited and idiopathic muscle wasting diseases. SPARC-positive cells were observed both in fetal and neonatal muscle, and in addition, fetal myofibers were observed to express SPARC at the age of 15–16 weeks. SPARC protein was detected in the majority of analyzed muscle biopsies (23 of 24), mainly in mononuclear cells of which few were pax7 positive. Myotubes and regenerating myofibers also expressed SPARC. The expression-degree seemed to reflect the severity of the lesion. In accordance with these in vivo findings, primary human-derived satellite cells were found to express SPARC both during proliferation and differentiation in vitro. In conclusion, this study shows SPARC expression both during muscle development and in regenerating muscle. The expression is detected both in satellite cells/myoblasts and in myotubes and muscle fibers, indicating a role for SPARC in the skeletal muscle compartment. (J Histochem Cytochem 57:29–39, 2009) PMID:18796407

Alternative splicing of exon 17 and a missense mutation in exon 20 of the insulin receptor gene in two brothers with a novel syndrome of insulin resistance (congenital fiber-type disproportion myopathy)

DEFF Research Database (Denmark)

Vorwerk, P; Christoffersen, C T; Müller, J

1999-01-01

to be compound heterozygotes for mutations in the IR gene. The maternal allele was alternatively spliced in exon 17 due to a point mutation in the -1 donor splice site of the exon. The abnormal skipping of exon 17 shifts the amino acid reading frame and leads to a truncated IR, missing the entire tyrosine kinase......The insulin receptor (IR) in two brothers with a rare syndrome of congenital muscle fiber type disproportion myopathy (CFTDM) associated with diabetes and severe insulin resistance was studied. By direct sequencing of Epstein-Barr virus-transformed lymphocytes both patients were found...... domain. In the correct spliced variant, the point mutation is silent and results in a normally translated IR. The paternal allele carries a missense mutation in the tyrosine kinase domain. All three cDNA variants were present in the lymphocytes of the patients. Purified IR from 293 cells overexpressing...

Identification of the CFTR c.1666A>G Mutation in Hereditary Inclusion Body Myopathy Using Next-Generation Sequencing Analysis

Directory of Open Access Journals (Sweden)

Yan Lu

2018-05-01

Full Text Available Hereditary inclusion body myopathy (HIBM is a rare autosomal recessive adult onset muscle disease which affects one to three individuals per million worldwide. This disease is autosomal dominant and occurs in adulthood. Our previous study reported a new subtype of HIBM linked to the susceptibility locus at 7q22.1-31.1. The present study is aimed to identify the candidate gene responsible for the phenotype in HIBM pedigree. After multipoint linkage analysis, we performed targeted capture sequencing on 16 members and whole-exome sequencing (WES on 5 members. Bioinformatics filtering was performed to prioritize the candidate pathogenic gene variants, which were further genotyped by Sanger sequencing. Our results showed that the highest peak of LOD score (4.70 was on chromosome 7q22.1-31.1.We identified 2 and 22 candidates using targeted capture sequencing and WES respectively, only one of which as CFTRc.1666A>G mutation was well cosegregated with the HIBM phenotype. Using transcriptome analysis, we did not detect the differences of CFTR's mRNA expression in the proband compared with healthy members. Due to low incidence of HIBM and there is no other pedigree to assess, mutation was detected in three patients with duchenne muscular dystrophyn (DMD and five patients with limb-girdle muscular dystrophy (LGMD. And we found that the frequency of mutation detected in DMD and LGMD patients was higher than that of being expected in normal population. We suggested that the CFTRc.1666A>G may be a candidate marker which has strong genetic linkage with the causative gene in the HIBM family.

Combined MRI and ³¹P-MRS investigations of the ACTA1(H40Y mouse model of nemaline myopathy show impaired muscle function and altered energy metabolism.

Directory of Open Access Journals (Sweden)

Charlotte Gineste

Full Text Available Nemaline myopathy (NM is the most common disease entity among non-dystrophic skeletal muscle congenital diseases. Mutations in the skeletal muscle α-actin gene (ACTA1 account for ∼25% of all NM cases and are the most frequent cause of severe forms of NM. So far, the mechanisms underlying muscle weakness in NM patients remain unclear. Additionally, recent Magnetic Resonance Imaging (MRI studies reported a progressive fatty infiltration of skeletal muscle with a specific muscle involvement in patients with ACTA1 mutations. We investigated strictly noninvasively the gastrocnemius muscle function of a mouse model carrying a mutation in the ACTA1 gene (H40Y. Skeletal muscle anatomy (hindlimb muscles and fat volumes and energy metabolism were studied using MRI and (31Phosphorus magnetic resonance spectroscopy. Skeletal muscle contractile performance was investigated while applying a force-frequency protocol (from 1-150 Hz and a fatigue protocol (80 stimuli at 40 Hz. H40Y mice showed a reduction of both absolute (-40% and specific (-25% maximal force production as compared to controls. Interestingly, muscle weakness was associated with an improved resistance to fatigue (+40% and an increased energy cost. On the contrary, the force frequency relationship was not modified in H40Y mice and the extent of fatty infiltration was minor and not different from the WT group. We concluded that the H40Y mouse model does not reproduce human MRI findings but shows a severe muscle weakness which might be related to an alteration of intrinsic muscular properties. The increased energy cost in H40Y mice might be related to either an impaired mitochondrial function or an alteration at the cross-bridges level. Overall, we provided a unique set of anatomic, metabolic and functional biomarkers that might be relevant for monitoring the progression of NM disease but also for assessing the efficacy of potential therapeutic interventions at a preclinical level.

Abstracts of the XII Annual Meeting of the Interuniversity Institute of Myology | Reggio Emilia, Italy, October 1-4, 2015

OpenAIRE

The Editors

2016-01-01

Duchenne muscular dystrophy (DMD) is the most common, lethal, inherited myopathy, which results in muscle degeneration. In this work, we aimed at developing an innovative 3D satellite cell niche derived from human induced pluripotent stem cells (hiPSC) within their native sublaminal position in an engineered human skeletal muscle myofiber. One of the main limitations of cell therapy for DMD is the high number of myogenic cells required and the efficiency of engraftment in vivo. hiPSC ensure l...

CINRG: Systems Biology of Glucocoricoids in Muscle Disease

Science.gov (United States)

2014-12-01

amyotrophic lateral sclerosis; BMD, Becker muscular dystrophy ; COX, cytochrome c oxidase; DMD, Duchenne mus- cular dystrophy ; FSH...to a lesser extent, in Becker muscular dystrophy (BMD; dystrophin mutation), LGMD2A (limb girdle muscular dystrophy type 2A; CALP3 [calpain 3...muscular dystrophy (FSH), normal human skeletal muscle (NHM), amyotrophic lateral sclerosis (ALS), acute quadriplegic myopathy (AQM), Becker muscular

Use of sodium hydroxide treated selenium deficient barley to induce vitamin E and selenium deficiency in yearling cattle.

Science.gov (United States)

Rice, D A; McMurray, C H

1986-02-15

Selenium deficient barley grown in Northern Ireland was treated with sodium hydroxide to deplete it of vitamin E. Housed cattle fed a complete diet based on this treated barley developed nutritional degenerative myopathy, showing that spontaneous myopathy in yearling cattle can be the result of vitamin E and selenium deficiency alone. The diet used is as effective and cheaper than others presently in use for inducing degenerative myopathy.

Reversible tetraplegia after percutaneous nephrostolithotomy and septic shock: a case of critical illness polyneuropathy and myopathy with acute onset and complete recovery

Directory of Open Access Journals (Sweden)

Li Hai

2013-02-01

Full Text Available Abstract Background Critical illness polyneuropathy (CIP and critical illness myopathy (CIM are complications causing weakness of respiratory and limb muscles in critically ill patients. As an important differential diagnosis of Guillain-Barré syndrome (GBS, CIP and CIM should be diagnosed with caution, after a complete clinical and laboratory examination. Although not uncommon in ICU, CIP and CIM as severe complications of percutaneous nephrostolithotomy (PNL have not been documented in literature. Case presentation A 48-year-old Chinese woman was referred to our hospital, complaining of occasional pain in the right lower back for one month. Lithiasis was diagnosed by ultrasonographical and radiological examinations on the urinary system. PNL was indicated and performed. The patient developed CIP and CIM on the fourth day after PNL. Early recognition and treatment of the severe complications contributed to a satisfactory recovery of the patient. Conclusion This case expands our understanding of the complications of PNL and underscores the importance of differentiating CIP/CIM from GBS in case of such patients developing weakness after the treatment. Clinical characteristics and examination results should be carefully evaluated to make the diagnosis of CIP or CIM. Both anti-septic prophylaxis and control of hyperglycemia might be effective for the prevention of CIP or CIM; aggressive treatment on sepsis and multiple organ failure is considered to be the most effective measure to reduce the incidence of CIP/CIM.

Deletion of the Ste20-like kinase SLK in skeletal muscle results in a progressive myopathy and muscle weakness.

Science.gov (United States)

Pryce, Benjamin R; Al-Zahrani, Khalid N; Dufresne, Sébastien; Belkina, Natalya; Labrèche, Cédrik; Patino-Lopez, Genaro; Frenette, Jérôme; Shaw, Stephen; Sabourin, Luc A

2017-02-02

The Ste20-like kinase, SLK, plays an important role in cell proliferation and cytoskeletal remodeling. In fibroblasts, SLK has been shown to respond to FAK/Src signaling and regulate focal adhesion turnover through Paxillin phosphorylation. Full-length SLK has also been shown to be essential for embryonic development. In myoblasts, the overexpression of a dominant negative SLK is sufficient to block myoblast fusion. In this study, we crossed the Myf5-Cre mouse model with our conditional SLK knockout model to delete SLK in skeletal muscle. A thorough analysis of skeletal muscle tissue was undertaken in order to identify defects in muscle development caused by the lack of SLK. Isometric force analysis was performed on adult knockout mice and compared to age-matched wild-type mice. Furthermore, cardiotoxin injections were performed followed by immunohistochemistry for myogenic markers to assess the efficiency muscle regeneration following SLK deletion. We show here that early deletion of SLK from the myogenic lineage does not markedly impair skeletal muscle development but delays the regenerative process. Interestingly, adult mice (~6 months) display an increase in the proportion of central nuclei and increased p38 activation. Furthermore, mice as young as 3 months old present with decreased force generation, suggesting that the loss of SLK impairs myofiber stability and function. Assessment of structural components revealed aberrant localization of focal adhesion proteins, such as FAK and paxillin. Our data show that the loss of SLK results in unstable myofibers resulting in a progressive myopathy. Additionally, the loss of SLK resulted in a delay in muscle regeneration following cardiotoxin injections. Our results show that SLK is dispensable for muscle development and regeneration but is required for myofiber stability and optimal force generation.

Types of CMT

Science.gov (United States)

... Marie-Tooth Disease (CMT) Congenital Muscular Dystrophy (CMD) Duchenne Muscular Dystrophy (DMD) Emery-Dreifuss Muscular Dystrophy Endocrine Myopathies Metabolic Diseases of Muscle Mitochondrial Myopathies (MM) Myotonic Dystrophy (DM) Spinal-Bulbar ...

Dermatomyositis: Signs and Symptoms

Science.gov (United States)

... Marie-Tooth Disease (CMT) Congenital Muscular Dystrophy (CMD) Duchenne Muscular Dystrophy (DMD) Emery-Dreifuss Muscular Dystrophy Endocrine Myopathies Metabolic Diseases of Muscle Mitochondrial Myopathies (MM) Myotonic Dystrophy (DM) Spinal-Bulbar ...

Myotonic Muscular Dystrophy

Science.gov (United States)

... Marie-Tooth Disease (CMT) Congenital Muscular Dystrophy (CMD) Duchenne Muscular Dystrophy (DMD) Emery-Dreifuss Muscular Dystrophy Endocrine Myopathies Metabolic Diseases of Muscle Mitochondrial Myopathies (MM) Myotonic Dystrophy (DM) Spinal-Bulbar ...

Dermatomyositis: Diagnosis

Science.gov (United States)

... Marie-Tooth Disease (CMT) Congenital Muscular Dystrophy (CMD) Duchenne Muscular Dystrophy (DMD) Emery-Dreifuss Muscular Dystrophy Endocrine Myopathies Metabolic Diseases of Muscle Mitochondrial Myopathies (MM) Myotonic Dystrophy (DM) Spinal-Bulbar ...

Limb-Girdle Muscular Dystrophy (LGMD)

Science.gov (United States)

... Marie-Tooth Disease (CMT) Congenital Muscular Dystrophy (CMD) Duchenne Muscular Dystrophy (DMD) Emery-Dreifuss Muscular Dystrophy Endocrine Myopathies Metabolic Diseases of Muscle Mitochondrial Myopathies (MM) Myotonic Dystrophy (DM) Spinal-Bulbar ...

Signs and Symptoms

Science.gov (United States)

... Marie-Tooth Disease (CMT) Congenital Muscular Dystrophy (CMD) Duchenne Muscular Dystrophy (DMD) Emery-Dreifuss Muscular Dystrophy Endocrine Myopathies Metabolic Diseases of Muscle Mitochondrial Myopathies (MM) Myotonic Dystrophy (DM) Spinal-Bulbar ...

Polymyositis: Diagnosis

Science.gov (United States)

... Marie-Tooth Disease (CMT) Congenital Muscular Dystrophy (CMD) Duchenne Muscular Dystrophy (DMD) Emery-Dreifuss Muscular Dystrophy Endocrine Myopathies Metabolic Diseases of Muscle Mitochondrial Myopathies (MM) Myotonic Dystrophy (DM) Spinal-Bulbar ...

Causes of Charcot-Marie-Tooth Disease (CMT)

Science.gov (United States)

... Marie-Tooth Disease (CMT) Congenital Muscular Dystrophy (CMD) Duchenne Muscular Dystrophy (DMD) Emery-Dreifuss Muscular Dystrophy Endocrine Myopathies Metabolic Diseases of Muscle Mitochondrial Myopathies (MM) Myotonic Dystrophy (DM) Spinal-Bulbar ...

[Overactive muscles: it can be more serious than common myalgia or cramp].

Science.gov (United States)

Molenaar, Joery P F; Snoeck, Marc M J; Voermans, Nicol C; van Engelen, Baziel G M

2016-01-01

Positive muscle phenomena are due to muscle overactivity. Examples are cramp, myalgia, and stiffness. These manifestations have mostly acquired causes, e.g. side-effects of medication, metabolic disorders, vitamin deficiency, excessive caffeine intake or neurogenic disorders. We report on three patients with various positive muscle phenomena, to illustrate the clinical signs that indicate an underlying myopathy. Patient A, a 56-year-old man, was diagnosed with muscle cramp in the context of excessive coffee use and previous lumbosacral radiculopathy. Patient B, a 71-year-old man, was shown to have RYR1-related myopathy. Patient C, a 42-year-old man, suffered from Brody myopathy. We propose for clinicians to look out for a number of 'red flags' that can point to an underlying myopathy, and call for referral to neurology if indicated. Red flags include second wind phenomenon, familial occurrence of similar complaints, marked muscle stiffness, myotonia, muscle weakness, muscle hypertrophy, and myoglobinuria. Establishing a correct diagnosis is important for proper treatment. Certain myopathies call for cardiac or respiratory screening.

Treatment with human immunoglobulin G improves the early disease course in a mouse model of Duchenne muscular dystrophy.

Science.gov (United States)

Zschüntzsch, Jana; Zhang, Yaxin; Klinker, Florian; Makosch, Gregor; Klinge, Lars; Malzahn, Dörthe; Brinkmeier, Heinrich; Liebetanz, David; Schmidt, Jens

2016-01-01

Duchenne muscular dystrophy (DMD) is a severe hereditary myopathy. Standard treatment by glucocorticosteroids is limited because of numerous side effects. The aim of this study was to test immunomodulation by human immunoglobulin G (IgG) as treatment in the experimental mouse model (mdx) of DMD. 2 g/kg human IgG compared to human albumin was injected intraperitoneally in mdx mice at the age of 3 and 7 weeks. Advanced voluntary wheel running parameters were recorded continuously. At the age of 11 weeks, animals were killed so that blood, diaphragm, and lower limb muscles could be removed for quantitative PCR, histological analysis and ex vivo muscle contraction tests. IgG compared to albumin significantly improved the voluntary running performance and reduced muscle fatigability in an ex vivo muscle contraction test. Upon IgG treatment, serum creatine kinase values were diminished and mRNA expression levels of relevant inflammatory markers were reduced in the diaphragm and limb muscles. Macrophage infiltration and myopathic damage were significantly ameliorated in the quadriceps muscle. Collectively, this study demonstrates that, in the early disease course of mdx mice, human IgG improves the running performance and diminishes myopathic damage and inflammation in the muscle. Therefore, IgG may be a promising approach for treatment of DMD. Two monthly intraperitoneal injections of human immunoglobulin G (IgG) improved the early 11-week disease phase of mdx mice. Voluntary running was improved and serum levels of creatine kinase were diminished. In the skeletal muscle, myopathic damage was ameliorated and key inflammatory markers such as mRNA expression of SPP1 and infiltration by macrophages were reduced. The study suggests that IgG could be explored as a potential treatment option for Duchenne muscular dystrophy and that pre-clinical long-term studies should be helpful. © 2015 International Society for Neurochemistry.

[The significance of Ulex europaeus agglutinin I lectin binding fibers in various muscular diseases].

Science.gov (United States)

Yatabe, K; Hiraguri, M; Sueishi, M; Takeuchi, M; Nonaka, I; Kawai, M

1998-05-01

In the present study, we have reported that Ulex europaeus agglutinin I (UEA I) lectin labeled muscle fibers in distal myopathy with rimmed vacuole formation (DMRV). UEA I binding to muscle fibers was also observed in a small number of biopsies with inflammatory myopathy, but not in other diseases, including neurogenic muscular atrophies and muscular dystrophies. In order to elucidate the relationship between this UEA I binding, rimmed vacuole formation and active autophagocytosis, we examined the UEA I binding fibers in other myopathies which frequently showed rimmed vacuoles, including adult onset acid maltase deficiency, oculo-pharyngo-distal type myopathy and oculopharyngeal muscular dystrophy. No UEA I lectin labeling fiber was observed in the diseases examined. We then studied UEA I binding behavior on 70 biopsies of inflammatory myopathy to characterize the clinical features of UEA I binding positive patients. UEA I binding fibers were observed in 3 of 28 patients (11%) with other collagen diseases, 11 of 36 (31%) without these disorders, and 2 of 6 (33%) with inclusion body myositis. There were no common clinical histories, complications or laboratory findings among the UEA I binding positive patients. In conclusion, a common process may exist between the muscle fiber degeneration in DMRV and subgroups of inflammatory myopathy patients, but the basic mechanism remains to be elucidated.

Desmin common mutation is associated with multi-systemic disease manifestations and depletion of mitochondria and mitochondrial DNA

Directory of Open Access Journals (Sweden)

Elizabeth eMcCormick

2015-06-01

Full Text Available Desmin (DES is a major muscle scaffolding protein that also functions to anchor mitochondria. Pathogenic DES mutations, however, have not previously been recognized as a cause of multi-systemic mitochondrial disease. Here, we describe a 45-year-old man who presented to The Children’s Hospital of Philadelphia Mitochondrial-Genetics Diagnostic Clinic for evaluation of progressive cardiac, neuromuscular, gastrointestinal, and mood disorders. Muscle biopsy at age 45 was remarkable for cytoplasmic bodies, as well as ragged red fibers and SDH positive/COX negative fibers that were suggestive of a mitochondrial myopathy. Muscle also showed significant reductions in mitochondrial content (16% of control mean for citrate synthase activity and mitochondrial DNA (35% of control mean. His family history was significant for cardiac conduction defects and myopathy in multiple maternal relatives. Multiple single gene and panel-based sequencing studies were unrevealing. Whole exome sequencing identified a known pathogenic p.S13F mutation in DES that had previously been associated with desmin-related myopathy. Desmin-related myopathy is an autosomal dominant disorder characterized by right ventricular hypertrophic cardiomyopathy, myopathy, and arrhythmias. However, neuropathy, gastrointestinal dysfunction, and depletion of both mitochondria and mitochondrial DNA have not previously been widely recognized in this disorder. Recognition that mitochondrial dysfunction occurs in desmin-related myopathy clarifies the basis for the multi-systemic manifestations, as are typical of primary mitochondrial disorders. Understanding the mitochondrial pathophysiology of desmin-related myopathy highlights the possibility of new therapies for the otherwise untreatable and often fatal class of disease. We postulate that drug treatments aimed at improving mitochondrial biogenesis or reducing oxidative stress may be effective therapies to ameliorate the effects of desmin

Patient-reported outcomes and adult patients' disease experience in the idiopathic inflammatory myopathies. report from the OMERACT 11 Myositis Special Interest Group.

Science.gov (United States)

Alexanderson, Helene; Del Grande, Maria; Bingham, Clifton O; Orbai, Ana-Maria; Sarver, Catherine; Clegg-Smith, Katherine; Lundberg, Ingrid E; Song, Yeong Wook; Christopher-Stine, Lisa

2014-03-01

The newly formed Outcome Measures in Rheumatology (OMERACT) Myositis Special Interest Group (SIG) was established to examine patient-reported outcome measures (PROM) in myositis. At OMERACT 11, a literature review of PROM used in the idiopathic inflammatory myopathies (IIM) and other neuromuscular conditions was presented. The group examined in more detail 2 PROM more extensively evaluated in patients with IIM, the Myositis Activities Profile, and the McMaster-Toronto Arthritis Patient Preference Disability Questionnaire, through the OMERACT filter of truth, discrimination, and feasibility. Preliminary results from a qualitative study of patients with myositis regarding their symptoms were discussed that emphasized the range of symptoms experienced: pain, physical tightness/stiffness, fatigue, disease effect on emotional life and relationships, and treatment-related side effects. Following discussion of these results and following additional discussions since OMERACT 11, a research agenda was developed. The next step in evaluating PROM in IIM will require additional focus groups with a spectrum of patients with different myositis disease phenotypes and manifestations across a range of disease activity, and from multiple international settings. The group will initially focus on dermatomyositis and polymyositis in adults. Qualitative analysis will facilitate the identification of commonalities and divergent patient-relevant aspects of disease, insights that are critical given the heterogeneous manifestations of these diseases. Based on these qualitative studies, existing myositis PROM can be examined to more thoroughly assess content validity, and will be important to identify gaps in domain measurement that will be required to develop a preliminary core set of patient-relevant domains for IIM.

Myositis Mimics.

Science.gov (United States)

Michelle, E Harlan; Mammen, Andrew L

2015-10-01

Patients with autoimmune myositis typically present with muscle weakness, elevated serum levels of muscle enzymes, and abnormal muscle biopsies. However, patients with other acquired myopathies or genetic muscle diseases may have remarkably similar presentations. Making the correct diagnosis of another muscle disease can prevent these patients from being exposed to the risks of immunosuppressive medications, which benefit those with myositis, but not those with other types of muscle disease. Here, we review some of the most common acquired and inherited muscle diseases that can mimic autoimmune myositis, including inclusion body myositis, limb girdle muscular dystrophies, metabolic myopathies, mitochondrial myopathies, and endocrine myopathies. We emphasize aspects of the medical history, physical exam, laboratory evaluation, and muscle biopsy analysis that can help clinicians distinguish myositis mimics from true autoimmune myositis.

Pilot study of safety and efficacy of polyprenols in combination with coenzyme Q10 in patients with statin-induced myopathy.

Science.gov (United States)

Latkovskis, Gustavs; Saripo, Vita; Sokolova, Emma; Upite, Dana; Vanaga, Ilona; Kletnieks, Ugis; Erglis, Andrejs

2016-01-01

Statin-induced myopathy (SIM) has been partially attributed to deficiency of dolichol and coenzyme Q10 (CoQ10). We aimed to test the safety and efficacy of plant polyprenols in combination with CoQ10 for alleviation of SIM. In an open-label, one-center prospective pilot study patients with SIM received conifer-tree needle polyprenols (4mg/day) and CoQ10 (100mg/day) for 8 weeks. Symptoms and safety were evaluated according to symptom severity score (0-10), creatine kinase (CK) levels, exercise test, dynamometry, complete blood count, clinical biochemistry and electrocardiography. Of the 14 patients, 11 completed the study per protocol. Two patients withdrew consent due to travels abroad, and it was discontinued for one patient with stage 3 chronic kidney disease due to asymptomatic elevations of liver enzymes at week 4. No safety parameters changed significantly in per protocol group. Non-significant increase of CK levels was observed (P=0.231). Muscle pain (n=10) and weakness (n=7) scores improved significantly (PMuscle pain completely disappeared in 2 patients, weakness resolved in 3 patients and cramps disappeared in two patients. Four patients assessed improvement strong enough to consider increase of statin dose. No changes were observed in exercise test or dynamometry. Conifer-tree polyprenols in combination with CoQ10 may be generally safe in patients with SIM, but caution should be exercised in patients with glomerular filtration rate <60mL/min and routine monitoring of the liver enzymes and CK is advocated in all patients. The observed efficacy provides the rationale for a larger, double-blind controlled study with polyprenols. Copyright © 2016 The Lithuanian University of Health Sciences. Production and hosting by Elsevier Urban & Partner Sp. z o.o. All rights reserved.

Clinical characteristics and favorable long-term outcomes for patients with idiopathic inflammatory myopathies: a retrospective single center study in China

Directory of Open Access Journals (Sweden)

Shu Xiao

2011-11-01

Full Text Available Abstract Background Little is known about the clinical features and true survival risk factors in Chinese Han population. We conducted the current study to investigate the clinical features, long-term outcome and true potential indicators associated with mortality of idiopathic inflammatory myopathies (IIM in China. Methods We restrospectvely investigated 188 patients diagnosed with IIM at our hospital from January 1986 to April 2009. The primary outcome was determined with mortality. The secondary outcomes for survival patients were organ damage and disease activity, health status, and disability, which were assessed with Myositis Damage Index, Myositis Disease Activity Assessment Visual Analogue Scales, Health Assessment Questionnaire Disability Index, and the Modified Rankin Scale, respectively. Potential prognostic factors for mortality were analyzed with the multivariate Cox regression model. Results Mean age at disease onset was 43.8 ± 15.8 years and male to female ratio was 1:2.1 in this cohort. The 1-, 5-, 10-, 15- and 20-year survival rates were 93.6%, 88.7%, 81%, 73.6% and 65.6%. The independent predicators for mortality were age at disease onset [hazard ratio (HR:1.05, 95% CI 1.02 - 1.08], presence of cancer (HR:3.68, 95%CI 1.39 - 9.74, and elevated IgA level at diagnosis (HR:2.80, 95% CI 1.16-6.74. At the end of the follow-up, 29 patients manifested drug withdrawal within an average 4.1 years (range 0.5-15.2 year, most patients (85.9% had no disease activity and 130 patients (83.4% had no disability. Conclusions The long-term outcomes of IIM patients in our cohort have improved dramatically. Those patients most likely to survive had a high chance of reaching stable disease status, and obtained long-term or possibly permanent remission to a large extent.

Fat and carbohydrate metabolism during exercise in phosphoglucomutase type 1 deficiency

DEFF Research Database (Denmark)

Preisler, Nicolai; Laforêt, Pascal; Echaniz-Laguna, Andoni

2013-01-01

Phosphoglucomutase type 1 (PGM1) deficiency is a rare metabolic myopathy in which symptoms are provoked by exercise.......Phosphoglucomutase type 1 (PGM1) deficiency is a rare metabolic myopathy in which symptoms are provoked by exercise....

[Autoantibody profile in myositis].

Science.gov (United States)

Allenbach, Y; Benveniste, O

2014-07-01

Patients suffering from muscular symptoms or with an increase of creatine kinase levels may present a myopathy. In such situations, clinicians have to confirm the existence of a myopathy and determine if it is an acquired or a genetic muscular disease. In the presence of an acquired myopathy after having ruled out an infectious, a toxic agent or an endocrine cause, physicians must identify which type of idiopathic myopathy the patient is presenting: either a myositis including polymyositis, dermatomyositis, and inclusion body myositis, or an immune-mediated necrotizing myopathy. Histopathology examination of a muscle biopsy is determinant but detection of autoantibody is now also crucial. The myositis-specific antibodies and myositis-associated antibodies lead to a serologic approach complementary to the histological classification, because strong associations of myositis-specific antibodies with clinical features and survival have been documented. The presence of anti-synthetase antibodies is associated with an original histopathologic pattern between polymyositis and dermatomyositis, and defines a syndrome where interstitial lung disease drives the prognosis. Anti-MDA-5 antibody are specifically associated with dermatomyositis, and define a skin-lung syndrome with a frequent severe disease course. Anti-TIF1-γ is also associated with dermatomyositis but its presence is frequently predictive of a cancer association whereas anti-MI2 is associated with the classical dermatomyositis. Two specific antibodies, anti-SRP and anti-HMGCR, are observed in patients with immune-mediated necrotizing myopathies and may be very useful to distinguish acquired myopathies from dystrophic muscular diseases in case of a slow onset and to allow the initiation of effective therapy. Copyright © 2013 Société nationale française de médecine interne (SNFMI). Published by Elsevier SAS. All rights reserved.

A young lady with swelling and stiffness of calf muscles

Directory of Open Access Journals (Sweden)

H S Kiran

2011-01-01

Full Text Available Hypothyroidism causes a variety of changes in the body. Though uncommon, hypothyroidism can present as myopathy. Hoffman′s syndrome is a specific, rare form of hypothyroid myopathy, which causes proximal weakness and pseudohypertrophy of muscles.

Whole Exome Sequencing Leading to the Diagnosis of Dysferlinopathy with a Novel Missense Mutation (c.959G>C

Directory of Open Access Journals (Sweden)

Abhisek Swaika

2016-01-01

Full Text Available Dysferlinopathy is an uncommon, progressive muscular dystrophy that has a wide phenotypic variability and primarily supportive management (Nguyen et al., 2007; Narayanaswami et al., 2014. Amyloid myopathy is a distinct, rare disorder that can present similarly to inflammatory myopathies and requires a high clinical suspicion for early intervention to prolong survival. Amyloid myopathy is typically associated with other systemic manifestations of amyloidosis, but rare cases of isolated amyloid myopathy have been described (Mandl et al., 2000; Hull et al., 2001. Positive Congo red stains on tissue biopsy remain the gold standard for diagnosis (Spuler et al., 1998; Karacostas et al., 2005. A high clinical suspicion and meticulous diagnostic workup that includes novel techniques are necessary for identifying these rare disorders. We report a middle-aged man with progressive leg muscle weakness who was initially treated as having amyloid myopathy but was later diagnosed as having dysferlinopathy by Whole Exome Sequencing (WES analysis. We also report a novel missense mutation (c.959G>C to help correlate in any patient with presumed dysferlinopathy and to add to the already known genotype of this disorder.

Myopathic EMG findings and type II muscle fiber atrophy in patients with Lambert-Eaton myasthenic syndrome

DEFF Research Database (Denmark)

Crone, Clarissa; Christiansen, Ingelise; Vissing, John

2013-01-01

Lambert-Eaton myasthenic syndrome (LEMS) is a rare condition, which may mimic myopathy. A few reports have described that EMG in LEMS may show changes compatible with myopathy, and muscle biopsies have been described with type II as well as type I atrophy. The EMG results were, however, based on ...... on qualitative EMG examination and the histopathological methods were not always clear. The objective of this study was to investigate if the previous EMG findings could be confirmed with quantitative EMG (QEMG) and to describe muscle histology in LEMS.......Lambert-Eaton myasthenic syndrome (LEMS) is a rare condition, which may mimic myopathy. A few reports have described that EMG in LEMS may show changes compatible with myopathy, and muscle biopsies have been described with type II as well as type I atrophy. The EMG results were, however, based...

Statin and fibrate associed myopathy: study of eight patients Miopatia associada a estatina e fibrato: estudo de oito pacientes

Directory of Open Access Journals (Sweden)

Alzira A. Siqueira Carvalho

2004-06-01

Full Text Available Lipid-lowering drugs have been occasionally associated with neuromuscular symptoms and muscle biopsy changes. We reported the clinical course and the muscle biopsy in eight patients with hyperlipoproteinemia, treated with lipid -lowering drugs (statins/fibrates. Five patients had myalgias while; in two cases there was proximal muscle weakness. All patients became asymptomatic after the withdrawal of the drug, although creatine kinase remained elevated. We performed muscle biopsy in six cases from three months to two years after suspension of the drug. We found variation in fibers diameters in all cases, with necrosis of fibers in five cases, inflammatory infiltration in one case, the presence of vacuolated fiber in one patient and ragged-red fibers in three subjects. We concluded that although the muscle biopsy findings were not specific, the prolonged use of statins and or fibrates might induce a chronic myopathy even in the absence of symptoms.As drogas redutoras de colesterol são ocasionalmente associadas a sintomas neuromusculares e alterações morfológicas observadas na biopsia muscular. Relatamos o curso clínico e achado da biopsia muscular em oito pacientes com hiperlipoproteinemia tratados com drogas redutoras de colesterol (estatinas/fibratos. Cinco pacientes tiveram mialgia e em dois havia fraqueza muscular proximal. Todos os pacientes ficaram assintomáticos após retirada da medicação embora a creatinoquinase permanecesse elevada. Analisamos a biopsia muscular em seis casos realizados entre três meses e dois anos após a suspensão da droga. Encontramos variação no calibre das fibras em todos os casos com necrose de fibras em cinco, infiltrado inflamatório em um caso, presença de vacúolos em um e "ragged red fiber" em três deles. Concluímos que, embora os achados da biopsia muscular não fossem específicos, o uso prolongado de estatinas e/ou fibratos pode induzir a uma miopatia crônica até mesmo na ausência de

Mosaicism for dominant collagen 6 mutations as a cause for intrafamilial phenotypic variability

NARCIS (Netherlands)

Donkervoort, S.; Hu, Y.; Stojkovic, T.; Voermans, N.C.; Foley, A.R.; Leach, M.E.; Dastgir, J.; Bolduc, V.; Cullup, T.; Becdelievre, A. de; Yang, L.; Su, H.; Meilleur, K.; Schindler, A.B.; Kamsteeg, E.J.; Richard, P.; Butterfield, R.J.; Winder, T.L.; Crawford, T.O.; Weiss, R.B.; Muntoni, F.; Allamand, V.; Bonnemann, C.G.

2015-01-01

Collagen 6-related dystrophies and myopathies (COL6-RD) are a group of disorders that form a wide phenotypic spectrum, ranging from severe Ullrich congenital muscular dystrophy, intermediate phenotypes, to the milder Bethlem myopathy. Both inter- and intrafamilial variable expressivity are commonly

Mitochondrial Alterations and Oxidative Stress in an Acute Transient Mouse Model of Muscle Degeneration

Science.gov (United States)

Ramadasan-Nair, Renjini; Gayathri, Narayanappa; Mishra, Sudha; Sunitha, Balaraju; Mythri, Rajeswara Babu; Nalini, Atchayaram; Subbannayya, Yashwanth; Harsha, Hindalahalli Chandregowda; Kolthur-Seetharam, Ullas; Bharath, Muchukunte Mukunda Srinivas

2014-01-01

Muscular dystrophies (MDs) and inflammatory myopathies (IMs) are debilitating skeletal muscle disorders characterized by common pathological events including myodegeneration and inflammation. However, an experimental model representing both muscle pathologies and displaying most of the distinctive markers has not been characterized. We investigated the cardiotoxin (CTX)-mediated transient acute mouse model of muscle degeneration and compared the cardinal features with human MDs and IMs. The CTX model displayed degeneration, apoptosis, inflammation, loss of sarcolemmal complexes, sarcolemmal disruption, and ultrastructural changes characteristic of human MDs and IMs. Cell death caused by CTX involved calcium influx and mitochondrial damage both in murine C2C12 muscle cells and in mice. Mitochondrial proteomic analysis at the initial phase of degeneration in the model detected lowered expression of 80 mitochondrial proteins including subunits of respiratory complexes, ATP machinery, fatty acid metabolism, and Krebs cycle, which further decreased in expression during the peak degenerative phase. The mass spectrometry (MS) data were supported by enzyme assays, Western blot, and histochemistry. The CTX model also displayed markers of oxidative stress and a lowered glutathione reduced/oxidized ratio (GSH/GSSG) similar to MDs, human myopathies, and neurogenic atrophies. MS analysis identified 6 unique oxidized proteins from Duchenne muscular dystrophy samples (n = 6) (versus controls; n = 6), including two mitochondrial proteins. Interestingly, these mitochondrial proteins were down-regulated in the CTX model thereby linking oxidative stress and mitochondrial dysfunction. We conclude that mitochondrial alterations and oxidative damage significantly contribute to CTX-mediated muscle pathology with implications for human muscle diseases. PMID:24220031

Mitochondrial alterations and oxidative stress in an acute transient mouse model of muscle degeneration: implications for muscular dystrophy and related muscle pathologies.

Science.gov (United States)

Ramadasan-Nair, Renjini; Gayathri, Narayanappa; Mishra, Sudha; Sunitha, Balaraju; Mythri, Rajeswara Babu; Nalini, Atchayaram; Subbannayya, Yashwanth; Harsha, Hindalahalli Chandregowda; Kolthur-Seetharam, Ullas; Srinivas Bharath, Muchukunte Mukunda

2014-01-03

Muscular dystrophies (MDs) and inflammatory myopathies (IMs) are debilitating skeletal muscle disorders characterized by common pathological events including myodegeneration and inflammation. However, an experimental model representing both muscle pathologies and displaying most of the distinctive markers has not been characterized. We investigated the cardiotoxin (CTX)-mediated transient acute mouse model of muscle degeneration and compared the cardinal features with human MDs and IMs. The CTX model displayed degeneration, apoptosis, inflammation, loss of sarcolemmal complexes, sarcolemmal disruption, and ultrastructural changes characteristic of human MDs and IMs. Cell death caused by CTX involved calcium influx and mitochondrial damage both in murine C2C12 muscle cells and in mice. Mitochondrial proteomic analysis at the initial phase of degeneration in the model detected lowered expression of 80 mitochondrial proteins including subunits of respiratory complexes, ATP machinery, fatty acid metabolism, and Krebs cycle, which further decreased in expression during the peak degenerative phase. The mass spectrometry (MS) data were supported by enzyme assays, Western blot, and histochemistry. The CTX model also displayed markers of oxidative stress and a lowered glutathione reduced/oxidized ratio (GSH/GSSG) similar to MDs, human myopathies, and neurogenic atrophies. MS analysis identified 6 unique oxidized proteins from Duchenne muscular dystrophy samples (n = 6) (versus controls; n = 6), including two mitochondrial proteins. Interestingly, these mitochondrial proteins were down-regulated in the CTX model thereby linking oxidative stress and mitochondrial dysfunction. We conclude that mitochondrial alterations and oxidative damage significantly contribute to CTX-mediated muscle pathology with implications for human muscle diseases.

P6. Assessment of Muscles, Connective and Fat Tissue, Using ?CT Data: Feasibility Study for Meat Quality Control

OpenAIRE

Salmons, Stanley; Gargiulo, Paolo; Edmunds, Kyle; Sigurdsson, Sigurdur; Carraro, Ugo; Gudnason, Vilmundur; Franchi, Martino V; Reeves, Neil D; Maganaris, Costantinos; Smith, Ken; Atherton, Philip J; Narici, Marco V; Stephenson, Robert S; Jarvis, Jonathan C; Ortolan, Paolo

2015-01-01

Central Core Disease (CCD; OMIM# 117000), one of the most common human congenital myopathies, is characterized by hypotonia and proximal muscle weakness with slow (or non progressive) clinical course. 1 Diagnosis of CCD is confirmed by histological examination of muscle biopsies showing amorphous central areas or cores (typically found in type I muscle fibers), lacking glycolytic/oxidative enzymes and mitochondria. Usually, orthopedic complications limit the ability of CCD adult patient to pe...

Transfer RNA and human disease

Directory of Open Access Journals (Sweden)

Jamie A Abbott

2014-06-01

Full Text Available Pathological mutations in tRNA genes and tRNA processing enzymes are numerous and result in very complicated clinical phenotypes. Mitochondrial tRNA (mt-tRNA genes are hotspots for pathological mutations and over 200 mt-tRNA mutations have been linked to various disease states. Often these mutations prevent tRNA aminoacylation. Disrupting this primary function affects protein synthesis and the expression, folding, and function of oxidative phosphorylation enzymes. Mitochondrial tRNA mutations manifest in a wide panoply of diseases related to cellular energetics, including COX deficiency (cytochrome C oxidase, mitochondrial myopathy, MERRF (Myoclonic Epilepsy with Ragged Red Fibers, and MELAS (mitochondrial encephalomyopathy, lactic acidosis, and stroke-like episodes. Diseases caused by mt-tRNA mutations can also affect very specific tissue types, as in the case of neurosensory non-syndromic hearing loss and pigmentary retinopathy, diabetes mellitus, and hypertrophic cardiomyopathy. Importantly, mitochondrial heteroplasmy plays a role in disease severity and age of onset as well. Not surprisingly, mutations in enzymes that modify cytoplasmic and mitochondrial tRNAs are also linked to a diverse range of clinical phenotypes. In addition to compromised aminoacylation of the tRNAs, mutated modifying enzymes can also impact tRNA expression and abundance, tRNA modifications, tRNA folding, and even tRNA maturation (e.g., splicing. Some of these pathological mutations in tRNAs and processing enzymes are likely to affect non-canonical tRNA functions, and contribute to the diseases without significantly impacting on translation. This chapter will review recent literature on the relation of mitochondrial and cytoplasmic tRNA, and enzymes that process tRNAs, to human disease. We explore the mechanisms involved in the clinical presentation of these various diseases with an emphasis on neurological disease.

Transfer RNA and human disease.

Science.gov (United States)

Abbott, Jamie A; Francklyn, Christopher S; Robey-Bond, Susan M

2014-01-01

Pathological mutations in tRNA genes and tRNA processing enzymes are numerous and result in very complicated clinical phenotypes. Mitochondrial tRNA (mt-tRNA) genes are "hotspots" for pathological mutations and over 200 mt-tRNA mutations have been linked to various disease states. Often these mutations prevent tRNA aminoacylation. Disrupting this primary function affects protein synthesis and the expression, folding, and function of oxidative phosphorylation enzymes. Mitochondrial tRNA mutations manifest in a wide panoply of diseases related to cellular energetics, including COX deficiency (cytochrome C oxidase), mitochondrial myopathy, MERRF (Myoclonic Epilepsy with Ragged Red Fibers), and MELAS (mitochondrial encephalomyopathy, lactic acidosis, and stroke-like episodes). Diseases caused by mt-tRNA mutations can also affect very specific tissue types, as in the case of neurosensory non-syndromic hearing loss and pigmentary retinopathy, diabetes mellitus, and hypertrophic cardiomyopathy. Importantly, mitochondrial heteroplasmy plays a role in disease severity and age of onset as well. Not surprisingly, mutations in enzymes that modify cytoplasmic and mitochondrial tRNAs are also linked to a diverse range of clinical phenotypes. In addition to compromised aminoacylation of the tRNAs, mutated modifying enzymes can also impact tRNA expression and abundance, tRNA modifications, tRNA folding, and even tRNA maturation (e.g., splicing). Some of these pathological mutations in tRNAs and processing enzymes are likely to affect non-canonical tRNA functions, and contribute to the diseases without significantly impacting on translation. This chapter will review recent literature on the relation of mitochondrial and cytoplasmic tRNA, and enzymes that process tRNAs, to human disease. We explore the mechanisms involved in the clinical presentation of these various diseases with an emphasis on neurological disease.

Identification of a novel myositis-associated antibody directed against cortactin.

Science.gov (United States)

Labrador-Horrillo, Moisés; Martínez, Maria Angeles; Selva-O'Callaghan, Albert; Trallero-Araguás, Ernesto; Grau-Junyent, Josep M; Vilardell-Tarrés, Miquel; Juarez, Candido

2014-10-01

The aim of this study is to describe a novel myositis-associated autoantibody (anti-cortactin antibody) and assess related clinical and immunological manifestations and its clinical significance. Adult patients with myositis (dermatomyositis, polymyositis, immune-mediated necrotizing myopathy, and inclusion body myositis), as well as patients with other autoimmune diseases and non-inflammatory myopathies were analyzed for the presence of anti-cortactin antibody using in-house developed ELISA and immunoblotting techniques with a commercial source of purified cortactin. The cut-off for positive status was determined in a group of healthy volunteers. Antibody against cortactin was positive in 7/34 (20%) polymyositis patients, 9/117 (7.6%) dermatomyositis, 2/7 (26%) immune-mediated necrotizing myopathy, and none of the 4 patients with inclusion body myositis. The antibody also tested positive in 3/101 patients with other autoimmune diseases (2 systemic sclerosis and 1 systemic lupus erythematosus), and in 1/29 patients with non-inflammatory myopathy. No relevant association with specific clinical features was found in patients with these antibodies. Anti-cortactin antibody was more frequently positive in patients with polymyositis and immune-mediated necrotizing myopathy than in the remaining myositis patients, and was the only myositis autoantibody found in sera of 3 patients from these groups. Our data indicate that cortactin is a novel target antigen in patients with autoimmune diseases, especially patients with polymyositis or immune-mediated necrotizing myopathy. Anti-cortactin can be considered a new myositis-associated antibody. Copyright © 2014 Elsevier B.V. All rights reserved.

Rabdomiolisis y miopatía como únicas manifestaciones de hipotiroidismo severo secundario a tiroiditis de Hashimoto Rhabdomyolysis and myopathy as the only manifestations of severe hypothyroidism secondary to Hashimoto’s thyroiditis

Directory of Open Access Journals (Sweden)

Juan P. Brito

2013-03-01

Full Text Available La tiroiditis de Hashimoto constituye la causa más frecuente de hipotiroidismo en las regiones sin deficiencia de yodo, es más frecuente en mujeres y muchas veces tiene asociación familiar. Los síntomas y signos del hipotiroidismo son sistémicos y dependen de la duración e intensidad de la deficiencia de la hormona tiroidea. Las manifestaciones neuromusculares, son excepcionalmente los únicos signos clínicos. Se presenta el caso de un paciente joven con una miopatía severa con rabdomiolisis como la única manifestación de hipotiroidismo severo debido a tiroiditis de HashimotoHashimoto’s thyroiditis is the most frequent cause of hypothyroidism. In the regions with no iodine deficiency, it is more frequent in women and oftentimes has a familial association. The symptoms and signs of hypothyroidism are systemic and depend on the duration and intensity of the thyroid hormone deficiency. Neuromuscular manifestations are seldom the only symptoms and signs present. We present the case of a young patient with severe myopathy, where rhabdomyolysis was the sole manifestation of severe hypothyroidism secondary to Hashimoto’s thyroiditis

Disease: H01906 [KEGG MEDICUS

Lifescience Database Archive (English)

Full Text Available H01906 Poikiloderma, hereditary fibrosing, with tendon contractures, myopathy, and... pulmonary fibrosis Poikiloderma, hereditary fibrosing, with tendon contractures, myopathy, and pulmonary fi...ies especially on the face and sun-exposed areas. Scalp hair, eyelashes, and eyebrows are typically sparse. Tendon contract

Nitric oxide scavenging by hemoglobin or nitric oxide synthase inhibition by N-Nitro-L-arginine induces cortical spreading ischemia when K+0+ is increased in the subarachnoid space

DEFF Research Database (Denmark)

Dreier, J.P.; Körner, K.; Ebert, Nathalie

1998-01-01

Cerebral blood flow, nitric oxide, potassium, spreading depression, vasospasm, migraine, migrainous stroke, mitochondrial myopathy, encephalopathy, lactic acidosis, and stroke-like episodes (MELAS)......Cerebral blood flow, nitric oxide, potassium, spreading depression, vasospasm, migraine, migrainous stroke, mitochondrial myopathy, encephalopathy, lactic acidosis, and stroke-like episodes (MELAS)...

Exome sequencing identifies variants in two genes encoding the LIM-proteins NRAP and FHL1 in an Italian patient with BAG3 myofibrillar myopathy.

Science.gov (United States)

D'Avila, Francesca; Meregalli, Mirella; Lupoli, Sara; Barcella, Matteo; Orro, Alessandro; De Santis, Francesca; Sitzia, Clementina; Farini, Andrea; D'Ursi, Pasqualina; Erratico, Silvia; Cristofani, Riccardo; Milanesi, Luciano; Braga, Daniele; Cusi, Daniele; Poletti, Angelo; Barlassina, Cristina; Torrente, Yvan

2016-06-01

Myofibrillar myopathies (MFMs) are genetically heterogeneous dystrophies characterized by the disintegration of Z-disks and myofibrils and are associated with mutations in genes encoding Z-disk or Z-disk-related proteins. The c.626 C > T (p.P209L) mutation in the BAG3 gene has been described as causative of a subtype of MFM. We report a sporadic case of a 26-year-old Italian woman, affected by MFM with axonal neuropathy, cardiomyopathy, rigid spine, who carries the c.626 C > T mutation in the BAG3 gene. The patient and her non-consanguineous healthy parents and brother were studied with whole exome sequencing (WES) to further investigate the genetic basis of this complex phenotype. In the patient, we found that the BAG3 mutation is associated with variants in the NRAP and FHL1 genes that encode muscle-specific, LIM domain containing proteins. Quantitative real time PCR, immunohistochemistry and Western blot analysis of the patient's muscular biopsy showed the absence of NRAP expression and FHL1 accumulation in aggregates in the affected skeletal muscle tissue. Molecular dynamic analysis of the mutated FHL1 domain showed a modification in its surface charge, which could affect its capability to bind its target proteins. To our knowledge this is the first study reporting, in a BAG3 MFM, the simultaneous presence of genetic variants in the BAG3 and FHL1 genes (previously described as independently associated with MFMs) and linking the NRAP gene to MFM for the first time.

Orthognathic Surgery in Patients With Congenital Myopathies and Congenital Muscular Dystrophies: Case Series and Review of the Literature.

Science.gov (United States)

Bezak, Brett J; Arce, Kevin A; Jacob, Adam; Van Ess, James

2016-03-01

This case series examined preoperative findings and the surgical, anesthetic, and postoperative management of 6 patients with congenital myopathies (CMs) and congenital muscular dystrophies (CMDs) treated at a tertiary medical institution with orthognathic surgery over 15 years to describe pertinent considerations for performing orthognathic surgery in these complex patients. According to the institutional review board-approved protocol, chart records were reviewed for all orthognathic surgical patients with a clinical, genetic, or muscle biopsy-proved diagnosis of CM or CMD. Six patients (5 male, 1 female) qualified, and they were treated by 4 surgeons in the division of oral and maxillofacial surgery from 1992 through 2007. Average age was 19.5 years at the time of orthognathic surgery. Five patients had Class III malocclusions and 1 patient had Class II malocclusion. All 6 patients had apertognathia with lip incompetence. Nasoendotracheal intubation with a difficulty of 0/3 (0=easiest, 3=most difficult) was performed in all cases. Routine induction and maintenance anesthetics, including halogenated agents and nondepolarizing muscle relaxants, were administered without malignant hyperthermia. All 6 patients underwent Le Fort level osteotomies; 4 also had mandibular setback surgery with or without balancing mandibular inferior border osteotomies. Five patients required planned intensive care unit care postoperatively (average, 18.4 days; range, 4 to 65 days). Postoperative respiratory complications resulting in major blood oxygen desaturations occurred in 5 patients; 4 of these patients required reintubation during emergency code response. Five patients required extended postoperative intubation (average, 4.2 days; range, 3 to 6 days) and ventilatory support. Average hospital length of stay was 21.8 days (range, 6 to 75 days). Average postoperative follow-up interval was 29.8 weeks (range, 6 to 128 weeks). Patients with CMs or CMDs often have characteristic

Advantage of CT scan in muscular pathology. Personal cases and review of the literature

International Nuclear Information System (INIS)

Laroche, M.; Rousseau, H.; Mazieres, B.; Bonafe, A.; Joffre, F.; Arlet, J.

1989-01-01

The advantage of CT scans in muscular pathology is studied. The scan, in addition to the diagnosis of tumors and muscular abscesses, permits to differentiate primary myopathies from neurogenic atrophies: in the course of myopathies, the muscle volume is preserved and they appear as a hypodensity; in neurogenic atrophies, the muscle volume is reduced with preserved density. The CT scan permits to determine the extension of these lesions. In the course of polymyositis, certain forms of rheumatid arthritis, the scan discloses a trabecular and 'worm-eaten' aspect of the muscles. This is also observed after long-term steroid therapy and other endocrine diseases (hyperthyroidism, osteomalacia) indicating an infra-clinical myopathy. In vertebral osteoporosis with fractures and patients with chronic lumbalgia, very ofter, an atrophy of the spinal muscle is observed. Finally, in the course of acquired kyphosis of the adult patient (camptocormia), the CT scan suggest an isolated myopathy, with late manifestations, of the paravertebral muscles [fr

Advantage of CT scan in muscular pathology. Personal cases and review of the literature

Energy Technology Data Exchange (ETDEWEB)

Laroche, M.; Rousseau, H.; Mazieres, B.; Bonafe, A.; Joffre, F.; Arlet, J.

1989-05-01

The advantage of CT scans in muscular pathology is studied. The scan, in addition to the diagnosis of tumors and muscular abscesses, permits to differentiate primary myopathies from neurogenic atrophies: in the course of myopathies, the muscle volume is preserved and they appear as a hypodensity; in neurogenic atrophies, the muscle volume is reduced with preserved density. The CT scan permits to determine the extension of these lesions. In the course of polymyositis, certain forms of rheumatid arthritis, the scan discloses a trabecular and 'worm-eaten' aspect of the muscles. This is also observed after long-term steroid therapy and other endocrine diseases (hyperthyroidism, osteomalacia) indicating an infra-clinical myopathy. In vertebral osteoporosis with fractures and patients with chronic lumbalgia, very ofter, an atrophy of the spinal muscle is observed. Finally, in the course of acquired kyphosis of the adult patient (camptocormia), the CT scan suggest an isolated myopathy, with late manifestations, of the paravertebral muscles.

Mitochondrial Myopathy

Science.gov (United States)

... these disorders and to find ways to effectively treat, prevent, or potentially cure them. Information from the National Library of Medicine’s MedlinePlus ... neuromuscular diseases caused by damage to the mitochondria—small, energy-producing structures that serve as the cells' "power plants." Nerve cells in the brain and muscles ...

Inflammatory Myopathies

Science.gov (United States)

... National Institutes of Health, the leading supporter of biomedical research in the world. The NINDS, along with other ... Testimony Legislative Updates Impact NINDS Contributions to Approved Therapies ... Director, Division of Intramural Research

Mitochondrial Myopathy

Science.gov (United States)

... Institutes of Health (NIH), the leading supporter of biomedical research in the world. In conjunction with other NIH ... Testimony Legislative Updates Impact NINDS Contributions to Approved Therapies ... Director, Division of Intramural Research

Metabolic Myopathies

Science.gov (United States)

... OII) Timed Up & Go (TUG) Western Ontario & McMaster Universities Osteoarthritis Index (WOMAC) Young Investigators Resources for Doctoral Students/Post-Doctoral Fellows Evidence-Based Practice for Academic Researchers Responsible Data Management in Research Career Planning Treatments Patient ...

Thyrotoxic Myopathy

Science.gov (United States)

... potassium levels (known as periodic paralysis). View Full Definition Treatment Treatment involves restoring normal levels of thyroid hormone and may include thyroid drugs, radioactive iodine, and sometimes partial or complete surgical ...

Mitochondrial Myopathies

Science.gov (United States)

... noting “soft signs” in unaffected relatives. These include deaf- ness, short stature, migraine headaches and PEO. Muscle ... mitochondrial defects and provide valuable information for family planning. Perhaps most important, knowing the genetic defects that ...

Manual muscle testing and hand-held dynamometry in people with inflammatory myopathy: An intra- and interrater reliability and validity study.

Science.gov (United States)

Baschung Pfister, Pierrette; de Bruin, Eling D; Sterkele, Iris; Maurer, Britta; de Bie, Rob A; Knols, Ruud H

2018-01-01

Manual muscle testing (MMT) and hand-held dynamometry (HHD) are commonly used in people with inflammatory myopathy (IM), but their clinimetric properties have not yet been sufficiently studied. To evaluate the reliability and validity of MMT and HHD, maximum isometric strength was measured in eight muscle groups across three measurement events. To evaluate reliability of HHD, intra-class correlation coefficients (ICC), the standard error of measurements (SEM) and smallest detectable changes (SDC) were calculated. To measure reliability of MMT linear Cohen`s Kappa was computed for single muscle groups and ICC for total score. Additionally, correlations between MMT8 and HHD were evaluated with Spearman Correlation Coefficients. Fifty people with myositis (56±14 years, 76% female) were included in the study. Intra-and interrater reliability of HHD yielded excellent ICCs (0.75-0.97) for all muscle groups, except for interrater reliability of ankle extension (0.61). The corresponding SEMs% ranged from 8 to 28% and the SDCs% from 23 to 65%. MMT8 total score revealed excellent intra-and interrater reliability (ICC>0.9). Intrarater reliability of single muscle groups was substantial for shoulder and hip abduction, elbow and neck flexion, and hip extension (0.64-0.69); moderate for wrist (0.53) and knee extension (0.49) and fair for ankle extension (0.35). Interrater reliability was moderate for neck flexion (0.54) and hip abduction (0.44); fair for shoulder abduction, elbow flexion, wrist and ankle extension (0.20-0.33); and slight for knee extension (0.08). Correlations between the two tests were low for wrist, knee, ankle, and hip extension; moderate for elbow flexion, neck flexion and hip abduction; and good for shoulder abduction. In conclusion, the MMT8 total score is a reliable assessment to consider general muscle weakness in people with myositis but not for single muscle groups. In contrast, our results confirm that HHD can be recommended to evaluate strength of

Muscle mitochondrial metabolism and calcium signaling impairment in patients treated with statins

Energy Technology Data Exchange (ETDEWEB)

Sirvent, P., E-mail: pascal.sirvent@univ-bpclermont.fr [U1046, INSERM, Université Montpellier 1 and Université Montpellier 2, 34295 Montpellier (France); CHRU Montpellier, 34295 Montpellier (France); Clermont Université, Université Blaise Pascal, EA 3533, Laboratoire des Adaptations Métaboliques à l' Exercice en conditions Physiologiques et Pathologiques (AME2P), BP 80026, F-63171 Aubière cedex (France); Fabre, O.; Bordenave, S. [U1046, INSERM, Université Montpellier 1 and Université Montpellier 2, 34295 Montpellier (France); CHRU Montpellier, 34295 Montpellier (France); Hillaire-Buys, D. [CHRU Montpellier, 34295 Montpellier (France); Raynaud De Mauverger, E.; Lacampagne, A.; Mercier, J. [U1046, INSERM, Université Montpellier 1 and Université Montpellier 2, 34295 Montpellier (France); CHRU Montpellier, 34295 Montpellier (France)

2012-03-01

The most common and problematic side effect of statins is myopathy. To date, the patho-physiological mechanisms of statin myotoxicity are still not clearly understood. In previous studies, we showed that acute application in vitro of simvastatin caused impairment of mitochondrial function and dysfunction of calcium homeostasis in human and rat healthy muscle samples. We thus evaluated in the present study, mitochondrial function and calcium signaling in muscles of patients treated with statins, who present or not muscle symptoms, by oxygraphy and recording of calcium sparks, respectively. Patients treated with statins showed impairment of mitochondrial respiration that involved mainly the complex I of the respiratory chain and altered frequency and amplitude of calcium sparks. The muscle problems observed in statin-treated patients appear thus to be related to impairment of mitochondrial function and muscle calcium homeostasis, confirming the results we previously reported in vitro. -- Highlights: ► The most common and problematic side effect of statins is myopathy. ► Patients treated with statins showed impairment of mitochondrial respiration. ► Statins-treated patients showed altered frequency and amplitude of calcium sparks.

Muscle mitochondrial metabolism and calcium signaling impairment in patients treated with statins

International Nuclear Information System (INIS)

Sirvent, P.; Fabre, O.; Bordenave, S.; Hillaire-Buys, D.; Raynaud De Mauverger, E.; Lacampagne, A.; Mercier, J.

2012-01-01

The most common and problematic side effect of statins is myopathy. To date, the patho-physiological mechanisms of statin myotoxicity are still not clearly understood. In previous studies, we showed that acute application in vitro of simvastatin caused impairment of mitochondrial function and dysfunction of calcium homeostasis in human and rat healthy muscle samples. We thus evaluated in the present study, mitochondrial function and calcium signaling in muscles of patients treated with statins, who present or not muscle symptoms, by oxygraphy and recording of calcium sparks, respectively. Patients treated with statins showed impairment of mitochondrial respiration that involved mainly the complex I of the respiratory chain and altered frequency and amplitude of calcium sparks. The muscle problems observed in statin-treated patients appear thus to be related to impairment of mitochondrial function and muscle calcium homeostasis, confirming the results we previously reported in vitro. -- Highlights: ► The most common and problematic side effect of statins is myopathy. ► Patients treated with statins showed impairment of mitochondrial respiration. ► Statins-treated patients showed altered frequency and amplitude of calcium sparks.

Mitochondrial iron-sulfur cluster biogenesis from molecular understanding to clinical disease

Science.gov (United States)

Alfadhel, Majid; Nashabat, Marwan; Ali, Qais Abu; Hundallah, Khalid

2017-01-01

Iron–sulfur clusters (ISCs) are known to play a major role in various protein functions. Located in the mitochondria, cytosol, endoplasmic reticulum and nucleus, they contribute to various core cellular functions. Until recently, only a few human diseases related to mitochondrial ISC biogenesis defects have been described. Such diseases include Friedreich ataxia, combined oxidative phosphorylation deficiency 19, infantile complex II/III deficiency defect, hereditary myopathy with lactic acidosis and mitochondrial muscle myopathy, lipoic acid biosynthesis defects, multiple mitochondrial dysfunctions syndromes and non ketotic hyperglycinemia due to glutaredoxin 5 gene defect. Disorders of mitochondrial import, export and translation, including sideroblastic anemia with ataxia, EVEN-PLUS syndrome and mitochondrial complex I deficiency due to nucleotide-binding protein-like protein gene defect, have also been implicated in ISC biogenesis defects. With advances in next generation sequencing technologies, more disorders related to ISC biogenesis defects are expected to be elucidated. In this article, we aim to shed the light on mitochondrial ISC biogenesis, related proteins and their function, pathophysiology, clinical phenotypes of related disorders, diagnostic approach, and future implications. PMID:28064324

Radioimmunoassay for human myoglobin: methods and results in patients with skeletal muscle or myocardial disorders

International Nuclear Information System (INIS)

Miyoshi, K.; Saito, S.; Kawai, H.; Kondo, A.; Iwasa, M.; Hayashi, T.; Yagita, M.

1978-01-01

A sensitive and specific radioimmunoassay has been developed for the measurement of serum Mb. Immunization of rabbit with human Mb yielded anti-Mb antibody which was purified by affinity chromatography. Human hemoglobin, CK, and the component of serum per se did not appear to cross-react with the antibody. Mb was radiolabeled by the chloramine T method. The radioimmunoassay method could detect as little as 0.3 ng of Mb and was not affected by hemolysis. Information is also given on precision, recovery, and specimen preservation. Mb levels could be detected in all of 120 normal adults, and the values ranged between 1 and 28 ng/ml (mean, 13.1 +- 6.1). No sex difference was observed. Levels were markedly elevated in all the patients with progressive muscular dystrophy, especially in the Duchenne type at the level of 40 to 1700 ng/ml. It was also noticed that about 70% of female gene carriers of Duchenne type had a slightly increased Mb level. An elevated serum Mb was also noted in polymyositis. In every case of acute myocardial infarction, serum Mb levels were increased, peak values ranging from 175 to 4400 ng/ml and averaging 1162 +- 287.9 Mb levels were elevated faster and peaked earlier (within 6 to 12 hr after the attack) than serum CK activity and returned to nearly normal range within 3 to 4 days. The increase in serum Mb was also noticed in shock and surgery. These data indicate that radioimmunoassay of Mb is a useful test for judging the myolytic state of myogenic myopathies and for early detection of myocardial infarction

[Muscle biopsy in children: Usefulness in 2012].

Science.gov (United States)

Cuisset, J-M; Maurage, C-A; Carpentier, A; Briand, G; Thévenon, A; Rouaix, N; Vallée, L

2013-01-01

Muscle biopsy is a mainstay diagnostic tool for investigating neuromuscular disorders in children. We report the yield of pediatric muscle biopsy in a population of 415 children by a retrospective study of 419 biopsies performed between 1/01/2000 and 31/12/2009 in a neuropediatric department, including mitochondrial respiratory chain analysis for 87 children. Two hundred and fifty-five biopsies were from boys (61%) 164 from girls (39%). Their mean age at biopsy was 6.5years; 155 (37%) biopsies were obtained before the child was 5years old. Final histopathological diagnoses were: congenital myopathy (n=193, including 15 structural congenital myopathies); progressive muscular dystrophy (n=75 [18%] including 57 dystrophinopathies); congenital muscular dystrophy (n=17, including six primary merosinopathies); dermatomyositis (n=11); spinal muscular atrophy (n=9, including six atypical spinal muscular atrophies); metabolic myopathy (n=32, including 19 mitochondrial myopathies); encephalomyopathy (n=53 [13%], including 27 with a mitochondrial respiratory chain defect). Pathological diagnosis remained undetermined in 16 cases. In 184 patients (44%), the muscle biopsy revealed specific histopathological anomalies (dystrophic process; specific ultrastructural abnormalities; perifascicular atrophy; neurogenic atrophy; metabolic anomalies) enabling a precise etiological diagnosis. For 85% of progressive muscular dystrophies, the biopsy resulted in a genetic diagnosis after identification of the protein defect. In 15% of the congenital myopathies, histopathological anomalies focused attention on one or several genes. Concerning dystrophinopathies, quantification of dystrophin deficiency on the biopsy specimen contributed to the definition of the clinical phenotype: Duchenne, or Becker. In children with a myopathy, muscle biopsy is often indispensable to establish the etiological diagnosis. Based on the results from this series, muscle biopsy can provide a precise

Symptomatic lipid storage in carriers for the PNPLA2 gene.

Science.gov (United States)

Janssen, Mirian C H; van Engelen, Baziel; Kapusta, Livia; Lammens, Martin; van Dijk, Martin; Fischer, Judith; van der Graaf, Marinette; Wevers, Ron A; Fahrleitner, Manuela; Zimmermann, Robert; Morava, Eva

2013-08-01

Neutral lipid storage disease comprises a heterogeneous group of inherited disorders characterized by severe accumulation of cytoplasmic triglyceride droplets in several tissues and neutrophils. A novel type of autosomal recessive lipid myopathy due to PNPLA2 mutations was recently described with associated cardiac disease, myopathy and frequent infections, but without ichthyosis. Here we describe the clinical and biochemical characteristics of a long surviving patient and report on four carrier family members with diverse clinical involvement. Interestingly, heterozygous patients show neutral lipid storage in muscle and in the keratocytes of the skin, Jordans' bodies, mild myopathy and frequent infections. Biochemical analysis of fibroblasts obtained from patients revealed increased triglyceride storage and reduced lipid droplet-associated triglyceride hydrolase activity. Together, our data implicate that the wild-type allele cannot fully compensate for the mutated dysfunctional allele of PNPLA2 leading to triglyceride accumulation in muscle and mild myopathy in PNPLA2 mutation carriers. The presence of neutral lipid droplets in the skin in PNPLA2 mutation carriers strengthens the link between NLSD and other neutral lipid storage diseases with ichthyosis.

Spatially Discordant Alternans and Arrhythmias in Tachypacing-Induced Cardiac Myopathy in Transgenic LQT1 Rabbits: The Importance of IKs and Ca2+ Cycling.

Directory of Open Access Journals (Sweden)

Emily Lau

Full Text Available Remodeling of cardiac repolarizing currents, such as the downregulation of slowly activating K+ channels (IKs, could underlie ventricular fibrillation (VF in heart failure (HF. We evaluated the role of Iks remodeling in VF susceptibility using a tachypacing HF model of transgenic rabbits with Long QT Type 1 (LQT1 syndrome.LQT1 and littermate control (LMC rabbits underwent three weeks of tachypacing to induce cardiac myopathy (TICM. In vivo telemetry demonstrated steepening of the QT/RR slope in LQT1 with TICM (LQT1-TICM; pre: 0.26±0.04, post: 0.52±0.01, P<0.05. In vivo electrophysiology showed that LQT1-TICM had higher incidence of VF than LMC-TICM (6 of 11 vs. 3 of 11, respectively. Optical mapping revealed larger APD dispersion (16±4 vs. 38±6 ms, p<0.05 and steep APD restitution in LQT1-TICM compared to LQT1-sham (0.53±0.12 vs. 1.17±0.13, p<0.05. LQT1-TICM developed spatially discordant alternans (DA, which caused conduction block and higher-frequency VF (15±1 Hz in LQT1-TICM vs. 13±1 Hz in LMC-TICM, p<0.05. Ca2+ DA was highly dynamic and preceded voltage DA in LQT1-TICM. Ryanodine abolished DA in 5 out of 8 LQT1-TICM rabbits, demonstrating the importance of Ca2+ in complex DA formation. Computer simulations suggested that HF remodeling caused Ca2+-driven alternans, which was further potentiated in LQT1-TICM due to the lack of IKs.Compared with LMC-TICM, LQT1-TICM rabbits exhibit steepened APD restitution and complex DA modulated by Ca2+. Our results strongly support the contention that the downregulation of IKs in HF increases Ca2+ dependent alternans and thereby the risk of VF.

Polymyositis and dermatomyositis: Disease spectrum and classification

Directory of Open Access Journals (Sweden)

Siba P Raychaudhuri

2012-01-01

Full Text Available Muscle inflammation and weakness are the key features of idiopathic inflammatory myopathies (IIMs. In addition IIMs are frequently associated with cutaneous and pulmonary involvement. In clinical practice the three common inflammatory myopathies we come across are polymyositis (PM, dermatomyositis (DM and inclusion body myositis (IBM. The Bohan and Peter criteria combine clinical, laboratory, and pathologic features to define PM and DM. They did not recognize inclusion body myositis (IBM or other inflammatory myopathies, such as granulomatous and eosinophilic myositis. Thus the disease spectrum is wide and IIMs are a heterogeneous group of autoimmune disorders. To address these issues in this article we have discussed the currently developing newer classifications of IIMs.

Long-chain 3-hydroxyacyl-coenzyme A dehydrogenase (L-CHAD) deficiency in a patient with the Bannayan-Riley-Ruvalcaba syndrome.

Science.gov (United States)

Fryburg, J S; Pelegano, J P; Bennett, M J; Bebin, E M

1994-08-01

Bannayan-Riley-Ruvalcaba syndrome (BRRS) is an autosomal dominant condition of macrocephaly in combination with lipomas/hemangiomas, hypotonia, developmental delay, and a lipid myopathy. The etiology of the lipid storage myopathy has been unclear. We describe a black boy with findings of BRRS who also has a defect in long-chain fatty acid oxidation expressed in cultured skin fibroblasts as a deficiency of long-chain-L-3-hydroxyacyl-CoA dehydrogenase (L-CHAD). He also has an abnormal brain MRI and increased size of both lower limbs. We present this child because of his unusual combination of findings, and postulate that L-CHAD deficiency may be the cause of the lipid myopathy in BRRS.

Stac3 has a direct role in skeletal muscle-type excitation-contraction coupling that is disrupted by a myopathy-causing mutation.

Science.gov (United States)

Polster, Alexander; Nelson, Benjamin R; Olson, Eric N; Beam, Kurt G

2016-09-27

In skeletal muscle, conformational coupling between CaV1.1 in the plasma membrane and type 1 ryanodine receptor (RyR1) in the sarcoplasmic reticulum (SR) is thought to underlie both excitation-contraction (EC) coupling Ca(2+) release from the SR and retrograde coupling by which RyR1 increases the magnitude of the Ca(2+) current via CaV1.1. Recent work has shown that EC coupling fails in muscle from mice and fish null for the protein Stac3 (SH3 and cysteine-rich domain 3) but did not establish the functional role of Stac3 in the CaV1.1-RyR1 interaction. We investigated this using both tsA201 cells and Stac3 KO myotubes. While confirming in tsA201 cells that Stac3 could support surface expression of CaV1.1 (coexpressed with its auxiliary β1a and α2-δ1 subunits) and the generation of large Ca(2+) currents, we found that without Stac3 the auxiliary γ1 subunit also supported membrane expression of CaV1.1/β1a/α2-δ1, but that this combination generated only tiny Ca(2+) currents. In Stac3 KO myotubes, there was reduced, but still substantial CaV1.1 in the plasma membrane. However, the CaV1.1 remaining in Stac3 KO myotubes did not generate appreciable Ca(2+) currents or EC coupling Ca(2+) release. Expression of WT Stac3 in Stac3 KO myotubes fully restored Ca(2+) currents and EC coupling Ca(2+) release, whereas expression of Stac3W280S (containing the Native American myopathy mutation) partially restored Ca(2+) currents but only marginally restored EC coupling. We conclude that membrane trafficking of CaV1.1 is facilitated by, but does not require, Stac3, and that Stac3 is directly involved in conformational coupling between CaV1.1 and RyR1.

Validation and clinical significance of the Childhood Myositis Assessment Scale for assessment of muscle function in the juvenile idiopathic inflammatory myopathies.

Science.gov (United States)

Huber, Adam M; Feldman, Brian M; Rennebohm, Robert M; Hicks, Jeanne E; Lindsley, Carol B; Perez, Maria D; Zemel, Lawrence S; Wallace, Carol A; Ballinger, Susan H; Passo, Murray H; Reed, Ann M; Summers, Ronald M; White, Patience H; Katona, Ildy M; Miller, Frederick W; Lachenbruch, Peter A; Rider, Lisa G

2004-05-01

To examine the measurement characteristics of the Childhood Myositis Assessment Scale (CMAS) in children with juvenile idiopathic inflammatory myopathy (juvenile IIM), and to obtain preliminary data on the clinical significance of CMAS scores. One hundred eight children with juvenile IIM were evaluated on 2 occasions, 7-9 months apart, using various measures of physical function, strength, and disease activity. Interrater reliability, construct validity, and responsiveness of the CMAS were examined. The minimum clinically important difference (MID) and CMAS scores corresponding to various degrees of physical disability were estimated. The intraclass correlation coefficient for 26 patients assessed by 2 examiners was 0.89, indicating very good interrater reliability. The CMAS score correlated highly with the Childhood Health Assessment Questionnaire (C-HAQ) score and with findings on manual muscle testing (MMT) (r(s) = -0.73 and 0.73, respectively) and moderately with physician-assessed global disease activity and skin activity, parent-assessed global disease severity, and muscle magnetic resonance imaging (r(s) = -0.44 to -0.61), thereby demonstrating good construct validity. The standardized response mean was 0.81 (95% confidence interval 0.53, 1.09) in patients with at least 0.8 cm improvement on a 10-cm visual analog scale for physician-assessed global disease activity, indicating strong responsiveness. In bivariate regression models predicting physician-assessed global disease activity, MMT remained significant in models containing the CMAS (P = 0.03) while the C-HAQ did not (P = 0.4). Estimates of the MID ranged from 1.5 to 3.0 points on a 0-52-point scale. CMAS scores corresponding to no, mild, mild-to-moderate, and moderate physical disability, respectively, were 48, 45, 39, and 30. The CMAS exhibits good reliability, construct validity, and responsiveness, and is therefore a valid instrument for the assessment of physical function, muscle strength, and

Kocher-Debré-Sémélaigne syndrome and congenital nystagmus

OpenAIRE

Radhakrishnan, K.; Walia, B. N. S.; Venkateswarlu, K.; Mann, S. B. S.

1982-01-01

A 11-year-old boy with hypothyroidism developed generalized muscle hypertrophy and proximal muscular weakness. Electromyographic findings were suggestive of myopathy. He had had congenital nystagmus (CN) since early infancy. Although the association of childhood hypothyroidism and CN has been documented before, the triad of hypothyroidism, hypertrophic myopathy and CN exhibited by the patient is believed to be unique.

Anti-Jo-1 antibody-positive patients show a characteristic necrotizing perifascicular myositis.

Science.gov (United States)

Mescam-Mancini, Lénaig; Allenbach, Yves; Hervier, Baptiste; Devilliers, Hervé; Mariampillay, Kuberaka; Dubourg, Odile; Maisonobe, Thierry; Gherardi, Romain; Mezin, Paulette; Preusse, Corinna; Stenzel, Werner; Benveniste, Olivier

2015-09-01

Idiopathic inflammatory myopathies can be classified as polymyositis, dermatomyositis, immune-mediated necrotizing myopathy, sporadic inclusion body myositis or non-specific myositis. Anti-Jo-1 antibody-positive patients are assigned to either polymyositis or dermatomyositis suggesting overlapping pathological features. We aimed to determine if anti-Jo-1 antibody-positive myopathy has a specific morphological phenotype. In a series of 53 muscle biopsies of anti-Jo-1 antibody-positive patients, relevant descriptive criteria defining a characteristic morphological pattern were identified. They were tested in a second series of anti-Jo-1 antibody-positive patients and compared to 63 biopsies from patients suffering from other idiopathic inflammatory myopathies. In anti-Jo-1 antibody-positive patients, necrotic fibres, which strongly clustered in perifascicular regions, were frequently observed. Sarcolemmal complement deposition was detected specifically in perifascicular areas. Inflammation was mainly located in the perimysium and around vessels in 90.6%. Perimysial fragmentation was observed in 90% of cases. Major histocompatibility complex class I staining was diffusely positive, with a perifascicular reinforcement. Multivariate analysis showed that criteria defining perifascicular pathology: perifascicular necrosis, atrophy, and perimysial fragmentation allow the distinction of anti-Jo-1 antibody-positive patients, among patients suffering from other idiopathic inflammatory myopathies. Anti-Jo-1 antibody-positive patients displayed perifascicular necrosis, whereas dermatomyositis patients exhibited perifascicular atrophy. © The Author (2015). Published by Oxford University Press on behalf of the Guarantors of Brain. All rights reserved. For Permissions, please email: journals.permissions@oup.com.

POLYMYOSITIS/DERMATOMIOSITIS: DIFFERENTIAL DIAGNOSIS

Directory of Open Access Journals (Sweden)

O. A. Antelava

2016-01-01

Full Text Available The lecture considers the problem of rare systemic connective tissue diseases, such as idiopathic inflammatory myopathies (IIMs. It underlines the clinical and immunological heterogeneity of their subtypes, which defines therapeutic tactics and prognosis. The diagnostic criteria for IIMs are given. A differential diagnostic algorithm based on the exclusion of phenotypically similar forms of myopathies of different genesis is proposed. 

Skeletal Muscle Magnetic Resonance Imaging of the Lower Limbs in Late-onset Lipid Storage Myopathy with Electron Transfer Flavoprotein Dehydrogenase Gene Mutations

Institute of Scientific and Technical Information of China (English)

Xin-Yi Liu; Ming Jin; Zhi-Qiang Wang; Dan-Ni Wang; Jun-Jie He; Min-Ting Lin; Hong-Xia Fu

2016-01-01

Background:Lipid storage myopathy (LSM) is a genetically heterogeneous group with variable clinical phenotypes.Late-onset multiple acyl-coenzyme A dehydrogenation deficiency (MADD) is a rather common form of LSM in China.Diagnosis and clinical management of it remain challenging,especially without robust muscle biopsy result and genetic detection.As the noninvasion and convenience,muscle magnetic resonance imaging (MRI) is a helpful assistant,diagnostic tool for neuromuscular disorders.However,the disease-specific MRI patterns of muscle involved and its diagnostic value in late-onset MADD have not been systematic analyzed.Methods:We assessed the MRI pattern and fat infiltration degree of the lower limb muscles in 28 late-onset MADD patients,combined with detailed clinical features and gene spectrum.Fat infiltration degree of the thigh muscle was scored while that ofgluteus was described as obvious or not.Associated muscular atrophy was defined as obvious muscle bulk reduction.Results:The mean scores were significantly different among the anterior,medial,and posterior thigh muscle groups.The mean of fat infiltration scores on posterior thigh muscle group was significantly higher than either anterior or medial thigh muscle group (P ＜ 0.001).Moreover,the mean score on medial thigh muscle group was significantly higher than that of anterior thigh muscle group (P ＜ 0.01).About half of the patients displayed fat infiltration and atrophy in gluteus muscles.Of 28 patients,12 exhibited atrophy in medial and/or posterior thigh muscle groups,especially in posterior thigh muscle group.Muscle edema pattern was not found in all the patients.Conclusions:Late-onset MADD patients show a typical muscular imaging pattern of fat infiltration and atrophy on anterior,posterior,and medial thigh muscle groups,with major involvement of posterior thigh muscle group and gluteus muscles and a sparing involvement of anterior thigh compartment.Our findings also suggest that muscle MRI of

Proximal weakness of lower limbs as the sole presentation of hyperthyroidism: report of one case.

Science.gov (United States)

Chen, Chu-Chin; Chiu, Pao-Chin; Shih, Chen-Houng; Hsieh, Kai-Sheng

2005-01-01

Most children with acute or chronic flaccid limb weakness have a disorder of motor unit. However, it is very important to exclude cerebral or other upper motor neuron disorders before we approach such patients as pure muscle disorders. In general, neuropathy results in distal limb weakness, myopathy manifests with proximal weakness. There are exceptions, however. Accurate diagnosis in this wide array of disorders is dependent on a careful clinical assessment followed by the appropriate investigations. Here we report a 14-year-old girl who presented with progressive difficulty in rising up from the floor for one month. Neurological examination revealed an obese, clumsy but clear girl with stable vital signs. The muscle power of neck and upper limbs was normal. There was positive Gower sign, but the toe and heel gaits were acceptable. The initial blood work and motor/sensory nerve conduction velocity were unremarkable. Further study for thyroid function showed a hyperthyroid state. The proximal myopathy recovered soon after medical treatment. There were no other symptoms, and signs indicating hyperthyroidism and proximal myopathy of lower limbs was the isolated clinical feature. Hyperthyroid myopathy is common in hyperthyroidism, but is unusual as the sole presenting symptom.

Bilateral iliopsoas muscle contracture and spinous process impingement in a German Shepherd dog.

Science.gov (United States)

Ragetly, Guillaume R; Griffon, Dominique J; Johnson, Ann L; Blevins, William E; Valli, Victor E

2009-12-01

To report diagnosis and treatment of bilateral iliopsoas muscle contracture in a dog with spinous process impingement. Case report. German Shepherd dog. A dog with chronic progressive lameness, flexion contracture of the coxofemoral joints, severe pain, and decreased femoral reflexes had severe spondylosis bridging the vertebral bodies from L1 to L4 and enlarged dorsal spinous processes from T8 to L6 with impingement and bony proliferation. Ultrasonographic and magnetic resonance imaging (MRI) findings were consistent with fibrosis, mineralization, and atrophy of the iliopsoas muscles bilaterally which was treated by staged tenectomy of the insertions of the iliopsoas muscles. Because of severe perivascular fibrosis, the femoral vessels required ligation. Bilateral iliopsoas muscle tenectomy improved gait and provided pain relief. Histologic findings were consistent with fibrotic myopathy. Slow progression of severe clinical signs observed bilaterally in this dog differs from previous reports of iliopsoas myopathy. Findings were similar to the fibrotic myopathy of the gracilis or semitendinosus muscles described in dogs. Iliopsoas muscle abnormalities should be considered in dogs with limited hip extension and pain. MRI is useful for diagnosing muscle fibrosis. Iliopsoas tenectomy may improve clinical function in dogs with fibrotic myopathy.