WorldWideScience

Sample records for human keratinocytes transduced

  1. Gene expression studies on human keratinocytes transduced with human growth hormone gene for a possible utilization in gene therapy

    International Nuclear Information System (INIS)

    Mathor, Monica Beatriz.

    1994-01-01

    Taking advantage of the recent progress in the DNA-recombinant techniques and of the potentiality of normal human keratinocytes primary culture to reconstitute the epidermis, it was decided to genetically transform these keratinocytes to produce human growth hormone under controllable conditions that would be used in gene therapy at this hormone deficient patients. The first step to achieve this goal was to standardize infection of keratinocytes with retrovirus producer cells containing a construct which included the gene of bacterial b-galactosidase. The best result was obtained cultivating the keratinocytes for 3 days in a 2:1 mixture of retrovirus producer cells and 3T3-J2 fibroblasts irradiated with 60 Gy, and splitting these infected keratinocytes on 3T3-J2 fibroblasts feeder layer. Another preliminary experiment was to infect normal human keratinocytes with interleukin-6 gene (hIL-6) that, in pathologic conditions, could be reproduced by keratinocytes and secreted to the blood stream. Thus, we verify that infected keratinocytes secrete an average amount of 500 ng/10 6 cell/day of cytokin during the in vitro life time, that certify the stable character of the injection. These keratinocytes, when grafted in mice, secrete hIL-6 to the blood stream reaching levels of 40 pg/ml of serum. After these preliminary experiments, we construct a retroviral vector with the human growth hormone gene (h GH) driven by human metallothionein promoter (h PMT), designated DChPMTGH. Normal human keratinocytes were infected with DChPMTGH producer cells, following previously standardized protocol, obtaining infected keratinocytes secreting to the culture media 340 ng h GH/10 6 cell/day without promoter activation. This is the highest level of h GH secreted in human keratinocytes primary culture described in literature. The h GH value increases approximately 10 times after activation with 100 μM Zn +2 for 8-12 hours. (author). 158 refs., 42 figs., 6 tabs

  2. Tofacitinib Represses the Janus Kinase-Signal Transducer and Activators of Transcription Signalling Pathway in Keratinocytes.

    Science.gov (United States)

    Srivastava, Ankit; Ståhle, Mona; Pivarcsi, Andor; Sonkoly, Enikö

    2018-05-08

    Tofacitinib is a Janus kinase (JAK) inhibitor, which has shown efficacy in treating psoriasis. The mode of action of tofacitinib is not completely understood but it has been thought to be mediated by the inhibition of CD4+ T-cell activation. Here, we investigated whether the molecular targets of tofacitinib are expressed in keratinocytes, and whether tofacitinib can modulate the activity of the JAK/Signal Transducer and Activators of Transcription (STAT)-pathway in keratinocytes. Transcriptomic profiling of human keratinocytes treated with IL-22 in combination with tofacitinib revealed that tofacitinib could prevent the majority of IL-22-mediated gene expression changes. Pathway analysis of tofacitinib-regulated genes in keratinocytes revealed enrichment of genes involved in the JAK/STAT signalling pathway. Quantitative real-time-PCR confirmed the upregulation of S100A7 and downregulation of EGR1 expression by IL-22, which was prevented by tofacitinib pre-treatment. These results indicate a direct effect of tofacinitib on keratinocytes, which can have relevance for systemic as well as for topical treatment of psoriasis with tofacitinib.

  3. Thalidomide increases human keratinocyte migration and proliferation.

    Science.gov (United States)

    Nasca, M R; O'Toole, E A; Palicharla, P; West, D P; Woodley, D T

    1999-11-01

    Thalidomide is reported to have therapeutic utility in the treatment of pyoderma gangrenosum, Behçet's disease, aphthous ulcers, and skin wounds. We investigated the effect of thalidomide on human keratinocyte proliferation and migration, two early and critical events in the re-epithelialization of skin wounds. Thalidomide at concentrations less than 1 microM did not affect keratinocyte viability. Using a thymidine incorporation assay, we found that thalidomide, at therapeutic concentrations, induced more than a 2. 5-fold increase in the proliferative potential of the cells. Keratinocyte migration was assessed by two independent motility assays: a colloidal gold assay and an in vitro scratch assay. At optimal concentrations, thalidomide increased keratinocyte migration on a collagen matrix more than 2-fold in the colloidal gold assay and more than 3-fold in the scratch assay over control. Although pro-migratory, thalidomide did not alter the level of metalloproteinase-9 secreted into culture medium. Thalidomide did, however, induce a 2-4-fold increase in keratinocyte-derived interleukin-8, a pro-migratory cellular autocrine factor. Human keratinocyte migration and proliferation are essential for re-epithelialization of skin wounds. Interleukin-8 increases human keratinocyte migration and proliferation and is chemotactic for keratinocytes. Therefore, thalidomide may modulate keratinocyte proliferation and motility by a chemokine-dependent pathway.

  4. Intermittent pressure decreases human keratinocyte proliferation in vitro.

    Science.gov (United States)

    Nasca, Maria R; Shih, Alan T; West, Dennis P; Martinez, Wanda M; Micali, Giuseppe; Landsman, Adam S

    2007-01-01

    The aim of this study was to investigate the correlation between pressure changes and keratinocyte proliferation by determining whether keratinocytes exposed to altered mechanical pressures would proliferate at different rates compared to control cells not subjected to pressure changes. Tissue culture flasks of human keratinocytes plated at an approximate density of 15,000 cells/cm(2) undergoing an intermittent cyclic pressure of 362 mm Hg at a frequency of 2.28 or 5.16 cycles/min (0.038 or 0.086 Hz) for 8 h were compared to control flasks grown at ambient room pressure. An in-line pressure transducer was used to monitor and adjust pressure within the cell chambers, using a solenoid valve. A thymidine incorporation assay assessed the amount of cell proliferation in each set of experiments. Differences in proliferation between keratinocytes subjected to cyclic pressure changes and control cells were found to be statistically significant (p < 0.05) in 4 out of 5 proliferation assays. Also, a higher frequency of pressure changes consistently generated a reduced proliferation rate compared to that seen in cells exposed to a lower frequency of pressure changes. These data indicate that keratinocytes undergoing intermittent pressure changes exhibit decreased proliferation rates compared to controls. Furthermore, an increased frequency rate seems to have a greater effect on proliferation than low-frequency rate pressure changes, suggesting that the stress caused by frequently changed pressure may play a greater role in reducing keratinocyte proliferation than the actual magnitude of load applied to the cells. Our results support the current treatment protocol of reducing speed and duration of walking on the site of the wound to promote healing of foot ulcers. (c) 2007 S. Karger AG, Basel.

  5. Gene expression studies on human keratinocytes transduced with human growth hormone gene for a possible utilization in gene therapy; Estudos da expressao genica mediante utilizacao de queratinocitos humanos normais transduzidos com o gene do hormonio de crscimento humano. Possivel utilizacao em terapia genica

    Energy Technology Data Exchange (ETDEWEB)

    Mathor, Monica Beatriz

    1994-12-31

    Taking advantage of the recent progress in the DNA-recombinant techniques and of the potentiality of normal human keratinocytes primary culture to reconstitute the epidermis, it was decided to genetically transform these keratinocytes to produce human growth hormone under controllable conditions that would be used in gene therapy at this hormone deficient patients. The first step to achieve this goal was to standardize infection of keratinocytes with retrovirus producer cells containing a construct which included the gene of bacterial b-galactosidase. The best result was obtained cultivating the keratinocytes for 3 days in a 2:1 mixture of retrovirus producer cells and 3T3-J2 fibroblasts irradiated with 60 Gy, and splitting these infected keratinocytes on 3T3-J2 fibroblasts feeder layer. Another preliminary experiment was to infect normal human keratinocytes with interleukin-6 gene (hIL-6) that, in pathologic conditions, could be reproduced by keratinocytes and secreted to the blood stream. Thus, we verify that infected keratinocytes secrete an average amount of 500 ng/10{sup 6} cell/day of cytokin during the in vitro life time, that certify the stable character of the injection. These keratinocytes, when grafted in mice, secrete hIL-6 to the blood stream reaching levels of 40 pg/ml of serum. After these preliminary experiments, we construct a retroviral vector with the human growth hormone gene (h GH) driven by human metallothionein promoter (h PMT), designated DChPMTGH. Normal human keratinocytes were infected with DChPMTGH producer cells, following previously standardized protocol, obtaining infected keratinocytes secreting to the culture media 340 ng h GH/10{sup 6} cell/day without promoter activation. This is the highest level of h GH secreted in human keratinocytes primary culture described in literature. The h GH value increases approximately 10 times after activation with 100 {mu}M Zn{sup +2} for 8-12 hours. (author). 158 refs., 42 figs., 6 tabs.

  6. Decorin gene expression and its regulation in human keratinocytes

    Energy Technology Data Exchange (ETDEWEB)

    Velez-DelValle, Cristina; Marsch-Moreno, Meytha; Castro-Munozledo, Federico [Department of Cell Biology, Centro de Investigacion y de Estudios Avanzados del IPN, Apdo. Postal 14-740, Mexico D.F. 07000 (Mexico); Kuri-Harcuch, Walid, E-mail: walidkuri@gmail.com [Department of Cell Biology, Centro de Investigacion y de Estudios Avanzados del IPN, Apdo. Postal 14-740, Mexico D.F. 07000 (Mexico)

    2011-07-22

    Highlights: {yields} We showed that cultured human diploid epidermal keratinocytes express and synthesize decorin. {yields} Decorin is found intracytoplasmic in suprabasal cells of cultures and in human epidermis. {yields} Decorin mRNA expression in cHEK is regulated by pro-inflammatory and proliferative cytokines. {yields} Decorin immunostaining of psoriatic lesions showed a lower intensity and altered intracytoplasmic arrangements. -- Abstract: In various cell types, including cancer cells, decorin is involved in regulation of cell attachment, migration and proliferation. In skin, decorin is seen in dermis, but not in keratinocytes. We show that decorin gene (DCN) is expressed in the cultured keratinocytes, and the protein is found in the cytoplasm of differentiating keratinocytes and in suprabasal layers of human epidermis. RT-PCR experiments showed that DCN expression is regulated by pro-inflammatory and proliferative cytokines. Our data suggest that decorin should play a significant role in keratinocyte terminal differentiation, cutaneous homeostasis and dermatological diseases.

  7. In Vitro Toxicity of Aluminum Nanoparticles in Human Keratinocytes

    National Research Council Canada - National Science Library

    McCormack-Brown, Stephanie

    2008-01-01

    .... There is no published data on AL NP toxicity effects on human skin. This research used in vitro techniques to determine the cytotoxicity of AL NPs, sized 50, 80, and 120 nm, on human keratinocytes...

  8. Differentiation of human scalp hair follicle keratinocytes in culture.

    Science.gov (United States)

    Weterings, P J; Verhagen, H; Wirtz, P; Vermorken, A J

    1984-01-01

    The morphology of human scalp hair follicle keratinocytes, cultured on the bovine eye lens capsule, is studied by light and electron microscopy. The hair follicle keratinocytes in the stratified cultures are characterized by the presence of numerous tonofilaments, desmosomes and lysosomes and by the presence of glycogen accumulations. The cells in the upper layers develop a cornified envelope. Moreover, an incomplete basal lamina is found between the capsule and the basal cells. However, some features of epidermal keratinocytes in vivo, such as keratohyalin granules and stratum corneum formation, are absent. Analysis of the polypeptides by sodium dodecylsulfate polyacrylamide gel electrophoresis also reveals differences between the cultured hair follicle cells and epidermis, whilst the patterns of cultured cells and hair follicle sheaths are similar. The morphological and protein biosynthetic aspects of terminal differentiation of the keratinocytes in vitro are correlated. These results are discussed in the light of the findings with cultured epidermal keratinocytes, reported in the literature.

  9. Human Keratinocytes Radioprotection with Mentha Longifolia

    Science.gov (United States)

    Rizzo, Angela Maria; Berselli, P.; Zava, S.; Negroni, M.; Corsetto, P.; Montorfano, G.; Bertolotti, A.; Ranza, E.; Ottolenghi, A.; Berra, B.

    Antioxidants are suggested to act as radioprotectors, and dietary supplements based on antiox-idants have been proposed for astronauts involved in long-term space missions. Plant extracts with antioxidant properties may be used in dietetic supplements for astronauts; in fact recent nutritional guidelines suggest that "fruits and vegetables may become as important on space-going vessels as limes were on the sea-going vessels of old". Mint presents a large variety of biological properties, such as antiallergenic, antibacterial, anti-inflammatory, antitumor, an-tiviral, gastrointestinal protective, hepatoprotective, chemopreventive activities, most of which are attributable to its antioxidant activity. The aim of the present study is to evaluate the antioxidant properties and protective bio-efficacy of a phenol enriched Mentha longifolia ex-tract on gamma rays stressed human keratinocytes (NCTC2544). We assessed first the in vitro antioxidant activity (ABTS and DPPH), and then evaluated different stress markers in order to investigate various oxidative stress targets: cell viability (MTT); retained proliferating ca-pability (CA); DNA damage (histone H2AX) and protein damage (HSP70 induction). Results indicate that this Mint extract has a higher antioxidant activity respect to fresh extracts, that could be responsible of its really interesting radio-protective effects.

  10. Serial cultivation of human scalp hair follicle keratinocytes.

    Science.gov (United States)

    Weterings, P J; Roelofs, H M; Vermorken, A J; Bloemendal, H

    1983-01-01

    A method is described for the serial cultivation of adult human hair follicle keratinocytes. Plucked scalp hair follicles, placed on bovine eye lens capsules as a growth substrate, give rise to quickly expanding colonies within a few days. After trypsinization, the cells are replated with irradiated 3T3 cells as 'feeders'. Using this combination of techniques the keratinocytes can be subcultured up to four times. In this way about 10(7) keratinocytes can be generated from one single hair follicle. Moreover, the technique enables cryogenic storage of the cells, allowing for instance, convenient transportation. Subcultured hair follicle keratinocytes can be plated on glass coverslips. This allows immunofluorescence studies. The keratin cytoskeletons visualized using an antiserum against human keratin.

  11. Polymeric membranes modulate human keratinocyte differentiation in specific epidermal layers.

    Science.gov (United States)

    Salerno, Simona; Morelli, Sabrina; Giordano, Francesca; Gordano, Amalia; Bartolo, Loredana De

    2016-10-01

    In vitro models of human bioengineered skin substitutes are an alternative to animal experimentation for testing the effects and toxicity of drugs, cosmetics and pollutants. For the first time specific and distinct human epidermal strata were engineered by using membranes and keratinocytes. To this purpose, biodegradable membranes of chitosan (CHT), polycaprolactone (PCL) and a polymeric blend of CHT-PCL were prepared by phase-inversion technique and characterized in order to evaluate their morphological, physico-chemical and mechanical properties. The capability of membranes to modulate keratinocyte differentiation inducing specific interactions in epidermal membrane systems was investigated. The overall results demonstrated that the membrane properties strongly influence the cell morpho-functional behaviour of human keratinocytes, modulating their terminal differentiation, with the creation of specific epidermal strata or a fully proliferative epidermal multilayer system. In particular, human keratinocytes adhered on CHT and CHT-PCL membranes, forming the structure of the epidermal top layers, such as the corneum and granulosum strata, characterized by withdrawal or reduction from the cell cycle and cell proliferation. On the PCL membrane, keratinocytes developed an epidermal basal lamina, with high proliferating cells that stratified and migrated over time to form a complete differentiating epidermal multilayer system. Copyright © 2016 Elsevier B.V. All rights reserved.

  12. Micronucleus formation in cultured human keratinocytes: Involvement of intercellular bioactivation.

    Science.gov (United States)

    van Pelt, F N; Haring, R M; Weterings, P J

    1991-01-01

    Micronucleus formation in cultured human keratinocytes was studied after exposure to benzo[a]pyrene, cyclophosphamide and 12-O-tetradecanoylphorbol-13-acetate without the addition of an exogenous metabolizing system. The first two agents need bioactivation by specific isoenzymes of cytochrome P-450 to form genotoxic intermediates. Benzo[a]pyrene induced the micronucleus formation in both uninduced and Aroclor 1254-pretreated cultures. Clastogenic effects of cyclophosphamide were observed only in Aroclor 1254-pretreated cells. The tumour promotor 12-O-tetradecanoylphorbol-13-acetate did not affect the frequency of micronuclei in human keratinocytes. The data indicate that cultured human keratinocytes can be used to study the tissue-specific response to genotoxic agents as well as interindividual variation in biotransformation capacity.

  13. Effects of UVB irradiation on keratinocyte growth factor (KGF) and receptor (KGFR) expression in cultured human keratinocytes

    Energy Technology Data Exchange (ETDEWEB)

    Zhou, Y.; Lee, H.S.T.; Kooshesh, F.; Fujisawa, H.; Sauder, D.N.; Kondo, S. [Univ. of Toronto, Sunnybrook Health Science Centre, Div. of Dermatology, Toronto (Canada)

    1996-06-01

    Keratinocyte growth factor (KGF) and its receptor (KGFR) are thought to play important roles in normal keratinocyte growth and differentiation. Since UVB radiation is known to influence keratinocyte growth, we sought to determine whether UVB would alter the expression of KGF and KGFR. Using a reverse-transcription coupled polymerase chain reaction (RT-PCR), the present study examined the expression of KGF and KGFR mRNA in cultured normal human keratinocytes exposed to UVB irradiation. Total cellular RNA was extracted from cultured keratinocytes at various time points after irradiation, reverse transcribed and used for PCR amplification using primers specific for KGF and KGFR. Constitutive expression of KGFR mRNA, but not KGF mRNA, was detected in normal cultured human keratinocytes. After UVB irradiation at 300 J/m{sup 2}, the KGF mRNA remained undetectable while the KGFR mRNA level was significantly decreased. The down-regulation of KGFR mRNA expression was also confirmed by Northern blot analysis. Immunohistochemical studies demonstrated a decreased positive signal of KGFR in human keratinocytes after UVB irradiation. Our results suggest a possible role for the KGF-KGFR signalling pathway in the skin after exposure to UVB, and that UVB-induced growth inhibition of keratinocytes in hyperproliferative skin disorders may be related to downregulation of KGFR. (au) 39 refs.

  14. AMPK regulation of the growth of cultured human keratinocytes

    International Nuclear Information System (INIS)

    Saha, Asish K.; Persons, Kelly; Safer, Joshua D.; Luo Zhijun; Holick, Michael F.; Ruderman, Neil B.

    2006-01-01

    AMP kinase (AMPK) is a fuel sensing enzyme that responds to cellular energy depletion by increasing processes that generate ATP and inhibiting others that require ATP but are not acutely necessary for survival. In the present study, we examined the relationship between AMPK activation and the growth (proliferation) of cultured human keratinocytes and assessed whether the inhibition of keratinocyte growth by vitamin D involves AMPK activation. In addition, we explored whether the inhibition of keratinocyte proliferation as they approach confluence could be AMPK-related. Keratinocytes were incubated for 12 h with the AMPK activator, 5-aminoimidazole-4-carboxamide-1-β-D-ribofuranoside (AICAR). At concentrations of 10 -4 and 10 -3 M, AICAR inhibited keratinocyte growth by 50% and 95%, respectively, based on measurements of thymidine incorporation into DNA. It also increased AMPK and acetyl CoA carboxylase phosphorylation (P-AMPK and P-ACC) and decreased the concentration of malonyl CoA confirming that AMPK activation had occurred. Incubation with the thiazolidinedione, troglitazone (10 -6 M) caused similar alterations in P-AMPK, P-ACC, and cell growth. In contrast, the well known inhibition of keratinocyte growth by 1,25-dihydroxyvitamin D 3 (10 -7 and 10 -6 M) was not associated with changes in P-AMPK or P-ACC. Like most cells, the growth of keratinocytes diminished as they approached confluence. Thus, it was of note that we found a progressive increase in P-AMPK (1.5- to 2-fold, p 3 is AMPK-independent

  15. Kinetics of growth and differentiation of cultured human epidermal keratinocytes

    International Nuclear Information System (INIS)

    Albers, K.M.

    1985-01-01

    A study was made of the interrelationship between replication and differentiation in cultures of human epidermal keratinocytes. Measures of both parameters were made using newly developed methods to quantify the rate at which keratinocytes replicate and the rate at which they withdraw from the cell cycle. Keratinocyte replication was measured by determining the cell doubling time, labeling index, and cell cycle duration. Cell cycle length was measured using a double label assay that determines the length of time between two successive phases of DNA synthesis. The first DNA synthesis phase was marked by labeling keratinocytes with 14 C-thymidine. At the next round of DNA synthesis, cells were labeled with bromodeoxyuridine, a heavy analog of thymidine. The cell cycle length is given by the time required for the 14 C-labeled DNA to become double labeled. To measure keratinocyte differentiation, the rate at which cells withdraw from the cell cycle was determined. To measure withdrawal, the percentage of cells labeled by a pulse of 14 C-thymidine that failed to undergo a second cycle of DNA synthesis, as measured by bromodeoxyuridine incorporation, was determined. Cells which failed to undergo a second cycle of synthesis were considered to have differentiated and withdrawn from the cell cycle

  16. Photodynamic toxicity of hematoporphyrin derivatives to human keratinocytes in culture.

    Science.gov (United States)

    Kappus, H; Reinhold, C; Artuc, M

    Human keratinocytes in culture were able to take up hematoporphyrin derivatives (HPDs) used during photodynamic chemotherapy of tumors. In the absence of light, HPDs showed no cytotoxic effects to keratinocytes. However, after irradiation with visible light, HPDs induced immediate cytotoxicity as measured by the neutral red uptake assay. On the other hand, cell attachment as measured by protein estimation was not affected. When the cells treated with HPDs and irradiated with light were cultured for a further 72 h, they partially lost their ability to attach to the collagen surface. Most of the cells remaining attached after 72 h were no longer viable following treatment with HPDs and light. All parameters measured depended on the intracellular concentration of HPDs used (7-50 ng/10(5) cells) and the time of irradiation (0-30 min). These results suggest that human keratinocytes are a good model to study cytotoxic effects of photodynamically active drugs. Further, keratinocytes were unable to recover after damage caused by HPDs and light.

  17. The peanut lectin-binding glycoproteins of human epidermal keratinocytes

    International Nuclear Information System (INIS)

    Morrison, A.I.; Keeble, S.; Watt, F.M.

    1988-01-01

    The peanut lectin (PNA) is known to bind more strongly to keratinocytes that are undergoing terminal differentiation than to proliferating keratinocytes. In order to investigate the significance of this change in cell-surface carbohydrate authors have identified the PNA-binding glycoproteins of cultured human keratinocytes and antibodies against them. Two heavily glycosylated bands of 110 and 250 kDa were resolved by PAGE of [ 14 C]galactose- or [ 14 C]mannose- and [ 14 C]glucosamine-labeled cell extracts eluted with galactose from PNA affinity columns. The higher molecular weight band was also detected on PNA blots of unlabeled cell extracts transferred to nitrocellulose. Both bands were sensitive to pronase digestion, but only the 250-kDa band was digested with trypsin. A rabbit antiserum that we prepared (anti-PNA-gp) immunoprecipitated both bands from cell extracts. In contrast to PNA, anti-PNA-gp bound equally to proliferating and terminally differentiating cells, indicating that some epitope(s) of the PNA-binding glycoproteins is present on the cell surface prior to terminal differentiation. When keratinocytes grown as a monolayer in low-calcium medium were switched to medium containing 2 mM calcium ions in order to induce desmosome formation and stratification, there was a dramatic redistribution of the PNA-binding glycoproteins, which became concentrated at the boundaries between cells. This may suggest a role for the glycoproteins in cell-cell interactions during stratification

  18. Effects of Human Mesenchymal Stem Cells Coculture on Calcium-Induced Differentiation of Normal Human Keratinocytes.

    Science.gov (United States)

    Sah, Shyam Kishor; Kim, Hae Young; Lee, Ji Hae; Lee, Seong-Wook; Kim, Hyung-Sik; Kim, Yeon-Soo; Kang, Kyung-Sun; Kim, Tae-Yoon

    2017-06-01

    The influence of mesenchymal stem cells (MSCs) on keratinocytes in altered microenvironments is poorly understood. Here, we cocultured umbilical cord blood-derived MSCs with normal human epidermal keratinocytes to evaluate their paracrine effect in the presence of high extracellular calcium (Ca 2+ ) concentration. High Ca 2+ environment to keratinocytes can disrupt normal skin barrier function due to abnormal/premature differentiation of keratinocytes. Surprisingly, we found that MSCs suppress both proliferation and differentiation of keratinocytes under a high Ca 2+ environment in transforming growth factors β1 (TGFβ1)-dependent manner. Furthermore, we determined that MSCs can regulate the mitogen-activated protein kinases, phosphatidylinositol 3-kinase/protein kinase B, and protein kinase C pathways in Ca 2+ -induced differentiated keratinocytes. Knockdown of TGFβ1 from MSCs results in decreased suppression of differentiation with significantly increased proliferation of keratinocytes compared with control MSCs. MSCs-derived TGFβ1 further induced growth inhibition of keratinocyte in high extracellular Ca 2+ environment as analyzed by a decrease in DNA synthesis, accumulation of phosphorylated retinoblastoma protein, cdc2, and increased mRNA level of p21, and independent of TGFβ1/SMAD pathway. Taken together, we found that MSCs-derived TGFβ1 is a critical regulator of keratinocyte function, and involves multiple proximal signaling cascades. Stem Cells 2017;35:1592-1602. © 2017 AlphaMed Press.

  19. Flow cytometry of human primary epidermal and follicular keratinocytes.

    Science.gov (United States)

    Gragnani, Alfredo; Ipolito, Michelle Zampieri; Sobral, Christiane S; Brunialti, Milena Karina Coló; Salomão, Reinaldo; Ferreira, Lydia Masako

    2008-02-19

    The aim of this study was to characterize using flow cytometry cultured human primary keratinocytes isolated from the epidermis and hair follicles by different methods. Human keratinocytes derived from discarded fragments of total skin and scalp hair follicles from patients who underwent plastic surgery in the Plastic Surgery Division at UNIFESP were used. The epidermal keratinocytes were isolated by using 3 different methods: the standard method, upon exposure to trypsin for 30 minutes; the second, by treatment with dispase for 18 hours and with trypsin for 10 minutes; and the third, by treatment with dispase for 18 hours and with trypsin for 30 minutes. Follicular keratinocytes were isolated using the standard method. On comparing the group treated with dispase for 18 hours and with trypsin for 10 minutes with the group treated with dispase for 18 hours and with trypsin for 30 minutes, it was observed that the first group presented the largest number of viable cells, the smallest number of cells in late apoptosis and necrosis with statistical significance, and no difference in apoptosis. When we compared the group treated with dispase for 18 hours and with trypsin for 10 minutes with the group treated with trypsin, the first group presented the largest number of viable cells, the smallest number of cells in apoptosis with statistical significance, and no difference in late apoptosis and necrosis. When we compared the results of the group treated with dispase for 18 hours and with trypsin for 10 minutes with the results for follical isolation, there was a statistical difference in apoptosis and viable cells. The isolation method of treatment with dispase for 18 hours and with trypsin for 10 minutes produced the largest number of viable cells and the smallest number of cells in apoptosis/necrosis.

  20. Enhanced expression of IL-8 in normal human keratinocytes and human keratinocyte cell line HaCaT in vitro after stimulation with contact sensitizers, tolerogens and irritants.

    Science.gov (United States)

    Mohamadzadeh, M; Müller, M; Hultsch, T; Enk, A; Saloga, J; Knop, J

    1994-12-01

    To investigate the interleukin-8 production of keratinocytes after stimulation in vitro we have used various agents: (i) contact sensitizer (2,4-dinitrofluorobenzene, 3-n-pentadecylcatechol); (ii) tolerogen (5-methyl-3-n-pentadecylcatechol); (iii) irritant (sodium lauryl sulfate). Interleukin-8 gene expression was assessed by northern blot hybridization of the total cytoplasmic RNA extracted from subconfluent normal human keratinocyte cultures and the keratinocyte cell line HaCaT using a radiolabeled DNA probe specific for human interleukin-8. Interleukin-8 gene expression was markedly increased upon in vitro stimulation after 1-6 h with contact sensitizers, tolerogen and the irritant. In contrast, interleukin-8 production was not detectable in unstimulated normal human keratinocytes or the HaCaT keratinocyte cell line. These results suggest that the induction and production of interleukin-8 is a response to nonspecific stimuli and may play a critical role in the early response to immunogenic or inflammatory signals in man.

  1. Response of human epidermal keratinocytes to UV light

    International Nuclear Information System (INIS)

    Kartasova, A.A.

    1987-01-01

    This thesis presents a study on the response of human epidermal keratinocytes to UV light as well as to other agents like 4-NQO and TPA. The effects of ultraviolet (UV) light on the protein synthesis in cultured keratinocytes are presented in ch. III. The next chapter describes the construction of a cDNA library using mRNA isolated from UV irradiated kernatinocytes. This library was differentially screened with cDNA probes synthesized on mRNA from either UV irradiated or nonirradiated cells. Several groups of cDNA clones corresponding to transcripts whose level in the cytoplasm seem to be affected by exposure to UV light have been isolated and characterized by cross-hybridization, sequencing and Northern blot analysis. More detailed analysis of some of the cDNA clones is presented in the two chapters following ch. IV. The complete cDNA sequence of the proteinase inhibitor cystatin A and the modulation of its expression by UV light and the carcinogen 4-nitroquinoline 1-oxide (4-NQO) in keratinocytes are described in ch. V. Two other groups of cDNA clones have been isolated which do not cross-hybridize with each other on Southern blots. However, the primary structures of the proteins deduced from the nucleotide sequences of these two groups of cDNA clones are very similar. 212 refs.; 33 figs.; 2 tabs

  2. Steroid synthesis by primary human keratinocytes; implications for skin disease

    Energy Technology Data Exchange (ETDEWEB)

    Hannen, Rosalind F., E-mail: r.f.hannen@qmul.ac.uk [Centre for Cutaneous Research, Institute of Cell and Molecular Science, Barts and The London School of Medicine and Dentistry, Queen Mary University of London, London E1 2AT (United Kingdom); Michael, Anthony E. [Centre for Developmental and Endocrine Signalling, Academic Section of Obstetrics and Gynaecology, Division of Clinical Developmental Sciences, 3rd Floor, Lanesborough Wing, St. George' s, University of London, Cranmer Terrace, Tooting, London SW17 0RE (United Kingdom); Jaulim, Adil [Centre for Cutaneous Research, Institute of Cell and Molecular Science, Barts and The London School of Medicine and Dentistry, Queen Mary University of London, London E1 2AT (United Kingdom); Bhogal, Ranjit [Life Science, Unilever R and D Colworth House, Sharnbrook, Bedfordshire MK44 1LQ (United Kingdom); Burrin, Jacky M. [Centre for Endocrinology, William Harvey Research Institute, Barts and The London School of Medicine and Dentistry, Queen Mary University of London, London EC1M 6BQ (United Kingdom); Philpott, Michael P. [Centre for Cutaneous Research, Institute of Cell and Molecular Science, Barts and The London School of Medicine and Dentistry, Queen Mary University of London, London E1 2AT (United Kingdom)

    2011-01-07

    Research highlights: {yields} Primary keratinocytes express the steroid enzymes required for cortisol synthesis. {yields} Normal primary human keratinocytes can synthesise cortisol. {yields} Steroidogenic regulators, StAR and MLN64, are expressed in normal epidermis. {yields} StAR expression is down regulated in eczema and psoriatic epidermis. -- Abstract: Cortisol-based therapy is one of the most potent anti-inflammatory treatments available for skin conditions including psoriasis and atopic dermatitis. Previous studies have investigated the steroidogenic capabilities of keratinocytes, though none have demonstrated that these skin cells, which form up to 90% of the epidermis are able to synthesise cortisol. Here we demonstrate that primary human keratinocytes (PHK) express all the elements required for cortisol steroidogenesis and metabolise pregnenolone through each intermediate steroid to cortisol. We show that normal epidermis and cultured PHK express each of the enzymes (CYP11A1, CYP17A1, 3{beta}HSD1, CYP21 and CYP11B1) that are required for cortisol synthesis. These enzymes were shown to be metabolically active for cortisol synthesis since radiometric conversion assays traced the metabolism of [7-{sup 3}H]-pregnenolone through each steroid intermediate to [7-{sup 3}H]-cortisol in cultured PHK. Trilostane (a 3{beta}HSD1 inhibitor) and ketoconazole (a CYP17A1 inhibitor) blocked the metabolism of both pregnenolone and progesterone. Finally, we show that normal skin expresses two cholesterol transporters, steroidogenic acute regulatory protein (StAR), regarded as the rate-determining protein for steroid synthesis, and metastatic lymph node 64 (MLN64) whose function has been linked to cholesterol transport in steroidogenesis. The expression of StAR and MLN64 was aberrant in two skin disorders, psoriasis and atopic dermatitis, that are commonly treated with cortisol, suggesting dysregulation of epidermal steroid synthesis in these patients. Collectively these data

  3. Steroid synthesis by primary human keratinocytes; implications for skin disease

    International Nuclear Information System (INIS)

    Hannen, Rosalind F.; Michael, Anthony E.; Jaulim, Adil; Bhogal, Ranjit; Burrin, Jacky M.; Philpott, Michael P.

    2011-01-01

    Research highlights: → Primary keratinocytes express the steroid enzymes required for cortisol synthesis. → Normal primary human keratinocytes can synthesise cortisol. → Steroidogenic regulators, StAR and MLN64, are expressed in normal epidermis. → StAR expression is down regulated in eczema and psoriatic epidermis. -- Abstract: Cortisol-based therapy is one of the most potent anti-inflammatory treatments available for skin conditions including psoriasis and atopic dermatitis. Previous studies have investigated the steroidogenic capabilities of keratinocytes, though none have demonstrated that these skin cells, which form up to 90% of the epidermis are able to synthesise cortisol. Here we demonstrate that primary human keratinocytes (PHK) express all the elements required for cortisol steroidogenesis and metabolise pregnenolone through each intermediate steroid to cortisol. We show that normal epidermis and cultured PHK express each of the enzymes (CYP11A1, CYP17A1, 3βHSD1, CYP21 and CYP11B1) that are required for cortisol synthesis. These enzymes were shown to be metabolically active for cortisol synthesis since radiometric conversion assays traced the metabolism of [7- 3 H]-pregnenolone through each steroid intermediate to [7- 3 H]-cortisol in cultured PHK. Trilostane (a 3βHSD1 inhibitor) and ketoconazole (a CYP17A1 inhibitor) blocked the metabolism of both pregnenolone and progesterone. Finally, we show that normal skin expresses two cholesterol transporters, steroidogenic acute regulatory protein (StAR), regarded as the rate-determining protein for steroid synthesis, and metastatic lymph node 64 (MLN64) whose function has been linked to cholesterol transport in steroidogenesis. The expression of StAR and MLN64 was aberrant in two skin disorders, psoriasis and atopic dermatitis, that are commonly treated with cortisol, suggesting dysregulation of epidermal steroid synthesis in these patients. Collectively these data show that PHK are capable of extra

  4. Stanniocalcin-1 regulates re-epithelialization in human keratinocytes.

    Directory of Open Access Journals (Sweden)

    Bonnie H Y Yeung

    Full Text Available Stanniocalcin-1 (STC1, a glycoprotein hormone, is believed to be involved in various biological processes such as inflammation, oxidative responses and cell migration. Riding on these emerging evidences, we hypothesized that STC1 may participate in the re-epithelialization during wound healing. Re-epithelialization is a critical step that involves keratinocyte lamellipodia (e-lam formation, followed by cell migration. In this study, staurosporine (STS treatment induced human keratinocyte (HaCaT e-lam formation on fibronectin matrix and migration via the activation of focal adhesion kinase (FAK, the surge of intracellular calcium level [Ca²⁺]i and the inactivation of Akt. In accompanied with these migratory features, a time- and dose-dependent increase in STC1 expression was detected. STC1 gene expression was found not the downstream target of FAK-signaling as illustrated by FAK inhibition using PF573228. The reduction of [Ca²⁺]i by BAPTA/AM blocked the STS-mediated keratinocyte migration and STC1 gene expression. Alternatively the increase of [Ca²⁺]i by ionomycin exerted promotional effect on STS-induced STC1 gene expression. The inhibition of Akt by SH6 and GSK3β by lithium chloride (LiCl could respectively induce and inhibit the STS-mediated e-lam formation, cell migration and STC1 gene expression. The STS-mediated e-lam formation and cell migration were notably hindered or induced respectively by STC1 knockdown or overexpression. This notion was further supported by the scratched wound assay. Collectively the findings provide the first evidence that STC1 promotes re-epithelialization in wound healing.

  5. Stanniocalcin-1 regulates re-epithelialization in human keratinocytes.

    Science.gov (United States)

    Yeung, Bonnie H Y; Wong, Chris K C

    2011-01-01

    Stanniocalcin-1 (STC1), a glycoprotein hormone, is believed to be involved in various biological processes such as inflammation, oxidative responses and cell migration. Riding on these emerging evidences, we hypothesized that STC1 may participate in the re-epithelialization during wound healing. Re-epithelialization is a critical step that involves keratinocyte lamellipodia (e-lam) formation, followed by cell migration. In this study, staurosporine (STS) treatment induced human keratinocyte (HaCaT) e-lam formation on fibronectin matrix and migration via the activation of focal adhesion kinase (FAK), the surge of intracellular calcium level [Ca²⁺]i and the inactivation of Akt. In accompanied with these migratory features, a time- and dose-dependent increase in STC1 expression was detected. STC1 gene expression was found not the downstream target of FAK-signaling as illustrated by FAK inhibition using PF573228. The reduction of [Ca²⁺]i by BAPTA/AM blocked the STS-mediated keratinocyte migration and STC1 gene expression. Alternatively the increase of [Ca²⁺]i by ionomycin exerted promotional effect on STS-induced STC1 gene expression. The inhibition of Akt by SH6 and GSK3β by lithium chloride (LiCl) could respectively induce and inhibit the STS-mediated e-lam formation, cell migration and STC1 gene expression. The STS-mediated e-lam formation and cell migration were notably hindered or induced respectively by STC1 knockdown or overexpression. This notion was further supported by the scratched wound assay. Collectively the findings provide the first evidence that STC1 promotes re-epithelialization in wound healing.

  6. Human keratinocyte sensitivity towards inflammatory cytokines varies with culture time

    Directory of Open Access Journals (Sweden)

    G. Elliott

    1992-01-01

    Full Text Available Proliferating keratinocyte cultures have been reported to synthesize higher concentrations of prostaglandin (PG E than confluent ones. As interleukin-1 (IL-1 stimulates keratinocyte PGE synthesis we investigated whether the degree of confluency of the keratinocyte culture modified the response of the cells to IL-1. It was found that IL-1α (100 U/ml stimulated PGE2 synthesis by proliferating (7 days in culture but not differentiating (14 days in culture keratinocytes. Similar effects were observed using tumour necrosis factor-α. Both arachidonic acid (AA and the calcium ionophore A23187 stimulated PGE2 synthesis by 7 and 14 day cultures although the increase was greatest when 7 day cultures were used. Our data indicate that there is a specific down-regulation of the mechanism(s by which some inflammatory cytokines stimulate keratinocyte eicosanoid synthesis as cultured keratinocytes begin to differentiate.

  7. Human keratinocytes produce the complement inhibitor factor H: synthesis is regulated by interferon-gamma

    NARCIS (Netherlands)

    Timár, Krisztina K.; Pasch, Marcel C.; van den Bosch, Norbert H. A.; Jarva, Hanna; Junnikkala, Sami; Meri, Seppo; Bos, Jan D.; Asghar, Syed S.

    2006-01-01

    Locally synthesized complement is believed to play an important role in host defense and inflammation at organ level. In the epidermis, keratinocytes have so far been shown to synthesize two complement components, C3 and factor B. Here, we studied the synthesis of factor H by human keratinocytes. We

  8. Forkhead Box C1 Regulates Human Primary Keratinocyte Terminal Differentiation.

    Directory of Open Access Journals (Sweden)

    Lianghua Bin

    Full Text Available The epidermis serves as a critical protective barrier between the internal and external environment of the human body. Its remarkable barrier function is established through the keratinocyte (KC terminal differentiation program. The transcription factors specifically regulating terminal differentiation remain largely unknown. Using a RNA-sequencing (RNA-seq profiling approach, we found that forkhead box c 1 (FOXC1 was significantly up-regulated in human normal primary KC during the course of differentiation. This observation was validated in human normal primary KC from several different donors and human skin biopsies. Silencing FOXC1 in human normal primary KC undergoing differentiation led to significant down-regulation of late terminal differentiation genes markers including epidermal differentiation complex genes, keratinization genes, sphingolipid/ceramide metabolic process genes and epidermal specific cell-cell adhesion genes. We further demonstrated that FOXC1 works down-stream of ZNF750 and KLF4, and upstream of GRHL3. Thus, this study defines FOXC1 as a regulator specific for KC terminal differentiation and establishes its potential position in the genetic regulatory network.

  9. Asymmetric migration of human keratinocytes under mechanical stretch and cocultured fibroblasts in a wound repair model.

    Directory of Open Access Journals (Sweden)

    Dongyuan Lü

    Full Text Available Keratinocyte migration during re-epithelization is crucial in wound healing under biochemical and biomechanical microenvironment. However, little is known about the underlying mechanisms whereby mechanical tension and cocultured fibroblasts or keratinocytes modulate the migration of keratinocytes or fibroblasts. Here we applied a tensile device together with a modified transwell assay to determine the lateral and transmembrane migration dynamics of human HaCaT keratinocytes or HF fibroblasts. A novel pattern of asymmetric migration was observed for keratinocytes when they were cocultured with non-contact fibroblasts, i.e., the accumulative distance of HaCaT cells was significantly higher when moving away from HF cells or migrating from down to up cross the membrane than that when moving close to HF cells or when migrating from up to down, whereas HF migration was symmetric. This asymmetric migration was mainly regulated by EGF derived from fibroblasts, but not transforming growth factor α or β1 production. Mechanical stretch subjected to fibroblasts fostered keratinocyte asymmetric migration by increasing EGF secretion, while no role of mechanical stretch was found for EGF secretion by keratinocytes. These results provided a new insight into understanding the regulating mechanisms of two- or three-dimensional migration of keratinocytes or fibroblasts along or across dermis and epidermis under biomechanical microenvironment.

  10. Effect of Nanodiamond and Nanoplatinum Liquid, DPV576, on Human Primary Keratinocytes.

    Science.gov (United States)

    Ghoneum, Mamdooh H; Katano, Hideki; Agrawal, Sudhanshu; Ganguly, Sreerupa; Agrawal, Anshu

    2017-01-01

    Nanofabrics are now being used in a wide range of products that come into direct contact with skin, including carpet, clothing, and medical fabrics. In the current study, we examined the effect of a dispersed aqueous mixture of nanodiamond (ND) and nanoplatinum (NP) (DPV576) on human primary keratinocytes with respect to transient receptor potential vanilloid (TRPV) channel expression, secretion of cytokines and production of nerve growth factor (NGF). Keratinocytes were treated with DPV576 at concentrations of 1:10 and 1:100 dilutions for 24 hours in vitro, and their activation of was determined by production of cytokines TNF-α, IL-1β, and prostaglandin (PGE2), and by production of NGF. Inhibitor experiments were carried out by incubating keratinocytes with the TRPV4-selective antagonist HC-067047. TRPV receptor expression (TRPV1, TRPV3 and TRPV4) on keratinocytes as well as changes in Ca2+ potential were examined by flow cytometry. DPV576 treatment of keratinocytes resulted in the following effects: (1) stimulation of keratinocytes as indicated by the significant secretion of cytokines IL-1β, TNF-α, and PGE2, an effect noted only at higher concentration (1:10); (2) significant decrease in the expression of TRPV4 on keratinocytes with a spike in the calcium flux, but no change in the expression of TRPV1 and TRPV3; (3) induction of cytokine secretion independent of TRPV4, as the addition of TRPV4 inhibitor had no significant effect on the cytokine production from keratinocytes; (4) induction of NGF secretion by keratinocytes. These results demonstrate that DPV576 activates keratinocytes via multiple signaling pathways which may reduce stress associated with inflammation, pain, and circadian rhythms. ND/NP-coated fabrics that target the modulation of local inflammation, pain, and circadian rhythms could potentially be of benefit to humans.

  11. Generation of organotypic raft cultures from primary human keratinocytes.

    Science.gov (United States)

    Anacker, Daniel; Moody, Cary

    2012-02-22

    The development of organotypic epithelial raft cultures has provided researchers with an efficient in vitro system that faithfully recapitulates epithelial differentiation. There are many uses for this system. For instance, the ability to grow three-dimensional organotypic raft cultures of keratinocytes has been an important milestone in the study of human papillomavirus (HPV)(1). The life cycle of HPV is tightly linked to the differentiation of squamous epithelium(2). Organotypic epithelial raft cultures as demonstrated here reproduce the entire papillomavirus life cycle, including virus production(3,4,5). In addition, these raft cultures exhibit dysplastic lesions similar to those observed upon in vivo infection with HPV. Hence this system can also be used to study epithelial cell cancers, as well as the effect of drugs on epithelial cell differentiation in general. Originally developed by Asselineau and Prunieras(6) and modified by Kopan et al.(7), the organotypic epithelial raft culture system has matured into a general, relatively easy culture model, which involves the growth of cells on collagen plugs maintained at an air-liquid interface (Figure 1A). Over the course of 10-14 days, the cells stratify and differentiate, forming a full thickness epithelium that produces differentiation-specific cytokeratins. Harvested rafts can be examined histologically, as well as by standard molecular and biochemical techniques. In this article, we describe a method for the generation of raft cultures from primary human keratinocytes. The same technique can be used with established epithelial cell lines, and can easily be adapted for use with epithelial tissue from normal or diseased biopsies(8). Many viruses target either the cutaneous or mucosal epithelium as part of their replicative life cycle. Over the past several years, the feasibility of using organotypic raft cultures as a method of studying virus-host cell interactions has been shown for several herpesviruses, as

  12. Chimeric Human Skin Substitute Tissue: A Novel Treatment Option for the Delivery of Autologous Keratinocytes.

    Science.gov (United States)

    Rasmussen, Cathy A; Allen-Hoffmann, B Lynn

    2012-04-01

    For patients suffering from catastrophic burns, few treatment options are available. Chimeric coculture of patient-derived autologous cells with a "carrier" cell source of allogeneic keratinocytes has been proposed as a means to address the complex clinical problem of severe skin loss. Currently, autologous keratinocytes are harvested, cultured, and expanded to form graftable epidermal sheets. However, epidermal sheets are thin, are extremely fragile, and do not possess barrier function, which only develops as skin stratifies and matures. Grafting is typically delayed for up to 4 weeks to propagate a sufficient quantity of the patient's cells for application to wound sites. Fully stratified chimeric bioengineered skin substitutes could not only provide immediate wound coverage and restore barrier function, but would simultaneously deliver autologous keratinocytes to wounds. The ideal allogeneic cell source for this application would be an abundant supply of clinically evaluated, nontumorigenic, pathogen-free, human keratinocytes. To evaluate this potential cell-based therapy, mixed populations of a green fluorescent protein-labeled neonatal human keratinocyte cell line (NIKS) and unlabeled primary keratinocytes were used to model the allogeneic and autologous components of chimeric monolayer and organotypic cultures. Relatively few autologous keratinocytes may be required to produce fully stratified chimeric skin substitute tissue substantially composed of autologous keratinocyte-derived regions. The need for few autologous cells interspersed within an allogeneic "carrier" cell population may decrease cell expansion time, reducing the time to patient application. This study provides proof of concept for utilizing NIKS keratinocytes as the allogeneic carrier for the generation of bioengineered chimeric skin substitute tissues capable of providing immediate wound coverage while simultaneously supplying autologous human cells for tissue regeneration.

  13. Exogenous hydrogen sulfide promotes cell proliferation and differentiation by modulating autophagy in human keratinocytes

    International Nuclear Information System (INIS)

    Xie, Xin; Dai, Hui; Zhuang, Binyu; Chai, Li; Xie, Yanguang; Li, Yuzhen

    2016-01-01

    The effects and the underlying mechanisms of hydrogen sulfide (H 2 S) on keratinocyte proliferation and differentiation are still less known. In the current study, we investigated the effects and the underlying mechanisms of exogenous H 2 S on keratinocyte proliferation and differentiation. Human keratinocytes (HaCaT cells) were treated with various concentrations (0.05, 0.25, 0.5 and 1 mM) of sodium hydrosulfide (NaHS, a donor of H 2 S) for 24 h. A CCK-8 assay was used to assess cell viability. Western blot analysis was performed to determine the expression levels of proteins associated with differentiation and autophagy. Transmission electron microscopy was performed to observe autophagic vacuoles, and flow cytometry was applied to evaluate apoptosis. NaHS promoted the viability, induced the differentiation, and enhanced autophagic activity in a dose-dependent manner in HaCaT cells but had no effect on cell apoptosis. Blockage of autophagy by ATG5 siRNA inhibited NaHS-induced cell proliferation and differentiation. The current study demonstrated that autophagy in response to exogenous H 2 S treatment promoted keratinocyte proliferation and differentiation. Our results provide additional insights into the potential role of autophagy in keratinocyte proliferation and differentiation. - Highlights: • Exogenous H 2 S promotes keratinocyte proliferation and differentiation. • The effects of H 2 S on proliferation and differentiation is modulated by autophagy. • Exogenous H 2 S has no effect on keratinocyte apoptosis.

  14. Differential Activation of Human Keratinocytes by Leishmania Species Causing Localized or Disseminated Disease.

    Science.gov (United States)

    Scorza, Breanna M; Wacker, Mark A; Messingham, Kelly; Kim, Peter; Klingelhutz, Aloysius; Fairley, Janet; Wilson, Mary E

    2017-10-01

    All Leishmania species parasites are introduced into mammalian skin through a sand fly bite, but different species cause distinct clinical outcomes. Mouse studies suggest that early responses are critical determinants of subsequent adaptive immunity in leishmaniasis, yet few studies address the role of keratinocytes, the most abundant cell in the epidermis. We hypothesized that Leishmania infection causes keratinocytes to produce immunomodulatory factors that influence the outcome of infection. Incubation of primary or immortalized human keratinocytes with Leishmania infantum or Leishmania major, which cause visceral or cutaneous leishmaniasis, respectively, elicited dramatically different responses. Keratinocytes incubated with L. infantum significantly increased expression of proinflammatory genes for IL-6, IL-8, tumor necrosis factor, and IL-1B, whereas keratinocytes exposed to several L. major isolates did not. Furthermore, keratinocyte-monocyte co-incubation studies across a 4 µM semipermeable membrane suggested that L. infantum-exposed keratinocytes release soluble factors that enhance monocyte control of intracellular L. infantum replication (P Leishmania species that may affect the course of disease. Copyright © 2017 The Authors. Published by Elsevier Inc. All rights reserved.

  15. Effects of titanium dioxide nanoparticles on human keratinocytes.

    Science.gov (United States)

    Wright, Clayton; Iyer, Anand Krishnan V; Wang, Liying; Wu, Nianqiang; Yakisich, Juan S; Rojanasakul, Yon; Azad, Neelam

    2017-01-01

    Titanium dioxide (TiO 2 ) is a ubiquitous whitening compound widely used in topical products such as sunscreens, lotions and facial creams. The damaging health effects of TiO 2 inhalation has been widely studied in rats, mice and humans showing oxidative stress increase, DNA damage, cell death and inflammatory gene upregulation in lung and throat cells; however, the effects on skin cells from long-term topical use of various products remain largely unknown. In this study, we assessed the effect of specific TiO 2 nanoparticles (H 2 TiO 7 ) on a human keratinocyte cell line (HaCaT). We performed a comparative analysis using three TiO 2 particles varying in size (Fine, Ultrafine and H 2 TiO 7 ) and analyzed their effects on HaCaTs. There is a clear dose-dependent increase in superoxide production, caspase 8 and 9 activity, and apoptosis in HaCaTs after treatment with all three forms of TiO 2 ; however, there is no consistent effect on cell viability and proliferation with either of these TiO 2 particles. While there is data suggesting UV exposure can enhance the carcinogenic effects of TiO 2 , we did not observe any significant effect of UV-C exposure combined with TiO 2 treatment on HaCaTs. Furthermore, TiO 2 -treated cells showed minimal effects on VEGF upregulation and Wnt signaling pathway thereby showing no potential effect on angiogenesis and malignant transformation. Overall, we report here an increase in apoptosis, which may be caspase 8/Fas-dependent, and that the H 2 TiO 7 nanoparticles, despite their smaller particle size, had no significant enhanced effect on HaCaT cells as compared to Fine and Ultrafine forms of TiO 2 .

  16. Marked stimulation of growth and motility of human keratinocytes by hepatocyte growth factor

    International Nuclear Information System (INIS)

    Matsumoto, K.; Hashimoto, K.; Yoshikawa, K.; Nakamura, T.

    1991-01-01

    Effect of hepatocyte growth factor (HGF) on normal human epidermal keratinocytes cultured under conditions of low Ca2+ (0.1 mM, growth-promoting condition) and physiological Ca2+ (1.8 mM, differentiation-promoting condition) was investigated. In low Ca2+, HGF markedly enhanced the migration of keratinocytes while it suppressed cell growth and DNA synthesis in a dose-dependent manner. In contrast, HGF enhanced the migration, cell growth, and DNA synthesis of keratinocytes cultured under conditions of physiological Ca2+. The maximal stimulation of DNA synthesis (2.4-fold stimulation) in physiological Ca2+ was seen at 2.5-5 ng/ml HGF and the stimulatory effect of HGF was suppressed by transforming growth factor-beta 1. Analysis of the HGF receptor using 125I-HGF as a ligand showed that human keratinocytes expressed a single class of specific, saturable receptor for HGF in both low and physiological Ca2+ conditions, exhibiting a Kd = 17.3 pM and approximately 690 binding sites/cell under physiological Ca2+. Thus, HGF is a potent factor which enhances growth and migration of normal human keratinocytes under conditions of physiological Ca2+. HGF may play an important role in epidermal tissue repair as it enhances both the migration and growth of keratinocytes

  17. Hyaluronan minimizes effects of UV irradiation on human keratinocytes

    Czech Academy of Sciences Publication Activity Database

    Hašová, M.; Crhák, Tomáš; Šafaříková, Barbora; Dvořáková, J.; Muthný, T.; Velebný, V.; Kubala, Lukáš

    2011-01-01

    Roč. 303, č. 4 (2011), s. 277-284 ISSN 0340-3696 R&D Projects: GA ČR(CZ) GA305/08/1704 Institutional research plan: CEZ:AV0Z50040507; CEZ:AV0Z50040702 Keywords : hyaluronan * keratinocyte * ultraviolet light Subject RIV: BO - Biophysics Impact factor: 2.279, year: 2011

  18. Exploratory Study on the Stability Characteristics of Commercial Human Keratinocytes

    Science.gov (United States)

    1990-04-01

    Invest. Dermatol. 75:176- 182; 1980. 16. Hayflick , L. The limited in vitro lifetime of huiran diploid strains. Exp. Cell Res. 37:614-636; 1965. 17...culture keratinocytes were considered by some investigators to have limited proliferative potential, so they used third and fourth passage commercial

  19. Adherence of human oral keratinocytes and gingival fibroblasts to nano-structured titanium surfaces.

    Science.gov (United States)

    Dorkhan, Marjan; Yücel-Lindberg, Tülay; Hall, Jan; Svensäter, Gunnel; Davies, Julia R

    2014-06-21

    A key element for long-term success of dental implants is integration of the implant surface with the surrounding host tissues. Modification of titanium implant surfaces can enhance osteoblast activity but their effects on soft-tissue cells are unclear. Adherence of human keratinocytes and gingival fibroblasts to control commercially pure titanium (CpTi) and two surfaces prepared by anodic oxidation was therefore investigated. Since implant abutments are exposed to a bacteria-rich environment in vivo, the effect of oral bacteria on keratinocyte adhesion was also evaluated. The surfaces were characterized using scanning electron microscopy (SEM). The number of adhered cells and binding strength, as well as vitality of fibroblasts and keratinocytes were evaluated using confocal scanning laser microscopy after staining with Live/Dead Baclight. To evaluate the effect of bacteria on adherence and vitality, keratinocytes were co-cultured with a four-species streptococcal consortium. SEM analysis showed the two anodically oxidized surfaces to be nano-structured with differing degrees of pore-density. Over 24 hours, both fibroblasts and keratinocytes adhered well to the nano-structured surfaces, although to a somewhat lesser degree than to CpTi (range 42-89% of the levels on CpTi). The strength of keratinocyte adhesion was greater than that of the fibroblasts but no differences in adhesion strength could be observed between the two nano-structured surfaces and the CpTi. The consortium of commensal streptococci markedly reduced keratinocyte adherence on all the surfaces as well as compromising membrane integrity of the adhered cells. Both the vitality and level of adherence of soft-tissue cells to the nano-structured surfaces was similar to that on CpTi. Co-culture with streptococci reduced the number of keratinocytes on all the surfaces to approximately the same level and caused cell damage, suggesting that commensal bacteria could affect adherence of soft-tissue cells to

  20. Enhanced secretion of TIMP-1 by human hypertrophic scar keratinocytes could contribute to fibrosis.

    Science.gov (United States)

    Simon, Franck; Bergeron, Daniele; Larochelle, Sébastien; Lopez-Vallé, Carlos A; Genest, Hervé; Armour, Alexis; Moulin, Véronique J

    2012-05-01

    Hypertrophic scars are a pathological process characterized by an excessive deposition of extracellular matrix components. Using a tissue-engineered reconstructed human skin (RHS) method, we previously reported that pathological keratinocytes induce formation of a fibrotic dermal matrix. We further investigated keratinocyte action using conditioned media. Results showed that conditioned media induce a similar action on dermal thickness similar to when an epidermis is present. Using a two-dimensional electrophoresis technique, we then compared conditioned media from normal or hypertrophic scar keratinocytes and determined that TIMP-1 was increased in conditioned media from hypertrophic scar keratinocytes. This differential profile was confirmed using ELISA, assaying TIMP-1 presence on media from monolayer cultured keratinocytes and from RHS. The dermal matrix of these RHS was recreated using mesenchymal cells from three different origins (skin, wound and hypertrophic scar). The effect of increased TIMP-1 levels on dermal fibrosis was also validated independently from the mesenchymal cell origin. Immunodetection of TIMP-1 showed that this protein was increased in the epidermis of hypertrophic scar biopsies. The findings of this study represent an important advance in understanding the role of keratinocytes as a direct potent modulator for matrix degradation and scar tissue remodeling, possibly through inactivation of MMPs. Copyright © 2011 Elsevier Ltd and ISBI. All rights reserved.

  1. Fos and jun proteins are specifically expressed during differentiation of human keratinocytes.

    Science.gov (United States)

    Mehic, Denis; Bakiri, Latifa; Ghannadan, Minoo; Wagner, Erwin F; Tschachler, Erwin

    2005-01-01

    Activator protein 1 (AP-1) proteins play key roles in the regulation of cell proliferation and differentiation. In this study we investigated the expression of Fos and Jun proteins in different models of terminal differentiation of human keratinocytes and in skin from psoriasis patients. All Jun and Fos proteins, with the exception of FosB, were efficiently expressed in keratinocytes in monolayer cultures. In contrast, in normal epidermis as well as in organotypic epidermal cultures, the expression pattern of AP-1 proteins was dependent on the differentiation stage. Fos proteins were readily detected in nuclei of keratinocytes of basal and suprabasal layers. JunB and JunD were expressed in all layers of normal epidermis. Interestingly, expression of c-Jun started suprabasally, then disappeared and became detectable again in distinct cells of the outermost granular layer directly at the transition zone to the stratum corneum. In psoriatic epidermis, c-Jun expression was prominent in both hyperproliferating basal and suprabasal keratinocytes, whereas c-Fos expression was unchanged. These data indicate that AP-1 proteins are expressed in a highly specific manner during terminal differentiation of keratinocytes and that the enhanced expression of c-Jun in basal and suprabasal keratinocytes might contribute to the pathogenesis of psoriasis.

  2. Human keratinocytes restrict chikungunya virus replication at a post-fusion step

    Energy Technology Data Exchange (ETDEWEB)

    Bernard, Eric [Centre d' étude d’agents Pathogènes et Biotechnologies pour la Santé, CPBS CNRS- UMR5236/UM1/UM2, Montpellier (France); Hamel, Rodolphe [Laboratoire Maladies Infectieuses et Vecteurs: Ecologie, Génétique, Evolution, Contrôle, UMR 5290 CNRS/IRD/UM1, Montpellier (France); Neyret, Aymeric [Centre d' étude d’agents Pathogènes et Biotechnologies pour la Santé, CPBS CNRS- UMR5236/UM1/UM2, Montpellier (France); Ekchariyawat, Peeraya [Laboratoire Maladies Infectieuses et Vecteurs: Ecologie, Génétique, Evolution, Contrôle, UMR 5290 CNRS/IRD/UM1, Montpellier (France); Molès, Jean-Pierre [INSERM U1058, UM1, CHU Montpellier (France); Simmons, Graham [Blood Systems Research Institute, San Francisco, CA 94118 (United States); Chazal, Nathalie [Centre d' étude d’agents Pathogènes et Biotechnologies pour la Santé, CPBS CNRS- UMR5236/UM1/UM2, Montpellier (France); Desprès, Philippe [Unité Interactions Moléculaires Flavivirus-Hôtes, Institut Pasteur, Paris (France); and others

    2015-02-15

    Transmission of chikungunya virus (CHIKV) to humans is initiated by puncture of the skin by a blood-feeding Aedes mosquito. Despite the growing knowledge accumulated on CHIKV, the interplay between skin cells and CHIKV following inoculation still remains unclear. In this study we questioned the behavior of human keratinocytes, the predominant cell population in the skin, following viral challenge. We report that CHIKV rapidly elicits an innate immune response in these cells leading to the enhanced transcription of type I/II and type III interferon genes. Concomitantly, we show that despite viral particles internalization into Rab5-positive endosomes and efficient fusion of virus and cell membranes, keratinocytes poorly replicate CHIKV as attested by absence of nonstructural proteins and genomic RNA synthesis. Accordingly, human keratinocytes behave as an antiviral defense against CHIKV infection rather than as a primary targets for initial replication. This picture significantly differs from that reported for Dengue and West Nile mosquito-borne viruses. - Highlights: • Human keratinocytes support endocytosis of CHIKV and fusion of viral membranes. • CHIKV replication is blocked at a post entry step in these cells. • Infection upregulates type-I, –II and –III IFN genes expression. • Keratinocytes behave as immune sentinels against CHIKV.

  3. Human keratinocytes restrict chikungunya virus replication at a post-fusion step

    International Nuclear Information System (INIS)

    Bernard, Eric; Hamel, Rodolphe; Neyret, Aymeric; Ekchariyawat, Peeraya; Molès, Jean-Pierre; Simmons, Graham; Chazal, Nathalie; Desprès, Philippe

    2015-01-01

    Transmission of chikungunya virus (CHIKV) to humans is initiated by puncture of the skin by a blood-feeding Aedes mosquito. Despite the growing knowledge accumulated on CHIKV, the interplay between skin cells and CHIKV following inoculation still remains unclear. In this study we questioned the behavior of human keratinocytes, the predominant cell population in the skin, following viral challenge. We report that CHIKV rapidly elicits an innate immune response in these cells leading to the enhanced transcription of type I/II and type III interferon genes. Concomitantly, we show that despite viral particles internalization into Rab5-positive endosomes and efficient fusion of virus and cell membranes, keratinocytes poorly replicate CHIKV as attested by absence of nonstructural proteins and genomic RNA synthesis. Accordingly, human keratinocytes behave as an antiviral defense against CHIKV infection rather than as a primary targets for initial replication. This picture significantly differs from that reported for Dengue and West Nile mosquito-borne viruses. - Highlights: • Human keratinocytes support endocytosis of CHIKV and fusion of viral membranes. • CHIKV replication is blocked at a post entry step in these cells. • Infection upregulates type-I, –II and –III IFN genes expression. • Keratinocytes behave as immune sentinels against CHIKV

  4. Human Papilloma Viral DNA Replicates as a Stable Episome in Cultured Epidermal Keratinocytes

    Science.gov (United States)

    Laporta, Robert F.; Taichman, Lorne B.

    1982-06-01

    Human papilloma virus (HPV) is poorly understood because systems for its growth in tissue culture have not been developed. We report here that cultured human epidermal keratinocytes could be infected with HPV from plantar warts and that the viral DNA persisted and replicated as a stable episome. There were 50-200 copies of viral DNA per cell and there was no evidence to indicate integration of viral DNA into the cellular genome. There was also no evidence to suggest that viral DNA underwent productive replication. We conclude that cultured human epidermal keratinocytes may be a model for the study of certain aspects of HPV biology.

  5. Cortactin involvement in the keratinocyte growth factor and fibroblast growth factor 10 promotion of migration and cortical actin assembly in human keratinocytes

    International Nuclear Information System (INIS)

    Ceccarelli, Simona; Cardinali, Giorgia; Aspite, Nicaela; Picardo, Mauro; Marchese, Cinzia; Torrisi, Maria Rosaria; Mancini, Patrizia

    2007-01-01

    Keratinocyte growth factor (KGF/FGF7) and fibroblast growth factor 10 (FGF10/KGF2) regulate keratinocyte proliferation and differentiation by binding to the tyrosine kinase KGF receptor (KGFR). KGF induces keratinocyte motility and cytoskeletal rearrangement, whereas a direct role of FGF10 on keratinocyte migration is not clearly established. Here we analyzed the motogenic activity of FGF10 and KGF on human keratinocytes. Migration assays and immunofluorescence of actin cytoskeleton revealed that FGF10 is less efficient than KGF in promoting migration and exerts a delayed effect in inducing lamellipodia and ruffles formation. Both growth factors promoted phosphorylation and subsequent membrane translocation of cortactin, an F-actin binding protein involved in cell migration; however, FGF10-induced cortactin phosphorylation was reduced, more transient and delayed with respect to that promoted by KGF. Cortactin phosphorylation induced by both growth factors was Src-dependent, while its membrane translocation and cell migration were blocked by either Src and PI3K inhibitors, suggesting that both pathways are involved in KGF- and FGF10-dependent motility. Furthermore, siRNA-mediated downregulation of cortactin inhibited KGF- and FGF10-induced migration. These results indicate that cortactin is involved in keratinocyte migration promoted by both KGF and FGF10

  6. Early Gene Expression in Wounded Human Keratinocytes Revealed by DNA Microarray Analysis

    Directory of Open Access Journals (Sweden)

    Pascal Barbry

    2006-04-01

    Full Text Available Wound healing involves several steps: spreading of the cells, migration and proliferation. We have profiled gene expression during the early events of wound healing in normal human keratinocytes with a home-made DNA microarray containing about 1000 relevant human probes. An original wounding machine was used, that allows the wounding of up to 40% of the surface of a confluent monolayer of cultured cells grown on a Petri dish (compared with 5% with a classical ‘scratch’ method. The two aims of the present study were: (a to validate a limited number of genes by comparing the expression levels obtained with this technique with those found in the literature; (b to combine the use of the wounding machine with DNA microarray analysis for large-scale detection of the molecular events triggered during the early stages of the wound-healing process. The time-courses of RNA expression observed at 0.5, 1.5, 3, 6 and 15 h after wounding for genes such as c-Fos, c-Jun, Egr1, the plasminogen activator PLAU (uPA and the signal transducer and transcription activator STAT3, were consistent with previously published data. This suggests that our methodologies are able to perform quantitative measurement of gene expression. Transcripts encoding two zinc finger proteins, ZFP36 and ZNF161, and the tumour necrosis factor α-induced protein TNFAIP3, were also overexpressed after wounding. The role of the p38 mitogen-activated protein kinase (p38MAPK in wound healing was shown after the inhibition of p38 by SB203580, but our results also suggest the existence of surrogate activating pathways.

  7. Curcuma longa Is Able to Induce Apoptotic Cell Death of Pterygium-Derived Human Keratinocytes.

    Science.gov (United States)

    Sancilio, Silvia; Di Staso, Silvio; Sebastiani, Stefano; Centurione, Lucia; Di Girolamo, Nick; Ciancaglini, Marco; Di Pietro, Roberta

    2017-01-01

    Pterygium is a relatively common eye disease that can display an aggressive clinical behaviour. To evaluate the in vitro effects of Curcuma longa on human pterygium-derived keratinocytes, specimens of pterygium from 20 patients undergoing pterygium surgical excision were collected. Pterygium explants were put into culture and derived keratinocytes were treated with an alcoholic extract of 1.3% Curcuma longa in 0.001% Benzalkonium Chloride for 3, 6, and 24 h. Cultured cells were examined for CAM5.2 (anti-cytokeratin antibody) and CD140 (anti-fibroblast transmembrane glycoprotein antibody) expression between 3th and 16th passage to assess cell homogeneity. TUNEL technique and Annexin-V/PI staining in flow cytometry were used to detect keratinocyte apoptosis. We showed that Curcuma longa exerts a proapoptotic effect on pterygium-derived keratinocytes already after 3 h treatment. Moreover, after 24 h treatment, Curcuma longa induces a significant increase in TUNEL as well as Annexin-V/PI positive cells in comparison to untreated samples. Our study confirms previous observations highlighting the expression, in pterygium keratinocytes, of nuclear VEGF and gives evidence for the first time to the expression of nuclear and cytoplasmic VEGF-R1. All in all, these findings suggest that Curcuma longa could have some therapeutic potential in the treatment and prevention of human pterygium.

  8. Curcuma longa Is Able to Induce Apoptotic Cell Death of Pterygium-Derived Human Keratinocytes

    Directory of Open Access Journals (Sweden)

    Silvia Sancilio

    2017-01-01

    Full Text Available Pterygium is a relatively common eye disease that can display an aggressive clinical behaviour. To evaluate the in vitro effects of Curcuma longa on human pterygium-derived keratinocytes, specimens of pterygium from 20 patients undergoing pterygium surgical excision were collected. Pterygium explants were put into culture and derived keratinocytes were treated with an alcoholic extract of 1.3% Curcuma longa in 0.001% Benzalkonium Chloride for 3, 6, and 24 h. Cultured cells were examined for CAM5.2 (anti-cytokeratin antibody and CD140 (anti-fibroblast transmembrane glycoprotein antibody expression between 3th and 16th passage to assess cell homogeneity. TUNEL technique and Annexin-V/PI staining in flow cytometry were used to detect keratinocyte apoptosis. We showed that Curcuma longa exerts a proapoptotic effect on pterygium-derived keratinocytes already after 3 h treatment. Moreover, after 24 h treatment, Curcuma longa induces a significant increase in TUNEL as well as Annexin-V/PI positive cells in comparison to untreated samples. Our study confirms previous observations highlighting the expression, in pterygium keratinocytes, of nuclear VEGF and gives evidence for the first time to the expression of nuclear and cytoplasmic VEGF-R1. All in all, these findings suggest that Curcuma longa could have some therapeutic potential in the treatment and prevention of human pterygium.

  9. Insulin binding properties of normal and transformed human epidermal cultured keratinocytes

    International Nuclear Information System (INIS)

    Verrando, P.; Ortonne, J.P.

    1985-01-01

    Insulin binding to its receptors was studied in cultured normal and transformed (A431 line) human epidermal keratinocytes. The specific binding was a temperature-dependent, saturable process. Normal keratinocytes possess a mean value of about 80,000 receptors per cell. Fifteen hours exposure of the cells to insulin lowered their receptor number (about 65% loss in available sites); these reappeared when the hormone was removed from the culture medium. In the A431 epidermoid carcinoma cell line, there is a net decrease in insulin binding (84% of the initial bound/free hormone ratio in comparison with normal cells) essentially related to a loss in receptor affinity for insulin. Thus, cultured human keratinocytes which express insulin receptors may be a useful tool in understanding skin pathology related to insulin disorders

  10. Exogenous hydrogen sulfide promotes cell proliferation and differentiation by modulating autophagy in human keratinocytes

    Energy Technology Data Exchange (ETDEWEB)

    Xie, Xin [Department of Dermatology, The Second Affiliated Hospital of Harbin Medical University, Harbin, 150086, Heilongjiang Province (China); Dai, Hui [Department of Cardiology, The First Affiliated Hospital of Harbin Medical University, Harbin, 150001, Heilongjiang Province (China); Zhuang, Binyu [Department of Dermatology, The Second Affiliated Hospital of Harbin Medical University, Harbin, 150086, Heilongjiang Province (China); Chai, Li; Xie, Yanguang [Institute of Dermatology of Heilongjiang Province, Harbin, 150001, Heilongjiang Province (China); Li, Yuzhen, E-mail: liyuzhen@medmail.com.cn [Department of Dermatology, The Second Affiliated Hospital of Harbin Medical University, Harbin, 150086, Heilongjiang Province (China)

    2016-04-08

    The effects and the underlying mechanisms of hydrogen sulfide (H{sub 2}S) on keratinocyte proliferation and differentiation are still less known. In the current study, we investigated the effects and the underlying mechanisms of exogenous H{sub 2}S on keratinocyte proliferation and differentiation. Human keratinocytes (HaCaT cells) were treated with various concentrations (0.05, 0.25, 0.5 and 1 mM) of sodium hydrosulfide (NaHS, a donor of H{sub 2}S) for 24 h. A CCK-8 assay was used to assess cell viability. Western blot analysis was performed to determine the expression levels of proteins associated with differentiation and autophagy. Transmission electron microscopy was performed to observe autophagic vacuoles, and flow cytometry was applied to evaluate apoptosis. NaHS promoted the viability, induced the differentiation, and enhanced autophagic activity in a dose-dependent manner in HaCaT cells but had no effect on cell apoptosis. Blockage of autophagy by ATG5 siRNA inhibited NaHS-induced cell proliferation and differentiation. The current study demonstrated that autophagy in response to exogenous H{sub 2}S treatment promoted keratinocyte proliferation and differentiation. Our results provide additional insights into the potential role of autophagy in keratinocyte proliferation and differentiation. - Highlights: • Exogenous H{sub 2}S promotes keratinocyte proliferation and differentiation. • The effects of H{sub 2}S on proliferation and differentiation is modulated by autophagy. • Exogenous H{sub 2}S has no effect on keratinocyte apoptosis.

  11. H{sup +}/peptide transporter (PEPT2) is expressed in human epidermal keratinocytes and is involved in skin oligopeptide transport

    Energy Technology Data Exchange (ETDEWEB)

    Kudo, Michiko; Katayoshi, Takeshi; Kobayashi-Nakamura, Kumiko [DHC Corporation Laboratories, Division 2, 2-42 Hamada, Mihama-ku, Chiba 261-0025 (Japan); Akagawa, Mitsugu [Department of Biological Chemistry, Division of Applied Life Science, Graduate School of Life and Environmental Sciences, Osaka Prefecture University, 1-1 Gakuen-cho, Naka-ku, Sakai 599-8531 (Japan); Tsuji-Naito, Kentaro, E-mail: knaito@dhc.co.jp [DHC Corporation Laboratories, Division 2, 2-42 Hamada, Mihama-ku, Chiba 261-0025 (Japan)

    2016-07-08

    Peptide transporter 2 (PEPT2) is a member of the proton-coupled oligopeptide transporter family, which mediates the cellular uptake of oligopeptides and peptide-like drugs. Although PEPT2 is expressed in many tissues, its expression in epidermal keratinocytes remains unclear. We investigated PEPT2 expression profile and functional activity in keratinocytes. We confirmed PEPT2 mRNA expression in three keratinocyte lines (normal human epidermal keratinocytes (NHEKs), immortalized keratinocytes, and malignant keratinocytes) by reverse transcription-polymerase chain reaction (RT-PCR) and quantitative real-time RT-PCR. In contrast to PEPT1, PEPT2 expression in the three keratinocytes was similar or higher than that in HepG2 cells, used as PEPT2-positive cells. Immunolocalization analysis using human skin showed epidermal PEPT2 localization. We studied keratinocyte transport function by measuring the oligopeptide content using liquid chromatography/tandem mass spectrometry. Glycylsarcosine uptake in NHEKs was pH-dependent, suggesting that keratinocytes could absorb small peptides in the presence of an inward H{sup +} gradient. We also performed a skin-permeability test of several oligopeptides using skin substitute, suggesting that di- and tripeptides pass actively through the epidermis. In conclusion, PEPT2 is expressed in keratinocytes and involved in skin oligopeptide uptake. -- Highlights: •PEPT2 is expressed in keratinocytes, which are more common than other skin cells. •Immunolocalization analysis using human skin revealed epidermal PEPT2 localization. •Keratinocytes could absorb small peptides in the presence of an inward H{sup +} gradient. •Di- and tripeptide pass actively through the epidermis.

  12. The stress caused by nitrite with titanium dioxide nanoparticles under UVA irradiation in human keratinocyte cell

    International Nuclear Information System (INIS)

    Tu, Min; Huang, Yi; Li, Hai-Ling; Gao, Zhong-Hong

    2012-01-01

    Highlights: ► Nitrite increased photo-toxicity of nano-TiO 2 on human keratinocyte cells in a dose-dependant manner. ► Morphological study suggested the cell death may be mediated by apoptosis inducing factor. ► Protein nitration was generated in the cells, and the most abundant nitrated protein was identified as cystatin-A. ► Tyr35 was the most likely site to be nitrated in cystatin-A. -- Abstract: Our previous work found that in the presence of nitrite, titanium dioxide nanoparticles can cause protein tyrosine nitration under UVA irradiation in vivo. In this paper, the human keratinocyte cells was used as a skin cell model to further study the photo-toxicity of titanium dioxide nanoparticles when nitrite was present. The results showed that nitrite increased the photo-toxicity of titanium dioxide in a dose-dependant manner, and generated protein tyrosine nitration in keratinocyte cells. Morphological study of keratinocyte cells suggested a specific apoptosis mediated by apoptosis inducing factor. It was also found the main target nitrated in cells was cystatin-A, which expressed abundantly in cytoplasm and functioned as a cysteine protease inhibitor. The stress induced by titanium dioxide with nitrite under UVA irradiation in human keratinocyte cells appeared to trigger the apoptosis inducing factor mediated cell death and lose the inhibition of active caspase by cystatin-A. We conclude that nitrite can bring new damage and stress to human keratinocyte cells with titanium dioxide nanoparticles under UVA irradiation.

  13. Differential Gene Expression in Primary Human Skin Keratinocytes and Fibroblasts in Response to Ionizing Radiation

    Science.gov (United States)

    Warters, Raymond L.; Packard, Ann T.; Kramer, Gwen F.; Gaffney, David K.; Moos, Philip J.

    2009-01-01

    Although skin is usually exposed during human exposures to ionizing radiation, there have been no thorough examinations of the transcriptional response of skin fibroblasts and keratinocytes to radiation. The transcriptional response of quiescent primary fibroblasts and keratinocytes exposed to from 10 cGy to 5 Gy and collected 4 h after treatment was examined. RNA was isolated and examined by microarray analysis for changes in the levels of gene expression. Exposure to ionizing radiation altered the expression of 279 genes across both cell types. Changes in RNA expression could be arranged into three main categories: (1) changes in keratinocytes but not in fibroblasts, (2) changes in fibroblasts but not in keratinocytes, and (3) changes in both. All of these changes were primarily of p53 target genes. Similar radiation-induced changes were induced in immortalized fibroblasts or keratinocytes. In separate experiments, protein was collected and analyzed by Western blotting for expression of proteins observed in microarray experiments to be overexpressed at the mRNA level. Both Q-PCR and Western blot analysis experiments validated these transcription changes. Our results are consistent with changes in the expression of p53 target genes as indicating the magnitude of cell responses to ionizing radiation. PMID:19580510

  14. Serially cultured keratinocytes from human scalp hair follicles: a tool for cytogenetic studies.

    Science.gov (United States)

    Weterings, P J; Roelofs, H M; Jansen, B A; Vermorken, A J

    1983-01-01

    Keratinocytes originating from adult human hair follicles, the most convenient biopsy tissue, can be serially cultured using a combination of two techniques. Primary cultures are established using plucked scalp hair follicles and the bovine eye lens capsule as a growth substrate. Subsequently, cells from these cultures are serially cultivated in the presence of irradiated 3T3 cells as feeders. By this combination of techniques many keratinocytes can be generated from one single hair follicle. These cultures, appropriately treated with colchicine, can provide an adequate number of metaphases suitable for chromosome studies.

  15. Micronucleus formation in cultured human keratinocytes following exposure to mitomycin C and cyclophosphamide.

    Science.gov (United States)

    van Pelt, F N; Haring, R M; Overkamp, M J; Weterings, P J

    1991-02-01

    A method is described to investigate the induction of micronuclei in cultured human keratinocytes after short-term exposure to known clastogenic agents. The cytokinesis-block method was applied to facilitate the scoring of micronucleated cells. Mitomycin C, a direct-acting compound, caused a 5-20-fold increase in micronuclei over the controls at the highest concentration tested (1 microgram/ml). Cyclophosphamide, an agent requiring metabolic activation, did not induce the formation of micronuclei in cultured keratinocytes. However, after pretreatment of the keratinocyte cultures with Aroclor 1254 for 72 h, exposure to cyclophosphamide resulted in a 3-fold increase in micronucleus frequency over the controls. No cytogenetic effect of Aroclor 1254 was observed in control experiments.

  16. Attachment and growth of human keratinocytes in a serum-free environment.

    Science.gov (United States)

    Gilchrest, B A; Calhoun, J K; Maciag, T

    1982-08-01

    Using a serum-free system, we have investigated the influence of human fibronectin (HFN) and selected growth factors (GF) on the attachment and growth of normal human keratinocytes in vitro. Single-cell suspensions of keratinocytes from near-confluent primary plates, plated on 5-10 microgram/cm2 HFN, showed approximately 30-40% attachment after 2-24 hours of incubation at 37 degrees C, compared with 4-6% attachment on uncoated platic plates. Percentage of attached cells was independent of seed density, tissue donor age, in vitro culture age, or medium composition, while subsequent cellular proliferation was strongly dependent on these factors. Keratinocytes grown on an adequate HFN matrix in a previously described hormone-supplemented medium (Maciag et al., 1981a) achieved four to eight population doubling over 7-12 days at densities greater than or equal to 104 cell/cm2. Removal of most GF individually from the medium had little or no effect on growth, while removal of epidermal growth factor (EGF) alone reduced growth by 30-35% and removal of bovine brain extract (BE) alone reduced growth by approximately 90%. Conversely, EGF alone in basal medium supported approximately 10% control growth, BE alone supported 30-40% control growth, and the combination of EGF and BE approximately 70%. In addition to its major effect on proliferation in this system, BE was necessary to preserve normal keratinocyte morphology and protein production. These findings expand earlier observations that HFN facilitates keratinocyte attachment in vitro and that a brain-derived extract can exert a major positive influence on cultured keratinocytes.

  17. Low calcium culture condition induces mesenchymal cell-like phenotype in normal human epidermal keratinocytes

    International Nuclear Information System (INIS)

    Takagi, Ryo; Yamato, Masayuki; Murakami, Daisuke; Sugiyama, Hiroaki; Okano, Teruo

    2011-01-01

    Highlights: → Normal human epidermal keratinocytes serially cultured under low calcium concentration were cytokeratin and vimentin double positive cells. → The human keratinocytes expressed some epithelial stem/progenitor cell makers, mesenchymal cell markers, and markers of epithelial-mesenchymal transition. → Mesenchymal cell-like phenotype in the keratinocytes was suppressed under high-calcium condition. -- Abstract: Epithelial-mesenchymal transition (EMT) is an important cellular phenomenon in organ developments, cancer invasions, and wound healing, and many types of transformed cell lines are used for investigating for molecular mechanisms of EMT. However, there are few reports for EMT in normal human epithelial cells, which are non-transformed or non-immortalized cells, in vitro. Therefore, normal human epidermal keratinocytes (NHEK) serially cultured in low-calcium concentration medium (LCM) were used for investigating relations between differentiation and proliferation and mesenchymal-like phenotype in the present study, since long-term cultivation of NHEK is achieved in LCM. Interestingly, NHEK serially cultured in LCM consisted essentially of cytokeratin-vimentin double positive cells (98%), although the NHEK exhibited differentiation under high-calcium culture condition with 3T3 feeder layer. The vimentin expression was suppressed under high-calcium condition. These results may indicate the importance of mesenchymal-like phenotype for serially cultivation of NHEK in vitro.

  18. Toxicity Assessment of Six Titanium Dioxide Nanoparticles in Human Epidermal Keratinocytes

    Science.gov (United States)

    Toxicity Assessment of Six Titanium Dioxide Nanoparticles in Human Epidermal Keratinocytes Nanoparticle uptake in cells may be an important determinant of their potential cytotoxic and inflammatory effects. Six commercial TiO2 NP (A=Alfa Aesar,10nm, A*=Alfa Aesar 32nm, B=P25 27...

  19. Chemical allergens stimulate human epidermal keratinocytes to produce lymphangiogenic vascular endothelial growth factor.

    Science.gov (United States)

    Bae, Ok-Nam; Ahn, Seyeon; Jin, Sun Hee; Hong, Soo Hyun; Lee, Jinyoung; Kim, Eun-Sun; Jeong, Tae Cheon; Chun, Young-Jin; Lee, Ai-Young; Noh, Minsoo

    2015-03-01

    Allergic contact dermatitis (ACD) is a cell-mediated immune response that involves skin sensitization in response to contact with various allergens. Angiogenesis and lymphangiogenesis both play roles in the allergic sensitization process. Epidermal keratinocytes can produce vascular endothelial growth factor (VEGF) in response to UV irradiation and during wound healing. However, the effect of haptenic chemical allergens on the VEGF production of human keratinocytes, which is the primary contact site of toxic allergens, has not been thoroughly researched. We systematically investigated whether immune-regulatory cytokines and chemical allergens would lead to the production of VEGF in normal human keratinocytes (NHKs) in culture. VEGF production significantly increased when NHKs were treated with IFNγ, IL-1α, IL-4, IL-6, IL-17A, IL-22 or TNFα. Among the human sensitizers listed in the OECD Test Guideline (TG) 429, we found that CMI/MI, DNCB, 4-phenylenediamine, cobalt chloride, 2-mercaptobenzothiazole, citral, HCA, cinnamic alcohol, imidazolidinyl urea and nickel chloride all significantly upregulated VEGF production in NHKs. In addition, common human haptenic allergens such as avobenzone, formaldehyde and urushiol, also induced the keratinocyte-derived VEGF production. VEGF upregulation by pro-inflammatory stimuli, IFNγ, DNCB or formaldehyde is preceded by the production of IL-8, an acute inflammatory phase cytokine. Lymphangiogenic VEGF-C gene transcription was significantly increased when NHKs were treated with formaldehyde, DNCB or urushiol, while transcription of VEGF-A and VEGF-B did not change. Therefore, the chemical allergen-induced VEGF upregulation is mainly due to the increase in lymphangiogenic VEGF-C transcription in NHKs. These results suggest that keratinocyte-derived VEGF may regulate the lymphangiogenic process during the skin sensitization process of ACD. Copyright © 2015 Elsevier Inc. All rights reserved.

  20. Analysis of aquaporin 9 expression in human epidermis and cultured keratinocytes

    Directory of Open Access Journals (Sweden)

    Yoshinori Sugiyama

    2014-01-01

    Full Text Available Aquaporin 9 (AQP9 is a member of the aquaglyceroporin family that transports glycerol, urea and other small solutes as well as water. Compared to the expression and function in epidermal keratinocytes of AQP3, another aquaglyceroporin, our knowledge of epidermal AQP9 remains elusive. In this study, we investigated the expression of AQP9 in the human epidermis and cultured keratinocytes. Immunofluorescence studies revealed that AQP9 expression is highly restricted to the stratum granulosum of the human epidermis, where occludin is also expressed at the tight junctions. Interestingly, the AQP3 staining decreased sharply below the cell layers in which AQP9 is expressed. In cultured normal human epidermal keratinocytes (NHEK, knock-down of AQP9 expression in the differentiated cells induced by RNA interference reduced glycerol uptake, which was not as pronounced as was the case with AQP3 knock-down cells. In contrast, similar reduction of urea uptake was detected in AQP9 and AQP3 knock-down cells. These findings suggested that AQP9 expression in NHEK facilitates at least the transport of glycerol and urea. Finally, we analyzed the effect of retinoic acid (RA, a potent stimulator of keratinocyte proliferation, on AQP3 and AQP9 mRNA expression in differentiated NHEK. Stimulation with RA at 1 μM for 24 h augmented AQP3 expression and down-regulated AQP9 expression. Collectively, these results indicate that AQP9 expression in epidermal keratinocytes is regulated in a different manner from that of AQP3.

  1. 5-fluorouracil Toxicity Mechanism Determination in Human Keratinocytes: in vitro Study on HaCaT

    Directory of Open Access Journals (Sweden)

    Jan Hartinger

    2018-01-01

    Full Text Available 5-fluorouracil (5-FU and capecitabine therapy is often accompanied by palmar-plantar erythrodysesthesia (PPE which is manifestation of 5-FU toxicity in keratinocytes. The main mechanisms of 5-FU action are thymidylate synthase (TS inhibition which can be abrogated by thymidine and strengthened by calciumfolinate (CF and incorporation of fluorouridinetriphosphate into RNA which can be abrogated by uridine. For proper PPE treatment 5-FU mechanism of action in keratinocytes needs to be elucidated. We used the 5-FU toxicity modulators uridine, thymidine and CF to discover the mechanism of 5-FU action in human keratinocyte cell line HaCaT. To measure the cellular viability, we used MTT test and RTCA test. CF did not augment 5-FU toxicity and 5-FU toxicity was weakened by uridine. Therefore, the primary mechanism of 5-FU toxicity in keratinocytes is 5-FU incorporation into RNA. The uridine protective effect cannot fully develop in the presence of CF. Thymidine addition to 5-FU and uridine treated cells not only prevents the toxicity-augmenting CF effect but it also prolongs the 5-FU treated cells survival in comparison to uridine only. Therefore, it can be assumed that in the presence of uridine the 5-FU toxicity mechanism is switched from RNA incorporation to TS inhibition. Although particular 5-FU toxicity mechanisms were previously described in various cell types, this is the first time when various combinations of pyrimidine nucleosides and CF were used for 5-FU toxicity mechanism elucidation in human keratinocytes. We suggest that for PPE treatment ointment containing uridine and thymidine should be further clinically tested.

  2. Prolonged Integration Site Selection of a Lentiviral Vector in the Genome of Human Keratinocytes.

    Science.gov (United States)

    Qian, Wei; Wang, Yong; Li, Rui-Fu; Zhou, Xin; Liu, Jing; Peng, Dai-Zhi

    2017-03-03

    BACKGROUND Lentiviral vectors have been successfully used for human skin cell gene transfer studies. Defining the selection of integration sites for retroviral vectors in the host genome is crucial in risk assessment analysis of gene therapy. However, genome-wide analyses of lentiviral integration sites in human keratinocytes, especially after prolonged growth, are poorly understood. MATERIAL AND METHODS In this study, 874 unique lentiviral vector integration sites in human HaCaT keratinocytes after long-term culture were identified and analyzed with the online tool GTSG-QuickMap and SPSS software. RESULTS The data indicated that lentiviral vectors showed integration site preferences for genes and gene-rich regions. CONCLUSIONS This study will likely assist in determining the relative risks of the lentiviral vector system and in the design of a safe lentiviral vector system in the gene therapy of skin diseases.

  3. Chemical allergens stimulate human epidermal keratinocytes to produce lymphangiogenic vascular endothelial growth factor

    Energy Technology Data Exchange (ETDEWEB)

    Bae, Ok-Nam [College of Pharmacy, Institute of Pharmaceutical Science and Technology, Hanyang University, Ansan 426-791 (Korea, Republic of); Ahn, Seyeon; Jin, Sun Hee; Hong, Soo Hyun; Lee, Jinyoung [College of Pharmacy, Natural Products Research Institute, Seoul National University, Seoul 151-742 (Korea, Republic of); Kim, Eun-Sun [College of Pharmacy, Institute of Pharmaceutical Science and Technology, Hanyang University, Ansan 426-791 (Korea, Republic of); Jeong, Tae Cheon [College of Pharmacy, Yeungnam University, Gyeongsan 712-749 (Korea, Republic of); Chun, Young-Jin [College of Pharmacy, Chung-Ang University, Seoul 156-756 (Korea, Republic of); Lee, Ai-Young, E-mail: leeay@duih.org [Department of Dermatology, Dongguk University Ilsan Hospital, Goyang 410-773 (Korea, Republic of); Noh, Minsoo, E-mail: minsoo@alum.mit.edu [College of Pharmacy, Natural Products Research Institute, Seoul National University, Seoul 151-742 (Korea, Republic of)

    2015-03-01

    Allergic contact dermatitis (ACD) is a cell-mediated immune response that involves skin sensitization in response to contact with various allergens. Angiogenesis and lymphangiogenesis both play roles in the allergic sensitization process. Epidermal keratinocytes can produce vascular endothelial growth factor (VEGF) in response to UV irradiation and during wound healing. However, the effect of haptenic chemical allergens on the VEGF production of human keratinocytes, which is the primary contact site of toxic allergens, has not been thoroughly researched. We systematically investigated whether immune-regulatory cytokines and chemical allergens would lead to the production of VEGF in normal human keratinocytes (NHKs) in culture. VEGF production significantly increased when NHKs were treated with IFNγ, IL-1α, IL-4, IL-6, IL-17A, IL-22 or TNFα. Among the human sensitizers listed in the OECD Test Guideline (TG) 429, we found that CMI/MI, DNCB, 4-phenylenediamine, cobalt chloride, 2-mercaptobenzothiazole, citral, HCA, cinnamic alcohol, imidazolidinyl urea and nickel chloride all significantly upregulated VEGF production in NHKs. In addition, common human haptenic allergens such as avobenzone, formaldehyde and urushiol, also induced the keratinocyte-derived VEGF production. VEGF upregulation by pro-inflammatory stimuli, IFNγ, DNCB or formaldehyde is preceded by the production of IL-8, an acute inflammatory phase cytokine. Lymphangiogenic VEGF-C gene transcription was significantly increased when NHKs were treated with formaldehyde, DNCB or urushiol, while transcription of VEGF-A and VEGF-B did not change. Therefore, the chemical allergen-induced VEGF upregulation is mainly due to the increase in lymphangiogenic VEGF-C transcription in NHKs. These results suggest that keratinocyte-derived VEGF may regulate the lymphangiogenic process during the skin sensitization process of ACD. - Highlights: • Pro-inflammatory cytokines induced VEGF production in normal human

  4. Chemical allergens stimulate human epidermal keratinocytes to produce lymphangiogenic vascular endothelial growth factor

    International Nuclear Information System (INIS)

    Bae, Ok-Nam; Ahn, Seyeon; Jin, Sun Hee; Hong, Soo Hyun; Lee, Jinyoung; Kim, Eun-Sun; Jeong, Tae Cheon; Chun, Young-Jin; Lee, Ai-Young; Noh, Minsoo

    2015-01-01

    Allergic contact dermatitis (ACD) is a cell-mediated immune response that involves skin sensitization in response to contact with various allergens. Angiogenesis and lymphangiogenesis both play roles in the allergic sensitization process. Epidermal keratinocytes can produce vascular endothelial growth factor (VEGF) in response to UV irradiation and during wound healing. However, the effect of haptenic chemical allergens on the VEGF production of human keratinocytes, which is the primary contact site of toxic allergens, has not been thoroughly researched. We systematically investigated whether immune-regulatory cytokines and chemical allergens would lead to the production of VEGF in normal human keratinocytes (NHKs) in culture. VEGF production significantly increased when NHKs were treated with IFNγ, IL-1α, IL-4, IL-6, IL-17A, IL-22 or TNFα. Among the human sensitizers listed in the OECD Test Guideline (TG) 429, we found that CMI/MI, DNCB, 4-phenylenediamine, cobalt chloride, 2-mercaptobenzothiazole, citral, HCA, cinnamic alcohol, imidazolidinyl urea and nickel chloride all significantly upregulated VEGF production in NHKs. In addition, common human haptenic allergens such as avobenzone, formaldehyde and urushiol, also induced the keratinocyte-derived VEGF production. VEGF upregulation by pro-inflammatory stimuli, IFNγ, DNCB or formaldehyde is preceded by the production of IL-8, an acute inflammatory phase cytokine. Lymphangiogenic VEGF-C gene transcription was significantly increased when NHKs were treated with formaldehyde, DNCB or urushiol, while transcription of VEGF-A and VEGF-B did not change. Therefore, the chemical allergen-induced VEGF upregulation is mainly due to the increase in lymphangiogenic VEGF-C transcription in NHKs. These results suggest that keratinocyte-derived VEGF may regulate the lymphangiogenic process during the skin sensitization process of ACD. - Highlights: • Pro-inflammatory cytokines induced VEGF production in normal human

  5. TCDD induces dermal accumulation of keratinocyte-derived matrix metalloproteinase-10 in an organotypic model of human skin

    Energy Technology Data Exchange (ETDEWEB)

    De Abrew, K. Nadira [Molecular and Environmental Toxicology Center, University of Wisconsin—Madison, Madison, WI 53706 (United States); Thomas-Virnig, Christina L.; Rasmussen, Cathy A. [Department of Pathology, University of Wisconsin—Madison, Madison, WI 53706 (United States); Bolterstein, Elyse A. [Molecular and Environmental Toxicology Center, University of Wisconsin—Madison, Madison, WI 53706 (United States); Schlosser, Sandy J. [Department of Pathology, University of Wisconsin—Madison, Madison, WI 53706 (United States); Allen-Hoffmann, B. Lynn, E-mail: blallenh@wisc.edu [Molecular and Environmental Toxicology Center, University of Wisconsin—Madison, Madison, WI 53706 (United States); Department of Pathology, University of Wisconsin—Madison, Madison, WI 53706 (United States)

    2014-05-01

    The epidermis of skin is the first line of defense against the environment. A three dimensional model of human skin was used to investigate tissue-specific phenotypes induced by the environmental contaminant, 2,3,7,8-tetrachlorodibenzo-p-dioxin (TCDD). Continuous treatment of organotypic cultures of human keratinocytes with TCDD resulted in intracellular spaces between keratinocytes of the basal and immediately suprabasal layers as well as thinning of the basement membrane, in addition to the previously reported hyperkeratinization. These tissue remodeling events were preceded temporally by changes in expression of the extracellular matrix degrading enzyme, matrix metalloproteinase-10 (MMP-10). In organotypic cultures MMP-10 mRNA and protein were highly induced following TCDD treatment. Q-PCR and immunoblot results from TCDD-treated monolayer cultures, as well as indirect immunofluorescence and immunoblot analysis of TCDD-treated organotypic cultures, showed that MMP-10 was specifically contributed by the epidermal keratinocytes but not the dermal fibroblasts. Keratinocyte-derived MMP-10 protein accumulated over time in the dermal compartment of organotypic cultures. TCDD-induced epidermal phenotypes in organotypic cultures were attenuated by the keratinocyte-specific expression of tissue inhibitor of metalloproteinase-1, a known inhibitor of MMP-10. These studies suggest that MMP-10 and possibly other MMP-10-activated MMPs are responsible for the phenotypes exhibited in the basement membrane, the basal keratinocyte layer, and the cornified layer of TCDD-treated organotypic cultures. Our studies reveal a novel mechanism by which the epithelial–stromal microenvironment is altered in a tissue-specific manner thereby inducing structural and functional pathology in the interfollicular epidermis of human skin. - Highlights: • TCDD causes hyperkeratosis and basement membrane changes in a model of human skin. • TCDD induces MMP-10 expression in organotypic cultures

  6. Replacement of murine fibroblasts by human fibroblasts irradiated in obtaining feeder layer for the culture of human keratinocytes

    International Nuclear Information System (INIS)

    Yoshito, Daniele; Sufi, Bianca S.; Santin, Stefany P.; Mathor, Monica B.; Altran, Silvana C.; Isaac, Cesar

    2011-01-01

    Human autologous epithelia cultivated in vitro, have been used successfully in treating damage to skin integrity. The methodology allowed the cultivation of these epithelia was described by Rheinwald and Green in 1975, this methodology consisted in seeding keratinocytes onto a feeder layer composed of lineage 3T3 murine fibroblasts, the proliferation rate is controlled through the action of ionizing radiation. However, currently there is a growing concern about the possibility of transmitting prions and murine viruses to transplanted patients. Taking into account this concern, in this present work, we replaced the feeder layer originally composed of murine fibroblasts by human fibroblasts. To obtain this new feeder layer was necessary to standardize the enough irradiation dose to inhibit the replication of human fibroblasts and the verification of effectiveness of the development of keratinocytes culture on a feeder layer thus obtained. According to the obtained results we can verify that the human fibroblasts irradiated at various tested doses (60, 70, 100, 200, 250 and 300 Gy) had their mitotic activity inactivated by irradiation, allowing the use of any of these doses to confection of the feeder layer, since these fibroblasts irradiated still showed viable until fourteen days of cultivation. In the test of colony formation efficiency was observed that keratinocytes seeded on irradiated human fibroblasts were able to develop satisfactorily, preserving their clonogenic potential. Therefore it was possible the replacement of murine fibroblasts by human fibroblasts in confection of the feeder layer, in order to eliminate this xenobiotic component of the keratinocytes culture. (author)

  7. Replacement of murine fibroblasts by human fibroblasts irradiated in obtaining feeder layer for the culture of human keratinocytes

    Energy Technology Data Exchange (ETDEWEB)

    Yoshito, Daniele; Sufi, Bianca S.; Santin, Stefany P.; Mathor, Monica B. [Instituto de Pesquisas Energeticas e Nucleares (IPEN/CNEN-SP), Sao Paulo, SP (Brazil); Altran, Silvana C.; Isaac, Cesar [Universidade Sao Paulo (USP), Sao Paulo, SP (Brazil). Fac. de Medicina. Lab. de Microcirurgia Plastica; Esteves-Pedro, Natalia M. [Universidade Sao Paulo (USP), Sao Paulo, SP (Brazil). Fac. de Ciencias Farmaceuticas. Lab. de Controle Biologico; Herson, Marisa R. [DonorTissue Bank of Victoria (Australia)

    2011-07-01

    Human autologous epithelia cultivated in vitro, have been used successfully in treating damage to skin integrity. The methodology allowed the cultivation of these epithelia was described by Rheinwald and Green in 1975, this methodology consisted in seeding keratinocytes onto a feeder layer composed of lineage 3T3 murine fibroblasts, the proliferation rate is controlled through the action of ionizing radiation. However, currently there is a growing concern about the possibility of transmitting prions and murine viruses to transplanted patients. Taking into account this concern, in this present work, we replaced the feeder layer originally composed of murine fibroblasts by human fibroblasts. To obtain this new feeder layer was necessary to standardize the enough irradiation dose to inhibit the replication of human fibroblasts and the verification of effectiveness of the development of keratinocytes culture on a feeder layer thus obtained. According to the obtained results we can verify that the human fibroblasts irradiated at various tested doses (60, 70, 100, 200, 250 and 300 Gy) had their mitotic activity inactivated by irradiation, allowing the use of any of these doses to confection of the feeder layer, since these fibroblasts irradiated still showed viable until fourteen days of cultivation. In the test of colony formation efficiency was observed that keratinocytes seeded on irradiated human fibroblasts were able to develop satisfactorily, preserving their clonogenic potential. Therefore it was possible the replacement of murine fibroblasts by human fibroblasts in confection of the feeder layer, in order to eliminate this xenobiotic component of the keratinocytes culture. (author)

  8. Enhanced constitutive invasion activity in human nontumorigenic keratinocytes exposed to a low level of barium for a long time.

    Science.gov (United States)

    Thang, Nguyen D; Yajima, Ichiro; Ohnuma, Shoko; Ohgami, Nobutaka; Kumasaka, Mayuko Y; Ichihara, Gaku; Kato, Masashi

    2015-02-01

    We have recently demonstrated that exposure to barium for a short time (≤4 days) and at a low level (5 µM = 687 µg/L) promotes invasion of human nontumorigenic HaCaT cells, which have characteristics similar to those of normal keratinocytes, suggesting that exposure to barium for a short time enhances malignant characteristics. Here we examined the effect of exposure to low level of barium for a long time, a condition mimicking the exposure to barium through well water, on malignant characteristics of HaCaT keratinocytes. Constitutive invasion activity, focal adhesion kinase (FAK) protein expression and activity, and matrix metalloproteinase 14 (MMP14) protein expression in primary cultured normal human epidermal keratinocytes, HaCaT keratinocytes, and HSC5 and A431 human squamous cell carcinoma cells were augmented following an increase in malignancy grade of the cells. Constitutive invasion activity, FAK phosphorylation, and MMP14 expression levels of HaCaT keratinocytes after treatment with 5 µM barium for 4 months were significantly higher than those of control untreated HaCaT keratinocytes. Taken together, our results suggest that exposure to a low level of barium for a long time enhances constitutive malignant characteristics of HaCaT keratinocytes via regulatory molecules (FAK and MMP14) for invasion. © 2013 Wiley Periodicals, Inc.

  9. Vanillin protects human keratinocyte stem cells against ultraviolet B irradiation.

    Science.gov (United States)

    Lee, Jienny; Cho, Jae Youl; Lee, Sang Yeol; Lee, Kyung-Woo; Lee, Jongsung; Song, Jae-Young

    2014-01-01

    Ultraviolet-B (UVB) irradiation is one of major factors which induce cellular damages in the epidermis. We investigated protective effects and mechanisms of vanillin, a main constituent of vanilla beans, against UVB-induced cellular damages in keratinocyte stem cells (KSC). Here, vanillin significantly attenuated UVB irradiation-induced cytotoxicity. The vanillin effects were also demonstrated by the results of the senescence-associated β-galactosidase and alkaline comet assays. In addition, vanillin induced production of pro-inflammatory cytokines. Attempts to elucidate a possible mechanism underlying the vanillin-mediated effects revealed that vanillin significantly reduced UVB-induced phosphorylation of ataxia telangiectasia mutated (ATM), serine threonine kinase checkpoint kinase 2 (Chk2), tumor suppressor protein 53 (p53), p38/mitogen-activated protein kinase (p38), c-Jun N-terminal kinase/stress-activated protein kinase (JNK), S6 ribosomal protein (S6RP), and histone 2A family member X (H2A.X). UVB-induced activation of p53 luciferase reporter was also significantly inhibited by vanillin. In addition, while ATM inhibitor had no effect on the vanillin effects, mouse double minute 2 homolog (MDM2) inhibitor significantly attenuated suppressive effects of vanillin on UVB-induced activation of p53 reporter in KSC. Taken together, these findings suggest that vanillin protects KSC from UVB irradiation and its effects may occur through the suppression of downstream step of MDM2 in UVB irradiation-induced p53 activation. Copyright © 2013 Elsevier Ltd. All rights reserved.

  10. Trichloroethylene-mediated cytotoxicity in human epidermal keratinocytes is mediated by the rapid accumulation of intracellular calcium: Interception by naringenin.

    Science.gov (United States)

    Ali, F; Khan, A Q; Khan, R; Sultana, S

    2016-02-01

    Industrial solvents pose a significant threat to the humankind. The mechanisms of their toxicity still remain in debate. Trichloroethylene (TCE) is a widespread industrial solvent responsible for severe liver dysfunction, cutaneous toxicity in occupationally exposed humans. We utilized an in vitro system of human epidermal keratinocyte (HaCaT) cells in this study to avoid complex cell and extracellular interactions. We report the cytotoxicity of organic solvent TCE in HaCaT and its reversal by a natural flavanone, naringenin (Nar). The cytotoxicity was attributed to the rapid intracellular free calcium (Ca(2+)) release, which might lead to the elevation of protein kinase C along with robust free radical generation, instability due to energy depletion, and sensitization of intracellular stress signal transducer nuclear factor κB. These effects were actually seen to induce significant amount of genomic DNA fragmentation. Furthermore, all these effects of TCE were effectively reversed by the treatment of Nar, a natural flavanone. Our studies identify intracellular Ca as a unique target used by organic solvents in the cytotoxicity and highlight the Ca(2+) ion stabilizer properties of Nar. © The Author(s) 2015.

  11. Effect of 1,24R-dihydroxyvitamin D3 on the growth of human keratinocytes.

    LENUS (Irish Health Repository)

    Matsumoto, K

    1990-02-01

    The effect of 1,24R-dihydroxyvitamin D3 (1,24R(OH)2D3), a synthetic analogue of a biologically active form of vitamin D3 (1,25-dihydroxyvitamin D3, 1,25(OH)2D3), on the growth of human keratinocytes cultured in serum-free medium was investigated. The growth of cultured normal human keratinocytes was inhibited by 65% by 10(-8)M 1,24R(OH)2D3 and by 90% by 10(-7)M 1,24(OH)2D3. It inhibited cell growth almost completely at 10(-6)M. The DNA synthesis of keratinocytes was also inhibited with 1,24R(OH)2D3 by 27% at 10(-8)M, 59% at 10(-7)M, and 92% at 10(-6)M. The inhibition of cell growth and DNA synthesis were more remarkable by 1,24R(OH)2D3 than by 1,25(OH)2D3. 1,24R(OH)2D3 also inhibited the growth of keratinocytes derived from patients with psoriasis vulgaris; the growth inhibitory effect was again more remarkable with 1,24R(OH)2D3 than with 1,25(OH)2D3. The viability and protein synthesis of keratinocytes were not affected by 1,24R(OH)2D3, suggesting that the growth inhibitory effect is due to its biological activity, not to cytotoxicity. The binding of [3H]-labeled 1,25(OH)2D3 to its receptor in the cytosolic fraction of cultured keratinocytes was competitively substituted by unlabeled 1,24R(OH)2D3 as well as 1,25(OH)2D3, suggesting that 1,24R(OH)2D3 binds to the 1,25(OH)2D3 receptor. It was found that the affinity of 1,24R(OH)2D3 for the receptor was slightly higher than that of 1,25(OH)2D3. These results demonstrate that 1,24R(OH)2D3 functions as a potent growth inhibitor in vitro in human keratinocytes from both normal and psoriatic epidermis, and it possesses a higher affinity for the 1,25(OH)2D3 receptor in cultured human keratinocytes. The difference in affinity of 1,24R(OH)2D3 for the 1,25(OH)2D3 receptor correlates with its greater inhibition of keratinocyte growth than 1,25(OH)2D3. 1,24R(OH)2D3 may be useful in the treatment of psoriasis.

  12. Heavy metal-induced cytotoxicity to cultured human epidermal keratinocytes and effects of antioxidants.

    Science.gov (United States)

    Kappus, H; Reinhold, C

    1994-04-01

    Human epidermal keratinocytes which have been cultured were treated with the heavy metal ions of cadmium, mercury, copper and zinc. Cytotoxicity was measured either by protein estimation or by using the neutral red assay. Antioxidants were added in order to find out whether heavy metal-induced cytotoxicity is related to oxidative stress. All metals used showed considerable cytotoxic effects within 24 h in moderate concentrations. None of the antioxidants vitamin E (alpha-tocopherol), pyrogallol, propyl gallate, BHT or ebselen showed any protective or preventive effect. This indicates that oxidative stress may not be involved in the cytotoxicity induced by heavy metals in human epidermal keratinocytes. The cells used are, however, a valuable tool to study mechanisms of cytotoxicity.

  13. Interleukin 1 gene expression in cultured human keratinocytes is augmented by ultraviolet irradiation

    International Nuclear Information System (INIS)

    Kupper, T.S.; Chua, A.O.; Flood, P.; McGuire, J.; Gubler, U.

    1987-01-01

    Interleukin 1 (IL-1) is a family of polypeptides initially found to be produced by activated monocytes and macrophages that mediate a wide variety of cellular responses to injury and infection. Epidermal epithelial cells (keratinocytes) produce ''epidermal cell-derived thymocyte activating factor'' or ETAF, which has been recently shown to be identical to IL-1. Human epidermis is normally exposed to significant amounts of solar ultraviolet radiation. Certain ultraviolet wavelengths (UVB, 290-320 nm) are thought to be responsible for most of the immediate and long-term pathological consequences of excessive exposure to sunlight. In this study, we asked whether exposure to UVB irradiation induced IL-1 gene expression in cultured human keratinocytes. Cultured human keratinocytes contain detectable amounts of IL-1 alpha and beta mRNA and protein in the absence of apparent stimulation; these levels could be significantly enhanced 6 h after exposure to 10 ng/ml of 12-O-tetradecanoyl-phorbol-13-acetate (TPA). Exposure to UVB irradiation with an emission spectrum comparable to that of sunlight (as opposed to that of an unfiltered artificial UV light source) significantly increased the steady state levels IL-1 alpha and beta mRNA in identical populations of human keratinocytes. This was reflected in the production of increased IL-1 activity by these cultures in vitro. In the same cell population, exposures to UVB irradiation did not alter the level of actin mRNA; therefore, the effect of UV irradiation on IL-1 represents a specific enhancement of IL-1 gene expression. Local increases of IL-1 may mediate the inflammation and vasodilation characteristic of acute UVB-injured skin, and systemic release of this epidermal IL-1 may account for fever, leukocytosis, and the acute phase response seen after excessive sun exposure

  14. The comparison of two methods to obtain human oral keratinocytes in primary culture

    International Nuclear Information System (INIS)

    Klingbeil, Maria Fatima Guarizo

    2006-01-01

    The therapeutic procedures frequently used in oral treatments for the pathological diseases are surgical, resulting in failures of the mucosal continuity.The possibility to obtain transplantable oral epithelia from an in vitro cell culture opens new utilization perspectives not only to where it comes from, but also as a reconstructive material for other parts of the human body, such as: urethra, epithelia corneo-limbal, cornea, ocular surface. Many researchers still use controversial methods for obtaining cells. It was therefore evaluated and compared the efficiency in both methods: enzymatic and direct explant to obtain oral keratinocytes from human oral mucosa. Fragments of intra oral epithelial tissues from healthy human subjects, undergoing dental surgeries, were donated to the research project. The keratinocytes were cultivated over a feeder-layer from a previously irradiated 3T3 Swiss albino fibroblasts. In this study it was compared the time needed in the cell obtention, the best cell amount between both methods, the life-span, the cell capacity to form an in vitro epithelia and its morphologic structure. The results in the assessment of both methods have shown the possibility to obtain keratinocytes from a small oral fragment, but at the same time we may verify the advantages and peculiar restrictions for each one of both analyzed methods. (author)

  15. Anti-Inflammatory Effect of Melittin on Porphyromonas Gingivalis LPS-Stimulated Human Keratinocytes.

    Science.gov (United States)

    Kim, Woon-Hae; An, Hyun-Jin; Kim, Jung-Yeon; Gwon, Mi-Gyeong; Gu, Hyemin; Jeon, Minji; Kim, Min-Kyung; Han, Sang-Mi; Park, Kwan-Kyu

    2018-02-05

    Periodontitis is a chronic inflammatory disease that contributes to the destruction of the gingiva. Porphyromonas gingivalis ( P. gingivalis ) can cause periodontitis via its pathogenic lipopolysaccharides (LPS). Melittin, a major component of bee venom, is known to have anti-inflammatory and antibacterial effects. However, the role of melittin in the inflammatory response has not been elucidated in periodontitis-like human keratinocytes. Therefore, we investigated the anti-inflammatory effects of melittin on a P. gingivalis LPS (PgLPS)-treated HaCaT human keratinocyte cell line. The cytotoxicity of melittin was measured using a human keratinocyte cell line, HaCaT, and a Cell Counting Kit-8. The effect of melittin on PgLPS-induced inflammation was determined with Western blot, real-time quantitative PCT, and immunofluorescence. PgLPS increased the expression of toll-like receptor (TLR) 4 and proinflammatory cytokines, such as tumor necrosis factor-α (TNF-α), interleukin (IL)-6, IL-8, and interferon-γ (IFN-γ). Moreover, PgLPS induced activation of the nuclear factor kappa-light-chain-enhancer of activated B cells (NF-κB), extracellular signal-regulated kinase (ERK), and protein kinase B/Akt. Melittin also inhibited the expression of proinflammatory cytokines by suppressing the activation of the NF-κB signaling pathway, ERK, and Akt. Melittin attenuates the PgLPS-induced inflammatory response and could therefore be applied in the treatment of periodontitis for anti-inflammatory effects.

  16. A Sensitive Sensor Cell Line for the Detection of Oxidative Stress Responses in Cultured Human Keratinocytes

    Directory of Open Access Journals (Sweden)

    Ute Hofmann

    2014-06-01

    Full Text Available In the progress of allergic and irritant contact dermatitis, chemicals that cause the generation of reactive oxygen species trigger a heat shock response in keratinocytes. In this study, an optical sensor cell line based on cultured human keratinocytes (HaCaT cells expressing green fluorescent protein (GFP under the control of the stress-inducible HSP70B’ promoter were constructed. Exposure of HaCaT sensor cells to 25 µM cadmium, a model substance for oxidative stress induction, provoked a 1.7-fold increase in total glutathione and a ~300-fold induction of transcript level of the gene coding for heat shock protein HSP70B’. An extract of Arnica montana flowers resulted in a strong induction of the HSP70B’ gene and a pronounced decrease of total glutathione in keratinocytes. The HSP70B’ promoter-based sensor cells conveniently detected cadmium-induced stress using GFP fluorescence as read-out with a limit of detection of 6 µM cadmium. In addition the sensor cells responded to exposure of cells to A. montana extract with induction of GFP fluorescence. Thus, the HaCaT sensor cells provide a means for the automated detection of the compromised redox status of keratinocytes as an early indicator of the development of human skin disorders and could be applied for the prediction of skin irritation in more complex in vitro 3D human skin models and in the development of micro-total analysis systems (µTAS that may be utilized in dermatology, toxicology, pharmacology and drug screenings.

  17. Ultraviolet radiation induces changes in membrane metabolism of human keratinocytes in culture

    International Nuclear Information System (INIS)

    De Leo, V.A.; Horlick, H.; Hanson, D.; Eisinger, M.; Harber, L.C.

    1984-01-01

    Human keratinocytes in culture were prelabeled with [ 3 H]arachidonic acid (AA) and then exposed to ultraviolet B radiation. Irradiated cells released labeled AA metabolites into media in a dose-dependent manner when compared to sham-irradiated cells. The response began immediately and continued for 24 h. Extracts from media were examined by high-performance liquid chromatography for identification of specific AA metabolites. Irradiated cells were stimulated to produce prostaglandin-like material (PGE2 and PGF2 alpha). These findings support the concept that the cell membrane of keratinocytes participates directly or indirectly in initiating the sunburn response. It is also felt that the metabolites formed following injury to the membrane are an integral component in the mediation of that response

  18. Leptin regulates the pro-inflammatory response in human epidermal keratinocytes.

    Science.gov (United States)

    Lee, Moonyoung; Lee, Eunyoung; Jin, Sun Hee; Ahn, Sungjin; Kim, Sae On; Kim, Jungmin; Choi, Dalwoong; Lim, Kyung-Min; Lee, Seung-Taek; Noh, Minsoo

    2018-05-01

    The role of leptin in cutaneous wound healing process has been suggested in genetically obese mouse studies. However, the molecular and cellular effects of leptin on human epidermal keratinocytes are still unclear. In this study, the whole-genome-scale microarray analysis was performed to elucidate the effect of leptin on epidermal keratinocyte functions. In the leptin-treated normal human keratinocytes (NHKs), we identified the 151 upregulated and 53 downregulated differentially expressed genes (DEGs). The gene ontology (GO) enrichment analysis with the leptin-induced DEGs suggests that leptin regulates NHKs to promote pro-inflammatory responses, extracellular matrix organization, and angiogenesis. Among the DEGs, the protein expression of IL-8, MMP-1, fibronectin, and S100A7, which play roles in which is important in the regulation of cutaneous inflammation, was confirmed in the leptin-treated NHKs. The upregulation of the leptin-induced proteins is mainly regulated by the STAT3 signaling pathway in NHKs. Among the downregulated DEGs, the protein expression of nucleosome assembly-associated centromere protein A (CENPA) and CENPM was confirmed in the leptin-treated NHKs. However, the expression of CENPA and CENPM was not coupled with those of other chromosome passenger complex like Aurora A kinase, INCENP, and survivin. In cell growth kinetics analysis, leptin had no significant effect on the cell growth curves of NHKs in the normal growth factor-enriched condition. Therefore, leptin-dependent downregulation of CENPA and CENPM in NHKs may not be directly associated with mitotic regulation during inflammation.

  19. The Herbal Bitter Drug Gentiana lutea Modulates Lipid Synthesis in Human Keratinocytes In Vitro and In Vivo.

    Science.gov (United States)

    Wölfle, Ute; Haarhaus, Birgit; Seiwerth, Jasmin; Cawelius, Anja; Schwabe, Kay; Quirin, Karl-Werner; Schempp, Christoph M

    2017-08-22

    Gentiana lutea is a herbal bitter drug that is used to enhance gastrointestinal motility and secretion. Recently we have shown that amarogentin, a characteristic bitter compound of Gentiana lutea extract (GE), binds to the bitter taste receptors TAS2R1 and TAS2R38 in human keratinocytes, and stimulates the synthesis of epidermal barrier proteins. Here, we wondered if GE also modulates lipid synthesis in human keratinocytes. To address this issue, human primary keratinocytes were incubated for 6 days with GE. Nile Red labeling revealed that GE significantly increased lipid synthesis in keratinocytes. Similarly, gas chromatography with flame ionization detector indicated that GE increases the amount of triglycerides in keratinocytes. GE induced the expression of epidermal ceramide synthase 3, but not sphingomyelinase. Lipid synthesis, as well as ceramide synthase 3 expression, could be specifically blocked by inhibitors of the p38 MAPK and PPARγ signaling pathway. To assess if GE also modulates lipid synthesis in vivo, we performed a proof of concept half side comparison on the volar forearms of 33 volunteers. In comparison to placebo, GE significantly increased the lipid content of the treated skin areas, as measured with a sebumeter. Thus, GE enhances lipid synthesis in human keratinocytes that is essential for building an intact epidermal barrier. Therefore, GE might be used to improve skin disorders with an impaired epidermal barrier, e.g., very dry skin and atopic eczema.

  20. In vitro human keratinocyte migration rates are associated with SNPs in the KRT1 interval.

    Directory of Open Access Journals (Sweden)

    Heng Tao

    Full Text Available Efforts to develop effective therapeutic treatments for promoting fast wound healing after injury to the epidermis are hindered by a lack of understanding of the factors involved. Re-epithelialization is an essential step of wound healing involving the migration of epidermal keratinocytes over the wound site. Here, we examine genetic variants in the keratin-1 (KRT1 locus for association with migration rates of human epidermal keratinocytes (HEK isolated from different individuals. Although the role of intermediate filament genes, including KRT1, in wound activated keratinocytes is well established, this is the first study to examine if genetic variants in humans contribute to differences in the migration rates of these cells. Using an in vitro scratch wound assay we observe quantifiable variation in HEK migration rates in two independent sets of samples; 24 samples in the first set and 17 samples in the second set. We analyze genetic variants in the KRT1 interval and identify SNPs significantly associated with HEK migration rates in both samples sets. Additionally, we show in the first set of samples that the average migration rate of HEK cells homozygous for one common haplotype pattern in the KRT1 interval is significantly faster than that of HEK cells homozygous for a second common haplotype pattern. Our study demonstrates that genetic variants in the KRT1 interval contribute to quantifiable differences in the migration rates of keratinocytes isolated from different individuals. Furthermore we show that in vitro cell assays can successfully be used to deconstruct complex traits into simple biological model systems for genetic association studies.

  1. SORBS2 and TLR3 induce premature senescence in primary human fibroblasts and keratinocytes

    International Nuclear Information System (INIS)

    Liesenfeld, Melanie; Mosig, Sandy; Funke, Harald; Jansen, Lars; Runnebaum, Ingo B; Dürst, Matthias; Backsch, Claudia

    2013-01-01

    Genetic aberrations are required for the progression of HPV-induced cervical precancers. A prerequisite for clonal expansion of cancer cells is unlimited proliferative capacity. In a cell culture model for cervical carcinogenesis loss of genes located on chromosome 4q35→qter and chromosome 10p14-p15 were found to be associated with escape from senescence. Moreover, by LOH and I-FISH analyses a higher frequency of allele loss of these regions was also observed in cervical carcinomas as compared to CIN3. The aim of this study was to identify candidate senescence-related genes located on chromosome 4q35→qter and chromosome 10p14-p15 which may contribute to clonal expansion at the transition of CIN3 to cancer. Microarray expression analyses were used to identify candidate genes down-regulated in cervical carcinomas as compared to CIN3. In order to relate these genes with the process of senescence their respective cDNAs were overexpressed in HPV16-immortalized keratinocytes as well as in primary human fibroblasts and keratinocytes using lentivirus mediated gene transduction. Overall fifteen genes located on chromosome 4q35→qter and chromosome 10p14-p15 were identified. Ten of these genes could be validated in biopsies by RT-PCR. Of interest is the novel finding that SORBS2 and TLR3 can induce senescence in primary human fibroblasts and keratinocytes but not in HPV-immortalized cell lines. Intriguingly, the endogenous expression of both genes increases during finite passaging of primary keratinocytes in vitro. The relevance of the genes SORBS2 and TLR3 in the process of cellular senescence warrants further investigation. In ongoing experiments we are investigating whether this increase in gene expression is also characteristic of replicative senescence

  2. PCB153 reduces telomerase activity and telomere length in immortalized human skin keratinocytes (HaCaT) but not in human foreskin keratinocytes (NFK)

    International Nuclear Information System (INIS)

    Senthilkumar, P.K.; Robertson, L.W.; Ludewig, G.

    2012-01-01

    Polychlorinated biphenyls (PCBs), ubiquitous environmental pollutants, are characterized by long term-persistence in the environment, bioaccumulation, and biomagnification in the food chain. Exposure to PCBs may cause various diseases, affecting many cellular processes. Deregulation of the telomerase and the telomere complex leads to several biological disorders. We investigated the hypothesis that PCB153 modulates telomerase activity, telomeres and reactive oxygen species resulting in the deregulation of cell growth. Exponentially growing immortal human skin keratinocytes (HaCaT) and normal human foreskin keratinocytes (NFK) were incubated with PCB153 for 48 and 24 days, respectively, and telomerase activity, telomere length, superoxide level, cell growth, and cell cycle distribution were determined. In HaCaT cells exposure to PCB153 significantly reduced telomerase activity, telomere length, cell growth and increased intracellular superoxide levels from day 6 to day 48, suggesting that superoxide may be one of the factors regulating telomerase activity, telomere length and cell growth compared to untreated control cells. Results with NFK cells showed no shortening of telomere length but reduced cell growth and increased superoxide levels in PCB153-treated cells compared to untreated controls. As expected, basal levels of telomerase activity were almost undetectable, which made a quantitative comparison of treated and control groups impossible. The significant down regulation of telomerase activity and reduction of telomere length by PCB153 in HaCaT cells suggest that any cell type with significant telomerase activity, like stem cells, may be at risk of premature telomere shortening with potential adverse health effects for the affected organism. -- Highlights: ► Human immortal (HaCaT) and primary (NFK) keratinocytes were exposed to PCB153. ► PCB153 significantly reduced telomerase activity and telomere length in HaCaT. ► No effect on telomere length and

  3. Effects of 25-hydroxyvitamin D3 on cathelicidin production and antibacterial function of human oral keratinocytes.

    Science.gov (United States)

    Wang, Qi; Zhang, Wu; Li, Hao; Aprecio, Raydolf; Wu, Wan; Lin, Yiqiao; Li, Yiming

    2013-01-01

    Vitamin D and its metabolites have been recognized as key determinants in innate immune modulation. In this study, we investigated the regulation of antibacterial functions of oral keratinocyte cells by 25-hydroxyvitamin D3 (25VD3). OKF6/TERT2 cells, an immortalized human oral keratinocyte cell line, were transfected with or without 24-hydroxylase small interfering RNA (siRNA) and incubated with different amounts of 25VD3. These epithelial cells expressed high levels of inactivating 24-hydroxylase (CYP24A1) and relatively low levels of activating 1α-hydroxylase (CYP27B1) in the presence of 25VD3. 25VD3 influenced the expression of vitamin D-driven genes and cathelicidin in a dose-related manner. SiRNA specific to 24-hydroxylase augmented the cathelicidin production and subseqently influenced the antibacterial activity on multispecies of oral pathogens. These observations suggest that 25VD3 is capable of stimulating cathelicidin production and modulating antibacterial function upon CYP24A1 knochdown in oral epithelial cells, and indicate novel mechanisms that 25VD3 may enhance antibacterial ability in oral keratinocytes. Copyright © 2013 Elsevier Inc. All rights reserved.

  4. Pseudomonas-derived ceramidase induces production of inflammatory mediators from human keratinocytes via sphingosine-1-phosphate.

    Directory of Open Access Journals (Sweden)

    Ami Oizumi

    Full Text Available Ceramide is important for water retention and permeability barrier functions in the stratum corneum, and plays a key role in the pathogenesis of atopic dermatitis (AD. A Pseudomonas aeruginosa-derived neutral ceramidase (PaCDase isolated from a patient with AD was shown to effectively degrade ceramide in the presence of Staphylococcus aureus-derived lipids or neutral detergents. However, the effect of ceramide metabolites on the functions of differentiating keratinocytes is poorly understood. We found that the ceramide metabolite sphingosine-1-phosphate (S1P stimulated the production of inflammatory mediators such as TNF-α and IL-8 from three-dimensionally cultured human primary keratinocytes (termed "3D keratinocytes", which form a stratum corneum. PaCDase alone did not affect TNF-α gene expression in 3D keratinocytes. In the presence of the detergent Triton X-100, which damages stratum corneum structure, PaCDase, but not heat-inactivated PaCDase or PaCDase-inactive mutant, induced the production of TNF-α, endothelin-1, and IL-8, indicating that this production was dependent on ceramidase activity. Among various ceramide metabolites, sphingosine and S1P enhanced the gene expression of TNF-α, endothelin-1, and IL-8. The PaCDase-enhanced expression of these genes was inhibited by a sphingosine kinase inhibitor and by an S1P receptor antagonist VPC 23019. The TNF-α-binding antibody infliximab suppressed the PaCDase-induced upregulation of IL-8, but not TNF-α, mRNA. PaCDase induced NF-κB p65 phosphorylation. The NF-κB inhibitor curcumin significantly inhibited PaCDase-induced expression of IL-8 and endothelin-1. VPC 23019 and infliximab inhibited PaCDase-induced NF-κB p65 phosphorylation and reduction in the protein level of the NF-κB inhibitor IκBα. Collectively, these findings suggest that (i 3D keratinocytes produce S1P from sphingosine, which is produced through the hydrolysis of ceramide by PaCDase, (ii S1P induces the production

  5. Rat embryonic fibroblasts improve reprogramming of human keratinocytes into induced pluripotent stem cells.

    Science.gov (United States)

    Linta, Leonhard; Stockmann, Marianne; Kleinhans, Karin N; Böckers, Anja; Storch, Alexander; Zaehres, Holm; Lin, Qiong; Barbi, Gotthold; Böckers, Tobias M; Kleger, Alexander; Liebau, Stefan

    2012-04-10

    Patient-specific human induced pluripotent stem (hiPS) cells not only provide a promising tool for cellular disease models in general, but also open up the opportunity to establish cell-type-specific systems for personalized medicine. One of the crucial prerequisites for these strategies, however, is a fast and efficient reprogramming strategy from easy accessible somatic cell populations. Keratinocytes from plucked human hair had been introduced as a superior cell source for reprogramming purposes compared with the widely used skin fibroblasts. The starting cell population is, however, limited and thereby further optimization in terms of time, efficiency, and quality is inevitable. Here we show that rat embryonic fibroblasts (REFs) should replace mouse embryonic fibroblasts as feeder cells in the reprogramming process. REFs enable a significantly more efficient reprogramming procedure as shown by colony number and total amount of SSEA4-positive cells. We successfully produced keratinocyte-derived hiPS (k-hiPS) cells from various donors. The arising k-hiPS cells display the hallmarks of pluripotency such as expression of stem cell markers and differentiation into all 3 germ layers. The increased reprogramming efficiency using REFs as a feeder layer occurred independent of the proliferation rate in the parental keratinocytes and acts, at least in part, in a non-cell autonomous way by secreting factors known to facilitate pluripotency such as Tgfb1, Inhba and Grem1. Hence, we provide an easy to use and highly efficient reprogramming system that could be very useful for a broad application to generate human iPS cells. © Mary Ann Liebert, Inc.

  6. UVA and UVB irradiation differentially regulate microRNA expression in human primary keratinocytes.

    Directory of Open Access Journals (Sweden)

    Anne Kraemer

    Full Text Available MicroRNA (miRNA-mediated regulation of the cellular transcriptome is an important epigenetic mechanism for fine-tuning regulatory pathways. These include processes related to skin cancer development, progression and metastasis. However, little is known about the role of microRNA as an intermediary in the carcinogenic processes following exposure to UV-radiation. We now show that UV irradiation of human primary keratinocytes modulates the expression of several cellular miRNAs. A common set of miRNAs was influenced by exposure to both UVA and UVB. However, each wavelength band also activated a distinct subset of miRNAs. Common sets of UVA- and UVB-regulated miRNAs harbor the regulatory elements GLYCA-nTRE, GATA-1-undefined-site-13 or Hox-2.3-undefined-site-2 in their promoters. In silico analysis indicates that the differentially expressed miRNAs responding to UV have potential functions in the cellular pathways of cell growth and proliferation. Interestingly, the expression of miR-23b, which is a differentiation marker of human keratinocytes, is remarkably up-regulated after UVA irradiation. Studying the interaction between miR-23b and its putative skin-relevant targets using a Luciferase reporter assay revealed that RRAS2 (related RAS viral oncogene homolog 2, which is strongly expressed in highly aggressive malignant skin cancer, to be a direct target of miR-23b. This study demonstrates for the first time a differential miRNA response to UVA and UVB in human primary keratinocytes. This suggests that selective regulation of signaling pathways occurs in response to different UV energies. This may shed new light on miRNA-regulated carcinogenic processes involved in UV-induced skin carcinogenesis.

  7. UVA and UVB Irradiation Differentially Regulate microRNA Expression in Human Primary Keratinocytes

    Science.gov (United States)

    Kraemer, Anne; Chen, I-Peng; Henning, Stefan; Faust, Alexandra; Volkmer, Beate; Atkinson, Michael J.; Moertl, Simone; Greinert, Ruediger

    2013-01-01

    MicroRNA (miRNA)-mediated regulation of the cellular transcriptome is an important epigenetic mechanism for fine-tuning regulatory pathways. These include processes related to skin cancer development, progression and metastasis. However, little is known about the role of microRNA as an intermediary in the carcinogenic processes following exposure to UV-radiation. We now show that UV irradiation of human primary keratinocytes modulates the expression of several cellular miRNAs. A common set of miRNAs was influenced by exposure to both UVA and UVB. However, each wavelength band also activated a distinct subset of miRNAs. Common sets of UVA- and UVB-regulated miRNAs harbor the regulatory elements GLYCA-nTRE, GATA-1-undefined-site-13 or Hox-2.3-undefined-site-2 in their promoters. In silico analysis indicates that the differentially expressed miRNAs responding to UV have potential functions in the cellular pathways of cell growth and proliferation. Interestingly, the expression of miR-23b, which is a differentiation marker of human keratinocytes, is remarkably up-regulated after UVA irradiation. Studying the interaction between miR-23b and its putative skin-relevant targets using a Luciferase reporter assay revealed that RRAS2 (related RAS viral oncogene homolog 2), which is strongly expressed in highly aggressive malignant skin cancer, to be a direct target of miR-23b. This study demonstrates for the first time a differential miRNA response to UVA and UVB in human primary keratinocytes. This suggests that selective regulation of signaling pathways occurs in response to different UV energies. This may shed new light on miRNA-regulated carcinogenic processes involved in UV-induced skin carcinogenesis. PMID:24391759

  8. Efficient generation of integration-free human induced pluripotent stem cells from keratinocytes by simple transfection of episomal vectors.

    Science.gov (United States)

    Piao, Yulan; Hung, Sandy Shen-Chi; Lim, Shiang Y; Wong, Raymond Ching-Bong; Ko, Minoru S H

    2014-07-01

    Keratinocytes represent an easily accessible cell source for derivation of human induced pluripotent stem (hiPS) cells, reportedly achieving higher reprogramming efficiency than fibroblasts. However, most studies utilized a retroviral or lentiviral method for reprogramming of keratinocytes, which introduces undesirable transgene integrations into the host genome. Moreover, current protocols of generating integration-free hiPS cells from keratinocytes are mostly inefficient. In this paper, we describe a more efficient, simple-to-use, and cost-effective method for generating integration-free hiPS cells from keratinocytes. Our improved method using lipid-mediated transfection achieved a reprogramming efficiency of ∼0.14% on average. Keratinocyte-derived hiPS cells showed no integration of episomal vectors, expressed stem cell-specific markers and possessed potentials to differentiate into all three germ layers by in vitro embryoid body formation as well as in vivo teratoma formation. To our knowledge, this represents the most efficient method to generate integration-free hiPS cells from keratinocytes. ©AlphaMed Press.

  9. Ultraviolet Radiation Increases the Toxicity of Pyrene, 1-Aminopyrene and 1-Hydroxypyrene to Human Keratinocytes

    Directory of Open Access Journals (Sweden)

    Huey-Min Hwang

    2005-04-01

    Full Text Available Over the past several years, a great deal of interest has been focused on the harmful effects of ultraviolet (UV radiation to human skin. UV light has been implicated in aging, sunburn and skin cancer. Few studies, however, have been done to determine the effects that UV light, in conjunction with other environmental contaminants, may have on human skin. Polycyclic Aromatic Hydrocarbons (PAHs are a class of compounds that have been reported to be toxic, mutagenic and carcinogenic to many eukaryotic organisms. UV light is also known to increase the toxicity of PAHs through photo-activation and photo-modification. The purpose of this study was to assess the effects of UV-A irradiated pyrene (Pyr, 1-aminopyrene (1-AP and 1-hydroxypyrene (1-HP on human keratinocytes, the skin primary site of UV irradiated PAH exposure. Our findings indicate that simultaneous treatment of human keratinocyte cell line, HaCaT, with 1.0μg/ml pyrene, 1-AP or 1-HP and 3.9 J/cm2/min UV-A light resulted in significant inhibition of cell proliferation. Approximately 100% of the cells died in the case of UV-A irradiated 1-AP and 1-HP. In the case of UV-A irradiated pyrene, more than 70% of the cells died, indicating that UV-A is able to transform these PAHs into more harmful intermediates.

  10. Portulaca oleracea extracts protect human keratinocytes and fibroblasts from UV-induced apoptosis.

    Science.gov (United States)

    Lee, Suyeon; Kim, Ki Ho; Park, Changhoon; Lee, Jong-Suk; Kim, Young Heui

    2014-10-01

    Portulaca oleracea extracts, known as Ma Chi Hyun in the traditional Korean medicine, show a variety of biomedical efficacies including those in anti-inflammation and anti-allergy. In this study, we investigate the protective activity of the P. oleracea extracts against UVB-induced damage in human epithelial keratinocytes and fibroblasts by several apoptosis-related tests. The results suggest that P. oleracea extracts have protective effects from UVB-induced apoptosis. © 2014 John Wiley & Sons A/S. Published by John Wiley & Sons Ltd.

  11. Immortalization of human foreskin keratinocytes by various human papillomavirus DNAs corresponds to their association with cervical carcinoma

    Energy Technology Data Exchange (ETDEWEB)

    Woodworth, C.D.; Doniger, J.; DiPaolo, J.A.

    1989-01-01

    Normal human foreskin keratinocytes cotransfected with the neomycin resistance gene and recombinant human papillomavirus (HPV) DNAs (types 16, 18, 31, and 33) that have a high or moderate association with cervical malignancy acquired immortality and contained integrated and transcriptionally active viral genomes. Only transcripts from the intact E6 and E7 genes were detected in at least one cell line, suggesting that one or both of these genes are responsible for immortalization. Recombinant HPV DNAs with low or no oncogenic potential for cervical cancer (HPV1a, -5, -6b, and -11) induced small G418-resistant colonies that senesced as did the nontransfected cells. These colonies contained only episomal virus DNA; therefore, integration of HPV sequences is important for immortalization of keratinocytes. This study suggests that the virus-encoded immortalization function contributes to the pathogenesis of cervical carcinoma.

  12. Hyperthermia-induced micronucleus formation in a human keratinocyte cell line

    International Nuclear Information System (INIS)

    Hintzsche, Henning; Riese, Thorsten; Stopper, Helga

    2012-01-01

    Elevated temperature can cause biological effects in vitro and in vivo. Many studies on effects of hypo- and hyperthermia have been conducted, but only few studies systematically investigated the formation of genomic damage in the micronucleus test in human cells in vitro as a consequence of different temperatures. In the present study, HaCaT human keratinocytes were exposed to different temperatures from 37 °C to 42 °C for 24 h in a regular cell culture incubator. Micronucleus frequency as a marker of genomic damage was elevated in a temperature-dependent and statistically significant manner. Apoptosis occurred at temperatures of 39 °C or higher. Cell proliferation was unaffected up to 40 °C and decreased at 41 °C and 42 °C. Expression of the heat shock protein Hsp70 was elevated, particularly at temperatures of 40 °C and higher. These findings are in agreement with several in vivo studies and some in vitro studies looking at single, specific temperatures, but a systematically investigated temperature-dependent increase of genomic damage in human keratinocytes in vitro is demonstrated for the first time here.

  13. Interaction of urokinase A chain with the receptor of human keratinocytes stimulates release of urokinase-like plasminogen activator

    Energy Technology Data Exchange (ETDEWEB)

    Fibbi, G.; Magnelli, L.; Pucci, M.; Del Rosso, M. (Florence Univ. (Italy))

    1990-03-01

    On the basis of a fibrinolytic assay with {sup 125}I-fibrin, zymography, and immunoprobing with anti-human urokinase antibody, the authors have observed that the in vitro established NCTC human keratinocyte cell line releases into the culture medium a 54,000-Da plasminogen activator which is indistinguishable from human urokinase. Only the early release following the washing of keratinocyte monolayers is accounted for by secretion of preformed enzyme, while late secretory events require the de novo synthesis of urokinase. The released enzyme can interact by autocriny with its own receptor present on keratinocytes. The addition to the keratinocyte culture medium of the urokinase A chain can stimulate a concentration-dependent urokinase oversecretion, which is not paralleled by oversecretion of plasminogen activator inhibitor-1. Since stimulation of urokinase production can be obtained by an A chain concentration which was previously shown to be efficient in inducing keratinocyte mobilization in an in vitro migration model system, they hypothesize that this mechanism may be important in vivo during the process of wound repair.

  14. Additive Effects of Millimeter Waves and 2-Deoxyglucose Co-Exposure on the Human Keratinocyte Transcriptome.

    Science.gov (United States)

    Soubere Mahamoud, Yonis; Aite, Meziane; Martin, Catherine; Zhadobov, Maxim; Sauleau, Ronan; Le Dréan, Yves; Habauzit, Denis

    2016-01-01

    Millimeter Waves (MMW) will be used in the next-generation of high-speed wireless technologies, especially in future Ultra-Broadband small cells in 5G cellular networks. Therefore, their biocompatibilities must be evaluated prior to their massive deployment. Using a microarray-based approach, we analyzed modifications to the whole genome of a human keratinocyte model that was exposed at 60.4 GHz-MMW at an incident power density (IPD) of 20 mW/cm2 for 3 hours in athermic conditions. No keratinocyte transcriptome modifications were observed. We tested the effects of MMWs on cell metabolism by co-treating MMW-exposed cells with a glycolysis inhibitor, 2-deoxyglucose (2dG, 20 mM for 3 hours), and whole genome expression was evaluated along with the ATP content. We found that the 2dG treatment decreased the cellular ATP content and induced a high modification in the transcriptome (632 coding genes). The affected genes were associated with transcriptional repression, cellular communication and endoplasmic reticulum homeostasis. The MMW/2dG co-treatment did not alter the keratinocyte ATP content, but it did slightly alter the transcriptome, which reflected the capacity of MMW to interfere with the bioenergetic stress response. The RT-PCR-based validation confirmed 6 MMW-sensitive genes (SOCS3, SPRY2, TRIB1, FAM46A, CSRNP1 and PPP1R15A) during the 2dG treatment. These 6 genes encoded transcription factors or inhibitors of cytokine pathways, which raised questions regarding the potential impact of long-term or chronic MMW exposure on metabolically stressed cells.

  15. Additive Effects of Millimeter Waves and 2-Deoxyglucose Co-Exposure on the Human Keratinocyte Transcriptome.

    Directory of Open Access Journals (Sweden)

    Yonis Soubere Mahamoud

    Full Text Available Millimeter Waves (MMW will be used in the next-generation of high-speed wireless technologies, especially in future Ultra-Broadband small cells in 5G cellular networks. Therefore, their biocompatibilities must be evaluated prior to their massive deployment. Using a microarray-based approach, we analyzed modifications to the whole genome of a human keratinocyte model that was exposed at 60.4 GHz-MMW at an incident power density (IPD of 20 mW/cm2 for 3 hours in athermic conditions. No keratinocyte transcriptome modifications were observed. We tested the effects of MMWs on cell metabolism by co-treating MMW-exposed cells with a glycolysis inhibitor, 2-deoxyglucose (2dG, 20 mM for 3 hours, and whole genome expression was evaluated along with the ATP content. We found that the 2dG treatment decreased the cellular ATP content and induced a high modification in the transcriptome (632 coding genes. The affected genes were associated with transcriptional repression, cellular communication and endoplasmic reticulum homeostasis. The MMW/2dG co-treatment did not alter the keratinocyte ATP content, but it did slightly alter the transcriptome, which reflected the capacity of MMW to interfere with the bioenergetic stress response. The RT-PCR-based validation confirmed 6 MMW-sensitive genes (SOCS3, SPRY2, TRIB1, FAM46A, CSRNP1 and PPP1R15A during the 2dG treatment. These 6 genes encoded transcription factors or inhibitors of cytokine pathways, which raised questions regarding the potential impact of long-term or chronic MMW exposure on metabolically stressed cells.

  16. Human lactoferrin stimulates skin keratinocyte function and wound re-epithelialization.

    Science.gov (United States)

    Tang, L; Wu, J J; Ma, Q; Cui, T; Andreopoulos, F M; Gil, J; Valdes, J; Davis, S C; Li, J

    2010-07-01

    Human lactoferrin (hLF), a member of the transferrin family, is known for its antimicrobial and anti-inflammatory effects. Recent studies on various nonskin cell lines indicate that hLF may have a stimulatory effect on cell proliferation. To study the potential role of hLF in wound re-epithelialization. The effects of hLF on cell growth, migration, attachment and survival were assessed, with a rice-derived recombinant hLF (holo-rhLF), using proliferation analysis, scratch migration assay, calcein-AM/propidium iodide staining and terminal deoxynucleotidyl transferase-mediated dUTP nick-end labelling (TUNEL) method, respectively. The mechanisms of hLF on cell proliferation and migration were explored using specific pathway inhibitors. The involvement of lactoferrin receptor low-density lipoprotein receptor-related protein 1 (LRP1) was examined with RNA interference technique. An in vivo swine second-degree burn wound model was also used to assess wound re-epithelialization. Studies revealed that holo-rhLF significantly stimulated keratinocyte proliferation which could be blocked by mitogen-activated protein kinase (MAPK) kinase 1 inhibitor. Holo-rhLF also showed strong promoting effects on keratinocyte migration, which could be blocked by either inhibition of the MAPK, Src and Rho/ROCK pathways, or downregulation of the LRP1 receptor. With cells under starving or 12-O-tetradecanoylphorbol-13-acetate exposure, the addition of holo-rhLF was found greatly to increase cell viability and inhibit cell apoptosis. Additionally, holo-rhLF significantly increased the rate of wound re-epithelialization in swine second-degree burn wounds. Our studies demonstrate the direct effects of holo-rhLF on wound re-epithelialization including the enhancement of keratinocyte proliferation and migration as well as the protection of cells from apoptosis. The data strongly indicate its potential therapeutic applications in wound healing.

  17. Long-wave ultraviolet light induces phospholipase activation in cultured human epidermal keratinocytes

    International Nuclear Information System (INIS)

    Hanson, D.; DeLeo, V.

    1990-01-01

    Long wave ultraviolet radiation (UVA) has been shown to play an important role in the overall response of skin to solar radiation, including sunburn, tanning, premature aging, and non-melanoma skin cancer. UVA induction of inflammation in human skin is thought to be mediated by membrane lipid derived products. In order to investigate the mechanism of this response we examined the effect of UVA on phospholipid metabolism of human epidermal keratinocytes in culture. Keratinocytes were grown in serum free low calcium medium. The cells were prelabeled with [3H] arachidonic acid or [3H] choline and irradiated with UVA (Honle 2002-Hg vapor lamp). Identification and quantitation of specific membrane phospholipid-derived components was achieved using high-performance liquid chromatography, paper chromatography, and radioimmunoassay. UVA resulted in a linear dose dependent release of [3H] arachidonic acid into medium between 1 and 20 joule/cm2. This response was inhibited in an oxygen-reduced environment. The radiolabel released was predominantly free arachidonate and cyclooxygenase metabolites. Cyclooxygenase metabolites prostaglandin E2 and prostacyclin derivative, 6-keto-prostaglandin F1a, were stimulated following UVA irradiation, but the lipoxygenase metabolite, leukotriene B was not detected. Maximal release was measured immediately after irradiation and changed little over 24 h post-irradiation. UVA stimulated an increase of [3H] choline metabolites glycerophosphorylcholine and phosphorylcholine in media extracts suggesting UVA activation of phospholipase C and phospholipase A2 or diacylglyceride lipase

  18. Transcription factors and stress response gene alterations in human keratinocytes following Solar Simulated Ultra Violet Radiation.

    Science.gov (United States)

    Marais, Thomas L Des; Kluz, Thomas; Xu, Dazhong; Zhang, Xiaoru; Gesumaria, Lisa; Matsui, Mary S; Costa, Max; Sun, Hong

    2017-10-19

    Ultraviolet radiation (UVR) from sunlight is the major effector for skin aging and carcinogenesis. However, genes and pathways altered by solar-simulated UVR (ssUVR), a mixture of UVA and UVB, are not well characterized. Here we report global changes in gene expression as well as associated pathways and upstream transcription factors in human keratinocytes exposed to ssUVR. Human HaCaT keratinocytes were exposed to either a single dose or 5 repetitive doses of ssUVR. Comprehensive analyses of gene expression profiles as well as functional annotation were performed at 24 hours post irradiation. Our results revealed that ssUVR modulated genes with diverse cellular functions changed in a dose-dependent manner. Gene expression in cells exposed to a single dose of ssUVR differed significantly from those that underwent repetitive exposures. While single ssUVR caused a significant inhibition in genes involved in cell cycle progression, especially G2/M checkpoint and mitotic regulation, repetitive ssUVR led to extensive changes in genes related to cell signaling and metabolism. We have also identified a panel of ssUVR target genes that exhibited persistent changes in gene expression even at 1 week after irradiation. These results revealed a complex network of transcriptional regulators and pathways that orchestrate the cellular response to ssUVR.

  19. Upregulation of FOXM1 induces genomic instability in human epidermal keratinocytes

    Directory of Open Access Journals (Sweden)

    Philpott Michael P

    2010-02-01

    Full Text Available Abstract Background The human cell cycle transcription factor FOXM1 is known to play a key role in regulating timely mitotic progression and accurate chromosomal segregation during cell division. Deregulation of FOXM1 has been linked to a majority of human cancers. We previously showed that FOXM1 was upregulated in basal cell carcinoma and recently reported that upregulation of FOXM1 precedes malignancy in a number of solid human cancer types including oral, oesophagus, lung, breast, kidney, bladder and uterus. This indicates that upregulation of FOXM1 may be an early molecular signal required for aberrant cell cycle and cancer initiation. Results The present study investigated the putative early mechanism of UVB and FOXM1 in skin cancer initiation. We have demonstrated that UVB dose-dependently increased FOXM1 protein levels through protein stabilisation and accumulation rather than de novo mRNA expression in human epidermal keratinocytes. FOXM1 upregulation in primary human keratinocytes triggered pro-apoptotic/DNA-damage checkpoint response genes such as p21, p38 MAPK, p53 and PARP, however, without causing significant cell cycle arrest or cell death. Using a high-resolution Affymetrix genome-wide single nucleotide polymorphism (SNP mapping technique, we provided the evidence that FOXM1 upregulation in epidermal keratinocytes is sufficient to induce genomic instability, in the form of loss of heterozygosity (LOH and copy number variations (CNV. FOXM1-induced genomic instability was significantly enhanced and accumulated with increasing cell passage and this instability was increased even further upon exposure to UVB resulting in whole chromosomal gain (7p21.3-7q36.3 and segmental LOH (6q25.1-6q25.3. Conclusion We hypothesise that prolonged and repeated UVB exposure selects for skin cells bearing stable FOXM1 protein causes aberrant cell cycle checkpoint thereby allowing ectopic cell cycle entry and subsequent genomic instability. The aberrant

  20. High Levels of Chemokine C-C Motif Ligand 20 in Human Milk and Its Production by Oral Keratinocytes.

    Science.gov (United States)

    Lourenço, Alan G; Komesu, Marilena C; Duarte, Geraldo; Del Ciampo, Luiz A; Mussi-Pinhata, Marisa M; Yamamoto, Aparecida Y

    2017-03-01

    Chemokine C-C motif ligand 20 (CCL20) is implicated in the formation and function of mucosal lymphoid tissues. Although CCL20 is secreted by many normal human tissues, no studies have evaluated the presence of CCL20 in human milk or its production by oral keratinocytes stimulated by human milk. To evaluate the presence of CCL20 in breast milk and verify CCL20 secretion in vitro by oral keratinocytes stimulated with human and bovine milk, as well as its possible association with breast milk lactoferrin levels. The levels of CCL20 and lactoferrin were measured by enzyme-linked immunosorbent assay in human milk at three different stages of maturation from 74 healthy breastfeeding mothers. In vitro, oral keratinocytes were stimulated with human and bovine milk, and CCL20 was measured in their supernatant. High concentrations of CCL20 were detected in the human breast milk samples obtained during the first week (1,777.07 pg/mL) and second week postpartum (1,523.44 pg/mL), with a significantly low concentration in samples at 3-6 weeks postpartum (238.42 pg/mL; p stimulated higher CCL20 secretion by oral keratinocytes compared with bovine milk (p stimulation had no association with breast milk lactoferrin concentration. CCl20 is present at high levels in human milk, predominantly in the first and second week postpartum, but at significantly lower levels at 3-6 weeks postpartum. Human milk is capable of stimulating CCL20 secretion by oral keratinocytes, and this induction had no association with breast milk lactoferrin concentration.

  1. Solar Simulated Ultraviolet Radiation Induces Global Histone Hypoacetylation in Human Keratinocytes.

    Science.gov (United States)

    Zhang, Xiaoru; Kluz, Thomas; Gesumaria, Lisa; Matsui, Mary S; Costa, Max; Sun, Hong

    2016-01-01

    Ultraviolet radiation (UVR) from sunlight is the primary effector of skin DNA damage. Chromatin remodeling and histone post-translational modification (PTM) are critical factors in repairing DNA damage and maintaining genomic integrity, however, the dynamic changes of histone marks in response to solar UVR are not well characterized. Here we report global changes in histone PTMs induced by solar simulated UVR (ssUVR). A decrease in lysine acetylation of histones H3 and H4, particularly at positions of H3 lysine 9, lysine 56, H4 lysine 5, and lysine 16, was found in human keratinocytes exposed to ssUVR. These acetylation changes were highly associated with ssUVR in a dose-dependent and time-specific manner. Interestingly, H4K16ac, a mark that is crucial for higher order chromatin structure, exhibited a persistent reduction by ssUVR that was transmitted through multiple cell divisions. In addition, the enzymatic activities of histone acetyltransferases were significantly reduced in irradiated cells, which may account for decreased global acetylation. Moreover, depletion of histone deacetylase SIRT1 in keratinocytes rescued ssUVR-induced H4K16 hypoacetylation. These results indicate that ssUVR affects both HDAC and HAT activities, leading to reduced histone acetylation.

  2. Dermal-epidermal membrane systems by using human keratinocytes and mesenchymal stem cells isolated from dermis

    Energy Technology Data Exchange (ETDEWEB)

    Salerno, Simona, E-mail: s.salerno@itm.cnr.it [Institute on Membrane Technology, National Research Council of Italy, ITM-CNR, c/o University of Calabria, via P. Bucci cubo 17/C, I-87036, Rende (CS) (Italy); Messina, Antonietta [Institute on Membrane Technology, National Research Council of Italy, ITM-CNR, c/o University of Calabria, via P. Bucci cubo 17/C, I-87036, Rende (CS) (Italy); Giordano, Francesca [Department of Pharmacy, Health and Nutritional Sciences, University of Calabria, I-87036 Rende, (CS) (Italy); Bader, Augustinus [Biomedical-Biotechnological Center, BBZ, University of Leipzig, D-04103 Leipzig (Germany); Drioli, Enrico [Institute on Membrane Technology, National Research Council of Italy, ITM-CNR, c/o University of Calabria, via P. Bucci cubo 17/C, I-87036, Rende (CS) (Italy); WCU Energy Engineering Department, Hanyang University, Seoul (Korea, Republic of); De Bartolo, Loredana, E-mail: l.debartolo@itm.cnr.it [Institute on Membrane Technology, National Research Council of Italy, ITM-CNR, c/o University of Calabria, via P. Bucci cubo 17/C, I-87036, Rende (CS) (Italy)

    2017-02-01

    Dermal-epidermal membrane systems were developed by co-culturing human keratinocytes with Skin derived Stem Cells (SSCs), which are Mesenchymal Stem Cells (MSCs) isolated from dermis, on biodegradable membranes of chitosan (CHT), polycaprolactone (PCL) and a polymeric blend of CHT and PCL. The membranes display physico-chemical, morphological, mechanical and biodegradation properties that could satisfy and fulfil specific requirements in skin tissue engineering. CHT membrane exhibits an optimal biodegradation rate for acute wounds; CHT-PCL for the chronic ones. On the other hand, PCL membrane in spite of its very slow biodegradation rate exhibits mechanical properties similar to in vivo dermis, a lower hydrophilic character, and a surface roughness, all properties that make it able to sustain cell adhesion and proliferation for in vitro skin models. Both CHT–PCL and PCL membranes guided epidermal and dermal differentiation of SSCs as pointed out by the expression of cytokeratins and the deposition of the ECM protein fibronectin, respectively. In the dermal-epidermal membrane systems, a more suitable microenvironment for the SSCs differentiation was promoted by the interactions and the mutual interplay with keratinocytes. Being skin tissue-biased stem cells committed to their specific final dermal and/or epidermal cell differentiation, SSCs are more suitable for skin tissue engineering than other adult MSCs with different origin. For this reason, they represent a useful autologous cell source for engineering skin substitutes for both in vivo and in vitro applications.

  3. IKKα regulates human keratinocyte migration through surveillance of the redox environment.

    Science.gov (United States)

    Lisse, Thomas S; Rieger, Sandra

    2017-03-01

    Although the functions of H 2 O 2 in epidermal wound repair are conserved throughout evolution, the underlying signaling mechanisms are largely unknown. In this study we used human keratinocytes (HEK001) to investigate H 2 O 2 -dependent wound repair mechanisms. Scratch wounding led to H 2 O 2 production in two or three cell layers at the wound margin within ∼30 min and subsequent cysteine modification of proteins via sulfenylation. Intriguingly, exogenous H 2 O 2 treatment resulted in preferential sulfenylation of keratinocytes that adopted a migratory phenotype and detached from neighboring cells, suggesting that one of the primary functions of H 2 O 2 is to stimulate signaling factors involved in cell migration. Based on previous findings that revealed epidermal growth factor receptor (EGFR) involvement in H 2 O 2 -dependent cell migration, we analyzed oxidation of a candidate upstream target, the inhibitor of κB kinase α (IKKα; encoded by CHUK ), as a mechanism of action. We show that IKKα is sulfenylated at a conserved cysteine residue in the kinase domain, which correlates with de-repression of EGF promoter activity and increased EGF expression. Thus, this indicates that IKKα promotes migration through dynamic interactions with the EGF promoter depending on the redox state within cells. © 2017. Published by The Company of Biologists Ltd.

  4. Analyses of the Secondary Particle Radiation and the DNA Damage it Causes to Human Keratinocytes

    Energy Technology Data Exchange (ETDEWEB)

    Lebel E. A.; Tafrov S.; Rusek, A.; Sivertz, M. B.; Yip, K.; Thompson, K. H.

    2011-11-01

    High-energy protons, and high mass and energy ions, along with the secondary particles they produce, are the main contributors to the radiation hazard during space explorations. Skin, particularly the epidermis, consisting mainly of keratinocytes with potential for proliferation and malignant transformation, absorbs the majority of the radiation dose. Therefore, we used normal human keratinocytes to investigate and quantify the DNA damage caused by secondary radiation. Its manifestation depends on the presence of retinol in the serum-free media, and is regulated by phosphatidylinositol 3-kinases. We simulated the generation of secondary radiation after the impact of protons and iron ions on an aluminum shield. We also measured the intensity and the type of the resulting secondary particles at two sample locations; our findings agreed well with our predictions. We showed that secondary particles inflict DNA damage to different extents, depending on the type of primary radiation. Low-energy protons produce fewer secondary particles and cause less DNA damage than do high-energy protons. However, both generate fewer secondary particles and inflict less DNA damage than do high mass and energy ions. The majority of cells repaired the initial damage, as denoted by the presence of 53BPI foci, within the first 24 hours after exposure, but some cells maintained the 53BP1 foci longer.

  5. Saponins from Tribulus terrestris L. protect human keratinocytes from UVB-induced damage.

    Science.gov (United States)

    Sisto, Margherita; Lisi, Sabrina; D'Amore, Massimo; De Lucro, Raffaella; Carati, Davide; Castellana, Donatello; La Pesa, Velia; Zuccarello, Vincenzo; Lofrumento, Dario D

    2012-12-05

    Chronic exposure to solar UVB radiation damages skin, increasing the risk to develop cancer. Hence the identification of compounds with a photoprotective efficacy is essential. This study examined the role of saponins derived from Tribulus terrestris L. (TT) on the modulation of apoptosis in normal human keratinocytes (NHEK) exposed to physiological doses of UVB and to evaluate their antitumoral properties. In NHEK, TT saponins attenuate UVB-induced programmed cell death through inhibition of intrinsic apoptotic pathway. In squamous cell carcinomas (SCC) TT saponins do not make the malignant keratinocytes more resistant to UVB and determine an enhanced apoptotic response. The photoprotective effect of TT saponins is tightly correlated to the enhancement of NER genes expression and the block of UVB-mediated NF-κB activation. Collectively, our study shows experimental evidence that TT has a preventive efficacy against UVB-induced carcinogenesis and the molecular knowledge on the mechanisms through which TT saponins regulate cell death suggests great potential for TT to be developed into a new medicine for cancer patients. Copyright © 2012 Elsevier B.V. All rights reserved.

  6. Resveratrol-Sensitized UVA Induced Apoptosis in Human Keratinocytes through Mitochondrial Oxidative Stress and Pore Opening

    Science.gov (United States)

    Boyer, Jean Z; Jandova, Jana; Janda, Jaroslav; Vleugels, Frank R; Elliott, David; Sligh, James E

    2012-01-01

    Resveratrol (3, 5, 4′-trihydroxy- trans- stilbene), a polyphenol compound, is derived from natural products such as the skin of red grapes, blueberries and cranberries. Resveratrol not only exhibits antioxidant, cardioprotection, and anti-aging properties, but can also inhibit cancer cell growth and induce apoptosis. It has been shown that resveratrol inhibits the activation of Nf-kB and subsequently down regulates the expression of Nf-kB regulated genes such as interleukin-2 and Bcl-2, leading to cell cycle arrest and increased apoptosis in multiple myeloma cells. In the skin, resveratrol has been reported to sensitize keratinocytes to UVA induced apoptosis. However, the effect of resveratrol on opening of the mitochondrial permeability transition pore has not been previously examined. Our data show that UVA (14J/cm2) along with resveratrol causes massive oxidative stress in mitochondria. As a consequence of oxidative stress, the mitochondrial membrane potential decreases which results in opening of the mitochondrial pores ultimately leading to apoptosis in human keratinocytes. These results may have clinical implications for development of future chemotherapeutic treatment for tumors of the skin. PMID:22673012

  7. Proteomic profiling of human keratinocytes undergoing UVB-induced alternative differentiation reveals TRIpartite Motif Protein 29 as a survival factor.

    Directory of Open Access Journals (Sweden)

    Véronique Bertrand-Vallery

    Full Text Available BACKGROUND: Repeated exposures to UVB of human keratinocytes lacking functional p16(INK-4a and able to differentiate induce an alternative state of differentiation rather than stress-induced premature senescence. METHODOLOGY/PRINCIPAL FINDINGS: A 2D-DIGE proteomic profiling of this alternative state of differentiation was performed herein at various times after the exposures to UVB. Sixty-nine differentially abundant protein species were identified by mass spectrometry, many of which are involved in keratinocyte differentiation and survival. Among these protein species was TRIpartite Motif Protein 29 (TRIM29. Increased abundance of TRIM29 following UVB exposures was validated by Western blot using specific antibody and was also further analysed by immunochemistry and by RT-PCR. TRIM29 was found very abundant in keratinocytes and reconstructed epidermis. Knocking down the expression of TRIM29 by short-hairpin RNA interference decreased the viability of keratinocytes after UVB exposure. The abundance of involucrin mRNA, a marker of late differentiation, increased concomitantly. In TRIM29-knocked down reconstructed epidermis, the presence of picnotic cells revealed cell injury. Increased abundance of TRIM29 was also observed upon exposure to DNA damaging agents and PKC activation. The UVB-induced increase of TRIM29 abundance was dependent on a PKC signaling pathway, likely PKCdelta. CONCLUSIONS/SIGNIFICANCE: These findings suggest that TRIM29 allows keratinocytes to enter a protective alternative differentiation process rather than die massively after stress.

  8. UVB induces IL-12 transcription in human keratinocytes in vivo and in vitro

    International Nuclear Information System (INIS)

    Enk, C.D.; Blauvet, A.; Katz, S.I.; Mahanty, S.

    1996-01-01

    Human epidermal cells produce a wide range of cytokines, including those characteristic of Th2-like responses such as interleukin (IL)-4 and IL-10. As well, keratinocytes have recently been shown to produce Th1-like cytokines such as IL-12. Exposure to UVB has profound effects on the skin and systemic immune system, which is in part mediated by secretion of tumor necrosis factor (TNF)-α by epidermal cells. Because IL-12 induces production of TNF-α by certain cells of the immune system, we sought to determine whether UVB is an inducer of IL-12 gene expression in epidermal cells. Human epidermal cells were exposed to UVB radiation in vivo, isolated by suction blister technique and trypsinization and transcription of the IL-12 p35 and p40 chains was examined by RT-PCR. (Author)

  9. Nuclear DNA damage-triggered NLRP3 inflammasome activation promotes UVB-induced inflammatory responses in human keratinocytes

    International Nuclear Information System (INIS)

    Hasegawa, Tatsuya; Nakashima, Masaya; Suzuki, Yoshiharu

    2016-01-01

    Ultraviolet (UV) radiation in sunlight can result in DNA damage and an inflammatory reaction of the skin commonly known as sunburn, which in turn can lead to cutaneous tissue disorders. However, little has been known about how UV-induced DNA damage mediates the release of inflammatory mediators from keratinocytes. Here, we show that UVB radiation intensity-dependently increases NLRP3 gene expression and IL-1β production in human keratinocytes. Knockdown of NLRP3 with siRNA suppresses UVB-induced production of not only IL-1β, but also other inflammatory mediators, including IL-1α, IL-6, TNF-α, and PGE_2. In addition, inhibition of DNA damage repair by knockdown of XPA, which is a major component of the nucleotide excision repair system, causes accumulation of cyclobutane pyrimidine dimer (CPD) and activation of NLRP3 inflammasome. In vivo immunofluorescence analysis confirmed that NLRP3 expression is also elevated in UV-irradiated human epidermis. Overall, our findings indicate that UVB-induced DNA damage initiates NLRP3 inflammasome activation, leading to release of various inflammatory mediators from human keratinocytes. - Highlights: • UVB radiation induces NLRP3 inflammasome activation in human keratinocytes. • NLRP3 knockdown suppresses production of UVB-induced inflammatory mediators. • UVB-induced DNA damage triggers NLRP3 inflammasome activation. • NLRP3 expression in human epidermis is elevated in response to UV radiation.

  10. Nuclear DNA damage-triggered NLRP3 inflammasome activation promotes UVB-induced inflammatory responses in human keratinocytes

    Energy Technology Data Exchange (ETDEWEB)

    Hasegawa, Tatsuya, E-mail: tatsuya.hasegawa@to.shiseido.co.jp; Nakashima, Masaya; Suzuki, Yoshiharu

    2016-08-26

    Ultraviolet (UV) radiation in sunlight can result in DNA damage and an inflammatory reaction of the skin commonly known as sunburn, which in turn can lead to cutaneous tissue disorders. However, little has been known about how UV-induced DNA damage mediates the release of inflammatory mediators from keratinocytes. Here, we show that UVB radiation intensity-dependently increases NLRP3 gene expression and IL-1β production in human keratinocytes. Knockdown of NLRP3 with siRNA suppresses UVB-induced production of not only IL-1β, but also other inflammatory mediators, including IL-1α, IL-6, TNF-α, and PGE{sub 2}. In addition, inhibition of DNA damage repair by knockdown of XPA, which is a major component of the nucleotide excision repair system, causes accumulation of cyclobutane pyrimidine dimer (CPD) and activation of NLRP3 inflammasome. In vivo immunofluorescence analysis confirmed that NLRP3 expression is also elevated in UV-irradiated human epidermis. Overall, our findings indicate that UVB-induced DNA damage initiates NLRP3 inflammasome activation, leading to release of various inflammatory mediators from human keratinocytes. - Highlights: • UVB radiation induces NLRP3 inflammasome activation in human keratinocytes. • NLRP3 knockdown suppresses production of UVB-induced inflammatory mediators. • UVB-induced DNA damage triggers NLRP3 inflammasome activation. • NLRP3 expression in human epidermis is elevated in response to UV radiation.

  11. Human atopic dermatitis skin-derived T cells can induce a reaction in mouse keratinocytes in vivo

    DEFF Research Database (Denmark)

    Martel, Britta C; Blom, Lars; Dyring-Andersen, Beatrice

    2015-01-01

    . In comparison, blood -derived in vitro differentiated Th2 cells only induced a weak response in a few of the mice. Thus, we conclude that human AD skin-derived T cells can induce a reaction in mouse skin through induction of a proliferative response in the mouse keratinocytes. This article is protected......In atopic dermatitis (AD), the inflammatory response between skin infiltrating T cells and keratinocytes is fundamental to the development of chronic lesional eczema. The aim of this study was to investigate whether skin-derived T cells from AD patients could induce an inflammatory response in mice...... through keratinocyte activation and consequently cause development of eczematous lesions. Punch biopsies of lesional skin from AD patients were used to establish skin-derived T cell cultures and which were transferred into NOD.Cg-Prkd(scid) Il2rg(tm1Sug) /JicTac (NOG) mice. We found that subcutaneous...

  12. Chromium III histidinate exposure modulates antioxidant gene expression in HaCaT human keratinocytes exposed to oxidative stress

    Science.gov (United States)

    While the toxicity of hexavalent chromium is well established, trivalent Cr (Cr(III)) is an essential nutrient involved in insulin and glucose homeostasis. Recently, antioxidant effects of chromium (III) histidinate (Cr(III)His) were reported in HaCaT human keratinocytes exposed to oxidative stress...

  13. Tumor necrosis factor related apoptosis inducing ligand triggers apoptosis in dividing but not in differentiating human epidermal keratinocytes

    NARCIS (Netherlands)

    Jansen, Bastiaan J. H.; van Ruissen, Fred; Cerneus, Stefanie; Cloin, Wendy; Bergers, Mieke; van Erp, Piet E. J.; Schalkwijk, Joost

    2003-01-01

    Using serial analysis of gene expression we have previously identified the expression of several pro-apoptotic and anti-apoptotic genes in cultured human primary epidermal keratinocytes, including tumor necrosis factor related apoptosis inducing ligand (TRAIL). TRAIL is a potent inducer of apoptosis

  14. Triterpenoid α-amyrin stimulates proliferation of human keratinocytes but does not protect them against UVB damage

    DEFF Research Database (Denmark)

    Biskup, Edyta; Gołębiowski, Marek; Gniadecki, Robert

    2012-01-01

    Rhaponticum carthamoides plants ("maral root") are widely used in Siberian folk medicine. The present study reports for the first time the presence of pentacyclic terpenoid, α-amyrin, in methanol extract from leaves of this plant. α-Amyrin induced proliferation of human keratinocytes (HaCaT) by a...

  15. Hepatocyte and keratinocyte growth factors and their receptors in human lung emphysema

    Directory of Open Access Journals (Sweden)

    Marchal Joëlle

    2005-10-01

    Full Text Available Abstract Background Hepatocyte and keratinocyte growth factors are key growth factors in the process of alveolar repair. We hypothesized that excessive alveolar destruction observed in lung emphysema involves impaired expression of hepatocyte and keratinocyte growth factors or their respective receptors, c-met and keratinocyte growth factor receptor. The aim of our study was to compare the expression of hepatocyte and keratinocyte growth factors and their receptors in lung samples from 3 groups of patients: emphysema; smokers without emphysema and non-smokers without emphysema. Methods Hepatocyte and keratinocyte growth factor proteins were analysed by immunoassay and western blot; mRNA expression was measured by real time quantitative polymerase chain reaction. Results Hepatocyte and keratinocyte growth factors, c-met and keratinocyte growth factor receptor mRNA levels were similar in emphysema and non-emphysema patients. Hepatocyte growth factor mRNA correlated negatively with FEV1 and the FEV1/FVC ratio both in emphysema patients and in smokers with or without emphysema. Hepatocyte and keratinocyte growth factor protein concentrations were similar in all patients' groups. Conclusion The expression of hepatocyte and keratinocyte growth factors and their receptors is preserved in patients with lung emphysema as compared to patients without emphysema. Hepatocyte growth factor mRNA correlates with the severity of airflow obstruction in smokers.

  16. Arsenic exposure disrupts epigenetic regulation of SIRT1 in human keratinocytes

    International Nuclear Information System (INIS)

    Herbert, Katharine J.; Holloway, Adele; Cook, Anthony L.; Chin, Suyin P.; Snow, Elizabeth T.

    2014-01-01

    Arsenic is an environmental toxin which increases skin cancer risk for exposed populations worldwide; however the underlying biomolecular mechanism for arsenic-induced carcinogenesis is complex and poorly defined. Recent investigations show that histone deacetylase and DNA methyltransferase activity is impaired, and epigenetic patterns of gene regulation are consistently altered in cancers associated with arsenic exposure. Expression of the histone deacetylase SIRT1 is altered in solid tumours and haematological malignancies; however its role in arsenic-induced pathology is unknown. In this study we investigated the effect of arsenic on epigenetic regulation of SIRT1 and its targeting microRNA, miR-34a in primary human keratinocytes. Acetylation of histone H4 at lysine 16 (H4K16) increased in keratinocytes exposed to 0.5 μM arsenite [As(III)]; and this was associated with chromatin remodelling at the miR-34a promoter. Moreover, although SIRT1 protein initially increased in these As(III)-exposed cells, after 24 days expression was not significantly different from untreated controls. Extended exposure to low-dose As(III) (0.5 μM; > 5 weeks) compromised the pattern of CpG methylation at SIRT1 and miR-34a gene promoters, and this was associated with altered expression for both genes. We have found that arsenic alters epigenetic regulation of SIRT1 expression via structural reorganisation of chromatin at the miR-34a gene promoter in the initial 24 h of exposure; and over time, through shifts in miR-34a and SIRT1 gene methylation. Taken together, this investigation demonstrates that arsenic produces cumulative disruptions to epigenetic regulation of miR-34a expression, and this is associated with impaired coordination of SIRT1 functional activity. - Highlights: • Submicromolar arsenic concentrations disrupt SIRT1 activity and expression in human keratinocytes. • Arsenic-induced chromatin remodelling at the miR-34a gene promoter is associated with hyperacetylation

  17. Cobalt Oxide Nanoparticles: Behavior towards Intact and Impaired Human Skin and Keratinocytes Toxicity

    Directory of Open Access Journals (Sweden)

    Marcella Mauro

    2015-07-01

    Full Text Available Skin absorption and toxicity on keratinocytes of cobalt oxide nanoparticles (Co3O4NPs have been investigated. Co3O4NPs are commonly used in industrial products and biomedicine. There is evidence that these nanoparticles can cause membrane damage and genotoxicity in vitro, but no data are available on their skin absorption and cytotoxicity on keratinocytes. Two independent 24 h in vitro experiments were performed using Franz diffusion cells, using intact (experiment 1 and needle-abraded human skin (experiment 2. Co3O4NPs at a concentration of 1000 mg/L in physiological solution were used as donor phase. Cobalt content was evaluated by Inductively Coupled–Mass Spectroscopy. Co permeation through the skin was demonstrated after 24 h only when damaged skin protocol was used (57 ± 38 ng·cm−2, while no significant differences were shown between blank cells (0.92 ± 0.03 ng cm−2 and those with intact skin (1.08 ± 0.20 ng·cm−2. To further investigate Co3O4NPs toxicity, human-derived HaCaT keratinocytes were exposed to Co3O4NPs and cytotoxicity evaluated by MTT, Alamarblue® and propidium iodide (PI uptake assays. The results indicate that a long exposure time (i.e., seven days was necessary to induce a concentration-dependent cell viability reduction (EC50 values: 1.3 × 10−4 M, 95% CL = 0.8–1.9 × 10−4 M, MTT essay; 3.7 × 10−5 M, 95% CI = 2.2–6.1 × 10−5 M, AlamarBlue® assay that seems to be associated to necrotic events (EC50 value: 1.3 × 10−4 M, 95% CL = 0.9–1.9 × 10−4 M, PI assay. This study demonstrated that Co3O4NPs can penetrate only damaged skin and is cytotoxic for HaCat cells after long term exposure.

  18. Arsenic exposure disrupts epigenetic regulation of SIRT1 in human keratinocytes

    Energy Technology Data Exchange (ETDEWEB)

    Herbert, Katharine J. [School of Health Sciences, University of Tasmania, Launceston, TAS 7250 (Australia); Holloway, Adele [Menzies Research Institute Tasmania, University of Tasmania, Hobart, TAS 7000 (Australia); Cook, Anthony L. [School of Health Sciences, University of Tasmania, Launceston, TAS 7250 (Australia); Chin, Suyin P. [Menzies Research Institute Tasmania, University of Tasmania, Hobart, TAS 7000 (Australia); Snow, Elizabeth T., E-mail: elizabeth.snow@utas.edu.au [School of Health Sciences, University of Tasmania, Launceston, TAS 7250 (Australia)

    2014-11-15

    Arsenic is an environmental toxin which increases skin cancer risk for exposed populations worldwide; however the underlying biomolecular mechanism for arsenic-induced carcinogenesis is complex and poorly defined. Recent investigations show that histone deacetylase and DNA methyltransferase activity is impaired, and epigenetic patterns of gene regulation are consistently altered in cancers associated with arsenic exposure. Expression of the histone deacetylase SIRT1 is altered in solid tumours and haematological malignancies; however its role in arsenic-induced pathology is unknown. In this study we investigated the effect of arsenic on epigenetic regulation of SIRT1 and its targeting microRNA, miR-34a in primary human keratinocytes. Acetylation of histone H4 at lysine 16 (H4K16) increased in keratinocytes exposed to 0.5 μM arsenite [As(III)]; and this was associated with chromatin remodelling at the miR-34a promoter. Moreover, although SIRT1 protein initially increased in these As(III)-exposed cells, after 24 days expression was not significantly different from untreated controls. Extended exposure to low-dose As(III) (0.5 μM; > 5 weeks) compromised the pattern of CpG methylation at SIRT1 and miR-34a gene promoters, and this was associated with altered expression for both genes. We have found that arsenic alters epigenetic regulation of SIRT1 expression via structural reorganisation of chromatin at the miR-34a gene promoter in the initial 24 h of exposure; and over time, through shifts in miR-34a and SIRT1 gene methylation. Taken together, this investigation demonstrates that arsenic produces cumulative disruptions to epigenetic regulation of miR-34a expression, and this is associated with impaired coordination of SIRT1 functional activity. - Highlights: • Submicromolar arsenic concentrations disrupt SIRT1 activity and expression in human keratinocytes. • Arsenic-induced chromatin remodelling at the miR-34a gene promoter is associated with hyperacetylation

  19. Exposure to Carbon Nanotube Material: Assessment of Nanotube Cytotoxicity Using Human Keratinocyte Cells

    Science.gov (United States)

    Shvedova, Anna A.; Castranova, Vincent; Kisin, Elena R.; Schwegler-Berry, Diane; Murray, Ashley R.; Gandelsman, Vadim Z.; Maynard, Andrew; Baron, Paul

    2003-01-01

    Carbon nanotubes are new members of carbon allotropes similar to fullerenes and graphite. Because of their unique electrical, mechanical, and thermal properties, carbon nanotubes are important for novel applications in the electronics, aerospace, and computer industries. Exposure to graphite and carbon materials has been associated with increased incidence of skin diseases, such as carbon fiber dermatitis, hyperkeratosis, and naevi. We investigated adverse effects of single-wall carbon nanotubes (SWCNT) using a cell culture of immortalized human epidermal keratinocytes (HaCaT). After 18 h of exposure of HaCaT to SWCNT, oxidative stress and cellular toxicity were indicated by formation of free radicals, accumulation of peroxidative products, antioxidant depletion, and loss of cell viability. Exposure to SWCNT also resulted in ultrastructural and morphological changes in cultured skin cells. These data indicate that dermal exposure to unrefined SWCNT may lead to dermal toxicity due to accelerated oxidative stress in the skin of exposed workers.

  20. Human eccrine sweat gland cells turn into melanin-uptaking keratinocytes in dermo-epidermal skin substitutes.

    Science.gov (United States)

    Böttcher-Haberzeth, Sophie; Biedermann, Thomas; Pontiggia, Luca; Braziulis, Erik; Schiestl, Clemens; Hendriks, Bart; Eichhoff, Ossia M; Widmer, Daniel S; Meuli-Simmen, Claudia; Meuli, Martin; Reichmann, Ernst

    2013-02-01

    Recently, Biedermann et al. (2010) have demonstrated that human eccrine sweat gland cells can develop a multilayered epidermis. The question still remains whether these cells can fulfill exclusive and very specific functional properties of epidermal keratinocytes, such as the incorporation of melanin, a feature absent in sweat gland cells. We added human melanocytes to eccrine sweat gland cells to let them develop into an epidermal analog in vivo. The interaction between melanocytes and sweat gland-derived keratinocytes was investigated. The following results were gained: (1) macroscopically, a pigmentation of the substitutes was seen 2-3 weeks after transplantation; (2) we confirmed the development of a multilayered, stratified epidermis with melanocytes distributed evenly throughout the basal layer; (3) melanocytic dendrites projected to suprabasal layers; and (4) melanin was observed to be integrated into former eccrine sweat gland cells. These skin substitutes were similar or equal to skin substitutes cultured from human epidermal keratinocytes. The only differences observed were a delay in pigmentation and less melanin uptake. These data suggest that eccrine sweat gland cells can form a functional epidermal melanin unit, thereby providing striking evidence that they can assume one of the most characteristic keratinocyte properties.

  1. A comparative in vitro study of the viability of human keratinocytes grown on irradiated human amnion membrane and fibrin glue scaffolds

    International Nuclear Information System (INIS)

    Dorai, A.A.; Lim, C.K.; Azman, W.S.; Halim, A.S.

    2008-01-01

    Full text: The dried irradiated human amnion membrane has been used as a biological dressing for various clinical conditions. Being another biological membrane its potential as a scaffold to grow human keratinocytes is not known yet. To compare the growth patterns and cell viability of keratinocytes using fibrin glue and air dried amnion membrane as a scaffold. Keratinocytes were obtained from skin samples of six patients undergoing elective surgery. Fibrin glue (Tisseel, Baxter ) was diluted and used to coat the wells. Human dried amnion membrane was obtained and placed into the 24 well plates. Keratinocytes were seeded into the fibrin and amnion scaffold. Cell viability assay (MTT) was performed after 24, 48 and 72 hours. Finally the measurements were done by the Enzyme-Linked Immunosorbent Assay (ELISA) reader at 570 nm. Six patients consented for the study. The cells growing on the amnion scaffold showed a decreasing trend (20.67%, 17.94% and 16.78% respectively for 24, 48 and 72 hours). The cells growing on the fibrin scaffold showed a steady increase in number at 24, 48 and 72 hours (73.03%, 74.12% and 79.66%). The percentage of growth of normal human keratinocytes were significantly greater in the fibrin scaffold group (Mann - Whitney p = 0.002) for 24, 48 and 72 hours. The air dried irradiated human amnion membrane can be used as a scaffold to grow keratinocytes but however the growth pattern does not sustain with time. Fibrin glue supports the growth of human keratinocytes and shows an increasing pattern of growth with time. (Author)

  2. Assessment of radiation induced cytogenetic damage in human keratinocytes by comet assay

    International Nuclear Information System (INIS)

    Joseph, Praveen; Sanjeev Ganesh; Narayana, Y.; Puthali, Abhay; Bhat, N.N.

    2010-01-01

    In the present study the effect of gamma radiation on normal human keratinocytes (HaCaT) cells has been analyzed using alkaline comet assay and a comparative study over the sensitivity of different comet parameters such as tail length (TL), olive tail moment (OTM) and percentage tail DNA (TDNA) has also been made. Human keratinocytes (HaCaT) cells were grown in Dulbecco's modified essential medium (DMEM) (10% FCS) at 37 °C in a humidified atmosphere containing 5% CO 2 . Cultured cells were harvested with 0.025 % trypsin EDTA. The sample (2 X 10 cells/ml) was exposed to gamma radiation of different dose using a 60 Co gamma source at dose rate of 2 Gy min -1 and the dosimetry has been carried out using Fricke and FBX dosimeters. After irradiation, to quantify the DNA damage the comet assay (single cell gel electrophoresis) was carried out under alkaline conditions, by the methods outlined by Singh et al. The quantification of the DNA strand breaks in each cells were performed using CASP software. The DNA damage quantification can be accomplished by measuring those comet parameters which exhibit a linear dependence on the amount of DNA damage. In the present study, comet parameters such as OTM, TL and TDNA were recorded and the variation of these parameters and their correlation coefficients for different doses of gamma radiation is plotted. The OTM value is normalized with control value and control for TL and TDNA is adjusted to zero to avoid initial variations in different experiments

  3. Cultivation of human dermal fibroblasts and epidermal keratinocytes on keratin-coated silica bead substrates.

    Science.gov (United States)

    Tan, Bee Yi; Nguyen, Luong T H; Kim, Hyo-Sop; Kim, Jae-Ho; Ng, Kee Woei

    2017-10-01

    Human hair keratin is promising as a bioactive material platform for various biomedical applications. To explore its versatility further, human hair keratin was coated onto monolayers of silica beads to produce film-like substrates. This combination was hypothesized to provide a synergistic effect in improving the biochemical properties of the resultant composite. Atomic force microscopy analysis showed uniform coatings of keratin on the silica beads with a slight increase in the resulting surface roughness. Keratin-coated silica beads had higher surface energy and relatively lower negative charge than those of bare silica beads. To investigate cell response, human dermal fibroblasts (HDFs), and human epidermal keratinocytes (HEKs) were cultured on the substrates over 4 days. Results showed that keratin coatings significantly enhanced the metabolic activity of HDFs and encouraged cell spreading but did not exert any significant effects on HEKs. HDF expression of collagen I was significantly more intense on the keratin-coated compared to the bare silica substrates. Furthermore, HDF secretion of various cytokines suggested that keratin coatings triggered active cell responses related to wound healing. Collectively, our study demonstrated that human hair keratin-coated silica bead monolayers have the potential to modulate HDF behavior in culture and may be exploited further. © 2017 Wiley Periodicals, Inc. J Biomed Mater Res Part A: 105A: 2789-2798, 2017. © 2017 Wiley Periodicals, Inc.

  4. Biological interactions of quantum dot nanoparticles in skin and in human epidermal keratinocytes

    International Nuclear Information System (INIS)

    Zhang, Leshuai W.; Yu, William W.; Colvin, Vicki L.; Monteiro-Riviere, Nancy A.

    2008-01-01

    Quantum dots nanoparticles have novel optical properties for biomedical applications and electronics, but little is known about their skin permeability and interaction with cells. QD621 are nail-shaped nanoparticles that contain a cadmium/selenide core with a cadmium sulfide shell coated with polyethylene glycol (PEG) and are soluble in water. QD were topically applied to porcine skin flow-through diffusion cells to assess penetration at 1 μM, 2 μM and 10 μM for 24 h. QD were also studied in human epidermal keratinocytes (HEK) to determine cellular uptake, cytotoxicity and inflammatory potential. Confocal microscopy depicted the penetration of QD621 through the uppermost stratum corneum (SC) layers of the epidermis and fluorescence was found primarily in the SC and near hair follicles. QD were found in the intercellular lipid bilayers of the SC by transmission electron microscopy (TEM). Inductively coupled plasma-optical emission spectroscopy (ICP-OES) analysis for cadmium (Cd) and fluorescence for QD both did not detect Cd nor fluorescence signal in the perfusate at any time point or concentration. In HEK, viability decreased significantly (p < 0.05) from 1.25 nM to 10nM after 24 h and 48 h. There was a significant increase in IL-6 at 1.25 nM to 10 nM, while IL-8 increased from 2.5nM to 10nM after 24 h and 48 h. TEM of HEK treated with 10 nM of QD621 at 24 h depicted QD in cytoplasmic vacuoles and at the periphery of the cell membranes. These results indicate that porcine skin penetration of QD621 is minimal and limited primarily to the outer SC layers, yet if the skin were damaged allowing direct QD exposure to skin or keratinocytes, an inflammatory response could be initiated

  5. Inhibition of inflammatory and proliferative responses of human keratinocytes exposed to the sesquiterpene lactones dehydrocostuslactone and costunolide.

    Directory of Open Access Journals (Sweden)

    Claudia Scarponi

    Full Text Available The imbalance of the intracellular redox state and, in particular, of the glutathione (GSH/GSH disulfide couple homeostasis, is involved in the pathogenesis of a number of diseases. In many skin diseases, including psoriasis, oxidative stress plays an important role, as demonstrated by the observation that treatments leading to increase of the local levels of oxidant species ameliorate the disease. Recently, dehydrocostuslactone (DCE and costunolide (CS, two terpenes naturally occurring in many plants, have been found to exert various anti-inflammatory and pro-apoptotic effects on different human cell types. These compounds decrease the level of the intracellular GSH by direct interaction with it, and, therefore, can alter cellular redox state. DCE and CS can trigger S-glutathionylation of various substrates, including the transcription factor STAT3 and JAK1/2 proteins. In the present study, we investigated on the potential role of DCE and CS in regulating inflammatory and proliferative responses of human keratinocytes to cytokines. We demonstrated that DCE and CS decreased intracellular GSH levels in human keratinocytes, as well as inhibited STAT3 and STAT1 phosphorylation and activation triggered by IL-22 or IFN-γ, respectively. Consequently, DCE and CS decreased the IL-22- and IFN-γ-induced expression of inflammatory and regulatory genes in keratinocytes, including CCL2, CXCL10, ICAM-1 and SOCS3. DCE and CS also inhibited proliferation and cell-cycle progression-related gene expression, as well as they promoted cell cycle arrest and apoptosis. In parallel, DCE and CS activated the anti-inflammatory EGFR and ERK1/2 molecules in keratinocytes, and, thus, wound healing in an in vitro injury model. In light of our findings, we can hypothesize that the employment of DCE and CS in psoriasis could efficiently counteract the pro-inflammatory effects of IFN-γ and IL-22 on keratinocytes, revert the apoptosis-resistant phenotype, as well as inhibit

  6. Comparative study of human-induced pluripotent stem cells derived from bone marrow cells, hair keratinocytes, and skin fibroblasts.

    Science.gov (United States)

    Streckfuss-Bömeke, Katrin; Wolf, Frieder; Azizian, Azadeh; Stauske, Michael; Tiburcy, Malte; Wagner, Stefan; Hübscher, Daniela; Dressel, Ralf; Chen, Simin; Jende, Jörg; Wulf, Gerald; Lorenz, Verena; Schön, Michael P; Maier, Lars S; Zimmermann, Wolfram H; Hasenfuss, Gerd; Guan, Kaomei

    2013-09-01

    Induced pluripotent stem cells (iPSCs) provide a unique opportunity for the generation of patient-specific cells for use in disease modelling, drug screening, and regenerative medicine. The aim of this study was to compare human-induced pluripotent stem cells (hiPSCs) derived from different somatic cell sources regarding their generation efficiency and cardiac differentiation potential, and functionalities of cardiomyocytes. We generated hiPSCs from hair keratinocytes, bone marrow mesenchymal stem cells (MSCs), and skin fibroblasts by using two different virus systems. We show that MSCs and fibroblasts are more easily reprogrammed than keratinocytes. This corresponds to higher methylation levels of minimal promoter regions of the OCT4 and NANOG genes in keratinocytes than in MSCs and fibroblasts. The success rate and reprogramming efficiency was significantly higher by using the STEMCCA system than the OSNL system. All analysed hiPSCs are pluripotent and show phenotypical characteristics similar to human embryonic stem cells. We studied the cardiac differentiation efficiency of generated hiPSC lines (n = 24) and found that MSC-derived hiPSCs exhibited a significantly higher efficiency to spontaneously differentiate into beating cardiomyocytes when compared with keratinocyte-, and fibroblast-derived hiPSCs. There was no significant difference in the functionalities of the cardiomyocytes derived from hiPSCs with different origins, showing the presence of pacemaker-, atrial-, ventricular- and Purkinje-like cardiomyocytes, and exhibiting rhythmic Ca2+ transients and Ca2+ sparks in hiPSC-derived cardiomyocytes. Furthermore, spontaneously and synchronously beating and force-developing engineered heart tissues were generated. Human-induced pluripotent stem cells can be reprogrammed from all three somatic cell types, but with different efficiency. All analysed iPSCs can differentiate into cardiomyocytes, and the functionalities of cardiomyocytes derived from different cell

  7. The Effect of Calcipotriol on the Expression of Human β Defensin-2 and LL-37 in Cultured Human Keratinocytes

    Directory of Open Access Journals (Sweden)

    Beom Joon Kim

    2009-01-01

    Full Text Available Background. Vitamin D has been reported to regulate innate immunity by controlling the expression of antimicrobial peptides (AMPs. Objective. We investigated the effect of calcipotriol on the expression of AMPs in human cultured keratinocytes. Methods. Keratinocytes were treated with lipopolysaccharide (LPS, TNF-α, Calcipotriol and irradiated with UVB, cultured, and harvested. To assess the expression of human beta defensin-2 and LL-37 in the control group, not exposed to any stimulants, the experimental group was treated with LPS, TNF-α, or UVB, and another group was treated again with calcipotriol; reverse transcriptase-polymerase chain reaction, Western blotting, and immunohistochemical staining were performed. Results. In the experimental group treated with LPS, UVB irradiation, and TNF-α, the expression of β-defensin and LL-37 was increased more than in the control group and then decreased in the experimental group treated with calcipotriol. Conclusions. Calcipotriol suppressed HBD-2 and LL-37, which were stimulated by UVB, LPS, and TNF-α.

  8. cDNA microarray analysis of human keratinocytes cells of patients submitted to chemoradiotherapy and oral photobiomodulation therapy: pilot study.

    Science.gov (United States)

    Antunes, Heliton S; Wajnberg, Gabriel; Pinho, Marcos B; Jorge, Natasha Andressa Nogueira; de Moraes, Joyce Luana Melo; Stefanoff, Claudio Gustavo; Herchenhorn, Daniel; Araújo, Carlos M M; Viégas, Celia Maria Pais; Rampini, Mariana P; Dias, Fernando L; de Araujo-Souza, Patricia Savio; Passetti, Fabio; Ferreira, Carlos G

    2018-01-01

    Oral mucositis is an acute toxicity that occurs in patients submitted to chemoradiotherapy to treat head and neck squamous cell carcinoma. In this study, we evaluated differences in gene expression in the keratinocytes of the oral mucosa of patients treated with photobiomodulation therapy and tried to associate the molecular mechanisms with clinical findings. From June 2009 to December 2010, 27 patients were included in a randomized double-blind pilot study. Buccal smears from 13 patients were obtained at days 1 and 10 of chemoradiotherapy, and overall gene expression of samples from both dates were analyzed by complementary DNA (cDNA) microarray. In addition, samples from other 14 patients were also collected at D1 and D10 of chemoradiotherapy for subsequent validation of cDNA microarray findings by qPCR. The expression array analysis identified 105 upregulated and 60 downregulated genes in our post-treatment samples when compared with controls. Among the upregulated genes with the highest fold change, it was interesting to observe the presence of genes related to keratinocyte differentiation. Among downregulated genes were observed genes related to cytotoxicity and immune response. The results indicate that genes known to be induced during differentiation of human epidermal keratinocytes were upregulated while genes associated with cytotoxicity and immune response were downregulated in the laser group. These results support previous clinical findings indicating that the lower incidence of oral mucositis associated with photobiomodulation therapy might be correlated to the activation of genes involved in keratinocyte differentiation.

  9. Effect of in vitro and in vivo UV irradiation on the production of ETAF activity by human and murine keratinocytes

    International Nuclear Information System (INIS)

    Ansel, J.C.; Luger, T.A.; Green, I.

    1983-01-01

    Cultured epidermal cells and keratinocytes produce a potent hormone-like factor called epidermal cell-derived thymocyte-activating factor (ETAF). ETAF appears to be similar if not identical to a monocyte-derived lymphokine, known as interleukin 1 (IL-1). These two cytokines are able to amplify a diverse number of proliferative and inflammatory processes. Several recent investigations have suggested that UV-induced immunosuppression may be due in part to the inhibition of IL-1/ETAF production by monocytes and keratinocytes, respectively. We therefore decided to directly study the effects of various doses of in vitro and in vivo UV radiation (UVR) on the production of ETAF by normal murine epidermal cells and a murine (Pam 212) and a human (SCC) keratinocyte cell line. Our results surprisingly demonstrated an increase in both the extracellular and the intracellular ETAF activity of the murine epidermal, Pam 212, and SCC after sublethal amounts of in vitro UVR. Likewise, increased ETAF activity of murine epidermal cells was detected after sublethal doses of in vivo UVR. The UV-induced ETAF activity was cycloheximide-sensitive, suggesting that de novo synthesis of ETAF rather than cell membrane leakage was responsible for the increased ETAF activity. The fact that UV irradiation can increase ETAF activity by keratinocytes could have important local and systemic consequences for the host and may provide an efficient, contaminant-free method for generating ETAF activity for further biochemical and immunologic studies

  10. Gene expression signatures affected by ethanol and/or nicotine in normal human normal oral keratinocytes (NHOKs

    Directory of Open Access Journals (Sweden)

    Jeffrey J. Kim

    2014-12-01

    Full Text Available It has been reported that nicotine/alcohol alters epigenetic control and leads to abrogated DNA methylation and histone modifications, which could subsequently perturb transcriptional regulation critically important in cellular transformation. The aim of this study is to determine the molecular mechanisms of nicotine/alcohol-induced epigenetic alterations and their mechanistic roles in transcriptional regulation in human adult stem cells. We hypothesized that nicotine/alcohol induces deregulation of epigenetic machinery and leads to epigenetic alterations, which subsequently affect transcriptional regulation in oral epithelial stem cells. As an initiating step we have profiled transcriptomic alterations induced by the combinatory administration of EtOH and nicotine in primary normal human oral keratinocytes. Here we provide detailed experimental methods, analysis and information associated with our data deposited into Gene Expression Omnibus (GEO under GSE57634. Our data provide comprehensive transcriptomic map describing molecular changes induced by EtOH and nicotine on normal human oral keratinocytes.

  11. Sacha Inchi Oil (Plukenetia volubilis L.), effect on adherence of Staphylococus aureus to human skin explant and keratinocytes in vitro.

    Science.gov (United States)

    Gonzalez-Aspajo, German; Belkhelfa, Haouaria; Haddioui-Hbabi, Laïla; Bourdy, Geneviève; Deharo, Eric

    2015-08-02

    Plukenetia volubilis L. (Euphorbiaceae) is a domesticated vine distributed from the high-altitude Andean rain forest to the lowlands of the Peruvian Amazon. Oil from the cold-pressed seeds, sold under the commercial name of Sacha Inchi Oil (SIO) is actually much in favour because it contains a high percentage of omega 3 and omega 6, and is hence used as a dietary supplement. SIO is also used traditionally for skin care, in order to maintain skin softness, and for the treatment of wounds, insect bites and skin infections, in a tropical context where the skin is frequently damaged. This study was designed in order to verify whether the traditional use of SIO for skin care would have any impact on Staphylococcus aureus growth and skin adherence, as S. aureus is involved in many skin pathologies (impetigo, folliculitis, furuncles and subcutaneous abscesses) being one if the main pathogens that can be found on the skin. Therefore, our objective was to assess SIO bactericidal activity and interference with adherence to human skin explants and the keratinocyte cell line. Cytotoxicity on that cells was also determined. The activity of SIO was compared to coconut oil (CocO), which is widely used for skin care but has different unsaturated fatty acids contents. Laboratory testing with certified oil, determined antibacterial activity against radio labelled S. aureus. Cytotoxic effects were measured with XTT on keratinocyte cells and with neutral red on human skin explants; phenol was used as cytotoxic control. Adherence assays were carried out by mixing H3-labelled S. aureus bacteria with keratinocyte cells and human skin explants, incubated with oils 2h before (to determine the inhibition of adherence, assimilated to a preventive effect) or 2h after the contact of the biological material with S. aureus (to assess the detachment of the bacteria, assimilated to a curative effect). Residual radioactivity measured after washings made it possible to determine the adherence

  12. The Antimicrobial Peptide Human Beta-Defensin-3 Is Induced by Platelet-Released Growth Factors in Primary Keratinocytes

    Directory of Open Access Journals (Sweden)

    Andreas Bayer

    2017-01-01

    Full Text Available Platelet-released growth factors (PRGF and its related clinically used formulations (e.g., Vivostat Platelet-Rich Fibrin (PRF® contain a variety of chemokines, cytokines, and growth factors and are therefore used to support healing of chronic, hard-to-heal, or infected wounds. Human beta-defensin-3 (hBD-3 is an antimicrobial peptide inducibly expressed in human keratinocytes especially upon wounding. The potent antimicrobial activity of hBD-3 together with its wound closure-promoting activities suggests that hBD-3 may play a crucial role in wound healing. Therefore, we analyzed the influence of PRGF on hBD-3 expression in human primary keratinocytes in vitro. In addition, we investigated the influence of Vivostat PRF on hBD-3 expression in artificially generated human skin wounds in vivo. PRGF treatment of primary keratinocytes induced a significant, concentration- and time-dependent increase in hBD-3 gene expression which was partially mediated by the epidermal growth factor receptor (EGFR. In line with these cell culture data, in vivo experiments revealed an enhanced hBD-3 expression in experimentally produced human wounds after the treatment with Vivostat PRF. Thus, the induction of hBD-3 may contribute to the beneficial effects of thrombocyte concentrate lysates in the treatment of chronic or infected wounds.

  13. The Antimicrobial Peptide Human Beta-Defensin-3 Is Induced by Platelet-Released Growth Factors in Primary Keratinocytes

    Science.gov (United States)

    Lammel, Justus; Tohidnezhad, Mersedeh; Lippross, Sebastian; Behrendt, Peter; Klüter, Tim; Pufe, Thomas; Cremer, Jochen; Jahr, Holger; Rademacher, Franziska; Gläser, Regine; Harder, Jürgen

    2017-01-01

    Platelet-released growth factors (PRGF) and its related clinically used formulations (e.g., Vivostat Platelet-Rich Fibrin (PRF®)) contain a variety of chemokines, cytokines, and growth factors and are therefore used to support healing of chronic, hard-to-heal, or infected wounds. Human beta-defensin-3 (hBD-3) is an antimicrobial peptide inducibly expressed in human keratinocytes especially upon wounding. The potent antimicrobial activity of hBD-3 together with its wound closure-promoting activities suggests that hBD-3 may play a crucial role in wound healing. Therefore, we analyzed the influence of PRGF on hBD-3 expression in human primary keratinocytes in vitro. In addition, we investigated the influence of Vivostat PRF on hBD-3 expression in artificially generated human skin wounds in vivo. PRGF treatment of primary keratinocytes induced a significant, concentration- and time-dependent increase in hBD-3 gene expression which was partially mediated by the epidermal growth factor receptor (EGFR). In line with these cell culture data, in vivo experiments revealed an enhanced hBD-3 expression in experimentally produced human wounds after the treatment with Vivostat PRF. Thus, the induction of hBD-3 may contribute to the beneficial effects of thrombocyte concentrate lysates in the treatment of chronic or infected wounds. PMID:28811680

  14. Insights into the impact of silver nanoparticles on human keratinocytes metabolism through NMR metabolomics.

    Science.gov (United States)

    Carrola, Joana; Bastos, Verónica; Ferreira de Oliveira, José Miguel P; Oliveira, Helena; Santos, Conceição; Gil, Ana M; Duarte, Iola F

    2016-01-01

    Due to their antimicrobial properties, silver nanoparticles (AgNPs) are increasingly incorporated into consumer goods and medical products. Their potential toxicity to human cells is however a major concern, and there is a need for improved understanding of their effects on cell metabolism and function. Here, Nuclear Magnetic Resonance (NMR) metabolomics was used to investigate the metabolic profile of human epidermis keratinocytes (HaCaT cell line) exposed for 48 h to 30 nm citrate-stabilized spherical AgNPs (10 and 40 μg/mL). Intracellular aqueous extracts, organic extracts and extracellular culture medium were analysed to provide an integrated view of the cellular metabolic response. The specific metabolite variations, highlighted through multivariate analysis and confirmed by spectral integration, suggested that HaCaT cells exposed to AgNPs displayed upregulated glutathione-based antioxidant protection, increased glutaminolysis, downregulated tricarboxylic acid (TCA) cycle activity, energy depletion and cell membrane modification. Importantly, most metabolic changes were apparent in cells exposed to a concentration of AgNPs which did not affect cell viability at significant levels, thus underlying the sensitivity of NMR metabolomics to detect early biochemical events, even in the absence of a clear cytotoxic response. It can be concluded that NMR metabolomics is an important new tool in the field of in vitro nanotoxicology. Copyright © 2015 Elsevier Inc. All rights reserved.

  15. Cellular interactions of a lipid-based nanocarrier model with human keratinocytes: Unravelling transport mechanisms.

    Science.gov (United States)

    Silva, Elisabete; Barreiros, Luísa; Segundo, Marcela A; Costa Lima, Sofia A; Reis, Salette

    2017-04-15

    Knowledge of delivery system transport through epidermal cell monolayer is vital to improve skin permeation and bioavailability. Recently, nanostructured lipid carriers (NLCs) have gained great attention for transdermal delivery due to their biocompatibility, high drug payload, occlusive properties and skin hydration effect. However, the nanocarriers transport related mechanisms in epidermal epithelial cells are not yet understood. In this research, the internalization and transport pathways of the NLCs across the epidermal epithelial cell monolayer (HaCaT cells) were investigated. The 250nm sized witepsol/miglyol NLCs, prepared by hot homogenization had reduced cytotoxicity and no effect on the integrity of cell membrane in human HaCaT keratinocytes. The internalization was time-, concentration- and energy-dependent, and the uptake of NLCs was a vesicle-mediated process by macropinocytosis and clathrin-mediated pathways. 3% of NLCs were found at the apical membrane side of the HaCaT monolayer through exocytosis mechanism. Additionally, the endoplasmic reticulum, Golgi apparatus and microtubules played crucial roles in the transport of NLCs out of HaCaT cells. NLCs were transported intact across the human keratinocytes monolayer, without disturbing the tight junction's structure. From the transcytosis data only approximately 12% of the internalized NLCs were passed from the apical to the basolateral side. The transcytosis of NLCs throughout the HaCaT cell monolayer towards the basolateral membrane side requires the involvement of the endoplasmic reticulum, Golgi apparatus and microtubules. Our findings may contribute to a systematic understanding of NLCs transport across epidermal epithelial cell monolayers and their optimization for clinical transdermal application. Transdermal drug delivery is a challenging and growing area of clinical application. Lipid nanoparticles such as nanostructured lipid carriers (NLCs) have gained wide interest for transdermal drug

  16. Isolation, identification, and pathological effects of beach sand bacterial extract on human skin keratinocytes in vitro

    Directory of Open Access Journals (Sweden)

    Fazli Subhan

    2018-01-01

    Full Text Available Background Beaches are recreational spots for people. However, beach sand contains harmful microbes that affect human health, and there are no established methods for either sampling and identifying beach-borne pathogens or managing the quality of beach sand. Method This study was conducted with the aim of improving human safety at beaches and augmenting the quality of the beach experience. Beach sand was used as a resource to isolate bacteria due to its distinctive features and the biodiversity of the beach sand biota. A selected bacterial isolate termed FSRS was identified as Pseudomonas stutzeri using 16S rRNA sequencing and phylogenetic analysis, and the sequence was deposited in the NCBI GenBank database under the accession number MF599548. The isolated P. stutzeri bacterium was cultured in Luria–Bertani growth medium, and a crude extract was prepared using ethyl acetate to examine the potential pathogenic effect of P. stutzeri on human skin. A human skin keratinocyte cell line (HaCaT was used to assess cell adhesion, cell viability, and cell proliferation using a morphological analysis and a WST-1 assay. Result The crude P. stutzeri extract inhibited cell adhesion and decreased cell viability in HaCaT cells. We concluded that the crude extract of P. stutzeri FSRS had a strong pathological effect on human skin cells. Discussion Beach visitors frequently get skin infections, but the exact cause of the infections is yet to be determined. The beach sand bacterium P. stutzeri may, therefore, be responsible for some of the dermatological problems experienced by people visiting the beach.

  17. Influence of ion implantation on the adhesion and grow of human keratinocytes

    International Nuclear Information System (INIS)

    Walachova, K.; Svorcik, V.; Dvorakova, B.; Vogtova, D.

    1999-01-01

    Interaction of keratinocytes with polymer modified by ion implantation was studied with the possibility of cultivate these cells for regeneration of dermal cover, for example, heavy burned persons. The modification on polyethylene (PE) with 100 μm thickness was processed by implantation the Ar + ions with the energy 63 keV and Xe + ions with the energy 156 keV. Some characteristics of superficial modified layers and influence of ion implantation on the adhesion and proliferation of keratinocytes were studied

  18. Tumor necrosis factor beta and ultraviolet radiation are potent regulators of human keratinocyte ICAM-1 expression

    International Nuclear Information System (INIS)

    Krutmann, J.; Koeck, A.S.; Schauer, E.; Parlow, F.; Moeller, A.K.; Kapp, A.; Foerster, E.S.; Schoepf, E.L.; Luger, T.A.

    1990-01-01

    Intercellular adhesion molecule-1 (ICAM-1) functions as a ligand of leukocyte function-associated antigen-1 (LFA-1), as well as a receptor for human picorna virus, and its regulation thus affects various immunologic and inflammatory reactions. The weak, constitutive ICAM-1 expression on human keratinocytes (KC) can be up-regulated by cytokines such as interferon-gamma (IFN gamma) and tumor necrosis factor alpha (TNF alpha). In order to further examine the regulation of KC ICAM-1 expression, normal human KC or epidermoid carcinoma cells (KB) were incubated with different cytokines and/or exposed to ultraviolet (UV) radiation. Subsequently, ICAM-1 expression was monitored cytofluorometrically using a monoclonal anti-ICAM-1 antibody. Stimulation of cells with recombinant human (rh) interleukin (IL) 1 alpha, rhIL-4, rhIL-5, rhIL-6, rh granulocyte/macrophage colony-stimulating factor (GM-CSF), rh interferon alpha (rhIFN alpha), and rh transforming growth factor beta (TGF beta) did not increase ICAM-1 surface expression. In contrast, rhTNF beta significantly up-regulated ICAM-1 expression in a time- and dose-dependent manner. Moreover, the combination of rhTNF beta with rhIFN gamma increased the percentage of ICAM-1-positive KC synergistically. This stimulatory effect of rhTNF beta was further confirmed by the demonstration that rhTNF beta was capable of markedly enhancing ICAM-1 mRNA expression in KC. Finally, exposure of KC in vitro to sublethal doses of UV radiation (0-100 J/m2) prior to cytokine (rhIFN tau, rhTNF alpha, rhTNF beta) stimulation inhibited ICAM-1 up-regulation in a dose-dependent fashion. These studies identify TNF beta and UV light as potent regulators of KC ICAM-1 expression, which may influence both attachment and detachment of leukocytes and possibly viruses to KC

  19. Protection against 2-chloroethyl ethyl sulfide (CEES) - induced cytotoxicity in human keratinocytes by an inducer of the glutathione detoxification pathway

    International Nuclear Information System (INIS)

    Abel, Erika L.; Bubel, Jennifer D.; Simper, Melissa S.; Powell, Leslie; McClellan, S. Alex; Andreeff, Michael; MacLeod, Michael C.; DiGiovanni, John

    2011-01-01

    Sulfur mustard (SM or mustard gas) was first used as a chemical warfare agent almost 100 years ago. Due to its toxic effects on the eyes, lungs, and skin, and the relative ease with which it may be synthesized, mustard gas remains a potential chemical threat to the present day. SM exposed skin develops fluid filled bullae resulting from potent cytotoxicity of cells lining the basement membrane of the epidermis. Currently, there are no antidotes for SM exposure; therefore, chemopreventive measures for first responders following an SM attack are needed. Glutathione (GSH) is known to have a protective effect against SM toxicity, and detoxification of SM is believed to occur, in part, via GSH conjugation. Therefore, we screened 6 potential chemopreventive agents for ability to induce GSH synthesis and protect cultured human keratinocytes against the SM analog, 2-chloroethyl ethyl sulfide (CEES). Using NCTC2544 human keratinocytes, we found that both sulforaphane and methyl-2-cyano-3,12-dioxooleana-1,9-dien-28-oate (CDDO-Me) stimulated nuclear localization of Nrf2 and induced expression of the GSH synthesis gene, GCLM. Additionally, we found that treatment with CDDO-Me elevated reduced GSH content of NCTC2544 cells and preserved their viability by ∼ 3-fold following exposure to CEES. Our data also suggested that CDDO-Me may act additively with 2,6-dithiopurine (DTP), a nucleophilic scavenging agent, to increase the viability of keratinocytes exposed to CEES. These results suggest that CDDO-Me is a promising chemopreventive agent for SM toxicity in the skin. - Highlights: → CDDO-Me treatment increased intracellular GSH in human keratinocytes. → CDDO-Me increased cell viability following exposure to the half-mustard, CEES. → The cytoprotective effect of CDDO-Me was likely due to scavenging with endogenous GSH.

  20. Radiation-induced genomic instability is associated with DNA methylation changes in cultured human keratinocytes

    International Nuclear Information System (INIS)

    Kaup, Sahana; Grandjean, Valerie; Mukherjee, Rajarshi; Kapoor, Aparna; Keyes, Edward; Seymour, Colin B.; Mothersill, Carmel E.; Schofield, Paul N.

    2006-01-01

    The mechanism by which radiation-induced genomic instability is initiated, propagated and effected is currently under intense scrutiny. We have investigated the potential role of altered genomic methylation patterns in the cellular response to irradiation and have found evidence for widespread dysregulation of CpG methylation persisting up to 20 population doublings post-irradiation. Similar effects are seen with cells treated with medium from irradiated cells (the 'bystander effect') rather than subjected to direct irradiation. Using an arbitrarily primed methylation sensitive PCR screening method we have demonstrated that irradiation causes reproducible alterations in the methylation profile of a human keratinocyte cell line, HPV-G, and have further characterised one of these sequences as being a member of a retrotransposon element derived sequence family on chromosome 7; MLT1A. Multiple changes were also detected in the screen, which indicate that although the response of cells is predominantly hypermethylation, specific hypomethylation occurs as well. Sequence specific changes are also reported in the methylation of the pericentromeric SAT2 satellite sequence. This is the first demonstration that irradiation results in the induction of heritable methylation changes in mammalian cells, and provides a link between the various non-radiological instigators of genomic instability, the perpetuation of the unstable state and several of its manifestations

  1. The radiosensitivity of human keratinocytes: influence of activated c-H-ras oncogene expression and tumorigenicity

    International Nuclear Information System (INIS)

    Mendonca, M.S.; Redpath, J.L.; Stanbridge, E.J.

    1991-01-01

    The authors investigated γ-ray sensitivity of several activated c-H-ras (EJ) containing clones established after transfection of the spontaneously immortalized non-tumorigenic human keratinocyte cell line HaCaT. The clones were grouped according to tumorigenic potential after subcutaneous injection into nude mice, and fell into three classes: Class I clones A-4 and I-6 are non-tumorigenic and express very low levels of c-H-ras mRNA and no mutated ras protein (p 21 ); Class II clones I-5 and I-7 grow to large (benign) epidermal cysts, express intermediate to high c-H-ras mRNA and variable levels of mutated ras p 21 protein with clone I-5 expressing little and clone I-7 expressing high levels of p 21 ; Class III clones II-3 and II-4 grow to solid squamous cell carcinomas, express high c-H-ras mRNA and high level of mutated p 21 ras protein similar to clone I-7. Comparison of single-hit multitarget or linear-quadratic survival curve parameters, and survival at 2Gy (S 2 ) indicate no general correlation with either activated c-H-ras expression level or tumorigenic potential, and increased radioresistance. (author)

  2. Postirradiation expression of lethal mutations in an immortalized human keratinocyte cell line

    International Nuclear Information System (INIS)

    O'Reilly, S.; Mothersill, C.; Seymour, C.B.

    1994-01-01

    The quantification of the extent of delayed cell death and the rate and pattern of its occurrence in relation to the cell division cycle is important in radiotherapy and also in radiation transformation studies related to protection and dose limits. Here the numbers of lethal mutations occurring over 45 population doublings (clonal expansion to about 10 13 cells per cell originally surviving irradiation) was measured in an HPV 16 immortalized human keratinocyte cell lines used for transformation studies. The results showed that when postirradiation (dose range 1-6 Gy) growth curves were constructed, the difference in slopes could be accounted for entirely by correcting for the non-clonogenic fraction in the cell count, excluding a longer cell generation time as an explanation. When the cell loss was examined over the entire growth period of 6 weeks (about 45 doublings of the cell population), it was found to be dose dependent for the first two passages, but then to become more independent of dose. The results allow a time/cell generation dependent factor to be derived for the cell line and used in survival curve equations where effects of radiation are being measured at times distant from the original exposure. (author)

  3. The effect of melanin on the bystander effect in human keratinocytes

    Energy Technology Data Exchange (ETDEWEB)

    Mosse, I. [Institute of Genetics and Cytology of the National Academy of Sciences, Academicheskaya Str. 27, Minsk (Belarus)]. E-mail: i.mosse@igc.bas-net.by; Marozik, P. [Institute of Genetics and Cytology of the National Academy of Sciences, Academicheskaya Str. 27, Minsk (Belarus); Radiation and Environmental Science Centre, DIT, Dublin 8 (Ireland); Seymour, C. [Department of Medical Physics and Applied Radiation Sciences, McMaster University, Hamilton, Ont. (Canada); Mothersill, C. [Department of Medical Physics and Applied Radiation Sciences, McMaster University, Hamilton, Ont. (Canada)

    2006-05-11

    The influence of melanin on radiation-induced bystander effects has been studied. Melanin is known to be a natural substance with proved radioprotective properties in different organisms and cell lines. It is non-toxic and is effective against acute and chronic irradiation. The lower the radiation dose, the higher the relative impact of melanin protection. In this study influence of melanin on human keratinocytes (HPV-G cells) has been studied using the colony-forming assay. We have shown that bystander donor medium from 0.5 Gy irradiated cells when transferred to unirradiated cells, caused almost the same effect as direct irradiation. Melanin increased the colony-forming ability of bystander recipient cells when it was added into culture medium before irradiation. The effect of melanin added after irradiation was to produce less protection in both the directly irradiated and bystander medium treated groups. The absorption spectrum of the filtered medium is identical to one of the intact culture medium showing that melanin was not present in filtered medium. Thus, it cannot protect recipient cells but reduces the amount of the bystander effect. It is concluded that melanin added before irradiation effectively decreased the radiation dose. The reduction of the impact of the bystander signal on recipient cells when melanin was added to the donor medium after harvest but before filtration, may mean that the bystander signal has a physical component as melanin can absorb all types of physical energy.

  4. Toll like receptors gene expression of human keratinocytes cultured of severe burn injury.

    Science.gov (United States)

    Cornick, Sarita Mac; Noronha, Silvana Aparecida Alves Corrêa de; Noronha, Samuel Marcos Ribeiro de; Cezillo, Marcus V B; Ferreira, Lydia Masako; Gragnani, Alfredo

    2014-01-01

    To evaluate the expression profile of genes related to Toll Like Receptors (TLR) pathways of human Primary Epidermal keratinocytes of patients with severe burns. After obtaining viable fragments of skin with and without burning, culture hKEP was initiated by the enzymatic method using Dispase (Sigma-Aldrich). These cells were treated with Trizol(r) (Life Technologies) for extraction of total RNA. This was quantified and analyzed for purity for obtaining cDNA for the analysis of gene expression using specific TLR pathways PCR Arrays plates (SA Biosciences). After the analysis of gene expression we found that 21% of these genes were differentially expressed, of which 100% were repressed or hyporegulated. Among these, the following genes (fold decrease): HSPA1A (-58), HRAS (-36), MAP2K3 (-23), TOLLIP (-23), RELA (-18), FOS (-16), and TLR1 (-6.0). This study contributes to the understanding of the molecular mechanisms related to TLR pathways and underlying wound infection caused by the burn. Furthermore, it may provide new strategies to restore normal expression of these genes and thereby change the healing process and improve clinical outcome.

  5. Innate and adaptive immunity gene expression of human keratinocytes cultured of severe burn injury.

    Science.gov (United States)

    Noronha, Silvana Aparecida Alves Corrêa de; Noronha, Samuel Marcos Ribeiro de; Lanziani, Larissa Elias; Ferreira, Lydia Masako; Gragnani, Alfredo

    2014-01-01

    Evaluate the expression profile of genes related to Innate and Adaptive Immune System (IAIS) of human Primary Epidermal keratinocytes (hPEKP) of patients with severe burns. After obtaining viable fragments of skin with and without burning, culture hKEP was initiated by the enzymatic method using Dispase (Sigma-Aldrich). These cells were treated with Trizol(r) (Life Technologies) for extraction of total RNA. This was quantified and analyzed for purity for obtaining cDNA for the analysis of gene expression using specific IAIS PCR Arrays plates (SA Biosciences). After the analysis of gene expression we found that 63% of these genes were differentially expressed, of which 77% were repressed and 23% were hyper-regulated. Among these, the following genes (fold increase or decrease): IL8 (41), IL6 (32), TNF (-92), HLA-E (-86), LYS (-74), CCR6 (- 73), CD86 (-41) and HLA-A (-35). This study contributes to the understanding of the molecular mechanisms underlying wound infection caused by the burn. Furthermore, it may provide new strategies to restore normal expression of these genes and thereby change the healing process and improve clinical outcome.

  6. The effect of melanin on the bystander effect in human keratinocytes

    International Nuclear Information System (INIS)

    Mosse, I.; Marozik, P.; Seymour, C.; Mothersill, C.

    2006-01-01

    The influence of melanin on radiation-induced bystander effects has been studied. Melanin is known to be a natural substance with proved radioprotective properties in different organisms and cell lines. It is non-toxic and is effective against acute and chronic irradiation. The lower the radiation dose, the higher the relative impact of melanin protection. In this study influence of melanin on human keratinocytes (HPV-G cells) has been studied using the colony-forming assay. We have shown that bystander donor medium from 0.5 Gy irradiated cells when transferred to unirradiated cells, caused almost the same effect as direct irradiation. Melanin increased the colony-forming ability of bystander recipient cells when it was added into culture medium before irradiation. The effect of melanin added after irradiation was to produce less protection in both the directly irradiated and bystander medium treated groups. The absorption spectrum of the filtered medium is identical to one of the intact culture medium showing that melanin was not present in filtered medium. Thus, it cannot protect recipient cells but reduces the amount of the bystander effect. It is concluded that melanin added before irradiation effectively decreased the radiation dose. The reduction of the impact of the bystander signal on recipient cells when melanin was added to the donor medium after harvest but before filtration, may mean that the bystander signal has a physical component as melanin can absorb all types of physical energy

  7. Blockage of JNK pathway enhances arsenic trioxide-induced apoptosis in human keratinocytes

    International Nuclear Information System (INIS)

    Huang, H.-S.; Liu, Z.-M.; Hong, D.-Y.

    2010-01-01

    Arsenic is well known as a carcinogen predisposing humans to some severe diseases and also as an effective medicine for treating acute promyelocytic leukemia, syphilis, and psoriasis. Multiple active mechanisms, including cell cycle arrest and apoptosis, have been proposed in therapy; however, the opposing effects of arsenic remain controversial. Our previous study found that arsenic trioxide (ATO)-induced activation of p21 WAF1/CIP1 (p21) led to A431 cell death through the antagonistic effects of the signaling of ERK1/2 and JNK1. In the current study, the inhibitory effects of JNK1 on ATO-induced p21 expression were explored. Over-expression of JNK1 in A431 cells could inhibit p21 expression, which was associated with HDAC1 and TGIF. Using the GST pull-down assay and fluorescence resonance energy transfer analysis, N-terminal domain (amino acids 1-108) of TGIF, critical to its binding with c-Jun, was found. Using reporter assays, requirement of the C-terminal domain (amino acids 138-272) of TGIF to suppress ATO-induced p21 expression was observed. Thus, the domains of TGIF that carried out its inhibitory effects on p21 were identified. Finally, treatment with JNK inhibitor SP600125 could enhance ATO-induced apoptosis of HaCaT keratinocytes by using flow cytometry.

  8. How Does Chronic Cigarette Smoke Exposure Affect Human Skin? A Global Proteomics Study in Primary Human Keratinocytes.

    Science.gov (United States)

    Rajagopalan, Pavithra; Nanjappa, Vishalakshi; Raja, Remya; Jain, Ankit P; Mangalaparthi, Kiran K; Sathe, Gajanan J; Babu, Niraj; Patel, Krishna; Cavusoglu, Nükhet; Soeur, Jeremie; Pandey, Akhilesh; Roy, Nita; Breton, Lionel; Chatterjee, Aditi; Misra, Namita; Gowda, Harsha

    2016-11-01

    Cigarette smoking has been associated with multiple negative effects on human skin. Long-term physiological effects of cigarette smoke are through chronic and not acute exposure. Molecular alterations due to chronic exposure to cigarette smoke remain unclear. Primary human skin keratinocytes chronically exposed to cigarette smoke condensate (CSC) showed a decreased wound-healing capacity with an increased expression of NRF2 and MMP9. Using quantitative proteomics, we identified 4728 proteins, of which 105 proteins were overexpressed (≥2-fold) and 41 proteins were downregulated (≤2-fold) in primary skin keratinocytes chronically exposed to CSC. We observed an alteration in the expression of several proteins involved in maintenance of epithelial barrier integrity, including keratin 80 (5.3 fold, p value 2.5 × 10 -7 ), cystatin A (3.6-fold, p value 3.2 × 10 -3 ), and periplakin (2.4-fold, p value 1.2 × 10 -8 ). Increased expression of proteins associated with skin hydration, including caspase 14 (2.2-fold, p value 4.7 × 10 -2 ) and filaggrin (3.6-fold, p value 5.4 × 10 -7 ), was also observed. In addition, we report differential expression of several proteins, including adipogenesis regulatory factor (2.5-fold, p value 1.3 × 10 -3 ) and histone H1.0 (2.5-fold, p value 6.3 × 10 -3 ) that have not been reported earlier. Bioinformatics analyses demonstrated that proteins differentially expressed in response to CSC are largely related to oxidative stress, maintenance of skin integrity, and anti-inflammatory responses. Importantly, treatment with vitamin E, a widely used antioxidant, could partially rescue adverse effects of CSC exposure in primary skin keratinocytes. The utility of antioxidant-based new dermatological formulations in delaying or preventing skin aging and oxidative damages caused by chronic cigarette smoke exposure warrants further clinical investigations and multi-omics research.

  9. Dynamic changes in nicotinamide pyridine dinucleotide content in normal human epidermal keratinocytes and their effect on retinoic acid biosynthesis

    International Nuclear Information System (INIS)

    Pinkas-Sarafova, Adriana; Markova, N.G.; Simon, M.

    2005-01-01

    The function of many enzymes that regulate metabolism and transcription depends critically on the nicotinamide pyridine dinucleotides. To understand the role of NAD(P)(H) in physiology and pathophysiology, it is imperative to estimate both their amount and ratios in a given cell type. In human epidermis and in cultured epidermal keratinocytes, we found that the total dinucleotide content is in the low millimolar range. The dinucleotide pattern changes during proliferation and maturation of keratinocytes in culture. Differences in the concentrations of NAD(P)(H) of 1.5- to 12-fold were observed. This resulted in alteration of the NAD(P)H/NAD(P) ratio, which could impact the differential regulation of both transcriptional and metabolic processes. In support of this notion, we provide evidence that the two-step oxidation of retinol to retinoic acid, a nuclear hormone critical for epidermal homeostasis, can be regulated by the relative physiological amounts of the pyridine dinucleotides

  10. IFN-β antiproliferative effect and miRNA regulation in Human Papilloma Virus E6- and E7-transformed keratinocytes.

    Science.gov (United States)

    Chiantore, Maria Vincenza; Mangino, Giorgio; Iuliano, Marco; Zangrillo, Maria Simona; De Lillis, Ilaria; Vaccari, Gabriele; Accardi, Rosita; Tommasino, Massimo; Fiorucci, Gianna; Romeo, Giovanna

    2017-01-01

    Human Papilloma Viruses (HPVs) are the causative agents of cervical cancer although other types of cancers are associated with HPV infection. Type I Interferons can interfere with HPV E6- and/or E7-dependent transformation and can affect microRNA (miRNA) expression. Cancer cells show a specific pattern of miRNA expression and HPVs are able to modulate miRNAs expressed in infected cells. Keratinocytes transduced with E6 and E7 from mucosal HPV-16 or cutaneous HPV-38 (K16 and K38) were studied to analyze the involvement of HPV oncoproteins in the anti-proliferative activity of IFN-β. In view of our previous data showing senescence induction by the cytokine in K38 cells, we observe that IFN-β treatment leads to p53-indipendent apoptosis in K16 cells whereas induces senescence in K16 cells if E6 is silenced and p53 expression is restored. The levels of selected miRNAs, deregulated in K16 and K38 cells, can be modulated by IFN-β when E6 and E7 proteins of HPV-16, but not HPV-38, are expressed. Copyright © 2015 Elsevier Ltd. All rights reserved.

  11. Six1 overexpression at early stages of HPV16-mediated transformation of human keratinocytes promotes differentiation resistance and EMT

    International Nuclear Information System (INIS)

    Xu, Hanwen; Pirisi, Lucia; Creek, Kim E.

    2015-01-01

    Previous studies in our laboratory discovered that SIX1 mRNA expression increased during in vitro progression of HPV16-immortalized human keratinocytes (HKc/HPV16) toward a differentiation-resistant (HKc/DR) phenotype. In this study, we explored the role of Six1 at early stages of HPV16-mediated transformation by overexpressing Six1 in HKc/HPV16. We found that Six1 overexpression in HKc/HPV16 increased cell proliferation and promoted cell migration and invasion by inducing epithelial–mesenchymal transition (EMT). Moreover, the overexpression of Six1 in HKc/HPV16 resulted in resistance to serum and calcium-induced differentiation, which is the hallmark of the HKc/DR phenotype. Activation of MAPK in HKc/HPV16 overexpressing Six1 is linked to resistance to calcium-induced differentiation. In conclusion, this study determined that Six1 overexpression resulted in differentiation resistance and promoted EMT at early stages of HPV16-mediated transformation of human keratinocytes. - Highlights: • Six1 expression increases during HPV16-mediated transformation. • Six1 overexpression causes differentiation resistance in HPV16-immortalized cells. • Six1 overexpression in HPV16-immortalized keratinocytes activates MAPK. • Activation of MAPK promotes EMT and differentiation resistance. • Six1 overexpression reduces Smad-dependent TGF-β signaling

  12. Influence of acidic pH on keratinocyte function and re-epithelialisation of human in vitro wounds.

    Science.gov (United States)

    Lönnqvist, Susanna; Emanuelsson, Peter; Kratz, Gunnar

    2015-01-01

    Chronic wounds are one of the greatest challenges for the healthcare system. Today, a plethora of dressings are used in the treatment of these wounds, each with specific influence on the wound environment. Due to differences in the permeability of the dressings the use will result in differences in the pH balance in the wound bed. However, little is known about how changes in the pH in the wound environment affect the different phases of the healing process. The aim of the present study was to investigate the effects of acidic pH on the regeneration phase by studying keratinocyte function in vitro and re-epithelialisation in an in vitro model of human skin. In vitro assays showed reduced viability and migration rates in human keratinocytes when pH was lowered. Real time PCR revealed differential expression of genes related to wound healing and environmental impairment. Tissue culture showed no re-epithelialisation of wounds subjected to pH 5.0 and moderate re-epithelialisation at pH 6.0, compared to controls at pH 7.4. The results indicate that lowering pH down to pH 5.0 in wounds is counterproductive in aspect of keratinocyte function which is crucial for successful wound healing.

  13. Ski protein levels increase during in vitro progression of HPV16-immortalized human keratinocytes and in cervical cancer

    International Nuclear Information System (INIS)

    Chen, Yi; Pirisi, Lucia; Creek, Kim E.

    2013-01-01

    We compared the levels of the Ski oncoprotein, an inhibitor of transforming growth factor-beta (TGF-β) signaling, in normal human keratinocytes (HKc), HPV16 immortalized HKc (HKc/HPV16), and differentiation resistant HKc/HPV16 (HKc/DR) in the absence and presence of TGF-β. Steady-state Ski protein levels increased in HKc/HPV16 and even further in HKc/DR, compared to HKc. TGF-β treatment of HKc, HKc/HPV16, and HKc/DR dramatically decreased Ski. TGF-β-induced Ski degradation was delayed in HKc/DR. Ski and phospho-Ski protein levels are cell cycle dependent with maximal Ski expression and localization to centrosomes and mitotic spindles during G2/M. ShRNA knock down of Ski in HKc/DR inhibited cell proliferation. More intense nuclear and cytoplasmic Ski staining and altered Ski localization were found in cervical cancer samples compared to adjacent normal tissue in a cervical cancer tissue array. Overall, these studies demonstrate altered Ski protein levels, degradation and localization in HPV16-transformed human keratinocytes and in cervical cancer. - Highlights: • Ski oncoprotein levels increase during progression of HPV16-transformed cells. • Ski and phospho-Ski protein levels are cell cycle dependent. • Ski knock-down in HPV16-transformed keratinocytes inhibited cell proliferation. • Cervical cancer samples overexpress Ski

  14. Incorporation and distribution of dihomo-gamma-linolenic acid, arachidonic acid, and eicosapentaenoic acid in cultured human keratinocytes

    International Nuclear Information System (INIS)

    Punnonen, K.; Puustinen, T.; Jansen, C.T.

    1986-01-01

    Human keratinocytes in culture were labelled with 14 C-dihomo-gamma-linolenic acid, 14 C-arachidonic acid or 14 C-eicosapentaenoic acid. All three eicosanoid precursor fatty acids were effectively incorporated into the cells. In phospholipids most of the radioactivity was recovered, in neutral lipids a substantial amount, and as free unesterified fatty acids only a minor amount. Most of the radioactivity was found in phosphatidylethanolamine which was also the major phospholipid as measured by phosphorous assay. The incorporation of dihomo-gamma-linolenic acid and arachidonic acid into lipid subfractions was essentially similar. Eicosapentaenoic acid was, however, much less effectively incorporated into phosphatidylinositol + phosphatidylserine and, correspondingly, more effectively into triacylglycerols as compared to the two other precursor fatty acids. Once incorporated, the distribution of all three precursor fatty acids was relatively stable, and only minor amounts of fatty acids were released into the culture medium during short term culture (two days). Our study demonstrates that eicosanoid precursor fatty acids are avidly taken up by human keratinocytes and esterified into membrane lipids. The clinical implication of this finding is that dietary manipulations might be employed to cause changes in the fatty acid composition of keratinocytes

  15. Activation of endogenous opioid gene expression in human keratinocytes and fibroblasts by pulsed radiofrequency energy fields

    Directory of Open Access Journals (Sweden)

    Moffett J

    2012-09-01

    Full Text Available John Moffett,1 Linley M Fray,1 Nicole J Kubat21Life Science Department, 2Independent Consultant, Regenesis Biomedical Inc, Scottsdale, AZ, USABackground: Pulsed radiofrequency energy (PRFE fields are being used increasingly for the treatment of pain arising from dermal trauma. However, despite their increased use, little is known about the biological and molecular mechanism(s responsible for PRFE-mediated analgesia. In general, current therapeutics used for analgesia target either endogenous factors involved in inflammation, or act on endogenous opioid pathways.Methods and Results: Using cultured human dermal fibroblasts (HDF and human epidermal keratinocytes (HEK, we investigated the effect of PRFE treatment on factors, which are involved in modulating peripheral analgesia in vivo. We found that PRFE treatment did not inhibit cyclooxygenase enzyme activity, but instead had a positive effect on levels of endogenous opioid precursor mRNA (proenkephalin, pro-opiomelanocortin, prodynorphin and corresponding opioid peptide. In HEK cells, increases in opioid mRNA were dependent, at least in part, on endothelin-1. In HDF cells, additional pathways also appear to be involved. PRFE treatment was also followed by changes in endogenous expression of several cytokines, including increased levels of interleukin-10 mRNA and decreased levels of interleukin-1β mRNA in both cell types.Conclusion: These findings provide a new insight into the molecular mechanism underlying PRFE-mediated analgesia reported in the clinical setting.Keywords: peripheral analgesia, endogenous opioids, endothelin-1, endothelin receptor A, endothelin receptor B, pulsed radiofrequency energy field, cyclooxygenase

  16. Lysophosphatidic acid induces expression of genes in human oral keratinocytes involved in wound healing.

    Science.gov (United States)

    Thorlakson, Hong Huynh; Engen, Stian Andre; Schreurs, Olav; Schenck, Karl; Blix, Inger Johanne Schytte

    2017-08-01

    Epithelial cells participate in wound healing by covering wounds, but also as important mediators of wound healing processes. Topical application of the phospholipid growth factor lysophosphatidic acid (LPA) accelerates dermal wound healing and we hypothesized that LPA can play a role in human oral wound healing through its effects on human oral keratinocytes (HOK). HOK were isolated from gingival biopsies and exposed to LPA. The LPA receptor profile, signal transduction pathways, gene expression and secretion of selected cytokines were analyzed. HOK expressed the receptors LPA 1 , LPA 5 and LPA 6 and LPA activated the ERK1/2, JNK and p38 intracellular pathways, substantiated by secretion of IL-6 and IL-8. The early (2h) and intermediate (6h) gene expression profiles of HOK after LPA treatment showed a wide array of regulated genes. The majority of the strongest upregulated genes were related to chemotaxis and inflammation, and became downregulated after 6h. At 6h, genes coding for factors involved in extracellular matrix remodeling and re-epithelialization became highly expressed. IL-36γ, not earlier known to be regulated by LPA, was strongly transcribed and translated but not secreted. After stimulation with LPA, HOK responded by regulating factors and genes that are essential in wound healing processes. As LPA is found in saliva and is released by activated cells after wounding, our results indicate that LPA has a favorable physiological role in oral wound healing. This may further point towards a beneficial role for application of LPA on oral surgical or chronic wounds. Copyright © 2017 Elsevier Ltd. All rights reserved.

  17. Expression and purification of recombinant truncated human keratinocyte growth factor-1

    International Nuclear Information System (INIS)

    Deng Lin; Ma Jisheng; Liu Xiaoju; Wang Xiaojie; Li Xiaokun; Gong Shouliang; Wang Huiyan; Tian Haishan

    2010-01-01

    Objective: To construct the genetic engineering bacteria highly expressing 23 amino acids human keratinocyte growth factor-1 (rhKGF1 dest23 ) missing N terminal, and provide experimental data for development of new drug for treatment of oral mucositis after radiotherapy and chemotherapy. Methods: PCR was used to synthese 23 amino acids rhKGF1 dest23 missing N terminal and sumo gene fragments, and construct four kinds of recombinant prokaryotic expression vectors: pET22b-rhKGF1 dest23 , pET22b-sumo-rhKGF1 dest23 , pET3c-rhKGF1 dest23 and pET3c-sumo-rhKGF1 dest23 , then they were transformed into prokaryotic expression host bacteria: Rosetta (DE3) plysS, BL21 (DE3), BL21 (DE3) Star plysS, origima(DE3) and BL21AI, the best expression combination of plasmid and host strain of rhKGF1 dest23 protein was screened and purified by CM ion-exchange and heparin affinity chromatography and identified with Western blotting. Results: pET22b-rhKGF1 dest23 plasmid and the BL21AI host bacteria was the best combination of expression, after induced by IPTG and arabinose, the majority of recombinant protein was expressed in soluble form, accounting for about 12% of the total bacterial proteins. Its purity reached to more than 95% of the protein after two steps chromatography, then conformed with Western blotting. Conclusion: Human genetic engineering bacteria of KGF1 dest23 is successfully constructed and induced by IPTG and arabinose, then after CM weak cation exchange and heparin affinity chromatography, the purified rhKGF1 dest23 protein is obtained. (authors)

  18. Recombinant human parvovirus B19 vectors: erythroid cell-specific delivery and expression of transduced genes.

    Science.gov (United States)

    Ponnazhagan, S; Weigel, K A; Raikwar, S P; Mukherjee, P; Yoder, M C; Srivastava, A

    1998-06-01

    A novel packaging strategy combining the salient features of two human parvoviruses, namely the pathogenic parvovirus B19 and the nonpathogenic adeno-associated virus type 2 (AAV), was developed to achieve erythroid cell-specific delivery as well as expression of the transduced gene. The development of such a chimeric vector system was accomplished by packaging heterologous DNA sequences cloned within the inverted terminal repeats of AAV and subsequently packaging the DNA inside the capsid structure of B19 virus. Recombinant B19 virus particles were assembled, as evidenced by electron microscopy as well as DNA slot blot analyses. The hybrid vector failed to transduce nonerythroid human cells, such as 293 cells, as expected. However, MB-02 cells, a human megakaryocytic leukemia cell line which can be infected by B19 virus following erythroid differentiation with erythropoietin (N. C. Munshi, S. Z. Zhou, M. J. Woody, D. A. Morgan, and A. Srivastava, J. Virol. 67:562-566, 1993) but lacks the putative receptor for AAV (S. Ponnazhagan, X.-S. Wang, M. J. Woody, F. Luo, L. Y. Kang, M. L. Nallari, N. C. Munshi, S. Z. Zhou, and A. Srivastava, J. Gen. Virol. 77:1111-1122, 1996), were readily transduced by this vector. The hybrid vector was also found to specifically target the erythroid population in primary human bone marrow cells as well as more immature hematopoietic progenitor cells following erythroid differentiation, as evidenced by selective expression of the transduced gene in these target cells. Preincubation with anticapsid antibodies against B19 virus, but not anticapsid antibodies against AAV, inhibited transduction of primary human erythroid cells. The efficiency of transduction of primary human erythroid cells by the recombinant B19 virus vector was significantly higher than that by the recombinant AAV vector. Further development of the AAV-B19 virus hybrid vector system should prove beneficial in gene therapy protocols aimed at the correction of inherited and

  19. Recombinant Human Parvovirus B19 Vectors: Erythroid Cell-Specific Delivery and Expression of Transduced Genes

    Science.gov (United States)

    Ponnazhagan, Selvarangan; Weigel, Kirsten A.; Raikwar, Sudhanshu P.; Mukherjee, Pinku; Yoder, Mervin C.; Srivastava, Arun

    1998-01-01

    A novel packaging strategy combining the salient features of two human parvoviruses, namely the pathogenic parvovirus B19 and the nonpathogenic adeno-associated virus type 2 (AAV), was developed to achieve erythroid cell-specific delivery as well as expression of the transduced gene. The development of such a chimeric vector system was accomplished by packaging heterologous DNA sequences cloned within the inverted terminal repeats of AAV and subsequently packaging the DNA inside the capsid structure of B19 virus. Recombinant B19 virus particles were assembled, as evidenced by electron microscopy as well as DNA slot blot analyses. The hybrid vector failed to transduce nonerythroid human cells, such as 293 cells, as expected. However, MB-02 cells, a human megakaryocytic leukemia cell line which can be infected by B19 virus following erythroid differentiation with erythropoietin (N. C. Munshi, S. Z. Zhou, M. J. Woody, D. A. Morgan, and A. Srivastava, J. Virol. 67:562–566, 1993) but lacks the putative receptor for AAV (S. Ponnazhagan, X.-S. Wang, M. J. Woody, F. Luo, L. Y. Kang, M. L. Nallari, N. C. Munshi, S. Z. Zhou, and A. Srivastava, J. Gen. Virol. 77:1111–1122, 1996), were readily transduced by this vector. The hybrid vector was also found to specifically target the erythroid population in primary human bone marrow cells as well as more immature hematopoietic progenitor cells following erythroid differentiation, as evidenced by selective expression of the transduced gene in these target cells. Preincubation with anticapsid antibodies against B19 virus, but not anticapsid antibodies against AAV, inhibited transduction of primary human erythroid cells. The efficiency of transduction of primary human erythroid cells by the recombinant B19 virus vector was significantly higher than that by the recombinant AAV vector. Further development of the AAV-B19 virus hybrid vector system should prove beneficial in gene therapy protocols aimed at the correction of inherited

  20. The Effects of Antifungal Azoles on Inflammatory Cytokine Production in Human Keratinocytes

    Directory of Open Access Journals (Sweden)

    K Zomorodian

    2008-04-01

    Full Text Available ABSTRACT: Introduction & Objective: Azoles drugs are being used successfully in treatment of fungal infections. Recently, immunosuppressive effects of some of these agents have been reported. Keratinocytes, as the major cells of the skin, have an important role in innate immunity against pathogenic agents. Considering the scanty of information about the effects of azoles on immune responces, this study was conducted to assess the expression and secretion of inflammatory cytokines in keratinocytes following treatment with azole drugs. Materials & Methods: This is an exprimental study conducted in in molecular biology division in Tehran University of Medical Sciences and Immunodermatology Department in Vienna Medical University. Primery keratinocytes were cultured and treated with different concentrations of fluconazole, itraconazole, ketoconazole and griseofulvin. Secreted IL1, IL6 and TNF-α by keratinocytes in culture supernatant were measured by quantitative enzyme immunoassay technique. Moreover, expression of the genes encoding IL1 and IL8 was evaluated by Real Time-PCR. Results: Treatment of keratinocytes with different concentrations of fluconazole and low concentration of ketoconazole resulted in decrease in IL1 secretion, but Itraconazole and griseofulvin did not show such an effect at the same concentrations. In addition, none of the examined drugs had an effect on secretion level of IL6 and TNF-α. Quantitative analysis of IL1 and IL8 encoding genes revealed that transcription on these genes might be suppressed following treatment with fluconazole or ketoconazole. Conclusion: Fluconazole and ketoconazole might modulate the expression and secretion of IL1 and IL8 and affect the direction of immune responses induced by keratinocytes

  1. Sustainability of keratinocyte gene transfer and cell survival in vivo.

    Science.gov (United States)

    Choate, K A; Khavari, P A

    1997-05-20

    The epidermis is an attractive site for therapeutic gene delivery because it is accessible and capable of delivering polypeptides to the systemic circulation. A number of difficulties, however, have emerged in attempts at cutaneous gene delivery, and central among these is an inability to sustain therapeutic gene production. We have examined two major potential contributing factors, viral vector stamina and involvement of long-lived epidermal progenitor cells. Human keratinocytes were either untreated or transduced with a retroviral vector for beta-galactosidase (beta-Gal) at > 99% efficiency and then grafted onto immunodeficient mice to regenerate human epidermis. Human epidermis was monitored in vivo after grafting for clinical and histologic appearance as well as for gene expression. Although integrated vector sequences persisted unchanged in engineered epidermis at 10 weeks post-grafting, retroviral long terminal repeat (LTR)-driven beta-Gal expression ceased in vivo after approximately 4 weeks. Endogenous cellular promoters, however, maintained consistently normal gene expression levels without evidence of time-dependent decline, as determined by immunostaining with species-specific antibodies for human involucrin, filaggrin, keratinocyte transglutaminase, keratin 10, type VII collagen, and Laminin 5 proteins out to week 14 post-grafting. Transduced human keratinocytes generated multilayer epidermis sustained through multiple epidermal turnover cycles; this epidermis demonstrated retention of a spatially appropriate pattern of basal and suprabasal epidermal marker gene expression. These results confirm previous findings suggesting that viral promoter-driven gene expression is not durable and demonstrate that keratinocytes passaged in vitro can regenerate and sustain normal epidermis for prolonged periods.

  2. The Antimicrobial Peptide Human Beta-Defensin-3 Is Induced by Platelet-Released Growth Factors in Primary Keratinocytes

    OpenAIRE

    Andreas Bayer; Justus Lammel; Mersedeh Tohidnezhad; Sebastian Lippross; Peter Behrendt; Tim Klüter; Thomas Pufe; Jochen Cremer; Holger Jahr; Franziska Rademacher; Regine Gläser; Jürgen Harder

    2017-01-01

    Platelet-released growth factors (PRGF) and its related clinically used formulations (e.g., Vivostat Platelet-Rich Fibrin (PRF?)) contain a variety of chemokines, cytokines, and growth factors and are therefore used to support healing of chronic, hard-to-heal, or infected wounds. Human beta-defensin-3 (hBD-3) is an antimicrobial peptide inducibly expressed in human keratinocytes especially upon wounding. The potent antimicrobial activity of hBD-3 together with its wound closure-promoting acti...

  3. Human papillomavirus type 59 immortalized keratinocytes express late viral proteins and infectious virus after calcium stimulation

    International Nuclear Information System (INIS)

    Lehr, Elizabeth E.; Qadadri, Brahim; Brown, Calla R.; Brown, Darron R.

    2003-01-01

    Human papillomavirus type 59 (HPV 59) is an oncogenic type related to HPV 18. HPV 59 was recently propagated in the athymic mouse xenograft system. A continuous keratinocyte cell line infected with HPV 59 was created from a foreskin xenograft grown in an athymic mouse. Cells were cultured beyond passage 50. The cells were highly pleomorphic, containing numerous abnormally shaped nuclei and mitotic figures. HPV 59 sequences were detected in the cells by DNA in situ hybridization in a diffuse nuclear distribution. Southern blots were consistent with an episomal state of HPV 59 DNA at approximately 50 copies per cell. Analysis of the cells using a PCR/reverse blot strip assay, which amplifies a portion of the L1 open reading frame, was strongly positive. Differentiation of cells in monolayers was induced by growth in F medium containing 2 mM calcium chloride for 10 days. Cells were harvested as a single tissue-like sheet, and histologic analysis revealed a four-to-six cell-thick layer. Transcripts encoding involucrin, a cornified envelope protein, and the E1-circumflexE4 and E1-circumflexE4-circumflexL1 viral transcripts were detected after several days of growth in F medium containing 2 mM calcium chloride. The E1-circumflexE4 and L1 proteins were detected by immunohistochemical analysis, and virus particles were seen in electron micrographs in a subset of differentiated cells. An extract of differentiated cells was prepared by vigorous sonication and was used to infect foreskin fragments. These fragments were implanted into athymic mice. HPV 59 was detected in the foreskin xenografts removed 4 months later by DNA in situ hybridization and PCR/reverse blot assay. Thus, the complete viral growth cycle, including production on infectious virus, was demonstrated in the HPV 59 immortalized cells grown in a simple culture system

  4. Factors affecting ultraviolet-A photon emission from β-irradiated human keratinocyte cells.

    Science.gov (United States)

    Le, M; Mothersill, C E; Seymour, C B; Ahmad, S B; Armstrong, A; Rainbow, A J; McNeill, F E

    2015-08-21

    The luminescence intensity of 340±5 nm photons emitted from HaCaT (human keratinocyte) cells was investigated using a single-photon-counting system during cellular exposure to (90)Y β-particles. Multiple factors were assessed to determine their influence upon the quantity and pattern of photon emission from β-irradiated cells. Exposure of 1 x 10(4) cells/5 mL to 703 μCi resulted in maximum UVA photoemission at 44.8 x 10(3)±2.5 x 10(3) counts per second (cps) from live HaCaT cells (background: 1-5 cps); a 16-fold increase above cell-free controls. Significant biophoton emission was achieved only upon stimulation and was also dependent upon presence of cells. UVA luminescence was measured for (90)Y activities 14 to 703 μCi where a positive relationship between photoemission and (90)Y activity was observed. Irradiation of live HaCaT cells plated at various densities produced a distinct pattern of emission whereby luminescence increased up to a maximum at 1 x 10(4) cells/5 mL and thereafter decreased. However, this result was not observed in the dead cell population. Both live and dead HaCaT cells were irradiated and were found to demonstrate different rates of photon emission at low β activities (⩽400 μCi). Dead cells exhibited greater photon emission rates than live cells which may be attributable to metabolic processes taking place to modulate the photoemissive effect. The results indicate that photon emission from HaCaT cells is perturbed by external stimulation, is dependent upon the activity of radiation delivered, the density of irradiated cells, and cell viability. It is postulated that biophoton emission may be modulated by a biological or metabolic process.

  5. Proteomic profiling and post-translational modifications in human keratinocytes treated with Mucuna pruriens leaf extract.

    Science.gov (United States)

    Cortelazzo, Alessio; Lampariello, Raffaella L; Sticozzi, Claudia; Guerranti, Roberto; Mirasole, Cristiana; Zolla, Lello; Sacchetti, Gianni; Hajek, Joussef; Valacchi, Giuseppe

    2014-02-03

    Mucuna pruriens (Mp) is a plant belonging to the Fabaceae family, with several medicinal properties among which its potential to treat diseases where reactive oxygen species (ROS) play an important role in the pathogeneses. The aim was to investigate the effects of Mp leaf methanolic extract (MPME) on human keratinocytes protein expression and its role in preventing proteins oxidation after oxidative stress (OS) exposure. The effects of MPME on HaCaT cells protein expression were evaluated treating cells with different concentrations of MPME, with glucose oxidase (GO, source of OS) and with MPME subsequently treated with GO. The protein patterns of treated HaCaT cells are analyzed by two-dimensional gel electrophoresis (2-DE) and compared with that of untreated HaCaT. Immunoblotting was then used to evaluate the role of MPME in preventing the 4-hydroxynonenal protein adducts (4-HNE PAs) formation (marker of OS). Eighteen proteins, identified by mass spectrometry (LC-ESI-CID-MS/MS), were modulated distinctly by MPME in HaCaT. Overall, MPME counteract GO effect, reducing the GO-induced overexpression of several proteins involved in stress response (T-complex protein 1, Protein disulfide-isomerase A3, Protein DJ-1, and Stress-induced-phosphoprotein 1), in cell energy methabolism (Inorganic pyrophosphatase, Triosephosphate isomerase isoform 1, 2-phosphopyruvate-hydratase alpha-enolase, and Fructose-bisphosphate aldolase A isoform 1), in cytoskeletal organization (Cytokeratins 18, 9, 2, Cofilin-1, Annexin A2 and F-actin-capping protein subunit beta isoform 1) and in cell cycle progression (Eukaryotic translation initiation factor 5A-1 isoform B). In addition, MPME decreased the 4-HNE PAs levels, in particular on 2-phosphopyruvate-hydratase alpha-enolase and Cytokeratin 9. Our findings show that MPME might be helpful in the treatment of OS-related skin diseases by preventing protein post-translational modifications (4-HNE PAs). © 2013 Published by Elsevier Ireland Ltd.

  6. Biocompatibility of polymer-infiltrated-ceramic-network (PICN) materials with Human Gingival Keratinocytes (HGKs).

    Science.gov (United States)

    Grenade, Charlotte; De Pauw-Gillet, Marie-Claire; Pirard, Catherine; Bertrand, Virginie; Charlier, Corinne; Vanheusden, Alain; Mainjot, Amélie

    2017-03-01

    Biocompatibility of polymer-infiltrated-ceramic-network (PICN) materials, a new class of CAD-CAM composites, is poorly explored in the literature, in particular, no data are available regarding Human Gingival Keratinocytes (HGK). The first objective of this study was to evaluate the in vitro biocompatibility of PICNs with HGKs in comparison with other materials typically used for implant prostheses. The second objective was to correlate results with PICN monomer release and indirect cytotoxicity. HGK attachment, proliferation and spreading on PICN, grade V titanium (Ti), yttrium zirconia (Zi), lithium disilicate glass-ceramic (eM) and polytetrafluoroethylene (negative control) discs were evaluated using a specific insert-based culture system. For PICN and eM samples, monomer release in the culture medium was quantified by high performance liquid chromatography and indirect cytotoxicity tests were performed. Ti and Zi exhibited the best results regarding HGK viability, number and coverage. eM showed inferior results while PICN showed statistically similar results to eM but also to Ti regarding cell number and to Ti and Zi regarding cell viability. No monomer release from PICN discs was found, nor indirect cytotoxicity, as for eM. The results confirmed the excellent behavior of Ti and Zi with gingival cells. Even if polymer based, PICN materials exhibited intermediate results between Ti-Zi and eM. These promising results could notably be explained by PICN high temperature-high pressure (HT-HP) innovative polymerization mode, as confirmed by the absence of monomer release and indirect cytotoxicity. Copyright © 2017 The Academy of Dental Materials. Published by Elsevier Ltd. All rights reserved.

  7. Cell cycle pathway dysregulation in human keratinocytes during chronic exposure to low arsenite.

    Science.gov (United States)

    Al-Eryani, Laila; Waigel, Sabine; Jala, Venkatakrishna; Jenkins, Samantha F; States, J Christopher

    2017-09-15

    Arsenic is naturally prevalent in the earth's crust and widely distributed in air and water. Chronic low arsenic exposure is associated with several cancers in vivo, including skin cancer, and with transformation in vitro of cell lines including immortalized human keratinocytes (HaCaT). Arsenic also is associated with cell cycle dysregulation at different exposure levels in multiple cell lines. In this work, we analyzed gene expression in HaCaT cells to gain an understanding of gene expression changes contributing to transformation at an early time point. HaCaT cells were exposed to 0 or 100nM NaAsO 2 for 7weeks. Total RNA was purified and analyzed by microarray hybridization. Differential expression with fold change≥|1.5| and p-value≤0.05 was determined using Partek Genomic Suite™ and pathway and network analyses using MetaCore™ software (FDR≤0.05). Cell cycle analysis was performed using flow cytometry. 644 mRNAs were differentially expressed. Cell cycle/cell cycle regulation pathways predominated in the list of dysregulated pathways. Genes involved in replication origin licensing were enriched in the network. Cell cycle assay analysis showed an increase in G2/M compartment in arsenite-exposed cells. Arsenite exposure induced differential gene expression indicating dysregulation of cell cycle control, which was confirmed by cell cycle analysis. The results suggest that cell cycle dysregulation is an early event in transformation manifested in cells unable to transit G2/M efficiently. Further study at later time points will reveal additional changes in gene expression related to transformation processes. Copyright © 2017 Elsevier Inc. All rights reserved.

  8. Effect of retinoic acid on the radiosensitivity of normal human oral keratinocyte

    International Nuclear Information System (INIS)

    Lee, Jean; Heo, Min Suk; Lee, Sam Sun; Oh, Sung Ook; Choi, Soon Chul; Park, Tae Won; Lee, Sul Mi; Choi, Hang Moon

    2003-01-01

    To evaluate the effect of all-trans-retinotic acid (ATRA) on the radiosensitivity of normal human oral keratinocyte (NHOK). Relative cell survival fraction including SF2 (survival fraction at 2 Gy) was calculated on the basis of colony formation assay. Data were fitted to the linear-quadratic model to establish the survival curve and calculate α and β values. Using flow cytometry at 1, 2, 3, 4, and 5 days after exposure to 2 and 10 Gy irradiation, cell cycle arrest and apoptosis were analysed. To understand the molecular mechanism of the radiosensitization of ATRA on NHOK, proteins related with apoptosis and cell cycle arrest were investigated by Western blot analysis. Treatment with ATRA resulted in a significant decrease of SF2 value for NHOK from 0.63 to 0.27, and increased α and β value, indicating that ATRA increased radiosensitivity of NHOK. ATRA increased LDH significantly, but increasing irradiation dose decreased LDH, suggesting that the radiosensitizing effect of ATRA is not directly related with increasing cell necrosis by ATRA. ATRA did not induce appotosis but increased G2 arrest after 10 Gy irradiation, implying that the increased radiosensitivity of NHOK may be due to a decrease in mitosis caused by increasing G2 arrest. ATRA inhibited the reduction of p53 at 3 days after 10 Gy irradiation and increased p21 at 1 day after 10 Gy irradiation. Further study is required to determine the precise relationship between this effect and the radiosensitizing effect of ATRA. These results suggested that ATRA increase radiosensitivity by inhibiting mitosis caused by increasing G2 arrest.

  9. Differential effects of the extracellular microenvironment on human embryonic stem cell differentiation into keratinocytes and their subsequent replicative life span.

    Science.gov (United States)

    Movahednia, Mohammad Mehdi; Kidwai, Fahad Karim; Zou, Yu; Tong, Huei Jinn; Liu, Xiaochen; Islam, Intekhab; Toh, Wei Seong; Raghunath, Michael; Cao, Tong

    2015-04-01

    Culture microenvironment plays a critical role in the propagation and differentiation of human embryonic stem cells (hESCs) and their differentiated progenies. Although high efficiency of hESC differentiation to keratinocytes (hESC-Kert) has been achieved, little is known regarding the effects of early culture microenvironment and pertinent extracellular matrix (ECM) interactions during epidermal commitment on subsequent proliferative capacity of hESC-Kert. The aim of this study is to evaluate the effects of the different ECM microenvironments during hESC differentiation on subsequent replicative life span of hESC-Kert. In doing so, H1-hESCs were differentiated to keratinocytes (H1-Kert) in two differentiation systems. The first system employed autologous fibroblast feeder support, in which keratinocytes (H1-Kert(ACC)) were derived by coculture of hESCs with hESC-derived fibroblasts (H1-ebFs). The second system employed a novel decellularized matrix from H1-ebFs to create a dermoepidermal junction-like (DEJ) matrix. H1-Kert(AFF) were derived by differentiation of hESCs on the feeder-free system employing the DEJ matrix. Our study indicated that the feeder-free system with the use of DEJ matrix was more efficient in differentiation of hESCs toward epidermal progenitors. However, the feeder-free system was not sufficient to support the subsequent replicative capacity of differentiated keratinocytes. Of note, H1-Kert(AFF) showed limited replicative capacity with reduced telomere length and early cellular senescence. We further showed that the lack of cell-cell interactions during epidermal commitment led to heightened production of TGF-β1 by hESC-Kert during extended culture, which in turn was responsible for resulting in the limited replicative life span with cellular senescence of hESC-Kert derived under the feeder-free culture system. This study highlights for the first time the importance of the culture microenvironment and cell-ECM interactions during

  10. Cultivation and grafting of human keratinocytes on a poly(hydroxyethyl methacrylate) support to the wound bed: a clinical study.

    Science.gov (United States)

    Dvoránková, B; Smetana, K; Königová, R; Singerová, H; Vacík, J; Jelínková, M; Kapounková, Z; Zahradník, M

    1998-01-01

    Cultured epithelial sheets on a textile support are used for the treatment of seriously burned patients. In this study we demonstrate a new procedure for the grafting of keratinocytes directly on a polymer cultivation support. This procedure is much easier in comparison with classical techniques, and encouraging results of clinical trials demonstrate the improved healing of the wound bed after the use of this procedure. There is no difference in the cytokeratine pattern (LP-34, cytokeratin-10) of the reconstructed epidermis and normal human skin.

  11. A stable murine-based RD114 retroviral packaging line efficiently transduces human hematopoietic cells.

    Science.gov (United States)

    Ward, Maureen; Sattler, Rose; Grossman, I Robert; Bell, Anthony J; Skerrett, Donna; Baxi, Laxmi; Bank, Arthur

    2003-11-01

    Several barriers exist to high-efficiency transfer of therapeutic genes into human hematopoietic stem cells (HSCs) using complex oncoretroviral vectors. Human clinical trials to date have used Moloney leukemia virus-based amphotropic and gibbon ape leukemia virus-based envelopes in stable retroviral packaging lines. However, retroviruses pseudotyped with these envelopes have low titers due to the inability to concentrate viral supernatants efficiently by centrifugation without damaging the virus and low transduction efficiencies because of low-level expression of viral target receptors on human HSC. The RD114 envelope from the feline endogenous virus has been shown to transduce human CD34+ cells using transient packaging systems and to be concentrated to high titers by centrifugation. Stable packaging systems have potential advantages over transient systems because greater and more reproducible viral productions can be attained. We have, therefore, constructed and tested a stable RD114-expressing packaging line capable of high-level transduction of human CD34+ cells. Viral particles from this cell line were concentrated up to 100-fold (up to 10(7) viral particles/ml) by ultracentrifugation. Human hematopoietic progenitors from cord blood and sickle cell CD34+ cells were efficiently transduced with a Neo(R)-containing vector after a single exposure to concentrated RD114-pseudotyped virus produced from this cell line. Up to 78% of progenitors from transduced cord blood CD34+ cells and 51% of progenitors from sickle cell CD34+ cells expressed the NeoR gene. We also show transfer of a human beta-globin gene into progenitor cells from CD34+ cells from sickle cell patients with this new RD114 stable packaging system. The results indicate that this packaging line may eventually be useful in human clinical trials of globin gene therapy.

  12. Interaction of Mycobacterium leprae with the HaCaT human keratinocyte cell line: new frontiers in the cellular immunology of leprosy.

    Science.gov (United States)

    Lyrio, Eloah C D; Campos-Souza, Ivy C; Corrêa, Luiz C D; Lechuga, Guilherme C; Verícimo, Maurício; Castro, Helena C; Bourguignon, Saulo C; Côrte-Real, Suzana; Ratcliffe, Norman; Declercq, Wim; Santos, Dilvani O

    2015-07-01

    Leprosy is a chronic granulomatous disease caused by Mycobacterium leprae affecting the skin and peripheral nerves. Despite M. leprae invasion of the skin and keratinocytes importance in innate immunity, the interaction of these cells in vitro during M. leprae infection is poorly understood. Conventional and fluorescence optical microscopy, transmission electronic microscopy, flow cytometry and ELISA were used to study the in vitro interaction of M. leprae with the HaCaT human keratinocyte cell line. Keratinocytes uptake of M. leprae is described, and modulation of the surface expression of CD80 and CD209, cathelicidin expression and TNF-α and IL-1β production of human keratinocytes are compared with dendritic cells and macrophages during M. leprae interaction. This study demonstrated that M. leprae interaction with human keratinocytes enhanced expression of cathelicidin and greatly increased TNF-α production. The highest spontaneous expression of cathelicidin was by dendritic cells which are less susceptible to M. leprae infection. In contrast, keratinocytes displayed low spontaneous cathelicidin expression and were more susceptible to M. leprae infection than dendritic cells. The results show, for the first time, an active role for keratinocytes during infection by irradiated whole cells of M. leprae and the effect of vitamin D on this process. They also suggest that therapies which target cathelicidin modulation may provide novel approaches for treatment of leprosy. © 2015 John Wiley & Sons A/S. Published by John Wiley & Sons Ltd.

  13. Resveratrol prevents oxidative stress-induced senescence and proliferative dysfunction by activating the AMPK-FOXO3 cascade in cultured primary human keratinocytes.

    Directory of Open Access Journals (Sweden)

    Yasuo Ido

    Full Text Available The aging process is perceived as resulting from a combination of intrinsic factors such as changes in intracellular signaling and extrinsic factors, most notably environmental stressors. In skin, the relationship between intrinsic changes and keratinocyte function is not clearly understood. Previously, we found that increasing the activity of AMP-activated protein kinase (AMPK suppressed senescence in hydrogen peroxide (H2O2-treated human primary keratinocytes, a model of oxidative stress-induced cellular aging. Using this model in the present study, we observed that resveratrol, an agent that increases the activities of both AMPK and sirtuins, ameliorated two age-associated phenotypes: cellular senescence and proliferative dysfunction. In addition, we found that treatment of keratinocytes with Ex527, a specific inhibitor of sirtuin 1 (SIRT1, attenuated the ability of resveratrol to suppress senescence. In keeping with the latter observation, we noted that compared to non-senescent keratinocytes, senescent cells lacked SIRT1. In addition to these effects on H2O2-induced senescence, resveratrol also prevented the H2O2-induced decrease in proliferation (as indicated by 3H-thymidine incorporation in the presence of insulin. This effect was abrogated by inhibition of AMPK but not SIRT1. Compared to endothelium, we found that human keratinocytes expressed relatively high levels of Forkhead box O3 (FOXO3, a downstream target of both AMPK and SIRT1. Treatment of keratinocytes with resveratrol transactivated FOXO3 and increased the expression of its target genes including catalase. Resveratrol's effects on both senescence and proliferation disappeared when FOXO3 was knocked down. Finally, we performed an exploratory study which showed that skin from humans over 50 years old had lower AMPK activity than skin from individuals under age 20. Collectively, these findings suggest that the effects of resveratrol on keratinocyte senescence and proliferation

  14. The effect of 648 nm diode laser irradiation on second messengers in senescent human keratinocytes

    Science.gov (United States)

    Hawkins Evans, D.; Abrahamse, H.

    2009-02-01

    Background/purpose: Stress induced premature senescence (SIPS) is defined as the long-term effect of subcytotoxic stress on proliferative cell types. Cells in SIPS display differences at the level of protein expression which affect energy metabolism, defense systems, redox potential, cell morphology and transduction pathways. This study aimed to determine the effect of laser irradiation on second messengers in senescent cells and to establish if that effect can be directly linked to changes in cellular function such as cell viability or proliferation. Materials and Methods: Human keratinocyte cell cultures were modified to induce premature senescence using repeated sub-lethal stresses of 200 uM H2O2 or 5% OH every day for four days with two days recovery. SIPS was confirmed by senescence-associated β-galactosidase staining. Control conditions included normal, repeated stress of 500 uM H2O2 to induce apoptosis and 200 uM PBN as an anti-oxidant or free radical scavenger. Cells were irradiated with 1.5 J/cm2 on day 1 and 4 using a 648 nm diode laser (3.3 mW/cm2) and cellular responses were measured 1 h post irradiation. The affect on second messengers was assessed by measuring cAMP, cGMP, nitric oxide and intracellular calcium (Ca2+) while functional changes were assessed using cell morphology, ATP cell viability, LDH membrane integrity and WST-1 cell proliferation. Results: Results indicate an increase in NO and a decrease in cGMP and Ca2+ in 200 uM H2O2 irradiated cells while PBN irradiated cells showed a decrease in cAMP and an increase in ATP viability and cell proliferation. Conclusion: Laser irradiation influences cell signaling which ultimately changes the biological function of senescent cells. If laser therapy can stimulate the biological function of senescent cells it may be beneficial to conditions such as immune senescence, skin ageing, muscle atrophy, premature ageing of arteries in patients with advanced heart disease, neurodegenerative disorders and

  15. Repair of ultraviolet light damage to the DNA of cultured human epidermal keratinocytes and fibroblasts

    International Nuclear Information System (INIS)

    Taichman, L.B.; Setlow, R.B.

    1979-01-01

    Pure cultures of dermal fibroblasts and epidermal keroatinocytes have been obtained from a single biopsy of newborn foreskin. The cells were labeled, exposed to several doses of uv light, and allowed to repair in the dark for 16 h. The number of pyrimidine dimers before and after repair was assessed by measuring the numbers of sites in the DNA sensitive to a specific uv endonuclease. At all doses used, the extent of repair was similar in the cultured keratinocytes and cultured fibroblasts

  16. Mannosides as crucial part of bioactive supports for cultivation of human epidermal keratinocytes without feeder cells

    Czech Academy of Sciences Publication Activity Database

    Labský, Jiří; Dvořánková, B.; Smetana, Karel; Holíková, Z.; Brož, L.; Gabius, H.J.

    2003-01-01

    Roč. 24, č. 5 (2003), s. 863-872 ISSN 0142-9612 R&D Projects: GA ČR GA203/00/1310; GA MŠk LN00A065; GA MZd ND6340 Institutional research plan: CEZ:AV0Z4050913 Keywords : cell therapy * keratinocyte * mannose Subject RIV: CD - Macromolecular Chemistry Impact factor: 2.903, year: 2003

  17. Multiple biological effects of inhibitors of arachidonic acid metabolism on human keratinocytes

    Czech Academy of Sciences Publication Activity Database

    Pacherník, Jiří; Hampl, Aleš; Souček, Karel; Kovaříková, Martina; Andrysík, Zdeněk; Hofmanová, Jiřina; Kozubík, Alois

    2002-01-01

    Roč. 293, č. 12 (2002), s. 626-633 ISSN 0340-3696 R&D Projects: GA ČR GA524/99/0694; GA AV ČR IBS5004009; GA ČR GA524/98/0190 Institutional research plan: CEZ:AV0Z5004920 Keywords : lipoxygenase * keratinocytes * cell cycle Subject RIV: BO - Biophysics Impact factor: 1.452, year: 2002

  18. The influence of ions implantation on adhesion and growth of human keratinocytes

    International Nuclear Information System (INIS)

    Walachova, K.; Dvorankova, B.; Vogtova, D.; Svorcik, V.

    1999-01-01

    This work deals with the study of modification of surface of the polyethylene after ion implantation. For experiments were used the Ar + ions with energy 63 keV and Xe + ions with energy 156 keV. Some surface properties of modified layers (100 nm) and their influence on adhesion and proliferation of keratinocytes were studied. For the study of structural changes of polymer were used methods UV-VIS and FTIR spectrometry, atomic force spectroscopy

  19. Comparative transcriptomic profiling of hydrogen peroxide signaling networks in zebrafish and human keratinocytes: Implications toward conservation, migration and wound healing.

    Science.gov (United States)

    Lisse, Thomas S; King, Benjamin L; Rieger, Sandra

    2016-02-05

    Skin wounds need to be repaired rapidly after injury to restore proper skin barrier function. Hydrogen peroxide (H2O2) is a conserved signaling factor that has been shown to promote a variety of skin wound repair processes, including immune cell migration, angiogenesis and sensory axon repair. Despite growing research on H2O2 functions in wound repair, the downstream signaling pathways activated by this reactive oxygen species in the context of injury remain largely unknown. The goal of this study was to provide a comprehensive analysis of gene expression changes in the epidermis upon exposure to H2O2 concentrations known to promote wound repair. Comparative transcriptome analysis using RNA-seq data from larval zebrafish and previously reported microarray data from a human epidermal keratinocyte line shows that H2O2 activates conserved cell migration, adhesion, cytoprotective and anti-apoptotic programs in both zebrafish and human keratinocytes. Further assessment of expression characteristics and signaling pathways revealed the activation of three major H2O2-dependent pathways, EGF, FOXO1, and IKKα. This study expands on our current understanding of the clinical potential of low-level H2O2 for the promotion of epidermal wound repair and provides potential candidates in the treatment of wound healing deficits.

  20. Protective Effect of the Ethyl Acetate Fraction of Sargassum muticum against Ultraviolet B–Irradiated Damage in Human Keratinocytes

    Directory of Open Access Journals (Sweden)

    Jin Won Hyun

    2011-11-01

    Full Text Available The aim of this study was to investigate the cytoprotective properties of the ethyl acetate fraction of Sargassum muticum (SME against ultraviolet B (UVB-induced cell damage in human keratinocytes (HaCaT cells. SME exhibited scavenging activity toward the 1,1-diphenyl-2-picrylhydrazyl radicals and hydrogen peroxide (H2O2 and UVB-induced intracellular reactive oxygen species (ROS. SME also scavenged the hydroxyl radicals generated by the Fenton reaction (FeSO4 + H2O2, which was detected using electron spin resonance spectrometry. In addition, SME decreased the level of lipid peroxidation that was increased by UVB radiation, and restored the level of protein expression and the activities of antioxidant enzymes that were decreased by UVB radiation. Furthermore, SME reduced UVB-induced apoptosis as shown by decreased DNA fragmentation and numbers of apoptotic bodies. These results suggest that SME protects human keratinocytes against UVB-induced oxidative stress by enhancing antioxidant activity in cells, thereby inhibiting apoptosis.

  1. Response of Primary Human Bone Marrow Mesenchymal Stromal Cells and Dermal Keratinocytes to Thermal Printer Materials In Vitro.

    Science.gov (United States)

    Schmelzer, Eva; Over, Patrick; Gridelli, Bruno; Gerlach, Jörg C

    Advancement in thermal three-dimensional printing techniques has greatly increased the possible applications of various materials in medical applications and tissue engineering. Yet, potential toxic effects on primary human cells have been rarely investigated. Therefore, we compared four materials commonly used in thermal printing for bioengineering, namely thermally printed acrylonitrile butadiene styrene, MED610, polycarbonate, and polylactic acid, and investigated their effects on primary human adult skin epidermal keratinocytes and bone marrow mesenchymal stromal cells (BM-MSCs) in vitro. We investigated indirect effects on both cell types caused by potential liberation of soluble substances from the materials, and also analyzed BM-MSCs in direct contact with the materials. We found that even in culture without direct contact with the materials, the culture with MED610 (and to a lesser extent acrylonitrile butadiene styrene) significantly affected keratinocytes, reducing cell numbers and proliferation marker Ki67 expression, and increasing glucose consumption, lactate secretion, and expression of differentiation-associated genes. BM-MSCs had decreased metabolic activity, and exhibited increased cell death in direct culture on the materials. MED610 and acrylonitrile butadiene styrene induced the strongest expression of genes associated to differentiation and estrogen receptor activation. In conclusion, we found strong cell-type-specific effects of the materials, suggesting that materials for applications in regenerative medicine should be carefully selected not only based on their mechanical properties but also based on their cell-type-specific biological effects.

  2. Metabolic activation of pyrrolizidine alkaloids leading to phototoxicity and photogenotoxicity in human HaCaT keratinocytes.

    Science.gov (United States)

    Wang, Chia-Chi; Xia, Qingsu; Li, Meng; Wang, Shuguang; Zhao, Yuewei; Tolleson, William H; Yin, Jun-Jie; Fu, Peter P

    2014-01-01

    Pyrrolizidine alkaloids, produced by a large number of poisonous plants with wide global distribution, are associated with genotoxicity, tumorigenicity, and hepatotoxicity in animals and humans. Mammalian metabolism converts pyrrolizidine alkaloids to reactive pyrrolic metabolites (dehydropyrrolizidine alkaloids) that form covalent protein and DNA adducts. Although a mechanistic understanding is currently unclear, pyrrolizidine alkaloids can cause secondary (hepatogenous) photosensitization and induce skin cancer. In this study, the phototoxicity of monocrotaline, riddelliine, dehydromonocrotaline, dehydroriddelliine, and dehydroretronecine (DHR) in human HaCaT keratinocytes under ultraviolet A (UVA) irradiation was determined. UVA irradiation of HaCaT cells treated with dehydromonocrotaline, dehydroriddelline, and DHR resulted in increased release of lactate dehydrogenase and enhanced photocytotoxicity proportional to the UVA doses. UVA-induced photochemical DNA damage also increased proportionally with dehydromonocrotaline and dehydroriddelline. UVA treatment potentiated the formation of 8-hydroxy-2'-deoxyguanosine DNA adducts induced by dehydromonocrotaline in HaCaT skin keratinocytes. Using electron spin resistance trapping, we found that UVA irradiation of dehydromonocrotaline and dehydroriddelliine generates reactive oxygen species (ROS), including hydroxyl radical, singlet oxygen, and superoxide, and electron transfer reactions, indicating that cytotoxicity and genotoxicity of these compounds could be mediated by ROS. Our results suggest that dehydropyrrolizidine alkaloids formed or delivered to the skin cause pyrrolizidine alkaloid-induced secondary photosensitization and possible skin cancer.

  3. Human papillomavirus types detected in skin warts and cancer differ in their transforming properties but commonly counteract UVB induced protective responses in human keratinocytes

    Energy Technology Data Exchange (ETDEWEB)

    Shterzer, Naama; Heyman, Dariya; Shapiro, Beny; Yaniv, Abraham; Jackman, Anna [Department of Clinical Microbiology and Immunology, Sackler School of Medicine, Tel-Aviv University, Tel-Aviv (Israel); Serour, Francis [Department of Pediatric Surgery, The E. Wolfson Medical Center, Holon (Israel); Chaouat, Malka [Laboratory of Experimental Surgery, Hadassah University Hospital, Ein Karem, Jerusalem (Israel); Gonen, Pinhas [Department of Clinical Microbiology and Immunology, Sackler School of Medicine, Tel-Aviv University, Tel-Aviv (Israel); Tommasino, Massimo [International Agency for Research on Cancer, World Health Organization, Lyon (France); Sherman, Levana [Department of Clinical Microbiology and Immunology, Sackler School of Medicine, Tel-Aviv University, Tel-Aviv (Israel)

    2014-11-15

    In the present study, E6E7 and E6 proteins of human papillomaviruses (HPVs) associated with skin warts and cancer were compared for their transforming and carcinogenic abilities in primary human keratinocytes (PHKs). We show that E6E7 of cancer associated beta HPV types, notably 49 and 24, were able to extend the life span and enhance the clonogenic efficiency of PHKs when maintained in serum free/low calcium medium. Activities of the beta HPV E6E7 were lower than those of HPV16 E6E7. In contrast, E6 proteins from HPV types detected in skin warts or cancer, notably 10, 49 and 38, attenuated UVB induced protective responses in PHKs including cell death, proliferation arrest and accumulation of the proapoptotic proteins, p53, bax or bak. Together, this investigation revealed functional differences and commonalities between HPVs associated with skin warts and cancer, and allowed the identification of specific properties of beta HPVs supporting their involvement in skin carcinogenesis. - Highlights: • Primary keratinocytes were used to evaluate transforming and carcinogenic abilities of cutaneous HPVs. • E6E7 of cancer associated β HPV types transform primary human keratinocytes. • E6 proteins of cancer and wart associated HPVs inhibit UVB induced cell death. • E6s of cancer and wart associated HPVs attenuate UVB induced proliferation arrest. • E6s of cancer and wart associated HPVs attenuate UVB induced apoptosis signaling.

  4. Human papillomavirus types detected in skin warts and cancer differ in their transforming properties but commonly counteract UVB induced protective responses in human keratinocytes

    International Nuclear Information System (INIS)

    Shterzer, Naama; Heyman, Dariya; Shapiro, Beny; Yaniv, Abraham; Jackman, Anna; Serour, Francis; Chaouat, Malka; Gonen, Pinhas; Tommasino, Massimo; Sherman, Levana

    2014-01-01

    In the present study, E6E7 and E6 proteins of human papillomaviruses (HPVs) associated with skin warts and cancer were compared for their transforming and carcinogenic abilities in primary human keratinocytes (PHKs). We show that E6E7 of cancer associated beta HPV types, notably 49 and 24, were able to extend the life span and enhance the clonogenic efficiency of PHKs when maintained in serum free/low calcium medium. Activities of the beta HPV E6E7 were lower than those of HPV16 E6E7. In contrast, E6 proteins from HPV types detected in skin warts or cancer, notably 10, 49 and 38, attenuated UVB induced protective responses in PHKs including cell death, proliferation arrest and accumulation of the proapoptotic proteins, p53, bax or bak. Together, this investigation revealed functional differences and commonalities between HPVs associated with skin warts and cancer, and allowed the identification of specific properties of beta HPVs supporting their involvement in skin carcinogenesis. - Highlights: • Primary keratinocytes were used to evaluate transforming and carcinogenic abilities of cutaneous HPVs. • E6E7 of cancer associated β HPV types transform primary human keratinocytes. • E6 proteins of cancer and wart associated HPVs inhibit UVB induced cell death. • E6s of cancer and wart associated HPVs attenuate UVB induced proliferation arrest. • E6s of cancer and wart associated HPVs attenuate UVB induced apoptosis signaling

  5. Modulation of interferon-gamma-induced HLA-DR expression on the human keratinocyte cell line SCC-13 by ultraviolet radiation

    International Nuclear Information System (INIS)

    Khan, I.U.; Boehm, K.D.; Elmets, C.A.

    1993-01-01

    Cell surface expression of major histocompatibility determinants on epidermal keratinocytes is a characteristic feature of a number of inflammatory dermatoses and in all likelihood is caused by diffusion of human leukocyte antigen (HLA)-DR-inducing cytokines from cells present in the dermal mononuclear cell infiltrate. Many of these same disorders respond to ultraviolet (UV) radiation phototherapy. Using the human SCC-13 keratinocyte cell line as a model, UV radiation was found to inhibit interferon-gamma-induced HLA-DR expression. Inhibition correlated closely with decreased steady-state levels of HLA-DR mRNA. These findings provide evidence that the therapeutic effect of UV radiation phototherapy may be mediated by its capacity to down-regulate cytokine-induced keratinocyte HLA-DR expression. (Author)

  6. Release by ultraviolet B (u.v.B) radiation of nitric oxide (NO) from human keratinocytes: a potential role for nitric oxide in erythema production

    International Nuclear Information System (INIS)

    Deliconstantinos, G.; Villiotou, V.; Stravrides, J.C.

    1995-01-01

    The mechanism of human sunburn is poorly understood but its characteristic features include the development of erythema. In this study we attempted to determine whether human keratinocytes possess a nitric oxide (NO) synthase (NOS), if this enzyme could be activated to release NO following exposure to ultraviolet B (u.v.B) and to define whether this photo-induced response could be involved in the pathogenesis of sunburn erythema. The present results indicate that u.v.B radiation acts as a potent stimulator of NOS in keratinocytes. NO is lipophilic and may diffuse out of the keratinocytes, activating sGC in endothelial cells and neighbouring smooth muscle cells. This may be a major part of the integrated response of the skin leading to vasodilatation and erythema. (author)

  7. Rho kinase inhibitor Y-27632 promotes the differentiation of human bone marrow mesenchymal stem cells into keratinocyte-like cells in xeno-free conditioned medium.

    Science.gov (United States)

    Li, Zhenzhen; Han, Shichao; Wang, Xingqin; Han, Fu; Zhu, Xiongxiang; Zheng, Zhao; Wang, Hongtao; Zhou, Qin; Wang, Yunchuan; Su, Linlin; Shi, Jihong; Tang, Chaowu; Hu, Dahai

    2015-03-11

    Bone marrow mesenchymal stem cells (BMSCs), which have the ability to self-renew and to differentiate into multiple cell types, have recently become a novel strategy for cell-based therapies. The differentiation of BMSCs into keratinocytes may be beneficial for patients with burns, disease, or trauma. However, the currently available cells are exposed to animal materials during their cultivation and induction. These xeno-contaminations severely limit their clinical outcomes. Previous studies have shown that the Rho kinase (ROCK) inhibitor Y-27632 can promote induction efficiency and regulate the self-renewal and differentiation of stem cells. In the present study, we attempted to establish a xeno-free system for the differentiation of BMSCs into keratinocytes and to investigate whether Y-27632 can facilitate this differentiation. BMSCs isolated from patients were cultured by using a xeno-free system and characterised by using flow cytometric analysis and adipogenic and osteogenic differentiation assays. Human primary keratinocytes were also isolated from patients. Then, the morphology, population doubling time, and β-galactosidase staining level of these cells were evaluated in the presence or absence of Y-27632 to determine the effects of Y-27632 on the state of the keratinocytes. Keratinocyte-like cells (KLCs) were detected at different time points by immunocytofluorescence analysis. Moreover, the efficiency of BMSC differentiation under different conditions was measured by quantitative real-time-polymerase chain reaction (RT-PCR) and Western blot analyses. The ROCK inhibitor Y-27632 promoted the proliferation and lifespan of human primary keratinocytes. In addition, we showed that keratinocyte-specific markers could be detected in BMSCs cultured in a xeno-free system using keratinocyte-conditioned medium (KCM) independent of the presence of Y-27632. However, the efficiency of the differentiation of BMSCs into KLCs was significantly higher in the presence of Y

  8. Alterations of nitric-oxide synthase and xanthine-oxidase activities of human keratinocytes by ultraviolet-B radiation -potential role for peroxynitrite in skin inflammation

    Energy Technology Data Exchange (ETDEWEB)

    Deliconstantinos, G.; Villiotou, V.; Stavrides, J.C. [Athens Univ. (Greece). School of Medicine

    1996-06-28

    In the present study, we demonstrated that NO synthase (cNOS) and xanthine oxidase (XO) of human keratinocytes can be activated to release NO, superoxide (O-2(-)) and peroxynitrite (ONOO-) following exposure to ultraviolet B (UVB) radiation. We defined that this photo induced response may be involved in the pathogenesis of sunburn erythema and inflammation. Treatment of human keratinocytes with UVB (290-320 nm) radiation (up to 200 mJ/cm(2)) resulted in a dose-dependent increase in NO and ONOO-release that was inhibited by N-monomethyl-L-arginine (L-NMMA). NO and ONOO- release from keratinocytes was accompanied by an increase in intracellular cGMP levels. Treatment of human keratinocyte cytosol with various doses of UVB (up to 100 mJ/cm(2)) resulted in an increase in XO activity that was inhibited by oxypurinol. In in vivo experiments, when experimental animals were subjected to UVB radiation, a protection factor (PF) of 6.5 {+-} 1.8 was calculated when an emulsified cream formulation containing nitro-L-arginine (L-NA) (2%) and L-NMMA (2%) was applied to their skin. The present study indicates that UVB radiation acts as a potent stimulator of cNOS and XO activities in human keratinocytes. NO and ONOO- may exert cytotoxic effects in keratinocytes themselves, as well as in their neighbouring endothelial and smooth muscle cells. This may be a major part of the integrated response leading to erythema production and the inflammation process. (UK).

  9. Alterations of nitric-oxide synthase and xanthine-oxidase activities of human keratinocytes by ultraviolet-B radiation -potential role for peroxynitrite in skin inflammation

    International Nuclear Information System (INIS)

    Deliconstantinos, G.; Villiotou, V.; Stavrides, J.C.

    1996-01-01

    In the present study, we demonstrated that NO synthase (cNOS) and xanthine oxidase (XO) of human keratinocytes can be activated to release NO, superoxide (O-2(-)) and peroxynitrite (ONOO-) following exposure to ultraviolet B (UVB) radiation. We defined that this photo induced response may be involved in the pathogenesis of sunburn erythema and inflammation. Treatment of human keratinocytes with UVB (290-320 nm) radiation (up to 200 mJ/cm(2)) resulted in a dose-dependent increase in NO and ONOO-release that was inhibited by N-monomethyl-L-arginine (L-NMMA). NO and ONOO- release from keratinocytes was accompanied by an increase in intracellular cGMP levels. Treatment of human keratinocyte cytosol with various doses of UVB (up to 100 mJ/cm(2)) resulted in an increase in XO activity that was inhibited by oxypurinol. In in vivo experiments, when experimental animals were subjected to UVB radiation, a protection factor (PF) of 6.5 ± 1.8 was calculated when an emulsified cream formulation containing nitro-L-arginine (L-NA) (2%) and L-NMMA (2%) was applied to their skin. The present study indicates that UVB radiation acts as a potent stimulator of cNOS and XO activities in human keratinocytes. NO and ONOO- may exert cytotoxic effects in keratinocytes themselves, as well as in their neighbouring endothelial and smooth muscle cells. This may be a major part of the integrated response leading to erythema production and the inflammation process. (UK)

  10. The E5 protein of human papillomavirus type 16 perturbs MHC class II antigen maturation in human foreskin keratinocytes treated with interferon-γ

    International Nuclear Information System (INIS)

    Zhang Benyue; Li Ping; Wang Exing; Brahmi, Zacharie; Dunn, Kenneth W.; Blum, Janice S.; Roman, Ann

    2003-01-01

    Major histocompatibility complex (MHC) class II antigens are expressed on human foreskin keratinocytes (HFKs) following exposure to interferon gamma. The expression of MHC class II proteins on the cell surface may allow keratinocytes to function as antigen-presenting cells and induce a subsequent immune response to virus infection. Invariant chain (Ii) is a chaperone protein which plays an important role in the maturation of MHC class II molecules. The sequential degradation of Ii within acidic endocytic compartments is a key process required for the successful loading of antigenic peptide onto MHC class II molecules. Since human papillomavirus (HPV) 16 E5 can inhibit the acidification of late endosomes in HFKs, the E5 protein may be able to affect proper peptide loading onto the MHC class II molecule. To test this hypothesis, HFKs were infected with either control virus or a recombinant virus expressing HPV16 E5 and the infected cells were subsequently treated with interferon-γ. ELISAs revealed a decrease of MHC class II expression on the surface of E5-expressing cells compared with control virus-infected cells after interferon treatment. Western blot analysis showed that, in cells treated with interferon gamma, E5 could prevent the breakdown of Ii and block the formation of peptide-loaded, SDS-stable mature MHC class II dimers, correlating with diminished surface MHC class II expression. These data suggest that HPV16 E5 may be able to decrease immune recognition of infected keratinocytes via disruption of MHC class II protein function

  11. Loss of Robustness and Addiction to IGF1 during Early Keratinocyte Transformation by Human Papilloma Virus 16

    Science.gov (United States)

    Geiger, Tamar; Levitzki, Alexander

    2007-01-01

    Infection of keratinocytes with high risk human Papilloma virus causes immortalization, and when followed by further mutations, leads to cervical cancer and other anogenital tumors. Here we monitor the progressive loss of robustness in an in vitro model of the early stages of transformation that comprises normal keratinocytes and progressive passages of HPV16 immortalized cells. As transformation progresses, the cells acquire higher proliferation rates and gain the ability to grow in soft agar. Concurrently, the cells lose robustness, becoming more sensitive to serum starvation and DNA damage by Cisplatin. Loss of robustness in the course of transformation correlates with significant reductions in the activities of the anti-apoptotic proteins PKB/Akt, Erk, Jnk and p38 both under normal growth conditions and upon stress. In parallel, loss of robustness is manifested by the shrinkage of the number of growth factors that can rescue starving cells from apoptosis, with the emergence of dependence solely on IGF1. Treatment with IGF1 activates PKB/Akt and Jnk and through them inhibits p53, rescuing the cells from starvation. We conclude that transformation in this model induces higher susceptibility of cells to stress due to reduced anti-apoptotic signaling and hyper-activation of p53 upon stress. PMID:17622350

  12. Strain-dependent augmentation of tight-junction barrier function in human primary epidermal keratinocytes by Lactobacillus and Bifidobacterium lysates.

    Science.gov (United States)

    Sultana, Reshma; McBain, Andrew J; O'Neill, Catherine A

    2013-08-01

    In this study, we investigated whether probiotic lysates can modify the tight-junction function of human primary keratinocytes. The keratinocytes were grown on cell culture inserts and treated with lysates from Bifidobacterium longum, Lactobacillus plantarum, Lactobacillus reuteri, Lactobacillus fermentum, or Lactobacillus rhamnosus GG. With the exception of L. fermentum (which decreased cell viability), all strains markedly enhanced tight-junction barrier function within 24 h, as assessed by measurements of transepithelial electrical resistance (TEER). However, B. longum and L. rhamnosus GG were the most efficacious, producing dose-dependent increases in resistance that were maintained for 4 days. These increases in TEER correlated with elevated expression of tight-junction protein components. Neutralization of Toll-like receptor 2 abolished both the increase in TEER and expression of tight-junction proteins induced by B. longum, but not L. rhamnosus GG. These data suggest that some bacterial strains increase tight-junction function via modulation of protein components but the different pathways involved may vary depending on the bacterial strain.

  13. Basement membrane reconstruction in human skin equivalents is regulated by fibroblasts and/or exogenously activated keratinocytes.

    Science.gov (United States)

    El Ghalbzouri, Abdoelwaheb; Jonkman, Marcel F; Dijkman, Remco; Ponec, Maria

    2005-01-01

    This study was undertaken to examine the role fibroblasts play in the formation of the basement membrane (BM) in human skin equivalents. For this purpose, keratinocytes were seeded on top of fibroblast-free or fibroblast-populated collagen matrix or de-epidermized dermis and cultured in the absence of serum and exogenous growth factors. The expression of various BM components was analyzed on the protein and mRNA level. Irrespective of the presence or absence of fibroblasts, keratin 14, hemidesmosomal proteins plectin, BP230 and BP180, and integrins alpha1beta1, alpha2beta1, alpha3beta1, and alpha6beta4 were expressed but laminin 1 was absent. Only in the presence of fibroblasts or of various growth factors, laminin 5 and laminin 10/11, nidogen, uncein, type IV and type VII collagen were decorating the dermal/epidermal junction. These findings indicate that the attachment of basal keratinocytes to the dermal matrix is most likely mediated by integrins alpha1beta1 and alpha2beta1, and not by laminins that bind to integrin alpha6beta4 and that the epithelial-mesenchymal cross-talk plays an important role in synthesis and deposition of various BM components.

  14. Cytoskeleton and pericellular matrix organization of pure adult human keratinocytes cultured from suction-blister roof epidermis.

    Science.gov (United States)

    Kariniemi, A L; Lehto, V P; Vartio, T; Virtanen, I

    1982-12-01

    Pure adult human keratinocyte cultures were raised from suction-blister roof epidermis and cultured in MCDB-151 medium. In primary culture the epidermal cells rapidly adhered, spread and began to proliferate on collagen-coated growth substrata but not on uncoated plastic or glass substrata. A fibrillar keratin-specific fluorescence, showing a typical cell-cell arrangement, was seen in all cells in indirect immunofluorescence microscopy, whereas only some cells also showed vimentin-specific staining. A fine fibrillar fibronectin-specific surface staining was seen at the margin of attaching cells and in marginal cells of spreading cell islands, whereas no fluorescence could be seen in epidermal cells, with antibodies against type IV collagen or laminin. Interestingly, the marginal cells also showed intracellular fibronectin. The synthesis of fibronectin in epidermal cell cultures could also be revealed by metabolic labelling experiments with [35S]methionine. In contrast to primary cultures, subcultivated keratinocytes also adhered to uncoated plastic and glass substrata. After subcultivation, keratin and surface fibronectin distribution remained unaltered but after some subcultivations, most of the cells also showed fibrillar vimentin and expressed fibronectin intracellularly. The results show that the suction-blister method provides an easy way to obtain pure epidermal cell cultures without contaminating mesenchymal cells. Our results also suggest a direct role for fibronectin but not for collagen type IV or laminin in adhesion and spreading of epidermal cells in vitro.

  15. Interleukin 22 early affects keratinocyte differentiation, but not proliferation, in a three-dimensional model of normal human skin

    Energy Technology Data Exchange (ETDEWEB)

    Donetti, Elena, E-mail: elena.donetti@unimi.it [Department of Biomedical Sciences for Health, Università degli Studi di Milano, 20133 Milan (Italy); Cornaghi, Laura; Arnaboldi, Francesca; Landoni, Federica [Department of Biomedical Sciences for Health, Università degli Studi di Milano, 20133 Milan (Italy); Romagnoli, Paolo [Department of Experimental and Clinical Medicine, Università degli Studi di Firenze, 50125 Florence (Italy); Mastroianni, Nicolino [Department of Biomedical Sciences for Health, Università degli Studi di Milano, 20133 Milan (Italy); Pescitelli, Leonardo [Department of Surgery and Translational Medicine, Università degli Studi di Firenze, 50125 Florence (Italy); Baruffaldi Preis, Franz W. [I.R.C.C.S. Istituto Ortopedico Galeazzi, 20161 Milan (Italy); Prignano, Francesca [Department of Surgery and Translational Medicine, Università degli Studi di Firenze, 50125 Florence (Italy)

    2016-07-15

    Interleukin (IL)-22 is a pro-inflammatory cytokine driving the progression of the psoriatic lesion with other cytokines, as Tumor Necrosis Factor (TNF)-alpha and IL-17. Our study was aimed at evaluating the early effect of IL-22 alone or in combination with TNF-alpha and IL-17 by immunofluorescence on i) keratinocyte (KC) proliferation, ii) terminal differentiation biomarkers as keratin (K) 10 and 17 expression, iii) intercellular junctions. Transmission electron microscopy (TEM) analysis was performed. A model of human skin culture reproducing a psoriatic microenvironment was used. Plastic surgery explants were obtained from healthy young women (n=7) after informed consent. Fragments were divided before adding IL-22 or a combination of the three cytokines, and harvested 24 (T24), 48 (T48), and 72 (T72) h later. From T24, in IL-22 samples we detected a progressive decrease in K10 immunostaining in the spinous layer paralleled by K17 induction. By TEM, after IL-22 incubation, keratin aggregates were evident in the perinuclear area. Occludin immunostaining was not homogeneously distributed. Conversely, KC proliferation was not inhibited by IL-22 alone, but only by the combination of cytokines. Our results suggest that IL-22 affects keratinocyte terminal differentiation, whereas, in order to induce a proliferation impairment, a more complex psoriatic-like microenvironment is needed.

  16. Interleukin 22 early affects keratinocyte differentiation, but not proliferation, in a three-dimensional model of normal human skin

    International Nuclear Information System (INIS)

    Donetti, Elena; Cornaghi, Laura; Arnaboldi, Francesca; Landoni, Federica; Romagnoli, Paolo; Mastroianni, Nicolino; Pescitelli, Leonardo; Baruffaldi Preis, Franz W.; Prignano, Francesca

    2016-01-01

    Interleukin (IL)-22 is a pro-inflammatory cytokine driving the progression of the psoriatic lesion with other cytokines, as Tumor Necrosis Factor (TNF)-alpha and IL-17. Our study was aimed at evaluating the early effect of IL-22 alone or in combination with TNF-alpha and IL-17 by immunofluorescence on i) keratinocyte (KC) proliferation, ii) terminal differentiation biomarkers as keratin (K) 10 and 17 expression, iii) intercellular junctions. Transmission electron microscopy (TEM) analysis was performed. A model of human skin culture reproducing a psoriatic microenvironment was used. Plastic surgery explants were obtained from healthy young women (n=7) after informed consent. Fragments were divided before adding IL-22 or a combination of the three cytokines, and harvested 24 (T24), 48 (T48), and 72 (T72) h later. From T24, in IL-22 samples we detected a progressive decrease in K10 immunostaining in the spinous layer paralleled by K17 induction. By TEM, after IL-22 incubation, keratin aggregates were evident in the perinuclear area. Occludin immunostaining was not homogeneously distributed. Conversely, KC proliferation was not inhibited by IL-22 alone, but only by the combination of cytokines. Our results suggest that IL-22 affects keratinocyte terminal differentiation, whereas, in order to induce a proliferation impairment, a more complex psoriatic-like microenvironment is needed.

  17. Evaluation of the effect of radiation levels and dose rates in irradiation of murine fibroblasts used as a feeder layer in the culture of human keratinocytes

    International Nuclear Information System (INIS)

    Yoshito, Daniele; Almeida, Tiago L.; Santin, Stefany Plumeri; Somessari, Elizabeth S.R.; Silveira, Carlos G. da; Mathor, Monica B.; Altran, Silvana C.; Isaac, Cesar

    2009-01-01

    In 1975, Rheinwald and Green published an effective methodology for obtaining and cultivating human keratinocytes. This methodology consisted of seeding keratinocytes onto a feeder layer composed of lineage 3T3 murine fibroblasts, the proliferation rate of which is then controlled through the action of ionizing radiation. The presence of the feeder layer encourages the development of keratinocyte colonies and their propagation in similar cultures, becoming possible several clinical applications as skin substitutes or wound dressings in situations such as post burn extensive skin loss and other skin disorders. However, good development of these keratinocytes depends on a high quality feeder layer among other factors. In the present work, we evaluated the relationship between radiation levels and dose rates applied to fibroblasts used in construction of feeder layers and the radiation effect on keratinocytes colonies forming efficiency. Results indicate 3T3 lineage murine fibroblasts irradiated with doses varying between 60 and 100 Gy can be used as a feeder layer immediately after irradiation or storage of the irradiated cells in suspension at 4 g C for 24 hours with similar results. The exception is when the irradiation dose rate is 2.75 Gyh -1 ; in this case, results suggested that the fibroblasts should be used immediately after irradiation. (author)

  18. IFI16 and cGAS cooperate in the activation of STING during DNA sensing in human keratinocytes.

    Science.gov (United States)

    Almine, Jessica F; O'Hare, Craig A J; Dunphy, Gillian; Haga, Ismar R; Naik, Rangeetha J; Atrih, Abdelmadjid; Connolly, Dympna J; Taylor, Jordan; Kelsall, Ian R; Bowie, Andrew G; Beard, Philippa M; Unterholzner, Leonie

    2017-02-13

    Many human cells can sense the presence of exogenous DNA during infection though the cytosolic DNA receptor cyclic GMP-AMP synthase (cGAS), which produces the second messenger cyclic GMP-AMP (cGAMP). Other putative DNA receptors have been described, but whether their functions are redundant, tissue-specific or integrated in the cGAS-cGAMP pathway is unclear. Here we show that interferon-γ inducible protein 16 (IFI16) cooperates with cGAS during DNA sensing in human keratinocytes, as both cGAS and IFI16 are required for the full activation of an innate immune response to exogenous DNA and DNA viruses. IFI16 is also required for the cGAMP-induced activation of STING, and interacts with STING to promote STING phosphorylation and translocation. We propose that the two DNA sensors IFI16 and cGAS cooperate to prevent the spurious activation of the type I interferon response.

  19. The human keratinocyte two-dimensional protein database (update 1994): towards an integrated approach to the study of cell proliferation, differentiation and skin diseases

    DEFF Research Database (Denmark)

    Celis, J E; Rasmussen, H H; Olsen, E

    1994-01-01

    The master two-dimensional (2-D) gel database of human keratinocytes currently lists 3087 cellular proteins (2168 isoelectric focusing, IEF; and 919 none-quilibrium pH gradient electrophoresis, NEPHGE), many of which correspond to posttranslational modifications, 890 polypeptides have been...... in the database. We also report a database of proteins recovered from the medium of noncultured, unfractionated keratinocytes. This database lists 398 polypeptides (309 IEF; 89 NEPHGE) of which 76 have been identified. The aim of the comprehensive databases is to gather, through a systematic study...

  20. Non-thermal Plasma Activates Human Keratinocytes by Stimulation of Antioxidant and Phase II Pathways

    Science.gov (United States)

    Schmidt, Anke; Dietrich, Stephan; Steuer, Anna; Weltmann, Klaus-Dieter; von Woedtke, Thomas; Masur, Kai; Wende, Kristian

    2015-01-01

    Non-thermal atmospheric pressure plasma provides a novel therapeutic opportunity to control redox-based processes, e.g. wound healing, cancer, and inflammatory diseases. By spatial and time-resolved delivery of reactive oxygen and nitrogen species, it allows stimulation or inhibition of cellular processes in biological systems. Our data show that both gene and protein expression is highly affected by non-thermal plasma. Nuclear factor erythroid-related factor 2 (NRF2) and phase II enzyme pathway components were found to act as key controllers orchestrating the cellular response in keratinocytes. Additionally, glutathione metabolism, which is a marker for NRF2-related signaling events, was affected. Among the most robustly increased genes and proteins, heme oxygenase 1, NADPH-quinone oxidoreductase 1, and growth factors were found. The roles of NRF2 targets, investigated by siRNA silencing, revealed that NRF2 acts as an important switch for sensing oxidative stress events. Moreover, the influence of non-thermal plasma on the NRF2 pathway prepares cells against exogenic noxae and increases their resilience against oxidative species. Via paracrine mechanisms, distant cells benefit from cell-cell communication. The finding that non-thermal plasma triggers hormesis-like processes in keratinocytes facilitates the understanding of plasma-tissue interaction and its clinical application. PMID:25589789

  1. Expression of the helix-loop-helix protein inhibitor of DNA binding-1 (ID-1) is activated by all-trans retinoic acid in normal human keratinocytes

    International Nuclear Information System (INIS)

    Villano, C.M.; White, L.A.

    2006-01-01

    The ID (inhibitor of differentiation or DNA binding) helix-loop-helix proteins are important mediators of cellular differentiation and proliferation in a variety of cell types through regulation of gene expression. Overexpression of the ID proteins in normal human keratinocytes results in extension of culture lifespan, indicating that these proteins are important for epidermal differentiation. Our hypothesis is that the ID proteins are targets of the retinoic acid signaling pathway in keratinocytes. Retinoids, vitamin A analogues, are powerful regulators of cell growth and differentiation and are widely used in the prevention and treatment of a variety of cancers in humans. Furthermore, retinoic acid is necessary for the maintenance of epithelial differentiation and demonstrates an inhibitory action on skin carcinogenesis. We examined the effect of all-trans retinoic acid on expression of ID-1, -2, -3, and -4 in normal human keratinocytes and found that exposure of these cells to all-trans retinoic acid causes an increase in both ID-1 and ID-3 gene expression. Furthermore, our data show that this increase is mediated by increased transcription involving several cis-acting elements in the distal portion of the promoter, including a CREB-binding site, an Egr1 element, and an YY1 site. These data demonstrate that the ID proteins are direct targets of the retinoic acid signaling pathway. Given the importance of the ID proteins to epidermal differentiation, these results suggest that IDs may be mediating some of the effects of all-trans retinoic acid in normal human keratinocytes

  2. Induction of interleukin-6 production by ultraviolet radiation in normal human epidermal keratinocytes and in a human keratinocyte cell line is mediated by DNA damage

    NARCIS (Netherlands)

    Petit-Frère, C.; Clingen, P.H.; Grewe, M.; Krutmann, J.; Roza, L.; Arlett, C.F.; Green, M.H.L.

    1998-01-01

    The sunburn reaction is the most common consequence of human exposure to ultraviolet radiation (UVR), and is mediated at least in part by interleukin- 6 (IL-6). The aim of this study was to determine if DNA is a major chromophore involved in the induction of IL-6 following UV irradiation of a human

  3. The human keratinocyte two-dimensional gel protein database (update 1995): mapping components of signal transduction pathways

    DEFF Research Database (Denmark)

    Celis, J E; Rasmussen, H H; Gromov, P

    1995-01-01

    identified (protein name, organelle components, etc.) using a procedure or a combination of procedures that include (i) comigration with known human proteins, (ii) 2-D gel immunoblotting using specific antibodies, (iii) microsequencing of Coomassie Brilliant Blue stained proteins, (iv) mass spectrometry, (v......)vaccinia virus expression of full length cDNAs, and (vi) in vitro transcription/translation of full-length cDNAs. This year, special emphasis has been given to the identification of signal transduction components by using 2-D gel immunoblotting of crude keratinocyte lysates in combination with enhanced......--through a systematic study of ekeratinocytes--qualitative and quantitative information on proteins and their genes that may allow us to identify abnormal patterns of gene expression and to pinpoint signaling pathways and components affected in various skin diseases, cancer included. Udgivelsesdato: 1995-Dec...

  4. Triggering Apoptotic Death of Human Epidermal Keratinocytes by Malic Acid: Involvement of Endoplasmic Reticulum Stress- and Mitochondria-Dependent Signaling Pathways

    Directory of Open Access Journals (Sweden)

    Yu-Ping Hsiao

    2015-01-01

    Full Text Available Malic acid (MA has been commonly used in cosmetic products, but the safety reports in skin are sparse. To investigate the biological effects of MA in human skin keratinocytes, we investigated the potential cytotoxicity and apoptotic effects of MA in human keratinocyte cell lines (HaCaT. The data showed that MA induced apoptosis based on the observations of DAPI staining, DNA fragmentation, and sub-G1 phase in HaCaT cells and normal human epidermal keratinocytes (NHEKs. Flow cytometric assays also showed that MA increased the production of mitochondrial superoxide (mito-SOX but decreased the mitochondrial membrane potential. Analysis of bioenergetics function with the XF 24 analyzer Seahorse extracellular flux analyzer demonstrated that oxygen consumption rate (OCR was significantly decreased whereas extracellular acidification rate (ECAR was increased in MA-treated keratinocytes. The occurrence of apoptosis was proved by the increased expressions of FasL, Fas, Bax, Bid, caspases-3, -8, -9, cytochrome c, and the declined expressions of Bcl-2, PARP. MA also induced endoplasmic reticulum stress associated protein expression such as GRP78, GADD153, and ATF6α. We demonstrated that MA had anti-proliferative effect in HaCaT cell through the inhibition of cell cycle progression at G0/G1, and the induction of programmed cell death through endoplasmic reticulum stress- and mitochondria-dependent pathways.

  5. Changes in localization of human discs large (hDlg) during keratinocyte differentiation is associated with expression of alternatively spliced hDlg variants

    International Nuclear Information System (INIS)

    Roberts, S.; Calautti, E.; Vanderweil, S.; Nguyen, H.O.; Foley, A.; Baden, H.P.; Viel, A.

    2007-01-01

    Alternative spliced variants of the human discs large (hDlg) tumour suppressor are characterized by combinations of insertions. Here, using insertions I2- and I3-specific antibodies, we show that I2 and I3 variants have distinct distributions in epidermal and cervical epithelia. In skin and cervix, I3 variants are found in the cytoplasm. Cytoplasmic localization of I3 variants decreases as cervical keratinocytes differentiate, concomitant with relocalization to the cell periphery. I2 variants are found at the cell periphery of differentiated epidermal and cervical keratinocytes. Nuclear localization of I2 variants was evident in both tissues, with concentration of nuclear I2 variants in basal and parabasal cervical keratinocytes. A prominent nuclear localization of hDlg in cells of hyperproliferative layers of psoriatic lesions, but not in mature differentiated keratinocytes, together with I2 redistribution in differentiating keratinocytes, suggests that nuclear hDlg functions may be pertinent to growth of undifferentiated cells. Supporting our findings in squamous tissues, a decrease of nuclear hDlg and an increase of membrane-bound and cytoplasmic hDlg upon calcium-induced keratinocyte differentiation were not concomitant processes. Furthermore, we confirm that the exit of I2 variants from the nucleus is linked to stimulation of epithelial differentiation. The dynamic redistribution of hDlg also correlated with a marked increase in the expression of I3 variants while the level of I2 variants showed only a moderate decrease. Because changes in the intracellular distribution of hDlg splice variants, and in their expression levels, correlate with changes in differentiation state we hypothesize that the different hDlg isoforms play distinct roles at various stages of epithelial differentiation

  6. [14C]mechlorethamine binding to proteins of the human keratinocyte

    International Nuclear Information System (INIS)

    Deaton, M.A.; Jones, G.P.; Bowman, P.D.

    1990-01-01

    Much mustard agent research has focused on mustard/DNA interactions. Mustard also interacts with proteins, however, and to reach the DNA any agent must first pass through the cytoplasm. We hypothesized that the cell's proteins would covalently bind mustard, and thereby limit its access to the DNA. Keratinocyte proteins were radiolabeled with [ 14 C]mechlorethamine and separated by electrophoresis. The banding patterns that resulted were made visible on x-ray films, then compared with control patterns. A correspondence of almost one-to-one was observed, which supports the hypothesis that many cellular proteins are susceptible to mustard alkylation. It follows that some mustard symptoms probably result from effects on existing proteins

  7. Human T-Lymphotropic virus (HTLV type I in vivo integration in oral keratinocytes

    Directory of Open Access Journals (Sweden)

    Martha C Domínguez

    2011-03-01

    Full Text Available Although the infection of HTLV-1 to cell components of the mouth have been previously reported, there was not until this report, a detailed study to show the characteristics of such infection. From 14 Tropical Spastic Paraparesis/ HTLV-1-Associated Myelopathy (HAM/TSP patients and 11 asymptomatic carrier individuals (AC coming from HTLV-1 endemic areas of southwest Pacific of Colombia, infected oral mucosa cells were primary cultured during five days. These cell cultures were immunophenotyped by dual color fluorescence cell assortment using different lymphocyte CD markers and also were immunohistochemically processed using a polyclonal anti-keratin antibody. Five days old primary cultures were characterized as oral keratinocytes, whose phenotype was CD3- /CD4-/CD8-/CD19-/CD14-/CD45-/A575-keratin+. From DNA extracted of primary cultures LTR, pol, env and tax HTLV-1 proviral DNA regions were differentially amplified by PCR showing proviral integration. Using poly A+ RNA obtained of these primary cultures, we amplify by RT-PCR cDNA of tax and pol in 57.14% (8/14 HAM/TSP patients and 27.28% (3/11 AC. Tax and pol poly A+ RNA were expressed only in those sIgA positive subjects. Our results showed that proviral integration and viral gene expression in oral keratinocytes are associated with a HTLV-1 specific local mucosal immune response only in those HTLV-1 infected individuals with detectable levels of sIgA in their oral fluids. Altogether the results gave strong evidence that oral mucosa infection would be parte of the systemic spreading of HTLV-1 infection.

  8. Effects of bee venom against Propionibacterium acnes-induced inflammation in human keratinocytes and monocytes.

    Science.gov (United States)

    Kim, Jung-Yeon; Lee, Woo-Ram; Kim, Kyung-Hyun; An, Hyun-Jin; Chang, Young-Chae; Han, Sang-Mi; Park, Yoon-Yub; Pak, Sok Cheon; Park, Kwan-Kyu

    2015-06-01

    Propionibacterium acnes (P. acnes) cause inflammatory acne and play an important role in the pathogenesis of acne by inducing inflammatory mediators. P. acnes contributes to the inflammatory responses of acne by activating inflammatory cells, keratinocytes and sebocytes to secrete pro-inflammatory cytokines such as tumor necrosis factor-α (TNF-α), interleukin (IL)-1β and IL-8. Bee venom has traditionally been used in the treatment of certain immune-related diseases. However, there has not yet been a robust trial to prove the therapeutic effect of bee venom in skin inflammation. The aim of the present study was to investigate anti-inflammatory properties of bee venom in skin inflammation induced by P. acnes using keratinocytes (HaCaT) and monocytes (THP-1). P. acnes is known to stimulate the production of pro-inflammatory cytokines such as IL-1, IL-8, IL-12 and TNF-α. In the present study, the production of interferon-γ (IFN-γ), IL-1β, IL-8 and TNF-α was increased by P. acnes treatment in HaCaT and THP-1 cells. By contrast, bee venom effectively inhibited the secretion of IFN-γ, IL-1β, IL-8 and TNF-α. Furthermore, P. acnes treatment activated the expression of IL-8 and toll-like receptor 2 (TLR2) in HaCaT cells. However, bee venom inhibited the expression of IL-8 and TLR2 in heat-killed P. acnes. Based on these results, it is concluded that bee venom has an effective anti-inflammatory activity against P. acnes in HaCaT and THP-1 cells. Therefore, we suggest that bee venom is an alternative treatment to antibiotic therapy of acne.

  9. Incoming human papillomavirus 16 genome is lost in PML protein-deficient HaCaT keratinocytes.

    Science.gov (United States)

    Bienkowska-Haba, Malgorzata; Luszczek, Wioleta; Keiffer, Timothy R; Guion, Lucile G M; DiGiuseppe, Stephen; Scott, Rona S; Sapp, Martin

    2017-05-01

    Human papillomaviruses (HPVs) target promyelocytic leukemia (PML) nuclear bodies (NBs) during infectious entry and PML protein is important for efficient transcription of incoming viral genome. However, the transcriptional down regulation was shown to be promoter-independent in that heterologous promoters delivered by papillomavirus particles were also affected. To further investigate the role of PML protein in HPV entry, we used small hairpin RNA to knockdown PML protein in HaCaT keratinocytes. Confirming previous findings, PML knockdown in HaCaT cells reduced HPV16 transcript levels significantly following infectious entry without impairing binding and trafficking. However, when we quantified steady-state levels of pseudogenomes in interphase cells, we found strongly reduced genome levels compared with parental HaCaT cells. Because nuclear delivery was comparable in both cell lines, we conclude that viral pseudogenome must be removed after successful nuclear delivery. Transcriptome analysis by gene array revealed that PML knockdown in clonal HaCaT cells was associated with a constitutive interferon response. Abrogation of JAK1/2 signaling prevented genome loss, however, did not restore viral transcription. In contrast, knockdown of PML protein in HeLa cells did not affect HPV genome delivery and transcription. HeLa cells are transformed by HPV18 oncogenes E6 and E7, which have been shown to interfere with the JAK/Stat signaling pathway. Our data imply that PML NBs protect incoming HPV genomes. Furthermore, they provide evidence that PML NBs are key regulators of the innate immune response in keratinocytes. Promyelocytic leukemia nuclear bodies (PML NBs) are important for antiviral defense. Many DNA viruses target these subnuclear structures and reorganize them. Reorganization of PML NBs by viral proteins is important for establishment of infection. In contrast, HPVs require the presence of PML protein for efficient transcription of incoming viral genome. Our

  10. GATA3 is a master regulator of the transcriptional response to low-dose ionizing radiation in human keratinocytes

    Energy Technology Data Exchange (ETDEWEB)

    Bonin, F.; Molina, M.; Berthier-Vergnes, O.; Lamartine, J. [Universite de Lyon, Lyon, F-69003 (France); Universite Lyon 1, Lyon, F-69003 (France); CNRS, UMR5534, Centre de Genetique Moleculaire et Cellulaire, Villeurbanne, F-69622 (France); Malet, C.; Ginestet, C. [Centre Leon Berard, Service de Radiotherapie, Lyon F-69008 (France); Martin, M.T. [Laboratoire de Genomique et Radiobiologie de la Keratinopoiese, CEA, IRCM, Evry F-91000 (France)

    2009-07-01

    Background: The general population is constantly exposed to low levels of radiation through natural, occupational or medical irradiation. Even if the biological effects of low-level radiation have been intensely debated and investigated, the molecular mechanisms underlying the cellular response to low doses remain largely unknown. Results: The present study investigated the role of GATA3 protein in the control of the cellular and molecular response of human keratinocytes exposed to a 1 cGy dose of X-rays. Chromatin immunoprecipitation showed GATA3 to be able to bind the promoter of 4 genes responding to a 1 cGy exposure. To go further into the role of GATA3 after ionizing radiation exposure, we studied the cellular and molecular consequences of radiation in GATA3 knock-down cells. Knockdown was obtained by lentiviral-mediated expression of an shRNA targeting the GATA3 transcript in differentiated keratinocytes. First, radiosensitivity was assessed: the toxicity, in terms of immediate survival (with XTT test), associated with 1 cGy radiation was found to be increased in GATA3 knock-down cells. The impact of GATA3 knock-down on the transcriptome of X-ray irradiated cells was also investigated, using oligonucleotide micro-arrays to assess changes between 3 h and 72 h post-irradiation in normal vs GATA3 knock-down backgrounds; transcriptome response was found to be completely altered in GATA3 knock-down cells, with a strong induction/repression peak 48 h after irradiation. Functional annotation revealed enrichment in genes known to be involved in chaperone activity, TGF{beta} signalling and stress response. Conclusion: Taken together, these data indicate that GATA3 is an important regulator of the cellular and molecular response of epidermal cells to very low doses of radiation. (authors)

  11. Osteo-/odontogenic differentiation of induced mesenchymal stem cells generated through epithelial-mesenchyme transition of cultured human keratinocytes.

    Science.gov (United States)

    Yi, Jin-Kyu; Mehrazarin, Shebli; Oh, Ju-Eun; Bhalla, Anu; Oo, Jenessa; Chen, Wei; Lee, Min; Kim, Reuben H; Shin, Ki-Hyuk; Park, No-Hee; Kang, Mo K

    2014-11-01

    Revascularization of necrotic pulp has been successful in the resolution of periradicular inflammation; yet, several case studies suggest the need for cell-based therapies using mesenchymal stem cells (MSCs) as an alternative for de novo pulp regeneration. Because the availability of MSCs may be limited, especially in an aged population, the current study reports an alternative approach in generating MSCs from epidermal keratinocytes through a process called epithelial-mesenchymal transition (EMT). We induced EMT in primary normal human epidermal keratinocytes (NHEKs) by transient transfection of small interfering RNA targeting the p63 gene. The resulting cells were assayed for their mesenchymal marker expression, proliferation capacities as a monolayer and in a 3-dimensional collagen scaffold, and differentiation capacities. Transient transfection of p63 small-interfering RNA successfully abolished the expression of endogenous p63 in NHEKs and induced the expression of mesenchymal markers (eg, vimentin and fibronectin), whereas epithelial markers (eg, E-cadherin and involucrin) were lost. The NHEKs exhibiting the EMT phenotype acquired extended replicative potential and an increased telomere length compared with the control cells. Similar to the established MSCs, the NHEKs with p63 knockdown showed attachment onto the 3-dimensional collagen scaffold and underwent progressive proliferation and differentiation. Upon differentiation, these EMT cells expressed alkaline phosphatase activity, osteocalcin, and osteonectin and readily formed mineralized nodules detected by alizarin S red staining, showing osteo-/odontogenic differentiation. The induction of EMT in primary NHEKs by means of transient p63 knockdown allows the generation of induced MSCs from autologous sources. These cells may be used for tissues engineering purposes, including that of dental pulp. Copyright © 2014 American Association of Endodontists. Published by Elsevier Inc. All rights reserved.

  12. Cox2 and β-Catenin/T-cell Factor Signaling Intestinalize Human Esophageal Keratinocytes When Cultured under Organotypic Conditions

    Directory of Open Access Journals (Sweden)

    Jianping Kong

    2011-09-01

    Full Text Available The incidence of esophageal adenocarcinoma (EAC is rising in the United States. An important risk factor for EAC is the presence of Barrett esophagus (BE. BE is the replacement of normal squamous esophageal epithelium with a specialized columnar epithelium in response to chronic acid and bile reflux. However, the emergence of BE from squamous keratinocytes has not yet been demonstrated. Our research has focused on this. Wnt and cyclooxygenase 2 (Cox2 are two pathways whose activation has been associated with BE and progression to EAC, but their role has not been tested experimentally. To explore their contribution, we engineered a human esophageal keratinocyte cell line to express either a dominant-active Wnt effector CatCLef or a Cox2 complementary DNA. In a two-dimensional culture environment, Cox2 expression increases cell proliferation and migration, but neither transgene induces known BE markers. In contrast, when these cells were placed into three-dimensional organotypic culture conditions, we observed more profound effects. CatCLef-expressing cells were more proliferative, developed a thicker epithelium, and upregulated Notch signaling and several BE markers including NHE2. Cox2 expression also increased cell proliferation and induced a thicker epithelium. More importantly, we observed cysts form within the epithelium, filled with intestinal mucins including Muc5B and Muc17. This suggests that Cox2 expression in a three-dimensional culture environment induces a lineage of mucin-secreting cells and supports an important causal role for Cox2 in BE pathogenesis. We conclude that in vitro modeling of BE pathogenesis can be improved by enhancing Wnt signaling and Cox2 activity and using three-dimensional organotypic culture conditions.

  13. Broad-spectrum sunscreens prevent the secretion of proinflammatory cytokines in human keratinocytes exposed to ultraviolet A and phototoxic lomefloxacin

    International Nuclear Information System (INIS)

    Reinhardt, P.; Cybulski, M.; Miller, S.M.; Ferrarotto, C.; Wilkins, R.; Deslauriers, Y.

    2006-01-01

    The combination of phototoxic drugs and ultraviolet (UV) radiation can trigger the release of proinflammatory cytokines. The present study measured the ability of sunscreens to prevent cytokine secretion in human keratinocytes following cotreatment of these cells with a known photoreactive drug and UVA. Keratinocytes were treated for 1 h with increasing concentrations of lomefloxacin (LOM) or norfloxacin (NOR), exposed to 15 J/cm 2 UVA, and incubated for 24 h. NOR, owing to the absence of a fluorine atom in position 8, was non-phototoxic and used as a negative control. Cell viability and the release of 3 cytokines were assessed, namely interleukin-1α (IL-1α), interleukin-6 (IL-6), and tumour necrosis factor-α (TNF-α). The measurement of these cytokines may be a useful tool for detecting photoreactive compounds. To measure their ability to prevent cytokine secretion, various sunscreens were inserted between the UVA source and the cells. Treatment with NOR, NOR plus UVA, or LOM had no effect on the cells. LOM plus UVA, however, had an effect on cell viability and on cytokine secretion. IL-1α levels increased with LOM concentration. The release of TNF-α and IL-6 followed the same pattern at lower concentrations of LOM but peaked at 15 μmol/L and decreased at higher concentrations. Sunscreens protected the cells from the effects of LOM plus UVA, as cell viability and levels of cytokines remained the same as in the control cells. In conclusion, the application of broad-spectrum sunscreen by individuals exposed to UVA radiation may prevent phototoxic reactions initiated by drugs such as LOM. (author)

  14. GATA3 is a master regulator of the transcriptional response to low-dose ionizing radiation in human keratinocytes

    International Nuclear Information System (INIS)

    Bonin, F.; Molina, M.; Berthier-Vergnes, O.; Lamartine, J.; Malet, C.; Ginestet, C.; Martin, M.T.

    2009-01-01

    Background: The general population is constantly exposed to low levels of radiation through natural, occupational or medical irradiation. Even if the biological effects of low-level radiation have been intensely debated and investigated, the molecular mechanisms underlying the cellular response to low doses remain largely unknown. Results: The present study investigated the role of GATA3 protein in the control of the cellular and molecular response of human keratinocytes exposed to a 1 cGy dose of X-rays. Chromatin immunoprecipitation showed GATA3 to be able to bind the promoter of 4 genes responding to a 1 cGy exposure. To go further into the role of GATA3 after ionizing radiation exposure, we studied the cellular and molecular consequences of radiation in GATA3 knock-down cells. Knockdown was obtained by lentiviral-mediated expression of an shRNA targeting the GATA3 transcript in differentiated keratinocytes. First, radiosensitivity was assessed: the toxicity, in terms of immediate survival (with XTT test), associated with 1 cGy radiation was found to be increased in GATA3 knock-down cells. The impact of GATA3 knock-down on the transcriptome of X-ray irradiated cells was also investigated, using oligonucleotide micro-arrays to assess changes between 3 h and 72 h post-irradiation in normal vs GATA3 knock-down backgrounds; transcriptome response was found to be completely altered in GATA3 knock-down cells, with a strong induction/repression peak 48 h after irradiation. Functional annotation revealed enrichment in genes known to be involved in chaperone activity, TGFβ signalling and stress response. Conclusion: Taken together, these data indicate that GATA3 is an important regulator of the cellular and molecular response of epidermal cells to very low doses of radiation. (authors)

  15. Evidence for Alteration of EZH2, BMI1, and KDM6A and Epigenetic Reprogramming in Human Papillomavirus Type 16 E6/E7-Expressing Keratinocytes

    OpenAIRE

    Hyland, Paula L.; McDade, Simon S.; McCloskey, Rachel; Dickson, Glenda J.; Arthur, Ken; McCance, Dennis J.; Patel, Daksha

    2011-01-01

    A number of epigenetic alterations occur in both the virus and host cellular genomes during human papillomavirus (HPV)-associated carcinogenesis, and investigations of such alterations, including changes in chromatin proteins and histone modifications, have the potential to lead to therapeutic epigenetic reversion. We report here that transformed HPV16 E6/E7-expressing primary human foreskin keratinocytes (HFKs) (E6/E7 cells) demonstrate increased expression of the PRC2 methyltransferase EZH2...

  16. Clinicopathological correlation of keratinocyte growth factor and matrix metalloproteinase-9 expression in human gastric cancer.

    Science.gov (United States)

    Zhang, Qing; Wang, Ping; Shao, Ming; Chen, Shi-Wen; Xu, Zhi-Feng; Xu, Feng; Yang, Zhong-Yin; Liu, Bing-Ya; Gu, Qin-Long; Zhang, Wen-Jian; Li, Yong

    2015-01-01

    Keratinocyte growth factor (KGF) is reported to be implicated in the growth of some cancer cells. Matrix metalloproteinase 9 (MMP-9) is thought to enhance the tumor invasion and metastasis ability. This study was aimed at analyzing the relationship between KGF and MMP-9 expression and patients' clinicopathological characteristics to clarify the clinical significance of the expression of KGF and MMP-9 in gastric cancer. Tissue samples from 161 patients with primary gastric cancer were investigated using immunohistochemistry. The relationship between KGF and/or MMP-9 expression and clinicopathological characteristics was analyzed. KGF expression and MMP-9 expression in gastric cancer tissue were observed in 62 cases (38.5%) and 97 cases (60.2%), respectively. MMP-9 was significantly associated with depth of invasion, lymph node metastasis and TNM stage. The prognosis of MMP-9-positive patients was significantly poorer than that of MMP-9-negative patients (p = 0.009). KGF expression was positively correlated with MMP-9 expression in gastric cancer, and the prognosis of patients with both KGF- and MMP-9-positive tumors was significantly worse than that of patients with negative tumors for either factor (p = 0.045). Expression of MMP-9 was revealed to be an independent prognostic factor (p = 0.026). Coexpression of KGF and MMP-9 in gastric cancer could be a useful prognostic factor, and MMP-9 might also serve as a novel target for both prognostic prediction and therapeutics.

  17. Measles virus envelope pseudotyped lentiviral vectors transduce quiescent human HSCs at an efficiency without precedent.

    Science.gov (United States)

    Lévy, Camille; Amirache, Fouzia; Girard-Gagnepain, Anais; Frecha, Cecilia; Roman-Rodríguez, Francisco J; Bernadin, Ornellie; Costa, Caroline; Nègre, Didier; Gutierrez-Guerrero, Alejandra; Vranckx, Lenard S; Clerc, Isabelle; Taylor, Naomi; Thielecke, Lars; Cornils, Kerstin; Bueren, Juan A; Rio, Paula; Gijsbers, Rik; Cosset, François-Loïc; Verhoeyen, Els

    2017-10-24

    Hematopoietic stem cell (HSC)-based gene therapy trials are now moving toward the use of lentiviral vectors (LVs) with success. However, one challenge in the field remains: efficient transduction of HSCs without compromising their stem cell potential. Here we showed that measles virus glycoprotein-displaying LVs (hemagglutinin and fusion protein LVs [H/F-LVs]) were capable of transducing 100% of early-acting cytokine-stimulated human CD34 + (hCD34 + ) progenitor cells upon a single application. Strikingly, these H/F-LVs also allowed transduction of up to 70% of nonstimulated quiescent hCD34 + cells, whereas conventional vesicular stomatitis virus G (VSV-G)-LVs reached 5% at the most with H/F-LV entry occurring exclusively through the CD46 complement receptor. Importantly, reconstitution of NOD/SCIDγc -/- (NSG) mice with H/F-LV transduced prestimulated or resting hCD34 + cells confirmed these high transduction levels in all myeloid and lymphoid lineages. Remarkably, for resting CD34 + cells, secondary recipients exhibited increasing transduction levels of up to 100%, emphasizing that H/F-LVs efficiently gene-marked HSCs in the resting state. Because H/F-LVs promoted ex vivo gene modification of minimally manipulated CD34 + progenitors that maintained stemness, we assessed their applicability in Fanconi anemia, a bone marrow (BM) failure with chromosomal fragility. Notably, only H/F-LVs efficiently gene-corrected minimally stimulated hCD34 + cells in unfractionated BM from these patients. These H/F-LVs improved HSC gene delivery in the absence of cytokine stimulation while maintaining their stem cell potential. Thus, H/F-LVs will facilitate future clinical applications requiring HSC gene modification, including BM failure syndromes, for which treatment has been very challenging up to now.

  18. Human keratinocytes are a source for tumor necrosis factor alpha: Evidence for synthesis and release upon stimulation with endotoxin or ultraviolet light

    International Nuclear Information System (INIS)

    Koeck, A.S.; Schwarz, T.; Kirnbauer, R.; Urbanski, A.; Perry, P.; Ansel, J.C.; Luger, T.A.

    1990-01-01

    Tumor necrosis factor alpha (TNF-alpha), in addition to being cytotoxic for certain tumor cells, has turned out as a multifunctional cytokine that is involved in the regulation of immunity and inflammation. Since human keratinocytes have been demonstrated to be a potent source of various cytokines, it was investigated whether epidermal cells synthesize and release TNF-alpha. Supernatants derived from normal human keratinocytes (HNK) and human epidermoid carcinoma cell lines (KB, A431) were tested both in a TNF-alpha-specific ELISA and a bioassay. In supernatants of untreated epidermal cells, no or minimal TNF-alpha activity was found, while after stimulation with lipopolysaccharide (LPS) or ultraviolet (UV) light, significant amounts were detected. Western blot analysis using an antibody directed against human TNF-alpha revealed a molecular mass of 17 kD for keratinocyte-derived TNF-alpha. These biological and biochemical data were also confirmed by Northern blot analysis revealing mRNA specific for TNF-alpha in LPS- or ultraviolet B (UVB)-treated HNK and KB cells. In addition, increased TNF-alpha levels were detected in the serum obtained from human volunteers 12 and 24 h after a single total body UVB exposure, which caused a severe sunburn reaction. These findings indicate that keratinocytes upon stimulation are able to synthesize and release TNF-alpha, which may gain access to the circulation. Thus, TNF-alpha in concert with other epidermal cell-derived cytokines may mediate local and systemic inflammatory reactions during host defense against injurious events caused by microbial agents or UV irradiation

  19. Protective effect of Opuntia ficus-indica L. cladodes against UVA-induced oxidative stress in normal human keratinocytes.

    Science.gov (United States)

    Petruk, Ganna; Di Lorenzo, Flaviana; Imbimbo, Paola; Silipo, Alba; Bonina, Andrea; Rizza, Luisa; Piccoli, Renata; Monti, Daria Maria; Lanzetta, Rosa

    2017-12-15

    Opuntia ficus-indica L. is known for its beneficial effects on human health, but still little is known on cladodes as a potent source of antioxidants. Here, a direct, economic and safe method was set up to obtain water extracts from Opuntia ficus-indica cladodes rich in antioxidant compounds. When human keratinocytes were pre-treated with the extract before being exposed to UVA radiations, a clear protective effect against UVA-induced stress was evidenced, as indicated by the inhibition of stress-induced processes, such as free radicals production, lipid peroxidation and GSH depletion. Moreover, a clear protective effect against apoptosis in pre-treated irradiated cells was evidenced. We found that eucomic and piscidic acids were responsible for the anti-oxidative stress action of cladode extract. In conclusion, a bioactive, safe, low-cost and high value-added extract from Opuntia cladodes was obtained to be used for skin health/protection. Copyright © 2017 Elsevier Ltd. All rights reserved.

  20. Cytotoxic effects of denture adhesives on primary human oral keratinocytes, fibroblasts and permanent L929 cell lines.

    Science.gov (United States)

    Chen, Fengying; Wu, Tianfu; Cheng, Xiangrong

    2014-03-01

    To date, there have been very little data on the cytotoxic responses of different cell lines to denture adhesives. To determine the cytotoxicity of three denture adhesives on primary human oral keratinocytes (HOKs), fibroblasts (HOFs) and permanent mouse fibroblasts cell lines (L929). Three commercial denture adhesives (two creams and one powder) were prepared for indirect contact using the agar diffusion test, as well as extracts in MTT assay. The results of the MTT assay were statistically analysed by one-way anova and Tukey's test (p adhesives showed mild to moderate cytotoxicity to primary HOKs (p  0.05) in both assays. For primary HOFs cultures, slight cytotoxicity was observed for one of the products from the agar diffusion test and undiluted eluates of all tested adhesives with MTT assay (p adhesives are toxic to the primary HOKs and HOFs cultures, whereas non-toxic to L929 cells. The results suggest that primary human oral mucosal cells may provide more valuable information in toxicity screening of denture adhesives. © 2012 John Wiley & Sons A/S and The Gerodontology Association. Published by John Wiley & Sons Ltd.

  1. Discrimination of skin sensitizers from non-sensitizers by interleukin-1α and interleukin-6 production on cultured human keratinocytes.

    Science.gov (United States)

    Jung, Daun; Che, Jeong-Hwan; Lim, Kyung-Min; Chun, Young-Jin; Heo, Yong; Seok, Seung Hyeok

    2016-09-01

    In vitro testing methods for classifying sensitizers could be valuable alternatives to in vivo sensitization testing using animal models, such as the murine local lymph node assay (LLNA) and the guinea pig maximization test (GMT), but there remains a need for in vitro methods that are more accurate and simpler to distinguish skin sensitizers from non-sensitizers. Thus, the aim of our study was to establish an in vitro assay as a screening tool for detecting skin sensitizers using the human keratinocyte cell line, HaCaT. HaCaT cells were exposed to 16 relevant skin sensitizers and 6 skin non-sensitizers. The highest dose used was the dose causing 75% cell viability (CV75) that we determined by an MTT [3-(4,5-dimethylthiazol-2-yl)-2,5-diphenyltetrazolium bromide] assay. The levels of extracellular production of interleukin-1α (IL-1α) and IL-6 were measured. The sensitivity of IL-1α was 63%, specificity was 83% and accuracy was 68%. In the case of IL-6, sensitivity: 69%, specificity: 83% and accuracy: 73%. Thus, this study suggests that measuring extracellular production of pro-inflammatory cytokines IL-1α and IL-6 by human HaCaT cells may potentially classify skin sensitizers from non-sensitizers. Copyright © 2015 John Wiley & Sons, Ltd. Copyright © 2015 John Wiley & Sons, Ltd.

  2. Assessment of the potential skin irritation of lysine-derivative anionic surfactants using mouse fibroblast and human keratinocytes as an alternative to animal testing

    OpenAIRE

    Sánchez Molina, Lourdes; Mitjans Arnal, Montserrat; Infante Martínez-Pardo, Ma. Rosa; Vinardell Martínez-Hidalgo, Ma. Pilar

    2004-01-01

    Purpose. The aim of this study was to identify new surfactants with low skin irritant properties for use in pharmaceutical and cosmetic formulations, employing cell culture as an alternative method to in vivo testing. In addition, we sought to establish whether potential cytotoxic properties were related to the size of the counterions bound to the surfactants. Methods. Cytotoxicity was assessed in the mouse fibroblast cell line 3T6, and the human keratinocyte cell line NCTC 2544, using the MT...

  3. Epidermal cell-shape regulation and subpopulation kinetics during butyrate-induced terminal maturation of normal and SV40-transformed human keratinocytes: epithelial models of differentiation therapy.

    Science.gov (United States)

    Staiano-Coico, L; Steinberg, M; Higgins, P J

    1990-10-15

    Recent data indicate that malignant human epidermal cells may be appropriate targets for sodium butyrate (NaB)-mediated differentiation therapy. The response of pre- and post-crisis populations of SV40-transformed human keratinocytes (SVKs) to this differentiation-inducing agent was assessed, therefore, within the framework of NaB-directed normal human keratinocyte (NHK) maturation. NaB augmented cornified envelope (CE) production in NHK and pre-crisis SVK cultures; the time-course and efficiency of induced maturation were similar in the 2 cell systems. In NHKs, the percentage of amplifying ("B" substate) cells decreased with time in NaB correlating with increases in both "C" stage keratinocytes and CEs. The latter formed over one or 2 layers of nucleated basal-like cells. Inductions were accompanied by immediate cell cycle blocks (in both the G1 and G2/M phases), reorganization within the actin cytoskeleton, and transient early increases in cellular actin content. Increased NHK and pre-crisis SVK cytoskeletal-associated actin reached a maximum approximately 48 hr after NaB addition and preceded development of CEs. The CE precursors, thus, probably reside in the "B" substate. Post-crisis SVKs, in contrast, were refractive to NaB-induced terminal maturation or cell-cycle perturbation, failed to initiate actin filament rearrangements, and retained a basal cell-like phenotype. Stable transformation of human SVKs in post-crisis phase, therefore, appears to be associated with loss of maturation "competence" within the "B" keratinocyte subpopulation.

  4. Autophagy participates in isoliquiritigenin-induced melanin degradation in human epidermal keratinocytes through PI3K/AKT/mTOR signaling.

    Science.gov (United States)

    Yang, Zhibo; Zeng, Biyun; Pan, Yi; Huang, Pan; Wang, Chang

    2018-01-01

    Melanin is the pigment responsible for the color of human skin and hair. Melanin serves as a double-edge sword which can exert both protective and spot-causing effects on skin. Although melanin has an important role in protecting the skin against UV damage, an excessive or uneven melanin production can lead to the formation of freckles and age spots. Isoliquiritigenin (ISL) has been reported to inhibit melanin synthesis; however, its role in melanin degradation remains unclear. In the present study, we evaluated the detailed function of ISL in melanin degradation in human epidermal keratinocytes. Since autophagy has been reported to be related to melanin degradation, we also examined the activation of autophagy by ISL treatment in keratinocytes by measurement of autophagy-related proteins, ATG7, LC3 and p62. Moreover, si-ATG7-induced ATG7 knockdown and autophagy inhibitor 3-MA decreased LC3 II protein levels and increased PMEL17, p62 and melanin levels in HaCaT cells, which could be partially reversed by ISL treatment, indicating that autophagy participated in melanin degradation. The decreased p-AKT and p-mTOR proteins upon ISL treatment indicated the involvement of PI3K/AKT/mTOR signaling in ISL-induced melanin degradation. Taken together, we demonstrated that autophagy participates in ISL-induced melanin degradation in human epidermal keratinocytes through PI3K/AKT/mTOR signaling. Copyright © 2017. Published by Elsevier Masson SAS.

  5. The comparison of two methods to obtain human oral keratinocytes in primary culture; Comparacao de dois metodos de obtencao celular para cultura primaria de queratinocitos bucais humanos

    Energy Technology Data Exchange (ETDEWEB)

    Klingbeil, Maria Fatima Guarizo

    2006-07-01

    The therapeutic procedures frequently used in oral treatments for the pathological diseases are surgical, resulting in failures of the mucosal continuity.The possibility to obtain transplantable oral epithelia from an in vitro cell culture opens new utilization perspectives not only to where it comes from, but also as a reconstructive material for other parts of the human body, such as: urethra, epithelia corneo-limbal, cornea, ocular surface. Many researchers still use controversial methods for obtaining cells. It was therefore evaluated and compared the efficiency in both methods: enzymatic and direct explant to obtain oral keratinocytes from human oral mucosa. Fragments of intra oral epithelial tissues from healthy human subjects, undergoing dental surgeries, were donated to the research project. The keratinocytes were cultivated over a feeder-layer from a previously irradiated 3T3 Swiss albino fibroblasts. In this study it was compared the time needed in the cell obtention, the best cell amount between both methods, the life-span, the cell capacity to form an in vitro epithelia and its morphologic structure. The results in the assessment of both methods have shown the possibility to obtain keratinocytes from a small oral fragment, but at the same time we may verify the advantages and peculiar restrictions for each one of both analyzed methods. (author)

  6. Chitosan-shelled oxygen-loaded nanodroplets abrogate hypoxia dysregulation of human keratinocyte gelatinases and inhibitors: New insights for chronic wound healing

    International Nuclear Information System (INIS)

    Khadjavi, Amina; Magnetto, Chiara; Panariti, Alice; Argenziano, Monica; Gulino, Giulia Rossana; Rivolta, Ilaria; Cavalli, Roberta; Giribaldi, Giuliana; Guiot, Caterina; Prato, Mauro

    2015-01-01

    Background: : In chronic wounds, efficient epithelial tissue repair is hampered by hypoxia, and balances between the molecules involved in matrix turn-over such as matrix metalloproteinases (MMPs) and tissue inhibitors of metalloproteinases (TIMPs) are seriously impaired. Intriguingly, new oxygenating nanocarriers such as 2H,3H-decafluoropentane-based oxygen-loaded nanodroplets (OLNs) might effectively target chronic wounds. Objective: : To investigate hypoxia and chitosan-shelled OLN effects on MMP/TIMP production by human keratinocytes. Methods: : HaCaT cells were treated for 24 h with 10% v/v OLNs both in normoxia or hypoxia. Cytotoxicity and cell viability were measured through biochemical assays; cellular uptake by confocal microscopy; and MMP and TIMP production by enzyme-linked immunosorbent assay or gelatin zymography. Results: : Normoxic HaCaT cells constitutively released MMP-2, MMP-9, TIMP-1 and TIMP-2. Hypoxia strongly impaired MMP/TIMP balances by reducing MMP-2, MMP-9, and TIMP-2, without affecting TIMP-1 release. After cellular uptake by keratinocytes, nontoxic OLNs abrogated all hypoxia effects on MMP/TIMP secretion, restoring physiological balances. OLN abilities were specifically dependent on time-sustained oxygen diffusion from OLN core. Conclusion: : Chitosan-shelled OLNs effectively counteract hypoxia-dependent dysregulation of MMP/TIMP balances in human keratinocytes. Therefore, topical administration of exogenous oxygen, properly encapsulated in nanodroplet formulations, might be a promising adjuvant approach to promote healing processes in hypoxic wounds. - Highlights: • Hypoxia impairs MMP9/TIMP1 and MMP2/TIMP2 balances in HaCaT human keratinocytes. • Chitosan-shelled oxygen-loaded nanodroplets (OLNs) are internalised by HaCaT cells. • OLNs are not toxic to HaCaT cells. • OLNs effectively counteract hypoxia effects on MMP/TIMP balances in HaCaT cells. • OLNs appear as promising and cost-effective therapeutic tools for hypoxic

  7. Chitosan-shelled oxygen-loaded nanodroplets abrogate hypoxia dysregulation of human keratinocyte gelatinases and inhibitors: New insights for chronic wound healing

    Energy Technology Data Exchange (ETDEWEB)

    Khadjavi, Amina [Dipartimento di Neuroscienze, Università di Torino, Torino (Italy); Magnetto, Chiara [Istituto Nazionale di Ricerca Metrologica (INRIM), Torino (Italy); Panariti, Alice [Dipartimento di Scienze della Salute, Università di Milano Bicocca, Monza (Italy); Argenziano, Monica [Dipartimento di Scienza e Tecnologia del Farmaco, Università di Torino, Torino (Italy); Gulino, Giulia Rossana [Dipartimento di Oncologia, Università di Torino, Torino (Italy); Rivolta, Ilaria [Dipartimento di Scienze della Salute, Università di Milano Bicocca, Monza (Italy); Cavalli, Roberta [Dipartimento di Scienza e Tecnologia del Farmaco, Università di Torino, Torino (Italy); Giribaldi, Giuliana [Dipartimento di Oncologia, Università di Torino, Torino (Italy); Guiot, Caterina [Dipartimento di Neuroscienze, Università di Torino, Torino (Italy); Prato, Mauro, E-mail: mauro.prato@unito.it [Dipartimento di Neuroscienze, Università di Torino, Torino (Italy); Dipartimento di Scienze della Sanità Pubblica e Pediatriche, Università di Torino, Torino (Italy)

    2015-08-01

    Background: : In chronic wounds, efficient epithelial tissue repair is hampered by hypoxia, and balances between the molecules involved in matrix turn-over such as matrix metalloproteinases (MMPs) and tissue inhibitors of metalloproteinases (TIMPs) are seriously impaired. Intriguingly, new oxygenating nanocarriers such as 2H,3H-decafluoropentane-based oxygen-loaded nanodroplets (OLNs) might effectively target chronic wounds. Objective: : To investigate hypoxia and chitosan-shelled OLN effects on MMP/TIMP production by human keratinocytes. Methods: : HaCaT cells were treated for 24 h with 10% v/v OLNs both in normoxia or hypoxia. Cytotoxicity and cell viability were measured through biochemical assays; cellular uptake by confocal microscopy; and MMP and TIMP production by enzyme-linked immunosorbent assay or gelatin zymography. Results: : Normoxic HaCaT cells constitutively released MMP-2, MMP-9, TIMP-1 and TIMP-2. Hypoxia strongly impaired MMP/TIMP balances by reducing MMP-2, MMP-9, and TIMP-2, without affecting TIMP-1 release. After cellular uptake by keratinocytes, nontoxic OLNs abrogated all hypoxia effects on MMP/TIMP secretion, restoring physiological balances. OLN abilities were specifically dependent on time-sustained oxygen diffusion from OLN core. Conclusion: : Chitosan-shelled OLNs effectively counteract hypoxia-dependent dysregulation of MMP/TIMP balances in human keratinocytes. Therefore, topical administration of exogenous oxygen, properly encapsulated in nanodroplet formulations, might be a promising adjuvant approach to promote healing processes in hypoxic wounds. - Highlights: • Hypoxia impairs MMP9/TIMP1 and MMP2/TIMP2 balances in HaCaT human keratinocytes. • Chitosan-shelled oxygen-loaded nanodroplets (OLNs) are internalised by HaCaT cells. • OLNs are not toxic to HaCaT cells. • OLNs effectively counteract hypoxia effects on MMP/TIMP balances in HaCaT cells. • OLNs appear as promising and cost-effective therapeutic tools for hypoxic

  8. Eicosapentaenoic acid inhibits TNF-α-induced matrix metalloproteinase-9 expression in human keratinocytes, HaCaT cells

    International Nuclear Information System (INIS)

    Kim, Hyeon Ho; Lee, Youngae; Eun, Hee Chul; Chung, Jin Ho

    2008-01-01

    Eicosapentaenoic acid (EPA) is an omega-3 (ω-3) polyunsaturated fatty acid (PUFA), which has anti-inflammatory and anti-cancer properties. Some reports have demonstrated that EPA inhibits NF-κB activation induced by tumor necrosis factor (TNF)-α or lipopolysaccharide (LPS) in various cells. However, its detailed mode of action is unclear. In this report, we investigated whether EPA inhibits the expression of TNF-α-induced matrix metalloproteinases (MMP)-9 in human immortalized keratinocytes (HaCaT). TNF-α induced MMP-9 expression by NF-κB-dependent pathway. Pretreatment of EPA inhibited TNF-α-induced MMP-9 expression and p65 phosphorylation. However, EPA could not affect IκB-α phosphorylation, nuclear translocation of p65, and DNA binding activity of NF-κB. EPA inhibited TNF-α-induced p65 phosphorylation through p38 and Akt inhibition and this inhibition was IKKα-dependent event. Taken together, we demonstrate that EPA inhibits TNF-α-induced MMP-9 expression through inhibition of p38 and Akt activation

  9. Assessment of dermal toxicity of nanosilica using cultured keratinocytes, a human skin equivalent model and an invivo model

    International Nuclear Information System (INIS)

    Park, Yoon-Hee; Kim, Ji Na; Jeong, Sang Hoon; Choi, Jae Eun; Lee, Seung-Ho; Choi, Byeong Hyeok; Lee, Jung Pyo; Sohn, Kyung Hee; Park, Kui Lea; Kim, Meyoung-Kon; Son, Sang Wook

    2010-01-01

    Assessments of skin irritation potentials are important aspects of the development of nanotechnology. Nanosilica is currently being widely used for commercial purposes, but little literature is available on its skin toxicity and irritation potential. This study was designed to determine whether nanosilica has the potential to cause acute cutaneous toxicity, using cultured HaCaT keratinocytes (CHK), a human skin equivalent model (HSEM), and invivo model. Nanosilica was characterized by scanning electron microscopy. We evaluated the cytotoxic effects of nanosilica on CHKs and the HSEM. In addition, we also investigated whether two commercially available nanosilicas with different sizes (7 and 10-20 nm) have different effects. To confirm invitro results, we evaluated the irritation potentials of nanosilicas on rabbit skin. Nanosilicas reduced the cell viabilities of CHKs in a dose-dependent manner. However, the HSEM revealed no irritation at 500 μg/ml of nanosilica. Furthermore, this result concurred with Draize skin irritation test findings. The present study data indicate that nanosilica does not cause acute cutaneous irritation. Furthermore, this study shows that the HSEM used provides more useful screening data than the conventional cell culture model on the relative toxicities of NPs.

  10. Progression from productive infection to integration and oncogenic transformation in human papillomavirus type 59-immortalized foreskin keratinocytes.

    Science.gov (United States)

    Spartz, Helena; Lehr, Elizabeth; Zhang, Benyue; Roman, Ann; Brown, Darron R

    2005-05-25

    Studies of changes in the virus and host cell upon progression from human papillomavirus (HPV) episomal infection to integration are critical to understanding HPV-related malignant transformation. However, there exist only a few in vitro models of both productive HPV infection and neoplastic progression on the same host background. We recently described a unique foreskin keratinocyte cell line (ERIN 59) that contains HPV 59 (a close relative of HPV 18). Early passages of ERIN 59 cells (passages 9-13) contained approximately 50 copies of episomes/cell, were feeder cell-dependent, and could be induced to differentiate and produce infectious virus in a simple culture system. We now report that late passage cells (passages greater than 50) were morphologically different from early passage cells, were feeder cell independent, and did not differentiate or produce virus. These late passage cells contained HPV in an integrated form. An integration-derived oncogene transcript was expressed in late passage cells. The E2 open reading frame was interrupted in this transcript at nucleotide 3351. Despite a lower viral genome copy number in late passage ERIN 59 cells, expression of E6/E7 oncogene transcripts was similar to early passage cells. We conclude that ERIN 59 cells are a valuable cell line representing a model of progression from HPV 59 episomal infection and virus production to HPV 59 integration and associated oncogenic transformation on the same host background.

  11. In Vitro Growth of Human Keratinocytes and Oral Cancer Cells into Microtissues: An Aerosol-Based Microencapsulation Technique

    Directory of Open Access Journals (Sweden)

    Wai Yean Leong

    2017-05-01

    Full Text Available Cells encapsulation is a micro-technology widely applied in cell and tissue research, tissue transplantation, and regenerative medicine. In this paper, we proposed a growth of microtissue model for the human keratinocytes (HaCaT cell line and an oral squamous cell carcinoma (OSCC cell line (ORL-48 based on a simple aerosol microencapsulation technique. At an extrusion rate of 20 μL/min and air flow rate of 0.3 L/min programmed in the aerosol system, HaCaT and ORL-48 cells in alginate microcapsules were encapsulated in microcapsules with a diameter ranging from 200 to 300 μm. Both cell lines were successfully grown into microtissues in the microcapsules of alginate within 16 days of culture. The microtissues were characterized by using a live/dead cell viability assay, field emission-scanning electron microscopy (FE-SEM, fluorescence staining, and cell re-plating experiments. The microtissues of both cell types were viable after being extracted from the alginate membrane using alginate lyase. However, the microtissues of HaCaT and ORL-48 demonstrated differences in both nucleus size and morphology. The microtissues with re-associated cells in spheroids are potentially useful as a cell model for pharmacological studies.

  12. Sonoporation delivery of monoclonal antibodies against human papillomavirus 16 E6 restores p53 expression in transformed cervical keratinocytes.

    Directory of Open Access Journals (Sweden)

    Melissa Togtema

    Full Text Available High-risk types of human papillomavirus (HPV, such as HPV16, have been found in nearly all cases of cervical cancer. Therapies targeted at blocking the HPV16 E6 protein and its deleterious effects on the tumour suppressor pathways of the cell can reverse the malignant phenotype of affected keratinocytes while sparing uninfected cells. Through a strong interdisciplinary collaboration between engineering and biology, a novel, non-invasive intracellular delivery method for the HPV16 E6 antibody, F127-6G6, was developed. The method employs high intensity focused ultrasound (HIFU in combination with microbubbles, in a process known as sonoporation. In this proof of principle study, it was first demonstrated that sonoporation antibody delivery into the HPV16 positive cervical carcinoma derived cell lines CaSki and SiHa was possible, using chemical transfection as a baseline for comparison. Delivery of the E6 antibody using sonoporation significantly restored p53 expression in these cells, indicating the antibody is able to enter the cells and remains active. This delivery method is targeted, non-cytotoxic, and non-invasive, making it more easily translatable for in vivo experiments than other transfection methods.

  13. Molecular photoprotection of human keratinocytes in vitro by the naturally occurring mycosporine-like amino acid palythine.

    Science.gov (United States)

    Lawrence, K P; Gacesa, R; Long, P F; Young, A R

    2017-11-13

    Solar ultraviolet radiation (UVR) induces molecular and genetic changes in the skin, which result in skin cancer, photoageing and photosensitivity disorders. The use of sunscreens is advocated to prevent such photodamage; however, most formulations contain organic and inorganic UVR filters that are nonbiodegradable and can damage fragile marine ecosystems. Mycosporine-like amino acids (MAAs) are natural UVR-absorbing compounds that have evolved in marine species for protection against chronic UVR exposure in shallow-water habitats. To determine if palythine, a photostable model MAA, could offer protection against a range of UVR-induced damage biomarkers that are important in skin cancer and photoageing. HaCaT human keratinocytes were used to assess the photoprotective potential of palythine using a number of end points including cell viability, DNA damage (nonspecific, cyclobutane pyrimidine dimers and oxidatively generated damage), gene expression changes (linked to inflammation, photoageing and oxidative stress) and oxidative stress. The antioxidant mechanism was investigated using chemical quenching and Nrf2 pathway activation assays. Palythine offered statistically significant protection (P photoprotective molecule in vitro that has potential to be developed as a natural and biocompatible alternative to currently approved UVR filters. © 2017 The Authors. British Journal of Dermatology published by John Wiley & Sons Ltd on behalf of British Association of Dermatologists.

  14. Dissecting the calcium-induced differentiation of human primary keratinocytes stem cells by integrative and structural network analyses.

    Directory of Open Access Journals (Sweden)

    Kiana Toufighi

    2015-05-01

    Full Text Available The molecular details underlying the time-dependent assembly of protein complexes in cellular networks, such as those that occur during differentiation, are largely unexplored. Focusing on the calcium-induced differentiation of primary human keratinocytes as a model system for a major cellular reorganization process, we look at the expression of genes whose products are involved in manually-annotated protein complexes. Clustering analyses revealed only moderate co-expression of functionally related proteins during differentiation. However, when we looked at protein complexes, we found that the majority (55% are composed of non-dynamic and dynamic gene products ('di-chromatic', 19% are non-dynamic, and 26% only dynamic. Considering three-dimensional protein structures to predict steric interactions, we found that proteins encoded by dynamic genes frequently interact with a common non-dynamic protein in a mutually exclusive fashion. This suggests that during differentiation, complex assemblies may also change through variation in the abundance of proteins that compete for binding to common proteins as found in some cases for paralogous proteins. Considering the example of the TNF-α/NFκB signaling complex, we suggest that the same core complex can guide signals into diverse context-specific outputs by addition of time specific expressed subunits, while keeping other cellular functions constant. Thus, our analysis provides evidence that complex assembly with stable core components and competition could contribute to cell differentiation.

  15. Evaluation of dermal-epidermal skin equivalents ('composite-skin') of human keratinocytes in a collagen-glycosaminoglycan matrix(Integra artificial skin).

    Science.gov (United States)

    Kremer, M; Lang, E; Berger, A C

    2000-09-01

    Integra artificial skin (Integra LifeSciences Corp., Plainsboro, NJ, USA) is a dermal template consisting of bovine collagen, chondroitin-6-sulphate and a silastic membrane manufactured as Integra. This product has gained widespread use in the clinical treatment of third degree burn wounds and full thickness skin defects of different aetiologies. The product was designed to significantly reduce the time needed to achieve final wound closure in the treatment of major burn wounds, to optimise the sparse autologous donor skin resources and to improve the durable mechanical quality of the skin substitute. The clinical procedure requires two stages. The first step creates a self neodermis, the second creates a self epidermis on the neodermis. However, it is desirable to cover major burn wounds early in a single step by a skin substitute consisting of a dermal equivalent seeded in vitro with autologous keratinocytes ('composite-skin') out of which a full thickness skin develops in vivo.The goal of this experimental study was to develop a method to integrate human keratinocytes in homogeneous distribution and depth into Integra Artificial Skin. The seeded cell-matrix composites were grafted onto athymic mice in order to evaluate their potential to reconstitute a human epidermis in vivo. We were able to demonstrate that the inoculated human keratinocytes reproducibly displayed a homogeneous pattern of distribution, adherence, proliferation and confluence. The cell-matrix composites grafted in this model exhibited good wound adherence, complete healing, minor wound contraction and had the potential to reconstitute an elastic, functional and durable human skin. Histologically we were able to show that the inoculated human keratinocytes in vivo colonised the matrix in a histomorphologically characteristic epidermal pattern (keratomorula, keratinocyte bubbling) and developed a persisting, stratified, keratinising epidermis which immunohistologically proved to be of human

  16. Differential responses of cells from human skin keratinocyte and bovine mammary epithelium to attack by pore-forming Staphylococcus aureus alpha-toxin.

    Science.gov (United States)

    Suriyaphol, Gunnaporn; Sarikaputi, Meena; Suriyaphol, Prapat

    2009-11-01

    Human skin keratinocytes HaCat attacked by Staphylococcus aureus alpha-toxin showed a transient drop of cellular ATP levels whereas in toxin-perforated bovine mammary epithelial cells (BMEC), the ATP levels dropped more slowly. Morphologically, during the ATP level depletion, HaCat cell developed a spacious intracellular vacuole together with the transient influx of trypan blue. WST-1 signal, which tested the function of mitochondrial enzyme in viable cells, also decreased concomitantly. On the other hand, BMEC excluded trypan blue and vacuolation was not observed throughout the experiment. We conclude that mammary epithelial cells resist the toxin better than keratinocytes. This is the first report showing that alpha-toxin enhances transient membrane permeability to large molecules, temporary vacuole formation and the transient defect of mitochondrial enzyme in viable cells without cell lysis.

  17. Influence of extracellular matrix proteins on human keratinocyte attachment, proliferation and transfer to a dermal wound model.

    Science.gov (United States)

    Dawson, R A; Goberdhan, N J; Freedlander, E; MacNeil, S

    1996-03-01

    The aim of this study was to investigate whether prior culture of cells on ECM proteins might positively influence the performance of keratinocytes when cells are transferred to a dermal in vitro wound bed model. Keratinocytes were cultured using a method for producing cultured epithelial autografts for severely burned patients (essentially using Green's medium, a mitogen-rich medium containing fetal calf serum, cholera toxin, EGF, insulin, transferrin and triiodothyronine). Cells were cultured either on irradiated 3T3 fibroblasts (as in the standard Rheinwald and Green technique) or, alternatively, on collagen I, collagen IV, matrigel, RGD, vitronectin or fibronectin. Under these conditions matrigel, collagen I and IV enhanced initial attachment, RGD, vitronectin, fibronectin and irradiated 3T3 fibroblasts did not. Proliferation of cells was positively influenced by matrigel, collagen I and IV and irradiated 3T3 fibroblasts; of these, however, only matrigel and 3T3 fibroblasts had sustained significant effects on keratinocyte proliferation over 4 days. Cells on fibronectin showed significantly reduced proliferation. An acellular non-viable dermis was then used to mimic the homograft allodermis onto which cultured epithelial autograft sheets are grafted clinically and cells cultured on the various ECM proteins for 96 h were transferred to this in vitro wound model. None of the substrates enhanced keratinocyte performance on this model. It was concluded that under these conditions some ECM proteins can significantly affect keratinocyte attachment and, to a lesser extent, proliferation but that the culture of keratinocytes on these ECM proteins does not appear to confer any lasting benefit to the attachment of these keratinocytes to an in vitro wound-bed model.

  18. Upregulation of adhesion complex proteins and fibronectin by human keratinocytes treated with an aqueous extract from the leaves of Chromolaena odorata (Eupolin).

    Science.gov (United States)

    Phan, T T; Allen, J; Hughes, M A; Cherry, G; Wojnarowska, F

    2000-01-01

    The fresh leaves and extract of the plant Chromolaena odorata are a traditional herbal treatment in developing countries for burns, soft tissue wounds and skin infections. We have previously shown that the extract had an effect on the growth and proliferation of keratinocytes and fibroblasts in culture. This study has demonstrated that Eupolin extract increased expression of several components of the adhesion complex and fibronectin by human keratinocytes. Using indirect immunofluorescence we found increased expression (dose-dependent) of laminin 5, laminin 1, collagen IV, and fibronectin. The expression of the b1 and b4 integrins was upregulated by the extract at low concentrations (0.1 and 1 microg/ml), but the expression was decreased at higher doses of Eupolin (10 microg-150 microg/ml). A number of clinical studies carried out by Vietnamese and international medical investigators have demonstrated the efficacy of this extract on the wound healing process. In this study we have shown that Eupolin stimulated the expression of many proteins of the adhesion complex and fibronectin by human keratinocytes. The adhesion complex proteins are essential to stabilise epithelium and this effect could contribute to the clinical efficacy of Eupolin in healing.

  19. Protective effect of 3,4-dihydroxybenzoic acid isolated from Cladophora wrightiana Harvey against ultraviolet B radiation-induced cell damage in human HaCaT keratinocytes.

    Science.gov (United States)

    Cha, Ji Won; Piao, Mei Jing; Kim, Ki Cheon; Zheng, Jian; Yao, Cheng Wen; Hyun, Chang Lim; Kang, Hee Kyoung; Yoo, Eun Sook; Koh, Young Sang; Lee, Nam Ho; Ko, Mi Hee; Hyun, Jin Won

    2014-03-01

    The aim of the present study was to elucidate the protective properties of 3,4-dihydroxybenzoic acid (DBA) isolated from Cladophora wrightiana Harvey (a green alga) against ultraviolet B (UVB)-induced damage to human HaCaT keratinocytes. DBA exhibited scavenging actions against the 1,1-diphenyl-2-picrylhydrazyl radical, the superoxide anion, and the hydroxyl radical. Furthermore, DBA decreased the levels of intracellular reactive oxygen species generated by hydrogen peroxide or UVB treatment of the cells. DBA also decreased the UVB-augmented levels of phospho-histone H2A.X and the extent of comet tail formation, which are both indications of DNA damage. In addition, the compound safeguarded keratinocytes from UVB-induced injury by reversing the production of apoptotic bodies, overturning the disruption of mitochondrial membrane potential, increasing the expression of the anti-apoptotic protein, B-cell lymphoma 2, and decreasing the expression of the pro-apoptotic proteins, Bcl-2-associated X and cleaved caspase-3. Taken together, these results demonstrate that DBA isolated from a green alga protects human keratinocytes against UVB-induced oxidative stress and apoptosis.

  20. Inflammatory responses of a human keratinocyte cell line to 10 nm citrate- and PEG-coated silver nanoparticles

    Energy Technology Data Exchange (ETDEWEB)

    Bastos, V. [University of Aveiro, CESAM & Laboratory of Biotechnology and Cytomics (Portugal); Brown, D.; Johnston, H. [Heriot-Watt University, School of Life Sciences (United Kingdom); Daniel-da-Silva, A. L.; Duarte, I. F. [University of Aveiro, Department of Chemistry, CICECO – Aveiro Institute of Materials (Portugal); Santos, C., E-mail: csantos@fc.up.pt; Oliveira, H. [University of Aveiro, CESAM & Laboratory of Biotechnology and Cytomics (Portugal)

    2016-07-15

    Silver nanoparticles (AgNPs) are among the most commonly used engineered NPs and various commercially available products are designed to come in direct contact with the skin (wound dressings, textiles, creams, among others). Currently, there is limited understanding of the influence of coatings on the toxicity of AgNPs and in particular their ability to impact on AgNP’s mediated inflammatory responses. As AgNPs are often stabilized by different coatings, including citrate and polyethyleneglycol (PEG), in this study we investigate the influence of citrate (Cit10) or PEG (PEG10) coatings to 10 nm AgNP on skin, using human HaCaT keratinocytes. AgNPs cytotoxicity and inflammatory response (nuclear factor (NF)-κB induction and cytokine production) of HaCaT were assessed after in vitro exposure to 10 and 40 µg/mL after 4, 24, and 48 h. Results showed that although both types of coated AgNPs decreased cell proliferation and viability, Cit10 AgNPs were more toxic. NF-κB inhibition was observed for the highest concentration (40 µg/mL) of PEG10 AgNPs, and the putative link to early apoptotic pathways observed in these cells is discussed. No production of IL-1β, IL-6, IL-10, and TNFα was stimulated by AgNPs. Furthermore, Cit10 and PEG10 AgNPs decreased the release of MCP-1 by HaCaT cells after 48 h of exposure. As cytokines are vital for the immunologic regulation in the human body, and it is demonstrated that they may interfere with NPs, more research is needed to understand how different AgNPs affect the immune system.

  1. Comparison of rat epidermal keratinocyte organotypic culture (ROC) with intact human skin

    DEFF Research Database (Denmark)

    Pappinen, Sari; Hermansson, Martin; Kuntsche, Judith

    2008-01-01

    study was to compare the stratum corneum lipid content of ROC with the corresponding material from human skin. The lipid composition was determined by thin-layer chromatography (TLC) and mass-spectrometry, and the thermal phase transitions of stratum corneum were studied by differential scanning...... calorimetry (DSC). All major lipid classes of the stratum corneum were present in ROC in a similar ratio as found in human stratum corneum. Compared to human skin, the level of non-hydroxyacid-sphingosine ceramide (NS) was increased in ROC, while alpha-hydroxyacid-phytosphingosine ceramide (AP) and non...... compared to human skin, in agreement with the results from DSC. ROC underwent a lipid lamellar order to disorder transition (T2) at a slightly lower temperature (68 degrees C) than human skin (74 degrees C). These differences in stratum corneum lipid composition and the thermal phase transitions may...

  2. Punicalagin and (-)-Epigallocatechin-3-Gallate Rescue Cell Viability and Attenuate Inflammatory Responses of Human Epidermal Keratinocytes Exposed to Airborne Particulate Matter PM10.

    Science.gov (United States)

    Seok, Jin Kyung; Lee, Jeong-Won; Kim, Young Mi; Boo, Yong Chool

    2018-01-01

    Airborne particulate matter with a diameter of < 10 µm (PM10) causes oxidative damage, inflammation, and premature skin aging. In this study, we evaluated whether polyphenolic antioxidants attenuate the inflammatory responses of PM10-exposed keratinocytes. Primary human epidermal keratinocytes were exposed in vitro to PM10 in the absence or presence of punicalagin and (-)-epigallocatechin-3-gallate (EGCG), which are the major polyphenolic antioxidants found in pomegranate and green tea, respectively. Assays were performed to determine cell viability, production of reactive oxygen species (ROS), and expression of NADPH oxidases (NOX), proinflammatory cytokines, and matrix metalloproteinase (MMP)-1. PM10 decreased cell viability and increased ROS production in a dose-dependent manner. It also increased the expression levels of NOX-1, NOX-2, tumor necrosis factor-α (TNF-α), interleukin (IL)-1β, IL-6, IL-8, and MMP-1. Punicalagin was not cytotoxic up to 300 μM, and (-)-EGCG was cytotoxic above 30 μM, respectively. Further, punicalagin (3-30 μM) and EGCG (3-10 μM) rescued the viability of PM10-exposed cells. They also attenuated ROS production and the expression of NOX-1, NOX-2, TNF-α, IL-1β, IL-6, IL-8, and MMP-1 stimulated by PM10. This study demonstrates that polyphenolic antioxidants, such as punicalagin and (-)-EGCG, rescue keratinocyte viability and attenuate the inflammatory responses of these cells due to airborne particles. © 2018 S. Karger AG, Basel.

  3. Inhibitors of cysteine cathepsin and calpain do not prevent ultraviolet-B-induced apoptosis in human keratinocytes and HeLa cells

    DEFF Research Database (Denmark)

    Bang, Bo; Baadsgaard, Ole; Skov, Lone

    2004-01-01

    been demonstrated to play a role in the execution of programmed cell death induced by other stimuli, e.g. TNF-alpha. The purpose of the present study was therefore to investigate whether inhibitors of cysteine cathepsins and calpains could prevent UVB-induced apoptosis in HeLa cells and keratinocytes....... This was done by investigating the effect of the irreversible cysteine protease inhibitor zFA-fmk, the cathepsin B inhibitor CA-074-Me and the calpain inhibitor ALLN on the viability of UVB-irradiated human keratinocytes and HeLa cells. At concentrations of 10 microM and above zVAD-fmk conferred partial dose......-dependent protection against UVB-induced apoptosis in HeLa cells and keratinocytes. Moreover, caspase-3 activity was completely blocked at zVAD-fmk concentrations of 1 microM in HeLa cells. This indicates that caspase-independent mechanisms could be involved in UVB-induced apoptosis. However, the protease inhibitors z...

  4. Cultivating technique for human keratinocyte under laboratory condition%实验室条件下人角质形成细胞的培养技术

    Institute of Scientific and Technical Information of China (English)

    卢宁; 朱平; 刘玉峰; 王刚; 张海龙; 赵小东

    2006-01-01

    %,9 d左右细胞融合达90%,11d左右细胞完全融合形成细胞膜片.角质形成细胞可在体外稳定培养2~3个月,细胞形态和生长速度无明显改变. ②不同代的角质形成细胞冻存和复苏情况:将不同代的角质形成细胞分别冻存于液氮罐中,3个月后进行复苏,发现角质形成细胞的形态和生长速度无明显改变.③角质形成细胞形态学观察结果:显微镜下细胞呈典型上皮样特征,高核浆比例,细胞紧密排列,轮廓清楚折光性好.透射电镜下培养的表皮角质形成细胞胞浆内有大量束状张力丝和张力原纤维,可见线粒体和粗面内质网,胞质周边有短的突起,细胞间有桥粒相连等角化细胞所具有的特点.结论:培养的角质形成细胞在多次传代后仍能够保持正常的形态特征,提示改良的培养角质形成细胞的技术可为实验和临床提供可靠丰富的角质形成细胞来源.%BACKGROUND: Along with the establishment and development of in vitro culture technique for human keratinocyte, skin would no longer be considered only as the physiological barrier, it's of important significance in immunity and endocrinology and so on.OBJECTIVE: To explore the experimental cultivating technique for human keratinocytes to provide reliable cell resource forthe appliance of keratinocytes in many ways.DESIGN: An opening study with keratinocytes as the subjects of the experiment.SETTING: Department of Immunology and Department of Dermatology,Xijing Hospital, Fourth Military Medical University of Chinese PLA MATERIALS: This experiment was carried out in the clinical laboratory of Department of Immunology of Xijing Hospital of the Fourth Military Medical University of Chinese PLA between March 2003 and March 2005.Prepuce sample was postoperatively obtained from a 6-year-old boy who was admitted to the department of urology surgery of Xijing hospital in April 2003, prepuce was used as the source for keratinocytes.METHODS:

  5. Large-scale analysis of protein expression changes in human keratinocytes immortalized by human papilloma virus type 16 E6 and E7 oncogenes

    Directory of Open Access Journals (Sweden)

    Arnouk Hilal

    2009-08-01

    Full Text Available Abstract Background Infection with high-risk type human papilloma viruses (HPVs is associated with cervical carcinomas and with a subset of head and neck squamous cell carcinomas. Viral E6 and E7 oncogenes cooperate to achieve cell immortalization by a mechanism that is not yet fully understood. Here, human keratinocytes were immortalized by long-term expression of HPV type 16 E6 or E7 oncoproteins, or both. Proteomic profiling was used to compare expression levels for 741 discrete protein features. Results Six replicate measurements were performed for each group using two-dimensional difference gel electrophoresis (2D-DIGE. The median within-group coefficient of variation was 19–21%. Significance of between-group differences was tested based on Significance Analysis of Microarray and fold change. Expression of 170 (23% of the protein features changed significantly in immortalized cells compared to primary keratinocytes. Most of these changes were qualitatively similar in cells immortalized by E6, E7, or E6/7 expression, indicating convergence on a common phenotype, but fifteen proteins (~2% were outliers in this regulatory pattern. Ten demonstrated opposite regulation in E6- and E7-expressing cells, including the cell cycle regulator p16INK4a; the carbohydrate binding protein Galectin-7; two differentially migrating forms of the intermediate filament protein Cytokeratin-7; HSPA1A (Hsp70-1; and five unidentified proteins. Five others had a pattern of expression that suggested cooperativity between the co-expressed oncoproteins. Two of these were identified as forms of the small heat shock protein HSPB1 (Hsp27. Conclusion This large-scale analysis provides a framework for understanding the cooperation between E6 and E7 oncoproteins in HPV-driven carcinogenesis.

  6. Investigation of double strand breaks induced by alpha particle irradiation using C.N.B.G. microbeam in human keratinocytes

    International Nuclear Information System (INIS)

    Pouthier, Th.

    2006-12-01

    To understand the mechanisms of interaction of ionizing radiation with living tissues exposed to low and protracted doses remains a major issue for risk evaluation. The response cannot be found in epidemiological studies because the only available data concern accidental exposures to high doses of radiation. The natural exposure represents the main source of exposure in the daily life, just before the medical sources (radiology, radiotherapy). In addition, this kind of exposure is very difficult to reproduce in vitro by irradiating cell lines. The method per preference is based on random irradiation of cell populations. The mean number of particles having traversed cells is then calculated on the basis of Poisson statistics. In addition to inevitable multiple impacts, the numerous potential intracellular targets (nuclei, cytoplasm), the indirect effects induced by the impact of particles on neighbouring cells or simply the extracellular targets, constitute phenomena that make more complex the interpretation of experimental data. A charged particle microbeam was developed at C.E.N.B.G. to perform the targeted irradiation of individual cells with a targeting precision of a few microns. It is possible to deliver a counted number of alpha particles down to the ultimate dose of one alpha per cell, to target predetermined cells and then to observe the response of the neighbouring cells. This facility has been validated during this work on human keratinocyte cells expressing a recombinant nuclear fluorescent protein (histone H2B-GFP). The combination of ion micro-beams with confocal microscopy and numeric quantitative analysis allowed the measurement of DNA double strand breaks via the phosphorylation of the histone H2A.X in individual cells. The mechanisms of DNA reparation and apoptosis induction were also in the scope of those studies. The experimental results obtained during this thesis validate the methodology we have developed by demonstrating the targeting

  7. Effect of irradiation on cell cycle, cell death and expression of its related proteins in normal human oral keratinocytes

    International Nuclear Information System (INIS)

    Kang, Mi Ae; Heo, Min Suk; Lee, Sam Sun; Oh, Sung Ook; Choi, Soon Chul; Park, Tae Won; Lee, Sul Mi; Jeon, In Seong

    2003-01-01

    To investigate the radiosensitivity of the normal human oral keratinocytes (NHOK), and the effect of irradiation on cell cycle and protein expression. To evaluate the radiosensitivity of NHOK, the number of colonies and cells were counted after irradiation and the SF2 (survival fraction as 2 Gy) value, and the cell survival curve fitted on a linear-quadratic model were obtained. LDH analysis was carried out to evaluate the necrosis of NHOK at 1, 2,3, and 4 days after 2, 10, and 20 Gy irradiation. Cell cycle arrest and the induction of apoptosis were analyzed using flow cytometry at 1, 2, 3, and 4 days after 2, 10, and 20 Gy irradiation. Finally, proteins related cell cycle arrest and apoptosis were analysed by Western blot. The number of survival cell was significantly decreased in a dose-dependent manner. The cell survival curve showed SF2, α, and β values to be 0.568, 0.209, and 0.020 respectively. At 20 Gy irradiated cells showed higher optical density than the control group. After irradiation, apoptosis was not observed but G2 arrest was observed in the NHOK cells. 1 day after 10 Gy irradiation, the expression of p53 remained unchanged, the p21 WAF1/Cip1 increased and the mdm2 decreased. The expression of bax, bcl-2, cyclin B1, and cyclin D remained unchanged. These results indicate that NHOK responds to irradiation by G2 arrest, which is possibly mediated by the expression of p21 WAF1/Cip1 , and that cell necrosis occurs by high dose irradiation.

  8. Pressure transducers

    International Nuclear Information System (INIS)

    Gomes, A.V.

    1975-01-01

    Strain gauges pressure transducers types are presented. Models, characteristics and calibration procedures were also analysed. Initially, a theoretical study was accomplished to evaluate metallic alloys behavior on sensing elements manufacturing, and diaphragm was used as deflecting elements. Electrical models for potenciometric transducers were proposed at the beginning and subsequently comproved according our experiments. Concerning bridge transducers, existing models confirmed the conditions of linearity and sensitivity related to the electrical signal. All the work done was of help on the calibration field and pressure measurements employing unbounded strain gauge pressure transducers

  9. Modulation of TLR2 protein expression by a miR-105 in human oral keratinocytes

    Science.gov (United States)

    Mammalian biological processes such as inflammation, involve regulation of hundreds of genes controlling onset and termination. MicroRNAs (miRNAs) can translationally repress target mRNAs and can regulate innate immune responses. Our model system comprised primary human keratinoc...

  10. lacZ transduced human breast cancer xenografts as an in vivo model for the study of invasion and metastasis

    DEFF Research Database (Denmark)

    Brünner, N; Thompson, E W; Spang-Thomsen, M

    1992-01-01

    in the animals by usual histological procedures would require extensive sectioning of the whole animal. To overcome this problem, we transduced human breast cancer cells with a replication-defective Moloney murine leukaemia retroviral vector (M-MuLV) containing both neoR (neomycin resistance) and lacZ genes...... but not the surrounding mouse tissue on either whole tissue blocks or histological sections. The staining procedure was highly sensitive, allowing detection of microfoci of human cancer cells, and quantitative estimation of the metastatic capacity of the cells. These results indicate that lacZ transduction of human...

  11. In vivo production of novel vitamin D2 hydroxy-derivatives by human placentas, epidermal keratinocytes, Caco-2 colon cells and the adrenal gland

    Science.gov (United States)

    Slominski, Andrzej T.; Kim, Tae-Kang; Shehabi, Haleem Z.; Tang, Edith; Benson, Heather A. E.; Semak, Igor; Lin, Zongtao; Yates, Charles R.; Wang, Jin; Li, Wei; Tuckey, Robert C.

    2014-01-01

    We investigated the metabolism of vitamin D2 to hydroxyvitamin D2 metabolites ((OH)D2) by human placentas ex-utero, adrenal glands ex-vivo and cultured human epidermal keratinocytes and colonic Caco-2 cells, and identified 20(OH)D2, 17,20(OH)2D2, 1,20(OH)2D2, 25(OH)D2 and 1,25(OH)2D2 as products. Inhibition of product formation by 22R-hydroxycholesterol indicated involvement of CYP11A1 in 20- and 17-hydroxylation of vitamin D2, while use of ketoconazole indicated involvement of CYP27B1 in 1α-hydroxylation of products. Studies with purified human CYP11A1 confirmed the ability of this enzyme to convert vitamin D2 to 20(OH)D2 and 17,20(OH)2D2. In placentas and Caco-2 cells, production of 20(OH)D2 was higher than 25(OH)D2 while in human keratinocytes the production of 20(OH)D2 and 25(OH)D2 were comparable. HaCaT keratinocytes showed high accumulation of 1,20(OH)2D2 relative to 20(OH)D2 indicating substantial CYP27B1 activity. This is the first in vivo evidence for a novel pathway of vitamin D2 metabolism initiated by CYP11A1 and modified by CYP27B1, with the product profile showing tissue- and cell-type specificity. PMID:24382416

  12. Protective effect of Juglans regia L. against ultraviolet B radiation induced inflammatory responses in human epidermal keratinocytes.

    Science.gov (United States)

    Muzaffer, Umar; Paul, V I; Prasad, Nagarajan Rajendra; Karthikeyan, Ramasamy; Agilan, Balupillai

    2018-03-15

    Juglans regia L. has a history of traditional medicinal use for the treatment of various maladies and have been documented with significant antioxidant and antiinflammatory properties. Although all parts of the plant are medicinally important, but male the flower of the plant has not been yet investigated against the photo-damage. The present study, we sought to determine the photoprotective effect of the male flower of J. regia L. against ultraviolet-B radiation-induced inflammatory responses in human skin cells. The profile of pharmacological active compounds present in the male flower of J. regia was analyzed by GC-MS. Then, the antioxidant property of methanolic extract of J. regia (MEJR) was analyzed by in vitro free radical scavenging assays. Further, we analyzed the sun protection factor of this extract by spectrophotometry. Moreover, we investigated the photoprotective effect of MEJR against UVB induced inflammatory signaling in human epidermal cells. Human skin epidermal keratinocytes (HaCaT) were pretreated with the MEJR (80 µg/ml), 30 min prior to UVB-irradiation at a dose of 20 mJ/cm 2 and were investigated for lipid peroxidation, enzymatic antioxidants activity, apoptosis and inflammatory markers expression level. The GC-MS results showed the presence of good amount of pharmacologically active compounds in the MEJR. We observed that the MEJR possess significant free radical scavenging activity and it was comparable with standard antioxidants. Further, the MEJR exhibits 8.8 sun-protection-factor (SPF) value. Pretreatment with MEJR, 30 min prior to UVB-irradiation, prevented ROS generation, lipid peroxidation and restored the activity of antioxidant status in HaCaT cells. Moreover, MEJR pretreatment significantly prevented UVB activated inflammatory markers like TNF-α, IL-1, IL-6, NF-κB, COX-2 in HaCaT. The present findings suggest that MEJR exhibit photoprotective effects and hence it may be useful for the treatment of inflammation related

  13. Ultraviolet B, melanin and mitochondrial DNA: Photo-damage in human epidermal keratinocytes and melanocytes modulated by alpha-melanocyte-stimulating hormone [version 1; referees: 2 approved

    Directory of Open Access Journals (Sweden)

    Markus Böhm

    2016-05-01

    Full Text Available Alpha-melanocyte-stimulating hormone (alpha-MSH increases melanogenesis and protects from UV-induced DNA damage. However, its effect on mitochondrial DNA (mtDNA damage is unknown. We have addressed this issue in a pilot study using human epidermal keratinocytes and melanocytes incubated with alpha-MSH and irradiated with UVB. Real-time touchdown PCR was used to quantify total and deleted mtDNA. The deletion detected encompassed the common deletion but was more sensitive to detection. There were 4.4 times more mtDNA copies in keratinocytes than in melanocytes. Irradiation alone did not affect copy numbers. Alpha-MSH slightly increased copy numbers in both cell types in the absence of UVB and caused a similar small decrease in copy number with dose in both cell types. Deleted copies were nearly twice as frequent in keratinocytes as in melanocytes. Alpha-MSH reduced the frequency of deleted copies by half in keratinocytes but not in melanocytes. UVB dose dependently led to an increase in the deleted copy number in alpha-MSH-treated melanocytes. UVB irradiation had little effect on deleted copy number in alpha-MSH-treated keratinocytes. In summary, alpha-MSH enhances mtDNA damage in melanocytes presumably by increased melanogenesis, while α-MSH is protective in keratinocytes, the more so in the absence of irradiation.

  14. Oxidative stress induced by palytoxin in human keratinocytes is mediated by a H+-dependent mitochondrial pathway

    International Nuclear Information System (INIS)

    Pelin, Marco; Ponti, Cristina; Sosa, Silvio; Gibellini, Davide; Florio, Chiara; Tubaro, Aurelia

    2013-01-01

    In the last decades, massive blooms of palytoxin (PLTX)-producing Ostreopsis cf. ovata have been observed along Mediterranean coasts, usually associated to human respiratory and cutaneous problems. At the molecular level, PLTX induces a massive intracellular Na + influx due to the transformation of Na + /K + ATPase in a cationic channel. Recently, we have demonstrated that Na + overload is the crucial step in mediating overproduction of reactive oxygen species (ROS) and cell death in human HaCaT keratinocytes, tentatively explaining PLTX-induced skin irritant effects. In the present study the molecular mechanisms of ROS production induced by PLTX-mediated Na + intracellular overload have been investigated. In HaCaT cells, PLTX exposure caused accumulation of superoxide anion, but not of nitric oxide or peroxynitrite/hydroxyl radicals. Even if RT-PCR and western blot analysis revealed an early NOX-2 and iNOS gene and protein over-expressions, their active involvement seemed to be only partial since selective inhibitors did not completely reduce O 2 − production. A significant role of other enzymes (COX-1, COX-2, XO) was not evidenced. Nigericin, that counteracts Na + -mediated H + -imbalance, dissipating ΔpH across mitochondrial inner membrane, and the uncouplers DNP significantly reduced O 2 − production. These inhibitions were synergistic when co-exposed with complex-I inhibitor rotenone. These results suggest a novel mechanism of O 2 − production induced by PLTX-mediated ionic imbalance. Indeed, the H + intracellular overload that follows PLTX-induced intracellular Na + accumulation, could enhance ΔpH across mitochondrial inner membrane, that seems to be the driving force for O 2 − production by reversing mitochondrial electron transport. Highlights: ► PLTX induces superoxide (O 2 − ) production by reversing mitochondrial transport chain. ► The mechanism of O 2 − production is dependent on PLTX-induced ionic imbalance. ► The results led to the

  15. Oxidative stress induced by palytoxin in human keratinocytes is mediated by a H{sup +}-dependent mitochondrial pathway

    Energy Technology Data Exchange (ETDEWEB)

    Pelin, Marco, E-mail: marco.pelin@phd.units.it [Department of Life Science, University of Trieste, Via L. Giorgieri 7/9, 34127 Trieste (Italy); Ponti, Cristina, E-mail: cponti@units.it [Department of Life Science, University of Trieste, Via L. Giorgieri 7/9, 34127 Trieste (Italy); Sosa, Silvio, E-mail: silvio.sosa@econ.units.it [Department of Life Science, University of Trieste, Via L. Giorgieri 7/9, 34127 Trieste (Italy); Gibellini, Davide, E-mail: davide.gibellini@unibo.it [Department of Haematology and Oncological Sciences, University of Bologna, Via Massarenti 9, 40138 Bologna (Italy); Florio, Chiara, E-mail: florioc@units.it [Department of Life Science, University of Trieste, Via L. Giorgieri 7/9, 34127 Trieste (Italy); Tubaro, Aurelia, E-mail: tubaro@units.it [Department of Life Science, University of Trieste, Via L. Giorgieri 7/9, 34127 Trieste (Italy)

    2013-01-01

    In the last decades, massive blooms of palytoxin (PLTX)-producing Ostreopsis cf. ovata have been observed along Mediterranean coasts, usually associated to human respiratory and cutaneous problems. At the molecular level, PLTX induces a massive intracellular Na{sup +} influx due to the transformation of Na{sup +}/K{sup +} ATPase in a cationic channel. Recently, we have demonstrated that Na{sup +} overload is the crucial step in mediating overproduction of reactive oxygen species (ROS) and cell death in human HaCaT keratinocytes, tentatively explaining PLTX-induced skin irritant effects. In the present study the molecular mechanisms of ROS production induced by PLTX-mediated Na{sup +} intracellular overload have been investigated. In HaCaT cells, PLTX exposure caused accumulation of superoxide anion, but not of nitric oxide or peroxynitrite/hydroxyl radicals. Even if RT-PCR and western blot analysis revealed an early NOX-2 and iNOS gene and protein over-expressions, their active involvement seemed to be only partial since selective inhibitors did not completely reduce O{sub 2}{sup −} production. A significant role of other enzymes (COX-1, COX-2, XO) was not evidenced. Nigericin, that counteracts Na{sup +}-mediated H{sup +}-imbalance, dissipating ΔpH across mitochondrial inner membrane, and the uncouplers DNP significantly reduced O{sub 2}{sup −} production. These inhibitions were synergistic when co-exposed with complex-I inhibitor rotenone. These results suggest a novel mechanism of O{sub 2}{sup −} production induced by PLTX-mediated ionic imbalance. Indeed, the H{sup +} intracellular overload that follows PLTX-induced intracellular Na{sup +} accumulation, could enhance ΔpH across mitochondrial inner membrane, that seems to be the driving force for O{sub 2}{sup −} production by reversing mitochondrial electron transport. Highlights: ► PLTX induces superoxide (O{sub 2}{sup −}) production by reversing mitochondrial transport chain. ► The mechanism of

  16. UV Radiation Activates Toll-Like Receptor 9 Expression in Primary Human Keratinocytes, an Event Inhibited by Human Papillomavirus 38 E6 and E7 Oncoproteins.

    Science.gov (United States)

    Pacini, Laura; Ceraolo, Maria Grazia; Venuti, Assunta; Melita, Giusi; Hasan, Uzma A; Accardi, Rosita; Tommasino, Massimo

    2017-10-01

    Several lines of evidence indicate that cutaneous human papillomavirus (HPV) types belonging to the beta genus of the HPV phylogenetic tree synergize with UV radiation in the development of skin cancer. Accordingly, the E6 and E7 oncoproteins from some beta HPV types are able to deregulate pathways related to immune response and cellular transformation. Toll-like receptor 9 (TLR9), in addition to playing a role in innate immunity, has been shown to be involved in the cellular stress response. Using primary human keratinocytes as experimental models, we have shown that UV irradiation (and other cellular stresses) activates TLR9 expression. This event is closely linked to p53 activation. Silencing the expression of p53 or deleting its encoding gene affected the activation of TLR9 expression after UV irradiation. Using various strategies, we have also shown that the transcription factors p53 and c-Jun are recruited onto a specific region of the TLR9 promoter after UV irradiation. Importantly, the E6 and E7 oncoproteins from beta HPV38, by inducing the accumulation of the p53 antagonist ΔNp73α, prevent the UV-mediated recruitment of these transcription factors onto the TLR9 promoter, with subsequent impairment of TLR9 gene expression. This study provides new insight into the mechanism that mediates TLR9 upregulation in response to cellular stresses. In addition, we show that HPV38 E6 and E7 are able to interfere with this mechanism, providing another explanation for the possible cooperation of beta HPV types with UV radiation in skin carcinogenesis. IMPORTANCE Beta HPV types have been suggested to act as cofactors in UV-induced skin carcinogenesis by altering several cellular mechanisms activated by UV radiation. We show that the expression of TLR9, a sensor of damage-associated molecular patterns produced during cellular stress, is activated by UV radiation in primary human keratinocytes (PHKs). Two transcription factors known to be activated by UV radiation, p53

  17. Acrolein, an I-κBα-independent downregulator of NF-κB activity, causes the decrease in nitric oxide production in human malignant keratinocytes.

    Science.gov (United States)

    Moon, Ki-Young

    2011-05-01

    Acrolein, a reactive electrophilic α, β-unsaturated aldehyde, is known to be an alkylating chemical carcinogen. The effect of acrolein on the activation of NF-κB in human malignant epidermal keratinocytes was examined to elucidate the molecular mechanism associated with this NF-κB-acrolein regulation and its consecutive sequence, nitric oxide (NO) production. Acrolein significantly downregulated the cellular NF-κB activity up to 60% compared with control as well as the lipopolysaccharide (LPS)-induced NO production in a dose response manner at concentrations of 10~30 μM. To investigate the regulatory mechanism associated with this NF-κB-acrolein downregulation, the relative level of phosphorylation of I-κBα (serines-32 and -36), a principle regulator of NF-κB activation, represented by acrolein, was quantified. Acrolein inhibited NF-κB activity without altering cellular levels of the phosphorylated and nonphosphorylated forms of I-κBα, implying that the downregulatory effect of acrolein on cellular NF-κB activity in human skin cells is an I-κBα-independent activation pathway. The results suggests that acrolein causes the decrease in nitric oxide production as an I-κBα-independent downregulator of NF-κB activity in human malignant keratinocytes, and acrolein-induced carcinogenesis may be associated with the modulation of cellular NF-κB activity.

  18. CARMA2sh and ULK2 control pathogen-associated molecular patterns recognition in human keratinocytes: psoriasis-linked CARMA2sh mutants escape ULK2 censorship.

    Science.gov (United States)

    Scudiero, Ivan; Mazzone, Pellegrino; D'Andrea, Luca E; Ferravante, Angela; Zotti, Tiziana; Telesio, Gianluca; De Rubis, Gabriele; Reale, Carla; Pizzulo, Maddalena; Muralitharan, Shanmugakonar; Vito, Pasquale; Stilo, Romania

    2017-02-23

    The molecular complexes formed by specific members of the family of CARMA proteins, the CARD domain-containing adapter molecule BCL10 and MALT1 (CBM complex) represent a central hub in regulating activation of the pleiotropic transcription factor NF-κB. Recently, missense mutations in CARMA2sh have been shown to cause psoriasis in a dominant manner and with high penetrancy. Here, we demonstrate that in human keratinocytes CARMA2sh plays an essential role in the signal transduction pathway that connects pathogen-associated molecular patterns recognition to NF-κB activation. We also find that the serine/threonine kinase ULK2 binds to and phosphorylates CARMA2sh, thereby inhibiting its capacity to activate NF-κB by promoting lysosomal degradation of BCL10, which is essential for CARMA2sh-mediated NF-κB signaling. Remarkably, CARMA2sh mutants associated with psoriasis escape ULK2 inhibition. Finally, we show that a peptide blocking CARD-mediated BCL10 interactions reduces the capacity of psoriasis-linked CARMA2sh mutants to activate NF-κB. Our work elucidates a fundamental signaling mechanism operating in human keratinocytes and opens to novel potential tools for the therapeutical treatment of human skin disorders.

  19. Effects of UVB-induced oxidative stress on protein expression and specific protein oxidation in normal human epithelial keratinocytes: a proteomic approach

    Directory of Open Access Journals (Sweden)

    De Marco Federico

    2010-03-01

    Full Text Available Abstract Background The UVB component of solar ultraviolet irradiation is one of the major risk factors for the development of skin cancer in humans. UVB exposure elicits an increased generation of reactive oxygen species (ROS, which are responsible for oxidative damage to proteins, DNA, RNA and lipids. In order to examine the biological impact of UVB irradiation on skin cells, we used a parallel proteomics approach to analyze the protein expression profile and to identify oxidatively modified proteins in normal human epithelial keratinocytes. Results The expression levels of fifteen proteins - involved in maintaining the cytoskeleton integrity, removal of damaged proteins and heat shock response - were differentially regulated in UVB-exposed cells, indicating that an appropriate response is developed in order to counteract/neutralize the toxic effects of UVB-raised ROS. On the other side, the redox proteomics approach revealed that seven proteins - involved in cellular adhesion, cell-cell interaction and protein folding - were selectively oxidized. Conclusions Despite a wide and well orchestrated cellular response, a relevant oxidation of specific proteins concomitantly occurs in UVB-irradiated human epithelial Keratinocytes. These modified (i.e. likely dysfunctional proteins might result in cell homeostasis impairment and therefore eventually promote cellular degeneration, senescence or carcinogenesis.

  20. Low-dose dose-response for reduced cell viability after exposure of human keratinocyte (HEK001 cells to arsenite

    Directory of Open Access Journals (Sweden)

    Kenneth T. Bogen

    Full Text Available The in vitro arsenite (AsIII cytotoxicity dose-response (DR of human keratinocytes (HEK001 was examined at greater statistical resolution than ever previously reported using the MTT assay to determine cell viability. Fifty-four 96-well plates were treated with AsIII concentrations of 0.25, 0.5, 1, 2, 3, 4, 5, 7, 10, 15, 20, 25, or 30 μM. Because of unexpected variation in viability response patterns, a two-stage DR analysis was used in which data on plate-specific viability (%, estimated as 100% times the ratio of measured viability in exposed to unexposed cells, were fit initially to a generalized lognormal response function positing that HEK001 cells studied consisted of: a proportion P of relatively highly sensitive (HS cells, a proportion Po of relatively resistant cells, and a remaining (1–P–Po fraction of typical-sensitivity (TS cells exhibiting the intermediate level of AsIII sensitivity characteristic of most cells in each assay. The estimated fractions P and Po were used to adjust data from all 54 plates (and from the 28 plates yielding the best fits to reflect the condition that P = Po = 0 to provide detailed DR analysis specifically for TS cells. Four DR models fit to the combined adjusted data were each very predictive (R2 > 0.97 overall but were inconsistent with at least one of the data set examined (p  0.30 and exceeded 100% significance (p ≤ 10−6. A low-dose hormetic model provided the best fit to the combined adjusted data for TS cells (R2 = 0.995. Marked variability in estimates of P (the proportion of apparent HS cells was unexpected, not readily explained, and warrants further study using additional cell lines and assay methods, and in vivo. Keywords: Arsenic, Arsenate, Cell culture, Cell death, Cytotoxicity, HEK001 cells

  1. Interleukin-1α Induction in Human Keratinocytes (HaCaT: An In Vitro Model for Chemoprevention in Skin

    Directory of Open Access Journals (Sweden)

    T. Magcwebeba

    2012-01-01

    Full Text Available Long-term exposure to UV irradiation and toxic chemicals is associated with chronic inflammation that contributes to skin cancer development with interleukin-1 alpha (IL-1α, constitutively produced by keratinocytes, playing a pivotal role in skin inflammation. The aim of this study was to investigate the modulation of IL-1α production in the HaCaT keratinocyte cell line. Phorbol 12-myristate 13-acetate failed to induce IL-1α in HaCaT cells, and this might be associated with the specific deficiency known to affect downstream signalling of the MEK/ERK pathway in these cells. The calcium ionophore, ionomycin, slightly enhanced the production of intracellular (icIL-1α, but this resulted in a necrotic release at higher concentrations. UV-B exposure significantly increased the production of icIL-1α in a dose-dependent manner with a maximal induction exhibited at 24 h with minimal necrotic and apoptotic effects. Validation of the HaCaT cell model indicated that the nonsteroidal anti-inflammatory drug (NSAID, ibuprofen, and the glucocorticoid, dexamethasone, inhibited icIL-1α production, and this was associated with a slight inhibition of cell viability. The UV-B-induced keratinocyte cell model provides an in vitro system that could, apart from phorbol ester-like compounds, be utilised as a screening assay in identifying skin irritants and/or therapeutic topical agents via the modulation of IL-1α production.

  2. Binding of antibodies to the extractable nuclear antigens SS-A/Ro and SS-B/La is induced on the surface of human keratinocytes by ultraviolet light (UVL): Implications for the pathogenesis of photosensitive cutaneous lupus

    International Nuclear Information System (INIS)

    Furukawa, F.; Kashihara-Sawami, M.; Lyons, M.B.; Norris, D.A.

    1990-01-01

    Autoantibodies to the non-histone nucleoprotein antigens SS-A/Ro, SS-B/La, and RNP are highly associated with photosensitive cutaneous lupus erythematosus (LE). In order to better understand the potential mechanisms of ultraviolet (UV) light on photosensitivity in patients with cutaneous LE, we designed immunopathologic in vitro and in vivo experiments to evaluate the effects of UV on the binding of such autoantibodies to the surface of human keratinocytes, one major target of immunologic damage in photosensitive LE. Short-term 2% paraformaldehyde fixation of suspensions of cultured human keratinocytes previously incubated with monospecific antiserum probes enabled the detection of ENA expression on the cell surface by flow-cytometry analysis. UVB light (280-320 nm) induced the binding of monospecific antibody probes for SS-A/Ro and SS-B/La on keratinocytes in a dose-dependent pattern with maximal induction observed at the dose of 200 mJ/cm2 UVB. Binding of SS-A/Ro, SS-B/La, and RNP antibody was augmented strongly, but binding of anti-Sm was very weak. In contrast, UVA (320-400 nm) light had no effect on the induction of binding of these antibody probes. Identical results were seen by standard immunofluorescence techniques. Hydroxyurea-treated keratinocytes showed similar induction of those antigens by UVB irradiation, which suggested that ENA expression on cultured keratinocytes by UVB were cell-cycle independent. Tunicamycin, an inhibitor of glycosylation of proteins, reduced UVB light effect on the SS-A/Ro and SS-B/La antigen's expression. These in vitro FACS analyses revealed that ENA augmentation on the keratinocyte cell surface was dose dependent, UVB dependent, glycosylation dependent, and cell-cycle independent. In vivo ENA augmentation on the keratinocyte surface was examined in suction blister epidermal roofs

  3. Acoustic transducer

    Science.gov (United States)

    Drumheller, Douglas S.

    2000-01-01

    An active acoustic transducer tool for use down-hole applications. The tool includes a single cylindrical mandrel including a shoulder defining the boundary of a narrowed portion over which is placed a sandwich-style piezoelectric tranducer assembly. The piezoelectric transducer assembly is prestressed by being placed in a thermal interference fit between the shoulder of the mandrel and the base of an anvil which is likewise positioned over the narrower portion of the mandrel. In the preferred embodiment, assembly of the tool is accomplished using a hydraulic jack to stretch the mandrel prior to emplacement of the cylindrical sandwich-style piezoelectric transducer assembly and anvil. After those elements are positioned and secured, the stretched mandrel is allowed to return substantially to its original (pre-stretch) dimensions with the result that the piezoelectric transducer elements are compressed between the anvil and the shoulder of the mandrel.

  4. Coaxial Transducer

    National Research Council Canada - National Science Library

    Ruffa, Anthony A

    2008-01-01

    The invention as disclosed is of a coaxial transducer that uses lead zirconate titanate ceramic or other suitable material as an isolator between the conductors in a coaxial cable to transmit acoustic...

  5. A distal region of the human TGM1 promoter is required for expression in transgenic mice and cultured keratinocytes

    Directory of Open Access Journals (Sweden)

    Lu Ying

    2004-04-01

    Full Text Available Abstract Background TGM1(transglutaminase 1 is an enzyme that crosslinks the cornified envelope of mature keratinocytes. Appropriate expression of the TGM1 gene is crucial for proper keratinocyte function as inactivating mutations lead to the debilitating skin disease, lamellar ichthyosis. TGM1 is also expressed in squamous metaplasia, a consequence in some epithelia of vitamin A deficiency or toxic insult that can lead to neoplasia. An understanding of the regulation of this gene in normal and abnormal differentiation states may contribute to better disease diagnosis and treatment. Methods In vivo requirements for expression of the TGM1 gene were studied by fusing various lengths of promoter DNA to a reporter and injecting the DNA into mouse embryos to generate transgenic animals. Expression of the reporter was ascertained by Western blotting and immunohistochemistry. Further delineation of a transcriptionally important distal region was determined by transfections of progressively shortened or mutated promoter DNA into cultured keratinocytes. Results In vivo analysis of a reporter transgene driven by the TGM1 promoter revealed that 1.6 kilobases, but not 1.1 kilobases, of DNA was sufficient to confer tissue-specific and cell layer-specific expression. This same region was responsible for reporter expression in tissues undergoing squamous metaplasia as a response to vitamin A deprivation. Mutation of a distal promoter AP1 site or proximal promoter CRE site, both identified as important transcriptional elements in transfection assays, did not prevent appropriate expression. Further searching for transcriptional elements using electrophoretic mobility shift (EMSA and transfection assays in cultured keratinocytes identified two Sp1 elements in a transcriptionally active region between -1.6 and -1.4 kilobases. While mutation of either Sp1 site or the AP1 site singly had only a small effect, mutation of all three sites eliminated nearly all the

  6. Nicotinamide enhances repair of arsenic and ultraviolet radiation-induced DNA damage in HaCaT keratinocytes and ex vivo human skin.

    Directory of Open Access Journals (Sweden)

    Benjamin C Thompson

    Full Text Available Arsenic-induced skin cancer is a significant global health burden. In areas with arsenic contamination of water sources, such as China, Pakistan, Myanmar, Cambodia and especially Bangladesh and West Bengal, large populations are at risk of arsenic-induced skin cancer. Arsenic acts as a co-carcinogen with ultraviolet (UV radiation and affects DNA damage and repair. Nicotinamide (vitamin B3 reduces premalignant keratoses in sun-damaged skin, likely by prevention of UV-induced cellular energy depletion and enhancement of DNA repair. We investigated whether nicotinamide modifies DNA repair following exposure to UV radiation and sodium arsenite. HaCaT keratinocytes and ex vivo human skin were exposed to 2μM sodium arsenite and low dose (2J/cm2 solar-simulated UV, with and without nicotinamide supplementation. DNA photolesions in the form of 8-oxo-7,8-dihydro-2'-deoxyguanosine and cyclobutane pyrimidine dimers were detected by immunofluorescence. Arsenic exposure significantly increased levels of 8-oxo-7,8-dihydro-2'-deoxyguanosine in irradiated cells. Nicotinamide reduced both types of photolesions in HaCaT keratinocytes and in ex vivo human skin, likely by enhancing DNA repair. These results demonstrate a reduction of two different photolesions over time in two different models in UV and arsenic exposed cells. Nicotinamide is a nontoxic, inexpensive agent with potential for chemoprevention of arsenic induced skin cancer.

  7. UVB irradiation does not directly induce detectable changes of DNA methylation in human keratinocytes [v1; ref status: indexed, http://f1000r.es/np

    Directory of Open Access Journals (Sweden)

    Christoph Lahtz

    2013-02-01

    Full Text Available Unprotected exposure to UVB radiation from the sun and the resulting DNA damage are thought to be responsible for physiological changes in the skin and for a variety of skin cancers, including basal cell and squamous cell carcinoma and malignant melanoma. Although the mutagenic effects of UVB have been well documented and studied mechanistically, there is only limited information as to whether UV light may also be responsible for inducing epigenetic changes in the genome of exposed cells. DNA methylation is a stable epigenetic modification involved in gene control. To study the effects of UVB radiation on DNA methylation, we repeatedly exposed normal human keratinocytes to a UVB light source. After a recovery period, we analyzed global DNA methylation patterns in the irradiated and control cells using the methylated-CpG island recovery assay (MIRA method in combination with high-resolution microarrays. Bioinformatics analysis revealed only a limited number of possible differences between UVB-exposed and control cells. However, these minor apparent changes could not be independently confirmed by bisulfite sequencing-based approaches. This study reveals that UVB irradiation of keratinocytes has no recognizable global effect on DNA methylation patterns and suggests that changes in DNA methylation, as observed in skin cancers, are not immediate consequences of human exposure to solar UVB irradiation.

  8. Comparison of the miRNA profiles in HPV-positive and HPV-negative tonsillar tumors and a model system of human keratinocyte clones

    International Nuclear Information System (INIS)

    Vojtechova, Zuzana; Sabol, Ivan; Salakova, Martina; Smahelova, Jana; Zavadil, Jiri; Turek, Lubomir; Grega, Marek; Klozar, Jan; Prochazka, Bohumir; Tachezy, Ruth

    2016-01-01

    Better insights into the molecular changes involved in virus-associated and -independent head and neck cancer may advance our knowledge of HNC carcinogenesis and identify critical disease biomarkers. Here we aimed to characterize the expression profiles in a matched set of well-characterized HPV-dependent and HPV-independent tonsillar tumors and equivalent immortalized keratinocyte clones to define potential and clinically relevant biomarkers of HNC of different etiology. Fresh frozen tonsillar cancer tissues were analyzed together with non-malignant tonsillar tissues and compared with cervical tumors and normal cervical tissues. Furthermore, relative miRNAs abundance levels of primary and immortalized human keratinocyte clones were evaluated. The global quantitation of miRNA gene abundance was performed using a TaqMan Low Density Array system. The confirmation of differentially expressed miRNAs was performed on a set of formalin-fixed paraffin-embedded tumor samples enriched for the tumor cell fraction by macrodissection. We defined 46 upregulated and 31 downregulated miRNAs characteristic for the HPV-positive tonsillar tumors and 42 upregulated miRNAs and 42 downregulated miRNAs characteristic for HPV-independent tumors. In comparison with the expression profiles in cervical tumors, we defined miR-141-3p, miR-15b-5p, miR-200a-3p, miR-302c-3p, and miR-9-5p as specific for HPV induced malignancies. MiR-335-5p, miR-579-3p, and miR-126-5p were shared by the expression profiles of HPV-positive tonsillar tumors and of the HPV immortalized keratinocyte clones, whereas miR-328-3p, miR-34c-3p, and miR-885-5p were shared by the miRNA profiles of HPV-negative tonsillar tumors and the HPV-negative keratinocytes. We identified the miRNAs characteristic for HPV-induced tumors and tonsillar tumors of different etiology, and the results were compared with those of the model system. Our report presents the basis for further investigations leading to the identification of

  9. Ultraviolet radiation can either suppress or induce expression of intercellular adhesion molecule 1 (ICAM-1) on the surface of cultured human keratinocytes

    International Nuclear Information System (INIS)

    Norris, D.A.; Lyons, M.B.; Middleton, M.H.; Yohn, J.J.; Kashihara-Sawami, M.

    1990-01-01

    Interactions of the ligand/receptor pair LFA-1(CD11a/CD18) and ICAM-1(CD54) initiate and control the cell-cell interactions of leukocytes and interactions of leukocytes with parenchymal cells in all phases of the immune response. Induction of the intercellular adhesion molecule 1 (ICAM-1) on the surface of epidermal keratinocytes has been proposed as an important regulator of contact-dependent aspects of cutaneous inflammation. Ultraviolet radiation (UVR) also modifies cutaneous inflammation, producing both up- and down-regulation of contact hypersensitivity. We have found that UVR has a biphasic effect on the induction of keratinocyte CD54. Using immunofluorescence and FACS techniques to quantitate cell-surface CD54 staining, we have shown that UVR significantly (p less than 0.01) inhibits keratinocyte CD54 induction by gamma interferon 24 h after irradiation. However, at 48, 72, and 96 h after UVR, CD54 expression is significantly induced to levels even greater than are induced by gamma interferon (20 U/ml). In addition, at 48, 72, or 96 h following UVR (30-100 mJ/cm2), the gamma-interferon-induced CD54 expression on human keratinocytes is also strongly (p less than 0.05 to p less than 0.001) enhanced. In this cell-culture system, gamma interferon and TNF-alpha are both strong CD54 inducers and are synergistic, but GM-CSF, TFG-beta, and IL-1 have no direct CD54-inducing effects. Thus the effects of UVR on CD54 induction are biphasic, producing inhibition at 24 h and induction at 48, 72, and 96 h. This effect on CD54 may contribute to the biphasic effects of UVR on delayed hypersensitivity in vivo. The early inhibition of ICAM-1 by UVR may also contribute to the therapeutic effects of UVR. We also speculate that the late induction of ICAM-1 by UVR might be an important step in the induction of photosensitive diseases such as lupus erythematosus

  10. Interferon-β induces cellular senescence in cutaneous human papilloma virus-transformed human keratinocytes by affecting p53 transactivating activity.

    Directory of Open Access Journals (Sweden)

    Maria V Chiantore

    Full Text Available Interferon (IFN-β inhibits cell proliferation and affects cell cycle in keratinocytes transformed by both mucosal high risk Human Papilloma Virus (HPV and cutaneous HPV E6 and E7 proteins. In particular, upon longer IFN-β treatments, cutaneous HPV38 expressing cells undergo senescence. IFN-β appears to induce senescence by upregulating the expression of the tumor suppressor PML, a well known IFN-induced gene. Indeed, experiments in gene silencing via specific siRNAs have shown that PML is essential in the execution of the senescence programme and that both p53 and p21 pathways are involved. IFN-β treatment leads to a modulation of p53 phosphorylation and acetylation status and a reduction in the expression of the p53 dominant negative ΔNp73. These effects allow the recovery of p53 transactivating activity of target genes involved in the control of cell proliferation. Taken together, these studies suggest that signaling through the IFN pathway might play an important role in cellular senescence. This additional understanding of IFN antitumor action and mechanisms influencing tumor responsiveness or resistance appears useful in aiding further promising development of biomolecular strategies in the IFN therapy of cancer.

  11. Upregulation of cathepsin S in psoriatic keratinocytes.

    Science.gov (United States)

    Schönefuss, Alexander; Wendt, Wiebke; Schattling, Benjamin; Schulten, Roxane; Hoffmann, Klaus; Stuecker, Markus; Tigges, Christian; Lübbert, Hermann; Stichel, Christine

    2010-08-01

    Cathepsin S (CATS) is a cysteine protease, well known for its role in MHC class II-mediated antigen presentation and extracellular matrix degradation. Disturbance of the expression or metabolism of this protease is a concomitant feature of several diseases. Given this importance we studied the localization and regulation of CATS expression in normal and pathological human/mouse skin. In normal human skin CATS-immunostaining is mainly present in the dermis and is localized in macrophages, Langerhans, T- and endothelial cells, but absent in keratinocytes. In all analyzed pathological skin biopsies, i.e. atopic dermatitis, actinic keratosis and psoriasis, CATS staining is strongly increased in the dermis. But only in psoriasis, CATS-immunostaining is also detectable in keratinocytes. We show that cocultivation with T-cells as well as treatment with cytokines can trigger expression and secretion of CATS, which is involved in MHC II processing in keratinocytes. Our data provide first evidence that CATS expression (i) is selectively induced in psoriatic keratinocytes, (ii) is triggered by T-cells and (iii) might be involved in keratinocytic MHC class II expression, the processing of the MHC class II-associated invariant chain and remodeling of the extracellular matrix. This paper expands our knowledge on the important role of keratinocytes in dermatological disease.

  12. Sustained phenotypic reversion of junctional epidermolysis bullosa dog keratinocytes: Establishment of an immunocompetent animal model for cutaneous gene therapy

    International Nuclear Information System (INIS)

    Spirito, Flavia; Capt, Annabelle; Rio, Marcela Del; Larcher, Fernando; Guaguere, Eric; Danos, Olivier; Meneguzzi, Guerrino

    2006-01-01

    Gene transfer represents the unique therapeutic issue for a number of inherited skin disorders including junctional epidermolysis bullosa (JEB), an untreatable genodermatose caused by mutations in the adhesion ligand laminin 5 (α3β3γ2) that is secreted in the extracellular matrix by the epidermal basal keratinocytes. Because gene therapy protocols require validation in animal models, we have phenotypically reverted by oncoretroviral transfer of the curative gene the keratinocytes isolated from dogs with a spontaneous form of JEB associated with a genetic mutation in the α3 chain of laminin 5. We show that the transduced dog JEB keratinocytes: (1) display a sustained secretion of laminin 5 in the extracellular matrix; (2) recover the adhesion, proliferation, and clonogenic capacity of wild-type keratinocytes; (3) generate fully differentiated stratified epithelia that after grafting on immunocompromised mice produce phenotypically normal skin and sustain permanent expression of the transgene. We validate an animal model that appears particularly suitable to demonstrate feasibility, efficacy, and safety of genetic therapeutic strategies for cutaneous disorders before undertaking human clinical trials

  13. ER signaling is activated to protect human HaCaT keratinocytes from ER stress induced by environmental doses of UVB

    International Nuclear Information System (INIS)

    Mera, Kentaro; Kawahara, Ko-ichi; Tada, Ko-ichi; Kawai, Kazuhiro; Hashiguchi, Teruto; Maruyama, Ikuro; Kanekura, Takuro

    2010-01-01

    Proteins are folded properly in the endoplasmic reticulum (ER). Various stress such as hypoxia, ischemia and starvation interfere with the ER function, causing ER stress, which is defined by the accumulation of unfolded protein (UP) in the ER. ER stress is prevented by the UP response (UPR) and ER-associated degradation (ERAD). These signaling pathways are activated by three major ER molecules, ATF6, IRE-1 and PERK. Using HaCaT cells, we investigated ER signaling in human keratinocytes irradiated by environmental doses of ultraviolet B (UVB). The expression of Ero1-Lα, an upstream signaling molecule of ER stress, decreased at 1-4 h after 10 mJ/cm 2 irradiation, indicating that the environmental dose of UVB-induced ER stress in HaCaT cells, without growth retardation. Furthermore, expression of intact ATF6 was decreased and it was translocated to the nuclei. The expression of XBP-1, a downstream molecule of IRE-1, which is an ER chaperone whose expression is regulated by XBP-1, and UP ubiquitination were induced by 10 mJ/cm 2 UVB at 4 h. PERK, which regulates apoptosis, was not phosphorylated. Our results demonstrate that UVB irradiation generates UP in HaCaT cells and that the UPR and ERAD systems are activated to protect cells from UVB-induced ER stress. This is the first report to show ER signaling in UVB-irradiated keratinocytes.

  14. The effect of the antipsoriatic drug metabolite etretin (Ro 10-1670) on UVB irradiation induced changes in the metabolism of arachidonic acid in human keratinocytes in culture

    International Nuclear Information System (INIS)

    Punnonen, Kari; Jansen, C.T.; Puustinen, Tapio

    1986-01-01

    [ 14 C]Arachidonic acid was avidly incorporated into human keratinocytes in culture and following exposure to UVB irradiation of 9 mJ/cm 2 (erythemally effective, EE) substantial amounts of 14 C-radiolabel were released from the cells. The release of radiolabel was accompanied by a decrease in the labelling of phosphatidylethanolamine whereas the labelling of triacylglycerols and cholesteryl esters was increased. Keratinocytes produced significant amounts of prostaglandin E 2 (PGE 2 ) and following UVB irradiation of 9 mJ/cm 2 (EE) the formation of prostaglandin E 2 was increased. Etretin (Ro 10-1670), the active metabolite of the antipsoriatic drug etretinate (Ro 10-9359), affected significantly neither the total release of radiolabel induced by UVB nor the formation of prostaglandin E 2 . However, in the presence of etretin the UVB irradiation induced transfer of [ 14 C]arachidonic acid into triacylglycerols and cholesteryl esters was not increased as much as in the corresponding experiments without etretin. On the basis of the present study it appears that etretin dose not interfere with the release of arachidonic acid in amounts which could be related to the therapeutic effects of the combination of retinoids with UVB irradiation (Re-UVB) in the treatment of psoriasis. (author)

  15. Barium promotes anchorage-independent growth and invasion of human HaCaT keratinocytes via activation of c-SRC kinase.

    Science.gov (United States)

    Thang, Nguyen Dinh; Yajima, Ichiro; Kumasaka, Mayuko Y; Ohnuma, Shoko; Yanagishita, Takeshi; Hayashi, Rumiko; Shekhar, Hossain U; Watanabe, Daisuke; Kato, Masashi

    2011-01-01

    Explosive increases in skin cancers have been reported in more than 36 million patients with arsenicosis caused by drinking arsenic-polluted well water. This study and previous studies showed high levels of barium as well as arsenic in the well water. However, there have been no reports showing a correlation between barium and cancer. In this study, we examined whether barium (BaCl(2)) may independently have cancer-related effects on human precancerous keratinocytes (HaCaT). Barium (5-50 µM) biologically promoted anchorage-independent growth and invasion of HaCaT cells in vitro. Barium (5 µM) biochemically enhanced activities of c-SRC, FAK, ERK and MT1-MMP molecules, which regulate anchorage-independent growth and/or invasion. A SRC kinase specific inhibitor, protein phosphatase 2 (PP2), blocked barium-mediated promotion of anchorage-independent growth and invasion with decreased c-SRC kinase activity. Barium (2.5-5 µM) also promoted anchorage-independent growth and invasion of fibroblasts (NIH3T3) and immortalized nontumorigenic melanocytes (melan-a), but not transformed cutaneous squamous cell carcinoma (HSC5 and A431) and malignant melanoma (Mel-ret) cells, with activation of c-SRC kinase. Taken together, our biological and biochemical findings newly suggest that the levels of barium shown in drinking well water independently has the cancer-promoting effects on precancerous keratinocytes, fibroblast and melanocytes in vitro.

  16. AP-2α Inhibits c-MYC Induced Oxidative Stress and Apoptosis in HaCaT Human Keratinocytes

    Directory of Open Access Journals (Sweden)

    Lei Yu

    2009-01-01

    AP-2 may have a direct effect on the c-myc gene. Chromatin immunoprecipitation assays demonstrated that AP-2 proteins bound to a cluster of AP-2 binding sites located within a 2 kb upstream regulatory region of c-myc These results suggest that the negative regulation of AP-2 on c-MYC activity was achieved through binding of AP-2 protein to the c-myc gene. The effects of AP-2 on c-MYC induced ROS accumulation and apoptosis in epidermal keratinocytes are likely to play an important role in cell growth, differentiation and carcinogenesis of the skin.

  17. A comprehensive two-dimensional gel protein database of noncultured unfractionated normal human epidermal keratinocytes: towards an integrated approach to the study of cell proliferation, differentiation and skin diseases

    DEFF Research Database (Denmark)

    Celis, J E; Madsen, Peder; Rasmussen, H H

    1991-01-01

    A two-dimensional (2-D) gel database of cellular proteins from noncultured, unfractionated normal human epidermal keratinocytes has been established. A total of 2651 [35S]methionine-labeled cellular proteins (1868 isoelectric focusing, 783 nonequilibrium pH gradient electrophoresis) were resolved...

  18. Germacrane sesquiterpenes isolated from the rhizome of Curcuma xanthorrhiza Roxb. inhibit UVB-induced upregulation of MMP-1, -2, and -3 expression in human keratinocytes.

    Science.gov (United States)

    Park, Ji-Hae; Mohamed, Mohamed Antar Aziz; Jung, Ye-Jin; Shrestha, Sabina; Lee, Tae Hoon; Lee, Chang-Ho; Han, Daeseok; Kim, Jiyoung; Baek, Nam-In

    2015-10-01

    Four sesquiterpenes were isolated from the rhizome of Curcuma xanthorrhiza Roxb.: furanodiene (1), germacrone (2), furanodienone (3), and 13-hydroxygermacrone (4). Importantly, this was the first time compounds 1 and 4 were isolated from this plant. The chemical structures of these compounds were determined using 1D- and 2D-nuclear magnetic resonance, infrared spectroscopy, and electron ionization mass spectrometry analyses. Among the isolated compounds, compounds 2 and 4 inhibited UVB-induced upregulation of the mRNA and protein expression levels of MMP-1, MMP-2, and MMP-3 in human keratinocytes (HaCaT). Moreover, this upregulation occurred in a dose-dependent manner over the range of 1-10 μM for each compound.

  19. Effect of Gloriosa superba and Catharanthus roseus Extracts on IFN-γ-Induced Keratin 17 Expression in HaCaT Human Keratinocytes

    Directory of Open Access Journals (Sweden)

    Nattaporn Pattarachotanant

    2014-01-01

    Full Text Available Gloriosa superba and Catharanthus roseus are useful in traditional medicine for treatment of various skin diseases and cancer. However, their molecular effect on psoriasis has not been investigated. In this study, the effect of ethanol extracts derived from G. superba leaves and C. roseus stems on the expression of psoriatic marker, keratin 17 (K17, was investigated in human keratinocytes using biochemical and molecular experimental approaches. Both extracts could reduce the expression of K17 in a dose-dependent manner through JAK/STAT pathway as demonstrated by an observation of reduced phosphorylation of STAT3 (p-STAT3. The inhibitory activity of G. superba extract was more potent than that of C. roseus. The Pearson's correlation between K17 and cell viability was shown positive. Taken together, the extracts of G. superba and C. roseus may be developed as alternative therapies for psoriasis.

  20. Citric acid induces cell-cycle arrest and apoptosis of human immortalized keratinocyte cell line (HaCaT) via caspase- and mitochondrial-dependent signaling pathways.

    Science.gov (United States)

    Ying, Tsung-Ho; Chen, Chia-Wei; Hsiao, Yu-Ping; Hung, Sung-Jen; Chung, Jing-Gung; Yang, Jen-Hung

    2013-10-01

    Citric acid is an alpha-hydroxyacid (AHA) widely used in cosmetic dermatology and skincare products. However, there is concern regarding its safety for the skin. In this study, we investigated the cytotoxic effects of citric acid on the human keratinocyte cell line HaCaT. HaCaT cells were treated with citric acid at 2.5-12.5 mM for different time periods. Cell-cycle arrest and apoptosis were investigated by 4,6-diamidino-2-phenylindole dihydrochloride (DAPI) staining, flow cytometry, western blot and confocal microscopy. Citric acid not only inhibited proliferation of HaCaT cells in a dose-dependent manner, but also induced apoptosis and cell cycle-arrest at the G2/M phase (before 24 h) and S phase (after 24 h). Citric acid increased the level of Bcl-2-associated X protein (BAX) and reduced the levels of B-cell lymphoma-2 (BCL-2), B-cell lymphoma-extra large (BCL-XL) and activated caspase-9 and caspase-3, which subsequently induced apoptosis via caspase-dependent and caspase-independent pathways. Citric acid also activated death receptors and increased the levels of caspase-8, activated BH3 interacting-domain death agonist (BID) protein, Apoptosis-inducing factor (AIF), and Endonuclease G (EndoG). Therefore, citric acid induces apoptosis through the mitochondrial pathway in the human keratinocyte cell line HaCaT. The study results suggest that citric acid is cytotoxic to HaCaT cells via induction of apoptosis and cell-cycle arrest in vitro.

  1. γ-Tocotrienol prevents 5-FU-induced reactive oxygen species production in human oral keratinocytes through the stabilization of 5-FU-induced activation of Nrf2.

    Science.gov (United States)

    Takano, Hideyuki; Momota, Yukihiro; Kani, Kouichi; Aota, Keiko; Yamamura, Yoshiko; Yamanoi, Tomoko; Azuma, Masayuki

    2015-04-01

    Chemotherapy-induced oral mucositis is a common adverse event in patients with oral squamous cell carcinoma, and is initiated through a variety of mechanisms, including the generation of reactive oxygen species (ROS). In this study, we examined the preventive effect of γ-tocotrienol on the 5-FU-induced ROS production in human oral keratinocytes (RT7). We treated RT7 cells with 5-FU and γ-tocotrienol at concentrations of 10 µg/ml and 10 nM, respectively. When cells were treated with 5-FU alone, significant growth inhibition was observed as compared to untreated cells. This inhibition was, in part, due to the ROS gene-rated by 5-FU treatment, because N-acetyl cysteine (NAC), a ROS scavenger, significantly ameliorated the growth of RT7 cells. γ-tocotrienol showed no cytotoxic effect on the growth of RT7 cells. Simultaneous treatment of cells with these agents resulted in the significant recovery of cell growth, owing to the suppression of ROS generation by γ-tocotrienol. Whereas 5-FU stimulated the expression of NF-E2-related factor 2 (Nrf2) protein in the nucleus up to 12 h after treatment of RT7 cells, γ-tocotrienol had no obvious effect on the expression of nuclear Nrf2 protein. Of note, the combined treatment with both agents stabilized the 5-FU-induced nuclear Nrf2 protein expression until 24 h after treatment. In addition, expression of Nrf2-dependent antioxidant genes, such as heme oxygenase-1 (HO-1) and quinone oxidoreductase-1 (NQO-1), was significantly augmented by treatment of cells with both agents. These findings suggest that γ-tocotrienol could prevent 5-FU-induced ROS generation by stabilizing Nrf2 activation, thereby leading to ROS detoxification and cell survival in human oral keratinocytes.

  2. Piperine attenuates UV-R induced cell damage in human keratinocytes via NF-kB, Bax/Bcl-2 pathway: An application for photoprotection.

    Science.gov (United States)

    Verma, Ankit; Kushwaha, Hari N; Srivastava, Ajeet K; Srivastava, Saumya; Jamal, Naseem; Srivastava, Kriti; Ray, Ratan Singh

    2017-07-01

    Chronic ultraviolet radiation (UV-R) exposure causes skin disorders like erythema, edema, hyperpigmentation, photoaging and photocarcinogenesis. Recent research trends of researchers have focused more attention on the identification and use of photo stable natural agents with photoprotective properties. Piperine (PIP), as a plant alkaloid, is an important constituent present in black pepper (Piper nigrum), used widely in ayurvedic and other traditional medicines and has broad pharmacological properties. The study was planned to photoprotective efficacy of PIP in human keratinocyte (HaCaT) cell line. We have assessed the UV-R induced activation of transcription factor NF-κB in coordination with cell death modulators (Bax/Bcl-2 and p21). The LC-MS/MS analysis revealed that PIP was photostable under UV-A/UV-B exposure. PIP (10μg/ml) attenuates the UV-R (A and B) induced phototoxicity of keratinocyte cell line through the restoration of cell viability, inhibition of ROS, and malondialdehyde generation. Further, PIP inhibited UV-R mediated DNA damage, prevented micronuclei formation, and reduced sub-G1 phase in cell cycle, which supported against photogenotoxicity. This study revealed that PIP pretreatment strongly suppressed UV-R induced photodamages. Molecular docking studies suggest that PIP binds at the active site of NF-κB, and thus, preventing its translocation to nucleus. In addition, transcriptional and translational analysis advocate the increased expression of NF-κB and concomitant decrease in IkB-α expression under UV-R exposed cells, favouring the apoptosis via Bax/Bcl-2 and p21 pathways. However, PIP induced expression of IkB-α suppress the NF-κB activity which resulted in suppression of apoptotic marker genes and proteins that involved in photoprotection. Therefore, we suggest the applicability of photostable PIP as photoprotective agent for human use. Copyright © 2017. Published by Elsevier B.V.

  3. Chafuroside B, an Oolong tea polyphenol, ameliorates UVB-induced DNA damage and generation of photo-immunosuppression related mediators in human keratinocytes.

    Directory of Open Access Journals (Sweden)

    Tatsuya Hasegawa

    Full Text Available Chafuroside B was recently isolated as a new polyphenolic constituent of oolong tea leaves. However, the effects of chafuroside B on skin function have not been examined. In this study, we investigated the protective effects of chafuroside B against UVB-induced DNA damage, apoptosis and generation of photo-immunosuppression related mediators in cultured normal human epidermal keratinocytes (NHEK. Chafuroside B at 1 µM attenuated both UVB-induced apoptosis, evaluated in terms of caspase-3/7 activity, and UVB-induced DNA damage, evaluated in terms of formation of cyclobutane pyrimidine dimers (CPD, in NHEK exposed to UVB (20 mJ/cm2. In addition, chafuroside B at 0.3 or 1 µM suppressed the UVB-induced production of interleukin (IL-10, tumor necrosis factor (TNF-α, and prostaglandin E2 (PGE2, as determined by ELISA, and conversely enhanced IL-12 mRNA expression and production, as measured by RT-PCR and ELISA. Further, chafuroside B at 1 µM also suppressed UVB-induced expression of receptor activator of nuclear factor κB ligand (RANKL mRNA. These results indicate that chafuroside B promotes repair of UVB-induced DNA damage and ameliorates the generation of IL-10, TNF-α, PGE2, and RANKL, all of which are UVB-induced immunosuppression related mediators. These effects of chafuroside B may be mediated at least in part through induction of IL-12 synthesis in human keratinocytes. Because chafuroside B might have practical value as a photoprotective agent, a further study of the in vivo effects of chafuroside B seems warranted.

  4. The key role of miR-21-regulated SOD2 in the medium-mediated bystander responses in human fibroblasts induced by α-irradiated keratinocytes

    International Nuclear Information System (INIS)

    Tian, Wenqian; Yin, Xiaoming; Wang, Longxiao; Wang, Jingdong; Zhu, Wei; Cao, Jianping; Yang, Hongying

    2015-01-01

    Highlights: • After co-culture with α-irradiated HaCaT cells, WS1 cells displayed oxidative stress and DNA damage. • Increased miR-21 expression in bystander cells was critical to the occurrence of RIBEs. • SOD2 of bystander cells played an important role in bystander responses. • miR-21 mediated bystander effects through its regulation on SOD2. - Abstract: Radiation-induced bystander effect (RIBE) is well accepted in the radiation research field by now, but the underlying molecular mechanisms for better understanding this phenomenon caused by intercellular communication and intracellular signal transduction are still incomplete. Although our previous study has demonstrated an important role of miR-21 of unirradiated bystander cells in RIBEs, the direct evidence for the hypothesis that RIBE is epigenetically regulated is still limited and how miR-21 mediates RIBEs is unknown. Reactive oxygen species (ROS) have been demonstrated to be involved in RIBEs, however, the roles of anti-oxidative stress system of cells in RIBEs are unclear. Using transwell insert co-culture system, we investigated medium-mediated bystander responses in WS1 human fibroblasts after co-culture with HaCaT keratinocytes traversed by α-particles. Results showed that the ROS levels in unirradiated bystander WS1 cells were significantly elevated after 30 min of co-culture, and 53BP1 foci, a surrogate marker of DNA damage, were obviously induced after 3 h of co-culture. This indicates the occurrence of oxidative stress and DNA damage in bystander WS1 cells after co-culture with irradiated keratinocytes. Furthermore, the expression of miR-21 was increased in bystander WS1 cells, downregulation of miR-21 eliminated the bystander responses, overexpression of miR-21 alone could induce bystander-like oxidative stress and DNA damage in WS1 cells. These data indicate an important mediating role of miR-21 in RIBEs. In addition, MnSOD or SOD2 in WS1 cells was involved in the bystander effects

  5. The key role of miR-21-regulated SOD2 in the medium-mediated bystander responses in human fibroblasts induced by α-irradiated keratinocytes.

    Science.gov (United States)

    Tian, Wenqian; Yin, Xiaoming; Wang, Longxiao; Wang, Jingdong; Zhu, Wei; Cao, Jianping; Yang, Hongying

    2015-10-01

    Radiation-induced bystander effect (RIBE) is well accepted in the radiation research field by now, but the underlying molecular mechanisms for better understanding this phenomenon caused by intercellular communication and intracellular signal transduction are still incomplete. Although our previous study has demonstrated an important role of miR-21 of unirradiated bystander cells in RIBEs, the direct evidence for the hypothesis that RIBE is epigenetically regulated is still limited and how miR-21 mediates RIBEs is unknown. Reactive oxygen species (ROS) have been demonstrated to be involved in RIBEs, however, the roles of anti-oxidative stress system of cells in RIBEs are unclear. Using transwell insert co-culture system, we investigated medium-mediated bystander responses in WS1 human fibroblasts after co-culture with HaCaT keratinocytes traversed by α-particles. Results showed that the ROS levels in unirradiated bystander WS1 cells were significantly elevated after 30min of co-culture, and 53BP1 foci, a surrogate marker of DNA damage, were obviously induced after 3h of co-culture. This indicates the occurrence of oxidative stress and DNA damage in bystander WS1 cells after co-culture with irradiated keratinocytes. Furthermore, the expression of miR-21 was increased in bystander WS1 cells, downregulation of miR-21 eliminated the bystander responses, overexpression of miR-21 alone could induce bystander-like oxidative stress and DNA damage in WS1 cells. These data indicate an important mediating role of miR-21 in RIBEs. In addition, MnSOD or SOD2 in WS1 cells was involved in the bystander effects, overexpression of SOD2 abolished the bystander oxidative stress and DNA damage, indicating that SOD2 was critical to the induction of RIBEs. Moreover, we found that miR-21 regulated SOD2, suggesting that miR-21 might mediate bystander responses through its regulation on SOD2. In conclusion, this study revealed a profound role of miR-21-regulated SOD2 of unirradiated WS1

  6. The key role of miR-21-regulated SOD2 in the medium-mediated bystander responses in human fibroblasts induced by α-irradiated keratinocytes

    Energy Technology Data Exchange (ETDEWEB)

    Tian, Wenqian; Yin, Xiaoming; Wang, Longxiao; Wang, Jingdong; Zhu, Wei; Cao, Jianping [School of Radiation Medicine and Protection, Medical College of Soochow University/Collaborative Innovation Center of Radiation Medicine of Jiangsu Higher Education Institutions, 199 Renai Road, Suzhou Industrial Park, Suzhou, Jiangsu Province 215123 (China); Yang, Hongying, E-mail: yanghongying@suda.edu.cn [School of Radiation Medicine and Protection, Medical College of Soochow University/Collaborative Innovation Center of Radiation Medicine of Jiangsu Higher Education Institutions, 199 Renai Road, Suzhou Industrial Park, Suzhou, Jiangsu Province 215123 (China); Institute of Radiotherapy & Oncology, Soochow University (China)

    2015-10-15

    Highlights: • After co-culture with α-irradiated HaCaT cells, WS1 cells displayed oxidative stress and DNA damage. • Increased miR-21 expression in bystander cells was critical to the occurrence of RIBEs. • SOD2 of bystander cells played an important role in bystander responses. • miR-21 mediated bystander effects through its regulation on SOD2. - Abstract: Radiation-induced bystander effect (RIBE) is well accepted in the radiation research field by now, but the underlying molecular mechanisms for better understanding this phenomenon caused by intercellular communication and intracellular signal transduction are still incomplete. Although our previous study has demonstrated an important role of miR-21 of unirradiated bystander cells in RIBEs, the direct evidence for the hypothesis that RIBE is epigenetically regulated is still limited and how miR-21 mediates RIBEs is unknown. Reactive oxygen species (ROS) have been demonstrated to be involved in RIBEs, however, the roles of anti-oxidative stress system of cells in RIBEs are unclear. Using transwell insert co-culture system, we investigated medium-mediated bystander responses in WS1 human fibroblasts after co-culture with HaCaT keratinocytes traversed by α-particles. Results showed that the ROS levels in unirradiated bystander WS1 cells were significantly elevated after 30 min of co-culture, and 53BP1 foci, a surrogate marker of DNA damage, were obviously induced after 3 h of co-culture. This indicates the occurrence of oxidative stress and DNA damage in bystander WS1 cells after co-culture with irradiated keratinocytes. Furthermore, the expression of miR-21 was increased in bystander WS1 cells, downregulation of miR-21 eliminated the bystander responses, overexpression of miR-21 alone could induce bystander-like oxidative stress and DNA damage in WS1 cells. These data indicate an important mediating role of miR-21 in RIBEs. In addition, MnSOD or SOD2 in WS1 cells was involved in the bystander effects

  7. Expression of human adenosine deaminase in mice reconstituted with retrovirus-transduced hematopoietic stem cells

    International Nuclear Information System (INIS)

    Wilson, J.M.; Danos, O.; Grossman, M.; Raulet, D.H.; Mulligan, R.C.

    1990-01-01

    Recombinant retroviruses encoding human adenosine deaminase have been used to infect murine hematopoietic stem cells. In bone marrow transplant recipients reconstituted with the genetically modified cells, human ADA was detected in peripheral blood mononuclear cells of the recipients for at least 6 months after transplantation. In animals analyzed in detail 4 months after transplantation, human ADA and proviral sequences were detected in all hematopoietic lineages; in several cases, human ADA activity exceeded the endogenous activity. These studies demonstrate the feasibility of introducing a functional human ADA gene into hematopoietic stem cells and obtaining expression in multiple hematopoietic lineages long after transplantation. This approach should be helpful in designing effective gene therapies for severe combined immunodeficiency syndromes in humans

  8. The transcriptional regulator gene E2 of the Human Papillomavirus (HPV) 16 influences the radiosensitivity of cervical keratinocytes

    International Nuclear Information System (INIS)

    Lindel, Katja; Rieken, Stefan; Daffinger, Sigrid; Weber, Klaus J; Villiers, Ethel-Michele de; Debus, Jürgen

    2012-01-01

    Clinical studies have demonstrated that HPV induced tumors constitute a specific subclass of cancer with a better response to radiation treatment. The purpose of this study was to investigate meaning of viral E2-gene for radiosensitivity. W12 cells contain episomal HPV 16 genomes, whereas S12 cells, which derive from the W12 line, contain HPV DNA as integrated copies. Clonogenic survival was analyzed using 96-well in vitro test. Using flow cytometry cell cycle analyses were performed. Expression of pRb and p53 were analyzed using intracellular staining. W12 cells (intact E2 gene) showed a lower survival fraction than S12 cells. W12 cells developed a G2/M block 24 h after irradiation with 2 Gy whereas S12 showed no G2/M bloc. After irradiation S12 cells developed polyploidy and pRb-positive cells decreased. W12 cells showed no change of pRb-positive cells. Depending on E2 gene status differences in cell cycle regulation might cause radioresistance. The E2/E7/pRb pathway seems to influence HPV-induced radiosensitivity. Our experiments demonstrated an effect of HPV on radiosensitivity of cervical keratinocytes via viral transcription regulator E2 pathway

  9. Effects of Wannachawee Recipe with Antipsoriatic Activity on Suppressing Inflammatory Cytokine Production in HaCaT Human Keratinocytes

    Directory of Open Access Journals (Sweden)

    Mingkwan Na Takuathung

    2017-01-01

    Full Text Available Psoriasis is a chronic inflammatory and immune-mediated skin disease. The pathogenesis involves T cells activation via the IL-23/Th17 axis. Conventional treatments of psoriasis have adverse events influencing patients’ adherence. Wannachawee Recipe (WCR has been effectively used as Thai folk remedy for psoriasis patients; however, preclinical evidence defining how WCR works is still lacking. This study defined mechanisms for its antiproliferation and anti-inflammatory effects in HaCaT cells. The cytotoxicity and antiproliferation results from SRB and CCK-8 assays showed that WCR inhibited the growth and viability of HaCaT cells in a concentration-dependent manner. The distribution of cell cycle phases determined by flow cytometry showed that WCR did not interrupt cell cycle progression. Interestingly, RT-qPCR revealed that WCR significantly decreased the mRNA expression of IL-1β, IL-6, IL-8, IL-17A, IL-22, IL-23, and TNF-α but induced IL-10 expression in TNF-α- and IFN-γ-induced HaCaT cells. At the protein level determined by ELISA, WCR significantly reduced the secretion of IL-17A, IL-22, and IL-23. The WCR at low concentrations was proved to possess anti-inflammatory effect without cytotoxicity and it did not interfere with cell cycle of keratinocytes. This is the first study to provide convincing evidence that WCR is a potential candidate for development of effective psoriasis therapies.

  10. Ultraviolet B irradiation induces changes in the distribution and release of arachidonic acid, dihomo-gamma-linolenic acid, and eicosapentaenoic acid in human keratinocytes in culture

    International Nuclear Information System (INIS)

    Punnonen, K.; Puustinen, T.; Jansen, C.T.

    1987-01-01

    There is increasing evidence that derivatives of 20-carbon polyunsaturated fatty acids, the eicosanoids, play an important role in the inflammatory responses of the human skin. To better understand the metabolic fate of fatty acids in the skin, the effect of ultraviolet B (UVB) irradiation (280-320 nm) on the distribution and release of 14 C-labeled arachidonic acid, dihomo-gamma-linolenic acid, and eicosapentaenoic acid in human keratinocytes in culture was investigated. Ultraviolet B irradiation induced the release of all three 14 C-labeled fatty acids from the phospholipids, especially from phosphatidylethanolamine, and this was accompanied by increased labeling of the nonphosphorus lipids. This finding suggests that UVB induces a significant liberation of eicosanoid precursor fatty acids from cellular phospholipids, but the liberated fatty acids are largely reincorporated into the nonphosphorus lipids. In conclusion, the present study suggests that not only arachidonic acid but also dihomo-gamma-linolenic acid, and eicosapentaenoic acid might be involved in the UVB irradiation-induced inflammatory reactions of human skin

  11. Humanized Mouse Model of Skin Inflammation Is Characterized by Disturbed Keratinocyte Differentiation and Influx of IL-17A Producing T Cells

    Science.gov (United States)

    de Oliveira, Vivian L.; Keijsers, Romy R. M. C.; van de Kerkhof, Peter C. M.; Seyger, Marieke M. B.; Fasse, Esther; Svensson, Lars; Latta, Markus; Norsgaard, Hanne; Labuda, Tord; Hupkens, Pieter; van Erp, Piet E. J.; Joosten, Irma; Koenen, Hans J. P. M.

    2012-01-01

    Humanized mouse models offer a challenging possibility to study human cell function in vivo. In the huPBL-SCID-huSkin allograft model human skin is transplanted onto immunodeficient mice and allowed to heal. Thereafter allogeneic human peripheral blood mononuclear cells are infused intra peritoneally to induce T cell mediated inflammation and microvessel destruction of the human skin. This model has great potential for in vivo study of human immune cells in (skin) inflammatory processes and for preclinical screening of systemically administered immunomodulating agents. Here we studied the inflammatory skin response of human keratinocytes and human T cells and the concomitant systemic human T cell response. As new findings in the inflamed human skin of the huPBL-SCID-huSkin model we here identified: 1. Parameters of dermal pathology that enable precise quantification of the local skin inflammatory response exemplified by acanthosis, increased expression of human β-defensin-2, Elafin, K16, Ki67 and reduced expression of K10 by microscopy and immunohistochemistry. 2. Induction of human cytokines and chemokines using quantitative real-time PCR. 3. Influx of inflammation associated IL-17A-producing human CD4+ and CD8+ T cells as well as immunoregulatory CD4+Foxp3+ cells using immunohistochemistry and -fluorescence, suggesting that active immune regulation is taking place locally in the inflamed skin. 4. Systemic responses that revealed activated and proliferating human CD4+ and CD8+ T cells that acquired homing marker expression of CD62L and CLA. Finally, we demonstrated the value of the newly identified parameters by showing significant changes upon systemic treatment with the T cell inhibitory agents cyclosporine-A and rapamycin. In summary, here we equipped the huPBL-SCID-huSkin humanized mouse model with relevant tools not only to quantify the inflammatory dermal response, but also to monitor the peripheral immune status. This combined approach will gain our

  12. Transduced human copper chaperone for Cu,Zn-SOD (PEP-1-CCS) protects against neuronal cell death.

    Science.gov (United States)

    Choi, Soo Hyun; Kim, Dae Won; Kim, So Young; An, Jae Jin; Lee, Sun Hwa; Choi, Hee Soon; Sohn, Eun Jung; Hwang, Seok-Il; Won, Moo Ho; Kang, Tae-Cheon; Kwon, Hyung Joo; Kang, Jung Hoon; Cho, Sung-Woo; Park, Jinseu; Eum, Won Sik; Choi, Soo Young

    2005-12-31

    Reactive oxygen species (ROS) contribute to the development of various human diseases. Cu,Zn-superoxide dismutase (SOD) is one of the major means by which cells counteract the deleterious effects of ROS. SOD activity is dependent upon bound copper ions supplied by its partner metallochaperone protein, copper chaperone for SOD (CCS). In the present study, we investigated the protective effects of PEP-1-CCS against neuronal cell death and ischemic insults. When PEP-1-CCS was added to the culture medium of neuronal cells, it rapidly entered the cells and protected them against paraquat-induced cell death. Moreover, transduced PEP-1-CCS markedly increased endogenous SOD activity in the cells. Immunohistochemical analysis revealed that it prevented neuronal cell death in the hippocampus in response to transient forebrain ischemia. These results suggest that CCS is essential to activate SOD, and that transduction of PEP-1-CCS provides a potential strategy for therapeutic delivery in various human diseases including stroke related to SOD or ROS.

  13. Areca nut extract up-regulates prostaglandin production, cyclooxygenase-2 mRNA and protein expression of human oral keratinocytes.

    Science.gov (United States)

    Jeng, J H; Ho, Y S; Chan, C P; Wang, Y J; Hahn, L J; Lei, D; Hsu, C C; Chang, M C

    2000-07-01

    There are about 600 million betel quid (BQ) chewers in the world. BQ chewing is associated with increased incidence of oral cancer and submucous fibrosis. In this study, areca nut (AN) extract (200-800 microg/ml) induced the prostaglandin E(2) (PGE(2)) production by 1. 4-3.4-fold and 6-keto-PGF(1 alpha) production by 1.1-1.7-fold of gingival keratinocytes (GK), respectively, following 24 h of exposure. Exposure of GK to AN extract (>400 microg/ml) led to cell retraction and intracellular vacuoles formation. At concentrations of 800 and 1200 microg/ml, AN extract induced cell death at 21-24 and 32-52% as detected by MTT assay and cellular lactate dehydrogenase release, respectively. Interestingly, AN-induced morphological changes of GK are reversible. GK can still proliferate following exposure to AN extract. Cytotoxicity of AN extract cannot be inhibited by indomethacin (1 microM) and aspirin (50 microM), indicating that prostaglandin (PG) production is not the major factor responsible for AN cytotoxicity. PGE(2) exhibited little effect on the growth of GK at concentrations ranging from 100-1000 pg/ml. Stimulating GK production of PGs by AN extract could be due to induction of cyclooxygenase-2 (COX-2) mRNA expression and protein production. These results suggest that AN ingredients are critical in the pathogenesis of oral submucous fibrosis and oral cancer via their stimulatory effects on the PGs, COX-2 production and associated tissue inflammatory responses. AN cytotoxicity to GK is not directly mediated by COX-2 stimulation and PG production.

  14. The Frog Skin-Derived Antimicrobial Peptide Esculentin-1a(1-21)NH2 Promotes the Migration of Human HaCaT Keratinocytes in an EGF Receptor-Dependent Manner: A Novel Promoter of Human Skin Wound Healing?

    Science.gov (United States)

    Di Grazia, Antonio; Cappiello, Floriana; Imanishi, Akiko; Mastrofrancesco, Arianna; Picardo, Mauro; Paus, Ralf; Mangoni, Maria Luisa

    2015-01-01

    One of the many functions of skin is to protect the organism against a wide range of pathogens. Antimicrobial peptides (AMPs) produced by the skin epithelium provide an effective chemical shield against microbial pathogens. However, whereas antibacterial/antifungal activities of AMPs have been extensively characterized, much less is known regarding their wound healing-modulatory properties. By using an in vitro re-epithelialisation assay employing special cell-culture inserts, we detected that a derivative of the frog-skin AMP esculentin-1a, named esculentin-1a(1-21)NH2, significantly stimulates migration of immortalized human keratinocytes (HaCaT cells) over a wide range of peptide concentrations (0.025-4 μM), and this notably more efficiently than human cathelicidin (LL-37). This activity is preserved in primary human epidermal keratinocytes. By using appropriate inhibitors and an enzyme-linked immunosorbent assay we found that the peptide-induced cell migration involves activation of the epidermal growth factor receptor and STAT3 protein. These results suggest that esculentin-1a(1-21)NH2 now deserves to be tested in standard wound healing assays as a novel candidate promoter of skin re-epithelialisation. The established ability of esculentin-1a(1-21)NH2 to kill microbes without harming mammalian cells, namely its high anti-Pseudomonal activity, makes this AMP a particularly attractive candidate wound healing promoter, especially in the management of chronic, often Pseudomonas-infected, skin ulcers.

  15. The Frog Skin-Derived Antimicrobial Peptide Esculentin-1a(1-21NH2 Promotes the Migration of Human HaCaT Keratinocytes in an EGF Receptor-Dependent Manner: A Novel Promoter of Human Skin Wound Healing?

    Directory of Open Access Journals (Sweden)

    Antonio Di Grazia

    Full Text Available One of the many functions of skin is to protect the organism against a wide range of pathogens. Antimicrobial peptides (AMPs produced by the skin epithelium provide an effective chemical shield against microbial pathogens. However, whereas antibacterial/antifungal activities of AMPs have been extensively characterized, much less is known regarding their wound healing-modulatory properties. By using an in vitro re-epithelialisation assay employing special cell-culture inserts, we detected that a derivative of the frog-skin AMP esculentin-1a, named esculentin-1a(1-21NH2, significantly stimulates migration of immortalized human keratinocytes (HaCaT cells over a wide range of peptide concentrations (0.025-4 μM, and this notably more efficiently than human cathelicidin (LL-37. This activity is preserved in primary human epidermal keratinocytes. By using appropriate inhibitors and an enzyme-linked immunosorbent assay we found that the peptide-induced cell migration involves activation of the epidermal growth factor receptor and STAT3 protein. These results suggest that esculentin-1a(1-21NH2 now deserves to be tested in standard wound healing assays as a novel candidate promoter of skin re-epithelialisation. The established ability of esculentin-1a(1-21NH2 to kill microbes without harming mammalian cells, namely its high anti-Pseudomonal activity, makes this AMP a particularly attractive candidate wound healing promoter, especially in the management of chronic, often Pseudomonas-infected, skin ulcers.

  16. Evidence for Alteration of EZH2, BMI1, and KDM6A and Epigenetic Reprogramming in Human Papillomavirus Type 16 E6/E7-Expressing Keratinocytes

    Science.gov (United States)

    Hyland, Paula L.; McDade, Simon S.; McCloskey, Rachel; Dickson, Glenda J.; Arthur, Ken; McCance, Dennis J.; Patel, Daksha

    2011-01-01

    A number of epigenetic alterations occur in both the virus and host cellular genomes during human papillomavirus (HPV)-associated carcinogenesis, and investigations of such alterations, including changes in chromatin proteins and histone modifications, have the potential to lead to therapeutic epigenetic reversion. We report here that transformed HPV16 E6/E7-expressing primary human foreskin keratinocytes (HFKs) (E6/E7 cells) demonstrate increased expression of the PRC2 methyltransferase EZH2 at both the mRNA and protein levels but do not exhibit the expected increase in trimethylated H3K27 (H3K27me3) compared to normal keratinocytes. In contrast, these cells show a reduction in global H3K27me3 levels in vitro, as well as upregulation of the KDM6A demethylase. We further show for the first time that transformation with the HPV16 E6 and E7 oncogenes also results in an increase in phosphorylated EZH2 serine 21 (P-EZH2-Ser21), mediated by active Akt, and in a downregulation of the PRC1 protein BMI1 in these cells. High-grade squamous cervical intraepithelial lesions also showed a loss of H3K27me3 in the presence of increased expression of EZH2. Correlating with the loss of H3K27me3, E6/E7 cells exhibited derepression of specific EZH2-, KMD6A-, and BMI1-targeted HOX genes. These results suggest that the observed reduction in H3K27me3 may be due to a combination of reduced activities/levels of specific polycomb proteins and increases in demethylases. The dysregulation of multiple chromatin proteins resulting in the loss of global H3K27me3 and the transcriptional reprogramming in HPV16 E6/E7-infected cells could provide an epigenetic signature associated with risk and/or progression of HPV16-associated cancers, as well as the potential for epigenetic reversion in the future. PMID:21865393

  17. Evidence for alteration of EZH2, BMI1, and KDM6A and epigenetic reprogramming in human papillomavirus type 16 E6/E7-expressing keratinocytes.

    Science.gov (United States)

    Hyland, Paula L; McDade, Simon S; McCloskey, Rachel; Dickson, Glenda J; Arthur, Ken; McCance, Dennis J; Patel, Daksha

    2011-11-01

    A number of epigenetic alterations occur in both the virus and host cellular genomes during human papillomavirus (HPV)-associated carcinogenesis, and investigations of such alterations, including changes in chromatin proteins and histone modifications, have the potential to lead to therapeutic epigenetic reversion. We report here that transformed HPV16 E6/E7-expressing primary human foreskin keratinocytes (HFKs) (E6/E7 cells) demonstrate increased expression of the PRC2 methyltransferase EZH2 at both the mRNA and protein levels but do not exhibit the expected increase in trimethylated H3K27 (H3K27me3) compared to normal keratinocytes. In contrast, these cells show a reduction in global H3K27me3 levels in vitro, as well as upregulation of the KDM6A demethylase. We further show for the first time that transformation with the HPV16 E6 and E7 oncogenes also results in an increase in phosphorylated EZH2 serine 21 (P-EZH2-Ser21), mediated by active Akt, and in a downregulation of the PRC1 protein BMI1 in these cells. High-grade squamous cervical intraepithelial lesions also showed a loss of H3K27me3 in the presence of increased expression of EZH2. Correlating with the loss of H3K27me3, E6/E7 cells exhibited derepression of specific EZH2-, KMD6A-, and BMI1-targeted HOX genes. These results suggest that the observed reduction in H3K27me3 may be due to a combination of reduced activities/levels of specific polycomb proteins and increases in demethylases. The dysregulation of multiple chromatin proteins resulting in the loss of global H3K27me3 and the transcriptional reprogramming in HPV16 E6/E7-infected cells could provide an epigenetic signature associated with risk and/or progression of HPV16-associated cancers, as well as the potential for epigenetic reversion in the future.

  18. Protective Effect of Mangifera indica Linn., Cocos nucifera Linn., and Averrhoa carambola Linn. Extracts against Ultraviolet B-Induced Damage in Human Keratinocytes

    Science.gov (United States)

    Ronpirin, Chalinee; Pattarachotanant, Nattaporn

    2016-01-01

    This study was aimed at investigating the antioxidant activity of Mangifera indica Linn., Cocos nucifera Linn., and Averrhoa carambola Linn. and their biological effect on human keratinocytes affected by the ultraviolet B (UVB), a major cause of cell damage and skin cancer through induction of DNA damage, production of reactive oxygen species (ROS), and apoptosis. The richest antioxidant activity was found in ethanol fraction of M. indica (21.32 ± 0.66 mg QE/g dry weight), while the lowest one was found in aqueous fractions of M. indica and C. nucifera (1.76 ± 2.10 and 1.65 ± 0.38 mg QE/g dry weight, respectively). Ethanol and aqueous fractions of A. carambola (250 µg/mL) significantly reduced the number of apoptotic cells. The expression of cleaved caspase 3 in UVB-treated group was significantly greater than that in untreated group. Both fractions of A. carambola (50, 100, and 250 µg/mL) significantly decreased the expression of cleaved caspase 3. Regarding the induction of DNA repair, ethanol (100 and 250 µg/mL) and aqueous (50, 100 and 250 µg/mL) fractions of A. carambola significantly decreased the percentage of cyclobutane pyrimidine dimers (CPD). Taken together, our results suggest that both fractions of A. carambola may be potentially developed for dermal applications. PMID:27057195

  19. Reinforcing the inner phase of the filled hydrogels with CNTs alters drug release properties and human keratinocyte morphology: A study on the gelatin- tamarind gum filled hydrogels.

    Science.gov (United States)

    Maharana, Vivek; Gaur, Deepanjali; Nayak, Suraj K; Singh, Vinay K; Chakraborty, Subhabrata; Banerjee, Indranil; Ray, Sirsendu S; Anis, Arfat; Pal, Kunal

    2017-11-01

    The study reports the synthesis and characterization of gelatin-tamarind gum (TG) based filled hydrogels for drug delivery applications. In this study, three different types of carbon nanotubes (CNTs) were incorporated within the dispersed TG phase of the filled hydrogels. The prepared hydrogels were thoroughly characterised using bright field microscope, FESEM, FTIR spectroscopy, differential scanning calorimeter, and mechanical tester. The swelling and the drug (salicylic acid) release properties of the filled hydrogels were also evaluated. The micrographs revealed the formation of biphasic systems. The internal phase appeared as agglomerates, and the CNTs were confined within the dispersed TG phase. FTIR and XRD studies revealed that CNTs promoted associative interactions among the components of the hydrogel, which promoted the formation of large crystallite size. The mechanical study indicated better resistance to the breakdown of the architecture of the CNT-containing filled hydrogels. Drug release studies, both passive and iontophoretic, suggested that the non-Fickian diffusion of the drug was prevalent during its release from hydrogel matrices. The prepared hydrogels were cytocompatible with human keratinocytes. The results suggested the probable use of such hydrogels in wound healing, tissue engineering and drug delivery applications. Copyright © 2017 Elsevier Ltd. All rights reserved.

  20. Protective Effect of Mangifera indica Linn., Cocos nucifera Linn., and Averrhoa carambola Linn. Extracts against Ultraviolet B-Induced Damage in Human Keratinocytes.

    Science.gov (United States)

    Ronpirin, Chalinee; Pattarachotanant, Nattaporn; Tencomnao, Tewin

    2016-01-01

    This study was aimed at investigating the antioxidant activity of Mangifera indica Linn., Cocos nucifera Linn., and Averrhoa carambola Linn. and their biological effect on human keratinocytes affected by the ultraviolet B (UVB), a major cause of cell damage and skin cancer through induction of DNA damage, production of reactive oxygen species (ROS), and apoptosis. The richest antioxidant activity was found in ethanol fraction of M. indica (21.32 ± 0.66 mg QE/g dry weight), while the lowest one was found in aqueous fractions of M. indica and C. nucifera (1.76 ± 2.10 and 1.65 ± 0.38 mg QE/g dry weight, respectively). Ethanol and aqueous fractions of A. carambola (250 µg/mL) significantly reduced the number of apoptotic cells. The expression of cleaved caspase 3 in UVB-treated group was significantly greater than that in untreated group. Both fractions of A. carambola (50, 100, and 250 µg/mL) significantly decreased the expression of cleaved caspase 3. Regarding the induction of DNA repair, ethanol (100 and 250 µg/mL) and aqueous (50, 100 and 250 µg/mL) fractions of A. carambola significantly decreased the percentage of cyclobutane pyrimidine dimers (CPD). Taken together, our results suggest that both fractions of A. carambola may be potentially developed for dermal applications.

  1. Protective Effect of Mangifera indica Linn., Cocos nucifera Linn., and Averrhoa carambola Linn. Extracts against Ultraviolet B-Induced Damage in Human Keratinocytes

    Directory of Open Access Journals (Sweden)

    Chalinee Ronpirin

    2016-01-01

    Full Text Available This study was aimed at investigating the antioxidant activity of Mangifera indica Linn., Cocos nucifera Linn., and Averrhoa carambola Linn. and their biological effect on human keratinocytes affected by the ultraviolet B (UVB, a major cause of cell damage and skin cancer through induction of DNA damage, production of reactive oxygen species (ROS, and apoptosis. The richest antioxidant activity was found in ethanol fraction of M. indica (21.32 ± 0.66 mg QE/g dry weight, while the lowest one was found in aqueous fractions of M. indica and C. nucifera (1.76 ± 2.10 and 1.65 ± 0.38 mg QE/g dry weight, respectively. Ethanol and aqueous fractions of A. carambola (250 µg/mL significantly reduced the number of apoptotic cells. The expression of cleaved caspase 3 in UVB-treated group was significantly greater than that in untreated group. Both fractions of A. carambola (50, 100, and 250 µg/mL significantly decreased the expression of cleaved caspase 3. Regarding the induction of DNA repair, ethanol (100 and 250 µg/mL and aqueous (50, 100 and 250 µg/mL fractions of A. carambola significantly decreased the percentage of cyclobutane pyrimidine dimers (CPD. Taken together, our results suggest that both fractions of A. carambola may be potentially developed for dermal applications.

  2. Effect of Standardized Boesenbergia pandurata Extract and Its Active Compound Panduratin A on Skin Hydration and Barrier Function in Human Epidermal Keratinocytes.

    Science.gov (United States)

    Woo, Seon Wook; Rhim, Dong-Bin; Kim, Changhee; Hwang, Jae-Kwan

    2015-03-01

    The skin plays a key role in protecting the body from the environment and from water loss. Cornified envelope (CE) and natural moisturizing factor (NMF) are considered as the primary regulators of skin hydration and barrier function. The CE prevents loss of water from the body and is formed by cross-linking of several proteins. Among these proteins, filaggrin is an important protein because NMF is produced by the degradation of filaggrin. Proteases, including matriptase and prostasin, stimulate the generation of filaggrin from profilaggrin and caspase-14 plays a role in the degradation of filaggrin. This study elucidated the effects of an ethanol extract of Boesenbergia pandurata (Roxb.) Schltr., known as fingerroot, and its active compound panduratin A on CE formation and filaggrin processing in HaCaT, human epidermal keratinocytes. B. pandurata extract (BPE) and panduratin A significantly stimulated not only CE formation but also the expression of CE proteins, such as loricrin, involucrin, and transglutaminase, which were associated with PPARα expression. The mRNA and protein levels of filaggrin and filaggrin-related enzymes, such as matriptase, prostasin, and caspase-14 were also up-regulated by BPE and panduratin A treatment. These results suggest that BPE and panduratin A are potential nutraceuticals which can enhance skin hydration and barrier function based on their CE formation and filaggrin processing.

  3. Influence of CAD/CAM all-ceramic materials on cell viability, migration ability and adenylate kinase release of human gingival fibroblasts and oral keratinocytes.

    Science.gov (United States)

    Pabst, A M; Walter, C; Grassmann, L; Weyhrauch, M; Brüllmann, D D; Ziebart, T; Scheller, H; Lehmann, K M

    2014-05-01

    The aim of this study was to analyze the influence of four CAD/CAM all-ceramic materials on cell viability, migration ability and adenylate kinase (ADK) release of human gingival fibroblasts (HGF) and oral keratinocytes (HOK). HGF and HOK were cultured on disc-shaped CAD/CAM all-ceramic materials (e.max CAD LT, e.max CAD HT, Empress CAD and Mark II) and on discs made of tissue culture polystyrene surface (TCPS) serving as control. Cell viability was analyzed by using an MTT assay, and migration ability was investigated by a scratch assay. A ToxiLight assay has been performed to analyze the effect of all-ceramic materials on ADK release and cell apoptosis. At MTT assay for HGF, no significant decrease of cell viability could be detected at all points of measurement (p each > 0.05), while HOK demonstrated a significant decrease in cell viability especially on Empress CAD and Mark II at each point of measurement (p each materials at all points of measurement (between -36 % and -71 %; p each ceramic materials could be investigated. This study disclosed significant differences in cell viability and migration ability of HGF and HOK on CAD/CAM all-ceramic materials. CAD/CAM all-ceramic materials can influence oral cell lines responsible for soft tissue creation which may affect the esthetic outcome.

  4. Characterisation of Human Keratinocytes by Measuring Cellular Repair Capacity of UVB-Induced DNA Damage and Monitoring of Cytogenetic Changes in Melanoma Cell Lines

    Energy Technology Data Exchange (ETDEWEB)

    Greinert, R.; Breibart, E.W.; Mitchell, D.; Smida, J.; Volkmer, B

    2000-07-01

    The molecular mechanisms for UV-induced photocarcinogenesis are far from being understood in detail, especially in the case of malignant melanoma of the skin. Nevertheless, it is known that deficiencies in cellular repair processes of UV-induced DNA damage (e.g. in the case of Xeroderma pigmentosum) represent important aetiological factors in the multistep development of skin cancer. The repair kinetics have therefore been studied of an established skin cell line (HaCaT), primary human keratinocytes, melanocytes and melanoma cell lines, using fluorescence microscopy and flow cytometry. Our data show a high degree of interindividual variability in cellular repair capacity for UV-induced DNA lesions, which might be due to individual differences in the degree of tolerable damage and/or the onsets of saturation of the enzymatic repair system. The cytogenetic analysis of melanoma cell lines, using spectral karyotyping (SKY) furthermore proves that malignant melanoma of the skin are characterised by high numbers of chromosomal aberrations. (author)

  5. Protective Effect of Diphlorethohydroxycarmalol against Ultraviolet B Radiation-Induced DNA Damage by Inducing the Nucleotide Excision Repair System in HaCaT Human Keratinocytes

    Directory of Open Access Journals (Sweden)

    Mei Jing Piao

    2015-09-01

    Full Text Available We investigated the protective properties of diphlorethohydroxycarmalol (DPHC, a phlorotannin, against ultraviolet B (UVB radiation-induced cyclobutane pyrimidine dimers (CPDs in HaCaT human keratinocytes. The nucleotide excision repair (NER system is the pathway by which cells identify and repair bulky, helix-distorting DNA lesions such as ultraviolet (UV radiation-induced CPDs and 6-4 photoproducts. CPDs levels were elevated in UVB-exposed cells; however, this increase was reduced by DPHC. Expression levels of xeroderma pigmentosum complementation group C (XPC and excision repair cross-complementing 1 (ERCC1, which are essential components of the NER pathway, were induced in DPHC-treated cells. Expression of XPC and ERCC1 were reduced following UVB exposure, whereas DPHC treatment partially restored the levels of both proteins. DPHC also increased expression of transcription factor specificity protein 1 (SP1 and sirtuin 1, an up-regulator of XPC, in UVB-exposed cells. DPHC restored binding of the SP1 to the XPC promoter, which is reduced in UVB-exposed cells. These results indicate that DPHC can protect cells against UVB-induced DNA damage by inducing the NER system.

  6. Increased p21ras activity in human fibroblasts transduced with survivin enhances cell proliferation

    International Nuclear Information System (INIS)

    Temme, Achim; Diestelkoetter-Bachert, Petra; Schmitz, Marc; Morgenroth, Agnieszka; Weigle, Bernd; Rieger, Michael A.; Kiessling, Andrea; Rieber, E. Peter

    2005-01-01

    Survivin is critically involved in mitosis and when overexpressed enhances the activity of the Aurora B kinase, a serine-threonine kinase belonging to the family of oncogenic Aurora/IpI1p-related kinases. Both proteins interact with Ras GTPase-activating protein suggesting an impact on the Ras pathway. This study aimed at defining the role of survivin in proliferation and potential transformation of cells. When survivin was overexpressed in normal human lung fibroblasts, the characteristic track lanes of fibroblasts were disturbed and the rate of cell proliferation was increased. An enhanced level of p21 ras mRNA and protein expression and concomitant rise in levels of activated p21 ras were observed. Despite increased proliferation cell survival remained dependent on serum and cells were not able to form colonies in soft agar assays. These data suggest that overexpression of survivin increases cell growth but, despite the increase in active p21 ras , is not sufficient to transform primary cells. Yet, in addition to its anti-apoptotic function it might contribute to the accelerated growth of tumour cells by increasing p21 ras activity

  7. Skin metabolism of aminophenols: Human keratinocytes as a suitable in vitro model to qualitatively predict the dermal transformation of 4-amino-2-hydroxytoluene in vivo

    International Nuclear Information System (INIS)

    Goebel, C.; Hewitt, N.J.; Kunze, G.; Wenker, M.; Hein, D.W.; Beck, H.; Skare, J.

    2009-01-01

    4-Amino-2-hydroxytolune (AHT) is an aromatic amine ingredient in oxidative hair colouring products. As skin contact occurs during hair dyeing, characterisation of dermal metabolism is important for the safety assessment of this chemical class. We have compared the metabolism of AHT in the human keratinocyte cell line HaCaT with that observed ex-vivo in human skin and in vivo (topical application versus oral (p.o.) and intravenous (i.v.) route). Three major metabolites of AHT were excreted, i.e. N-acetyl-AHT, AHT-sulfate and AHT-glucuronide. When 12.5 mg/kg AHT was applied topically, the relative amounts of each metabolite were altered such that N-acetyl-AHT product was the major metabolite (66% of the dose in comparison with 37% and 32% of the same applied dose after i.v. and p.o. administration, respectively). N-acetylated products were the only metabolites detected in HaCaT cells and ex-vivo whole human skin discs for AHT and p-aminophenol (PAP), an aromatic amine known to undergo N-acetylation in vivo. Since N-acetyltransferase 1 (NAT1) is the responsible enzyme, kinetics of AHT was further compared to the standard NAT1 substrate p-aminobenzoic acid (PABA) in the HaCaT model revealing similar values for K m and V max . In conclusion NAT1 dependent dermal N-acetylation of AHT represents a 'first-pass' metabolism effect in the skin prior to entering the systemic circulation. Since the HaCaT cell model represents a suitable in vitro assay for addressing the qualitative contribution of the skin to the metabolism of topically-applied aromatic amines it may contribute to a reduction in animal testing

  8. Interactive effects of 2,3,7,8-tetrachlorodibenzo-p-dioxin and retinoids on proliferation and differentiation in cultured human keratinocytes: quantification of cross-linked envelope formation

    International Nuclear Information System (INIS)

    Berkers, J.A.M.; Hassing, I.; Spenkelink, B.; Brouwer, A.; Blaauboer, B.J.

    1995-01-01

    Dioxins are potent inducers of chloracne in humans. This skin aberration can be interpreted as an altered differentiation pattern of acinar sebaceous base cells and a change in the rate of terminal differentiation of the keratinocytes. We measured this rate induced by 2,3,7,8-tetrachlorodibenzo-p-dioxin (TCDD) in primary cultures of human keratinocytes. As parameters for differentiation, we quantified the 35 S-methionine incorporation into cross-linked envelopes (revealing the total CLE biomass), as well as the number of microscopically visible CLEs. It was shown that TCDD is a very potent inducer of both CLE biomass and number with a half-maximal effect concentration (EC 50 ) of 1.4 nM. CLE biomass was maximally increased 10-fold and the number of cells in culture producing a CLE was increased from 15% in control cultures to maximally 75% of the cells in TCDD-treated cultures. Both effects were Ca 2+ -dependent and increased with elevated cell density, being optimal in post-confluent cultures. Retinoic acid dose-dependently decreased the effect of 10 -8 M TCDD, 10 -6 M having a nearly complete antagonistic action. This interaction of retinoic acid with TCDD-induced differentiation was non-competitive. Retinol was equally potent as an antagonist of the TCDD-induced elevation of CLE formation as compared with retinoic acid. Retinyl palmitate and etretinate were not very effective as TCDD antagonists. Supplementation of hydrocortisone suppressed the TCDD-induced keratinocyte differentiation. It was concluded that CLE biomass quantification provides a reliable and sensitive parameter for keratinocyte differentiation. In this in vitro system it is shown that TCDD strongly induces a switch from proliferation to terminal differentiation and that this effect can be antagonized effectively by retinoic acid and retinol. (orig.)

  9. The epithelial-mesenchymal transition induced by keratinocyte growth conditions is overcome by E6 and E7 from HPV16, but not HPV8 and HPV38: Characterization of global transcription profiles

    International Nuclear Information System (INIS)

    Azzimonti, Barbara; Dell'Oste, Valentina; Borgogna, Cinzia; Mondini, Michele; Gugliesi, Francesca; De Andrea, Marco; Chiorino, Giovanna; Scatolini, Maria; Ghimenti, Chiara; Landolfo, Santo; Gariglio, Marisa

    2009-01-01

    The aim of this study was to evaluate the growth properties of primary human keratinocytes expressing E6 and E7 proteins, which are from either the β- or α-genotypes, under different culture conditions. We demonstrated that keratinocytes expressing E6 and E7, from both HPV8 and 38, irreversibly underwent the epithelial-mesenchymal transition (EMT) when grown on plastic with FAD medium (F12/DMEM/5%FBS). Expression of E6/E7 from HPV16 was capable of fully overcoming the FAD-induced EMT. Immortalization was only observed in HPV16-transduced cell lines, while the more proliferating phenotype of both KerHPV8 and 38 was mainly related to FAD-induced EMT. Microarray analysis of exponentially growing cells identified 146 cellular genes that were differentially regulated in HPV16 compared to HPV8- and 38-transduced cells. A large accumulation of transcripts associated with epidermal development and differentiation was observed in HPV16-transduced cells, whereas transcripts of genes involved in the extracellular matrix, multicellular organismal processes, and inflammatory response were affected in HPV8 and 38-transduced cells.

  10. Selective response of human airway epithelia to luminal but not serosal solution hypertonicity. Possible role for proximal airway epithelia as an osmolality transducer

    DEFF Research Database (Denmark)

    Willumsen, Niels J.; Davis, C.W.; Boucher, R.C.

    1994-01-01

    exposure (10 min) to 430 mosM luminal solution elicited no regulation of any parameter. Optical measurements revealed a reduction in the thickness of preparations only in response to luminal hypertonic solutions. We conclude that (a) airway epithelial cells exhibit asymmetric water transport properties......- secretion; and (d) cell volume loss increases the resistance of the paracellular path. We speculate that these properties configure human nasal epithelium to behave as an osmotic sensor, transducing information about luminal solutions to the airway wall....

  11. Coordination of different ligands to copper(II) and cobalt(III) metal centers enhances Zika virus and dengue virus loads in both arthropod cells and human keratinocytes.

    Science.gov (United States)

    Dutta, Shovan; Celestine, Michael J; Khanal, Supreet; Huddleston, Alexis; Simms, Colin; Arca, Jessa Faye; Mitra, Amlan; Heller, Loree; Kraj, Piotr J; Ledizet, Michel; Anderson, John F; Neelakanta, Girish; Holder, Alvin A; Sultana, Hameeda

    2018-01-01

    Trace elements such as copper and cobalt have been associated with virus-host interactions. However, studies to show the effect of conjugation of copper(II) or cobalt(III) metal centers to thiosemicarbazone ligand(s) derived from either food additives or mosquito repellent such as 2-acetylethiazole or citral, respectively, on Zika virus (ZIKV) or dengue virus (serotype 2; DENV2) infections have not been explored. In this study, we show that four compounds comprising of thiosemicarbazone ligand derived from 2-acetylethiazole viz., (E)-N-ethyl-2-[1-(thiazol-2-yl)ethylidene]hydrazinecarbothioamide (acetylethTSC) (compound 1), a copper(II) complex with acetylethTSC as a ligand (compound 2), a thiosemicarbazone ligand-derived from citral (compound 3) and a cobalt(III) complex with a citral-thiosemicarbazone ligand (compound 4) increased DENV2 and ZIKV replication in both mosquito C6/36 cells and human keratinocytes (HaCaT cells). Treatment of both cell lines with compounds 2 or 4 showed increased dengue viral titers at all three tested doses. Enhanced dengue viral plaque formation was also noted at the tested dose of 100μM, suggesting higher production of infectious viral particles. Treatment with the compounds 2 or 4 enhanced ZIKV and DENV2 RNA levels in HeLa cell line and primary cultures of mouse bone marrow derived dendritic cells. Also, pre- or post treatments with conjugated compounds 2 or 4 showed higher loads of ZIKV or DENV2 envelope (E) protein in HaCaT cells. No changes in loads of E-protein were found in ZIKV-infected C6/36 cells, when compounds were treated after infection. In addition, we tested bis(1,10-phenanthroline)copper(II) chloride ([Cu(phen) 2 ]Cl 2 , (compound 5) and tris(1,10-phenanthroline)cobalt(III) chloride ([Co(phen) 3 ]Cl 3 , (compound 6) that also showed enhanced DENV2 loads. Also, we found that copper(II) chloride dehydrate (CuCl 2 ·2H 2 O) or cobalt(II) chloride hexahydrate (CoCl 2 ·6H 2 O) alone had no effects as "free" cations

  12. Inhibition of Genotoxic Effects of UVC Radiation on Human Keratinocyte HaCaT Cells by Echinacea Purpurea (L.) Moench Herbal Extract

    International Nuclear Information System (INIS)

    Kosalec, I.; Segvic Klaric, M.; Kopjar, N.; Milic, M.

    2013-01-01

    Exposure of skin to ultraviolet (UV) radiation might provoke acute and chronic inflammation and oxidative stress which might cause DNA damage leading to skin photoaging and photocarcinogenesis. Previously we showed that Echinacea purpurea (L.) Moench (EH) extract, rich in phenolic acids, has protective effect on human blood lymphocytes exposed to UVC radiation. In this study we checked whether the pre-treatment of human keratinocyte HaCaT cells with lyophilisate of EH (1 and 10 mg/mL) could reduce or prevent primary DNA damage induced by UVC radiation (253.7 nm) in laboratory conditions. Prior to that experiment we examined cell viability using MTT test upon exposure to EH and UVC (30 and 60 min) alone and in combination. Primary DNA damage in HaCaT cells was studied using the alkaline comet assay. Exposure of cells to EH and UVC alone or EH in combination with UV radiation did not reduce cell viability. Opposite to that UV radiation (30 and 60 min) caused a significant increase in the level of primary DNA damage (P < 0.001). Pre-treatment of cells with both concentrations of EH was not genotoxic to HaCaT cells. Only concentration of 1 mg/mL EH successfully protected the cells against the effects of 30 min exposure to UVC radiation. Positive results obtained in this study speak in favour of continuing the research on effectiveness of Echinacea purpurea preparations and their potential application in developing cosmetic products for skin protection.(author)

  13. Arsenic transformation predisposes human skin keratinocytes to UV-induced DNA damage yet enhances their survival apparently by diminishing oxidant response

    International Nuclear Information System (INIS)

    Sun Yang; Kojima, Chikara; Chignell, Colin; Mason, Ronald; Waalkes, Michael P.

    2011-01-01

    Inorganic arsenic and UV, both human skin carcinogens, may act together as skin co-carcinogens. We find human skin keratinocytes (HaCaT cells) are malignantly transformed by low-level arsenite (100 nM, 30 weeks; termed As-TM cells) and with transformation concurrently undergo full adaptation to arsenic toxicity involving reduced apoptosis and oxidative stress response to high arsenite concentrations. Oxidative DNA damage (ODD) is a possible mechanism in arsenic carcinogenesis and a hallmark of UV-induced skin cancer. In the current work, inorganic arsenite exposure (100 nM) did not induce ODD during the 30 weeks required for malignant transformation. Although acute UV-treatment (UVA, 25 J/cm 2 ) increased ODD in passage-matched control cells, once transformed by arsenic to As-TM cells, acute UV actually further increased ODD (> 50%). Despite enhanced ODD, As-TM cells were resistant to UV-induced apoptosis. The response of apoptotic factors and oxidative stress genes was strongly mitigated in As-TM cells after UV exposure including increased Bcl2/Bax ratio and reduced Caspase-3, Nrf2, and Keap1 expression. Several Nrf2-related genes (HO-1, GCLs, SOD) showed diminished responses in As-TM cells after UV exposure consistent with reduced oxidant stress response. UV-exposed As-TM cells showed increased expression of cyclin D1 (proliferation gene) and decreased p16 (tumor suppressor). UV exposure enhanced the malignant phenotype of As-TM cells. Thus, the co-carcinogenicity between UV and arsenic in skin cancer might involve adaptation to chronic arsenic exposure generally mitigating the oxidative stress response, allowing apoptotic by-pass after UV and enhanced cell survival even in the face of increased UV-induced oxidative stress and increased ODD. - Highlights: → Arsenic transformation adapted to UV-induced apoptosis. → Arsenic transformation diminished oxidant response. → Arsenic transformation enhanced UV-induced DNA damage.

  14. N-Acetylglutaminoyl-S-farnesyl-L-cysteine (SIG-1191): an anti-inflammatory molecule that increases the expression of the aquaglyceroporin, aquaporin-3, in human keratinocytes.

    Science.gov (United States)

    Fernández, José R; Webb, Corey; Rouzard, Karl; Voronkov, Michael; Huber, Kristen L; Stock, Jeffry B; Stock, Maxwell; Gordon, Joel S; Perez, Eduardo

    2017-03-01

    Isoprenylcysteine (IPC) small molecules were discovered as signal transduction modulating compounds ~25 years ago. More recently, IPC molecules have demonstrated antioxidant and anti-inflammatory properties in a variety of dermal cells as well as antimicrobial activity, representing a novel class of compounds to ameliorate skin conditions and disease. Here, we demonstrate a new IPC compound, N-acetylglutaminoyl-S-farnesyl-L-cysteine (SIG-1191), which inhibits UVB-induced inflammation blocking pro-inflammatory cytokine interleukin-6 (IL-6) and tumor necrosis factor alpha (TNF-α) production. To investigate further the previously reported hydrating potential of IPC compounds, SIG-1191 was tested for its ability to modulate aquaporin expression. Specifically, aquaporin 3 (AQP3) the most abundant aquaporin found in skin has been reported to play a key role in skin hydration, elasticity and barrier repair. Results show here for the first time that SIG-1191 increases AQP3 expression in both cultured normal human epidermal keratinocytes as well as when applied topically in a three-dimensional (3D) reconstructed human skin equivalent. Additionally, SIG-1191 dose dependently increased AQP3 protein levels, as determined by specific antibody staining, in the epidermis of the 3D skin equivalents. To begin to elucidate which signaling pathways SIG-1191 may be modulating to increase AQP3 levels, we used several pharmacological pathway inhibitors and determined that AQP3 expression is mediated by the Mitogen-activated protein kinase/Extracellular signal-regulated kinase kinase (MEK) pathway. Altogether, these data suggest SIG-1191 represents a new IPC derivative with anti-inflammatory activity that may also promote increased skin hydration based on its ability to increase AQP3 levels.

  15. Regression of established renal cell carcinoma in nude mice using lentivirus-transduced human T cells expressing a human anti-CAIX chimeric antigen receptor

    Directory of Open Access Journals (Sweden)

    Agnes Shuk-Yee Lo

    2014-01-01

    Full Text Available Carbonic anhydrase IX (CAIX is a tumor-associated antigen and marker of hypoxia that is overexpressed on > 90% of clear-cell type renal cell carcinoma (RCC but not on neighboring normal kidney tissue. Here, we report on the construction of two chimeric antigen receptors (CARs that utilize a carbonic anhydrase (CA domain mapped, human single chain antibody (scFv G36 as a targeting moiety but differ in their capacity to provide costimulatory signaling for optimal T cell proliferation and tumor cell killing. The resulting anti-CAIX CARs were expressed on human primary T cells via lentivirus transduction. CAR-transduced T cells (CART cells expressing second-generation G36-CD28-TCRζ exhibited more potent in vitro antitumor effects on CAIX+ RCC cells than first-generation G36-CD8-TCRζ including cytotoxicity, cytokine secretion, proliferation, and clonal expansion. Adoptive G36-CD28-TCRζ CART cell therapy combined with high-dose interleukin (IL-2 injection also lead to superior regression of established RCC in nude mice with evidence of tumor cell apoptosis and tissue necrosis. These results suggest that the fully human G36-CD28-TCRζ CARs should provide substantial improvements over first-generation mouse anti-CAIX CARs in clinical use through reduced human anti-mouse antibody responses against the targeting scFv and administration of lower doses of T cells during CART cell therapy of CAIX+ RCC.

  16. Suppression of Innate Immune Response by Primary Human Keratinocytes Expressing HPV-16 E6 and E7

    National Research Council Canada - National Science Library

    Guess, Jennifer L

    2005-01-01

    Human papillomavims (HPV) types infect the skin and mucosal epithelium. Lesions resulting from HPV infection can linger for months or years suggesting that HPV - presence goes unnoticed by the host immune system...

  17. Xenobiotic metabolism capacities of human skin in comparison with a 3D-epidermis model and keratinocyte-based cell culture as in vitro alternatives for chemical testing: phase II enzymes.

    Science.gov (United States)

    Götz, Christine; Pfeiffer, Roland; Tigges, Julia; Ruwiedel, Karsten; Hübenthal, Ulrike; Merk, Hans F; Krutmann, Jean; Edwards, Robert J; Abel, Josef; Pease, Camilla; Goebel, Carsten; Hewitt, Nicola; Fritsche, Ellen

    2012-05-01

    The 7th Amendment to the EU Cosmetics Directive prohibits the use of animals in cosmetic testing for certain endpoints, such as genotoxicity. Therefore, skin in vitro models have to replace chemical testing in vivo. However, the metabolic competence neither of human skin nor of alternative in vitro models has so far been fully characterized, although skin is the first-pass organ for accidentally or purposely (cosmetics and pharmaceuticals) applied chemicals. Thus, there is an urgent need to understand the xenobiotic-metabolizing capacities of human skin and to compare these activities to models developed to replace animal testing. We have measured the activity of the phase II enzymes glutathione S-transferase, UDP-glucuronosyltransferase and N-acetyltransferase in ex vivo human skin, the 3D epidermal model EpiDerm 200 (EPI-200), immortalized keratinocyte-based cell lines (HaCaT and NCTC 2544) and primary normal human epidermal keratinocytes. We show that all three phase II enzymes are present and highly active in skin as compared to phase I. Human skin, therefore, represents a more detoxifying than activating organ. This work systematically compares the activities of three important phase II enzymes in four different in vitro models directly to human skin. We conclude from our studies that 3D epidermal models, like the EPI-200 employed here, are superior over monolayer cultures in mimicking human skin xenobiotic metabolism and thus better suited for dermatotoxicity testing. © 2012 John Wiley & Sons A/S.

  18. Ultraviolet radiation (UVR) induces cell-surface Ro/SSA antigen expression by human keratinocytes in vitro: a possible mechanism for the UVR induction of cutaneous lupus lesions

    International Nuclear Information System (INIS)

    Jones, S.K.

    1992-01-01

    Antinuclear antibodies are useful markers of connective tissue disease. In this study, UVB but not UVA induced the expression of Ro/SSA antigen on keratinocyte surfaces in vitro. This expression was also found with the extractable nuclear antigens RnP and Sm, but not with single or double-stranded DNA. The expression was prevented by blocking protein synthesis, suggesting that it was an active process. The results suggest that UVB exposure may result in the expression of Ro/SSA antigen on the surfaces of basal keratinocytes in vivo. This antigen could then bind circulating antibody leading to the cutaneous lesions in neonatal and subacute cutaneous lupus erythematosus. (Author)

  19. Shining a Light on Black Holes in Keratinocytes.

    Science.gov (United States)

    Bowman, Shanna L; Marks, Michael S

    2018-03-01

    The mechanisms by which melanins are transferred from melanocytes and stored within keratinocytes to generate skin pigmentation are hotly debated. Correia et al. and Hurbain et al. provide evidence that melanin cores of melanosomes are secreted from melanocytes and taken up and stored within non-degradative membranous organelles in keratinocytes in the basal epidermis of human skin. Copyright © 2017 The Authors. Published by Elsevier Inc. All rights reserved.

  20. Transducer-Mounting Fixture

    Science.gov (United States)

    Spiegel, Kirk W.

    1990-01-01

    Transducer-mounting fixture holds transducer securely against stud. Projects only slightly beyond stud after installation. Flanged transducer fits into fixture when hinged halves open. When halves reclosed, fixture tightened onto threaded stud until stud makes contact with transducer. Knurled area on fixture aids in tightening fixture on stud.

  1. Establishment of a humanized APL model via the transplantation of PML-RARA-transduced human common myeloid progenitors into immunodeficient mice.

    Directory of Open Access Journals (Sweden)

    Hiromichi Matsushita

    Full Text Available Recent advances in cancer biology have revealed that many malignancies possess a hierarchal system, and leukemic stem cells (LSC or leukemia-initiating cells (LIC appear to be obligatory for disease progression. Acute promyelocytic leukemia (APL, a subtype of acute myeloid leukemia characterized by the formation of a PML-RARα fusion protein, leads to the accumulation of abnormal promyelocytes. In order to understand the precise mechanisms involved in human APL leukemogenesis, we established a humanized in vivo APL model involving retroviral transduction of PML-RARA into CD34(+ hematopoietic cells from human cord blood and transplantation of these cells into immunodeficient mice. The leukemia well recapitulated human APL, consisting of leukemic cells with abundant azurophilic abnormal granules in the cytoplasm, which expressed CD13, CD33 and CD117, but not HLA-DR and CD34, were clustered in the same category as human APL samples in the gene expression analysis, and demonstrated sensitivity to ATRA. As seen in human APL, the induced APL cells showed a low transplantation efficiency in the secondary recipients, which was also exhibited in the transplantations that were carried out using the sorted CD34- fraction. In order to analyze the mechanisms underlying APL initiation and development, fractionated human cord blood was transduced with PML-RARA. Common myeloid progenitors (CMP from CD34(+/CD38(+ cells developed APL. These findings demonstrate that CMP are a target fraction for PML-RARA in APL, whereas the resultant CD34(- APL cells may share the ability to maintain the tumor.

  2. Filaggrin silencing by shRNA directly impairs the skin barrier function of normal human epidermal keratinocytes and then induces an immune response

    Energy Technology Data Exchange (ETDEWEB)

    Dang, N.N. [Department of Dermatology, Jinan Central Hospital Affiliated to Shandong University, Jinan, Shandong Province (China); College of Life Science, Shandong Normal University, Jinan, Shandong Province (China); Pang, S.G. [Department of Endocrinology, Jinan Central Hospital Affiliated to Shandong University, Jinan, Shandong Province (China); Song, H.Y. [Department of Dermatology, Jinan Central Hospital Affiliated to Shandong University, Jinan, Shandong Province (China); An, L.G. [College of Life Science, Shandong Normal University, Jinan, Shandong Province (China); Ma, X.L. [Central Laboratory, Jinan Central Hospital Affiliated to Shandong University, Jinan, Shandong Province (China)

    2014-11-14

    The objective of this study was to investigate whether a single defect in skin barrier function simulated by filaggrin silencing could induce Th2-predominant inflammation. Filaggrin gene expression was silenced in cultured normal human epidermal keratinocytes (NHEKs) using small hairpin RNA (shRNA, GTTGGCTCAAGCATATTATTT). The efficacy of silencing was confirmed by polymerase chain reaction (PCR) and Western blotting. Filaggrin-silenced cells (LV group), shRNA control cells (NC group), and noninfected cells (Blank group) were evaluated. The expression of cornified cell envelope-related proteins, including cytokeratin (CK)-5, -10, -14, loricrin, involucrin, and transglutaminase (TGM)-1, was detected by Western blotting. Interleukins (IL)-2, IL-4, IL-5, IL-12p70, IL-13, and interferon-gamma (IFN-γ) were detected by enzyme-linked immunosorbent assay (ELISA). After filaggrin was successfully silenced by shRNA, the expressions of CK-5, -10, -14, involucrin, and TGM-1 in NHEKs were significantly downregulated compared to the Blank and NC groups (P<0.05 or P<0.01); only loricrin expression was markedly upregulated (P<0.01). Filaggrin silencing also resulted in significant increases of IL-2, IL-4, IL-5, and IL-13 (P<0.05 or P<0.01), and significant decreases of IL-12p70 and IFN-γ (P<0.01) compared with cells in the Blank and NC groups. Filaggrin silencing impaired normal skin barrier function mainly by targeting the cornified cell envelope. The immune response after filaggrin silencing was characterized by Th2 cells, mainly because of the inhibition of IFN-γ expression. Lack of filaggrin may directly impair skin barrier function and then further induce the immune response.

  3. Toxicity of jet fuel aliphatic and aromatic hydrocarbon mixtures on human epidermal Keratinocytes: evaluation based on in vitro cytotoxicity and interleukin-8 release

    Energy Technology Data Exchange (ETDEWEB)

    Yang, Jen-Hung (Chung-Shan Medical University Hospital, Department of Dermatology, Taichung, Taiwan, R.O.C); Lee, Chia-Hue; Tsang, Chau-Loong [National Chung-Hsing University, College of Veterinary Medicine, Taichung (Taiwan); Monteiro-Riviere, Nancy A.; Riviere, Jim E. [North Carolina State University, Center for Chemical Toxicology Research and Pharmacokinetics (CCTRP), Raleigh, NC (United States); Chou, Chi-Chung [National Chung-Hsing University, College of Veterinary Medicine, Taichung (Taiwan); National Chung-Hsing University, College of Veterinary Medicine, Taichung (Taiwan)

    2006-08-15

    Jet fuels are complex mixtures of aliphatic (ALI) and aromatic (ARO) hydrocarbons that vary significantly in individual cytotoxicity and proinflammatory activity in human epidermal keratinocytes (HEK). In order to delineate the toxicological interactions among individual hydrocarbons in a mixture and their contributions to cutaneous toxicity, nine ALI and five ARO hydrocarbons were each divided into five (high/medium/low cytotoxic and strong/weak IL-8 induction) groups and intra/inter-mixed to assess for their mixture effects on HEK mortality and IL-8 release. Addition of single hydrocarbon to JP-8 fuel was also evaluated for their changes in fuel dermatotoxicity. The results indicated that when hydrocarbons were mixed, HEK mortality and IL-8 release were not all predictable by their individual ability affecting these two parameters. The lowest HEK mortality (7%) and the highest IL-8 production were induced with mixtures including high cytotoxic and weak IL-8 inductive ARO hydrocarbons. Antagonistic reactions not consistently correlated with ALI carbon chain length and ARO structure were evident and carried different weight in the overall mixture toxicities. Single addition of benzene, toluene, xylene or ethylbenzene for up to tenfold in JP-8 did not increase HEK mortality while single addition of ALI hydrocarbons exhibited dose-related differential response in IL-8. In an all ALI environment, no single hydrocarbon is the dominating factor in the determination of HEK cytotoxicity while deletion of hexadecane resulted in a 2.5-fold increase in IL-8 production. Overall, decane, undecane and dodecane were the major hydrocarbons associated with high cytotoxicity while tetradecane, pentadecane and hexadecane were those which had the greatest buffering effect attenuating dermatotoxicity. The mixture effects must be considered when evaluating jet fuel toxicity to HEK. (orig.)

  4. Direct biological effects of fractional ultrapulsed CO2 laser irradiation on keratinocytes and fibroblasts in human organotypic full-thickness 3D skin models.

    Science.gov (United States)

    Schmitt, L; Huth, S; Amann, P M; Marquardt, Y; Heise, R; Fietkau, K; Huth, L; Steiner, T; Hölzle, F; Baron, J M

    2018-05-01

    Molecular effects of various ablative and non-ablative laser treatments on human skin cells-especially primary effects on epidermal keratinocytes and dermal fibroblasts-are not yet fully understood. We present the first study addressing molecular effects of fractional non-sequential ultrapulsed CO 2 laser treatment using a 3D skin model that allows standardized investigations of time-dependent molecular changes ex vivo. While histological examination was performed to assess morphological changes, we utilized gene expression profiling using microarray and qRT-PCR analyses to identify molecular effects of laser treatment. Irradiated models exhibited dose-dependent morphological changes resulting in an almost complete recovery of the epidermis 5 days after irradiation. On day 5 after laser injury with a laser fluence of 100 mJ/cm 2 , gene array analysis identified an upregulation of genes associated with tissue remodeling and wound healing (e.g., COL12A1 and FGF7), genes that are involved in the immune response (e.g., CXCL12 and CCL8) as well as members of the heat shock protein family (e.g., HSPB3). On the other hand, we detected a downregulation of matrix metalloproteinases (e.g., MMP3), differentiation markers (e.g., LOR and S100A7), and the pro-inflammatory cytokine IL1α.Overall, our findings substantiate the understanding of time-dependent molecular changes after CO 2 laser treatment. The utilized 3D skin model system proved to be a reliable, accurate, and reproducible tool to explore the effects of various laser settings both on skin morphology and gene expression during wound healing.

  5. Y chromosome and vimentin used to trace the fate of allogeneic keratinocytes delivered to the wound by the recombined human/pig skin

    Czech Academy of Sciences Publication Activity Database

    Pokorná, Eva; Brož, L.; Veselý, Pavel; Matoušková, Eva

    2001-01-01

    Roč. 47, č. 4 (2001), s. 128-134 ISSN 0015-5500 R&D Projects: GA MZd IZ4368; GA MZd NK6126 Keywords : allogeneic keratinocytes * xenodermis * Y-chromosome FISH Subject RIV: EB - Genetics ; Molecular Biology Impact factor: 0.519, year: 2001

  6. Establishment of primary keratinocyte culture from horse tissue biopsates

    Directory of Open Access Journals (Sweden)

    Jernej OGOREVC

    2015-12-01

    Full Text Available Primary cell lines established from skin tissue can be used in immunological, proteomic and genomic studies as in vitro skin models. The goal of our study was to establish a primary keratinocyte cell culture from tissue biopsates of two horses. The primary keratinocyte cell culture was obtained by mechanical and enzymatic dissociation and with explant culture method. The result was a heterogeneous primary culture comprised of keratinocytes and fibroblasts. To distinguish epithelial and mesenchymal cells immunofluorescent characterisation was performed, using antibodies against cytokeratin 14 and vimentin. We successfully at attained a primary cell line of keratinocytes, which could potentially be used to study equine skin diseases, as an animal model for human diseases, and for cosmetic and therapeutic product testing.

  7. Keratinocytes at the uppermost layer of epidermis might act as sensors of atmospheric pressure change.

    Science.gov (United States)

    Denda, Mitsuhiro

    2016-01-01

    It has long been suggested that climate, especially atmospheric pressure change, can cause health problems ranging from migraine to myocardial infarction. Here, I hypothesize that the sensory system of epidermal keratinocytes mediates the influence of atmospheric pressure change on the human physiological condition. We previously demonstrated that even subtle changes of atmospheric pressure (5-20 hPa) induce elevation of intracellular calcium level in cultured human keratinocytes (excitation of keratinocytes). It is also established that communication occurs between epidermal keratinocytes and peripheral nerve systems. Moreover, various neurotransmitters and hormones that influence multiple systems (nervous, cardiovascular, endocrine, and immune systems) are generated and released from epidermal keratinocytes in response to various external stimuli. Thus, I suggest that pathophysiological phenomena induced by atmospheric pressure changes might be triggered by epidermal keratinocytes.

  8. 20-Hydroxycholecalciferol, product of vitamin D3 hydroxylation by P450scc, decreases NF-kappaB activity by increasing IkappaB alpha levels in human keratinocytes.

    Directory of Open Access Journals (Sweden)

    Zorica Janjetovic

    Full Text Available The side chain of vitamin D3 is hydroxylated in a sequential manner by cytochrome P450scc (CYP11A1 to form 20-hydroxycholecalciferol, which can induce growth arrest and differentiation of both primary and immortalized epidermal keratinocytes. Since nuclear factor-kappaB (NF-kappaB plays a pivotal role in the regulation of cell proliferation, differentiation and apoptosis, we examined the capability of 20-hydroxycholecalciferol to modulate the activity of NF-kappaB, using 1,25-dihydroxycholecalciferol (calcitriol as a positive control. 20-hydroxycholecalciferol inhibits the activation of NFkappaB DNA binding activity as well as NF-kappaB-driven reporter gene activity in keratinocytes. Also, 20-hydroxycholecalciferol induced significant increases in the mRNA and protein levels of the NF-kappaB inhibitor protein, IkappaB alpha, in a time dependent manner, while no changes in total NF-kappaB-p65 mRNA or protein levels were observed. Another measure of NF-kappaB activity, p65 translocation from the cytoplasm into the nucleus was also inhibited in extracts of 20-hydroxycholecalciferol treated keratinocytes. Increased IkappaB alpha was concomitantly observed in cytosolic extracts of 20-hydroxycholecalciferol treated keratinocytes, as determined by immunoblotting and immunofluorescent staining. In keratinocytes lacking vitamin D receptor (VDR, 20-hydroxycholecalciferol did not affect IkappaB alpha mRNA levels, indicating that it requires VDR for its action on NF-kappaB activity. Comparison of the effects of calcitrol, hormonally active form of vitamin D3, with 20-hydrocholecalciferol show that both agents have a similar potency in inhibiting NF-kappaB. Since NF-kappaB is a major transcription factor for the induction of inflammatory mediators, our findings indicate that 20-hydroxycholecalciferol may be an effective therapeutic agent for inflammatory and hyperproliferative skin diseases.

  9. Platelet-Released Growth Factors Induce Differentiation of Primary Keratinocytes

    Science.gov (United States)

    Tohidnezhad, Mersedeh; Lammel, Justus; Lippross, Sebastian; Behrendt, Peter; Klüter, Tim; Pufe, Thomas; Jahr, Holger; Cremer, Jochen; Rademacher, Franziska; Gläser, Regine; Harder, Jürgen

    2017-01-01

    Autologous thrombocyte concentrate lysates, for example, platelet-released growth factors, (PRGFs) or their clinically related formulations (e.g., Vivostat PRF®) came recently into the physicians' focus as they revealed promising effects in regenerative and reparative medicine such as the support of healing of chronic wounds. To elucidate the underlying mechanisms, we analyzed the influence of PRGF and Vivostat PRF on human keratinocyte differentiation in vitro and on epidermal differentiation status of skin wounds in vivo. Therefore, we investigated the expression of early (keratin 1 and keratin 10) and late (transglutaminase-1 and involucrin) differentiation markers. PRGF treatment of primary human keratinocytes decreased keratin 1 and keratin 10 gene expression but induced involucrin and transglutaminase-1 gene expression in an epidermal growth factor receptor- (EGFR-) dependent manner. In concordance with these results, microscopic analyses revealed that PRGF-treated human keratinocytes displayed morphological features typical of keratinocytes undergoing terminal differentiation. In vivo treatment of artificial human wounds with Vivostat PRF revealed a significant induction of involucrin and transglutaminase-1 gene expression. Together, our results indicate that PRGF and Vivostat PRF induce terminal differentiation of primary human keratinocytes. This potential mechanism may contribute to the observed beneficial effects in the treatment of hard-to-heal wounds with autologous thrombocyte concentrate lysates in vivo. PMID:28808357

  10. Platelet-Released Growth Factors Induce Differentiation of Primary Keratinocytes

    Directory of Open Access Journals (Sweden)

    Andreas Bayer

    2017-01-01

    Full Text Available Autologous thrombocyte concentrate lysates, for example, platelet-released growth factors, (PRGFs or their clinically related formulations (e.g., Vivostat PRF® came recently into the physicians’ focus as they revealed promising effects in regenerative and reparative medicine such as the support of healing of chronic wounds. To elucidate the underlying mechanisms, we analyzed the influence of PRGF and Vivostat PRF on human keratinocyte differentiation in vitro and on epidermal differentiation status of skin wounds in vivo. Therefore, we investigated the expression of early (keratin 1 and keratin 10 and late (transglutaminase-1 and involucrin differentiation markers. PRGF treatment of primary human keratinocytes decreased keratin 1 and keratin 10 gene expression but induced involucrin and transglutaminase-1 gene expression in an epidermal growth factor receptor- (EGFR- dependent manner. In concordance with these results, microscopic analyses revealed that PRGF-treated human keratinocytes displayed morphological features typical of keratinocytes undergoing terminal differentiation. In vivo treatment of artificial human wounds with Vivostat PRF revealed a significant induction of involucrin and transglutaminase-1 gene expression. Together, our results indicate that PRGF and Vivostat PRF induce terminal differentiation of primary human keratinocytes. This potential mechanism may contribute to the observed beneficial effects in the treatment of hard-to-heal wounds with autologous thrombocyte concentrate lysates in vivo.

  11. HPV16-E2 protein modifies self-renewal and differentiation rate in progenitor cells of human immortalized keratinocytes.

    Science.gov (United States)

    Domínguez-Catzín, Victoria; Reveles-Espinoza, Alicia-María; Sánchez-Ramos, Janet; Cruz-Cadena, Raúl; Lemus-Hernández, Diana; Garrido, Efraín

    2017-04-03

    Cervical cancer is the fourth cause of death worldwide by cancer in women and is a disease associated to persistent infection with human papillomavirus (HPV), particularly from two high-risk types HPV16 and 18. The virus initiates its replicative cycle infecting cells located in the basal layer of the epithelium, where a small population of epithelial stem cells is located performing important functions of renewal and maintenance of the tissue. Viral E2 gene is one of the first expressed after infection and plays relevant roles in the replicative cycle of the virus, modifying fundamental processes in the infected cells. Thus, the aim of the present study was to demonstrate the presence of hierarchic subpopulations in HaCaT cell line and evaluate the effect of HPV16-E2 expression, on their biological processes. HaCaT-HPV16-E2 cells were generated by transduction of HaCaT cell line with a lentiviral vector. The α6-integrin-CD71 expression profile was established by immunostaining and flow cytometric analysis. After sorting, cell subpopulations were analyzed in biological assays for self-renewal, clonogenicity and expression of stemness factors (RT-qPCR). We identified in HaCaT cell line three different subpopulations that correspond to early differentiated cells (α6-integrin dim ), transitory amplifying cells (α6-integrin bri /CD71 bri ) and progenitor cells (α6-integrin bri /CD71 dim ). The last subpopulation showed stem cell characteristics, such as self-renewal ability, clonogenicity and expression of the well-known stem cell factors SOX2, OCT4 and NANOG, suggesting they are stem-like cells. Interestingly, the expression of HPV16-E2 in HaCaT cells changed its α6-integrin-CD71 immunophenotype modifying the relative abundance of the cell subpopulations, reducing significantly the percentage of α6-integrin bri /CD71 dim cells. Moreover, the expression of the stem cell markers was also modified, increasing the expression of SOX2 and NANOG, but decreasing notably

  12. Coalgebraising subsequential transducers

    NARCIS (Netherlands)

    H.H. Hansen (Helle); J. Adamek; C.A. Kupke (Clemens)

    2008-01-01

    htmlabstractSubsequential transducers generalise both classic deterministic automata and Mealy/Moore type state machines by combining (input) language recognition with transduction. In this paper we show that normalisation and taking differentials of subsequential transducers and their underlying

  13. Coalgebraising Subsequential Transducers

    NARCIS (Netherlands)

    Hansen, H.H.

    2008-01-01

    Subsequential transducers generalise both classic deterministic automata and Mealy/Moore type state machines by combining (input) language recognition with transduction. In this paper we show that normalisation and taking differentials of subsequential transducers and their underlying structures can

  14. Cystathionine metabolic enzymes play a role in the inflammation resolution of human keratinocytes in response to sub-cytotoxic formaldehyde exposure

    Energy Technology Data Exchange (ETDEWEB)

    Lee, Eunyoung [College of Pharmacy, Seoul National University, Seoul 08826 (Korea, Republic of); Natural Products Research Institute, Seoul National University, Seoul 08826 (Korea, Republic of); Kim, Hyoung-June [Basic Research and Innovation Division, AmorePacific Corporation R& D Center, Yongin, Gyeounggi-do 17074 (Korea, Republic of); Lee, Moonyoung [College of Pharmacy, Seoul National University, Seoul 08826 (Korea, Republic of); Jin, Sun Hee; Hong, Soo Hyun; Ahn, Seyeon; Kim, Sae On [College of Pharmacy, Seoul National University, Seoul 08826 (Korea, Republic of); Natural Products Research Institute, Seoul National University, Seoul 08826 (Korea, Republic of); Shin, Dong Wook [Basic Research and Innovation Division, AmorePacific Corporation R& D Center, Yongin, Gyeounggi-do 17074 (Korea, Republic of); Lee, Seung-Taek [Department of Biochemistry, College of Life Science and Biotechnology, Yonsei University, Seoul 03722 (Korea, Republic of); Noh, Minsoo, E-mail: minsoonoh@snu.ac.kr [College of Pharmacy, Seoul National University, Seoul 08826 (Korea, Republic of); Natural Products Research Institute, Seoul National University, Seoul 08826 (Korea, Republic of)

    2016-11-01

    Low-level formaldehyde exposure is inevitable in industrialized countries. Although daily-life formaldehyde exposure level is practically impossible to induce cell death, most of mechanistic studies related to formaldehyde toxicity have been performed in cytotoxic concentrations enough to trigger cell death mechanism. Currently, toxicological mechanisms underlying the sub-cytotoxic exposure to formaldehyde are not clearly elucidated in skin cells. In this study, the genome-scale transcriptional analysis in normal human keratinocytes (NHKs) was performed to investigate cutaneous biological pathways associated with daily life formaldehyde exposure. We selected the 175 upregulated differentially expressed genes (DEGs) and 116 downregulated DEGs in NHKs treated with 200 μM formaldehyde. In the Gene Ontology (GO) enrichment analysis of the 175 upregulated DEGs, the endoplasmic reticulum (ER) unfolded protein response (UPR) was identified as the most significant GO biological process in the formaldeyde-treated NHKs. Interestingly, the sub-cytotoxic formaldehyde affected NHKs to upregulate two enzymes important in the cellular transsulfuration pathway, cystathionine γ-lyase (CTH) and cystathionine-β-synthase (CBS). In the temporal expression analysis, the upregulation of the pro-inflammatory DEGs such as MMP1 and PTGS2 was detected earlier than that of CTH, CBS and other ER UPR genes. The metabolites of CTH and CBS, L-cystathionine and L-cysteine, attenuated the formaldehyde-induced upregulation of pro-inflammatory DEGs, MMP1, PTGS2, and CXCL8, suggesting that CTH and CBS play a role in the negative feedback regulation of formaldehyde-induced pro-inflammatory responses in NHKs. In this regard, the sub-cytotoxic formaldehyde-induced CBS and CTH may regulate inflammation fate decision to resolution by suppressing the early pro-inflammatory response. - Highlights: • Sub-cytotoxic formaldehyde upregulates ER UPR-associated genes in NHKs. • Formaldehyde-induced ER UPR

  15. Driving electrostatic transducers

    DEFF Research Database (Denmark)

    Nielsen, Dennis; Knott, Arnold; Andersen, Michael A. E.

    2013-01-01

    Electrostatic transducers represent a very interesting alternative to the traditional inefficient electrodynamic transducers. In order to establish the full potential of these transducers, power amplifiers which fulfill the strict requirements imposed by such loads (high impedance, frequency...... depended, nonlinear and high bias voltage for linearization) must be developed. This paper analyzes power stages and bias configurations suitable for driving an electrostatic transducer. Measurement results of a 300 V prototype amplifier are shown. Measuring THD across a high impedance source is discussed...

  16. Antioxidant Opuntia ficus-indica Extract Activates AHR-NRF2 Signaling and Upregulates Filaggrin and Loricrin Expression in Human Keratinocytes.

    Science.gov (United States)

    Nakahara, Takeshi; Mitoma, Chikage; Hashimoto-Hachiya, Akiko; Takahara, Masakazu; Tsuji, Gaku; Uchi, Hiroshi; Yan, Xianghong; Hachisuka, Junichi; Chiba, Takahito; Esaki, Hitokazu; Kido-Nakahara, Makiko; Furue, Masutaka

    2015-10-01

    Opuntia ficus-indica (OFI) is a cactus species widely used as an anti-inflammatory, antilipidemic, and hypoglycemic agent. It has been shown that OFI extract (OFIE) inhibits oxidative stress in animal models of diabetes and hepatic disease; however, its antioxidant mechanism remains largely unknown. In this study, we demonstrated that OFIE exhibited potent antioxidant activity through the activation of nuclear factor erythroid 2-related factor 2 (NRF2) and the downstream antioxidant enzyme quinone oxidoreductase 1 (NQO1), which inhibited the generation of reactive oxygen species in keratinocytes challenged with tumor necrosis factor α or benzo[α]pyrene. The antioxidant capacity of OFIE was canceled in NRF2 knockdown keratinocytes. OFIE exerted this NRF2-NQO1 upregulation through activation of the aryl hydrocarbon receptor (AHR). Moreover, the ligation of AHR by OFIE upregulated the expression of epidermal barrier proteins: filaggrin and loricrin. OFIE also prevented TH2 cytokine-mediated downregulation of filaggrin and loricrin expression in an AHR-dependent manner because it was canceled in AHR knockdown keratinocytes. Antioxidant OFIE is a potent activator of AHR-NRF2-NQO1 signaling and may be beneficial in treating barrier-disrupted skin disorders.

  17. Effect of Wnt3a on Keratinocytes Utilizing in Vitro and Bioinformatics Analysis

    Directory of Open Access Journals (Sweden)

    Ju-Suk Nam

    2014-03-01

    Full Text Available Wingless-type (Wnt signaling proteins participate in various cell developmental processes. A suppressive role of Wnt5a on keratinocyte growth has already been observed. However, the role of other Wnt proteins in proliferation and differentiation of keratinocytes remains unknown. Here, we investigated the effects of the Wnt ligand, Wnt3a, on proliferation and differentiation of keratinocytes. Keratinocytes from normal human skin were cultured and treated with recombinant Wnt3a alone or in combination with the inflammatory cytokine, tumor necrosis factor α (TNFα. Furthermore, using bioinformatics, we analyzed the biochemical parameters, molecular evolution, and protein–protein interaction network for the Wnt family. Application of recombinant Wnt3a showed an anti-proliferative effect on keratinocytes in a dose-dependent manner. After treatment with TNFα, Wnt3a still demonstrated an anti-proliferative effect on human keratinocytes. Exogenous treatment of Wnt3a was unable to alter mRNA expression of differentiation markers of keratinocytes, whereas an altered expression was observed in TNFα-stimulated keratinocytes. In silico phylogenetic, biochemical, and protein–protein interaction analysis showed several close relationships among the family members of the Wnt family. Moreover, a close phylogenetic and biochemical similarity was observed between Wnt3a and Wnt5a. Finally, we proposed a hypothetical mechanism to illustrate how the Wnt3a protein may inhibit the process of proliferation in keratinocytes, which would be useful for future researchers.

  18. Transducer handbook user's directory of electrical transducers

    CERN Document Server

    Boyle, H B

    2013-01-01

    When selecting or using a particular type of transducer or sensor, there are a number of factors which must be considered. The question is not only for what kind of measurement, but under what physical conditions, constraints of accuracy, and to meet which service requirements, is a transducer needed? This handbook is designed to meet the selection needs of anyone specifying or using transducers with an electrical output. Each transducer is described in an easy-to-use tabular format, giving all of the necessary data including operating principles, applications, range limits, errors, over-range protection, supply voltage requirements, sensitivities, cross sensitivities, temperature ranges and sensitivities and signal conditioning needs. The author has added notes that reflect his broad practical experience. Added to this is an extensive worldwide suppliers directory.

  19. Transduction of the E6 and E7 genes of epidermodysplasia-verruciformis-associated human papillomaviruses alters human keratinocyte growth and differentiation in organotypic cultures

    NARCIS (Netherlands)

    Boxman, I. L.; Mulder, L. H.; Noya, F.; de Waard, V.; Gibbs, S.; Broker, T. R.; ten Kate, F.; Chow, L. T.; ter Schegget, J.

    2001-01-01

    Epidermodysplasia-verruciformis-associated human papilloma virus DNA has been detected in skin cancers, in premalignant and benign skin lesions, and in plucked hairs from immunocompetent and immunosuppressed patients. The role of epidermodysplasia-verruciformis-associated human papilloma virus in

  20. Psidium guajava extract inhibits thymus and activation-regulated chemokine (TARC/CCL17) production in human keratinocytes by inducing heme oxygenase-1 and blocking NF-κB and STAT1 activation.

    Science.gov (United States)

    Han, Eun Hee; Hwang, Yong Pil; Choi, Jae Ho; Yang, Ji Hye; Seo, Jong Kwon; Chung, Young Chul; Jeong, Hye Gwang

    2011-09-01

    Psidium guajava (P. guajava) is a food and medicinal plant with antioxidant, anti-inflammatory, and anti-allergic activities that support its traditional uses. The aim of this study was to determine the effects of P. guajava ethyl acetate extract (PGEA) on atopic dermatitis and to investigate the possible mechanisms by which PGEA inhibits cytokine-induced Th2 chemokine expression in HaCaT human keratinocyte cells. We found that PGEA suppressed the IFN-γ/TNF-α-co-induced production of thymus and activation-regulated chemokine (TARC) protein and mRNA in HaCaT cells. Additionally, PGEA inhibited the TNF-α/IFN-γ-co-induced activation of NF-κB and STAT1 and increased the expression of heme oxygenase-1 (HO-1) protein and mRNA. HO-1 inhibitor enhanced the suppressive effects of PGEA on TNF-α/IFN-γ-co-induced TARC production and gene expression. Collectively, these data demonstrate that PGEA inhibits chemokine expression in keratinocytes by inducing HO-1 expression and it suggests a possible therapeutic application in atopic dermatitis and other inflammatory skin diseases. Copyright © 2011 Elsevier B.V. All rights reserved.

  1. Handbook of force transducers

    CERN Document Server

    Stefanescu, Dan Mihai

    2011-01-01

    Part I introduces the basic ""Principles and Methods of Force Measurement"" acording to a classification into a dozen of force transducers types: resistive, inductive, capacitive, piezoelectric, electromagnetic, electrodynamic, magnetoelastic, galvanomagnetic (Hall-effect), vibrating wires, (micro)resonators, acoustic and gyroscopic. Two special chapters refer to force balance techniques and to combined methods in force measurement. Part II discusses the ""(Strain Gauge) Force Transducers Components"", evolving from the classical force transducer to the digital / intelligent one, with the inco

  2. Chemosensory Information Processing between Keratinocytes and Trigeminal Neurons

    Science.gov (United States)

    Sondersorg, Anna Christina; Busse, Daniela; Kyereme, Jessica; Rothermel, Markus; Neufang, Gitta; Gisselmann, Günter; Hatt, Hanns; Conrad, Heike

    2014-01-01

    Trigeminal fibers terminate within the facial mucosa and skin and transmit tactile, proprioceptive, chemical, and nociceptive sensations. Trigeminal sensations can arise from the direct stimulation of intraepithelial free nerve endings or indirectly through information transmission from adjacent cells at the peripheral innervation area. For mechanical and thermal cues, communication processes between skin cells and somatosensory neurons have already been suggested. High concentrations of most odors typically provoke trigeminal sensations in vivo but surprisingly fail to activate trigeminal neuron monocultures. This fact favors the hypothesis that epithelial cells may participate in chemodetection and subsequently transmit signals to neighboring trigeminal fibers. Keratinocytes, the major cell type of the epidermis, express various receptors that enable reactions to multiple environmental stimuli. Here, using a co-culture approach, we show for the first time that exposure to the odorant chemicals induces a chemical communication between human HaCaT keratinocytes and mouse trigeminal neurons. Moreover, a supernatant analysis of stimulated keratinocytes and subsequent blocking experiments with pyrodoxalphosphate-6-azophenyl-2′,4′-disulfonate revealed that ATP serves as the mediating transmitter molecule released from skin cells after odor stimulation. We show that the ATP release resulting from Javanol® stimulation of keratinocytes was mediated by pannexins. Consequently, keratinocytes act as chemosensors linking the environment and the trigeminal system via ATP signaling. PMID:24790106

  3. Programming macro tree transducers

    DEFF Research Database (Denmark)

    Bahr, Patrick; Day, Laurence E.

    2013-01-01

    transducers can be concisely represented in Haskell, and demonstrate the benefits of utilising such an approach with a number of examples. In particular, tree transducers afford a modular programming style as they can be easily composed and manipulated. Our Haskell representation generalises the original...

  4. Crossflow force transducer

    International Nuclear Information System (INIS)

    Mulcahy, T.M.

    1982-05-01

    A force transducer for measuring lift and drag coefficients for a circular cylinder in turbulent water flow is presented. In addition to describing the actual design and construction of the strain-gauged force- ring based transducer, requirements for obtained valid fluid force test data are discussed, and pertinent flow test experience is related

  5. SNOM and AFM microscopy techniques to study the effect of non-ionizing radiation on the morphological and biochemical properties of human keratinocytes cell line (HaCaT).

    Science.gov (United States)

    Rieti, S; Manni, V; Lisi, A; Giuliani, L; Sacco, D; D'Emilia, E; Cricenti, A; Generosi, R; Luce, M; Grimaldi, S

    2004-01-01

    In this study we have employed atomic force microscopy (AFM) and scanning near-field optical microscopy (SNOM) techniques to study the effect of the interaction between human keratinocytes (HaCaT) and electromagnetic fields at low frequency. HaCaT cells were exposed to a sinusoidal magnetic field at a density of 50 Hz, 1 mT. AFM analysis revealed modification in shape and morphology in exposed cells with an increase in the areas of adhesion between cells. This latter finding was confirmed by SNOM indirect immunofluorescence analysis performed with a fluorescent antibody against the adhesion marker beta4 integrin, which revealed an increase of beta4 integrin segregation in the cell membrane of 50-Hz exposed cells, suggesting that a higher percentage of these cells shows a modified pattern of this adhesion marker.

  6. In vivo effects of myeloablative alkylator therapy on survival and differentiation of MGMTP140K-transduced human G-CSF-mobilized peripheral blood cells.

    Science.gov (United States)

    Cai, Shanbao; Hartwell, Jennifer R; Cooper, Ryan J; Juliar, Beth E; Kreklau, Emi; Abonour, Rafat; Goebel, W Scott; Pollok, Karen E

    2006-05-01

    High-intensity alkylator-based chemotherapy is required to eradicate tumors expressing high levels of O6-methylguanine DNA methyltransferase (MGMT). This treatment, however, can lead to life-threatening myelosuppression. We investigated a gene therapy strategy to protect human granulocyte colony-stimulating factor-mobilized peripheral blood CD34+ cells (MPB) from a high-intensity alkylator-based regimen. We transduced MPB with an oncoretroviral vector that coexpresses MGMT(P140K) and the enhanced green fluorescent protein (EGFP) (n = 5 donors). At 4 weeks posttransplantation into nonobese diabetic/severe combined immunodeficient (NOD/SCID) mice, cohorts were not treated or were treated with low- or high-intensity alkylating chemotherapy. In the high-intensity-treated cohort, it was necessary to infuse NOD/SCID bone marrow (BM) to alleviate hematopoietic toxicity. At 8 weeks posttreatment, human CD45+ cells in the BM of mice treated with either regimen were EGFP+ and contained MGMT-specific DNA repair activity. In cohorts receiving low-intensity therapy, both primitive and mature hematopoietic cells were present in the BM. Although B-lymphoid and myeloid cells were resistant to in vivo drug treatment in cohorts that received high-intensity therapy, no human CD34+ cells or B-cell precursors were detected. These data suggest that improved strategies to optimize repair of DNA damage in primitive human hematopoietic cells are needed when using high-intensity anti-cancer therapy.

  7. Modeling of ultrasound transducers

    DEFF Research Database (Denmark)

    Bæk, David

    This Ph.D. dissertation addresses ultrasound transducer modeling for medical ultrasound imaging and combines the modeling with the ultrasound simulation program Field II. The project firstly presents two new models for spatial impulse responses (SIR)s to a rectangular elevation focused transducer...... (REFT) and to a convex rectangular elevation focused transducer (CREFT). These models are solvable on an analog time scale and give exact smooth solutions to the Rayleigh integral. The REFT model exhibits a root mean square (RMS) error relative to Field II predictions of 0.41 % at 3400 MHz, and 1.......37 % at 100MHz. The CREFT model exhibits a RMS deviation of 0.01 % relative to the exact numerical solution on a CREFT transducer. A convex non-elevation focused, a REFT, and a linear flat transducer are shown to be covered with the CREFT model as well. Pressure pulses calculated with a one...

  8. Prevention of burn wound conversion by allogeneic keratinocytes cultured on acellular xenodermis

    Czech Academy of Sciences Publication Activity Database

    Matoušková, Eva; Brož, L.; Pokorná, Eva; Königová, R.

    2002-01-01

    Roč. 3, č. 1 (2002), s. 29-35 ISSN 1389-9333 Institutional research plan: CEZ:AV0Z5052915 Keywords : human keratinocytes * tissue engineered skin * dried porcine dermis Subject RIV: EB - Genetics ; Molecular Biology

  9. Smart transducer with radiomodem

    Science.gov (United States)

    Pugach, V. N.; Voronin, E. L.

    2018-04-01

    Systems for measuring different parameters enabling metering and wireless data transmission are an urgent problem in the industry. One of the most promising solutions is the developments of metering instruments enabling radio-link and GSM data transmission. The article describes a transducer operating with temperature sensors of different types as well as with the sensors of other physical values with the output signal represented as current or voltage with subsequent measurement data transmission from the transducer to the computer via radio-link. The article provides transducer measurement accuracy check. The work confirmed the claimed temperature measurement accuracy, noted a stable data transmission via radio link and convenience of work with the transducer and software.

  10. [Cultivated keratinocytes on micro-carriers: in vitro studies of a new carrier system].

    Science.gov (United States)

    Hecht, J; Hoefter, E A; Hecht, J; Haraida, S; Nerlich, A; Hartinger, A; Mühlbauer, W; Dimoudis, N

    1997-03-01

    Epidermal grafts from confluently cultivated keratinocytes have been used since the early eighties for the treatment of severe burns, where the shortage of donor sites for split-thickness skin grafts did not allow for adequate wound coverage. The difficult handling of these grafts as well as the advanced differentiation of their epithelial cells into a multilayer sheet poses a problem for their clinical application. The aim of the study was to characterize cultivated keratinocytes, as well as to observe their migration and proliferation from the MC onto a surface. Keratinocytes were isolated from human foreskin and cultivated in serum-free and serum-containing medium according to a modified method by Rheinwald and Green. Collagen-coated Dextran beads were used as MC. The MC were colonized with keratinocytes using the Spinner culture technique. After seeding the colonized MC into culture flasks, their migration and proliferation was monitored regularly through immunohistochemical studies and measurement of the metabolic cell activity. Immunohistological staining proved that the cells isolated from human foreskin represent keratinocytes of the basal type. Keratinocytes, cultivated with serum-containing and serum free medium, both adhered to the surface of the MC, then migrated onto the surface of the flasks and proliferated to form a multilayer of epithelial cells. In the long-term, a flexible epithelial graft consisting of poorly differentiated keratinocytes should be available, which is simple to produce and easy to handle. This would be an alternative method for treating wounds, where the conventional multilayer epithelial graft (ET) is insufficient.

  11. Differentiation of human keratinocytes: changes in lipid synthesis, plasma membrane lipid composition, and 125I-EGF binding upon administration of 25-hydroxycholesterol and mevinolin

    International Nuclear Information System (INIS)

    Ponec, M.; Kempenaar, J.; Weerheim, A.; Boonstra, J.

    1987-01-01

    We have studied the relationship between differentiation capacity, plasma membrane composition, and epidermal growth factor (EGF) receptor expression of normal keratinocytes in vitro. The plasma membrane composition of the cells was modulated experimentally by cholesterol depletion, using specific inhibitors of cholesterol synthesis, such as 25-hydroxycholesterol and mevinolin. Exposure of the cells towards these inhibitors resulted in a drastic decrease of cholesterol biosynthesis, as determined from 14 C-acetate incorporation into the various lipid fractions. This effect on cholesterol biosynthesis was reflected by changes in plasma membrane composition, as determined by lipid analysis of isolated plasma membrane fractions, these resulting in a decreased cholesterol-phospholipid ratio. The experimental modulation of plasma membrane composition by 25-hydroxycholesterol or mevinolin were accompanied by a decreased cornified envelope formation and by high expression of EGF binding sites. These phenomena were more pronounced in cells induced to differentiate by exposure of cells grown under low Ca2+ to normal Ca2+ concentrations, as compared to cells grown persistently under low Ca2+ concentrations. These results suggest a close correlation between plasma membrane composition, differentiation capacity, and EGF receptor expression

  12. Keratinocyte-Derived Chemokines Orchestrate T-Cell Positioning in the Epidermis during Vitiligo and May Serve as Biomarkers of Disease.

    Science.gov (United States)

    Richmond, Jillian M; Bangari, Dinesh S; Essien, Kingsley I; Currimbhoy, Sharif D; Groom, Joanna R; Pandya, Amit G; Youd, Michele E; Luster, Andrew D; Harris, John E

    2017-02-01

    Vitiligo is an autoimmune disease of the skin that results in the destruction of melanocytes and the clinical appearance of white spots. Disease pathogenesis depends on IFN-γ and IFN-γ-induced chemokines to promote T-cell recruitment to the epidermis where melanocytes reside. The skin is a complex organ, with a variety of resident cell types. We sought to better define the microenvironment and distinct cellular contributions during autoimmunity in vitiligo, and we found that the epidermis is a chemokine-high niche in both a mouse model and human vitiligo. Analysis of chemokine expression in mouse skin showed that CXCL9 and CXCL10 expression strongly correlate with disease activity, whereas CXCL10 alone correlates with severity, supporting them as potential biomarkers for following disease progression. Further studies in both our mouse model and human patients showed that keratinocytes were the major chemokine producers throughout the course of disease, and functional studies using a conditional signal transducer and activator of transcription (STAT)-1 knockout mouse showed that IFN-γ signaling in keratinocytes was critical for disease progression and proper autoreactive T-cell homing to the epidermis. In contrast, epidermal immune cell populations including endogenous T cells, Langerhans cells, and γδ T cells were not required. These results have important clinical implications, because topical therapies that target IFN-γ signaling in keratinocytes could be safe and effective new treatments, and skin expression of these chemokines could be used to monitor disease activity and treatment responses. Copyright © 2016 The Authors. Published by Elsevier Inc. All rights reserved.

  13. AKT delays the early-activated apoptotic pathway in UVB-irradiated keratinocytes via BAD translocation.

    Science.gov (United States)

    Claerhout, Sofie; Decraene, David; Van Laethem, An; Van Kelst, Sofie; Agostinis, Patrizia; Garmyn, Marjan

    2007-02-01

    Upon irradiation with a high dose of UVB, keratinocytes undergo apoptosis as a protective mechanism. In previous work, we demonstrated the existence of an early-activated UVB-induced apoptotic pathway in growth factor-depleted human keratinocytes, which can be substantially delayed by the exclusive supplementation of IGF-1. We now show that in human keratinocytes, IGF-1 inhibits the onset of UVB-triggered apoptosis through a transcriptional independent, AKT-mediated mechanism, involving BAD serine 136 phosphorylation. Our results show that the early UVB-induced apoptosis in growth factor-depleted human keratinocytes is exclusively triggered through the mitochondrial pathway. It is accompanied by BAX translocation, cytochrome c release, and procaspase-9 cleavage, but not by procaspase-8 or BID cleavage. In human keratinocytes, IGF-1 supplementation inhibits these events in a transcription-independent manner. Both IGF-1 supplementation and the transduction of a membrane-targeted form of AKT result in a shift of the BH3-only protein BAD from the mitochondria to the cytoplasm, paralleled by an increase of AKT-specific Ser136 phospho-BAD bound to 14-3-3zeta protein. These data indicate that AKT-induced BAD phosphorylation and its subsequent cytoplasmic sequestration by 14-3-3zeta is a major mechanism responsible for the postponement of UVB-induced apoptosis in human keratinocytes.

  14. Calibration of acoustic emission transducers

    International Nuclear Information System (INIS)

    Leschek, W.C.

    1976-01-01

    A method is described for calibrating an acoustic emission transducer to be used in a pre-set frequency range. The absolute reception sensitivity of a reference transducer is determined at frequencies selected within the frequency range. The reference transducer and the acoustic emission transducer are put into acoustic communication with the surface of a limited acoustic medium representing an equivalent acoustic load appreciably identical to that of the medium in which the use of the acoustic emission transducer is intended. A blank random acoustic noise is emitted in the acoustic medium in order to establish a diffuse and reverberating sound field, after which the output responses of the reference transducer and of the acoustic emission transducer are obtained with respect to the diffuse and reverberating field, for selected frequencies. The output response of the acoustic emission transducer is compared with that of the reference transducer for the selected frequencies, so as to determine the reception sensitivity of the acoustic emission transducer [fr

  15. Rab11b mediates melanin transfer between donor melanocytes and acceptor keratinocytes via coupled exo/endocytosis.

    Science.gov (United States)

    Tarafder, Abul K; Bolasco, Giulia; Correia, Maria S; Pereira, Francisco J C; Iannone, Lucio; Hume, Alistair N; Kirkpatrick, Niall; Picardo, Mauro; Torrisi, Maria R; Rodrigues, Inês P; Ramalho, José S; Futter, Clare E; Barral, Duarte C; Seabra, Miguel C

    2014-04-01

    The transfer of melanin from melanocytes to keratinocytes is a crucial process underlying maintenance of skin pigmentation and photoprotection against UV damage. Here, we present evidence supporting coupled exocytosis of the melanin core, or melanocore, by melanocytes and subsequent endocytosis by keratinocytes as a predominant mechanism of melanin transfer. Electron microscopy analysis of human skin samples revealed three lines of evidence supporting this: (1) the presence of melanocores in the extracellular space; (2) within keratinocytes, melanin was surrounded by a single membrane; and (3) this membrane lacked the melanosomal membrane protein tyrosinase-related protein 1 (TYRP1). Moreover, co-culture of melanocytes and keratinocytes suggests that melanin exocytosis is specifically induced by keratinocytes. Furthermore, depletion of Rab11b, but not Rab27a, caused a marked decrease in both keratinocyte-stimulated melanin exocytosis and transfer to keratinocytes. Thus, we propose that the predominant mechanism of melanin transfer is keratinocyte-induced exocytosis, mediated by Rab11b through remodeling of the melanosome membrane, followed by subsequent endocytosis by keratinocytes.

  16. Calcite microcrystals in the pineal gland of the human brain: second harmonic generators and possible piezoelectric transducers

    International Nuclear Information System (INIS)

    Lang, S.B.

    2004-01-01

    Full text: A new form of biomineralization in the pineal gland of the human brain has been studied. It consists of small crystals that are less than 20 μm in length and that are completely distinct from the often-observed mulberry-type hydroxyapatite concretions. Cubic, hexagonal and cylindrical morphologies have been identified using scanning electron microscopy. Energy dispersive spectroscopy, selected-area electron diffraction and near infrared Raman spectroscopy established that the crystals were calcite. Experiments at the European Synchrotron Radiation Facility (ESRF) to study the biomineralization showed the presence of sulfur originating from both sugars and proteins. Other studies at the ESRF furnished information on the complex texture crystallization of the calcite. With the exception of the otoconia structure of the inner ear, this is the only known non-pathological occurrence of calcite in the human body. The calcite microcrystals are believed to be responsible for the previously observed second harmonic generation (SHG) in pineal tissue sections. There is a strong possibility that the complex twinned structure of the crystals may lower their symmetry and permit the existence of a piezoelectric effect

  17. Investigation of double strand breaks induced by alpha particle irradiation using C.N.B.G. microbeam in human keratinocytes; Mise en evidence de cassures double brin de l'ADN induites par irradiation de keratinocytes humains en microfaisceau alpha

    Energy Technology Data Exchange (ETDEWEB)

    Pouthier, Th

    2006-12-15

    To understand the mechanisms of interaction of ionizing radiation with living tissues exposed to low and protracted doses remains a major issue for risk evaluation. The response cannot be found in epidemiological studies because the only available data concern accidental exposures to high doses of radiation. The natural exposure represents the main source of exposure in the daily life, just before the medical sources (radiology, radiotherapy). In addition, this kind of exposure is very difficult to reproduce in vitro by irradiating cell lines. The method per preference is based on random irradiation of cell populations. The mean number of particles having traversed cells is then calculated on the basis of Poisson statistics. In addition to inevitable multiple impacts, the numerous potential intracellular targets (nuclei, cytoplasm), the indirect effects induced by the impact of particles on neighbouring cells or simply the extracellular targets, constitute phenomena that make more complex the interpretation of experimental data. A charged particle microbeam was developed at C.E.N.B.G. to perform the targeted irradiation of individual cells with a targeting precision of a few microns. It is possible to deliver a counted number of alpha particles down to the ultimate dose of one alpha per cell, to target predetermined cells and then to observe the response of the neighbouring cells. This facility has been validated during this work on human keratinocyte cells expressing a recombinant nuclear fluorescent protein (histone H2B-GFP). The combination of ion micro-beams with confocal microscopy and numeric quantitative analysis allowed the measurement of DNA double strand breaks via the phosphorylation of the histone H2A.X in individual cells. The mechanisms of DNA reparation and apoptosis induction were also in the scope of those studies. The experimental results obtained during this thesis validate the methodology we have developed by demonstrating the targeting

  18. Selective in vivo radiosensitization by 5-fluorocytosine of human colorectal carcinoma cells transduced with the E. coli cytosine deaminase (CD) gene

    International Nuclear Information System (INIS)

    Gabel, M.; Kim, J.H.; Kolozsvary, A.; Khil, M.; Freytag, S.

    1998-01-01

    Purpose: The E. coli cytosine deaminase (CD) gene encodes an enzyme capable of converting the nontoxic prodrug 5-fluorocytosine (5-FC) to 5-fluorouracil (5-FU), a known radiosensitizer. Having previously shown that combined CD suicide gene therapy and radiation (RT) results in pronounced radiosensitization in vitro, we progressed to in vivo studies of combined therapy. Methods and Materials: WiDr human colon cancer cells were transduced in vitro with the CD gene and cells expressing CD were selected for use as xenografts in a nude mouse model. After administration of 5-FC, tumors received 10-30 Gy local field radiation (RT) and tumor growth delay was compared to control animals receiving either 5-FU, 5-FC, or RT alone. Results: Maximal growth delay was seen in mice treated with 5-FC for 6 consecutive days prior to RT. Combined treatment with 15 Gy radiation resulted in a dose-modifying factor (DMF) of 1.50, and a greater DMF was observed with higher doses of radiation. There was no appreciable toxicity using this new approach. In contrast, a similar treatment of combined 5-FU and radiation resulted in considerable toxicity and no appreciable radiosensitization. Conclusion: The present results show that combined suicide gene therapy and RT results in pronounced antitumor effect without any notable toxicity. This indicates that the CD gene may be useful in the development of novel treatment strategies combining radiation and gene therapy in the treatment of locally advanced cancers

  19. No evidence for induction of key components of the Notch signaling pathway (Notch-1, Jagged-1) by treatment with UV-B, 1,25(OH)(2)D(3), and/or epigenetic drugs (TSA, 5-Aza) in human keratinocytes in vitro.

    Science.gov (United States)

    Reichrath, Sandra; Reichrath, Jörg

    2012-01-01

    Notch signaling is of high importance for growth and survival of various cell types. We now analyzed the protein expression of two key components of the Notch signaling pathway (Notch-1, Jagged-1) in spontaneously immortalized (HaCaT) and in malignant (SCL-1) human keratinocytes, using western analysis. We found that Notch-1 and its corresponding ligand Jagged-1 are expressed in both cell lines, with no marked change following UV-B treatment. Moreover, treatment of both cell lines before or after UV-B irradiation with 1,25-dihydroxyvitamin D(3), the biologically active form of vitamin D, and/or epigenetic modulating drugs (TSA; 5-Aza) did not result in a marked modulation of the protein expression of Notch-1 or Jagged-1. Under the experimental conditions of this study, treatment with 1,25(OH)(2)D(3) protected human keratinocytes in part against the antiproliferative effects of UV-B-radiation. In conclusion, our findings do not point at a differential expression of these two key components of Notch signaling in non-malignant as compared to malignant human keratinocytes, indicating that alterations in their expression are not of importance for the photocarcinogenesis of human squamous cell carcinomas. Moreover, our findings do not support the hypothesis that modulation of Notch signaling may be involved in the photoprotective effect of 1,25-dihydroxyvitamin D(3), that we and others reported previously. Additionally, we demonstrate that epigenetic modulating drugs (TSA, 5-Aza) do not markedly modulate the expression Notch-1 or Jagged-1 in UV-B-treated human keratinocytes in vitro.

  20. The protective effects of piceatannol from passion fruit (Passiflora edulis) seeds in UVB-irradiated keratinocytes.

    Science.gov (United States)

    Maruki-Uchida, Hiroko; Kurita, Ikuko; Sugiyama, Kenkichi; Sai, Masahiko; Maeda, Kazuhisa; Ito, Tatsuhiko

    2013-01-01

    The use of naturally occurring botanicals with substantial antioxidant activity to prevent photoageing is receiving increasing attention. We have previously identified piceatannol and scirpusin B, which is a dimer of piceatannol, as strong antioxidants that are present in passion fruit (Passiflora edulis) seeds. In the present study, the effects of passion fruit seed extract, piceatannol, and scirpusin B on human keratinocytes were investigated. The passion fruit seed extract and piceatannol upregulated the glutathione (GSH) levels in keratinocytes in a dose-dependent manner, indicating that piceatannol is an active component of the passion fruit seed extract in keratinocytes. The pretreatment with piceatannol also suppressed the UVB-induced generation of reactive oxygen species (ROS) in the keratinocytes. In addition, the transfer of the medium from the UVB-irradiated keratinocytes to non-irradiated fibroblasts enhanced matrix-metalloproteinase (MMP)-1 activity, and this MMP-1 induction was reduced when the keratinocytes were pretreated with piceatannol. These results suggest that piceatannol attenuates the UVB-induced activity of MMP-1 along with a reduction of ROS generation in keratinocytes. Thus, piceatannol and passion fruit seed extract containing high amounts of piceatannol are potential anti-photoageing cosmetic ingredients.

  1. Possible role of epidermal keratinocytes in the construction of acupuncture meridians.

    Science.gov (United States)

    Denda, Mitsuhiro; Tsutsumi, Moe

    2014-04-01

    Acupuncture meridians consist of a network of acupuncture points on the skin, stimulation of which is well established to have a variety of physiological effects. We have previously demonstrated that epidermal keratinocytes contain multiple sensory systems for temperature, mechanical stimuli, electric potentials and other stimuli. These sensory systems generate changes in the calcium-ion concentration in the epidermis, so epidermal keratinocytes can generate spatially-localized electro-physiological patterns in the skin. We have previously demonstrated signaling between epidermal keratinocytes and peripheral nerve systems. Therefore, stimuli sensed by epidermal keratinocytes might be transferred to the unmyelinated nerve fibers that are known to exist in the epidermis and, thence, to the spinal cord and brain. We propose that epidermal keratinocytes form an information-gathering network in the skin and that this network plays a key role in whole-body homeostasis in response to the changing environment. We also hypothesize that this network corresponds to the acupuncture meridians. As supporting examples, we present some striking calcium propagation patterns observed in cultured human keratinocytes after adenosine-triphosphate (ATP) stimulation. These results support the ideas that keratinocytes can generate spatially-restricted signaling patterns after environmental stimulation and that the cultures might be in-vitro models of meridians as an information-gathering network in skin. Copyright © 2014. Published by Elsevier B.V.

  2. Lactobacillus rhamnosus GG Lysate Increases Re-Epithelialization of Keratinocyte Scratch Assays by Promoting Migration.

    Science.gov (United States)

    Mohammedsaeed, Walaa; Cruickshank, Sheena; McBain, Andrew J; O'Neill, Catherine A

    2015-11-05

    A limited number of studies have investigated the potential of probiotics to promote wound healing in the digestive tract. The aim of the current investigation was to determine whether probiotic bacteria or their extracts could be beneficial in cutaneous wound healing. A keratinocyte monolayer scratch assay was used to assess re-epithelialization; which comprises keratinocyte proliferation and migration. Primary human keratinocyte monolayers were scratched then exposed to lysates of Lactobacillus (L) rhamnosus GG, L. reuteri, L. plantarum or L. fermentum. Re-epithelialization of treated monolayers was compared to that of untreated controls. Lysates of L. rhamnosus GG and L. reuteri significantly increased the rate of re-epithelialization, with L. rhamnosus GG being the most efficacious. L. reuteri increased keratinocyte proliferation while L. rhamnosus GG lysate significantly increased proliferation and migration. Microarray analysis of L. rhamnosus GG treated scratches showed increased expression of multiple genes including the chemokine CXCL2 and its receptor CXCR2. These are involved in normal wound healing where they stimulate keratinocyte proliferation and/or migration. Increased protein expression of both CXCL2 and CXCR2 were confirmed by ELISA and immunoblotting. These data demonstrate that L. rhamnosus GG lysate accelerates re-epithelialization of keratinocyte scratch assays, potentially via chemokine receptor pairs that induce keratinocyte migration.

  3. Gelatin for purification and proliferation of primary keratinocyte culture for use in chronic wounds and burns.

    Science.gov (United States)

    Rahsaz, Marjan; Geramizadeh, Bita; Kaviani, Maryam; Marzban, Saeed

    2015-04-01

    Human epidermal keratinocytes are currently established as a treatment for burns and wounds and have laboratory applications. Keratinocyte culture contamination by unwanted cells and inhibition of cell proliferation are barriers in primary keratinocyte culture. According to the recent literature, these cells are hard to culture. The present study was conducted to evaluate the efficacy of gelatin-coated surfaces in keratinocyte cultures. After enzymatic isolation of keratinocytes from normal epidermis by trypsin, the cells were cultured on gelatin-coated flasks in serum-free medium. Another group of cells were cultured as a control group without gelatin coating. We showed positive effects of surface coating with gelatin on the primary culture of keratinocytes. Culture of these cells on a gelatincoated surface showed better proliferation with suitable morphology. By using gelatin, adhesion of these cells to the surface was more efficient and without contamination by small round cells. Successful primary culture of keratinocytes on a gelatin-coated surface may provide better yield and optimal number of cells for research and clinical applications.

  4. Novel 11β-hydroxysteroid dehydrogenase 1 inhibitors reduce cortisol levels in keratinocytes and improve dermal collagen content in human ex vivo skin after exposure to cortisone and UV.

    Directory of Open Access Journals (Sweden)

    Stéphanie M Boudon

    Full Text Available Activity and selectivity assessment of new bi-aryl amide 11β-hydroxysteroid dehydrogenase 1 (11β-HSD1 inhibitors, prepared in a modular manner via Suzuki cross-coupling, are described. Several compounds inhibiting 11β-HSD1 at nanomolar concentrations were identified. Compounds 2b, 3e, 7b and 12e were shown to selectively inhibit 11β-HSD1 over 11β-HSD2, 17β-HSD1 and 17β-HSD2. These inhibitors also potently inhibited 11β-HSD1 activity in intact HEK-293 cells expressing the recombinant enzyme and in intact primary human keratinocytes expressing endogenous 11β-HSD1. Moreover, compounds 2b, 3e and 12e were tested for their activity in human skin biopsies. They were able to prevent, at least in part, both the cortisone- and the UV-mediated decreases in collagen content. Thus, inhibition of 11β-HSD1 by these compounds can be further investigated to delay or prevent UV-mediated skin damage and skin aging.

  5. NMR signal transducer

    International Nuclear Information System (INIS)

    Kucheryaev, A.G.; Oliferchuk, N.L.

    1975-01-01

    A signal transducer of nuclear magnetic resonance for simultaneously measuring frequency and intensitivity of two various isotope signals, which are in one specimen is described. The transducer represents radiofrequency circuit with two resonance frequences, which is common for two autodyne generators. To decrease measuring time and to increase recording diagram stability the radiofrequency circuit has LC netork, in the inductivity of which investigated specimen is located; a circuit variable capacity is connected in parallel with one of the autodyne generators. Besides the radiofrequency circuit has an inductance coil in series with a standard specimen inside as well as a variable capacitor connected in parallel with the second autodyne generator. An amplitude of oscillation of each resonance frequency is controlled and adjusted separately. The transducer described can be used for the measurement of a nuclei concentration, isotope concentration and for the spin determination

  6. Comparative studies of types 1 and 2 herpes simplex virus infection of cultured normal keratinocytes.

    OpenAIRE

    Su, S J; Wu, H H; Lin, Y H; Lin, H Y

    1995-01-01

    AIMS--To investigate the differences in biological properties, multiplication patterns, and cytopathic effects between type 1 and type 2 herpes simplex virus (HSV) through the replication of HSV in cultured normal human keratinocytes. METHODS--Keratinocytes were obtained from surgical specimens of normal gingiva, cervix, trunk skin, and newborn foreskin. They were cultured in serum free, chemically defined, culture medium and infected with a pool of HSV collected from clinical specimens. RESU...

  7. Piezoelectric transducer array microspeaker

    KAUST Repository

    Carreno, Armando Arpys Arevalo; Conchouso Gonzalez, David; Castro, David; Kosel, Jü rgen; Foulds, Ian G.

    2016-01-01

    contains 2n piezoelectric transducer membranes, where “n” is the bit number. Every element of the array has a circular shape structure. The membrane is made out four layers: 300nm of platinum for the bottom electrode, 250nm or lead zirconate titanate (PZT

  8. Vibration transducer calibration techniques

    Science.gov (United States)

    Brinkley, D. J.

    1980-09-01

    Techniques for the calibration of vibration transducers used in the Aeronautical Quality Assurance Directorate of the British Ministry of Defence are presented. Following a review of the types of measurements necessary in the calibration of vibration transducers, the performance requirements of vibration transducers, which can be used to measure acceleration, velocity or vibration amplitude, are discussed, with particular attention given to the piezoelectric accelerometer. Techniques for the accurate measurement of sinusoidal vibration amplitude in reference-grade transducers are then considered, including the use of a position sensitive photocell and the use of a Michelson laser interferometer. Means of comparing the output of working-grade accelerometers with that of previously calibrated reference-grade devices are then outlined, with attention given to a method employing a capacitance bridge technique and a method to be used at temperatures between -50 and 200 C. Automatic calibration procedures developed to speed up the calibration process are outlined, and future possible extensions of system software are indicated.

  9. Alanine-scanning mutagenesis of human signal transducer and activator of transcription 1 to estimate loss- or gain-of-function variants.

    Science.gov (United States)

    Kagawa, Reiko; Fujiki, Ryoji; Tsumura, Miyuki; Sakata, Sonoko; Nishimura, Shiho; Itan, Yuval; Kong, Xiao-Fei; Kato, Zenichiro; Ohnishi, Hidenori; Hirata, Osamu; Saito, Satoshi; Ikeda, Maiko; El Baghdadi, Jamila; Bousfiha, Aziz; Fujiwara, Kaori; Oleastro, Matias; Yancoski, Judith; Perez, Laura; Danielian, Silvia; Ailal, Fatima; Takada, Hidetoshi; Hara, Toshiro; Puel, Anne; Boisson-Dupuis, Stéphanie; Bustamante, Jacinta; Casanova, Jean-Laurent; Ohara, Osamu; Okada, Satoshi; Kobayashi, Masao

    2017-07-01

    Germline heterozygous mutations in human signal transducer and activator of transcription 1 (STAT1) can cause loss of function (LOF), as in patients with Mendelian susceptibility to mycobacterial diseases, or gain of function (GOF), as in patients with chronic mucocutaneous candidiasis. LOF and GOF mutations are equally rare and can affect the same domains of STAT1, especially the coiled-coil domain (CCD) and DNA-binding domain (DBD). Moreover, 6% of patients with chronic mucocutaneous candidiasis with a GOF STAT1 mutation have mycobacterial disease, obscuring the functional significance of the identified STAT1 mutations. Current computational approaches, such as combined annotation-dependent depletion, do not distinguish LOF and GOF variants. We estimated variations in the CCD/DBD of STAT1. We mutagenized 342 individual wild-type amino acids in the CCD/DBD (45.6% of full-length STAT1) to alanine and tested the mutants for STAT1 transcriptional activity. Of these 342 mutants, 201 were neutral, 30 were LOF, and 111 were GOF mutations in a luciferase assay. This assay system correctly estimated all previously reported LOF mutations (100%) and slightly fewer GOF mutations (78.1%) in the CCD/DBD of STAT1. We found that GOF alanine mutants occurred at the interface of the antiparallel STAT1 dimer, suggesting that they destabilize this dimer. This assay also precisely predicted the effect of 2 hypomorphic and dominant negative mutations, E157K and G250E, in the CCD of STAT1 that we found in 2 unrelated patients with Mendelian susceptibility to mycobacterial diseases. The systematic alanine-scanning assay is a useful tool to estimate the GOF or LOF status and the effect of heterozygous missense mutations in STAT1 identified in patients with severe infectious diseases, including mycobacterial and fungal diseases. Copyright © 2016 American Academy of Allergy, Asthma & Immunology. Published by Elsevier Inc. All rights reserved.

  10. TIG3 - AN IMPORTANT REGULATOR OF KERATINOCYTE PROLIFERATION AND SURVIVAL

    OpenAIRE

    Scharadin, Tiffany M.; Eckert, Richard L.

    2014-01-01

    Tazarotene induced gene 3 (TIG3) is a tumor suppressor protein. In normal human epidermis, TIG3 is present in the differentiated, suprabasal layers and regulates terminal differentiation. TIG3 level is reduced in hyperproliferative diseases, including psoriasis and skin cancer, suggesting that loss of TIG3 is associated with enhanced cell proliferation. Moreover, transient expression of TIG3 leads to terminal differentiation in normal keratinocytes and apoptosis in skin cancer cells. In both ...

  11. Platelet-Released Growth Factors Induce Differentiation of Primary Keratinocytes

    OpenAIRE

    Bayer, Andreas; Tohidnezhad, Mersedeh; Lammel, Justus; Lippross, Sebastian; Behrendt, Peter; Klüter, Tim; Pufe, Thomas; Jahr, Holger; Cremer, Jochen; Rademacher, Franziska; Gläser, Regine; Harder, Jürgen

    2017-01-01

    Autologous thrombocyte concentrate lysates, for example, platelet-released growth factors, (PRGFs) or their clinically related formulations (e.g., Vivostat PRF?) came recently into the physicians' focus as they revealed promising effects in regenerative and reparative medicine such as the support of healing of chronic wounds. To elucidate the underlying mechanisms, we analyzed the influence of PRGF and Vivostat PRF on human keratinocyte differentiation in vitro and on epidermal differentiatio...

  12. MicroRNA-17-92 cluster promotes the proliferation and the chemokine production of keratinocytes: implication for the pathogenesis of psoriasis.

    Science.gov (United States)

    Zhang, Weigang; Yi, Xiuli; An, Yawen; Guo, Sen; Li, Shuli; Song, Pu; Chang, Yuqian; Zhang, Shaolong; Gao, Tianwen; Wang, Gang; Li, Chunying

    2018-05-11

    Keratinocytes are the main epidermal cell type that constitutes the skin barrier against environmental damages, which emphasizes the balance between the growth and the death of keratinocytes in maintaining skin homeostasis. Aberrant proliferation of keratinocytes and the secretion of inflammatory factors from keratinocytes are related to the formation of chronic inflammatory skin diseases like psoriasis. MicroRNA-17-92 (miRNA-17-92 or miR-17-92) is a miRNA cluster that regulates cell growth and immunity, but the role of miR-17-92 cluster in keratinocytes and its relation to skin diseases have not been well investigated. In the present study, we initially found that miR-17-92 cluster promoted the proliferation and the cell-cycle progression of keratinocytes via suppressing cyclin-dependent kinase inhibitor 2B (CDKN2B). Furthermore, miR-17-92 cluster facilitated the secretion of C-X-C motif chemokine ligand 9 (CXCL9) and C-X-C motif chemokine ligand 10 (CXCL10) from keratinocytes by inhibiting suppressor of cytokine signaling 1 (SOCS1), which enhanced the chemotaxis for T lymphocytes formed by keratinocytes. In addition, we detected increased expression of miR-17-92 cluster in psoriatic lesions and the level of lesional miR-17-92 cluster was positively correlated with the disease severity in psoriasis patients. At last, miR-17-92 cluster was increased in keratinocytes by cytokines through the activation of signal transducers and activators of transcription 1 (STAT1) signaling pathway. Our findings demonstrate that cytokine-induced overexpression of miR-17-92 cluster can promote the proliferation and the immune function of keratinocytes, and thus may contribute to the development of inflammatory skin diseases like psoriasis, which implicates miR-17-92 cluster as a potential therapeutic target for psoriasis and other skin diseases with similar inflammatory pathogenesis.

  13. Progressive loss of sensitivity to growth control by retinoic acid and transforming growth factor-beta at late stages of human papillomavirus type 16-initiated transformation of human keratinocytes.

    Science.gov (United States)

    Creek, K E; Geslani, G; Batova, A; Pirisi, L

    1995-01-01

    Retinoids (vitamin A and its natural and synthetic derivatives) have shown potential as chemopreventive agents, and diets poor in vitamin A and/or its precursor beta-carotene have been linked to an increased risk of cancer at several sites including the cervix. Human papillomavirus (HPV) plays an important role in the etiology of cervical cancer. We have developed an in vitro model of cancer progression using human keratinocytes (HKc) immortalized by HPV16 DNA (HKc/HPV16). Although immortal, early passage HKc/HPV16, like normal HKc, require epidermal growth factor (EGF) and bovine pituitary extract (BPE) for proliferation and undergo terminal differentiation in response to serum and calcium. However, following prolonged culture, growth factor independent HKc/HPV16 lines that no longer require EGF and BPE can be selected (HKc/GFI). Further selection of HKc/GFI produces lines that are resistant to serum- and calcium- induced terminal differentiation (HKc/DR). HKc/DR, but not early passage HKc/HPV16, are susceptible to malignant conversion following transfection with viral Harvey ras or Herpes simplex virus type II DNA. We have investigated the sensitivity of low to high passage HKc/HPV16 and HKc/GFI to growth control by all-trans-retinoic acid (RA, an active metabolite of vitamin A). Early passage HKc/HPV16 are very sensitive to growth inhibition by RA, and in these cells RA decreases the expression of the HPV16 oncogenes E6 and E7. However, as the cells progress in culture they lose their sensitivity to RA. Growth inhibition by RA may be mediated through the cytokine transforming growth factor-beta (TGF-beta), a potent inhibitor of epithelial cell proliferation. RA treatment of HKc/HPV16 and HKc/GFI results in a dose-and time-dependent induction (maximal of 3-fold) in secreted levels of TGF-beta. Also, Northern blot analysis of mRNA isolated from HKc/HPV16 demonstrated that RA treatment induced TGF-beta 1 and TGF-beta 2 expression about 3- and 50-fold, respectively

  14. Scanning Ion Conductance Microscopy of Live Keratinocytes

    International Nuclear Information System (INIS)

    Hegde, V; Mason, A; Saliev, T; Smith, F J D; McLean, W H I; Campbell, P A

    2012-01-01

    Scanning ion conductance microscopy (SICM) is perhaps the least well known technique from the scanning probe microscopy (SPM) family of instruments. As with its more familiar counterpart, atomic force microscopy (AFM), the technique provides high-resolution topographic imaging, with the caveat that target structures must be immersed in a conducting solution so that a controllable ion current may be utilised as the basis for feedback. In operation, this non-contact characteristic of SICM makes it ideal for the study of delicate structures, such as live cells. Moreover, the intrinsic architecture of the instrument, incorporating as it does, a scanned micropipette, lends itself to combination approaches with complementary techniques such as patch-clamp electrophysiology: SICM therefore boasts the capability for both structural and functional imaging. For the present observations, an ICnano S system (Ionscope Ltd., Melbourn, UK) operating in 'hopping mode' was used, with the objective of assessing the instrument's utility for imaging live keratinocytes under physiological buffers. In scans employing cultured HaCaT cells (spontaneously immortalised, human keratinocytes), we compared the qualitative differences of live cells imaged with SICM and AFM, and also with their respective counterparts after chemical fixation in 4% paraformaldehyde. Characteristic surface microvilli were particularly prominent in live cell imaging by SICM. Moreover, time lapse SICM imaging on live cells revealed that changes in the pattern of microvilli could be tracked over time. By comparison, AFM imaging on live cells, even at very low contact forces (< nN), could not routinely image microvilli: rather, an apparently convolved image of the underlying cytoskeleton was instead prevalent. We note that the present incarnation of the commercial instrument falls some way behind the market leading SPMs in terms of technical prowess and scanning speed, however, the intrinsic non-obtrusive nature of

  15. Treatment of burn injuries with keratinocyte cultures

    International Nuclear Information System (INIS)

    Syring, C.; Maenig, H.J.; Von Versen, R.; Bruck, J.

    1999-01-01

    The German Institute for Cell and Tissue Replacement (DIZG) provides burned patients with skin and amnion for a temporary wound closure. Severely burned patients (>60% BSA for adults, >40% BSA for children) were supplied with autologous and allogenic grafts from cultured keratinocytes. The keratinocyte culture is done under GMP-conditions using the method of Rheinwald and Green. The 3T3 fibroblasts were irradiated with 60 Gy and used as feeder cells to produce keratinocyte sheets within 3 weeks. In this time up to 6.000 cm are available. The sheets were harvested by detachment with dispase (1,2 U/ml), fixed to gauze and transported to the hospital. The DIZG has a 3 years experience in the treatment of burns with keratinocyte sheets. The sheets were transplanted to patients in different hospitals, the total transplanted area is about 30.000 cm. This paper describes the experiences with ten severely burned patients treated with keratinocyte sheet

  16. Th17 cell-mediated immune responses promote mast cell proliferation by triggering stem cell factor in keratinocytes

    International Nuclear Information System (INIS)

    Cho, Kyung-Ah; Park, Minhwa; Kim, Yu-Hee; Woo, So-Youn

    2017-01-01

    Although mast cells are traditionally thought to function as effector cells in allergic responses, they have increasingly been recognized as important regulators of various immune responses. Mast cells mature locally; thus, tissue-specific influences are important for promoting mast cell accumulation and survival in the skin and the gastrointestinal tract. In this study, we determined the effects of keratinocytes on mast cell accumulation during Th17-mediated skin inflammation. We observed increases in dermal mast cells in imiquimod-induced psoriatic dermatitis in mice accompanied by the expression of epidermal stem cell factor (SCF), a critical mast cell growth factor. Similar to mouse epidermal keratinocytes, SCF was highly expressed in the human HaCaT keratinocyte cell line following stimulation with IL−17. Further, keratinocytes promoted mast cell proliferation following stimulation with IL−17 in vitro. However, the effects of keratinocytes on mast cells were significantly diminished in the presence of anti−CD117 (stem cell factor receptor) blocking antibodies. Taken together, our results revealed that the Th17-mediated inflammatory environment promotes mast cell accumulation through keratinocyte-derived SCF. - Highlights: • Psoriasis-like skin inflammation increase dermal mast cells. • Keratinocyte produce stem cell factor in psoriasis-like skin inflammation. • Keratinocyte promote mast cell proliferation by stem cell factor dependent manner

  17. MiR-217 is down-regulated in psoriasis and promotes keratinocyte differentiation via targeting GRHL2

    International Nuclear Information System (INIS)

    Zhu, Haigang; Hou, Liyue; Liu, Jingjing; Li, Zhiming

    2016-01-01

    MiR-217 is a well-known tumor suppressor, and its down-regulation has been shown in a wide range of solid and leukaemic cancers. However, the biological role of miR-217 in psoriasis pathogenesis, especially in keratinocyte hyperproliferation and differentiation, is not clearly understood. In this study, we found the expression of miR-217 was markedly down-regulated in psoriasis keratinocytes of psoriatic patients. In addition, overexpression of miR-217 inhibited the proliferation and promoted the differentiation of primary human keratinocytes. On the contrary, inhibition of endogenous miR-217 increased cell proliferation and delayed differentiation. Furthermore, Grainyhead-like 2 (GRHL2) was identified as a direct target of miR-217 by luciferase reporter assay. The expression of miR-217 and GRHL2 was inversely correlated in both transfected keratinocytes and in psoriasis lesional skin. Moreover, knocking down GRHL2 expression by siRNA enhanced keratinocyte differentiation. Taken together, our results demonstrate a role for miR-217 in the regulation of keratinocyte differentiation, partially through the regulation of GRHL2. - Highlights: • miR-217 is down-regulated in psoriasis skin lesions. • miR-217 inhibits the proliferation and promotes differentiation of keratinocytes. • GRHL2 is a novel target of miR-217 in keratinocytes. • GRHL2 is up-regulated and inversely correlated with miR-217 in psoriasis skin lesions.

  18. MiR-217 is down-regulated in psoriasis and promotes keratinocyte differentiation via targeting GRHL2

    Energy Technology Data Exchange (ETDEWEB)

    Zhu, Haigang; Hou, Liyue; Liu, Jingjing; Li, Zhiming, E-mail: lizm_1001@sina.com

    2016-02-26

    MiR-217 is a well-known tumor suppressor, and its down-regulation has been shown in a wide range of solid and leukaemic cancers. However, the biological role of miR-217 in psoriasis pathogenesis, especially in keratinocyte hyperproliferation and differentiation, is not clearly understood. In this study, we found the expression of miR-217 was markedly down-regulated in psoriasis keratinocytes of psoriatic patients. In addition, overexpression of miR-217 inhibited the proliferation and promoted the differentiation of primary human keratinocytes. On the contrary, inhibition of endogenous miR-217 increased cell proliferation and delayed differentiation. Furthermore, Grainyhead-like 2 (GRHL2) was identified as a direct target of miR-217 by luciferase reporter assay. The expression of miR-217 and GRHL2 was inversely correlated in both transfected keratinocytes and in psoriasis lesional skin. Moreover, knocking down GRHL2 expression by siRNA enhanced keratinocyte differentiation. Taken together, our results demonstrate a role for miR-217 in the regulation of keratinocyte differentiation, partially through the regulation of GRHL2. - Highlights: • miR-217 is down-regulated in psoriasis skin lesions. • miR-217 inhibits the proliferation and promotes differentiation of keratinocytes. • GRHL2 is a novel target of miR-217 in keratinocytes. • GRHL2 is up-regulated and inversely correlated with miR-217 in psoriasis skin lesions.

  19. Platelets Regulate the Migration of Keratinocytes via Podoplanin/CLEC-2 Signaling during Cutaneous Wound Healing in Mice.

    Science.gov (United States)

    Asai, Jun; Hirakawa, Satoshi; Sakabe, Jun-ichi; Kishida, Tsunao; Wada, Makoto; Nakamura, Naomi; Takenaka, Hideya; Mazda, Osam; Urano, Tetsumei; Suzuki-Inoue, Katsue; Tokura, Yoshiki; Katoh, Norito

    2016-01-01

    Podoplanin is an endogenous ligand for C-type lectin-like receptor 2 (CLEC-2), which is expressed on platelets. Recent evidence indicates that this specific marker of lymphatic endothelial cells is also expressed by keratinocytes at the edge of wounds. However, whether podoplanin or platelets play a role in keratinocyte activity during wound healing remains unknown. We evaluated the effect of podoplanin expression levels on keratinocyte motility using cultured primary normal human epidermal keratinocytes (NHEKs). Down-regulation of podoplanin in NHEKs via transfection with podoplanin siRNA inhibited their migration, indicating that podoplanin plays a mandatory role in this process. In addition, down-regulation of podoplanin was correlated with up-regulation of E-cadherin, suggesting that podoplanin-mediated stimulation of keratinocyte migration is associated with a loss of E-cadherin. Both the addition of platelets and treatment with CLEC-2 inhibited the migration of NHEKs. The down-regulation of RhoA activity and the up-regulation of E-cadherin in keratinocytes were also induced by CLEC-2. In conclusion, these results suggest that podoplanin/CLEC-2 signaling regulates keratinocyte migration via modulating E-cadherin expression through RhoA signaling. Altering the regulation of keratinocyte migration by podoplanin might be a novel therapeutic approach to improve wound healing. Copyright © 2016 American Society for Investigative Pathology. Published by Elsevier Inc. All rights reserved.

  20. Nano-optomechanical transducer

    Science.gov (United States)

    Rakich, Peter T; El-Kady, Ihab F; Olsson, Roy H; Su, Mehmet Fatih; Reinke, Charles; Camacho, Ryan; Wang, Zheng; Davids, Paul

    2013-12-03

    A nano-optomechanical transducer provides ultrabroadband coherent optomechanical transduction based on Mach-wave emission that uses enhanced photon-phonon coupling efficiencies by low impedance effective phononic medium, both electrostriction and radiation pressure to boost and tailor optomechanical forces, and highly dispersive electromagnetic modes that amplify both electrostriction and radiation pressure. The optomechanical transducer provides a large operating bandwidth and high efficiency while simultaneously having a small size and minimal power consumption, enabling a host of transformative phonon and signal processing capabilities. These capabilities include optomechanical transduction via pulsed phonon emission and up-conversion, broadband stimulated phonon emission and amplification, picosecond pulsed phonon lasers, broadband phononic modulators, and ultrahigh bandwidth true time delay and signal processing technologies.

  1. Stress wave focusing transducers

    Energy Technology Data Exchange (ETDEWEB)

    Visuri, S.R., LLNL

    1998-05-15

    Conversion of laser radiation to mechanical energy is the fundamental process behind many medical laser procedures, particularly those involving tissue destruction and removal. Stress waves can be generated with laser radiation in several ways: creation of a plasma and subsequent launch of a shock wave, thermoelastic expansion of the target tissue, vapor bubble collapse, and ablation recoil. Thermoelastic generation of stress waves generally requires short laser pulse durations and high energy density. Thermoelastic stress waves can be formed when the laser pulse duration is shorter than the acoustic transit time of the material: {tau}{sub c} = d/c{sub s} where d = absorption depth or spot diameter, whichever is smaller, and c{sub s} = sound speed in the material. The stress wave due to thermoelastic expansion travels at the sound speed (approximately 1500 m/s in tissue) and leaves the site of irradiation well before subsequent thermal events can be initiated. These stress waves, often evolving into shock waves, can be used to disrupt tissue. Shock waves are used in ophthalmology to perform intraocular microsurgery and photodisruptive procedures as well as in lithotripsy to fragment stones. We have explored a variety of transducers that can efficiently convert optical to mechanical energy. One such class of transducers allows a shock wave to be focused within a material such that the stress magnitude can be greatly increased compared to conventional geometries. Some transducer tips could be made to operate regardless of the absorption properties of the ambient media. The size and nature of the devices enable easy delivery, potentially minimally-invasive procedures, and precise tissue- targeting while limiting thermal loading. The transducer tips may have applications in lithotripsy, ophthalmology, drug delivery, and cardiology.

  2. Synthesis and biological activity of M6-P and M6-P analogs on fibroblast and keratinocyte proliferation.

    Science.gov (United States)

    Clavel, Caroline; Barragan-Montero, Véronique; Garric, Xavier; Molès, Jean-Pierre; Montero, Jean-Louis

    2005-09-01

    A new synthetic route to obtain the carboxylate analog of mannose 6-phosphate (M6-P) is presented. The effects of the M6-P, the carboxylate and two other analogs (the phosphonate and the alpha,beta ethylenic carboxylate) on the proliferation of human keratinocytes and dermal fibroblasts as well as on the proliferation of a murine fibroblast cell line, 3T3-J2 are tested. We observed that M6-P is a potent inhibitor of proliferation of both fibroblasts and keratinocytes. Among its analogs, the phosphonate showed a similar effect on human dermal fibroblasts but not on keratinocytes.

  3. Steerable Doppler transducer probes

    International Nuclear Information System (INIS)

    Fidel, H.F.; Greenwood, D.L.

    1986-01-01

    An ultrasonic diagnostic probe is described which is capable of performing ultrasonic imaging and Doppler measurement consisting of: a hollow case having an acoustic window which passes ultrasonic energy and including chamber means for containing fluid located within the hollow case and adjacent to a portion of the acoustic window; imaging transducer means, located in the hollow case and outside the fluid chamber means, and oriented to direct ultrasonic energy through the acoustic window toward an area which is to be imaged; Doppler transducer means, located in the hollow case within the fluid chamber means, and movably oriented to direct Doppler signals through the acoustic window toward the imaged area; means located within the fluid chamber means and externally controlled for controllably moving the Doppler transducer means to select one of a plurality of axes in the imaged area along which the Doppler signals are to be directed; and means, located external to the fluid chamber means and responsive to the means for moving, for providing an indication signal for identifying the selected axis

  4. Platelet-released growth factors inhibit proliferation of primary keratinocytes in vitro.

    Science.gov (United States)

    Bayer, Andreas; Tohidnezhad, Mersedeh; Berndt, Rouven; Lippross, Sebastian; Behrendt, Peter; Klüter, Tim; Pufe, Thomas; Jahr, Holger; Cremer, Jochen; Rademacher, Franziska; Simanski, Maren; Gläser, Regine; Harder, Jürgen

    2018-01-01

    Autologous thrombocyte concentrate lysates as platelet-released growth factors (PRGF) or Vivostat Platelet Rich Fibrin (PRF ® ) represent important tools in modern wound therapy, especially in the treatment of chronic, hard-to-heal or infected wounds. Nevertheless, underlying cellular and molecular mechanisms of the beneficial clinical effects of a local wound therapy with autologous thrombocyte concentrate lysates are poorly understood. Recently, we have demonstrated that PRGF induces antimicrobial peptides in primary keratinocytes and accelerates keratinocytes' differentiation. In the present study we analyzed the influence of PRGF on primary human keratinocytes' proliferation. Using the molecular proliferation marker Ki-67 we observed a concentration- and time dependent inhibition of Ki-67 gene expression in PRGF treated primary keratinocytes. These effects were independent from the EGFR- and the IL-6-R pathway. Inhibition of primary keratinocytes' proliferation by PRGF treatment was confirmed in colorimetric cell proliferation assays. Together, these data indicate that the clinically observed positive effects of autologous thrombocytes concentrates in the treatment of chronic, hard-to-heal wounds are not based on an increased keratinocytes proliferation. Copyright © 2017 Elsevier GmbH. All rights reserved.

  5. Crucial role of vinexin for keratinocyte migration in vitro and epidermal wound healing in vivo

    International Nuclear Information System (INIS)

    Kioka, Noriyuki; Ito, Takuya; Yamashita, Hiroshi; Uekawa, Natsuko; Umemoto, Tsutomu; Motoyoshi, Soh; Imai, Hiroshi; Takahashi, Kenzo; Watanabe, Hideto; Yamada, Masayasu; Ueda, Kazumitsu

    2010-01-01

    In the process of tissue injury and repair, epithelial cells rapidly migrate and form epithelial sheets. Vinexin is a cytoplasmic molecule of the integrin-containing cell adhesion complex localized at focal contacts in vitro. Here, we investigated the roles of vinexin in keratinocyte migration in vitro and wound healing in vivo. Vinexin knockdown using siRNA delayed migration of both HaCaT human keratinocytes and A431 epidermoid carcinoma cells in scratch assay but did not affect cell proliferation. Induction of cell migration by scratching the confluent monolayer culture of these cells activated both EGFR and ERK, and their inhibitors AG1478 and U0126 substantially suppressed scratch-induced keratinocyte migration. Vinexin knockdown in these cells inhibited the scratch-induced activation of EGFR, but not that of ERK, suggesting that vinexin promotes cell migration via activation of EGFR. We further generated vinexin (-/-) mice and isolated their keratinocytes. They similarly showed slow migration in scratch assay. Furthermore, vinexin (-/-) mice exhibited a delay in cutaneous wound healing in both the back skin and tail without affecting the proliferation of keratinocytes. Together, these results strongly suggest a crucial role of vinexin in keratinocyte migration in vitro and cutaneous wound healing in vivo.

  6. Novel glycosylated mycosporine-like amino acid, 13-O-(β-galactosyl)-porphyra-334, from the edible cyanobacterium Nostoc sphaericum-protective activity on human keratinocytes from UV light.

    Science.gov (United States)

    Ishihara, Kenji; Watanabe, Ryuichi; Uchida, Hajime; Suzuki, Toshiyuki; Yamashita, Michiaki; Takenaka, Hiroyuki; Nazifi, Ehsan; Matsugo, Seiichi; Yamaba, Minami; Sakamoto, Toshio

    2017-07-01

    A UV-absorbing compound was purified and identified as a novel glycosylated mycosporine-like amino acid (MAA), 13-O-β-galactosyl-porphyra-334 (β-Gal-P334) from the edible cyanobacterium Nostoc sphaericum, known as "ge xian mi" in China and "cushuro" in Peru. Occurrence of the hexosylated derivative of shinorine (hexosyl-shinorine) was also supported by LC-MS/MS analysis. β-Gal-P334 accounted for about 86.5% of total MAA in N. sphaericum, followed by hexosyl-shinorine (13.2%) and porphyra-334 (0.2%). β-Gal-P334 had an absorption maximum at 334nm and molecular absorption coefficient was 46,700 at 334nm. Protection activity of β-Gal-P334 from UVB and UVA+8-methoxypsoralen induced cell damage on human keratinocytes (HaCaT) was assayed in comparison with other MAA (porphyra-334, shinorine, palythine and mycosporine-glycine). The UVB protection activity was highest in mycosporine-glycine, followed by palythine, β-Gal-P334, porphyra-334 and shinorine in order. β-Gal-P334 had highest protection activity from UVA+8-methoxypsoralen induced cell damage followed by porphyra-334, shinorine, mycosporine-glycine and palythine. We also found an antioxidant (radical-scavenging) activity of β-Gal-P334 by colorimetric and ESR methods. From these findings, β-Gal-P334 was suggested to play important roles in stress tolerant mechanisms such as UV and oxidative stress in N. sphaericum as a major MAA. We also consider that the newly identified MAA, β-Gal-P334 has a potential for use as an ingredient of cosmetics and toiletries. Copyright © 2017 Elsevier B.V. All rights reserved.

  7. Fisetin inhibits TNF-α-induced inflammatory action and hydrogen peroxide-induced oxidative damage in human keratinocyte HaCaT cells through PI3K/AKT/Nrf-2-mediated heme oxygenase-1 expression.

    Science.gov (United States)

    Seo, Seung-Hee; Jeong, Gil-Saeng

    2015-12-01

    Oxidative skin damage and skin inflammation play key roles in the pathogenesis of skin-related diseases. Fisetin is a naturally occurring flavonoid abundantly found in several vegetables and fruits. Fisetin has been shown to exert various positive biological effects, such as anti-cancer, anti-proliferative, neuroprotective and anti-oxidative effects. In this study, we investigate the skin protective effects and anti-inflammatory properties of fisetin in hydrogen peroxide- and TNF-α-challenged human keratinocyte HaCaT cells. When HaCaT cells were treated with non-cytotoxic concentrations of fisetin (1-20μM), heme oxygenase (HO)-1 mRNA and protein expression increased in a dose-dependent manner. Furthermore, fisetin dose-dependently increased cell viability and reduced ROS production in hydrogen peroxide-treated HaCaT cells. Fisetin also inhibited the production of NO, PGE2 IL-1β, IL-6, expression of iNOS and COX-2, and activation of NF-κB in HaCaT cells treated with TNF-α. Fisetin induced Nrf2 translocation to the nuclei. HO-1 siRNA transient transfection reversed the effects of fisetin on cytoprotection, ROS reduction, NO, PGE2, IL-1β, IL-6, and TNF-α production, and NF-κB DNA-binding activity. Moreover, fisetin increased Akt phosphorylation and a PI3K pathway inhibitor (LY294002) abolished fisetin-induced cytoprotection and NO inhibition. Taken together, these results provide evidence for a beneficial role of fisetin in skin therapy. Copyright © 2015. Published by Elsevier B.V.

  8. 3D co-cultures of keratinocytes and melanocytes and cytoprotective effects on keratinocytes against reactive oxygen species by insect virus-derived protein microcrystals

    International Nuclear Information System (INIS)

    Shimabukuro, Junji; Yamaoka, Ayako; Murata, Ken-ichi; Kotani, Eiji; Hirano, Tomoko; Nakajima, Yumiko; Matsumoto, Goichi; Mori, Hajime

    2014-01-01

    Stable protein microcrystals called polyhedra are produced by certain insect viruses. Cytokines, such as fibroblast growth factors (FGFs), can be immobilized within polyhedra. Here, we investigated three-dimensional (3D) co-cultures of keratinocytes and melanocytes on collagen gel containing FGF-2 and FGF-7 polyhedra. Melanocytes were observed to reside at the base of the 3D cell culture and melanin was also typically observed in the lower layer. The 3D cell culture model with FGF-2 and FGF-7 polyhedra was a useful in vitro model of the epidermis due to effective melanogenesis, proliferation and differentiation of keratinocytes. FGF-7 polyhedra showed a potent cytoprotective effect when keratinocytes were treated with menadione, which is a generator of reactive oxygen species. The cytoprotective effect was activated by the inositol triphosphate kinase–Akt pathway leading to upregulation of the antioxidant enzymes superoxide dismutase and peroxiredoxin 6. - Highlights: • 3D cultures using FGF-2 and FGF-7 microcrystals as a human skin model • Cytoprotection of keratinocytes against ROS by FGF-7 microcrystals • Overexpression of SOD and Prdx6 in keratinocytes by FGF-7 microcrystals

  9. 3D co-cultures of keratinocytes and melanocytes and cytoprotective effects on keratinocytes against reactive oxygen species by insect virus-derived protein microcrystals

    Energy Technology Data Exchange (ETDEWEB)

    Shimabukuro, Junji; Yamaoka, Ayako; Murata, Ken-ichi [Department of Applied Biology, Kyoto Institute of Technology, Kyoto (Japan); Kotani, Eiji [Department of Applied Biology, Kyoto Institute of Technology, Kyoto (Japan); Insect Biomedical Research Center, Kyoto Institute of Technology, Kyoto (Japan); Hirano, Tomoko [Venture Laboratory, Kyoto Institute of Technology, Kyoto (Japan); Nakajima, Yumiko [Functional Genomics Group, COMB, Tropical Biosphere Research Center, University of the Ryukyus, Okinawa (Japan); Matsumoto, Goichi [Division of Oral Surgery, Yokohama Clinical Education Center of Kanagawa Dental University, Yokohama (Japan); Mori, Hajime, E-mail: hmori@kit.ac.jp [Department of Applied Biology, Kyoto Institute of Technology, Kyoto (Japan); Insect Biomedical Research Center, Kyoto Institute of Technology, Kyoto (Japan)

    2014-09-01

    Stable protein microcrystals called polyhedra are produced by certain insect viruses. Cytokines, such as fibroblast growth factors (FGFs), can be immobilized within polyhedra. Here, we investigated three-dimensional (3D) co-cultures of keratinocytes and melanocytes on collagen gel containing FGF-2 and FGF-7 polyhedra. Melanocytes were observed to reside at the base of the 3D cell culture and melanin was also typically observed in the lower layer. The 3D cell culture model with FGF-2 and FGF-7 polyhedra was a useful in vitro model of the epidermis due to effective melanogenesis, proliferation and differentiation of keratinocytes. FGF-7 polyhedra showed a potent cytoprotective effect when keratinocytes were treated with menadione, which is a generator of reactive oxygen species. The cytoprotective effect was activated by the inositol triphosphate kinase–Akt pathway leading to upregulation of the antioxidant enzymes superoxide dismutase and peroxiredoxin 6. - Highlights: • 3D cultures using FGF-2 and FGF-7 microcrystals as a human skin model • Cytoprotection of keratinocytes against ROS by FGF-7 microcrystals • Overexpression of SOD and Prdx6 in keratinocytes by FGF-7 microcrystals.

  10. Numerical Transducer Modeling

    DEFF Research Database (Denmark)

    Henriquez, Vicente Cutanda

    This thesis describes the development of a numerical model of the propagation of sound waves in fluids with viscous and thermal losses, with application to the simulation of acoustic transducers, in particular condenser microphones for measurement. The theoretical basis is presented, numerical...... manipulations are developed to satisfy the more complicated boundary conditions, and a model of a condenser microphone with a coupled membrane is developed. The model is tested against measurements of ¼ inch condenser microphones and analytical calculations. A detailed discussion of the results is given....

  11. Piezoelectric transducer array microspeaker

    KAUST Repository

    Carreno, Armando Arpys Arevalo

    2016-12-19

    In this paper we present the fabrication and characterization of a piezoelectric micro-speaker. The speaker is an array of micro-machined piezoelectric membranes, fabricated on silicon wafer using advanced micro-machining techniques. Each array contains 2n piezoelectric transducer membranes, where “n” is the bit number. Every element of the array has a circular shape structure. The membrane is made out four layers: 300nm of platinum for the bottom electrode, 250nm or lead zirconate titanate (PZT), a top electrode of 300nm and a structural layer of 50

  12. Ecklonia cava Extract and Dieckol Attenuate Cellular Lipid Peroxidation in Keratinocytes Exposed to PM10.

    Science.gov (United States)

    Lee, Jeong-Won; Seok, Jin Kyung; Boo, Yong Chool

    2018-01-01

    Airborne particulate matter can cause oxidative stress, inflammation, and premature skin aging. Marine plants such as Ecklonia cava Kjellman contain high amounts of polyphenolic antioxidants. The purpose of this study was to examine the antioxidative effects of E. cava extract in cultured keratinocytes exposed to airborne particulate matter with a diameter of <10  μ m (PM10). After the exposure of cultured HaCaT keratinocytes to PM10 in the absence and presence of E. cava extract and its constituents, cell viability and cellular lipid peroxidation were assessed. The effects of eckol and dieckol on cellular lipid peroxidation and cytokine expression were examined in human epidermal keratinocytes exposed to PM10. The total phenolic content of E. cava extract was the highest among the 50 marine plant extracts examined. The exposure of HaCaT cells to PM10 decreased cell viability and increased lipid peroxidation. The PM10-induced cellular lipid peroxidation was attenuated by E. cava extract and its ethyl acetate fraction. Dieckol more effectively attenuated cellular lipid peroxidation than eckol in both HaCaT cells and human epidermal keratinocytes. Dieckol and eckol attenuated the expression of inflammatory cytokines such as tumor necrosis factor- (TNF-) α , interleukin- (IL-) 1 β , IL-6, and IL-8 in human epidermal keratinocytes stimulated with PM10. This study suggested that the polyphenolic constituents of E. cava , such as dieckol, attenuated the oxidative and inflammatory reactions in skin cells exposed to airborne particulate matter.

  13. Comparison of epidermal keratinocytes and dermal fibroblasts as potential target cells for somatic gene therapy of phenylketonuria

    DEFF Research Database (Denmark)

    Christensen, Rikke; Güttler, Flemming; Jensen, Thomas G

    2002-01-01

    gene therapy. We have previously shown that overexpression of PAH and GTP-CH in primary human keratinocytes leads to high levels of phenylalanine clearance without BH(4) supplementation [Gene Ther. 7 (2000) 1971]. Here, we investigate the capacity of fibroblasts, another cell type from the skin......, to metabolize phenylalanine. After retroviral gene transfer of PAH and GTP-CH both normal and PKU patient fibroblasts were able to metabolize phenylalanine, however, in lower amounts compared to genetically modified keratinocytes. Further comparative analyses between keratinocytes and fibroblasts revealed...

  14. Lactobacillus rhamnosus GG Inhibits the Toxic Effects of Staphylococcus aureus on Epidermal Keratinocytes

    Science.gov (United States)

    Mohammedsaeed, Walaa; McBain, Andrew J.; Cruickshank, Sheena M.

    2014-01-01

    Few studies have evaluated the potential benefits of the topical application of probiotic bacteria or material derived from them. We have investigated whether a probiotic bacterium, Lactobacillus rhamnosus GG, can inhibit Staphylococcus aureus infection of human primary keratinocytes in culture. When primary human keratinocytes were exposed to S. aureus, only 25% of the keratinocytes remained viable following 24 h of incubation. However, in the presence of 108 CFU/ml of live L. rhamnosus GG, the viability of the infected keratinocytes increased to 57% (P = 0.01). L. rhamnosus GG lysates and spent culture fluid also provided significant protection to keratinocytes, with 65% (P = 0.006) and 57% (P = 0.01) of cells, respectively, being viable following 24 h of incubation. Keratinocyte survival was significantly enhanced regardless of whether the probiotic was applied in the viable form or as cell lysates 2 h before or simultaneously with (P = 0.005) or 12 h after (P = 0.01) S. aureus infection. However, spent culture fluid was protective only if added before or simultaneously with S. aureus. With respect to mechanism, both L. rhamnosus GG lysate and spent culture fluid apparently inhibited adherence of S. aureus to keratinocytes by competitive exclusion, but only viable bacteria or the lysate could displace S. aureus (P = 0.04 and 0.01, respectively). Furthermore, growth of S. aureus was inhibited by either live bacteria or lysate but not spent culture fluid. Together, these data suggest at least two separate activities involved in the protective effects of L. rhamnosus GG against S. aureus, growth inhibition and reduction of bacterial adhesion. PMID:25015889

  15. Cadmium, lead, and arsenic contamination in paddy soils of a mining area and their exposure effects on human HEPG2 and keratinocyte cell-lines.

    Science.gov (United States)

    Xue, Shengguo; Shi, Lizheng; Wu, Chuan; Wu, Hui; Qin, Yanyan; Pan, Weisong; Hartley, William; Cui, Mengqian

    2017-07-01

    A mining district in south China shows significant metal(loid) contamination in paddy fields. In the soils, average Pb, Cd and As concentrations were 460.1, 11.7 and 35.1mgkg -1 respectively, which were higher than the environmental quality standard for agricultural soils in China (GB15618-1995) and UK Clea Soil Guideline Value. The average contents of Pb, Cd and As in rice were 5.24, 1.1 and 0.7mgkg -1 respectively, which were about 25, 4.5 or 2.5 times greater than the limit values of the maximum safe contaminant concentration standard in food of China (GB 2762-2012), and about 25, 10 or 1 times greater than the limit values of FAO/WHO standard. The elevated contents of Pb, Cd and As detected in soils around the factories, indicated that their spatial distribution was influenced by anthropogenic activity, while greater concentrations of Cd in rice appeared in the northwest region of the factories, indicating that the spatial distribution of heavy metals was also affected by natural factors. As human exposure around mining districts is mainly through oral intake of food and dermal contact, the effects of these metals on the viability and MT protein of HepG2 and KERTr cells were investigated. The cell viability decreased with increasing metal concentrations. Co-exposure to heavy metals (Pb+Cd) increased the metals (Pb or Cd)-mediated MT protein induction in both human HepG2 and KERTr cells. Increased levels of MT protein will lead to greater risk of carcinogenic manifestations, and it is likely that chronic exposure to metals may increase the risk to human health. Nevertheless, when co-exposure to two or more metals occur (such as As+Pb), they may have an antagonistic effect thus reducing the toxic effects of each other. Metal contaminations in paddy soils and rice were influenced by anthropogenic activity; metal co-exposure induced MT protein in human cells. Copyright © 2017 Elsevier Inc. All rights reserved.

  16. Effects of 12-O-tetradecanoyl-phorbol-13-acetate [corrected] and sodium lauryl sulfate on the production and expression of cytokines and proto-oncogenes in photoaged and intrinsically aged human keratinocytes.

    Science.gov (United States)

    Suh, D H; Youn, J I; Eun, H C

    2001-11-01

    Skin aging may be divided into photoaging and intrinsic aging. The purpose of this study was to investigate the effects of 12-O-tetradecanoyl-phorbol-13-acetate and sodium lauryl sulfate on the production and expression of cytokines and proto-oncogenes in photoaged and intrinsically aged skin, compared with young skin. Keratinocytes were taken from newborns, young adults in their twenties, and from the forearm and thigh of volunteers in their fifties and seventies. Interleukin-1alpha and -6, and interleukin-1 receptor antagonist, c-fos and c-myc were measured after cultured keratinocytes had been treated with 12-O-tetradecanoyl-phorbol-13-acetate and sodium lauryl sulfate. There has been no report concerning the dependence of cytokine production by sodium lauryl sulfate upon photoaging and intrinsic aging. This study also involves the first investigation of the effects of aging on c-myc expression by 12-O-tetradecanoyl-phorbol-13-acetate treatment. Cytokine production decreased markedly with age. These results suggest the progressive decline of cellular function with age. The ratio of cytokine production in the irritant-treated group compared with that in the control group showed a different pattern in photoaging and intrinsic aging. With the significant difference between photoaging and intrinsic aging, T/C ratio decreased in interleukin-1alpha and interleukin-1 receptor antagonist upon aging, whereas it increased in interleukin-6. S/C ratio was uniquely elevated on photoaged skin in the 50 y age group. It is suggested that photoaged skin shows an exaggerated reaction to surfactant. Compared with the control, c-fos expression in 12-O-tetradecanoyl-phorbol-13-acetate-treated keratinocytes decreased with age in the thigh, but increased in the photoaged skin of forearm. The increased c-fos expression in 12-O-tetradecanoyl-phorbol-13-acetate-treated keratinocytes could be relevant for the predisposition of photoaged keratinocytes to malignant transformation.

  17. Comparison of the rate of uptake and biologic effects of retinol added to human keratinocytes either directly to the culture medium or bound to serum retinol-binding protein

    International Nuclear Information System (INIS)

    Hodam, J.R.; St Hilaire, P.; Creek, K.E.

    1991-01-01

    Retinol circulates in the plasma bound to retinol-binding protein (RBP), but the mechanism by which retinol is transferred from RBP to target cells is not known. To study retinol delivery, human keratinocytes (HKc) were incubated with [3H]retinol added directly to the culture medium or bound to RBP and the uptake of [3H]retinol was determined at various times. During the first hour of incubation, the rate of [3H]retinol accumulation by HKc was about 40 times greater when the vitamin was added directly to the media rather than bound to RBP. Although maximal uptake of [3H]retinol added directly to the culture medium occurred at 3 h, the uptake of [3H]retinol from RBP was linear with time for at least 72 h. By 57 h, cell-associated [3H]retinol was the same whether it was added directly to the culture medium or bound to RBP. Excess unlabeled retinol or pretreatment of HKc with retinol had no effect on the uptake of [3H]retinol added directly to the culture medium or bound to RBP. Apo- but not holo-RBP was capable of competing with HKc for the uptake of [3H]retinol from RBP. No specific or saturable binding of 125I-labeled RBP to HKc cultured in the absence or the presence of retinol was found. The dose response of retinol inhibition of cholesterol sulfate synthesis and phorbol ester-induced ornithine decarboxylase activity or retinol modulation of keratin expression was the same whether the retinol was delivered to HKc bound to RBP or added directly to the medium. Our data support a mechanism for retinol delivery from RBP to HKc that does not involve cell-surface RBP receptors but instead suggest that the vitamin is first slowly released from RBP and then becomes cell-associated from the aqueous phase. This mechanism is consistent with the finding that HKc respond identically to retinol whether or not it is delivered to them bound to RBP

  18. Interferon-gamma up-regulates a unique set of proteins in human keratinocytes. Molecular cloning and expression of the cDNA encoding the RGD-sequence-containing protein IGUP I-5111

    DEFF Research Database (Denmark)

    Honoré, B; Leffers, H; Madsen, Peder

    1993-01-01

    AMP (Bt2cAMP), dibutyryl cGMP (Bt2cGMP)] and compounds known to affect keratinocytes [4 beta-phorbol 12-myristate 13-acetate (PMA), retinoic acid, Ca2+, dexamethasone, lipopolysaccharides, foetal calf serum]. Protein IGUP I-5111 was selected for further studies as its level is affected by simian-virus-40......, which migrated with the AMA variant of keratinocyte protein IEF SSP 5111, is novel although it exhibits weak similarity to cytoskeletal proteins. IGUP I-5111 contains the RGD sequence found in many extracellular glycoprotein ligands of the integrin receptor family and it is found at least partially...... in the culture supernatant. Considering the presence of IFN-gamma in psoriatic plaques as well as its putative involvement in the pathophysiology of the disease it was of interest to determine whether the set of proteins was upregulated in these cells. Two-dimensional gel analysis of the protein phenotype of non-cultured...

  19. Air-Stimulated ATP Release from Keratinocytes Occurs through Connexin Hemichannels

    Science.gov (United States)

    Barr, Travis P.; Albrecht, Phillip J.; Hou, Quanzhi; Mongin, Alexander A.; Strichartz, Gary R.; Rice, Frank L.

    2013-01-01

    Cutaneous ATP release plays an important role in both epidermal stratification and chronic pain, but little is known about ATP release mechanisms in keratinocytes that comprise the epidermis. In this study, we analyzed ATP release from cultured human neonatal keratinocytes briefly exposed to air, a process previously demonstrated to trigger ATP release from these cells. We show that exposing keratinocytes to air by removing media for 15 seconds causes a robust, long-lasting ATP release. This air-stimulated ATP release was increased in calcium differentiated cultures which showed a corresponding increase in connexin 43 mRNA, a major component of keratinocyte hemichannels. The known connexin hemichannel inhibitors 1-octanol and carbenoxolone both significantly reduced air-stimulated ATP release, as did two drugs traditionally used as ABC transporter inhibitors (glibenclamide and verapamil). These same 4 inhibitors also prevented an increase in the uptake of a connexin permeable dye induced by air exposure, confirming that connexin hemichannels are open during air-stimulated ATP release. In contrast, activity of the MDR1 ABC transporter was reduced by air exposure and the drugs that inhibited air-stimulated ATP release had differential effects on this transporter. These results indicate that air exposure elicits non-vesicular release of ATP from keratinocytes through connexin hemichannels and that drugs used to target connexin hemichannels and ABC transporters may cross-inhibit. Connexins represent a novel, peripheral target for the treatment of chronic pain and dermatological disease. PMID:23457608

  20. Galectin-7 overexpression is associated with the apoptotic process in UVB-induced sunburn keratinocytes

    Science.gov (United States)

    Bernerd, Francoise; Sarasin, Alain; Magnaldo, Thierry

    1999-01-01

    Galectin-7 is a β-galactoside binding protein specifically expressed in stratified epithelia and notably in epidermis, but barely detectable in epidermal tumors and absent from squamous carcinoma cell lines. Galectin-7 gene is an early transcriptional target of the tumor suppressor protein P53 [Polyak, K., Xia, Y., Zweier, J., Kinzler, K. & Vogelstein, B. (1997) Nature (London) 389, 300–305]. Because p53 transcriptional activity is increased by genotoxic stresses we have examined the possible effects of ultraviolet radiations (UVB) on galectin-7 expression in epidermal keratinocytes. The amounts of galectin-7 mRNA and protein are increased rapidly after UVB irradiation of epidermal keratinocytes. The increase of galectin-7 is parallel to P53 stabilization. UVB irradiation of skin reconstructed in vitro and of human skin ex vivo demonstrates that galectin-7 overexpression is associated with sunburn/apoptotic keratinocytes. Transfection of a galectin-7 expression vector results in a significant increase in terminal deoxynucleotidyltransferase-mediated UTP end labeling-positive keratinocytes. The present findings demonstrate a keratinocyte-specific protein involved in the UV-induced apoptosis, an essential process in the maintenance of epidermal homeostasis. PMID:10500176

  1. GRHL3 binding and enhancers rearrange as epidermal keratinocytes transition between functional states.

    Directory of Open Access Journals (Sweden)

    Rachel Herndon Klein

    2017-04-01

    Full Text Available Transcription factor binding, chromatin modifications and large scale chromatin re-organization underlie progressive, irreversible cell lineage commitments and differentiation. We know little, however, about chromatin changes as cells enter transient, reversible states such as migration. Here we demonstrate that when human progenitor keratinocytes either differentiate or migrate they form complements of typical enhancers and super-enhancers that are unique for each state. Unique super-enhancers for each cellular state link to gene expression that confers functions associated with the respective cell state. These super-enhancers are also enriched for skin disease sequence variants. GRHL3, a transcription factor that promotes both differentiation and migration, binds preferentially to super-enhancers in differentiating keratinocytes, while during migration, it binds preferentially to promoters along with REST, repressing the expression of migration inhibitors. Key epidermal differentiation transcription factor genes, including GRHL3, are located within super-enhancers, and many of these transcription factors in turn bind to and regulate super-enhancers. Furthermore, GRHL3 represses the formation of a number of progenitor and non-keratinocyte super-enhancers in differentiating keratinocytes. Hence, chromatin relocates GRHL3 binding and enhancers to regulate both the irreversible commitment of progenitor keratinocytes to differentiation and their reversible transition to migration.

  2. Keratinocyte-derived laminin-332 protein promotes melanin synthesis via regulation of tyrosine uptake.

    Science.gov (United States)

    Chung, Heesung; Jung, Hyejung; Lee, Jung-Hyun; Oh, Hye Yun; Kim, Ok Bin; Han, Inn-Oc; Oh, Eok-Soo

    2014-08-01

    Melanocytes, which produce the pigment melanin, are known to be closely regulated by neighboring keratinocytes. However, how keratinocytes regulate melanin production is unclear. Here we report that melanin production in melanoma cells (B16F10 and MNT-1) was increased markedly on a keratinocyte-derived extracellular matrix compared with a melanoma cell-derived extracellular matrix. siRNA-mediated reduction of keratinocyte-derived laminin-332 expression decreased melanin synthesis in melanoma cells, and laminin-332, but not fibronectin, enhanced melanin content and α-melanocyte-stimulating hormone-regulated melanin production in melanoma cells. Similar effects were observed in human melanocytes. Interestingly, however, laminin-332 did not affect the expression or activity of tyrosinase. Instead, laminin-332 promoted the uptake of extracellular tyrosine and, subsequently, increased intracellular levels of tyrosine in both melanocytes and melanoma cells. Taken together, these data strongly suggest that keratinocyte-derived laminin-332 contributes to melanin production by regulating tyrosine uptake. © 2014 by The American Society for Biochemistry and Molecular Biology, Inc.

  3. Circuit for Driving Piezoelectric Transducers

    Science.gov (United States)

    Randall, David P.; Chapsky, Jacob

    2009-01-01

    The figure schematically depicts an oscillator circuit for driving a piezoelectric transducer to excite vibrations in a mechanical structure. The circuit was designed and built to satisfy application-specific requirements to drive a selected one of 16 such transducers at a regulated amplitude and frequency chosen to optimize the amount of work performed by the transducer and to compensate for both (1) temporal variations of the resonance frequency and damping time of each transducer and (2) initially unknown differences among the resonance frequencies and damping times of different transducers. In other words, the circuit is designed to adjust itself to optimize the performance of whichever transducer is selected at any given time. The basic design concept may be adaptable to other applications that involve the use of piezoelectric transducers in ultrasonic cleaners and other apparatuses in which high-frequency mechanical drives are utilized. This circuit includes three resistor-capacitor networks that, together with the selected piezoelectric transducer, constitute a band-pass filter having a peak response at a frequency of about 2 kHz, which is approximately the resonance frequency of the piezoelectric transducers. Gain for generating oscillations is provided by a power hybrid operational amplifier (U1). A junction field-effect transistor (Q1) in combination with a resistor (R4) is used as a voltage-variable resistor to control the magnitude of the oscillation. The voltage-variable resistor is part of a feedback control loop: Part of the output of the oscillator is rectified and filtered for use as a slow negative feedback to the gate of Q1 to keep the output amplitude constant. The response of this control loop is much slower than 2 kHz and, therefore, does not introduce significant distortion of the oscillator output, which is a fairly clean sine wave. The positive AC feedback needed to sustain oscillations is derived from sampling the current through the

  4. Micromachined Integrated Transducers for Ultrasound Imaging

    DEFF Research Database (Denmark)

    la Cour, Mette Funding

    The purpose of this project is to develop capacitive micromachined ultrasonic transducers (CMUTs) for medical imaging. Medical ultrasound transducers used today are fabricated using piezoelectric materials and bulk processing. To fabricate transducers capable of delivering a higher imaging...

  5. Quercetin inhibits the poly(dA:dT)-induced secretion of IL-18 via down-regulation of the expressions of AIM2 and pro-caspase-1 by inhibiting the JAK2/STAT1 pathway in IFN-γ-primed human keratinocytes.

    Science.gov (United States)

    Lee, Kyung-Mi; Kang, Jung Hoon; Yun, Mihee; Lee, Seong-Beom

    2018-06-05

    Quercetin, a polyphenol, belongs to a class of flavonoids that exerts anti-inflammatory effects. Interleukin (IL)-18 is a member of the IL-1 family cytokine that regulates immune responses and is implicated in various inflammatory skin diseases. Absent in melanoma 2 (AIM2) is a cytosolic double-stranded (ds) DNA sensor that recognizes the dsDNA of a microbial or host origin. Binding of dsDNA to AIM2 simulates caspase-1-dependent inflammasome activity, which leads to the production of IL-1β and IL-18. Increased levels of AIM2 have been observed in patients with inflammatory skin diseases. In the current study, we investigated the issue of whether or how Quercetin attenuates poly (dA:dT), a synthetic analog of microbial dsDNA, -induced IL-18 secretion in IFN-γ-primed human keratinocytes. Treatment with 5 and 10 μM of Quercetin inhibited the poly (dA:dT)-induced secretion of IL-18 after IFN-γ priming and before poly (dA:dT)-induced AIM2 activation. In addition, treatment with Quercetin at 10 μM, significantly inhibited the phosphorylation of JAK2 and STAT1, and the nuclear translocation of phosphorylated STAT1 in poly (dA:dT)-treated and IFN-γ-primed keratinocytes. These results suggest that treatment with Quercetin inhibits the poly (dA:dT)-induced secretion of IL-18 via down-regulation of the expressions of AIM2 and pro-caspase-1 by inhibiting the JAK2/STAT1 pathway in IFN-γ-primed keratinocytes. Copyright © 2018 Elsevier Inc. All rights reserved.

  6. In vitro induction of matrix metalloproteinase-2 and matrix metalloproteinase-9 expression in keratinocytes by boron and manganese.

    Science.gov (United States)

    Chebassier, Nathalie; El Houssein, Ouijja; Viegas, Isabelle; Dréno, Brigitte

    2004-08-01

    Matrix metalloproteinase (MMP)-2 and MMP-9 are involved in keratinocyte migration and granulation tissue remodeling during wound healing. Thermal water cures are sometimes proposed as complementary treatment for accelerating healing of wounds resulting from burns and/or surgery, but their mechanisms of action remain unknown. Some thermal waters are rich in trace elements such as boron and manganese. Interestingly, clinical studies have shown the beneficial effects of trace elements such as boron and manganese for human wound healing. To try to specify the role of trace elements in cutaneous healing, the present study investigated the effects of these trace elements on the production of MMP-2 and MMP-9 by normal human keratinocytes cultured in vitro. Immunohistochemistry and Western blot showed that intracellular MMP-9 expression in keratinocytes was induced when incubated for 6 h with boron at 10 micro g/ml or manganese at 0.2 micro g/ml. Moreover, gelatin zymography on keratinocyte supernatants showed an increase of gelatinase secretion after 24 h of incubation of keratinocytes with boron or manganese, regardless of concentration. Gelatinase secretion was not associated with keratinocyte proliferation induced by trace elements. Thus, our results suggest that boron and manganese could play a role in the clinical efficiency of thermal water on wound healing.

  7. An enzyme logic bioprotonic transducer

    Energy Technology Data Exchange (ETDEWEB)

    Miyake, Takeo; Keene, Scott; Deng, Yingxin; Rolandi, Marco, E-mail: rolandi@uw.edu [Department of Materials Science and Engineering, University of Washington, Seattle, Washington 98195-2120 (United States); Josberger, Erik E. [Department of Materials Science and Engineering, University of Washington, Seattle, Washington 98195-2120 (United States); Department of Electrical Engineering, University of Washington, Seattle, Washington 98195-2500 (United States)

    2015-01-01

    Translating ionic currents into measureable electronic signals is essential for the integration of bioelectronic devices with biological systems. We demonstrate the use of a Pd/PdH{sub x} electrode as a bioprotonic transducer that connects H{sup +} currents in solution into an electronic signal. This transducer exploits the reversible formation of PdH{sub x} in solution according to PdH↔Pd + H{sup +} + e{sup −}, and the dependence of this formation on solution pH and applied potential. We integrate the protonic transducer with glucose dehydrogenase as an enzymatic AND gate for glucose and NAD{sup +}. PdH{sub x} formation and associated electronic current monitors the output drop in pH, thus transducing a biological function into a measurable electronic output.

  8. Selenoproteins are essential for proper keratinocyte function and skin development.

    Directory of Open Access Journals (Sweden)

    Aniruddha Sengupta

    2010-08-01

    Full Text Available Dietary selenium is known to protect skin against UV-induced damage and cancer and its topical application improves skin surface parameters in humans, while selenium deficiency compromises protective antioxidant enzymes in skin. Furthermore, skin and hair abnormalities in humans and rodents may be caused by selenium deficiency, which are overcome by dietary selenium supplementation. Most important biological functions of selenium are attributed to selenoproteins, proteins containing selenium in the form of the amino acid, selenocysteine (Sec. Sec insertion into proteins depends on Sec tRNA; thus, knocking out the Sec tRNA gene (Trsp ablates selenoprotein expression. We generated mice with targeted removal of selenoproteins in keratin 14 (K14 expressing cells and their differentiated descendents. The knockout progeny had a runt phenotype, developed skin abnormalities and experienced premature death. Lack of selenoproteins in epidermal cells led to the development of hyperplastic epidermis and aberrant hair follicle morphogenesis, accompanied by progressive alopecia after birth. Further analyses revealed that selenoproteins are essential antioxidants in skin and unveiled their role in keratinocyte growth and viability. This study links severe selenoprotein deficiency to abnormalities in skin and hair and provides genetic evidence for the role of these proteins in keratinocyte function and cutaneous development.

  9. Concentration-dependent effect of platelet-rich plasma on keratinocyte and fibroblast wound healing.

    Science.gov (United States)

    Xian, Law Jia; Chowdhury, Shiplu Roy; Bin Saim, Aminuddin; Idrus, Ruszymah Bt Hj

    2015-03-01

    Platelet-rich plasma (PRP) has been found to contain a high concentration of growth factors that are present during the process of healing. Studies conducted found that application of PRP accelerates wound healing. In this study, we characterized the skin cell suspension harvested using the co-isolation technique and evaluated the effects of PRP (10% and 20%, v/v) on co-cultured keratinocytes and fibroblasts in terms of wound healing. Human keratinocytes and fibroblasts were harvested via co-isolation technique and separated via differential trypsinization. These cells were then indirectly co-cultured in medium supplemented with 10% or 20% PRP for 3 days without medium change for analysis of wound-healing potential. The wound-healing potential of keratinocytes and fibroblasts was evaluated in terms of growth property, migratory property, extracellular matrix gene expression and soluble factor secretion. The co-isolation technique yielded a skin cell population dominated by fibroblasts and keratinocytes, with a small amount of melanocytes. Comparison between the 10% and 20% PRP cultures showed that the 10% PRP culture exhibited higher keratinocyte apparent specific growth rate, and secretion of hepatocyte growth factor, monocyte chemoattractant protein-1, epithelial-derived neutrophil-activating protein 78 and vascular endothelial growth factor A, whereas the 20% PRP culture has significantly higher collagen type 1 and collagen type 3 expressions and produced more granulocyte-macrophage colony-stimulating factor. PRP concentration modulates keratinocyte and fibroblast wound healing potential, whereby the 10% PRP promotes wound remodeling, whereas the 20% PRP enhances inflammation and collagen deposition. Copyright © 2015 International Society for Cellular Therapy. Published by Elsevier Inc. All rights reserved.

  10. Chemical peeling by SA-PEG remodels photo-damaged skin: suppressing p53 expression and normalizing keratinocyte differentiation.

    Science.gov (United States)

    Dainichi, Teruki; Amano, Satoshi; Matsunaga, Yukiko; Iriyama, Shunsuke; Hirao, Tetsuji; Hariya, Takeshi; Hibino, Toshihiko; Katagiri, Chika; Takahashi, Motoji; Ueda, Setsuko; Furue, Masutaka

    2006-02-01

    Chemical peeling with salicylic acid in polyethylene glycol vehicle (SA-PEG), which specifically acts on the stratum corneum, suppresses the development of skin tumors in UVB-irradiated hairless mice. To elucidate the mechanism through which chemical peeling with SA-PEG suppresses skin tumor development, the effects of chemical peeling on photodamaged keratinocytes and cornified envelopes (CEs) were evaluated in vivo. Among UVB-irradiated hairless mice, the structural atypia and expression of p53 protein in keratinocytes induced by UVB irradiation were intensely suppressed in the SA-PEG-treated mice 28 days after the start of weekly SA-PEG treatments when compared to that in the control UVB-irradiated mice. Incomplete expression of filaggrin and loricrin in keratinocytes from the control mice was also improved in keratinocytes from the SA-PEG-treated mice. In photo-exposed human facial skin, immature CEs were replaced with mature CEs 4 weeks after treatment with SA-PEG. Restoration of photodamaged stratum corneum by treatment with SA-PEG, which may affect remodeling of the structural environment of the keratinocytes, involved the normalization of keratinocyte differentiation and suppression of skin tumor development. These results suggest that the stratum corneum plays a protective role against carcinogenesis, and provide a novel strategy for the prevention of photo-induced skin tumors.

  11. AAV vector encoding human VEGF165-transduced pectineus muscular flaps increase the formation of new tissue through induction of angiogenesis in an in vivo chamber for tissue engineering: A technique to enhance tissue and vessels in microsurgically engineered tissue.

    Science.gov (United States)

    Moimas, Silvia; Manasseri, Benedetto; Cuccia, Giuseppe; Stagno d'Alcontres, Francesco; Geuna, Stefano; Pattarini, Lucia; Zentilin, Lorena; Giacca, Mauro; Colonna, Michele R

    2015-01-01

    In regenerative medicine, new approaches are required for the creation of tissue substitutes, and the interplay between different research areas, such as tissue engineering, microsurgery and gene therapy, is mandatory. In this article, we report a modification of a published model of tissue engineering, based on an arterio-venous loop enveloped in a cross-linked collagen-glycosaminoglycan template, which acts as an isolated chamber for angiogenesis and new tissue formation. In order to foster tissue formation within the chamber, which entails on the development of new vessels, we wondered whether we might combine tissue engineering with a gene therapy approach. Based on the well-described tropism of adeno-associated viral vectors for post-mitotic tissues, a muscular flap was harvested from the pectineus muscle, inserted into the chamber and transduced by either AAV vector encoding human VEGF165 or AAV vector expressing the reporter gene β-galactosidase, as a control. Histological analysis of the specimens showed that muscle transduction by AAV vector encoding human VEGF165 resulted in enhanced tissue formation, with a significant increase in the number of arterioles within the chamber in comparison with the previously published model. Pectineus muscular flap, transduced by adeno-associated viral vectors, acted as a source of the proangiogenic factor vascular endothelial growth factor, thus inducing a consistent enhancement of vessel growth into the newly formed tissue within the chamber. In conclusion, our present findings combine three different research fields such as microsurgery, tissue engineering and gene therapy, suggesting and showing the feasibility of a mixed approach for regenerative medicine.

  12. Characterization of Dielectric Electroactive Polymer transducers

    DEFF Research Database (Denmark)

    Nielsen, Dennis; Møller, Martin B.; Sarban, Rahimullah

    2014-01-01

    This paper analysis the small-signal model of the Dielectric Electro Active Polymer (DEAP) transducer. The DEAP transducer have been proposed as an alternative to the electrodynamic transducer in sound reproduction systems. In order to understand how the DEAP transducer works, and provide...

  13. Pimecrolimus enhances TLR2/6-induced expression of antimicrobial peptides in keratinocytes.

    Science.gov (United States)

    Büchau, Amanda S; Schauber, Jürgen; Hultsch, Thomas; Stuetz, Anton; Gallo, Richard L

    2008-11-01

    Calcineurin inhibitors are potent inhibitors of T-cell-receptor mediated activation of the adaptive immune system. The effects of this class of drug on the innate immune response system are not known. Keratinocytes are essential to innate immunity in skin and rely on toll-like receptors (TLRs) and antimicrobial peptides to appropriately recognize and respond to injury or microbes. In this study we examined the response of cultured human keratinocytes to pimecrolimus. We observed that pimecrolimus enhances distinct expression of cathelicidin, CD14, and human beta-defensin-2 and beta-defensin-3 in response to TLR2/6 ligands. Some of these responses were further enhanced by 1,25 vitamin D3. Pimecrolimus also increased the functional capacity of keratinocytes to inhibit growth of Staphylococcus aureus and decreased TLR2/6-induced expression of IL-10 and IL-1beta. Furthermore, pimecrolimus inhibited nuclear translocation of NFAT and NF-kappaB in keratinocytes. These observations uncover a previously unreported function for pimecrolimus in cutaneous innate host defense.

  14. Melanosomes are transferred from melanocytes to keratinocytes through the processes of packaging, release, uptake, and dispersion.

    Science.gov (United States)

    Ando, Hideya; Niki, Yoko; Ito, Masaaki; Akiyama, Kaoru; Matsui, Mary S; Yarosh, Daniel B; Ichihashi, Masamitsu

    2012-04-01

    Recent studies have described the role of shedding vesicles as physiological conveyers of intracellular components between neighboring cells. Here we report that melanosomes are one example of shedding vesicle cargo, but are processed by a previously unreported mechanism. Pigment globules were observed to be connected to the filopodia of melanocyte dendrites, which have previously been shown to be conduits for melanosomes. Pigment globules containing multiple melanosomes were released from various areas of the dendrites of normal human melanocytes derived from darkly pigmented skin. The globules were then captured by the microvilli of normal human keratinocytes, also derived from darkly pigmented skin, which incorporated them in a protease-activated receptor-2 (PAR-2)-dependent manner. After the pigment globules were ingested by the keratinocytes, the membrane that surrounded each melanosome cluster was gradually degraded, and the individual melanosomes then spread into the cytosol and were distributed primarily in the perinuclear area of each keratinocyte. These results suggest a melanosome transfer pathway wherein melanosomes are transferred from melanocytes to keratinocytes via the shedding vesicle system. This packaging system generates pigment globules containing multiple melanosomes in a unique manner.

  15. Auto-positioning ultrasonic transducer system

    Science.gov (United States)

    Buchanan, Randy K. (Inventor)

    2010-01-01

    An ultrasonic transducer apparatus and process for determining the optimal transducer position for flow measurement along a conduit outer surface. The apparatus includes a transmitting transducer for transmitting an ultrasonic signal, said transducer affixed to a conduit outer surface; a guide rail attached to a receiving transducer for guiding movement of a receiving transducer along the conduit outer surface, wherein the receiving transducer receives an ultrasonic signal from the transmitting transducer and sends a signal to a data acquisition system; and a motor for moving the receiving transducer along the guide rail, wherein the motor is controlled by a controller. The method includes affixing a transmitting transducer to an outer surface of a conduit; moving a receiving transducer on the conduit outer surface, wherein the receiving transducer is moved along a guide rail by a motor; transmitting an ultrasonic signal from the transmitting transducer that is received by the receiving transducer; communicating the signal received by the receiving transducer to a data acquisition and control system; and repeating the moving, transmitting, and communicating along a length of the conduit.

  16. Keratinocyte proliferation, differentiation, and apoptosis-Differential mechanisms of regulation by curcumin, EGCG and apigenin

    International Nuclear Information System (INIS)

    Balasubramanian, Sivaprakasam; Eckert, Richard L.

    2007-01-01

    We have proposed that it is important to examine the impact of chemopreventive agents on the function of normal human epidermal keratinocytes since these cells comprise the barrier that protects the body from a range of environmental insults. In this context, it is widely appreciated that cancer may be retarded by consumption or topical application of naturally occurring food-derived chemopreventive agents. Our studies show that (-)-epigallocatechin-3-gallate (EGCG), a green tea-derived polyphenol, acts to enhance the differentiation of normal human keratinocytes as evidenced by its ability to increase involucrin (hINV), transglutaminase type 1 (TG1) and caspase-14 gene expression. EGCG also stimulates keratinocyte morphological differentiation. These actions of EGCG are mediated via activation of a nPKC, Ras, MEKK1, MEK3, p38δ-ERK1/2 signaling cascade which leads to increased activator protein 1 (AP1) and CAATT enhancer binding protein (C/EBP) transcription factor expression, increased binding of these factors to DNA, and increased gene transcription. In contrast, apigenin, a dietary flavonoid derived from plants and vegetables, and curcumin, an agent derived from turmeric, inhibit differentiation by suppressing MAPK signal transduction and reducing API transcription factor level. Curcumin also acts to enhance apoptosis, although EGCG and apigenin do not stimulate apoptosis. In addition, all of these agents inhibit keratinocyte proliferation. These findings indicate that each of these diet-derived chemopreventive agents has a profound impact on normal human keratinocyte function and that they operate via distinct and sometimes opposing mechanisms. However, all are expected to act as chemopreventive agents

  17. Cryopreservation of dermal fibroblasts and keratinocytes in hydroxyethyl starch-based cryoprotectants.

    Science.gov (United States)

    Naaldijk, Yahaira; Johnson, Adiv A; Friedrich-Stöckigt, Annett; Stolzing, Alexandra

    2016-12-01

    Preservation of human skin fibroblasts and keratinocytes is essential for the creation of skin tissue banks. For successful cryopreservation of cells, selection of an appropriate cryoprotectant agent (CPA) is imperative. The aim of this study was to identify CPAs that minimize toxic effects and allow for the preservation of human fibroblasts and keratinocytes in suspension and in monolayers. We cryopreserved human fibroblasts and keratinocytes with different CPAs and compared them to fresh, unfrozen cells. Cells were frozen in the presence and absence of hydroxyethyl starch (HES) or dimethyl sulfoxide (DMSO), the latter of which is a commonly used CPA known to exert toxic effects on cells. Cell numbers were counted immediately post-thaw as well as three days after thawing. Cellular structures were analyzed and counted by labeling nuclei, mitochondria, and actin filaments. We found that successful cryopreservation of suspended or adherent keratinocytes can be accomplished with a 10% HES or a 5% HES, 5% DMSO solution. Cell viability of fibroblasts cryopreserved in suspension was maintained with 10% HES or 5% HES, 5% DMSO solutions. Adherent, cryopreserved fibroblasts were successfully maintained with a 5% HES, 5% DMSO solution. We conclude that skin tissue cells can be effectively cryopreserved by substituting all or a portion of DMSO with HES. Given that DMSO is the most commonly used CPA and is believed to be more toxic than HES, these findings are of clinical significance for tissue-based replacement therapies. Therapies that require the use of keratinocyte and fibroblast cells, such as those aimed at treating skin wounds or skin burns, may be optimized by substituting a portion or all of DMSO with HES during cryopreservation protocols.

  18. Model of a Piezoelectric Transducer

    Science.gov (United States)

    Goodenow, Debra

    2004-01-01

    It's difficult to control liquid and gas in propellant tanks in zero gravity. A possible a design would utilize acoustic liquid manipulation (ALM) technology which uses ultrasonic beams conducted through a liquid and solid media, to push gas bubbles in the liquid to desirable locations. We can propel and control the bubble with acoustic radiation pressure by aiming the acoustic waves on the bubble s surface. This allows us to design a so called smart tank in which the ALM devices transfer the gas to the outer wall of the tank and isolating the liquid in the center. Because the heat transfer rate of a gas is lower of that of the liquid it would substantially decrease boil off and provide of for a longer storage life. The ALM beam is composed of little wavelets which are individual waves that constructively interfere with each other to produce a single, combined acoustic wave front. This is accomplished by using a set of synchronized ultrasound transducers arranged in an array. A slight phase offset of these elements allows us to focus and steer the beam. The device that we are using to produce the acoustic beam is called the piezoelectric transducer. This device converts electrical energy to mechanical energy, which appears in the form of acoustic energy. Therefore the behavior of the device is dependent on both the mechanical characteristics, such as its density, cross-sectional area, and its electrical characteristics, such as, electric flux permittivity and coupling factor. These devices can also be set up in a number of modes which are determined by the way the piezoelectric device is arranged, and the shape of the transducer. For this application we are using the longitudinal or thickness mode for our operation. The transducer also vibrates in the lateral mode, and one of the goals of my project is to decrease the amount of energy lost to the lateral mode. To model the behavior of the transducers I will be using Pspice, electric circuit modeling tool, to

  19. Home Automation System Based on Intelligent Transducer Enablers

    Science.gov (United States)

    Suárez-Albela, Manuel; Fraga-Lamas, Paula; Fernández-Caramés, Tiago M.; Dapena, Adriana; González-López, Miguel

    2016-01-01

    This paper presents a novel home automation system named HASITE (Home Automation System based on Intelligent Transducer Enablers), which has been specifically designed to identify and configure transducers easily and quickly. These features are especially useful in situations where many transducers are deployed, since their setup becomes a cumbersome task that consumes a significant amount of time and human resources. HASITE simplifies the deployment of a home automation system by using wireless networks and both self-configuration and self-registration protocols. Thanks to the application of these three elements, HASITE is able to add new transducers by just powering them up. According to the tests performed in different realistic scenarios, a transducer is ready to be used in less than 13 s. Moreover, all HASITE functionalities can be accessed through an API, which also allows for the integration of third-party systems. As an example, an Android application based on the API is presented. Remote users can use it to interact with transducers by just using a regular smartphone or a tablet. PMID:27690031

  20. Home Automation System Based on Intelligent Transducer Enablers.

    Science.gov (United States)

    Suárez-Albela, Manuel; Fraga-Lamas, Paula; Fernández-Caramés, Tiago M; Dapena, Adriana; González-López, Miguel

    2016-09-28

    This paper presents a novel home automation system named HASITE (Home Automation System based on Intelligent Transducer Enablers), which has been specifically designed to identify and configure transducers easily and quickly. These features are especially useful in situations where many transducers are deployed, since their setup becomes a cumbersome task that consumes a significant amount of time and human resources. HASITE simplifies the deployment of a home automation system by using wireless networks and both self-configuration and self-registration protocols. Thanks to the application of these three elements, HASITE is able to add new transducers by just powering them up. According to the tests performed in different realistic scenarios, a transducer is ready to be used in less than 13 s. Moreover, all HASITE functionalities can be accessed through an API, which also allows for the integration of third-party systems. As an example, an Android application based on the API is presented. Remote users can use it to interact with transducers by just using a regular smartphone or a tablet.

  1. Home Automation System Based on Intelligent Transducer Enablers

    Directory of Open Access Journals (Sweden)

    Manuel Suárez-Albela

    2016-09-01

    Full Text Available This paper presents a novel home automation system named HASITE (Home Automation System based on Intelligent Transducer Enablers, which has been specifically designed to identify and configure transducers easily and quickly. These features are especially useful in situations where many transducers are deployed, since their setup becomes a cumbersome task that consumes a significant amount of time and human resources. HASITE simplifies the deployment of a home automation system by using wireless networks and both self-configuration and self-registration protocols. Thanks to the application of these three elements, HASITE is able to add new transducers by just powering them up. According to the tests performed in different realistic scenarios, a transducer is ready to be used in less than 13 s. Moreover, all HASITE functionalities can be accessed through an API, which also allows for the integration of third-party systems. As an example, an Android application based on the API is presented. Remote users can use it to interact with transducers by just using a regular smartphone or a tablet.

  2. Death penalty for keratinocytes: apoptosis versus cornification.

    Science.gov (United States)

    Lippens, S; Denecker, G; Ovaere, P; Vandenabeele, P; Declercq, W

    2005-11-01

    Homeostasis implies a balance between cell growth and cell death. This balance is essential for the development and maintenance of multicellular organisms. Homeostasis is controlled by several mechanisms including apoptosis, a process by which cells condemned to death are completely eliminated. However, in some cases, total destruction and removal of dead cells is not desirable, as when they fulfil a specific function such as formation of the skin barrier provided by corneocytes, also known as terminally differentiated keratinocytes. In this case, programmed cell death results in accumulation of functional cell corpses. Previously, this process has been associated with apoptotic cell death. In this overview, we discuss differences and similarities in the molecular regulation of epidermal programmed cell death and apoptosis. We conclude that despite earlier confusion, apoptosis and cornification occur through distinct molecular pathways, and that possibly antiapoptotic mechanisms are implicated in the terminal differentiation of keratinocytes.

  3. Culture technique of rabbit primary epidermal keratinocytes

    Directory of Open Access Journals (Sweden)

    Marini M

    2012-10-01

    Full Text Available The epidermis is the protective covering outer layer of the mammalian skin. The epidermal cells are stratified squamous epithelia which undergo continuous differentiation of loss and replacement of cells. Ninety per cent of epidermal cells consist of keratinocytes that are found in the basal layer of the stratified epithelium called epidermis. Keratinocytes are responsible for forming tight junctions with the nerves of the skin as well as in the process of wound healing. This article highlights the method of isolation and culture of rabbit primary epidermal keratinocytes in vitro. Approximately 2cm x 2cm oval shaped line was drawn on the dorsum of the rabbit to mark the surgical area. Then, the skin was carefully excised using a surgical blade and the target skin specimens harvested from the rabbits were placed in transport medium comprising of Dulbecco’s Modified Eagle Medium (DMEM and 1% of antibiotic-antimycotic solution. The specimens were transferred into a petri dish containing 70% ethanol and washed for 5 min followed by a wash in 1 x Dulbecco’s Phosphate Buffered Saline (DBPS. Then, the skin specimens were placed in DMEM and minced into small pieces using a scalpel. The minced pieces were placed in a centrifuge tube containing 0.6% Dispase and 1% antibiotic-antimycotic solution overnight at 4°C in a horizontal orientation. The epidermis layer (whitish, semi-transparent was separated from the dermis (pink, opaque, gooey with the aid of curved forceps by fixing the dermis with one pair of forceps while detaching the epidermis with the second pair. The cells were cultured at a density of 4 x 104 cells/cm2 in culture flask at 37°C and 5% CO2. The cell morphology of the keratinocytes was analyzed using inverted microscope.

  4. Keratinocytes express fibrillin and assemble microfibrils: implications for dermal matrix organization.

    Science.gov (United States)

    Haynes, S L; Shuttleworth, C A; Kielty, C M

    1997-07-01

    Fibrillin-containing microfibrils are key architectural structures of the upper dermis and integral components of the dermal elastic fibre network. Microfibril bundles intercalate into the dermal-epithelial junction and provide an elastic connection between the dermal elastic fibre network and the epidermis. Immunohistochemical studies have suggested that they are laid down both at the dermal-epithelial junction and in the deep dermis. While dermal fibroblasts are responsible for deposition of the elastin and microfibrillar components that comprise the elastic fibres of the deep dermis, the cellular origin of the microfibril bundles that extrude from the dermal-epithelial junction is not well defined. We have used fresh tissues, freshly isolated epidermis and primary human and porcine keratinocyte cultures to investigate the possibility that keratinocytes are responsible for deposition of these microfibrils. We have shown that keratinocytes in vivo and in vitro synthesize both fibrillin-1 and fibrillin-2, and assemble beaded microfibrils concurrently with expression of basement membrane collagen. These observations suggest that keratinocytes co-ordinate the secretion, deposition and assembly of these distinct structural elements of the dermal matrix, and have important implications for skin remodelling.

  5. DEVELOPMENTAL STUDIES OF NUCLEAR DIGITAL TRANSDUCERS

    Energy Technology Data Exchange (ETDEWEB)

    Hyde, James L.

    1963-09-15

    A pressure transducer based on mechanical modulation of a beam of alpha particles is described. This type of transducer is capable of direct digital pressure measurexnent with corresponding telemetry advantages. Any variable that is sensed through a mechanical displacement is measurable by means of a corresponding member of this transducer family. Preliminary tests of an experimental pressure transducer show an overall accuracy within a few tenths of one percent, with promise of substantial improvement. General characteristics of nuclear digital transducers include exceptional long-term calibration stability and accuracy, independent of ambient environmental effects. Three concepts of systems enipioying these transducers are discussed. (auth)

  6. Acoustic Levitation With One Transducer

    Science.gov (United States)

    Barmatz, Martin B.

    1987-01-01

    Higher resonator modes enables simplification of equipment. Experimental acoustic levitator for high-temperature containerless processing has round cylindrical levitation chamber and only one acoustic transducer. Stable levitation of solid particle or liquid drop achieved by exciting sound in chamber to higher-order resonant mode that makes potential well for levitated particle or drop at some point within chamber.

  7. Proceedings of transducer 84 conference

    Energy Technology Data Exchange (ETDEWEB)

    1984-01-01

    In the broad and varied field of sensors this conference reviews thermal sensors for temperature measurements, gas sensors for gas analysis (for example analysis of exhaust gases from vehicles), optical fiber sensors, applications for optics, mechanics, robotics and signal processing. In particular one of the applications concerns acoustical transducers operating in liquid sodium for LMFBR reactors.

  8. Calculations for Piezoelectric Ultrasonic Transducers

    DEFF Research Database (Denmark)

    Jensen, Henrik

    1986-01-01

    Analysis of piezoelectric ultrasonic transducers implies a solution of a boundary value problem, for a boay which consists of different materials, including a piezoelectric part. The problem is dynamic at frequencies, where a typical wavelength is somewhat less than the size of the body. Radiation...

  9. Irradiation Testing of Ultrasonic Transducers

    International Nuclear Information System (INIS)

    Daw, J.; Rempe, J.; Palmer, J.; Tittmann, B.; Reinhardt, B.; Kohse, G.; Ramuhalli, P.; Montgomery, R.; Chien, H.T.; Villard, J.F.

    2013-06-01

    Ultrasonic technologies offer the potential for high accuracy and resolution in-pile measurement of numerous parameters, including geometry changes, temperature, crack initiation and growth, gas pressure and composition, and microstructural changes. Many Department of Energy-Office of Nuclear Energy (DOE-NE) programs are exploring the use of ultrasonic technologies to provide enhanced sensors for in-pile instrumentation during irradiation testing. For example, the ability of single, small diameter ultrasonic thermometers (UTs) to provide a temperature profile in candidate metallic and oxide fuel would provide much needed data for validating new fuel performance models. Other efforts include an ultrasonic technique to detect morphology changes (such as crack initiation and growth) and acoustic techniques to evaluate fission gas composition and pressure. These efforts are limited by the lack of existing knowledge of ultrasonic transducer material survivability under irradiation conditions. To address this need, the Pennsylvania State University (PSU) was awarded an Advanced Test Reactor National Scientific User Facility (ATR NSUF) project to evaluate promising magnetostrictive and piezoelectric transducer performance in the Massachusetts Institute of Technology Research Reactor (MITR) up to a fast fluence of at least 10 21 n/cm 2 (E> 0.1 MeV). This test will be an instrumented lead test; and real-time transducer performance data will be collected along with temperature and neutron and gamma flux data. By characterizing magnetostrictive and piezoelectric transducer survivability during irradiation, test results will enable the development of novel radiation tolerant ultrasonic sensors for use in Material and Test Reactors (MTRs). The current work bridges the gap between proven out-of-pile ultrasonic techniques and in-pile deployment of ultrasonic sensors by acquiring the data necessary to demonstrate the performance of ultrasonic transducers. (authors)

  10. The research on high power transducer

    International Nuclear Information System (INIS)

    Zhao Wuling; Li Yubin; Peng Shuwen

    2014-01-01

    This paper introduces the transducer structure used double PWM mode, the control system design of hardware and software. The transducer has been applied in factory. From the real experiment, it shows that the system has a high reliability. (authors)

  11. A Direct Driver for Electrostatic Transducers

    DEFF Research Database (Denmark)

    Nielsen, Dennis; Knott, Arnold; Andersen, Michael A. E.

    2014-01-01

    Electrostatic transducers represent a very interesting alternative to the traditional inefficient electrodynamic transducers. In order to establish the full potential of these transducers, power amplifiers which fulfill the strict requirements imposed by such loads (high impedance, frequency...... depended, nonlinear and high bias voltage for linearization) must be developed. This paper analyzes a power stage suitable for driving an electrostatic transducer under biasing. Measurement results of a ±400 V prototype amplifier are shown. THD below 1% is reported....

  12. Characterization of Fetal Keratinocytes, Showing Enhanced Stem Cell-Like Properties: A Potential Source of Cells for Skin Reconstruction

    Directory of Open Access Journals (Sweden)

    Kenneth K.B. Tan

    2014-08-01

    Full Text Available Epidermal stem cells have been in clinical application as a source of culture-generated grafts. Although applications for such cells are increasing due to aging populations and the greater incidence of diabetes, current keratinocyte grafting technology is limited by immunological barriers and the time needed for culture amplification. We studied the feasibility of using human fetal skin cells for allogeneic transplantation and showed that fetal keratinocytes have faster expansion times, longer telomeres, lower immunogenicity indicators, and greater clonogenicity with more stem cell indicators than adult keratinocytes. The fetal cells did not induce proliferation of T cells in coculture and were able to suppress the proliferation of stimulated T cells. Nevertheless, fetal keratinocytes could stratify normally in vitro. Experimental transplantation of fetal keratinocytes in vivo seeded on an engineered plasma scaffold yielded a well-stratified epidermal architecture and showed stable skin regeneration. These results support the possibility of using fetal skin cells for cell-based therapeutic grafting.

  13. Enhancement of keratinocyte performance in the production of tissue-engineered skin using a low-calcium medium.

    Science.gov (United States)

    Hernon, Catherine A; Harrison, Caroline A; Thornton, Daniel J A; MacNeil, Sheila

    2007-01-01

    The success of laboratory-expanded autologous keratinocytes for the treatment of severe burn injuries is often compromised by their lack of dermal remnants and failure to establish a secure dermo-epidermal junction on the wound bed. We have developed a tissue-engineered skin substitute for in vivo use, based on a sterilized donor human dermis seeded with autologous keratinocytes and fibroblasts. However, culture rates are currently too slow for clinical use in acute burns. Our aim in this study was to increase the rate of production of tissue-engineered skin. Two approaches were explored: one using a commercial low-calcium media and the other supplementing well-established media for keratinocyte culture with the calcium-chelating agent ethylene glutamine tetra-acetic acid (EGTA). Using commercial low-calcium media for both the initial cell culture and subsequent culture of tissue-engineered skin did not produce tissue suitable for clinical use. However, it was possible to enhance the initial proliferation of keratinocytes and to increase their horizontal migration in tissue-engineered skin by supplementing established culture medium with 0.04 mM EGTA without sacrificing epidermal attachment and differentiation. Enhancement of keratinocyte migration with EGTA was also maximal in the absence of fibroblasts or basement membrane.

  14. α6 Integrin and CD44 enrich for a primary keratinocyte population that displays resistance to UV-induced apoptosis.

    Directory of Open Access Journals (Sweden)

    Helen Wray

    Full Text Available Epidermal human keratinocytes are exposed to a wide range of environmental genotoxic insults, including the UV component of solar radiation. Epidermal homeostasis in response to cellular or tissue damage is maintained by a population of keratinocyte stem cells (KSC that reside in the basal layer of the epithelium. Using cell sorting based on cell-surface markers, we have identified a novel α6 integrin(high+/CD44(+ sub-population of basal keratinocytes. These α6 integrin(high+/CD44(+ keratinocytes have both high proliferative potential, form colonies in culture that have characteristics of holoclones and have a unique pattern of resistance to apoptosis induced by UVB radiation or by agents that induce single- or double strand DNA breaks. Resistance to UVB induced apoptosis in the α6 integrin(high+/CD44(+ cells involved increased expression of TAp63 and was overcome by PI-3 kinase inhibition. In marked contrast, the α6 integrin(high+/CD44(+ cells were sensitive to apoptosis induced by the cross-linking agent cisplatin, and imatinib inhibition of c-Abl blocked the ability of cisplatin to kill α6 integrin(high+/CD44(+ cells. Our findings reveal a population of basal keratinocytes with long-term proliferative properties that display specific patterns of apoptotic resistance that is dependent upon the genotoxic stimulus, and provide insights into how these cells can be targeted with chemotherapeutic agents.

  15. Digital electrostatic acoustic transducer array

    KAUST Repository

    Carreno, Armando Arpys Arevalo

    2016-12-19

    In this paper we present the fabrication and characterization of an array of electrostatic acoustic transducers. The array is micromachined on a silicon wafer using standard micro-machining techniques. Each array contains 2n electrostatic transducer membranes, where “n” is the bit number. Every element of the array has a hexagonal membrane shape structure, which is separated from the substrate by 3µm air gap. The membrane is made out 5µm thick polyimide layer that has a bottom gold electrode on the substrate and a gold top electrode on top of the membrane (250nm). The wafer layout design was diced in nine chips with different array configurations, with variation of the membrane dimensions. The device was tested with 90 V giving and sound output level as high as 35dB, while actuating all the elements at the same time.

  16. Digital electrostatic acoustic transducer array

    KAUST Repository

    Carreno, Armando Arpys Arevalo; Castro, David; Conchouso Gonzalez, David; Kosel, Jü rgen; Foulds, Ian G.

    2016-01-01

    In this paper we present the fabrication and characterization of an array of electrostatic acoustic transducers. The array is micromachined on a silicon wafer using standard micro-machining techniques. Each array contains 2n electrostatic transducer membranes, where “n” is the bit number. Every element of the array has a hexagonal membrane shape structure, which is separated from the substrate by 3µm air gap. The membrane is made out 5µm thick polyimide layer that has a bottom gold electrode on the substrate and a gold top electrode on top of the membrane (250nm). The wafer layout design was diced in nine chips with different array configurations, with variation of the membrane dimensions. The device was tested with 90 V giving and sound output level as high as 35dB, while actuating all the elements at the same time.

  17. Image enhancement of optical images for binary system of melanocytes and keratinocytes

    Science.gov (United States)

    Takanezawa, S.; Baba, A.; Sako, Y.; Ozaki, Y.; Date, A.; Toyama, K.; Morita, S.

    2013-05-01

    Automatic determination of the cell shapes of large numbers of melanocytes based on optical images of human skin models have been largely unsuccessful (the complexities introduced by dendrites and the melanin pigmentation over the keratinocytes to give unclear outlines). Here, we present an image enhancement procedure for enhancing the contrast of images with removing the non-uniformity of background. The brightness is normalized also for the non-uniform population density of melanocytes.

  18. Calculations for piezoelectric ultrasonic transducers

    International Nuclear Information System (INIS)

    Jensen, H.

    1986-05-01

    Analysis of piezoelectric ultrasonic transducers implies a solution of a boundary value problem, for a body which consists of different materials, including a piezoelectric part. The problem is dynamic at frequencies, where a typical wavelength is somewhat less than the size of the body. Radiation losses as well as internal losses may be important. Due to the complexity of the problem, a closed form solution is the exception rather than the rule. For this reason, it is necessary to use approximate methods for the analysis. Equivalent circuits, the Rayleigh-Ritz method, Mindlin plate theory and in particular the finite element method are considered. The finite element method is utilized for analysis of axisymmetric transducers. An explicit, fully piezoelectric, triangular ring element, with linear variations in displacement and electric potential is given. The influence of a fluid half-space is also given, in the form of a complex stiffness matrix. A special stacking procedure, for analysis of the backing has been developed. This procedure gives a saving, which is similar to that of the fast fourier transform algorithm, and is also wellsuited for analysis of finite and infinite waveguides. Results obtained by the finite element method are shown and compared with measurements and exact solutions. Good agreement is obtained. It is concluded that the finite element method can be a valueable tool in analysis and design of ultrasonic transducers. (author)

  19. Chitosan modified poly(lactic-co-glycolic acid nanoparticles interaction with normal, precancerous keratinocytes and dental pulp cells

    Directory of Open Access Journals (Sweden)

    Maria Justina Roxana Virlan

    2017-03-01

    Conclusion: Chitosan-coated PLGAChi NPs proved to be able to cross the cellular membrane of oral keratinocytes, in 2D as well as in 3D cultures. The polymeric NPs used in the present study seem not to be suitable for applications that require NPs uptake by DPCs, as no evidence of uptake in these cells was found in this study. The finding that PLGAChi NPs showed significant internalization by human keratinocytes indicate that they could be used for drug delivery purposes to oral mucosa.

  20. Photoprotection by Punica granatum seed oil nanoemulsion entrapping polyphenol-rich ethyl acetate fraction against UVB-induced DNA damage in human keratinocyte (HaCaT) cell line.

    Science.gov (United States)

    Baccarin, Thaisa; Mitjans, Montserrat; Ramos, David; Lemos-Senna, Elenara; Vinardell, Maria Pilar

    2015-12-01

    There has been an increase in the use of botanicals as skin photoprotective agents. Pomegranate (Punica granatum L.) is well known for its high concentration of polyphenolic compounds and for its antioxidant and anti-inflammatory properties. The aim of this study was to analyze the photoprotection provided by P. granatum seed oil nanoemulsion entrapping the polyphenol-rich ethyl acetate fraction against UVB-induced DNA damage in the keratinocyte HaCaT cell line. For this purpose, HaCaT cells were pretreated for 1h with nanoemulsions in a serum-free medium and then irradiated with UVB (90-200 mJ/cm(2)) rays. Fluorescence microscopy analysis provided information about the cellular internalization of the nanodroplets. We also determined the in vitro SPF of the nanoemulsions and evaluated their phototoxicity using the 3T3 Neutral Red Uptake Phototoxicity Test. The nanoemulsions were able to protect the cells' DNA against UVB-induced damage in a concentration dependent manner. Nanodroplets were internalized by the cells but a higher proportion was detected along the cell membrane. The SPF obtained (~25) depended on the concentration of the ethyl acetate fraction and pomegranate seed oil in the nanoemulsion. The photoprotective formulations were classified as non-phototoxic. In conclusion, nanoemulsions entrapping the polyphenol-rich ethyl acetate fraction show potential for use as a sunscreen product. Copyright © 2015 Elsevier B.V. All rights reserved.

  1. Transducers

    Digital Repository Service at National Institute of Oceanography (India)

    Chakraborty, B

    stream_size 27 stream_content_type text/plain stream_name Encycl_Microcomputers_18_335.pdf.txt stream_source_info Encycl_Microcomputers_18_335.pdf.txt Content-Encoding ISO-8859-1 Content-Type text/plain; charset=ISO-8859-1 ...

  2. Aqueous extract from Vitis vinifera tendrils is able to enrich keratinocyte antioxidant defences.

    Science.gov (United States)

    Fraternale, Daniele; De Bellis, Roberta; Calcabrini, Cinzia; Potenza, Lucia; Cucchiarini, Luigi; Mancini, Umberto; Dachà, Marina; Ricci, Donata

    2011-09-01

    An aqueous extract of V. vinifera L. tendrils was evaluated for its ability to enrich the antioxidant capacity of cultured cells. The long-time antioxidant capability of the extract was measured by in vitro chemical methods, and its influence on reduced glutathione levels and plasma membrane oxido reductase activity was determined in cultured human keratinocytes (NCTC 2544). Keratinocytes are cells normally exposed to oxidative stress, and for this reason adequately equipped with antioxidant defences. However, it has long been suggested that exogenous antioxidants may play an important role in minimizing the adverse effects of oxidative stress on skin.We demonstrated that V. vinifera tendril aqueous extract was able to increase, in a time- and dose-dependent manner, the reduced glutathione concentration and activity of trans plasma membrane oxido reductase as an indirect evaluation of the intracellular redox status of the cells demonstrating a relevant antioxidant activity of this phytocomplex.

  3. Inhibition of Akt signaling by exclusion from lipid rafts in normal and transformed epidermal keratinocytes

    DEFF Research Database (Denmark)

    Calay, Damien; Vind-Kezunovic, Dina; Frankart, Aurelie

    2010-01-01

    Lipid rafts are cholesterol-rich plasma membrane domains that regulate signal transduction. Because our earlier work indicated that raft disruption inhibited proliferation and caused cell death, we investigated here the role of membrane cholesterol, the crucial raft constituent, in the regulation...... of the phosphatidylinositol-3 kinase (PI3K)/Akt pathway. Raft disruption was achieved in normal human keratinocytes and precancerous (HaCaT) or transformed (A431) keratinocytes by cholesterol extraction or inactivation with methyl-beta-cyclodextrin, filipin III, or 5-cholestene-5-beta-ol. Lipid raft disruption did not affect...... in deactivation of mammalian target of rapamycin, activation of FoxO3a, and increased sensitivity to apoptosis stimuli. Lipid raft disruption abrogated the binding of Akt and the major Akt kinase, phosphatidylinositol-dependent kinase 1, to the membrane by pleckstrin-homology domains. Thus, the integrity of lipid...

  4. Keratinocyte growth factor mRNA expression in periodontal ligament fibroblasts

    DEFF Research Database (Denmark)

    Dabelsteen, S; Wandall, H H; Grøn, B

    1997-01-01

    Keratinocyte growth factor (KGF) is a fibroblast growth factor which mediates epithelial growth and differentiation. KGF is expressed in subepithelial fibroblasts, but generally not in fibroblasts of deep connective tissue, such as fascia and ligaments. Here we demonstrate that KGF mRNA is expres......Keratinocyte growth factor (KGF) is a fibroblast growth factor which mediates epithelial growth and differentiation. KGF is expressed in subepithelial fibroblasts, but generally not in fibroblasts of deep connective tissue, such as fascia and ligaments. Here we demonstrate that KGF m......RNA is expressed in periodontal ligament fibroblasts, and that the expression is increased upon serum stimulation. Fibroblasts from human periodontal ligament, from buccal mucosa, from gingiva, and from skin were established from explants. Alkaline phosphatase activity was used as an indicator of the periodontal...

  5. Radiation-resistant pressure transducers

    International Nuclear Information System (INIS)

    Abbasov, Sh.M.; Kerimova, T.I.

    2005-01-01

    Full text : The sensitive element of vibrofrequency tensor converter (VTC) is an electromechanical resonator of string type with electrostatic excitation of longitudinal mechanical vibrations. The string is made from tensosensitive thread-like monocrystal n-Ge1-x Six (length 1-5 mm, diameter 8-12 mcm) with current outlet and strictly fixed by ends at plate or deformable surface (in elastic element) at 50 mcm apartheid. With increasing Si atomic percent in n-Ge1-x Six the converter tens sensitivity increases. There has been shown the scheme of pressure transducer which contains monocrystalline silicon membrane and string tens converter from thread-like monocrystal Ge-Si. Using method, when crystal position on membrane while it deforms by pressure, corresponds to free (uptight) state, allowed to obtain the maximum sensitivity in measurement of pressure fluctuation. The transducers of absolute and pressure differential of this type can be used in automated systems of life activity. The high sensitivity of string transducers to pressure exceeding 100 hertz/mm (water column) permits to use them in devices for measuring gas concentration. The combination of optical and deformation methods of measurements forms the basis of their operation. The pressure change occurs due to the fact that gas molecules absorbing the quanta of incident light, become at excited state and then excitation energy of their vibrational-rotatory degrees of fr