WorldWideScience

Sample records for human immune responsiveness

  1. Sex hormones and the immune response in humans

    NARCIS (Netherlands)

    Bouman, Annechien; Heineman, Maas Jan; Faas, Marijke M.

    2005-01-01

    In addition to their effects on sexual differentiation and reproduction, sex hormones appear to influence the immune system. This results in a sexual dimorphism in the immune response in humans: for instance, females produce more vigorous cellular and more vigorous humoral immune reactions, are more

  2. [Human milk, immune responses and health effects].

    Science.gov (United States)

    Løland, Beate Fossum; Baerug, Anne B; Nylander, Gro

    2007-09-20

    Besides providing optimal nutrition to infants, human milk contains a multitude of immunological components. These components are important for protection against infections and also support the development and maturation of the infant's own immune system. This review focuses on the function of some classical immunocomponents of human milk. Relevant studies are presented that describe health benefits of human milk for the child and of lactation for the mother. Relevant articles were found mainly by searching PubMed. Humoral and cellular components of human milk confer protection against infections in the respiratory--, gastrointestinal--and urinary tract. Human milk also protects premature children from neonatal sepsis and necrotizing enterocolitis. There is evidence that human milk may confer long-term benefits such as lower risk of certain autoimmune diseases, inflammatory bowel disease and probably some malignancies. Human milk possibly affects components of the metabolic syndrome. Recent studies demonstrate long-term health benefits of lactation also for the mother. A reduced incidence of breast cancer is best documented. An increasing number of studies indicate protection against ovarian cancer, rheumatoid arthritis and type II diabetes.

  3. Human Immune Response to Dengue Infections

    Science.gov (United States)

    1991-06-30

    had been immunized with yellow fever vaccine and later became infected with dengue 3 virus, responded best to dengue 3 antigen but also responded to...effective dengue virus subunit vaccines . We found evidence of marked T cell activation in patients with DHF. T cell activation in patients with DF was similar...Treatment and Control of Dengue Hemorrhagic Fever. World Health Organization, Geneva, Switzerland 7. Sabin AB (1952) Research on dengue during World

  4. Immune response capacity after human splenic autotransplantation - Restoration of response to individual pneumococcal vaccine subtypes

    NARCIS (Netherlands)

    Leemans, R; Manson, W; Snijder, JAM; Smit, JW; Klasen, HJ; The, TH; Timens, W

    Objective To evaluate features of general immune function, in particular the restoration of the humoral immune response to pneumococcal capsular polysaccharides, in humans undergoing a spleen autotransplantation after splenectomy because of trauma. Summary Background Data After splenectomy, patients

  5. Curcumin prevents human dendritic cell response to immune stimulants

    International Nuclear Information System (INIS)

    Shirley, Shawna A.; Montpetit, Alison J.; Lockey, R.F.; Mohapatra, Shyam S.

    2008-01-01

    Curcumin, a compound found in the Indian spice turmeric, has anti-inflammatory and immunomodulatory properties, though the mechanism remains unclear. Dendritic cells (DCs) are important to generating an immune response and the effect of curcumin on human DCs has not been explored. The role curcumin in the DC response to bacterial and viral infection was investigated in vitro using LPS and Poly I:C as models of infection. CD14 + monocytes, isolated from human peripheral blood, were cultured in GM-CSF- and IL-4-supplemented medium to generate immature DCs. Cultures were incubated with curcumin, stimulated with LPS or Poly I:C and functional assays were performed. Curcumin prevents DCs from responding to immunostimulants and inducing CD4 + T cell proliferation by blocking maturation marker, cytokine and chemokine expression and reducing both migration and endocytosis. These data suggest a therapeutic role for curcumin as an immune suppressant

  6. Immune responses to implanted human collagen graft in rats

    International Nuclear Information System (INIS)

    Quteish, D.; Dolby, A.E.

    1991-01-01

    Immunity to collagen implants may be mediated by cellular and humoral immune responses. To examine the possibility of such immunological reactivity and crossreactivity to collagen, 39 Sprague-Dawley rats (female, 10 weeks old, approximately 250 g wt) were implanted subcutaneously at thigh sites with crosslinked, freeze-dried human placental type I collagen grafts (4x4x2 mm) which had been irradiated (520 Gray) or left untreated. Blood was obtained by intracardiac sampling prior to implantation or from normal rats, and at various times afterwards when the animals were sacrificed. The sera from these animals were examined for circulating antibodies to human, bovine and rat tail (type I) collagens by enzyme-linked immunosorbent assay (ELISA). Also, the lymphoblastogenic responses of spleen lymphocytes from the irradiated collagen-implanted animals were assessed in culture by measuring thymidine uptake with autologous and normal rat sera in the presence of human bovine type I collagens. Implantation of the irradiated and non-irradiated collagen graft in rats led to a significant increase in the level of circulating antibodies to human collagen. Also antibody to bovine and rat tail collagens was detectable in the animals implanted with irradiated collagen grafts but at a lower level than the human collagen. There was a raised lymphoblastogenic response to both human and bovine collagens. The antibody level and lymphoblastogenesis to the tested collagens gradually decreased towards the end of the post-implantation period. (author)

  7. Cell mediated immune response in human antirabies revaccination

    Directory of Open Access Journals (Sweden)

    Débora Regina Veiga

    1987-04-01

    Full Text Available The occurrence of secondary cell mediated immune response (CMI in human antirabies immunization was studied. The Puenzalida & Palácios vaccine was used because it is routinely used in Brazil. CMI was evaluated by lymphoblastic transformation indices obtained in whole blood culture in the presence of rabies and control (nervous tissue antigens. Eleven volunteers submitted to revaccination constituted the group under study, while three other volunteers submitted primo vaccination were utilized as control group. A clear secondary CMI to rabies antigen was detected in all the revaccinated volunteers who showed earlier and more intense response than the control group. Response to the control antigen, however, present in all the components of the first group was not detectable in two out of the three primovaccinated and very low in the third one.

  8. Humanized mouse model for assessing the human immune response to xenogeneic and allogeneic decellularized biomaterials.

    Science.gov (United States)

    Wang, Raymond M; Johnson, Todd D; He, Jingjin; Rong, Zhili; Wong, Michelle; Nigam, Vishal; Behfar, Atta; Xu, Yang; Christman, Karen L

    2017-06-01

    Current assessment of biomaterial biocompatibility is typically implemented in wild type rodent models. Unfortunately, different characteristics of the immune systems in rodents versus humans limit the capability of these models to mimic the human immune response to naturally derived biomaterials. Here we investigated the utility of humanized mice as an improved model for testing naturally derived biomaterials. Two injectable hydrogels derived from decellularized porcine or human cadaveric myocardium were compared. Three days and one week after subcutaneous injection, the hydrogels were analyzed for early and mid-phase immune responses, respectively. Immune cells in the humanized mouse model, particularly T-helper cells, responded distinctly between the xenogeneic and allogeneic biomaterials. The allogeneic extracellular matrix derived hydrogels elicited significantly reduced total, human specific, and CD4 + T-helper cell infiltration in humanized mice compared to xenogeneic extracellular matrix hydrogels, which was not recapitulated in wild type mice. T-helper cells, in response to the allogeneic hydrogel material, were also less polarized towards a pro-remodeling Th2 phenotype compared to xenogeneic extracellular matrix hydrogels in humanized mice. In both models, both biomaterials induced the infiltration of macrophages polarized towards a M2 phenotype and T-helper cells polarized towards a Th2 phenotype. In conclusion, these studies showed the importance of testing naturally derived biomaterials in immune competent animals and the potential of utilizing this humanized mouse model for further studying human immune cell responses to biomaterials in an in vivo environment. Copyright © 2017 Elsevier Ltd. All rights reserved.

  9. The immune response of the human brain to abdominal surgery

    DEFF Research Database (Denmark)

    Forsberg, Anton; Cervenka, Simon; Jonsson Fagerlund, Malin

    2017-01-01

    OBJECTIVE: Surgery launches a systemic inflammatory reaction that reaches the brain and associates with immune activation and cognitive decline. Although preclinical studies have in part described this systemic-to-brain signaling pathway, we lack information on how these changes appear in humans....... This study examines the short- and long-term impact of abdominal surgery on the human brain immune system by positron emission tomography (PET) in relation to blood immune reactivity, plasma inflammatory biomarkers, and cognitive function. METHODS: Eight males undergoing prostatectomy under general...... anesthesia were included. Prior to surgery (baseline), at postoperative days 3 to 4, and after 3 months, patients were examined using [11C]PBR28 brain PET imaging to assess brain immune cell activation. Concurrently, systemic inflammatory biomarkers, ex vivo blood tests on immunoreactivity...

  10. Humanized Mouse Model of Ebola Virus Disease Mimics the Immune Responses in Human Disease.

    Science.gov (United States)

    Bird, Brian H; Spengler, Jessica R; Chakrabarti, Ayan K; Khristova, Marina L; Sealy, Tara K; Coleman-McCray, JoAnn D; Martin, Brock E; Dodd, Kimberly A; Goldsmith, Cynthia S; Sanders, Jeanine; Zaki, Sherif R; Nichol, Stuart T; Spiropoulou, Christina F

    2016-03-01

    Animal models recapitulating human Ebola virus disease (EVD) are critical for insights into virus pathogenesis. Ebola virus (EBOV) isolates derived directly from human specimens do not, without adaptation, cause disease in immunocompetent adult rodents. Here, we describe EVD in mice engrafted with human immune cells (hu-BLT). hu-BLT mice developed EVD following wild-type EBOV infection. Infection with high-dose EBOV resulted in rapid, lethal EVD with high viral loads, alterations in key human antiviral immune cytokines and chemokines, and severe histopathologic findings similar to those shown in the limited human postmortem data available. A dose- and donor-dependent clinical course was observed in hu-BLT mice infected with lower doses of either Mayinga (1976) or Makona (2014) isolates derived from human EBOV cases. Engraftment of the human cellular immune system appeared to be essential for the observed virulence, as nonengrafted mice did not support productive EBOV replication or develop lethal disease. hu-BLT mice offer a unique model for investigating the human immune response in EVD and an alternative animal model for EVD pathogenesis studies and therapeutic screening. Published by Oxford University Press for the Infectious Diseases Society of America 2015. This work is written by (a) US Government employee(s) and is in the public domain in the US.

  11. Characterization of humoral and cellular immune responses in patients with human papilloma virus

    International Nuclear Information System (INIS)

    Clares Pochet, Maria del Carmen; Ferrer Cosme, Belkis Maria; Dominguez Cardosa, Magda

    2012-01-01

    A descriptive and cross-sectional study was carried out in 30 females infected with the human papilloma virus, attended in the office of Immunology of the Specialty Polyclinic belonging to 'Saturnino Lora' Provincial Clinical Surgical Teaching Hospital in Santiago de Cuba, from June 2009 to June 2010, in order to characterize them according to immune response. To evaluate the humoral and cellular immune response rosetting assay and quantification of immunoglobulins were used respectively. Women between 25-36 years of age (40 %) infected with this virus, especially those coming from urban areas, prevailed in the series, and a significant decrease of the cellular response as compared to the humoral response was evidenced

  12. Earthworms and Humans in Vitro: Characterizing Evolutionarily Conserved Stress and Immune Responses to Silver Nanoparticles

    DEFF Research Database (Denmark)

    Hayashi, Yuya; Engelmann, Péter; Foldbjerg, Rasmus

    2012-01-01

    Little is known about the potential threats of silver nanoparticles (AgNPs) to ecosystem health, with no detailed report existing on the stress and immune responses of soil invertebrates. Here we use earthworm primary cells, cross-referencing to human cell cultures with a particular emphasis on t...... in the coelomocytes and THP-1 cells. Our findings provide mechanistic clues on cellular innate immunity toward AgNPs that is likely to be evolutionarily conserved across the animal kingdom....

  13. Human innate responses and adjuvant activity of TLR ligands in vivo in mice reconstituted with a human immune system.

    Science.gov (United States)

    Cheng, Liang; Zhang, Zheng; Li, Guangming; Li, Feng; Wang, Li; Zhang, Liguo; Zurawski, Sandra M; Zurawski, Gerard; Levy, Yves; Su, Lishan

    2017-10-27

    TLR ligands (TLR-Ls) represent a class of novel vaccine adjuvants. However, their immunologic effects in humans remain poorly defined in vivo. Using a humanized mouse model with a functional human immune system, we investigated how different TLR-Ls stimulated human innate immune response in vivo and their applications as vaccine adjuvants for enhancing human cellular immune response. We found that splenocytes from humanized mice showed identical responses to various TLR-Ls as human PBMCs in vitro. To our surprise, various TLR-Ls stimulated human cytokines and chemokines differently in vivo compared to that in vitro. For example, CpG-A was most efficient to induce IFN-α production in vitro. In contrast, CpG-B, R848 and Poly I:C stimulated much more IFN-α than CpG-A in vivo. Importantly, the human innate immune response to specific TLR-Ls in humanized mice was different from that reported in C57BL/6 mice, but similar to that reported in nonhuman primates. Furthermore, we found that different TLR-Ls distinctively activated and mobilized human plasmacytoid dendritic cells (pDCs), myeloid DCs (mDCs) and monocytes in different organs. Finally, we showed that, as adjuvants, CpG-B, R848 and Poly I:C can all enhance antigen specific CD4 + T cell response, while only R848 and Poly I:C induced CD8 + cytotoxic T cells response to a CD40-targeting HIV vaccine in humanized mice, correlated with their ability to activate human mDCs but not pDCs. We conclude that humanized mice serve as a highly relevant model to evaluate and rank the human immunologic effects of novel adjuvants in vivo prior to testing in humans. Copyright © 2017 Elsevier Ltd. All rights reserved.

  14. Mathematical modeling provides kinetic details of the human immune response to vaccination

    Directory of Open Access Journals (Sweden)

    Dustin eLe

    2015-01-01

    Full Text Available With major advances in experimental techniques to track antigen-specific immune responses many basic questions on the kinetics of virus-specific immunity in humans remain unanswered. To gain insights into kinetics of T and B cell responses in human volunteers we combine mathematical models and experimental data from recent studies employing vaccines against yellow fever and smallpox. Yellow fever virus-specific CD8 T cell population expanded slowly with the average doubling time of 2 days peaking 2.5 weeks post immunization. Interestingly, we found that the peak of the yellow fever-specific CD8 T cell response is determined by the rate of T cell proliferation and not by the precursor frequency of antigen-specific cells as has been suggested in several studies in mice. We also found that while the frequency of virus-specific T cells increases slowly, the slow increase can still accurately explain clearance of yellow fever virus in the blood. Our additional mathematical model describes well the kinetics of virus-specific antibody-secreting cell and antibody response to vaccinia virus in vaccinated individuals suggesting that most of antibodies in 3 months post immunization are derived from the population of circulating antibody-secreting cells. Taken together, our analysis provides novel insights into mechanisms by which live vaccines induce immunity to viral infections and highlight challenges of applying methods of mathematical modeling to the current, state-of-the-art yet limited immunological data.

  15. Mathematical modeling provides kinetic details of the human immune response to vaccination.

    Science.gov (United States)

    Le, Dustin; Miller, Joseph D; Ganusov, Vitaly V

    2014-01-01

    With major advances in experimental techniques to track antigen-specific immune responses many basic questions on the kinetics of virus-specific immunity in humans remain unanswered. To gain insights into kinetics of T and B cell responses in human volunteers we combined mathematical models and experimental data from recent studies employing vaccines against yellow fever and smallpox. Yellow fever virus-specific CD8 T cell population expanded slowly with the average doubling time of 2 days peaking 2.5 weeks post immunization. Interestingly, we found that the peak of the yellow fever-specific CD8 T cell response was determined by the rate of T cell proliferation and not by the precursor frequency of antigen-specific cells as has been suggested in several studies in mice. We also found that while the frequency of virus-specific T cells increased slowly, the slow increase could still accurately explain clearance of yellow fever virus in the blood. Our additional mathematical model described well the kinetics of virus-specific antibody-secreting cell and antibody response to vaccinia virus in vaccinated individuals suggesting that most of antibodies in 3 months post immunization were derived from the population of circulating antibody-secreting cells. Taken together, our analysis provided novel insights into mechanisms by which live vaccines induce immunity to viral infections and highlighted challenges of applying methods of mathematical modeling to the current, state-of-the-art yet limited immunological data.

  16. Astaxanthin decreased oxidative stress and inflammation and enhanced immune response in humans

    Directory of Open Access Journals (Sweden)

    Line Larry L

    2010-03-01

    Full Text Available Abstract Background Astaxanthin modulates immune response, inhibits cancer cell growth, reduces bacterial load and gastric inflammation, and protects against UVA-induced oxidative stress in in vitro and rodent models. Similar clinical studies in humans are unavailable. Our objective is to study the action of dietary astaxanthin in modulating immune response, oxidative status and inflammation in young healthy adult female human subjects. Methods Participants (averaged 21.5 yr received 0, 2, or 8 mg astaxanthin (n = 14/diet daily for 8 wk in a randomized double-blind, placebo-controlled study. Immune response was assessed on wk 0, 4 and 8, and tuberculin test performed on wk 8. Results Plasma astaxanthin increased (P helper, Tcytotoxic or natural killer cells. A higher percentage of leukocytes expressed the LFA-1 marker in subjects given 2 mg astaxanthin on wk 8. Subjects fed 2 mg astaxanthin had a higher tuberculin response than unsupplemented subjects. There was no difference in TNF and IL-2 concentrations, but plasma IFN-γ and IL-6 increased on wk 8 in subjects given 8 mg astaxanthin. Conclusion Therefore, dietary astaxanthin decreases a DNA damage biomarker and acute phase protein, and enhances immune response in young healthy females.

  17. Characterization of the early local immune response to Ixodes ricinus tick bites in human skin.

    Science.gov (United States)

    Glatz, Martin; Means, Terry; Haas, Josef; Steere, Allen C; Müllegger, Robert R

    2017-03-01

    Little is known about the immunomodulation by tick saliva during a natural tick bite in human skin, the site of the tick-host interaction. We examined the expression of chemokines, cytokines and leucocyte markers on the mRNA levels and histopathologic changes in human skin biopsies of tick bites (n=37) compared to unaffected skin (n=9). Early tick-bite skin lesions (skin. With longer tick attachment (>24 hours), the numbers of innate immune cells and mediators (not significantly) declined, whereas the numbers of lymphocytes (not significantly) increased. Natural tick bites by Ixodes ricinus ticks initially elicit a strong local innate immune response in human skin. Beyond 24 hours of tick attachment, this response usually becomes less, perhaps because of immunomodulation by tick saliva. © 2016 John Wiley & Sons A/S. Published by John Wiley & Sons Ltd.

  18. Innate Immune Responses of Bat and Human Cells to Filoviruses: Commonalities and Distinctions.

    Science.gov (United States)

    Kuzmin, Ivan V; Schwarz, Toni M; Ilinykh, Philipp A; Jordan, Ingo; Ksiazek, Thomas G; Sachidanandam, Ravi; Basler, Christopher F; Bukreyev, Alexander

    2017-04-15

    Marburg (MARV) and Ebola (EBOV) viruses are zoonotic pathogens that cause severe hemorrhagic fever in humans. The natural reservoir of MARV is the Egyptian rousette bat ( Rousettus aegyptiacus ); that of EBOV is unknown but believed to be another bat species. The Egyptian rousette develops subclinical productive infection with MARV but is refractory to EBOV. Interaction of filoviruses with hosts is greatly affected by the viral interferon (IFN)-inhibiting domains (IID). Our study was aimed at characterization of innate immune responses to filoviruses and the role of filovirus IID in bat and human cells. The study demonstrated that EBOV and MARV replicate to similar levels in all tested cell lines, indicating that permissiveness for EBOV at cell and organism levels do not necessarily correlate. Filoviruses, particularly MARV, induced a potent innate immune response in rousette cells, which was generally stronger than that in human cells. Both EBOV VP35 and VP24 IID were found to suppress the innate immune response in rousette cells, but only VP35 IID appeared to promote virus replication. Along with IFN-α and IFN-β, IFN-γ was demonstrated to control filovirus infection in bat cells but not in human cells, suggesting host species specificity of the antiviral effect. The antiviral effects of bat IFNs appeared not to correlate with induction of IFN-stimulated genes 54 and 56, which were detected in human cells ectopically expressing bat IFN-α and IFN-β. As bat IFN-γ induced the type I IFN pathway, its antiviral effect is likely to be partially induced via cross talk. IMPORTANCE Bats serve as reservoirs for multiple emerging viruses, including filoviruses, henipaviruses, lyssaviruses, and zoonotic coronaviruses. Although there is no evidence for symptomatic disease caused by either Marburg or Ebola viruses in bats, spillover of these viruses into human populations causes deadly outbreaks. The reason for the lack of symptomatic disease in bats infected with

  19. Quantitative assay for the measurement of immune responses directed against the human placenta

    Energy Technology Data Exchange (ETDEWEB)

    Davies, M; Sutcliffe, R G [Glasgow Univ. (UK)

    1982-02-12

    A quantitative in vitro immune assay based on the classical chromium release assay has been developed to detect immune responses directed against alien antigens expressed by the developing foetus and present on the maternal-facing surface of the human placenta. A plasma membrane fraction from the surface of the placenta was prepared and the vesicles thus formed were radiolabelled with /sup 51/Cr. The /sup 51/Cr-labelled vesicles, by various criteria, were found to be suitable for use as targets in a release assay. Further, by means of experimentally immunised animals, the target membranes were shown to be capable of detecting both cellular and humoral anti-placental activity.

  20. Humoral and cellular immune responses to Yersinia pestis Pla antigen in humans immunized with live plague vaccine.

    Science.gov (United States)

    Feodorova, Valentina A; Lyapina, Anna M; Khizhnyakova, Maria A; Zaitsev, Sergey S; Sayapina, Lidiya V; Arseneva, Tatiana E; Trukhachev, Alexey L; Lebedeva, Svetlana A; Telepnev, Maxim V; Ulianova, Onega V; Lyapina, Elena P; Ulyanov, Sergey S; Motin, Vladimir L

    2018-06-01

    To establish correlates of human immunity to the live plague vaccine (LPV), we analyzed parameters of cellular and antibody response to the plasminogen activator Pla of Y. pestis. This outer membrane protease is an essential virulence factor that is steadily expressed by Y. pestis. PBMCs and sera were obtained from a cohort of naïve (n = 17) and LPV-vaccinated (n = 34) donors. Anti-Pla antibodies of different classes and IgG subclasses were determined by ELISA and immunoblotting. The analysis of antibody response was complicated with a strong reactivity of Pla with normal human sera. The linear Pla B-cell epitopes were mapped using a library of 15-mer overlapping peptides. Twelve peptides that reacted specifically with sera of vaccinated donors were found together with a major cross-reacting peptide IPNISPDSFTVAAST located at the N-terminus. PBMCs were stimulated with recombinant Pla followed by proliferative analysis and cytokine profiling. The T-cell recall response was pronounced in vaccinees less than a year post-immunization, and became Th17-polarized over time after many rounds of vaccination. The Pla protein can serve as a biomarker of successful vaccination with LPV. The diagnostic use of Pla will require elimination of cross-reactive parts of the antigen.

  1. Suppression of Antitumor Immune Responses by Human Papillomavirus through Epigenetic Downregulation of CXCL14

    Directory of Open Access Journals (Sweden)

    Louis Cicchini

    2016-05-01

    Full Text Available High-risk human papillomaviruses (HPVs are causally associated with multiple human cancers. Previous studies have shown that the HPV oncoprotein E7 induces immune suppression; however, the underlying mechanisms remain unknown. To understand the mechanisms by which HPV deregulates host immune responses in the tumor microenvironment, we analyzed gene expression changes of all known chemokines and their receptors using our global gene expression data sets from human HPV-positive and -negative head/neck cancer and cervical tissue specimens in different disease stages. We report that, while many proinflammatory chemokines increase expression throughout cancer progression, CXCL14 is dramatically downregulated in HPV-positive cancers. HPV suppression of CXCL14 is dependent on E7 and associated with DNA hypermethylation in the CXCL14 promoter. Using in vivo mouse models, we revealed that restoration of Cxcl14 expression in HPV-positive mouse oropharyngeal carcinoma cells clears tumors in immunocompetent syngeneic mice, but not in Rag1-deficient mice. Further, Cxcl14 reexpression significantly increases natural killer (NK, CD4+ T, and CD8+ T cell infiltration into the tumor-draining lymph nodes in vivo. In vitro transwell migration assays show that Cxcl14 reexpression induces chemotaxis of NK, CD4+ T, and CD8+ T cells. These results suggest that CXCL14 downregulation by HPV plays an important role in suppression of antitumor immune responses. Our findings provide a new mechanistic understanding of virus-induced immune evasion that contributes to cancer progression.

  2. Autologous Stem Cell Transplantation Disrupts Adaptive Immune Responses during Rebound Simian/Human Immunodeficiency Virus Viremia.

    Science.gov (United States)

    Reeves, Daniel B; Peterson, Christopher W; Kiem, Hans-Peter; Schiffer, Joshua T

    2017-07-01

    Primary HIV-1 infection induces a virus-specific adaptive/cytolytic immune response that impacts the plasma viral load set point and the rate of progression to AIDS. Combination antiretroviral therapy (cART) suppresses plasma viremia to undetectable levels that rebound upon cART treatment interruption. Following cART withdrawal, the memory component of the virus-specific adaptive immune response may improve viral control compared to primary infection. Here, using primary infection and treatment interruption data from macaques infected with simian/human immunodeficiency virus (SHIV), we observe a lower peak viral load but an unchanged viral set point during viral rebound. The addition of an autologous stem cell transplant before cART withdrawal alters viral dynamics: we found a higher rebound set point but similar peak viral loads compared to the primary infection. Mathematical modeling of the data that accounts for fundamental immune parameters achieves excellent fit to heterogeneous viral loads. Analysis of model output suggests that the rapid memory immune response following treatment interruption does not ultimately lead to better viral containment. Transplantation decreases the durability of the adaptive immune response following cART withdrawal and viral rebound. Our model's results highlight the impact of the endogenous adaptive immune response during primary SHIV infection. Moreover, because we capture adaptive immune memory and the impact of transplantation, this model will provide insight into further studies of cure strategies inspired by the Berlin patient. IMPORTANCE HIV patients who interrupt combination antiretroviral therapy (cART) eventually experience viral rebound, the return of viral loads to pretreatment levels. However, the "Berlin patient" remained free of HIV rebound over a decade after stopping cART. His cure is attributed to leukemia treatment that included an HIV-resistant stem cell transplant. Inspired by this case, we studied the impact

  3. Functional motifs responsible for human metapneumovirus M2-2-mediated innate immune evasion.

    Science.gov (United States)

    Chen, Yu; Deng, Xiaoling; Deng, Junfang; Zhou, Jiehua; Ren, Yuping; Liu, Shengxuan; Prusak, Deborah J; Wood, Thomas G; Bao, Xiaoyong

    2016-12-01

    Human metapneumovirus (hMPV) is a major cause of lower respiratory infection in young children. Repeated infections occur throughout life, but its immune evasion mechanisms are largely unknown. We recently found that hMPV M2-2 protein elicits immune evasion by targeting mitochondrial antiviral-signaling protein (MAVS), an antiviral signaling molecule. However, the molecular mechanisms underlying such inhibition are not known. Our mutagenesis studies revealed that PDZ-binding motifs, 29-DEMI-32 and 39-KEALSDGI-46, located in an immune inhibitory region of M2-2, are responsible for M2-2-mediated immune evasion. We also found both motifs prevent TRAF5 and TRAF6, the MAVS downstream adaptors, to be recruited to MAVS, while the motif 39-KEALSDGI-46 also blocks TRAF3 migrating to MAVS. In parallel, these TRAFs are important in activating transcription factors NF-kB and/or IRF-3 by hMPV. Our findings collectively demonstrate that M2-2 uses its PDZ motifs to launch the hMPV immune evasion through blocking the interaction of MAVS and its downstream TRAFs. Copyright © 2016 Elsevier Inc. All rights reserved.

  4. Soluble CD14 in human breast milk and its role in innate immune responses.

    Science.gov (United States)

    Vidal, K; Labéta, M O; Schiffrin, E J; Donnet-Hughes, A

    2001-10-01

    Immune factors secreted in milk are important for health in the neonatal gut. We have detected the bacterial pattern recognition receptor, soluble CD14 (sCD14) in human breast milk at different times during lactation. The molecule occurs in a single form in milk, in contrast to human serum, in which there are two isoforms. Produced by mammary epithelial cells, milk sCD14 mediates secretion of innate immune response molecules such as interleukin-8, tumor necrosis factor-alpha, and epithelial neutrophil activator-78 by CD14-negative intestinal epithelial cells exposed to lipopolysaccharide (LPS) or bacteria. Although present at low concentrations in milk, LPS-binding protein may be implicated in the biological effects observed. Our findings support the premise that milk sCD14 acts as a 'sentinel' molecule and immune modulator in homeostasis and in the defense of the neonatal intestine. In so doing, it may prevent the immune and inflammatory conditions of the gut to which non-breastfed infants are predisposed.

  5. Cell-mediated immune response: a clinical review of the therapeutic potential of human papillomavirus vaccination.

    Science.gov (United States)

    Meyer, Sonja Izquierdo; Fuglsang, Katrine; Blaakaer, Jan

    2014-12-01

    This clinical review aims to assess the efficacy of human papillomavirus 16/18 (HPV16/18) vaccination on the cell-mediated immune response in women with existing cervical intraepithelial neoplasia or cervical cancer induced by HPV16 or HPV18. A focused and thorough literature search conducted in five different databases found 996 publications. Six relevant articles were chosen for further review. In total, 154 patients (>18 years of age) were enrolled in prospective study trials with 3-15 months of follow up. The vaccine applications were administered two to four times. The vaccines contained different combinations of HPV16 and HPV18 and early proteins, E6 and E7. The primary outcome was the cell-mediated immune response. Correlation to clinical outcome (histopathology) and human leukocyte antigen genes were secondary endpoints. All vaccines triggered a detectable cell-mediated immune response, some of which were statistically significant. Correlations between immunological response and clinical outcome (histopathology) were not significant, so neoplasms may not be susceptible to vaccine-generated cytotoxic T cells (CD8(+)). Prophylactic HPV vaccines have been introduced to reduce the incidence of cervical cancer in young women. Women already infected with HPV could benefit from a therapeutic HPV vaccination. Hence, it is important to continue the development of therapeutic HPV vaccines to lower the rate of HPV-associated malignancies and crucial to evaluate vaccine efficacy clinically. This clinical review represents an attempt to elucidate the theories supporting the development of an HPV vaccine with a therapeutic effect on human papillomavirus-induced malignancies of the cervix. © 2014 Nordic Federation of Societies of Obstetrics and Gynecology.

  6. The human immune response to streptococcal extracellular antigens: clinical, diagnostic, and potential pathogenetic implications.

    Science.gov (United States)

    Johnson, Dwight R; Kurlan, Roger; Leckman, James; Kaplan, Edward L

    2010-02-15

    Determination of an immune response to group A Streptococcus (GAS) antigens, frequently anti-streptolysin O and anti-DNase B, is crucial for documentation of bona fide GAS infection. Although the importance of immunologic confirmation of infection is widely accepted, the immediate and long-term immunokinetics of the human antibody response are incompletely documented and poorly understood. Pediatric study participants (n = 160) were followed during a 2-year study with monthly throat cultures (n = 3491) and blood samples (n = 1679) obtained every 13 weeks. Recovered GAS were characterized; serum anti-streptolysin O and anti-DNase B antibody titers were determined. Antibody titers and GAS culture results were temporally correlated and analyzed. The analyses clearly document, in some instances for the first time, that an increase in antibody titer more accurately defines infection than does an absolute titer (eg, "upper limit of normal"), that antibody titers can remain elevated for many months even without GAS, and that some individuals may harbor GAS continuously for months or years without symptoms of infection and without an associated immune response. Measuring 2 different antibodies is more accurate in defining infection. Single time-point cultures and single antibody titers are often misleading. Sequential samples more accurately define infection, allowing correlation of titer increases with temporal confirmation of GAS acquisition. Understanding kinetics of the immune response(s) to GAS infection is necessary in formulating accurate clinical diagnostic conclusions, to appropriate design of clinical and epidemiological studies examining the association of GAS with subsequent sequelae, and to providing insight into pathogenetic mechanisms associated with this important human pathogen.

  7. Characterising the mucosal and systemic immune responses to experimental human hookworm infection.

    Directory of Open Access Journals (Sweden)

    Soraya Gaze

    2012-02-01

    Full Text Available The mucosal cytokine response of healthy humans to parasitic helminths has never been reported. We investigated the systemic and mucosal cytokine responses to hookworm infection in experimentally infected, previously hookworm naive individuals from non-endemic areas. We collected both peripheral blood and duodenal biopsies to assess the systemic immune response, as well as the response at the site of adult worm establishment. Our results show that experimental hookworm infection leads to a strong systemic and mucosal Th2 (IL-4, IL-5, IL-9 and IL-13 and regulatory (IL-10 and TGF-β response, with some evidence of a Th1 (IFN-γ and IL-2 response. Despite upregulation after patency of both IL-15 and ALDH1A2, a known Th17-inducing combination in inflammatory diseases, we saw no evidence of a Th17 (IL-17 response. Moreover, we observed strong suppression of mucosal IL-23 and upregulation of IL-22 during established hookworm infection, suggesting a potential mechanism by which Th17 responses are suppressed, and highlighting the potential that hookworms and their secreted proteins offer as therapeutics for human inflammatory diseases.

  8. Voluntary activation of the sympathetic nervous system and attenuation of the innate immune response in humans.

    Science.gov (United States)

    Kox, Matthijs; van Eijk, Lucas T; Zwaag, Jelle; van den Wildenberg, Joanne; Sweep, Fred C G J; van der Hoeven, Johannes G; Pickkers, Peter

    2014-05-20

    Excessive or persistent proinflammatory cytokine production plays a central role in autoimmune diseases. Acute activation of the sympathetic nervous system attenuates the innate immune response. However, both the autonomic nervous system and innate immune system are regarded as systems that cannot be voluntarily influenced. Herein, we evaluated the effects of a training program on the autonomic nervous system and innate immune response. Healthy volunteers were randomized to either the intervention (n = 12) or control group (n = 12). Subjects in the intervention group were trained for 10 d in meditation (third eye meditation), breathing techniques (i.a., cyclic hyperventilation followed by breath retention), and exposure to cold (i.a., immersions in ice cold water). The control group was not trained. Subsequently, all subjects underwent experimental endotoxemia (i.v. administration of 2 ng/kg Escherichia coli endotoxin). In the intervention group, practicing the learned techniques resulted in intermittent respiratory alkalosis and hypoxia resulting in profoundly increased plasma epinephrine levels. In the intervention group, plasma levels of the anti-inflammatory cytokine IL-10 increased more rapidly after endotoxin administration, correlated strongly with preceding epinephrine levels, and were higher. Levels of proinflammatory mediators TNF-α, IL-6, and IL-8 were lower in the intervention group and correlated negatively with IL-10 levels. Finally, flu-like symptoms were lower in the intervention group. In conclusion, we demonstrate that voluntary activation of the sympathetic nervous system results in epinephrine release and subsequent suppression of the innate immune response in humans in vivo. These results could have important implications for the treatment of conditions associated with excessive or persistent inflammation, such as autoimmune diseases.

  9. Human disturbance alters endocrine and immune responses in the Galapagos marine iguana (Amblyrhynchus cristatus)

    Science.gov (United States)

    French, Susannah S; DeNardo, Dale F.; Greives, Timothy J.; Strand, Christine R.; Demas, Gregory E.

    2010-01-01

    Anthropogenic disturbance is a relevant and widespread facilitator of environmental change and there is clear evidence that it impacts natural populations. While population-level responses to major anthropogenic changes have been well studied, individual physiological responses to mild disturbance can be equally critical to the long-term survival of a species, yet they remain largely unexamined. The current study investigated the impact of seemingly low-level anthropogenic disturbance (ecotourism) on stress responsiveness and specific fitness-related immune measures in different breeding stages of the marine iguana (Amblyrhynchus cristatus). Specifically, we found stress-induced elevations in plasma corticosterone among tourist-exposed populations relative to undisturbed populations. We also found changes in multiple immunological responses associated with stress-related effects of human disturbance, including bacterial killing ability, cutaneous wound healing, and hemolytic complement activity, and the responses varied according to reproductive state. By identifying health-related consequences of human disturbance, this study provides critical insight into the conservation of a well-known species that has a very distinct ecology. The study also broadens the foundation of knowledge needed to understand the global significance of various levels of human disturbance. PMID:20708010

  10. Human disturbance alters endocrine and immune responses in the Galapagos marine iguana (Amblyrhynchus cristatus).

    Science.gov (United States)

    French, Susannah S; DeNardo, Dale F; Greives, Timothy J; Strand, Christine R; Demas, Gregory E

    2010-11-01

    Anthropogenic disturbance is a relevant and widespread facilitator of environmental change and there is clear evidence that it impacts natural populations. While population-level responses to major anthropogenic changes have been well studied, individual physiological responses to mild disturbance can be equally critical to the long-term survival of a species, yet they remain largely unexamined. The current study investigated the impact of seemingly low-level anthropogenic disturbance (ecotourism) on stress responsiveness and specific fitness-related immune measures in different breeding stages of the marine iguana (Amblyrhynchus cristatus). Specifically, we found stress-induced elevations in plasma corticosterone among tourist-exposed populations relative to undisturbed populations. We also found changes in multiple immunological responses associated with stress-related effects of human disturbance, including bacterial killing ability, cutaneous wound healing, and hemolytic complement activity, and the responses varied according to reproductive state. By identifying health-related consequences of human disturbance, this study provides critical insight into the conservation of a well-known species that has a very distinct ecology. The study also broadens the foundation of knowledge needed to understand the global significance of various levels of human disturbance. Copyright © 2010 Elsevier Inc. All rights reserved.

  11. Heterologous humoral immune response in patients treated with human growth hormone from different sources

    International Nuclear Information System (INIS)

    Cardoso, A.I.; Llera, A.S.; Iacono, R.F.

    1993-01-01

    The existence of homologous anti-human growth hormone (anti-hGH) and heterologous anti-bovine growth hormone (anti-bGH) humoral immune responses in hypopituitary patients under hGH therapy has been reported previously. In order to study the influence of the hormone source, both responses were compared by radiobinding assays performed with [ 125 I]hGH or [ 125 I]bGH as tracers. 57 hypopituitary patients treated with extractive hGH, recombinant methionyl hGH or authentic recombinant hGH were studied. A very low incidence of heterologous antibodies was found in patients under recombinant hGH therapy, contrary to the high incidence observed in patients treated with extractive hGH preparations. In addition, immunochemical studies performed with a synthetic peptide (hGH 44-128) indicated that this peptide exhibited, in the anti-bGH/[ 125 I]bGH radioimmunoassay system, higher reactivity than the native hGH, suggesting that such fragment resembled an altered conformation of the hormone. The high heterologous response elicited only by the extractive hGH along with the behaviour of the hGH 44-128 fragment supports the fact that the extraction and purification procedures in extractive preparations may alter slightly the structure of the hGH molecule and trigger a heterologous immune response. 16 refs., 4 figs., 1 tab

  12. Heterologous humoral immune response in patients treated with human growth hormone from different sources

    Energy Technology Data Exchange (ETDEWEB)

    Cardoso, A.I.; Llera, A.S.; Iacono, R.F. (and others) (Inst. de Estudios de la Inmunidad Humoral, Buenos Aires (Argentina))

    1993-07-01

    The existence of homologous anti-human growth hormone (anti-hGH) and heterologous anti-bovine growth hormone (anti-bGH) humoral immune responses in hypopituitary patients under hGH therapy has been reported previously. In order to study the influence of the hormone source, both responses were compared by radiobinding assays performed with [[sup 125]I]hGH or [[sup 125]I]bGH as tracers. 57 hypopituitary patients treated with extractive hGH, recombinant methionyl hGH or authentic recombinant hGH were studied. A very low incidence of heterologous antibodies was found in patients under recombinant hGH therapy, contrary to the high incidence observed in patients treated with extractive hGH preparations. In addition, immunochemical studies performed with a synthetic peptide (hGH 44-128) indicated that this peptide exhibited, in the anti-bGH/[[sup 125]I]bGH radioimmunoassay system, higher reactivity than the native hGH, suggesting that such fragment resembled an altered conformation of the hormone. The high heterologous response elicited only by the extractive hGH along with the behaviour of the hGH 44-128 fragment supports the fact that the extraction and purification procedures in extractive preparations may alter slightly the structure of the hGH molecule and trigger a heterologous immune response. 16 refs., 4 figs., 1 tab.

  13. Human immune responses to H. pylori HLA Class II epitopes identified by immunoinformatic methods.

    Directory of Open Access Journals (Sweden)

    Songhua Zhang

    Full Text Available H. pylori persists in the human stomach over decades and promotes several adverse clinical sequelae including gastritis, peptic ulcers and gastric cancer that are linked to the induction and subsequent evasion of chronic gastric inflammation. Emerging evidence indicates that H. pylori infection may also protect against asthma and some other immune-mediated conditions through regulatory T cell effects outside the stomach. To characterize the complexity of the CD4+ T cell response generated during H. pylori infection, computational methods were previously used to generate a panel of 90 predicted epitopes conserved among H. pylori genomes that broadly cover HLA Class II diversity for maximum population coverage. Here, these sequences were tested individually for their ability to induce in vitro responses in peripheral blood mononuclear cells by interferon-γ ELISpot assay. The average number of spot-forming cells/million PBMCs was significantly elevated in H. pylori-infected subjects over uninfected persons. Ten of the 90 peptides stimulated IFN-γ secretion in the H. pylori-infected group only, whereas two out of the 90 peptides elicited a detectable IFN-γ response in the H. pylori-uninfected subjects but no response in the H. pylori-infected group. Cytokine ELISA measurements performed using in vitro PBMC culture supernatants demonstrated significantly higher levels of TNF-α, IL-2, IL-4, IL-6, IL-10, and TGF-β1 in the H. pylori-infected subjects, whereas IL-17A expression was not related to the subjects H. pylori-infection status. Our results indicate that the human T cell responses to these 90 peptides are generally increased in actively H. pylori-infected, compared with H. pylori-naïve, subjects. This information will improve understanding of the complex immune response to H. pylori, aiding rational epitope-driven vaccine design as well as helping identify other H. pylori epitopes with potentially immunoregulatory effects.

  14. Human metapneumovirus M2-2 protein inhibits innate immune response in monocyte-derived dendritic cells.

    Directory of Open Access Journals (Sweden)

    Junping Ren

    Full Text Available Human metapneumovirus (hMPV is a leading cause of lower respiratory infection in young children, the elderly and immunocompromised patients. Repeated hMPV infections occur throughout life. However, immune evasion mechanisms of hMPV infection are largely unknown. Recently, our group has demonstrated that hMPV M2-2 protein, an important virulence factor, contributes to immune evasion in airway epithelial cells by targeting the mitochondrial antiviral-signaling protein (MAVS. Whether M2-2 regulates the innate immunity in human dendritic cells (DC, an important family of immune cells controlling antigen presenting, is currently unknown. We found that human DC infected with a virus lacking M2-2 protein expression (rhMPV-ΔM2-2 produced higher levels of cytokines, chemokines and IFNs, compared to cells infected with wild-type virus (rhMPV-WT, suggesting that M2-2 protein inhibits innate immunity in human DC. In parallel, we found that myeloid differentiation primary response gene 88 (MyD88, an essential adaptor for Toll-like receptors (TLRs, plays a critical role in inducing immune response of human DC, as downregulation of MyD88 by siRNA blocked the induction of immune regulatory molecules by hMPV. Since M2-2 is a cytoplasmic protein, we investigated whether M2-2 interferes with MyD88-mediated antiviral signaling. We found that indeed M2-2 protein associated with MyD88 and inhibited MyD88-dependent gene transcription. In this study, we also identified the domains of M2-2 responsible for its immune inhibitory function in human DC. In summary, our results demonstrate that M2-2 contributes to hMPV immune evasion by inhibiting MyD88-dependent cellular responses in human DC.

  15. Potent innate immune response to pathogenic leptospira in human whole blood.

    Directory of Open Access Journals (Sweden)

    Marga G A Goris

    Full Text Available BACKGROUND: Leptospirosis is caused by pathogenic spirochetes of the genus Leptospira. The bacteria enter the human body via abraded skin or mucous membranes and may disseminate throughout. In general the clinical picture is mild but some patients develop rapidly progressive, severe disease with a high case fatality rate. Not much is known about the innate immune response to leptospires during haematogenous dissemination. Previous work showed that a human THP-1 cell line recognized heat-killed leptospires and leptospiral LPS through TLR2 instead of TLR4. The LPS of virulent leptospires displayed a lower potency to trigger TNF production by THP-1 cells compared to LPS of non-virulent leptospires. METHODOLOGY/PRINCIPAL FINDINGS: We investigated the host response and killing of virulent and non-virulent Leptospira of different serovars by human THP-1 cells, human PBMC's and human whole blood. Virulence of each leptospiral strain was tested in a well accepted standard guinea pig model. Virulent leptospires displayed complement resistance in human serum and whole blood while in-vitro attenuated non-virulent leptospires were rapidly killed in a complement dependent manner. In vitro stimulation of THP-1 and PBMC's with heat-killed and living leptospires showed differential serovar and cell type dependence of cytokine induction. However, at low, physiological, leptospiral dose, living virulent complement resistant strains were consistently more potent in whole blood stimulations than the corresponding non-virulent complement sensitive strains. At higher dose living virulent and non-virulent leptospires were equipotent in whole blood. Inhibition of different TLRs indicated that both TLR2 and TLR4 as well as TLR5 play a role in the whole blood cytokine response to living leptospires. CONCLUSIONS/SIGNIFICANCE: Thus, in a minimally altered system as human whole blood, highly virulent Leptospira are potent inducers of the cytokine response.

  16. Molecular genetics of human immune responsiveness to Lolium perenne (rye) allergen, Lol p III.

    Science.gov (United States)

    Ansari, A A; Freidhoff, L R; Marsh, D G

    1989-01-01

    Lol p II and III are each about 11-kD protein allergens from the pollen of Lolium perenne (rye grass). We have found that human immune responses (IgE and IgG antibodies) to both proteins are significantly associated with HLA-DR3. In addition, the two proteins are cross-reactive with the antibodies in many human sera (about 84% human sera showed the cross-reactivity). We have determined greater than 90% of the amino acid sequences of the two proteins and found that they are at least 54% homologous. Berzofsky found that 75% of the 23 known T cell sites in various proteins had an amphipathic structure. Our analysis by the same method showed that both Lol p II and III have a major region of amphipathicity (at residues 61-67, Lol p III numbering) which might contain sites for binding to an Ia molecule and a T cell receptor. This region is identical between Lol p II and III, except for an Arg-Lys substitution, and could account, in part, for the DR3 association with responsiveness to both molecules. An interesting difference between the two proteins is that immune response to Lol p III is associated with DR5 (in addition to DR3), whereas no DR5 association is found in the case of Lol p II. One possibility is that Lol p III has an additional site which binds to the DR5 Ia molecule. Lol p III indeed has a second highly amphiphathic peptide, 24-30 (Lol p III 24 R P G D T L A 30), which is different and not amphipathic in Lol p II.(ABSTRACT TRUNCATED AT 250 WORDS)

  17. Human Leukocyte Antigen (HLA and Immune Regulation: How Do Classical and Non-Classical HLA Alleles Modulate Immune Response to Human Immunodeficiency Virus and Hepatitis C Virus Infections?

    Directory of Open Access Journals (Sweden)

    Nicole B. Crux

    2017-07-01

    Full Text Available The genetic factors associated with susceptibility or resistance to viral infections are likely to involve a sophisticated array of immune response. These genetic elements may modulate other biological factors that account for significant influence on the gene expression and/or protein function in the host. Among them, the role of the major histocompatibility complex in viral pathogenesis in particular human immunodeficiency virus (HIV and hepatitis C virus (HCV, is very well documented. We, recently, added a novel insight into the field by identifying the molecular mechanism associated with the protective role of human leukocyte antigen (HLA-B27/B57 CD8+ T cells in the context of HIV-1 infection and why these alleles act as a double-edged sword protecting against viral infections but predisposing the host to autoimmune diseases. The focus of this review will be reexamining the role of classical and non-classical HLA alleles, including class Ia (HLA-A, -B, -C, class Ib (HLA-E, -F, -G, -H, and class II (HLA-DR, -DQ, -DM, and -DP in immune regulation and viral pathogenesis (e.g., HIV and HCV. To our knowledge, this is the very first review of its kind to comprehensively analyze the role of these molecules in immune regulation associated with chronic viral infections.

  18. mEBT: multiple-matching Evidence-based Translator of Murine Genomic Responses for Human Immunity Studies.

    Science.gov (United States)

    Tae, Donghyun; Seok, Junhee

    2018-05-29

    In this paper, we introduce multiple-matching Evidence-based Translator (mEBT) to discover genomic responses from murine expression data for human immune studies, which are significant in the given condition of mice and likely have similar responses in the corresponding condition of human. mEBT is evaluated over multiple data sets and shows improved inter-species agreement. mEBT is expected to be useful for research groups who use murine models to study human immunity. http://cdal.korea.ac.kr/mebt/. jseok14@korea.ac.kr. Supplementary data are available at Bioinformatics online.

  19. Human Norovirus and Its Surrogates Induce Plant Immune Response in Arabidopsis thaliana and Lactuca sativa.

    Science.gov (United States)

    Markland, Sarah M; Bais, Harsh; Kniel, Kalmia E

    2017-08-01

    Human norovirus is the leading cause of foodborne illness worldwide with the majority of outbreaks linked to fresh produce and leafy greens. It is essential that we thoroughly understand the type of relationship and interactions that take place between plants and human norovirus to better utilize control strategies to reduce transmission of norovirus in the field onto plants harvested for human consumption. In this study the expression of gene markers for the salicylic acid (SA) and jasmonic acid (JA) plant defense pathways was measured and compared in romaine lettuce (Lactuca sativa) and Arabidopsis thaliana Col-0 plants that were inoculated with Murine Norovirus-1, Tulane Virus, human norovirus GII.4, or Hank's Balanced Salt Solution (control). Genes involving both the SA and JA pathways were expressed in both romaine lettuce and A. thaliana for all three viruses, as well as controls. Studies, including gene expression of SA- and JA-deficient A. thaliana mutant lines, suggest that the JA pathway is more likely involved in the plant immune response to human norovirus. This research provides the first pieces of information regarding how foodborne viruses interact with plants in the preharvest environment.

  20. A model for personalized in vivo analysis of human immune responsiveness

    NARCIS (Netherlands)

    Kalscheuer, Hannes; Danzl, Nichole; Onoe, Takashi; Faust, Ted; Winchester, Robert; Goland, Robin; Greenberg, Ellen; Spitzer, Thomas R; Savage, David G; Tahara, Hiroyuki; Choi, Goda; Yang, Yong-Guang; Sykes, Megan

    2012-01-01

    Studies of human immune diseases are generally limited to the analysis of peripheral blood lymphocytes of heterogeneous patient populations. Improved models are needed to allow analysis of fundamental immunologic abnormalities predisposing to disease and in which to assess immunotherapies.

  1. Voluntary activation of the sympathetic nervous system and attenuation of the innate immune response in humans

    NARCIS (Netherlands)

    Kox, M.; Eijk, L.T.G.J. van; Zwaag, J.; Wildenberg, J. van den; Sweep, F.C.; Hoeven, J.G. van der; Pickkers, P.

    2014-01-01

    Excessive or persistent proinflammatory cytokine production plays a central role in autoimmune diseases. Acute activation of the sympathetic nervous system attenuates the innate immune response. However, both the autonomic nervous system and innate immune system are regarded as systems that cannot

  2. The capsule of Porphyromonas gingivalis reduces the immune response of human gingival fibroblasts

    Directory of Open Access Journals (Sweden)

    van Winkelhoff Arie J

    2010-01-01

    Full Text Available Abstract Background Periodontitis is a bacterial infection of the periodontal tissues. The Gram-negative anaerobic bacterium Porphyromonas gingivalis is considered a major causative agent. One of the virulence factors of P. gingivalis is capsular polysaccharide (CPS. Non-encapsulated strains have been shown to be less virulent in mouse models than encapsulated strains. Results To examine the role of the CPS in host-pathogen interactions we constructed an insertional isogenic P. gingivalis knockout in the epimerase-coding gene epsC that is located at the end of the CPS biosynthesis locus. This mutant was subsequently shown to be non-encapsulated. K1 capsule biosynthesis could be restored by in trans expression of an intact epsC gene. We used the epsC mutant, the W83 wild type strain and the complemented mutant to challenge human gingival fibroblasts to examine the immune response by quantification of IL-1β, IL-6 and IL-8 transcription levels. For each of the cytokines significantly higher expression levels were found when fibroblasts were challenged with the epsC mutant compared to those challenged with the W83 wild type, ranging from two times higher for IL-1β to five times higher for IL-8. Conclusions These experiments provide the first evidence that P. gingivalis CPS acts as an interface between the pathogen and the host that may reduce the host's pro-inflammatory immune response. The higher virulence of encapsulated strains may be caused by this phenomenon which enables the bacteria to evade the immune system.

  3. Assessment of humoral immune responses to blood-stage malaria antigens following ChAd63-MVA immunization, controlled human malaria infection and natural exposure.

    Science.gov (United States)

    Biswas, Sumi; Choudhary, Prateek; Elias, Sean C; Miura, Kazutoyo; Milne, Kathryn H; de Cassan, Simone C; Collins, Katharine A; Halstead, Fenella D; Bliss, Carly M; Ewer, Katie J; Osier, Faith H; Hodgson, Susanne H; Duncan, Christopher J A; O'Hara, Geraldine A; Long, Carole A; Hill, Adrian V S; Draper, Simon J

    2014-01-01

    The development of protective vaccines against many difficult infectious pathogens will necessitate the induction of effective antibody responses. Here we assess humoral immune responses against two antigens from the blood-stage merozoite of the Plasmodium falciparum human malaria parasite--MSP1 and AMA1. These antigens were delivered to healthy malaria-naïve adult volunteers in Phase Ia clinical trials using recombinant replication-deficient viral vectors--ChAd63 to prime the immune response and MVA to boost. In subsequent Phase IIa clinical trials, immunized volunteers underwent controlled human malaria infection (CHMI) with P. falciparum to assess vaccine efficacy, whereby all but one volunteer developed low-density blood-stage parasitemia. Here we assess serum antibody responses against both the MSP1 and AMA1 antigens following i) ChAd63-MVA immunization, ii) immunization and CHMI, and iii) primary malaria exposure in the context of CHMI in unimmunized control volunteers. Responses were also assessed in a cohort of naturally-immune Kenyan adults to provide comparison with those induced by a lifetime of natural malaria exposure. Serum antibody responses against MSP1 and AMA1 were characterized in terms of i) total IgG responses before and after CHMI, ii) responses to allelic variants of MSP1 and AMA1, iii) functional growth inhibitory activity (GIA), iv) IgG avidity, and v) isotype responses (IgG1-4, IgA and IgM). These data provide the first in-depth assessment of the quality of adenovirus-MVA vaccine-induced antibody responses in humans, along with assessment of how these responses are modulated by subsequent low-density parasite exposure. Notable differences were observed in qualitative aspects of the human antibody responses against these malaria antigens depending on the means of their induction and/or exposure of the host to the malaria parasite. Given the continued clinical development of viral vectored vaccines for malaria and a range of other diseases

  4. Assessment of humoral immune responses to blood-stage malaria antigens following ChAd63-MVA immunization, controlled human malaria infection and natural exposure.

    Directory of Open Access Journals (Sweden)

    Sumi Biswas

    Full Text Available The development of protective vaccines against many difficult infectious pathogens will necessitate the induction of effective antibody responses. Here we assess humoral immune responses against two antigens from the blood-stage merozoite of the Plasmodium falciparum human malaria parasite--MSP1 and AMA1. These antigens were delivered to healthy malaria-naïve adult volunteers in Phase Ia clinical trials using recombinant replication-deficient viral vectors--ChAd63 to prime the immune response and MVA to boost. In subsequent Phase IIa clinical trials, immunized volunteers underwent controlled human malaria infection (CHMI with P. falciparum to assess vaccine efficacy, whereby all but one volunteer developed low-density blood-stage parasitemia. Here we assess serum antibody responses against both the MSP1 and AMA1 antigens following i ChAd63-MVA immunization, ii immunization and CHMI, and iii primary malaria exposure in the context of CHMI in unimmunized control volunteers. Responses were also assessed in a cohort of naturally-immune Kenyan adults to provide comparison with those induced by a lifetime of natural malaria exposure. Serum antibody responses against MSP1 and AMA1 were characterized in terms of i total IgG responses before and after CHMI, ii responses to allelic variants of MSP1 and AMA1, iii functional growth inhibitory activity (GIA, iv IgG avidity, and v isotype responses (IgG1-4, IgA and IgM. These data provide the first in-depth assessment of the quality of adenovirus-MVA vaccine-induced antibody responses in humans, along with assessment of how these responses are modulated by subsequent low-density parasite exposure. Notable differences were observed in qualitative aspects of the human antibody responses against these malaria antigens depending on the means of their induction and/or exposure of the host to the malaria parasite. Given the continued clinical development of viral vectored vaccines for malaria and a range of other

  5. The human metapneumovirus matrix protein stimulates the inflammatory immune response in vitro.

    Directory of Open Access Journals (Sweden)

    Audrey Bagnaud-Baule

    Full Text Available Each year, during winter months, human Metapneumovirus (hMPV is associated with epidemics of bronchiolitis resulting in the hospitalization of many infants. Bronchiolitis is an acute illness of the lower respiratory tract with a consequent inflammation of the bronchioles. The rapid onset of inflammation suggests the innate immune response may have a role to play in the pathogenesis of this hMPV infection. Since, the matrix protein is one of the most abundant proteins in the Paramyxoviridae family virion, we hypothesized that the inflammatory modulation observed in hMPV infected patients may be partly associated with the matrix protein (M-hMPV response. By western blot analysis, we detected a soluble form of M-hMPV released from hMPV infected cell as well as from M-hMPV transfected HEK 293T cells suggesting that M-hMPV may be directly in contact with antigen presenting cells (APCs during the course of infection. Moreover, flow cytometry and confocal microscopy allowed determining that M-hMPV was taken up by dendritic cells (moDCs and macrophages inducing their activation. Furthermore, these moDCs enter into a maturation process inducing the secretion of a broad range of inflammatory cytokines when exposed to M-hMPV. Additionally, M-hMPV activated DCs were shown to stimulate IL-2 and IFN-γ production by allogeneic T lymphocytes. This M-hMPV-mediated activation and antigen presentation of APCs may in part explain the marked inflammatory immune response observed in pathology induced by hMPV in patients.

  6. A change in inflammatory footprint precedes plaque instability: a systematic evaluation of cellular aspects of the adaptive immune response in human atherosclerosis

    NARCIS (Netherlands)

    van Dijk, R. A.; Duinisveld, A. J. F.; Schaapherder, A. F.; Mulder-Stapel, A.; Hamming, J. F.; Kuiper, J.; de Boer, O. J.; van der Wal, A. C.; Kolodgie, F. D.; Virmani, R.; Lindeman, J. H. N.

    2015-01-01

    Experimental studies characterize adaptive immune response as a critical factor in the progression and complications of atherosclerosis. Yet, it is unclear whether these observations translate to the human situation. This study systematically evaluates cellular components of the adaptive immune

  7. Immune responses to metastases

    International Nuclear Information System (INIS)

    Herberman, R.B.; Wiltrout, R.H.; Gorelik, E.

    1987-01-01

    The authors present the changes in the immune system in tumor-bearing hosts that may influence the development of progression of metastases. Included are mononuclear cell infiltration of metastases; alterations in natural resistance mediated by natural killer cells and macrophages; development of specific immunity mediated by T-lymphocytes or antibodies; modulation of tumor-associated antigen expression; and the down-regulation of the immune response to the tumor by several suppressor mechanisms; the augmentation of the immune response and its potential for therapeutic application; includes the prophylaxis of metastases formation by NK cells; the therapy of metastases by augmentation NK-, macrophage-, or T-lymphocyte-mediated responses by biological response modifiers; and the transfer of anticancer activity by cytoxic T-lymphocytes or immunoconjugates of monoclonal antibodies with specificity for tumors

  8. Systems-Biology Approaches to Discover Anti-Viral Effectors of the Human Innate Immune Response

    Directory of Open Access Journals (Sweden)

    Andreas F.R. Sommer

    2011-07-01

    Full Text Available Virus infections elicit an immediate innate response involving antiviral factors. The activities of some of these factors are, in turn, blocked by viral countermeasures. The ensuing battle between the host and the viruses is crucial for determining whether the virus establishes a foothold and/or induces adaptive immune responses. A comprehensive systems-level understanding of the repertoire of anti-viral effectors in the context of these immediate virus-host responses would provide significant advantages in devising novel strategies to interfere with the initial establishment of infections. Recent efforts to identify cellular factors in a comprehensive and unbiased manner, using genome-wide siRNA screens and other systems biology “omics” methodologies, have revealed several potential anti-viral effectors for viruses like Human immunodeficiency virus type 1 (HIV-1, Hepatitis C virus (HCV, West Nile virus (WNV, and influenza virus. This review describes the discovery of novel viral restriction factors and discusses how the integration of different methods in systems biology can be used to more comprehensively identify the intimate interactions of viruses and the cellular innate resistance.

  9. Immune response to the West Nile virus in aged non-human primates.

    Directory of Open Access Journals (Sweden)

    Anne M Wertheimer

    2010-12-01

    Full Text Available Risk of encephalitis from West Nile virus (WNV infection increases dramatically with age. Understanding the basis of this susceptibility requires development of suitable animal models. Here, we investigated the immune response to WNV in old non-human primates.We investigated clinical, immunological and virological correlates of WNV infection in aging non-human primates. Aged (17-30 yrs and adult (6-9 yrs Rhesus macaques (RM were challenged with WNV in the presence or the absence of the mosquito salivary gland extract (SGE to approximate natural infection. None of the 26 animals exhibited clinical signs of the disease. Quantitative PCR suggested discrete and short-lived viremia, but infectious virus was never isolated. There was markedly increased, age-independent, proliferation of CD3(- non-B cells, followed by B-cell proliferation, which correlated to the loss of detectable WNV genomes. Moreover, animals primed with mosquito salivary gland extract exhibited reduced circulating WNV RNA. While we found the expected age-associated reduction in T cell proliferation, adaptive immunity did not correlate with infection outcome. That was further confirmed in a cohort of thymectomized and/or CD8 T-cell depleted Cynomolgus macaques (CM; N = 15, who also failed to develop WNV disease.Results are consistent with strong and age-independent innate resistance of macaques against WNV challenge. This animal model is therefore not suitable for vaccine and therapeutic testing against WNV. However, understanding the basis of their innate resistance against WNV in macaques could provide helpful clues to improve anti-WNV protection of older adults.

  10. Aberrant cellular immune responses in humans infected persistently with parvovirus B19

    DEFF Research Database (Denmark)

    Isa, Adiba; Norbeck, Oscar; Hirbod, Taha

    2006-01-01

    A subset of parvovirus B19 (B19) infected patients retains the infection for years, as defined by detection of B19 DNA in bone marrow. Thus far, analysis of B19-specific humoral immune responses and viral genome variations has not revealed a mechanism for the absent viral clearance. In this study......, ex-vivo cellular immune responses were assessed by enzyme linked immunospot assay mounted against the majority of the translated viral genome. Compared to seropositive healthy individuals, individuals with B19 persistence (2-8 years) showed larger number of responses to the structural proteins (P = 0.......0022), whereas responses to the non-structural protein were of lower magnitude (P = 0.012). These observations provide the first findings of immunological discrepancies between individuals with B19 persistence and healthy individuals, findings that may reflect both failed immunity and antigenic exhaustion....

  11. Humoral immune response to the entire human immunodeficiency virus envelope glycoprotein made in insect cells

    Energy Technology Data Exchange (ETDEWEB)

    Rusche, J.R.; Lynn, D.L.; Robert-Guroff, M.; Langlois, A.J.; Lyerly, H.K.; Carson, H.; Krohn, K.; Ranki, A.; Gallo, R.C.; Bolognesi, D.P.; Putney, S.D.

    1987-10-01

    The human immunodeficiency virus envelope gene was expressed in insect cells by using a Baculovirus expression vector. The protein has an apparent molecular mass of 160 kDa, appears on the surface of infected insect cells, and does not appear to be cleaved to glycoproteins gp120 and gp41. Goats immunized with the 160-kDa protein have high titers of antibody that neutralizes virus infection as measured by viral gene expression or cell cytolysis. In addition, immune sera can block fusion of human immunodeficiency virus-infected cells in culture. Both neutralization and fusion-blocking activities are bound to and eluted from immobilized gp120.

  12. Humoral immune response to the entire human immunodeficiency virus envelope glycoprotein made in insect cells

    International Nuclear Information System (INIS)

    Rusche, J.R.; Lynn, D.L.; Robert-Guroff, M.

    1987-01-01

    The human immunodeficiency virus envelope gene was expressed in insect cells by using a Baculovirus expression vector. The protein has an apparent molecular mass of 160 kDa, appears on the surface of infected insect cells, and does not appear to be cleaved to glycoproteins gp120 and gp41. Goats immunized with the 160-kDa protein have high titers of antibody that neutralizes virus infection as measured by viral gene expression or cell cytolysis. In addition, immune sera can block fusion of human immunodeficiency virus-infected cells in culture. Both neutralization and fusion-blocking activities are bound to and eluted from immobilized gp120

  13. Survey of innate immune responses to Burkholderia pseudomallei in human blood identifies a central role for lipopolysaccharide.

    Directory of Open Access Journals (Sweden)

    Narisara Chantratita

    Full Text Available B. pseudomallei is a gram-negative bacterium that causes the tropical infection melioidosis. In northeast Thailand, mortality from melioidosis approaches 40%. As exemplified by the lipopolysaccharide-Toll-like receptor 4 interaction, innate immune responses to invading bacteria are precipitated by activation of host pathogen recognition receptors by pathogen associated molecular patterns. Human melioidosis is characterized by up-regulation of pathogen recognition receptors and pro-inflammatory cytokine release. In contrast to many gram-negative pathogens, however, the lipopolysaccharide of B. pseudomallei is considered only weakly inflammatory. We conducted a study in 300 healthy Thai subjects to investigate the ex vivo human blood response to various bacterial pathogen associated molecular patterns, including lipopolysaccharide from several bacteria, and to two heat-killed B. pseudomallei isolates. We measured cytokine levels after stimulation of fresh whole blood with a panel of stimuli. We found that age, sex, and white blood cell count modulate the innate immune response to B. pseudomallei. We further observed that, in comparison to other stimuli, the innate immune response to B. pseudomallei is most highly correlated with the response to lipopolysaccharide. The magnitude of cytokine responses induced by B. pseudomallei lipopolysaccharide was significantly greater than those induced by lipopolysaccharide from Escherichia coli and comparable to many responses induced by lipopolysaccharide from Salmonella minnesota despite lower amounts of lipid A in the B. pseudomallei lipopolysaccharide preparation. In human monocytes stimulated with B. pseudomallei, addition of polymyxin B or a TLR4/MD-2 neutralizing antibody inhibited the majority of TNF-α production. Challenging existing views, our data indicate that the innate immune response to B. pseudomallei in human blood is largely driven by lipopolysaccharide, and that the response to B

  14. Clinical responses to adoptive T-cell transfer can be modeled in an autologous immune-humanized mouse model

    DEFF Research Database (Denmark)

    Jespersen, Henrik; Lindberg, Mattias F; Donia, Marco

    2017-01-01

    Immune checkpoint inhibitors and adoptive cell transfer (ACT) of autologous tumor-infiltrating T cells have shown durable responses in patients with melanoma. To study ACT and immunotherapies in a humanized model, we have developed PDXv2.0 - a melanoma PDX model where tumor cells and tumor...

  15. B-Cell and T-Cell Immune Responses to Experimental Helicobacter pylori Infection in Humans

    Science.gov (United States)

    Nurgalieva, Zhannat Z.; Conner, Margaret E.; Opekun, Antone R.; Zheng, Carl Q.; Elliott, Susan N.; Ernst, Peter B.; Osato, Michael; Estes, Mary K.; Graham, David Y.

    2005-01-01

    The acute antibody and T-cell immune response to Helicobacter pylori infection in humans has not been studied systematically. Serum from H. pylori-naive volunteers challenged with H. pylori and cured after 4 or 12 weeks was tested by enzyme-linked immunosorbent assays for anti-H. pylori-specific immunoglobulin M (IgM) and IgA established using bacterial lysates from homologous (the infecting strain) and heterologous H. pylori. Proteins recognized by IgM antibody were identified by mass spectrometry of immunoreactive bands separated by two-dimensional gel electrophoresis. Mucosal T-cell subsets (CD4, CD8, CD3, and CD30 cells) were assessed by immunohistochemistry. All 18 infected volunteers developed H. pylori-specific IgM responses to both homologous or heterologous H. pylori antigens. H. pylori antigens reacted with IgM antibody at 4 weeks postinfection. IgM Western blotting showed immunoreactivity of postinfection serum samples to multiple H. pylori proteins with molecular weights ranging between 9,000 (9K) to 150K with homologous strains but only a 70K band using heterologous antigens. Two-dimensional electrophoresis demonstrated that production of H. pylori-specific IgM antibodies was elicited by H. pylori flagellins A and B, urease B, ABC transporter binding protein, heat shock protein 70 (DnaK), and alkyl hydroperoxide reductase. Mucosal CD3, CD4, and CD8 T-cell numbers increased following infection. IgM antibody responses were detected to a range of homologous H. pylori antigens 2 to 4 weeks postchallenge. The majority of H. pylori proteins were those involved in motility and colonization and may represent targets for vaccine development. PMID:15845507

  16. Immune response to H pylori

    Science.gov (United States)

    Suarez, Giovanni; Reyes, Victor E; Beswick, Ellen J

    2006-01-01

    The gastric mucosa separates the underlying tissue from the vast array of antigens that traffic through the stomach lumen. While the extreme pH of this environment is essential in aiding the activation of enzymes and food digestion, it also renders the gastric epithelium free from bacterial colonization, with the exception of one important human pathogen, H pylori. This bacterium has developed mechanisms to survive the harsh environment of the stomach, actively move through the mucosal layer, attach to the epithelium, evade immune responses, and achieve persistent colonization. While a hallmark of this infection is a marked inflammatory response with the infiltration of various immune cells into the infected gastric mucosa, the host immune response is unable to clear the infection and may actually contribute to the associated pathogenesis. Here, we review the host responses involved during infection with H pylori and how they are influenced by this bacterium. PMID:17007009

  17. immune response in human leishmania infections Respuesta inmune en infecciones humanas por Leishmania spp

    Directory of Open Access Journals (Sweden)

    Sara María Robledo Restrepo

    2000-03-01

    Full Text Available This review summarizes relevant information about the immune response triggered during leishmaniosis, a disease of great importance from the epidemiological point of view, since it is endemic in Colombia and other countries. We emphasize on human leishmaniosis; nevertheless, some important findings in the murine model are also mentioned. This information allows to conclude that Leishmania infection is a complex and coordinated process, which includes adhesion and entrance of the parasite into the host cells and its survival inside them. Events that mediate the infection process may influence its result in terms of elimination of the parasite or development of the disease, through induction or not of an effective specific immune response which involves host cell activation and parasite destruction. La presente revisión tiene como objetivo resumir la información más relevante acerca de la respuesta inmune que se desencadena durante la leishmaniosis, una enfermedad de gran importancia desde el punto de vista epidemiológico dado que es endémica en Colombia y otros países. Aunque la respuesta inmune en la leishmaniosis es un tema que se ha estudiado ampliamente en las infecciones por especies de Leishmania del Viejo Mundo, particularmente Leishmania major y Leishmania donovani y en el modelo murino, la presente revisión hace énfasis en la leishmaniosis humana. Algunos hallazgos importantes en el modelo murino también se mencionan. La información contenida en la revisión, en su mayoría, proviene de publicaciones derivadas de investigaciones, las cuales se seleccionaron con base en la calidad del trabajo realizado y en los aportes de sus resultados en el avance del conocimiento sobre las infecciones en humanos. La síntesis de la información seleccionada nos permite concluir que la infección por Leishmania es un proceso complejo y coordinado que incluye la adherencia y entrada del parásito a la célula hospedera y su posterior

  18. Human Immunodeficiency Virus Type 1-Hepatitis C Virus Coinfection: Intraindividual Comparison of Cellular Immune Responses against Two Persistent Viruses

    OpenAIRE

    Lauer, Georg M.; Nguyen, Tam N.; Day, Cheryl L.; Robbins, Gregory K.; Flynn, Theresa; McGowan, Katherine; Rosenberg, Eric S.; Lucas, Michaela; Klenerman, Paul; Chung, Raymond T.; Walker, Bruce D.

    2002-01-01

    Both human immunodeficiency virus type 1 (HIV-1) and hepatitis C virus (HCV) lead to chronic infection in a high percentage of persons, and an expanding epidemic of HIV-1-HCV coinfection has recently been identified. These individuals provide an opportunity for simultaneous assessment of immune responses to two viral infections associated with chronic plasma viremia. In this study we analyzed the breadth and magnitude of the CD8+- and CD4+-T-lymphocyte responses in 22 individuals infected wit...

  19. Catalog of Differentially Expressed Long Non-Coding RNA following Activation of Human and Mouse Innate Immune Response

    Directory of Open Access Journals (Sweden)

    Benoit T. Roux

    2017-08-01

    Full Text Available Despite increasing evidence to indicate that long non-coding RNAs (lncRNAs are novel regulators of immunity, there has been no systematic attempt to identify and characterize the lncRNAs whose expression is changed following the induction of the innate immune response. To address this issue, we have employed next-generation sequencing data to determine the changes in the lncRNA profile in four human (monocytes, macrophages, epithelium, and chondrocytes and four mouse cell types (RAW 264.7 macrophages, bone marrow-derived macrophages, peritoneal macrophages, and splenic dendritic cells following exposure to the pro-inflammatory mediators, lipopolysaccharides (LPS, or interleukin-1β. We show differential expression of 204 human and 210 mouse lncRNAs, with positional analysis demonstrating correlation with immune-related genes. These lncRNAs are predominantly cell-type specific, composed of large regions of repeat sequences, and show poor evolutionary conservation. Comparison within the human and mouse sequences showed less than 1% sequence conservation, although we identified multiple conserved motifs. Of the 204 human lncRNAs, 21 overlapped with syntenic mouse lncRNAs, of which five were differentially expressed in both species. Among these syntenic lncRNA was IL7-AS (antisense, which was induced in multiple cell types and shown to regulate the production of the pro-inflammatory mediator interleukin-6 in both human and mouse cells. In summary, we have identified and characterized those lncRNAs that are differentially expressed following activation of the human and mouse innate immune responses and believe that these catalogs will provide the foundation for the future analysis of the role of lncRNAs in immune and inflammatory responses.

  20. FINE SPECIFICITY OF CELLULAR IMMUNE-RESPONSES IN HUMANS TO HUMAN CYTOMEGALOVIRUS IMMEDIATE-EARLY 1-PROTEIN

    NARCIS (Netherlands)

    ALP, NJ; ALLPORT, TD; VANZANTEN, J; RODGERS, B; SISSONS, JGP; BORYSIEWICZ, LK

    Cell-mediated immunity is important in maintaining the virus-host equilibrium in persistent human cytomegalovirus (HCMV) infection. The HCMV 72-kDa major immediate early 1 protein (IE1) is a target for CD8+ cytotoxic T cells in humans, as is the equivalent 89-kDa protein in mouse. Less is known

  1. Characterization of cellular immune response and innate immune signaling in human and nonhuman primate primary mononuclear cells exposed to Burkholderia mallei.

    Science.gov (United States)

    Alam, Shahabuddin; Amemiya, Kei; Bernhards, Robert C; Ulrich, Robert G; Waag, David M; Saikh, Kamal U

    2015-01-01

    Burkholderia pseudomallei infection causes melioidosis and is often characterized by severe sepsis. Although rare in humans, Burkholderia mallei has caused infections in laboratory workers, and the early innate cellular response to B. mallei in human and nonhuman primates has not been characterized. In this study, we examined the primary cellular immune response to B. mallei in PBMC cultures of non-human primates (NHPs), Chlorocebus aethiops (African Green Monkeys), Macaca fascicularis (Cynomolgus macaque), and Macaca mulatta (Rhesus macaque) and humans. Our results demonstrated that B. mallei elicited strong primary pro-inflammatory cytokines (IFN-γ, TNF-α, IL-1β, and IL-6) equivalent to the levels of B. pseudomallei in primary PBMC cultures of NHPs and humans. When we examined IL-1β and other cytokine responses by comparison to Escherichia coli LPS, African Green Monkeys appears to be most responsive to B. mallei than Cynomolgus or Rhesus. Characterization of the immune signaling mechanism for cellular response was conducted by using a ligand induced cell-based reporter assay, and our results demonstrated that MyD88 mediated signaling contributed to the B. mallei and B. pseudomallei induced pro-inflammatory responses. Notably, the induced reporter activity with B. mallei, B. pseudomallei, or purified LPS from these pathogens was inhibited and cytokine production was attenuated by a MyD88 inhibitor. Together, these results show that in the scenario of severe hyper-inflammatory responses to B. mallei infection, MyD88 targeted therapeutic intervention may be a successful strategy for therapy. Published by Elsevier Ltd.

  2. Evaluation of the humoral immune response to human leukocyte antigens in Brazilian renal transplant candidates.

    Directory of Open Access Journals (Sweden)

    Patricia Keiko Saito

    Full Text Available Pre-transplant sensitization to human leukocyte antigens (HLA is a risk factor for graft failure. Studies of the immunological profile related to anti-HLA antibodies in Brazilian renal transplant candidates are few. In this study, we evaluated the humoral immune response to HLA antigens in 269 renal transplant candidates, in Paraná State, Brazil. The HLA typing was performed by the polymerase chain reaction sequence-specific oligonucleotide method (PCR-SSO combined with Luminex technology, using an SSO-LABType commercial kit (One Lambda, Inc., Canoga Park, CA, USA. The percentages of panel-reactive antibodies (PRA and the specificity of anti-HLA antibodies were determined using the LS1PRA and LS2PRA commercial kits (One Lambda, Inc.. The PRA-positive group consisted of 182 (67.7% patients, and the PRA-negative group of 87 (32.3% patients. The two groups differed significantly only with respect to gender. Females were the most sensitized. Among the 182 patients with PRA- positive, 62 (34.1% were positive for class I and negative for class II, 39 (21.4% were negative for class I and positive for class II, and 81 (44.5% were positive for both classes I and II. The HLA-A*02, A*24, A*01, B*44, B*35, B*15, DRB1*11, DRB1*04 and DRB1*03 allele groups were the most frequent. The specificities of anti-HLA antibodies were more frequent: A34, B57, Cw15, Cw16, DR51, DQ8 and DP14. This study documented the profile of anti-HLA antibodies in patients with chronic renal failure who were on waiting lists for an organ in Paraná, and found high sensitization to HLA antigens in the samples.

  3. Evaluation of the Humoral Immune Response to Human Leukocyte Antigens in Brazilian Renal Transplant Candidates

    Science.gov (United States)

    Saito, Patricia Keiko; Yamakawa, Roger Haruki; Aparecida, Erica Pereira; da Silva Júnior, Waldir Verissimo; Borelli, Sueli Donizete

    2014-01-01

    Pre-transplant sensitization to human leukocyte antigens (HLA) is a risk factor for graft failure. Studies of the immunological profile related to anti-HLA antibodies in Brazilian renal transplant candidates are few. In this study, we evaluated the humoral immune response to HLA antigens in 269 renal transplant candidates, in Paraná State, Brazil. The HLA typing was performed by the polymerase chain reaction sequence-specific oligonucleotide method (PCR-SSO) combined with Luminex technology, using an SSO-LABType commercial kit (One Lambda, Inc., Canoga Park, CA, USA). The percentages of panel-reactive antibodies (PRA) and the specificity of anti-HLA antibodies were determined using the LS1PRA and LS2PRA commercial kits (One Lambda, Inc.). The PRA-positive group consisted of 182 (67.7%) patients, and the PRA-negative group of 87 (32.3%) patients. The two groups differed significantly only with respect to gender. Females were the most sensitized. Among the 182 patients with PRA- positive, 62 (34.1%) were positive for class I and negative for class II, 39 (21.4%) were negative for class I and positive for class II, and 81 (44.5%) were positive for both classes I and II. The HLA-A*02, A*24, A*01, B*44, B*35, B*15, DRB1*11, DRB1*04 and DRB1*03 allele groups were the most frequent. The specificities of anti-HLA antibodies were more frequent: A34, B57, Cw15, Cw16, DR51, DQ8 and DP14. This study documented the profile of anti-HLA antibodies in patients with chronic renal failure who were on waiting lists for an organ in Paraná, and found high sensitization to HLA antigens in the samples. PMID:24927116

  4. Innate Immune Responses to TLR2 and TLR4 Agonists Differ between Baboons, Chimpanzees and Humans

    Science.gov (United States)

    Brinkworth, Jessica F.; Pechenkina, Ekaterina A.; Silver, Jack; Goyert, Sanna M.

    2012-01-01

    Background African catarrhine primates differ in bacterial disease susceptibility. Methods Human, chimpanzee, and baboon blood was stimulated with TLR-detected bacterial agonists and cytokine/chemokine induction assessed by real-time pcr. Results Humans and chimpanzees shared similar cytokine/chemokine responses, while baboon cytokine/chemokine induction differed. Generally, responses were agonist-independent. Conclusions These primates tend to generate species rather than agonist–specific responses to bacterial agonists. PMID:22978822

  5. Vaccination targeting human HER3 alters the phenotype of infiltrating T cells and responses to immune checkpoint inhibition.

    Science.gov (United States)

    Osada, Takuya; Morse, Michael A; Hobeika, Amy; Diniz, Marcio A; Gwin, William R; Hartman, Zachary; Wei, Junping; Guo, Hongtao; Yang, Xiao-Yi; Liu, Cong-Xiao; Kaneko, Kensuke; Broadwater, Gloria; Lyerly, H Kim

    2017-01-01

    Expression of human epidermal growth factor family member 3 (HER3), a critical heterodimerization partner with EGFR and HER2, promotes more aggressive biology in breast and other epithelial malignancies. As such, inhibiting HER3 could have broad applicability to the treatment of EGFR- and HER2-driven tumors. Although lack of a functional kinase domain limits the use of receptor tyrosine kinase inhibitors, HER3 contains antigenic targets for T cells and antibodies. Using novel human HER3 transgenic mouse models of breast cancer, we demonstrate that immunization with recombinant adenoviral vectors encoding full length human HER3 (Ad-HER3-FL) induces HER3-specific T cells and antibodies, alters the T cell infiltrate in tumors, and influences responses to immune checkpoint inhibitions. Both preventative and therapeutic Ad-HER3-FL immunization delayed tumor growth but were associated with both intratumoral PD-1 expressing CD8 + T cells and regulatory CD4 + T cell infiltrates. Immune checkpoint inhibition with either anti-PD-1 or anti-PD-L1 antibodies increased intratumoral CD8 + T cell infiltration and eliminated tumor following preventive vaccination with Ad-HER3-FL vaccine. The combination of dual PD-1/PD-L1 and CTLA4 blockade slowed the growth of tumor in response to Ad-HER3-FL in the therapeutic model. We conclude that HER3-targeting vaccines activate HER3-specific T cells and induce anti-HER3 specific antibodies, which alters the intratumoral T cell infiltrate and responses to immune checkpoint inhibition.

  6. β-Glucan Size Controls Dectin-1-Mediated Immune Responses in Human Dendritic Cells by Regulating IL-1β Production

    Directory of Open Access Journals (Sweden)

    Matthew J. Elder

    2017-07-01

    Full Text Available Dectin-1/CLEC7A is a pattern recognition receptor that recognizes β-1,3 glucans, and its stimulation initiates signaling events characterized by the production of inflammatory cytokines from human dendritic cells (DCs required for antifungal immunity. β-glucans differ greatly in size, structure, and ability to activate effector immune responses from DC; as such, small particulate β-glucans are thought to be poor activators of innate immunity. We show that β-glucan particle size is a critical factor contributing to the secretion of cytokines from human DC; large β-glucan-stimulated DC generate significantly more IL-1β, IL-6, and IL-23 compared to those stimulated with the smaller β-glucans. In marked contrast, the secretion of TSLP and CCL22 were found to be insensitive to β-glucan particle size. Furthermore, we show that the capacity to induce phagocytosis, and the relative IL-1β production determined by β-glucan size, regulates the composition of the cytokine milieu generated from DC. This suggests that β-glucan particle size is critically important in orchestrating the nature of the immune response to fungi.

  7. Influence of immune activation and inflammatory response on cardiovascular risk associated with the human immunodeficiency virus

    Directory of Open Access Journals (Sweden)

    Beltrán LM

    2015-01-01

    Full Text Available Luis M Beltrán,1 Alfonso Rubio-Navarro,2 Juan Manuel Amaro-Villalobos,2 Jesús Egido,2–4 Juan García-Puig,1 Juan Antonio Moreno21Metabolic-Vascular Unit, Fundación IdiPAZ-Hospital Universitario La Paz, Madrid, Spain; 2Vascular, Renal, and Diabetes Research Lab, IIS-Fundación Jiménez Díaz, Madrid, Spain; 3Centro de Investigación Biomédica en Red de Diabetes y Enfermedades Metabólicas Asociadas (CIBERDEM, Madrid, Spain; 4Fundación Renal Iñigo Alvarez de Toledo-Instituto Reina Sofía de Investigaciones Nefrológicas (FRIAT-IRSIN, Madrid, SpainAbstract: Patients infected with the human immunodeficiency virus (HIV have an increased cardiovascular risk. Although initially this increased risk was attributed to metabolic alterations associated with antiretroviral treatment, in recent years, the attention has been focused on the HIV disease itself. Inflammation, immune system activation, and endothelial dysfunction facilitated by HIV infection have been identified as key factors in the development and progression of atherosclerosis. In this review, we describe the epidemiology and pathogenesis of cardiovascular disease in patients with HIV infection and summarize the latest knowledge on the relationship between traditional and novel inflammatory, immune activation, and endothelial dysfunction biomarkers on the cardiovascular risk associated with HIV infection.Keywords: HIV, cardiovascular disease, immune activation, inflammation, antiretroviral therapy

  8. Humoral and cell-mediated immune response against human retinal antigens in relation to ocular onchocerciasis

    NARCIS (Netherlands)

    van der Lelij, A.; Rothova, A.; Stilma, J. S.; Vetter, J. C.; Hoekzema, R.; Kijlstra, A.

    1990-01-01

    Autoimmune mechanisms are thought to be involved in the pathogenesis of the chorioretinal changes in ocular onchocerciasis. The humoral autoimmune response was determined by measuring serum levels of autoantibodies, directed against human S-antigen and interphotoreceptor retinoid binding protein

  9. The Cell Wall of the Human Fungal Pathogen Aspergillus fumigatus: Biosynthesis, Organization, Immune Response, and Virulence.

    Science.gov (United States)

    Latgé, Jean-Paul; Beauvais, Anne; Chamilos, Georgios

    2017-09-08

    More than 90% of the cell wall of the filamentous fungus Aspergillus fumigatus comprises polysaccharides. Biosynthesis of the cell wall polysaccharides is under the control of three types of enzymes: transmembrane synthases, which are anchored to the plasma membrane and use nucleotide sugars as substrates, and cell wall-associated transglycosidases and glycosyl hydrolases, which are responsible for remodeling the de novo synthesized polysaccharides and establishing the three-dimensional structure of the cell wall. For years, the cell wall was considered an inert exoskeleton of the fungal cell. The cell wall is now recognized as a living organelle, since the composition and cellular localization of the different constitutive cell wall components (especially of the outer layers) vary when the fungus senses changes in the external environment. The cell wall plays a major role during infection. The recognition of the fungal cell wall by the host is essential in the initiation of the immune response. The interactions between the different pattern-recognition receptors (PRRs) and cell wall pathogen-associated molecular patterns (PAMPs) orientate the host response toward either fungal death or growth, which would then lead to disease development. Understanding the molecular determinants of the interplay between the cell wall and host immunity is fundamental to combatting Aspergillus diseases.

  10. Late effects of atomic bomb radiation on human immune responses, (10)

    International Nuclear Information System (INIS)

    Kusunoki, Yoichiro; Kyoizumi, Seishi; Ozaki, Kyoko; Saito, Mayumi; Cologne, J.B.; Akiyama, Mitoshi

    1992-01-01

    Anti-Epstein-Barr (EV) virus antibody titers were measured in age- and sex-matched three groups of each 124 A-bomb survivors who had exposed to 1 Gy. These serum samples showed positive antibodies against viral capsid antigens (VCA). Antibody titers to anti-VCA-IgM or anti-EA-IgG were significantly higher in the groups of 0.01-1 Gy and >1 Gy than in the group of <0.01 Gy, reflecting decreased immune response ability for EV virus. When precursor frequency of cytotoxic cells against autologous EB virus LCL was determined in 68 other A-bomb survivors, no definitive influence of A-bombing was observed. However, serological study revealed that there was inverse correlation between precursor frequency and anti-EA-IgG antibody titer. These findings suggest that the immune response ability for EB virus may have been damaged and that biological reactivity of EB virus may occur frequently in A-bomb survivors. (N.K.)

  11. Indirect detection of an epitope-specific response to HIV-1 gp120 immunization in human subjects.

    Directory of Open Access Journals (Sweden)

    Evgeny Shmelkov

    Full Text Available A specific response of human serum neutralizing antibodies (nAb to a conformational epitope as a result of vaccination of human subjects with the surface envelope glycoprotein (gp120 of HIV-1 has not previously been documented. Here, we used computational analysis to assess the epitope-specific responses of human subjects, which were immunized with recombinant gp120 immunogens in the VAX003 and VAX004 clinical trials. Our computational methodology--a variation of sieve analysis--compares the occurrence of specific nAb targeted conformational 3D epitopes on viruses from infected individuals who received vaccination to the occurrence of matched epitopes in the viruses infecting placebo subjects. We specifically studied seven crystallographically defined nAb targeted conformational epitopes in the V3 loop, an immunogenic region of gp120. Of the six epitopes present in the immunogens and targeted by known monoclonal neutralizing antibodies, only the one targeted by the anti-V3 nAb 2219 exhibited a significant reduction in occurrence in vaccinated subjects compared to the placebo group. This difference occurred only in the VAX003 Thailand cohort. No difference was seen between vaccinated and placebo groups for the occurrence of an epitope that was not present in the immunogen. Thus, it can be theorized that a specific 2219-like human neutralizing antibody immune response to AIDSVAX immunization occurred in the VAX003 cohort, and that this response protected subjects from a narrow subset of HIV-1 viruses circulating in Thailand in the 1990s and bearing the conformational epitope targeted by the neutralizing antibody 2219.

  12. Cloned, CD117 selected human amniotic fluid stem cells are capable of modulating the immune response.

    Directory of Open Access Journals (Sweden)

    Emily C Moorefield

    Full Text Available Amniotic fluid stem (AFS cells are broadly multipotent, can be expanded extensively in culture, are not tumorigenic and can be readily cryopreserved for cell banking. Mesenchymal stem cells (MSC show immunomodulatory activity and secrete a wide spectrum of cytokines and chemokines that suppress inflammatory responses, block mixed lymphocyte reactions (MLR and other immune reactions, and have proven therapeutic against conditions such as graft-versus-host disease. AFS cells resemble MSCs in many respects including surface marker expression and differentiation potential. We therefore hypothesized that AFS cells may exhibit similar immunomodulatory capabilities. We present data to demonstrate that direct contact with AFS cells inhibits lymphocyte activation. In addition, we show that cell-free supernatants derived from AFS cells primed with total blood monocytes or IL-1β, a cytokine released by monocytes and essential in mediation of the inflammatory response, also inhibited lymphocyte activation. Further investigation of AFS cell-free supernatants by protein array revealed secretion of multiple factors in common with MSCs that are known to be involved in immune regulation including growth related oncogene (GRO and monocyte chemotactic protein (MCP family members as well as interleukin-6 (IL-6. AFS cells activated by PBMCs released several additional cytokines as compared to BM-MSCs, including macrophage inflammatory protein-3α (MIP-3α, MIP-1α and Activin. AFS cells also released higher levels of MCP-1 and lower levels of MCP-2 compared to BM-MSCs in response to IL-1β activation. This suggests that there may be some AFS-specific mechanisms of inhibition of lymphocyte activation. Our results indicate that AFS cells are able to suppress inflammatory responses in vitro and that soluble factors are an essential component in the communication between lymphocytes and AFS cells. Their extensive self-renewal capacity, possibility for banking and

  13. B-cell depletion is protective against anti-AAV capsid immune response: a human subject case study

    Directory of Open Access Journals (Sweden)

    M Corti

    2014-01-01

    Full Text Available Gene therapy strategies for congenital myopathies may require repeat administration of adeno-associated viral (AAV vectors due to aspects of the clinical application, such as: (i administration of doses below therapeutic efficacy in patients enrolled in early phase clinical trials; (ii progressive reduction of the therapeutic gene expression over time as a result of increasing muscle mass in patients treated at a young age; and (iii a possibly faster depletion of pathogenic myofibers in this patient population. Immune response triggered by the first vector administration, and to subsequent doses, represents a major obstacle for successful gene transfer in young patients. Anti-capsid and anti-transgene product related humoral and cell-mediated responses have been previously observed in all preclinical models and human subjects who received gene therapy or enzyme replacement therapy (ERT for congenital myopathies. Immune responses may result in reduced efficacy of the gene transfer over time and/or may preclude for the possibility of re-administration of the same vector. In this study, we evaluated the immune response of a Pompe patient dosed with an AAV1-GAA vector after receiving Rituximab and Sirolimus to modulate reactions against ERT. A key finding of this single subject case report is the observation that B-cell ablation with rituximab prior to AAV vector exposure results in non-responsiveness to both capsid and transgene, therefore allowing the possibility of repeat administration in the future. This observation is significant for future gene therapy studies and establishes a clinically relevant approach to blocking immune responses to AAV vectors.

  14. Structural and Nonstructural Viral Proteins Are Targets of T-Helper Immune Response against Human Respiratory Syncytial Virus.

    Science.gov (United States)

    Lorente, Elena; Barriga, Alejandro; Barnea, Eilon; Mir, Carmen; Gebe, John A; Admon, Arie; López, Daniel

    2016-06-01

    Proper antiviral humoral and cellular immune responses require previous recognition of viral antigenic peptides that are bound to HLA class II molecules, which are exposed on the surface of antigen-presenting cells. The helper immune response is critical for the control and the clearance of human respiratory syncytial virus (HRSV) infection, a virus with severe health risk in infected pediatric, immunocompromised, and elderly populations. In this study, using a mass spectrometry analysis of complex HLA class II-bound peptide pools that were isolated from large amounts of HRSV-infected cells, 19 naturally processed HLA-DR ligands, most of them included in a complex nested set of peptides, were identified. Both the immunoprevalence and the immunodominance of the HLA class II response to HRSV were focused on one nonstructural (NS1) and two structural (matrix and mainly fusion) proteins of the infective virus. These findings have clear implications for analysis of the helper immune response as well as for antiviral vaccine design. © 2016 by The American Society for Biochemistry and Molecular Biology, Inc.

  15. A human type 5 adenovirus-based Trypanosoma cruzi therapeutic vaccine re-programs immune response and reverses chronic cardiomyopathy.

    Directory of Open Access Journals (Sweden)

    Isabela Resende Pereira

    2015-01-01

    Full Text Available Chagas disease (CD, caused by the protozoan Trypanosoma cruzi, is a prototypical neglected tropical disease. Specific immunity promotes acute phase survival. Nevertheless, one-third of CD patients develop chronic chagasic cardiomyopathy (CCC associated with parasite persistence and immunological unbalance. Currently, the therapeutic management of patients only mitigates CCC symptoms. Therefore, a vaccine arises as an alternative to stimulate protective immunity and thereby prevent, delay progression and even reverse CCC. We examined this hypothesis by vaccinating mice with replication-defective human Type 5 recombinant adenoviruses (rAd carrying sequences of amastigote surface protein-2 (rAdASP2 and trans-sialidase (rAdTS T. cruzi antigens. For prophylactic vaccination, naïve C57BL/6 mice were immunized with rAdASP2+rAdTS (rAdVax using a homologous prime/boost protocol before challenge with the Colombian strain. For therapeutic vaccination, rAdVax administration was initiated at 120 days post-infection (dpi, when mice were afflicted by CCC. Mice were analyzed for electrical abnormalities, immune response and cardiac parasitism and tissue damage. Prophylactic immunization with rAdVax induced antibodies and H-2Kb-restricted cytotoxic and interferon (IFNγ-producing CD8+ T-cells, reduced acute heart parasitism and electrical abnormalities in the chronic phase. Therapeutic vaccination increased survival and reduced electrical abnormalities after the prime (analysis at 160 dpi and the boost (analysis at 180 and 230 dpi. Post-therapy mice exhibited less heart injury and electrical abnormalities compared with pre-therapy mice. rAdVax therapeutic vaccination preserved specific IFNγ-mediated immunity but reduced the response to polyclonal stimuli (anti-CD3 plus anti-CD28, CD107a+ CD8+ T-cell frequency and plasma nitric oxide (NO levels. Moreover, therapeutic rAdVax reshaped immunity in the heart tissue as reduced the number of perforin+ cells

  16. The Bacterial Species Campylobacter jejuni Induce Diverse Innate Immune Responses in Human and Avian Intestinal Epithelial Cells

    Directory of Open Access Journals (Sweden)

    Daniel A. John

    2017-09-01

    Full Text Available Campylobacter remain the major cause of human gastroenteritis in the Developed World causing a significant burden to health services. Campylobacter are pathogens in humans and chickens, although differences in mechanistic understanding are incomplete, in part because phenotypic strain diversity creates inconsistent findings. Here, we took Campylobacter jejuni isolates (n = 100 from multi-locus sequence typed collections to assess their pathogenic diversity, through their inflammatory, cytotoxicity, adhesion, invasion and signaling responses in a high-throughput model using avian and human intestinal epithelial cells. C. jejuni induced IL-8 and CXCLi1/2 in human and avian epithelial cells, respectively, in a MAP kinase-dependent manner. In contrast, IL-10 responses in both cell types were PI 3-kinase/Akt-dependent. C. jejuni strains showed diverse levels of invasion with high invasion dependent on MAP kinase signaling in both cell lines. C. jejuni induced diverse cytotoxic responses in both cell lines with cdt-positive isolates showing significantly higher toxicity. Blockade of endocytic pathways suggested that invasion by C. jejuni was clathrin- and dynamin-dependent but caveolae- independent in both cells. In contrast, IL-8 (and CXCLi1/2 production was dependent on clathrin, dynamin, and caveolae. This study is important because of its scale, and the data produced, suggesting that avian and human epithelial cells use similar innate immune pathways where the magnitude of the response is determined by the phenotypic diversity of the Campylobacter species.

  17. Immune responses of mice and human breast cancer patients following immunization with synthetic sialyl-Tn conjugated to KLH plus detox adjuvant.

    Science.gov (United States)

    Longenecker, B M; Reddish, M; Koganty, R; MacLean, G D

    1993-08-12

    We generated a synthetic epitope, NANA alpha(2-6) GalNAc alpha-O-Crotyl (STn-crotyl), designed to "mimic" the natural O-linked epitope expressed on human carcinoma cells, NANA alpha(2-6)GalNAc alpha-O-Serine (STn-serine). STn-crotyl was conjugated to the carrier protein KLH through the crotyl linker arm, and a "vaccine" containing STn-KLH plus DETOX adjuvant was formulated. The immunogenicity of the vaccine was evaluated preclinically in CAF1 mice and subsequently in patients with metastatic breast cancer. The specificity and titers of IgG antibodies were evaluated by kinetic ELISA on synthetic STn-HSA and on ovine submaxillary mucin (OSM) solid phases. Ovine submaxillary mucin is a convenient source of repeating, natural O-linked STn-serine structures. Mice immunized three times with as little as 0.25 micrograms of STn-KLH produced IgG titers ranging from 1:10(4) to 1:10(5) when tested on solid phase OSM. Anti-OSM IgG, both polyclonal and monoclonal antibodies, generated from these mice were completely inhibited in their binding to solid phase OSM equally well by STn-serine and STn-crotyl synthetic haptens but not by several other closely related synthetic haptens. These monoclonal antibodies also bound to STn determinants on human tumor cell surfaces. Breast cancer patients immunized with 100 micrograms of the same vaccine produced median peak IgG titers 1:1280 measured on STn-HSA and 1:160 on OSM. Hapten inhibition experiments with the human sera demonstrated the specificities of the IgG antibodies for STn-crotyl and STn-serine, but not against several other related synthetic haptens. We found little evidence that the artificial linker arm (crotyl linker) contributed substantially to either the titer or affinity of the antibodies generated in either mice or human breast cancer patients. This suggests that the antibodies recognized the cancer-associated disaccharide NANA alpha(2-->6)-GalNAc. Small but not large doses of STn-KLH immunogen induced anti-STn DTH

  18. Monomethylarsonous Acid (MMAIII Has an Adverse Effect on the Innate Immune Response of Human Bronchial Epithelial Cells to Pseudomonas aeruginosa.

    Directory of Open Access Journals (Sweden)

    Emily G Notch

    Full Text Available Arsenic is the number one contaminant of concern with regard to human health according to the World Health Organization. Epidemiological studies on Asian and South American populations have linked arsenic exposure with an increased incidence of lung disease, including pneumonia, and chronic obstructive pulmonary disease, both of which are associated with bacterial infection. However, little is known about the effects of low dose arsenic exposure, or the contributions of organic arsenic to the innate immune response to bacterial infection. This study examined the effects on Pseudomonas aeruginosa (P. aeruginosa induced cytokine secretion by human bronchial epithelial cells (HBEC by inorganic sodium arsenite (iAsIII and two major metabolites, monomethylarsonous acid (MMAIII and dimethylarsenic acid (DMAV, at concentrations relevant to the U.S.Neither iAsIII nor DMAV altered P. aeruginosa induced cytokine secretion. By contrast, MMAIII increased P. aeruginosa induced secretion of IL-8, IL-6 and CXCL2. A combination of iAsIII, MMAIII and DMAV (10 pbb total reduced IL-8 and CXCL1 secretion. These data demonstrate for the first time that exposure to MMAIII alone, and a combination of iAsIII, MMAIII and DMAV at levels relevant to the U.S. may have negative effects on the innate immune response of human bronchial epithelial cells to P. aeruginosa.

  19. Antimicrobial peptides in innate immune responses

    DEFF Research Database (Denmark)

    Sorensen, O.E.; Borregaard, N.; Cole, A.M.

    2008-01-01

    Antimicrobial peptides (AMPs) are ancient effector molecules in the innate immune response of eukaryotes. These peptides are important for the antimicrobial efficacy of phagocytes and for the innate immune response mounted by epithelia of humans and other mammals. AMPs are generated either by de...... novo synthesis or by proteolytic cleavage from antimicrobially inactive proproteins. Studies of human diseases and animal studies have given important clues to the in vivo role of AMPs. It is now evident that dysregulation of the generation of AMPs in innate immune responses plays a role in certain...

  20. Late effects of atomic bomb radiation on human immune responses, (10); Results on studies of immune responses to EB-virus

    Energy Technology Data Exchange (ETDEWEB)

    Kusunoki, Yoichiro; Kyoizumi, Seishi; Ozaki, Kyoko; Saito, Mayumi; Cologne, J.B.; Akiyama, Mitoshi (Radiation Effects Research Foundation, Hiroshima (Japan))

    1992-12-01

    Anti-Epstein-Barr (EV) virus antibody titers were measured in age- and sex-matched three groups of each 124 A-bomb survivors who had exposed to <0.01 Gy, 0.01-1 Gy, or >1 Gy. These serum samples showed positive antibodies against viral capsid antigens (VCA). Antibody titers to anti-VCA-IgM or anti-EA-IgG were significantly higher in the groups of 0.01-1 Gy and >1 Gy than in the group of <0.01 Gy, reflecting decreased immune response ability for EV virus. When precursor frequency of cytotoxic cells against autologous EB virus LCL was determined in 68 other A-bomb survivors, no definitive influence of A-bombing was observed. However, serological study revealed that there was inverse correlation between precursor frequency and anti-EA-IgG antibody titer. These findings suggest that the immune response ability for EB virus may have been damaged and that biological reactivity of EB virus may occur frequently in A-bomb survivors. (N.K.).

  1. Insight into bacterial virulence mechanisms against host immune response via the Yersinia pestis-human protein-protein interaction network.

    Science.gov (United States)

    Yang, Huiying; Ke, Yuehua; Wang, Jian; Tan, Yafang; Myeni, Sebenzile K; Li, Dong; Shi, Qinghai; Yan, Yanfeng; Chen, Hui; Guo, Zhaobiao; Yuan, Yanzhi; Yang, Xiaoming; Yang, Ruifu; Du, Zongmin

    2011-11-01

    A Yersinia pestis-human protein interaction network is reported here to improve our understanding of its pathogenesis. Up to 204 interactions between 66 Y. pestis bait proteins and 109 human proteins were identified by yeast two-hybrid assay and then combined with 23 previously published interactions to construct a protein-protein interaction network. Topological analysis of the interaction network revealed that human proteins targeted by Y. pestis were significantly enriched in the proteins that are central in the human protein-protein interaction network. Analysis of this network showed that signaling pathways important for host immune responses were preferentially targeted by Y. pestis, including the pathways involved in focal adhesion, regulation of cytoskeleton, leukocyte transendoepithelial migration, and Toll-like receptor (TLR) and mitogen-activated protein kinase (MAPK) signaling. Cellular pathways targeted by Y. pestis are highly relevant to its pathogenesis. Interactions with host proteins involved in focal adhesion and cytoskeketon regulation pathways could account for resistance of Y. pestis to phagocytosis. Interference with TLR and MAPK signaling pathways by Y. pestis reflects common characteristics of pathogen-host interaction that bacterial pathogens have evolved to evade host innate immune response by interacting with proteins in those signaling pathways. Interestingly, a large portion of human proteins interacting with Y. pestis (16/109) also interacted with viral proteins (Epstein-Barr virus [EBV] and hepatitis C virus [HCV]), suggesting that viral and bacterial pathogens attack common cellular functions to facilitate infections. In addition, we identified vasodilator-stimulated phosphoprotein (VASP) as a novel interaction partner of YpkA and showed that YpkA could inhibit in vitro actin assembly mediated by VASP.

  2. Transgenic expression of soluble human CD5 enhances experimentally-induced autoimmune and anti-tumoral immune responses.

    Directory of Open Access Journals (Sweden)

    Rafael Fenutría

    Full Text Available CD5 is a lymphoid-specific transmembrane glycoprotein constitutively expressed on thymocytes and mature T and B1a lymphocytes. Current data support the view that CD5 is a negative regulator of antigen-specific receptor-mediated signaling in these cells, and that this would likely be achieved through interaction with CD5 ligand/s (CD5L of still undefined nature expressed on immune or accessory cells. To determine the functional consequence of loss of CD5/CD5L interaction in vivo, a new transgenic mouse line was generated (shCD5EμTg, expressing a circulating soluble form of human CD5 (shCD5 as a decoy to impair membrane-bound CD5 function. These shCD5EμTg mice showed an enhanced response to autologous antigens, as deduced from the presentation of more severe forms of experimentally inducible autoimmune disease (collagen-induced arthritis, CIA; and experimental autoimmune encephalitis, EAE, as well as an increased anti-tumoral response in non-orthotopic cancer models (B16 melanoma. This enhancement of the immune response was in agreement with the finding of significantly reduced proportions of spleen and lymph node Treg cells (CD4+CD25+FoxP3+, and of peritoneal IL-10-producing and CD5+ B cells, as well as an increased proportion of spleen NKT cells in shCD5EμTg mice. Similar changes in lymphocyte subpopulations were observed in wild-type mice following repeated administration of exogenous recombinant shCD5 protein. These data reveal the relevant role played by CD5/CD5L interactions on the homeostasis of some functionally relevant lymphocyte subpopulations and the modulation of immune responses to autologous antigens.

  3. Interleukin 37 limits monosodium urate crystal-induced innate immune responses in human and murine models of gout.

    Science.gov (United States)

    Liu, Lei; Xue, Yu; Zhu, Yingfeng; Xuan, Dandan; Yang, Xue; Liang, Minrui; Wang, Juan; Zhu, Xiaoxia; Zhang, Jiong; Zou, Hejian

    2016-11-18

    Interleukin (IL)-37 has emerged as a fundamental inhibitor of innate immunity. Acute gout is a self-limiting inflammatory response to monosodium urate (MSU) crystals. In the current study, we assessed the preventive and therapeutic effect of recombinant human IL-37 (rhIL-37) in human and murine gout models. We investigated the expression of IL-37 in patients with active and inactive gouty arthritis and assessed the effect of rhIL-37 in human and murine gout models: a human monocyte cell line (THP-1) and human synovial cells (containing macrophage-like and fibroblast-like synoviocytes) exposed to MSU crystals, a peritoneal murine model of gout and a murine gouty arthritis model. After inhibition of Mer receptor tyrosine kinase (Mertk), levels of IL-1β, IL-8 and chemokine (C-C motif) ligand 2 (CCL-2) were detected by ELISA and expression of mammalian homologs of the drosophila Mad gene 3 (Smad), suppressor of cytokine signaling 3 (SOCS3), NACHT-LRR-PYD-containing protein 3 (NLRP3), and IL-8R of THP-1 were assessed by qPCR and western blot to explore the molecular mechanisms. Our studies strongly indicated that rhIL-37 played a potent immunosuppressive role in the pathogenesis of experimental gout models both in vitro and in vivo, by downregulating proinflammatory cytokines and chemokines, markedly reducing neutrophil and monocyte recruitment, and mitigating pathological joint inflammation. In our studies, rhIL-37 suppressed MSU-induced innate immune responses by enhancing expression of Smad3 and IL-1R8 to trigger multiple intracellular switches to block inflammation, including inhibition of NLRP3 and activation of SOCS3. Mertk signaling participated in rhIL-37 inhibitory pathways in gout models. By inhibition of Mertk, the anti-inflammatory effect of rhIL-37 was partly abrogated, and IL-1R8, Smad3 and S​OCS3 expression were suppressed, whereas NLRP3 expression was reactivated. Our studies reveal that IL-37 limits runaway inflammation initiated by MSU crystal

  4. Pathogenesis, humoral immune responses and transmission between co-housed animals in a ferret model of human RSV infection.

    Science.gov (United States)

    Chan, Kok Fei; Carolan, Louise A; Druce, Julian; Chappell, Keith; Watterson, Daniel; Young, Paul; Korenkov, Daniil; Subbarao, Kanta; Barr, Ian G; Laurie, Karen L; Reading, Patrick C

    2017-11-29

    Small animal models have been used to obtain many insights regarding the pathogenesis and immune responses induced following infection with human respiratory syncytial virus (hRSV). Amongst those described to date, infections in cotton rats, mice, guinea pigs, chinchillas and Syrian hamsters with hRSV strains Long and/or A2 have been well characterised, although clinical isolates have also been examined. Ferrets are also susceptible to hRSV infection but the pathogenesis and immune responses elicited following infection have not been well characterised. Herein, we describe the infection of adult ferrets with hRSV Long or A2 via the intranasal route and characterised virus replication, as well as cytokine induction, in the upper and lower airways. Virus replication and cytokine induction during the acute phase of infection (days 0-15 post-infection) were similar between the two strains and both elicited high levels of F glycoprotein-specific binding and neutralising antibodies following virus clearance (days 16-22 post-infection). Importantly, we demonstrate transmission from experimentally infected donor ferrets to co-housed naïve recipients and have characterised virus replication and cytokine induction in the upper airways of infected contact animals. Together, these studies provide a direct comparison of the pathogenesis of hRSV Long and A2 in ferrets and highlight the potential of this animal model to study serological responses and examine interventions that limit transmission of hRSV. IMPORTANCE Ferrets have been widely used to study pathogenesis, immunity and transmission following human influenza virus infections, however far less is known regarding the utility of the ferret model to study hRSV infections. Following intranasal (IN) infection of adult ferrets with the well characterised Long or A2 strains of hRSV, we report virus replication and cytokine induction in the upper and lower airways, as well as the development of virus-specific humoral responses

  5. Differential Impact of LPG-and PG-Deficient Leishmania major Mutants on the Immune Response of Human Dendritic Cells.

    Directory of Open Access Journals (Sweden)

    Michelle A Favila

    2015-12-01

    Full Text Available Leishmania major infection induces robust interleukin-12 (IL12 production in human dendritic cells (hDC, ultimately resulting in Th1-mediated immunity and clinical resolution. The surface of Leishmania parasites is covered in a dense glycocalyx consisting of primarily lipophosphoglycan (LPG and other phosphoglycan-containing molecules (PGs, making these glycoconjugates the likely pathogen-associated molecular patterns (PAMPS responsible for IL12 induction.Here we explored the role of parasite glycoconjugates on the hDC IL12 response by generating L. major Friedlin V1 mutants defective in LPG alone, (FV1 lpg1-, or generally deficient for all PGs, (FV1 lpg2-. Infection with metacyclic, infective stage, L. major or purified LPG induced high levels of IL12B subunit gene transcripts in hDCs, which was abrogated with FV1 lpg1- infections. In contrast, hDC infections with FV1 lpg2- displayed increased IL12B expression, suggesting other PG-related/LPG2 dependent molecules may act to dampen the immune response. Global transcriptional profiling comparing WT, FV1 lpg1-, FV1 lpg2- infections revealed that FV1 lpg1- mutants entered hDCs in a silent fashion as indicated by repression of gene expression. Transcription factor binding site analysis suggests that LPG recognition by hDCs induces IL-12 in a signaling cascade resulting in Nuclear Factor κ B (NFκB and Interferon Regulatory Factor (IRF mediated transcription.These data suggest that L. major LPG is a major PAMP recognized by hDC to induce IL12-mediated protective immunity and that there is a complex interplay between PG-baring Leishmania surface glycoconjugates that result in modulation of host cellular IL12.

  6. The landscape of human genes involved in the immune response to parasitic worms

    Directory of Open Access Journals (Sweden)

    Fumagalli Matteo

    2010-08-01

    Full Text Available Abstract Background More than 2 billion individuals worldwide suffer from helminth infections. The highest parasite burdens occur in children and helminth infection during pregnancy is a risk factor for preterm delivery and reduced birth weight. Therefore, helminth infections can be regarded as a strong selective pressure. Results Here we propose that candidate susceptibility genes for parasitic worm infections can be identified by searching for SNPs that display a strong correlation with the diversity of helminth species/genera transmitted in different geographic areas. By a genome-wide search we identified 3478 variants that correlate with helminth diversity. These SNPs map to 810 distinct human genes including loci involved in regulatory T cell function and in macrophage activation, as well as leukocyte integrins and co-inhibitory molecules. Analysis of functional relationships among these genes identified complex interaction networks centred around Th2 cytokines. Finally, several genes carrying candidate targets for helminth-driven selective pressure also harbour susceptibility alleles for asthma/allergy or are involved in airway hyper-responsiveness, therefore expanding the known parallelism between these conditions and parasitic infections. Conclusions Our data provide a landscape of human genes that modulate susceptibility to helminths and indicate parasitic worms as one of the major selective forces in humans.

  7. Th9/IL-9 Profile in Human Echinococcosis: Their Involvement in Immune Response during Infection by Echinococcus granulosus

    Directory of Open Access Journals (Sweden)

    Nannan Pang

    2014-01-01

    Full Text Available Th9 cells have been reported to contribute to immune responses; however, the role of Th9 cells in Echinococcus granulosus infection is unknown. This study is to determine whether Th9 cells and IL-9 are involved in human Echinococcus granulosus infection. Compared with healthy controls (HC group, the mRNA levels of PU.1, IL-9, and GATA-3 were significantly increased in patients before therapy (CE group, as revealed by qRT-PCR. Flow cytometry analysis showed that the percentages of Th9 and Th2 cells in CE group were significantly higher. The levels of IL-9, IL-4, IL-10, and TGF-β in CE group were also significantly increased, as detected by CBA assay. The percentages of Th9 and Th2 cells in CE group were positively correlated. After treatments of surgery in combination with albendazole, the PU.1 and GATA-3 mRNA levels were significantly decreased in patients after therapy (PCE group compared with CE group. The numbers of Th9 and Th2 cells and levels of IL-9, IL-4, IL-10, and TGF-β were also significantly decreased in PCE group. In conclusion, the ratios of Th9 cells and IL-9 levels were significantly decreased after treatment, suggesting that Th9/IL-9 may be involved in immune response induced by Echinococcus granulosus infection.

  8. Dengue-2 Structural Proteins Associate with Human Proteins to Produce a Coagulation and Innate Immune Response Biased Interactome

    Directory of Open Access Journals (Sweden)

    Soares Luis RB

    2011-01-01

    Full Text Available Abstract Background Dengue virus infection is a public health threat to hundreds of millions of individuals in the tropical regions of the globe. Although Dengue infection usually manifests itself in its mildest, though often debilitating clinical form, dengue fever, life-threatening complications commonly arise in the form of hemorrhagic shock and encephalitis. The etiological basis for the virus-induced pathology in general, and the different clinical manifestations in particular, are not well understood. We reasoned that a detailed knowledge of the global biological processes affected by virus entry into a cell might help shed new light on this long-standing problem. Methods A bacterial two-hybrid screen using DENV2 structural proteins as bait was performed, and the results were used to feed a manually curated, global dengue-human protein interaction network. Gene ontology and pathway enrichment, along with network topology and microarray meta-analysis, were used to generate hypothesis regarding dengue disease biology. Results Combining bioinformatic tools with two-hybrid technology, we screened human cDNA libraries to catalogue proteins physically interacting with the DENV2 virus structural proteins, Env, cap and PrM. We identified 31 interacting human proteins representing distinct biological processes that are closely related to the major clinical diagnostic feature of dengue infection: haemostatic imbalance. In addition, we found dengue-binding human proteins involved with additional key aspects, previously described as fundamental for virus entry into cells and the innate immune response to infection. Construction of a DENV2-human global protein interaction network revealed interesting biological properties suggested by simple network topology analysis. Conclusions Our experimental strategy revealed that dengue structural proteins interact with human protein targets involved in the maintenance of blood coagulation and innate anti

  9. Mycobacterium leprae antigens involved in human immune responses. I. Identification of four antigens by monoclonal antibodies

    Energy Technology Data Exchange (ETDEWEB)

    Britton, W.J.; Hellqvist, L.; Basten, A.; Raison, R.L.

    1985-12-01

    Four distinct antigens were identified in soluble sonicates of Mycobacterium leprae by using a panel of 11 monoclonal antibodies. Cross-reactivity studies with other mycobacterial species were conducted by using ELISA and immunoblot assays, and demonstrated that determinants on two of the antigens were present in many mycobacteria, whereas the other two were limited in distribution. Competitive inhibition experiments with radiolabeled monoclonal antibodies showed cross-inhibition between antibodies identifying two of the four antigenicbands. These two bands, of M/sub tau/ 4.5 to 6 KD and 30 to 40 KD, were resistant to protease treatment after immunoblotting. In contrast the two other bands of 16 and 70 KD were protease-sensitive. Although all four bands reacted with some human lepromatous leprosy sera in immunoblots, the 4.5 to 6 KD and 30 to 40 KD bands were most prominent. Lepromatous leprosy sera also inhibited the binding of radiolabeled monoclonal antibodies to each of the four antigens, with the mean titer causing 50% inhibition being higher for antibodies reacting with the 4.5 to 6 KD and 30 to 40 KD bands. These findings indicated that all four antigens were involved in the human B cell response to M. leprae.

  10. Mycobacterium leprae antigens involved in human immune responses. I. Identification of four antigens by monoclonal antibodies

    International Nuclear Information System (INIS)

    Britton, W.J.; Hellqvist, L.; Basten, A.; Raison, R.L.

    1985-01-01

    Four distinct antigens were identified in soluble sonicates of Mycobacterium leprae by using a panel of 11 monoclonal antibodies. Cross-reactivity studies with other mycobacterial species were conducted by using ELISA and immunoblot assays, and demonstrated that determinants on two of the antigens were present in many mycobacteria, whereas the other two were limited in distribution. Competitive inhibition experiments with radiolabeled monoclonal antibodies showed cross-inhibition between antibodies identifying two of the four antigenicbands. These two bands, of M/sub tau/ 4.5 to 6 KD and 30 to 40 KD, were resistant to protease treatment after immunoblotting. In contrast the two other bands of 16 and 70 KD were protease-sensitive. Although all four bands reacted with some human lepromatous leprosy sera in immunoblots, the 4.5 to 6 KD and 30 to 40 KD bands were most prominent. Lepromatous leprosy sera also inhibited the binding of radiolabeled monoclonal antibodies to each of the four antigens, with the mean titer causing 50% inhibition being higher for antibodies reacting with the 4.5 to 6 KD and 30 to 40 KD bands. These findings indicated that all four antigens were involved in the human B cell response to M. leprae

  11. Suppression of Innate Immune Response by Primary Human Keratinocytes Expressing HPV-16 E6 and E7

    National Research Council Canada - National Science Library

    Guess, Jennifer L

    2005-01-01

    Human papillomavims (HPV) types infect the skin and mucosal epithelium. Lesions resulting from HPV infection can linger for months or years suggesting that HPV - presence goes unnoticed by the host immune system...

  12. Activated human T cells secrete exosomes that participate in IL-2 mediated immune response signaling.

    Directory of Open Access Journals (Sweden)

    Jessica Wahlgren

    Full Text Available It has previously been shown that nano-meter sized vesicles (30-100 nm, exosomes, secreted by antigen presenting cells can induce T cell responses thus showing the potential of exosomes to be used as immunological tools. Additionally, activated CD3⁺ T cells can secrete exosomes that have the ability to modulate different immunological responses. Here, we investigated what effects exosomes originating from activated CD3⁺ T cells have on resting CD3⁺ T cells by studying T cell proliferation, cytokine production and by performing T cell and exosome phenotype characterization. Human exosomes were generated in vitro following CD3⁺ T cell stimulation with anti-CD28, anti-CD3 and IL-2. Our results show that exosomes purified from stimulated CD3⁺ T cells together with IL-2 were able to generate proliferation in autologous resting CD3⁺ T cells. The CD3⁺ T cells stimulated with exosomes together with IL-2 had a higher proportion of CD8⁺ T cells and had a different cytokine profile compared to controls. These results indicate that activated CD3⁺ T cells communicate with resting autologous T cells via exosomes.

  13. Humoral immune response against proteins E6 and E7 in cervical carcinoma patients positive for human papilloma virus type 16 during treatment and follow-up

    NARCIS (Netherlands)

    Baay, M. F.; Duk, J. M.; Burger, M. P.; de Bruijn, H. W.; Stolz, E.; Herbrink, P.

    1999-01-01

    To investigate the humoral immune response to transforming proteins E6 and E7 of human papillomavirus type 16 before and after treatment and during follow-up, consecutive serum samples from 36 cervical cancer patients whose tumours were found to contain human papillomavirus type 16 DNA by use of the

  14. Humoral immune response against proteins E6 and E7 in cervical carcinoma patients positive for human papilloma virus type 16 during treatment and follow-up

    NARCIS (Netherlands)

    Baay, MFD; Duk, JM; Burger, MPM; de Bruijn, HWA; Stolz, E; Herbrink, P

    To investigate the humoral immune response to transforming proteins E6 and E7 of human papillomavirus type 16 before and after treatment and during follow-up, consecutive serum samples from 36 cervical cancer patients whose tumours were found to contain human papillomavirus type 16 DNA by use of the

  15. Thirty Minutes of Hypobaric Hypoxia Provokes Alterations of Immune Response, Haemostasis, and Metabolism Proteins in Human Serum

    Directory of Open Access Journals (Sweden)

    Jochen Hinkelbein

    2017-08-01

    Full Text Available Hypobaric hypoxia (HH during airline travel induces several (patho- physiological reactions in the human body. Whereas severe hypoxia is investigated thoroughly, very little is known about effects of moderate or short-term hypoxia, e.g. during airline flights. The aim of the present study was to analyse changes in serum protein expression and activation of signalling cascades in human volunteers staying for 30 min in a simulated altitude equivalent to airline travel. After approval of the local ethics committee, 10 participants were exposed to moderate hypoxia (simulation of 2400 m or 8000 ft for 30 min in a hypobaric pressure chamber. Before and after hypobaric hypoxia, serum was drawn, centrifuged, and analysed by two-dimensional gel electrophoresis (2-DIGE and matrix-assisted laser desorption/ionization followed by time-of-flight mass spectrometry (MALDI-TOF. Biological functions of regulated proteins were identified using functional network analysis (GeneMania®, STRING®, and Perseus® software. In participants, oxygen saturation decreased from 98.1 ± 1.3% to 89.2 ± 1.8% during HH. Expression of 14 spots (i.e., 10 proteins: ALB, PGK1, APOE, GAPDH, C1QA, C1QB, CAT, CA1, F2, and CLU was significantly altered. Bioinformatic analysis revealed an association of the altered proteins with the signalling cascades “regulation of haemostasis” (four proteins, “metabolism” (five proteins, and “leukocyte mediated immune response” (five proteins. Even though hypobaric hypoxia was short and moderate (comparable to an airliner flight, analysis of protein expression in human subjects revealed an association to immune response, protein metabolism, and haemostasis

  16. High dose of plasmid IL-15 inhibits immune responses in an influenza non-human primates immunogenicity model

    International Nuclear Information System (INIS)

    Yin Jiangmei; Dai Anlan; Laddy, Dominick J.; Yan Jian; Arango, Tatiana; Khan, Amir S.; Lewis, Mark G.; Andersen, Hanne; Kutzler, Michele A.; Draghia-Akli, Ruxandra; Weiner, David B.; Boyer, Jean D.

    2009-01-01

    Interleukin (IL)-15, is a cytokine that is important for the maintenance of long-lasting, high-avidity T cell response to invading pathogens and has, therefore, been used in vaccine and therapeutic platforms as an adjuvant. In addition to pure protein delivery, plasmids encoding the IL-15 gene have been utilized. However, it is critical to determine the appropriate dose to maximize the adjuvanting effects. We immunized rhesus macaques with different doses of IL-15 expressing plasmid in an influenza non-human primate immunogenicity model. We found that co-immunization of rhesus macaques with a Flu DNA-based vaccine and low doses of plasmid encoding macaque IL-15 enhanced the production of IFN-γ (0.5 mg) and the proliferation of CD4 + and CD8 + T cells, as well as T CM levels in proliferating CD8 + T cells (0.25 mg). Whereas, high doses of IL-15 (4 mg) decrease the production of IFN-γ and the proliferation of CD4 + and CD8 + T cells and T CM levels in the proliferating CD4 + and CD8 + T cells. In addition, the data of hemagglutination inhibition (HI) antibody titer suggest that although not significantly different, there appears to be a slight increase in antibodies at lower doses of IL-15. Importantly, however, the higher doses of IL-15 decrease the antibody levels significantly. This study demonstrates the importance of optimizing DNA-based cytokine adjuvants.

  17. The Association of the Immune Response Genes to Human Papillomavirus-Related Cervical Disease in a Brazilian Population

    Directory of Open Access Journals (Sweden)

    Amanda Vansan Marangon

    2013-01-01

    Full Text Available The genetic variability of the host contributes to the risk of human papillomavirus (HPV-related cervical disease. Immune response genes to HPV must be investigated to define patients with the highest risk of developing malignant disease. The aim of this study was to investigate the association of polymorphic immune response genes, namely KIR, HLA class I and II, and single-nucleotide polymorphisms (SNPs of cytokines with HPV-related cervical disease. We selected 79 non-related, admixed Brazilian women from the state of Paraná, southern region of Brazil, who were infected with high carcinogenic risk HPV and present cervical intraepithelial neoplasia grade 3 (CIN3, and 150 HPV-negative women from the same region matched for ethnicity. KIR genes were genotyped using an in-house PCR-SSP. HLA alleles were typed using a reverse sequence-specific oligonucleotide technique. SNPs of TNF −308G>A, IL6 −174G>C, IFNG +874T>A, TGFB1 +869T>C +915G>C, and IL10 −592C>A −819C>T −1082G>A were evaluated using PCR-SSP. The KIR genes were not associated with HPV, although some pairs of i(inhibitoryKIR-ligands occurred more frequently in patients, supporting a role for NK in detrimental chronic inflammatory and carcinogenesis. Some HLA haplotypes were associated with HPV. The associations of INFG and IL10 SNPs potentially reflect impaired or invalid responses in advanced lesions.

  18. The Association of the Immune Response Genes to Human Papillomavirus-Related Cervical Disease in a Brazilian Population

    Science.gov (United States)

    Marangon, Amanda Vansan; Guelsin, Gláucia Andreia Soares; Visentainer, Jeane Eliete Laguila; Borelli, Sueli Donizete; Watanabe, Maria Angélica Ehara; Consolaro, Márcia Edilaine Lopes; Caleffi-Ferracioli, Katiany Rizzieri; Rudnick, Cristiane Conceição Chagas; Sell, Ana Maria

    2013-01-01

    The genetic variability of the host contributes to the risk of human papillomavirus (HPV)-related cervical disease. Immune response genes to HPV must be investigated to define patients with the highest risk of developing malignant disease. The aim of this study was to investigate the association of polymorphic immune response genes, namely KIR, HLA class I and II, and single-nucleotide polymorphisms (SNPs) of cytokines with HPV-related cervical disease. We selected 79 non-related, admixed Brazilian women from the state of Paraná, southern region of Brazil, who were infected with high carcinogenic risk HPV and present cervical intraepithelial neoplasia grade 3 (CIN3), and 150 HPV-negative women from the same region matched for ethnicity. KIR genes were genotyped using an in-house PCR-SSP. HLA alleles were typed using a reverse sequence-specific oligonucleotide technique. SNPs of TNF −308G>A, IL6 −174G>C, IFNG +874T>A, TGFB1 +869T>C +915G>C, and IL10 −592C>A −819C>T −1082G>A were evaluated using PCR-SSP. The KIR genes were not associated with HPV, although some pairs of i(inhibitory)KIR-ligands occurred more frequently in patients, supporting a role for NK in detrimental chronic inflammatory and carcinogenesis. Some HLA haplotypes were associated with HPV. The associations of INFG and IL10 SNPs potentially reflect impaired or invalid responses in advanced lesions. PMID:23936772

  19. Outer membrane vesicles from Brucella abortus promote bacterial internalization by human monocytes and modulate their innate immune response.

    Directory of Open Access Journals (Sweden)

    Cora N Pollak

    Full Text Available Outer membrane vesicles (OMVs released by some gram-negative bacteria have been shown to exert immunomodulatory effects that favor the establishment of the infection. The aim of the present study was to assess the interaction of OMVs from Brucella abortus with human epithelial cells (HeLa and monocytes (THP-1, and the potential immunomodulatory effects they may exert. Using confocal microscopy and flow cytometry, FITC-labeled OMVs were shown to be internalized by both cell types. Internalization was shown to be partially mediated by clathrin-mediated endocytosis. Pretreatment of THP-1 cells with Brucella OMVs inhibited some cytokine responses (TNF-α and IL-8 to E. coli LPS, Pam3Cys or flagellin (TLR4, TLR2 and TLR5 agonists, respectively. Similarly, pretreatment with Brucella OMVs inhibited the cytokine response of THP-1 cells to B. abortus infection. Treatment of THP-1 cells with OMVs during IFN-γ stimulation reduced significantly the inducing effect of this cytokine on MHC-II expression. OMVs induced a dose-dependent increase of ICAM-1 expression on THP-1 cells and an increased adhesion of these cells to human endothelial cells. The addition of OMVs to THP-1 cultures before the incubation with live B. abortus resulted in increased numbers of adhered and internalized bacteria as compared to cells not treated with OMVs. Overall, these results suggest that OMVs from B. abortus exert cellular effects that promote the internalization of these bacteria by human monocytes, but also downregulate the innate immune response of these cells to Brucella infection. These effects may favor the persistence of Brucella within host cells.

  20. Human leukocyte antigen and cytokine receptor gene polymorphisms associated with heterogeneous immune responses to mumps viral vaccine.

    Science.gov (United States)

    Ovsyannikova, Inna G; Jacobson, Robert M; Dhiman, Neelam; Vierkant, Robert A; Pankratz, V Shane; Poland, Gregory A

    2008-05-01

    Mumps outbreaks continue to occur throughout the world, including in highly vaccinated populations. Vaccination against mumps has been successful; however, humoral and cellular immune responses to mumps vaccines vary significantly from person to person. We set out to assess whether HLA and cytokine gene polymorphisms are associated with variations in the immune response to mumps viral vaccine. To identify genetic factors that might contribute to variations in mumps vaccine-induced immune responses, we performed HLA genotyping in a group of 346 healthy schoolchildren (12-18 years of age) who previously received 2 doses of live mumps vaccine. Single-nucleotide polymorphisms (minor allele frequency of >5%) in cytokine and cytokine receptor genes were genotyped for a subset of 118 children. Median values for mumps-specific antibody titers and lymphoproliferative stimulation indices were 729 IU/mL and 4.8, respectively. Girls demonstrated significantly higher mumps antibody titers than boys, indicating gender-linked genetic differences in humoral immune response. Significant associations were found between the HLA-DQB1*0303 alleles and lower mumps-specific antibody titers. An interesting finding was the association of several HLA class II alleles with mumps-specific lymphoproliferation. Alleles of the DRB1 (*0101, *0301, *0801, *1001, *1201, and *1302), DQA1 (*0101, *0105, *0401, and *0501), and DQB1 (*0201, *0402, and *0501) loci were associated with significant variations in lymphoproliferative immune responses to mumps vaccine. Additional associations were observed with single-nucleotide polymorphisms in the interleukin-10RA, interleukin-12RB1, and interleukin-12RB2 cytokine receptor genes. Minor alleles for 4 single-nucleotide polymorphisms within interleukin-10RA and interleukin-12RB genes were associated with variations in humoral and cellular immune responses to mumps vaccination. These data suggest the important role of HLA and immunoregulatory cytokine receptor

  1. Atherosclerotic lesions in humans. In situ immunophenotypic analysis suggesting an immune mediated response

    NARCIS (Netherlands)

    van der Wal, A. C.; Das, P. K.; Bentz van de Berg, D.; van der Loos, C. M.; Becker, A. E.

    1989-01-01

    The immunophenotypical features of the cellular infiltrates in different types of human atherosclerotic lesions, including diffuse intimal thickening as a potential but controversial precursor lesion, have been examined using monoclonal antibodies. Special emphasis is put on monocytes/macrophages,

  2. Immunological mechanism underlying the immune response to tecombinant human protein therapeutics

    NARCIS (Netherlands)

    Sauerborn, M.S.; Brinks, V.; Jiskoot, W.; Schellekens, H.

    2010-01-01

    Recombinant human (rhu) protein therapeutics are powerful tools to treat several severe diseases such as multiple sclerosis and diabetes mellitus, among others. A major drawback of these proteins is the production of anti-drug antibodies (ADAs). In some cases, these ADAs have neutralizing capacity

  3. Adherent Human Alveolar Macrophages Exhibit a Transient Pro-Inflammatory Profile That Confounds Responses to Innate Immune Stimulation

    Science.gov (United States)

    Tomlinson, Gillian S.; Booth, Helen; Petit, Sarah J.; Potton, Elspeth; Towers, Greg J.; Miller, Robert F.; Chain, Benjamin M.; Noursadeghi, Mahdad

    2012-01-01

    Alveolar macrophages (AM) are thought to have a key role in the immunopathogenesis of respiratory diseases. We sought to test the hypothesis that human AM exhibit an anti-inflammatory bias by making genome-wide comparisons with monocyte derived macrophages (MDM). Adherent AM obtained by bronchoalveolar lavage of patients under investigation for haemoptysis, but found to have no respiratory pathology, were compared to MDM from healthy volunteers by whole genome transcriptional profiling before and after innate immune stimulation. We found that freshly isolated AM exhibited a marked pro-inflammatory transcriptional signature. High levels of basal pro-inflammatory gene expression gave the impression of attenuated responses to lipopolysaccharide (LPS) and the RNA analogue, poly IC, but in rested cells pro-inflammatory gene expression declined and transcriptional responsiveness to these stimuli was restored. In comparison to MDM, both freshly isolated and rested AM showed upregulation of MHC class II molecules. In most experimental paradigms ex vivo adherent AM are used immediately after isolation. Therefore, the confounding effects of their pro-inflammatory profile at baseline need careful consideration. Moreover, despite the prevailing view that AM have an anti-inflammatory bias, our data clearly show that they can adopt a striking pro-inflammatory phenotype, and may have greater capacity for presentation of exogenous antigens than MDM. PMID:22768282

  4. Trappin-2/elafin modulate innate immune responses of human endometrial epithelial cells to PolyI:C.

    Directory of Open Access Journals (Sweden)

    Anna G Drannik

    Full Text Available BACKGROUND: Upon viral recognition, innate and adaptive antiviral immune responses are initiated by genital epithelial cells (ECs to eradicate or contain viral infection. Such responses, however, are often accompanied by inflammation that contributes to acquisition and progression of sexually transmitted infections (STIs. Hence, interventions/factors enhancing antiviral protection while reducing inflammation may prove beneficial in controlling the spread of STIs. Serine antiprotease trappin-2 (Tr and its cleaved form, elafin (E, are alarm antimicrobials secreted by multiple cells, including genital epithelia. METHODOLOGY AND PRINCIPAL FINDINGS: We investigated whether and how each Tr and E (Tr/E contribute to antiviral defenses against a synthetic mimic of viral dsRNA, polyinosine-polycytidylic acid (polyI:C and vesicular stomatitis virus. We show that delivery of a replication-deficient adenovector expressing Tr gene (Ad/Tr to human endometrial epithelial cells, HEC-1A, resulted in secretion of functional Tr, whereas both Tr/E were detected in response to polyI:C. Moreover, Tr/E were found to significantly reduce viral replication by either acting directly on virus or through enhancing polyI:C-driven antiviral protection. The latter was associated with reduced levels of pro-inflammatory factors IL-8, IL-6, TNFα, lowered expression of RIG-I, MDA5 and attenuated NF-κB activation. Interestingly, enhanced polyI:C-driven antiviral protection of HEC-Ad/Tr cells was partially mediated through IRF3 activation, but not associated with higher induction of IFNβ, suggesting multiple antiviral mechanisms of Tr/E and the involvement of alternative factors or pathways. CONCLUSIONS AND SIGNIFICANCE: This is the first evidence of both Tr/E altering viral binding/entry, innate recognition and mounting of antiviral and inflammatory responses in genital ECs that could have significant implications for homeostasis of the female genital tract.

  5. Serum immune response to Shigella protein antigens in rhesus monkeys and humans infected with Shigella spp.

    OpenAIRE

    Oaks, E V; Hale, T L; Formal, S B

    1986-01-01

    The serum antibody response to proteins encoded by the virulence-associated plasmid of Shigella flexneri was determined in monkeys challenged with virulent S. flexneri serotype 2a. With water-extractable antigen in an enzyme-linked immunosorbent assay, a significant increase in antibody titer against proteins from a plasmid-carrying, virulent strain of S. flexneri serotype 5 could be demonstrated in convalescent sera. There were minimal antibody titers against proteins from an avirulent (plas...

  6. Activation of nucleotide oligomerization domain 2 (NOD2 by human cytomegalovirus initiates innate immune responses and restricts virus replication.

    Directory of Open Access Journals (Sweden)

    Arun Kapoor

    Full Text Available Nucleotide-binding oligomerization domain 2 (NOD2 is an important innate immune sensor of bacterial pathogens. Its induction results in activation of the classic NF-κB pathway and alternative pathways including type I IFN and autophagy. Although the importance of NOD2 in recognizing RNA viruses has recently been identified, its role in sensing DNA viruses has not been studied. We report that infection with human cytomegalovirus (HCMV results in significant induction of NOD2 expression, beginning as early as 2 hours post infection and increasing steadily 24 hours post infection and afterwards. Infection with human herpesvirus 1 and 2 does not induce NOD2 expression. While the HCMV-encoded glycoprotein B is not required for NOD2 induction, a replication competent virion is necessary. Lentivirus-based NOD2 knockdown in human foreskin fibroblasts (HFFs and U373 glioma cells leads to enhanced HCMV replication along with decreased levels of interferon beta (IFN-β and the pro-inflammatory cytokine, IL8. NOD2 induction in HCMV-infected cells activates downstream NF-κB and interferon pathways supported by reduced nuclear localization of NF-κB and pIRF3 in NOD2 knockdown HFFs. Stable overexpression of NOD2 in HFFs restricts HCMV replication in association with increased levels of IFN-β and IL8. Similarly, transient overexpression of NOD2 in U373 cells or its downstream kinase, RIPK2, results in decreased HCMV replication and enhanced cytokine responses. However, overexpression of a mutant NOD2, 3020insC, associated with severe Crohn's disease, results in enhanced HCMV replication and decreased levels of IFN-β in U373 cells. These results show for the first time that NOD2 plays a significant role in HCMV replication and may provide a model for studies of HCMV recognition by the host cell and HCMV colitis in Crohn's disease.

  7. Remnant Cholesterol Elicits Arterial Wall Inflammation and a Multilevel Cellular Immune Response in Humans

    DEFF Research Database (Denmark)

    Bernelot Moens, Sophie J; Verweij, Simone L; Schnitzler, Johan G

    2017-01-01

    cholesterol accumulates in human hematopoietic stem and progenitor cells coinciding with myeloid skewing. CONCLUSIONS: Patients with FD have increased arterial wall and cellular inflammation. These findings imply an important inflammatory component to the atherogenicity of remnant cholesterol, contributing......OBJECTIVE: Mendelian randomization studies revealed a causal role for remnant cholesterol in cardiovascular disease. Remnant particles accumulate in the arterial wall, potentially propagating local and systemic inflammation. We evaluated the impact of remnant cholesterol on arterial wall...... inflammation, circulating monocytes, and bone marrow in patients with familial dysbetalipoproteinemia (FD). APPROACH AND RESULTS: Arterial wall inflammation and bone marrow activity were measured using 18F-FDG PET/CT. Monocyte phenotype was assessed with flow cytometry. The correlation between remnant levels...

  8. Natural immune responses against eight oncogenic human papillomaviruses in the ASCUS-LSIL triage study

    Science.gov (United States)

    Wilson, Lauren E.; Pawlita, Michael; Castle, Phillip E.; Waterboer, Tim; Sahasrabuddhe, Vikrant; Gravitt, Patti E.; Schiffman, Mark; Wentzensen, Nicolas

    2014-01-01

    Only a subset of women with human papillomavirus (HPV) infections will become seropositive, and the factors influencing seroconversion are not well-understood. We used a multiplex serology assay in women with mildly abnormal cytology results to examine seroreactivity to oncogenic HPV genotypes. An unbiased subset of women in the atypical squamous cell of undetermined significance /low-grade squamous intraepithelial lesion Triage Study (ALTS) provided blood samples at trial enrollment for serological testing. A Luminex assay based on GST-L1 fusion proteins as antigens was used to test seroreactivity against eight carcinogenic HPV genotypes (16, 18, 31, 33, 35, 45, 52, 58). We analyzed the relationship between seroprevalence in women free of precancer (N=2464) and HPV DNA status, age, sexual behavior, and other HPV-related risk factors. The overall seroprevalence was 24.5% for HPV16 L1 and ~ 20% for 18L1 and 31L1. Among women free of precancer, seroprevalence peaked in women less than 29 years and decreased with age. Type-specific seroprevalence was associated with baseline DNA detection for HPV16 (OR= 1.36, 95%CI: 1.04–1.79) and HPV18 (OR= 2.31, 95%CI: 1.61–3.32), as well as for HPV52 and HPV58. Correlates of sexual exposure were associated with increased seroprevalence across most genotypes. Women who were current or former smokers were less likely to be seropositive for all eight of the tested oncogenic genotypes. The multiplex assay showed associations between seroprevalence and known risk factors for HPV infection across nearly all tested HPV genotypes but associations between DNA- and serostatus were weak, suggesting possible misclassification of the participants’ HPV serostatus. PMID:23588935

  9. A repeated injection of polyethyleneglycol-conjugated recombinant human butyrylcholinesterase elicits immune response in mice

    International Nuclear Information System (INIS)

    Chilukuri, Nageswararao; Sun Wei; Parikh, Kalpana; Naik, Ramachandra S.; Tang Lin; Doctor, Bhupendra P.; Saxena, Ashima

    2008-01-01

    Human serum butyrylcholinesterase (Hu BChE) serves as an efficacious bioscavenger of highly toxic organophosphorus (OP) compounds. Since there is a concern that the supply of native Hu BChE may be limited, monomeric and tetrameric forms of recombinant Hu BChE (rHu BChE) were evaluated as replacements and found that they lacked sufficient stability in vivo. However, their in vivo stability could be significantly prolonged by conjugation with polyethyleneglycol-20K (PEG) suggesting that monomeric and tetrameric PEG-rHu BChE could function as bioscavengers. Here, the immunogenicity of PEG-rHu BChE was evaluated in mice following two injections given four weeks apart. In addition to pharmacokinetic parameters, such as mean residence time, maximal concentration, time to reach the maximal concentration, elimination half-life and area under the plasma concentration-time curve extrapolated to infinity, the presence of circulating anti-rHu BChE antibodies was also determined. Although the pharmacokinetic parameters were significantly improved for the first injection of monomeric and tetrameric PEG-rHu BChEs, they were much lower for the second injection. Anti-rHu BChE antibodies were detected in the blood of mice following the first and second enzyme injections and their levels were approximately higher by 5-fold and 2-fold in mice injected with monomeric and tetrameric PEG-rHu BChEs as compared to mice injected with unconjugated enzymes. The findings that the rapid clearance of a repeat injection of PEG-rHu BChEs in mice which coincides with the presence of circulating anti-rHu BChE antibodies suggest that PEG conjugation prolonged the circulatory stability of rHu BChE but failed to eliminate its immunogenicity in mice

  10. A human type 5 adenovirus-based tuberculosis vaccine induces robust T cell responses in humans despite preexisting anti-adenovirus immunity.

    Science.gov (United States)

    Smaill, Fiona; Jeyanathan, Mangalakumari; Smieja, Marek; Medina, Maria Fe; Thanthrige-Don, Niroshan; Zganiacz, Anna; Yin, Cindy; Heriazon, Armando; Damjanovic, Daniela; Puri, Laura; Hamid, Jemila; Xie, Feng; Foley, Ronan; Bramson, Jonathan; Gauldie, Jack; Xing, Zhou

    2013-10-02

    There is an urgent need to develop new tuberculosis (TB) vaccines to safely and effectively boost Bacille Calmette-Guérin (BCG)-triggered T cell immunity in humans. AdHu5Ag85A is a recombinant human type 5 adenovirus (AdHu5)-based TB vaccine with demonstrated efficacy in a number of animal species, yet it remains to be translated to human applications. In this phase 1 study, we evaluated the safety and immunogenicity of AdHu5Ag85A in both BCG-naïve and previously BCG-immunized healthy adults. Intramuscular immunization of AdHu5Ag85A was safe and well tolerated in both trial volunteer groups. Moreover, although AdHu5Ag85A was immunogenic in both trial volunteer groups, it much more potently boosted polyfunctional CD4(+) and CD8(+) T cell immunity in previously BCG-vaccinated volunteers. Furthermore, despite prevalent preexisting anti-AdHu5 humoral immunity in most of the trial volunteers, we found little evidence that such preexisting anti-AdHu5 immunity significantly dampened the potency of AdHu5Ag85A vaccine. This study supports further clinical investigations of the AdHu5Ag85A vaccine for human applications. It also suggests that the widely perceived negative effect of preexisting anti-AdHu5 immunity may not be universally applied to all AdHu5-based vaccines against different types of human pathogens.

  11. Synthetic double-stranded RNAs are adjuvants for the induction of T helper 1 and humoral immune responses to human papillomavirus in rhesus macaques.

    Directory of Open Access Journals (Sweden)

    Christiane Stahl-Hennig

    2009-04-01

    Full Text Available Toll-like receptor (TLR ligands are being considered as adjuvants for the induction of antigen-specific immune responses, as in the design of vaccines. Polyriboinosinic-polyribocytoidylic acid (poly I:C, a synthetic double-stranded RNA (dsRNA, is recognized by TLR3 and other intracellular receptors. Poly ICLC is a poly I:C analogue, which has been stabilized against the serum nucleases that are present in the plasma of primates. Poly I:C(12U, another analogue, is less toxic but also less stable in vivo than poly I:C, and TLR3 is essential for its recognition. To study the effects of these compounds on the induction of protein-specific immune responses in an animal model relevant to humans, rhesus macaques were immunized subcutaneously (s.c. with keyhole limpet hemocyanin (KLH or human papillomavirus (HPV16 capsomeres with or without dsRNA or a control adjuvant, the TLR9 ligand CpG-C. All dsRNA compounds served as adjuvants for KLH-specific cellular immune responses, with the highest proliferative responses being observed with 2 mg/animal poly ICLC (p = 0.002 or 6 mg/animal poly I:C(12U (p = 0.001 when compared with immunization with KLH alone. Notably, poly ICLC -- but not CpG-C given at the same dose -- also helped to induce HPV16-specific Th1 immune responses while both adjuvants supported the induction of strong anti-HPV16 L1 antibody responses as determined by ELISA and neutralization assay. In contrast, control animals injected with HPV16 capsomeres alone did not develop substantial HPV16-specific immune responses. Injection of dsRNA led to increased numbers of cells producing the T cell-activating chemokines CXCL9 and CXCL10 as detected by in situ hybridization in draining lymph nodes 18 hours after injections, and to increased serum levels of CXCL10 (p = 0.01. This was paralleled by the reduced production of the homeostatic T cell-attracting chemokine CCL21. Thus, synthetic dsRNAs induce an innate chemokine response and act as adjuvants

  12. Dynamic innate immune responses of human bronchial epithelial cells to severe acute respiratory syndrome-associated coronavirus infection.

    Directory of Open Access Journals (Sweden)

    Tomoki Yoshikawa

    2010-01-01

    Full Text Available Human lung epithelial cells are likely among the first targets to encounter invading severe acute respiratory syndrome-associated coronavirus (SARS-CoV. Not only can these cells support the growth of SARS-CoV infection, but they are also capable of secreting inflammatory cytokines to initiate and, eventually, aggravate host innate inflammatory responses, causing detrimental immune-mediated pathology within the lungs. Thus, a comprehensive evaluation of the complex epithelial signaling to SARS-CoV is crucial for paving the way to better understand SARS pathogenesis. Based on microarray-based functional genomics, we report here the global gene response of 2B4 cells, a cloned bronchial epithelial cell line derived from Calu-3 cells. Specifically, we found a temporal and spatial activation of nuclear factor (NFkappaB, activator protein (AP-1, and interferon regulatory factor (IRF-3/7 in infected 2B4 cells at 12-, 24-, and 48-hrs post infection (p.i., resulting in the activation of many antiviral genes, including interferon (IFN-beta, -lambdas, inflammatory mediators, and many IFN-stimulated genes (ISGs. We also showed, for the first time, that IFN-beta and IFN-lambdas were capable of exerting previously unrecognized, non-redundant, and complementary abilities to limit SARS-CoV replication, even though their expression could not be detected in infected 2B4 bronchial epithelial cells until 48 hrs p.i. Collectively, our results highlight the mechanics of the sequential events of antiviral signaling pathway/s triggered by SARS-CoV in bronchial epithelial cells and identify novel cellular targets for future studies, aiming at advancing strategies against SARS.

  13. Nano-Pulse Stimulation induces immunogenic cell death in human papillomavirus-transformed tumors and initiates an adaptive immune response.

    Directory of Open Access Journals (Sweden)

    Joseph G Skeate

    Full Text Available Nano-Pulse Stimulation (NPS is a non-thermal pulsed electric field modality that has been shown to have cancer therapeutic effects. Here we applied NPS treatment to the human papillomavirus type 16 (HPV 16-transformed C3.43 mouse tumor cell model and showed that it is effective at eliminating primary tumors through the induction of immunogenic cell death while subsequently increasing the number of tumor-infiltrating lymphocytes within the tumor microenvironment. In vitro NPS treatment of C3.43 cells resulted in a doubling of activated caspase 3/7 along with the translocation of phosphatidylserine (PS to the outer leaflet of the plasma membrane, indicating programmed cell death activity. Tumor-bearing mice receiving standard NPS treatment showed an initial decrease in tumor volume followed by clearing of tumors in most mice, and a significant increase in overall survival. Intra-tumor analysis of mice that were unable to clear tumors showed an inverse correlation between the number of tumor infiltrating lymphocytes and the size of the tumor. Approximately half of the mice that cleared established tumors were protected against tumor re-challenge on the opposite flank. Selective depletion of CD8+ T cells eliminated this protection, suggesting that NPS treatment induces an adaptive immune response generating CD8+ T cells that recognize tumor antigen(s associated with the C3.43 tumor model. This method may be utilized in the future to not only ablate primary tumors, but also to induce an anti-tumor response driven by effector CD8+ T cells capable of protecting individuals from disease recurrence.

  14. Nano-Pulse Stimulation induces immunogenic cell death in human papillomavirus-transformed tumors and initiates an adaptive immune response.

    Science.gov (United States)

    Skeate, Joseph G; Da Silva, Diane M; Chavez-Juan, Elena; Anand, Snjezana; Nuccitelli, Richard; Kast, W Martin

    2018-01-01

    Nano-Pulse Stimulation (NPS) is a non-thermal pulsed electric field modality that has been shown to have cancer therapeutic effects. Here we applied NPS treatment to the human papillomavirus type 16 (HPV 16)-transformed C3.43 mouse tumor cell model and showed that it is effective at eliminating primary tumors through the induction of immunogenic cell death while subsequently increasing the number of tumor-infiltrating lymphocytes within the tumor microenvironment. In vitro NPS treatment of C3.43 cells resulted in a doubling of activated caspase 3/7 along with the translocation of phosphatidylserine (PS) to the outer leaflet of the plasma membrane, indicating programmed cell death activity. Tumor-bearing mice receiving standard NPS treatment showed an initial decrease in tumor volume followed by clearing of tumors in most mice, and a significant increase in overall survival. Intra-tumor analysis of mice that were unable to clear tumors showed an inverse correlation between the number of tumor infiltrating lymphocytes and the size of the tumor. Approximately half of the mice that cleared established tumors were protected against tumor re-challenge on the opposite flank. Selective depletion of CD8+ T cells eliminated this protection, suggesting that NPS treatment induces an adaptive immune response generating CD8+ T cells that recognize tumor antigen(s) associated with the C3.43 tumor model. This method may be utilized in the future to not only ablate primary tumors, but also to induce an anti-tumor response driven by effector CD8+ T cells capable of protecting individuals from disease recurrence.

  15. Human cellular and humoral immune responses to Phlebotomus papatasi salivary gland antigens in endemic areas differing in prevalence of Leishmania major infection.

    Directory of Open Access Journals (Sweden)

    Wafa Kammoun-Rebai

    2017-10-01

    Full Text Available Sand fly saliva compounds are able to elicit specific immune responses that have a significant role in Leishmania parasite establishment and disease outcome. Characterizing anti-saliva immune responses in individuals living in well defined leishmaniasis endemic areas would provide valuable insights regarding their effect on parasite transmission and establishment in humans.We explored the cellular and humoral immune responses to Phlebotomus (P. papatasi salivary gland extracts (SGE in individuals living in cutaneous leishmaniasis (CL old or emerging foci (OF, EF. OF was characterized by a higher infection prevalence as assessed by higher proportions of leishmanin skin test (LST positive individuals compared to EF. Subjects were further subdivided into healed, asymptomatic or naïve groups. We showed anti-SGE proliferation in less than 30% of the individuals, regardless of the immune status, in both foci. IFN-γ production was higher in OF and only observed in immune individuals from OF and naïve subjects from EF. Although IL-10 was not detected, addition of anti-human IL-10 antibodies revealed an increase in proliferation and IFN-γ production only in individuals from OF. The percentage of seropositive individuals was similar in immune and naïves groups but was significantly higher in OF. No correlation was observed between anti-saliva immune responses and LST response. High anti-SGE-IgG responses were associated with an increased risk of developing ZCL. No differences were observed for anti-SGE humoral or cellular responses among naïve individuals who converted or not their LST response or developed or not ZCL after the transmission season.These data suggest that individuals living in an old focus characterized by a frequent exposure to sand fly bites and a high prevalence of infection, develop higher anti-saliva IgG responses and IFN-γ levels and a skew towards a Th2-type cellular response, probably in favor of parasite establishment

  16. Immune Response to Dengue and Zika.

    Science.gov (United States)

    Ngono, Annie Elong; Shresta, Sujan

    2018-04-26

    Flaviviruses such as dengue (DENV), yellow fever (YFV), West Nile (WNV), and Zika (ZIKV) are human pathogens of global significance. In particular, DENV causes the most prevalent mosquito-borne viral diseases in humans, and ZIKV emerged from obscurity into the spotlight in 2016 as the etiologic agent of congenital Zika syndrome. Owing to the recent emergence of ZIKV as a global pandemic threat, the roles of the immune system during ZIKV infections are as yet unclear. In contrast, decades of DENV research implicate a dual role for the immune system in protection against and pathogenesis of DENV infection. As DENV and ZIKV are closely related, knowledge based on DENV studies has been used to prioritize investigation of ZIKV immunity and pathogenesis, and to accelerate ZIKV diagnostic, therapeutic, and vaccine design. This review discusses the following topics related to innate and adaptive immune responses to DENV and ZIKV: the interferon system as the key mechanism of host defense and viral target for immune evasion, antibody-mediated protection versus antibody-dependent enhancement, and T cell-mediated protection versus original T cell antigenic sin. Understanding the mechanisms that regulate the balance between immune-mediated protection and pathogenesis during DENV and ZIKV infections is critical toward development of safe and effective DENV and ZIKV therapeutics and vaccines.

  17. Human immune responsiveness to Lolium perenne pollen allergen Lol p III (rye III) is associated with HLA-DR3 and DR5.

    Science.gov (United States)

    Ansari, A A; Freidhoff, L R; Meyers, D A; Bias, W B; Marsh, D G

    1989-05-01

    A well-characterized allergen of Lolium perenne (perennial rye grass) pollen, Lol p III, has been used as a model antigen to study the genetic control of the human immune response. Associations between HLA type and IgE or IgG antibody (Ab) responsiveness to Lol p III were studied in two groups of skin-test-positive Caucasoid adults (N = 135 and 67). We found by nonparametric and parametric analyses that immune responsiveness to Lol p III was significantly associated with HLA-DR3 and DR5. No association was found between any DQ type and immune responsiveness to Lol p III. Geometric mean IgE or IgG Ab levels to Lol p III were not different between B8+, DR3+ subjects and B8-, DR3+ subjects, showing that HLA-B8 had no influence on the association. Lol p III IgG Ab data obtained on subjects after grass antigen immunotherapy showed that 100% of DR3 subjects and 100% of DR5 subjects were Ab+. A comparison of all the available protein sequences of DRB gene products showed that the first hypervariable region of DR3 and DR5 (and DRw6), and no other region, contains the sequence Glu9-Tyr-Ser-Thr-Ser13. Our observations are consistent with the possibility that immune responsiveness to the allergen Lol p III is associated with this amino acid sequence in the first hypervariable region of the DR beta 1 polypeptide chain.

  18. Innate Immune Responses in Leprosy

    Science.gov (United States)

    Pinheiro, Roberta Olmo; Schmitz, Veronica; Silva, Bruno Jorge de Andrade; Dias, André Alves; de Souza, Beatriz Junqueira; de Mattos Barbosa, Mayara Garcia; de Almeida Esquenazi, Danuza; Pessolani, Maria Cristina Vidal; Sarno, Euzenir Nunes

    2018-01-01

    Leprosy is an infectious disease that may present different clinical forms depending on host immune response to Mycobacterium leprae. Several studies have clarified the role of various T cell populations in leprosy; however, recent evidences suggest that local innate immune mechanisms are key determinants in driving the disease to its different clinical manifestations. Leprosy is an ideal model to study the immunoregulatory role of innate immune molecules and its interaction with nervous system, which can affect homeostasis and contribute to the development of inflammatory episodes during the course of the disease. Macrophages, dendritic cells, neutrophils, and keratinocytes are the major cell populations studied and the comprehension of the complex networking created by cytokine release, lipid and iron metabolism, as well as antimicrobial effector pathways might provide data that will help in the development of new strategies for leprosy management. PMID:29643852

  19. Molecular and cellular characterization of a Salmonella enterica serovar Paratyphi a outbreak strain and the human immune response to infection.

    Science.gov (United States)

    Gal-Mor, Ohad; Suez, Jotham; Elhadad, Dana; Porwollik, Steffen; Leshem, Eyal; Valinsky, Lea; McClelland, Michael; Schwartz, Eliezer; Rahav, Galia

    2012-02-01

    Enteric fever is an invasive life-threatening systemic disease caused by the Salmonella enterica human-adapted serovars Typhi and Paratyphi. Increasing incidence of infections with Salmonella enterica serovar Paratyphi A and the spreading of its antibiotic-resistant derivates pose a significant health concern in some areas of the world. Herein, we describe a molecular and phenotypic characterization of an S. Paratyphi A strain accounted for a recent paratyphoid outbreak in Nepal that affected at least 37 travelers. Pulsed-field gel electrophoresis analysis of the outbreak isolates revealed one genetic clone (pulsotype), confirming a single infecting source. Genetic profiling of the outbreak strain demonstrated the contribution of specific bacteriophages as a prime source of genetic diversity among clinical isolates of S. Paratyphi A. Phenotypic characterization in comparison with the S. Paratyphi A ATCC 9150 reference sequenced strain showed differences in flagellar morphology and increased abilities of the outbreak strain with respect to its motility, invasion into nonphagocytic cells, intracellular multiplication, survival within macrophages, and higher induction of interleukin-8 (IL-8) secreted by host cells. Collectively, these differences suggest an enhanced virulence potential of this strain and demonstrate an interesting phenotypic variation among S. Paratyphi A isolates. In vivo profiling of 16 inflammatory cytokines in patients infected with the outbreak strain revealed a common profile of a remarkable gamma interferon (IFN-γ) induction together with elevated concentrations of tumor necrosis factor alpha (TNF-α), IL-6, IL-8, IL-10, and IL-15, but not IL-12, which was previously demonstrated as elevated in nontyphoidal Salmonella infections. This apparent profile implies a distinct immune response to paratyphoid infections.

  20. Humoral immunity response to human endogenous retroviruses K/W differentiates between amyotrophic lateral sclerosis and other neurological diseases.

    Science.gov (United States)

    Arru, G; Mameli, G; Deiana, G A; Rassu, A L; Piredda, R; Sechi, E; Caggiu, E; Bo, M; Nako, E; Urso, D; Mariotto, S; Ferrari, S; Zanusso, G; Monaco, S; Sechi, G; Sechi, L A

    2018-03-31

    Human endogenous retroviruses (HERV) K/W seem to play a role in fostering and exacerbation of some neurological diseases, including amyotrophic lateral sclerosis (ALS). Given these findings, the immunity response against HERV-K and HERV-W envelope surface (env-su) glycoprotein antigens in serum and cerebrospinal fluid (CSF) was investigated for ALS, multiple sclerosis (MS) and Alzheimer's disease patients and in healthy controls. Four antigenic peptides derived respectively from HERV-K and HERV-W env-su proteins were studied in 21 definite or probable ALS patients, 26 possible or definite relapsing-remitting MS patients, 18 patients with Alzheimer's disease and 39 healthy controls. An indirect enzyme-linked immunosorbent assay was set up to detect specific antibodies (Abs) against env-su peptides. Amongst the measured levels of Abs against the four different HERV-K peptide fragments, only HERV-K env-su 19-37 was significantly elevated in ALS compared to other groups, both in serum and CSF. Instead, amongst the Abs levels directed against the four different HERV-W peptide fragments, only HERV-W env-su 93-108 and HERV-W env-su 248-262 were significantly elevated, in the serum and CSF of the MS group compared to other groups. In ALS patients, the HERV-K env-su 19-37 Abs levels were significantly correlated with clinical measures of disease severity, both in serum and CSF. Increased circulating levels of Abs directed against the HERV-W env-su 93-108 and HERV-W env-su 248-262 peptide fragments could serve as possible biomarkers in patients with MS. Similarly, increased circulating levels of Abs directed against the HERV-K env-su 19-37 peptide fragment could serve as a possible early novel biomarker in patients with ALS. © 2018 EAN.

  1. The viral transcription group determines the HLA class I cellular immune response against human respiratory syncytial virus.

    Science.gov (United States)

    Johnstone, Carolina; Lorente, Elena; Barriga, Alejandro; Barnea, Eilon; Infantes, Susana; Lemonnier, François A; David, Chella S; Admon, Arie; López, Daniel

    2015-04-01

    The cytotoxic T-lymphocyte-mediated killing of virus-infected cells requires previous recognition of short viral antigenic peptides bound to human leukocyte antigen class I molecules that are exposed on the surface of infected cells. The cytotoxic T-lymphocyte response is critical for the clearance of human respiratory syncytial virus infection. In this study, naturally processed viral human leukocyte antigen class I ligands were identified with mass spectrometry analysis of complex human leukocyte antigen-bound peptide pools isolated from large amounts of human respiratory syncytial virus-infected cells. Acute antiviral T-cell response characterization showed that viral transcription determines both the immunoprevalence and immunodominance of the human leukocyte antigen class I response to human respiratory syncytial virus. These findings have clear implications for antiviral vaccine design. © 2015 by The American Society for Biochemistry and Molecular Biology, Inc.

  2. The Viral Transcription Group Determines the HLA Class I Cellular Immune Response Against Human Respiratory Syncytial Virus*

    Science.gov (United States)

    Johnstone, Carolina; Lorente, Elena; Barriga, Alejandro; Barnea, Eilon; Infantes, Susana; Lemonnier, François A.; David, Chella S.; Admon, Arie; López, Daniel

    2015-01-01

    The cytotoxic T-lymphocyte-mediated killing of virus-infected cells requires previous recognition of short viral antigenic peptides bound to human leukocyte antigen class I molecules that are exposed on the surface of infected cells. The cytotoxic T-lymphocyte response is critical for the clearance of human respiratory syncytial virus infection. In this study, naturally processed viral human leukocyte antigen class I ligands were identified with mass spectrometry analysis of complex human leukocyte antigen-bound peptide pools isolated from large amounts of human respiratory syncytial virus-infected cells. Acute antiviral T-cell response characterization showed that viral transcription determines both the immunoprevalence and immunodominance of the human leukocyte antigen class I response to human respiratory syncytial virus. These findings have clear implications for antiviral vaccine design. PMID:25635267

  3. Abnormal humoral immune response to influenza vaccination in pediatric type-1 human immunodeficiency virus infected patients receiving highly active antiretroviral therapy

    Directory of Open Access Journals (Sweden)

    Carlos J Montoya

    2007-06-01

    Full Text Available Given that highly active antiretroviral therapy (HAART has been demonstrated useful to restore immune competence in type-1 human immunodeficiency virus (HIV-1-infected subjects, we evaluated the specific antibody response to influenza vaccine in a cohort of HIV-1-infected children on HAART so as to analyze the quality of this immune response in patients under antiretroviral therapy. Sixteen HIV-1-infected children and 10 HIV-1 seronegative controls were immunized with a commercially available trivalent inactivated influenza vaccine containing the strains A/H1N1, A/H3N2, and B. Serum hemagglutinin inhibition (HI antibody titers were determined for the three viral strains at the time of vaccination and 1 month later. Immunization induced a significantly increased humoral response against the three influenza virus strains in controls, and only against A/H3N2 in HIV-1-infected children. The comparison of post-vaccination HI titers between HIV-1+ patients and HIV-1 negative controls showed significantly higher HI titers against the three strains in controls. In addition, post vaccination protective HI titers (defined as equal to or higher than 1:40 against the strains A/H3N2 and B were observed in a lower proportion of HIV-1+ children than in controls, while a similar proportion of individuals from each group achieved protective HI titers against the A/H1N1 strain. The CD4+ T cell count, CD4/CD8 T cells ratio, and serum viral load were not affected by influenza virus vaccination when pre- vs post-vaccination values were compared. These findings suggest that despite the fact that HAART is efficient in controlling HIV-1 replication and in increasing CD4+ T cell count in HIV-1-infected children, restoration of immune competence and response to cognate antigens remain incomplete, indicating that additional therapeutic strategies are required to achieve a full reconstitution of immune functions.

  4. Broad blockade antibody responses in human volunteers after immunization with a multivalent norovirus VLP candidate vaccine: immunological analyses from a phase I clinical trial.

    Directory of Open Access Journals (Sweden)

    Lisa C Lindesmith

    2015-03-01

    Full Text Available Human noroviruses (NoVs are the primary cause of acute gastroenteritis and are characterized by antigenic variation between genogroups and genotypes and antigenic drift of strains within the predominant GII.4 genotype. In the context of this diversity, an effective NoV vaccine must elicit broadly protective immunity. We used an antibody (Ab binding blockade assay to measure the potential cross-strain protection provided by a multivalent NoV virus-like particle (VLP candidate vaccine in human volunteers.Sera from ten human volunteers immunized with a multivalent NoV VLP vaccine (genotypes GI.1/GII.4 were analyzed for IgG and Ab blockade of VLP interaction with carbohydrate ligand, a potential correlate of protective immunity to NoV infection and illness. Immunization resulted in rapid rises in IgG and blockade Ab titers against both vaccine components and additional VLPs representing diverse strains and genotypes not represented in the vaccine. Importantly, vaccination induced blockade Ab to two novel GII.4 strains not in circulation at the time of vaccination or sample collection. GII.4 cross-reactive blockade Ab titers were more potent than responses against non-GII.4 VLPs, suggesting that previous exposure history to this dominant circulating genotype may impact the vaccine Ab response. Further, antigenic cartography indicated that vaccination preferentially activated preexisting Ab responses to epitopes associated with GII.4.1997. Study interpretations may be limited by the relevance of the surrogate neutralization assay and the number of immunized participants evaluated.Vaccination with a multivalent NoV VLP vaccine induces a broadly blocking Ab response to multiple epitopes within vaccine and non-vaccine NoV strains and to novel antigenic variants not yet circulating at the time of vaccination. These data reveal new information about complex NoV immune responses to both natural exposure and to vaccination, and support the potential

  5. Development of immune organs and functioning in humans and test animals: Implications for immune intervention studies.

    Science.gov (United States)

    Kuper, C Frieke; van Bilsen, Jolanda; Cnossen, Hilde; Houben, Geert; Garthoff, Jossie; Wolterbeek, Andre

    2016-09-01

    A healthy immune status is mostly determined during early life stages and many immune-related diseases may find their origin in utero and the first years of life. Therefore, immune health optimization may be most effective during early life. This review is an inventory of immune organ maturation events in relation to developmental timeframes in minipig, rat, mouse and human. It is concluded that time windows of immune organ development in rodents can be translated to human, but minipig reflects the human timeframes better; however the lack of prenatal maternal-fetal immune interaction in minipig may cause less responsiveness to prenatal intervention. It is too early to conclude which immune parameters are most appropriate, because there are not enough comparative immune parameters. Filling these gaps will increase the predictability of results observed in experimental animals, and guide future intervention studies by assessing relevant parameters in the right corresponding developmental time frames. Copyright © 2016 Elsevier Inc. All rights reserved.

  6. Immune Responses in the Central Nervous System Are Anatomically Segregated in a Non-Human Primate Model of Human Immunodeficiency Virus Infection

    Directory of Open Access Journals (Sweden)

    Barbara Tavano

    2017-03-01

    Full Text Available The human immunodeficiency virus (HIV accesses the central nervous system (CNS early during infection, leading to HIV-associated cognitive impairment and establishment of a viral reservoir. Here, we describe a dichotomy in inflammatory responses in different CNS regions in simian immunodeficiency virus (SIV-infected macaques, a model for HIV infection. We found increased expression of inflammatory genes and perivascular leukocyte infiltration in the midbrain of SIV-infected macaques. Conversely, the frontal lobe showed downregulation of inflammatory genes associated with interferon-γ and interleukin-6 pathways, and absence of perivascular cuffing. These immunologic alterations were not accompanied by differences in SIV transcriptional activity within the tissue. Altered expression of genes associated with neurotoxicity was observed in both midbrain and frontal lobe. The segregation of inflammatory responses to specific regions of the CNS may both account for HIV-associated neurological symptoms and constitute a critical hurdle for HIV eradication by shielding the CNS viral reservoir from antiviral immunity.

  7. Investigating the Role of the Arabidopsis Homologue of the Human G3BP in RNA Metabolism, Cellular Stress Responses and Innate Immunity

    KAUST Repository

    Abulfaraj, Aala A.

    2018-04-01

    Mitogen-activated protein kinases (MAPKs) belong to the most conserved signaling pathways and are found in all eukaryotes, including humans where they play important roles in various diseases and cancer. Stimulation of this signal transduction pathway by microbe-associated molecular patterns (MAMP) results in a multitude of events to regulate innate immune responses in Arabidopsis thaliana stimulating large-scale changes in gene expression. Starting from a phosphoproteomic screen in Arabidopsis thaliana wild type and mpk3, mpk4 and mpk6 mutants following microbe-associated molecular pattern (MAMP) treatment, several novel chromatin-associated proteins were identified that are differentially phosphorylated by stress-induced protein kinases. Arabidopsis Ras GTPase-activating protein SH3-domain-binding protein (AtG3BP-1) is a downstream putative substrate of the MAMP-stimulated MAPK pathway that is phosphorylated by MPK3, 4 and 6 in in vitro kinase assays. AtG3BP1 belongs to a highly conserved family of RNA-binding proteins in eukaryotes that link kinase receptormediated signaling to RNA metabolism. Here, we report the characterization of the Arabidopsis homolog of human G3BP1 in plant innate immunity. AtG3BP1 negatively regulates plant immunity and defense immune responses. Atg3bp1 mutant lines show constitutive stomata closure, expression of a number of key defense marker genes, and accumulate salicylic acid but not jasmonic acid. Furthermore, Atg3bp1 plants exhibit enhanced resistance to the biotrophic pathogen Pseudomonas syringae pv. tomato. Pathogen resistance was mediated by stomatal and apoplastic immunity in Atg3bp1. More generally, our data reinforce that AtG3BP1 is a key mediator of plant defense responses and transient expression of AtG3BP1 delivered striking disease resistance in the absence of yield penalty, highlighting a potential application of this gene in crop protection.

  8. Immune Responses Involved in Mycobacterium Tuberculosis Infection

    Directory of Open Access Journals (Sweden)

    Roghayeh Teimourpour

    2016-09-01

    Full Text Available Background and Objectives: Mycobacterium tuberculosis is the causative agent of tuberculosis (TB. Approximately one-third of the world's population is infected with M. tuberculosis. Despite the availability of drug and vaccine, it remains one of the leading causes of death in humans especially in developing countries. Epidemiological studies have indicated that only 10-30% of people exposed to tubercle bacillus are infected with M. tuberculosis, and at least 90% of the infected people finally do not acquire TB. The studies have indicated that the host efficient immune system has essential roles in the control of TB infection such that the highest rate of mortality and morbidity is seen in immunocompromised patients such as people infected with HIV. M. tuberculosis is an obligatory intracellular bacterium. It enters the body mainly through the respiratory tract and alveolar macrophages combat this pathogen most commonly. In addition to alveolar macrophages, various T-cell subpopulations need to be activated to overcome this bacterium's resistance to the host defense systems. CD4+ T cells, through production of several cytokines such as IFN-γ and TNF-α, and CD8+ T cells, through cytotoxic activities and induction of apoptosis in infected cells, play critical roles in inducing appropriate immune responses against M. tuberculosis. Although cell-mediated immunity is the cornerstone of host responses against TB and the recent studies have provided evidence for the importance of humoral and innate immune system in the control of TB, a profound understanding of the immune responses would provide a basis for development of new generations of vaccines and drugs. The present study addresses immune responses involved in M. tuberculosis infection.

  9. Cell-mediated and humoral immune responses induced by scarification vaccination of human volunteers with a new lot of the live vaccine strain of Francisella tularensis.

    Science.gov (United States)

    Waag, D M; Galloway, A; Sandstrom, G; Bolt, C R; England, M J; Nelson, G O; Williams, J C

    1992-01-01

    Tularemia is a disease caused by the facultative intracellular bacterium Francisella tularensis. We evaluated a new lot of live F. tularensis vaccine for its immunogenicity in human volunteers. Scarification vaccination induced humoral and cell-mediated immune responses. Indications of a positive immune response after vaccination included an increase in specific antibody levels, which were measured by enzyme-linked immunosorbent and immunoblot assays, and the ability of peripheral blood lymphocytes to respond to whole F. tularensis bacteria as recall antigens. Vaccination caused a significant rise (P less than 0.05) in immunoglobulin A (IgA), IgG, and IgM titers. Lymphocyte stimulation indices were significantly increased (P less than 0.01) in vaccinees 14 days after vaccination. These data verify that this new lot of live F. tularensis vaccine is immunogenic. Images PMID:1400988

  10. Immune Response to Lipoproteins in Atherosclerosis

    Directory of Open Access Journals (Sweden)

    Sonia Samson

    2012-01-01

    Full Text Available Atherosclerosis, the underlying cause of cardiovascular disease, is characterized by chronic inflammation and altered immune response. Cholesterol is a well-known risk factor associated with the development of cardiovascular diseases. Elevated serum cholesterol is unique because it can lead to development of atherosclerosis in animals and humans even in the absence of other risk factors. Modifications of low-density lipoproteins mediated by oxidation, enzymatic degradation, and aggregation result in changes in their function and activate both innate and adaptive immune system. Oxidized low-density lipoprotein (LDL has been identified as one of the most important autoantigens in atherosclerosis. This escape from self-tolerance is dependent on the formation of oxidized phospholipids. The emerging understanding of the importance of immune responses against oxidized LDL in atherosclerosis has focused attention on the possibility of development of novel therapy for atherosclerosis. This review provides an overview of immune response to lipoproteins and the fascinating possibility of developing an immunomodulatory therapy for atherosclerosis.

  11. Eosinophils in mucosal immune responses

    Science.gov (United States)

    Travers, J; Rothenberg, M E

    2015-01-01

    Eosinophils, multifunctional cells that contribute to both innate and adaptive immunity, are involved in the initiation, propagation and resolution of immune responses, including tissue repair. They achieve this multifunctionality by expression of a diverse set of activation receptors, including those that directly recognize pathogens and opsonized targets, and by their ability to store and release preformed cytotoxic mediators that participate in host defense, to produce a variety of de novo pleotropic mediators and cytokines and to interact directly and indirectly with diverse cell types, including adaptive and innate immunocytes and structural cells. Herein, we review the basic biology of eosinophils and then focus on new emerging concepts about their role in mucosal immune homeostasis, particularly maintenance of intestinal IgA. We review emerging data about their development and regulation and describe new concepts concerning mucosal eosinophilic diseases. We describe recently developed therapeutic strategies to modify eosinophil levels and function and provide collective insight about the beneficial and detrimental functions of these enigmatic cells. PMID:25807184

  12. Attenuation of Pathogenic Immune Responses during Infection with Human and Simian Immunodeficiency Virus (HIV/SIV) by the Tetracycline Derivative Minocycline

    Science.gov (United States)

    Drewes, Julia L.; Szeto, Gregory L.; Engle, Elizabeth L.; Liao, Zhaohao; Shearer, Gene M.; Zink, M. Christine; Graham, David R.

    2014-01-01

    HIV immune pathogenesis is postulated to involve two major mechanisms: 1) chronic innate immune responses that drive T cell activation and apoptosis and 2) induction of immune regulators that suppress T cell function and proliferation. Both arms are elevated chronically in lymphoid tissues of non-natural hosts, which ultimately develop AIDS. However, these mechanisms are not elevated chronically in natural hosts of SIV infection that avert immune pathogenesis despite similarly high viral loads. In this study we investigated whether minocycline could modulate these pathogenic antiviral responses in non-natural hosts of HIV and SIV. We found that minocycline attenuated in vitro induction of type I interferon (IFN) and the IFN-stimulated genes indoleamine 2,3-dioxygenase (IDO1) and TNF-related apoptosis inducing ligand (TRAIL) in human plasmacytoid dendritic cells and PBMCs exposed to aldrithiol-2 inactivated HIV or infectious influenza virus. Activation-induced TRAIL and expression of cytotoxic T-lymphocyte antigen 4 (CTLA-4) in isolated CD4+ T cells were also reduced by minocycline. Translation of these in vitro findings to in vivo effects, however, were mixed as minocycline significantly reduced markers of activation and activation-induced cell death (CD25, Fas, caspase-3) but did not affect expression of IFNβ or the IFN-stimulated genes IDO1, FasL, or Mx in the spleens of chronically SIV-infected pigtailed macaques. TRAIL expression, reflecting the mixed effects of minocycline on activation and type I IFN stimuli, was reduced by half, but this change was not significant. These results show that minocycline administered after infection may protect against aspects of activation-induced cell death during HIV/SIV immune disease, but that in vitro effects of minocycline on type I IFN responses are not recapitulated in a rapid progressor model in vivo. PMID:24732038

  13. The effects of orally administered Beta-glucan on innate immune responses in humans, a randomized open-label intervention pilot-study.

    Directory of Open Access Journals (Sweden)

    Jenneke Leentjens

    Full Text Available To prevent or combat infection, increasing the effectiveness of the immune response is highly desirable, especially in case of compromised immune system function. However, immunostimulatory therapies are scarce, expensive, and often have unwanted side-effects. β-glucans have been shown to exert immunostimulatory effects in vitro and in vivo in experimental animal models. Oral β-glucan is inexpensive and well-tolerated, and therefore may represent a promising immunostimulatory compound for human use.We performed a randomized open-label intervention pilot-study in 15 healthy male volunteers. Subjects were randomized to either the β -glucan (n = 10 or the control group (n = 5. Subjects in the β-glucan group ingested β-glucan 1000 mg once daily for 7 days. Blood was sampled at various time-points to determine β-glucan serum levels, perform ex vivo stimulation of leukocytes, and analyze microbicidal activity.β-glucan was barely detectable in serum of volunteers at all time-points. Furthermore, neither cytokine production nor microbicidal activity of leukocytes were affected by orally administered β-glucan.The present study does not support the use of oral β-glucan to enhance innate immune responses in humans.ClinicalTrials.gov NCT01727895.

  14. Cellular immune responses to respiratory viruses

    NARCIS (Netherlands)

    van Helden, M.J.G.

    2011-01-01

    When a respiratory virus successfully infects the lungs, cascades of immune responses are initiated aimed to remove the pathogen. Immediate non-specific protection is provided by the innate immune system and this reduces the viral load during the first days of infection. The adaptive immune response

  15. The Immune Response of Maternally Immune Chicks to Vaccination ...

    African Journals Online (AJOL)

    The Immune Response of Maternally Immune Chicks to Vaccination with Newcastle Disease Virus. ... G A El-Tayeb, M Y El-Ttegani, I E Hajer, M A Mohammed ... This study was conducted to determine the persistence of maternally derived antibodies (MDA) to Newcastle disease virus (NDV) in newly hatched chicks and the ...

  16. Hepatitis C Virus Sensing by Human Trophoblasts Induces Innate Immune Responses and Recruitment of Maternal NK Cells: Potential Implications for Limiting Vertical Transmission.

    Science.gov (United States)

    Giugliano, Silvia; Petroff, Margaret G; Warren, Bryce D; Jasti, Susmita; Linscheid, Caitlin; Ward, Ashley; Kramer, Anita; Dobrinskikh, Evgenia; Sheiko, Melissa A; Gale, Michael; Golden-Mason, Lucy; Winn, Virginia D; Rosen, Hugo R

    2015-10-15

    Hepatitis C virus (HCV) is the world's most common blood-borne viral infection for which there is no vaccine. The rates of vertical transmission range between 3 and 6% with odds 90% higher in the presence of HIV coinfection. Prevention of vertical transmission is not possible because of lack of an approved therapy for use in pregnancy or an effective vaccine. Recently, HCV has been identified as an independent risk factor for preterm delivery, perinatal mortality, and other complications. In this study, we characterized the immune responses that contribute to the control of viral infection at the maternal-fetal interface (MFI) in the early gestational stages. In this study, we show that primary human trophoblast cells and an extravillous trophoblast cell line (HTR8), from first and second trimester of pregnancy, express receptors relevant for HCV binding/entry and are permissive for HCV uptake. We found that HCV-RNA sensing by human trophoblast cells induces robust upregulation of type I/III IFNs and secretion of multiple chemokines that elicit recruitment and activation of decidual NK cells. Furthermore, we observed that HCV-RNA transfection induces a proapoptotic response within HTR8 that could affect the morphology of the placenta. To our knowledge, for the first time, we demonstrate that HCV-RNA sensing by human trophoblast cells elicits a strong antiviral response that alters the recruitment and activation of innate immune cells at the MFI. This work provides a paradigm shift in our understanding of HCV-specific immunity at the MFI as well as novel insights into mechanisms that limit vertical transmission but may paradoxically lead to virus-related pregnancy complications. Copyright © 2015 by The American Association of Immunologists, Inc.

  17. Molecular and immunological tools for the evaluation of the cellular immune response in the neotropical monkey Saimiri sciureus, a non-human primate model for malaria research.

    Science.gov (United States)

    Riccio, Evelyn K P; Pratt-Riccio, Lilian R; Bianco-Júnior, Cesare; Sanchez, Violette; Totino, Paulo R R; Carvalho, Leonardo J M; Daniel-Ribeiro, Cláudio Tadeu

    2015-04-18

    The neotropical, non-human primates (NHP) of the genus Saimiri and Aotus are recommended by the World Health Organization as experimental models for the study of human malaria because these animals can be infected with the same Plasmodium that cause malaria in humans. However, one limitation is the lack of immunological tools to assess the immune response in these models. The present study focuses on the development and comparative use of molecular and immunological methods to evaluate the cellular immune response in Saimiri sciureus. Blood samples were obtained from nineteen uninfected Saimiri. Peripheral blood mononuclear cells (PBMC) from these animals and splenocytes from one splenectomized animal were cultured for 6, 12, 18, 24, 48, 72 and 96 hrs in the presence of phorbol-12-myristate-13-acetate and ionomycin. The cytokine levels in the supernatant were detected using human and NHP cytometric bead array Th1/Th2 cytokine kits, the Bio-Plex Pro Human Cytokine Th1/Th2 Assay, enzyme-linked immunosorbent assay, enzyme-linked immunospot assays and intracellular cytokine secretion assays. Cytokine gene expression was examined through TaqMan® Gene Expression Real-Time PCR using predesigned human gene-specific primers and probes or primers and probes designed based on published S. sciureus cytokine sequences. The use of five assays based on monoclonal antibodies specific for human cytokines facilitated the detection of IL-2, IL-4 and/or IFN-γ. TaqMan array plates facilitated the detection of 12 of the 28 cytokines assayed. However, only seven cytokines (IL-1A, IL-2, IL-10, IL-12B, IL-17, IFN-β, and TNF) presented relative expression levels of at least 70% of the gene expression observed in human PBMC. The use of primers and probes specific for S. sciureus cytokines facilitated the detection of transcripts that showed relative expression below the threshold of 70%. The most efficient evaluation of cytokine gene expression, in PBMC and splenocytes, was observed

  18. Probiotic Lactobacillus rhamnosus GG enhanced Th1 cellular immunity but did not affect antibody responses in a human gut microbiota transplanted neonatal gnotobiotic pig model.

    Directory of Open Access Journals (Sweden)

    Ke Wen

    Full Text Available This study aims to establish a human gut microbiota (HGM transplanted gnotobiotic (Gn pig model of human rotavirus (HRV infection and diarrhea, and to verify the dose-effects of probiotics on HRV vaccine-induced immune responses. Our previous studies using the Gn pig model found that probiotics dose-dependently regulated both T cell and B cell immune responses induced by rotavirus vaccines. We generated the HGM transplanted neonatal Gn pigs through daily feeding of neonatal human fecal suspension to germ-free pigs for 3 days starting at 12 hours after birth. We found that attenuated HRV (AttHRV vaccination conferred similar overall protection against rotavirus diarrhea and virus shedding in Gn pigs and HGM transplanted Gn pigs. HGM promoted the development of the neonatal immune system, as evidenced by the significantly enhanced IFN-γ producing T cell responses and reduction of regulatory T cells and their cytokine production in the AttHRV-vaccinated pigs. The higher dose Lactobacillus rhamnosus GG (LGG feeding (14 doses, up to 109 colony-forming-unit [CFU]/dose effectively increased the LGG counts in the HGM Gn pig intestinal contents and significantly enhanced HRV-specific IFN-γ producing T cell responses to the AttHRV vaccine. Lower dose LGG (9 doses, up to 106 CFU/dose was ineffective. Neither doses of LGG significantly improved the protection rate, HRV-specific IgA and IgG antibody titers in serum, or IgA antibody titers in intestinal contents compared to the AttHRV vaccine alone, suggesting that an even higher dose of LGG is needed to overcome the influence of the microbiota to achieve the immunostimulatory effect in the HGM pigs. This study demonstrated that HGM Gn pig is an applicable animal model for studying immune responses to rotavirus vaccines and can be used for studying interventions (i.e., probiotics and prebiotics that may enhance the immunogenicity and protective efficacy of vaccines through improving the gut microbiota.

  19. Innate immune response of human plasmacytoid dendritic cells to poxvirus infection is subverted by vaccinia E3 via its Z-DNA/RNA binding domain.

    Directory of Open Access Journals (Sweden)

    Hua Cao

    Full Text Available Plasmacytoid dendritic cells (pDCs play important roles in antiviral innate immunity by producing type I interferon (IFN. In this study, we assess the immune responses of primary human pDCs to two poxviruses, vaccinia and myxoma virus. Vaccinia, an orthopoxvirus, was used for immunization against smallpox, a contagious human disease with high mortality. Myxoma virus, a Leporipoxvirus, causes lethal disease in rabbits, but is non-pathogenic in humans. We report that myxoma virus infection of human pDCs induces IFN-α and TNF production, whereas vaccinia infection does not. Co-infection of pDCs with myxoma virus plus vaccinia blocks myxoma induction effects. We find that heat-inactivated vaccinia (Heat-VAC; by incubating the virus at 55°C for 1 h gains the ability to induce IFN-α and TNF in primary human pDCs. Induction of IFN-α in pDCs by myxoma virus or Heat-VAC is blocked by chloroquine, which inhibits endosomal acidification required for TLR7/9 signaling, and by inhibitors of cellular kinases PI3K and Akt. Using purified pDCs from genetic knockout mice, we demonstrate that Heat-VAC-induced type I IFN production in pDCs requires the endosomal RNA sensor TLR7 and its adaptor MyD88, transcription factor IRF7 and the type I IFN feedback loop mediated by IFNAR1. These results indicate that (i vaccinia virus, but not myxoma virus, expresses inhibitor(s of the poxvirus sensing pathway(s in pDCs; and (ii Heat-VAC infection fails to produce inhibitor(s but rather produces novel activator(s, likely viral RNA transcripts that are sensed by the TLR7/MyD88 pathway. Using vaccinia gene deletion mutants, we show that the Z-DNA/RNA binding domain at the N-terminus of the vaccinia immunomodulatory E3 protein is an antagonist of the innate immune response of human pDCs to poxvirus infection and TLR agonists. The myxoma virus ortholog of vaccinia E3 (M029 lacks the N-terminal Z-DNA/RNA binding domain, which might contribute to the immunostimulating

  20. Innate Immune Response of Human Plasmacytoid Dendritic Cells to Poxvirus Infection Is Subverted by Vaccinia E3 via Its Z-DNA/RNA Binding Domain

    Science.gov (United States)

    Dai, Peihong; Wang, Weiyi; Li, Hao; Yuan, Jianda; Wang, Fangjin; Fang, Chee-Mun; Pitha, Paula M; Liu, Jia; Condit, Richard C; McFadden, Grant; Merghoub, Taha; Houghton, Alan N; Young, James W; Shuman, Stewart; Deng, Liang

    2012-01-01

    Plasmacytoid dendritic cells (pDCs) play important roles in antiviral innate immunity by producing type I interferon (IFN). In this study, we assess the immune responses of primary human pDCs to two poxviruses, vaccinia and myxoma virus. Vaccinia, an orthopoxvirus, was used for immunization against smallpox, a contagious human disease with high mortality. Myxoma virus, a Leporipoxvirus, causes lethal disease in rabbits, but is non-pathogenic in humans. We report that myxoma virus infection of human pDCs induces IFN-α and TNF production, whereas vaccinia infection does not. Co-infection of pDCs with myxoma virus plus vaccinia blocks myxoma induction effects. We find that heat-inactivated vaccinia (Heat-VAC; by incubating the virus at 55°C for 1 h) gains the ability to induce IFN-α and TNF in primary human pDCs. Induction of IFN-α in pDCs by myxoma virus or Heat-VAC is blocked by chloroquine, which inhibits endosomal acidification required for TLR7/9 signaling, and by inhibitors of cellular kinases PI3K and Akt. Using purified pDCs from genetic knockout mice, we demonstrate that Heat-VAC-induced type I IFN production in pDCs requires the endosomal RNA sensor TLR7 and its adaptor MyD88, transcription factor IRF7 and the type I IFN feedback loop mediated by IFNAR1. These results indicate that (i) vaccinia virus, but not myxoma virus, expresses inhibitor(s) of the poxvirus sensing pathway(s) in pDCs; and (ii) Heat-VAC infection fails to produce inhibitor(s) but rather produces novel activator(s), likely viral RNA transcripts that are sensed by the TLR7/MyD88 pathway. Using vaccinia gene deletion mutants, we show that the Z-DNA/RNA binding domain at the N-terminus of the vaccinia immunomodulatory E3 protein is an antagonist of the innate immune response of human pDCs to poxvirus infection and TLR agonists. The myxoma virus ortholog of vaccinia E3 (M029) lacks the N-terminal Z-DNA/RNA binding domain, which might contribute to the immunostimulating properties of

  1. Herpes simplex virus (HSV)-specific proliferative and cytotoxic T-cell responses in humans immunized with an HSF type 2 glycoprotein subunit vaccine

    Energy Technology Data Exchange (ETDEWEB)

    Zarling, J.M.; Moran, P.A.; Brewer, L.; Ashley, R.; Corey, L.

    1988-12-01

    Studies were undertaken to determine whether immunization of humans with a herpes simplex virus type 2 (HSV-2) glycoprotein-subunit vaccine would result in the priming of both HSV-specific proliferating cells and cytotoxic T cells. Peripheral blood lymphocytes (PBL) from all eight vaccinees studied responded by proliferating after stimulation with HSV-2, HSV-1, and glycoprotein gB-1. The PBL of five of these eight vaccinees proliferated following stimulation with gD-2, whereas stimulation with Gd-1 resulted in relatively low or no proliferative responses. T-cell clones were generated from HSV-2-stimulated PBL of three vaccinees who demonstrated strong proliferative responses to HSV-1 and HSV-2. Of 12 clones studied in lymphoproliferative assays, 9 were found to be cross-reactive for HSV-1 and HSV-2. Of the approximately 90 T-cell clones isolated, 14 demonstrated HSV-specific cytotoxic activity. Radioimmunoprecipitation-polyacrylamide gel electrophoresis analyses confirmed that the vaccinees had antibodies only to HSV glycoproteins, not to proteins which are absent in the subunit vaccine, indicating that these vaccinees had not become infected with HSV. Immunization of humans with an HSV-2 glycoprotein-subunit vaccine thus results in the priming of T cells that proliferate in response to stimulation with HSV and its glycoproteins and T cells that have cytotoxic activity against HSV-infected cells. Such HSV-specific memory T cells were detected as late as 2 years following the last boost with the subunit vaccine.

  2. Human immunophenotyping via low-variance, low-bias, interpretive regression modeling of small, wide data sets: Application to aging and immune response to influenza vaccination.

    Science.gov (United States)

    Holmes, Tyson H; He, Xiao-Song

    2016-10-01

    Small, wide data sets are commonplace in human immunophenotyping research. As defined here, a small, wide data set is constructed by sampling a small to modest quantity n,1small, wide data sets. These prescriptions are distinctive in their especially heavy emphasis on minimizing the use of out-of-sample information for conducting statistical inference. This allows the working immunologist to proceed without being encumbered by imposed and often untestable statistical assumptions. Problems of unmeasured confounders, confidence-interval coverage, feature selection, and shrinkage/denoising are defined clearly and treated in detail. We propose an extension of an existing nonparametric technique for improved small-sample confidence-interval tail coverage from the univariate case (single immune feature) to the multivariate (many, possibly correlated immune features). An important role for derived features in the immunological interpretation of regression analyses is stressed. Areas of further research are discussed. Presented principles and methods are illustrated through application to a small, wide data set of adults spanning a wide range in ages and multiple immunophenotypes that were assayed before and after immunization with inactivated influenza vaccine (IIV). Our regression modeling prescriptions identify some potentially important topics for future immunological research. 1) Immunologists may wish to distinguish age-related differences in immune features from changes in immune features caused by aging. 2) A form of the bootstrap that employs linear extrapolation may prove to be an invaluable analytic tool because it allows the working immunologist to obtain accurate estimates of the stability of immune parameter estimates with a bare minimum of imposed assumptions. 3) Liberal inclusion of immune features in phenotyping panels can facilitate accurate separation of biological signal of interest from noise. In addition, through a combination of denoising and

  3. Aged Garlic Extract Modifies Human Immunity.

    Science.gov (United States)

    Percival, Susan S

    2016-02-01

    Garlic contains numerous compounds that have the potential to influence immunity. Immune cells, especially innate immune cells, are responsible for the inflammation necessary to kill pathogens. Two innate lymphocytes, γδ-T and natural killer (NK) cells, appear to be susceptible to diet modification. The purpose of this review was to summarize the influence of aged garlic extract (AGE) on the immune system. The author's laboratory is interested in AGE's effects on cell proliferation and activation and inflammation and to learn whether those changes might affect the occurrence and severity of colds and flu. Healthy human participants (n = 120), between 21 and 50 y of age, were recruited for a randomized, double-blind, placebo-controlled parallel-intervention study to consume 2.56 g AGE/d or placebo supplements for 90 d during the cold and flu season. Peripheral blood mononuclear cells were isolated before and after consumption, and γδ-T and NK cell function was assessed by flow cytometry. The effect on cold and flu symptoms was determined by using daily diary records of self-reported illnesses. After 45 d of AGE consumption, γδ-T and NK cells proliferated better and were more activated than cells from the placebo group. After 90 d, although the number of illnesses was not significantly different, the AGE group showed reduced cold and flu severity, with a reduction in the number of symptoms, the number of days participants functioned suboptimally, and the number of work/school days missed. These results suggest that AGE supplementation may enhance immune cell function and may be partly responsible for the reduced severity of colds and flu reported. The results also suggest that the immune system functions well with AGE supplementation, perhaps with less accompanying inflammation. This trial was registered at clinicaltrials.gov as NCT01390116. © 2016 American Society for Nutrition.

  4. Evaluation of Immune Responses Mediated by Listeria-Stimulated Human Dendritic Cells: Implications for Cancer Vaccine Therapy

    Science.gov (United States)

    2013-07-01

    transfected with RNA. NatBiotech. 1998;16:364-369. 20. Heiser A, Dahm P, Yancey DR, et al. Human dendritic cells transfected with RNA encoding prostate...specific antigen stimulate prostate-specific CTL responses in vitro. J Immunol. 2000;164(10):5508-5514. 21. Heiser A, Maurice MA, Yancey DR...primary and metastatic tumors. Cancer Res. 2001;61(8):3388-3393. 22. Heiser A, Coleman D, Dannull J, et al. Autologous dendritic cells transfected

  5. Immune oncology, immune responsiveness and the theory of everything.

    Science.gov (United States)

    Turan, Tolga; Kannan, Deepti; Patel, Maulik; Matthew Barnes, J; Tanlimco, Sonia G; Lu, Rongze; Halliwill, Kyle; Kongpachith, Sarah; Kline, Douglas E; Hendrickx, Wouter; Cesano, Alessandra; Butterfield, Lisa H; Kaufman, Howard L; Hudson, Thomas J; Bedognetti, Davide; Marincola, Francesco; Samayoa, Josue

    2018-06-05

    Anti-cancer immunotherapy is encountering its own checkpoint. Responses are dramatic and long lasting but occur in a subset of tumors and are largely dependent upon the pre-existing immune contexture of individual cancers. Available data suggest that three landscapes best define the cancer microenvironment: immune-active, immune-deserted and immune-excluded. This trichotomy is observable across most solid tumors (although the frequency of each landscape varies depending on tumor tissue of origin) and is associated with cancer prognosis and response to checkpoint inhibitor therapy (CIT). Various gene signatures (e.g. Immunological Constant of Rejection - ICR and Tumor Inflammation Signature - TIS) that delineate these landscapes have been described by different groups. In an effort to explain the mechanisms of cancer immune responsiveness or resistance to CIT, several models have been proposed that are loosely associated with the three landscapes. Here, we propose a strategy to integrate compelling data from various paradigms into a "Theory of Everything". Founded upon this unified theory, we also propose the creation of a task force led by the Society for Immunotherapy of Cancer (SITC) aimed at systematically addressing salient questions relevant to cancer immune responsiveness and immune evasion. This multidisciplinary effort will encompass aspects of genetics, tumor cell biology, and immunology that are pertinent to the understanding of this multifaceted problem.

  6. Maternal immunity enhances systemic recall immune responses upon oral immunization of piglets with F4 fimbriae.

    Science.gov (United States)

    Nguyen, Ut V; Melkebeek, Vesna; Devriendt, Bert; Goetstouwers, Tiphanie; Van Poucke, Mario; Peelman, Luc; Goddeeris, Bruno M; Cox, Eric

    2015-06-23

    F4 enterotoxigenic Escherichia coli (ETEC) cause diarrhoea and mortality in piglets leading to severe economic losses. Oral immunization of piglets with F4 fimbriae induces a protective intestinal immune response evidenced by an F4-specific serum and intestinal IgA response. However, successful oral immunization of pigs with F4 fimbriae in the presence of maternal immunity has not been demonstrated yet. In the present study we aimed to evaluate the effect of maternal immunity on the induction of a systemic immune response upon oral immunization of piglets. Whereas F4-specific IgG and IgA could be induced by oral immunization of pigs without maternal antibodies and by intramuscular immunization of pigs with maternal antibodies, no such response was seen in the orally immunized animals with maternal antibodies. Since maternal antibodies can mask an antibody response, we also looked by ELIspot assays for circulating F4-specific antibody secreting cells (ASCs). Enumerating the F4-specific ASCs within the circulating peripheral blood mononuclear cells, and the number of F4-specific IgA ASCs within the circulating IgA(+) B-cells revealed an F4-specific immune response in the orally immunized animals with maternal antibodies. Interestingly, results suggest a more robust IgA booster response by oral immunization of pigs with than without maternal antibodies. These results demonstrate that oral immunization of piglets with F4-specific maternal antibodies is feasible and that these maternal antibodies seem to enhance the secondary systemic immune response. Furthermore, our ELIspot assay on enriched IgA(+) B-cells could be used as a screening procedure to optimize mucosal immunization protocols in pigs with maternal immunity.

  7. Surface structure characterization of Aspergillus fumigatus conidia mutated in the melanin synthesis pathway and their human cellular immune response.

    Science.gov (United States)

    Bayry, Jagadeesh; Beaussart, Audrey; Dufrêne, Yves F; Sharma, Meenu; Bansal, Kushagra; Kniemeyer, Olaf; Aimanianda, Vishukumar; Brakhage, Axel A; Kaveri, Srini V; Kwon-Chung, Kyung J; Latgé, Jean-Paul; Beauvais, Anne

    2014-08-01

    In Aspergillus fumigatus, the conidial surface contains dihydroxynaphthalene (DHN)-melanin. Six-clustered gene products have been identified that mediate sequential catalysis of DHN-melanin biosynthesis. Melanin thus produced is known to be a virulence factor, protecting the fungus from the host defense mechanisms. In the present study, individual deletion of the genes involved in the initial three steps of melanin biosynthesis resulted in an altered conidial surface with masked surface rodlet layer, leaky cell wall allowing the deposition of proteins on the cell surface and exposing the otherwise-masked cell wall polysaccharides at the surface. Melanin as such was immunologically inert; however, deletion mutant conidia with modified surfaces could activate human dendritic cells and the subsequent cytokine production in contrast to the wild-type conidia. Cell surface defects were rectified in the conidia mutated in downstream melanin biosynthetic pathway, and maximum immune inertness was observed upon synthesis of vermelone onward. These observations suggest that although melanin as such is an immunologically inert material, it confers virulence by facilitating proper formation of the A. fumigatus conidial surface. Copyright © 2014, American Society for Microbiology. All Rights Reserved.

  8. 6. THE ROLE OF SELENIUM IN HUMAN IMMUNITY

    African Journals Online (AJOL)

    Esem

    lymphocyte (CD3+) immune response was enhanced in persons that ... Selenium and Disease Conditions ... In China, Keshan and Kashin-Beck diseases are human. 21,22,23 ... and cytotoxic cell activities that act against the HIV virus.

  9. Gastrointestinal immune responses in HIV infected subjects

    Directory of Open Access Journals (Sweden)

    LRR Castello-Branco

    1996-06-01

    Full Text Available The gut associated lymphoid tissue is responsible for specific responses to intestinal antigens. During HIV infection, mucosal immune deficiency may account for the gastrointestinal infections. In this review we describe the humoral and cellular mucosal immune responses in normal and HIV-infected subjects.

  10. Role of yqiC in the pathogenicity of Salmonella and innate immune responses of human intestinal epithelium

    Directory of Open Access Journals (Sweden)

    Ke-Chuan Wang

    2016-10-01

    Full Text Available The yqiC gene of Salmonella enterica serovar Typhimurium (S. Typhimurium regulates bacterial growth at different temperatures and mice survival after infection. However, the role of yqiC in bacterial colonization and host immunity remains unknown. We infected human LS174T, Caco-2, HeLa, and THP-1 cells with S. Typhimurium wild-type SL1344, its yqiC mutant, and its complemented strain. Bacterial colonization and internalization in the four cell lines significantly reduced on yqiC depletion. Postinfection production of interleukin-8 and human β-defensin-3 in LS174T cells significantly reduced because of yqiC deleted in S. Typhimurium. The phenotype of yqiC mutant exhibited few and short flagella, fimbriae on the cell surface, enhanced biofilm formation, upregulated type-1 fimbriae expression, and reduced bacterial motility. Type-1 fimbriae, flagella, SPI-1, and SPI-2 gene expression was quantified using real-time PCR. The data show that deletion of yqiC upregulated fimA and fimZ expression and downregulated flhD, fliZ, invA, and sseB expression. Furthermore, thin-layer chromatography and high-performance liquid chromatography revealed the absence of menaquinone in the yqiC mutant, thus validating the importance of yqiC in the bacterial electron transport chain. Therefore, YqiC can negatively regulate FimZ for type-1 fimbriae expression and manipulate the functions of its downstream virulence factors including flagella, SPI-1, and SPI-2 effectors.

  11. Modulation of neonatal microbial recognition: TLR-mediated innate immune responses are specifically and differentially modulated by human milk.

    Science.gov (United States)

    LeBouder, Emmanuel; Rey-Nores, Julia E; Raby, Anne-Catherine; Affolter, Michael; Vidal, Karine; Thornton, Catherine A; Labéta, Mario O

    2006-03-15

    The mechanisms controlling innate microbial recognition in the neonatal gut are still to be fully understood. We have sought specific regulatory mechanisms operating in human breast milk relating to TLR-mediated microbial recognition. In this study, we report a specific and differential modulatory effect of early samples (days 1-5) of breast milk on ligand-induced cell stimulation via TLRs. Although a negative modulation was exerted on TLR2 and TLR3-mediated responses, those via TLR4 and TLR5 were enhanced. This effect was observed in human adult and fetal intestinal epithelial cell lines, monocytes, dendritic cells, and PBMC as well as neonatal blood. In the latter case, milk compensated for the low capacity of neonatal plasma to support responses to LPS. Cell stimulation via the IL-1R or TNFR was not modulated by milk. This, together with the differential effect on TLR activation, suggested that the primary effect of milk is exerted upstream of signaling proximal to TLR ligand recognition. The analysis of TLR4-mediated gene expression, used as a model system, showed that milk modulated TLR-related genes differently, including those coding for signal intermediates and regulators. A proteinaceous milk component of > or =80 kDa was found to be responsible for the effect on TLR4. Notably, infant milk formulations did not reproduce the modulatory activity of breast milk. Together, these findings reveal an unrecognized function of human milk, namely, its capacity to influence neonatal microbial recognition by modulating TLR-mediated responses specifically and differentially. This in turn suggests the existence of novel mechanisms regulating TLR activation.

  12. Studies on the antibody response of mice and humans after immunization with potential influenza virus A (H1N1) vaccines

    International Nuclear Information System (INIS)

    Poumbourios, P.; Jackson, D.C.; Oxford, J.S.

    1993-01-01

    The antibody response of mice and adult humans to immunization with subunit vaccines derived from a pair of antigenically distinct influenza A H1N1 viruses isolate in eggs was investigated. Although the haemagglutinin molecule of each virus differed by only three amino acid residues, highly specific antibody responses were elicited in mice as determined by haemagglutination inhibition and radioimmunoprecipitation assays. Results from competitive radioimmunoassays using monoclonal antibodies of known specificity and a study of the reactivity of mouse antisera with H1N1 field strains indicated that the marked differences in the antibody responses to the two vaccines was due to an amino acid substitution in the distal tip of the haemagglutinin molecule. In contrast, cross reactive antibody responses were elicited in humans presumably due to exposure to viruses related to the candidate vaccine prior to vaccination. Although immunogenic differences are apparent in this pair of antigenically distinct viruses in naive laboratory animals, these differences are not apparent following vaccination of humans that had prior exposure to related viruses. 21 refs., 5 tabs., 4 figs

  13. Innate Immune Responses of Drosophila melanogaster Are Altered by Spaceflight

    Science.gov (United States)

    Marcu, Oana; Lera, Matthew P.; Sanchez, Max E.; Levic, Edina; Higgins, Laura A.; Shmygelska, Alena; Fahlen, Thomas F.; Nichol, Helen; Bhattacharya, Sharmila

    2011-01-01

    Alterations and impairment of immune responses in humans present a health risk for space exploration missions. The molecular mechanisms underpinning innate immune defense can be confounded by the complexity of the acquired immune system of humans. Drosophila (fruit fly) innate immunity is simpler, and shares many similarities with human innate immunity at the level of molecular and genetic pathways. The goals of this study were to elucidate fundamental immune processes in Drosophila affected by spaceflight and to measure host-pathogen responses post-flight. Five containers, each containing ten female and five male fruit flies, were housed and bred on the space shuttle (average orbit altitude of 330.35 km) for 12 days and 18.5 hours. A new generation of flies was reared in microgravity. In larvae, the immune system was examined by analyzing plasmatocyte number and activity in culture. In adults, the induced immune responses were analyzed by bacterial clearance and quantitative real-time polymerase chain reaction (qPCR) of selected genes following infection with E. coli. The RNA levels of relevant immune pathway genes were determined in both larvae and adults by microarray analysis. The ability of larval plasmatocytes to phagocytose E. coli in culture was attenuated following spaceflight, and in parallel, the expression of genes involved in cell maturation was downregulated. In addition, the level of constitutive expression of pattern recognition receptors and opsonins that specifically recognize bacteria, and of lysozymes, antimicrobial peptide (AMP) pathway and immune stress genes, hallmarks of humoral immunity, were also reduced in larvae. In adults, the efficiency of bacterial clearance measured in vivo following a systemic infection with E. coli post-flight, remained robust. We show that spaceflight altered both cellular and humoral immune responses in Drosophila and that the disruption occurs at multiple interacting pathways. PMID:21264297

  14. Innate immune responses of Drosophila melanogaster are altered by spaceflight.

    Directory of Open Access Journals (Sweden)

    Oana Marcu

    2011-01-01

    Full Text Available Alterations and impairment of immune responses in humans present a health risk for space exploration missions. The molecular mechanisms underpinning innate immune defense can be confounded by the complexity of the acquired immune system of humans. Drosophila (fruit fly innate immunity is simpler, and shares many similarities with human innate immunity at the level of molecular and genetic pathways. The goals of this study were to elucidate fundamental immune processes in Drosophila affected by spaceflight and to measure host-pathogen responses post-flight. Five containers, each containing ten female and five male fruit flies, were housed and bred on the space shuttle (average orbit altitude of 330.35 km for 12 days and 18.5 hours. A new generation of flies was reared in microgravity. In larvae, the immune system was examined by analyzing plasmatocyte number and activity in culture. In adults, the induced immune responses were analyzed by bacterial clearance and quantitative real-time polymerase chain reaction (qPCR of selected genes following infection with E. coli. The RNA levels of relevant immune pathway genes were determined in both larvae and adults by microarray analysis. The ability of larval plasmatocytes to phagocytose E. coli in culture was attenuated following spaceflight, and in parallel, the expression of genes involved in cell maturation was downregulated. In addition, the level of constitutive expression of pattern recognition receptors and opsonins that specifically recognize bacteria, and of lysozymes, antimicrobial peptide (AMP pathway and immune stress genes, hallmarks of humoral immunity, were also reduced in larvae. In adults, the efficiency of bacterial clearance measured in vivo following a systemic infection with E. coli post-flight, remained robust. We show that spaceflight altered both cellular and humoral immune responses in Drosophila and that the disruption occurs at multiple interacting pathways.

  15. Primary Human Blood Dendritic Cells for Cancer Immunotherapy—Tailoring the Immune Response by Dendritic Cell Maturation

    Directory of Open Access Journals (Sweden)

    Simone P. Sittig

    2015-12-01

    Full Text Available Dendritic cell (DC-based cancer vaccines hold the great promise of tipping the balance from tolerance of the tumor to rejection. In the last two decades, we have gained tremendous knowledge about DC-based cancer vaccines. The maturation of DCs has proven indispensable to induce immunogenic T cell responses. We review the insights gained from the development of maturation cocktails in monocyte derived DC-based trials. More recently, we have also gained insights into the functional specialization of primary human blood DC subsets. In peripheral human blood, we can distinguish at least three primary DC subsets, namely CD1c+ and CD141+ myeloid DCs and plasmacytoid DCs. We reflect the current knowledge on maturation and T helper polarization by these blood DC subsets in the context of DC-based cancer vaccines. The maturation stimulus in combination with the DC subset will determine the type of T cell response that is induced. First trials with these natural DCs underline their excellent in vivo functioning and mark them as promising tools for future vaccination strategies.

  16. Dendritic-cell-based immunotherapy evokes potent anti-tumor immune responses in CD105+ human renal cancer stem cells.

    Science.gov (United States)

    Zhang, Xiao-Fei; Weng, De-Sheng; Pan, Ke; Zhou, Zi-Qi; Pan, Qiu-Zhong; Zhao, Jing-Jing; Tang, Yan; Jiang, Shan-Shan; Chen, Chang-Long; Li, Yong-Qiang; Zhang, Hong-Xia; Chang, Alfred E; Wicha, Max S; Zeng, Yi-Xin; Li, Qiao; Xia, Jian-Chuan

    2017-11-01

    Cancer stem cells (CSCs) are responsible for tumor initiation, progression, and resistance to therapeutic agents; they are usually less sensitive to conventional cancer therapies, and could cause tumor relapse. An ideal therapeutic strategy would therefore be to selectively target and destroy CSCs, thereby preventing tumor relapse. The aim of the present study was to evaluate the effectiveness of dendritic cells (DCs) pulsed with antigen derived from CD105+ human renal cell carcinoma (RCC) CSCs against renal cancer cells in vitro and in vivo. We identified "stem-like" characteristics of CD105+ cells in two human RCC cell lines: A498 and SK-RC-39. Loading with cell lysates did not change the characteristics of the DCs. However, DCs loaded with lysates derived from CD105+ CSCs induced more functionally specific active T cells and specific antibodies against CSCs, and clearly depressed the tumor growth in mice. Our results could form the basis for a novel strategy to improve the efficacy of DC-based immunotherapy for human RCC. © 2017 Wiley Periodicals, Inc.

  17. Bacteria in the vaginal microbiome alter the innate immune response and barrier properties of the human vaginal epithelia in a species-specific manner.

    Science.gov (United States)

    Doerflinger, Sylvie Y; Throop, Andrea L; Herbst-Kralovetz, Melissa M

    2014-06-15

    Bacterial vaginosis increases the susceptibility to sexually transmitted infections and negatively affects women's reproductive health. To investigate host-vaginal microbiota interactions and the impact on immune barrier function, we colonized 3-dimensional (3-D) human vaginal epithelial cells with 2 predominant species of vaginal microbiota (Lactobacillus iners and Lactobacillus crispatus) or 2 prevalent bacteria associated with bacterial vaginosis (Atopobium vaginae and Prevotella bivia). Colonization of 3-D vaginal epithelial cell aggregates with vaginal microbiota was observed with direct attachment to host cell surface with no cytotoxicity. A. vaginae infection yielded increased expression membrane-associated mucins and evoked a robust proinflammatory, immune response in 3-D vaginal epithelial cells (ie, expression of CCL20, hBD-2, interleukin 1β, interleukin 6, interleukin 8, and tumor necrosis factor α) that can negatively affect barrier function. However, P. bivia and L. crispatus did not significantly upregulate pattern-recognition receptor-signaling, mucin expression, antimicrobial peptides/defensins, or proinflammatory cytokines in 3-D vaginal epithelial cell aggregates. Notably, L. iners induced pattern-recognition receptor-signaling activity, but no change was observed in mucin expression or secretion of interleukin 6 and interleukin 8. We identified unique species-specific immune signatures from vaginal epithelial cells elicited by colonization with commensal and bacterial vaginosis-associated bacteria. A. vaginae elicited a signature that is consistent with significant disruption of immune barrier properties, potentially resulting in enhanced susceptibility to sexually transmitted infections during bacterial vaginosis. © The Author 2014. Published by Oxford University Press on behalf of the Infectious Diseases Society of America. All rights reserved. For Permissions, please e-mail: journals.permissions@oup.com.

  18. DNA Damage Response and Immune Defence: Links and Mechanisms

    Directory of Open Access Journals (Sweden)

    Björn Schumacher

    2016-08-01

    Full Text Available DNA damage plays a causal role in numerous human pathologies including cancer, premature aging and chronic inflammatory conditions. In response to genotoxic insults, the DNA damage response (DDR orchestrates DNA damage checkpoint activation and facilitates the removal of DNA lesions. The DDR can also arouse the immune system by for example inducing the expression of antimicrobial peptides as well as ligands for receptors found on immune cells. The activation of immune signalling is triggered by different components of the DDR including DNA damage sensors, transducer kinases, and effectors. In this review, we describe recent advances on the understanding of the role of DDR in activating immune signalling. We highlight evidence gained into (i which molecular and cellular pathways of DDR activate immune signalling, (ii how DNA damage drives chronic inflammation, and (iii how chronic inflammation causes DNA damage and pathology in humans.

  19. Size- and shape-dependent foreign body immune response to materials implanted in rodents and non-human primates

    Science.gov (United States)

    Veiseh, Omid; Doloff, Joshua C.; Ma, Minglin; Vegas, Arturo J.; Tam, Hok Hei; Bader, Andrew R.; Li, Jie; Langan, Erin; Wyckoff, Jeffrey; Loo, Whitney S.; Jhunjhunwala, Siddharth; Chiu, Alan; Siebert, Sean; Tang, Katherine; Hollister-Lock, Jennifer; Aresta-Dasilva, Stephanie; Bochenek, Matthew; Mendoza-Elias, Joshua; Wang, Yong; Qi, Merigeng; Lavin, Danya M.; Chen, Michael; Dholakia, Nimit; Thakrar, Raj; Lacík, Igor; Weir, Gordon C.; Oberholzer, Jose; Greiner, Dale L.; Langer, Robert; Anderson, Daniel G.

    2015-06-01

    The efficacy of implanted biomedical devices is often compromised by host recognition and subsequent foreign body responses. Here, we demonstrate the role of the geometry of implanted materials on their biocompatibility in vivo. In rodent and non-human primate animal models, implanted spheres 1.5 mm and above in diameter across a broad spectrum of materials, including hydrogels, ceramics, metals and plastics, significantly abrogated foreign body reactions and fibrosis when compared with smaller spheres. We also show that for encapsulated rat pancreatic islet cells transplanted into streptozotocin-treated diabetic C57BL/6 mice, islets prepared in 1.5-mm alginate capsules were able to restore blood-glucose control for up to 180 days, a period more than five times longer than for transplanted grafts encapsulated within conventionally sized 0.5-mm alginate capsules. Our findings suggest that the in vivo biocompatibility of biomedical devices can be significantly improved simply by tuning their spherical dimensions.

  20. Radiation responses of human bladder cancer assessed in vitro or as xenografts in immune-deprived mice

    International Nuclear Information System (INIS)

    Tannock, I.; Choo, B.; Buick, R.

    1984-01-01

    The response to radiation of cells derived from transitional cell carcinoma (TCC) of the human bladder has been studied. In vitro radiation survival curves for two established cell lines, RT-4 and MGH-U1, and for a cell line HB-10 derived recently from biopsy of a metastatic lymph node were characterized by values of D 0 and anti n in the range of 1.1-1.5 Gy and 2-7 respectively. The oxygen enhancement ratio of HB-10 cells was 2.8. Xenografts derived from the line HB-10 were irradiated in vivo under both aerobic and hypoxic conditions and cell survival was assessed in agar. Both aerobic and hypoxic survival curves were similar to that obtained for irradiation of hypoxic HB-10 cells in culture. Another tumor line, HB-15, derived from a cystoscopic biopsy of primary TCC, was maintained by transplantation of xenografts. Regrowth curves for HB-15 xenografts after radiation doses of 10 or 20 Gy were parallel to the growth curve for untreated controls but with volume reduced by factors of about 5 and 20 respectively. Cells derived from TCC of the human bladder exhibit parameters of radiation survival similar to those of other mammalian cells, and that xenografts derived from such cells contain a high proportion of hypoxic cells

  1. Investigating the Role of the Arabidopsis Homologue of the Human G3BP in RNA Metabolism, Cellular Stress Responses and Innate Immunity

    KAUST Repository

    Abulfaraj, Aala A.

    2018-01-01

    immunity and defense immune responses. Atg3bp1 mutant lines show constitutive stomata closure, expression of a number of key defense marker genes, and accumulate salicylic acid but not jasmonic acid. Furthermore, Atg3bp1 plants exhibit enhanced resistance

  2. Heavy metal pollution disturbs immune response in wild ant populations

    International Nuclear Information System (INIS)

    Sorvari, Jouni; Rantala, Liisa M.; Rantala, Markus J.; Hakkarainen, Harri; Eeva, Tapio

    2007-01-01

    Concern about the effects of environmental contaminants on immune function in both humans and wildlife is growing and practically nothing is known about this impact on terrestrial invertebrates, even though they are known to easily accumulate pollutants. We studied the effect of industrial heavy metal contamination on immune defense of a free-living wood ant (Formica aquilonia). To find out whether ants show an adapted immune function in a polluted environment, we compared encapsulation responses between local and translocated colonies. Local colonies showed higher heavy metal levels than the translocated ones but the encapsulation response was similar between the two groups, indicating that the immune system of local ants has not adapted to high contamination level. The encapsulation response was elevated in moderate whereas suppressed in high heavy metal levels suggesting higher risk for infections in heavily polluted areas. - Heavy metal pollution affects immune function in ants

  3. Analysis of Humoral Immune Responses to Surface and Virulence-Associated Chlamydia abortus Proteins in Ovine and Human Abortions by Use of a Newly Developed Line Immunoassay.

    Science.gov (United States)

    Hagemann, Jürgen Benjamin; Simnacher, Ulrike; Longbottom, David; Livingstone, Morag; Maile, Julia; Soutschek, Erwin; Walder, Gernot; Boden, Katharina; Sachse, Konrad; Essig, Andreas

    2016-07-01

    The obligate intracellular bacterium Chlamydia abortus is the causative agent of enzootic abortion of ewes and poses a significant zoonotic risk for pregnant women. Using proteomic analysis and gene expression library screening in a previous project, we identified potential virulence factors and candidates for serodiagnosis, of which nine were scrutinized here with a strip immunoassay. We have shown that aborting sheep exhibited a strong antibody response to surface (MOMP, MIP, Pmp13G) and virulence-associated (CPAF, TARP, SINC) antigens. While the latter disappeared within 18 weeks following abortion in a majority of the animals, antibodies to surface proteins persisted beyond the duration of the study. In contrast, nonaborting experimentally infected sheep developed mainly antibodies to surface antigens (MOMP, MIP, Pmp13G), all of which did not persist. We were also able to detect antibodies to these surface antigens in C abortus-infected women who had undergone septic abortion, whereas a group of shepherds and veterinarians with occupational exposure to C abortus-infected sheep revealed only sporadic immune responses to the antigens selected. The most specific antigen for the serodiagnosis of human C abortus infections was Pmp13G, which showed no cross-reactivity with other chlamydiae infecting humans. We suggest that Pmp13G-based serodiagnosis accomplished by the detection of antibodies to virulence-associated antigens such as CPAF, TARP, and SINC may improve the laboratory diagnosis of human and animal C abortus infections. Copyright © 2016, American Society for Microbiology. All Rights Reserved.

  4. Evasion of host immune defenses by human papillomavirus.

    Science.gov (United States)

    Westrich, Joseph A; Warren, Cody J; Pyeon, Dohun

    2017-03-02

    A majority of human papillomavirus (HPV) infections are asymptomatic and self-resolving in the absence of medical interventions. Various innate and adaptive immune responses, as well as physical barriers, have been implicated in controlling early HPV infections. However, if HPV overcomes these host immune defenses and establishes persistence in basal keratinocytes, it becomes very difficult for the host to eliminate the infection. The HPV oncoproteins E5, E6, and E7 are important in regulating host immune responses. These oncoproteins dysregulate gene expression, protein-protein interactions, posttranslational modifications, and cellular trafficking of critical host immune modulators. In addition to the HPV oncoproteins, sequence variation and dinucleotide depletion in papillomavirus genomes has been suggested as an alternative strategy for evasion of host immune defenses. Since anti-HPV host immune responses are also considered to be important for antitumor immunity, immune dysregulation by HPV during virus persistence may contribute to immune suppression essential for HPV-associated cancer progression. Here, we discuss cellular pathways dysregulated by HPV that allow the virus to evade various host immune defenses. Copyright © 2016 The Authors. Published by Elsevier B.V. All rights reserved.

  5. Human IgG repertoire of malaria antigen-immunized human immune system (HIS) mice.

    Science.gov (United States)

    Nogueira, Raquel Tayar; Sahi, Vincent; Huang, Jing; Tsuji, Moriya

    2017-08-01

    Humanized mouse models present an important tool for preclinical evaluation of new vaccines and therapeutics. Here we show the human variable repertoire of antibody sequences cloned from a previously described human immune system (HIS) mouse model that possesses functional human CD4+ T cells and B cells, namely HIS-CD4/B mice. We sequenced variable IgG genes from single memory B-cell and plasma-cell sorted from splenocytes or whole blood lymphocytes of HIS-CD4/B mice that were vaccinated with a human plasmodial antigen, a recombinant Plasmodium falciparum circumsporozoite protein (rPfCSP). We demonstrate that rPfCSP immunization triggers a diverse B-cell IgG repertoire composed of various human VH family genes and distinct V(D)J recombinations that constitute diverse CDR3 sequences similar to humans, although low hypermutated sequences were generated. These results demonstrate the substantial genetic diversity of responding human B cells of HIS-CD4/B mice and their capacity to mount human IgG class-switched antibody response upon vaccination. Copyright © 2017 European Federation of Immunological Societies. Published by Elsevier B.V. All rights reserved.

  6. Cholinergic Modulation of Type 2 Immune Responses

    Directory of Open Access Journals (Sweden)

    Goele Bosmans

    2017-12-01

    Full Text Available In recent years, the bidirectional relationship between the nervous and immune system has become increasingly clear, and its role in both homeostasis and inflammation has been well documented over the years. Since the introduction of the cholinergic anti-inflammatory pathway, there has been an increased interest in parasympathetic regulation of both innate and adaptive immune responses, including T helper 2 responses. Increasing evidence has been emerging suggesting a role for the parasympathetic nervous system in the pathophysiology of allergic diseases, including allergic rhinitis, asthma, food allergy, and atopic dermatitis. In this review, we will highlight the role of cholinergic modulation by both nicotinic and muscarinic receptors in several key aspects of the allergic inflammatory response, including barrier function, innate and adaptive immune responses, and effector cells responses. A better understanding of these cholinergic processes mediating key aspects of type 2 immune disorders might lead to novel therapeutic approaches to treat allergic diseases.

  7. Immune Modulation in Normal Human Peripheral Blood Mononuclear Cells (PBMCs) (Lymphocytes) in Response to Benzofuran-2-Carboxylic Acid Derivative KMEG during Spaceflight

    Science.gov (United States)

    Okoro, Elvis; Mann, Vivek; Ellis, Ivory; Mansoor, Elvedina; Olamigoke, Loretta; Marriott, Karla Sue; Denkins, Pamela; Williams, Willie; Sundaresan, Alamelu

    2017-08-01

    Microgravity and radiation exposure during space flight have been widely reported to induce the suppression of normal immune system function, and increase the risk of cancer development in humans. These findings pose a serious risk to manned space missions. Interestingly, recent studies have shown that benzofuran-2-carboxylic acid derivatives can inhibit the progression of some of these devastating effects on earth and in modeled microgravity. However, these studies had not assessed the impacts of benzofuran-2- carboxylic acid and its derivatives on global gene expression under spaceflight conditions. In this study, the ability of a specific benzofuran-2-carboxylic acid derivative (KMEG) to confer protection from radiation and restore normal immune function was investigated following exposure to space flight conditions on the ISS. Normal human peripheral blood mononuclear cells (lymphocytes) treated with 10 µ g/ml of KMEG together with untreated control samples were flown on Nanoracks hardware on Spacex-3 flight. The Samples were returned one month later and gene expression was analyzed. A 1g-ground control experiment was performed in parallel at the Kennedy spaceflight center. The first overall subtractive unrestricted analysis revealed 78 genes, which were differentially expressed in space flight KMEG, untreated lymphocytes as compared to the corresponding ground controls. However, in KMEG-treated space flight lymphocytes, there was an increased expression of a group of genes that mediate increased transcription, translation and innate immune system mediating functions of lymphocytes as compared to KMEG-untreated samples. Analysis of genes related to T cell proliferation in spaceflight KMEG-treated lymphocytes compared to 1g-ground KMEG- treated lymphocytes revealed six T cell proliferation and signaling genes to be significantly upregulated (p trafficking, promote early response, mediating C-myc related proliferation, promote antiapoptotic activity and protects

  8. An alphavirus vector overcomes the presence of neutralizing antibodies and elevated numbers of Tregs to induce immune responses in humans with advanced cancer.

    Science.gov (United States)

    Morse, Michael A; Hobeika, Amy C; Osada, Takuya; Berglund, Peter; Hubby, Bolyn; Negri, Sarah; Niedzwiecki, Donna; Devi, Gayathri R; Burnett, Bruce K; Clay, Timothy M; Smith, Jonathan; Lyerly, H Kim

    2010-09-01

    Therapeutic anticancer vaccines are designed to boost patients' immune responses to tumors. One approach is to use a viral vector to deliver antigen to in situ DCs, which then activate tumor-specific T cell and antibody responses. However, vector-specific neutralizing antibodies and suppressive cell populations such as Tregs remain great challenges to the efficacy of this approach. We report here that an alphavirus vector, packaged in virus-like replicon particles (VRP) and capable of efficiently infecting DCs, could be repeatedly administered to patients with metastatic cancer expressing the tumor antigen carcinoembryonic antigen (CEA) and that it overcame high titers of neutralizing antibodies and elevated Treg levels to induce clinically relevant CEA-specific T cell and antibody responses. The CEA-specific antibodies mediated antibody-dependent cellular cytotoxicity against tumor cells from human colorectal cancer metastases. In addition, patients with CEA-specific T cell responses exhibited longer overall survival. These data suggest that VRP-based vectors can overcome the presence of neutralizing antibodies to break tolerance to self antigen and may be clinically useful for immunotherapy in the setting of tumor-induced immunosuppression.

  9. Innate immune functions of microglia isolated from human glioma patients

    Directory of Open Access Journals (Sweden)

    Grimm Elizabeth

    2006-03-01

    Full Text Available Abstract Background Innate immunity is considered the first line of host defense and microglia presumably play a critical role in mediating potent innate immune responses to traumatic and infectious challenges in the human brain. Fundamental impairments of the adaptive immune system in glioma patients have been investigated; however, it is unknown whether microglia are capable of innate immunity and subsequent adaptive anti-tumor immune responses within the immunosuppressive tumor micro-environment of human glioma patients. We therefore undertook a novel characterization of the innate immune phenotype and function of freshly isolated human glioma-infiltrating microglia (GIM. Methods GIM were isolated by sequential Percoll purification from patient tumors immediately after surgical resection. Flow cytometry, phagocytosis and tumor cytotoxicity assays were used to analyze the phenotype and function of these cells. Results GIM expressed significant levels of Toll-like receptors (TLRs, however they do not secrete any of the cytokines (IL-1β, IL-6, TNF-α critical in developing effective innate immune responses. Similar to innate macrophage functions, GIM can mediate phagocytosis and non-MHC restricted cytotoxicity. However, they were statistically less able to mediate tumor cytotoxicity compared to microglia isolated from normal brain. In addition, the expression of Fas ligand (FasL was low to absent, indicating that apoptosis of the incoming lymphocyte population may not be a predominant mode of immunosuppression by microglia. Conclusion We show for the first time that despite the immunosuppressive environment of human gliomas, GIM are capable of innate immune responses such as phagocytosis, cytotoxicity and TLR expression but yet are not competent in secreting key cytokines. Further understanding of these innate immune functions could play a critical role in understanding and developing effective immunotherapies to malignant human gliomas.

  10. Humoral immune response to AAV

    Directory of Open Access Journals (Sweden)

    Roberto eCalcedo

    2013-10-01

    Full Text Available Adeno-associated virus (AAV is a member of the family parvoviridae that has been widely used as a vector for gene therapy because of its safety profile, its ability to transduce both dividing and non-dividing cells, and its low immunogenicity. AAV has been detected in many different tissues of several animal species but has not been associated with any disease. As a result of natural infections, antibodies to AAV can be found in many animals including humans. It has been shown that pre-existing AAV antibodies can modulate the safety and efficacy of AAV vector-mediated gene therapy by blocking vector transduction or by redirecting distribution of AAV vectors to tissues other than the target organ. This review will summarize antibody responses against natural AAV infections, as well as AAV gene therapy vectors and their impact in the clinical development of AAV vectors for gene therapy. We will also review and discuss the various methods used for AAV antibody detection and strategies to overcome neutralizing antibodies in AAV-mediated gene therapy.

  11. Filaggrin silencing by shRNA directly impairs the skin barrier function of normal human epidermal keratinocytes and then induces an immune response

    Energy Technology Data Exchange (ETDEWEB)

    Dang, N.N. [Department of Dermatology, Jinan Central Hospital Affiliated to Shandong University, Jinan, Shandong Province (China); College of Life Science, Shandong Normal University, Jinan, Shandong Province (China); Pang, S.G. [Department of Endocrinology, Jinan Central Hospital Affiliated to Shandong University, Jinan, Shandong Province (China); Song, H.Y. [Department of Dermatology, Jinan Central Hospital Affiliated to Shandong University, Jinan, Shandong Province (China); An, L.G. [College of Life Science, Shandong Normal University, Jinan, Shandong Province (China); Ma, X.L. [Central Laboratory, Jinan Central Hospital Affiliated to Shandong University, Jinan, Shandong Province (China)

    2014-11-14

    The objective of this study was to investigate whether a single defect in skin barrier function simulated by filaggrin silencing could induce Th2-predominant inflammation. Filaggrin gene expression was silenced in cultured normal human epidermal keratinocytes (NHEKs) using small hairpin RNA (shRNA, GTTGGCTCAAGCATATTATTT). The efficacy of silencing was confirmed by polymerase chain reaction (PCR) and Western blotting. Filaggrin-silenced cells (LV group), shRNA control cells (NC group), and noninfected cells (Blank group) were evaluated. The expression of cornified cell envelope-related proteins, including cytokeratin (CK)-5, -10, -14, loricrin, involucrin, and transglutaminase (TGM)-1, was detected by Western blotting. Interleukins (IL)-2, IL-4, IL-5, IL-12p70, IL-13, and interferon-gamma (IFN-γ) were detected by enzyme-linked immunosorbent assay (ELISA). After filaggrin was successfully silenced by shRNA, the expressions of CK-5, -10, -14, involucrin, and TGM-1 in NHEKs were significantly downregulated compared to the Blank and NC groups (P<0.05 or P<0.01); only loricrin expression was markedly upregulated (P<0.01). Filaggrin silencing also resulted in significant increases of IL-2, IL-4, IL-5, and IL-13 (P<0.05 or P<0.01), and significant decreases of IL-12p70 and IFN-γ (P<0.01) compared with cells in the Blank and NC groups. Filaggrin silencing impaired normal skin barrier function mainly by targeting the cornified cell envelope. The immune response after filaggrin silencing was characterized by Th2 cells, mainly because of the inhibition of IFN-γ expression. Lack of filaggrin may directly impair skin barrier function and then further induce the immune response.

  12. Human intestinal dendritic cells as controllers of mucosal immunity

    Directory of Open Access Journals (Sweden)

    David Bernardo

    2013-06-01

    Full Text Available Dendritic cells are the most potent, professional antigen-presenting cells in the body; following antigen presentation they control the type (proinflammatory/regulatory of immune response that will take place, as well as its location. Given their high plasticity and maturation ability in response to local danger signals derived from innate immunity, dendritic cells are key actors in the connection between innate immunity and adaptive immunity responses. In the gut dendritic cells control immune tolerance mechanisms against food and/or commensal flora antigens, and are also capable of initiating an active immune response in the presence of invading pathogens. Dendritic cells are thus highly efficient in controlling the delicate balance between tolerance and immunity in an environment so rich in antigens as the gut, and any factor involving these cells may impact their function, ultimately leading to the development of bowel conditions such as celiac disease or inflammatory bowel disease. In this review we shall summarize our understanding of human intestinal dendritic cells, their ability to express and induce migration markers, the various environmental factors modulating their properties, their subsets in the gut, and the problems entailed by their study, including identification strategies, differences between humans and murine models, and phenotypical variations along the gastrointestinal tract.

  13. Characterization of host immune responses in Ebola virus infections.

    Science.gov (United States)

    Wong, Gary; Kobinger, Gary P; Qiu, Xiangguo

    2014-06-01

    Ebola causes highly lethal hemorrhagic fever in humans with no licensed countermeasures. Its virulence can be attributed to several immunoevasion mechanisms: an early inhibition of innate immunity started by the downregulation of type I interferon, epitope masking and subversion of the adaptive humoural immunity by secreting a truncated form of the viral glycoprotein. Deficiencies in specific and non-specific antiviral responses result in unrestricted viral replication and dissemination in the host, causing death typically within 10 days after the appearance of symptoms. This review summarizes the host immune response to Ebola infection, and highlights the short- and long-term immune responses crucial for protection, which holds implications for the design of future vaccines and therapeutics.

  14. Escaping deleterious immune response in their hosts: lessons from trypanosomatids

    Directory of Open Access Journals (Sweden)

    Anne eGeiger

    2016-05-01

    Full Text Available The Trypanosomatidae family includes the genera Trypanosoma and Leishmania, protozoan parasites displaying complex digenetic life cycles requiring a vertebrate host and an insect vector. Trypanosoma brucei gambiense, T. cruzi and Leishmania spp are important human pathogens causing Human African Trypanosomiasis (HAT or Sleeping Sickness, Chagas’ disease, and various clinical forms of Leishmaniasis, respectively. They are transmitted to humans by tsetse flies, triatomine bugs or sandflies and affect millions of people worldwide.In humans, extracellular African trypanosomes (T. brucei evade the hosts’ immune defences, allowing their transmission to the next host, via the tsetse vector. By contrast, T. cruzi and Leishmania sp. have developed a complex intracellular lifestyle, also preventing several mechanisms to circumvent the host’s immune response.This review seeks to set out the immune evasion strategies developed by the different trypanosomatids resulting from parasite-host interactions and, will focus on: clinical and epidemiological importance of diseases; life cycles: parasites-hosts-vectors; innate immunity: key steps for trypanosomatids in invading hosts; deregulation of antigen presenting cells; disruption of efficient specific immunity; and the immune responses used for parasite proliferation.

  15. Escaping Deleterious Immune Response in Their Hosts: Lessons from Trypanosomatids

    Science.gov (United States)

    Geiger, Anne; Bossard, Géraldine; Sereno, Denis; Pissarra, Joana; Lemesre, Jean-Loup; Vincendeau, Philippe; Holzmuller, Philippe

    2016-01-01

    The Trypanosomatidae family includes the genera Trypanosoma and Leishmania, protozoan parasites displaying complex digenetic life cycles requiring a vertebrate host and an insect vector. Trypanosoma brucei gambiense, Trypanosoma cruzi, and Leishmania spp. are important human pathogens causing human African trypanosomiasis (HAT or sleeping sickness), Chagas’ disease, and various clinical forms of Leishmaniasis, respectively. They are transmitted to humans by tsetse flies, triatomine bugs, or sandflies, and affect millions of people worldwide. In humans, extracellular African trypanosomes (T. brucei) evade the hosts’ immune defenses, allowing their transmission to the next host, via the tsetse vector. By contrast, T. cruzi and Leishmania sp. have developed a complex intracellular lifestyle, also preventing several mechanisms to circumvent the host’s immune response. This review seeks to set out the immune evasion strategies developed by the different trypanosomatids resulting from parasite–host interactions and will focus on: clinical and epidemiological importance of diseases; life cycles: parasites–hosts–vectors; innate immunity: key steps for trypanosomatids in invading hosts; deregulation of antigen-presenting cells; disruption of efficient specific immunity; and the immune responses used for parasite proliferation. PMID:27303406

  16. Human and Autologous Adipose-derived Stromal Cells Increase Flap Survival in Rats Independently of Host Immune Response

    DEFF Research Database (Denmark)

    Toyserkani, Navid Mohamadpour; Jensen, Charlotte Harken; Andersen, Ditte Caroline

    2018-01-01

    evaluated after 7 days. RESULTS: The mean survival rates for SVF treatment regardless of human or autologous origin were significantly increased as compared with the control group. Adipose stem/stromal cell and SVF lysate injection did not increase flap survival. Vessel density was increased for human...... injections lead to increased vessel density, but it did not necessarily lead to increased flap survival. Further research should elaborate which molecular events make SVF treatment more efficacious than ASC....

  17. Enhancement of human adaptive immune responses by administration of a high-molecular-weight polysaccharide extract from the cyanobacterium Arthrospira platensis

    DEFF Research Database (Denmark)

    Pedersen, Morten Løbner; Walsted, Anette; Larsen, Rune

    2008-01-01

    The effect of consumption of Immulina, a high-molecular-weight polysaccharide extract from the cyanobacterium Arthrospira platensis, on adaptive immune responses was investigated by evaluation of changes in leukocyte responsiveness to two foreign recall antigens, Candida albicans (CA) and tetanus...

  18. The Impact of Ultraviolet Radiation on Immune Responses (invited paper)

    International Nuclear Information System (INIS)

    Norval, M.

    2000-01-01

    In addition to its genotoxic and mutagenic effects, UV has the capacity to suppress immune responses. The mechanism involved is complex, beginning with chromophores located in the skin which absorb UV, this leading in turn to changes in the production of a range of immune mediators locally and systemically which then induce phenotypic and functional alterations in antigen presentation. The cascade ends with the promotion of a subset of T-cells downregulating cell-mediated immunity. The possible consequences of this immunomodulation for the control of tumours and infectious diseases require careful evaluation from laboratory and human studies. (author)

  19. Echovirus 6 Infects Human Exocrine and Endocrine Pancreatic Cells and Induces Pro-Inflammatory Innate Immune Response

    Directory of Open Access Journals (Sweden)

    Luis Sarmiento

    2017-01-01

    Full Text Available Human enteroviruses (HEV, especially coxsackievirus serotype B (CVB and echovirus (E, have been associated with diseases of both the exocrine and endocrine pancreas, but so far evidence on HEV infection in human pancreas has been reported only in islets and ductal cells. This study aimed to investigate the capability of echovirus strains to infect human exocrine and endocrine pancreatic cells. Infection of explanted human islets and exocrine cells with seven field strains of E6 caused cytopathic effect, virus titer increase and production of HEV protein VP1 in both cell types. Virus particles were found in islets and acinar cells infected with E6. No cytopathic effect or infectious progeny production was observed in exocrine cells exposed to the beta cell-tropic strains of E16 and E30. Endocrine cells responded to E6, E16 and E30 by upregulating the transcription of interferon-induced with helicase C domain 1 (IF1H1, 2'-5'-oligoadenylate synthetase 1 (OAS1, interferon-β (IFN-β, chemokine (C–X–C motif ligand 10 (CXCL10 and chemokine (C–C motif ligand 5 (CCL5. Echovirus 6, but not E16 or E30, led to increased transcription of these genes in exocrine cells. These data demonstrate for the first time that human exocrine cells represent a target for E6 infection and suggest that certain HEV serotypes can replicate in human pancreatic exocrine cells, while the pancreatic endocrine cells are permissive to a wider range of HEV.

  20. Expression of IL-8, IL-6 and IL-1β in Tears as a Main Characteristic of the Immune Response in Human Microbial Keratitis

    Science.gov (United States)

    Santacruz, Concepcion; Linares, Marisela; Garfias, Yonathan; Loustaunau, Luisa M.; Pavon, Lenin; Perez-Tapia, Sonia Mayra; Jimenez-Martinez, Maria C.

    2015-01-01

    Corneal infections are frequent and potentially vision-threatening diseases, and despite the significance of the immunological response in animal models of microbial keratitis (MK), it remains unclear in humans. The aim of this study was to describe the cytokine profile of tears in patients with MK. Characteristics of ocular lesions such as size of the epithelial defect, stromal infiltration, and hypopyon were analyzed. Immunological evaluation included determination of interleukine (IL)-1β, IL-6, IL-8, IL-10, IL-12 and tumor necrosis factor (TNF)-α in tear samples obtained from infected eyes of 28 patients with MK and compared with their contralateral non-infected eyes. Additionally, frequency of CD4+, CD8+, CD19+ and CD3−CD56+ cells was also determined in peripheral blood mononuclear cells in patients with MK, and compared with 48 healthy controls. Non-significant differences were observed in the size of the epithelial defect, stromal infiltration, and hypopyon. Nevertheless, we found an immunological profile apparently related to MK etiology. IL-8 > IL-6 in patients with bacterial keratitis; IL-8 > IL-6 > IL-1β and increased frequency of circulating CD3−CD56+ NK cells in patients with gram-negative keratitis; and IL-8 = IL-6 > IL-1β in patients with fungal keratitis. Characterization of tear cytokines from patients with MK could aid our understanding of the immune pathophysiological mechanisms underlying corneal damage in humans. PMID:25741769

  1. Genomic Programming of Human Neonatal Dendritic Cells in Congenital Systemic and In Vitro Cytomegalovirus Infection Reveal Plastic and Robust Immune Pathway Biology Responses

    Directory of Open Access Journals (Sweden)

    Widad Dantoft

    2017-09-01

    Full Text Available Neonates and especially premature infants are highly susceptible to infection but still can have a remarkable resilience that is poorly understood. The view that neonates have an incomplete or deficient immune system is changing. Human neonatal studies are challenging, and elucidating host protective responses and underlying cognate pathway biology, in the context of viral infection in early life, remains to be fully explored. In both resource rich and poor settings, human cytomegalovirus (HCMV is the most common cause of congenital infection. By using unbiased systems analyses of transcriptomic resources for HCMV neonatal infection, we find the systemic response of a preterm congenital HCMV infection, involves a focused IFN regulatory response associated with dendritic cells. Further analysis of transcriptional-programming of neonatal dendritic cells in response to HCMV infection in culture revealed an early dominant IFN-chemokine regulatory subnetworks, and at later times the plasticity of pathways implicated in cell-cycle control and lipid metabolism. Further, we identify previously unknown suppressed networks associated with infection, including a select group of GPCRs. Functional siRNA viral growth screen targeting 516-GPCRs and subsequent validation identified novel GPCR-dependent antiviral (ADORA1 and proviral (GPR146, RGS16, PTAFR, SCTR, GPR84, GPR85, NMUR2, FZ10, RDS, CCL17, and SORT1 roles. By contrast a gene family cluster of protocadherins is significantly differentially induced in neonatal cells, suggestive of possible immunomodulatory roles. Unexpectedly, programming responses of adult and neonatal dendritic cells, upon HCMV infection, demonstrated comparable quantitative and qualitative responses showing that functionally, neonatal dendritic cell are not overly compromised. However, a delay in responses of neonatal cells for IFN subnetworks in comparison with adult-derived cells are notable, suggestive of subtle plasticity

  2. Genomic Programming of Human Neonatal Dendritic Cells in Congenital Systemic and In Vitro Cytomegalovirus Infection Reveal Plastic and Robust Immune Pathway Biology Responses.

    Science.gov (United States)

    Dantoft, Widad; Martínez-Vicente, Pablo; Jafali, James; Pérez-Martínez, Lara; Martin, Kim; Kotzamanis, Konstantinos; Craigon, Marie; Auer, Manfred; Young, Neil T; Walsh, Paul; Marchant, Arnaud; Angulo, Ana; Forster, Thorsten; Ghazal, Peter

    2017-01-01

    Neonates and especially premature infants are highly susceptible to infection but still can have a remarkable resilience that is poorly understood. The view that neonates have an incomplete or deficient immune system is changing. Human neonatal studies are challenging, and elucidating host protective responses and underlying cognate pathway biology, in the context of viral infection in early life, remains to be fully explored. In both resource rich and poor settings, human cytomegalovirus (HCMV) is the most common cause of congenital infection. By using unbiased systems analyses of transcriptomic resources for HCMV neonatal infection, we find the systemic response of a preterm congenital HCMV infection, involves a focused IFN regulatory response associated with dendritic cells. Further analysis of transcriptional-programming of neonatal dendritic cells in response to HCMV infection in culture revealed an early dominant IFN-chemokine regulatory subnetworks, and at later times the plasticity of pathways implicated in cell-cycle control and lipid metabolism. Further, we identify previously unknown suppressed networks associated with infection, including a select group of GPCRs. Functional siRNA viral growth screen targeting 516-GPCRs and subsequent validation identified novel GPCR-dependent antiviral (ADORA1) and proviral (GPR146, RGS16, PTAFR, SCTR, GPR84, GPR85, NMUR2, FZ10, RDS, CCL17, and SORT1) roles. By contrast a gene family cluster of protocadherins is significantly differentially induced in neonatal cells, suggestive of possible immunomodulatory roles. Unexpectedly, programming responses of adult and neonatal dendritic cells, upon HCMV infection, demonstrated comparable quantitative and qualitative responses showing that functionally, neonatal dendritic cell are not overly compromised. However, a delay in responses of neonatal cells for IFN subnetworks in comparison with adult-derived cells are notable, suggestive of subtle plasticity differences. These

  3. Association of HLA-DR3 with human immune response to Lol p I and Lol p II allergens in allergic subjects.

    Science.gov (United States)

    Freidhoff, L R; Ehrlich-Kautzky, E; Meyers, D A; Ansari, A A; Bias, W B; Marsh, D G

    1988-04-01

    Associations between HLA type and IgE or IgG antibody (Ab) responses to two well-characterized, antigenetically non-crossreactive components of Lolium perenne (rye grass) pollen extract, Lol p I (Rye I) and Lol p II (Rye II) were studied in two groups of skin-test positive (ST+) Caucasoid adults. By both nonparametric and parametric statistical methods, significant associations were found between Ab responses to both Lol I and Lol II and the possession of HLA-DR3. In view of the well-known associations of both DR3 and B8 (which are in linkage disequilibrium) with many autoimmune diseases, differences in anti-Lol I and anti-Lol II mean log[Ab] levels between B8+, DR3- vs B8-, DR3- subjects and B8+, DR3+ vs B8-, DR3+ subjects were investigated. No differences were found. Our data, along with recent RFLP and DNA sequence studies, suggest that an Ia molecule involved in immune recognition of a similar major Ia recognition site of both the Lol molecules may consist of a DR3 alpha-beta I pair. Abbreviations used: Ab: Antibody. HLA: Human leukocyte antigen. Lol p I, Lol I: Group I allergen from Lolium perenne pollen (Rye I). Lol p II, Lol II: Group II allergen from Lolium perenne pollen (Rye II). Mr: Relative molecular mass. Rx: Immunotherapy with grass pollen extracts. ST: Skin test.

  4. Influence of prevaccination immunity on the human B-lymphocyte response to a Haemophilus influenzae type b conjugate vaccine

    DEFF Research Database (Denmark)

    Barington, T; Kristensen, K; Henrichsen, J

    1991-01-01

    of Haemophilus influenzae type b capsular polysaccharide (PRP) and diphtheria toxoid (DT), and the response was related to the prevaccination levels of PRP and DT antibodies. Positive correlations were found between increases in plasma PRP (median, 32.0 micrograms/ml) and DT (1.14 IU/ml) antibodies and numbers...

  5. Balancing immune protection and immune pathology by CD8+ T cell responses to influenza infection

    Directory of Open Access Journals (Sweden)

    Susu eDuan

    2016-02-01

    Full Text Available Influenza A virus (IAV is a significant human pathogen causing annual epidemics and periodic pandemics. CD8+ cytotoxic T lymphocyte (CTL-mediated immunity contributes to clearance of virus-infected cells; CTL immunity targeting the conserved internal proteins of IAVs is a key protection mechanism when neutralizing antibodies are absent during heterosubtypic IAV infection. However, CTL infiltration into the airways, their cytotoxicity, and the effects of produced pro-inflammatory cytokines can cause severe lung tissue injury, thereby contributing to immunopathology. Studies have discovered complicated and exquisite stimulatory and inhibitory mechanisms that regulate CTL magnitude and effector activities during IAV infection. Here, we review the state of knowledge on the roles of IAV-specific CTLs in immune protection and immunopathology during IAV infection in animal models, highlighting the key findings of various requirements and constraints regulating the balance of immune protection and pathology involved in CTL immunity. We also discuss the evidence of cross-reactive CTL immunity as a positive correlate of cross-subtype protection during secondary IAV infection in both animal and human studies. We argue that the effects of CTL immunity on protection and immunopathology depend on multiple layers of host and viral factors, including complex host mechanisms to regulate CTL magnitude and effector activity, the pathogenic nature of the IAV, the innate response milieu, and the host historical immune context of influenza infection. Future efforts are needed to further understand these key host and viral factors, especially to differentiate those that constrain optimally effective CTL anti-viral immunity from those necessary to restrain CTL-mediated nonspecific immunopathology in the various contexts of IAV infection, in order to develop better vaccination and therapeutic strategies for modifying protective CTL immunity.

  6. Randomized controlled trial of oral omega-3 PUFA in solar-simulated radiation-induced suppression of human cutaneous immune responses1-3

    OpenAIRE

    Pilkington, Suzanne M.; Massey, Karen A.; Bennett, Susan P.; Al-Aasswad, Naser M I; Roshdy, Khaled; Gibbs, Neil K.; Friedmann, Peter S.; Nicolaou, Anna; Rhodes, Lesley E.

    2013-01-01

    BACKGROUND: Skin cancer is a major public health concern, and the majority of cases are caused by solar ultraviolet radiation (UVR) exposure, which suppresses skin immunity. Omega-3 (n-3) PUFAs protect against photoimmunosuppression and skin cancer in mice, but the impact in humans is unknown.OBJECTIVES: We hypothesized that EPA-rich n-3 PUFA would abrogate photoimmunosuppression in humans. Therefore, a nutritional study was performed to assess the effect on UVR suppression of cutaneous cell-...

  7. Trachoma: protective and pathogenic ocular immune responses to Chlamydia trachomatis.

    Directory of Open Access Journals (Sweden)

    Victor H Hu

    Full Text Available Trachoma, caused by Chlamydia trachomatis (Ct, is the leading infectious blinding disease worldwide. Chronic conjunctival inflammation develops in childhood and leads to eyelid scarring and blindness in adulthood. The immune response to Ct provides only partial protection against re-infection, which can be frequent. Moreover, the immune response is central to the development of scarring pathology, leading to loss of vision. Here we review the current literature on both protective and pathological immune responses in trachoma. The resolution of Ct infection in animal models is IFNγ-dependent, involving Th1 cells, but whether this is the case in human ocular infection still needs to be confirmed. An increasing number of studies indicate that innate immune responses arising from the epithelium and other innate immune cells, along with changes in matrix metalloproteinase activity, are important in the development of tissue damage and scarring. Current trachoma control measures, which are centred on repeated mass antibiotic treatment of populations, are logistically challenging and have the potential to drive antimicrobial resistance. A trachoma vaccine would offer significant advantages. However, limited understanding of the mechanisms of both protective immunity and immunopathology to Ct remain barriers to vaccine development.

  8. Pathogen recognition in the innate immune response.

    Science.gov (United States)

    Kumar, Himanshu; Kawai, Taro; Akira, Shizuo

    2009-04-28

    Immunity against microbial pathogens primarily depends on the recognition of pathogen components by innate receptors expressed on immune and non-immune cells. Innate receptors are evolutionarily conserved germ-line-encoded proteins and include TLRs (Toll-like receptors), RLRs [RIG-I (retinoic acid-inducible gene-I)-like receptors] and NLRs (Nod-like receptors). These receptors recognize pathogens or pathogen-derived products in different cellular compartments, such as the plasma membrane, the endosomes or the cytoplasm, and induce the expression of cytokines, chemokines and co-stimulatory molecules to eliminate pathogens and instruct pathogen-specific adaptive immune responses. In the present review, we will discuss the recent progress in the study of pathogen recognition by TLRs, RLRs and NLRs and their signalling pathways.

  9. Humoral immune-response against human cytomegalovirus (hcmv)-specific proteins after hcmv infection in lung transplantation as detected with recombinant and naturally-occurring proteins

    NARCIS (Netherlands)

    van Zanten, J; Harmsen, M. C.; van der Giessen, M.; van der Bij, W; Prop, J.; de Leij, L; The, T. Hauw

    The humoral immune response to four intracellularly located cytomegalovirus (CMV) proteins was studied in 15 lung transplant recipients experiencing active CMV infections. Five patients had primary infections, and 10 had secondary infections. Antibodies of the immunoglobulin M (IgM) and IgG classes

  10. Probiotics, antibiotics and the immune responses to vaccines.

    Science.gov (United States)

    Praharaj, Ira; John, Sushil M; Bandyopadhyay, Rini; Kang, Gagandeep

    2015-06-19

    Orally delivered vaccines have been shown to perform poorly in developing countries. There are marked differences in the structure and the luminal environment of the gut in developing countries resulting in changes in immune and barrier function. Recent studies using newly developed technology and analytic methods have made it increasingly clear that the intestinal microbiota activate a multitude of pathways that control innate and adaptive immunity in the gut. Several hypotheses have been proposed for the underperformance of oral vaccines in developing countries, and modulation of the intestinal microbiota is now being tested in human clinical trials. Supplementation with specific strains of probiotics has been shown to have modulatory effects on intestinal and systemic immune responses in animal models and forms the basis for human studies with vaccines. However, most studies published so far that have evaluated the immune response to vaccines in children and adults have been small and results have varied by age, antigen, type of antibody response and probiotic strain. Use of anthelminthic drugs in children has been shown to possibly increase immunogenicity following oral cholera vaccination, lending further support to the rationale for modulation of the immune response to oral vaccination through the intestinal microbiome. © 2015 The Author(s) Published by the Royal Society. All rights reserved.

  11. Effect of short-term intralipid infusion on the immune response during low-dose endotoxemia in humans

    DEFF Research Database (Denmark)

    Krogh-Madsen, R.; Plomgaard, P.; Åkerström, Thorbjörn

    2008-01-01

    on the inflammatory response to a low dose of endotoxin. Fourteen healthy male volunteers underwent the following two trials in a randomized crossover design: 1) continuous infusion of 20% Intralipid [0.7 ml.kg(-1).h(-1) (1.54 g/kg)] for 11 h, and 2) infusion of isotonic saline for 11 h (control). In each trial......, heparin was given to activate lipoprotein lipase, and an intravenous bolus of endotoxin (0.1 ng/kg) was given after 6 h of Intralipid/saline infusion. Blood samples and muscle and fat biopsies were obtained before the Intralipid/saline infusion and before as well as after infusion of an endotoxin bolus....... Plasma levels of FFA, triglycerides, and glycerol were markedly increased during the Intralipid infusion. Endotoxin exposure induced an increase in plasma levels of TNF-alpha, IL-6, and neutrophils and further stimulated gene expression of TNF-alpha and IL-6 in both skeletal muscle and adipose tissue...

  12. The immune response against Candida spp. and Sporothrix schenckii.

    Science.gov (United States)

    Martínez-Álvarez, José A; Pérez-García, Luis A; Flores-Carreón, Arturo; Mora-Montes, Héctor M

    2014-01-01

    Candida albicans is the main causative agent of systemic candidiasis, a condition with high mortality rates. The study of the interaction between C. albicans and immune system components has been thoroughly studied and nowadays there is a model for the anti-C. albicans immune response; however, little is known about the sensing of other pathogenic species of the Candida genus. Sporothrix schenckii is the causative agent of sporotrichosis, a subcutaneous mycosis, and thus far there is limited information about its interaction with the immune system. In this paper, we review the most recent information about the immune sensing of species from genus Candida and S. schenckii. Thoroughly searches in scientific journal databases were performed, looking for papers addressing either Candida- or Sporothrix-immune system interactions. There is a significant advance in the knowledge of non-C. albicans species of Candida and Sporothrix immune sensing; however, there are still relevant points to address, such as the specific contribution of pathogen-associated molecular patterns (PAMPs) for sensing by different immune cells and the immune receptors involved in such interactions. This manuscript is part of the series of works presented at the "V International Workshop: Molecular genetic approaches to the study of human pathogenic fungi" (Oaxaca, Mexico, 2012). Copyright © 2013 Revista Iberoamericana de Micología. Published by Elsevier Espana. All rights reserved.

  13. The Mycoplasma hominis P120 membrane protein contains a 216 amino acid hypervariable domain that is recognized by the human humoral immune response

    DEFF Research Database (Denmark)

    Nyvold, Charlotte Guldborg; Birkelund, Svend; Christiansen, Gunna

    1997-01-01

    In the antigenically heterogeneous species Mycoplasma hominis a monoclonal antibody, mAb 26.7D, was previously found to recognize a 120 kDa polypeptide from M. hominis 7488. This antibody did not react with the type strain PG21. The homologous gene from M. hominis PG21 was cloned and sequenced an...... response. Such a variable domain may be important in evasion of the host's immune response, and thus aid survival of the micro-organism....

  14. Effects of ultraviolet radiation on the immune system in humans

    International Nuclear Information System (INIS)

    Morison, W.L.

    1989-01-01

    In experimental animals, exposure to UV-B radiation produces selective alterations of immune function which are mainly in the form of suppression of normal immune responses. This immune suppression is important in the development of nonmelanoma skin cancer, may influence the development and course of infectious disease and possibly protects against autoimmune reactions. The evidence that this form of immune suppression occurs in humans is less compelling and very incomplete. The wavelengths of radiation most affected by a depletion of the stratospheric ozone layer are those known to be most immunosuppressive in animals and it is likely that such depletion will increase any suppressive effect of sunlight on immunity in humans. In addition to establishing whether or not UV-B radiation can cause suppression of immune function in humans, studies are required to determine if melanin can provide protection against such suppression, the role of this suppression in the pathogenesis of skin cancer, the development of infectious disease and vaccine effectiveness, and the capacity for humans to develop adaptive, protective mechanisms which may limit damage from continued exposure to UV-B radiation. (author)

  15. Stress proteins and the immune response.

    Science.gov (United States)

    Moseley, P

    2000-07-25

    The heat shock or stress response is one of the most highly conserved adaptive responses in nature. In single cell organisms, the stress response confers tolerance to a variety of stresses including hyperthermia, hyperoxia, hypoxia, and other perturbations, which alter protein synthesis. This tolerance phenomenon is also extremely important in the multicellular organism, resulting in not only thermal tolerance, but also resistance to stresses of the whole organism such as ischemia-reperfusion injury. Moreover, recent data indicates that these stress proteins have the ability to modulate the cellular immune response. Although the terms heat shock proteins (HSPs) and stress proteins are often used interchangeably, the term stress proteins includes the HSPs, the glucose-regulated proteins (GRPs) and ubiquitin. The stress proteins may be grouped by molecular weight ranging from the large 110 kDa HSP110 to ubiquitin at 8 kDa. These proteins serve as cellular chaperones, participating in protein synthesis and transport through the various cellular compartments. Because these proteins have unique cellular localizations, the chaperone function of the stress proteins often involves a transfer of peptides between stress proteins as the peptide is moved between cellular compartments. For example, HSP70 is a cytosolic and nuclear chaperone, which is critical for the transfer of cellular peptides in the mitochondrion through a hand-off that involves mitochondrial HSP60 at the inner mitochondrial membrane. Similarly, cytosolic proteins are transferred from HSP70 to gp96 as they move into the endoplasmic reticulum. The central role of the stress proteins in the transfer of peptides through the cell may be responsible for the recently recognized importance of the stress proteins in the modulation of the immune system [Feder, M.E., Hofmann, G.E., 1999. Heat-shock proteins, molecular chaperones, and the stress response: evolutionary and ecological physiology. Annu. Rev. Physiol. 61

  16. Human dendritic cell DC-SIGN and TLR-2 mediate complementary immune regulatory activities in response to Lactobacillus rhamnosus JB-1.

    Directory of Open Access Journals (Sweden)

    Patrycja Konieczna

    Full Text Available The microbiota is required for optimal host development and ongoing immune homeostasis. Lactobacilli are common inhabitants of the mammalian large intestine and immunoregulatory effects have been described for certain, but not all, strains. The mechanisms underpinning these protective effects are beginning to be elucidated. One such protective organism is Lactobacillus rhamnosus JB-1 (Lb. rhamnosus JB-1. Lb. murinus has no such anti-inflammatory protective effects and was used as a comparator organism. Human monocyte-derived dendritic cells (MDDCs were co-incubated with bacteria and analysed over time for bacterial adhesion and intracellular processing, costimulatory molecule expression, cytokine secretion and induction of lymphocyte polarization. Neutralising antibodies were utilized to identify the responsible MDDC receptors. Lb. rhamnosus JB-1 adhered to MDDCs, but internalization and intracellular processing was significantly delayed, compared to Lb. murinus which was rapidly internalized and processed. Lb. murinus induced CD80 and CD86 expression, accompanied by high levels of cytokine secretion, while Lb. rhamnosus JB-1 was a poor inducer of costimulatory molecule expression and cytokine secretion. Lb. rhamnosus JB-1 primed MDDCs induced Foxp3 expression in autologous lymphocytes, while Lb. murinus primed MDDCs induced Foxp3, T-bet and Ror-γt expression. DC-SIGN was required for Lb. rhamnosus JB-1 adhesion and influenced IL-12 secretion, while TLR-2 influenced IL-10 and IL-12 secretion. Here we demonstrate that the delayed kinetics of bacterial processing by MDDCs correlates with MDDC activation and stimulation of lymphocytes. Thus, inhibition or delay of intracellular processing may be a novel strategy by which certain commensals may avoid the induction of proinflammatory responses.

  17. Human Dendritic Cell DC-SIGN and TLR-2 Mediate Complementary Immune Regulatory Activities in Response to Lactobacillus rhamnosus JB-1

    Science.gov (United States)

    Konieczna, Patrycja; Schiavi, Elisa; Ziegler, Mario; Groeger, David; Healy, Selena; Grant, Ray; O’Mahony, Liam

    2015-01-01

    The microbiota is required for optimal host development and ongoing immune homeostasis. Lactobacilli are common inhabitants of the mammalian large intestine and immunoregulatory effects have been described for certain, but not all, strains. The mechanisms underpinning these protective effects are beginning to be elucidated. One such protective organism is Lactobacillus rhamnosus JB-1 (Lb. rhamnosus JB-1). Lb. murinus has no such anti-inflammatory protective effects and was used as a comparator organism. Human monocyte-derived dendritic cells (MDDCs) were co-incubated with bacteria and analysed over time for bacterial adhesion and intracellular processing, costimulatory molecule expression, cytokine secretion and induction of lymphocyte polarization. Neutralising antibodies were utilized to identify the responsible MDDC receptors. Lb. rhamnosus JB-1 adhered to MDDCs, but internalization and intracellular processing was significantly delayed, compared to Lb. murinus which was rapidly internalized and processed. Lb. murinus induced CD80 and CD86 expression, accompanied by high levels of cytokine secretion, while Lb. rhamnosus JB-1 was a poor inducer of costimulatory molecule expression and cytokine secretion. Lb. rhamnosus JB-1 primed MDDCs induced Foxp3 expression in autologous lymphocytes, while Lb. murinus primed MDDCs induced Foxp3, T-bet and Ror-γt expression. DC-SIGN was required for Lb. rhamnosus JB-1 adhesion and influenced IL-12 secretion, while TLR-2 influenced IL-10 and IL-12 secretion. Here we demonstrate that the delayed kinetics of bacterial processing by MDDCs correlates with MDDC activation and stimulation of lymphocytes. Thus, inhibition or delay of intracellular processing may be a novel strategy by which certain commensals may avoid the induction of proinflammatory responses. PMID:25816321

  18. Human dendritic cell DC-SIGN and TLR-2 mediate complementary immune regulatory activities in response to Lactobacillus rhamnosus JB-1.

    Science.gov (United States)

    Konieczna, Patrycja; Schiavi, Elisa; Ziegler, Mario; Groeger, David; Healy, Selena; Grant, Ray; O'Mahony, Liam

    2015-01-01

    The microbiota is required for optimal host development and ongoing immune homeostasis. Lactobacilli are common inhabitants of the mammalian large intestine and immunoregulatory effects have been described for certain, but not all, strains. The mechanisms underpinning these protective effects are beginning to be elucidated. One such protective organism is Lactobacillus rhamnosus JB-1 (Lb. rhamnosus JB-1). Lb. murinus has no such anti-inflammatory protective effects and was used as a comparator organism. Human monocyte-derived dendritic cells (MDDCs) were co-incubated with bacteria and analysed over time for bacterial adhesion and intracellular processing, costimulatory molecule expression, cytokine secretion and induction of lymphocyte polarization. Neutralising antibodies were utilized to identify the responsible MDDC receptors. Lb. rhamnosus JB-1 adhered to MDDCs, but internalization and intracellular processing was significantly delayed, compared to Lb. murinus which was rapidly internalized and processed. Lb. murinus induced CD80 and CD86 expression, accompanied by high levels of cytokine secretion, while Lb. rhamnosus JB-1 was a poor inducer of costimulatory molecule expression and cytokine secretion. Lb. rhamnosus JB-1 primed MDDCs induced Foxp3 expression in autologous lymphocytes, while Lb. murinus primed MDDCs induced Foxp3, T-bet and Ror-γt expression. DC-SIGN was required for Lb. rhamnosus JB-1 adhesion and influenced IL-12 secretion, while TLR-2 influenced IL-10 and IL-12 secretion. Here we demonstrate that the delayed kinetics of bacterial processing by MDDCs correlates with MDDC activation and stimulation of lymphocytes. Thus, inhibition or delay of intracellular processing may be a novel strategy by which certain commensals may avoid the induction of proinflammatory responses.

  19. Gene expression profiling of Gram-negative bacteria-induced inflammation in human whole blood: The role of complement and CD14-mediated innate immune response

    Directory of Open Access Journals (Sweden)

    Corinna Lau

    2015-09-01

    Full Text Available Non-sterile pathogen-induced sepsis and sterile inflammation like in trauma or ischemia–reperfusion injury may both coincide with the life threatening systemic inflammatory response syndrome and multi-organ failure. Consequently, there is an urgent need for specific biomarkers in order to distinguish sepsis from sterile conditions. The overall aim of this study was to uncover putative sepsis biomarkers and biomarker pathways, as well as to test the efficacy of combined inhibition of innate immunity key players complement and Toll-like receptor co-receptor CD14 as a possible therapeutic regimen for sepsis. We performed whole blood gene expression analyses using microarray in order to profile Gram-negative bacteria-induced inflammatory responses in an ex vivo human whole blood model. The experiments were performed in the presence or absence of inhibitors of complement proteins (C3 and CD88 (C5a receptor 1 and CD14, alone or in combination. In addition, we used blood from a C5-deficient donor. Anti-coagulated whole blood was challenged with heat-inactivated Escherichia coli for 2 h, total RNA was isolated and microarray analyses were performed on the Affymetrix GeneChip Gene 1.0 ST Array platform. The initial experiments were performed in duplicates using blood from two healthy donors. C5-deficiency is very rare, and only one donor could be recruited. In order to increase statistical power, a technical replicate of the C5-deficient samples was run. Subsequently, log2-transformed intensities were processed by robust multichip analysis and filtered using a threshold of four. In total, 73 microarray chips were run and analyzed. The normalized and filtered raw data have been deposited in NCBI's Gene Expression Omnibus (GEO and are accessible with GEO Series accession number GSE55537. Linear models for microarray data were applied to estimate fold changes between data sets and the respective multiple testing adjusted p-values (FDR q-values. The

  20. Immune Response in Mussels To Environmental Pollution.

    Science.gov (United States)

    Pryor, Stephen C.; Facher, Evan

    1997-01-01

    Describes the use of mussels in measuring the extent of chemical contamination and its variation in different coastal regions. Presents an experiment to introduce students to immune response and the effects of environmental pollution on marine organisms. Contains 14 references. (JRH)

  1. Modulation of immune response by bacterial lipopolysaccharides

    Directory of Open Access Journals (Sweden)

    Gustavo Aldapa-Vega

    2016-08-01

    Full Text Available Lipopolysaccharide (LPS is a molecule that is profusely found on the outer membrane of Gram-negative bacteria and is also a potent stimulator of the immune response. As the main molecule on the bacterial surface, is also the most biologically active. The immune response of the host is activated by the recognition of LPS through Toll-like receptor 4 (TLR4 and this receptor-ligand interaction is closely linked to LPS structure. Microorganisms have evolved systems to control the expression and structure of LPS, producing structural variants that are used for modulating the host immune responses during infection. Examples of this include Helicobacter pylori, Francisella tularensis, Chlamydia trachomatis and Salmonella spp. High concentrations of LPS can cause fever, increased heart rate and lead to septic shock and death. However, at relatively low concentrations some LPS are highly active immunomodulators, which can induce non-specific resistance to invading microorganisms. The elucidation of the molecular and cellular mechanisms involved in the recognition of LPS and its structural variants has been fundamental to understand inflammation and is currently a pivotal field of research to understand the innate immune response, inflammation, the complex host-pathogen relationship and has important implications for the rational development of new immunomodulators and adjuvants.

  2. Effect of partial and complete variable loop deletions of the human immunodeficiency virus type 1 envelope glycoprotein on the breadth of gp160-specific immune responses

    International Nuclear Information System (INIS)

    Gzyl, Jaroslaw; Bolesta, Elizabeth; Wierzbicki, Andrew; Kmieciak, Dariusz; Naito, Toshio; Honda, Mitsuo; Komuro, Katsutoshi; Kaneko, Yutaro; Kozbor, Danuta

    2004-01-01

    Induction of cross-reactive cellular and humoral responses to the HIV-1 envelope (env) glycoprotein was examined after DNA immunization of BALB/c mice with gp140 89.6 -derived constructs exhibiting partial or complete deletions of the V1, V2, and V3 domains. It was demonstrated that specific modification of the V3 loop (mV3) in combination with the V2-modified (mV2) or V1/V2-deleted (ΔV1/V2) region elicited increased levels of cross-reactive CD8 + T cell responses. Mice immunized with the mV2/mV3 or ΔV1/V2/mV3 gp140 89.6 plasmid DNA were greater than 50-fold more resistant to challenge with recombinant vaccinia virus (rVV) expressing heterologous env gene products than animals immunized with the wild-type (WT) counterpart. Sera from mV2/mV3- and ΔV1/V2/mV3-immunized mice exhibited the highest cross-neutralizing activity and displayed intermediate antibody avidity values which were further enhanced by challenge with rVV expressing the homologous gp160 glycoprotein. In contrast, complete deletion of the variable regions had little or no effect on the cross-reactive antibody responses. The results of these experiments indicate that the breadth of antibody responses to the HIV-1 env glycoprotein may not be increased by removal of the variable domains. Instead, partial deletions within these regions may redirect specific responses toward conserved epitopes and facilitate approaches for boosting cross-reactive cellular and antibody responses to the env glycoprotein

  3. Human neutrophils in auto-immunity.

    Science.gov (United States)

    Thieblemont, Nathalie; Wright, Helen L; Edwards, Steven W; Witko-Sarsat, Véronique

    2016-04-01

    Human neutrophils have great capacity to cause tissue damage in inflammatory diseases via their inappropriate activation to release reactive oxygen species (ROS), proteases and other tissue-damaging molecules. Furthermore, activated neutrophils can release a wide variety of cytokines and chemokines that can regulate almost every element of the immune system. In addition to these important immuno-regulatory processes, activated neutrophils can also release, expose or generate neoepitopes that have the potential to break immune tolerance and result in the generation of autoantibodies, that characterise a number of human auto-immune diseases. For example, in vasculitis, anti-neutrophil cytoplasmic antibodies (ANCA) that are directed against proteinase 3 or myeloperoxidase are neutrophil-derived autoantigens and activated neutrophils are the main effector cells of vascular damage. In other auto-immune diseases, these neutrophil-derived neoepitopes may arise from a number of processes that include release of granule enzymes and ROS, changes in the properties of components of their plasma membrane as a result of activation or apoptosis, and via the release of Neutrophil Extracellular Traps (NETs). NETs are extracellular structures that contain chromatin that is decorated with granule enzymes (including citrullinated proteins) that can act as neo-epitopes to generate auto-immunity. This review therefore describes the processes that can result in neutrophil-mediated auto-immunity, and the role of neutrophils in the molecular pathologies of auto-immune diseases such as vasculitis, rheumatoid arthritis (RA) and systemic lupus erythematosus (SLE). We discuss the potential role of NETs in these processes and some of the debate in the literature regarding the role of this phenomenon in microbial killing, cell death and auto-immunity. Copyright © 2016 Elsevier Ltd. All rights reserved.

  4. Adrenaline influence on the immune response. I

    International Nuclear Information System (INIS)

    Depelchin, A.; Letesson, J.J.

    1981-01-01

    The intervention of adrenaline in the immunoregulation was investigated through the modification of the anti-SRBC PFC response of mice after its i.p. administration (4 μg) at various intervals before SRBC antigen. When the interval was less than 24 h, adrenaline accelerated the immune kinetics. This modification was apparent on both direct and indirect PFC, as well as on naive and immune mice. However, mice treated from 2 days showed a suppression of the response. The adrenaline affect subsisted on the adoptive response of spleen cells drug-treated either in vivo or in vitro. The mitogenic response after in vitro PHA or LPS stimulation of spleen cells from adrenaline-treated mice indicated that the T-cells were the drug target. The physiological role of the adrenaline and immunological influences of acute stress are discussed in the paper. The stress was provided by gamma irradiation. (Auth.)

  5. Induction of immune response in macaque monkeys infected with simian-human immunodeficiency virus having the TNF-α gene at an early stage of infection

    International Nuclear Information System (INIS)

    Shimizu, Yuya; Miyazaki, Yasuyuki; Ibuki, Kentaro; Suzuki, Hajime; Kaneyasu, Kentaro; Goto, Yoshitaka; Hayami, Masanori; Miura, Tomoyuki; Haga, Takeshi

    2005-01-01

    TNF-α has been implicated in the pathogenesis of, and the immune response against, HIV-1 infection. To clarify the roles of TNF-α against HIV-1-related virus infection in an SHIV-macaque model, we genetically engineered an SHIV to express the TNF-α gene (SHIV-TNF) and characterized the virus's properties in vivo. After the acute viremic stage, the plasma viral loads declined earlier in the SHIV-TNF-inoculated monkeys than in the parental SHIV (SHIV-NI)-inoculated monkeys. SHIV-TNF induced cell death in the lymph nodes without depletion of circulating CD4 + T cells. SHIV-TNF provided some immunity in monkeys by increasing the production of the chemokine RANTES and by inducing an antigen-specific proliferation of lymphocytes. The monkeys immunized with SHIV-TNF were partly protected against a pathogenic SHIV (SHIV-C2/1) challenge. These findings suggest that TNF-α contributes to the induction of an effective immune response against HIV-1 rather than to the progression of disease at the early stage of infection

  6. Ovine model for studying pulmonary immune responses

    International Nuclear Information System (INIS)

    Joel, D.D.; Chanana, A.D.

    1984-01-01

    Anatomical features of the sheep lung make it an excellent model for studying pulmonary immunity. Four specific lung segments were identified which drain exclusively to three separate lymph nodes. One of these segments, the dorsal basal segment of the right lung, is drained by the caudal mediastinal lymph node (CMLN). Cannulation of the efferent lymph duct of the CMLN along with highly localized intrabronchial instillation of antigen provides a functional unit with which to study factors involved in development of pulmonary immune responses. Following intrabronchial immunization there was an increased output of lymphoblasts and specific antibody-forming cells in efferent CMLN lymph. Continuous divergence of efferent lymph eliminated the serum antibody response but did not totally eliminate the appearance of specific antibody in fluid obtained by bronchoalveolar lavage. In these studies localized immunization of the right cranial lobe served as a control. Efferent lymphoblasts produced in response to intrabronchial antigen were labeled with 125 I-iododeoxyuridine and their migrational patterns and tissue distribution compared to lymphoblasts obtained from the thoracic duct. The results indicated that pulmonary immunoblasts tend to relocate in lung tissue and reappear with a higher specific activity in pulmonary lymph than in thoracic duct lymph. The reverse was observed with labeled intestinal lymphoblasts. 35 references, 2 figures, 3 tables

  7. Ovine model for studying pulmonary immune responses

    Energy Technology Data Exchange (ETDEWEB)

    Joel, D.D.; Chanana, A.D.

    1984-11-25

    Anatomical features of the sheep lung make it an excellent model for studying pulmonary immunity. Four specific lung segments were identified which drain exclusively to three separate lymph nodes. One of these segments, the dorsal basal segment of the right lung, is drained by the caudal mediastinal lymph node (CMLN). Cannulation of the efferent lymph duct of the CMLN along with highly localized intrabronchial instillation of antigen provides a functional unit with which to study factors involved in development of pulmonary immune responses. Following intrabronchial immunization there was an increased output of lymphoblasts and specific antibody-forming cells in efferent CMLN lymph. Continuous divergence of efferent lymph eliminated the serum antibody response but did not totally eliminate the appearance of specific antibody in fluid obtained by bronchoalveolar lavage. In these studies localized immunization of the right cranial lobe served as a control. Efferent lymphoblasts produced in response to intrabronchial antigen were labeled with /sup 125/I-iododeoxyuridine and their migrational patterns and tissue distribution compared to lymphoblasts obtained from the thoracic duct. The results indicated that pulmonary immunoblasts tend to relocate in lung tissue and reappear with a higher specific activity in pulmonary lymph than in thoracic duct lymph. The reverse was observed with labeled intestinal lymphoblasts. 35 references, 2 figures, 3 tables.

  8. Pre-existing adenovirus immunity modifies a complex mixed Th1 and Th2 cytokine response to an Ad5/HIV-1 vaccine candidate in humans.

    Directory of Open Access Journals (Sweden)

    Samuel O Pine

    2011-04-01

    Full Text Available The results of the recent Step Study highlight a need to clarify the effects of pre-existing natural immunity to a vaccine vector on vaccine-induced T-cell responses. To investigate this interaction, we examined the relationship between pre-existing Ad5 immunity and T-cell cytokine response profiles in healthy, HIV-uninfected recipients of MRKAd5 HIV-1 gag vaccine (HVTN 050, ClinicalTrials.gov #NCT00849732. Participants were grouped by baseline Ad5 neutralizing antibody titer as either Ad5-seronegative (titer ≤18; n = 36 or Ad5-seropositive (titer >200; n = 34. Samples from vaccine recipients were analyzed for immune responses to either HIV-1 Gag peptide pools or Ad5 empty vector using an ex vivo assay that measures thirty cytokines in the absence of long-term culture. The overall profiles of cytokine responses to Gag and Ad5 had similar combinations of induced Th1- and Th2-type cytokines, including IFN-γ, IL-2, TNF-α, IP-10, IL-13, and IL-10, although the Ad5-specific responses were uniformly higher than the Gag-specific responses (p<0.0001 for 9 out of 11 significantly expressed analytes. At the peak response time point, PBMC from Ad5-seronegative vaccinees secreted significantly more IP-10 in response to Gag (p = 0.008, and significantly more IP-10 (p = 0.0009, IL-2 (p = 0.006 and IL-10 (p = 0.05 in response to Ad5 empty vector than PBMC from Ad5-seropositive vaccinees. Additionally, similar responses to the Ad5 vector prior to vaccination were observed in almost all subjects, regardless of Ad5 neutralizing antibody status, and the levels of secreted IFN-γ, IL-10, IL-1Ra and GM-CSF were blunted following vaccination. The cytokine response profile of Gag-specific T cells mirrored the Ad5-specific response present in all subjects before vaccination, and included a number of Th1- and Th2-associated cytokines not routinely assessed in current vaccine trials, such as IP-10, IL-10, IL-13, and GM-CSF. Together, these

  9. Multiscale modeling of mucosal immune responses

    Science.gov (United States)

    2015-01-01

    Computational modeling techniques are playing increasingly important roles in advancing a systems-level mechanistic understanding of biological processes. Computer simulations guide and underpin experimental and clinical efforts. This study presents ENteric Immune Simulator (ENISI), a multiscale modeling tool for modeling the mucosal immune responses. ENISI's modeling environment can simulate in silico experiments from molecular signaling pathways to tissue level events such as tissue lesion formation. ENISI's architecture integrates multiple modeling technologies including ABM (agent-based modeling), ODE (ordinary differential equations), SDE (stochastic modeling equations), and PDE (partial differential equations). This paper focuses on the implementation and developmental challenges of ENISI. A multiscale model of mucosal immune responses during colonic inflammation, including CD4+ T cell differentiation and tissue level cell-cell interactions was developed to illustrate the capabilities, power and scope of ENISI MSM. Background Computational techniques are becoming increasingly powerful and modeling tools for biological systems are of greater needs. Biological systems are inherently multiscale, from molecules to tissues and from nano-seconds to a lifespan of several years or decades. ENISI MSM integrates multiple modeling technologies to understand immunological processes from signaling pathways within cells to lesion formation at the tissue level. This paper examines and summarizes the technical details of ENISI, from its initial version to its latest cutting-edge implementation. Implementation Object-oriented programming approach is adopted to develop a suite of tools based on ENISI. Multiple modeling technologies are integrated to visualize tissues, cells as well as proteins; furthermore, performance matching between the scales is addressed. Conclusion We used ENISI MSM for developing predictive multiscale models of the mucosal immune system during gut

  10. Multiscale modeling of mucosal immune responses.

    Science.gov (United States)

    Mei, Yongguo; Abedi, Vida; Carbo, Adria; Zhang, Xiaoying; Lu, Pinyi; Philipson, Casandra; Hontecillas, Raquel; Hoops, Stefan; Liles, Nathan; Bassaganya-Riera, Josep

    2015-01-01

    Computational techniques are becoming increasingly powerful and modeling tools for biological systems are of greater needs. Biological systems are inherently multiscale, from molecules to tissues and from nano-seconds to a lifespan of several years or decades. ENISI MSM integrates multiple modeling technologies to understand immunological processes from signaling pathways within cells to lesion formation at the tissue level. This paper examines and summarizes the technical details of ENISI, from its initial version to its latest cutting-edge implementation. Object-oriented programming approach is adopted to develop a suite of tools based on ENISI. Multiple modeling technologies are integrated to visualize tissues, cells as well as proteins; furthermore, performance matching between the scales is addressed. We used ENISI MSM for developing predictive multiscale models of the mucosal immune system during gut inflammation. Our modeling predictions dissect the mechanisms by which effector CD4+ T cell responses contribute to tissue damage in the gut mucosa following immune dysregulation.Computational modeling techniques are playing increasingly important roles in advancing a systems-level mechanistic understanding of biological processes. Computer simulations guide and underpin experimental and clinical efforts. This study presents ENteric Immune Simulator (ENISI), a multiscale modeling tool for modeling the mucosal immune responses. ENISI's modeling environment can simulate in silico experiments from molecular signaling pathways to tissue level events such as tissue lesion formation. ENISI's architecture integrates multiple modeling technologies including ABM (agent-based modeling), ODE (ordinary differential equations), SDE (stochastic modeling equations), and PDE (partial differential equations). This paper focuses on the implementation and developmental challenges of ENISI. A multiscale model of mucosal immune responses during colonic inflammation, including CD4+ T

  11. Quantitating cellular immune responses to cancer vaccines.

    Science.gov (United States)

    Lyerly, H Kim

    2003-06-01

    While the future of immunotherapy in the treatment of cancer is promising, it is difficult to compare the various approaches because monitoring assays have not been standardized in approach or technique. Common assays for measuring the immune response need to be established so that these assays can one day serve as surrogate markers for clinical response. Assays that accurately detect and quantitate T-cell-mediated, antigen-specific immune responses are particularly desired. However, to date, increases in the number of cytotoxic T cells through immunization have not been correlated with clinical tumor regression. Ideally, then, a T-cell assay not only needs to be sensitive, specific, reliable, reproducible, simple, and quick to perform, it must also demonstrate close correlation with clinical outcome. Assays currently used to measure T-cell response are delayed-type hypersensitivity testing, flow cytometry using peptide major histocompatibility complex tetramers, lymphoproliferation assay, enzyme-linked immunosorbant assay, enzyme-linked immunospot assay, cytokine flow cytometry, direct cytotoxicity assay, measurement of cytokine mRNA by quantitative reverse transcriptase polymerase chain reaction, and limiting dilution analysis. The purpose of this review is to describe the attributes of each test and compare their advantages and disadvantages.

  12. 21 CFR 640.100 - Immune Globulin (Human).

    Science.gov (United States)

    2010-04-01

    ... 21 Food and Drugs 7 2010-04-01 2010-04-01 false Immune Globulin (Human). 640.100 Section 640.100 Food and Drugs FOOD AND DRUG ADMINISTRATION, DEPARTMENT OF HEALTH AND HUMAN SERVICES (CONTINUED) BIOLOGICS ADDITIONAL STANDARDS FOR HUMAN BLOOD AND BLOOD PRODUCTS Immune Globulin (Human) § 640.100 Immune...

  13. The host immune response to Clostridium difficile infection

    Science.gov (United States)

    2013-01-01

    Clostridium difficile infection (CDI) is the most common infectious cause of healthcare-acquired diarrhoea. Outcomes of C. difficile colonization are varied, from asymptomatic carriage to fulminant colitis and death, due in part to the interplay between the pathogenic virulence factors of the bacterium and the counteractive immune responses of the host. Secreted toxins A and B are the major virulence factors of C. difficile and induce a profound inflammatory response by intoxicating intestinal epithelial cells causing proinflammatory cytokine release. Host cell necrosis, vascular permeability and neutrophil infiltration lead to an elevated white cell count, profuse diarrhoea and in severe cases, dehydration, hypoalbuminaemia and toxic megacolon. Other bacterial virulence factors, including surface layer proteins and flagella proteins, are detected by host cell surface signal molecules that trigger downstream cell-mediated immune pathways. Human studies have identified a role for serum and faecal immunoglobulin levels in protection from disease, but the recent development of a mouse model of CDI has enabled studies into the precise molecular interactions that trigger the immune response during infection. Key effector molecules have been identified that can drive towards a protective anti-inflammatory response or a damaging proinflammatory response. The limitations of current antimicrobial therapies for CDI have led to the development of both active and passive immunotherapies, none of which have, as yet been formally approved for CDI. However, recent advances in our understanding of the molecular basis of host immune protection against CDI may provide an exciting opportunity for novel therapeutic developments in the future. PMID:25165542

  14. Flavobacterium psychrophilum - Experimental challenge and immune response

    DEFF Research Database (Denmark)

    Henriksen, Maya Maria Mihályi

    the immune system of the fry is not fully developed. Theoretically, the infection pressure could be subdued by vaccinating larger fish, but no commercial vaccine is yet available. Diagnostic methods are well described and the disease is treated with antibiotics. To prevent disease outbreaks and subsequent......-time PCR (RT-PCR) was used to examine the immune response in the head kidney during the first eight days after infection, and enzyme-linked immunosorbent assay (ELISA) was used to evaluate the production of antibodies 50 days post-exposure. A pro-inflammatory response was observed in both groups infected...... of edemas, but in both cases the tissue was regenerating after 192 hours. However, when the fish had been exposed to both H2O2 and F. psychrophilum, the damage was still evident at this time point. The relative pathogen load measured as 16S rRNA was highest at the first sampling and decreased steadily...

  15. Evaluation of Mucosal and Systemic Immune Responses Elicited by GPI-0100-Adjuvanted Influenza Vaccine Delivered by Different Immunization Strategies

    NARCIS (Netherlands)

    Liu, Heng; Patil, Harshad P.; de Vries-Idema, Jacqueline; Wilschut, Jan; Huckriede, Anke

    2013-01-01

    Vaccines for protection against respiratory infections should optimally induce a mucosal immune response in the respiratory tract in addition to a systemic immune response. However, current parenteral immunization modalities generally fail to induce mucosal immunity, while mucosal vaccine delivery

  16. The behavioural immune system and the psychology of human sociality.

    Science.gov (United States)

    Schaller, Mark

    2011-12-12

    Because immunological defence against pathogens is costly and merely reactive, human anti-pathogen defence is also characterized by proactive behavioural mechanisms that inhibit contact with pathogens in the first place. This behavioural immune system comprises psychological processes that infer infection risk from perceptual cues, and that respond to these perceptual cues through the activation of aversive emotions, cognitions and behavioural impulses. These processes are engaged flexibly, producing context-contingent variation in the nature and magnitude of aversive responses. These processes have important implications for human social cognition and social behaviour-including implications for social gregariousness, person perception, intergroup prejudice, mate preferences, sexual behaviour and conformity. Empirical evidence bearing on these many implications is reviewed and discussed. This review also identifies important directions for future research on the human behavioural immune system--including the need for enquiry into underlying mechanisms, additional behavioural consequences and implications for human health and well-being.

  17. Ebola haemorrhagic fever virus: pathogenesis, immune responses, potential prevention.

    Science.gov (United States)

    Marcinkiewicz, Janusz; Bryniarski, Krzysztof; Nazimek, Katarzyna

    2014-01-01

    Ebola zoonotic RNA filovirus represents human most virulent and lethal pathogens, which induces acute hemorrhagic fever and death within few days in a range of 60-90% of symptomatic individuals. Last outbreak in 2014 in West Africa caused panic that Ebola epidemic can be spread to other continents. Number of deaths in late December reached almost 8,000 individuals out of more than 20,000 symptomatic patients. It seems that only a coordinated international response could counteract the further spread of Ebola. Major innate immunity mechanisms against Ebola are associated with the production of interferons, that are inhibited by viral proteins. Activation of host NK cells was recognized as a leading immune function responsible for recovery of infected people. Uncontrolled cell infection by Ebola leads to an impairment of immunity with cytokine storm, coagulopathy, systemic bleeding, multi-organ failure and death. Tested prevention strategies to induce antiviral immunity include: i. recombinant virus formulations (vaccines); ii. cocktail of monoclonal antibodies (serotherapy); iii. alternative RNA-interference-based antiviral methods. Maintaining the highest standards of aseptic and antiseptic precautions is equally important. Present brief review summarizes a current knowledge concerning pathogenesis of Ebola hemorrhagic disease and the virus interaction with the immune system and discusses recent advances in prevention of Ebola infection by vaccination and serotherapy.

  18. Immune Defence Factors In Human Milk

    Directory of Open Access Journals (Sweden)

    Kumar Sanjeev

    1985-01-01

    Full Text Available Scientific evidence is accumulating to prove the nutritional, anti-infective, anti-fertility, psychosomal and economic advantages of breast-feeding. A number of studies have shown that breast milk protects against diarrheal, respiratory and other infections. Its value in protecting against allergy has also been established. This article reviews the studies on various immune defence factors present in the human milk. The available scientific knowledge makes a very strong case in favour of promoting breast-feeding.

  19. Cocoa Diet and Antibody Immune Response in Preclinical Studies

    Directory of Open Access Journals (Sweden)

    Mariona Camps-Bossacoma

    2017-06-01

    Full Text Available The ability of cocoa to interact with the immune system in vitro and in vivo has been described. In the latter context, a cocoa-enriched diet in healthy rats was able to modify the immune system’s functionality. This fact could be observed in the composition and functionality of lymphoid tissues, such as the thymus, spleen, and lymph nodes. Consequently, immune effector mechanisms, such as antibody synthesis, were modified. A cocoa-enriched diet in young rats was able to attenuate the serum levels of immunoglobulin (Ig G, IgM, and IgA and also the intestinal IgM and IgA secretion. Moreover, in immunized rats, the intake of cocoa decreased specific IgG1, IgG2a, IgG2c, and IgM concentrations in serum. This immune-regulator potential was then tested in disease models in which antibodies play a pathogenic role. A cocoa-enriched diet was able to partially prevent the synthesis of autoantibodies in a model of autoimmune arthritis in rats and was also able to protect against IgE and T helper 2-related antibody synthesis in two rat models of allergy. Likewise, a cocoa-enriched diet prevented an oral sensitization process in young rats. In this review, we will focus on the influence of cocoa on the acquired branch of the immune function. Therefore, we will focus on how a cocoa diet influences lymphocyte function both in the systemic and intestinal immune system. Likewise, its potential role in preventing some antibody-induced immune diseases is also included. Although further studies must characterize the particular cocoa components responsible for such effects and nutritional studies in humans need to be carried out, cocoa has potential as a nutraceutical agent in some hypersensitivity status.

  20. Immune Response among Patients Exposed to Molds

    Directory of Open Access Journals (Sweden)

    Jordan N. Fink

    2009-12-01

    Full Text Available Macrocyclic trichothecenes, mycotoxins produced by Stachybotrys chartarum, have been implicated in adverse reactions in individuals exposed to mold-contaminated environments. Cellular and humoral immune responses and the presence of trichothecenes were evaluated in patients with mold-related health complaints. Patients underwent history, physical examination, skin prick/puncture tests with mold extracts, immunological evaluations and their sera were analyzed for trichothecenes. T-cell proliferation, macrocyclic trichothecenes, and mold specific IgG and IgA levels were not significantly different than controls; however 70% of the patients had positive skin tests to molds. Thus, IgE mediated or other non-immune mechanisms could be the cause of their symptoms.

  1. Manipulations of the immune response in the chicken

    International Nuclear Information System (INIS)

    Bixler, G.S. Jr.

    1978-01-01

    The chicken with its dissociation of immune responses in cell-mediated immunity, dependent on the thymus, and humoral immunity, dependent on the bursa of Fabricius, provides a unique model for studying the two components of the immune system. While there are methods of obtaining selective, profound deficiency of humoral immunity, in this species, methods for obtaining a consistent, profound selective deficiency of cell-mediated immunity have been lacking. Oxisuran, 2[(methylsulfinyl)acetal] pyridine, has been reported to have the unique ability to differentially suppress cell-mediated immunity in several species of mammals without a concomitant reduction in antibody forming capacity. The effect of this compound on two parameters of cell-mediated immune responses in chickens was investigated. In further attempts to create a deficiency of both cell-mediated and humoral immunity, the effects of a combination of cyclophosphamide treatment and x-irradiation early in life on immune responses were studied

  2. Genetic adaptation of the antibacterial human innate immunity network

    Directory of Open Access Journals (Sweden)

    Lazarus Ross

    2011-07-01

    Full Text Available Abstract Background Pathogens have represented an important selective force during the adaptation of modern human populations to changing social and other environmental conditions. The evolution of the immune system has therefore been influenced by these pressures. Genomic scans have revealed that immune system is one of the functions enriched with genes under adaptive selection. Results Here, we describe how the innate immune system has responded to these challenges, through the analysis of resequencing data for 132 innate immunity genes in two human populations. Results are interpreted in the context of the functional and interaction networks defined by these genes. Nucleotide diversity is lower in the adaptors and modulators functional classes, and is negatively correlated with the centrality of the proteins within the interaction network. We also produced a list of candidate genes under positive or balancing selection in each population detected by neutrality tests and showed that some functional classes are preferential targets for selection. Conclusions We found evidence that the role of each gene in the network conditions the capacity to evolve or their evolvability: genes at the core of the network are more constrained, while adaptation mostly occurred at particular positions at the network edges. Interestingly, the functional classes containing most of the genes with signatures of balancing selection are involved in autoinflammatory and autoimmune diseases, suggesting a counterbalance between the beneficial and deleterious effects of the immune response.

  3. Genetic adaptation of the antibacterial human innate immunity network.

    Science.gov (United States)

    Casals, Ferran; Sikora, Martin; Laayouni, Hafid; Montanucci, Ludovica; Muntasell, Aura; Lazarus, Ross; Calafell, Francesc; Awadalla, Philip; Netea, Mihai G; Bertranpetit, Jaume

    2011-07-11

    Pathogens have represented an important selective force during the adaptation of modern human populations to changing social and other environmental conditions. The evolution of the immune system has therefore been influenced by these pressures. Genomic scans have revealed that immune system is one of the functions enriched with genes under adaptive selection. Here, we describe how the innate immune system has responded to these challenges, through the analysis of resequencing data for 132 innate immunity genes in two human populations. Results are interpreted in the context of the functional and interaction networks defined by these genes. Nucleotide diversity is lower in the adaptors and modulators functional classes, and is negatively correlated with the centrality of the proteins within the interaction network. We also produced a list of candidate genes under positive or balancing selection in each population detected by neutrality tests and showed that some functional classes are preferential targets for selection. We found evidence that the role of each gene in the network conditions the capacity to evolve or their evolvability: genes at the core of the network are more constrained, while adaptation mostly occurred at particular positions at the network edges. Interestingly, the functional classes containing most of the genes with signatures of balancing selection are involved in autoinflammatory and autoimmune diseases, suggesting a counterbalance between the beneficial and deleterious effects of the immune response.

  4. MECHANISMS OF IMMUNE RESPONSES IN CNIDARIANS

    Directory of Open Access Journals (Sweden)

    Iván Darío Ocampo

    2015-05-01

    Full Text Available The immune system maintains the integrity of the organisms through a complex network of molecules, cells, and tissues that recognize internal or external antigenic substances to neutralized and eliminate them. The mechanisms of immune response have evolved in a modular fashion, where members of a given module interact strongly among them, but weakly with members of other modules, providing robustness and evolvability to the immune system. Ancestral modules are the raw material for the generation of new modules through evolution. Thus, the study of immune systems in basal metazoans such as cnidarians seeks to determine the basic tool kit from which the metazoans started to construct their immune systems. In addition, understanding the immune mechanisms in cnidarians contributes to decipher the etiopathology of coral diseases of infectious nature that are affecting coral reefs worldwide. RESUMEN El sistema inmune mantiene la integridad de los organismos vivos por medio de una red compleja de moléculas, células y tejidos que reconocen sustancias antigénicas internas o externas para neutralizarlas y eliminarlas. Los mecanismos de respuesta inmune han evolucionado de una manera modular, en donde miembros de un módulo dado interactúan fuertemente entre sí, pero débilmente con componentes de otros módulos, otorgando así robustez y potencial evolutivo al sistema inmune. Módulos ancestrales representan el material básico para la generación de nuevos módulos durante el proceso evolutivo. Así, el estudio de sistemas inmunes en metazoarios basales como los cnidarios busca determinar cuales son los módulos ancestrales a partir de los cuales se constituyen los sistemas inmunes de animales derivados. Adicionalmente, el entendimiento de los mecanismos de respuesta inmune en cnidarios eventualmente contribuirá a descifrar la etiopatología de las enfermedades de corales de carácter infeccioso que está afectando los corales en el mundo.

  5. Influence of diabetes mellitus on immunity to human tuberculosis.

    Science.gov (United States)

    Kumar Nathella, Pavan; Babu, Subash

    2017-09-01

    Type 2 diabetes mellitus(DM) is a major risk factor for the development of active pulmonary tuberculosis (TB), with development of DM pandemic in countries where TB is also endemic. Understanding the impact of DM on TB and the determinants of co-morbidity is essential in responding to this growing public health problem with improved therapeutic approaches. Despite the clinical and public health significance posed by the dual burden of TB and DM, little is known about the immunological and biochemical mechanisms of susceptibility. One possible mechanism is that an impaired immune response in patients with DM facilitates either primary infection with Mycobacterium tuberculosis or reactivation of latent TB. Diabetes is associated with immune dysfunction and alterations in the components of the immune system, including altered levels of specific cytokines and chemokines. Some effects of DM on adaptive immunity that are potentially relevant to TB defence have been identified in humans. In this review, we summarize current findings regarding the alterations in the innate and adaptive immune responses and immunological mechanisms of susceptibility of patients with DM to M. tuberculosis infection and disease. © 2017 John Wiley & Sons Ltd.

  6. The skin immune system (SIS): distribution and immunophenotype of lymphocyte subpopulations in normal human skin

    NARCIS (Netherlands)

    Bos, J. D.; Zonneveld, I.; Das, P. K.; Krieg, S. R.; van der Loos, C. M.; Kapsenberg, M. L.

    1987-01-01

    The complexity of immune response-associated cells present in normal human skin was recently redefined as the skin immune system (SIS). In the present study, the exact immunophenotypes of lymphocyte subpopulations with their localizations in normal human skin were determined quantitatively. B cells

  7. Effect of oral administration of lactobacillus acidophilus on the immune responses and survival of BALB/c mice bearing human breast cancer

    Directory of Open Access Journals (Sweden)

    Soltan Dallal MM

    2010-02-01

    Full Text Available "n Normal 0 false false false EN-US X-NONE AR-SA MicrosoftInternetExplorer4 /* Style Definitions */ table.MsoNormalTable {mso-style-name:"Table Normal"; mso-tstyle-rowband-size:0; mso-tstyle-colband-size:0; mso-style-noshow:yes; mso-style-priority:99; mso-style-qformat:yes; mso-style-parent:""; mso-padding-alt:0in 5.4pt 0in 5.4pt; mso-para-margin:0in; mso-para-margin-bottom:.0001pt; mso-pagination:widow-orphan; font-size:11.0pt; font-family:"Calibri","sans-serif"; mso-ascii-font-family:Calibri; mso-ascii-theme-font:minor-latin; mso-fareast-font-family:"Times New Roman"; mso-fareast-theme-font:minor-fareast; mso-hansi-font-family:Calibri; mso-hansi-theme-font:minor-latin; mso-bidi-font-family:Arial; mso-bidi-theme-font:minor-bidi;} Background: In according to immunomodulatory effect of probiotics and effect of these bacteria on the effectiveness of immune responses, at the present work we proposed the evaluation of oral administration of L.acidophilus on the immune statues in BALB/c mice bearing breast cancer."n"nMethods: A total of 30 In-bred BALB/c mices aged from six to eight weeks weighting 25-30g were randomly enrolled in our study, in two groups each consist of 15 mices. The L.acidophilus ATCC4356 strain used in this study was inoculated in MRS broth and cultivated for a day at 37°C under anaerobic conditions, collected by centrifugation and resuspend in Phosphate Buffer Saline (PBS. After preparation of proper amount of these suspensions it was orally administered to the mice with a gastric feeding, Control mices received an equal volume of PBS in duration of study."n"nResults: Results showed the increase in production of IFnγ (p<0.005, and decrease in production of Th2 cytokines such as IL4 (p=0.347 in the L.acidophilus administered mice in comparison to control group of mice. In addition the proliferation of immune cells in probiotic group was significantly higher than controls, and most importantly probiotic administered mice showed

  8. The Integrated Impact of Diet on Human Immune Response, the Gut Microbiota, and Nutritional Status During Adaptation to a Spaceflight Analog

    Science.gov (United States)

    Douglas, G. L.; Zwart, S. R.; Young, M.; Kloeris, V.; Crucian, B.; Smith, S. M.; Lorenzi, H.

    2018-01-01

    Spaceflight impacts human physiology, including well documented immune system dysregulation. Diet, immune function, and the microbiome are interlinked, but diet is the only one of these factors that we have the ability to easily, and significantly, alter on Earth or during flight. As we understand dietary impacts on physiology more thoroughly, we may then improve the spaceflight diet to improve crew health and potentially reduce spaceflight-associated physiological alterations. It is expected that increasing the consumption of fruits and vegetables and bioactive compounds (e.g., omega-3 fatty acids, lycopene, flavonoids) and therefore enhancing overall nutritional intake from the nominal shelf-stable, fully-processed space food system could serve as a countermeasure to improve human immunological profiles, the taxonomic profile of the gut microbiota, and nutritional status, especially where currently dysregulated during spaceflight. This interdisciplinary study will determine the effect of the current shelf-stable spaceflight diet compared to an "enhanced" shelf-stable spaceflight diet (25% more foods rich in omega-3 fatty acids, lycopene, flavonoids, and more fruits, and vegetables in general). The NASA Human Exploration Research Analog (HERA) 2017 missions, consisting of four 45-day missions with closed chamber confinement and realistic mission simulation in a high-fidelity mock space vehicle, will serve as a platform to replicate mission stressors and the effects on crew biochemistry, immunology, and the gut microbiome. Bio sampling of crewmembers is scheduled for selected intervals pre- and in-mission. Data collection also includes dietary intake recording. Outcome measures will include immune markers (e.g., peripheral leukocyte distribution, inflammatory cytokine profiles, T cell function), the taxonomic and metatranscriptomic profile of the gut microbiome, and nutritional status biomarkers and metabolites. Statistical evaluations will determine physiological

  9. immune response can measuring immunity to hiv during ...

    African Journals Online (AJOL)

    2005-11-01

    Nov 1, 2005 ... inhibitors (PIs), have resulted in significant suppression of viral replication. ... thymus, with the potential for immune reconstitution when ..... HIV-exposed but uninfected Gambian women [published erratum appears in. Nat Med ...

  10. Modulation of the innate immune responses in the striped ...

    African Journals Online (AJOL)

    Thus, most of the innate non-specific immune responses are inducible though they are constitutive of fish immune system exhibiting a basal level of activity even in the absence of pathogen challenge. Keywords: Aeromonas hydrophila, Experimental challenge, Innate immune response, Striped snakehead murrel ...

  11. The n-hexane and chloroform fractions of Piper betle L. trigger different arms of immune responses in BALB/c mice and exhibit antifilarial activity against human lymphatic filarid Brugia malayi.

    Science.gov (United States)

    Singh, Meghna; Shakya, Shilpy; Soni, Vishal Kumar; Dangi, Anil; Kumar, Nikhil; Bhattacharya, Shailja-Misra

    2009-06-01

    Modulation of immune functions by using herbal plants and their products has become fundamental regime of therapeutic approach. Piper betle Linn. (Piperaceae) is a widely distributed plant in the tropical and subtropical regions of the world and has been attributed as traditional herbal remedy for many diseases. We have recently reported the antifilarial and antileishmanial efficacy in the leaf extract of Bangla Mahoba landrace of P. betle which is a female plant. The present report describes the in vivo immunomodulatory efficacy of the crude methanolic extract and its n-hexane, chloroform, n-butanol fractions of the female plant at various dose levels ranging between 0.3 and 500 mg/kg in BALB/c. Attempts were also made to observe antifilarial activity of the active extracts and correlate it with the antigen specific immune responses in another rodent Mastomys coucha infected with human lymphatic filarial parasite Brugia malayi. The crude methanol extract and n-hexane fraction were found to potentiate significant (p<0.001) enhancement of both humoral (plaque forming cells, hemagglutination titre) as well as cell-mediated (lymphoproliferation, macrophage activation, delayed type hypersensitivity) immune responses in mice. The flow cytometric analysis of splenocytes of treated mice indicated enhanced population of T-cells (CD4(+), CD8(+)) and B-cells (CD19(+)). The n-hexane fraction (3 mg/kg) was found to induce biased type 2 cytokine response as revealed by increased IL-4(+) and decreased IFN-gamma(+) T-cell population while the chloroform fraction (10 mg/kg) produced a predominant type 1 cytokines. Crude methanolic extract (100 mg/kg) demonstrated a mixed type 1 and type 2 cytokine responses thus suggesting a remarkable immunomodulatory property in this plant. The induction of differential T-helper cell immune response appears ideal to overcome immunosuppression as observed in case of lymphatic, filarial Brugia malayi infection which may also be extended to other

  12. Work stress and innate immune response.

    Science.gov (United States)

    Boscolo, P; Di Gioacchino, M; Reale, M; Muraro, R; Di Giampaolo, L

    2011-01-01

    Several reports highlight the relationship between blood NK cytotoxic activity and life style. Easy life style, including physical activity, healthy dietary habits as well as good mental health are characterized by an efficient immune response. Life style is related to the type of occupational activity since work has a central part in life either as source of income or contributing to represent the social identity. Not only occupational stress, but also job loss or insecurity are thus considered serious stressful situations, inducing emotional disorders which may affect both neuroendocrine and immune systems; reduced reactivity to mitogens and/or decreased blood NK cytotoxic activity was reported in unemployed workers or in those with a high perception of job insecurity and/or job stress. Although genetic factors have a key role in the pathogenesis of autoimmune disorders, occupational stress (as in night shifts) was reported associated to an increased incidence of autoimmune disorders. Monitoring blood NK response may thus be included in the health programs as an indirect index of stressful job and/or poor lifestyle.

  13. Recent advances in immunity to human schistosomiasis

    Directory of Open Access Journals (Sweden)

    Paul Hagan

    1992-01-01

    Full Text Available For many years the epidemiological significance of immunity in human schistosomiasis has been the subject of inconclusive debate. Recently, the results of studies from Brazil and Kenya, on Shistosoma mansoni and from Zimbabwe and The Gambia on S. haematobium have confirmed the importance of protective immunity. In communities in endemic areas the development of immunity to infection only occurs after many years of exposure. In part this due to the slow development of antibodies wich are protective but also to the earlier development of antibody isotypes which lack protective capacity and wich are capable of interfering with the functioning of protective antibodies. Protective antibodies appear to be of the IgE class but some IgG subclasses may be also be important. Initially, blocking antibodies were thought to be predominantly IgM and IgG2 but IgG4 also seems to posses blocking activity. The early production of blocking antibodies and late production of protective antibodies may be indicative of cytokine induced immunoglobulin class swiching caused by the sequential involvment of different lymphokines.

  14. Chicken Immune Response after In Ovo Immunization with Chimeric TLR5 Activating Flagellin of Campylobacter jejuni.

    Directory of Open Access Journals (Sweden)

    Katarzyna A Radomska

    Full Text Available Campylobacter jejuni is the main cause of bacterial food-borne diseases in developed countries. Chickens are the most important source of human infection. Vaccination of poultry is an attractive strategy to reduce the number of C. jejuni in the intestinal tract of chickens. We investigated the immunogenicity and protective efficacy of a recombinant C. jejuni flagellin-based subunit vaccine with intrinsic adjuvant activity. Toll-like receptor activation assays demonstrated the purity and TLR5 stimulating (adjuvant activity of the vaccine. The antigen (20-40 μg was administered in ovo to 18 day-old chicken embryos. Serum samples and intestinal content were assessed for antigen-specific systemic and mucosal humoral immune responses. In ovo vaccination resulted in the successful generation of IgY and IgM serum antibodies against the flagellin-based subunit vaccine as determined by ELISA and Western blotting. Vaccination did not induce significant amounts of flagellin-specific secretory IgA in the chicken intestine. Challenge of chickens with C. jejuni yielded similar intestinal colonization levels for vaccinated and control animals. Our results indicate that in ovo delivery of recombinant C. jejuni flagellin subunit vaccine is a feasible approach to yield a systemic humoral immune response in chickens but that a mucosal immune response may be needed to reduce C. jejuni colonization.

  15. Enhancement of Immune Memory Responses to Respiratory Infection

    Science.gov (United States)

    2017-08-01

    AWARD NUMBER: W81XWH-16-1-0360 TITLE: Enhancement of Immune Memory Responses to Respiratory Infection PRINCIPAL INVESTIGATORs: Dr Min Chen PhD...5a. CONTRACT NUMBER Enhancement of Immune Memory Responses to Respiratory Infection 5b. GRANT NUMBER W81XWH-16-1-0360 5c. PROGRAM ELEMENT NUMBER...entitled “ENHANCEMENT OF IMMUNE MEMORY RESPONSES TO RESPIRATORY INFECTION: AUTOPHAGY IN MEMORY B-CELLS RESPONSE TO INFLUENZA VACCINE (AMBRIV

  16. Plant innate immunity against human bacterial pathogens

    Directory of Open Access Journals (Sweden)

    Maeli eMelotto

    2014-08-01

    Full Text Available Certain human bacterial pathogens such as the enterohemorrhagic Escherichia coli and Salmonella enterica are not proven to be plant pathogens yet. Nonetheless, under certain conditions they can survive on, penetrate into, and colonize internal plant tissues causing serious food borne disease outbreaks. In this review, we highlight current understanding on the molecular mechanisms of plant responses against human bacterial pathogens and discuss salient common and contrasting themes of plant interactions with phytopathogens or human pathogens.

  17. Early-life inflammation, immune response and ageing.

    Science.gov (United States)

    Khan, Imroze; Agashe, Deepa; Rolff, Jens

    2017-03-15

    Age-related diseases are often attributed to immunopathology, which results in self-damage caused by an inappropriate inflammatory response. Immunopathology associated with early-life inflammation also appears to cause faster ageing, although we lack direct experimental evidence for this association. To understand the interactions between ageing, inflammation and immunopathology, we used the mealworm beetle Tenebrio molitor as a study organism. We hypothesized that phenoloxidase, an important immune effector in insect defence, may impose substantial immunopathological costs by causing tissue damage to Malpighian tubules (MTs; functionally equivalent to the human kidney), in turn accelerating ageing. In support of this hypothesis, we found that RNAi knockdown of phenoloxidase (PO) transcripts in young adults possibly reduced inflammation-induced autoreactive tissue damage to MTs, and increased adult lifespan. Our work thus suggests a causative link between immunopathological costs of early-life inflammation and faster ageing. We also reasoned that if natural selection weakens with age, older individuals should display increased immunopathological costs associated with an immune response. Indeed, we found that while old infected individuals cleared infection faster than young individuals, possibly they also displayed exacerbated immunopathological costs (larger decline in MT function) and higher post-infection mortality. RNAi-mediated knockdown of PO response partially rescued MTs function in older beetles and resulted in increased lifespan after infection. Taken together, our data are consistent with a direct role of immunopathological consequences of immune response during ageing in insects. Our work is also the first report that highlights the pervasive role of tissue damage under diverse contexts of ageing and immune response. © 2017 The Author(s).

  18. Chemokine-mediated immune responses in the female genital tract mucosa.

    Science.gov (United States)

    Deruaz, Maud; Luster, Andrew D

    2015-04-01

    The genital tract mucosa is the site where sexually transmitted infections gain entry to the host. The immune response at this site is thus critical to provide innate protection against pathogens that are seen for the very first time as well as provide long-term pathogen-specific immunity, which would be required for an effective vaccine against sexually transmitted infection. A finely regulated immune response is therefore required to provide an effective barrier against pathogens without compromising the capacity of the genital tract to allow for successful conception and fetal development. We review recent developments in our understanding of the immune response in the female genital tract to infectious pathogens, using herpes simplex virus-2, human immunodeficiency virus-1 and Chlamydia trachomatis as examples, with a particular focus on the role of chemokines in orchestrating immune cell migration necessary to achieve effective innate and adaptive immune responses in the female genital tract.

  19. The IL23R R381Q gene variant protects against immune-mediated diseases by impairing IL-23-induced Th17 effector response in humans.

    Directory of Open Access Journals (Sweden)

    Paola Di Meglio

    2011-02-01

    Full Text Available IL-23 and Th17 cells are key players in tissue immunosurveillance and are implicated in human immune-mediated diseases. Genome-wide association studies have shown that the IL23R R381Q gene variant protects against psoriasis, Crohn's disease and ankylosing spondylitis. We investigated the immunological consequences of the protective IL23R R381Q gene variant in healthy donors. The IL23R R381Q gene variant had no major effect on Th17 cell differentiation as the frequency of circulating Th17 cells was similar in carriers of the IL23R protective (A and common (G allele. Accordingly, Th17 cells generated from A and G donors produced similar amounts of Th17 cytokines. However, IL-23-mediated Th17 cell effector function was impaired, as Th17 cells from A allele carriers had significantly reduced IL-23-induced IL-17A production and STAT3 phosphorylation compared to G allele carriers. Our functional analysis of a human disease-associated gene variant demonstrates that IL23R R381Q exerts its protective effects through selective attenuation of IL-23-induced Th17 cell effector function without interfering with Th17 differentiation, and highlights its importance in the protection against IL-23-induced tissue pathologies.

  20. The IL23R R381Q gene variant protects against immune-mediated diseases by impairing IL-23-induced Th17 effector response in humans.

    Science.gov (United States)

    Di Meglio, Paola; Di Cesare, Antonella; Laggner, Ute; Chu, Chung-Ching; Napolitano, Luca; Villanova, Federica; Tosi, Isabella; Capon, Francesca; Trembath, Richard C; Peris, Ketty; Nestle, Frank O

    2011-02-22

    IL-23 and Th17 cells are key players in tissue immunosurveillance and are implicated in human immune-mediated diseases. Genome-wide association studies have shown that the IL23R R381Q gene variant protects against psoriasis, Crohn's disease and ankylosing spondylitis. We investigated the immunological consequences of the protective IL23R R381Q gene variant in healthy donors. The IL23R R381Q gene variant had no major effect on Th17 cell differentiation as the frequency of circulating Th17 cells was similar in carriers of the IL23R protective (A) and common (G) allele. Accordingly, Th17 cells generated from A and G donors produced similar amounts of Th17 cytokines. However, IL-23-mediated Th17 cell effector function was impaired, as Th17 cells from A allele carriers had significantly reduced IL-23-induced IL-17A production and STAT3 phosphorylation compared to G allele carriers. Our functional analysis of a human disease-associated gene variant demonstrates that IL23R R381Q exerts its protective effects through selective attenuation of IL-23-induced Th17 cell effector function without interfering with Th17 differentiation, and highlights its importance in the protection against IL-23-induced tissue pathologies.

  1. CTA1-DD adjuvant promotes strong immunity against human immunodeficiency virus type 1 envelope glycoproteins following mucosal immunization.

    Science.gov (United States)

    Sundling, Christopher; Schön, Karin; Mörner, Andreas; Forsell, Mattias N E; Wyatt, Richard T; Thorstensson, Rigmor; Karlsson Hedestam, Gunilla B; Lycke, Nils Y

    2008-12-01

    Strategies to induce potent and broad antibody responses against the human immunodeficiency virus type 1 (HIV-1) envelope glycoproteins (Env) at both systemic and mucosal sites represent a central goal for HIV-1 vaccine development. Here, we show that the non-toxic CTA1-DD adjuvant promoted mucosal and systemic humoral and cell-mediated immune responses following intranasal (i.n.) immunizations with trimeric or monomeric forms of HIV-1 Env in mice and in non-human primates. Env-specific IgG subclasses in the serum of immunized mice reflected a balanced Th1/Th2 type of response. Strikingly, i.n. immunizations with Env and the CTA1-DD adjuvant induced substantial levels of mucosal anti-Env IgA in bronchial alveolar lavage and also detectable levels in vaginal secretions. By contrast, parenteral immunizations of Env formulated in Ribi did not stimulate mucosal IgA responses, while the two adjuvants induced a similar distribution of Env-specific IgG-subclasses in serum. A single parenteral boost with Env in Ribi adjuvant into mice previously primed i.n. with Env and CTA1-DD, augmented the serum anti-Env IgG levels to similar magnitudes as those observed after three intraperitoneal immunizations with Env in Ribi. The augmenting potency of CTA1-DD was similar to that of LTK63 or CpG oligodeoxynucleotides (ODN). However, in contrast to CpG ODN, the effect of CTA1-DD and LTK63 appeared to be independent of MyD88 and toll-like receptor signalling. This is the first demonstration that CTA1-DD augments specific immune responses also in non-human primates, suggesting that this adjuvant could be explored further as a clinically safe mucosal vaccine adjuvant for humoral and cell-mediated immunity against HIV-1 Env.

  2. Adrenaline influence on the immune response. II

    International Nuclear Information System (INIS)

    Depelchin, A.; Letesson, J.J.

    1981-01-01

    Experiments were carried out to specify the adrenaline target among the immunocompetent cells. Adrenaline administered for some hours exerted opposite effects on the natural PFC and RFC: the first were enhanced and the second significantly reduced. These paradoxical results were interpreted as a consequence of the inhibition of the suppressor T-cells in the resting status. Adrenaline appeared to act on the sensitive cells through beta- rather than through alpha-receptors. Further experiments on the adrenaline influence on the syngeneic barrier phenomenon and on the cellular balance at its termination seemed to indicate that adrenaline was directly inhibitory for the Ts but not for their precursors. These results are discussed in the light of the cellular networks regulating the immune response. Irradiated mice were compared with non-irradiated mice as described in the previous article. (Auth.)

  3. Immune Response to Recombinant Adenovirus in Humans: Capsid Components from Viral Input Are Targets for Vector-Specific Cytotoxic T Lymphocytes

    Science.gov (United States)

    Molinier-Frenkel, Valérie; Gahery-Segard, Hanne; Mehtali, Majid; Le Boulaire, Christophe; Ribault, Sébastien; Boulanger, Pierre; Tursz, Thomas; Guillet, Jean-Gérard; Farace, Françoise

    2000-01-01

    We previously demonstrated that a single injection of 109 PFU of recombinant adenovirus into patients induces strong vector-specific immune responses (H. Gahéry-Ségard, V. Molinier-Frenkel, C. Le Boulaire, P. Saulnier, P. Opolon, R. Lengagne, E. Gautier, A. Le Cesne, L. Zitvogel, A. Venet, C. Schatz, M. Courtney, T. Le Chevalier, T. Tursz, J.-G. Guillet, and F. Farace, J. Clin. Investig. 100:2218–2226, 1997). In the present study we analyzed the mechanism of vector recognition by cytotoxic T lymphocytes (CTL). CD8+ CTL lines were derived from two patients and maintained in long-term cultures. Target cell infections with E1-deleted and E1-plus E2-deleted adenoviruses, as well as transcription-blocking experiments with actinomycin D, revealed that host T-cell recognition did not require viral gene transcription. Target cells treated with brefeldin A were not lysed, indicating that viral input protein-derived peptides are associated with HLA class I molecules. Using recombinant capsid component-loaded targets, we observed that the three major proteins could be recognized. These results raise the question of the use of multideleted adenoviruses for gene therapy in the quest to diminish antivector CTL responses. PMID:10906225

  4. Population-expression models of immune response

    International Nuclear Information System (INIS)

    Stromberg, Sean P; Antia, Rustom; Nemenman, Ilya

    2013-01-01

    The immune response to a pathogen has two basic features. The first is the expansion of a few pathogen-specific cells to form a population large enough to control the pathogen. The second is the process of differentiation of cells from an initial naive phenotype to an effector phenotype which controls the pathogen, and subsequently to a memory phenotype that is maintained and responsible for long-term protection. The expansion and the differentiation have been considered largely independently. Changes in cell populations are typically described using ecologically based ordinary differential equation models. In contrast, differentiation of single cells is studied within systems biology and is frequently modeled by considering changes in gene and protein expression in individual cells. Recent advances in experimental systems biology make available for the first time data to allow the coupling of population and high dimensional expression data of immune cells during infections. Here we describe and develop population-expression models which integrate these two processes into systems biology on the multicellular level. When translated into mathematical equations, these models result in non-conservative, non-local advection-diffusion equations. We describe situations where the population-expression approach can make correct inference from data while previous modeling approaches based on common simplifying assumptions would fail. We also explore how model reduction techniques can be used to build population-expression models, minimizing the complexity of the model while keeping the essential features of the system. While we consider problems in immunology in this paper, we expect population-expression models to be more broadly applicable. (paper)

  5. Danger Signals Activating the Immune Response after Trauma

    Directory of Open Access Journals (Sweden)

    Stefanie Hirsiger

    2012-01-01

    Full Text Available Sterile injury can cause a systemic inflammatory response syndrome (SIRS that resembles the host response during sepsis. The inflammatory response following trauma comprises various systems of the human body which are cross-linked with each other within a highly complex network of inflammation. Endogenous danger signals (danger-associated molecular patterns; DAMPs; alarmins as well as exogenous pathogen-associated molecular patterns (PAMPs play a crucial role in the initiation of the immune response. With popularization of the “danger theory,” numerous DAMPs and PAMPs and their corresponding pathogen-recognition receptors have been identified. In this paper, we highlight the role of the DAMPs high-mobility group box protein 1 (HMGB1, interleukin-1α (IL-1α, and interleukin-33 (IL-33 as unique dual-function mediators as well as mitochondrial danger signals released upon cellular trauma and necrosis.

  6. 21 CFR 640.102 - Manufacture of Immune Globulin (Human).

    Science.gov (United States)

    2010-04-01

    ... 21 Food and Drugs 7 2010-04-01 2010-04-01 false Manufacture of Immune Globulin (Human). 640.102 Section 640.102 Food and Drugs FOOD AND DRUG ADMINISTRATION, DEPARTMENT OF HEALTH AND HUMAN SERVICES....102 Manufacture of Immune Globulin (Human). (a) Processing method. The processing method shall be one...

  7. Non specific immune response in the African catfish ...

    African Journals Online (AJOL)

    Non specific immune response in the African catfish, Heterobranchus longifilis fed diets fortified with ethanolic extracts of selected traditional medicinal plants and disease resistance against Pseudomonas aeruginosa.

  8. Qualitative and quantitative evaluation of donkeys responses to immunization by rabbits' IgG

    International Nuclear Information System (INIS)

    Hassan, A. M. E.; Saeed, A. M.

    2012-12-01

    In this study two apparently healthy donkeys were immunized with highly pure rabbit's 1gG using a revised protocol. Qualitative test using the same immuno gen was done as a primary test to eva lute the immune system response. However, the same 1gG was iodinated with 1 25I using chloramine T method and the labeled 1gG was used to quantitatively study the immune response. The two donkeys showed good response with the younger one having the best response. The obtained donkey anti rabbit sera was used as separating agent for RIA assay for human PRL. (Author)

  9. Innate immune defences in the human endometrium

    Directory of Open Access Journals (Sweden)

    Kelly Rodney W

    2003-11-01

    Full Text Available Abstract The human endometrium is an important site of innate immune defence, giving protection against uterine infection. Such protection is critical to successful implantation and pregnancy. Infection is a major cause of preterm birth and can also cause infertility and ectopic pregnancy. Natural anti-microbial peptides are key mediators of the innate immune system. These peptides, between them, have anti-bacterial, anti-fungal and anti-viral activity and are expressed at epithelial surfaces throughout the female genital tract. Two families of natural anti-microbials, the defensins and the whey acidic protein (WAP motif proteins, appear to be prominent in endometrium. The human endometrial epithelium expresses beta-defensins 1–4 and the WAP motif protein, secretory leukocyte protease inhibitor. Each beta-defensin has a different expression profile in relation to the stage of the menstrual cycle, providing potential protection throughout the cycle. Secretory leukocyte protease inhibitor is expressed during the secretory phase of the cycle and has a range of possible roles including anti-protease and anti-microbial activity as well as having effects on epithelial cell growth. The leukocyte populations in the endometrium are also a source of anti-microbial production. Neutrophils are a particularly rich source of alpha-defensins, lactoferrin, lysozyme and the WAP motif protein, elafin. The presence of neutrophils during menstruation will enhance anti-microbial protection at a time when the epithelial barrier is disrupted. Several other anti-microbials including the natural killer cell product, granulysin, are likely to have a role in endometrium. The sequential production of natural anti-microbial peptides by the endometrium throughout the menstrual cycle and at other sites in the female genital tract will offer protection from many pathogens, including those that are sexually transmitted.

  10. Sex differences in immune responses: Hormonal effects, antagonistic selection, and evolutionary consequences.

    Science.gov (United States)

    Roved, Jacob; Westerdahl, Helena; Hasselquist, Dennis

    2017-02-01

    Males and females differ in both parasite load and the strength of immune responses and these effects have been verified in humans and other vertebrates. Sex hormones act as important modulators of immune responses; the male sex hormone testosterone is generally immunosuppressive while the female sex hormone estrogen tends to be immunoenhancing. Different sets of T-helper cells (Th) have important roles in adaptive immunity, e.g. Th1 cells trigger type 1 responses which are primarily cell-mediated, and Th2 cells trigger type 2 responses which are primarily humoral responses. In our review of the literature, we find that estrogen and progesterone enhance type 2 and suppress type 1 responses in females, whereas testosterone suppresses type 2 responses and shows an inconsistent pattern for type 1 responses in males. When we combine these patterns of generally immunosuppressive and immunoenhancing effects of the sex hormones, our results imply that the sex differences in immune responses should be particularly strong in immune functions associated with type 2 responses, and less pronounced with type 1 responses. In general the hormone-mediated sex differences in immune responses may lead to genetic sexual conflicts on immunity. Thus, we propose the novel hypothesis that sexually antagonistic selection may act on immune genes shared by the sexes, and that the strength of this sexually antagonistic selection should be stronger for type 2- as compared with type 1-associated immune genes. Finally, we put the consequences of sex hormone-induced effects on immune responses into behavioral and ecological contexts, considering social mating system, sexual selection, geographical distribution of hosts, and parasite abundance. Copyright © 2016 Elsevier Inc. All rights reserved.

  11. Immune response and anamnestic immune response in children after a 3-dose primary hepatitis b vaccination

    International Nuclear Information System (INIS)

    Afzal, M.F.; Sultan, M.A.; Saleemi, A.I.

    2017-01-01

    Diseases caused by Hepatitis B virus (HBV) have a worldwide distribution. Pakistan adopted the recommendations of World Health Organization (WHO) for routine universal infant vaccination against hepatitis B in 2002, currently being administered at 6, 10, and 14 weeks of age in a combination vaccine. This study was conducted to determine the immune response and anamnestic immune response in children, 9 months-10 years of age, after a 3-dose primary Hepatitis B vaccination. Methods: This cross sectional study was conducted in the Department of Paediatrics, King Edward Medical University/Mayo Hospital, Lahore, Pakistan, from January to June, 2014. A total of 200 children of either sex between the ages of 9 months to 10 years, docu mented to have received 3 doses of hepatitis B vaccines according to Expanded Program of Immunization (6,10,14 weeks) schedule in infancy, were recruited by consecutive sampling. The level of serum anti-HBsAb by ELIZA was measured. Children with anti-HBs titers =10 mIU/mL were considered to be immune. Those with anti-HBsAb levels <10 mIU/mL were offered a booster dose of infant recombinant hepatitis B vaccine. The second serum sample was obtained 21-28 days following the administration of the booster dose and the anamnestic immune response was measured. Data was analysed using SPSS 17 to determine the relation between time interval since last vaccination and antibody titer. Chi square test was applied. Results: Of the 200 children, protective antibody response was found in 58 percent. Median serological response was 18.60 (range 2.82-65.15). Antibody levels were found to have a statistically significant (p-value 0.019) negative correlation with the time since last administration of vaccine. A booster dose of Hepatitis B vaccine was administered to all non-responders, with each registering a statistically significant (p-value 0.00) anamnestic response. Conclusion: The vaccination schedule with short dosage interval was unable to provide

  12. Respons imun humoral pada pulpitis (Humoral immune response on pulpitis)

    OpenAIRE

    Widodo, Trijoedani

    2005-01-01

    Pulpitis is an inflammation process on dental pulp tissue, and usually as the continuous of caries. The microorganism in the caries is a potential immunogenic triggering the immune respons, both humoral and celluler immune responses. The aim of this research is to explain the humoral immune response changes in the dental pulp tissues of pulpitis. This research was done on three group samples: Irreversible pulpitis, Reversible pulpitis and sound teeth as the control group. The result showed th...

  13. Innate immune response development in nestling tree swallows

    Science.gov (United States)

    Stambaugh, T.; Houdek, B.J.; Lombardo, M.P.; Thorpe, P.A.; Caldwell, Hahn D.

    2011-01-01

    We tracked the development of innate immunity in nestling Tree Swallows (Tachycineta bicolor) and compared it to that of adults using blood drawn from nestlings during days 6, 12, and 18 of the ???20-day nestling period and from adults. Innate immunity was characterized using an in vitro assay of the ability of whole blood to kill Escherichia coli. The ability of whole blood to kill E. coli increased as nestlings matured. Neither this component of innate immunity nor right wing chord length on day18 were as developed as in adults indicating that development of the innate immune system and growth both continued after fledging. Narrow sense heritability analyses suggest that females with strong immune responses produced nestlings with strong immune responses. These data suggest nestling Tree Swallows allocated sufficient energy to support rapid growth to enable fledging by day 18, but that further development of innate immunity occurred post-fledging. ?? 2011 by the Wilson Ornithological Society.

  14. Dynamic Nature of Noncoding RNA Regulation of Adaptive Immune Response

    Directory of Open Access Journals (Sweden)

    Franca Citarella

    2013-08-01

    Full Text Available Immune response plays a fundamental role in protecting the organism from infections; however, dysregulation often occurs and can be detrimental for the organism, leading to a variety of immune-mediated diseases. Recently our understanding of the molecular and cellular networks regulating the immune response, and, in particular, adaptive immunity, has improved dramatically. For many years, much of the focus has been on the study of protein regulators; nevertheless, recent evidence points to a fundamental role for specific classes of noncoding RNAs (ncRNAs in regulating development, activation and homeostasis of the immune system. Although microRNAs (miRNAs are the most comprehensive and well-studied, a number of reports suggest the exciting possibility that long ncRNAs (lncRNAs could mediate host response and immune function. Finally, evidence is also accumulating that suggests a role for miRNAs and other small ncRNAs in autocrine, paracrine and exocrine signaling events, thus highlighting an elaborate network of regulatory interactions mediated by different classes of ncRNAs during immune response. This review will explore the multifaceted roles of ncRNAs in the adaptive immune response. In particular, we will focus on the well-established role of miRNAs and on the emerging role of lncRNAs and circulating ncRNAs, which all make indispensable contributions to the understanding of the multilayered modulation of the adaptive immune response.

  15. Tetraspanins in the immune response against cancer

    NARCIS (Netherlands)

    Veenbergen, S.; van Spriel, A.B.

    2011-01-01

    The role of the immune system in the defense against cancer, a process termed tumor immunosurveillance, has been extensively studied. Evidence is accumulating that the molecular organization of proteins and lipids in the plasma membrane of immune cells is of critical importance. Tetraspanin proteins

  16. Frequent adaptive immune responses against arginase-1

    DEFF Research Database (Denmark)

    Martinenaite, Evelina; Mortensen, Rasmus Erik Johansson; Hansen, Morten

    2018-01-01

    The enzyme arginase-1 reduces the availability of arginine to tumor-infiltrating immune cells, thus reducing T-cell functionality in the tumor milieu. Arginase-1 is expressed by some cancer cells and by immune inhibitory cells, such as myeloid-derived suppressor cells (MDSCs) and tumor-associated...

  17. Long-chain inulin for stimulating an immune response

    NARCIS (Netherlands)

    de Vos, Paulus; Vogt, Leonie

    2017-01-01

    The invention relates to a long chain inulin for influencing the immune response against a pathogen. The invention also relates to a combination comprising a long chain inulin and a vaccine for influencing the immune response against a pathogen, wherein the long chain inulin is orally administrated.

  18. Risk factors for discordant immune response among HIV-infected ...

    African Journals Online (AJOL)

    Risk factors for discordant immune response among HIV-infected patients initiating antiretroviral therapy: A retrospective cohort study. ... Multivariate logistic regression models were used to estimate adjusted odds ratios (AORs) to determine associations between discordant immune response and clinical and demographic ...

  19. Importins and Exportins Regulating Allergic Immune Responses

    Directory of Open Access Journals (Sweden)

    Ankita Aggarwal

    2014-01-01

    Full Text Available Nucleocytoplasmic shuttling of macromolecules is a well-controlled process involving importins and exportins. These karyopherins recognize and bind to receptor-mediated intracellular signals through specific signal sequences that are present on cargo proteins and transport into and out of the nucleus through nuclear pore complexes. Nuclear localization signals (NLS present on cargo molecules to be imported while nuclear export signals (NES on the molecules to be exported are recognized by importins and exportins, respectively. The classical NLS are found on many transcription factors and molecules that are involved in the pathogenesis of allergic diseases. In addition, several immune modulators, including corticosteroids and vitamin D, elicit their cellular responses by regulating the expression and activity of importin molecules. In this review article, we provide a comprehensive list of importin and exportin molecules and their specific cargo that shuttled between cytoplasm and the nucleus. We also critically review the role and regulation of specific importin and exportin involved in the transport of activated transcription factors in allergic diseases, the underlying molecular mechanisms, and the potential target sites for developing better therapeutic approaches.

  20. Linear ubiquitination signals in adaptive immune responses.

    Science.gov (United States)

    Ikeda, Fumiyo

    2015-07-01

    Ubiquitin can form eight different linkage types of chains using the intrinsic Met 1 residue or one of the seven intrinsic Lys residues. Each linkage type of ubiquitin chain has a distinct three-dimensional topology, functioning as a tag to attract specific signaling molecules, which are so-called ubiquitin readers, and regulates various biological functions. Ubiquitin chains linked via Met 1 in a head-to-tail manner are called linear ubiquitin chains. Linear ubiquitination plays an important role in the regulation of cellular signaling, including the best-characterized tumor necrosis factor (TNF)-induced canonical nuclear factor-κB (NF-κB) pathway. Linear ubiquitin chains are specifically generated by an E3 ligase complex called the linear ubiquitin chain assembly complex (LUBAC) and hydrolyzed by a deubiquitinase (DUB) called ovarian tumor (OTU) DUB with linear linkage specificity (OTULIN). LUBAC linearly ubiquitinates critical molecules in the TNF pathway, such as NEMO and RIPK1. The linear ubiquitin chains are then recognized by the ubiquitin readers, including NEMO, which control the TNF pathway. Accumulating evidence indicates an importance of the LUBAC complex in the regulation of apoptosis, development, and inflammation in mice. In this article, I focus on the role of linear ubiquitin chains in adaptive immune responses with an emphasis on the TNF-induced signaling pathways. © 2015 John Wiley & Sons A/S. Published by John Wiley & Sons Ltd.

  1. Immune markers and correlates of protection for vaccine induced immune responses

    DEFF Research Database (Denmark)

    Thakur, Aneesh; Pedersen, Lasse Eggers; Jungersen, Gregers

    2012-01-01

    of an appropriate humoral response currently remain the best validated correlates of protective immunity after vaccination. Despite advancements in the field of immunology over the past few decades currently there are, however, no sufficiently validated immune correlates of vaccine induced protection against......-specific production of interferon-gamma (IFN-γ) has been promoted as a quantitative marker of protective cell-mediated immune responses over the past couple of decades. More recently, however, evidence from several infections has pointed towards the quality of the immune response, measured through increased levels...... of antigen-specific polyfunctional T cells capable of producing a triad of relevant cytokines, as a better correlate of sustained protective immunity against this type of infections. Also the possibilities to measure antigen-specific cytotoxic T cells (CTL) during infection or in response to vaccination...

  2. HLA-Driven Convergence of HIV-1 Viral Subtypes B and F Toward the Adaptation to Immune Responses in Human Populations

    Science.gov (United States)

    Dilernia, Dario Alberto; Jones, Leandro; Rodriguez, Sabrina; Turk, Gabriela; Rubio, Andrea E.; Pampuro, Sandra; Gomez-Carrillo, Manuel; Bautista, Christian; Deluchi, Gabriel; Benetucci, Jorge; Lasala, María Beatriz; Lourtau, Leonardo; Losso, Marcelo Horacio; Perez, Héctor; Cahn, Pedro; Salomón, Horacio

    2008-01-01

    Background Cytotoxic T-Lymphocyte (CTL) response drives the evolution of HIV-1 at a host-level by selecting HLA-restricted escape mutations. Dissecting the dynamics of these escape mutations at a population-level would help to understand how HLA-mediated selection drives the evolution of HIV-1. Methodology/Principal Findings We undertook a study of the dynamics of HIV-1 CTL-escape mutations by analyzing through statistical approaches and phylogenetic methods the viral gene gag sequenced in plasma samples collected between the years 1987 and 2006 from 302 drug-naïve HIV-positive patients. By applying logistic regression models and after performing correction for multiple test, we identified 22 potential CTL-escape mutations (p-value<0.05; q-value<0.2); 10 of these associations were confirmed in samples biologically independent by a Bayesian Markov Chain Monte-Carlo method. Analyzing their prevalence back in time we found that escape mutations that are the consensus residue in samples collected after 2003 have actually significantly increased in time in one of either B or F subtype until becoming the most frequent residue, while dominating the other viral subtype. Their estimated prevalence in the viral subtype they did not dominate was lower than 30% for the majority of samples collected at the end of the 80's. In addition, when screening the entire viral region, we found that the 75% of positions significantly changing in time (p<0.05) were located within known CTL epitopes. Conclusions Across HIV Gag protein, the rise of polymorphisms from independent origin during the last twenty years of epidemic in our setting was related to an association with an HLA allele. The fact that these mutations accumulated in one of either B or F subtypes have also dominated the other subtype shows how this selection might be causing a convergence of viral subtypes to variants which are more likely to evade the immune response of the population where they circulate. PMID:18941505

  3. Immunization of rabbits with highly purified, soluble, trimeric human immunodeficiency virus type 1 envelope glycoprotein induces a vigorous B cell response and broadly cross-reactive neutralization.

    Directory of Open Access Journals (Sweden)

    Gerald V Quinnan

    Full Text Available Previously we described induction of cross-reactive HIV-1 neutralizing antibody responses in rabbits using a soluble HIV-1 gp140 envelope glycoprotein (Env in an adjuvant containing monophosphoryl lipid A (MPL and QS21 (AS02A. Here, we compared different forms of the same HIV-1 strain R2 Env for antigenic and biophysical characteristics, and in rabbits characterized the extent of B cell induction for specific antibody expression and secretion and neutralizing responses. The forms of this Env that were produced in and purified from stably transformed 293T cells included a primarily dimeric gp140, a trimeric gp140 appended to a GCN4 trimerization domain (gp140-GCN4, gp140-GCN4 with a 15 amino acid flexible linker between the gp120 and gp41 ectodomain (gp140-GCN4-L, also trimeric, and a gp140 with the flexible linker purified from cell culture supernatants as either dimer (gp140-L(D or monomer (gp140-L(M. Multimeric states of the Env proteins were assessed by native gel electrophoresis and analytical ultracentrifugation. The different forms of gp140 bound broadly cross-reactive neutralizing (BCN human monoclonal antibodies (mAbs similarly in ELISA and immunoprecipitation assays. All Envs bound CD4i mAbs in the presence and absence of sCD4, as reported for the R2 Env. Weak neutralization of some strains of HIV-1 was seen after two additional doses in AS02A. Rabbits that were given a seventh dose of gp140-GCN4-L developed BCN responses that were weak to moderate, similar to our previous report. The specificity of these responses did not appear similar to that of any of the known BCN human mAbs. Induction of spleen B cell and plasma cells producing immunoglobulins that bound trimeric gp140-GCN4-L was vigorous, based on ELISpot and flow cytometry analyses. The results demonstrate that highly purified gp140-GCN4-L trimer in adjuvant elicits BCN responses in rabbits accompanied by vigorous B cell induction.

  4. Effects of Stressor Controllability on Acute Stress Responses: Cardiovascular, Neuroendocrine, and Immune Responses

    OpenAIRE

    磯和, 勅子; Isowa, Tokiko

    2008-01-01

    This thesis is concerned with the effects of controllability over acute stressors on psychological and physiological responses intermediated by immune, cardiovascular, neuroendocrine systems. The effects of stressor controllability have been examined in animal studies based on the learned helplessness theory. However, there were few studies in human. Especially, there were remarkably few studies that examined the effects of stressor controllability on immunological system. In addition, result...

  5. Effect of oral administration of Lactobacillus paracasei L9 on mouse systemic immunity and the immune response in the intestine

    Directory of Open Access Journals (Sweden)

    Zhu Yuanbo

    2016-01-01

    Full Text Available A probiotic strain Lactobacillus paracasei L9,which was isolated from human intestine, was investigated for its immunomodulatory activity in vivo. Results showed that L9 improved systemic immunity by enhancing the phagocytic activity of peritoneal macrophages, the proliferation ratio of splenocytes, the IgG level in the serum and the level of IgA in the mucosa. Further, L9induced theTh1-polarized immune response by elevating the IFN-γ/IL-4 ratio in the mucosa. This effect was confirmed by the enhanced IL-12-inducing activity of macrophages after in vitro stimulation of L9. Also detected was increased expression of TLR-2mRNA in the mucosa. We predict that L9 could enhance innate immunity by activating TLR-2 in the mucosa, and enhance acquired immunity by promoting Th1 polarization through induced production of IL-12 by macrophages.

  6. Immune response induction in the central nervous system

    DEFF Research Database (Denmark)

    Owens, Trevor; Babcock, Alicia

    2002-01-01

    The primary function of the immune response is protection of the host against infection with pathogens, including viruses. Since viruses can infect any tissue of the body, including the central nervous system (CNS), it is logical that cells of the immune system should equally have access to all...... tissues. Nevertheless, the brain and spinal cord are noted for their lack of immune presence. Relative to other organ systems, the CNS appears immunologically privileged. Furthermore, when immune responses do occur in the CNS, they are frequently associated with deleterious effects such as inflammatory...

  7. Immune responses to influenza virus and its correlation to age and inherited factors

    Directory of Open Access Journals (Sweden)

    Azadeh Bahadoran

    2016-11-01

    Full Text Available Influenza viruses belong to the family Orthomyxoviridae of enveloped viruses and are an important cause of respiratory infections worldwide. The influenza virus is able to infect a wide variety species as diverse as poultry, marine, pigs, horses and humans. Upon infection with influenza virus the innate immunity plays a critical role in efficient and rapid control of viral infections as well as in adaptive immunity initiation. The humoral immune system produces antibodies against different influenza antigens, of which the HA-specific antibody is the most important for neutralization of the virus and thus prevention of illness. Cell mediated immunity including CD4+ helper T cells and CD8+ cytotoxic T cells are the other arms of adaptive immunity induced upon influenza virus infection. The complex inherited factors and age related changes are associated with the host immune responses. Here, we review the different components of immune responses against influenza virus. Additionally, the correlation of the immune response to age and inherited factors has been discussed. These determinations lead to a better understanding of the limitations of immune responses for developing improved vaccines to control influenza virus infection.

  8. The innate immune response during urinary tract infection and pyelonephritis.

    Science.gov (United States)

    Spencer, John David; Schwaderer, Andrew L; Becknell, Brian; Watson, Joshua; Hains, David S

    2014-07-01

    Despite its proximity to the fecal flora, the urinary tract is considered sterile. The precise mechanisms by which the urinary tract maintains sterility are not well understood. Host immune responses are critically important in the antimicrobial defense of the urinary tract. During recent years, considerable advances have been made in our understanding of the mechanisms underlying immune homeostasis of the kidney and urinary tract. Dysfunctions in these immune mechanisms may result in acute disease, tissue destruction and overwhelming infection. The objective of this review is to provide an overview of the innate immune response in the urinary tract in response to microbial assault. In doing so, we focus on the role of antimicrobial peptides-a ubiquitous component of the innate immune response.

  9. Serum and mucosal immune responses to an inactivated influenza virus vaccine induced by epidermal powder immunization.

    Science.gov (United States)

    Chen, D; Periwal, S B; Larrivee, K; Zuleger, C; Erickson, C A; Endres, R L; Payne, L G

    2001-09-01

    Both circulating and mucosal antibodies are considered important for protection against infection by influenza virus in humans and animals. However, current inactivated vaccines administered by intramuscular injection using a syringe and needle elicit primarily circulating antibodies. In this study, we report that epidermal powder immunization (EPI) via a unique powder delivery system elicits both serum and mucosal antibodies to an inactivated influenza virus vaccine. Serum antibody responses to influenza vaccine following EPI were enhanced by codelivery of cholera toxin (CT), a synthetic oligodeoxynucleotide containing immunostimulatory CpG motifs (CpG DNA), or the combination of these two adjuvants. In addition, secretory immunoglobulin A (sIgA) antibodies were detected in the saliva and mucosal lavages of the small intestine, trachea, and vaginal tract, although the titers were much lower than the IgG titers. The local origin of the sIgA antibodies was further shown by measuring antibodies released from cultured tracheal and small intestinal fragments and by detecting antigen-specific IgA-secreting cells in the lamina propria using ELISPOT assays. EPI with a single dose of influenza vaccine containing CT or CT and CpG DNA conferred complete protection against lethal challenges with an influenza virus isolated 30 years ago, whereas a prime and boost immunizations were required for protection in the absence of an adjuvant. The ability to elicit augmented circulating antibody and mucosal antibody responses makes EPI a promising alternative to needle injection for administering vaccines against influenza and other diseases.

  10. Yersinia type III effectors perturb host innate immune responses

    Science.gov (United States)

    Pha, Khavong; Navarro, Lorena

    2016-01-01

    The innate immune system is the first line of defense against invading pathogens. Innate immune cells recognize molecular patterns from the pathogen and mount a response to resolve the infection. The production of proinflammatory cytokines and reactive oxygen species, phagocytosis, and induced programmed cell death are processes initiated by innate immune cells in order to combat invading pathogens. However, pathogens have evolved various virulence mechanisms to subvert these responses. One strategy utilized by Gram-negative bacterial pathogens is the deployment of a complex machine termed the type III secretion system (T3SS). The T3SS is composed of a syringe-like needle structure and the effector proteins that are injected directly into a target host cell to disrupt a cellular response. The three human pathogenic Yersinia spp. (Y. pestis, Y. enterocolitica, and Y. pseudotuberculosis) are Gram-negative bacteria that share in common a 70 kb virulence plasmid which encodes the T3SS. Translocation of the Yersinia effector proteins (YopE, YopH, YopT, YopM, YpkA/YopO, and YopP/J) into the target host cell results in disruption of the actin cytoskeleton to inhibit phagocytosis, downregulation of proinflammatory cytokine/chemokine production, and induction of cellular apoptosis of the target cell. Over the past 25 years, studies on the Yersinia effector proteins have unveiled tremendous knowledge of how the effectors enhance Yersinia virulence. Recently, the long awaited crystal structure of YpkA has been solved providing further insights into the activation of the YpkA kinase domain. Multisite autophosphorylation by YpkA to activate its kinase domain was also shown and postulated to serve as a mechanism to bypass regulation by host phosphatases. In addition, novel Yersinia effector protein targets, such as caspase-1, and signaling pathways including activation of the inflammasome were identified. In this review, we summarize the recent discoveries made on Yersinia

  11. Evidence Report: Risk of Crew Adverse Health Event Due to Altered Immune Response

    Science.gov (United States)

    Crucian, Brian; Sams, Clarence F.

    2013-01-01

    The Risk of Crew Adverse Health Event Due to Altered Immune Response is identified by the National Aeronautics and Space Administration (NASA) Human Research Program (HRP) as a recognized risk to human health and performance in space. The HRP Program Requirements Document (PRD) defines these risks. This Evidence Report provides a summary of the evidence that has been used to identify and characterize this risk. It is known that human immune function is altered in- and post-flight, but it is unclear at present if such alterations lead to increased susceptibility to disease. Reactivation of latent viruses has been documented in crewmembers, although this reactivation has not been directly correlated with immune changes or with observed diseases. As described in this report, further research is required to better characterize the relationships between altered immune response and susceptibility to disease during and after spaceflight. This is particularly important for future deep-space exploration missions.

  12. Gene-environment interactions in multiple sclerosis: innate and adaptive immune responses to human endogenous retrovirus and herpesvirus antigens and the lectin complement activation pathway

    DEFF Research Database (Denmark)

    Christensen, Tove; Petersen, Thor; Thiel, Steffen

    2006-01-01

    -associated molecular pattern recognition: mannan-binding lectin (MBL), and MASP-2 and MASP-3. For representative MS families, we also determined herpesvirus serology for HSV-1, VZV, and EBV; and tissue typed for HLA-B, and HLA DR and DQ. In MS, a significant correlation between elevated immune reactivity to HERV-H Env...

  13. Gene-environment interactions in multiple sclerosis: Innate and adaptive immune responses to human endogenous retrovirus and herpesvirus antigens and the lectin complement activation pathway

    DEFF Research Database (Denmark)

    Christensen, Tove; Petersen, Thor; Thiel, Steffen

    2007-01-01

    -associated molecular pattern recognition: mannan-binding lectin (MBL), and MASP-2 and MASP-3. For representative MS families, we also determined herpesvirus serology for HSV-1, VZV, and EBV; and tissue typed for HLA-B, and HLA DR and DQ. In MS, a significant correlation between elevated immune reactivity to HERV-H Env...

  14. Immune response in the lungs following oral immunization with bacterial lysates of respiratory pathogens.

    OpenAIRE

    Ruedl, C; Frühwirth, M; Wick, G; Wolf, H

    1994-01-01

    We have investigated the local immune response of the BALB/c mouse respiratory tract after oral immunization with a bacterial lysate of seven common respiratory pathogens. After two immunization on five consecutive days, we examined the immunoglobulin (immunoglobulin G [IgG], IgM, and IgA) secretion rates of cells isolated from the lungs and compared them with those of spleen cells of orally immunized and nonimmunized animals by using a new test system based on time-resolved fluorescence. The...

  15. Immunomodulator-based enhancement of anti smallpox immune responses.

    Science.gov (United States)

    Martínez, Osmarie; Miranda, Eric; Ramírez, Maite; Santos, Saritza; Rivera, Carlos; Vázquez, Luis; Sánchez, Tomás; Tremblay, Raymond L; Ríos-Olivares, Eddy; Otero, Miguel

    2015-01-01

    The current live vaccinia virus vaccine used in the prevention of smallpox is contraindicated for millions of immune-compromised individuals. Although vaccination with the current smallpox vaccine produces protective immunity, it might result in mild to serious health complications for some vaccinees. Thus, there is a critical need for the production of a safe virus-free vaccine against smallpox that is available to everyone. For that reason, we investigated the impact of imiquimod and resiquimod (Toll-like receptors agonists), and the codon-usage optimization of the vaccinia virus A27L gene in the enhancement of the immune response, with intent of producing a safe, virus-free DNA vaccine coding for the A27 vaccinia virus protein. We analyzed the cellular-immune response by measuring the IFN-γ production of splenocytes by ELISPOT, the humoral-immune responses measuring total IgG and IgG2a/IgG1 ratios by ELISA, and the TH1 and TH2 cytokine profiles by ELISA, in mice immunized with our vaccine formulation. The proposed vaccine formulation enhanced the A27L vaccine-mediated production of IFN-γ on mouse spleens, and increased the humoral immunity with a TH1-biased response. Also, our vaccine induced a TH1 cytokine milieu, which is important against viral infections. These results support the efforts to find a new mechanism to enhance an immune response against smallpox, through the implementation of a safe, virus-free DNA vaccination platform.

  16. Interplay between behavioural thermoregulation and immune response in mealworms.

    Science.gov (United States)

    Catalán, Tamara P; Niemeyer, Hermann M; Kalergis, Alexis M; Bozinovic, Francisco

    2012-11-01

    Since the preferential body temperature should positively correlate with physiological performance, behavioural fever should enhance an organism's immune response under an immune challenge. Here we have studied the preferential body temperature (T(p)) and its consequences on immune response performance after an immune challenge in larvae of Tenebrio molitor. We evaluated T(p) and immune responses of larvae following a challenge with various concentrations of lipopolysaccharide (LPS), and we studied the correlation between T(p) and two immune traits, namely antibacterial and phenoloxidase (PO) activities. Larvae that were immune challenged with higher LPS concentrations (C(50) and C(100)) preferred in average, warmer temperatures than did larvae challenged with lower concentrations (C(0) and C(25)). T(p) of C(25)-C(100) (challenged)-mealworms was 2.3°C higher than of C(0) (control) larvae. At lower LPS concentration immune challenge (C(0) and C(25)) antibacterial activity correlated positively with T(p), but at C(50) and C(100) correlation was lose. PO activity was higher at higher LPS concentration, but its magnitude of response did not correlate with T(p) Our data suggest that behavioural fever may have a positive effect on host performance by enhancing antibacterial response under a low pathogen load situation. Copyright © 2012 Elsevier Ltd. All rights reserved.

  17. Interplay between immune responses to HLA and non-HLA self-antigens in allograft rejection.

    Science.gov (United States)

    Angaswamy, Nataraju; Tiriveedhi, Venkataswarup; Sarma, Nayan J; Subramanian, Vijay; Klein, Christina; Wellen, Jason; Shenoy, Surendra; Chapman, William C; Mohanakumar, T

    2013-11-01

    Recent studies strongly suggest an increasing role for immune responses against self-antigens (Ags) which are not encoded by the major histocompatibility complex in the immunopathogenesis of allograft rejection. Although, improved surgical techniques coupled with improved methods to detect and avoid sensitization against donor human leukocyte antigen (HLA) have improved the immediate and short term function of transplanted organs. However, acute and chronic rejection still remains a vexing problem for the long term function of the transplanted organ. Immediately following organ transplantation, several factors both immune and non immune mechanisms lead to the development of local inflammatory milieu which sets the stage for allograft rejection. Traditionally, development of antibodies (Abs) against mismatched donor HLA have been implicated in the development of Ab mediated rejection. However, recent studies from our laboratory and others have demonstrated that development of humoral and cellular immune responses against non-HLA self-Ags may contribute in the pathogenesis of allograft rejection. There are reports demonstrating that immune responses to self-Ags especially Abs to the self-Ags as well as cellular immune responses especially through IL17 has significant pro-fibrotic properties leading to chronic allograft failure. This review summarizes recent studies demonstrating the role for immune responses to self-Ags in allograft immunity leading to rejection as well as present recent evidence suggesting there is interplay between allo- and autoimmunity leading to allograft dysfunction. Copyright © 2013 American Society for Histocompatibility and Immunogenetics. Published by Elsevier Inc. All rights reserved.

  18. Immune response at birth, long-term immune memory and 2 years follow-up after in-utero anti-HBV DNA immunization.

    Science.gov (United States)

    Fazio, V M; Ria, F; Franco, E; Rosati, P; Cannelli, G; Signori, E; Parrella, P; Zaratti, L; Iannace, E; Monego, G; Blogna, S; Fioretti, D; Iurescia, S; Filippetti, R; Rinaldi, M

    2004-03-01

    Infections occurring at the end of pregnancy, during birth or by breastfeeding are responsible for the high toll of death among first-week infants. In-utero DNA immunization has demonstrated the effectiveness in inducing specific immunity in newborns. A major contribution to infant immunization would be achieved if a vaccine proved able to be protective as early as at the birth, preventing the typical 'first-week infections'. To establish its potential for use in humans, in-utero DNA vaccination efficiency has to be evaluated for short- and long-term safety, protection at delivery, efficacy of boosts in adults and effective window/s for modulation of immune response during pregnancy, in an animal model suitable with human development. Here we show that a single intramuscular in-utero anti-HBV DNA immunization at two-thirds of pig gestation produces, at birth, antibody titers considered protective in humans. The boost of antibody titers in every animal following recall at 4 and 10 months demonstrates the establishment of immune memory. The safety of in-utero fetus manipulation is guaranteed by short-term (no fetus loss, lack of local alterations, at-term spontaneous delivery, breastfeeding) and long-term (2 years) monitoring. Treatment of fetuses closer to delivery results in immune ignorance without induction of tolerance. This result highlights the repercussion of selecting the appropriate time point when this approach is used to deliver therapeutic genes. All these findings illustrate the relevance of naked DNA-based vaccination technology in therapeutic efforts aimed to prevent the high toll of death among first-week infants.

  19. Fluorescent dye labeled influenza virus mainly infects innate immune cells and activated lymphocytes and can be used in cell-mediated immune response assay

    OpenAIRE

    Xie, Dongxu

    2009-01-01

    Early results have recognized that influenza virus infects the innate and adaptive immune cells. The data presented in this paper demonstrated that influenza virus labeled with fluorescent dye not only retained the ability to infect and replicate in host cells, but also stimulated a similar human immune response as did unlabeled virus. Influenza virus largely infected the innate and activated adaptive immune cells. Influenza B type virus was different from that of A type virus. B type virus w...

  20. Study of the integrated immune response induced by an inactivated EV71 vaccine.

    Directory of Open Access Journals (Sweden)

    Longding Liu

    Full Text Available Enterovirus 71 (EV71, a major causative agent of hand-foot-and-mouth disease (HFMD, causes outbreaks among children in the Asia-Pacific region. A vaccine is urgently needed. Based on successful pre-clinical work, phase I and II clinical trials of an inactivated EV71 vaccine, which included the participants of 288 and 660 respectively, have been conducted. In the present study, the immune response and the correlated modulation of gene expression in the peripheral blood mononuclear cells (PBMCs of 30 infants (6 to 11 months immunized with this vaccine or placebo and consented to join this study in the phase II clinical trial were analyzed. The results showed significantly greater neutralizing antibody and specific T cell responses in vaccine group after two inoculations on days 0 and 28. Additionally, more than 600 functional genes that were up- or down-regulated in PBMCs were identified by the microarray assay, and these genes included 68 genes associated with the immune response in vaccine group. These results emphasize the gene expression profile of the immune system in response to an inactivated EV71 vaccine in humans and confirmed that such an immune response was generated as the result of the positive mobilization of the immune system. Furthermore, the immune response was not accompanied by the development of a remarkable inflammatory response.NCT01391494 and NCT01512706.

  1. Functional characterization of Foxp3-specific spontaneous immune responses

    DEFF Research Database (Denmark)

    Larsen, Susanne Købke; Munir, S; Andersen, Anders Woetmann

    2013-01-01

    Tumor-infiltrating CD4+CD25+ regulatory T cells (Tregs) are associated with an impaired prognosis in several cancers. The transcription factor forkhead box P3 (Foxp3) is generally expressed in Tregs. Here, we identify and characterize spontaneous cytotoxic immune responses to Foxp3-expressing cel....... Consequently, induction of Foxp3-specific cytotoxic T-cell responses appears as an attractive tool to boost spontaneous or therapeutically provoked immune responses, for example, for the therapy of cancer....

  2. The Role of the Immune Response in Merkel Cell Carcinoma

    International Nuclear Information System (INIS)

    Triozzi, Pierre L.; Fernandez, Anthony P.

    2013-01-01

    Merkel cell carcinoma (MCC) is an aggressive neuroendocrine skin cancer. The Merkel cell polyomavirus (MCPyV) is implicated in its pathogenesis. Immune mechanisms are also implicated. Patients who are immunosuppressed have an increased risk. There is evidence that high intratumoral T-cell counts and immune transcripts are associated with favorable survival. Spontaneous regressions implicate immune effector mechanisms. Immunogenicity is also supported by observation of autoimmune paraneoplastic syndromes. Case reports suggest that immune modulation, including reduction of immune suppression, can result in tumor regression. The relationships between MCPyV infection, the immune response, and clinical outcome, however, remain poorly understood. Circulating antibodies against MCPyV antigens are present in most individuals. MCPyV-reactive T cells have been detected in both MCC patients and control subjects. High intratumoral T-cell counts are also associated with favorable survival in MCPyV-negative MCC. That the immune system plays a central role in preventing and controlling MCC is supported by several observations. MCCs often develop, however, despite the presence of humoral and cellular immune responses. A better understanding on how MCPyV and MCC evade the immune response will be necessary to develop effective immunotherapies

  3. The Role of the Immune Response in Merkel Cell Carcinoma

    Energy Technology Data Exchange (ETDEWEB)

    Triozzi, Pierre L., E-mail: triozzp@ccf.org [Taussig Cancer Institute, Cleveland Clinic Foundation, 9500 Euclid Avenue, Cleveland, OH 44195 (United States); Fernandez, Anthony P. [Departments of Dermatology and Anatomic Pathology, Cleveland Clinic Foundation, 9500 Euclid Avenue, Cleveland, OH 44195 (United States)

    2013-02-28

    Merkel cell carcinoma (MCC) is an aggressive neuroendocrine skin cancer. The Merkel cell polyomavirus (MCPyV) is implicated in its pathogenesis. Immune mechanisms are also implicated. Patients who are immunosuppressed have an increased risk. There is evidence that high intratumoral T-cell counts and immune transcripts are associated with favorable survival. Spontaneous regressions implicate immune effector mechanisms. Immunogenicity is also supported by observation of autoimmune paraneoplastic syndromes. Case reports suggest that immune modulation, including reduction of immune suppression, can result in tumor regression. The relationships between MCPyV infection, the immune response, and clinical outcome, however, remain poorly understood. Circulating antibodies against MCPyV antigens are present in most individuals. MCPyV-reactive T cells have been detected in both MCC patients and control subjects. High intratumoral T-cell counts are also associated with favorable survival in MCPyV-negative MCC. That the immune system plays a central role in preventing and controlling MCC is supported by several observations. MCCs often develop, however, despite the presence of humoral and cellular immune responses. A better understanding on how MCPyV and MCC evade the immune response will be necessary to develop effective immunotherapies.

  4. Caracterización de las respuestas inmunocelular y humoral en pacientes con virus del papiloma humano Characterization of humoral and cellular immune responses in patients with human papilloma virus

    Directory of Open Access Journals (Sweden)

    María del Carmen Clares Pochet

    2012-09-01

    Full Text Available Se realizó un estudio descriptivo y transversal de 30 féminas con infección por el virus del papiloma humano, atendidas en la consulta de Inmunología del Policlínico de Especialidades perteneciente al Hospital Provincial Docente Clinicoquirúrgico "Saturnino Lora Torres" de Santiago de Cuba, desde junio del 2009 hasta igual mes del 2010, a fin de caracterizarlas según la respuesta inmunitaria. Para evaluar la respuesta inmune celular y humoral se empleó el test de rosetas y la cuantificación de inmunoglobulinas, respectivamente. En la serie prevaleció la infección por el virus antes mencionado en las mujeres de 25-35 años (40,0 %, en especial las procedentes de la zona urbana y se evidenció una disminución de la respuesta celular significativa con relación a la humoral.A descriptive and cross-sectional study was carried out in 30 females infected with the human papilloma virus, attended in the office of Immunology of the Specialty Polyclinic belonging to "Saturnino Lora" Provincial Clinical Surgical Teaching Hospital in Santiago de Cuba, from June 2009 to June 2010, in order to characterize them according to immune response. To evaluate the humoral and cellular immune response rosetting assay and quantification of immunoglobulines were used respectively. Women between 25-36 years of age (40 % infected with this virus, especially those coming from urban areas, prevailed in the series, and a significant decrease of the cellular response as compared to the humoral response was evidenced.

  5. Pleurodeles Waltl Humoral Immune Response under Spaceflight Conditions

    Science.gov (United States)

    Bascove, Matthieu; Touche, Nadege; Frippiat, Jean-Pol

    2008-06-01

    The immune system is an important regulatory mechanism affected by spaceflights. In a previous work, we performed a first study of the humoral immune response induced by the immunization of Pleurodeles waltl during a 5 months stay onboard the Mir space station. This analysis indicated that heavy-chain variable domains of specific IgM are encoded by genes of the VHII and VHVI families. However, the contributions of these two families to IgM heavy-chains are different in flown animals [1]. To better understand this immune response modification, we have now determined how individual VH genes have been used to build specific IgM binding sites in animals immunized on earth or in space. This new study revealed quantitative and qualitative modifications in VH genes expression. These data confirm that a spaceflight might affect the humoral response.

  6. Aggression, Social Stress, and the Immune System in Humans and Animal Models

    Directory of Open Access Journals (Sweden)

    Aki Takahashi

    2018-03-01

    Full Text Available Social stress can lead to the development of psychological problems ranging from exaggerated anxiety and depression to antisocial and violence-related behaviors. Increasing evidence suggests that the immune system is involved in responses to social stress in adulthood. For example, human studies show that individuals with high aggression traits display heightened inflammatory cytokine levels and dysregulated immune responses such as slower wound healing. Similar findings have been observed in patients with depression, and comorbidity of depression and aggression was correlated with stronger immune dysregulation. Therefore, dysregulation of the immune system may be one of the mediators of social stress that produces aggression and/or depression. Similar to humans, aggressive animals also show increased levels of several proinflammatory cytokines, however, unlike humans these animals are more protected from infectious organisms and have faster wound healing than animals with low aggression. On the other hand, subordinate animals that receive repeated social defeat stress have been shown to develop escalated and dysregulated immune responses such as glucocorticoid insensitivity in monocytes. In this review we synthesize the current evidence in humans, non-human primates, and rodents to show a role for the immune system in responses to social stress leading to psychiatric problems such as aggression or depression. We argue that while depression and aggression represent two fundamentally different behavioral and physiological responses to social stress, it is possible that some overlapped, as well as distinct, pattern of immune signaling may underlie both of them. We also argue the necessity of studying animal models of maladaptive aggression induced by social stress (i.e., social isolation for understanding neuro-immune mechanism of aggression, which may be relevant to human aggression.

  7. Aggression, Social Stress, and the Immune System in Humans and Animal Models.

    Science.gov (United States)

    Takahashi, Aki; Flanigan, Meghan E; McEwen, Bruce S; Russo, Scott J

    2018-01-01

    Social stress can lead to the development of psychological problems ranging from exaggerated anxiety and depression to antisocial and violence-related behaviors. Increasing evidence suggests that the immune system is involved in responses to social stress in adulthood. For example, human studies show that individuals with high aggression traits display heightened inflammatory cytokine levels and dysregulated immune responses such as slower wound healing. Similar findings have been observed in patients with depression, and comorbidity of depression and aggression was correlated with stronger immune dysregulation. Therefore, dysregulation of the immune system may be one of the mediators of social stress that produces aggression and/or depression. Similar to humans, aggressive animals also show increased levels of several proinflammatory cytokines, however, unlike humans these animals are more protected from infectious organisms and have faster wound healing than animals with low aggression. On the other hand, subordinate animals that receive repeated social defeat stress have been shown to develop escalated and dysregulated immune responses such as glucocorticoid insensitivity in monocytes. In this review we synthesize the current evidence in humans, non-human primates, and rodents to show a role for the immune system in responses to social stress leading to psychiatric problems such as aggression or depression. We argue that while depression and aggression represent two fundamentally different behavioral and physiological responses to social stress, it is possible that some overlapped, as well as distinct, pattern of immune signaling may underlie both of them. We also argue the necessity of studying animal models of maladaptive aggression induced by social stress (i.e., social isolation) for understanding neuro-immune mechanism of aggression, which may be relevant to human aggression.

  8. HTLV-1, Immune Response and Autoimmunity

    Directory of Open Access Journals (Sweden)

    Juarez A S Quaresma

    2015-12-01

    Full Text Available Human T-lymphotropic virus type-1 (HTLV-1 infection is associated with adult T-cell leukemia/lymphoma (ATL. Tropical spastic paraparesis/HTLV-1-associated myelopathy (PET/HAM is involved in the development of autoimmune diseases including Rheumatoid Arthritis (RA, Systemic Lupus Erythematosus (SLE, and Sjögren’s Syndrome (SS. The development of HTLV-1-driven autoimmunity is hypothesized to rely on molecular mimicry, because virus-like particles can trigger an inflammatory response. However, HTLV-1 modifies the behavior of CD4+ T cells on infection and alters their cytokine production. A previous study showed that in patients infected with HTLV-1, the activity of regulatory CD4+ T cells and their consequent expression of inflammatory and anti-inflammatory cytokines are altered. In this review, we discuss the mechanisms underlying changes in cytokine release leading to the loss of tolerance and development of autoimmunity.

  9. Hepatitis B Virus Vaccine immune response in Egyptian children 15 ...

    African Journals Online (AJOL)

    Egypt J Pediatr Allergy Immunol 2015;13(2):45-48. 45. Hepatitis B Virus Vaccine immune response in Egyptian children 15-17 years after primary immunization; should we provide a booster dose? INTRODUCTION. Hepatitis B virus (HBV) infection is a global public health problem. With approximately 350 million hepatitis B ...

  10. Humoral and cellular immune responses to modified hepatitis B ...

    African Journals Online (AJOL)

    Purpose: To evaluate the immunogenicity and types of immune response of a quality-controlled modified recombinant hepatitis B surface antigen (HBsAg) plasmid encoding HBsAg in mice. Methods: The characterized plasmid DNA was used in the immunization of Balb/c mice. Three groups of mice were intramuscularly ...

  11. Modulation of the immune response by emotional stress

    NARCIS (Netherlands)

    Croiset, G; Heijnen, C J; Veldhuis, H D; de Wied, D; Ballieux, R E

    1987-01-01

    The influence of mild, emotional stress was investigated for its effect on the immune system by subjecting rats to the one-trial-learning passive avoidance test. The reactivity of the immune system was tested by determining the proliferative response after mitogenic stimulation in vitro as well as

  12. Reprogramming Antitumor Immune Responses with microRNAs

    Science.gov (United States)

    2013-10-01

    disease, including cancer etiology (4) and the generation and inhibition of antitumor immune responses (5–9). Biologically active miRNAs bind to MREs...breast, colorectal, lung, pancreatic , and thyroid carcinomas and in liquid tumors including lymphomas and some acute myeloid leukemias (9, 35). The...immunity [9], underscoring the potential of targeting this major microenvironmental compartment. Accumulating evidence suggests that chronic

  13. The sterile immune response during hepatic ischemia/reperfusion

    NARCIS (Netherlands)

    van Golen, Rowan F.; van Gulik, Thomas M.; Heger, Michal

    2012-01-01

    Hepatic ischemia and reperfusion elicits an immune response that lacks a microbial constituent yet poses a potentially lethal threat to the host. In this sterile setting, the immune system is alarmed by endogenous danger signals that are release by stressed and dying liver cells. The detection of

  14. Immune and stress responses in oysters with insights on adaptation.

    Science.gov (United States)

    Guo, Ximing; He, Yan; Zhang, Linlin; Lelong, Christophe; Jouaux, Aude

    2015-09-01

    Oysters are representative bivalve molluscs that are widely distributed in world oceans. As successful colonizers of estuaries and intertidal zones, oysters are remarkably resilient against harsh environmental conditions including wide fluctuations in temperature and salinity as well as prolonged air exposure. Oysters have no adaptive immunity but can thrive in microbe-rich estuaries as filter-feeders. These unique adaptations make oysters interesting models to study the evolution of host-defense systems. Recent advances in genomic studies including sequencing of the oyster genome have provided insights into oyster's immune and stress responses underlying their amazing resilience. Studies show that the oyster genomes are highly polymorphic and complex, which may be key to their resilience. The oyster genome has a large gene repertoire that is enriched for immune and stress response genes. Thousands of genes are involved in oyster's immune and stress responses, through complex interactions, with many gene families expanded showing high sequence, structural and functional diversity. The high diversity of immune receptors and effectors may provide oysters with enhanced specificity in immune recognition and response to cope with diverse pathogens in the absence of adaptive immunity. Some members of expanded immune gene families have diverged to function at different temperatures and salinities or assumed new roles in abiotic stress response. Most canonical innate immunity pathways are conserved in oysters and supported by a large number of diverse and often novel genes. The great diversity in immune and stress response genes exhibited by expanded gene families as well as high sequence and structural polymorphisms may be central to oyster's adaptation to highly stressful and widely changing environments. Copyright © 2015 Elsevier Ltd. All rights reserved.

  15. Superior therapeutic efficacy of alphavirus-mediated immunization against human papilloma virus type 16 antigens in a murine tumour model : effects of the route of immunization

    NARCIS (Netherlands)

    Daemen, T; Riezebos-Brilman, A; Regts, J; Dontje, B; van der Zee, A; Wilschut, J

    2004-01-01

    In our efforts to develop a strong, effective immune response against cervical carcinoma and premalignant disease, we study the use of recombinant Semliki Forest virus (SFV) encoding the oncoproteins E6 and E7 from high-risk human papilloma viruses (HPVs). Optimal immunization conditions are

  16. Models for Immune Response and Immune Evasion in MSI Cancer and Lynch Syndrome

    OpenAIRE

    Özcan, Mine

    2017-01-01

    Microsatellite-unstable (MSI) cancers occurring in the context of the hereditary Lynch syndrome or as sporadic cancers elicit pronounced tumor-specific immune responses. The pronounced immune response was shown to be closely associated with frameshift peptides (FSP) that are generated as a result of deficiency in DNA mismatch repair system leading to insertion/deletion mutations in coding microsatellites (cMS). FSP neoantigens are long antigenic amino acid stretches that bear m...

  17. Predictors of responses to immune checkpoint blockade in advanced melanoma

    DEFF Research Database (Denmark)

    Jacquelot, N; Roberti, M P; Enot, D P

    2017-01-01

    Immune checkpoint blockers (ICB) have become pivotal therapies in the clinical armamentarium against metastatic melanoma (MMel). Given the frequency of immune related adverse events and increasing use of ICB, predictors of response to CTLA-4 and/or PD-1 blockade represent unmet clinical needs....... Using a systems biology-based approach to an assessment of 779 paired blood and tumor markers in 37 stage III MMel patients, we analyzed association between blood immune parameters and the functional immune reactivity of tumor-infiltrating cells after ex vivo exposure to ICB. Based on this assay, we...

  18. Carbohydrate Mimetic Peptides Augment Carbohydrate-Reactive Immune Responses in the Absence of Immune Pathology

    Energy Technology Data Exchange (ETDEWEB)

    Hennings, Leah; Artaud, Cecile; Jousheghany, Fariba; Monzavi-Karbassi, Behjatolah; Pashov, Anastas; Kieber-Emmons, Thomas, E-mail: tke@uams.edu [Winthrop P. Rockefeller Cancer Institute and Department of Pathology, University of Arkansas for Medical Sciences, Little Rock, AR 72205 (United States)

    2011-11-11

    Among the most challenging of clinical targets for cancer immunotherapy are Tumor Associated Carbohydrate Antigens (TACAs). To augment immune responses to TACA we are developing carbohydrate mimetic peptides (CMPs) that are sufficiently potent to activate broad-spectrum anti-tumor reactivity. However, the activation of immune responses against terminal mono- and disaccharide constituents of TACA raises concerns regarding the balance between “tumor destruction” and “tissue damage”, as mono- and disaccharides are also expressed on normal tissue. To support the development of CMPs for clinical trial testing, we demonstrate in preclinical safety assessment studies in mice that vaccination with CMPs can enhance responses to TACAs without mediating tissue damage to normal cells expressing TACA. BALB/c mice were immunized with CMPs that mimic TACAs reactive with Griffonia simplicifolia lectin 1 (GS-I), and tissue reactivity of serum antibodies were compared with the tissue staining profile of GS-I. Tissues from CMP immunized mice were analyzed using hematoxylin and eosin stain, and Luxol-fast blue staining for myelination. Western blots of membranes from murine mammary 4T1 cells, syngeneic with BALB/c mice, were also compared using GS-I, immunized serum antibodies, and naive serum antibodies. CMP immunization enhanced glycan reactivities with no evidence of pathological autoimmunity in any immunized mice demonstrating that tissue damage is not an inevitable consequence of TACA reactive responses.

  19. Carbohydrate Mimetic Peptides Augment Carbohydrate-Reactive Immune Responses in the Absence of Immune Pathology

    International Nuclear Information System (INIS)

    Hennings, Leah; Artaud, Cecile; Jousheghany, Fariba; Monzavi-Karbassi, Behjatolah; Pashov, Anastas; Kieber-Emmons, Thomas

    2011-01-01

    Among the most challenging of clinical targets for cancer immunotherapy are Tumor Associated Carbohydrate Antigens (TACAs). To augment immune responses to TACA we are developing carbohydrate mimetic peptides (CMPs) that are sufficiently potent to activate broad-spectrum anti-tumor reactivity. However, the activation of immune responses against terminal mono- and disaccharide constituents of TACA raises concerns regarding the balance between “tumor destruction” and “tissue damage”, as mono- and disaccharides are also expressed on normal tissue. To support the development of CMPs for clinical trial testing, we demonstrate in preclinical safety assessment studies in mice that vaccination with CMPs can enhance responses to TACAs without mediating tissue damage to normal cells expressing TACA. BALB/c mice were immunized with CMPs that mimic TACAs reactive with Griffonia simplicifolia lectin 1 (GS-I), and tissue reactivity of serum antibodies were compared with the tissue staining profile of GS-I. Tissues from CMP immunized mice were analyzed using hematoxylin and eosin stain, and Luxol-fast blue staining for myelination. Western blots of membranes from murine mammary 4T1 cells, syngeneic with BALB/c mice, were also compared using GS-I, immunized serum antibodies, and naive serum antibodies. CMP immunization enhanced glycan reactivities with no evidence of pathological autoimmunity in any immunized mice demonstrating that tissue damage is not an inevitable consequence of TACA reactive responses

  20. Enhancement of mucosal immune responses by chimeric influenza HA/SHIV virus-like particles

    International Nuclear Information System (INIS)

    Guo Lizheng; Lu Xiaoyan; Kang, S.-M.; Chen Changyi; Compans, Richard W.; Yao Qizhi

    2003-01-01

    To enhance mucosal immune responses using simian/human immunodeficiency virus-like particles (SHIV VLPs), we have produced novel phenotypically mixed chimeric influenza HA/SHIV VLPs and used them to immunize C57BL/6J mice intranasally. Antibody and cytotoxic T-cell (CTL) responses as well as cytokine production in both systemic and mucosal sites were compared after immunization with SHIV VLPs or chimeric HA/SHIV VLPs. By using enzyme-linked immunosorbent assay (ELISA), the levels of serum IgG and mucosal IgA to the HIV envelope protein (Env) were found to be highest in the group immunized with chimeric HA/SHIV VLPs. Furthermore, the highest titer of serum neutralizing antibody against HIV Env was found with the group immunized with chimeric HA/SHIV VLPs. Analysis of the IgG1/IgG2a ratio indicated that a T H 1-oriented immune response resulted from these VLP immunizations. HA/SHIV VLP-immunized mice also showed significantly higher CTL responses than those observed in SHIV VLP-immunized mice. Moreover, a MHC class I restricted T-cell activation ELISPOT assay showed a mixed type of T H 1/T H 2 cytokines in the HA/SHIV VLP-immunized mice, indicating that the chimeric VLPs can enhance both humoral and cellular immune responses to the HIV Env protein at multiple mucosal and systemic sites. The results indicate that incorporation of influenza HA into heterotypic VLPs may be highly effective for targeting vaccines to mucosal surfaces

  1. Anopheles gambiae antiviral immune response to systemic O'nyong-nyong infection.

    Directory of Open Access Journals (Sweden)

    Joanna Waldock

    Full Text Available Mosquito-borne viral diseases cause significant burden in much of the developing world. Although host-virus interactions have been studied extensively in the vertebrate host, little is known about mosquito responses to viral infection. In contrast to mosquitoes of the Aedes and Culex genera, Anopheles gambiae, the principal vector of human malaria, naturally transmits very few arboviruses, the most important of which is O'nyong-nyong virus (ONNV. Here we have investigated the A. gambiae immune response to systemic ONNV infection using forward and reverse genetic approaches.We have used DNA microarrays to profile the transcriptional response of A. gambiae inoculated with ONNV and investigate the antiviral function of candidate genes through RNAi gene silencing assays. Our results demonstrate that A. gambiae responses to systemic viral infection involve genes covering all aspects of innate immunity including pathogen recognition, modulation of immune signalling, complement-mediated lysis/opsonisation and other immune effector mechanisms. Patterns of transcriptional regulation and co-infections of A. gambiae with ONNV and the rodent malaria parasite Plasmodium berghei suggest that hemolymph immune responses to viral infection are diverted away from melanisation. We show that four viral responsive genes encoding two putative recognition receptors, a galectin and an MD2-like receptor, and two effector lysozymes, function in limiting viral load.This study is the first step in elucidating the antiviral mechanisms of A. gambiae mosquitoes, and has revealed interesting differences between A. gambiae and other invertebrates. Our data suggest that mechanisms employed by A. gambiae are distinct from described invertebrate antiviral immunity to date, and involve the complement-like branch of the humoral immune response, supressing the melanisation response that is prominent in anti-parasitic immunity. The antiviral immune response in A. gambiae is thus

  2. Immune responses to red blood cell antigens

    NARCIS (Netherlands)

    Stegmann, T.C.

    2016-01-01

    The research described in this thesis is aimed towards elucidation of the mechanism of action of anti-D. Anti-D is administered prophylactivly to prevent alloimmunization against the immunogenic D-antigen to D⁻ pregnant women carrying a D⁺ fetus. The plasma of women who became immunized during

  3. Differential immune microenvironments and response to immune checkpoint blockade amongst molecular subtypes of murine medulloblastoma

    Science.gov (United States)

    Pham, Christina D.; Flores, Catherine; Yang, Changlin; Pinheiro, Elaine M.; Yearley, Jennifer H.; Sayour, Elias J.; Pei, Yanxin; Moore, Colin; McLendon, Roger E.; Huang, Jianping; Sampson, John H.; Wechsler-Reya, Robert; Mitchell, Duane A.

    2016-01-01

    PURPOSE Despite significant strides in the identification and characterization of potential therapeutic targets for medulloblastoma (MB), the role of the immune system and its interplay with the tumor microenvironment within these tumors are poorly understood. To address this, we adapted two syngeneic animal models of human Sonic Hedgehog (SHH)-driven and Group 3 MB for preclinical evaluation in immunocompetent C57BL/6 mice. METHODS AND RESULTS Multicolor flow cytometric analyses were used to phenotype and characterize immune infiltrating cells within established cerebellar tumors. We observed significantly higher percentages of dendritic cells, infiltrating lymphocytes, myeloid derived suppressor cells and tumor-associated macrophages in murine SHH model tumors compared with Group 3 tumors. However, murine Group 3 tumors had higher percentages of CD8+ PD-1+ T cells within the CD3 population. PD-1 blockade conferred superior antitumor efficacy in animals bearing intracranial Group 3 tumors compared to SHH group tumors, indicating that immunologic differences within the tumor microenvironment can be leveraged as potential targets to mediate antitumor efficacy. Further analysis of anti-PD-1 monoclonal antibody localization revealed binding to PD-1+ peripheral T cells, but not tumor infiltrating lymphocytes within the brain tumor microenvironment. Peripheral PD-1 blockade additionally resulted in a marked increase in CD3+ T cells within the tumor microenvironment. CONCLUSIONS This is the first immunologic characterization of preclinical models of molecular subtypes of MB and demonstration that response to immune checkpoint blockade differs across subtype classification. Our findings also suggest that effective anti-PD-1 blockade does not require that systemically administered antibodies penetrate the brain tumor microenvironment. PMID:26405194

  4. Differential Immune Microenvironments and Response to Immune Checkpoint Blockade among Molecular Subtypes of Murine Medulloblastoma.

    Science.gov (United States)

    Pham, Christina D; Flores, Catherine; Yang, Changlin; Pinheiro, Elaine M; Yearley, Jennifer H; Sayour, Elias J; Pei, Yanxin; Moore, Colin; McLendon, Roger E; Huang, Jianping; Sampson, John H; Wechsler-Reya, Robert; Mitchell, Duane A

    2016-02-01

    Despite significant strides in the identification and characterization of potential therapeutic targets for medulloblastoma, the role of the immune system and its interplay with the tumor microenvironment within these tumors are poorly understood. To address this, we adapted two syngeneic animal models of human Sonic Hedgehog (SHH)-driven and group 3 medulloblastoma for preclinical evaluation in immunocompetent C57BL/6 mice. Multicolor flow cytometric analyses were used to phenotype and characterize immune infiltrating cells within established cerebellar tumors. We observed significantly higher percentages of dendritic cells, infiltrating lymphocytes, myeloid-derived suppressor cells, and tumor-associated macrophages in murine SHH model tumors compared with group 3 tumors. However, murine group 3 tumors had higher percentages of CD8(+) PD-1(+) T cells within the CD3 population. PD-1 blockade conferred superior antitumor efficacy in animals bearing intracranial group 3 tumors compared with SHH group tumors, indicating that immunologic differences within the tumor microenvironment can be leveraged as potential targets to mediate antitumor efficacy. Further analysis of anti-PD-1 monoclonal antibody localization revealed binding to PD-1(+) peripheral T cells, but not tumor infiltrating lymphocytes within the brain tumor microenvironment. Peripheral PD-1 blockade additionally resulted in a marked increase in CD3(+) T cells within the tumor microenvironment. This is the first immunologic characterization of preclinical models of molecular subtypes of medulloblastoma and demonstration that response to immune checkpoint blockade differs across subtype classification. Our findings also suggest that effective anti-PD-1 blockade does not require that systemically administered antibodies penetrate the brain tumor microenvironment. ©2015 American Association for Cancer Research.

  5. [Effect of vitamine A on mice immune response induced by specific periodontal pathogenic bacteria-immunization].

    Science.gov (United States)

    Lin, Xiao-Ping; Zhou, Xiao-Jia; Liu, Hong-Li; DU, Li-Li; Toshihisa, Kawai

    2010-12-01

    The aim of this study was to investigate the effect of vitamine-A deficiency on the induction of specific periodontal pathogenic bacteria A. actinomycetetemcomitans(Aa) immunization. BALB/c mice were fed with vitamine A-depleted diet or control regular diet throughout the whole experiment period. After 2 weeks, immunized formalin-killed Aa to build immunized models, 6 weeks later, sacrificed to determine specific antibody-IgG, IgM and sub-class IgG antibody titers in serum, and concentration of IL-10, IFN-γ, TNF-α and RANKL in T cell supernatant were measured by ELISA and T cell proliferation was measured by cintilography. SPSS 11.5 software package was used for statistical analysis. The levels of whole IgG and IgM antibody which were immunized by Aa significantly elevated, non-immune group was unable to produce any antibody. Compared with Aa immunized+RD group, the level of whole IgG in Aa immunized+VAD group was significantly higher (Pvitamin-A diet can increase the immunized mice's susceptibility to periodontal pathogenic bacteria and trigger or aggravate immune inflammatory response. Adequate vitamin A is an important factor in maintaining body health. Supported by Natural Science Foundation of Liaoning Province (Grant No.20092139) and Science and Technology Program of Shenyang Municipality (Grant No.F10-149-9-32).

  6. Respons imun humoral pada pulpitis (Humoral immune response on pulpitis

    Directory of Open Access Journals (Sweden)

    Trijoedani Widodo

    2005-06-01

    Full Text Available Pulpitis is an inflammation process on dental pulp tissue, and usually as the continuous of caries. The microorganism in the caries is a potential immunogenic triggering the immune respons, both humoral and celluler immune responses. The aim of this research is to explain the humoral immune response changes in the dental pulp tissues of pulpitis. This research was done on three group samples: Irreversible pulpitis, Reversible pulpitis and sound teeth as the control group. The result showed that there were three pulpitis immunopathologic patterns: the sound teeth immunopathologic pattern showing a low humoral immune response, in a low level of IgG, IgA and IgM, the reversible pulpitis pattern showing that in a higher humoral immune response, IgG and IgA decreased but IgM increased, the irreversible pulpitis pattern showing that IgG and IgM increased, but it couldn't be repaired although it has highly immunity, and it showed an unusually low level of IgA. This low level of IgA meant that irreversible pulpitis had a low mucosal immunity.

  7. The role of STAT3 in leading the crosstalk between human cancers and the immune system.

    Science.gov (United States)

    Wang, Yu; Shen, Yicheng; Wang, Sinan; Shen, Qiang; Zhou, Xuan

    2018-02-28

    The development and progression of human cancers are continuously and dynamically regulated by intrinsic and extrinsic factors. As a converging point of multiple oncogenic pathways, signal transducer and activator of transcription 3 (STAT3) is constitutively activated both in tumor cells and tumor-infiltrated immune cells. Activated STAT3 persistently triggers tumor progression through direct regulation of oncogenic gene expression. Apart from its oncogenic role in regulating gene expression in tumor cells, STAT3 also paves the way for human cancer growth through immunosuppression. Activated STAT3 in immune cells results in inhibition of immune mediators and promotion of immunosuppressive factors. Therefore, STAT3 modulates the interaction between tumor cells and host immunity. Accumulating evidence suggests that targeting STAT3 may enhance anti-cancer immune responses and rescue the suppressed immunologic microenvironment in tumors. Taken together, STAT3 has emerged as a promising target in cancer immunotherapy. Copyright © 2017 Elsevier B.V. All rights reserved.

  8. GSL-enriched membrane microdomains in innate immune responses.

    Science.gov (United States)

    Nakayama, Hitoshi; Ogawa, Hideoki; Takamori, Kenji; Iwabuchi, Kazuhisa

    2013-06-01

    Many pathogens target glycosphingolipids (GSLs), which, together with cholesterol, GPI-anchored proteins, and various signaling molecules, cluster on host cell membranes to form GSL-enriched membrane microdomains (lipid rafts). These GSL-enriched membrane microdomains may therefore be involved in host-pathogen interactions. Innate immune responses are triggered by the association of pathogens with phagocytes, such as neutrophils, macrophages and dendritic cells. Phagocytes express a diverse array of pattern-recognition receptors (PRRs), which sense invading microorganisms and trigger pathogen-specific signaling. PRRs can recognize highly conserved pathogen-associated molecular patterns expressed on microorganisms. The GSL lactosylceramide (LacCer, CDw17), which binds to various microorganisms, including Candida albicans, is expressed predominantly on the plasma membranes of human mature neutrophils and forms membrane microdomains together with the Src family tyrosine kinase Lyn. These LacCer-enriched membrane microdomains can mediate superoxide generation, migration, and phagocytosis, indicating that LacCer functions as a PRR in innate immunity. Moreover, the interactions of GSL-enriched membrane microdomains with membrane proteins, such as growth factor receptors, are important in mediating the physiological properties of these proteins. Similarly, we recently found that interactions between LacCer-enriched membrane microdomains and CD11b/CD18 (Mac-1, CR3, or αMβ2-integrin) are significant for neutrophil phagocytosis of non-opsonized microorganisms. This review describes the functional role of LacCer-enriched membrane microdomains and their interactions with CD11b/CD18.

  9. Immune response in pemphigus and beyond: progresses and emerging concepts.

    Science.gov (United States)

    Di Zenzo, Giovanni; Amber, Kyle T; Sayar, Beyza S; Müller, Eliane J; Borradori, Luca

    2016-01-01

    Pemphigus vulgaris (PV) and pemphigus foliaceus (PF) are two severe autoimmune bullous diseases of the mucosae and/or skin associated with autoantibodies directed against desmoglein (Dsg) 3 and/or Dsg1. These two desmosomal cadherins, typifying stratified epithelia, are components of cell adhesion complexes called desmosomes and represent extra-desmosomal adhesion receptors. We herein review the advances in our understanding of the immune response underlying pemphigus, including human leucocyte antigen (HLA) class II-associated genetic susceptibility, characteristics of pathogenic anti-Dsg antibodies, antigenic mapping studies as well as findings about Dsg-specific B and T cells. The pathogenicity of anti-Dsg autoantibodies has been convincingly demonstrated. Disease activity and clinical phenotype correlate with anti-Dsg antibody titers and profile while passive transfer of anti-Dsg IgG from pemphigus patients' results in pemphigus-like lesions in neonatal and adult mice. Finally, adoptive transfer of splenocytes from Dsg3-knockout mice immunized with murine Dsg3 into immunodeficient mice phenotypically recapitulates PV. Although the exact pathogenic mechanisms leading to blister formation have not been fully elucidated, intracellular signaling following antibody binding has been found to be necessary for inducing cell-cell dissociation, at least for PV. These new insights not only highlight the key role of Dsgs in maintenance of tissue homeostasis but are expected to progressively change pemphigus management, paving the way for novel targeted immunologic and pharmacologic therapies.

  10. Nasal Immunization Confers High Avidity Neutralizing Antibody Response and Immunity to Primary and Recurrent Genital Herpes in Guinea Pigs

    Science.gov (United States)

    Persson, Josefine; Zhang, Yuan; Olafsdottir, Thorunn A.; Thörn, Karolina; Cairns, Tina M.; Wegmann, Frank; Sattentau, Quentin J.; Eisenberg, Roselyn J.; Cohen, Gary H.; Harandi, Ali M.

    2016-01-01

    Genital herpes is one of the most prevalent sexually transmitted infections in both the developing and developed world. Following infection, individuals experience life-long latency associated with sporadic ulcerative outbreaks. Despite many efforts, no vaccine has yet been licensed for human use. Herein, we demonstrated that nasal immunization with an adjuvanted HSV-2 gD envelope protein mounts significant protection to primary infection as well as the establishment of latency and recurrent genital herpes in guinea pigs. Nasal immunization was shown to elicit specific T cell proliferative and IFN-γ responses as well as systemic and vaginal gD-specific IgG antibody (Ab) responses. Furthermore, systemic IgG Abs displayed potent HSV-2 neutralizing properties and high avidity. By employing a competitive surface plasmon resonance (SPR) analysis combined with a battery of known gD-specific neutralizing monoclonal Abs (MAbs), we showed that nasal immunization generated IgG Abs directed to two major discontinuous neutralizing epitopes of gD. These results highlight the potential of nasal immunization with an adjuvanted HSV-2 envelope protein for induction of protective immunity to primary and recurrent genital herpes. PMID:28082979

  11. Nasal Immunization Confers High Avidity Neutralizing Antibody Response and Immunity to Primary and Recurrent Genital Herpes in Guinea Pigs.

    Science.gov (United States)

    Persson, Josefine; Zhang, Yuan; Olafsdottir, Thorunn A; Thörn, Karolina; Cairns, Tina M; Wegmann, Frank; Sattentau, Quentin J; Eisenberg, Roselyn J; Cohen, Gary H; Harandi, Ali M

    2016-01-01

    Genital herpes is one of the most prevalent sexually transmitted infections in both the developing and developed world. Following infection, individuals experience life-long latency associated with sporadic ulcerative outbreaks. Despite many efforts, no vaccine has yet been licensed for human use. Herein, we demonstrated that nasal immunization with an adjuvanted HSV-2 gD envelope protein mounts significant protection to primary infection as well as the establishment of latency and recurrent genital herpes in guinea pigs. Nasal immunization was shown to elicit specific T cell proliferative and IFN-γ responses as well as systemic and vaginal gD-specific IgG antibody (Ab) responses. Furthermore, systemic IgG Abs displayed potent HSV-2 neutralizing properties and high avidity. By employing a competitive surface plasmon resonance (SPR) analysis combined with a battery of known gD-specific neutralizing monoclonal Abs (MAbs), we showed that nasal immunization generated IgG Abs directed to two major discontinuous neutralizing epitopes of gD. These results highlight the potential of nasal immunization with an adjuvanted HSV-2 envelope protein for induction of protective immunity to primary and recurrent genital herpes.

  12. Study of the immune response to thyroglobulin through a model of experimental autoimmune thyroiditis

    International Nuclear Information System (INIS)

    Santos Castro, M. dos.

    1981-01-01

    The cellular and humoral immune response to thyroglobulin of different species was studied in guinea pigs. The experiments described suggested that the immune system can be activated against self-determinants. Human and pork thyroglobulin were able to induce the experimental thyroiditis as well as some immune responses, such as in vitro proliferative response, delayed hypersensitivity and antibodies. Although guinea pig thyroglobulin was unable to induce specific T-lymphocyte proliferation in vitro, delayed hypersensitivity response and antibodies, it was very efficient in inducing the autoimmune thyroiditis. On the contrary, bovine thyroglobulin did not induce experimental autoimmune thyroiditis despite producing good responses as determined by similar in vitro proliferative response, delayed hypersensitivity and on the humoral level. These results suggest that the assays utilised were not able to evaluate the relevant immune response to genesis of the thyroiditis. The determinant selection mechanisms operating in these immune responses are probably selecting determinants not responsible for self-recognition in vivo. It was suggested that the macrophage could be the cell responsible for the presentation of these determinants to the lymphocyte in an immunogenic form. (Author) [pt

  13. Evaluation of mucosal and systemic immune responses elicited by GPI-0100- adjuvanted influenza vaccine delivered by different immunization strategies.

    Directory of Open Access Journals (Sweden)

    Heng Liu

    Full Text Available Vaccines for protection against respiratory infections should optimally induce a mucosal immune response in the respiratory tract in addition to a systemic immune response. However, current parenteral immunization modalities generally fail to induce mucosal immunity, while mucosal vaccine delivery often results in poor systemic immunity. In order to find an immunization strategy which satisfies the need for induction of both mucosal and systemic immunity, we compared local and systemic immune responses elicited by two mucosal immunizations, given either by the intranasal (IN or the intrapulmonary (IPL route, with responses elicited by a mucosal prime followed by a systemic boost immunization. The study was conducted in BALB/c mice and the vaccine formulation was an influenza subunit vaccine supplemented with GPI-0100, a saponin-derived adjuvant. While optimal mucosal antibody titers were obtained after two intrapulmonary vaccinations, optimal systemic antibody responses were achieved by intranasal prime followed by intramuscular boost. The latter strategy also resulted in the best T cell response, yet, it was ineffective in inducing nose or lung IgA. Successful induction of secretory IgA, IgG and T cell responses was only achieved with prime-boost strategies involving intrapulmonary immunization and was optimal when both immunizations were given via the intrapulmonary route. Our results underline that immunization via the lungs is particularly effective for priming as well as boosting of local and systemic immune responses.

  14. Evaluation of Mucosal and Systemic Immune Responses Elicited by GPI-0100- Adjuvanted Influenza Vaccine Delivered by Different Immunization Strategies

    Science.gov (United States)

    Liu, Heng; Patil, Harshad P.; de Vries-Idema, Jacqueline; Wilschut, Jan; Huckriede, Anke

    2013-01-01

    Vaccines for protection against respiratory infections should optimally induce a mucosal immune response in the respiratory tract in addition to a systemic immune response. However, current parenteral immunization modalities generally fail to induce mucosal immunity, while mucosal vaccine delivery often results in poor systemic immunity. In order to find an immunization strategy which satisfies the need for induction of both mucosal and systemic immunity, we compared local and systemic immune responses elicited by two mucosal immunizations, given either by the intranasal (IN) or the intrapulmonary (IPL) route, with responses elicited by a mucosal prime followed by a systemic boost immunization. The study was conducted in BALB/c mice and the vaccine formulation was an influenza subunit vaccine supplemented with GPI-0100, a saponin-derived adjuvant. While optimal mucosal antibody titers were obtained after two intrapulmonary vaccinations, optimal systemic antibody responses were achieved by intranasal prime followed by intramuscular boost. The latter strategy also resulted in the best T cell response, yet, it was ineffective in inducing nose or lung IgA. Successful induction of secretory IgA, IgG and T cell responses was only achieved with prime-boost strategies involving intrapulmonary immunization and was optimal when both immunizations were given via the intrapulmonary route. Our results underline that immunization via the lungs is particularly effective for priming as well as boosting of local and systemic immune responses. PMID:23936066

  15. Alloimmune Responses of Humanized Mice to Human Pluripotent Stem Cell Therapeutics

    Directory of Open Access Journals (Sweden)

    Nigel G. Kooreman

    2017-08-01

    Full Text Available There is growing interest in using embryonic stem cell (ESC and induced pluripotent stem cell (iPSC derivatives for tissue regeneration. However, an increased understanding of human immune responses to stem cell-derived allografts is necessary for maintaining long-term graft persistence. To model this alloimmunity, humanized mice engrafted with human hematopoietic and immune cells could prove to be useful. In this study, an in-depth analysis of graft-infiltrating human lymphocytes and splenocytes revealed that humanized mice incompletely model human immune responses toward allogeneic stem cells and their derivatives. Furthermore, using an “allogenized” mouse model, we show the feasibility of reconstituting immunodeficient mice with a functional mouse immune system and describe a key role of innate immune cells in the rejection of mouse stem cell allografts.

  16. Optimal approximation of linear systems by artificial immune response

    Institute of Scientific and Technical Information of China (English)

    2006-01-01

    This paper puts forward a novel artificial immune response algorithm for optimal approximation of linear systems. A quaternion model of artificial immune response is proposed for engineering computing. The model abstracts four elements, namely, antigen, antibody, reaction rules among antibodies, and driving algorithm describing how the rules are applied to antibodies, to simulate the process of immune response. Some reaction rules including clonal selection rules, immunological memory rules and immune regulation rules are introduced. Using the theorem of Markov chain, it is proofed that the new model is convergent. The experimental study on the optimal approximation of a stable linear system and an unstable one show that the approximate models searched by the new model have better performance indices than those obtained by some existing algorithms including the differential evolution algorithm and the multi-agent genetic algorithm.

  17. Discovery of stimulation-responsive immune enhancers with CRISPR activation

    Science.gov (United States)

    Simeonov, Dimitre R.; Gowen, Benjamin G.; Boontanrart, Mandy; Roth, Theodore L.; Gagnon, John D.; Mumbach, Maxwell R.; Satpathy, Ansuman T.; Lee, Youjin; Bray, Nicolas L.; Chan, Alice Y.; Lituiev, Dmytro S.; Nguyen, Michelle L.; Gate, Rachel E.; Subramaniam, Meena; Li, Zhongmei; Woo, Jonathan M.; Mitros, Therese; Ray, Graham J.; Curie, Gemma L.; Naddaf, Nicki; Chu, Julia S.; Ma, Hong; Boyer, Eric; van Gool, Frederic; Huang, Hailiang; Liu, Ruize; Tobin, Victoria R.; Schumann, Kathrin; Daly, Mark J.; Farh, Kyle K.; Ansel, K. Mark; Ye, Chun J.; Greenleaf, William J.; Anderson, Mark S.; Bluestone, Jeffrey A.; Chang, Howard Y.; Corn, Jacob E.; Marson, Alexander

    2017-09-01

    The majority of genetic variants associated with common human diseases map to enhancers, non-coding elements that shape cell-type-specific transcriptional programs and responses to extracellular cues. Systematic mapping of functional enhancers and their biological contexts is required to understand the mechanisms by which variation in non-coding genetic sequences contributes to disease. Functional enhancers can be mapped by genomic sequence disruption, but this approach is limited to the subset of enhancers that are necessary in the particular cellular context being studied. We hypothesized that recruitment of a strong transcriptional activator to an enhancer would be sufficient to drive target gene expression, even if that enhancer was not currently active in the assayed cells. Here we describe a discovery platform that can identify stimulus-responsive enhancers for a target gene independent of stimulus exposure. We used tiled CRISPR activation (CRISPRa) to synthetically recruit a transcriptional activator to sites across large genomic regions (more than 100 kilobases) surrounding two key autoimmunity risk loci, CD69 and IL2RA. We identified several CRISPRa-responsive elements with chromatin features of stimulus-responsive enhancers, including an IL2RA enhancer that harbours an autoimmunity risk variant. Using engineered mouse models, we found that sequence perturbation of the disease-associated Il2ra enhancer did not entirely block Il2ra expression, but rather delayed the timing of gene activation in response to specific extracellular signals. Enhancer deletion skewed polarization of naive T cells towards a pro-inflammatory T helper (TH17) cell state and away from a regulatory T cell state. This integrated approach identifies functional enhancers and reveals how non-coding variation associated with human immune dysfunction alters context-specific gene programs.

  18. Discovery of stimulation-responsive immune enhancers with CRISPR activation

    Science.gov (United States)

    Simeonov, Dimitre R.; Gowen, Benjamin G.; Boontanrart, Mandy; Roth, Theodore L.; Gagnon, John D.; Mumbach, Maxwell R.; Satpathy, Ansuman T.; Lee, Youjin; Bray, Nicolas L.; Chan, Alice Y.; Lituiev, Dmytro S.; Nguyen, Michelle L.; Gate, Rachel E.; Subramaniam, Meena; Li, Zhongmei; Woo, Jonathan M.; Mitros, Therese; Ray, Graham J.; Curie, Gemma L.; Naddaf, Nicki; Chu, Julia S.; Ma, Hong; Boyer, Eric; Van Gool, Frederic; Huang, Hailiang; Liu, Ruize; Tobin, Victoria R.; Schumann, Kathrin; Daly, Mark J.; Farh, Kyle K; Ansel, K. Mark; Ye, Chun J.; Greenleaf, William J.; Anderson, Mark S.; Bluestone, Jeffrey A.; Chang, Howard Y.; Corn, Jacob E.; Marson, Alexander

    2017-01-01

    The majority of genetic variants associated with common human diseases map to enhancers, non-coding elements that shape cell-type-specific transcriptional programs and responses to extracellular cues1–3. Systematic mapping of functional enhancers and their biological contexts is required to understand the mechanisms by which variation in non-coding genetic sequences contributes to disease. Functional enhancers can be mapped by genomic sequence disruption4–6, but this approach is limited to the subset of enhancers that are necessary in the particular cellular context being studied. We hypothesized that recruitment of a strong transcriptional activator to an enhancer would be sufficient to drive target gene expression, even if that enhancer was not currently active in the assayed cells. Here we describe a discovery platform that can identify stimulus-responsive enhancers for a target gene independent of stimulus exposure. We used tiled CRISPR activation (CRISPRa)7 to synthetically recruit a transcriptional activator to sites across large genomic regions (more than 100 kilobases) surrounding two key autoimmunity risk loci, CD69 and IL2RA. We identified several CRISPRa-responsive elements with chromatin features of stimulus-responsive enhancers, including an IL2RA enhancer that harbours an autoimmunity risk variant. Using engineered mouse models, we found that sequence perturbation of the disease-associated Il2ra enhancer did not entirely block Il2ra expression, but rather delayed the timing of gene activation in response to specific extracellular signals. Enhancer deletion skewed polarization of naive T cells towards a pro-inflammatory T helper (TH17) cell state and away from a regulatory T cell state. This integrated approach identifies functional enhancers and reveals how non-coding variation associated with human immune dysfunction alters context-specific gene programs. PMID:28854172

  19. Maternal immunity enhances Mycoplasma hyopneumoniae vaccination induced cell-mediated immune responses in piglets.

    Science.gov (United States)

    Bandrick, Meggan; Theis, Kara; Molitor, Thomas W

    2014-06-05

    Passively acquired maternal derived immunity (MDI) is a double-edged sword. Maternal derived antibody-mediated immunity (AMI) and cell-mediated immunity (CMI) are critical immediate defenses for the neonate; however, MDI may interfere with the induction of active immunity in the neonate, i.e. passive interference. The effect of antigen-specific MDI on vaccine-induced AMI and CMI responses to Mycoplasma hyopneumoniae (M. hyopneumoniae) was assessed in neonatal piglets. To determine whether CMI and AMI responses could be induced in piglets with MDI, piglets with high and low levels of maternal M. hyopneumoniae-specific immunity were vaccinated against M. hyopneumoniae at 7 d of age. Piglet M. hyopneumoniae-specific antibody, lymphoproliferation, and delayed type hypersensitivity (DTH) responses were measured 7 d and 14 d post vaccination. Piglets with M. hyopneumoniae-specific MDI failed to show vaccine-induced AMI responses; there was no rise in M. hyopneumoniae antibody levels following vaccination of piglets in the presence of M. hyopneumoniae-specific MDI. However, piglets with M. hyopneumoniae-specific MDI had primary (antigen-specific lymphoproliferation) and secondary (DTH) M. hyopneumoniae-specific CMI responses following vaccination. In this study neonatal M. hyopneumoniae-specific CMI was not subject to passive interference by MDI. Further, it appears that both maternal derived and endogenous CMI contribute to M. hyopneumoniae-specific CMI responses in piglets vaccinated in the face of MDI.

  20. Initiation of innate immune responses by surveillance of homeostasis perturbations.

    Science.gov (United States)

    Colaço, Henrique G; Moita, Luis F

    2016-07-01

    Pathogen recognition, signaling transduction pathways, and effector mechanisms are necessary steps of innate immune responses that play key roles in the early phase of defense and in the stimulation of the later specific response of adaptive immunity. Here, we argue that in addition to the direct recognition of conserved common structural and functional molecular signatures of microorganisms using pattern recognition receptors, hosts can mount an immune response following the sensing of disruption in homeostasis as proximal reporters for infections. Surveillance of disruption of core cellular activities leading to defense responses is a flexible strategy that requires few additional components and that can effectively detect relevant threats. It is likely to be evolutionarily very conserved and ancient because it is operational in organisms that lack pattern recognition triggered immunity. A homeostasis disruption model of immune response initiation and modulation has broad implications for pathophysiology and treatment of disease and might constitute an often overlooked but central component of a comprehensive conceptual framework for innate immunity. © 2016 Federation of European Biochemical Societies.

  1. Agouron and immune response to commercialize remune immune-based treatment.

    Science.gov (United States)

    James, J S

    1998-06-19

    Agouron Pharmaceuticals agreed in June to collaborate with The Immune Response Corporation on the final development and marketing of an immune-based treatment for HIV. Remune, the vaccine developed by Dr. Jonas Salk, is currently in Phase III randomized trials with 2,500 patients, and the trials are expected to be completed in April 1999. Immune-based treatments have been difficult to test, as there is no surrogate marker, like viral load, to determine if the drug is working. Agouron agreed to participate in the joint venture after reviewing encouraging results from preliminary trials in which remune was taken in combination with highly active antiretroviral drugs.

  2. Development and function of human innate immune cells in a humanized mouse model.

    Science.gov (United States)

    Rongvaux, Anthony; Willinger, Tim; Martinek, Jan; Strowig, Till; Gearty, Sofia V; Teichmann, Lino L; Saito, Yasuyuki; Marches, Florentina; Halene, Stephanie; Palucka, A Karolina; Manz, Markus G; Flavell, Richard A

    2014-04-01

    Mice repopulated with human hematopoietic cells are a powerful tool for the study of human hematopoiesis and immune function in vivo. However, existing humanized mouse models cannot support development of human innate immune cells, including myeloid cells and natural killer (NK) cells. Here we describe two mouse strains called MITRG and MISTRG, in which human versions of four genes encoding cytokines important for innate immune cell development are knocked into their respective mouse loci. The human cytokines support the development and function of monocytes, macrophages and NK cells derived from human fetal liver or adult CD34(+) progenitor cells injected into the mice. Human macrophages infiltrated a human tumor xenograft in MITRG and MISTRG mice in a manner resembling that observed in tumors obtained from human patients. This humanized mouse model may be used to model the human immune system in scenarios of health and pathology, and may enable evaluation of therapeutic candidates in an in vivo setting relevant to human physiology.

  3. Immune Recognition of Latency-insitigating Pathogens by Human Dendritic Cells

    DEFF Research Database (Denmark)

    Søndergaard, Jonas Nørskov

    for society. Consequently there is a pressing need to search for new treatment strategies. Nowadays it is known that HIV-1 and Mtb have acquired the ability to escape the removal from the body by exploiting the immune system for their own benefits. Dendritic cells (DCs) determine the way the immune response......Latent infections with the human pathogenic microorganisms Mycobacterium tuberculosis (Mtb) and the human immunodeficiency virus (HIV) are creating some of the most devastating pandemics to date, with great impact on the infected people’s lives, their expected lifetime, as well as general costs...... unfolds by signaling other immune cells how to respond. An early deregulation of the DCs may therefore propagate into detrimental effects in later stages of the immune response, and may permit HIV-1 and Mtb to become latent. Hence, understanding the way HIV-1 and Mtb interacts with DCs could lead to novel...

  4. Modulation of systemic immune responses through commensal gastrointestinal microbiota.

    Directory of Open Access Journals (Sweden)

    Kyle M Schachtschneider

    Full Text Available Colonization of the gastrointestinal (GI tract is initiated during birth and continually seeded from the individual's environment. Gastrointestinal microorganisms play a central role in developing and modulating host immune responses and have been the subject of investigation over the last decades. Animal studies have demonstrated the impact of GI tract microbiota on local gastrointestinal immune responses; however, the full spectrum of action of early gastrointestinal tract stimulation and subsequent modulation of systemic immune responses is poorly understood. This study explored the utility of an oral microbial inoculum as a therapeutic tool to affect porcine systemic immune responses. For this study a litter of 12 pigs was split into two groups. One group of pigs was inoculated with a non-pathogenic oral inoculum (modulated, while another group (control was not. DNA extracted from nasal swabs and fecal samples collected throughout the study was sequenced to determine the effects of the oral inoculation on GI and respiratory microbial communities. The effects of GI microbial modulation on systemic immune responses were evaluated by experimentally infecting with the pathogen Mycoplasma hyopneumoniae. Coughing levels, pathology, toll-like receptors 2 and 6, and cytokine production were measured throughout the study. Sequencing results show a successful modulation of the GI and respiratory microbiomes through oral inoculation. Delayed type hypersensitivity responses were stronger (p = 0.07, and the average coughing levels and respiratory TNF-α variance were significantly lower in the modulated group (p<0.0001 and p = 0.0153, respectively. The M. hyopneumoniae infection study showed beneficial effects of the oral inoculum on systemic immune responses including antibody production, severity of infection and cytokine levels. These results suggest that an oral microbial inoculation can be used to modulate microbial communities, as well as

  5. Predictive Virtual Infection Modeling of Fungal Immune Evasion in Human Whole Blood.

    Science.gov (United States)

    Prauße, Maria T E; Lehnert, Teresa; Timme, Sandra; Hünniger, Kerstin; Leonhardt, Ines; Kurzai, Oliver; Figge, Marc Thilo

    2018-01-01

    Bloodstream infections by the human-pathogenic fungi Candida albicans and Candida glabrata increasingly occur in hospitalized patients and are associated with high mortality rates. The early immune response against these fungi in human blood comprises a concerted action of humoral and cellular components of the innate immune system. Upon entering the blood, the majority of fungal cells will be eliminated by innate immune cells, i.e., neutrophils and monocytes. However, recent studies identified a population of fungal cells that can evade the immune response and thereby may disseminate and cause organ dissemination, which is frequently observed during candidemia. In this study, we investigate the so far unresolved mechanism of fungal immune evasion in human whole blood by testing hypotheses with the help of mathematical modeling. We use a previously established state-based virtual infection model for whole-blood infection with C. albicans to quantify the immune response and identified the fungal immune-evasion mechanism. While this process was assumed to be spontaneous in the previous model, we now hypothesize that the immune-evasion process is mediated by host factors and incorporate such a mechanism in the model. In particular, we propose, based on previous studies that the fungal immune-evasion mechanism could possibly arise through modification of the fungal surface by as of yet unknown proteins that are assumed to be secreted by activated neutrophils. To validate or reject any of the immune-evasion mechanisms, we compared the simulation of both immune-evasion models for different infection scenarios, i.e., infection of whole blood with either C. albicans or C. glabrata under non-neutropenic and neutropenic conditions. We found that under non-neutropenic conditions, both immune-evasion models fit the experimental data from whole-blood infection with C. albicans and C. glabrata . However, differences between the immune-evasion models could be observed for the

  6. Predictive Virtual Infection Modeling of Fungal Immune Evasion in Human Whole Blood

    Directory of Open Access Journals (Sweden)

    Maria T. E. Prauße

    2018-03-01

    Full Text Available Bloodstream infections by the human-pathogenic fungi Candida albicans and Candida glabrata increasingly occur in hospitalized patients and are associated with high mortality rates. The early immune response against these fungi in human blood comprises a concerted action of humoral and cellular components of the innate immune system. Upon entering the blood, the majority of fungal cells will be eliminated by innate immune cells, i.e., neutrophils and monocytes. However, recent studies identified a population of fungal cells that can evade the immune response and thereby may disseminate and cause organ dissemination, which is frequently observed during candidemia. In this study, we investigate the so far unresolved mechanism of fungal immune evasion in human whole blood by testing hypotheses with the help of mathematical modeling. We use a previously established state-based virtual infection model for whole-blood infection with C. albicans to quantify the immune response and identified the fungal immune-evasion mechanism. While this process was assumed to be spontaneous in the previous model, we now hypothesize that the immune-evasion process is mediated by host factors and incorporate such a mechanism in the model. In particular, we propose, based on previous studies that the fungal immune-evasion mechanism could possibly arise through modification of the fungal surface by as of yet unknown proteins that are assumed to be secreted by activated neutrophils. To validate or reject any of the immune-evasion mechanisms, we compared the simulation of both immune-evasion models for different infection scenarios, i.e., infection of whole blood with either C. albicans or C. glabrata under non-neutropenic and neutropenic conditions. We found that under non-neutropenic conditions, both immune-evasion models fit the experimental data from whole-blood infection with C. albicans and C. glabrata. However, differences between the immune-evasion models could be

  7. Immune response of T cells during herpes simplex virus type 1 (HSV-1) infection.

    Science.gov (United States)

    Zhang, Jie; Liu, Huan; Wei, Bin

    Herpes simplex virus type 1 (HSV-1), a neurotropic member of the alphaherpes virus family, is among the most prevalent and successful human pathogens. HSV-1 can cause serious diseases at every stage of life including fatal disseminated disease in newborns, cold sores, eye disease, and fatal encephalitis in adults. HSV-1 infection can trigger rapid immune responses, and efficient inhibition and clearance of HSV-1 infection rely on both the innate and adaptive immune responses of the host. Multiple strategies have been used to restrict host innate immune responses by HSV-1 to facilitate its infection in host cells. The adaptive immunity of the host plays an important role in inhibiting HSV-1 infections. The activation and regulation of T cells are the important aspects of the adaptive immunity. They play a crucial role in host-mediated immunity and are important for clearing HSV-1. In this review, we examine the findings on T cell immune responses during HSV-1 infection, which hold promise in the design of new vaccine candidates for HSV-1.

  8. Flavobacterium psychrophilum, prevention and immune response

    DEFF Research Database (Denmark)

    Henriksen, Maya Maria Mihályi; Dalsgaard, Inger

    The fish pathogen Flavobacterium psychrophilum is one of the main causes of mortality in farmed rainbow trout and other salmonid fish. The disease following infection is often called bacterial coldwater disease (BCWD) in USA or rainbow trout fry syndrome (RTFS) in Europe. An infected farm can exp...... goal is to examine gene expression and location of transcription products in rainbow trout fry, in order to optimize vaccination or immune-stimulation. The presentation will focus on the future plans for the project, since no data have yet been obtained....

  9. Inter-donor variation in cell subset specific immune signaling responses in healthy individuals.

    Science.gov (United States)

    Longo, Diane M; Louie, Brent; Wang, Ena; Pos, Zoltan; Marincola, Francesco M; Hawtin, Rachael E; Cesano, Alessandra

    2012-01-01

    Single cell network profiling (SCNP) is a multi-parameter flow cytometry based approach that allows for the simultaneous interrogation of intracellular signaling pathways in multiple cell subpopulations within heterogeneous tissues, without the need for individual cell subset isolation. Thus, the technology is extremely well-suited for characterizing the multitude of interconnected signaling pathways and immune cell subpopulations that regulate the function of the immune system. Recently, SCNP was applied to generate a functional map of the healthy human immune cell signaling network by profiling immune signaling pathways downstream of 12 immunomodulators in 7 distinct immune cell subsets within peripheral blood mononuclear cells (PBMCs) from 60 healthy donors. In the study reported here, the degree of inter-donor variation in the magnitude of the immune signaling responses was analyzed. The highest inter-donor differences in immune signaling pathway activity occurred following perturbation of the immune signaling network, rather than in basal signaling. When examining the full panel of immune signaling responses, as one may expect, the overall degree of inter-donor variation was positively correlated (r = 0.727) with the magnitude of node response (i.e. a larger median signaling response was associated with greater inter-donor variation). However, when examining the degree of heterogeneity across cell subpopulations for individual signaling nodes, cell subset specificity in the degree of inter-donor variation was observed for several nodes. For such nodes, relatively weak correlations between inter-donor variation and the magnitude of the response were observed. Further, within the phenotypically distinct subpopulations, a fraction of the immune signaling responses had bimodal response profiles in which (a) only a portion of the cells had elevated phospho-protein levels following modulation and (b) the proportion of responsive cells varied by donor. These data

  10. Manifestations of Immune Privilege in the Human Reproductive Tract

    Directory of Open Access Journals (Sweden)

    Gary F Clark

    2013-02-01

    Full Text Available Like other mucosal surfaces (e.g., the gastrointestinal tract, the respiratory tract, the human female reproductive tract acts as an initial barrier to foreign antigens. In this role, the epithelial surface and subepithelial immune cells must balance protection against pathogenic insults against harmful inflammatory reactions and acceptance of particular foreign antigens. Two common examples of these acceptable foreign antigens are the fetal allograft and human semen/sperm. Both are purposely deposited into the female genital tract and appropriate immunologic response to these non-self antigens is essential to the survival of the species. In light of the weight of this task, it is not surprising that multiple, redundant and overlapping mechanisms are involved. For instance, cells at the immunologic interface between self (female reproductive tract epithelium and non-self (placental trophoblast cells or human sperm express glycosylation patterns that mimic those on many metastatic cancer cells and successful pathogens. The cytokine/chemokine milieu at this interface is altered through endocrine and immunologic mechanisms to favor tolerance of non-self. The foreign cells themselves also play an integral role in their own immunologic acceptance, since sperm and placental trophoblast cells are unusual and unique in their antigen presenting molecule expression patterns. Here, we will discuss these and other mechanisms that allow the human female reproductive tract to perform this delicate and indispensible balancing act.

  11. HPV-16 L1 genes with inactivated negative RNA elements induce potent immune responses

    International Nuclear Information System (INIS)

    Rollman, Erik; Arnheim, Lisen; Collier, Brian; Oeberg, Daniel; Hall, Haakan; Klingstroem, Jonas; Dillner, Joakim; Pastrana, Diana V.; Buck, Chris B.; Hinkula, Jorma; Wahren, Britta; Schwartz, Stefan

    2004-01-01

    Introduction of point mutations in the 5' end of the human papillomavirus type 16 (HPV-16) L1 gene specifically inactivates negative regulatory RNA processing elements. DNA vaccination of C57Bl/6 mice with the mutated L1 gene resulted in improved immunogenicity for both neutralizing antibodies as well as for broad cellular immune responses. Previous reports on the activation of L1 by codon optimization may be explained by inactivation of the regulatory RNA elements. The modified HPV-16 L1 DNA that induced anti-HPV-16 immunity may be seen as a complementary approach to protein subunit immunization against papillomavirus

  12. In vivo Ebola virus infection leads to a strong innate response in circulating immune cells.

    Science.gov (United States)

    Caballero, Ignacio S; Honko, Anna N; Gire, Stephen K; Winnicki, Sarah M; Melé, Marta; Gerhardinger, Chiara; Lin, Aaron E; Rinn, John L; Sabeti, Pardis C; Hensley, Lisa E; Connor, John H

    2016-09-05

    Ebola virus is the causative agent of a severe syndrome in humans with a fatality rate that can approach 90 %. During infection, the host immune response is thought to become dysregulated, but the mechanisms through which this happens are not entirely understood. In this study, we analyze RNA sequencing data to determine the host response to Ebola virus infection in circulating immune cells. Approximately half of the 100 genes with the strongest early increases in expression were interferon-stimulated genes, such as ISG15, OAS1, IFIT2, HERC5, MX1 and DHX58. Other highly upregulated genes included cytokines CXCL11, CCL7, IL2RA, IL2R1, IL15RA, and CSF2RB, which have not been previously reported to change during Ebola virus infection. Comparing this response in two different models of exposure (intramuscular and aerosol) revealed a similar signature of infection. The strong innate response in the aerosol model was seen not only in circulating cells, but also in primary and secondary target tissues. Conversely, the innate immune response of vaccinated macaques was almost non-existent. This suggests that the innate response is a major aspect of the cellular response to Ebola virus infection in multiple tissues. Ebola virus causes a severe infection in humans that is associated with high mortality. The host immune response to virus infection is thought to be an important aspect leading to severe pathology, but the components of this overactive response are not well characterized. Here, we analyzed how circulating immune cells respond to the virus and found that there is a strong innate response dependent on active virus replication. This finding is in stark contrast to in vitro evidence showing a suppression of innate immune signaling, and it suggests that the strong innate response we observe in infected animals may be an important contributor to pathogenesis.

  13. Immunomodulator-based enhancement of anti smallpox immune responses.

    Directory of Open Access Journals (Sweden)

    Osmarie Martínez

    Full Text Available The current live vaccinia virus vaccine used in the prevention of smallpox is contraindicated for millions of immune-compromised individuals. Although vaccination with the current smallpox vaccine produces protective immunity, it might result in mild to serious health complications for some vaccinees. Thus, there is a critical need for the production of a safe virus-free vaccine against smallpox that is available to everyone. For that reason, we investigated the impact of imiquimod and resiquimod (Toll-like receptors agonists, and the codon-usage optimization of the vaccinia virus A27L gene in the enhancement of the immune response, with intent of producing a safe, virus-free DNA vaccine coding for the A27 vaccinia virus protein.We analyzed the cellular-immune response by measuring the IFN-γ production of splenocytes by ELISPOT, the humoral-immune responses measuring total IgG and IgG2a/IgG1 ratios by ELISA, and the TH1 and TH2 cytokine profiles by ELISA, in mice immunized with our vaccine formulation.The proposed vaccine formulation enhanced the A27L vaccine-mediated production of IFN-γ on mouse spleens, and increased the humoral immunity with a TH1-biased response. Also, our vaccine induced a TH1 cytokine milieu, which is important against viral infections.These results support the efforts to find a new mechanism to enhance an immune response against smallpox, through the implementation of a safe, virus-free DNA vaccination platform.

  14. Immunomodulator-Based Enhancement of Anti Smallpox Immune Responses

    Science.gov (United States)

    Martínez, Osmarie; Miranda, Eric; Ramírez, Maite; Santos, Saritza; Rivera, Carlos; Vázquez, Luis; Sánchez, Tomás; Tremblay, Raymond L.; Ríos-Olivares, Eddy; Otero, Miguel

    2015-01-01

    Background The current live vaccinia virus vaccine used in the prevention of smallpox is contraindicated for millions of immune-compromised individuals. Although vaccination with the current smallpox vaccine produces protective immunity, it might result in mild to serious health complications for some vaccinees. Thus, there is a critical need for the production of a safe virus-free vaccine against smallpox that is available to everyone. For that reason, we investigated the impact of imiquimod and resiquimod (Toll-like receptors agonists), and the codon-usage optimization of the vaccinia virus A27L gene in the enhancement of the immune response, with intent of producing a safe, virus-free DNA vaccine coding for the A27 vaccinia virus protein. Methods We analyzed the cellular-immune response by measuring the IFN-γ production of splenocytes by ELISPOT, the humoral-immune responses measuring total IgG and IgG2a/IgG1 ratios by ELISA, and the TH1 and TH2 cytokine profiles by ELISA, in mice immunized with our vaccine formulation. Results The proposed vaccine formulation enhanced the A27L vaccine-mediated production of IFN-γ on mouse spleens, and increased the humoral immunity with a TH1-biased response. Also, our vaccine induced a TH1 cytokine milieu, which is important against viral infections. Conclusion These results support the efforts to find a new mechanism to enhance an immune response against smallpox, through the implementation of a safe, virus-free DNA vaccination platform. PMID:25875833

  15. Transgenerational effects enhance specific immune response in a wild passerine

    Directory of Open Access Journals (Sweden)

    Juli Broggi

    2016-03-01

    Full Text Available Vertebrate mothers transfer diverse compounds to developing embryos that can affect their development and final phenotype (i.e., maternal effects. However, the way such effects modulate offspring phenotype, in particular their immunity, remains unclear. To test the impact of maternal effects on offspring development, we treated wild breeding house sparrows (Passer domesticus in Sevilla, SE Spain with Newcastle disease virus (NDV vaccine. Female parents were vaccinated when caring for first broods, eliciting a specific immune response to NDV. The immune response to the same vaccine, and to the PHA inflammatory test were measured in 11-day-old chicks from their following brood. Vaccinated chicks from vaccinated mothers developed a stronger specific response that was related to maternal NDV antibody concentration while rearing their chicks. The chicks’ carotenoid concentration and total antioxidant capacity in blood were negatively related to NDV antibody concentration, whereas no relation with PHA response was found. Specific NDV antibodies could not be detected in 11-day-old control chicks from vaccinated mothers, implying that maternally transmitted antibodies are not directly involved but may promote offspring specific immunity through a priming effect, while other immunity components remain unaffected. Maternally transmitted antibodies in the house sparrow are short-lived, depend on maternal circulation levels and enhance pre-fledging chick specific immunity when exposed to the same pathogens as the mothers.

  16. Sexual dimorphism of stress response and immune/ inflammatory reaction: the corticotropin releasing hormone perspective

    Directory of Open Access Journals (Sweden)

    Nicholas V. Vamvakopoulos

    1995-01-01

    Full Text Available This review higlghts key aspects of corticotropin releasing hormone (CRH biology of potential relevance to the sexual dimorphism of the stress response and immune/inflammatory reaction, and introduces two important new concepts based on the regulatory potential of the human (h CRH gene: (1 a proposed mechanism to account for the tissue-specific antithetical responses of hCRH gene expression to glucocorticolds, that may also explain the frequently observed antithetical effects of chronic glucocorticoid administration in clinical practice and (2 a heuristic diagram to illustrate the proposed modulation of the stress response and immune/ inflammatory reaction by steroid hormones, from the perspective of the CRH system.

  17. A modified live canine parvovirus vaccine. II. Immune response.

    Science.gov (United States)

    Carmichael, L E; Joubert, J C; Pollock, R V

    1983-01-01

    The safety and efficacy of an attenuated canine parvovirus (A-CPV) vaccine was evaluated in both experimental and in field dogs. After parenteral vaccination, seronegative dogs developed hemagglutination-inhibition (HI) antibody titers as early as postvaccination (PV) day 2. Maximal titers occurred within 1 week. Immunity was associated with the persistence of HI antibody titers (titers greater than 80) that endured at least 2 years. Immune dogs challenged with virulent CPV did not shed virus in their feces. The A-CPV vaccine did not cause illness alone or in combination with living canine distemper (CD) and canine adenovirus type-2 (CAV-2) vaccines, nor did it interfere with the immune response to the other viruses. A high rate (greater than 98%) of immunity was engendered in seronegative pups. In contrast, maternal antibody interfered with the active immune response to the A-CPV. More than 95% of the dogs with HI titers less than 10 responded to the vaccine, but only 50% responded when titers were approximately 20. No animal with a titer greater than 80 at the time of vaccination became actively immunized. Susceptibility to virulent CPV during that period when maternal antibody no longer protects against infection, but still prevents active immunization, is the principal cause of vaccinal failure in breeding kennels where CPV is present. Reduction, but not complete elimination, of CPV disease in large breeding kennels occurred within 1-2 months of instituting an A-CPV vaccination program.

  18. A simple non-linear model of immune response

    International Nuclear Information System (INIS)

    Gutnikov, Sergei; Melnikov, Yuri

    2003-01-01

    It is still unknown why the adaptive immune response in the natural immune system based on clonal proliferation of lymphocytes requires interaction of at least two different cell types with the same antigen. We present a simple mathematical model illustrating that the system with separate types of cells for antigen recognition and patogen destruction provides more robust adaptive immunity than the system where just one cell type is responsible for both recognition and destruction. The model is over-simplified as we did not have an intention of describing the natural immune system. However, our model provides a tool for testing the proposed approach through qualitative analysis of the immune system dynamics in order to construct more sophisticated models of the immune systems that exist in the living nature. It also opens a possibility to explore specific features of highly non-linear dynamics in nature-inspired computational paradigms like artificial immune systems and immunocomputing . We expect this paper to be of interest not only for mathematicians but also for biologists; therefore we made effort to explain mathematics in sufficient detail for readers without professional mathematical background

  19. [Bone marrow stromal damage mediated by immune response activity].

    Science.gov (United States)

    Vojinović, J; Kamenov, B; Najman, S; Branković, Lj; Dimitrijević, H

    1994-01-01

    The aim of this work was to estimate influence of activated immune response on hematopoiesis in vitro, using the experimental model of BCG immunized BALB/c mice and in patients with chronic immunoactivation: long-lasting infections, autoimmunity or malignancy. We correlated changes in long term bone marrow cultures (Dexter) and NBT reduction with appearance of anemia in patients and experimental model of immunization by BCG. Increased spontaneous NBT reduction pointed out role of macrophage activation in bone marrow stroma damage. Long-term bone marrow cultures showed reduced number of hematopoietic cells, with predomination of fibroblasts and loss of fat cells. This results correlated with anemia and leucocytosis with stimulated myelopoiesis in peripheral blood. Activation of immune response, or acting of any agent that directly changes extracellular matrix and cellularity of bone marrow, may result in microenviroment bone marrow damage that modify hematopoiesis.

  20. Augmentation of alphavirus vector-induced human papilloma virus-specific immune and anti-tumour responses by co-expression of interleukin-12

    NARCIS (Netherlands)

    Riezebos-Brilman, Annelies; Regts, Joke; Chen, Margaret; Wilschut, Jan; Daemen, Toos

    2009-01-01

    To enhance the efficacy of a therapeutic immunisition strategy against human papillomavirus-induced cervical cancer we evaluated the adjuvant effect of interleukin-12 (IL12) expressed by a Semliki Forest virus vector (SFV) in mice. Depending on the dose and schedule. SFV-IL12 Stimulated

  1. Anti-Mycobacterium leprae monoclonal antibodies cross-react with human skin: an alternative explanation for the immune responses in leprosy

    NARCIS (Netherlands)

    Naafs, B.; Kolk, A. H.; Chin A Lien, R. A.; Faber, W. R.; van Dijk, G.; Kuijper, S.; Stolz, E.; van Joost, T.

    1990-01-01

    A panel of 17 mouse monoclonal antibodies (MoAb) raised against Mycobacterium leprae (M. leprae) antigens was used to detect antigenic determinants in normal human skin. An indirect immunoperoxidase technique was used. Eight of the MoAb detected epidermal antigens similar to patterns well known for

  2. Low-frequency electromagnetic fields do not alter responses of inflammatory genes and proteins in human monocytes and immune cell lines

    NARCIS (Netherlands)

    Bouwens, M.; Kleijn, de S.; Cuppen, J.J.M.; Savelkoul, H.F.J.; Verburg-van Kemenade, B.M.L.

    2012-01-01

    The effects of low frequency electromagnetic fields (LF EMF) on human health are the subject of on-going research and serious public concern. These fields potentially elicit small effects that have been proposed to have consequences, either positive or negative, for biological systems. To reveal

  3. The nature of immune responses to urinary tract infections

    Science.gov (United States)

    Abraham, Soman N.; Miao, Yuxuan

    2016-01-01

    The urinary tract is constantly exposed to microorganisms that inhabit the gastrointestinal tract, but generally the urinary tract resists infection by gut microorganisms. This resistance to infection is mainly ascribed to the versatility of the innate immune defences in the urinary tract as the adaptive immune responses are limited, particularly when only the lower urinary tract is infected. In recent years, as the strengths and weaknesses of the immune system of the urinary tract have emerged and as the virulence attributes of uropathogens are recognized, several potentially effective and unconventional strategies to contain or prevent urinary tract infections have emerged. PMID:26388331

  4. Compendium of Immune Signatures Identifies Conserved and Species-Specific Biology in Response to Inflammation.

    Science.gov (United States)

    Godec, Jernej; Tan, Yan; Liberzon, Arthur; Tamayo, Pablo; Bhattacharya, Sanchita; Butte, Atul J; Mesirov, Jill P; Haining, W Nicholas

    2016-01-19

    Gene-expression profiling has become a mainstay in immunology, but subtle changes in gene networks related to biological processes are hard to discern when comparing various datasets. For instance, conservation of the transcriptional response to sepsis in mouse models and human disease remains controversial. To improve transcriptional analysis in immunology, we created ImmuneSigDB: a manually annotated compendium of ∼5,000 gene-sets from diverse cell states, experimental manipulations, and genetic perturbations in immunology. Analysis using ImmuneSigDB identified signatures induced in activated myeloid cells and differentiating lymphocytes that were highly conserved between humans and mice. Sepsis triggered conserved patterns of gene expression in humans and mouse models. However, we also identified species-specific biological processes in the sepsis transcriptional response: although both species upregulated phagocytosis-related genes, a mitosis signature was specific to humans. ImmuneSigDB enables granular analysis of transcriptomic data to improve biological understanding of immune processes of the human and mouse immune systems. Copyright © 2016 Elsevier Inc. All rights reserved.

  5. Ageing and the humoral immune response in mice

    International Nuclear Information System (INIS)

    Blankwater, M.J.

    1978-01-01

    The study presented in this thesis is concerned with changes in the humoral immune system as a function of age in different inbred mouse strains. Their capacity to develop humoral immune responses to experimentally given thymus-dependent and thymus-independent antigens under various conditions is compared. Furthermore, experiments employing thymus transplantation and thymic humoral factors which are directed at the restoration of the diminished T cell functions in old age are reported. (Auth.)

  6. ENDOCANNABINOIDS AND EICOSAMOIDS: BIOSYNTHESIS AND INTERACTIONS WITH IMMUNE RESPONSE

    Directory of Open Access Journals (Sweden)

    Yu. K. Karaman

    2013-01-01

    Full Text Available The review is dedicated to modern concepts of arachidonic acid metabolites, i.e., endocannabinoids and eicosanoids, their biosynthetic pathways, cross-talk mechanisms and participation in immune response. New information from literature and own results include data concerning overlapping enzymatic pathways controlling biosynthesis of endocannabinoids and eicosanoids. Impact of synthetic cannabinoid receptor ligands upon production rates of proinflammatory cytokines and eicosanoids is discussed, as like as relationships among immune system reactivity and expression levels of cannabinoid receptors.

  7. Role of Activin A in Immune Response to Breast Cancer

    Science.gov (United States)

    2016-12-01

    strategies are needed in order to eradicate metastatic breast cancer. In this respect, the activation of the immune system to elicit anti-tumor immune...responses represents one of the most promising approaches that have recently demonstrated some success in other diseases. However, clinically apparent...content/76/14_Supplement/4986 Advertisement Advanced Search search ! Clinical Research (Excluding Clinical Trials) Abstract 4986: Regulation of radiation

  8. Bovine anaplasmosis with emphasis on immune responses and protection

    International Nuclear Information System (INIS)

    Ristic, M.

    1980-01-01

    Anaplasmosis is an infectious and transmissible disease manifested by progressive anaemia and the appearance of other characteristic disease symptoms. It is a world-wide tick-borne disease of cattle and some wild ruminants caused by the rickettsia Anaplasma marginale. By drawing on information obtained from studies of plasmodial cell cultures, a method has recently been developed for short-term in vitro cultivation of A. marginale. An attenuated Anaplasma organism capable of growth in both ovine and bovine erythrocytes was used to demonstrate that the in vitro system provided the necessary requirements for active transfer of the organism from cell to cell. Organismal antigens are found in the erythrocytes of infected animals, whereas soluble antigens are derived from their erythrocytes and serum. Serums from convalescing animals interact with these antigens in agglutination, complement fixation, fluorescent antibody and precipitation tests. Passive transfer of sera from immune to susceptible cattle, however, does not seem to confer protection against the infection and development of the disease. Studies that employed various tests for measuring cell-mediated immune (CMI) responses (leukocyte migration inhibition, blast transformation and cytotoxicity), in association with information collected simultaneously on antibody activity, have shown that both humoral and cellular immune responses are needed for the development of protective immunity in anaplasmosis. It was further shown that an active replication of Anaplasma is essential for induction of these two types of immune responses. Consequently, live virulent and attenuated immunogens fulfil requirements for induction of protective immunity. With the virulent agent, however, development of protective immunity is preceded by induction of auto-immune responses apparently associated with pathogenesis of anaemia in anaplasmosis. Inactivated immunogens derived from blood of infected cattle and used in combination with

  9. The immune response to sand fly salivary proteins and its influence on Leishmania immunity

    Directory of Open Access Journals (Sweden)

    Regis eGomes

    2012-05-01

    Full Text Available Leishmaniasis is a vector-borne disease transmitted by bites of phlebotomine sand flies. During Leishmania transmission, sand fly saliva is co-inoculated with parasites into the skin of the mammalian host. Sand fly saliva consists of roughly thirty different salivary proteins, many with known roles linked to blood feeding facilitation. Apart from the anti-hemostatic capacity of saliva, several sand fly salivary proteins have been shown to be immunogenic upon multiple contacts with a mammalian host. Immunization with single immunogenic salivary proteins or exposure to uninfected bites can produce protective immune responses against leishmaniasis. These sand fly salivary proteins induce cellular immune responses and/or antibodies. Antibodies to saliva are not required for protection in a mouse model against leishmaniasis. A strong body of evidence points to the role for saliva-specific T cells producing IFN-γ in the form of a delayed-type hypersensitivity reaction at the bite site as the main protective response. Herein, we review immunity to sand fly salivary proteins in the context of its vector-parasite-host combinations and vaccine potential, as well as some recent advances to shed light on the mechanism of how an immune response to sand fly saliva protects against leishmaniasis.

  10. An Immune-inspired Adaptive Automated Intrusion Response System Model

    Directory of Open Access Journals (Sweden)

    Ling-xi Peng

    2012-09-01

    Full Text Available An immune-inspired adaptive automated intrusion response system model, named as , is proposed. The descriptions of self, non-self, immunocyte, memory detector, mature detector and immature detector of the network transactions, and the realtime network danger evaluation equations are given. Then, the automated response polices are adaptively performed or adjusted according to the realtime network danger. Thus, not only accurately evaluates the network attacks, but also greatly reduces the response times and response costs.

  11. The role of dehydroepiandrosterone on functional innate immune responses to acute stress.

    Science.gov (United States)

    Prall, Sean P; Larson, Emilee E; Muehlenbein, Michael P

    2017-12-01

    The androgen dehydroepiandrosterone (DHEA) responds to stress activation, exhibits anti-glucocorticoid properties, and modulates immunity in diverse ways, yet little is known of its role in acute stress responses. In this study, the effects of DHEA and its sulfate ester DHEA-S on human male immune function during exposure to an acute stressor is explored. Variation in DHEA, DHEA-S, testosterone, and cortisol, along with bacterial killing assays, was measured in response to a modified Trier Social Stress test in 27 young adult males. Cortisol was positively related to salivary innate immunity but only for participants who also exhibited high DHEA responses. Additionally, DHEA positively and DHEA-S negatively predicted salivary immunity, but the opposite was observed for serum-based innate immunity. The DHEA response to acute stress appears to be an important factor in stress-mediated immunological responses, with differential effects on immunity dependent upon the presence of other hormones, primarily cortisol and DHEA-S. These results suggest that DHEA plays an important role, alongside other hormones, in modulating immunological shifts during acute stress. Copyright © 2017 John Wiley & Sons, Ltd.

  12. Host control of malaria infections: constraints on immune and erythropoeitic response kinetics.

    Directory of Open Access Journals (Sweden)

    Philip G McQueen

    2008-08-01

    Full Text Available The two main agents of human malaria, Plasmodium vivax and Plasmodium falciparum, can induce severe anemia and provoke strong, complex immune reactions. Which dynamical behaviors of host immune and erythropoietic responses would foster control of infection, and which would lead to runaway parasitemia and/or severe anemia? To answer these questions, we developed differential equation models of interacting parasite and red blood cell (RBC populations modulated by host immune and erythropoietic responses. The model immune responses incorporate both a rapidly responding innate component and a slower-responding, long-term antibody component, with several parasite developmental stages considered as targets for each type of immune response. We found that simulated infections with the highest parasitemia tended to be those with ineffective innate immunity even if antibodies were present. We also compared infections with dyserythropoiesis (reduced RBC production during infection to those with compensatory erythropoiesis (boosted RBC production or a fixed basal RBC production rate. Dyserythropoiesis tended to reduce parasitemia slightly but at a cost to the host of aggravating anemia. On the other hand, compensatory erythropoiesis tended to reduce the severity of anemia but with enhanced parasitemia if the innate response was ineffective. For both parasite species, sharp transitions between the schizont and the merozoite stages of development (i.e., with standard deviation in intra-RBC development time immune response, though P. vivax attacks a much smaller subset of RBCs. Since most P. vivax infections are nonlethal (if debilitating clinically, this suggests that P

  13. TYK2, a Candidate Gene for Type 1 Diabetes, Modulates Apoptosis and the Innate Immune Response in Human Pancreatic β-Cells

    DEFF Research Database (Denmark)

    Marroqui, Laura; Dos Santos, Reinaldo Sousa; Fløyel, Tina

    2015-01-01

    histocompatibility complex (MHC) class I proteins, a hallmark of early β-cell inflammation in type 1 diabetes. Importantly, TYK2 inhibition prevented PIC-induced β-cell apoptosis via the mitochondrial pathway of cell death. The present findings suggest that TYK2 regulates apoptotic and proinflammatory pathways...... in pancreatic β-cells via modulation of IFNα signaling, subsequent increase in MHC class I protein, and modulation of chemokines such as CXCL10 that are important for recruitment of T cells to the islets.......Pancreatic β-cells are destroyed by an autoimmune attack in type 1 diabetes. Linkage and genome-wide association studies point to >50 loci that are associated with the disease in the human genome. Pathway analysis of candidate genes expressed in human islets identified a central role for interferon...

  14. Modulation of immune responses in stress by Yoga

    Directory of Open Access Journals (Sweden)

    Arora Sarika

    2008-01-01

    Full Text Available Stress is a constant factor in today′s fastpaced life that can jeopardize our health if left unchecked. It is only in the last half century that the role of stress in every ailment from the common cold to AIDS has been emphasized, and the mechanisms involved in this process have been studied. Stress influences the immune response presumably through the activation of the hypothalamic-pituitary adrenal axis, hypothalamic pituitary-gonadal axis, and the sympathetic-adrenal-medullary system. Various neurotransmitters, neuropeptides, hormones, and cytokines mediate these complex bidirectional interactions between the central nervous system (CNS and the immune system. The effects of stress on the immune responses result in alterations in the number of immune cells and cytokine dysregulation. Various stress management strategies such as meditation, yoga, hypnosis, and muscle relaxation have been shown to reduce the psychological and physiological effects of stress in cancers and HIV infection. This review aims to discuss the effect of stress on the immune system and examine how relaxation techniques such as Yoga and meditation could regulate the cytokine levels and hence, the immune responses during stress.

  15. Effect of partially purified fumonisins on cellular immune response in ...

    African Journals Online (AJOL)

    After 7 days, cellular immune response was evaluated by delayed-type hypersensitivity (DTH) and lymphoproliferative assays (LA) using spleen cells. Nitric oxide (NO) production by spleen cells was also evaluated. The specific LA response to Pb antigen was higher in group PB than in FB and CTR groups (p< 0.05) but not ...

  16. Metabolic and adaptive immune responses induced in mice infected ...

    African Journals Online (AJOL)

    This study investigated metabolic and immuno-inflammatory responses of mice infected with tissue-dwelling larvae of Trichinella zimbabwensis and explored the relationship between infection, metabolic parameters and Th1/Th17 immune responses. Sixty (60) female BALB/c mice aged between 6 to 8 weeks old were ...

  17. Immune responses of pigs inoculated with a recombinant fowlpox ...

    African Journals Online (AJOL)

    Yomi

    2012-04-03

    Apr 3, 2012 ... Key words: PCV2, rFPV, FMDV, immune response, prime-boost. .... After 10 min in the dark at room temperature, the color reaction was terminated with 50 µl of ..... ponses and improve memory and/or effector cell responses ...

  18. 17D yellow fever vaccine elicits comparable long-term immune responses in healthy individuals and immune-compromised patients

    NARCIS (Netherlands)

    Wieten, R. W.; Goorhuis, A.; Jonker, E. F. F.; de Bree, G. J.; de Visser, A. W.; van Genderen, P. J. J.; Remmerswaal, E. B. M.; ten Berge, I. J. M.; Visser, L. G.; Grobusch, M. P.; van Leeuwen, E. M. M.

    2016-01-01

    The 17D live attenuated yellow fever (YF) vaccine is contra-indicated in immune-compromised individuals and may elicit a suboptimal immunologic response. The aim of this study is to assess whether long-term immune responses against the YF vaccine are impaired in immune-compromised patients. Fifteen

  19. Human immune system mouse models of Ebola virus infection.

    Science.gov (United States)

    Spengler, Jessica R; Prescott, Joseph; Feldmann, Heinz; Spiropoulou, Christina F

    2017-08-01

    Human immune system (HIS) mice, immunodeficient mice engrafted with human cells (with or without donor-matched tissue), offer a unique opportunity to study pathogens that cause disease predominantly or exclusively in humans. Several HIS mouse models have recently been used to study Ebola virus (EBOV) infection and disease. The results of these studies are encouraging and support further development and use of these models in Ebola research. HIS mice provide a small animal model to study EBOV isolates, investigate early viral interactions with human immune cells, screen vaccines and therapeutics that modulate the immune system, and investigate sequelae in survivors. Here we review existing models, discuss their use in pathogenesis studies and therapeutic screening, and highlight considerations for study design and analysis. Finally, we point out caveats to current models, and recommend future efforts for modeling EBOV infection in HIS mice. Published by Elsevier B.V.

  20. Merck Ad5/HIV induces broad innate immune activation that predicts CD8⁺ T-cell responses but is attenuated by preexisting Ad5 immunity.

    Science.gov (United States)

    Zak, Daniel E; Andersen-Nissen, Erica; Peterson, Eric R; Sato, Alicia; Hamilton, M Kristina; Borgerding, Joleen; Krishnamurty, Akshay T; Chang, Joanne T; Adams, Devin J; Hensley, Tiffany R; Salter, Alexander I; Morgan, Cecilia A; Duerr, Ann C; De Rosa, Stephen C; Aderem, Alan; McElrath, M Juliana

    2012-12-11

    To better understand how innate immune responses to vaccination can lead to lasting protective immunity, we used a systems approach to define immune signatures in humans over 1 wk following MRKAd5/HIV vaccination that predicted subsequent HIV-specific T-cell responses. Within 24 h, striking increases in peripheral blood mononuclear cell gene expression associated with inflammation, IFN response, and myeloid cell trafficking occurred, and lymphocyte-specific transcripts decreased. These alterations were corroborated by marked serum inflammatory cytokine elevations and egress of circulating lymphocytes. Responses of vaccinees with preexisting adenovirus serotype 5 (Ad5) neutralizing antibodies were strongly attenuated, suggesting that enhanced HIV acquisition in Ad5-seropositive subgroups in the Step Study may relate to the lack of appropriate innate activation rather than to increased systemic immune activation. Importantly, patterns of chemoattractant cytokine responses at 24 h and alterations in 209 peripheral blood mononuclear cell transcripts at 72 h were predictive of subsequent induction and magnitude of HIV-specific CD8(+) T-cell responses. This systems approach provides a framework to compare innate responses induced by vectors, as shown here by contrasting the more rapid, robust response to MRKAd5/HIV with that to yellow fever vaccine. When applied iteratively, the findings may permit selection of HIV vaccine candidates eliciting innate immune response profiles more likely to drive HIV protective immunity.

  1. Systemic and Terminal Ileum Mucosal Immunity Elicited by Oral Immunization With the Ty21a Typhoid Vaccine in HumansSummary

    Directory of Open Access Journals (Sweden)

    Jayaum S. Booth

    2017-11-01

    Full Text Available Background & Aims: Systemic cellular immunity elicited by the Ty21a oral typhoid vaccine has been extensively characterized. However, very limited data are available in humans regarding mucosal immunity at the site of infection (terminal ileum [TI]. Here we investigated the host immunity elicited by Ty21a immunization on terminal ileum–lamina propria mononuclear cells (LPMC and peripheral blood in volunteers undergoing routine colonoscopy. Methods: We characterized LPMC-T memory (TM subsets and assessed Salmonella enterica serovar Typhi (S Typhi–specific responses by multichromatic flow cytometry. Results: No differences were observed in cell yields and phenotypes in LPMC CD8+-TM subsets following Ty21a immunization. However, Ty21a immunization elicited LPMC CD8+ T cells exhibiting significant S Typhi–specific responses (interferon-γ, tumor necrosis factor-α, interleukin-17A, and/or CD107a in all major TM subsets (T-effector/memory [TEM], T-central/memory, and TEM-CD45RA+, although each TM subset exhibited unique characteristics. We also investigated whether Ty21a immunization elicited S Typhi–specific multifunctional effectors in LPMC CD8+ TEM. We observed that LPMC CD8+ TEM responses were mostly multifunctional, except for those cells exhibiting the characteristics associated with cytotoxic responses. Finally, we compared mucosal with systemic responses and made the important observation that LPMC CD8+ S Typhi–specific responses were unique and distinct from their systemic counterparts. Conclusions: This study provides the first demonstration of S Typhi–specific responses in the human terminal ileum mucosa and provides novel insights into the generation of mucosal immune responses following oral Ty21a immunization. Keywords: Lamina Propria Mononuclear Cells, Multifunctional T Cells, CD8+-T Memory Cells, Typhoid, Vaccines

  2. Skin immunization by microneedle patch overcomes statin-induced suppression of immune responses to influenza vaccine.

    Science.gov (United States)

    Vassilieva, Elena V; Wang, Shelly; Li, Song; Prausnitz, Mark R; Compans, Richard W

    2017-12-19

    Recent studies indicated that in elderly individuals, statin therapy is associated with a reduced response to influenza vaccination. The present study was designed to determine effects on the immune response to influenza vaccination induced by statin administration in a mouse model, and investigate potential approaches to improve the outcome of vaccination on the background of statin therapy. We fed middle aged BALB/c mice a high fat "western" diet (WD) alone or supplemented with atorvastatin (AT) for 14 weeks, and control mice were fed with the regular rodent diet. Mice were immunized with a single dose of subunit A/Brisbane/59/07 (H1N1) vaccine, either systemically or with dissolving microneedle patches (MNPs). We observed that a greater age-dependent decline in the hemagglutinin inhibition titers occurred in systemically-immunized mice than in MNP- immunized mice. AT dampened the antibody response in the animals vaccinated by either route of vaccine delivery. However, the MNP-vaccinated AT-treated animals had ~20 times higher total antibody levels to the influenza vaccine than the systemically vaccinated group one month postvaccination. We propose that microneedle vaccination against influenza provides an approach to ameliorate the immunosuppressive effect of statin therapy observed with systemic immunization.

  3. Immune responses of ducks infected with duck Tembusu virus

    Directory of Open Access Journals (Sweden)

    Ning eLi

    2015-05-01

    Full Text Available Duck Tembusu virus (DTMUV can cause serious disease in ducks, characterized by reduced egg production. Although the virus has been isolated and detection methods developed, the host immune responses to DTMUV infection are unclear. Therefore, we systematically examined the expression of immune-related genes and the viral distribution in DTMUV-infected ducks, using quantitative real-time PCR. Our results show that DTMUV replicates quickly in many tissues early in infection, with the highest viral titers in the spleen 1 day after infection. Rig-1, Mda5, and Tlr3 are involved in the host immune response to DTMUV, and the expression of proinflammatory cytokines (Il-1β, -2, -6, Cxcl8 and antiviral proteins (Mx, Oas, etc. are also upregulated early in infection. The expression of Il-6 increased most significantly in the tissues tested. The upregulation of Mhc-I was observed in the brain and spleen, but the expression of Mhc-II was upregulated in the brain and downregulated in the spleen. The expression of the interferons was also upregulated to different degrees in the spleen but that of the brain was various. Our study suggests that DTMUV replicates rapidly in various tissues and that the host immune responses are activated early in infection. However, the overexpression of cytokines may damage the host. These results extend our understanding of the immune responses of ducks to DTMUV infection, and provide insight into the pathogenesis of DTMUV attributable to host factors.

  4. Systems biology of neutrophil differentiation and immune response

    DEFF Research Database (Denmark)

    Theilgaard-Mönch, Kim; Porse, Bo T; Borregaard, Niels

    2005-01-01

    Systems biology has emerged as a new scientific field, which aims at investigating biological processes at the genomic and proteomic levels. Recent studies have unravelled aspects of neutrophil differentiation and immune responses at the systems level using high-throughput technologies. These stu......Systems biology has emerged as a new scientific field, which aims at investigating biological processes at the genomic and proteomic levels. Recent studies have unravelled aspects of neutrophil differentiation and immune responses at the systems level using high-throughput technologies....... These studies have identified a plethora of novel effector proteins stored in the granules of neutrophils. In addition, these studies provide evidence that neutrophil differentiation and immune response are governed by a highly coordinated transcriptional programme that regulates cellular fate and function...

  5. Secondary immune response of rainbow trout following repeated immersion vaccination

    DEFF Research Database (Denmark)

    Jaafar, R. M.; Al-Jubury, A.; Chettri, J. K.

    2017-01-01

    Teleosts are able to raise a protective immune response, comprising both innate and adaptive elements, against various pathogens. This is the basis for a widespread use of vaccines, administered as injection or immersion, in the aquaculture industry. It has been described that repeated injection...... vaccination of fish raises a secondary immune response, consisting of rapid, accelerated and increased antibody reaction. This study reports how rainbow trout responds to repeated immersion vaccination against yersiniosis (ERM) caused by the bacterial pathogen Yersinia ruckeri. It was found that rainbow trout...... does not raise a classical secondary response following repeated immersion vaccination. Serum antibody titres were merely slightly increased even after three immunizations, using 30-s immersion into a bacterin consisting of formalin-inactivated Y. ruckeri (serotype O1, biotypes 1 and 2), performed over...

  6. Secondary immune response of rainbow trout following repeated immersion vaccination

    DEFF Research Database (Denmark)

    Jaafar, R. M.; Al-Jubury, Azmi; Chettri, Jiwan Kumar

    2018-01-01

    Teleosts are able to raise a protective immune response, comprising both innate and adaptive elements, against various pathogens. This is the basis for a widespread use of vaccines, administered as injection or immersion, in the aquaculture industry. It has been described that repeated injection...... vaccination of fish raises a secondary immune response, consisting of rapid, accelerated and increased antibody reaction. This study reports how rainbow trout responds to repeated immersion vaccination against yersiniosis (ERM) caused by the bacterial pathogen Yersinia ruckeri. It was found that rainbow trout...... does not raise a classical secondary response following repeated immersion vaccination. Serum antibody titres were merely slightly increased even after three immunizations, using 30-s immersion into a bacterin consisting of formalin-inactivated Y. ruckeri (serotype O1, biotypes 1 and 2), performed over...

  7. Vesicular trafficking of immune mediators in human eosinophils revealed by immunoelectron microscopy

    Energy Technology Data Exchange (ETDEWEB)

    Melo, Rossana C.N., E-mail: rossana.melo@ufjf.edu.br [Laboratory of Cellular Biology, Department of Biology, ICB, Federal University of Juiz de Fora, UFJF, Rua José Lourenço Kelmer, Juiz de Fora, MG 36036-900 (Brazil); Department of Medicine, Beth Israel Deaconess Medical Center, Harvard Medical School, 330 Brookline Avenue, CLS 943, Boston, MA 02215 (United States); Weller, Peter F. [Department of Medicine, Beth Israel Deaconess Medical Center, Harvard Medical School, 330 Brookline Avenue, CLS 943, Boston, MA 02215 (United States)

    2016-10-01

    Electron microscopy (EM)-based techniques are mostly responsible for our current view of cell morphology at the subcellular level and continue to play an essential role in biological research. In cells from the immune system, such as eosinophils, EM has helped to understand how cells package and release mediators involved in immune responses. Ultrastructural investigations of human eosinophils enabled visualization of secretory processes in detail and identification of a robust, vesicular trafficking essential for the secretion of immune mediators via a non-classical secretory pathway associated with secretory (specific) granules. This vesicular system is mainly organized as large tubular-vesicular carriers (Eosinophil Sombrero Vesicles – EoSVs) actively formed in response to cell activation and provides a sophisticated structural mechanism for delivery of granule-stored mediators. In this review, we highlight the application of EM techniques to recognize pools of immune mediators at vesicular compartments and to understand the complex secretory pathway within human eosinophils involved in inflammatory and allergic responses. - Highlights: • Application of EM to understand the complex secretory pathway in human eosinophils. • EM techniques reveal an active vesicular system associated with secretory granules. • Tubular vesicles are involved in the transport of granule-derived immune mediators.

  8. Vesicular trafficking of immune mediators in human eosinophils revealed by immunoelectron microscopy

    International Nuclear Information System (INIS)

    Melo, Rossana C.N.; Weller, Peter F.

    2016-01-01

    Electron microscopy (EM)-based techniques are mostly responsible for our current view of cell morphology at the subcellular level and continue to play an essential role in biological research. In cells from the immune system, such as eosinophils, EM has helped to understand how cells package and release mediators involved in immune responses. Ultrastructural investigations of human eosinophils enabled visualization of secretory processes in detail and identification of a robust, vesicular trafficking essential for the secretion of immune mediators via a non-classical secretory pathway associated with secretory (specific) granules. This vesicular system is mainly organized as large tubular-vesicular carriers (Eosinophil Sombrero Vesicles – EoSVs) actively formed in response to cell activation and provides a sophisticated structural mechanism for delivery of granule-stored mediators. In this review, we highlight the application of EM techniques to recognize pools of immune mediators at vesicular compartments and to understand the complex secretory pathway within human eosinophils involved in inflammatory and allergic responses. - Highlights: • Application of EM to understand the complex secretory pathway in human eosinophils. • EM techniques reveal an active vesicular system associated with secretory granules. • Tubular vesicles are involved in the transport of granule-derived immune mediators.

  9. Two Lactobacillus strains, isolated from breast milk, differently modulate the immune response

    NARCIS (Netherlands)

    Diaz-Ropero, M.P.; Martin, R.; Sierra, S.; Lara-Villoslada, F.; Rodriguez, J.M.; Xaus, J.; Olivares, M.

    2007-01-01

    Aims: The ability of two different Lactobacillus strains (Lactobacillus salivarius CECT5713 and Lactobacillus fermentum CECT5716), isolated from human breast milk, to modulate the immune response was examined. Methods and Results: In rodent bone-marrow-derived macrophages (BMDM), the presence of

  10. Suppressive influences in the immune response to cancer.

    Science.gov (United States)

    Bronte, Vincenzo; Mocellin, Simone

    2009-01-01

    Although much evidence has been gathered demonstrating that immune effectors can play a significant role in controlling tumor growth under natural conditions or in response to therapeutic manipulation, it is clear that malignant cells do evade immune surveillance in most cases. Considering that anticancer active specific immunotherapy seems to have reached a plateau of results and that currently no vaccination regimen is indicated as a standard anticancer therapy, the dissection of the molecular events underlying tumor immune escape is the necessary condition to make anticancer vaccines a therapeutic weapon effective enough to be implemented in the routine clinical setting. Recent years have witnessed significant advances in our understanding of the molecular mechanisms underlying tumor immune escape. These mechanistic insights are fostering the development of rationally designed therapeutics aimed to revert the immunosuppressive circuits that undermine an effective antitumor immune response. In this review, the best characterized mechanisms that allow cancer cells to evade immune surveillance are overviewed and the most debated controversies constellating this complex field are highlighted.

  11. Influences of large sets of environmental exposures on immune responses in healthy adult men.

    Science.gov (United States)

    Yi, Buqing; Rykova, Marina; Jäger, Gundula; Feuerecker, Matthias; Hörl, Marion; Matzel, Sandra; Ponomarev, Sergey; Vassilieva, Galina; Nichiporuk, Igor; Choukèr, Alexander

    2015-08-26

    Environmental factors have long been known to influence immune responses. In particular, clinical studies about the association between migration and increased risk of atopy/asthma have provided important information on the role of migration associated large sets of environmental exposures in the development of allergic diseases. However, investigations about environmental effects on immune responses are mostly limited in candidate environmental exposures, such as air pollution. The influences of large sets of environmental exposures on immune responses are still largely unknown. A simulated 520-d Mars mission provided an opportunity to investigate this topic. Six healthy males lived in a closed habitat simulating a spacecraft for 520 days. When they exited their "spacecraft" after the mission, the scenario was similar to that of migration, involving exposure to a new set of environmental pollutants and allergens. We measured multiple immune parameters with blood samples at chosen time points after the mission. At the early adaptation stage, highly enhanced cytokine responses were observed upon ex vivo antigen stimulations. For cell population frequencies, we found the subjects displayed increased neutrophils. These results may presumably represent the immune changes occurred in healthy humans when migrating, indicating that large sets of environmental exposures may trigger aberrant immune activity.

  12. Cell-mediated immunity against human retinal extract, S-antigen, and interphotoreceptor retinoid binding protein in onchocercal chorioretinopathy

    NARCIS (Netherlands)

    van der Lelij, A.; Rothova, A.; Stilma, J. S.; Hoekzema, R.; Kijlstra, A.

    1990-01-01

    Autoimmune mechanisms are thought to be involved in the pathogenesis of onchocercal chorioretinopathy. Cell-mediated immune responses to human retinal S-antigen, interphotoreceptor retinoid binding protein (IRBP), and crude retinal extract were investigated in patients with onchocerciasis from

  13. The intracellular cholesterol landscape: dynamic integrator of the immune response

    Science.gov (United States)

    Fessler, Michael B.

    2016-01-01

    Cholesterol has typically been considered an exogenous, disease-related factor in immunity; however, recent literature suggests that a paradigm shift is in order. Sterols are now recognized to ligate several immune receptors. Altered flux through the mevalonic acid synthesis pathway also appears to be a required event in the antiviral interferon response of macrophages and in the activation, proliferation, and differentiation of T cells. In this review, evidence is discussed that suggests an intrinsic, ‘professional’ role for sterols and oxysterols in macrophage and T cell immunity. Host defense may have been the original selection pressure behind the development of mechanisms for intracellular cholesterol homeostasis. Functional coupling between sterol metabolism and immunity has fundamental implications for health and disease. PMID:27692616

  14. Polar lipids of Burkholderia pseudomallei induce different host immune responses.

    Directory of Open Access Journals (Sweden)

    Mercedes Gonzalez-Juarrero

    Full Text Available Melioidosis is a disease in tropical and subtropical regions of the world that is caused by Burkholderia pseudomallei. In endemic regions the disease occurs primarily in humans and goats. In the present study, we used the goat as a model to dissect the polar lipids of B. pseudomallei to identify lipid molecules that could be used for adjuvants/vaccines or as diagnostic tools. We showed that the lipidome of B. pseudomallei and its fractions contain several polar lipids with the capacity to elicit different immune responses in goats, namely rhamnolipids and ornithine lipids which induced IFN-γ, whereas phospholipids and an undefined polar lipid induced strong IL-10 secretion in CD4(+ T cells. Autologous T cells co-cultured with caprine dendritic cells (cDCs and polar lipids of B. pseudomallei proliferated and up-regulated the expression of CD25 (IL-2 receptor molecules. Furthermore, we demonstrated that polar lipids were able to up-regulate CD1w2 antigen expression in cDCs derived from peripheral blood monocytes. Interestingly, the same polar lipids had only little effect on the expression of MHC class II DR antigens in the same caprine dendritic cells. Finally, antibody blocking of the CD1w2 molecules on cDCs resulted in decreased expression for IFN-γ by CD4(+ T cells. Altogether, these results showed that polar lipids of B. pseudomallei are recognized by the caprine immune system and that their recognition is primarily mediated by the CD1 antigen cluster.

  15. Polar Lipids of Burkholderia pseudomallei Induce Different Host Immune Responses

    Science.gov (United States)

    Gonzalez-Juarrero, Mercedes; Mima, Naoko; Trunck, Lily A.; Schweizer, Herbert P.; Bowen, Richard A.; Dascher, Kyle; Mwangi, Waithaka; Eckstein, Torsten M.

    2013-01-01

    Melioidosis is a disease in tropical and subtropical regions of the world that is caused by Burkholderia pseudomallei. In endemic regions the disease occurs primarily in humans and goats. In the present study, we used the goat as a model to dissect the polar lipids of B. pseudomallei to identify lipid molecules that could be used for adjuvants/vaccines or as diagnostic tools. We showed that the lipidome of B. pseudomallei and its fractions contain several polar lipids with the capacity to elicit different immune responses in goats, namely rhamnolipids and ornithine lipids which induced IFN-γ, whereas phospholipids and an undefined polar lipid induced strong IL-10 secretion in CD4+ T cells. Autologous T cells co-cultured with caprine dendritic cells (cDCs) and polar lipids of B. pseudomallei proliferated and up-regulated the expression of CD25 (IL-2 receptor) molecules. Furthermore, we demonstrated that polar lipids were able to up-regulate CD1w2 antigen expression in cDCs derived from peripheral blood monocytes. Interestingly, the same polar lipids had only little effect on the expression of MHC class II DR antigens in the same caprine dendritic cells. Finally, antibody blocking of the CD1w2 molecules on cDCs resulted in decreased expression for IFN-γ by CD4+ T cells. Altogether, these results showed that polar lipids of B. pseudomallei are recognized by the caprine immune system and that their recognition is primarily mediated by the CD1 antigen cluster. PMID:24260378

  16. Lesion-Specific Immune Response in Granulomas of Patients with Pulmonary Tuberculosis: A Pilot Study.

    Directory of Open Access Journals (Sweden)

    Selvakumar Subbian

    Full Text Available The formation and maintenance of granulomas is central to the host response to Mycobacterium tuberculosis (Mtb infection. It is widely accepted that the lungs of patients with tuberculosis (TB usually contain multiple infection foci, and that the granulomas evolve and differentiate independently, resulting in considerable heterogeneity. Although gene expression profiles of human blood cells have been proposed as biomarkers of Mtb infection and/or active disease, the immune profiles of discrete lesion types has not been studied extensively. Using histology, immunopathology and genome-wide transcriptome analysis, we explored the immunological profile of human lung TB granulomas. We show that although the different granulomas share core similarities in their immunological/inflammatory characteristics, they also exhibit significant divergence. Despite similar numbers of CD68+ macrophages in the different lesions, the extent of immune reactivity, as determined by the density of CD3+ T cells in the macrophage rich areas, and the extent of fibrosis, shows considerable variation. Both quantitative and qualitative differences among significantly differentially expressed genes (SDEG were noted in each of the lesion types studied. Further, network/pathway analysis of SDEG revealed differential regulation of inflammatory response, immune cell trafficking, and cell mediated immune response in the different lesions. Our data highlight the formidable challenges facing ongoing efforts to identify peripheral blood biomarkers due to the diversity of lesion types and complexity of local immune responses in the lung.

  17. Effects of inhaled insoluble 239PuO2 on immune responses following lung immunization

    International Nuclear Information System (INIS)

    Bice, D.E.; Harris, D.L.; Brooks, A.L.; Mewhinney, J.A.

    1978-01-01

    To determine if inhaled 239 PuO 2 suppresses immunity in lung-associated lymph nodes, Chinese hamsters were exposed to a polydisperse aerosol of 239 PuO 2 produced at 1150 0 C. The mean lung burden of these animals was estimated to be 10 nCi at 8 days after exposure. At 128, 256 and 400 days after exposure, sham exposed controls and experimental animals were immunized by intratracheal instillation of 1 x 10 8 sheep red blood cells (SRBC). Six days later, they were sacrificed and the number of antibody forming cells (AFC) in lung-associated lymph nodes, spleen and cervical lymph nodes was evaluated. Results of these studies indicated that the number of AFC in lung-associated lymph modes was significantly lower in animals exposed to 239 PuO 2 . Only a few AFC were found in spleen and cervical lymph nodes after intratracheal immunization and the number in exposed animals was not significantly different than in the controls. These data indicate that even though the 239 PuO 2 exposure had suppressed immune responses in lung-associated lymph nodes, their filtering capacity was unaffected and antigen did not translocate to the spleen. We conclude that, at the sacrifice intervals evaluated, the immune function of lung-associated lymph nodes was suppressed and that distant lymphoid tissue (e.g., spleen and cervical lymph nodes) did not replace the immune function of the lung-associated lymph nodes

  18. Modulation of immune response by alloactivated suppressor T cells

    International Nuclear Information System (INIS)

    Bernstein, A.; Sopori, M.L.; Gose, J.E.; Sondel, P.M.

    1979-01-01

    These studies show that there may be several different kinds of suppressor cells, each activated by different pathways and able to suppress different parts of the immune response either specifically or nonspecifically. As such, the physiology of one type of suppressor cell need not necessarily apply to that of another type of suppressor. Thus we emphasize the trap that the suppressor cell option provides: that is, virtually any previously inexplicable in vitro and in vivo immune phenomenon can always be adequately accounted for by evoking a suppressor mechanism, either by suppressing the response or suppressing the suppressor

  19. Nanotechnology, neuromodulation & the immune response: discourse, materiality & ethics.

    Science.gov (United States)

    Fins, Joseph J

    2015-04-01

    Drawing upon the American Pragmatic tradition in philosophy and the more recent work of philosopher Karen Barad, this paper examines how scientific problems are both obscured, and resolved by our use of language describing the natural world. Using the example of the immune response engendered by neural implants inserted in the brain, the author explains how this discourse has been altered by the advent of nanotechnology methods and devices which offer putative remedies that might temper the immune response in the central nervous system. This emergent nanotechnology has altered this problem space and catalyzed one scientific community to acknowledge a material reality that was always present, if not fully acknowledged.

  20. The role of complement in the acquired immune response

    DEFF Research Database (Denmark)

    Nielsen, C H; Fischer, E M; Leslie, R G

    2000-01-01

    Studies over the past three decades have clearly established a central role for complement in the promotion of a humoral immune response. The primary function of complement, in this regard, is to opsonize antigen or immune complexes for uptake by complement receptor type 2 (CR2, CD21) expressed...... on B cells, follicular dendritic cells (FDC) and some T cells. A variety of mechanisms appear to be involved in complement-mediated promotion of the humoral response. These include: enhancement of antigen (Ag) uptake and processing by both Ag-specific and non-specific B cells for presentation...

  1. Innate Immune Response to Burkholderia mallei

    Science.gov (United States)

    2017-02-16

    highly contagious and often fatal disease, glanders. With its high rate of infectivity via aerosol and recalcitrance towards antibiotics , this...pathology (1-7). Glanders transmits amongst animals via respiratory secretions and exudates from skin lesions. In human infections, the primary modes of...resulted in the uniform production of cytokines interleukin 1 beta (IL-1β), tumor necrosis factor alpha (TNF-α), and murine keratinocyte-derived

  2. Multivariate statistical analyses demonstrate unique host immune responses to single and dual lentiviral infection.

    Directory of Open Access Journals (Sweden)

    Sunando Roy

    2009-10-01

    Full Text Available Feline immunodeficiency virus (FIV and human immunodeficiency virus (HIV are recently identified lentiviruses that cause progressive immune decline and ultimately death in infected cats and humans. It is of great interest to understand how to prevent immune system collapse caused by these lentiviruses. We recently described that disease caused by a virulent FIV strain in cats can be attenuated if animals are first infected with a feline immunodeficiency virus derived from a wild cougar. The detailed temporal tracking of cat immunological parameters in response to two viral infections resulted in high-dimensional datasets containing variables that exhibit strong co-variation. Initial analyses of these complex data using univariate statistical techniques did not account for interactions among immunological response variables and therefore potentially obscured significant effects between infection state and immunological parameters.Here, we apply a suite of multivariate statistical tools, including Principal Component Analysis, MANOVA and Linear Discriminant Analysis, to temporal immunological data resulting from FIV superinfection in domestic cats. We investigated the co-variation among immunological responses, the differences in immune parameters among four groups of five cats each (uninfected, single and dual infected animals, and the "immune profiles" that discriminate among them over the first four weeks following superinfection. Dual infected cats mount an immune response by 24 days post superinfection that is characterized by elevated levels of CD8 and CD25 cells and increased expression of IL4 and IFNgamma, and FAS. This profile discriminates dual infected cats from cats infected with FIV alone, which show high IL-10 and lower numbers of CD8 and CD25 cells.Multivariate statistical analyses demonstrate both the dynamic nature of the immune response to FIV single and dual infection and the development of a unique immunological profile in dual

  3. Protein A Suppresses Immune Responses during Staphylococcus aureus Bloodstream Infection in Guinea Pigs

    Science.gov (United States)

    Kim, Hwan Keun; Falugi, Fabiana; Thomer, Lena; Missiakas, Dominique M.

    2015-01-01

    ABSTRACT   Staphylococcus aureus infection is not associated with the development of protective immunity, and disease relapses occur frequently. We hypothesize that protein A, a factor that binds immunoglobulin Fcγ and cross-links VH3 clan B cell receptors (IgM), is the staphylococcal determinant for host immune suppression. To test this, vertebrate IgM was examined for protein A cross-linking. High VH3 binding activity occurred with human and guinea immunoglobulin, whereas mouse and rabbit immunoglobulins displayed little and no binding, respectively. Establishing a guinea pig model of S. aureus bloodstream infection, we show that protein A functions as a virulence determinant and suppresses host B cell responses. Immunization with SpAKKAA, which cannot bind immunoglobulin, elicits neutralizing antibodies that enable guinea pigs to develop protective immunity. Importance  Staphylococcus aureus is the leading cause of soft tissue and bloodstream infections; however, a vaccine with clinical efficacy is not available. Using mice to model staphylococcal infection, earlier work identified protective antigens; however, corresponding human clinical trials did not reach their endpoints. We show that B cell receptor (IgM) cross-linking by protein A is an important immune evasion strategy of S. aureus that can be monitored in a guinea pig model of bloodstream infection. Further, immunization with nontoxigenic protein A enables infected guinea pigs to elicit antibody responses that are protective against S. aureus. Thus, the guinea pig model may support preclinical development of staphylococcal vaccines. PMID:25564466

  4. The Host Immune Response to Streptococcus pneumoniae: Bridging Innate and Adaptive Immunity

    Science.gov (United States)

    2006-07-06

    P.J. (1989) Effect of Streptococcus pneumoniae on human respiratory epithelium in vitro. Infect. Immun. 57: 2006-2013. Stoop, J.N., van der Molen ...antibiotics. Clin. Microbiol. Rev. 3: 171-196. Knapp, S., Wieland, C.W., van ’t Veer, C., Takeuchi, O., Akira, S., Florquin, S., and van der Poll...R.G., Baan, C.C., van der Laan, L.J., Kuipers, E.J., Kusters, J.G., and Janssen, H.L. (2005) Regulatory T cells contribute to the impaired immune

  5. The serological response to heartwater immunization in cattle is an indicator of protective immunity

    DEFF Research Database (Denmark)

    Lawrence, J A; Tjørnehøj, Kirsten; Whiteland, A P

    1995-01-01

    A significant correlation was demonstrated in Friesian-cross steers between the serological response to previous vaccination with the Ball 3 strain of Cowdria ruminantium and the development of protective immunity against the Kalota isolate from Malawi. Of 10 animals which seroconverted after vac...

  6. Immune response in the lungs following oral immunization with bacterial lysates of respiratory pathogens.

    Science.gov (United States)

    Ruedl, C; Frühwirth, M; Wick, G; Wolf, H

    1994-03-01

    We have investigated the local immune response of the BALB/c mouse respiratory tract after oral immunization with a bacterial lysate of seven common respiratory pathogens. After two immunization on five consecutive days, we examined the immunoglobulin (immunoglobulin G [IgG], IgM, and IgA) secretion rates of cells isolated from the lungs and compared them with those of spleen cells of orally immunized and nonimmunized animals by using a new test system based on time-resolved fluorescence. The procedure followed the principle of the classical ELISPOT test with nitrocellulose-bottomed microtiter plates, but europium (Eu3+)-linked streptavidin rather than enzyme-conjugated streptavidin was used, with the advantage of quantifying secreted immunoglobulins instead of detecting single antibody-secreting cells. Lymphocytes isolated from the lungs of treated animals revealed significant increases in total and antigen-specific IgA synthesis compared with the rates of the controls, whereas IgG and IgM production rates showed no remarkable differences. In addition, the sera of treated mice revealed higher antigen-specific IgA titers but not increased IgM and IgG levels. We conclude that priming the gut-associated lymphoid tissue with bacterial antigens of pneumotropic microorganisms can elicit an enhanced IgA response in a distant mucosal effector site, such as the respiratory tract, according to the concept of a common mucosa-associated immune system.

  7. Effect of produced water on cod (Gadus morhua) immune responses

    Energy Technology Data Exchange (ETDEWEB)

    Hamoutene, D.; Mabrouk, G.; Samuelson, S.; Mansour, A.; Lee, K. [Fisheries and Oceans Canada, Dartmouth, NS (Canada). Maritimes Region, Ocean Sciences Division; Volkoff, H.; Parrish, C. [Memorial Univ. of Newfoundland, St. John' s, NL (Canada); Mathieu, A. [Oceans Ltd., St. John' s, NL (Canada)

    2007-07-01

    Studies have shown that produced water (PW) discharged from North Sea offshore platforms affects the biota at greater distances from operational platforms than originally presumed. According to PW dispersion simulations, dilution by at least 240 times occurs within 50-100 m, and up to 9000 times by 20 km from the discharge. In this study, the effect of PW on cod immunity was investigated by exposing fish to 0, 100 ppm (x 10,000 dilution) or 200 ppm (x 500) of PW for 76 days. Immune responses were evaluated at the end of the exposure. Fish from the 3 groups were injected with Aeromonas salmonicida lipopolysaccharides (LPS). Blood cell observation and flow cytometry were used to investigate the serum cortisol levels and gill histology along with ratios and respiratory burst (RB) responses of both circulating and head-kidney white blood cells (WBCs). The study revealed that baseline immunity and stress response were not affected by PW, other than an irritant-induced change in gill cells found in treated cod. In all groups, LPS injection resulted in a pronounced decrease in RB of head-kidney cells and an increase in serum cortisol and protein levels. However, the group exposed to 200 ppm of PW exhibited the most significant changes. LPS injection was also shown to influence WBC ratios, but further studies are needed to determine if this impact is stronger in fish exposed to PW. This study suggested an effect of PW on cod immunity after immune challenge with LPS.

  8. Influence of bedding type on mucosal immune responses.

    Science.gov (United States)

    Sanford, Amy N; Clark, Stephanie E; Talham, Gwen; Sidelsky, Michael G; Coffin, Susan E

    2002-10-01

    The mucosal immune system interacts with the external environment. In the study reported here, we found that bedding materials can influence the intestinal immune responses of mice. We observed that mice housed on wood, compared with cotton bedding, had increased numbers of Peyer's patches (PP) visible under a dissecting microscope. In addition, culture of lymphoid organs revealed increased production of total and virus-specific IgA by PP and mesenteric lymph node (MLN) lymphocytes from mice housed on wood, compared with cotton bedding. However, bedding type did not influence serum virus-specific antibody responses. These observations indicate that bedding type influences the intestinal immune system and suggest that this issue should be considered by mucosal immunologists and personnel at animal care facilities.

  9. Frequent detection of human papillomavirus 16 E2-specific T-helper immunity in healthy subjects

    NARCIS (Netherlands)

    de Jong, Annemieke; van der Burg, Sjoerd H.; Kwappenberg, Kitty M. C.; van der Hulst, Jeanette M.; Franken, Kees L. M. C.; Geluk, Annemieke; van Meijgaarden, Krista E.; Drijfhout, Jan Wouter; Kenter, Gemma; Vermeij, Pieter; Melief, Cornelis J. M.; Offringa, Rienk

    2002-01-01

    The incidence of genital human papillomavirus (HPV) infections is high in young, sexually active individuals. Most infections are cleared within 1 year after infection. The targets for the cellular immune response in this process of viral clearance remain to be identified, but the expression pattern

  10. Human sexual response.

    Science.gov (United States)

    Basson, Rosemary

    2015-01-01

    The human sexual response to sexually arousing stimuli is a motivational incentive-based cycle comprising subjective experience and physiologic changes. Clinical and empirical data support a circular model of overlapping phases of variable order. Brain imaging data of sexual arousal identify areas of cerebral activation and inhibition reflecting a complex network of cognitive, motivational, emotional, and autonomic components. Psychologic and biologic factors influence the brain's appraisal and processing of sexual stimuli to allow or disallow subsequent arousal. The sexual and non-sexual outcomes influence motivation to future sexual intimacy. Variability is marked both between individuals and within a person's sexual life, influenced by multiple factors, including stage of life cycle, mental health, and relationship happiness. Neurologic disease can interrupt the cycle at many points: by limiting motivation, reducing ability to attend to and feel sexual stimuli, and accomplishing the movements needed to stimulate and experience intercourse. Impairments to genital congestion, penile erection, and orgasm may also occur. Disease-associated changes to the interpersonal relationship and self-image plus frequently comorbid depression will tend to lessen motivation and temper the brain's appraisal of sexual stimuli, so precluding arousal. Therapy begins by explaining the sexual response cycle, clarifying the points of interruption in the patient's own cycle so as to guide treatment. © 2015 Elsevier B.V. All rights reserved.

  11. The Pig as a Large Animal Model for Studying Anti-Tumor Immune Responses

    DEFF Research Database (Denmark)

    Overgaard, Nana Haahr

    but also generates a selective pressure, which may lead to selection of tumor cell variants with reduced immunogenicity; thereby, increasing the risk of tumor escape. Cancer immunotherapy includes treatment strategies aimed at activating anti-tumor immune responses or inhibiting suppressive and tumor......-favorable immune mechanisms. One of the promising arms of cancer immunotherapy is peptide-based therapeutic vaccines; yet, no such vaccine has been approved for use in human oncology. For many years, mouse models have provided invaluable understanding of complex immunological pathways; however, the majority...... tolerance towards IDO and the establishment of an antigen-specific cell-mediated immune (CMI) response. When comparing the different CAF09-formulated antigen doses, we demonstrate the induction of a CMI-dominant response upon exposure to a low endogenous peptide dose. In contrast, a mixed CMI and humoral...

  12. A Drosophila immune response against Ras-induced overgrowth

    Directory of Open Access Journals (Sweden)

    Thomas Hauling

    2014-03-01

    Full Text Available Our goal is to characterize the innate immune response against the early stage of tumor development. For this, animal models where genetic changes in specific cells and tissues can be performed in a controlled way have become increasingly important, including the fruitfly Drosophila melanogaster. Many tumor mutants in Drosophila affect the germline and, as a consequence, also the immune system itself, making it difficult to ascribe their phenotype to a specific tissue. Only during the past decade, mutations have been induced systematically in somatic cells to study the control of tumorous growth by neighboring cells and by immune cells. Here we show that upon ectopic expression of a dominant-active form of the Ras oncogene (RasV12, both imaginal discs and salivary glands are affected. Particularly, the glands increase in size, express metalloproteinases and display apoptotic markers. This leads to a strong cellular response, which has many hallmarks of the granuloma-like encapsulation reaction, usually mounted by the insect against larger foreign objects. RNA sequencing of the fat body reveals a characteristic humoral immune response. In addition we also identify genes that are specifically induced upon expression of RasV12. As a proof-of-principle, we show that one of the induced genes (santa-maria, which encodes a scavenger receptor, modulates damage to the salivary glands. The list of genes we have identified provides a rich source for further functional characterization. Our hope is that this will lead to a better understanding of the earliest stage of innate immune responses against tumors with implications for mammalian immunity.

  13. Radiation, Inflammation, and Immune Responses in Cancer

    Energy Technology Data Exchange (ETDEWEB)

    Multhoff, Gabriele [Department of Radiation Oncology, Klinikum rechts der Isar, Technische Universität München, Munich (Germany); Helmholtz Zentrum München, Clinical Cooperation Group Innate Immunity in Tumor Biology, Munich (Germany); Radons, Jürgen, E-mail: raj10062@web.de [multimmune GmbH, Munich (Germany)

    2012-06-04

    Chronic inflammation has emerged as one of the hallmarks of cancer. Inflammation also plays a pivotal role in modulating radiation responsiveness of tumors. As discussed in this review, ionizing radiation (IR) leads to activation of several transcription factors modulating the expression of numerous mediators in tumor cells and cells of the microenvironment promoting cancer development. Novel therapeutic approaches thus aim to interfere with the activity or expression of these factors, either in single-agent or combinatorial treatment or as supplements of the existing therapeutic concepts. Among them, NF-κB, STAT-3, and HIF-1 play a crucial role in radiation-induced inflammatory responses embedded in a complex inflammatory network. A great variety of classical or novel drugs including nutraceuticals such as plant phytochemicals have the capacity to interfere with the inflammatory network in cancer and are considered as putative radiosensitizers. Thus, targeting the inflammatory signaling pathways induced by IR offers the opportunity to improve the clinical outcome of radiation therapy by enhancing radiosensitivity and decreasing putative metabolic effects. Since inflammation and sex steroids also impact tumorigenesis, a therapeutic approach targeting glucocorticoid receptors and radiation-induced production of tumorigenic factors might be effective in sensitizing certain tumors to IR.

  14. Radiation, Inflammation, and Immune Responses in Cancer

    International Nuclear Information System (INIS)

    Multhoff, Gabriele; Radons, Jürgen

    2012-01-01

    Chronic inflammation has emerged as one of the hallmarks of cancer. Inflammation also plays a pivotal role in modulating radiation responsiveness of tumors. As discussed in this review, ionizing radiation (IR) leads to activation of several transcription factors modulating the expression of numerous mediators in tumor cells and cells of the microenvironment promoting cancer development. Novel therapeutic approaches thus aim to interfere with the activity or expression of these factors, either in single-agent or combinatorial treatment or as supplements of the existing therapeutic concepts. Among them, NF-κB, STAT-3, and HIF-1 play a crucial role in radiation-induced inflammatory responses embedded in a complex inflammatory network. A great variety of classical or novel drugs including nutraceuticals such as plant phytochemicals have the capacity to interfere with the inflammatory network in cancer and are considered as putative radiosensitizers. Thus, targeting the inflammatory signaling pathways induced by IR offers the opportunity to improve the clinical outcome of radiation therapy by enhancing radiosensitivity and decreasing putative metabolic effects. Since inflammation and sex steroids also impact tumorigenesis, a therapeutic approach targeting glucocorticoid receptors and radiation-induced production of tumorigenic factors might be effective in sensitizing certain tumors to IR.

  15. CAF01 potentiates immune responses and efficacy of an inactivated influenza vaccine in ferrets.

    Directory of Open Access Journals (Sweden)

    Cyril Jean-Marie Martel

    Full Text Available Trivalent inactivated vaccines (TIV against influenza are given to 350 million people every year. Most of these are non-adjuvanted vaccines whose immunogenicity and protective efficacy are considered suboptimal. Commercially available non-adjuvanted TIV are known to elicit mainly a humoral immune response, whereas the induction of cell-mediated immune responses is negligible. Recently, a cationic liposomal adjuvant (dimethyldioctadecylammonium/trehalose 6,6'-dibehenate, CAF01 was developed. CAF01 has proven to enhance both humoral and cell-mediated immune responses to a number of different experimental vaccine candidates. In this study, we compared the immune responses in ferrets to a commercially available TIV with the responses to the same vaccine mixed with the CAF01 adjuvant. Two recently circulating H1N1 viruses were used as challenge to test the vaccine efficacy. CAF01 improved the immunogenicity of the vaccine, with increased influenza-specific IgA and IgG levels. Additionally, CAF01 promoted cellular-mediated immunity as indicated by interferon-gamma expressing lymphocytes, measured by flow cytometry. CAF01 also enhanced the protection conferred by the vaccine by reducing the viral load measured in nasal washes by RT-PCR. Finally, CAF01 allowed for dose-reduction and led to higher levels of protection compared to TIV adjuvanted with a squalene emulsion. The data obtained in this human-relevant challenge model supports the potential of CAF01 in future influenza vaccines.

  16. Virion Glycoprotein-Mediated Immune Evasion by Human Cytomegalovirus: a Sticky Virus Makes a Slick Getaway

    Science.gov (United States)

    Gardner, Thomas J.

    2016-01-01

    SUMMARY The prototypic herpesvirus human cytomegalovirus (CMV) exhibits the extraordinary ability to establish latency and maintain a chronic infection throughout the life of its human host. This is even more remarkable considering the robust adaptive immune response elicited by infection and reactivation from latency. In addition to the ability of CMV to exist in a quiescent latent state, its persistence is enabled by a large repertoire of viral proteins that subvert immune defense mechanisms, such as NK cell activation and major histocompatibility complex antigen presentation, within the cell. However, dissemination outside the cell presents a unique existential challenge to the CMV virion, which is studded with antigenic glycoprotein complexes targeted by a potent neutralizing antibody response. The CMV virion envelope proteins, which are critical mediators of cell attachment and entry, possess various characteristics that can mitigate the humoral immune response and prevent viral clearance. Here we review the CMV glycoprotein complexes crucial for cell attachment and entry and propose inherent properties of these proteins involved in evading the CMV humoral immune response. These include viral glycoprotein polymorphism, epitope competition, Fc receptor-mediated endocytosis, glycan shielding, and cell-to-cell spread. The consequences of CMV virion glycoprotein-mediated immune evasion have a major impact on persistence of the virus in the population, and a comprehensive understanding of these evasion strategies will assist in designing effective CMV biologics and vaccines to limit CMV-associated disease. PMID:27307580

  17. [Immune response of Hansen's disease. Review].

    Science.gov (United States)

    Rada, Elsa; Aranzazu, Nacarid; Convit, Jacinto

    2009-12-01

    Hansen's disease presents a wide spectrum of clinical and histopathological manifestations that reflect the nature of the immunological response of the host towards diverse Mycobacterium leprae components. The immunological system, composed by both innate and adaptive immunology, offers protection towards infections of various etiologies, among them bacterial. Bacteria, of course, have developed multiple strategies for evading host defenses, based on either very complex or simple mechanisms, but with a single purpose: to "resist" host attacks and to be able to survive. We have tried to summarize some recent studies in Hansen's disease, with more emphasis in the inmunology area. We think that in the future, all illnesses should also be very strongly related to other important aspects such as the social, environmental and economic, and whose development is not solved in a laboratory.

  18. Immune and clinical response to honeybee venom in beekeepers

    Directory of Open Access Journals (Sweden)

    Jan Matysiak

    2016-03-01

    The differences in the immune response to a bee sting between the beekeepers and individuals not exposed to bees were probably due to the high exposure of the beekeepers to honeybee venom allergens. This may suggest a different approach to the bee venom allergy diagnostic tests in this occupational group.

  19. Induction of protective immune responses in mice by double DNA ...

    African Journals Online (AJOL)

    Purpose: To investigate the efficacy of a double DNA vaccine encoding of Brucella melitensis omp31 gene and of Escherichia coli eae gene in inducing protective immune response in a mouse model. Methods: After performing PCR assays and cloning both the eae and omp31 genes, the generated DNA vaccines were ...

  20. Impact on allergic immune response after treatment with vitamin A

    DEFF Research Database (Denmark)

    Matheu, Victor; Berggård, Karin; Barrios, Yvelise

    2009-01-01

    ABSTRACT: BACKGROUND: Vitamin A may have some influence on the immune system, but the role in allergy modulation is still unclear. OBJECTIVE: To clarify whether high levels of retinoic acid (RA) affects allergic response in vivo, we used a murine experimental model of airway allergic disease...

  1. Genetic variations in non-specific immune response to ...

    African Journals Online (AJOL)

    Non-specific immune response in three strains of Heterobranchus bidorsalis challenged with the bacterium Aeromonas hydrophilia was evaluated. The study was undertaken in three strains of H. bidorsalis from different ecological zones in Nigeria and the percentage cumulative mortality was lowest and significantly ...

  2. Humoral and cellular immune responses to modified hepatitis B ...

    African Journals Online (AJOL)

    These findings indicate that the vaccine induced both a humoral and cellular ... Keywords: Hepatitis B virus, Plasmid DNA, Vaccine, Spleen cytokines, Humoral and cellular immune responses ... produced in mice. ... were performed and HBsAg specific IgM and IgG ..... and protection elicited against Plasmodium berghei.

  3. Cellular immune response in prognosis of Bell's palsy and its ...

    African Journals Online (AJOL)

    Objective: To determine the cellular immune response in Bell's palsy (BP) and its prognostic value in relation to clinical and electrophysiological findings. Methods: Twenty patients with BP were subjected to: Facial nerve paralysis assessment according to House–Brackmann (H&B) grading system, bilateral facial nerve ...

  4. Radiation-induced augmentation of the immune response

    International Nuclear Information System (INIS)

    Anderson, R.E.; Lefkovits, I.; Troup, G.M.

    1980-01-01

    Radiation-induced augmentation of the immune response has been shown to occur both in vivo and in vitro. Evidence is presented to implicate injury to an extremely radiosensitive T cell in the expression of this phenomenon. Experiments are outlined which could be employed to support or reflect this hypothesis

  5. A multiherbal formulation influencing immune response in vitro.

    Science.gov (United States)

    Menghini, L; Leporini, L; Scanu, N; Pintore, G; Ferrante, C; Recinella, L; Orlando, G; Vacca, M; Brunetti, L

    2012-02-01

    Aim of this study was to evaluate the effects of phytocomplexes of Uncaria, Shiitake and Ribes in terms of viability and inflammatory response on immune cell-derived cultures. Standardized extracts of Uncaria, Shitake and Ribes and their commercial formulation were tested on cell lines PBMC, U937 and macrophage. The activity was evaluated in terms of cell viability (MTT test), variations of oxidative marker release (ROS and PGE2) and modulatory effects on immune response (gene expression of IL-6, IL-8 and TNFα, RT-PCR). Cell viability was not affected by extracts, except subtle variations observed only at higher doses (>250 µg/mL). The extract mixture was well tolerated, with no effects on cell viability up to doses of 500 µg/mL. Pre-treatment of macrophages with subtoxic doses of the extracts reduced the basal release of oxidative markers and enhanced the cell response to exogenous oxidant stimulation, as revealed by ROS and PGE2 release reduction. The same treatment on macrophage resulted in a selective modulation of the immune response, as shown by an increase of IL-6 mRNA and, partially, IL-8 mRNA, while a reduction was observed for TNFα mRNA. Data confirm that extracts and their formulations can act as regulator of the immune system with mechanisms involving the oxidative stress and the release of selected proinflammatory cytokines.

  6. Signalling through C-type lectin receptors: shaping immune responses

    NARCIS (Netherlands)

    Geijtenbeek, Teunis B. H.; Gringhuis, Sonja I.

    2009-01-01

    C-type lectin receptors (CLRs) expressed by dendritic cells are crucial for tailoring immune responses to pathogens. Following pathogen binding, CLRs trigger distinct signalling pathways that induce the expression of specific cytokines which determine T cell polarization fates. Some CLRs can induce

  7. The immune system strikes back: cellular immune responses against indoleamine 2,3-dioxygenase

    DEFF Research Database (Denmark)

    Sørensen, Rikke Baek; Berge-Hansen, Linda; Junker, Niels

    2009-01-01

    BACKGROUND: The enzyme indoleamine 2,3-dioxygenase (IDO) exerts an well established immunosuppressive function in cancer. IDO is expressed within the tumor itself as well as in antigen-presenting cells in tumor-draining lymph nodes, where it promotes the establishment of peripheral immune tolerance...... to tumor antigens. In the present study, we tested the notion whether IDO itself may be subject to immune responses. METHODS AND FINDINGS: The presence of naturally occurring IDO-specific CD8 T cells in cancer patients was determined by MHC/peptide stainings as well as ELISPOT. Antigen specific cytotoxic T...... of the major immune suppressive cell populations. CONCLUSION: IDO may serve as an important and widely applicable target for anti-cancer immunotherapeutic strategies. Furthermore, as emerging evidence suggests that IDO constitutes a significant counter-regulatory mechanism induced by pro-inflammatory signals...

  8. Tumor PDT-associated immune response: relevance of sphingolipids

    Science.gov (United States)

    Korbelik, Mladen; Merchant, Soroush; Separovic, Duska M.

    2010-02-01

    Sphingolipids have become recognized as essential effector molecules in signal transduction with involvement in various aspects of cell function and death, immune response and cancer treatment response. Major representatives of sphingolipids family, ceramide, sphingosine and sphingosine-1-phosphate (S1P), have attracted interest in their relevance to tumor response to photodynamic therapy (PDT) because of their roles as enhancers of apoptosis, mediators of cell growth and vasculogenesis, and regulators of immune response. Our recent in vivo studies with mouse tumor models have confirmed that PDT treatment has a pronounced impact on sphingolipid profile in the targeted tumor and that significant advances in therapeutic gain with PDT can be attained by combining this modality with adjuvant treatment with ceramide analog LCL29.

  9. Sexual dimorphism of stress response and immune/ inflammatory reaction: the corticotropin releasing hormone perspective

    OpenAIRE

    Vamvakopoulos, Nicholas V.

    1995-01-01

    This review higlghts key aspects of corticotropin releasing hormone (CRH) biology of potential relevance to the sexual dimorphism of the stress response and immune/inflammatory reaction, and introduces two important new concepts based on the regulatory potential of the human (h) CRH gene: (1) a proposed mechanism to account for the tissue-specific antithetical responses of hCRH gene expression to glucocorticolds, that may also explain the frequently observed antithetical effects of chronic gl...

  10. Induction and Subversion of Human Protective Immunity: Contrasting Influenza and Respiratory Syncytial Virus

    Science.gov (United States)

    Ascough, Stephanie; Paterson, Suzanna; Chiu, Christopher

    2018-01-01

    Respiratory syncytial virus (RSV) and influenza are among the most important causes of severe respiratory disease worldwide. Despite the clinical need, barriers to developing reliably effective vaccines against these viruses have remained firmly in place for decades. Overcoming these hurdles requires better understanding of human immunity and the strategies by which these pathogens evade it. Although superficially similar, the virology and host response to RSV and influenza are strikingly distinct. Influenza induces robust strain-specific immunity following natural infection, although protection by current vaccines is short-lived. In contrast, even strain-specific protection is incomplete after RSV and there are currently no licensed RSV vaccines. Although animal models have been critical for developing a fundamental understanding of antiviral immunity, extrapolating to human disease has been problematic. It is only with recent translational advances (such as controlled human infection models and high-dimensional technologies) that the mechanisms responsible for differences in protection against RSV compared to influenza have begun to be elucidated in the human context. Influenza infection elicits high-affinity IgA in the respiratory tract and virus-specific IgG, which correlates with protection. Long-lived influenza-specific T cells have also been shown to ameliorate disease. This robust immunity promotes rapid emergence of antigenic variants leading to immune escape. RSV differs markedly, as reinfection with similar strains occurs despite natural infection inducing high levels of antibody against conserved antigens. The immunomodulatory mechanisms of RSV are thus highly effective in inhibiting long-term protection, with disturbance of type I interferon signaling, antigen presentation and chemokine-induced inflammation possibly all contributing. These lead to widespread effects on adaptive immunity with impaired B cell memory and reduced T cell generation and

  11. Induction and Subversion of Human Protective Immunity: Contrasting Influenza and Respiratory Syncytial Virus

    Directory of Open Access Journals (Sweden)

    Stephanie Ascough

    2018-03-01

    Full Text Available Respiratory syncytial virus (RSV and influenza are among the most important causes of severe respiratory disease worldwide. Despite the clinical need, barriers to developing reliably effective vaccines against these viruses have remained firmly in place for decades. Overcoming these hurdles requires better understanding of human immunity and the strategies by which these pathogens evade it. Although superficially similar, the virology and host response to RSV and influenza are strikingly distinct. Influenza induces robust strain-specific immunity following natural infection, although protection by current vaccines is short-lived. In contrast, even strain-specific protection is incomplete after RSV and there are currently no licensed RSV vaccines. Although animal models have been critical for developing a fundamental understanding of antiviral immunity, extrapolating to human disease has been problematic. It is only with recent translational advances (such as controlled human infection models and high-dimensional technologies that the mechanisms responsible for differences in protection against RSV compared to influenza have begun to be elucidated in the human context. Influenza infection elicits high-affinity IgA in the respiratory tract and virus-specific IgG, which correlates with protection. Long-lived influenza-specific T cells have also been shown to ameliorate disease. This robust immunity promotes rapid emergence of antigenic variants leading to immune escape. RSV differs markedly, as reinfection with similar strains occurs despite natural infection inducing high levels of antibody against conserved antigens. The immunomodulatory mechanisms of RSV are thus highly effective in inhibiting long-term protection, with disturbance of type I interferon signaling, antigen presentation and chemokine-induced inflammation possibly all contributing. These lead to widespread effects on adaptive immunity with impaired B cell memory and reduced T cell

  12. Memory B-Cell and Antibody Responses Induced by Plasmodium falciparum Sporozoite Immunization

    NARCIS (Netherlands)

    Nahrendorf, W.; Scholzen, A.; Bijker, E.M.; Teirlinck, A.C.; Bastiaens, G.J.H.; Schats, R.; Hermsen, C.C.; Visser, L.G.; Langhorne, J.; Sauerwein, R.W.

    2014-01-01

    BACKGROUND: Immunization of healthy volunteers during receipt of chemoprophylaxis with Plasmodium falciparum sporozoites (CPS-immunization) induces sterile protection from malaria. Antibody responses have long been known to contribute to naturally acquired immunity against malaria, but their

  13. The role of glycans in immune evasion: the human fetoembryonic defence system hypothesis revisited.

    Science.gov (United States)

    Clark, Gary F

    2014-03-01

    Emerging data suggest that mechanisms to evade the human immune system may be shared by the conceptus, tumour cells, persistent pathogens and viruses. It is therefore timely to revisit the human fetoembryonic defense system (Hu-FEDS) hypothesis that was proposed in two papers in the 1990s. The initial paper suggested that glycoconjugates expressed in the human reproductive system inhibited immune responses directed against gametes and the developing human by employing their carbohydrate sequences as functional groups. These glycoconjugates were proposed to block specific binding interactions and interact with lectins linked to signal transduction pathways that modulated immune cell functions. The second article suggested that aggressive tumour cells and persistent pathogens (HIV, H. pylori, schistosomes) either mimicked or acquired the same carbohydrate functional groups employed in this system to evade immune responses. This subterfuge enabled these pathogens and tumour cells to couple their survival to the human reproductive imperative. The Hu-FEDS model has been repeatedly tested since its inception. Data relevant to this model have also been obtained in other studies. Herein, the Hu-FEDS hypothesis is revisited in the context of these more recent findings. Far more supportive evidence for this model now exists than when it was first proposed, and many of the original predictions have been validated. This type of subterfuge by pathogens and tumour cells likely applies to all sexually reproducing metazoans that must protect their gametes from immune responses. Intervention in these pathological states will likely remain problematic until this system of immune evasion is fully understood and appreciated.

  14. Immune Response to Electromagnetic Fields through Cybernetic Modeling

    International Nuclear Information System (INIS)

    Godina-Nava, J. J.; Segura, M. A. Rodriguez; Cadena, S. Reyes; Sierra, L. C. Gaitan

    2008-01-01

    We study the optimality of the humoral immune response through a mathematical model, which involves the effect of electromagnetic fields over the large lymphocytes proliferation. Are used the so called cybernetic variables in the context of the matching law of microeconomics or mathematical psychology, to measure the large lymphocytes population and to maximize the instantaneous antibody production rate in time during the immunologic response in order to most efficiently inactivate the antigen

  15. Immune Response to Electromagnetic Fields through Cybernetic Modeling

    Science.gov (United States)

    Godina-Nava, J. J.; Segura, M. A. Rodríguez; Cadena, S. Reyes; Sierra, L. C. Gaitán

    2008-08-01

    We study the optimality of the humoral immune response through a mathematical model, which involves the effect of electromagnetic fields over the large lymphocytes proliferation. Are used the so called cybernetic variables in the context of the matching law of microeconomics or mathematical psychology, to measure the large lymphocytes population and to maximize the instantaneous antibody production rate in time during the immunologic response in order to most efficiently inactivate the antigen.

  16. Glycan-mediated modification of the immune response

    DEFF Research Database (Denmark)

    Madsen, Caroline B; Pedersen, Anders E; Wandall, Hans H

    2013-01-01

    Aberrantly glycosylated tumor antigens represent promising targets for the development of anti-cancer vaccines, yet how glycans influence immune responses is poorly understood. Recent studies have demonstrated that GalNAc-glycosylation enhances antigen uptake by dendritic cells as well as CD4(+) T......-cell and humoral responses, but prevents CD8(+) T-cell activation. Here, we briefly discuss the relevance of glycans as candidate targets for anti-cancer vaccines....

  17. Human Immune Responses to Experimental Vaccinia Vaccines

    National Research Council Canada - National Science Library

    Ennis, Francis

    1996-01-01

    .... During the two years of this contract we have: (1) obtained, separated and cryopreserved peripheral blood mononuclear cells from 92 vaccinees in a clinical study to compare the standard and an experimental small pox vaccine, (2...

  18. Stochastic responses of tumor–immune system with periodic treatment

    International Nuclear Information System (INIS)

    Li Dong-Xi; Li Ying

    2017-01-01

    We investigate the stochastic responses of a tumor–immune system competition model with environmental noise and periodic treatment. Firstly, a mathematical model describing the interaction between tumor cells and immune system under external fluctuations and periodic treatment is established based on the stochastic differential equation. Then, sufficient conditions for extinction and persistence of the tumor cells are derived by constructing Lyapunov functions and Ito’s formula. Finally, numerical simulations are introduced to illustrate and verify the results. The results of this work provide the theoretical basis for designing more effective and precise therapeutic strategies to eliminate cancer cells, especially for combining the immunotherapy and the traditional tools. (paper)

  19. Immunization with Brucella VirB proteins reduces organ colonization in mice through a Th1-type immune response and elicits a similar immune response in dogs.

    Science.gov (United States)

    Pollak, Cora N; Wanke, María Magdalena; Estein, Silvia M; Delpino, M Victoria; Monachesi, Norma E; Comercio, Elida A; Fossati, Carlos A; Baldi, Pablo C

    2015-03-01

    VirB proteins from Brucella spp. constitute the type IV secretion system, a key virulence factor mediating the intracellular survival of these bacteria. Here, we assessed whether a Th1-type immune response against VirB proteins may protect mice from Brucella infection and whether this response can be induced in the dog, a natural host for Brucella. Splenocytes from mice immunized with VirB7 or VirB9 responded to their respective antigens with significant and specific production of gamma interferon (IFN-γ), whereas interleukin-4 (IL-4) was not detected. Thirty days after an intraperitoneal challenge with live Brucella abortus, the spleen load of bacteria was almost 1 log lower in mice immunized with VirB proteins than in unvaccinated animals. As colonization reduction seemed to correlate with a Th1-type immune response against VirB proteins, we decided to assess whether such a response could be elicited in the dog. Peripheral blood mononuclear cells (PBMCs) from dogs immunized with VirB proteins (three subcutaneous doses in QuilA adjuvant) produced significantly higher levels of IFN-γ than cells from control animals upon in vitro stimulation with VirB proteins. A skin test to assess specific delayed-type hypersensitivity was positive in 4 out of 5 dogs immunized with either VirB7 or VirB9. As both proteins are predicted to locate in the outer membrane of Brucella organisms, the ability of anti-VirB antibodies to mediate complement-dependent bacteriolysis of B. canis was assessed in vitro. Sera from dogs immunized with either VirB7 or VirB9, but not from those receiving phosphate-buffered saline (PBS), produced significant bacteriolysis. These results suggest that VirB-specific responses that reduce organ colonization by Brucella in mice can be also elicited in dogs. Copyright © 2015, American Society for Microbiology. All Rights Reserved.

  20. Primary immune system responders to nucleus pulposus cells: evidence for immune response in disc herniation

    Directory of Open Access Journals (Sweden)

    K Murai

    2010-01-01

    Full Text Available Although intervertebral disc herniation and associated sciatica is a common disease, its molecular pathogenesis is not well understood. Immune responses are thought to be involved. This study provides direct evidence that even non-degenerated nucleus pulposus (NP cells elicit immune responses. An in vitro colony forming inhibition assay demonstrated the suppressive effects of autologous spleen cells on NP cells and an in vitro cytotoxicity assay showed the positive cytotoxic effects of natural killer (NK cells and macrophages on NP cells. Non-degenerated rat NP tissues transplanted into wild type rats and immune-deficient mice demonstrated a significantly higher NP cell survival rate in immune-deficient mice. Immunohistochemical staining showed the presence of macrophages and NK cells in the transplanted NP tissues. These results suggest that even non-degenerated autologous NP cells are recognized by macrophages and NK cells, which may have an immunological function in the early phase of disc herniation. These findings contribute to understanding resorption and the inflammatory reaction to disc herniation.

  1. Immunization with avian metapneumovirus harboring chicken Fc induces higher immune responses.

    Science.gov (United States)

    Paudel, Sarita; Easwaran, Maheswaran; Jang, Hyun; Jung, Ho-Kyoung; Kim, Joo-Hun; Shin, Hyun-Jin

    2016-07-15

    In this study, we evaluated the immune responses of avian metapneumovirus harboring chicken Fc molecule. Stable Vero cells expressing chicken Fc chimera on its surface (Vero-cFc) were established, and we confirmed that aMPV grown in Vero-cFc incorporated host derived chimera Fc into the aMPV virions. Immunization of chicken with aMPV-cFc induced higher level of antibodies and inflammatory cytokines; (Interferon (IFN)-γ and Interleukin (IL)-1β) compared to those of aMPV. The increased levels of antibodies and inflammatory cytokines in chicken immunized with aMPV-cFc were statistically significantly (p<0.05) to that of aMPV and control. The aMPV-cFc group also generated the highest neutralizing antibody response. After challenges, chickens immunized with aMPV-cFc showed much less pathological signs in nasal turbinates and trachea so that we could confirm aMPV-cFc induced higher protection than that of aMPV. The greater ability of aMPV harboring chicken Fc to that of aMPV presented it as a possible vaccine candidate. Copyright © 2016 Elsevier B.V. All rights reserved.

  2. Vaccine-mediated immune responses to experimental pulmonary Cryptococcus gattii infection in mice.

    Directory of Open Access Journals (Sweden)

    Ashok K Chaturvedi

    Full Text Available Cryptococcus gattii is a fungal pathogen that can cause life-threatening respiratory and disseminated infections in immune-competent and immune-suppressed individuals. Currently, there are no standardized vaccines against cryptococcosis in humans, underlying an urgent need for effective therapies and/or vaccines. In this study, we evaluated the efficacy of intranasal immunization with C. gattii cell wall associated (CW and/or cytoplasmic (CP protein preparations to induce protection against experimental pulmonary C. gattii infection in mice. BALB/c mice immunized with C. gattii CW and/or CP protein preparations exhibited a significant reduction in pulmonary fungal burden and prolonged survival following pulmonary challenge with C. gattii. Protection was associated with significantly increased pro-inflammatory and Th1-type cytokine recall responses, in vitro and increased C. gattii-specific antibody production in immunized mice challenged with C. gattii. A number of immunodominant proteins were identified following immunoblot analysis of C. gattii CW and CP protein preparations using sera from immunized mice. Immunization with a combined CW and CP protein preparation resulted in an early increase in pulmonary T cell infiltrates following challenge with C. gattii. Overall, our studies show that C. gattii CW and CP protein preparations contain antigens that may be included in a subunit vaccine to induce prolonged protection against pulmonary C. gattii infection.

  3. Inflammation and Immune Response in COPD: Where Do We Stand?

    Directory of Open Access Journals (Sweden)

    Nikoletta Rovina

    2013-01-01

    Full Text Available Increasing evidence indicates that chronic inflammatory and immune responses play key roles in the development and progression of COPD. Recent data provide evidence for a role in the NLRP3 inflammasome in the airway inflammation observed in COPD. Cigarette smoke activates innate immune cells by triggering pattern recognition receptors (PRRs to release “danger signal”. These signals act as ligands to Toll-like receptors (TLRs, triggering the production of cytokines and inducing innate inflammation. In smokers who develop COPD there appears to be a specific pattern of inflammation in the airways and parenchyma as a result of both innate and adaptive immune responses, with the predominance of CD8+ and CD4+ cells, and in the more severe disease, with the presence of lymphoid follicles containing B lymphocytes and T cells. Furthermore, viral and bacterial infections interfere with the chronic inflammation seen in stable COPD and exacerbations via pathogen-associated molecular patterns (PAMPs. Finally, autoimmunity is another novel aspect that may play a critical role in the pathogenesis of COPD. This review is un update of the currently discussed roles of inflammatory and immune responses in the pathogenesis of COPD.

  4. Structural and functional analyses of DNA-sensing and immune activation by human cGAS.

    Science.gov (United States)

    Kato, Kazuki; Ishii, Ryohei; Goto, Eiji; Ishitani, Ryuichiro; Tokunaga, Fuminori; Nureki, Osamu

    2013-01-01

    The detection of cytosolic DNA, derived from pathogens or host cells, by cytosolic receptors is essential for appropriate host immune responses. Cyclic GMP-AMP synthase (cGAS) is a newly identified cytosolic DNA receptor that produces cyclic GMP-AMP, which activates stimulator of interferon genes (STING), resulting in TBK1-IRF3 pathway activation followed by the production of type I interferons. Here we report the crystal structure of human cGAS. The structure revealed that a cluster of lysine and arginine residues forms the positively charged DNA binding surface of human cGAS, which is important for the STING-dependent immune activation. A structural comparison with other previously determined cGASs and our functional analyses suggested that a conserved zinc finger motif and a leucine residue on the DNA binding surface are crucial for the DNA-specific immune response of human cGAS, consistent with previous work. These structural features properly orient the DNA binding to cGAS, which is critical for DNA-induced cGAS activation and STING-dependent immune activation. Furthermore, we showed that the cGAS-induced activation of STING also involves the activation of the NF-κB and IRF3 pathways. Our results indicated that cGAS is a DNA sensor that efficiently activates the host immune system by inducing two distinct pathways.

  5. Structural and functional analyses of DNA-sensing and immune activation by human cGAS.

    Directory of Open Access Journals (Sweden)

    Kazuki Kato

    Full Text Available The detection of cytosolic DNA, derived from pathogens or host cells, by cytosolic receptors is essential for appropriate host immune responses. Cyclic GMP-AMP synthase (cGAS is a newly identified cytosolic DNA receptor that produces cyclic GMP-AMP, which activates stimulator of interferon genes (STING, resulting in TBK1-IRF3 pathway activation followed by the production of type I interferons. Here we report the crystal structure of human cGAS. The structure revealed that a cluster of lysine and arginine residues forms the positively charged DNA binding surface of human cGAS, which is important for the STING-dependent immune activation. A structural comparison with other previously determined cGASs and our functional analyses suggested that a conserved zinc finger motif and a leucine residue on the DNA binding surface are crucial for the DNA-specific immune response of human cGAS, consistent with previous work. These structural features properly orient the DNA binding to cGAS, which is critical for DNA-induced cGAS activation and STING-dependent immune activation. Furthermore, we showed that the cGAS-induced activation of STING also involves the activation of the NF-κB and IRF3 pathways. Our results indicated that cGAS is a DNA sensor that efficiently activates the host immune system by inducing two distinct pathways.

  6. Human immune cell targeting of protein nanoparticles - caveospheres

    Science.gov (United States)

    Glass, Joshua J.; Yuen, Daniel; Rae, James; Johnston, Angus P. R.; Parton, Robert G.; Kent, Stephen J.; de Rose, Robert

    2016-04-01

    Nanotechnology has the power to transform vaccine and drug delivery through protection of payloads from both metabolism and off-target effects, while facilitating specific delivery of cargo to immune cells. However, evaluation of immune cell nanoparticle targeting is conventionally restricted to monocultured cell line models. We generated human caveolin-1 nanoparticles, termed caveospheres, which were efficiently functionalized with monoclonal antibodies. Using this platform, we investigated CD4+ T cell and CD20+ B cell targeting within physiological mixtures of primary human blood immune cells using flow cytometry, imaging flow cytometry and confocal microscopy. Antibody-functionalization enhanced caveosphere binding to targeted immune cells (6.6 to 43.9-fold) within mixed populations and in the presence of protein-containing fluids. Moreover, targeting caveospheres to CCR5 enabled caveosphere internalization by non-phagocytic CD4+ T cells--an important therapeutic target for HIV treatment. This efficient and flexible system of immune cell-targeted caveosphere nanoparticles holds promise for the development of advanced immunotherapeutics and vaccines.

  7. Preventive immunization of aged and juvenile non-human primates to beta-amyloid

    Directory of Open Access Journals (Sweden)

    Kofler Julia

    2012-05-01

    Full Text Available Abstract Background Immunization against beta-amyloid (Aβ is a promising approach for the treatment of Alzheimer’s disease, but the optimal timing for the vaccination remains to be determined. Preventive immunization approaches may be more efficacious and associated with fewer side-effects; however, there is only limited information available from primate models about the effects of preclinical vaccination on brain amyloid composition and the neuroinflammatory milieu. Methods Ten non-human primates (NHP of advanced age (18–26 years and eight 2-year-old juvenile NHPs were immunized at 0, 2, 6, 10 and 14 weeks with aggregated Aβ42 admixed with monophosphoryl lipid A as adjuvant, and monitored for up to 6 months. Anti-Aβ antibody levels and immune activation markers were assessed in plasma and cerebrospinal fluid samples before and at several time-points after immunization. Microglial activity was determined by [11C]PK11195 PET scans acquired before and after immunization, and by post-mortem immunohistochemical and real-time PCR evaluation. Aβ oligomer composition was assessed by immunoblot analysis in the frontal cortex of aged immunized and non-immunized control animals. Results All juvenile animals developed a strong and sustained serum anti-Aβ IgG antibody response, whereas only 80 % of aged animals developed detectable antibodies. The immune response in aged monkeys was more delayed and significantly weaker, and was also more variable between animals. Pre- and post-immunization [11C]PK11195 PET scans showed no evidence of vaccine-related microglial activation. Post-mortem brain tissue analysis indicated a low overall amyloid burden, but revealed a significant shift in oligomer size with an increase in the dimer:pentamer ratio in aged immunized animals compared with non-immunized controls (P  Conclusions Our results indicate that preventive Aβ immunization is a safe therapeutic approach lacking adverse CNS immune system

  8. Polysaccharides isolated from Açaí fruit induce innate immune responses.

    Directory of Open Access Journals (Sweden)

    Jeff Holderness

    2011-02-01

    Full Text Available The Açaí (Acai fruit is a popular nutritional supplement that purportedly enhances immune system function. These anecdotal claims are supported by limited studies describing immune responses to the Acai polyphenol fraction. Previously, we characterized γδ T cell responses to both polyphenol and polysaccharide fractions from several plant-derived nutritional supplements. Similar polyphenol and polysaccharide fractions are found in Acai fruit. Thus, we hypothesized that one or both of these fractions could activate γδ T cells. Contrary to previous reports, we did not identify agonist activity in the polyphenol fraction; however, the Acai polysaccharide fraction induced robust γδ T cell stimulatory activity in human, mouse, and bovine PBMC cultures. To characterize the immune response to Acai polysaccharides, we fractionated the crude polysaccharide preparation and tested these fractions for activity in human PBMC cultures. The largest Acai polysaccharides were the most active in vitro as indicated by activation of myeloid and γδ T cells. When delivered in vivo, Acai polysaccharide induced myeloid cell recruitment and IL-12 production. These results define innate immune responses induced by the polysaccharide component of Acai and have implications for the treatment of asthma and infectious disease.

  9. Indigenous enteric eosinophils control DCs to initiate a primary Th2 immune response in vivo

    Science.gov (United States)

    Chu, Derek K.; Jimenez-Saiz, Rodrigo; Verschoor, Christopher P.; Walker, Tina D.; Goncharova, Susanna; Llop-Guevara, Alba; Shen, Pamela; Gordon, Melissa E.; Barra, Nicole G.; Bassett, Jennifer D.; Kong, Joshua; Fattouh, Ramzi; McCoy, Kathy D.; Bowdish, Dawn M.; Erjefält, Jonas S.; Pabst, Oliver; Humbles, Alison A.; Kolbeck, Roland; Waserman, Susan

    2014-01-01

    Eosinophils natively inhabit the small intestine, but a functional role for them there has remained elusive. Here, we show that eosinophil-deficient mice were protected from induction of Th2-mediated peanut food allergy and anaphylaxis, and Th2 priming was restored by reconstitution with il4+/+ or il4−/− eosinophils. Eosinophils controlled CD103+ dendritic cell (DC) activation and migration from the intestine to draining lymph nodes, events necessary for Th2 priming. Eosinophil activation in vitro and in vivo led to degranulation of eosinophil peroxidase, a granule protein whose enzymatic activity promoted DC activation in mice and humans in vitro, and intestinal and extraintestinal mouse DC activation and mobilization to lymph nodes in vivo. Further, eosinophil peroxidase enhanced responses to ovalbumin seen after immunization. Thus, eosinophils can be critical contributors to the intestinal immune system, and granule-mediated shaping of DC responses can promote both intestinal and extraintestinal adaptive immunity. PMID:25071163

  10. FEATURES OF THE IMMUNE RESPONSE DURING INFECTION AND PROSPECTS FOR THE VACCINES CREATION

    Directory of Open Access Journals (Sweden)

    Davidova T.V.

    2015-12-01

    Full Text Available The influenza virus belongs to the family Orthomyxoviridae and is a major cause of respiratory infections in humans. Each year, influenza viruses cause, according to experts, 3-5 million severe course of the disease and 250 000-500 000 deaths. Influenza A viruses are divided into serotypes based on their surface glycoproteins - known currently 17 subtypes of HA and NA subtypes ten. Upon infection with an influenza virus, both innate and adaptive immune responses are inducing. In recent years the annual seasonal epidemics were causing strains of the virus A (H1N1 and H3N2 and virus B. This may be due to their ability to be unrecognizable virus specific antibodies due to antigenic drift (Figure 1. Seasonal flu vaccine, to be effective, must be updated almost annually, according to new epidemic strains. In this work will discuss various strategies used by influenza viruses to evade innate immune responses and recognition by components of the humoral and cellular immune response, which consequently may result in reduced clearing of the virus and virus-infected cells.The primary targets for influenza viruses are the epithelial cells that line the respiratory tract and which initiate an antiviral immune response upon detection of the virus. The first line of defense is formed by the innate immune system, which is quick but lacks specificity and memory. Innate immunity is formed by physical barriers and innate cellular immune responses. Here, we outline several of the innate defense mechanisms directed against influenza infections. During homeostasis, alveolar macrophages exhibit a relatively quiescent state, producing only low levels of cytokines, and suppress the induction of innate and adaptive immunity. Activated macrophages enhance their pro-inflammatory cytokine response, including IL-6 and TNF-α. Alveolar macrophages have a direct role in limiting viral spread by phagocytosis of apoptotic infected cells and by phagocyte

  11. Modulation of innate immune responses by Yersinia type III secretion system translocators and effectors.

    Science.gov (United States)

    Bliska, James B; Wang, Xiaoying; Viboud, Gloria I; Brodsky, Igor E

    2013-10-01

    The innate immune system of mammals responds to microbial infection through detection of conserved molecular determinants called 'pathogen-associated molecular patterns' (PAMPs). Pathogens use virulence factors to counteract PAMP-directed responses. The innate immune system can in turn recognize signals generated by virulence factors, allowing for a heightened response to dangerous pathogens. Many Gram-negative bacterial pathogens encode type III secretion systems (T3SSs) that translocate effector proteins, subvert PAMP-directed responses and are critical for infection. A plasmid-encoded T3SS in the human-pathogenic Yersinia species translocates seven effectors into infected host cells. Delivery of effectors by the T3SS requires plasma membrane insertion of two translocators, which are thought to form a channel called a translocon. Studies of the Yersinia T3SS have provided key advances in our understanding of how innate immune responses are generated by perturbations in plasma membrane and other signals that result from translocon insertion. Additionally, studies in this system revealed that effectors function to inhibit innateimmune responses resulting from insertion of translocons into plasma membrane. Here, we review these advances with the goal of providing insight into how a T3SS can activate and inhibit innate immune responses, allowing a virulent pathogen to bypass host defences. © 2013 John Wiley & Sons Ltd.

  12. Persistence of the immune response induced by BCG vaccination

    Directory of Open Access Journals (Sweden)

    Blitz Rose

    2008-01-01

    Full Text Available Abstract Background Although BCG vaccination is recommended in most countries of the world, little is known of the persistence of BCG-induced immune responses. As novel TB vaccines may be given to boost the immunity induced by neonatal BCG vaccination, evidence concerning the persistence of the BCG vaccine-induced response would help inform decisions about when such boosting would be most effective. Methods A randomised control study of UK adolescents was carried out to investigate persistence of BCG immune responses. Adolescents were tested for interferon-gamma (IFN-γ response to Mycobacterium tuberculosis purified protein derivative (M.tb PPD in a whole blood assay before, 3 months, 12 months (n = 148 and 3 years (n = 19 after receiving teenage BCG vaccination or 14 years after receiving infant BCG vaccination (n = 16. Results A gradual reduction in magnitude of response was evident from 3 months to 1 year and from 1 year to 3 years following teenage vaccination, but responses 3 years after vaccination were still on average 6 times higher than before vaccination among vaccinees. Some individuals (11/86; 13% failed to make a detectable antigen-specific response three months after vaccination, or lost the response after 1 (11/86; 13% or 3 (3/19; 16% years. IFN-γ response to Ag85 was measured in a subgroup of adolescents and appeared to be better maintained with no decline from 3 to 12 months. A smaller group of adolescents were tested 14 years after receiving infant BCG vaccination and 13/16 (81% made a detectable IFN-γ response to M.tb PPD 14 years after infant vaccination as compared to 6/16 (38% matched unvaccinated controls (p = 0.012; teenagers vaccinated in infancy were 19 times more likely to make an IFN-γ response of > 500 pg/ml than unvaccinated teenagers. Conclusion BCG vaccination in infancy and adolescence induces immunological memory to mycobacterial antigens that is still present and measurable for at least 14 years in the

  13. Defence mechanisms and immune evasion in the interplay between the humane immune system and Plasmodium falciparum

    DEFF Research Database (Denmark)

    Theander, T G

    1992-01-01

    Immunity to P. falciparum malaria is developed as a result of long term exposure to the parasite and depends on immunological memory. The key directors in immune recognition and regulation of the immunological responses are the T-cells. It seems reasonable to propose that immunity is acquired when...... with development of immunity. Several mechanisms seem to be operating. 1) Induction of the immune response to some macromolecules is avoided because the parasites are living inside host cells during part of their life cycle, and the reaction to other molecules is apparently avoided by mimicry of host molecules. 2...

  14. Augmenting Plant Immune Responses and Biological Control by Microbial Determinants

    Directory of Open Access Journals (Sweden)

    Sang Moo Lee

    2015-09-01

    Full Text Available Plant have developed sophisticated defence mechanisms against microbial pathogens. The recent accumulated information allow us to understand the nature of plant immune responses followed by recognition of microbial factors/determinants through cutting-edge genomics and multi-omics techniques. However, the practical approaches to sustain plant health using enhancement of plant immunity is yet to be fully appreciated. Here, we overviewed the general concept and representative examples on the plant immunity. The fungal, bacterial, and viral determinants that was previously reported as the triggers of plant immune responses are introduced and described as the potential protocol of biological control. Specifically, the role of chitin, glucan, lipopolysaccharides/extracellular polysaccharides, microbe/pathogen-associated molecular pattern, antibiotics, mimic-phytohormones, N-acyl homoserine lactone, harpin, vitamins, and volatile organic compounds are considered. We hope that this review stimulates scientific community and farmers to broaden their knowledge on the microbial determinant-based biological control and to apply the technology on the integrated pest management program.

  15. Pathogens and host immunity in the ancient human oral cavity

    Science.gov (United States)

    Warinner, Christina; Matias Rodrigues, João F.; Vyas, Rounak; Trachsel, Christian; Shved, Natallia; Grossmann, Jonas; Radini, Anita; Hancock, Y.; Tito, Raul Y.; Fiddyment, Sarah; Speller, Camilla; Hendy, Jessica; Charlton, Sophy; Luder, Hans Ulrich; Salazar-García, Domingo C.; Eppler, Elisabeth; Seiler, Roger; Hansen, Lars; Samaniego Castruita, José Alfredo; Barkow-Oesterreicher, Simon; Teoh, Kai Yik; Kelstrup, Christian; Olsen, Jesper V.; Nanni, Paolo; Kawai, Toshihisa; Willerslev, Eske; von Mering, Christian; Lewis, Cecil M.; Collins, Matthew J.; Gilbert, M. Thomas P.; Rühli, Frank; Cappellini, Enrico

    2014-01-01

    Calcified dental plaque (dental calculus) preserves for millennia and entraps biomolecules from all domains of life and viruses. We report the first high-resolution taxonomic and protein functional characterization of the ancient oral microbiome and demonstrate that the oral cavity has long served as a reservoir for bacteria implicated in both local and systemic disease. We characterize: (i) the ancient oral microbiome in a diseased state, (ii) 40 opportunistic pathogens, (iii) the first evidence of ancient human-associated putative antibiotic resistance genes, (iv) a genome reconstruction of the periodontal pathogen Tannerella forsythia, (v) 239 bacterial and 43 human proteins, allowing confirmation of a long-term association between host immune factors, “red-complex” pathogens, and periodontal disease, and (vi) DNA sequences matching dietary sources. Directly datable and nearly ubiquitous, dental calculus permits the simultaneous investigation of pathogen activity, host immunity, and diet, thereby extending the direct investigation of common diseases into the human evolutionary past. PMID:24562188

  16. Immunity to rhabdoviruses in rainbow trout: the antibody response

    DEFF Research Database (Denmark)

    Lorenzen, Niels; Lapatra, S.E.

    1999-01-01

    to their occasional detrimental effect on rainbow trout farming. Research efforts have been focused on understanding the mechanisms involved in protective immunity. Several specific and nonspecific cellular and humoral parameters are believed to be involved, but only the antibody response has been characterised......, have demonstrated that rainbow trout can produce specific and highly functional antibodies that are able to neutralise virus pathogenicity in vitro as well as in vivo. The apparently more restricted antibody response to IHNV and VHSV antigens in fish compared to mammals could possibly be explained...... aspects of antibody response and antibody reactivity with IHNV and VHSV antigens....

  17. Immune responses of Helicoverpa armigera to different kinds of pathogens

    Directory of Open Access Journals (Sweden)

    Zhao Xiao-Fan

    2010-03-01

    Full Text Available Abstract Background Insects react against pathogens through innate immunity. The cotton bollworm Helicoverpa armigera (H. armigera is an important defoliator and an extremely destructive pest insect of many crops. The elucidation of the mechanism of the immune response of H. armigera to various pathogens can provide a theoretical basis for new approaches to biologically control this pest. Results Four kinds of pathogens Bacillus thuringiensis, Klebsiella pneumoniae, Candida albicans, and Autographa californica multiple nucleocapsid nucleopolyhedrovirus harbored green fluorescence protein and polyhedron (AcMNPV-GFP were used to challenge the insect. The cellular and humoral immune responses to the pathogens were analyzed in the challenged H. armigera. The results show that in the five kinds of haemocytes, only granulocytes phagocytized the Gram-negative and Gram-positive bacteria and fungi. All haemocytes can be infected by AcMNPV. Fourteen immune-related genes including pattern recognition receptors (PRRs such as peptidoglycan recognition proteins (HaPGRP and HaPGRP C and Gram-Negative Bacteria-Binding Protein (HaGNBP, and antimicrobial peptides (AMPs such as cecropin-1, 2 and 3 (HaCec-1, 2 and 3, lysozyme (HaLys, attacin (HaAtt, gallerimycin-like (HaGall, gloverin-like (HaGlo, moricin-like (HaMor, cobatoxin-like (HaCob, galiomicin-like (HaGali, and immune inducible protein (HaIip appeared in different expression profiles to different pathogen infections. The transcripts of 13 immune related genes (except HaPGRPC are obviously up-regulated by Gram-positive bacteria. HaCec-1 and 3, HaMor, HaAtt, HaLys, HaIip, HaPGRP and HaGNBP are greatly up-regulated after fungal infection. HaGNBP, HaCec-2, HaGall, HaGlo, HaMor, HaCob, HaGali obviously increased in Gram-negative bacterial infection. Only five genes, HaGNBP, HaCec-1, HaGali, HaGlo, and HaLys, are weakly up-regulated after viral infection. The AMP transcripts had higher expression levels than the

  18. Binding of human papilloma virus L1 virus-like particles to dendritic cells is mediated through heparan sulfates and induces immune activation

    NARCIS (Netherlands)

    de Witte, Lot; Zoughlami, Younes; Aengeneyndt, Birgit; David, Guido; van Kooyk, Yvette; Gissmann, Lutz; Geijtenbeek, Teunis B. H.

    2007-01-01

    Immunization using human papilloma virus (HPV)-L1 virus-like particles (VLPs) induces a robust and effective immune response, which has recently resulted in the implementation of the HPV-L1 VLP vaccination in health programs. However, during infection, HPV can escape immune surveillance leading to

  19. CD28 Aptamers as Powerful Immune Response Modulators

    Directory of Open Access Journals (Sweden)

    Fernando Pastor

    2013-01-01

    Full Text Available CD28 is one of the main costimulatory receptors responsible for the proper activation of T lymphocytes. We have isolated two aptamers that bind to the CD28 receptor. As a monomer, one of them interfered with the binding of CD28 to its ligand (B7, precluding the costimulatory signal, whereas the other one was inactive. However, dimerization of any of the anti-CD28 aptamers was sufficient to provide an artificial costimulatory signal. No antibody has featured a dual function (i.e., the ability to work as agonist and antagonist to date. Two different agonistic structures were engineered for each anti-CD28 aptamer. One showed remarkably improved costimulatory properties, surpassing the agonistic effect of an anti-CD28 antibody. Moreover, we showed in vivo that the CD28 agonistic aptamer is capable of enhancing the cellular immune response against a lymphoma idiotype and of prolonging survival of mice which receive the aptamer together with an idiotype vaccine. The CD28 aptamers described in this work could be used to modulate the immune response either blocking the interaction with B7 or enhancing vaccine-induced immune responses in cancer immunotherapy.

  20. Tailoring the Immune Response via Customization of Pathogen Gene Expression.

    Science.gov (United States)

    Runco, Lisa M; Stauft, Charles B; Coleman, J Robert

    2014-01-01

    The majority of studies focused on the construction and reengineering of bacterial pathogens have mainly relied on the knocking out of virulence factors or deletion/mutation of amino acid residues to then observe the microbe's phenotype and the resulting effect on the host immune response. These knockout bacterial strains have also been proposed as vaccines to combat bacterial disease. Theoretically, knockout strains would be unable to cause disease since their virulence factors have been removed, yet they could induce a protective memory response. While knockout strains have been valuable tools to discern the role of virulence factors in host immunity and bacterial pathogenesis, they have been unable to yield clinically relevant vaccines. The advent of synthetic biology and enhanced user-directed gene customization has altered this binary process of knockout, followed by observation. Recent studies have shown that a researcher can now tailor and customize a given microbe's gene expression to produce a desired immune response. In this commentary, we highlight these studies as a new avenue for controlling the inflammatory response as well as vaccine development.

  1. Inhibition of the immune response to experimental fresh osteoarticular allografts

    International Nuclear Information System (INIS)

    Rodrigo, J.J.; Schnaser, A.M.; Reynolds, H.M. Jr.; Biggart, J.M. III; Leathers, M.W.; Chism, S.E.; Thorson, E.; Grotz, T.; Yang, Q.M.

    1989-01-01

    The immune response to osteoarticular allografts is capable of destroying the cartilage--a tissue that has antigens on its cells identical to those on the bone and marrow cells. Osteoarticular allografts of the distal femur were performed in rats using various methods to attempt to temporarily inhibit the antibody response. The temporary systemic immunosuppressant regimens investigated were cyclophosphamide, azathioprine and prednisolone, cyclosporine A, and total lymphoid irradiation. The most successful appeared to be cyclosporine A, but significant side effects were observed. To specifically inhibit the immune response in the allograft antigens without systemically inhibiting the entire immune system, passive enhancement and preadministration of donor blood were tried. Neither was as effective as coating the donor bone with biodegradable cements, a method previously found to be successful. Cyclosporine A was investigated in dogs in a preliminary study of medial compartmental knee allografts and was found to be successful in inhibiting the antibody response and in producing a more successful graft; however, some significant side effects were similarly observed

  2. Human perinatal immunity in physiological conditions and during infection.

    Science.gov (United States)

    van Well, Gijs T J; Daalderop, Leonie A; Wolfs, Tim; Kramer, Boris W

    2017-12-01

    The intrauterine environment was long considered sterile. However, several infectious threats are already present during fetal life. This review focuses on the postnatal immunological consequences of prenatal exposure to microorganisms and related inflammatory stimuli. Both the innate and adaptive immune systems of the fetus and neonate are immature, which makes them highly susceptible to infections. There is good evidence that prenatal infections are a primary cause of preterm births. Additionally, the association between antenatal inflammation and adverse neonatal outcomes has been well established. The lung, gastrointestinal tract, and skin are exposed to amniotic fluid during pregnancy and are probable targets of infection and subsequent inflammation during pregnancy. We found a large number of studies focusing on prenatal infection and the host response. Intrauterine infection and fetal immune responses are well studied, and we describe clinical data on cellular, cytokine, and humoral responses to different microbial challenges. The link to postnatal immunological effects including immune paralysis and/or excessive immune activation, however, turned out to be much more complicated. We found studies relating prenatal infectious or inflammatory hits to well-known neonatal diseases such as respiratory distress syndrome, bronchopulmonary dysplasia, and necrotizing enterocolitis. Despite these data, a direct link between prenatal hits and postnatal immunological outcome could not be undisputedly established. We did however identify several unresolved topics and propose questions for further research.

  3. An overview of HCV molecular biology, replication and immune responses

    Directory of Open Access Journals (Sweden)

    Nawaz Zafar

    2011-04-01

    Full Text Available Abstract Hepatitis C virus (HCV causes acute and chronic hepatitis which can eventually lead to permanent liver damage, hepatocellular carcinoma and death. Currently, there is no vaccine available for prevention of HCV infection due to high degree of strain variation. The current treatment of care, Pegylated interferon α in combination with ribavirin is costly, has significant side effects and fails to cure about half of all infections. In this review, we summarize molecular virology, replication and immune responses against HCV and discussed how HCV escape from adaptive and humoral immune responses. This advance knowledge will be helpful for development of vaccine against HCV and discovery of new medicines both from synthetic chemistry and natural sources.

  4. Immune responses of poultry to Newcastle disease virus.

    Science.gov (United States)

    Kapczynski, Darrell R; Afonso, Claudio L; Miller, Patti J

    2013-11-01

    Newcastle disease (ND) remains a constant threat to poultry producers worldwide, in spite of the availability and global employment of ND vaccinations since the 1950s. Strains of Newcastle disease virus (NDV) belong to the order Mononegavirales, family Paramyxoviridae, and genus Avulavirus, are contained in one serotype and are also known as avian paramyxovirus serotype-1 (APMV-1). They are pleomorphic in shape and are single-stranded, non-segmented, negative sense RNA viruses. The virus has been reported to infect most orders of birds and thus has a wide host range. Isolates are characterized by virulence in chickens and the presence of basic amino acids at the fusion protein cleavage site. Low virulent NDV typically produce subclinical disease with some morbidity, whereas virulent isolates can result in rapid, high mortality of birds. Virulent NDV are listed pathogens that require immediate notification to the Office of International Epizootics and outbreaks typically result in trade embargos. Protection against NDV is through the use of vaccines generated with low virulent NDV strains. Immunity is derived from neutralizing antibodies formed against the viral hemagglutinin and fusion glycoproteins, which are responsible for attachment and spread of the virus. However, new techniques and technologies have also allowed for more in depth analysis of the innate and cell-mediated immunity of poultry to NDV. Gene profiling experiments have led to the discovery of novel host genes modulated immediately after infection. Differences in virus virulence alter host gene response patterns have been demonstrated. Furthermore, the timing and contributions of cell-mediated immune responses appear to decrease disease and transmission potential. In view of recent reports of vaccine failure from many countries on the ability of classical NDV vaccines to stop spread of disease, renewed interest in a more complete understanding of the global immune response of poultry to NDV will be

  5. Enhancement of Immune Memory Responses to Respiratory Infection

    Science.gov (United States)

    2017-08-01

    Unlimited Distribution 13. SUPPLEMENTARY NOTES 14. ABSTRACT Maintenance of long - term immunological memory against pathogens is crucial for the rapid...highly expressed in memory B cells in mice, and Atg7 is required for maintenance of long - term memory B cells needed to protect against influenza...AWARD NUMBER: W81XWH-16-1-0361 TITLE: Enhancement of Immune Memory Responses to Respiratory Infection PRINCIPAL INVESTIGATORs: Dr Farrah

  6. Strains of bacterial species induce a greatly varied acute adaptive immune response: The contribution of the accessory genome.

    Directory of Open Access Journals (Sweden)

    Uri Sela

    2018-01-01

    Full Text Available A fundamental question in human susceptibility to bacterial infections is to what extent variability is a function of differences in the pathogen species or in individual humans. To focus on the pathogen species, we compared in the same individual the human adaptive T and B cell immune response to multiple strains of two major human pathogens, Staphylococcus aureus and Streptococcus pyogenes. We found wide variability in the acute adaptive immune response induced by various strains of a species, with a unique combination of activation within the two arms of the adaptive response. Further, this was also accompanied by a dramatic difference in the intensity of the specific protective T helper (Th response. Importantly, the same immune response differences induced by the individual strains were maintained across multiple healthy human donors. A comparison of isogenic phage KO strains, demonstrated that of the pangenome, prophages were the major contributor to inter-strain immune heterogeneity, as the T cell response to the remaining "core genome" was noticeably blunted. Therefore, these findings extend and modify the notion of an adaptive response to a pathogenic bacterium, by implying that the adaptive immune response signature of a bacterial species should be defined either per strain or alternatively to the species' 'core genome', common to all of its strains. Further, our results demonstrate that the acquired immune response variation is as wide among different strains within a single pathogenic species as it is among different humans, and therefore may explain in part the clinical heterogeneity observed in patients infected with the same species.

  7. Harnessing what lies within: Programming immunity with biocompatible devices to treat human disease

    Science.gov (United States)

    Roberts, Reid Austin

    Advances in our mechanistic insight of cellular function and how this relates to host physiology have revealed a world which is intimately connected at the macro and micro level. Our increasing understanding of biology exemplifies this, where cells respond to environmental cues through interconnected networks of proteins which function as receptors and adaptors to elicit gene expression changes that drive appropriate cellular programs for a given stimulus. Consequently, our deeper molecular appreciation of host homeostasis implicates aberrations of these pathways in nearly all major human disease categories, including those of infectious, metabolic, neurologic, oncogenic, and autoimmune etiology. We have come to recognize the mammalian immune system as a common network hub among all these varied pathologies. As such, the major goal of this dissertation is to identify a platform to program immune responses in mammals so that we may enhance our ability to treat disease and improve health in the 21st century. Using advances in materials science, in particular a recently developed particle fabrication technology termed Particle Replication in Non-wetting Templates (PRINT), our studies systematically assess the murine and human immune response to precisely fabricated nano- and microscale particles composed of biodegradable and biocompatible materials. We then build on these findings and present particle design parameters to program a number of clinically attractive immune responses by targeting endogenous cellular signaling pathways. These include control of particle uptake through surface modification, design parameters that modulate the magnitude and kinetics of biological signaling dynamics that can be used to exacerbate or dampen inflammatory responses, as well as particle designs which may be of use in treating allergies and autoimmune disorders. In total, this dissertation provides evidence that rational design of biocompatible nano- and microparticles is a viable

  8. Immune surveillance properties of human NK cell-derived exosomes.

    Science.gov (United States)

    Lugini, Luana; Cecchetti, Serena; Huber, Veronica; Luciani, Francesca; Macchia, Gianfranco; Spadaro, Francesca; Paris, Luisa; Abalsamo, Laura; Colone, Marisa; Molinari, Agnese; Podo, Franca; Rivoltini, Licia; Ramoni, Carlo; Fais, Stefano

    2012-09-15

    Exosomes are nanovesicles released by normal and tumor cells, which are detectable in cell culture supernatant and human biological fluids, such as plasma. Functions of exosomes released by "normal" cells are not well understood. In fact, several studies have been carried out on exosomes derived from hematopoietic cells, but very little is known about NK cell exosomes, despite the importance of these cells in innate and adaptive immunity. In this paper, we report that resting and activated NK cells, freshly isolated from blood of healthy donors, release exosomes expressing typical protein markers of NK cells and containing killer proteins (i.e., Fas ligand and perforin molecules). These nanovesicles display cytotoxic activity against several tumor cell lines and activated, but not resting, immune cells. We also show that NK-derived exosomes undergo uptake by tumor target cells but not by resting PBMC. Exosomes purified from plasma of healthy donors express NK cell markers, including CD56+ and perforin, and exert cytotoxic activity against different human tumor target cells and activated immune cells as well. The results of this study propose an important role of NK cell-derived exosomes in immune surveillance and homeostasis. Moreover, this study supports the use of exosomes as an almost perfect example of biomimetic nanovesicles possibly useful in future therapeutic approaches against various diseases, including tumors.

  9. Effect of host nutrition on immunity and local immune response of rabbits to Obeliscoides cuniculi

    International Nuclear Information System (INIS)

    Sinski, E.; Bezubik, B.; Wedrychowicz, H.; Szklarczyk, J.; Doligalska, M.

    1988-01-01

    In a series of experiments carried out on young and adult rabbits the effect of isocaloric low protein diets containing 4% or 8% protein compared with a diet containing 21% protein on Obeliscoides cuniculi infection was studied. The pathogenesis, resistance and local immunity were assessed after single infections with 10,000 larvae or reinfection with 5000 larvae. Live weight gain was reduced in young and adult rabbits fed the low protein diets, but the establishment of parasites was not substantially influenced by protein deprivation. However, development of worms in the histotrophic phase and parasite fecundity were impaired in association with the low protein diet. Moreover, mild anaemia as well as changes in the mucosal immune response as a result of infection were related to the level of dietary protein. (author). 30 refs, 6 figs, 5 tabs

  10. Maternal obesity alters immune cell frequencies and responses in umbilical cord blood samples.

    Science.gov (United States)

    Wilson, Randall M; Marshall, Nicole E; Jeske, Daniel R; Purnell, Jonathan Q; Thornburg, Kent; Messaoudi, Ilhem

    2015-06-01

    Maternal obesity is one of the several key factors thought to modulate neonatal immune system development. Data from murine studies demonstrate worse outcomes in models of infection, autoimmunity, and allergic sensitization in offspring of obese dams. In humans, children born to obese mothers are at increased risk for asthma. These findings suggest a dysregulation of immune function in the children of obese mothers; however, the underlying mechanisms remain poorly understood. The aim of this study was to examine the relationship between maternal body weight and the human neonatal immune system. Umbilical cord blood samples were collected from infants born to lean, overweight, and obese mothers. Frequency and function of major innate and adaptive immune cell populations were quantified using flow cytometry and multiplex analysis of circulating factors. Compared to babies born to lean mothers, babies of obese mothers had fewer eosinophils and CD4 T helper cells, reduced monocyte and dendritic cell responses to Toll-like receptor ligands, and increased plasma levels of IFN-α2 and IL-6 in cord blood. These results support the hypothesis that maternal obesity influences programming of the neonatal immune system, providing a potential link to increased incidence of chronic inflammatory diseases such as asthma and cardiovascular disease in the offspring. © 2015 John Wiley & Sons A/S. Published by John Wiley & Sons Ltd.

  11. Humoral and cell-mediated immune responses in DNA immunized mink challenged with wild-type canine distemper virus.

    Science.gov (United States)

    Nielsen, Line; Søgaard, Mette; Karlskov-Mortensen, Peter; Jensen, Trine Hammer; Jensen, Tove Dannemann; Aasted, Bent; Blixenkrone-Møller, Merete

    2009-07-30

    The aim of the study was to investigate the different phases of the immune response after DNA immunization with the hemagglutinin and nucleoprotein genes from canine distemper virus (CDV). Although attenuated live CDV vaccines have effectively reduced the incidence of disease, canine distemper is still a problem worldwide. The broad host range of CDV creates a constant viral reservoir among wildlife animals. Our results demonstrated early humoral and cell-mediated immune responses (IFN-gamma) in DNA vaccinated mink compared to mock-vaccinated mink after challenge with a Danish wild-type CDV. The DNA vaccine-induced immunity protected the natural host against disease development.

  12. Human embryo immune escape mechanisms rediscovered by the tumor.

    Science.gov (United States)

    Ridolfi, Laura; Petrini, Massimiliano; Fiammenghi, Laura; Riccobon, Angela; Ridolfi, Ruggero

    2009-01-01

    Towards the end of the 1990s, the two opposing theories on immunosurveillance and immunostimulation were extensively studied by researchers in an attempt to understand the complex mechanisms that regulate the relation between tumors and the host's immune system. Both theories probably have elements that would help us to comprehend how the host can induce anti-tumor clinical responses through stimulation of the immune system and which could also give us a deeper insight into the mechanisms of tumor immunosuppression. The model that most resembles the behavior of tumor cells in terms of growth, infiltration and suppression of the immune system of the environment in which they live is undoubtedly that of the embryonic cell. The fetus behaves like an allogenic transplant within the mother's body, using every means it has to escape from and defend itself against the mother's immune system. The majority of these mechanisms are the same as those found in tumor cells: antigenic loss, lack of expression of classic HLA-I molecules, production of immunosuppressive cytokines, induction of lack of expression of co-stimulatory molecules in antigen presenting cells, and induction of apoptosis in infiltrating lymphocytes, with activation of a type Th2 regulatory lymphocyte response. A careful and comparative study of key mechanisms capable of triggering tolerance or cytotoxicity in both embryonic and tumor cells could prove immensely valuable in designing new strategies for anti-tumor immunotherapy.

  13. Cancer Immunotherapy and the Immune Response in Hodgkin Lymphoma

    Directory of Open Access Journals (Sweden)

    Christoph Renner

    2018-06-01

    Full Text Available Patients with classical Hodgkin lymphoma (cHL have an impaired cellular immune response as indicated by an anergic reaction against standard recall antigens and a diminished rejection reaction of allogeneic skin transplant. This clinical observation can be linked to the histopathological feature of cHL since the typical pattern of a cHL manifestation is characterized by sparse large CD30+ tumor-infiltrating Hodgkin–Reed–Sternberg (HRS cells that are surrounded by a dense inflammatory immune microenvironment with mixed cellularity. Despite this extensive polymorphous inflammatory infiltrate, there is only a poor antitumor immune response seen to the neoplastic HRS cells. This is primarily mediated by a high expression of PD-L1 and PD-L2 ligands on the HRS cell surface which in turn antagonizes the activity of programmed death-1 (PD-1 antigen-positive T cells. PD-L1/L2 overexpression is caused by gene amplification at the 9p24.1 locus and/or latent Epstein–Barr virus infection present in around 40% of cHL cases. The blockade of the PD-L1/L2–PD-1 pathway by monoclonal antibodies can restore local T cell activity and leads to impressive tumor responses, some of which are long lasting and eventually curative. Another feature of HRS cells is the high CD30 antigen expression. Monoclonal antibody technology allowed for the successful development of CD30-specific immunotoxins, bispecific antibodies, and reprogrammed autologous T cells with the first one already approved for the treatment of high risk or relapsed cHL. Altogether, the discovery of the described pathomechanism of immune suppression and the identification of preferential target antigens has rendered cHL to be a prime subject for the successful development of new immunotherapeutic approaches.

  14. Alterations in immune responses in prenatally irradiated dogs

    International Nuclear Information System (INIS)

    Nold, J.B.; Benjamin, S.A.; Miller, G.K.

    1988-01-01

    Immunologic responses were studied in beagle dogs following prenatal (35 days gestation) irradiation to evaluate the effects of ionizing radiation on the developing immune system. Each dog received 1.5 Gy 60 Co gamma irradiation or sham irradiation. Prenatally irradiated dogs exhibited a significant reduction in primary humoral antibody responses to inoculated sheep red blood cells, a T-dependent antigen, and a concurrent decrease in T-helper lymphocyte subpopulations in the peripheral blood at 3 to 4 months of age. Similarly, irradiated fetuses have been shown to have defects in epitheliostromal development of the thymus. It is suggested that the postnatal immunologic deficits may relate to the prenatal thymic injury

  15. Effects of anti-schistosomal chemotherapy on immune responses, protection and immunity. II. Concomitant immunity and immunization with irradiated cercariae

    International Nuclear Information System (INIS)

    Tawfik, A.F.; Colley, D.G.

    1986-01-01

    Resistance of mice to challenge infections of Schistosoma mansoni was evaluated before and after elimination of their primary, established S. mansoni infections with the chemotherapeutic drug praziquantel. Mice treated after either 10 or 20 weeks of primary infection were challenged 6 or 10 weeks after treatment. Mice infected for for 10 weeks prior to treatment expressed progressively less resistance 6 and 10 weeks after treatment. By 10 weeks after treatment significant levels of protection were no longer observed. Resistance waned more slowly if mice were treated 20 weeks after infection, and there was still significant expression of resistance to challenge 10 weeks after treatment. A separate set of experiments evaluated the use of highly irradiated cercariae as a vaccine in mice that had been previously infected with S. mansoni and cured with praziquantel. It was observed that effective immunizations were possible in previously infected mice. These studies demonstrate that established resistance waned after treatment and the rate of loss of protection was dependent upon the duration of infection prior to treatment. Furthermore, the irradiated cercarial vaccine studies indicate that in the murine model induction of immunological resistance was feasible following chemotherapeutic treatment of infected populations

  16. Exosome RNA Released by Hepatocytes Regulates Innate Immune Responses to Hepatitis B Virus Infection

    Directory of Open Access Journals (Sweden)

    Takahisa Kouwaki

    2016-08-01

    Full Text Available The innate immune system is essential for controlling viral infection. Hepatitis B virus (HBV persistently infects human hepatocytes and causes hepatocellular carcinoma. However, the innate immune response to HBV infection in vivo remains unclear. Using a tree shrew animal model, we showed that HBV infection induced hepatic interferon (IFN-γ expression during early infection. Our in vitro study demonstrated that hepatic NK cells produced IFN-γ in response to HBV only in the presence of hepatic F4/80+ cells. Moreover, extracellular vesicles released from HBV-infected hepatocytes contained viral nucleic acids and induced NKG2D ligand expression in macrophages by stimulating MyD88, TICAM-1, and MAVS-dependent pathways. In addition, depletion of exosomes from extracellular vesicles markedly reduced NKG2D ligand expression, suggesting the importance of exosomes for NK cell activation. In contrast, infection of hepatocytes with HBV increased immunoregulatory microRNA levels in extracellular vesicles and exosomes, which were transferred to macrophages, thereby suppressing IL-12p35 mRNA expression in macrophages to counteract the host innate immune response. IFN-γ increased the hepatic expression of DDX60 and augmented the DDX60-dependent degradation of cytoplasmic HBV RNA. Our results elucidated the crucial role of exosomes in antiviral innate immune response against HBV.

  17. MicroRNA-mediated networks underlie immune response regulation in papillary thyroid carcinoma

    Science.gov (United States)

    Huang, Chen-Tsung; Oyang, Yen-Jen; Huang, Hsuan-Cheng; Juan, Hsueh-Fen

    2014-09-01

    Papillary thyroid carcinoma (PTC) is a common endocrine malignancy with low death rate but increased incidence and recurrence in recent years. MicroRNAs (miRNAs) are small non-coding RNAs with diverse regulatory capacities in eukaryotes and have been frequently implied in human cancer. Despite current progress, however, a panoramic overview concerning miRNA regulatory networks in PTC is still lacking. Here, we analyzed the expression datasets of PTC from The Cancer Genome Atlas (TCGA) Data Portal and demonstrate for the first time that immune responses are significantly enriched and under specific regulation in the direct miRNA-target network among distinctive PTC variants to different extents. Additionally, considering the unconventional properties of miRNAs, we explore the protein-coding competing endogenous RNA (ceRNA) and the modulatory networks in PTC and unexpectedly disclose concerted regulation of immune responses from these networks. Interestingly, miRNAs from these conventional and unconventional networks share general similarities and differences but tend to be disparate as regulatory activities increase, coordinately tuning the immune responses that in part account for PTC tumor biology. Together, our systematic results uncover the intensive regulation of immune responses underlain by miRNA-mediated networks in PTC, opening up new avenues in the management of thyroid cancer.

  18. The Hepatitis C Virus Glycan Shield and Evasion of the Humoral Immune Response

    Directory of Open Access Journals (Sweden)

    Jean Dubuisson

    2011-10-01

    Full Text Available Despite the induction of effective immune responses, 80% of hepatitis C virus (HCV-infected individuals progress from acute to chronic hepatitis. In contrast to the cellular immune response, the role of the humoral immune response in HCV clearance is still subject to debate. Indeed, HCV escapes neutralizing antibodies in chronically infected patients and reinfection has been described in human and chimpanzee. Studies of antibody-mediated HCV neutralization have long been hampered by the lack of cell-culture-derived virus and the absence of a small animal model. However, the development of surrogate models and recent progress in HCV propagation in vitro now enable robust neutralization assays to be performed. These advances are beginning to shed some light on the mechanisms of HCV neutralization. This review summarizes the current state of knowledge of the viral targets of anti-HCV-neutralizing antibodies and the mechanisms that enable HCV to evade the humoral immune response. The recent description of the HCV glycan shield that reduces the immunogenicity of envelope proteins and masks conserved neutralizing epitopes at their surface constitutes the major focus of this review.

  19. Multi-scale modeling of the CD8 immune response

    Energy Technology Data Exchange (ETDEWEB)

    Barbarroux, Loic, E-mail: loic.barbarroux@doctorant.ec-lyon.fr [Inria, Université de Lyon, UMR 5208, Institut Camille Jordan (France); Ecole Centrale de Lyon, 36 avenue Guy de Collongue, 69134 Ecully (France); Michel, Philippe, E-mail: philippe.michel@ec-lyon.fr [Inria, Université de Lyon, UMR 5208, Institut Camille Jordan (France); Ecole Centrale de Lyon, 36 avenue Guy de Collongue, 69134 Ecully (France); Adimy, Mostafa, E-mail: mostafa.adimy@inria.fr [Inria, Université de Lyon, UMR 5208, Université Lyon 1, Institut Camille Jordan, 43 Bd. du 11 novembre 1918, F-69200 Villeurbanne Cedex (France); Crauste, Fabien, E-mail: crauste@math.univ-lyon1.fr [Inria, Université de Lyon, UMR 5208, Université Lyon 1, Institut Camille Jordan, 43 Bd. du 11 novembre 1918, F-69200 Villeurbanne Cedex (France)

    2016-06-08

    During the primary CD8 T-Cell immune response to an intracellular pathogen, CD8 T-Cells undergo exponential proliferation and continuous differentiation, acquiring cytotoxic capabilities to address the infection and memorize the corresponding antigen. After cleaning the organism, the only CD8 T-Cells left are antigen-specific memory cells whose role is to respond stronger and faster in case they are presented this very same antigen again. That is how vaccines work: a small quantity of a weakened pathogen is introduced in the organism to trigger the primary response, generating corresponding memory cells in the process, giving the organism a way to defend himself in case it encounters the same pathogen again. To investigate this process, we propose a non linear, multi-scale mathematical model of the CD8 T-Cells immune response due to vaccination using a maturity structured partial differential equation. At the intracellular scale, the level of expression of key proteins is modeled by a delay differential equation system, which gives the speeds of maturation for each cell. The population of cells is modeled by a maturity structured equation whose speeds are given by the intracellular model. We focus here on building the model, as well as its asymptotic study. Finally, we display numerical simulations showing the model can reproduce the biological dynamics of the cell population for both the primary response and the secondary responses.

  20. Immune and Inflammatory Cell Composition of Human Lung Cancer Stroma.

    Directory of Open Access Journals (Sweden)

    G-Andre Banat

    Full Text Available Recent studies indicate that the abnormal microenvironment of tumors may play a critical role in carcinogenesis, including lung cancer. We comprehensively assessed the number of stromal cells, especially immune/inflammatory cells, in lung cancer and evaluated their infiltration in cancers of different stages, types and metastatic characteristics potential. Immunohistochemical analysis of lung cancer tissue arrays containing normal and lung cancer sections was performed. This analysis was combined with cyto-/histomorphological assessment and quantification of cells to classify/subclassify tumors accurately and to perform a high throughput analysis of stromal cell composition in different types of lung cancer. In human lung cancer sections we observed a significant elevation/infiltration of total-T lymphocytes (CD3+, cytotoxic-T cells (CD8+, T-helper cells (CD4+, B cells (CD20+, macrophages (CD68+, mast cells (CD117+, mononuclear cells (CD11c+, plasma cells, activated-T cells (MUM1+, B cells, myeloid cells (PD1+ and neutrophilic granulocytes (myeloperoxidase+ compared with healthy donor specimens. We observed all of these immune cell markers in different types of lung cancers including squamous cell carcinoma, adenocarcinoma, adenosquamous cell carcinoma, small cell carcinoma, papillary adenocarcinoma, metastatic adenocarcinoma, and bronchioloalveolar carcinoma. The numbers of all tumor-associated immune cells (except MUM1+ cells in stage III cancer specimens was significantly greater than those in stage I samples. We observed substantial stage-dependent immune cell infiltration in human lung tumors suggesting that the tumor microenvironment plays a critical role during lung carcinogenesis. Strategies for therapeutic interference with lung cancer microenvironment should consider the complexity of its immune cell composition.

  1. Secretion of interferon gamma from human immune cells is altered by exposure to tributyltin and dibutyltin.

    Science.gov (United States)

    Lawrence, Shanieek; Reid, Jacqueline; Whalen, Margaret

    2015-05-01

    Tributyltin (TBT) and dibutyltin (DBT) are widespread environmental contaminants found in food, beverages, and human blood samples. Both of these butyltins (BTs) interfere with the ability of human natural killer (NK) cells to lyse target cells and alter secretion of the pro-inflammatory cytokine tumor necrosis factor alpha (TNFα) from human immune cells in vitro. The capacity of BTs to interfere with secretion of other pro-inflammatory cytokines has not been examined. Interferon gamma (IFNγ) is a modulator of adaptive and innate immune responses, playing an important role in overall immune competence. This study shows that both TBT and DBT alter secretion of IFNγ from human immune cells. Peripheral blood cell preparations that were increasingly reconstituted were used to determine if exposures to either TBT or DBT affected IFNγ secretion and how the makeup of the cell preparation influenced that effect. IFNγ secretion was examined after 24 h, 48 h, and 6 day exposures to TBT (200 - 2.5 nM) and DBT (5 - 0.05 µM) in highly enriched human NK cells, a monocyte-depleted preparation of PBMCs, and monocyte-containing PBMCs. Both BTs altered IFNγ secretion from immune cells at most of the conditions tested (either increasing or decreasing secretion). However, there was significant variability among donors as to the concentrations and time points that showed changes as well as the baseline secretion of IFNγ. The majority of donors showed an increase in IFNγ secretion in response to at least one concentration of TBT or DBT at a minimum of one length of exposure. © 2013 Wiley Periodicals, Inc.

  2. Hypocretin/orexin loss changes the hypothalamic immune response.

    Science.gov (United States)

    Tanaka, Susumu; Takizawa, Nae; Honda, Yoshiko; Koike, Taro; Oe, Souichi; Toyoda, Hiromi; Kodama, Tohru; Yamada, Hisao

    2016-10-01

    Hypocretin, also known as orexin, maintains the vigilance state and regulates various physiological processes, such as arousal, sleep, food intake, energy expenditure, and reward. Previously, we found that when wild-type mice and hypocretin/ataxin-3 littermates (which are depleted of hypothalamic hypocretin-expressing neurons postnatally) were administered lipopolysaccharide (LPS), the two genotypes exhibited significant differences in their sleep/wake cycle, including differences in the degree of increase in sleep periods and in recovery from sickness behaviour. In the present study, we examined changes in the hypothalamic vigilance system and in the hypothalamic expression of inflammatory factors in response to LPS in hypocretin/ataxin-3 mice. Peripheral immune challenge with LPS affected the hypothalamic immune response and vigilance states. This response was altered by the loss of hypocretin. Hypocretin expression was inhibited after LPS injection in both hypocretin/ataxin-3 mice and their wild-type littermates, but expression was completely abolished only in hypocretin/ataxin-3 mice. Increases in the number of histidine decarboxylase (HDC)-positive cells and in Hdc mRNA expression were found in hypocretin/ataxin-3 mice, and this increase was suppressed by LPS. Hypocretin loss did not impact the change in expression of hypothalamic inflammatory factors in response to LPS, except for interferon gamma and colony stimulating factor 3. The number of c-Fos-positive/HDC-positive cells in hypocretin/ataxin-3 mice administered LPS injections was elevated, even during the rest period, in all areas, suggesting that there is an increase in the activity of histaminergic neurons in hypocretin/ataxin-3 mice following LPS injection. Taken together, our results suggest a novel role for hypocretin in the hypothalamic response to peripheral immune challenge. Our findings contribute to the understanding of the pathophysiology of narcolepsy. Copyright © 2016 Elsevier Inc. All

  3. DMPD: Innate immune responses: crosstalk of signaling and regulation of genetranscription. [Dynamic Macrophage Pathway CSML Database

    Lifescience Database Archive (English)

    Full Text Available 16753195 Innate immune responses: crosstalk of signaling and regulation of genetran...l) (.csml) Show Innate immune responses: crosstalk of signaling and regulation of genetranscription. PubmedI...D 16753195 Title Innate immune responses: crosstalk of signaling and regulation o

  4. Redox rhythm reinforces the circadian clock to gate immune response.

    Science.gov (United States)

    Zhou, Mian; Wang, Wei; Karapetyan, Sargis; Mwimba, Musoki; Marqués, Jorge; Buchler, Nicolas E; Dong, Xinnian

    2015-07-23

    Recent studies have shown that in addition to the transcriptional circadian clock, many organisms, including Arabidopsis, have a circadian redox rhythm driven by the organism's metabolic activities. It has been hypothesized that the redox rhythm is linked to the circadian clock, but the mechanism and the biological significance of this link have only begun to be investigated. Here we report that the master immune regulator NPR1 (non-expressor of pathogenesis-related gene 1) of Arabidopsis is a sensor of the plant's redox state and regulates transcription of core circadian clock genes even in the absence of pathogen challenge. Surprisingly, acute perturbation in the redox status triggered by the immune signal salicylic acid does not compromise the circadian clock but rather leads to its reinforcement. Mathematical modelling and subsequent experiments show that NPR1 reinforces the circadian clock without changing the period by regulating both the morning and the evening clock genes. This balanced network architecture helps plants gate their immune responses towards the morning and minimize costs on growth at night. Our study demonstrates how a sensitive redox rhythm interacts with a robust circadian clock to ensure proper responsiveness to environmental stimuli without compromising fitness of the organism.

  5. Effect of human papillomavirus infection on the immune system and its role in the course of cervical cancer.

    Science.gov (United States)

    Song, Dan; Li, Hong; Li, Haibo; Dai, Jianrong

    2015-08-01

    Human papillomavirus (HPV) is widely known as a cause of cervical intraepithelial neoplasia (CIN) and cervical cancer. The mechanisms involved have been studied by numerous studies. The integration of the virus genome into the host cells results in the abnormal regulation of cell cycle control. HPV can also induce immune evasion of the infected cells, which enable the virus to be undetectable for long periods of time. The induction of immunotolerance of the host's immune system by the persistent infection of HPV is one of the most important mechanisms for cervical lesions. The present review ela