WorldWideScience

Sample records for human immune responsiveness

  1. [Immune response genes products in human physiology].

    Science.gov (United States)

    Khaitov, R M; Alekseev, L P

    2012-09-01

    Current data on physiological role of human immune response genes' proteomic products (antigens) are discussed. The antigens are specified by a very high level of diversity that mediates a wide specter ofphysiological functions. They actually provide integrity and biological stability of human as species. These data reveal new ideas on many pathological processes as well as drafts new approaches for prophylaxis and treatment.

  2. Human Metapneumovirus Antagonism of Innate Immune Responses

    Directory of Open Access Journals (Sweden)

    Xiaoyong Bao

    2012-12-01

    Full Text Available  Human metapneumovirus (hMPV is a recently identified RNA virus belonging to the Paramyxoviridae family, which includes several major human and animal pathogens. Epidemiological studies indicate that hMPV is a significant human respiratory pathogen with worldwide distribution. It is associated with respiratory illnesses in children, adults, and immunocompromised patients, ranging from upper respiratory tract infections to severe bronchiolitis and pneumonia. Interferon (IFN represents a major line of defense against virus infection, and in response, viruses have evolved countermeasures to inhibit IFN production as well as IFN signaling. Although the strategies of IFN evasion are similar, the specific mechanisms by which paramyxoviruses inhibit IFN responses are quite diverse. In this review, we will present an overview of the strategies that hMPV uses to subvert cellular signaling in airway epithelial cells, the major target of infection, as well as in primary immune cells.

  3. Sex hormones and the immune response in humans

    NARCIS (Netherlands)

    Bouman, Annechien; Heineman, Maas Jan; Faas, Marijke M.

    2005-01-01

    In addition to their effects on sexual differentiation and reproduction, sex hormones appear to influence the immune system. This results in a sexual dimorphism in the immune response in humans: for instance, females produce more vigorous cellular and more vigorous humoral immune reactions, are more

  4. Seasonal changes in human immune responses to malaria

    DEFF Research Database (Denmark)

    Hviid, L; Theander, T G

    1993-01-01

    Cellular as well as humorol immune responses to malaria antigens fluctuate in time in individuals living in molono-endemic areas, particularly where malaria transmission is seasonal. The most pronounced changes are seen in association with clinical attacks, but osymptomatic infection can also lead...... to apparent immune depression. However, recent data have shown that seasonal variation in cellular immune responses may occur even in the absence of detectable porositaemia. Here, Lars Hviid and Thor G. Theonder review the seasonal variation in human immune responses to malaria, and discuss its possible...

  5. Immune responses to chlamydial antigens in humans.

    Science.gov (United States)

    Hanna, L; Kerlan, R; Senyk, G; Stites, D P; Juster, R P; Jawetz, E

    1982-01-01

    Antibody titer, lymphocyte stimulation and leukocyte migration inhibition with chlamydial antigens were determined repeatedly over many months on human subjects. The volunteers were retrospectively placed into four groups on the basis of clinical, laboratory and epidemiologic criteria. Group A consisted of persons with proven or probable chlamydial infection, including an illness confirmed by chlamydial isolation or seroconversion, or a clinically compatible illness with positive serologic results. Group B were sexual partners or close contacts of group A individuals. Group C were laboratory workers with prolonged exposure to viable chlamydiae or their antigens. Group D included persons of comparable age as those in groups A and B, but lacking a history of symptomatic chlamydial infection or of contact with chlamydiae. Individual cases illustrated the rise of antibody and some cell mediated immunity reactions (CMI) with active chlamydial infection. By contrast, laboratory exposure resulted in elevation of CMI but not of antibody. Statistical analysis of the results in 46 volunteers tested repeatedly indicated a strong association of specific antibody with lymphocyte stimulation, but not with leukocyte migration inhibition. Regression analysis suggested that the type of exposure markedly influenced the relationship between antibody and lymphocyte stimulation. Measurement of immunotype-specific antibody titer by microimmunofluorescence (or an equally sensitive method) remains the best laboratory indicator of past chlamydial infection. Neither antibody nor CMI can, as yet, be definitely related to resistance to re-infection in humans.

  6. The immune response of the human brain to abdominal surgery

    DEFF Research Database (Denmark)

    Forsberg, Anton; Cervenka, Simon; Jonsson Fagerlund, Malin

    2017-01-01

    OBJECTIVE: Surgery launches a systemic inflammatory reaction that reaches the brain and associates with immune activation and cognitive decline. Although preclinical studies have in part described this systemic-to-brain signaling pathway, we lack information on how these changes appear in humans....... This study examines the short- and long-term impact of abdominal surgery on the human brain immune system by positron emission tomography (PET) in relation to blood immune reactivity, plasma inflammatory biomarkers, and cognitive function. METHODS: Eight males undergoing prostatectomy under general...... to change in [(11) C]PBR28 binding (p = 0.027). INTERPRETATION: This study translates preclinical data on changes in the brain immune system after surgery to humans, and suggests an interplay between the human brain and the inflammatory response of the peripheral innate immune system. These findings may...

  7. Human immune responses during schistosomiasis mansoni

    Directory of Open Access Journals (Sweden)

    Giovanni Gazzinelli

    1992-06-01

    Full Text Available Studies of immune responses as they occur in patients with schistosomiasis appear to progress relative to corrent technological advances, and to advance despite the understandable inability to pursue in vivo manipulations in this host/parasite system. Emphasis is most often placed on making immunological comparisons between such patient groups as reinfected/non-reinfected, intestinals/hepatosplenic, high/low intensities of infection, infected/uninfected within endemic areas, and those born of infected/uninfected mothers. Based on these types of comparisons, reasonable conjectures can be made regarding the immunological occurrences during this chronic exposure condition. Some consideration is now being given to the immune mechanisms of some of the observations made, and while some of these must then be carried back to experimental models for further manipulation-based analysis, new technological developments continue to assist in the field/bench ability to ask questions that might assist our understanding to a point where this knowledge can be applied to shaping developmental approaches to vaccine development and the goal of alleviating morbidity.O estudo da resposta imune de pacientes com esquistossomose progride em função do avanço tecnológico, apesar das dificuldades de manipulação in vivo deste complexo sistema parasita-hospedeiro. A ênfase nos estudos tem sido mais freqüentemente dirigida para comparações entre grupos característicos de indivíduos, tais como infectado/não infectado, reinfectado/ não reinfectado, assintomático/hepato-esplênico, com intensidade de infecção alta/baixa, etc. Baseado nessas comparações tem-se obtido informações que permitem conjecturas razoáveis com relação à regulação imunológica, susceptibilidade e resistência e até mesmo considerações sôbre mecanismos, que têm sido mais apropriadamente analisados, entretanto, em sistemas experimentais. Tais estudos têm como finalidade a

  8. Modulation of Human Immune Response by Fungal Biocontrol Agents

    Science.gov (United States)

    Konstantinovas, Cibele; de Oliveira Mendes, Tiago A.; Vannier-Santos, Marcos A.; Lima-Santos, Jane

    2017-01-01

    Although the vast majority of biological control agents is generally regarded as safe for humans and environment, the increased exposure of agriculture workers, and consumer population to fungal substances may affect the immune system. Those compounds may be associated with both intense stimulation, resulting in IgE-mediated allergy and immune downmodulation induced by molecules such as cyclosporin A and mycotoxins. This review discusses the potential effects of biocontrol fungal components on human immune responses, possibly associated to infectious, inflammatory diseases, and defective defenses. PMID:28217107

  9. Human Immune Responses to Dengue Viruses.

    Science.gov (United States)

    1985-08-01

    FA titer of these antisera. We found using these hyper- immunized murine ascitis fluids that the homologous antiserum was most active in augmenting...statistically significant (pɘ.05). CHyperimmune mouse ascitis fluid was used as a source of anti-dengue 2 anti- body at a 1:20 dilution. dAx...by PBL without anti-dengue 2 antibody. *statistically significant (pɘ.05), l1not significant. bHyperimmune mouse ascitis fluid was used as a source

  10. MURINE IMMUNE RESPONSES TO HUMAN SPERM ANTIGENS FOLLOWING DIFFERENT IMMUNIZATIONS

    Institute of Scientific and Technical Information of China (English)

    MALan; CAOXiao-Mei; BENKun-Long; CHENYun-Liang

    1989-01-01

    Clinical and experimental investigations have shown that secretory IgA antibodies to human sperm may bc one of the most important factors in immunological infertility. Studies on the effects of these antibodies on sperm function arc helpful to understand the role of

  11. Characterization of human antiviral adaptive immune responses during hepatotropic virus infection in HLA-transgenic human immune system mice.

    Science.gov (United States)

    Billerbeck, Eva; Horwitz, Joshua A; Labitt, Rachael N; Donovan, Bridget M; Vega, Kevin; Budell, William C; Koo, Gloria C; Rice, Charles M; Ploss, Alexander

    2013-08-15

    Humanized mice have emerged as a promising model to study human immunity in vivo. Although they are susceptible to many pathogens exhibiting an almost exclusive human tropism, human immune responses to infection remain functionally impaired. It has recently been demonstrated that the expression of HLA molecules improves human immunity to lymphotropic virus infections in humanized mice. However, little is known about the extent of functional human immune responses in nonlymphoid tissues, such as in the liver, and the role of HLA expression in this context. Therefore, we analyzed human antiviral immunity in humanized mice during a hepatotropic adenovirus infection. We compared immune responses of conventional humanized NOD SCID IL-2Rγ-deficient (NSG) mice to those of a novel NOD SCID IL-2Rγ-deficient strain transgenic for both HLA-A*0201 and a chimeric HLA-DR*0101 molecule. Using a firefly luciferase-expressing adenovirus and in vivo bioluminescence imaging, we demonstrate a human T cell-dependent partial clearance of adenovirus-infected cells from the liver of HLA-transgenic humanized mice. This correlated with liver infiltration and activation of T cells, as well as the detection of Ag-specific humoral and cellular immune responses. When infected with a hepatitis C virus NS3-expressing adenovirus, HLA-transgenic humanized mice mounted an HLA-A*0201-restricted hepatitis C virus NS3-specific CD8(+) T cell response. In conclusion, our study provides evidence for the generation of partial functional antiviral immune responses against a hepatotropic pathogen in humanized HLA-transgenic mice. The adenovirus reporter system used in our study may serve as simple in vivo method to evaluate future strategies for improving human intrahepatic immune responses in humanized mice.

  12. The immune response of the human brain to abdominal surgery.

    Science.gov (United States)

    Forsberg, Anton; Cervenka, Simon; Jonsson Fagerlund, Malin; Rasmussen, Lars S; Zetterberg, Henrik; Erlandsson Harris, Helena; Stridh, Pernilla; Christensson, Eva; Granström, Anna; Schening, Anna; Dymmel, Karin; Knave, Nina; Terrando, Niccolò; Maze, Mervyn; Borg, Jacqueline; Varrone, Andrea; Halldin, Christer; Blennow, Kaj; Farde, Lars; Eriksson, Lars I

    2017-04-01

    Surgery launches a systemic inflammatory reaction that reaches the brain and associates with immune activation and cognitive decline. Although preclinical studies have in part described this systemic-to-brain signaling pathway, we lack information on how these changes appear in humans. This study examines the short- and long-term impact of abdominal surgery on the human brain immune system by positron emission tomography (PET) in relation to blood immune reactivity, plasma inflammatory biomarkers, and cognitive function. Eight males undergoing prostatectomy under general anesthesia were included. Prior to surgery (baseline), at postoperative days 3 to 4, and after 3 months, patients were examined using [(11) C]PBR28 brain PET imaging to assess brain immune cell activation. Concurrently, systemic inflammatory biomarkers, ex vivo blood tests on immunoreactivity to lipopolysaccharide (LPS) stimulation, and cognitive function were assessed. Patients showed a global downregulation of gray matter [(11) C]PBR28 binding of 26 ± 26% (mean ± standard deviation) at 3 to 4 days postoperatively compared to baseline (p = 0.023), recovering or even increasing after 3 months. LPS-induced release of the proinflammatory marker tumor necrosis factor-α in blood displayed a reduction (41 ± 39%) on the 3rd to 4th postoperative day, corresponding to changes in [(11) C]PBR28 distribution volume. Change in Stroop Color-Word Test performance between postoperative days 3 to 4 and 3 months correlated to change in [(11) C]PBR28 binding (p = 0.027). This study translates preclinical data on changes in the brain immune system after surgery to humans, and suggests an interplay between the human brain and the inflammatory response of the peripheral innate immune system. These findings may be related to postsurgical impairments of cognitive function. Ann Neurol 2017;81:572-582. © 2017 American Neurological Association.

  13. Cell mediated immune response in human antirabies revaccination

    Directory of Open Access Journals (Sweden)

    Débora Regina Veiga

    1987-04-01

    Full Text Available The occurrence of secondary cell mediated immune response (CMI in human antirabies immunization was studied. The Puenzalida & Palácios vaccine was used because it is routinely used in Brazil. CMI was evaluated by lymphoblastic transformation indices obtained in whole blood culture in the presence of rabies and control (nervous tissue antigens. Eleven volunteers submitted to revaccination constituted the group under study, while three other volunteers submitted primo vaccination were utilized as control group. A clear secondary CMI to rabies antigen was detected in all the revaccinated volunteers who showed earlier and more intense response than the control group. Response to the control antigen, however, present in all the components of the first group was not detectable in two out of the three primovaccinated and very low in the third one.

  14. Effects of Morphine, Fentanyl and Tramadol on Human Immune Response

    Institute of Scientific and Technical Information of China (English)

    LIU Zhihen; GAO Feng; TIAN Yuke

    2006-01-01

    Morphine has been reported to suppress human immune response. We aimed to observe the effects of morphine, fentanyl and tramadol on NF- κ B and IL-2 from both laboratory and clinical perspective. Jurkat cells were incubated with ten times clinically relevant concentrations of morphine,fentanyl and tramadol before being stimulated with PMA. NF- κ B binding activity and IL-2 levels were measured. In the clinical study, 150 consenting patients were randomized into 3 groups according to the analgesics used in them, namely, group morphine (M), group fentanyl (F) and group tramadol (T). IL-2 was measured preoperatively and 1, 3 and 24 h after operation. Consequently, NF-κ B activation was suppressed by morphine and fentanyl but not by tramadol. IL-2 was significantly decreased by morphine and fentanyl but not by tramadol in vitro. In the PCA patients, IL-2 was decreased in group M and increased in group F postoperatively. Whereas in group T, IL-2 was unchanged 1 h after operation but was significantly elevated 3 and 24 h after operation. Our results showed that the inhibition of morphine on IL-2 was most probably related to its suppression on NF-κ B. Fentanyl had different effects on human immune response in vitro and in vivo. Tramadol may have immune enhancing effect.

  15. Vaccines against Human Carcinomas: Strategies to Improve Antitumor Immune Responses

    Directory of Open Access Journals (Sweden)

    Claudia Palena

    2010-01-01

    Full Text Available Multiple observations in preclinical and clinical studies support a role for the immune system in controlling tumor growth and progression. Various components of the innate and adaptive immune response are able to mediate tumor cell destruction; however, certain immune cell populations can also induce a protumor environment that favors tumor growth and the development of metastasis. Moreover, tumor cells themselves are equipped with various mechanisms that allow them to evade surveillance by the immune system. The goal of cancer vaccines is to induce a tumor-specific immune response that ultimately will reduce tumor burden by tipping the balance from a protumor to an antitumor immune environment. This review discusses common mechanisms that govern immune cell activation and tumor immune escape, and some of the current strategies employed in the field of cancer vaccines aimed at enhancing activation of tumor-specific T-cells with concurrent reduction of immunosuppression.

  16. Humanized mouse model for assessing the human immune response to xenogeneic and allogeneic decellularized biomaterials.

    Science.gov (United States)

    Wang, Raymond M; Johnson, Todd D; He, Jingjin; Rong, Zhili; Wong, Michelle; Nigam, Vishal; Behfar, Atta; Xu, Yang; Christman, Karen L

    2017-06-01

    Current assessment of biomaterial biocompatibility is typically implemented in wild type rodent models. Unfortunately, different characteristics of the immune systems in rodents versus humans limit the capability of these models to mimic the human immune response to naturally derived biomaterials. Here we investigated the utility of humanized mice as an improved model for testing naturally derived biomaterials. Two injectable hydrogels derived from decellularized porcine or human cadaveric myocardium were compared. Three days and one week after subcutaneous injection, the hydrogels were analyzed for early and mid-phase immune responses, respectively. Immune cells in the humanized mouse model, particularly T-helper cells, responded distinctly between the xenogeneic and allogeneic biomaterials. The allogeneic extracellular matrix derived hydrogels elicited significantly reduced total, human specific, and CD4(+) T-helper cell infiltration in humanized mice compared to xenogeneic extracellular matrix hydrogels, which was not recapitulated in wild type mice. T-helper cells, in response to the allogeneic hydrogel material, were also less polarized towards a pro-remodeling Th2 phenotype compared to xenogeneic extracellular matrix hydrogels in humanized mice. In both models, both biomaterials induced the infiltration of macrophages polarized towards a M2 phenotype and T-helper cells polarized towards a Th2 phenotype. In conclusion, these studies showed the importance of testing naturally derived biomaterials in immune competent animals and the potential of utilizing this humanized mouse model for further studying human immune cell responses to biomaterials in an in vivo environment.

  17. Studying the immune response to human viral infections using zebrafish.

    Science.gov (United States)

    Goody, Michelle F; Sullivan, Con; Kim, Carol H

    2014-09-01

    Humans and viruses have a long co-evolutionary history. Viral illnesses have and will continue to shape human history: from smallpox, to influenza, to HIV, and beyond. Animal models of human viral illnesses are needed in order to generate safe and effective antiviral medicines, adjuvant therapies, and vaccines. These animal models must support the replication of human viruses, recapitulate aspects of human viral illnesses, and respond with conserved immune signaling cascades. The zebrafish is perhaps the simplest, most commonly used laboratory model organism in which innate and/or adaptive immunity can be studied. Herein, we will discuss the current zebrafish models of human viral illnesses and the insights they have provided. We will highlight advantages of early life stage zebrafish and the importance of innate immunity in human viral illnesses. We will also discuss viral characteristics to consider before infecting zebrafish with human viruses as well as predict other human viruses that may be able to infect zebrafish.

  18. Leishmania major infection in humanized mice induces systemic infection and provokes a nonprotective human immune response.

    Directory of Open Access Journals (Sweden)

    Anja Kathrin Wege

    Full Text Available BACKGROUND: Leishmania (L. species are the causative agent of leishmaniasis. Due to the lack of efficient vaccine candidates, drug therapies are the only option to deal with cutaneous leishmaniasis. Unfortunately, chemotherapeutic interventions show high toxicity in addition to an increased risk of dissemination of drug-resistant parasites. An appropriate laboratory animal based model is still missing which allows testing of new drug strategies in the context of human immune cells in vivo. METHODOLOGY/PRINCIPAL FINDINGS: Humanized mice were infected subcutaneously with stationary phase promastigote L. major into the footpad. The human immune response against the pathogen and the parasite host interactions were analyzed. In addition we proved the versatility of this new model to conduct drug research studies by the inclusion of orally given Miltefosine. We show that inflammatory human macrophages get infected with Leishmania parasites at the site of infection. Furthermore, a Leishmania-specific human-derived T cell response is initiated. However, the human immune system is not able to prevent systemic infection. Thus, we treated the mice with Miltefosine to reduce the parasitic load. Notably, this chemotherapy resulted in a reduction of the parasite load in distinct organs. Comparable to some Miltefosine treated patients, humanized mice developed severe side effects, which are not detectable in the classical murine model of experimental leishmaniasis. CONCLUSIONS/SIGNIFICANCE: This study describes for the first time L. major infection in humanized mice, characterizes the disease development, the induction of human adaptive and innate immune response including cytokine production and the efficiency of Miltefosine treatment in these animals. In summary, humanized mice might be beneficial for future preclinical chemotherapeutic studies in systemic (visceral leishmaniasis allowing the investigation of human immune response, side effects of the drug

  19. Innate immune interferon responses to human immunodeficiency virus-1 infection.

    Science.gov (United States)

    Hughes, Rose; Towers, Greg; Noursadeghi, Mahdad

    2012-07-01

    Type I interferon (IFN) responses represent the canonical host innate immune response to viruses, which serves to upregulate expression of antiviral restriction factors and augment adaptive immune defences. There is clear evidence for type I IFN activity in both acute and chronic HIV-1 infection in vivo, and plasmacytoid dendritic cells have been identified as one important source for these responses, through innate immune detection of viral RNA by Toll-like receptor 7. In addition, new insights into the molecular mechanisms that trigger induction of type I IFNs suggest innate immune receptors for viral DNA may also mediate these responses. It is widely recognised that HIV-1 restriction factors share the characteristic of IFN-inducible expression, and that the virus has evolved to counteract these antiviral mechanisms. However, in some target cells, such as macrophages, IFN can still effectively restrict virus. In this context, HIV-1 shows the ability to evade innate immune recognition and thereby avoid induction of type I IFN in order to successfully establish productive infection. The relative importance of evasion of innate immune detection and evasion of IFN-inducible restriction in the natural history of HIV-1 infection is not known, and the data suggest that type I IFN responses may play a role in both viral control and in the immunopathogenesis of progressive disease. Further study of the relationship between HIV-1 infection and type I IFN responses is required to unravel these issues and inform the development of novel therapeutics or vaccine strategies.

  20. The suppression of innate immune response by human rhinovirus C.

    Science.gov (United States)

    Pang, Li-Li; Yuan, Xin-Hui; Shao, Chang-Sheng; Li, Mao-Zhong; Wang, Ying; Wang, Hui-Min; Xie, Guang-Cheng; Xie, Zhi-Ping; Yuan, Yue; Zhou, Dong-Mei; Sun, Xiao-Man; Zhang, Qing; Xin, Yan; Li, Dan-di; Duan, Zhao-Jun

    2017-08-12

    Rhinovirus C (RV-C), a newly identified group of human rhinoviruses (RVs), is associated with exacerbation of severe asthma. The type I interferon (IFN) response induced by this virus and the mechanisms of evasion of IFN-mediated innate immunity for RV-C remain unclear. In this study, we constructed a full-length cDNA clone of RV-C (LZ651) from a clinical sample. IFN-β mRNA and protein levels were not elevated in differentiated Human bronchial epithelial (HBE) cells at the air-liquid interface infected with RV-C, except in the early stage of infection. The ability to attenuate IFN-β activation was ascribed to 3C(pro) of RV-C, and the 40-His site of 3C(pro) played an important role. Furthermore, RIG-I was degraded by 3C(pro) in a caspase-dependent manner and 3C(pro) cleaved MAVS at 148 Q/A, which inhibited IFN signaling. Taken together, our results demonstrate the mechanism by which RV-C circumvents the production of type I IFN in infected cells. Copyright © 2017. Published by Elsevier Inc.

  1. Humanized Mouse Model of Ebola Virus Disease Mimics the Immune Responses in Human Disease.

    Science.gov (United States)

    Bird, Brian H; Spengler, Jessica R; Chakrabarti, Ayan K; Khristova, Marina L; Sealy, Tara K; Coleman-McCray, JoAnn D; Martin, Brock E; Dodd, Kimberly A; Goldsmith, Cynthia S; Sanders, Jeanine; Zaki, Sherif R; Nichol, Stuart T; Spiropoulou, Christina F

    2016-03-01

    Animal models recapitulating human Ebola virus disease (EVD) are critical for insights into virus pathogenesis. Ebola virus (EBOV) isolates derived directly from human specimens do not, without adaptation, cause disease in immunocompetent adult rodents. Here, we describe EVD in mice engrafted with human immune cells (hu-BLT). hu-BLT mice developed EVD following wild-type EBOV infection. Infection with high-dose EBOV resulted in rapid, lethal EVD with high viral loads, alterations in key human antiviral immune cytokines and chemokines, and severe histopathologic findings similar to those shown in the limited human postmortem data available. A dose- and donor-dependent clinical course was observed in hu-BLT mice infected with lower doses of either Mayinga (1976) or Makona (2014) isolates derived from human EBOV cases. Engraftment of the human cellular immune system appeared to be essential for the observed virulence, as nonengrafted mice did not support productive EBOV replication or develop lethal disease. hu-BLT mice offer a unique model for investigating the human immune response in EVD and an alternative animal model for EVD pathogenesis studies and therapeutic screening.

  2. Strain-Related Differences in the Immune Response: Relevance to Human Stroke.

    Science.gov (United States)

    Becker, Kyra J

    2016-08-01

    There are significant differences in the immune response and in the susceptibility to autoimmune diseases among rodent strains. It would thus be expected that the contribution of the immune response to cerebral ischemic injury would also differ among rodent strains. More importantly, there are significant differences between the immune responses of rodents and humans. All of these factors are likely to impact the successful translation of immunomodulatory therapies from experimental rodent models to patients with stroke.

  3. Cytokines and dysregulation of the immune response in human malaria

    Directory of Open Access Journals (Sweden)

    M. Fátima C. Alves

    1992-01-01

    Full Text Available The dysregulation of the immune response by malaria parasite has been considered as a possible constraint to the effectiveness of malaria vaccination. In spite of the important role interleukin-I (IL-1 in malaria are lacking. We found that only 2 out of 35 subjectswith acute malaria showed increased levels of serum IL-1 alpha by enzyme immunoassay. To assess whether IL-1 could interfere with T- lymphocyte responses, blood mononuclear cells from patients infected with Plasmodium falciparum, P. vivax, or healthy subjects were cultured with phytohemagglutinin, and lymphocyte proliferation measured 72h later by 3H-thymidine incorporation. Our data showed that T-lymphocyte responses are depressed both in P. falciparum (10,500 ñ 2,900 and P. vivax malaria (13,000 ñ 3,300, as compared to that of healthy individuals (27,000 ñ 3,000. Addition of IL-1 partially reserved depression of malaria lymphocytes, but had no effect on normal cells. On the other hand, T-lymphocytes from malaria infected-subjects presented a minimal decrease in proliferation, when cultured in the presence of exogenous PGE2. These data indicate the occurrence of two defects of immunoregulation in malaria: a deficiency of IL-1 production by monocytes/macrophages, and an increased resistance of lymphocytes to the antiproliferative effect of PGE2.

  4. Modulation of human immune responses by bovine interleukin-10.

    Directory of Open Access Journals (Sweden)

    Gerco den Hartog

    Full Text Available Cytokines can be functionally active across species barriers. Bovine IL-10 has an amino acid sequence identity with human IL-10 of 76.8%. Therefore, the aim of this study was to evaluate whether bovine IL-10 has immunomodulatory activities on human monocytes and dendritic cells. Peripheral blood monocytes were isolated from healthy donors, and used directly or allowed to differentiate to dendritic cells under the influence of IL-4 and GM-CSF. Recombinant bovine IL-10 inhibited TLR induced activation of monocytes, and dose-dependently inhibited LPS-induced activation of monocyte-derived DCs comparable to human IL-10. By using blocking antibodies to either bovine IL-10 or the human IL-10 receptor it was demonstrated that inhibition of monocyte activation by bovine IL-10 was dependent on binding of bovine IL-10 to the human IL-10R. These data demonstrate that bovine IL-10 potently inhibits the activation of human myeloid cells in response to TLR activation. Bovine IL-10 present in dairy products may thus potentially contribute to the prevention of necrotizing enterocolitis and allergy, enhance mucosal tolerance induction and decrease intestinal inflammation and may therefore be applicable in infant foods and in immunomodulatory diets.

  5. Bystander T cells in human immune responses to dengue antigens

    Directory of Open Access Journals (Sweden)

    Suwannasaen Duangchan

    2010-09-01

    Full Text Available Abstract Background Previous studies of T cell activation in dengue infection have focused on restriction of specific T cell receptors (TCRs and classical MHC molecules. However, bystander T cell activation, which is TCR independent, occurs via cytokines in other viral infections, both in vitro and in vivo, and enables T cells to bypass certain control checkpoints. Moreover, clinical and pathological evidence has pointed to cytokines as the mediators of dengue disease severity. Therefore, we investigated bystander T cell induction by dengue viral antigen. Results Whole blood samples from 55 Thai schoolchildren aged 13-14 years were assayed for in vitro interferon-gamma (IFN-γ induction in response to inactivated dengue serotype 2 antigen (Den2. The contribution of TCR-dependent and independent pathways was tested by treatment with cyclosporin A (CsA, which inhibits TCR-dependent activation of T cells. ELISA results revealed that approximately 72% of IFN-γ production occurred via the TCR-dependent pathway. The major IFN-γ sources were natural killer (NK (mean ± SE = 55.2 ± 3.3, CD4+T (24.5 ± 3.3 and CD8+T cells (17.9 ± 1.5, respectively, as demonstrated by four-color flow cytometry. Interestingly, in addition to these cells, we found CsA-resistant IFN-γ producing T cells (CD4+T = 26.9 ± 3.6% and CD8+T = 20.3 ± 2.1% implying the existence of activated bystander T cells in response to dengue antigen in vitro. These bystander CD4+ and CD8+T cells had similar kinetics to NK cells, appeared after 12 h and were inhibited by anti-IL-12 neutralization indicating cytokine involvement. Conclusions This study described immune cell profiles and highlighted bystander T cell activation in response to dengue viral antigens of healthy people in an endemic area. Further studies on bystander T cell activation in dengue viral infection may reveal the immune mechanisms that protect or enhance pathogenesis of secondary dengue infection.

  6. Immune response

    Science.gov (United States)

    ... and tetanus antitoxin are examples of passive immunization. BLOOD COMPONENTS The immune system includes certain types of white ... lymphocytes develop, they normally learn to tell the difference between your own body tissues and substances that ...

  7. Intestinal immune response to human Cryptosporidium sp. infection

    Science.gov (United States)

    2008-01-01

    intestinal tissues from AIDS patients with cryptosporidiosis, we did not detect CXCL-8 (90). Finally, CXCL-8 attracts mainly granu - locytes. However, in...cryptosporidiosis but not after reconstitution of immunity. Infect. Immun. 75:481–487. 91. Weinstock, J. V., A. Blum, J. Walder, and R. Walder. 1988. Eosinophils

  8. Human immune system mice: current potential and limitations for translational research on human antibody responses.

    Science.gov (United States)

    Vuyyuru, Raja; Patton, John; Manser, Tim

    2011-12-01

    It has recently become possible to generate chimeric mice durably engrafted with many components of the human immune system (HIS mice). We have characterized the maturation and function of the B cell compartment of HIS mice. The antibody response of HIS mice to T cell-dependent B cell antigens is limited, and contributing factors may be the general immaturity of the B cell compartment, infrequent helper T cells selected on human MHC class II antigens, and incomplete reconstitution of secondary lymphoid organs and their microenvironments. In contrast, HIS mice generate protective antibody responses to the bacterium Borrelia hermsii, which acts as a T cell-independent antigen in mice, but do not respond to purified polysaccharide antigens (PPS). We speculate that the anti-B. hermsii response of HIS mice is derived from an abundant B cell subset that may be analogous to B1 B cells in mice. We suggest that failure of HIS mice to respond to PPS is due to the lack of a B cell subset that may originate from adult bone marrow and is highly dependent on human interleukin-7 for development.

  9. ANTI-TUMOR ACTIVITY AND IMMUNE RESPONSES INDUCED BY HUMAN CANCER-ASSOCIATED MUCIN CORE PEPTIDE

    Institute of Scientific and Technical Information of China (English)

    Ma Yunguo; Yuan Mei; Fei Lihua; Li Li

    1998-01-01

    Objective: To investigate the immune responses induced by apomucin which is a mixture of mucin core peptide, in mice for elucidating the role of mucin core peptide in the modulation of cancers. Methods:Apomucin was isolated from human pancreatic cancer cell line SW1990. The mice were immunized with this apomucin (10μg/time×6) plus DETOX. Results: When immunized, all mice developed delayed-type hypersensitivity (DTH) after challenged with apomucin or synthetic peptide MUC-2 or MUC-3, while the mice immunized with apomucin alone did not develop DTH.No antibodies were detected by ELISA after immunization. When the spleen cells of vaccinated mice were cocultured with this apomucin (10-50μg/ml) and rhIL-2(50U/ml) in vitro, the proliferated lymphocytes showed cytotoxicity against human cancer cells, including colon cancer, gastric cancer, pancreatic cancer and leukemia as measured by Cr-51 release assay. Antibodies against MUC-2 and MUC-3 could block the cytotoxicity. Conclusion: It was identified that a vaccine combined of apomucin and immune adjuvant DETOX can induce cellular immune response and anti-tumor cytotoxicity in mice.

  10. Ingested human insulin inhibits the mosquito NF-¿B-dependent immune response to Plasmodium falciparum

    Science.gov (United States)

    We showed previously that ingested human insulin activates the insulin/IGF-1 signaling pathway in Anopheles stephensi and increases the susceptibility of these mosquitoes to Plasmodium falciparum. In other organisms insulin can alter immune responsiveness through regulation of NF-kB transcription fa...

  11. Earthworms and Humans in Vitro: Characterizing Evolutionarily Conserved Stress and Immune Responses to Silver Nanoparticles

    DEFF Research Database (Denmark)

    Hayashi, Yuya; Engelmann, Péter; Foldbjerg, Rasmus

    2012-01-01

    Little is known about the potential threats of silver nanoparticles (AgNPs) to ecosystem health, with no detailed report existing on the stress and immune responses of soil invertebrates. Here we use earthworm primary cells, cross-referencing to human cell cultures with a particular emphasis on t...

  12. Mitochondrial reactive oxygen species modulate innate immune response to influenza A virus in human nasal epithelium.

    Science.gov (United States)

    Kim, Sujin; Kim, Min-Ji; Park, Do Yang; Chung, Hyo Jin; Kim, Chang-Hoon; Yoon, Joo-Heon; Kim, Hyun Jik

    2015-07-01

    The innate immune system of the nasal epithelium serves as a first line of defense against invading respiratory viruses including influenza A virus (IAV). Recently, it was verified that interferon (IFN)-related immune responses play a critical role in local antiviral innate immunity. Reactive oxygen species (ROS) generation by exogenous pathogens has also been demonstrated in respiratory epithelial cells and modulation of ROS has been reported to be important for respiratory virus-induced innate immune mechanisms. Passage-2 normal human nasal epithelial (NHNE) cells were inoculated with IAV (WS/33, H1N1) to assess the sources of IAV-induced ROS and the relationship between ROS and IFN-related innate immune responses. Both STAT1 and STAT2 phosphorylation and the mRNA levels of IFN-stimulated genes, including Mx1, 2,5-OAS1, IFIT1, and CXCL10, were induced after IAV infection up to three days post infection. Similarly, we observed that mitochondrial ROS generation increased maximally at 2 days after IAV infection. After suppression of mitochondrial ROS generation, IAV-induced phosphorylation of STAT and mRNA levels of IFN-stimulated genes were attenuated and actually, viral titers of IAV were significantly higher in cases with scavenging ROS. Our findings suggest that mitochondrial ROS might be responsible for controlling IAV infection and may be potential sources of ROS generation, which is required to initiate an innate immune response in NHNE cells.

  13. Mathematical modeling provides kinetic details of the human immune response to vaccination

    Directory of Open Access Journals (Sweden)

    Dustin eLe

    2015-01-01

    Full Text Available With major advances in experimental techniques to track antigen-specific immune responses many basic questions on the kinetics of virus-specific immunity in humans remain unanswered. To gain insights into kinetics of T and B cell responses in human volunteers we combine mathematical models and experimental data from recent studies employing vaccines against yellow fever and smallpox. Yellow fever virus-specific CD8 T cell population expanded slowly with the average doubling time of 2 days peaking 2.5 weeks post immunization. Interestingly, we found that the peak of the yellow fever-specific CD8 T cell response is determined by the rate of T cell proliferation and not by the precursor frequency of antigen-specific cells as has been suggested in several studies in mice. We also found that while the frequency of virus-specific T cells increases slowly, the slow increase can still accurately explain clearance of yellow fever virus in the blood. Our additional mathematical model describes well the kinetics of virus-specific antibody-secreting cell and antibody response to vaccinia virus in vaccinated individuals suggesting that most of antibodies in 3 months post immunization are derived from the population of circulating antibody-secreting cells. Taken together, our analysis provides novel insights into mechanisms by which live vaccines induce immunity to viral infections and highlight challenges of applying methods of mathematical modeling to the current, state-of-the-art yet limited immunological data.

  14. Staphylococcus aureus Colonization: Modulation of Host Immune Response and Impact on Human Vaccine Design

    Science.gov (United States)

    Brown, Aisling F.; Leech, John M.; Rogers, Thomas R.; McLoughlin, Rachel M.

    2014-01-01

    In apparent contrast to its invasive potential Staphylococcus aureus colonizes the anterior nares of 20–80% of the human population. The relationship between host and microbe appears particularly individualized and colonization status seems somehow predetermined. After decolonization, persistent carriers often become re-colonized with their prior S. aureus strain, whereas non-carriers resist experimental colonization. Efforts to identify factors facilitating colonization have thus far largely focused on the microorganism rather than on the human host. The host responds to S. aureus nasal colonization via local expression of anti-microbial peptides, lipids, and cytokines. Interplay with the co-existing microbiota also influences colonization and immune regulation. Transient or persistent S. aureus colonization induces specific systemic immune responses. Humoral responses are the most studied of these and little is known of cellular responses induced by colonization. Intriguingly, colonized patients who develop bacteremia may have a lower S. aureus-attributable mortality than their non-colonized counterparts. This could imply a staphylococcal-specific immune “priming” or immunomodulation occurring as a consequence of colonization and impacting on the outcome of infection. This has yet to be fully explored. An effective vaccine remains elusive. Anti-S. aureus vaccine strategies may need to drive both humoral and cellular immune responses to confer efficient protection. Understanding the influence of colonization on adaptive response is essential to intelligent vaccine design, and may determine the efficacy of vaccine-mediated immunity. Clinical trials should consider colonization status and the resulting impact of this on individual patient responses. We urgently need an increased appreciation of colonization and its modulation of host immunity. PMID:24409186

  15. Astaxanthin decreased oxidative stress and inflammation and enhanced immune response in humans

    Directory of Open Access Journals (Sweden)

    Line Larry L

    2010-03-01

    Full Text Available Abstract Background Astaxanthin modulates immune response, inhibits cancer cell growth, reduces bacterial load and gastric inflammation, and protects against UVA-induced oxidative stress in in vitro and rodent models. Similar clinical studies in humans are unavailable. Our objective is to study the action of dietary astaxanthin in modulating immune response, oxidative status and inflammation in young healthy adult female human subjects. Methods Participants (averaged 21.5 yr received 0, 2, or 8 mg astaxanthin (n = 14/diet daily for 8 wk in a randomized double-blind, placebo-controlled study. Immune response was assessed on wk 0, 4 and 8, and tuberculin test performed on wk 8. Results Plasma astaxanthin increased (P helper, Tcytotoxic or natural killer cells. A higher percentage of leukocytes expressed the LFA-1 marker in subjects given 2 mg astaxanthin on wk 8. Subjects fed 2 mg astaxanthin had a higher tuberculin response than unsupplemented subjects. There was no difference in TNF and IL-2 concentrations, but plasma IFN-γ and IL-6 increased on wk 8 in subjects given 8 mg astaxanthin. Conclusion Therefore, dietary astaxanthin decreases a DNA damage biomarker and acute phase protein, and enhances immune response in young healthy females.

  16. Human rhinovirus induced cytokine/chemokine responses in human airway epithelial and immune cells.

    Directory of Open Access Journals (Sweden)

    Devi Rajan

    Full Text Available Infections with human rhinovirus (HRV are commonly associated with acute upper and lower respiratory tract disease and asthma exacerbations. The role that HRVs play in these diseases suggests it is important to understand host-specific or virus-specific factors that contribute to pathogenesis. Since species A HRVs are often associated with more serious HRV disease than species B HRVs, differences in immune responses they induce should inform disease pathogenesis. To identify species differences in induced responses, we evaluated 3 species A viruses, HRV 25, 31 and 36 and 3 species B viruses, HRV 4, 35 and 48 by exposing human PBMCs to HRV infected Calu-3 cells. To evaluate the potential effect of memory induced by previous HRV infection on study responses, we tested cord blood mononuclear cells that should be HRV naïve. There were HRV-associated increases (significant increase compared to mock-infected cells for one or more HRVs for IP-10 and IL-15 that was unaffected by addition of PBMCs, for MIP-1α, MIP-1β, IFN-α, and HGF only with addition of PBMCs, and for ENA-78 only without addition of PBMCs. All three species B HRVs induced higher levels, compared to A HRVs, of MIP-1α and MIP-1β with PBMCs and ENA-78 without PBMCs. In contrast, addition of CBMCs had less effect and did not induce MIP-1α, MIP-1β, or IFN-α nor block ENA-78 production. Addition of CBMCs did, however, increase IP-10 levels for HRV 35 and HRV 36 infection. The presence of an effect with PBMCs and no effect with CBMCs for some responses suggest differences between the two types of cells possibly because of the presence of HRV memory responses in PBMCs and not CBMCs or limited response capacity for the immature CBMCs relative to PBMCs. Thus, our results indicate that different HRV strains can induce different patterns of cytokines and chemokines; some of these differences may be due to differences in memory responses induced by past HRV infections, and other differences

  17. RAGE Expression in Human T Cells: A Link between Environmental Factors and Adaptive Immune Responses

    Science.gov (United States)

    Akirav, Eitan M.; Preston-Hurlburt, Paula; Garyu, Justin; Henegariu, Octavian; Clynes, Raphael; Schmidt, Ann Marie; Herold, Kevan C.

    2012-01-01

    The Receptor for Advanced Glycation Endproducts (RAGE) is a scavenger ligand that binds glycated endproducts as well as molecules released during cell death such as S100b and HMGB1. RAGE is expressed on antigen presenting cells where it may participate in activation of innate immune responses but its role in adaptive human immune responses has not been described. We have found that RAGE is expressed intracellularly in human T cells following TCR activation but constitutively on T cells from patients with diabetes. The levels of RAGE on T cells from patients with diabetes are not related to the level of glucose control. It co-localizes to the endosomes. Its expression increases in activated T cells from healthy control subjects but bystander cells also express RAGE after stimulation of the antigen specific T cells. RAGE ligands enhance RAGE expression. In patients with T1D, the level of RAGE expression decreases with T cell activation. RAGE+ T cells express higher levels of IL-17A, CD107a, and IL-5 than RAGE− cells from the same individual with T1D. Our studies have identified the expression of RAGE on adaptive immune cells and a role for this receptor and its ligands in modulating human immune responses. PMID:22509345

  18. Neural progenitor cells from human induced pluripotent stem cells generated less autogenous immune response.

    Science.gov (United States)

    Huang, Ke; Liu, PengFei; Li, Xiang; Chen, ShuBin; Wang, LiHui; Qin, Li; Su, ZhengHui; Huang, WenHao; Liu, Juli; Jia, Bei; Liu, Jie; Cai, JingLei; Pei, DuanQing; Pan, GuangJin

    2014-02-01

    The breakthrough development of induced pluripotent stem cells (iPSCs) raises the prospect of patient-specific treatment for many diseases through the replacement of affected cells. However, whether iPSC-derived functional cell lineages generate a deleterious immune response upon auto-transplantation remains unclear. In this study, we differentiated five human iPSC lines from skin fibroblasts and urine cells into neural progenitor cells (NPCs) and analyzed their immunogenicity. Through co-culture with autogenous peripheral blood mononuclear cells (PBMCs), we showed that both somatic cells and iPSC-derived NPCs do not stimulate significant autogenous PBMC proliferation. However, a significant immune reaction was detected when these cells were co-cultured with allogenous PBMCs. Furthermore, no significant expression of perforin or granzyme B was detected following stimulation of autogenous immune effector cells (CD3(+)CD8(-) T cells, CD3(+)CD8(+) T cells or CD3(-)CD56(+) NK cells) by NPCs in both PBMC and T cell co-culture systems. These results suggest that human iPSC-derived NPCs may not initiate an immune response in autogenous transplants, and thus set a base for further preclinical evaluation of human iPSCs.

  19. An In vitro Model to Study Immune Responses of Human Peripheral Blood Mononuclear Cells to Human Respiratory Syncytial Virus Infection

    NARCIS (Netherlands)

    Vissers, M.; Habets, M.N.; Ahout, I.M.L.; Jans, J.; Jonge, M.I. de; Diavatopoulos, D.A.; Ferwerda, G.

    2013-01-01

    Human respiratory syncytial virus (HRSV) infections present a broad spectrum of disease severity, ranging from mild infections to life-threatening bronchiolitis. An important part of the pathogenesis of severe disease is an enhanced immune response leading to immunopathology. Here, we describe a

  20. An In vitro Model to Study Immune Responses of Human Peripheral Blood Mononuclear Cells to Human Respiratory Syncytial Virus Infection

    NARCIS (Netherlands)

    Vissers, M.; Habets, M.N.; Ahout, I.M.L.; Jans, J.; Jonge, M.I. de; Diavatopoulos, D.A.; Ferwerda, G.

    2013-01-01

    Human respiratory syncytial virus (HRSV) infections present a broad spectrum of disease severity, ranging from mild infections to life-threatening bronchiolitis. An important part of the pathogenesis of severe disease is an enhanced immune response leading to immunopathology. Here, we describe a pro

  1. Longevity and composition of cellular immune responses following experimental Plasmodium falciparum malaria infection in humans.

    NARCIS (Netherlands)

    Teirlinck, A.C.; McCall, M.B.B.; Roestenberg, M.; Scholzen, A.; Woestenenk, R.M.; Mast, Q. de; Ven, A.J.A.M. van der; Hermsen, C.C.; Luty, A.J.F.; Sauerwein, R.W.

    2011-01-01

    Cellular responses to Plasmodium falciparum parasites, in particular interferon-gamma (IFNgamma) production, play an important role in anti-malarial immunity. However, clinical immunity to malaria develops slowly amongst naturally exposed populations, the dynamics of cellular responses in relation

  2. Anopheles gambiae immune responses to human and rodent Plasmodium parasite species.

    OpenAIRE

    Yuemei Dong; Ruth Aguilar; Zhiyong Xi; Emma Warr; Emmanuel Mongin; George Dimopoulos

    2006-01-01

    Transmission of malaria is dependent on the successful completion of the Plasmodium lifecycle in the Anopheles vector. Major obstacles are encountered in the midgut tissue, where most parasites are killed by the mosquito's immune system. In the present study, DNA microarray analyses have been used to compare Anopheles gambiae responses to invasion of the midgut epithelium by the ookinete stage of the human pathogen Plasmodium falciparum and the rodent experimental model pathogen P. berghei. I...

  3. Human cytomegalovirus induces a distinct innate immune response in the maternal-fetal interface.

    Science.gov (United States)

    Weisblum, Yiska; Panet, Amos; Zakay-Rones, Zichria; Vitenshtein, Alon; Haimov-Kochman, Ronit; Goldman-Wohl, Debra; Oiknine-Djian, Esther; Yamin, Rachel; Meir, Karen; Amsalem, Hagai; Imbar, Tal; Mandelboim, Ofer; Yagel, Simcha; Wolf, Dana G

    2015-11-01

    The initial interplay between human cytomegalovirus (HCMV) and innate tissue response in the human maternal-fetal interface, though crucial for determining the outcome of congenital HCMV infection, has remained unknown. We studied the innate response to HCMV within the milieu of the human decidua, the maternal aspect of the maternal-fetal interface, maintained ex vivo as an integral tissue. HCMV infection triggered a rapid and robust decidual-tissue innate immune response predominated by interferon (IFN)γ and IP-10 induction, dysregulating the decidual cytokine/chemokine environment in a distinctive fashion. The decidual-tissue response was already elicited during viral-tissue contact, and was not affected by neutralizing HCMV antibodies. Of note, IFNγ induction, reflecting immune-cell activation, was distinctive to the maternal decidua, and was not observed in concomitantly-infected placental (fetal) villi. Our studies in a clinically-relevant surrogate human model, provide a novel insight into the first-line decidual tissue response which could affect the outcome of congenital infection.

  4. Flow cytometric investigation of immune-response-related surface molecules on human colorectal cancers

    DEFF Research Database (Denmark)

    Diederichsen, Axel Cosmus Pyndt; Stenholm, A C; Kronborg, O;

    1998-01-01

    Our purpose was to clarify whether human colorectal cancer cells are equipped to present tumour-associated-antigens to the immune system, and whether this ability correlates with lymphoid infiltration, the Dukes' stage and Jass classification. Enzymatically dissociated tumour cells from 70...... molecules, but not the class II, was correlated with lymphoid infiltration and the Jass classification. Expression of these surface molecules was not correlated with the Dukes' stage. The tumour cells were generally equipped to present antigens to the effector arm of the immune system since HLA class I...... is expressed, but the tumour cells were not optimal in stimulating an immune response, since HLA class II and CD58 were only marginally expressed and CD80 and CD54 were absent....

  5. Anti-human immunodeficiency virus type 1 humoral immune response and highly active antiretroviral treatment

    Directory of Open Access Journals (Sweden)

    Vera Bongertz

    2007-11-01

    Full Text Available Highly active antiretroviral treatment (HAART of human immunodeficiency type 1 (HIV-1 infection is very effective in controlling infection, but elimination of viral infection has not been achieved as yet, and upon treatment interruption an immediate rebound of viremia is observed. A combination of HAART with an immune stimulation might allow treatment interruption without this rebounding viremia, as the very low viremias observed with successful HAART may be insufficient to permit maintenance of a specific anti-HIV-1 immune response. The objective of this study was to compare the humoral immune response of individuals undergoing successful HAART (NF=no failure with that of individuals with evidence of failure of therapy (FT and to verify if the viremia peaks observed in individuals with therapy failure would act as a specific stimulus for the humoral anti-HIV-1 immune response. Antibodies binding to gp120 V3 genotype consensus peptides were more frequently observed for FT, mainly against peptides corresponding to sequences of genotypes prevalent in the Rio de Janeiro city area, B and F. HIV-1 neutralization of HIV-1 IIIB and of four primary isolates from Rio de Janeiro was less frequently observed for plasma from the NF than the FT group, but this difference was more expressive when plasma from individuals with detectable viremia were compared to that of individuals with undetectable viral loads in the year before sample collection. Although statistically significant differences were observed only in some specific comparisons, the study indicates that presence of detectable viremia may contribute to the maintenance of a specific anti-HIV-1 humoral immune response.

  6. Harnessing the immune system's arsenal: producing human monoclonal antibodies for therapeutics and investigating immune responses

    Science.gov (United States)

    Sullivan, Meghan; Kaur, Kaval; Pauli, Noel

    2011-01-01

    Monoclonal antibody technology has undergone rapid and innovative reinvention over the last 30 years. Application of these technologies to human samples revealed valuable therapeutic and experimental insights. These technologies, each with their own benefits and flaws, have proven indispensable for immunological research and in our fight to provide new treatments and improved vaccines for infectious disease. PMID:21876728

  7. Cellular immune responses to HIV

    Science.gov (United States)

    McMichael, Andrew J.; Rowland-Jones, Sarah L.

    2001-04-01

    The cellular immune response to the human immunodeficiency virus, mediated by T lymphocytes, seems strong but fails to control the infection completely. In most virus infections, T cells either eliminate the virus or suppress it indefinitely as a harmless, persisting infection. But the human immunodeficiency virus undermines this control by infecting key immune cells, thereby impairing the response of both the infected CD4+ T cells and the uninfected CD8+ T cells. The failure of the latter to function efficiently facilitates the escape of virus from immune control and the collapse of the whole immune system.

  8. Analysis of human immune responses in quasi-experimental settings: tutorial in biostatistics.

    Science.gov (United States)

    Sarkar, Rajiv; Ajjampur, Sitara S; Ward, Honorine D; Kang, Gagandeep; Naumova, Elena N

    2012-01-03

    Human immunology is a growing field of research in which experimental, clinical, and analytical methods of many life science disciplines are utilized. Classic epidemiological study designs, including observational longitudinal birth cohort studies, offer strong potential for gaining new knowledge and insights into immune response to pathogens in humans. However, rigorous discussion of methodological issues related to designs and statistical analysis that are appropriate for longitudinal studies is lacking. In this communication we address key questions of quality and validity of traditional and recently developed statistical tools applied to measures of immune responses. For this purpose we use data on humoral immune response (IR) associated with the first cryptosporidial diarrhea in a birth cohort of children residing in an urban slum in south India. The main objective is to detect the difference and derive inferences for a change in IR measured at two time points, before (pre) and after (post) an event of interest. We illustrate the use and interpretation of analytical and data visualization techniques including generalized linear and additive models, data-driven smoothing, and combinations of box-, scatter-, and needle-plots. We provide step-by-step instructions for conducting a thorough and relatively simple analytical investigation, describe the challenges and pitfalls, and offer practical solutions for comprehensive examination of data. We illustrate how the assumption of time irrelevance can be handled in a study with a pre-post design. We demonstrate how one can study the dynamics of IR in humans by considering the timing of response following an event of interest and seasonal fluctuation of exposure by proper alignment of time of measurements. This alignment of calendar time of measurements and a child's age at the event of interest allows us to explore interactions between IR, seasonal exposures and age at first infection. The use of traditional

  9. Analysis of human immune responses in quasi-experimental settings: tutorial in biostatistics

    Directory of Open Access Journals (Sweden)

    Sarkar Rajiv

    2012-01-01

    Full Text Available Abstract Background Human immunology is a growing field of research in which experimental, clinical, and analytical methods of many life science disciplines are utilized. Classic epidemiological study designs, including observational longitudinal birth cohort studies, offer strong potential for gaining new knowledge and insights into immune response to pathogens in humans. However, rigorous discussion of methodological issues related to designs and statistical analysis that are appropriate for longitudinal studies is lacking. Methods In this communication we address key questions of quality and validity of traditional and recently developed statistical tools applied to measures of immune responses. For this purpose we use data on humoral immune response (IR associated with the first cryptosporidial diarrhea in a birth cohort of children residing in an urban slum in south India. The main objective is to detect the difference and derive inferences for a change in IR measured at two time points, before (pre and after (post an event of interest. We illustrate the use and interpretation of analytical and data visualization techniques including generalized linear and additive models, data-driven smoothing, and combinations of box-, scatter-, and needle-plots. Results We provide step-by-step instructions for conducting a thorough and relatively simple analytical investigation, describe the challenges and pitfalls, and offer practical solutions for comprehensive examination of data. We illustrate how the assumption of time irrelevance can be handled in a study with a pre-post design. We demonstrate how one can study the dynamics of IR in humans by considering the timing of response following an event of interest and seasonal fluctuation of exposure by proper alignment of time of measurements. This alignment of calendar time of measurements and a child's age at the event of interest allows us to explore interactions between IR, seasonal exposures and age

  10. Priming of protective T cell responses against virus-induced tumors in mice with human immune system components.

    Science.gov (United States)

    Strowig, Till; Gurer, Cagan; Ploss, Alexander; Liu, Yi-Fang; Arrey, Frida; Sashihara, Junji; Koo, Gloria; Rice, Charles M; Young, James W; Chadburn, Amy; Cohen, Jeffrey I; Münz, Christian

    2009-06-08

    Many pathogens that cause human disease infect only humans. To identify the mechanisms of immune protection against these pathogens and also to evaluate promising vaccine candidates, a small animal model would be desirable. We demonstrate that primary T cell responses in mice with reconstituted human immune system components control infection with the oncogenic and persistent Epstein-Barr virus (EBV). These cytotoxic and interferon-gamma-producing T cell responses were human leukocyte antigen (HLA) restricted and specific for EBV-derived peptides. In HLA-A2 transgenic animals and similar to human EBV carriers, T cell responses against lytic EBV antigens dominated over recognition of latent EBV antigens. T cell depletion resulted in elevated viral loads and emergence of EBV-associated lymphoproliferative disease. Both loss of CD4(+) and CD8(+) T cells abolished immune control. Therefore, this mouse model recapitulates features of symptomatic primary EBV infection and generates T cell-mediated immune control that resists oncogenic transformation.

  11. Anopheles gambiae immune responses to human and rodent Plasmodium parasite species.

    Directory of Open Access Journals (Sweden)

    Yuemei Dong

    2006-06-01

    Full Text Available Transmission of malaria is dependent on the successful completion of the Plasmodium lifecycle in the Anopheles vector. Major obstacles are encountered in the midgut tissue, where most parasites are killed by the mosquito's immune system. In the present study, DNA microarray analyses have been used to compare Anopheles gambiae responses to invasion of the midgut epithelium by the ookinete stage of the human pathogen Plasmodium falciparum and the rodent experimental model pathogen P. berghei. Invasion by P. berghei had a more profound impact on the mosquito transcriptome, including a variety of functional gene classes, while P. falciparum elicited a broader immune response at the gene transcript level. Ingestion of human malaria-infected blood lacking invasive ookinetes also induced a variety of immune genes, including several anti-Plasmodium factors. Twelve selected genes were assessed for effect on infection with both parasite species and bacteria using RNAi gene silencing assays, and seven of these genes were found to influence mosquito resistance to both parasite species. An MD2-like receptor, AgMDL1, and an immunolectin, FBN39, showed specificity in regulating only resistance to P. falciparum, while the antimicrobial peptide gambicin and a novel putative short secreted peptide, IRSP5, were more specific for defense against the rodent parasite P. berghei. While all the genes that affected Plasmodium development also influenced mosquito resistance to bacterial infection, four of the antimicrobial genes had no effect on Plasmodium development. Our study shows that the impact of P. falciparum and P. berghei infection on A. gambiae biology at the gene transcript level is quite diverse, and the defense against the two Plasmodium species is mediated by antimicrobial factors with both universal and Plasmodium-species specific activities. Furthermore, our data indicate that the mosquito is capable of sensing infected blood constituents in the absence

  12. The human immune system's response to carcinogenic and other infectious agents transmitted by mosquito vectors.

    Science.gov (United States)

    Johansson, Olle; Ward, Martin

    2017-01-01

    It has been hypothesised that mosquitoes [Diptera: Culicidae] may play more of a role in certain cancers than is currently appreciated. Research links 33 infectious agents to cancer, 27 of which have a presence in mosquitoes, and that, in addition, mosquito saliva downregulates the immune system. The objective of this paper is to review the literature on the immune system and cancer-causing infectious agents, particularly those present in mosquitoes, with a view to establishing whether such infectious agents can, in the long run, defeat the immune system or be defeated by it. Many of the viruses, bacteria and parasites recognised by the International Agency for Research on Cancer (IARC) as carcinogenic and suspected by others as being involved in cancer have evolved numerous complex ways of avoiding, suppressing or altering the immune system's responses. These features, coupled with the multiplicity and variety of serious infectious agents carried by some species of mosquitoes and the adverse effects on the immune system of mosquito saliva, suggest that post-mosquito bite the immune system is likely to be overwhelmed. In such a situation, immunisation strategies offer little chance of cancer prevention, unless a single or limited number of critical infectious agents can be isolated from the 'mosquito' cocktail. If that proves to be impossible cancer prevention will, therefore, if the hypothesis proves to be correct, rest on the twin strategies of environmentally controlling the mosquito population and humans avoiding being bitten. The latter strategy will involve determining the factors that demark those being bitten from those that are not.

  13. Human papillomavirus (HPV upregulates the cellular deubiquitinase UCHL1 to suppress the keratinocyte's innate immune response.

    Directory of Open Access Journals (Sweden)

    Rezaul Karim

    Full Text Available Persistent infection of basal keratinocytes with high-risk human papillomavirus (hrHPV may cause cancer. Keratinocytes are equipped with different pattern recognition receptors (PRRs but hrHPV has developed ways to dampen their signals resulting in minimal inflammation and evasion of host immunity for sustained periods of time. To understand the mechanisms underlying hrHPV's capacity to evade immunity, we studied PRR signaling in non, newly, and persistently hrHPV-infected keratinocytes. We found that active infection with hrHPV hampered the relay of signals downstream of the PRRs to the nucleus, thereby affecting the production of type-I interferon and pro-inflammatory cytokines and chemokines. This suppression was shown to depend on hrHPV-induced expression of the cellular protein ubiquitin carboxyl-terminal hydrolase L1 (UCHL1 in keratinocytes. UCHL1 accomplished this by inhibiting tumor necrosis factor receptor-associated factor 3 (TRAF3 K63 poly-ubiquitination which lead to lower levels of TRAF3 bound to TANK-binding kinase 1 and a reduced phosphorylation of interferon regulatory factor 3. Furthermore, UCHL1 mediated the degradation of the NF-kappa-B essential modulator with as result the suppression of p65 phosphorylation and canonical NF-κB signaling. We conclude that hrHPV exploits the cellular protein UCHL1 to evade host innate immunity by suppressing PRR-induced keratinocyte-mediated production of interferons, cytokines and chemokines, which normally results in the attraction and activation of an adaptive immune response. This identifies UCHL1 as a negative regulator of PRR-induced immune responses and consequently its virus-increased expression as a strategy for hrHPV to persist.

  14. Modulation of human humoral immune response through orally administered bovine colostrum.

    Science.gov (United States)

    He, F; Tuomola, E; Arvilommi, H; Salminen, S

    2001-08-01

    Eighteen healthy volunteers were randomized into two treatment groups and consumed liquid prepackaged bovine colostrum whey and placebo for 7 days. On days 1, 3 and 5, an attenuated Salmonella typhi Ty21a oral vaccine was given to all subjects to mimic an enteropathogenic infection. The circulating antibody secreting cells and the expression of phagocytosis receptors of the subjects before and after oral immunization were measured with the ELISPOT assay and flow cytometry. All subjects responded well to the vaccine. No significant differences were observed in ELISPOT values for IgA, IgG, IgM, Fcgamma and CR receptor expression on neutrophils and monocytes between the two groups. There was a trend towards greater increase in specific IgA among the subjects receiving their vaccine with bovine colostrum. These results suggest that bovine colostrum may possess some potential to enhance human special immune responses.

  15. Characterising the mucosal and systemic immune responses to experimental human hookworm infection.

    Directory of Open Access Journals (Sweden)

    Soraya Gaze

    2012-02-01

    Full Text Available The mucosal cytokine response of healthy humans to parasitic helminths has never been reported. We investigated the systemic and mucosal cytokine responses to hookworm infection in experimentally infected, previously hookworm naive individuals from non-endemic areas. We collected both peripheral blood and duodenal biopsies to assess the systemic immune response, as well as the response at the site of adult worm establishment. Our results show that experimental hookworm infection leads to a strong systemic and mucosal Th2 (IL-4, IL-5, IL-9 and IL-13 and regulatory (IL-10 and TGF-β response, with some evidence of a Th1 (IFN-γ and IL-2 response. Despite upregulation after patency of both IL-15 and ALDH1A2, a known Th17-inducing combination in inflammatory diseases, we saw no evidence of a Th17 (IL-17 response. Moreover, we observed strong suppression of mucosal IL-23 and upregulation of IL-22 during established hookworm infection, suggesting a potential mechanism by which Th17 responses are suppressed, and highlighting the potential that hookworms and their secreted proteins offer as therapeutics for human inflammatory diseases.

  16. Longevity and composition of cellular immune responses following experimental Plasmodium falciparum malaria infection in humans.

    Directory of Open Access Journals (Sweden)

    Anne C Teirlinck

    2011-12-01

    Full Text Available Cellular responses to Plasmodium falciparum parasites, in particular interferon-gamma (IFNγ production, play an important role in anti-malarial immunity. However, clinical immunity to malaria develops slowly amongst naturally exposed populations, the dynamics of cellular responses in relation to exposure are difficult to study and data about the persistence of such responses are controversial. Here we assess the longevity and composition of cellular immune responses following experimental malaria infection in human volunteers. We conducted a longitudinal study of cellular immunological responses to sporozoites (PfSpz and asexual blood-stage (PfRBC malaria parasites in naïve human volunteers undergoing single (n = 5 or multiple (n = 10 experimental P. falciparum infections under highly controlled conditions. IFNγ and interleukin-2 (IL-2 responses following in vitro re-stimulation were measured by flow-cytometry prior to, during and more than one year post infection. We show that cellular responses to both PfSpz and PfRBC are induced and remain almost undiminished up to 14 months after even a single malaria episode. Remarkably, not only 'adaptive' but also 'innate' lymphocyte subsets contribute to the increased IFNγ response, including αβT cells, γδT cells and NK cells. Furthermore, results from depletion and autologous recombination experiments of lymphocyte subsets suggest that immunological memory for PfRBC is carried within both the αβT cells and γδT compartments. Indeed, the majority of cytokine producing T lymphocytes express an CD45RO(+ CD62L(- effector memory (EM phenotype both early and late post infection. Finally, we demonstrate that malaria infection induces and maintains polyfunctional (IFNγ(+IL-2(+ EM responses against both PfRBC and PfSpz, previously found to be associated with protection. These data demonstrate that cellular responses can be readily induced and are long-lived following infection with P

  17. Innate, adaptive and regulatory immune responses in human schistosomiasis in Gabon

    NARCIS (Netherlands)

    Łabuda, Łucja

    2014-01-01

    The work presented in this thesis is an investigation of the immune responses induced by chronic schistosomiasis in Gabonese schoolchildren. By investigating concurrently various aspects of the immune response, including innate, adaptive and regulatory responses, we are able to gain a more in-depth

  18. Cellular immune response of humans to the circumsporozoite protein of Plasmodium vivax

    Directory of Open Access Journals (Sweden)

    Mauricio M. Rodrigues

    1991-06-01

    Full Text Available The cellular immune response to the circumsporozoite (CS protein of plasmodium vivax of individuals from malaria-endemic areas of Brazil was studied. We examined the in vitro proliferative response of the peripheral blood mononuclear cells (PBMC of 22 individuals when stimulated with a CS recombinant protein (rPvCS-2 and two other synthetic peptides based on the sequenceof the P. vivax CS protein. Seven of the individuals from malaria-endemic area displayed an antigen specific in vitro proliferative responseto the recombinant protein PvCS-2 and one out of 6, proliferative response to the peptide 308-320. In contrast, none of the individuals displayed a proliferative reponse when stimulated with the D/A peptide which represent some of the repeated units present in this CS protein. Our study, therefore, provides evidence for the presence, withinthe major surface antigen of P. vivax sporozoites, of epitopes capble to induce proliferation of human PBMC.

  19. Human immune responses to H. pylori HLA Class II epitopes identified by immunoinformatic methods.

    Directory of Open Access Journals (Sweden)

    Songhua Zhang

    Full Text Available H. pylori persists in the human stomach over decades and promotes several adverse clinical sequelae including gastritis, peptic ulcers and gastric cancer that are linked to the induction and subsequent evasion of chronic gastric inflammation. Emerging evidence indicates that H. pylori infection may also protect against asthma and some other immune-mediated conditions through regulatory T cell effects outside the stomach. To characterize the complexity of the CD4+ T cell response generated during H. pylori infection, computational methods were previously used to generate a panel of 90 predicted epitopes conserved among H. pylori genomes that broadly cover HLA Class II diversity for maximum population coverage. Here, these sequences were tested individually for their ability to induce in vitro responses in peripheral blood mononuclear cells by interferon-γ ELISpot assay. The average number of spot-forming cells/million PBMCs was significantly elevated in H. pylori-infected subjects over uninfected persons. Ten of the 90 peptides stimulated IFN-γ secretion in the H. pylori-infected group only, whereas two out of the 90 peptides elicited a detectable IFN-γ response in the H. pylori-uninfected subjects but no response in the H. pylori-infected group. Cytokine ELISA measurements performed using in vitro PBMC culture supernatants demonstrated significantly higher levels of TNF-α, IL-2, IL-4, IL-6, IL-10, and TGF-β1 in the H. pylori-infected subjects, whereas IL-17A expression was not related to the subjects H. pylori-infection status. Our results indicate that the human T cell responses to these 90 peptides are generally increased in actively H. pylori-infected, compared with H. pylori-naïve, subjects. This information will improve understanding of the complex immune response to H. pylori, aiding rational epitope-driven vaccine design as well as helping identify other H. pylori epitopes with potentially immunoregulatory effects.

  20. Potent innate immune response to pathogenic leptospira in human whole blood.

    Directory of Open Access Journals (Sweden)

    Marga G A Goris

    Full Text Available BACKGROUND: Leptospirosis is caused by pathogenic spirochetes of the genus Leptospira. The bacteria enter the human body via abraded skin or mucous membranes and may disseminate throughout. In general the clinical picture is mild but some patients develop rapidly progressive, severe disease with a high case fatality rate. Not much is known about the innate immune response to leptospires during haematogenous dissemination. Previous work showed that a human THP-1 cell line recognized heat-killed leptospires and leptospiral LPS through TLR2 instead of TLR4. The LPS of virulent leptospires displayed a lower potency to trigger TNF production by THP-1 cells compared to LPS of non-virulent leptospires. METHODOLOGY/PRINCIPAL FINDINGS: We investigated the host response and killing of virulent and non-virulent Leptospira of different serovars by human THP-1 cells, human PBMC's and human whole blood. Virulence of each leptospiral strain was tested in a well accepted standard guinea pig model. Virulent leptospires displayed complement resistance in human serum and whole blood while in-vitro attenuated non-virulent leptospires were rapidly killed in a complement dependent manner. In vitro stimulation of THP-1 and PBMC's with heat-killed and living leptospires showed differential serovar and cell type dependence of cytokine induction. However, at low, physiological, leptospiral dose, living virulent complement resistant strains were consistently more potent in whole blood stimulations than the corresponding non-virulent complement sensitive strains. At higher dose living virulent and non-virulent leptospires were equipotent in whole blood. Inhibition of different TLRs indicated that both TLR2 and TLR4 as well as TLR5 play a role in the whole blood cytokine response to living leptospires. CONCLUSIONS/SIGNIFICANCE: Thus, in a minimally altered system as human whole blood, highly virulent Leptospira are potent inducers of the cytokine response.

  1. Active suppression of early immune response in tobacco by the human pathogen Salmonella Typhimurium.

    Directory of Open Access Journals (Sweden)

    Natali Shirron

    Full Text Available The persistence of enteric pathogens on plants has been studied extensively, mainly due to the potential hazard of human pathogens such as Salmonella enterica being able to invade and survive in/on plants. Factors involved in the interactions between enteric bacteria and plants have been identified and consequently it was hypothesized that plants may be vectors or alternative hosts for enteric pathogens. To survive, endophytic bacteria have to escape the plant immune systems, which function at different levels through the plant-bacteria interactions. To understand how S. enterica survives endophyticaly we conducted a detailed analysis on its ability to elicit or evade the plant immune response. The models of this study were Nicotiana tabacum plants and cells suspension exposed to S. enterica serovar Typhimurium. The plant immune response was analyzed by looking at tissue damage and by testing oxidative burst and pH changes. It was found that S. Typhimurium did not promote disease symptoms in the contaminated plants. Live S. Typhimurium did not trigger the production of an oxidative burst and pH changes by the plant cells, while heat killed or chloramphenicol treated S. Typhimurium and purified LPS of Salmonella were significant elicitors, indicating that S. Typhimurium actively suppress the plant response. By looking at the plant response to mutants defective in virulence factors we showed that the suppression depends on secreted factors. Deletion of invA reduced the ability of S. Typhimurium to suppress oxidative burst and pH changes, indicating that a functional SPI1 TTSS is required for the suppression. This study demonstrates that plant colonization by S. Typhimurium is indeed an active process. S. Typhimurium utilizes adaptive strategies of altering innate plant perception systems to improve its fitness in the plant habitat. All together these results suggest a complex mechanism for perception of S. Typhimurium by plants.

  2. Innate immune response to influenza A virus in differentiated human alveolar type II cells.

    Science.gov (United States)

    Wang, Jieru; Nikrad, Mrinalini P; Phang, Tzulip; Gao, Bifeng; Alford, Taylor; Ito, Yoko; Edeen, Karen; Travanty, Emily A; Kosmider, Beata; Hartshorn, Kevan; Mason, Robert J

    2011-09-01

    Alveolar Type II (ATII) cells are important targets for seasonal and pandemic influenza. To investigate the influenza-induced innate immune response in those cells, we measured the global gene expression profile of highly differentiated ATII cells infected with the influenza A virus at a multiplicity of infection of 0.5 at 4 hours and 24 hours after inoculation. Infection with influenza stimulated a significant increase in the mRNA concentrations of many host defense-related genes, including pattern/pathogen recognition receptors, IFN, and IFN-induced genes, chemokines, and suppressors of cytokine signaling. We verified these changes by quantitative real-time RT-PCR. At the protein level, we detected a robust virus-induced secretion of the three glutamic acid-leucine-arginine (ELR)-negative chemokines CXCL9, CXCL10, and CXCL11, according to ELISA. The ultraviolet inactivation of virus abolished the chemokine and cytokine response. Viral infection did not appear to alter the differentiation of ATII cells, as measured by cellular mRNA and concentrations of surfactant proteins. However, viral infection significantly reduced the secretion of surfactant protein (SP)-A and SP-D. In addition, influenza A virus triggered a time-dependent activation of phosphatidylinositol 3-kinase signaling in ATII cells. The inhibition of this pathway significantly decreased the release of infectious virus and the chemokine response, but did not alter virus-induced cell death. This study provides insights into influenza-induced innate immunity in differentiated human ATII cells, and demonstrates that the alveolar epithelium is a critical part of the initial innate immune response to influenza.

  3. Molecular genetics of human immune responsiveness to Lolium perenne (rye) allergen, Lol p III.

    Science.gov (United States)

    Ansari, A A; Freidhoff, L R; Marsh, D G

    1989-01-01

    Lol p II and III are each about 11-kD protein allergens from the pollen of Lolium perenne (rye grass). We have found that human immune responses (IgE and IgG antibodies) to both proteins are significantly associated with HLA-DR3. In addition, the two proteins are cross-reactive with the antibodies in many human sera (about 84% human sera showed the cross-reactivity). We have determined greater than 90% of the amino acid sequences of the two proteins and found that they are at least 54% homologous. Berzofsky found that 75% of the 23 known T cell sites in various proteins had an amphipathic structure. Our analysis by the same method showed that both Lol p II and III have a major region of amphipathicity (at residues 61-67, Lol p III numbering) which might contain sites for binding to an Ia molecule and a T cell receptor. This region is identical between Lol p II and III, except for an Arg-Lys substitution, and could account, in part, for the DR3 association with responsiveness to both molecules. An interesting difference between the two proteins is that immune response to Lol p III is associated with DR5 (in addition to DR3), whereas no DR5 association is found in the case of Lol p II. One possibility is that Lol p III has an additional site which binds to the DR5 Ia molecule. Lol p III indeed has a second highly amphiphathic peptide, 24-30 (Lol p III 24 R P G D T L A 30), which is different and not amphipathic in Lol p II.(ABSTRACT TRUNCATED AT 250 WORDS)

  4. Lactobacilli and bifidobacteria promote immune homeostasis by modulating innate immune responses to human rotavirus in neonatal gnotobiotic pigs.

    Directory of Open Access Journals (Sweden)

    Anastasia N Vlasova

    Full Text Available The effects of co-colonization with Lactobacillus rhamnosus GG (LGG and Bifidobacterium lactis Bb12 (Bb12 on 3-dose vaccination with attenuated HRV and challenge with virulent human rotavirus (VirHRV were assessed in 4 groups of gnotobiotic (Gn pigs: Pro+Vac (probiotic-colonized/vaccinated, Vac (vaccinated, Pro (probiotic-colonized, non-vaccinated and Control (non-colonized, non-vaccinated. Subsets of pigs were euthanized pre- [post-challenge day (PCD 0] and post (PCD7-VirHRV challenge to assess diarrhea, fecal HRV shedding and dendritic cell/innate immune responses. Post-challenge, Pro+Vac and Vac groups were completely protected from diarrhea; protection rates against HRV shedding were 100% and 83%, respectively. Diarrhea and HRV shedding were reduced in Pro compared to Control pigs following VirHRV challenge. Diarrhea scores and virus shedding were significantly higher in Controls, compared to all other groups, coincident with significantly higher serum interferon-alpha levels post-challenge. LGG+Bb12 colonization ±vaccine promoted immunomaturation as reflected by increased frequencies of CD4, SWC3a, CD11R1, MHCII expressing mononuclear cells (MNCs and conventional dendritic cells in intestinal tissues and blood post-challenge. Colonization decreased frequencies of toll-like receptors (TLR 2 and TLR4 expressing MNCs from vaccinated pigs (Pro+Vac pre-challenge and increased frequencies of TLR3 expressing MNCs from Pro pigs post-challenge, suggesting that probiotics likely exert anti-inflammatory (TLR2 and 4 down-regulation and antiviral (TLR3 up-regulation by HRV dsRNA actions via TLR signaling. Probiotic colonization alone (Pro increased frequencies of intestinal and systemic apoptotic MNCs pre-challenge, thereby regulating immune hyperreactivity and tolerance. However, these frequencies were decreased in intestinal and systemic tissues post-challenge, moderating HRV-induced apoptosis. Additionally, post-challenge, Pro+Vac and Pro groups had

  5. Human Norovirus and Its Surrogates Induce Plant Immune Response in Arabidopsis thaliana and Lactuca sativa.

    Science.gov (United States)

    Markland, Sarah M; Bais, Harsh; Kniel, Kalmia E

    2017-08-01

    Human norovirus is the leading cause of foodborne illness worldwide with the majority of outbreaks linked to fresh produce and leafy greens. It is essential that we thoroughly understand the type of relationship and interactions that take place between plants and human norovirus to better utilize control strategies to reduce transmission of norovirus in the field onto plants harvested for human consumption. In this study the expression of gene markers for the salicylic acid (SA) and jasmonic acid (JA) plant defense pathways was measured and compared in romaine lettuce (Lactuca sativa) and Arabidopsis thaliana Col-0 plants that were inoculated with Murine Norovirus-1, Tulane Virus, human norovirus GII.4, or Hank's Balanced Salt Solution (control). Genes involving both the SA and JA pathways were expressed in both romaine lettuce and A. thaliana for all three viruses, as well as controls. Studies, including gene expression of SA- and JA-deficient A. thaliana mutant lines, suggest that the JA pathway is more likely involved in the plant immune response to human norovirus. This research provides the first pieces of information regarding how foodborne viruses interact with plants in the preharvest environment.

  6. A model for personalized in vivo analysis of human immune responsiveness

    NARCIS (Netherlands)

    Kalscheuer, Hannes; Danzl, Nichole; Onoe, Takashi; Faust, Ted; Winchester, Robert; Goland, Robin; Greenberg, Ellen; Spitzer, Thomas R; Savage, David G; Tahara, Hiroyuki; Choi, Goda; Yang, Yong-Guang; Sykes, Megan

    2012-01-01

    Studies of human immune diseases are generally limited to the analysis of peripheral blood lymphocytes of heterogeneous patient populations. Improved models are needed to allow analysis of fundamental immunologic abnormalities predisposing to disease and in which to assess immunotherapies.

  7. A model for personalized in vivo analysis of human immune responsiveness

    NARCIS (Netherlands)

    Kalscheuer, Hannes; Danzl, Nichole; Onoe, Takashi; Faust, Ted; Winchester, Robert; Goland, Robin; Greenberg, Ellen; Spitzer, Thomas R; Savage, David G; Tahara, Hiroyuki; Choi, Goda; Yang, Yong-Guang; Sykes, Megan

    2012-01-01

    Studies of human immune diseases are generally limited to the analysis of peripheral blood lymphocytes of heterogeneous patient populations. Improved models are needed to allow analysis of fundamental immunologic abnormalities predisposing to disease and in which to assess immunotherapies. Immunodef

  8. The capsule of Porphyromonas gingivalis reduces the immune response of human gingival fibroblasts

    Directory of Open Access Journals (Sweden)

    van Winkelhoff Arie J

    2010-01-01

    Full Text Available Abstract Background Periodontitis is a bacterial infection of the periodontal tissues. The Gram-negative anaerobic bacterium Porphyromonas gingivalis is considered a major causative agent. One of the virulence factors of P. gingivalis is capsular polysaccharide (CPS. Non-encapsulated strains have been shown to be less virulent in mouse models than encapsulated strains. Results To examine the role of the CPS in host-pathogen interactions we constructed an insertional isogenic P. gingivalis knockout in the epimerase-coding gene epsC that is located at the end of the CPS biosynthesis locus. This mutant was subsequently shown to be non-encapsulated. K1 capsule biosynthesis could be restored by in trans expression of an intact epsC gene. We used the epsC mutant, the W83 wild type strain and the complemented mutant to challenge human gingival fibroblasts to examine the immune response by quantification of IL-1β, IL-6 and IL-8 transcription levels. For each of the cytokines significantly higher expression levels were found when fibroblasts were challenged with the epsC mutant compared to those challenged with the W83 wild type, ranging from two times higher for IL-1β to five times higher for IL-8. Conclusions These experiments provide the first evidence that P. gingivalis CPS acts as an interface between the pathogen and the host that may reduce the host's pro-inflammatory immune response. The higher virulence of encapsulated strains may be caused by this phenomenon which enables the bacteria to evade the immune system.

  9. Deregulation of innate and adaptive immune responses in human papillomavirus infection and cancer

    NARCIS (Netherlands)

    Karim, Rezaul

    2015-01-01

    HPVs need to avoid immune responses of the host in order to establish persistent infection. HPVs achieve this by dampening innate immunity of keratinocytes, the major cell type targeted by HPV. As there is reduced production of danger signals including antimicrobial molecules, proinflammatory cytoki

  10. Deregulation of innate and adaptive immune responses in human papillomavirus infection and cancer

    NARCIS (Netherlands)

    Karim, Rezaul

    2015-01-01

    HPVs need to avoid immune responses of the host in order to establish persistent infection. HPVs achieve this by dampening innate immunity of keratinocytes, the major cell type targeted by HPV. As there is reduced production of danger signals including antimicrobial molecules, proinflammatory

  11. Voluntary activation of the sympathetic nervous system and attenuation of the innate immune response in humans

    NARCIS (Netherlands)

    Kox, M.; Eijk, L.T.G.J. van; Zwaag, J.; Wildenberg, J. van den; Sweep, F.C.; Hoeven, J.G. van der; Pickkers, P.

    2014-01-01

    Excessive or persistent proinflammatory cytokine production plays a central role in autoimmune diseases. Acute activation of the sympathetic nervous system attenuates the innate immune response. However, both the autonomic nervous system and innate immune system are regarded as systems that cannot b

  12. Smoking during pregnancy influences the maternal immune response in mice and humans

    NARCIS (Netherlands)

    Prins, Jelmer R; Hylkema, Machteld N; Erwich, Jan Jaap H. M.; Huitema, Sippie; Dekkema, Gerjan J; Dijkstra, Frank E; Faas, Marijke M; Melgert, Barbro N

    2012-01-01

    OBJECTIVE: During pregnancy the maternal immune system has to adapt its response to accommodate the fetus. The objective of this study was to analyze the effects of smoking on the maternal immune system. STUDY DESIGN: First-trimester decidual tissue and peripheral blood of smoking and nonsmoking wom

  13. Microbial antigenic pressure and evolution of the immune response: toward a better understanding of the human immune system in health and disease and therapeutic interventions.

    Science.gov (United States)

    Magrone, Thea; Jirillo, Emilio

    2010-09-01

    The continuous antigenic triggering has greatly contributed to the evolution of the immune system and, therefore, animals have developed cells able to cope with a broad variety of microbial antigens and or their toxins, e.g., endotoxins. At the same time, intestinal commensals have evolved along with human progress and introduction of new foods, thus empowering both regional and systemic immune response. In this review, some important steps in the evolution of the immune system will be analyzed such as organization of lymphoid organs, formation of germinal centers, leukocyte attraction to tissue function of Toll like receptors and role of antimicrobial peptides. In particular, the major phylogenetic acquisitions of living organisms in the assessment of the immune machinery will be emphasized. Finally, fish will be taken into consideration as animal models of human diseases also in view of drug design strategies. Special attention will be focused on vaccinated salmon and zebrafish models.

  14. Immune response to acetaldehyde-human serum albumin adduct among healthy subjects related to alcohol intake.

    Science.gov (United States)

    Romanazzi, Valeria; Schilirò, Tiziana; Carraro, Elisabetta; Gilli, Giorgio

    2013-09-01

    Acetaldehyde (AA) is the main metabolic product in ethanol metabolism, although it can also derive from sources of airborne pollution. As a typical aldehyde, AA is able to react with a variety of molecular targets, including DNA and protein. This property justifies the hypothesis of a immune reaction against this kind of adduct, to be studied by a seroprevalence screening approach. In this study, the correlation between drinking habits and the amount of circulating AA-human serum albumin adduct (AA-HSA) was evaluated in a group of healthy subjects, non alcohol-addicted. Daily ethanol intake (grams) was inferred for each subject using the information collected through a questionnaire, and AA-HSA antibodies (AA-HSA ab) analyses were performed using the Displacement Assay on whole blood samples. The findings showed a correlation between ethanol intake and immune response to molecular adduct. These results underscore the evaluation of AA-HSA ab amount as a suitable molecular marker for alcohol intake that can be applied in future investigations on a large scale for prevention screening.

  15. Assessment of humoral immune responses to blood-stage malaria antigens following ChAd63-MVA immunization, controlled human malaria infection and natural exposure.

    Directory of Open Access Journals (Sweden)

    Sumi Biswas

    Full Text Available The development of protective vaccines against many difficult infectious pathogens will necessitate the induction of effective antibody responses. Here we assess humoral immune responses against two antigens from the blood-stage merozoite of the Plasmodium falciparum human malaria parasite--MSP1 and AMA1. These antigens were delivered to healthy malaria-naïve adult volunteers in Phase Ia clinical trials using recombinant replication-deficient viral vectors--ChAd63 to prime the immune response and MVA to boost. In subsequent Phase IIa clinical trials, immunized volunteers underwent controlled human malaria infection (CHMI with P. falciparum to assess vaccine efficacy, whereby all but one volunteer developed low-density blood-stage parasitemia. Here we assess serum antibody responses against both the MSP1 and AMA1 antigens following i ChAd63-MVA immunization, ii immunization and CHMI, and iii primary malaria exposure in the context of CHMI in unimmunized control volunteers. Responses were also assessed in a cohort of naturally-immune Kenyan adults to provide comparison with those induced by a lifetime of natural malaria exposure. Serum antibody responses against MSP1 and AMA1 were characterized in terms of i total IgG responses before and after CHMI, ii responses to allelic variants of MSP1 and AMA1, iii functional growth inhibitory activity (GIA, iv IgG avidity, and v isotype responses (IgG1-4, IgA and IgM. These data provide the first in-depth assessment of the quality of adenovirus-MVA vaccine-induced antibody responses in humans, along with assessment of how these responses are modulated by subsequent low-density parasite exposure. Notable differences were observed in qualitative aspects of the human antibody responses against these malaria antigens depending on the means of their induction and/or exposure of the host to the malaria parasite. Given the continued clinical development of viral vectored vaccines for malaria and a range of other

  16. Human Memory CD4+ T Cell Immune Responses against Giardia lamblia.

    Science.gov (United States)

    Saghaug, Christina Skår; Sørnes, Steinar; Peirasmaki, Dimitra; Svärd, Staffan; Langeland, Nina; Hanevik, Kurt

    2015-09-16

    The intestinal protozoan parasite Giardia lamblia may cause severe prolonged diarrheal disease or pass unnoticed as an asymptomatic infection. T cells seem to play an important role in the immune response to Giardia infection, and memory responses may last years. Recently, TH17 responses have been found in three animal studies of Giardia infection. The aim of this study was to characterize the human CD4(+) T cell responses to Giardia. Peripheral blood mononuclear cells (PBMCs) were obtained from 21 returning travelers with recent or ongoing giardiasis and 12 low-risk healthy controls and stimulated in vitro with Giardia lamblia proteins. Production of tumor necrosis factor alpha (TNF-α), gamma interferon, interleukin-17A (IL-17A), IL-10, and IL-4 was measured in CD4(+) effector memory (EM) T cells after 24 h by flow cytometry. After 6 days of culture, activation and proliferation were measured by flow cytometry, while an array of inflammatory cytokine levels in supernatants were measured with multiplex assays. We found the number of IL-17A-producing CD4(+) EM T cells, as well as that of cells simultaneously producing both IL-17A and TNF-α, to be significantly elevated in the Giardia-exposed individuals after 24 h of antigen stimulation. In supernatants of PBMCs stimulated with Giardia antigens for 6 days, we found inflammation-associated cytokines, including 1L-17A, as well as CD4(+) T cell activation and proliferation, to be significantly elevated in the Giardia-exposed individuals. We conclude that symptomatic Giardia infection in humans induces a CD4(+) EM T cell response of which IL-17A production seems to be an important component.

  17. The human metapneumovirus matrix protein stimulates the inflammatory immune response in vitro.

    Directory of Open Access Journals (Sweden)

    Audrey Bagnaud-Baule

    Full Text Available Each year, during winter months, human Metapneumovirus (hMPV is associated with epidemics of bronchiolitis resulting in the hospitalization of many infants. Bronchiolitis is an acute illness of the lower respiratory tract with a consequent inflammation of the bronchioles. The rapid onset of inflammation suggests the innate immune response may have a role to play in the pathogenesis of this hMPV infection. Since, the matrix protein is one of the most abundant proteins in the Paramyxoviridae family virion, we hypothesized that the inflammatory modulation observed in hMPV infected patients may be partly associated with the matrix protein (M-hMPV response. By western blot analysis, we detected a soluble form of M-hMPV released from hMPV infected cell as well as from M-hMPV transfected HEK 293T cells suggesting that M-hMPV may be directly in contact with antigen presenting cells (APCs during the course of infection. Moreover, flow cytometry and confocal microscopy allowed determining that M-hMPV was taken up by dendritic cells (moDCs and macrophages inducing their activation. Furthermore, these moDCs enter into a maturation process inducing the secretion of a broad range of inflammatory cytokines when exposed to M-hMPV. Additionally, M-hMPV activated DCs were shown to stimulate IL-2 and IFN-γ production by allogeneic T lymphocytes. This M-hMPV-mediated activation and antigen presentation of APCs may in part explain the marked inflammatory immune response observed in pathology induced by hMPV in patients.

  18. Axl Mediates ZIKA Virus Entry in Human Glial Cells and Modulates Innate Immune Responses

    Directory of Open Access Journals (Sweden)

    Laurent Meertens

    2017-01-01

    Full Text Available ZIKA virus (ZIKV is an emerging pathogen responsible for neurological disorders and congenital microcephaly. However, the molecular basis for ZIKV neurotropism remains poorly understood. Here, we show that Axl is expressed in human microglia and astrocytes in the developing brain and that it mediates ZIKV infection of glial cells. Axl-mediated ZIKV entry requires the Axl ligand Gas6, which bridges ZIKV particles to glial cells. Following binding, ZIKV is internalized through clathrin-mediated endocytosis and traffics to Rab5+ endosomes to establish productive infection. During entry, the ZIKV/Gas6 complex activates Axl kinase activity, which downmodulates interferon signaling and facilitates infection. ZIKV infection of human glial cells is inhibited by MYD1, an engineered Axl decoy receptor, and by the Axl kinase inhibitor R428. Our results highlight the dual role of Axl during ZIKV infection of glial cells: promoting viral entry and modulating innate immune responses. Therefore, inhibiting Axl function may represent a potential target for future antiviral therapies.

  19. Serologic analysis of anti-porcine endogenous retroviruses immune responses in humans after ex vivo transgenic pig liver perfusion.

    Science.gov (United States)

    Xu, Hui; Sharma, Ajay; Okabe, Jeannine; Cui, Cunqi; Huang, Liping; Wei, Yuan Yuan; Wan, Hua; Lei, Ying; Logan, John S; Levy, Marlon F; Byrne, Guerard W

    2003-01-01

    Improvements in xenotransplantation may significantly increase the availability of organs for human transplantation. The use of porcine organs, however, has raised concern about possible transmission of porcine endogenous retroviruses (PERV) to the recipients. The authors developed monoclonal antibodies specific to the PERV Gag viral product and show that these antibodies can detect PERV antigen under a variety of assay conditions, including enzyme linked immunosorbent assay (ELISA), Western blot, and immunofluorescence staining methods. Two patients in fulminant hepatic failure were treated by extracorporeal perfusion using transgenic porcine livers before receiving orthotopic liver transplants. Despite the use of immune suppression that allowed survival of the allograft, these patients both showed a strong immune response to the xenograft suggesting a largely intact capability to mount a humoral immune response. However, analysis of patient serum samples over a 3 to 4 year period has showed no evidence of an immune response to PERV antigens, suggesting a lack of PERV infection.

  20. Human immune system variation.

    Science.gov (United States)

    Brodin, Petter; Davis, Mark M

    2017-01-01

    The human immune system is highly variable between individuals but relatively stable over time within a given person. Recent conceptual and technological advances have enabled systems immunology analyses, which reveal the composition of immune cells and proteins in populations of healthy individuals. The range of variation and some specific influences that shape an individual's immune system is now becoming clearer. Human immune systems vary as a consequence of heritable and non-heritable influences, but symbiotic and pathogenic microbes and other non-heritable influences explain most of this variation. Understanding when and how such influences shape the human immune system is key for defining metrics of immunological health and understanding the risk of immune-mediated and infectious diseases.

  1. Effects of dietary salt levels on monocytic cells and immune responses in healthy human subjects: a longitudinal study.

    Science.gov (United States)

    Yi, Buqing; Titze, Jens; Rykova, Marina; Feuerecker, Matthias; Vassilieva, Galina; Nichiporuk, Igor; Schelling, Gustav; Morukov, Boris; Choukèr, Alexander

    2015-07-01

    Increasing evidence indicated that excess salt consumption can impose risks on human health and a reduction in daily salt intake from the current average of approximately 12 g/d to 5-6 g/d was suggested by public health authorities. The studies on mice have revealed that sodium chloride plays a role in the modulation of the immune system and a high-salt diet can promote tissue inflammation and autoimmune disease. However, translational evidence of dietary salt on human immunity is scarce. We used an experimental approach of fixing salt intake of healthy human subjects at 12, 9, and 6 g/d for months and examined the relationship between salt-intake levels and changes in the immune system. Blood samples were taken from the end point of each salt intake period. Immune phenotype changes were monitored through peripheral leukocyte phenotype analysis. We assessed immune function changes through the characterization of cytokine profiles in response to mitogen stimulation. The results showed that subjects on the high-salt diet of 12 g/d displayed a significantly higher number of immune cell monocytes compared with the same subjects on a lower-salt diet, and correlation test revealed a strong positive association between salt-intake levels and monocyte numbers. The decrease in salt intake was accompanied by reduced production of proinflammatory cytokines interleukin (IL)-6 and IL-23, along with enhanced producing ability of anti-inflammatory cytokine IL-10. These results suggest that in healthy humans high-salt diet has a potential to bring about excessive immune response, which can be damaging to immune homeostasis, and a reduction in habitual dietary salt intake may induce potentially beneficial immune alterations.

  2. Systems-Biology Approaches to Discover Anti-Viral Effectors of the Human Innate Immune Response

    Directory of Open Access Journals (Sweden)

    Andreas F.R. Sommer

    2011-07-01

    Full Text Available Virus infections elicit an immediate innate response involving antiviral factors. The activities of some of these factors are, in turn, blocked by viral countermeasures. The ensuing battle between the host and the viruses is crucial for determining whether the virus establishes a foothold and/or induces adaptive immune responses. A comprehensive systems-level understanding of the repertoire of anti-viral effectors in the context of these immediate virus-host responses would provide significant advantages in devising novel strategies to interfere with the initial establishment of infections. Recent efforts to identify cellular factors in a comprehensive and unbiased manner, using genome-wide siRNA screens and other systems biology “omics” methodologies, have revealed several potential anti-viral effectors for viruses like Human immunodeficiency virus type 1 (HIV-1, Hepatitis C virus (HCV, West Nile virus (WNV, and influenza virus. This review describes the discovery of novel viral restriction factors and discusses how the integration of different methods in systems biology can be used to more comprehensively identify the intimate interactions of viruses and the cellular innate resistance.

  3. Humoral immune response to the entire human immunodeficiency virus envelope glycoprotein made in insect cells

    Energy Technology Data Exchange (ETDEWEB)

    Rusche, J.R.; Lynn, D.L.; Robert-Guroff, M.; Langlois, A.J.; Lyerly, H.K.; Carson, H.; Krohn, K.; Ranki, A.; Gallo, R.C.; Bolognesi, D.P.; Putney, S.D.

    1987-10-01

    The human immunodeficiency virus envelope gene was expressed in insect cells by using a Baculovirus expression vector. The protein has an apparent molecular mass of 160 kDa, appears on the surface of infected insect cells, and does not appear to be cleaved to glycoproteins gp120 and gp41. Goats immunized with the 160-kDa protein have high titers of antibody that neutralizes virus infection as measured by viral gene expression or cell cytolysis. In addition, immune sera can block fusion of human immunodeficiency virus-infected cells in culture. Both neutralization and fusion-blocking activities are bound to and eluted from immobilized gp120.

  4. Survey of innate immune responses to Burkholderia pseudomallei in human blood identifies a central role for lipopolysaccharide.

    Directory of Open Access Journals (Sweden)

    Narisara Chantratita

    Full Text Available B. pseudomallei is a gram-negative bacterium that causes the tropical infection melioidosis. In northeast Thailand, mortality from melioidosis approaches 40%. As exemplified by the lipopolysaccharide-Toll-like receptor 4 interaction, innate immune responses to invading bacteria are precipitated by activation of host pathogen recognition receptors by pathogen associated molecular patterns. Human melioidosis is characterized by up-regulation of pathogen recognition receptors and pro-inflammatory cytokine release. In contrast to many gram-negative pathogens, however, the lipopolysaccharide of B. pseudomallei is considered only weakly inflammatory. We conducted a study in 300 healthy Thai subjects to investigate the ex vivo human blood response to various bacterial pathogen associated molecular patterns, including lipopolysaccharide from several bacteria, and to two heat-killed B. pseudomallei isolates. We measured cytokine levels after stimulation of fresh whole blood with a panel of stimuli. We found that age, sex, and white blood cell count modulate the innate immune response to B. pseudomallei. We further observed that, in comparison to other stimuli, the innate immune response to B. pseudomallei is most highly correlated with the response to lipopolysaccharide. The magnitude of cytokine responses induced by B. pseudomallei lipopolysaccharide was significantly greater than those induced by lipopolysaccharide from Escherichia coli and comparable to many responses induced by lipopolysaccharide from Salmonella minnesota despite lower amounts of lipid A in the B. pseudomallei lipopolysaccharide preparation. In human monocytes stimulated with B. pseudomallei, addition of polymyxin B or a TLR4/MD-2 neutralizing antibody inhibited the majority of TNF-α production. Challenging existing views, our data indicate that the innate immune response to B. pseudomallei in human blood is largely driven by lipopolysaccharide, and that the response to B

  5. Human milk oligosaccharides: The role in the fine-tuning of innate immune responses.

    Science.gov (United States)

    Kulinich, Anna; Liu, Li

    2016-09-02

    In order to secure the health of newborns over the period of immune immaturity during the first months of life, a mother provides her offspring with passive protection: bioactive molecules transferred through the placenta and breast milk. It is well known that human milk contains immunoglobulins (Ig), immune cells and diverse cytokines, which affect newborn directly or indirectly and contribute to the maturation of the immune system. However, in addition to the above-stated molecules, human milk oligosaccharides (HMOs), a complex mixture of free indigestible carbohydrates with multiple functions, play exceptional roles in the functioning of the infants' immune system. These biological molecules have been studied over decades, however, interest in HMOs does not seem to have abated. Although biological activities of oligosaccharides from human milk have been explicitly reviewed, information regarding the role of HMOs in inflammation remains rather fragmented. The purpose of this review is to compile existing knowledge about the role of certain species of HMOs, including fucosylated, galactosylated and sialylated oligosaccharides, and their signaling pathways in immunity and inflammation. The advances in applying this information to the treatment of diseases in infants as well as adults were also reviewed here.

  6. Genetic variation of the human urinary tract innate immune response and asymptomatic bacteriuria in women.

    Directory of Open Access Journals (Sweden)

    Thomas R Hawn

    Full Text Available BACKGROUND: Although several studies suggest that genetic factors are associated with human UTI susceptibility, the role of DNA variation in regulating early in vivo urine inflammatory responses has not been fully examined. We examined whether candidate gene polymorphisms were associated with altered urine inflammatory profiles in asymptomatic women with or without bacteriuria. METHODOLOGY: We conducted a cross-sectional analysis of asymptomatic bacteriuria (ASB in 1,261 asymptomatic women ages 18-49 years originally enrolled as participants in a population-based case-control study of recurrent UTI and pyelonephritis. We genotyped polymorphisms in CXCR1, CXCR2, TLR1, TLR2, TLR4, TLR5, and TIRAP in women with and without ASB. We collected urine samples and measured levels of uropathogenic bacteria, neutrophils, and chemokines. PRINCIPAL FINDINGS: Polymorphism TLR2_G2258A, a variant associated with decreased lipopeptide-induced signaling, was associated with increased ASB risk (odds ratio 3.44, 95%CI; 1.65-7.17. Three CXCR1 polymorphisms were associated with ASB caused by gram-positive organisms. ASB was associated with urinary CXCL-8 levels, but not CXCL-5, CXCL-6, or sICAM-1 (P< or =0.0001. Urinary levels of CXCL-8 and CXCL-6, but not ICAM-1, were associated with higher neutrophil levels (P< or =0.0001. In addition, polymorphism CXCR1_G827C was associated with increased CXCL-8 levels in women with ASB (P = 0.004. CONCLUSIONS: TLR2 and CXCR1 polymorphisms were associated with ASB and a CXCR1 variant was associated with urine CXCL-8 levels. These results suggest that genetic factors are associated with early in vivo human bladder immune responses prior to the development of symptomatic UTIs.

  7. Human papillomavirus (HPV) upregulates the cellular deubiquitinase UCHL1 to suppress the keratinocyte's innate immune response

    NARCIS (Netherlands)

    Karim, R.; Tummers, B.; Meyers, C.; Biryukov, J.L.; Alam, S.; Backendorf, C.; Jha, V.; Offringa, R.; van Ommen, G.J.; Melief, C.J.; Guardavaccaro, D.; Boer, J.M.; van der Burg, S.H.

    2013-01-01

    Persistent infection of basal keratinocytes with high-risk human papillomavirus (hrHPV) may cause cancer. Keratinocytes are equipped with different pattern recognition receptors (PRRs) but hrHPV has developed ways to dampen their signals resulting in minimal inflammation and evasion of host immunity

  8. Human papillomavirus (HPV) upregulates the cellular deubiquitinase UCHL1 to suppress the keratinocyte's innate immune response

    NARCIS (Netherlands)

    Karim, R.; Tummers, B.; Meyers, C.; Biryukov, J.L.; Alam, S.; Backendorf, C.; Jha, V.; Offringa, R.; van Ommen, G.J.; Melief, C.J.; Guardavaccaro, D.; Boer, J.M.; van der Burg, S.H.

    2013-01-01

    Persistent infection of basal keratinocytes with high-risk human papillomavirus (hrHPV) may cause cancer. Keratinocytes are equipped with different pattern recognition receptors (PRRs) but hrHPV has developed ways to dampen their signals resulting in minimal inflammation and evasion of host immunity

  9. Recombinant Ag85B vaccine by taking advantage of characteristics of human parainfluenza type 2 virus vector showed Mycobacteria-specific immune responses by intranasal immunization.

    Science.gov (United States)

    Watanabe, Kenta; Matsubara, Akihiro; Kawano, Mitsuo; Mizuno, Satoru; Okamura, Tomotaka; Tsujimura, Yusuke; Inada, Hiroyasu; Nosaka, Tetsuya; Matsuo, Kazuhiro; Yasutomi, Yasuhiro

    2014-03-26

    Viral vectors are promising vaccine candidates for eliciting suitable Ag-specific immune response. Since Mycobacterium tuberculosis (Mtb) normally enters hosts via the mucosal surface of the lung, the best defense against Mtb is mucosal vaccines that are capable of inducing both systemic and mucosal immunity. Although Mycobacterium bovis bacille Calmette-Guérin is the only licensed tuberculosis (TB) vaccine, its efficacy against adult pulmonary forms of TB is variable. In this study, we assessed the effectiveness of a novel mucosal TB vaccine using recombinant human parainfluenza type 2 virus (rhPIV2) as a vaccine vector in BALB/c mice. Replication-incompetent rhPIV2 (M gene-eliminated) expressing Ag85B (rhPIV2-Ag85B) was constructed by reverse genetics technology. Intranasal administration of rhPIV2-Ag85B induced Mtb-specific immune responses, and the vaccinated mice showed a substantial reduction in the number of CFU of Mtb in lungs and spleens. Unlike other viral vaccine vectors, the immune responses against Ag85B induced by rhPIV2-Ag85B immunization had an advantage over that against the viral vector. In addition, it was revealed that rhPIV2-Ag85B in itself has an adjuvant activity through the retinoic acid-inducible gene I receptor. These findings provide further evidence for the possibility of rhPIV2-Ag85B as a novel TB vaccine.

  10. Immune response to H pylori

    Institute of Scientific and Technical Information of China (English)

    Giovanni Suarez; Victor E Reyes; Ellen J Beswick

    2006-01-01

    The gastric mucosa separates the underlying tissue from the vast array of antigens that traffic through the stomach lumen. While the extreme pH of this environment is essential in aiding the activation of enzymes and food digestion, it also renders the gastric epithelium free from bacterial colonization, with the exception of one important human pathogen, H pylori. This bacterium has developed mechanisms to survive the harsh environment of the stomach, actively move through the mucosal layer,attach to the epithelium, evade immune responses, and achieve persistent colonization. While a hallmark of this infection is a marked inflammatory response with the infiltration of various immune cells into the infected gastric mucosa, the host immune response is unable to clear the infection and may actually contribute to the associated pathogenesis. Here, we review the host responses involved during infection with H pylori and how they are influenced by this bacterium.

  11. A melanoma immune response signature including Human Leukocyte Antigen-E.

    Science.gov (United States)

    Tremante, Elisa; Ginebri, Agnese; Lo Monaco, Elisa; Benassi, Barbara; Frascione, Pasquale; Grammatico, Paola; Cappellacci, Sandra; Catricalà, Caterina; Arcelli, Diego; Natali, Pier Giorgio; Di Filippo, Franco; Mottolese, Marcella; Visca, Paolo; Benevolo, Maria; Giacomini, Patrizio

    2014-01-01

    Paired cultures of early-passage melanoma cells and melanocytes were established from metastatic lesions and the uninvolved skin of five patients. In this stringent autologous setting, cDNA profiling was used to analyze a subset of 1477 genes selected by the Gene Ontology term 'immune response'. Human Leukocyte Antigen E (HLA-E) was ranked 19th among melanoma-overexpressed genes and was embedded in a transformation signature including its preferred peptide ligand donors HLA-A, HLA-B, HLA-C, and HLA-G. Mostly undetectable in normal skin and 39 nevi (including rare and atypical lesions), HLA-E was detected by immunohistochemistry in 17/30 (57%) and 32/48 (67%) primary and metastatic lesions, respectively. Accordingly, surface HLA-E was higher on melanoma cells than on melanocytes and protected the former (6/6 cell lines) from lysis by natural killer (NK) cells, functionally counteracting co-expressed triggering ligands. Although lacking HLA-E, melanocytes (4/4 cultures) were nevertheless (and surprisingly) fully protected from NK cell lysis.

  12. Synthetic immunology: modulating the human immune system.

    Science.gov (United States)

    Geering, Barbara; Fussenegger, Martin

    2015-02-01

    Humans have manipulated the immune system to dampen or boost the immune response for thousands of years. As our understanding of fundamental immunology and biotechnological methodology accumulates, we can capitalize on this combined knowledge to engineer biological devices with the aim of rationally manipulating the immune response. We address therapeutic approaches based on the principles of synthetic immunology that either ameliorate disorders of the immune system by interfering with the immune response, or improve diverse pathogenic conditions by exploiting immune cell effector functions. We specifically highlight synthetic proteins investigated in preclinical and clinical trials, summarize studies that have used engineered immune cells, and finish with a discussion of possible future therapeutic concepts.

  13. Aberrant cellular immune responses in humans infected persistently with parvovirus B19

    DEFF Research Database (Denmark)

    Isa, Adiba; Norbeck, Oscar; Hirbod, Taha

    2006-01-01

    A subset of parvovirus B19 (B19) infected patients retains the infection for years, as defined by detection of B19 DNA in bone marrow. Thus far, analysis of B19-specific humoral immune responses and viral genome variations has not revealed a mechanism for the absent viral clearance. In this study...

  14. immune response in human leishmania infections Respuesta inmune en infecciones humanas por Leishmania spp

    Directory of Open Access Journals (Sweden)

    Sara María Robledo Restrepo

    2000-03-01

    Full Text Available This review summarizes relevant information about the immune response triggered during leishmaniosis, a disease of great importance from the epidemiological point of view, since it is endemic in Colombia and other countries. We emphasize on human leishmaniosis; nevertheless, some important findings in the murine model are also mentioned. This information allows to conclude that Leishmania infection is a complex and coordinated process, which includes adhesion and entrance of the parasite into the host cells and its survival inside them. Events that mediate the infection process may influence its result in terms of elimination of the parasite or development of the disease, through induction or not of an effective specific immune response which involves host cell activation and parasite destruction. La presente revisión tiene como objetivo resumir la información más relevante acerca de la respuesta inmune que se desencadena durante la leishmaniosis, una enfermedad de gran importancia desde el punto de vista epidemiológico dado que es endémica en Colombia y otros países. Aunque la respuesta inmune en la leishmaniosis es un tema que se ha estudiado ampliamente en las infecciones por especies de Leishmania del Viejo Mundo, particularmente Leishmania major y Leishmania donovani y en el modelo murino, la presente revisión hace énfasis en la leishmaniosis humana. Algunos hallazgos importantes en el modelo murino también se mencionan. La información contenida en la revisión, en su mayoría, proviene de publicaciones derivadas de investigaciones, las cuales se seleccionaron con base en la calidad del trabajo realizado y en los aportes de sus resultados en el avance del conocimiento sobre las infecciones en humanos. La síntesis de la información seleccionada nos permite concluir que la infección por Leishmania es un proceso complejo y coordinado que incluye la adherencia y entrada del parásito a la célula hospedera y su posterior

  15. Exercise boosts immune response.

    Science.gov (United States)

    Sander, Ruth

    2012-06-29

    Ageing is associated with a decline in normal functioning of the immune system described as 'immunosenescence'. This contributes to poorer vaccine response and increased incidence of infection and malignancy seen in older people. Regular exercise can enhance vaccination response, increase T-cells and boost the function of the natural killer cells in the immune system. Exercise also lowers levels of the inflammatory cytokines that cause the 'inflamm-ageing' that is thought to play a role in conditions including cardiovascular disease; type 2 diabetes; Alzheimer's disease; osteoporosis and some cancers.

  16. Immune responses to improving welfare.

    Science.gov (United States)

    Berghman, L R

    2016-09-01

    The relationship between animal welfare and the immune status of an animal has a complex nature. Indeed, the intuitive notion that "increased vigilance of the immune system is by definition better" because it is expected to better keep the animal healthy, does not hold up under scrutiny. This is mostly due to the fact that the immune system consists of 2 distinct branches, the innate and the adaptive immune system. While they are intimately intertwined and synergistic in the living organism, they are profoundly different in their costs, both in terms of performance and wellbeing. In contrast to the adaptive immune system, the action of the innate immune system has a high metabolic cost as well as undesirable behavioral consequences. When a pathogen breaches the first line of defense (often a mucosal barrier), that organism's molecular signature is recognized by resident macrophages. The macrophages respond by releasing a cocktail of pro-inflammatory cytokines (including interleukin-1 and -6) that signal the brain via multiple pathways (humoral as well as neural) of the ongoing peripheral innate immune response. The behavioral response to the release of proinflammatory cytokines, known as "sickness behavior," includes nearly all the behavioral aspects that are symptomatic for clinical depression in humans. Hence, undesired innate immune activity, such as chronic inflammation, needs to be avoided by the industry. From an immunological standpoint, one of the most pressing poultry industry needs is the refinement of our current veterinary vaccine arsenal. The response to a vaccine, especially to a live attenuated vaccine, is often a combination of innate and adaptive immune activities, and the desired immunogenicity comes at the price of high reactogenicity. The morbidity, albeit limited and transient, caused by live vaccines against respiratory diseases and coccidiosis are good examples. Thankfully, the advent of various post-genomics technologies, such as DNA

  17. Immune responses in human infections with Brugia malayi: specific cellular unresponsiveness to filarial antigens.

    Science.gov (United States)

    Piessens, W F; McGreevy, P B; Piessens, P W; McGreevy, M; Koiman, I; Saroso, J S; Dennis, D T

    1980-01-01

    We evaluated the cellular immune competence of 101 subjects living in an area of South Kalimantan (Borneo) where Malayan filariasis is endemic. All patients with elephantiasis but none with other clinical stages of filariasis reacted with adult worm antigens. The majority of subjects without clinical or parasitological evidence of filariasis and approximately one-half of those with amicrofilaremic filariasis reacted with microfilarial antigens. In contrast, most patients with patent microfilaremia did not respond to microfilarial antigens. The in vitro reactivity of all patient categories to nonparasite antigens was similar to that of the distant control group. These results indicate that patent microfilaremia is associated with a state of specific cellular immune unresponsiveness and are consistent with the current hypothesis that the various clinical manifestations of filariasis result from different types of immune responses to distinct antigens associated with different developmental stages of filarial worms. PMID:7350196

  18. A cell-based systems biology assessment of human blood to monitor immune responses after influenza vaccination.

    Science.gov (United States)

    Hoek, Kristen L; Samir, Parimal; Howard, Leigh M; Niu, Xinnan; Prasad, Nripesh; Galassie, Allison; Liu, Qi; Allos, Tara M; Floyd, Kyle A; Guo, Yan; Shyr, Yu; Levy, Shawn E; Joyce, Sebastian; Edwards, Kathryn M; Link, Andrew J

    2015-01-01

    Systems biology is an approach to comprehensively study complex interactions within a biological system. Most published systems vaccinology studies have utilized whole blood or peripheral blood mononuclear cells (PBMC) to monitor the immune response after vaccination. Because human blood is comprised of multiple hematopoietic cell types, the potential for masking responses of under-represented cell populations is increased when analyzing whole blood or PBMC. To investigate the contribution of individual cell types to the immune response after vaccination, we established a rapid and efficient method to purify human T and B cells, natural killer (NK) cells, myeloid dendritic cells (mDC), monocytes, and neutrophils from fresh venous blood. Purified cells were fractionated and processed in a single day. RNA-Seq and quantitative shotgun proteomics were performed to determine expression profiles for each cell type prior to and after inactivated seasonal influenza vaccination. Our results show that transcriptomic and proteomic profiles generated from purified immune cells differ significantly from PBMC. Differential expression analysis for each immune cell type also shows unique transcriptomic and proteomic expression profiles as well as changing biological networks at early time points after vaccination. This cell type-specific information provides a more comprehensive approach to monitor vaccine responses.

  19. Systemic and mucosal immune responses to sublingual or intramuscular human papilloma virus antigens in healthy female volunteers.

    Directory of Open Access Journals (Sweden)

    Zhiming Huo

    Full Text Available The sublingual route has been proposed as a needle-free option to induce systemic and mucosal immune protection against viral infections. In a translational study of systemic and mucosal humoral immune responses to sublingual or systemically administered viral antigens, eighteen healthy female volunteers aged 19-31 years received three immunizations with a quadravalent Human Papilloma Virus vaccine at 0, 4 and 16 weeks as sublingual drops (SL, n = 12 or intramuscular injection (IM, n = 6. IM antigen delivery induced or boosted HPV-specific serum IgG and pseudovirus-neutralizing antibodies, HPV-specific cervical and vaginal IgG, and elicited circulating IgG and IgA antibody secreting cells. SL antigens induced ~38-fold lower serum and ~2-fold lower cervical/vaginal IgG than IM delivery, and induced or boosted serum virus neutralizing antibody in only 3/12 subjects. Neither route reproducibly induced HPV-specific mucosal IgA. Alternative delivery systems and adjuvants will be required to enhance and evaluate immune responses following sublingual immunization in humans.ClinicalTrials.govNCT00949572.

  20. Placebo effects on the immune response in humans: the role of learning and expectation.

    Directory of Open Access Journals (Sweden)

    Antje Albring

    Full Text Available Placebo responses are primarily mediated via two neuropsychological mechanisms: patients' expectation towards the benefit of a treatment and associative learning processes. Immune functions, like other physiological responses, can be modulated through behavioral conditioning. However, it is unknown whether learned immune responses are affected by the number of re-expositions to the conditioned stimulus (CS during evocation. Moreover, it is unclear whether immune functions can also be modulated through mere verbally induced expectation. In the experiments reported here, we investigated in healthy male volunteers with an established model of learned immunosuppression whether a single re-exposition to the CS is able to induce a behaviorally conditioned immunosuppression. This conditioned immunosuppression is reflected through a significantly decreased interleukin (IL-2 production by anti-CD3 stimulated peripheral blood mononuclear cells. Our data revealed that in contrast to four CS re-expositions (control group n = 15; experimental group n = 17, a single CS re-exposition was not sufficient to significantly suppress IL-2 production (control group n = 9, experimental group n = 10. Furthermore, we could demonstrate that mere expectation of taking an immunosuppressant did not cause an immunosuppressive response (n = 8-9 per expectation condition. Together, these findings extend our knowledge about the kinetics and mechanisms of placebo-induced immunosuppression and provide therewith information for designing conditioning protocols, which might be employed as a supportive therapy in clinical settings.

  1. Levamisole enhances immune response by affecting the activation and maturation of human monocyte-derived dendritic cells

    Science.gov (United States)

    Chen, L-Y; Lin, Y-L; Chiang, B-L

    2008-01-01

    Levamisole is a synthetic phenylimidazolthiazole that was first introduced in 1966 as an anti-helmintic agent. Current studies have been focused upon its effect on immune response and on cancer treatment. We examined the molecular mechanisms of levamisole in the activation and maturation of human monocyte-derived dendritic cells (DC) and human T cells. Treatment of DC with levamisole increased the presentation of CD80, CD86, CD83 and human leucocyte antigen D-related (HLA-DR) molecules on the cell membrane, as well as the production of interleukin (IL)-12 p40 and IL-10. Levamisole-treated human DC also enhanced T cell activation towards type 1 T helper immune response by inducing interferon-γ secretion. Neutralization with antibodies against Toll-like receptor (TLR)-2 inhibited levamisole-induced production of IL-12 p40 and IL-10, suggesting a vital role for TLR-2 in signalling DC upon incubation with levamisole. The inhibition of nuclear factor-κB, extracellular signal-regulated kinases 1/2 or c-Jun N-terminal kinases pathways also prevented the effects of levamisole on DC in producing IL-12 p40 or IL-10. Taken together, levamisole could enhance immune response towards T helper 1 development through the activation of dendritic cells or T cell aspects. PMID:18005262

  2. Evaluation of the humoral immune response to human leukocyte antigens in Brazilian renal transplant candidates.

    Directory of Open Access Journals (Sweden)

    Patricia Keiko Saito

    Full Text Available Pre-transplant sensitization to human leukocyte antigens (HLA is a risk factor for graft failure. Studies of the immunological profile related to anti-HLA antibodies in Brazilian renal transplant candidates are few. In this study, we evaluated the humoral immune response to HLA antigens in 269 renal transplant candidates, in Paraná State, Brazil. The HLA typing was performed by the polymerase chain reaction sequence-specific oligonucleotide method (PCR-SSO combined with Luminex technology, using an SSO-LABType commercial kit (One Lambda, Inc., Canoga Park, CA, USA. The percentages of panel-reactive antibodies (PRA and the specificity of anti-HLA antibodies were determined using the LS1PRA and LS2PRA commercial kits (One Lambda, Inc.. The PRA-positive group consisted of 182 (67.7% patients, and the PRA-negative group of 87 (32.3% patients. The two groups differed significantly only with respect to gender. Females were the most sensitized. Among the 182 patients with PRA- positive, 62 (34.1% were positive for class I and negative for class II, 39 (21.4% were negative for class I and positive for class II, and 81 (44.5% were positive for both classes I and II. The HLA-A*02, A*24, A*01, B*44, B*35, B*15, DRB1*11, DRB1*04 and DRB1*03 allele groups were the most frequent. The specificities of anti-HLA antibodies were more frequent: A34, B57, Cw15, Cw16, DR51, DQ8 and DP14. This study documented the profile of anti-HLA antibodies in patients with chronic renal failure who were on waiting lists for an organ in Paraná, and found high sensitization to HLA antigens in the samples.

  3. Evaluation of the humoral immune response to human leukocyte antigens in Brazilian renal transplant candidates.

    Science.gov (United States)

    Saito, Patricia Keiko; Yamakawa, Roger Haruki; Aparecida, Erica Pereira; da Silva Júnior, Waldir Verissimo; Borelli, Sueli Donizete

    2014-01-01

    Pre-transplant sensitization to human leukocyte antigens (HLA) is a risk factor for graft failure. Studies of the immunological profile related to anti-HLA antibodies in Brazilian renal transplant candidates are few. In this study, we evaluated the humoral immune response to HLA antigens in 269 renal transplant candidates, in Paraná State, Brazil. The HLA typing was performed by the polymerase chain reaction sequence-specific oligonucleotide method (PCR-SSO) combined with Luminex technology, using an SSO-LABType commercial kit (One Lambda, Inc., Canoga Park, CA, USA). The percentages of panel-reactive antibodies (PRA) and the specificity of anti-HLA antibodies were determined using the LS1PRA and LS2PRA commercial kits (One Lambda, Inc.). The PRA-positive group consisted of 182 (67.7%) patients, and the PRA-negative group of 87 (32.3%) patients. The two groups differed significantly only with respect to gender. Females were the most sensitized. Among the 182 patients with PRA- positive, 62 (34.1%) were positive for class I and negative for class II, 39 (21.4%) were negative for class I and positive for class II, and 81 (44.5%) were positive for both classes I and II. The HLA-A*02, A*24, A*01, B*44, B*35, B*15, DRB1*11, DRB1*04 and DRB1*03 allele groups were the most frequent. The specificities of anti-HLA antibodies were more frequent: A34, B57, Cw15, Cw16, DR51, DQ8 and DP14. This study documented the profile of anti-HLA antibodies in patients with chronic renal failure who were on waiting lists for an organ in Paraná, and found high sensitization to HLA antigens in the samples.

  4. Immune cellular response to HPV: current concepts

    Directory of Open Access Journals (Sweden)

    Maria Alice Guimarães Gonçalves

    Full Text Available Although cellular immunity is essential for the elimination of human papillomavirus (HPV, the mechanisms involved are still poorly understood. We summarize the main mechanisms involved in cellular immune response to infections caused by HPV. Immunotherapies for HPV-related cancers require the disruption of T-cell response control mechanisms, associated with the stimulation of the Th1 cytokine response.

  5. Immune response to fungal infections.

    Science.gov (United States)

    Blanco, Jose L; Garcia, Marta E

    2008-09-15

    The immune mechanisms of defence against fungal infections are numerous, and range from protective mechanisms that were present early in evolution (innate immunity) to sophisticated adaptive mechanisms that are induced specifically during infection and disease (adaptive immunity). The first-line innate mechanism is the presence of physical barriers in the form of skin and mucous membranes, which is complemented by cell membranes, cellular receptors and humoral factors. There has been a debate about the relative contribution of humoral and cellular immunity to host defence against fungal infections. For a long time it was considered that cell-mediated immunity (CMI) was important, but humoral immunity had little or no role. However, it is accepted now that CMI is the main mechanism of defence, but that certain types of antibody response are protective. In general, Th1-type CMI is required for clearance of a fungal infection, while Th2 immunity usually results in susceptibility to infection. Aspergillosis, which is a disease caused by the fungus Aspergillus, has been the subject of many studies, including details of the immune response. Attempts to relate aspergillosis to some form of immunosuppression in animals, as is the case with humans, have not been successful to date. The defence against Aspergillus is based on recognition of the pathogen, a rapidly deployed and highly effective innate effector phase, and a delayed but robust adaptive effector phase. Candida albicans, part of the normal microbial flora associated with mucous surfaces, can be present as congenital candidiasis or as acquired defects of cell-mediated immunity. Resistance to this yeast is associated with Th1 CMI, whereas Th2 immunity is associated with susceptibility to systemic infection. Dermatophytes produce skin alterations in humans and other animals, and the essential role of the CMI response is to destroy the fungi and produce an immunoprotective status against re-infection. The resolution

  6. Innate immune response of human alveolar type II cells infected with severe acute respiratory syndrome-coronavirus.

    Science.gov (United States)

    Qian, Zhaohui; Travanty, Emily A; Oko, Lauren; Edeen, Karen; Berglund, Andrew; Wang, Jieru; Ito, Yoko; Holmes, Kathryn V; Mason, Robert J

    2013-06-01

    Severe acute respiratory syndrome (SARS)-coronavirus (CoV) produces a devastating primary viral pneumonia with diffuse alveolar damage and a marked increase in circulating cytokines. One of the major cell types to be infected is the alveolar type II cell. However, the innate immune response of primary human alveolar epithelial cells infected with SARS-CoV has not been defined. Our objectives included developing a culture system permissive for SARS-CoV infection in primary human type II cells and defining their innate immune response. Culturing primary human alveolar type II cells at an air-liquid interface (A/L) improved their differentiation and greatly increased their susceptibility to infection, allowing us to define their primary interferon and chemokine responses. Viral antigens were detected in the cytoplasm of infected type II cells, electron micrographs demonstrated secretory vesicles filled with virions, virus RNA concentrations increased with time, and infectious virions were released by exocytosis from the apical surface of polarized type II cells. A marked increase was evident in the mRNA concentrations of interferon-β and interferon-λ (IL-29) and in a large number of proinflammatory cytokines and chemokines. A surprising finding involved the variability of expression of angiotensin-converting enzyme-2, the SARS-CoV receptor, in type II cells from different donors. In conclusion, the cultivation of alveolar type II cells at an air-liquid interface provides primary cultures in which to study the pulmonary innate immune responses to infection with SARS-CoV, and to explore possible therapeutic approaches to modulating these innate immune responses.

  7. Early Transcriptional Signatures of the Immune Response to a Live Attenuated Tetravalent Dengue Vaccine Candidate in Non-human Primates

    Science.gov (United States)

    Strouts, Fiona R.; Popper, Stephen J.; Partidos, Charalambos D.; Stinchcomb, Dan T.; Osorio, Jorge E.; Relman, David A.

    2016-01-01

    predictive of development of adaptive immunity to TDV vaccination in cynomolgus macaques, and will inform studies of human responses to dengue vaccines. PMID:27214236

  8. Early Transcriptional Signatures of the Immune Response to a Live Attenuated Tetravalent Dengue Vaccine Candidate in Non-human Primates.

    Directory of Open Access Journals (Sweden)

    Fiona R Strouts

    2016-05-01

    Full Text Available The development of a vaccine against dengue faces unique challenges, including the complexity of the immune responses to the four antigenically distinct serotypes. Genome-wide transcriptional profiling provides insight into the pathways and molecular features that underlie responses to immune system stimulation, and may facilitate predictions of immune protection.In this study, we measured early transcriptional responses in the peripheral blood of cynomolgus macaques following vaccination with a live, attenuated tetravalent dengue vaccine candidate, TDV, which is based on a DENV-2 backbone. Different doses and routes of vaccine administration were used, and viral load and neutralizing antibody titers were measured at different time-points following vaccination. All 30 vaccinated animals developed a neutralizing antibody response to each of the four dengue serotypes, and only 3 of these animals had detectable serum viral RNA after challenge with wild-type dengue virus (DENV, suggesting protection of vaccinated animals to DENV infection. The vaccine induced statistically significant changes in 595 gene transcripts on days 1, 3, 5 and 7 as compared with baseline and placebo-treated animals. Genes involved in the type I interferon (IFN response, including IFI44, DDX58, MX1 and OASL, exhibited the highest fold-change in transcript abundance, and this response was strongest following double dose and subcutaneous (versus intradermal vaccine administration. In addition, modules of genes involved in antigen presentation, dendritic cell activation, and T cell activation and signaling were enriched following vaccination. Increased abundance of gene transcripts related to T cell activation on day 5, and the type I IFN response on day 7, were significantly correlated with the development of high neutralizing antibody titers on day 30.These results suggest that early transcriptional responses may be predictive of development of adaptive immunity to TDV

  9. Anthrax lethal toxin-mediated killing of human and murine dendritic cells impairs the adaptive immune response.

    Directory of Open Access Journals (Sweden)

    Abdelkrim Alileche

    2005-10-01

    Full Text Available Many pathogens have acquired strategies to combat the immune response. Bacillus anthracis interferes with host defenses by releasing anthrax lethal toxin (LT, which inactivates mitogen-activated protein kinase pathways, rendering dendritic cells (DCs and T lymphocytes nonresponsive to immune stimulation. However, these cell types are considered resistant to killing by LT. Here we show that LT kills primary human DCs in vitro, and murine DCs in vitro and in vivo. Kinetics of LT-mediated killing of murine DCs, as well as cell death pathways induced, were dependent upon genetic background: LT triggered rapid necrosis in BALB/c-derived DCs, and slow apoptosis in C57BL/6-derived DCs. This is consistent with rapid and slow killing of LT-injected BALB/c and C57BL/6 mice, respectively. We present evidence that anthrax LT impairs adaptive immunity by specifically targeting DCs. This may represent an immune-evasion strategy of the bacterium, and contribute to anthrax disease progression. We also established that genetic background determines whether apoptosis or necrosis is induced by LT. Finally, killing of C57BL/6-derived DCs by LT mirrors that of human DCs, suggesting that C57BL/6 DCs represent a better model system for human anthrax than the prototypical BALB/c macrophages.

  10. Type I Interferons Regulate Immune Responses in Humans with Blood-Stage Plasmodium falciparum Infection

    Science.gov (United States)

    Montes de Oca, Marcela; Kumar, Rajiv; de Labastida Rivera, Fabian; Amante, Fiona H.; Sheel, Meru; Faleiro, Rebecca J.; Bunn, Patrick T.; Best, Shannon E.; Beattie, Lynette; Ng, Susanna S.; Edwards, Chelsea L.; Boyle, Glen M.; Price, Ric N.; Anstey, Nicholas M.; Loughland, Jessica R.; Burel, Julie; Doolan, Denise L.; Haque, Ashraful; McCarthy, James S.; Engwerda, Christian R.

    2016-01-01

    Summary The development of immunoregulatory networks is important to prevent disease. However, these same networks allow pathogens to persist and reduce vaccine efficacy. Here, we identify type I interferons (IFNs) as important regulators in developing anti-parasitic immunity in healthy volunteers infected for the first time with Plasmodium falciparum. Type I IFNs suppressed innate immune cell function and parasitic-specific CD4+ T cell IFNγ production, and they promoted the development of parasitic-specific IL-10-producing Th1 (Tr1) cells. Type I IFN-dependent, parasite-specific IL-10 production was also observed in P. falciparum malaria patients in the field following chemoprophylaxis. Parasite-induced IL-10 suppressed inflammatory cytokine production, and IL-10 levels after drug treatment were positively associated with parasite burdens before anti-parasitic drug administration. These findings have important implications for understanding the development of host immune responses following blood-stage P. falciparum infection, and they identify type I IFNs and related signaling pathways as potential targets for therapies or vaccine efficacy improvement. PMID:27705789

  11. The human immune response to tuberculosis and its treatment: a view from the blood

    Science.gov (United States)

    Cliff, Jacqueline M; Kaufmann, Stefan H E; McShane, Helen; van Helden, Paul; O'Garra, Anne

    2015-01-01

    The immune response upon infection with the pathogen Mycobacterium tuberculosis is poorly understood, hampering the discovery of new treatments and the improvements in diagnosis. In the last years, a blood transcriptional signature in tuberculosis has provided knowledge on the immune response occurring during active tuberculosis disease. This signature was absent in the majority of asymptomatic individuals who are latently infected with M. tuberculosis (referred to as latent). Using modular and pathway analyses of the complex data has shown, now in multiple studies, that the signature of active tuberculosis is dominated by overexpression of interferon-inducible genes (consisting of both type I and type II interferon signaling), myeloid genes, and inflammatory genes. There is also downregulation of genes encoding B and T-cell function. The blood signature of tuberculosis correlates with the extent of radiographic disease and is diminished upon effective treatment suggesting the possibility of new improved strategies to support diagnostic assays and methods for drug treatment monitoring. The signature suggested a previously under-appreciated role for type I interferons in development of active tuberculosis disease, and numerous mechanisms have now been uncovered to explain how type I interferon impedes the protective response to M. tuberculosis infection. PMID:25703554

  12. Cell-mediated immune response

    DEFF Research Database (Denmark)

    Meyer, Sonja Izquierdo; Fuglsang, Katrine; Blaakaer, Jan

    2014-01-01

    OBJECTIVE: This clinical review aims to assess the efficacy of human papillomavirus 16/18 (HPV16/18) vaccination on the cell-mediated immune response in women with existing cervical intraepithelial neoplasia or cervical cancer induced by HPV16 or HPV18. DATA SOURCES AND STUDY SELECTION: A focused...... and thorough literature search conducted in five different databases found 996 publications. Six relevant articles were chosen for further review. In total, 154 patients (>18 years of age) were enrolled in prospective study trials with 3-15 months of follow up. The vaccine applications were administered two...... triggered a detectable cell-mediated immune response, some of which were statistically significant. Correlations between immunological response and clinical outcome (histopathology) were not significant, so neoplasms may not be susceptible to vaccine-generated cytotoxic T cells (CD8(+)). CONCLUSIONS...

  13. Human and Autologous Adipose-derived Stromal Cells Increase Flap Survival in Rats Independently of Host Immune Response

    DEFF Research Database (Denmark)

    Toyserkani, Navid Mohamadpour; Jensen, Charlotte Harken; Andersen, Ditte Caroline

    2017-01-01

    evaluated after 7 days. RESULTS: The mean survival rates for SVF treatment regardless of human or autologous origin were significantly increased as compared with the control group. Adipose stem/stromal cell and SVF lysate injection did not increase flap survival. Vessel density was increased for human...... and rat SVF and human ASC but not for SVF lysate. Human cells were not detected in the flaps after 7 days. CONCLUSIONS: Flap survival increased with SVF treatment regardless of human or autologous origin, suggesting that increased flap survival is independent of the host immune response. All cell...... injections lead to increased vessel density, but it did not necessarily lead to increased flap survival. Further research should elaborate which molecular events make SVF treatment more efficacious than ASC....

  14. Antimicrobial peptides in innate immune responses

    DEFF Research Database (Denmark)

    Sorensen, O.E.; Borregaard, N.; Cole, A.M.

    2008-01-01

    Antimicrobial peptides (AMPs) are ancient effector molecules in the innate immune response of eukaryotes. These peptides are important for the antimicrobial efficacy of phagocytes and for the innate immune response mounted by epithelia of humans and other mammals. AMPs are generated either by de ...

  15. Indirect detection of an epitope-specific response to HIV-1 gp120 immunization in human subjects.

    Directory of Open Access Journals (Sweden)

    Evgeny Shmelkov

    Full Text Available A specific response of human serum neutralizing antibodies (nAb to a conformational epitope as a result of vaccination of human subjects with the surface envelope glycoprotein (gp120 of HIV-1 has not previously been documented. Here, we used computational analysis to assess the epitope-specific responses of human subjects, which were immunized with recombinant gp120 immunogens in the VAX003 and VAX004 clinical trials. Our computational methodology--a variation of sieve analysis--compares the occurrence of specific nAb targeted conformational 3D epitopes on viruses from infected individuals who received vaccination to the occurrence of matched epitopes in the viruses infecting placebo subjects. We specifically studied seven crystallographically defined nAb targeted conformational epitopes in the V3 loop, an immunogenic region of gp120. Of the six epitopes present in the immunogens and targeted by known monoclonal neutralizing antibodies, only the one targeted by the anti-V3 nAb 2219 exhibited a significant reduction in occurrence in vaccinated subjects compared to the placebo group. This difference occurred only in the VAX003 Thailand cohort. No difference was seen between vaccinated and placebo groups for the occurrence of an epitope that was not present in the immunogen. Thus, it can be theorized that a specific 2219-like human neutralizing antibody immune response to AIDSVAX immunization occurred in the VAX003 cohort, and that this response protected subjects from a narrow subset of HIV-1 viruses circulating in Thailand in the 1990s and bearing the conformational epitope targeted by the neutralizing antibody 2219.

  16. B-cell depletion is protective against anti-AAV capsid immune response: a human subject case study

    Directory of Open Access Journals (Sweden)

    M Corti

    2014-01-01

    Full Text Available Gene therapy strategies for congenital myopathies may require repeat administration of adeno-associated viral (AAV vectors due to aspects of the clinical application, such as: (i administration of doses below therapeutic efficacy in patients enrolled in early phase clinical trials; (ii progressive reduction of the therapeutic gene expression over time as a result of increasing muscle mass in patients treated at a young age; and (iii a possibly faster depletion of pathogenic myofibers in this patient population. Immune response triggered by the first vector administration, and to subsequent doses, represents a major obstacle for successful gene transfer in young patients. Anti-capsid and anti-transgene product related humoral and cell-mediated responses have been previously observed in all preclinical models and human subjects who received gene therapy or enzyme replacement therapy (ERT for congenital myopathies. Immune responses may result in reduced efficacy of the gene transfer over time and/or may preclude for the possibility of re-administration of the same vector. In this study, we evaluated the immune response of a Pompe patient dosed with an AAV1-GAA vector after receiving Rituximab and Sirolimus to modulate reactions against ERT. A key finding of this single subject case report is the observation that B-cell ablation with rituximab prior to AAV vector exposure results in non-responsiveness to both capsid and transgene, therefore allowing the possibility of repeat administration in the future. This observation is significant for future gene therapy studies and establishes a clinically relevant approach to blocking immune responses to AAV vectors.

  17. Cloned, CD117 selected human amniotic fluid stem cells are capable of modulating the immune response.

    Directory of Open Access Journals (Sweden)

    Emily C Moorefield

    Full Text Available Amniotic fluid stem (AFS cells are broadly multipotent, can be expanded extensively in culture, are not tumorigenic and can be readily cryopreserved for cell banking. Mesenchymal stem cells (MSC show immunomodulatory activity and secrete a wide spectrum of cytokines and chemokines that suppress inflammatory responses, block mixed lymphocyte reactions (MLR and other immune reactions, and have proven therapeutic against conditions such as graft-versus-host disease. AFS cells resemble MSCs in many respects including surface marker expression and differentiation potential. We therefore hypothesized that AFS cells may exhibit similar immunomodulatory capabilities. We present data to demonstrate that direct contact with AFS cells inhibits lymphocyte activation. In addition, we show that cell-free supernatants derived from AFS cells primed with total blood monocytes or IL-1β, a cytokine released by monocytes and essential in mediation of the inflammatory response, also inhibited lymphocyte activation. Further investigation of AFS cell-free supernatants by protein array revealed secretion of multiple factors in common with MSCs that are known to be involved in immune regulation including growth related oncogene (GRO and monocyte chemotactic protein (MCP family members as well as interleukin-6 (IL-6. AFS cells activated by PBMCs released several additional cytokines as compared to BM-MSCs, including macrophage inflammatory protein-3α (MIP-3α, MIP-1α and Activin. AFS cells also released higher levels of MCP-1 and lower levels of MCP-2 compared to BM-MSCs in response to IL-1β activation. This suggests that there may be some AFS-specific mechanisms of inhibition of lymphocyte activation. Our results indicate that AFS cells are able to suppress inflammatory responses in vitro and that soluble factors are an essential component in the communication between lymphocytes and AFS cells. Their extensive self-renewal capacity, possibility for banking and

  18. SIGIRR inhibits toll-like receptor 4, 5, 9-mediated immune responses in human airway epithelial cells.

    Science.gov (United States)

    Zhang, Chun; Wu, Xueling; Zhao, Yunfeng; Deng, Zhaoxia; Qian, Guisheng

    2011-01-01

    Human airway epithelial cells (HAEC) may contribute to acute lung injury (ALI) and acute respiratory distress syndrome (ARDS) through toll-like receptors (TLRs)-mediated molecular mechanisms. TLRs exist on the surface of HAEC where binding to their cognate ligands initiates airway inflammation. Single immunoglobulin interleukin-1 receptor-related protein (SIGIRR) is a member of the toll-interleukin-1 receptor (TIR) family that can negatively modulate the immune response. We carried out studies to characterize SIGIRR modulation of TLR-mediated immune response in HAEC and to define its mechanisms of action. Following treatment with various concentrations of LPS, flagellin and CpG DNA, the levels of cognate TLRs 4, 5, and 9 were measured in the supernatants of HAEC over-expressing the SIGIRR molecule. Moreover, the interaction of the TLR adaptor myeloid differentiation factor 88 (MyD88) with SIGIRR in response to LPS-, flagellin- and CpG DNA-stimulation was examined by co-immunoprecipitation. The findings from this study revealed that overexpression of SIGIRR in HAEC stimulated by LPS, flagellin or CpG DNA resulted in attenuated production of the inflammatory mediators IL-6 and TNF-α. This attenuation was not the result of decreased expression of TLR4, 5 or 9, but rather a sequestration of MyD88 to the TLRs. In conclusion, SIGIRR can inhibit TLR4, 5, and 9-mediated immune responses in HAEC and may be a valuable therapeutic target for the prevention of ALI/ARDS.

  19. Integrative genomic analysis of the human immune response to influenza vaccination

    Science.gov (United States)

    Franco, Luis M; Bucasas, Kristine L; Wells, Janet M; Niño, Diane; Wang, Xueqing; Zapata, Gladys E; Arden, Nancy; Renwick, Alexander; Yu, Peng; Quarles, John M; Bray, Molly S; Couch, Robert B; Belmont, John W; Shaw, Chad A

    2013-01-01

    Identification of the host genetic factors that contribute to variation in vaccine responsiveness may uncover important mechanisms affecting vaccine efficacy. We carried out an integrative, longitudinal study combining genetic, transcriptional, and immunologic data in humans given seasonal influenza vaccine. We identified 20 genes exhibiting a transcriptional response to vaccination, significant genotype effects on gene expression, and correlation between the transcriptional and antibody responses. The results show that variation at the level of genes involved in membrane trafficking and antigen processing significantly influences the human response to influenza vaccination. More broadly, we demonstrate that an integrative study design is an efficient alternative to existing methods for the identification of genes involved in complex traits. DOI: http://dx.doi.org/10.7554/eLife.00299.001 PMID:23878721

  20. Human and Autologous Adipose-derived Stromal Cells Increase Flap Survival in Rats Independently of Host Immune Response.

    Science.gov (United States)

    Toyserkani, Navid Mohamadpour; Jensen, Charlotte Harken; Andersen, Ditte Caroline; Sheikh, Søren Paludan; Sørensen, Jens Ahm

    2017-07-22

    There is a rising interest in adipose-derived stromal cells for clinical use; however, it is unknown whether freshly isolated stromal cells (SVF) or culture-expanded cells (ASCs) are more efficacious. We therefore aimed to compare the 2 cellular therapies in an in vivo model of angiogenesis, the ischemic flap in rats, which induces acute ischemia. We also aimed to determine the importance of cell presence and the host immune response. A total of 96 rats (n = 12 in each group) were used, and in each rat, a caudally based random flap measuring 2 × 7 cm was made. The study was conducted in 3 phases. First, each rat was treated with human SVF cells, human ASCs, or vehicle. Second, each rat was treated with human SVF, human SVF lysate, or vehicle. Finally, each rat was treated with rat (autologous) SVF cells or vehicle. Flap survival, vessel density, and stromal cell retention were evaluated after 7 days. The mean survival rates for SVF treatment regardless of human or autologous origin were significantly increased as compared with the control group. Adipose stem/stromal cell and SVF lysate injection did not increase flap survival. Vessel density was increased for human and rat SVF and human ASC but not for SVF lysate. Human cells were not detected in the flaps after 7 days. Flap survival increased with SVF treatment regardless of human or autologous origin, suggesting that increased flap survival is independent of the host immune response. All cell injections lead to increased vessel density, but it did not necessarily lead to increased flap survival. Further research should elaborate which molecular events make SVF treatment more efficacious than ASC.

  1. A human type 5 adenovirus-based Trypanosoma cruzi therapeutic vaccine re-programs immune response and reverses chronic cardiomyopathy.

    Directory of Open Access Journals (Sweden)

    Isabela Resende Pereira

    2015-01-01

    Full Text Available Chagas disease (CD, caused by the protozoan Trypanosoma cruzi, is a prototypical neglected tropical disease. Specific immunity promotes acute phase survival. Nevertheless, one-third of CD patients develop chronic chagasic cardiomyopathy (CCC associated with parasite persistence and immunological unbalance. Currently, the therapeutic management of patients only mitigates CCC symptoms. Therefore, a vaccine arises as an alternative to stimulate protective immunity and thereby prevent, delay progression and even reverse CCC. We examined this hypothesis by vaccinating mice with replication-defective human Type 5 recombinant adenoviruses (rAd carrying sequences of amastigote surface protein-2 (rAdASP2 and trans-sialidase (rAdTS T. cruzi antigens. For prophylactic vaccination, naïve C57BL/6 mice were immunized with rAdASP2+rAdTS (rAdVax using a homologous prime/boost protocol before challenge with the Colombian strain. For therapeutic vaccination, rAdVax administration was initiated at 120 days post-infection (dpi, when mice were afflicted by CCC. Mice were analyzed for electrical abnormalities, immune response and cardiac parasitism and tissue damage. Prophylactic immunization with rAdVax induced antibodies and H-2Kb-restricted cytotoxic and interferon (IFNγ-producing CD8+ T-cells, reduced acute heart parasitism and electrical abnormalities in the chronic phase. Therapeutic vaccination increased survival and reduced electrical abnormalities after the prime (analysis at 160 dpi and the boost (analysis at 180 and 230 dpi. Post-therapy mice exhibited less heart injury and electrical abnormalities compared with pre-therapy mice. rAdVax therapeutic vaccination preserved specific IFNγ-mediated immunity but reduced the response to polyclonal stimuli (anti-CD3 plus anti-CD28, CD107a+ CD8+ T-cell frequency and plasma nitric oxide (NO levels. Moreover, therapeutic rAdVax reshaped immunity in the heart tissue as reduced the number of perforin+ cells

  2. Importance of Salmonella Typhi-Responsive CD8+ T Cell Immunity in a Human Typhoid Fever Challenge Model.

    Science.gov (United States)

    Fresnay, Stephanie; McArthur, Monica A; Magder, Laurence S; Darton, Thomas C; Jones, Claire; Waddington, Claire S; Blohmke, Christoph J; Angus, Brian; Levine, Myron M; Pollard, Andrew J; Sztein, Marcelo B

    2017-01-01

    Typhoid fever, caused by the human-restricted organism Salmonella enterica serovar Typhi (S. Typhi), constitutes a major global health problem. The development of improved attenuated vaccines is pressing, but delayed by the lack of appropriate preclinical models. Herein, we report that high levels of S. Typhi-responsive CD8+ T cells at baseline significantly correlate with an increased risk of disease in humans challenged with a high dose (~10(4) CFU) wild-type S. Typhi. Typhoid fever development was associated with higher multifunctional S. Typhi-responsive CD8+ T effector memory cells at baseline. Early decreases of these cells in circulation following challenge were observed in both S. Typhi-responsive integrin α4β7- and integrin α4β7+ CD8+ T effector memory (TEM) cells, suggesting their potential to home to both mucosal and extra-intestinal sites. Participants with higher baseline levels of S. Typhi-responsive CD8+ T memory cells had a higher risk of acquiring disease, but among those who acquired disease, those with a higher baseline responses took longer to develop disease. In contrast, protection against disease was associated with low or absent S. Typhi-responsive T cells at baseline and no changes in circulation following challenge. These data highlight the importance of pre-existing S. Typhi-responsive immunity in predicting clinical outcome following infection with wild-type S. Typhi and provide novel insights into the complex mechanisms involved in protective immunity to natural infection in a stringent human model with a high challenge dose. They also contribute important information on the immunological responses to be assessed in the appraisal and selection of new generation typhoid vaccines.

  3. Importance of Salmonella Typhi-Responsive CD8+ T Cell Immunity in a Human Typhoid Fever Challenge Model

    Science.gov (United States)

    Fresnay, Stephanie; McArthur, Monica A.; Magder, Laurence S.; Darton, Thomas C.; Jones, Claire; Waddington, Claire S.; Blohmke, Christoph J.; Angus, Brian; Levine, Myron M.; Pollard, Andrew J.; Sztein, Marcelo B.

    2017-01-01

    Typhoid fever, caused by the human-restricted organism Salmonella enterica serovar Typhi (S. Typhi), constitutes a major global health problem. The development of improved attenuated vaccines is pressing, but delayed by the lack of appropriate preclinical models. Herein, we report that high levels of S. Typhi-responsive CD8+ T cells at baseline significantly correlate with an increased risk of disease in humans challenged with a high dose (~104 CFU) wild-type S. Typhi. Typhoid fever development was associated with higher multifunctional S. Typhi-responsive CD8+ T effector memory cells at baseline. Early decreases of these cells in circulation following challenge were observed in both S. Typhi-responsive integrin α4β7− and integrin α4β7+ CD8+ T effector memory (TEM) cells, suggesting their potential to home to both mucosal and extra-intestinal sites. Participants with higher baseline levels of S. Typhi-responsive CD8+ T memory cells had a higher risk of acquiring disease, but among those who acquired disease, those with a higher baseline responses took longer to develop disease. In contrast, protection against disease was associated with low or absent S. Typhi-responsive T cells at baseline and no changes in circulation following challenge. These data highlight the importance of pre-existing S. Typhi-responsive immunity in predicting clinical outcome following infection with wild-type S. Typhi and provide novel insights into the complex mechanisms involved in protective immunity to natural infection in a stringent human model with a high challenge dose. They also contribute important information on the immunological responses to be assessed in the appraisal and selection of new generation typhoid vaccines. PMID:28303138

  4. Th1 and Th2 immune response to P30 and ROP18 peptides in human toxoplasmosis.

    Science.gov (United States)

    Torres-Morales, Elizabeth; Taborda, Laura; Cardona, Nestor; De-la-Torre, Alejandra; Sepulveda-Arias, Juan Carlos; Patarroyo, Manuel Alfonso; Gomez-Marin, Jorge Enrique

    2014-10-01

    We determined the specific lymphocyte proliferative response and cytokine profile production regarding Toxoplasma P30 (2017 from virulent and non-virulent strain) and ROP18 protein-derived peptides (from clonal lineages I, II and III) in 19 patients having ocular toxoplasmosis, five suffering chronic asymptomatic infection, nine with congenital toxoplasmosis and eight Toxoplasma negative people. A Beckman Coulter FC500 flow cytometer was used for determining antigen-specific T cells (CD3+ CD4+ or CD3+ CD8+ cells) in peripheral blood culture. IFN γ and IL10 levels were determined in culture supernatants. Specific CD4+ and CD8+ T cell response to total antigen and P30- and ROP18-derived peptides was observed in infected people. Ocular toxoplasmosis patients had a preferential Th2 response after antigenic stimulation. Non-virulent peptide 2017 was able to shift response toward Th1 in congenitally infected children and virulent peptide 2017 induced a Th2 response in chronically infected, asymptomatic people. An immune response in human toxoplasmosis after ex vivo antigenic stimulation was Th1- or Th2-skewed, depending on a patient's clinical condition. Colombian ocular toxoplasmosis patients' immune response was Th2-skewed, regardless of the nature of antigen stimulus.

  5. Innate Response to Human Cancer Cells with or without IL-2 Receptor Common γ-Chain Function in NOD Background Mice Lacking Adaptive Immunity

    National Research Council Canada - National Science Library

    Nishime, Chiyoko; Kawai, Kenji; Yamamoto, Takehiro; Katano, Ikumi; Monnai, Makoto; Goda, Nobuhito; Mizushima, Tomoko; Suemizu, Hiroshi; Nakamura, Masato; Murata, Mitsuru; Suematsu, Makoto; Wakui, Masatoshi

    2015-01-01

    .... To better understand innate response in the absence of adaptive immunity, we examined amounts of metastatic foci in the livers after intrasplenic transfer of human colon cancer HCT116 cells into NOD...

  6. Research on Preparation of Human Immune Cell in vitro with Response to Shrimp Allergen

    Directory of Open Access Journals (Sweden)

    W.B. Pan

    2015-01-01

    Full Text Available Shrimp is one of the most important food allergens. Tropomyosin is its major allergen. Wherein Pen a 1, contains five antibody binding regions, has been identified as the only major shrimp allergen. However, the study on IgE with response to shrimp allergen is still a serious lack, compared with the allergenic proteins. Particularly in the aspects of the preparation of IgE in vitro, it is restricted and can only obtain the complete IgE molecules by polyclonal or monoclonal technology. As for the preparation of small molecule IgE to the shrimp allergen has not yet been reported. This study attempts to carry out research on obtaining of cell materials that are used to clone. It sets up a convenient and efficient immune system in vitro which combines dendritic cell differentiation, allergens immune, mixed lymphocyte culture and so on. Finally the system successfully activates the proliferation of specific B cells and the secretion of a large number of specific IgE antibodies to shrimp allergen.

  7. The Bacterial Species Campylobacter jejuni Induce Diverse Innate Immune Responses in Human and Avian Intestinal Epithelial Cells

    Directory of Open Access Journals (Sweden)

    Daniel A. John

    2017-09-01

    Full Text Available Campylobacter remain the major cause of human gastroenteritis in the Developed World causing a significant burden to health services. Campylobacter are pathogens in humans and chickens, although differences in mechanistic understanding are incomplete, in part because phenotypic strain diversity creates inconsistent findings. Here, we took Campylobacter jejuni isolates (n = 100 from multi-locus sequence typed collections to assess their pathogenic diversity, through their inflammatory, cytotoxicity, adhesion, invasion and signaling responses in a high-throughput model using avian and human intestinal epithelial cells. C. jejuni induced IL-8 and CXCLi1/2 in human and avian epithelial cells, respectively, in a MAP kinase-dependent manner. In contrast, IL-10 responses in both cell types were PI 3-kinase/Akt-dependent. C. jejuni strains showed diverse levels of invasion with high invasion dependent on MAP kinase signaling in both cell lines. C. jejuni induced diverse cytotoxic responses in both cell lines with cdt-positive isolates showing significantly higher toxicity. Blockade of endocytic pathways suggested that invasion by C. jejuni was clathrin- and dynamin-dependent but caveolae- independent in both cells. In contrast, IL-8 (and CXCLi1/2 production was dependent on clathrin, dynamin, and caveolae. This study is important because of its scale, and the data produced, suggesting that avian and human epithelial cells use similar innate immune pathways where the magnitude of the response is determined by the phenotypic diversity of the Campylobacter species.

  8. IMMUNE RESPONSE AND COST ANALYSIS OF INTRADERMAL RABIES VACCINATION FOR POST-EXPOSURE PROPHYLAXIS REGIMEN IN HUMAN

    Directory of Open Access Journals (Sweden)

    N. S. Budayanti

    2014-01-01

    Full Text Available BackgroundThe outbreak of rabies in human in Bali-Indonesia is causing an extraordinary pressure for the government in providing adequate doses of anti-rabies vaccine for post-exposure prophylaxis (PEP. Here, we directly compare the immune response and benefit of the intradermal (ID protocol for rabies vaccine delivery with the intramuscular (IM route. Methods: Sixty health workers who were willing to participate in this study have been randomly selected and grouped into ID, IM, and control groups, each with 20 volunteers. The Thai Red Cross ID- and Zangreb IM-protocols have been applied to the respective group. The sera of the volunteers were collected at day 0, week 1, week 3, week 4, month 3, month 6, month 9, and month 12 after the first vaccination. Anti-rabies virus IgG was detected using PlateliaTM Rabies II Kit (Bio-Rad. Results: Anti-rabies IgG could be detected in the ID-group at one week. The ID-vaccine delivery induced a slightly higher maximum antibody titer compared to IM, though not statistically significant (p>0.05. ID vaccination caused less adverse reactions and produces longer lasting protective immune response.  Cost minimization analysis (CMA on the provincial and national PEP data in 2009-2011 shows that the ID-delivery will reduce the total cost for a completed regimen by USD 28.5, and would have saved the Indonesian government budget approximately USD 3.6 and 4.3 million for complete regimens in Bali and Indonesia, respectively. Conclusion: The ID administration of anti-rabies vaccine induces a similar immune response compared to that of intramuscular injection. It also produces longer lasting protective immune response. It offers additional advantages of potential net cost savings as well as decreasing the pressure on vaccine availability due to the high number of dog bite cases.

  9. Human CD4+CD25+ regulatory T cells are sensitive to low dose cyclophosphamide: implications for the immune response.

    Directory of Open Access Journals (Sweden)

    Daniel Heylmann

    Full Text Available Regulatory T cells (Treg play a pivotal role in the immune system since they inhibit the T cell response. It is well known that cyclophosphamide applied at low dose is able to stimulate the immune response while high dose cyclophosphamide exerts inhibitory activity. Data obtained in mice indicate that cyclophosphamide provokes a reduction in the number of Treg and impairs their suppressive activity, resulting in immune stimulation. Here, we addressed the question of the sensitivity of human Treg to cyclophosphamide, comparing Treg with cytotoxic T cells (CTL and T helper cells (Th. We show that Treg are more sensitive than CTL and Th to mafosfamide, which is an active derivative of cyclophosphamide, which does not need metabolic activation. The high sensitivity of Treg was due to the induction of apoptosis. Treg compared to CTL and Th were not more sensitive to the alkylating drugs temozolomide and nimustine and also not to mitomycin C, indicating a specific Treg response to mafosfamide. The high sensitivity of Treg to mafosfamide resulted not only in enhanced cell death, but also in impaired Treg function as demonstrated by a decline in the suppressor activity of Treg in a co-culture model with Th and Helios positive Treg. Treatment of Treg with mafosfamide gave rise to a high level of DNA crosslinks, which were not repaired to the same extent as observed in Th and CTL. Also, Treg showed a low level of γH2AX foci up to 6 h and a high level 24 h after treatment, indicating alterations in the DNA damage response. Overall, this is the first demonstration that human Treg are, in comparison with Th and CTL, hypersensitive to cyclophosphamide, which is presumably due to a DNA repair defect.

  10. In vivo monitoring of transfected DNA, gene expression kinetics, and cellular immune responses in mice immunized with a human NIS gene-expressing plasmid.

    Science.gov (United States)

    Son, Hye-Youn; Jeon, Yong-Hyun; Chung, June-Key; Kim, Chul-Woo

    2016-12-01

    In assessing the effectiveness of DNA vaccines, it is important to monitor: (1) the kinetics of target gene expression in vivo; and (2) the movement of cells that become transfected with the plasmid DNA used in the immunization of a subject. In this study, we used, as a visual imaging marker, expression of the transfected human sodium/iodide symporter (hNIS) gene, which enhances intracellular radio-pertechnetate (TcO4-) accumulation. After intradermal (i.d.) and systemic injection of mice with pcDNA-hNIS and radioactive Technetium-99m (Tc-99m), respectively, whole-body images were obtained by nuclear scintigraphy. The migration of mice cells transfected with the hNIS gene was monitored over a 2-week period by gamma-radioactivity counting of isolated cell populations and was demonstrated in peripheral lymphoid tissues, especially in the draining lymph nodes (dLNs). Beginning at 24 h after DNA inoculation and continuing for the 2-week monitoring period, hNIS-expressing cells were observed specifically in the T-cell-rich zones of the paracortical area of the dLNs. Over the same time period, high levels of INF-γ-secreting CD8 T-cells were found in the dLNs of the pcDNA-hNIS immunized mice. Tumor growth was also significantly retarded in the mice that received hNIS DNA immunization followed by inoculation with CT26 colorectal adenocarcinoma cells that had been transfected with the rat NIS gene (rNIS), which is 93% homologous to the hNIS gene. In conclusion, mouse cells transfected with hNIS DNA after i.d. immunization were found to traffic to the dLNs, and hNIS gene expression in these cells continued for at least 2 weeks post immunization. Furthermore, sequential presentation of NIS DNA to T-cells by migratory antigen presenting cells could induce NIS DNA-specific Th1 immune responses and thus retard the growth of NIS-expressing tumors.

  11. Association of human TLR1 and TLR6 deficiency with altered immune responses to BCG vaccination in South African infants.

    Directory of Open Access Journals (Sweden)

    April Kaur Randhawa

    2011-08-01

    development of adaptive immune responses after in vivo vaccination against a bacterial pathogen in humans. These findings could potentially guide novel adjuvant vaccine strategies as well as have implications for IFN-γ-based diagnostic testing for TB.

  12. Protective host immune responses to Salmonella infection.

    Science.gov (United States)

    Pham, Oanh H; McSorley, Stephen J

    2015-01-01

    Salmonella enterica serovars Typhi and Paratyphi are the causative agents of human typhoid fever. Current typhoid vaccines are ineffective and are not widely used in endemic areas. Greater understanding of host-pathogen interactions during Salmonella infection should facilitate the development of improved vaccines to combat typhoid and nontyphoidal Salmonellosis. This review will focus on our current understanding of Salmonella pathogenesis and the major host immune components that participate in immunity to Salmonella infection. In addition, recent findings regarding host immune mechanisms in response to Salmonella infection will be also discussed, providing a new perspective on the utility of improved tools to study the immune response to Salmonella infections.

  13. Activation of the innate immune response against DENV in normal non-transformed human fibroblasts.

    Directory of Open Access Journals (Sweden)

    José Bustos-Arriaga

    2011-12-01

    Full Text Available BACKGROUND: When mosquitoes infected with DENV are feeding, the proboscis must traverse the epidermis several times ("probing" before reaching a blood vessel in the dermis. During this process, the salivary glands release the virus, which is likely to interact first with cells of the various epidermal and dermal layers, cells which could be physiologically relevant to DENV infection and replication in humans. However, important questions are whether more abundant non-hematopoietic cells such as fibroblasts become infected, and whether they play any role in antiviral innate immunity in the very early stages of infection, or even if they might be used by DENV as primary replication cells. METHODOLOGY/PRINCIPAL FINDINGS: Fibroblasts freshly released from healthy skin and infected 12 hours after their isolation show a positive signal for DENV. In addition, when primary skin fibroblast cultures were established and subsequently infected, we showed DENV-2 antigen-positive intracellular signal at 24 hours and 48 hours post-infection. Moreover, the fibroblasts showed productive infection in a conventional plaque assay. The skin fibroblasts infected with DENV-2 underwent potent signaling through both TLR3 and RIG- 1, but not Mda5, triggering up-regulation of IFNβ, TNFα, defensin 5 (HB5 and β defensin 2 (HβD2. In addition, DENV infected fibroblasts showed increased nuclear translocation of interferon (IFN regulatory factor 3 (IRF3, but not interferon regulatory factor 7 (IRF7, when compared with mock-infected fibroblasts. CONCLUSIONS/SIGNIFICANCE: In this work, we demonstrated the high susceptibility to DENV infection by primary fibroblasts from normal human skin, both in situ and in vitro. Our results suggest that these cells may contribute to the pro-inflammatory and anti-viral microenvironment in the early stages of interaction with DENV-2. Furthermore, the data suggest that fibroblast may also be used as a primary site of DENV replication and

  14. Insight into bacterial virulence mechanisms against host immune response via the Yersinia pestis-human protein-protein interaction network.

    Science.gov (United States)

    Yang, Huiying; Ke, Yuehua; Wang, Jian; Tan, Yafang; Myeni, Sebenzile K; Li, Dong; Shi, Qinghai; Yan, Yanfeng; Chen, Hui; Guo, Zhaobiao; Yuan, Yanzhi; Yang, Xiaoming; Yang, Ruifu; Du, Zongmin

    2011-11-01

    A Yersinia pestis-human protein interaction network is reported here to improve our understanding of its pathogenesis. Up to 204 interactions between 66 Y. pestis bait proteins and 109 human proteins were identified by yeast two-hybrid assay and then combined with 23 previously published interactions to construct a protein-protein interaction network. Topological analysis of the interaction network revealed that human proteins targeted by Y. pestis were significantly enriched in the proteins that are central in the human protein-protein interaction network. Analysis of this network showed that signaling pathways important for host immune responses were preferentially targeted by Y. pestis, including the pathways involved in focal adhesion, regulation of cytoskeleton, leukocyte transendoepithelial migration, and Toll-like receptor (TLR) and mitogen-activated protein kinase (MAPK) signaling. Cellular pathways targeted by Y. pestis are highly relevant to its pathogenesis. Interactions with host proteins involved in focal adhesion and cytoskeketon regulation pathways could account for resistance of Y. pestis to phagocytosis. Interference with TLR and MAPK signaling pathways by Y. pestis reflects common characteristics of pathogen-host interaction that bacterial pathogens have evolved to evade host innate immune response by interacting with proteins in those signaling pathways. Interestingly, a large portion of human proteins interacting with Y. pestis (16/109) also interacted with viral proteins (Epstein-Barr virus [EBV] and hepatitis C virus [HCV]), suggesting that viral and bacterial pathogens attack common cellular functions to facilitate infections. In addition, we identified vasodilator-stimulated phosphoprotein (VASP) as a novel interaction partner of YpkA and showed that YpkA could inhibit in vitro actin assembly mediated by VASP.

  15. Transgenic expression of soluble human CD5 enhances experimentally-induced autoimmune and anti-tumoral immune responses.

    Directory of Open Access Journals (Sweden)

    Rafael Fenutría

    Full Text Available CD5 is a lymphoid-specific transmembrane glycoprotein constitutively expressed on thymocytes and mature T and B1a lymphocytes. Current data support the view that CD5 is a negative regulator of antigen-specific receptor-mediated signaling in these cells, and that this would likely be achieved through interaction with CD5 ligand/s (CD5L of still undefined nature expressed on immune or accessory cells. To determine the functional consequence of loss of CD5/CD5L interaction in vivo, a new transgenic mouse line was generated (shCD5EμTg, expressing a circulating soluble form of human CD5 (shCD5 as a decoy to impair membrane-bound CD5 function. These shCD5EμTg mice showed an enhanced response to autologous antigens, as deduced from the presentation of more severe forms of experimentally inducible autoimmune disease (collagen-induced arthritis, CIA; and experimental autoimmune encephalitis, EAE, as well as an increased anti-tumoral response in non-orthotopic cancer models (B16 melanoma. This enhancement of the immune response was in agreement with the finding of significantly reduced proportions of spleen and lymph node Treg cells (CD4+CD25+FoxP3+, and of peritoneal IL-10-producing and CD5+ B cells, as well as an increased proportion of spleen NKT cells in shCD5EμTg mice. Similar changes in lymphocyte subpopulations were observed in wild-type mice following repeated administration of exogenous recombinant shCD5 protein. These data reveal the relevant role played by CD5/CD5L interactions on the homeostasis of some functionally relevant lymphocyte subpopulations and the modulation of immune responses to autologous antigens.

  16. Differential Impact of LPG-and PG-Deficient Leishmania major Mutants on the Immune Response of Human Dendritic Cells.

    Directory of Open Access Journals (Sweden)

    Michelle A Favila

    2015-12-01

    Full Text Available Leishmania major infection induces robust interleukin-12 (IL12 production in human dendritic cells (hDC, ultimately resulting in Th1-mediated immunity and clinical resolution. The surface of Leishmania parasites is covered in a dense glycocalyx consisting of primarily lipophosphoglycan (LPG and other phosphoglycan-containing molecules (PGs, making these glycoconjugates the likely pathogen-associated molecular patterns (PAMPS responsible for IL12 induction.Here we explored the role of parasite glycoconjugates on the hDC IL12 response by generating L. major Friedlin V1 mutants defective in LPG alone, (FV1 lpg1-, or generally deficient for all PGs, (FV1 lpg2-. Infection with metacyclic, infective stage, L. major or purified LPG induced high levels of IL12B subunit gene transcripts in hDCs, which was abrogated with FV1 lpg1- infections. In contrast, hDC infections with FV1 lpg2- displayed increased IL12B expression, suggesting other PG-related/LPG2 dependent molecules may act to dampen the immune response. Global transcriptional profiling comparing WT, FV1 lpg1-, FV1 lpg2- infections revealed that FV1 lpg1- mutants entered hDCs in a silent fashion as indicated by repression of gene expression. Transcription factor binding site analysis suggests that LPG recognition by hDCs induces IL-12 in a signaling cascade resulting in Nuclear Factor κ B (NFκB and Interferon Regulatory Factor (IRF mediated transcription.These data suggest that L. major LPG is a major PAMP recognized by hDC to induce IL12-mediated protective immunity and that there is a complex interplay between PG-baring Leishmania surface glycoconjugates that result in modulation of host cellular IL12.

  17. Leptin induces the phagocytosis and protective immune response in Leishmania donovani infected THP-1 cell line and human PBMCs.

    Science.gov (United States)

    Dayakar, Alti; Chandrasekaran, Sambamurthy; Veronica, Jalaja; Maurya, Radheshyam

    2016-01-01

    Visceral leishmaniasis (VL) is an infectious disease responsible for several deaths in malnourished children due to impaired cell-mediated immunity, which is accompanied by low circulating leptin levels. The cytokine function of leptin is implicated for several immune regulation activities such as hematopoiesis, angiogenesis, innate and adaptive immunity. Its deficiency associated with polarization of Th2 response, which coincides with VL pathogenesis. To determine the cytokine role of leptin in case of experimental VL, we tested the leptin associated Th1/Th2 type cytokine profile at mRNA level from Leishmania donovani infected human monocytic leukemia cell line (THP-1) and peripheral blood mononuclear cells (PBMCs). We also tested the effect of leptin on macrophages activation (viz. studying the phosphorylation of signaling moieties), phagocytic activity and intracellular reactive oxygen species (ROS) production during infection. We observed that leptin induced Th1 specific response by upregulation of IL-1α, IL-1β, IL-8 and TNF-α in THP-1 and IFN-γ, IL-12 and IL-2 in PBMCs. We also observed the downregulation of Th2 type cytokine i.e. IL-10 in THP-1 and unaltered expression of cytokines i.e. TGF-β, IL-10 and IL-4 in PBMCs. In addition, leptin stimulates the macrophages by inducing phosphorylation of Erk1/2 and Akt which are usually dephosphorylated in L. donovani infection. In concordance, leptin also induces the macrophage phagocytic activity by enhancing the intracellular ROS generation which helps in phagolysosome formation and oxidative killing of the parasite. In compilation, leptin is able to maintain the defensive environment against L. donovani infection through the classical macrophage activity.

  18. Human papillomavirus targets crossroads in immune signaling

    NARCIS (Netherlands)

    Tummers, Bart

    2016-01-01

    Persistent infections with high-risk type human papillomaviruses (hrHPVs) can progress to cancer. HrHPVs infect keratinocytes (KCs) and successfully suppress host immunity for up to two years despite the fact that KCs are well equipped to detect and initiate immune responses to invading pathogens.

  19. Mycobacterium leprae antigens involved in human immune responses. I. Identification of four antigens by monoclonal antibodies

    Energy Technology Data Exchange (ETDEWEB)

    Britton, W.J.; Hellqvist, L.; Basten, A.; Raison, R.L.

    1985-12-01

    Four distinct antigens were identified in soluble sonicates of Mycobacterium leprae by using a panel of 11 monoclonal antibodies. Cross-reactivity studies with other mycobacterial species were conducted by using ELISA and immunoblot assays, and demonstrated that determinants on two of the antigens were present in many mycobacteria, whereas the other two were limited in distribution. Competitive inhibition experiments with radiolabeled monoclonal antibodies showed cross-inhibition between antibodies identifying two of the four antigenicbands. These two bands, of M/sub tau/ 4.5 to 6 KD and 30 to 40 KD, were resistant to protease treatment after immunoblotting. In contrast the two other bands of 16 and 70 KD were protease-sensitive. Although all four bands reacted with some human lepromatous leprosy sera in immunoblots, the 4.5 to 6 KD and 30 to 40 KD bands were most prominent. Lepromatous leprosy sera also inhibited the binding of radiolabeled monoclonal antibodies to each of the four antigens, with the mean titer causing 50% inhibition being higher for antibodies reacting with the 4.5 to 6 KD and 30 to 40 KD bands. These findings indicated that all four antigens were involved in the human B cell response to M. leprae.

  20. Th9/IL-9 profile in human echinococcosis: their involvement in immune response during infection by Echinococcus granulosus.

    Science.gov (United States)

    Pang, Nannan; Zhang, Fengbo; Ma, Xiumin; Zhang, Zhaoxia; Zhao, Hui; Xin, Yan; Wang, Song; Zhu, Yuejie; Wen, Hao; Ding, Jianbing

    2014-01-01

    Th9 cells have been reported to contribute to immune responses; however, the role of Th9 cells in Echinococcus granulosus infection is unknown. This study is to determine whether Th9 cells and IL-9 are involved in human Echinococcus granulosus infection. Compared with healthy controls (HC group), the mRNA levels of PU.1, IL-9, and GATA-3 were significantly increased in patients before therapy (CE group), as revealed by qRT-PCR. Flow cytometry analysis showed that the percentages of Th9 and Th2 cells in CE group were significantly higher. The levels of IL-9, IL-4, IL-10, and TGF- β in CE group were also significantly increased, as detected by CBA assay. The percentages of Th9 and Th2 cells in CE group were positively correlated. After treatments of surgery in combination with albendazole, the PU.1 and GATA-3 mRNA levels were significantly decreased in patients after therapy (PCE group) compared with CE group. The numbers of Th9 and Th2 cells and levels of IL-9, IL-4, IL-10, and TGF- β were also significantly decreased in PCE group. In conclusion, the ratios of Th9 cells and IL-9 levels were significantly decreased after treatment, suggesting that Th9/IL-9 may be involved in immune response induced by Echinococcus granulosus infection.

  1. Th9/IL-9 Profile in Human Echinococcosis: Their Involvement in Immune Response during Infection by Echinococcus granulosus

    Directory of Open Access Journals (Sweden)

    Nannan Pang

    2014-01-01

    Full Text Available Th9 cells have been reported to contribute to immune responses; however, the role of Th9 cells in Echinococcus granulosus infection is unknown. This study is to determine whether Th9 cells and IL-9 are involved in human Echinococcus granulosus infection. Compared with healthy controls (HC group, the mRNA levels of PU.1, IL-9, and GATA-3 were significantly increased in patients before therapy (CE group, as revealed by qRT-PCR. Flow cytometry analysis showed that the percentages of Th9 and Th2 cells in CE group were significantly higher. The levels of IL-9, IL-4, IL-10, and TGF-β in CE group were also significantly increased, as detected by CBA assay. The percentages of Th9 and Th2 cells in CE group were positively correlated. After treatments of surgery in combination with albendazole, the PU.1 and GATA-3 mRNA levels were significantly decreased in patients after therapy (PCE group compared with CE group. The numbers of Th9 and Th2 cells and levels of IL-9, IL-4, IL-10, and TGF-β were also significantly decreased in PCE group. In conclusion, the ratios of Th9 cells and IL-9 levels were significantly decreased after treatment, suggesting that Th9/IL-9 may be involved in immune response induced by Echinococcus granulosus infection.

  2. Activated human T cells secrete exosomes that participate in IL-2 mediated immune response signaling.

    Directory of Open Access Journals (Sweden)

    Jessica Wahlgren

    Full Text Available It has previously been shown that nano-meter sized vesicles (30-100 nm, exosomes, secreted by antigen presenting cells can induce T cell responses thus showing the potential of exosomes to be used as immunological tools. Additionally, activated CD3⁺ T cells can secrete exosomes that have the ability to modulate different immunological responses. Here, we investigated what effects exosomes originating from activated CD3⁺ T cells have on resting CD3⁺ T cells by studying T cell proliferation, cytokine production and by performing T cell and exosome phenotype characterization. Human exosomes were generated in vitro following CD3⁺ T cell stimulation with anti-CD28, anti-CD3 and IL-2. Our results show that exosomes purified from stimulated CD3⁺ T cells together with IL-2 were able to generate proliferation in autologous resting CD3⁺ T cells. The CD3⁺ T cells stimulated with exosomes together with IL-2 had a higher proportion of CD8⁺ T cells and had a different cytokine profile compared to controls. These results indicate that activated CD3⁺ T cells communicate with resting autologous T cells via exosomes.

  3. Humoral immune response against proteins E6 and E7 in cervical carcinoma patients positive for human papilloma virus type 16 during treatment and follow-up

    NARCIS (Netherlands)

    Baay, MFD; Duk, JM; Burger, MPM; de Bruijn, HWA; Stolz, E; Herbrink, P

    1999-01-01

    To investigate the humoral immune response to transforming proteins E6 and E7 of human papillomavirus type 16 before and after treatment and during follow-up, consecutive serum samples from 36 cervical cancer patients whose tumours were found to contain human papillomavirus type 16 DNA by use of the

  4. Study on the immune responses against pancreatic cancer induced by mucin 4 and human telomerase reverse transcriptase mRNA co-transfected dendritic cells in vitro

    Institute of Scientific and Technical Information of China (English)

    陈江

    2014-01-01

    Objective To investigate the anti-tumor immune response induced by human pancreatic cancer mucin 4mRNA and human telomerase reverse transcriptase(hTERT)mRNA cotransfected dendritic cells(DC),and to provide the experimental evidences for the treatment of pancreatic cancer with multi-epitope loaded DC vaccine.Methods DC were isolated from peripheral DC.

  5. Live Attenuated Influenza Vaccine Strains Elicit a Greater Innate Immune Response than Antigenically-Matched Seasonal Influenza Viruses during Infection of Human Nasal Epithelial Cell Cultures

    Science.gov (United States)

    Fischer, William A.; Brighton, Missy; Jaspers, Ilona

    2014-01-01

    Influenza viruses are global pathogens that infect approximately 10–20% of the world’s population each year. Vaccines, including the live attenuated influenza vaccine (LAIV), are the best defense against influenza infections. The LAIV is a novel vaccine that actively replicates in the human nasal epithelium and elicits both mucosal and systemic protective immune responses. The differences in replication and innate immune responses following infection of human nasal epithelium with influenza seasonal wild type (WT) and LAIV viruses remain unknown. Using a model of primary differentiated human nasal epithelial cell (hNECs) cultures, we compared influenza WT and antigenically-matched cold adapted (CA) LAIV virus replication and the subsequent innate immune response including host cellular pattern recognition protein expression, host innate immune gene expression, secreted pro-inflammatory cytokine production, and intracellular viral RNA levels. Growth curves comparing virus replication between WT and LAIV strains revealed significantly less infectious virus production during LAIV compared with WT infection. Despite this disparity in infectious virus production the LAIV strains elicited a more robust innate immune response with increased expression of RIG-I, TLR-3, IFNβ, STAT-1, IRF-7, MxA, and IP-10. There were no differences in cytotoxicity between hNEC cultures infected with WT and LAIV strains as measured by basolateral levels of LDH. Elevated levels of intracellular viral RNA during LAIV as compared with WT virus infection of hNEC cultures at 33°C may explain the augmented innate immune response via the up-regulation of pattern recognition receptors and down-stream type I IFN expression. Taken together our results suggest that the decreased replication of LAIV strains in human nasal epithelial cells is associated with a robust innate immune response that differs from infection with seasonal influenza viruses, limits LAIV shedding and plays a role in the

  6. Live attenuated influenza vaccine strains elicit a greater innate immune response than antigenically-matched seasonal influenza viruses during infection of human nasal epithelial cell cultures.

    Science.gov (United States)

    Fischer, William A; Chason, Kelly D; Brighton, Missy; Jaspers, Ilona

    2014-03-26

    Influenza viruses are global pathogens that infect approximately 10-20% of the world's population each year. Vaccines, including the live attenuated influenza vaccine (LAIV), are the best defense against influenza infections. The LAIV is a novel vaccine that actively replicates in the human nasal epithelium and elicits both mucosal and systemic protective immune responses. The differences in replication and innate immune responses following infection of human nasal epithelium with influenza seasonal wild type (WT) and LAIV viruses remain unknown. Using a model of primary differentiated human nasal epithelial cell (hNECs) cultures, we compared influenza WT and antigenically-matched cold adapted (CA) LAIV virus replication and the subsequent innate immune response including host cellular pattern recognition protein expression, host innate immune gene expression, secreted pro-inflammatory cytokine production, and intracellular viral RNA levels. Growth curves comparing virus replication between WT and LAIV strains revealed significantly less infectious virus production during LAIV compared with WT infection. Despite this disparity in infectious virus production the LAIV strains elicited a more robust innate immune response with increased expression of RIG-I, TLR-3, IFNβ, STAT-1, IRF-7, MxA, and IP-10. There were no differences in cytotoxicity between hNEC cultures infected with WT and LAIV strains as measured by basolateral levels of LDH. Elevated levels of intracellular viral RNA during LAIV as compared with WT virus infection of hNEC cultures at 33°C may explain the augmented innate immune response via the up-regulation of pattern recognition receptors and down-stream type I IFN expression. Taken together our results suggest that the decreased replication of LAIV strains in human nasal epithelial cells is associated with a robust innate immune response that differs from infection with seasonal influenza viruses, limits LAIV shedding and plays a role in the silent

  7. Thirty Minutes of Hypobaric Hypoxia Provokes Alterations of Immune Response, Haemostasis, and Metabolism Proteins in Human Serum

    Directory of Open Access Journals (Sweden)

    Jochen Hinkelbein

    2017-08-01

    Full Text Available Hypobaric hypoxia (HH during airline travel induces several (patho- physiological reactions in the human body. Whereas severe hypoxia is investigated thoroughly, very little is known about effects of moderate or short-term hypoxia, e.g. during airline flights. The aim of the present study was to analyse changes in serum protein expression and activation of signalling cascades in human volunteers staying for 30 min in a simulated altitude equivalent to airline travel. After approval of the local ethics committee, 10 participants were exposed to moderate hypoxia (simulation of 2400 m or 8000 ft for 30 min in a hypobaric pressure chamber. Before and after hypobaric hypoxia, serum was drawn, centrifuged, and analysed by two-dimensional gel electrophoresis (2-DIGE and matrix-assisted laser desorption/ionization followed by time-of-flight mass spectrometry (MALDI-TOF. Biological functions of regulated proteins were identified using functional network analysis (GeneMania®, STRING®, and Perseus® software. In participants, oxygen saturation decreased from 98.1 ± 1.3% to 89.2 ± 1.8% during HH. Expression of 14 spots (i.e., 10 proteins: ALB, PGK1, APOE, GAPDH, C1QA, C1QB, CAT, CA1, F2, and CLU was significantly altered. Bioinformatic analysis revealed an association of the altered proteins with the signalling cascades “regulation of haemostasis” (four proteins, “metabolism” (five proteins, and “leukocyte mediated immune response” (five proteins. Even though hypobaric hypoxia was short and moderate (comparable to an airliner flight, analysis of protein expression in human subjects revealed an association to immune response, protein metabolism, and haemostasis

  8. Innate immune induction and influenza protection elicited by a response-selective agonist of human C5a.

    Directory of Open Access Journals (Sweden)

    Sam D Sanderson

    Full Text Available The anaphylatoxin C5a is an especially potent mediator of both local and systemic inflammation. However, C5a also plays an essential role in mucosal host defense against bacterial, viral, and fungal infection. We have developed a response-selective agonist of human C5a, termed EP67, which retains the immunoenhancing activity of C5a at the expense of its inflammatory, anaphylagenic properties. EP67 insufflation results in the rapid induction of pulmonary cytokines and chemokines. This is followed by an influx of innate immune effector cells, including neutrophils, NK cells, and dendritic cells. EP67 exhibits both prophylactic and therapeutic protection when tested in a murine model of influenza A infection. Mice treated with EP67 within a twenty-four hour window of non-lethal infection were significantly protected from influenza-induced weight loss. Furthermore, EP67 delivered twenty-four hours after lethal infection completely blocked influenza-induced mortality (0% vs. 100% survival. Since protection based on innate immune induction is not restricted to any specific pathogen, EP67 may well prove equally efficacious against a wide variety of possible viral, bacterial, and fungal pathogens. Such a strategy could be used to stop the worldwide spread of emergent respiratory diseases, including but not limited to novel strains of influenza.

  9. The Association of the Immune Response Genes to Human Papillomavirus-Related Cervical Disease in a Brazilian Population

    Directory of Open Access Journals (Sweden)

    Amanda Vansan Marangon

    2013-01-01

    Full Text Available The genetic variability of the host contributes to the risk of human papillomavirus (HPV-related cervical disease. Immune response genes to HPV must be investigated to define patients with the highest risk of developing malignant disease. The aim of this study was to investigate the association of polymorphic immune response genes, namely KIR, HLA class I and II, and single-nucleotide polymorphisms (SNPs of cytokines with HPV-related cervical disease. We selected 79 non-related, admixed Brazilian women from the state of Paraná, southern region of Brazil, who were infected with high carcinogenic risk HPV and present cervical intraepithelial neoplasia grade 3 (CIN3, and 150 HPV-negative women from the same region matched for ethnicity. KIR genes were genotyped using an in-house PCR-SSP. HLA alleles were typed using a reverse sequence-specific oligonucleotide technique. SNPs of TNF −308G>A, IL6 −174G>C, IFNG +874T>A, TGFB1 +869T>C +915G>C, and IL10 −592C>A −819C>T −1082G>A were evaluated using PCR-SSP. The KIR genes were not associated with HPV, although some pairs of i(inhibitoryKIR-ligands occurred more frequently in patients, supporting a role for NK in detrimental chronic inflammatory and carcinogenesis. Some HLA haplotypes were associated with HPV. The associations of INFG and IL10 SNPs potentially reflect impaired or invalid responses in advanced lesions.

  10. Human respiratory syncytial virus nucleoprotein and inclusion bodies antagonize the innate immune response mediated by MDA5 and MAVS.

    Science.gov (United States)

    Lifland, Aaron W; Jung, Jeenah; Alonas, Eric; Zurla, Chiara; Crowe, James E; Santangelo, Philip J

    2012-08-01

    Currently, the spatial distribution of human respiratory syncytial virus (hRSV) proteins and RNAs in infected cells is still under investigation, with many unanswered questions regarding the interaction of virus-induced structures and the innate immune system. Very few studies of hRSV have used subcellular imaging as a means to explore the changes in localization of retinoic-acid-inducible gene-I (RIG-I)-like receptors or the mitochondrial antiviral signaling (MAVS) protein, in response to the infection and formation of viral structures. In this investigation, we found that both RIG-I and melanoma differentiation-associated gene 5 (MDA5) colocalized with viral genomic RNA and the nucleoprotein (N) as early as 6 h postinfection (hpi). By 12 hpi, MDA5 and MAVS were observed within large viral inclusion bodies (IB). We used a proximity ligation assay (PLA) and determined that the N protein was in close proximity to MDA5 and MAVS in IBs throughout the course of the infection. Similar results were found with the transient coexpression of N and the phosphoprotein (P). Additionally, we demonstrated that the localization of MDA5 and MAVS in IBs inhibited the expression of interferon β mRNA 27-fold following Newcastle disease virus infection. From these data, we concluded that the N likely interacts with MDA5, is in close proximity to MAVS, and localizes these molecules within IBs in order to attenuate the interferon response. To our knowledge, this is the first report of a specific function for hRSV IBs and of the hRSV N protein as a modulator of the innate immune response.

  11. Immune response signatures of benzo{alpha}pyrene exposure in normal human mammary epithelial cells in the absence or presence of chlorophyllin.

    Science.gov (United States)

    John, Kaarthik; Keshava, Channa; Richardson, Diana L; Weston, Ainsley; Nath, Joginder

    2009-01-01

    Carcinogenic polycylic aromatic hydrocarbons can alter immune responses. Changes in immune response gene expression profiles in multiple human mammary cell strains exposed to benzo(alpha)pyrene (BP) (4 microM) in vitro, in the presence or absence of chlorophyllin (5 microM), were observed using Affymetrix gene arrays. Expressions of five immune response genes were altered ~3.0-fold by BP exposure and 24 genes by BP in the presence chlorophyllin. In silico pathway analysis revealed altered immune response genes form interactive gene networks with many cellular processes, suggesting their role in a complex multigenic response to toxins. Additionally, it was suggestive of the possible immunomodulatory potential of chlorophyllin apart from various other well-documented mechanisms of action. Gene expression matrices revealed consistent alteration patterns involving IL1B, SECTM1 and CXCL14 on exposure to BP, and IL1RN, CD86, IF144 and GIP2 in the presence of chlorophyllin and BP, suggesting some of these genes might constitute putative immune response biomarkers of PAH exposure. This study has therefore identified a battery of potential immune response biomarkers of PAH exposure, amidst several genes, for future validation studies.

  12. Human Lung Immunity against Mycobacterium tuberculosis

    Science.gov (United States)

    Schwander, Stephan; Dheda, Keertan

    2011-01-01

    The study of human pulmonary immunity against Mycobacterium tuberculosis (M.tb) provides a unique window into the biological interactions between the human host and M.tb within the broncho-alveolar microenvironment, the site of natural infection. Studies of bronchoalveolar cells (BACs) and lung tissue evaluate innate, adaptive, and regulatory immune mechanisms that collectively contribute to immunological protection or its failure. In aerogenically M.tb–exposed healthy persons lung immune responses reflect early host pathogen interactions that may contribute to sterilization, the development of latent M.tb infection, or progression to active disease. Studies in these persons may allow the identification of biomarkers of protective immunity before the initiation of inflammatory and disease-associated immunopathological changes. In healthy close contacts of patients with tuberculosis (TB) and during active pulmonary TB, immune responses are compartmentalized to the lungs and characterized by an exuberant helper T-cell type 1 response, which as suggested by recent evidence is counteracted by local suppressive immune mechanisms. Here we discuss how exploring human lung immunity may provide insights into disease progression and mechanisms of failure of immunological protection at the site of the initial host–pathogen interaction. These findings may also aid in the identification of new biomarkers of protective immunity that are urgently needed for the development of new and the improvement of current TB vaccines, adjuvant immunotherapies, and diagnostic technologies. To facilitate further work in this area, methodological and procedural approaches for bronchoalveolar lavage studies and their limitations are also discussed. PMID:21075901

  13. Leptin Regulation of Immune Responses.

    Science.gov (United States)

    Naylor, Caitlin; Petri, William A

    2016-02-01

    Leptin is a regulatory hormone with multiple roles in the immune system. We favor the concept that leptin signaling 'licenses' various immune cells to engage in immune responses and/or to differentiate. Leptin is an inflammatory molecule that is capable of activating both adaptive and innate immunity. It can also 'enhance' immune functions, including inflammatory cytokine production in macrophages, granulocyte chemotaxis, and increased Th17 proliferation. Leptin can also 'inhibit' cells; CD4(+) T cells are inhibited from differentiating into regulatory T cells in the presence of elevated leptin, while NK cells can exhibit impaired cytotoxicity under the same circumstances. Consequently, understanding the effect of leptin signaling is important to appreciate various aspects of immune dysregulation observed in malnutrition, obesity, and autoimmunity.

  14. Outer membrane vesicles from Brucella abortus promote bacterial internalization by human monocytes and modulate their innate immune response.

    Directory of Open Access Journals (Sweden)

    Cora N Pollak

    Full Text Available Outer membrane vesicles (OMVs released by some gram-negative bacteria have been shown to exert immunomodulatory effects that favor the establishment of the infection. The aim of the present study was to assess the interaction of OMVs from Brucella abortus with human epithelial cells (HeLa and monocytes (THP-1, and the potential immunomodulatory effects they may exert. Using confocal microscopy and flow cytometry, FITC-labeled OMVs were shown to be internalized by both cell types. Internalization was shown to be partially mediated by clathrin-mediated endocytosis. Pretreatment of THP-1 cells with Brucella OMVs inhibited some cytokine responses (TNF-α and IL-8 to E. coli LPS, Pam3Cys or flagellin (TLR4, TLR2 and TLR5 agonists, respectively. Similarly, pretreatment with Brucella OMVs inhibited the cytokine response of THP-1 cells to B. abortus infection. Treatment of THP-1 cells with OMVs during IFN-γ stimulation reduced significantly the inducing effect of this cytokine on MHC-II expression. OMVs induced a dose-dependent increase of ICAM-1 expression on THP-1 cells and an increased adhesion of these cells to human endothelial cells. The addition of OMVs to THP-1 cultures before the incubation with live B. abortus resulted in increased numbers of adhered and internalized bacteria as compared to cells not treated with OMVs. Overall, these results suggest that OMVs from B. abortus exert cellular effects that promote the internalization of these bacteria by human monocytes, but also downregulate the innate immune response of these cells to Brucella infection. These effects may favor the persistence of Brucella within host cells.

  15. Active suppression of early immune response in tobacco by the human pathogen Salmonella Typhimurium

    National Research Council Canada - National Science Library

    Shirron, Natali; Yaron, Sima

    2011-01-01

    The persistence of enteric pathogens on plants has been studied extensively, mainly due to the potential hazard of human pathogens such as Salmonella enterica being able to invade and survive in/on plants...

  16. Immune response to lipoproteins in atherosclerosis.

    Science.gov (United States)

    Samson, Sonia; Mundkur, Lakshmi; Kakkar, Vijay V

    2012-01-01

    Atherosclerosis, the underlying cause of cardiovascular disease, is characterized by chronic inflammation and altered immune response. Cholesterol is a well-known risk factor associated with the development of cardiovascular diseases. Elevated serum cholesterol is unique because it can lead to development of atherosclerosis in animals and humans even in the absence of other risk factors. Modifications of low-density lipoproteins mediated by oxidation, enzymatic degradation, and aggregation result in changes in their function and activate both innate and adaptive immune system. Oxidized low-density lipoprotein (LDL) has been identified as one of the most important autoantigens in atherosclerosis. This escape from self-tolerance is dependent on the formation of oxidized phospholipids. The emerging understanding of the importance of immune responses against oxidized LDL in atherosclerosis has focused attention on the possibility of development of novel therapy for atherosclerosis. This review provides an overview of immune response to lipoproteins and the fascinating possibility of developing an immunomodulatory therapy for atherosclerosis.

  17. Using Zebrafish Models of Human Influenza A Virus Infections to Screen Antiviral Drugs and Characterize Host Immune Cell Responses.

    Science.gov (United States)

    Sullivan, Con; Jurcyzszak, Denise; Goody, Michelle F; Gabor, Kristin A; Longfellow, Jacob R; Millard, Paul J; Kim, Carol H

    2017-01-20

    Each year, seasonal influenza outbreaks profoundly affect societies worldwide. In spite of global efforts, influenza remains an intractable healthcare burden. The principle strategy to curtail infections is yearly vaccination. In individuals who have contracted influenza, antiviral drugs can mitigate symptoms. There is a clear and unmet need to develop alternative strategies to combat influenza. Several animal models have been created to model host-influenza interactions. Here, protocols for generating zebrafish models for systemic and localized human influenza A virus (IAV) infection are described. Using a systemic IAV infection model, small molecules with potential antiviral activity can be screened. As a proof-of-principle, a protocol that demonstrates the efficacy of the antiviral drug Zanamivir in IAV-infected zebrafish is described. It shows how disease phenotypes can be quantified to score the relative efficacy of potential antivirals in IAV-infected zebrafish. In recent years, there has been increased appreciation for the critical role neutrophils play in the human host response to influenza infection. The zebrafish has proven to be an indispensable model for the study of neutrophil biology, with direct impacts on human medicine. A protocol to generate a localized IAV infection in the Tg(mpx:mCherry) zebrafish line to study neutrophil biology in the context of a localized viral infection is described. Neutrophil recruitment to localized infection sites provides an additional quantifiable phenotype for assessing experimental manipulations that may have therapeutic applications. Both zebrafish protocols described faithfully recapitulate aspects of human IAV infection. The zebrafish model possesses numerous inherent advantages, including high fecundity, optical clarity, amenability to drug screening, and availability of transgenic lines, including those in which immune cells such as neutrophils are labeled with fluorescent proteins. The protocols detailed here

  18. Human Immune Responses to Dengue Virus Infection: lessons learned from prospective cohort studies

    Directory of Open Access Journals (Sweden)

    Timothy P Endy

    2014-04-01

    Full Text Available Dengue virus (DENV continues to spread globally and is a major cause of morbidity and mortality. Currently there is no antiviral treatment to diminish severe illness or a vaccine to induce protection from infection. An effective dengue vaccine that protects against all four DENV serotypes is a high priority for endemic countries and several candidates are in development by various United States Federal Agencies and private pharmaceutical companies. Challenges faced by dengue vaccine developers include creating tetravalent formulations that provide tetravalent protection, the lack of a correlate of protective immunity, a changing viral landscape as DENV evolves, and a complex viral-host pathogenesis that can result in a spectrum of illness from subclinical infection to severe hemorrhagic fever. There have been a number of long-term prospective studies on DENV transmission and dengue severity that have provided invaluable information on DENV epidemiology and pathogenesis of this disease. In this section we will review the critical lessons learned from these studies and their application for dengue vaccine development.

  19. The immune response to bovine tuberculosis: Correlates of protection and relevance to human tuberculosis

    Science.gov (United States)

    Tuberculosis (TB), primarily due to Mycobacterium tuberculosis in humans and Mycobacterium bovis in cattle, is a classic model for demonstration of the One Health Concept. Early studies with cattle were instrumental in the development of the use of Koch’s tuberculin as an in vivo measure of cell-med...

  20. Dominance of Human Innate Immune Responses in Primary Francisella tularensis Live Vaccine Strain Vaccination

    Science.gov (United States)

    2006-03-31

    Diseases, Bacteriology Division, 425 Porter St, Frederick , MD 21702-5011. Dr Brittingham is the recipient of the National Research Council Fellowship...tularemia vaccine strain) infection by the sera of human recipients of the live tula- remia vaccine. Am J Med Sci 1994;308:83-7. 10. Herzberg VL

  1. Immune responses and Lassa virus infection.

    Science.gov (United States)

    Russier, Marion; Pannetier, Delphine; Baize, Sylvain

    2012-11-05

    Lassa fever is a hemorrhagic fever endemic to West Africa and caused by Lassa virus, an Old World arenavirus. It may be fatal, but most patients recover from acute disease and some experience asymptomatic infection. The immune mechanisms associated with these different outcomes have not yet been fully elucidated, but considerable progress has recently been made, through the use of in vitro human models and nonhuman primates, the only relevant animal model that mimics the pathophysiology and immune responses induced in patients. We discuss here the roles of the various components of the innate and adaptive immune systems in Lassa virus infection and in the control of viral replication and pathogenesis.

  2. Antimicrobial peptides in innate immune responses.

    Science.gov (United States)

    Sørensen, Ole E; Borregaard, Niels; Cole, Alexander M

    2008-01-01

    Antimicrobial peptides (AMPs) are ancient effector molecules in the innate immune response of eukaryotes. These peptides are important for the antimicrobial efficacy of phagocytes and for the innate immune response mounted by epithelia of humans and other mammals. AMPs are generated either by de novo synthesis or by proteolytic cleavage from antimicrobially inactive proproteins. Studies of human diseases and animal studies have given important clues to the in vivo role of AMPs. It is now evident that dysregulation of the generation of AMPs in innate immune responses plays a role in certain diseases like Crohn's disease and atopic dermatitis. AMPs are attractive candidates for development of novel antibiotics due to their in vivo activity profile and some peptides may serve as templates for further drug development.

  3. Immune responses to recombinant hepatitis B virus vaccine in human immunodeficiency virus-1-infected patients with different CD4~+ T-lymphocyte

    Institute of Scientific and Technical Information of China (English)

    蔡琳

    2014-01-01

    Objective.To compare the difference of immune responses to hepatitis B virus(HBV)vaccine in human immunodeficiency virus(HIV)-1-infected patients with different CD4+T-lymphocyte counts.Methods HIV-1 infected patients who visited clinic at the Public Health Clinical Center of Chengdu were enrolled and divided in-+

  4. Rhinovirus exposure impairs immune responses to bacterial products in human alveolar macrophages

    NARCIS (Netherlands)

    Oliver, B G G; Lim, S; Wark, P; Laza-Stanca, V; King, N; Black, J L; Burgess, J K; Roth, M; Johnston, S L

    2008-01-01

    BACKGROUND: Rhinovirus infection is responsible for considerable morbidity and mortality as the major cause of exacerbations of asthma, and is also known to induce exacerbations of cystic fibrosis and chronic obstructive pulmonary disease. Exacerbations of these diseases are also frequently associat

  5. Trappin-2/elafin modulate innate immune responses of human endometrial epithelial cells to PolyI:C.

    Directory of Open Access Journals (Sweden)

    Anna G Drannik

    Full Text Available BACKGROUND: Upon viral recognition, innate and adaptive antiviral immune responses are initiated by genital epithelial cells (ECs to eradicate or contain viral infection. Such responses, however, are often accompanied by inflammation that contributes to acquisition and progression of sexually transmitted infections (STIs. Hence, interventions/factors enhancing antiviral protection while reducing inflammation may prove beneficial in controlling the spread of STIs. Serine antiprotease trappin-2 (Tr and its cleaved form, elafin (E, are alarm antimicrobials secreted by multiple cells, including genital epithelia. METHODOLOGY AND PRINCIPAL FINDINGS: We investigated whether and how each Tr and E (Tr/E contribute to antiviral defenses against a synthetic mimic of viral dsRNA, polyinosine-polycytidylic acid (polyI:C and vesicular stomatitis virus. We show that delivery of a replication-deficient adenovector expressing Tr gene (Ad/Tr to human endometrial epithelial cells, HEC-1A, resulted in secretion of functional Tr, whereas both Tr/E were detected in response to polyI:C. Moreover, Tr/E were found to significantly reduce viral replication by either acting directly on virus or through enhancing polyI:C-driven antiviral protection. The latter was associated with reduced levels of pro-inflammatory factors IL-8, IL-6, TNFα, lowered expression of RIG-I, MDA5 and attenuated NF-κB activation. Interestingly, enhanced polyI:C-driven antiviral protection of HEC-Ad/Tr cells was partially mediated through IRF3 activation, but not associated with higher induction of IFNβ, suggesting multiple antiviral mechanisms of Tr/E and the involvement of alternative factors or pathways. CONCLUSIONS AND SIGNIFICANCE: This is the first evidence of both Tr/E altering viral binding/entry, innate recognition and mounting of antiviral and inflammatory responses in genital ECs that could have significant implications for homeostasis of the female genital tract.

  6. MAP Kinases in Immune Responses

    Institute of Scientific and Technical Information of China (English)

    Yongliang Zhang; Chen Dong

    2005-01-01

    MAP kinases are evolutionarily conserved signaling regulators from budding yeast to mammals and play essential roles in both innate and adaptive immune responses. There are three main families of MAPKs in mammals. Each of them has its own activators, inactivators, substrates and scaffolds, which altogether form a fine signaling network in response to different extracellular or intracellular stimulation. In this review, we summarize recent advances in understanding of the regulation of MAP kinases and the roles of MAP kinases in innate and adaptive immune responses.

  7. MAP Kinases in Immune Responses

    Institute of Scientific and Technical Information of China (English)

    YongliangZhang; ChenDong

    2005-01-01

    MAP kinases are evolutionarily conserved signaling regulators from budding yeast to mammals and play essential roles in both innate and adaptive immune responses. There are three main families of MAPKs in mammals. Each of them has its own activators, inactivators, substrates and scaffolds, which altogether form a fine signaling network in response to different extracellular or intracellular stimulation. In this review, we summarize recent advances in understanding of the regulation of MAP kinases and the roles of MAP kinases in innate and adaptive immune responses. Cellular & Molecular Immunology. 2005;2(1):20-27.

  8. The early antitumor immune response is necessary for tumor growth

    OpenAIRE

    Parmiani, Giorgio; Maccalli, Cristina

    2012-01-01

    Early events responsible of tumor growth in patients with a normal immune system are poorly understood. Here, we discuss, in the context of human melanoma, the Prehn hypothesis according to which a weak antitumor immune response may be required for tumor growth before weakly or non-immunogenic tumor cell subpopulations are selected by the immune system.

  9. Telmisartan ameliorates lipopolysaccharide-induced innate immune response through peroxisome proliferator-activated receptor-γ activation in human monocytes

    Science.gov (United States)

    Pang, Tao; Benicky, Julius; Wang, Juan; Orecna, Martina; Sanchez-Lemus, Enrique; Saavedra, Juan M.

    2011-01-01

    Objective Angiotensin II type 1 receptor (AT1) blockers (ARBs) reduce the bacterial endotoxin lipopolysaccharide (LPS)-induced innate immune response in human circulating monocytes expressing few AT1. To clarify the mechanisms of anti-inflammatory effects of ARBs with different peroxisome proliferator-activated receptor-γ (PPARγ)-activating potencies, we focused our study on telmisartan, an ARB with the highest PPARγ-stimulating activity. Methods Human circulating monocytes and monocytic THP-1 (human acute monocytic leukemia cell line) cells were exposed to 50 ng/ml LPS with or without pre-incubation with telmisartan. AT1 mRNA and protein expressions were determined by real-time PCR and membrane receptor binding assay, respectively. The expression of pro-inflammatory factors was determined by real-time PCR, western blot analysis and ELISA. PPARγ activation was measured by electrophoretic mobility shift assay and its role was determined by pharmacological inhibition and PPARγ gene silencing. Results In human monocytes, telmisartan significantly attenuated the LPS-induced expression of pro-inflammatory factors, the release of pro-inflammatory cytokines and prostaglandin E2, nuclear factor-κB activation and reactive oxygen species formation. In THP-1 cells, telmisartan significantly reduced LPS-induced tumor necrosis factor-α, inhibitor of κB-α, monocyte chemotactic protein-1 (MCP-1) and lectin-like oxidized low-density lipoprotein receptor-1 gene expression and MCP-1-directed migration. Telmisartan also stimulated the expression of the PPARγ target genes cluster of differentiation 36 and ATP-binding cassette subfamily G member 1 in monocytes. The anti-inflammatory effects of telmisartan were prevented by both PPARγ antagonism and PPARγ gene silencing. Anti-inflammatory effects of ARBs correlated with their PPARγ agonist potency. Conclusion Our observations demonstrate that in human monocytes, ARBs inhibit the LPS-induced pro-inflammatory response to a

  10. Slamf receptors : Modulators of Phagocyte Immune Responses

    NARCIS (Netherlands)

    Van Driel, Boaz Job

    2015-01-01

    Signaling Lymphocyte Activation Molecule family (Slamf) receptors can operate in three distinct modes. Slamf receptors can dictate the extent of immune responses, thereby maneuvering immunity to the optimal zone between immunopathology or autoimmunity and weak, ineffective immune responses. A second

  11. Immune Response After Measles Vaccination

    Directory of Open Access Journals (Sweden)

    Bhardwaj A.K

    1991-01-01

    Full Text Available Measles immunization of 192 under 5 years of age children was undertaken and the overall seroconversion was 76.0%. Seroconversion rate in the age group of 9-12 months was 70.9% and it was 100% after one year. Immune response in malnourished children was more as compared to normal children. There were negligible side reactions after measles vaccination, and this vaccine passed normal potency tests under field conditions.

  12. Gamma-Irradiated Bacille Calmette-Guérin Vaccination Does Not Modulate the Innate Immune Response during Experimental Human Endotoxemia in Adult Males

    Directory of Open Access Journals (Sweden)

    Linda A. C. Hamers

    2015-01-01

    Full Text Available Bacille Calmette-Guérin (BCG vaccine exerts nonspecific immunostimulatory effects and may therefore represent a novel therapeutic option to treat sepsis-induced immunoparalysis. We investigated whether BCG vaccination modulates the systemic innate immune response in humans in vivo during experimental endotoxemia. We used inactivated gamma-irradiated BCG vaccine because of the potential risk of disseminated disease with the live vaccine in immunoparalyzed patients. In a randomized double-blind placebo-controlled study, healthy male volunteers were vaccinated with gamma-irradiated BCG (n=10 or placebo (n=10 and received 1 ng/kg lipopolysaccharide (LPS intravenously on day 5 after vaccination to assess the in vivo immune response. Peripheral blood mononuclear cells were stimulated with various related and unrelated pathogens 5, 8 to 10, and 25 to 35 days after vaccination to assess ex vivo immune responses. BCG vaccination resulted in a scar in 90% of vaccinated subjects. LPS administration elicited a profound systemic immune response, characterized by increased levels of pro- and anti-inflammatory cytokines, hemodynamic changes, and flu-like symptoms. However, BCG modulated neither this in vivo immune response, nor ex vivo leukocyte responses at any time point. In conclusion, gamma-irradiated BCG is unlikely to represent an effective treatment option to restore immunocompetence in patients with sepsis-induced immunoparalysis. This trial is registered with NCT02085590.

  13. Activation of nucleotide oligomerization domain 2 (NOD2 by human cytomegalovirus initiates innate immune responses and restricts virus replication.

    Directory of Open Access Journals (Sweden)

    Arun Kapoor

    Full Text Available Nucleotide-binding oligomerization domain 2 (NOD2 is an important innate immune sensor of bacterial pathogens. Its induction results in activation of the classic NF-κB pathway and alternative pathways including type I IFN and autophagy. Although the importance of NOD2 in recognizing RNA viruses has recently been identified, its role in sensing DNA viruses has not been studied. We report that infection with human cytomegalovirus (HCMV results in significant induction of NOD2 expression, beginning as early as 2 hours post infection and increasing steadily 24 hours post infection and afterwards. Infection with human herpesvirus 1 and 2 does not induce NOD2 expression. While the HCMV-encoded glycoprotein B is not required for NOD2 induction, a replication competent virion is necessary. Lentivirus-based NOD2 knockdown in human foreskin fibroblasts (HFFs and U373 glioma cells leads to enhanced HCMV replication along with decreased levels of interferon beta (IFN-β and the pro-inflammatory cytokine, IL8. NOD2 induction in HCMV-infected cells activates downstream NF-κB and interferon pathways supported by reduced nuclear localization of NF-κB and pIRF3 in NOD2 knockdown HFFs. Stable overexpression of NOD2 in HFFs restricts HCMV replication in association with increased levels of IFN-β and IL8. Similarly, transient overexpression of NOD2 in U373 cells or its downstream kinase, RIPK2, results in decreased HCMV replication and enhanced cytokine responses. However, overexpression of a mutant NOD2, 3020insC, associated with severe Crohn's disease, results in enhanced HCMV replication and decreased levels of IFN-β in U373 cells. These results show for the first time that NOD2 plays a significant role in HCMV replication and may provide a model for studies of HCMV recognition by the host cell and HCMV colitis in Crohn's disease.

  14. Delineation of the innate and adaptive T-cell immune outcome in the human host in response to Campylobacter jejuni infection.

    Science.gov (United States)

    Edwards, Lindsey A; Nistala, Kiran; Mills, Dominic C; Stephenson, Holly N; Zilbauer, Matthias; Wren, Brendan W; Dorrell, Nick; Lindley, Keith J; Wedderburn, Lucy R; Bajaj-Elliott, Mona

    2010-11-09

    Campylobacter jejuni is the most prevalent cause of bacterial gastroenteritis worldwide. Despite the significant health burden this infection presents, molecular understanding of C. jejuni-mediated disease pathogenesis remains poorly defined. Here, we report the characterisation of the early, innate immune response to C. jejuni using an ex-vivo human gut model of infection. Secondly, impact of bacterial-driven dendritic cell activation on T-cell mediated immunity was also sought. Healthy, control paediatric terminal ileum or colonic biopsy tissue was infected with C. jejuni for 8-12 hours. Bacterial colonisation was followed by confocal microscopy and mucosal innate immune responses measured by ELISA. Marked induction of IFNγ with modest increase in IL-22 and IL-17A was noted. Increased mucosal IL-12, IL-23, IL-1β and IL-6 were indicative of a cytokine milieu that may modulate subsequent T-cell mediated immunity. C. jejuni-driven human monocyte-derived dendritic cell activation was followed by analyses of T cell immune responses utilising flow cytometry and ELISA. Significant increase in Th-17, Th-1 and Th-17/Th-1 double-positive cells and corresponding cytokines was observed. The ability of IFNγ, IL-22 and IL-17 cytokines to exert host defence via modulation of C. jejuni adhesion and invasion to intestinal epithelia was measured by standard gentamicin protection assay. Both innate and adaptive T cell-immunity to C. jejuni infection led to the release of IFNγ, IL-22 and IL-17A; suggesting a critical role for this cytokine triad in establishing host anti-microbial immunity during the acute and effectors phase of infection. In addition, to their known anti-microbial functions; IL-17A and IL-17F reduced the number of intracellular C. jejuni in intestinal epithelia, highlighting a novel aspect of how IL-17 family members may contribute to protective immunity against C. jejuni.

  15. Delineation of the innate and adaptive T-cell immune outcome in the human host in response to Campylobacter jejuni infection.

    Directory of Open Access Journals (Sweden)

    Lindsey A Edwards

    Full Text Available BACKGROUND: Campylobacter jejuni is the most prevalent cause of bacterial gastroenteritis worldwide. Despite the significant health burden this infection presents, molecular understanding of C. jejuni-mediated disease pathogenesis remains poorly defined. Here, we report the characterisation of the early, innate immune response to C. jejuni using an ex-vivo human gut model of infection. Secondly, impact of bacterial-driven dendritic cell activation on T-cell mediated immunity was also sought. METHODOLOGY: Healthy, control paediatric terminal ileum or colonic biopsy tissue was infected with C. jejuni for 8-12 hours. Bacterial colonisation was followed by confocal microscopy and mucosal innate immune responses measured by ELISA. Marked induction of IFNγ with modest increase in IL-22 and IL-17A was noted. Increased mucosal IL-12, IL-23, IL-1β and IL-6 were indicative of a cytokine milieu that may modulate subsequent T-cell mediated immunity. C. jejuni-driven human monocyte-derived dendritic cell activation was followed by analyses of T cell immune responses utilising flow cytometry and ELISA. Significant increase in Th-17, Th-1 and Th-17/Th-1 double-positive cells and corresponding cytokines was observed. The ability of IFNγ, IL-22 and IL-17 cytokines to exert host defence via modulation of C. jejuni adhesion and invasion to intestinal epithelia was measured by standard gentamicin protection assay. CONCLUSIONS: Both innate and adaptive T cell-immunity to C. jejuni infection led to the release of IFNγ, IL-22 and IL-17A; suggesting a critical role for this cytokine triad in establishing host anti-microbial immunity during the acute and effectors phase of infection. In addition, to their known anti-microbial functions; IL-17A and IL-17F reduced the number of intracellular C. jejuni in intestinal epithelia, highlighting a novel aspect of how IL-17 family members may contribute to protective immunity against C. jejuni.

  16. Dynamic Metabolism in Immune Response

    Science.gov (United States)

    Al-Hommrani, Mazen; Chakraborty, Paramita; Chatterjee, Shilpak; Mehrotra, Shikhar

    2016-01-01

    Cell, the basic unit of life depends for its survival on nutrients and thereby energy to perform its physiological function. Cells of lymphoid and myeloid origin are key in evoking an immune response against “self” or “non-self” antigens. The thymus derived lymphoid cells called T cells are a heterogenous group with distinct phenotypic and molecular signatures that have been shown to respond against an infection (bacterial, viral, protozoan) or cancer. Recent studies have unearthed the key differences in energy metabolism between the various T cell subsets, natural killer cells, dendritic cells, macrophages and myeloid derived suppressor cells. While a number of groups are dwelling into the nuances of the metabolism and its role in immune response at various strata, this review focuses on dynamic state of metabolism that is operational within various cellular compartments that interact to mount an effective immune response to alleviate disease state.

  17. Remnant Cholesterol Elicits Arterial Wall Inflammation and a Multilevel Cellular Immune Response in Humans.

    Science.gov (United States)

    Bernelot Moens, Sophie J; Verweij, Simone L; Schnitzler, Johan G; Stiekema, Lotte C A; Bos, Merijn; Langsted, Anne; Kuijk, Carlijn; Bekkering, Siroon; Voermans, Carlijn; Verberne, Hein J; Nordestgaard, Børge G; Stroes, Erik S G; Kroon, Jeffrey

    2017-05-01

    Mendelian randomization studies revealed a causal role for remnant cholesterol in cardiovascular disease. Remnant particles accumulate in the arterial wall, potentially propagating local and systemic inflammation. We evaluated the impact of remnant cholesterol on arterial wall inflammation, circulating monocytes, and bone marrow in patients with familial dysbetalipoproteinemia (FD). Arterial wall inflammation and bone marrow activity were measured using (18)F-FDG PET/CT. Monocyte phenotype was assessed with flow cytometry. The correlation between remnant levels and hematopoietic activity was validated in the CGPS (Copenhagen General Population Study). We found a 1.2-fold increase of (18)F-FDG uptake in the arterial wall in patients with FD (n=17, age 60±8 years, remnant cholesterol: 3.26 [2.07-5.71]) compared with controls (n=17, age 61±8 years, remnant cholesterol 0.29 [0.27-0.40]; Pcholesterol accumulates in human hematopoietic stem and progenitor cells coinciding with myeloid skewing. Patients with FD have increased arterial wall and cellular inflammation. These findings imply an important inflammatory component to the atherogenicity of remnant cholesterol, contributing to the increased cardiovascular disease risk in patients with FD. © 2017 American Heart Association, Inc.

  18. Scallop phenylalanine hydroxylase implicates in immune response and can be induced by human TNF-α.

    Science.gov (United States)

    Zhou, Zhi; Wang, Lingling; Wang, Mengqiang; Zhang, Huan; Wu, Tiantian; Qiu, Limei; Song, Linsheng

    2011-12-01

    Phenylalanine hydroxylase (PAH) is an important metabolic enzyme of aromatic amino acids, which is responsible for the irreversible oxidation of phenylalanine to tyrosine. In the present study, the full-length cDNA encoding PAH from Chlamys farreri (designated CfPAH) was cloned by using rapid amplification of cDNA ends (RACE) approaches and expression sequence tag (EST) analysis. The open reading frame of CfPAH encoded a polypeptide of 460 amino acids, and its sequence shared 64.4-74.2% similarity with those of PAHs from other animals. There were an N-terminal regulatory ACT domain and a C-terminal catalytic Biopterin_H domain in the deduced CfPAH protein. The mRNA transcripts of CfPAH could be detected in all the tested tissues, including adductor muscle, mantle, gill, gonad, haemocytes and hepatopancreas. And its expression level in haemocytes was increased significantly during 3-48 h after bacteria Vibrio anguillarum challenge with the highest level (9.1-fold, P phenylalanine to tyrosine within 1 min (nmol min(-1) mg(-1) protein) in vitro. These results indicated collectively that CfPAH, as a homologue of phenylalanine hydroxylase in scallop C. farreri, could be induced by cytokine and involved in the immunomodulation of scallops by supplying the starting material tyrosine for the synthesis of melanin and catecholamines.

  19. Adaptive immune responses to Candida albicans infection

    Science.gov (United States)

    Richardson, Jonathan P; Moyes, David L

    2015-01-01

    Fungal infections are becoming increasingly prevalent in the human population and contribute to morbidity and mortality in healthy and immunocompromised individuals respectively. Candida albicans is the most commonly encountered fungal pathogen of humans, and is frequently found on the mucosal surfaces of the body. Host defense against C. albicans is dependent upon a finely tuned implementation of innate and adaptive immune responses, enabling the host to neutralise the invading fungus. Central to this protection are the adaptive Th1 and Th17 cellular responses, which are considered paramount to successful immune defense against C. albicans infections, and enable tissue homeostasis to be maintained in the presence of colonising fungi. This review will highlight the recent advances in our understanding of adaptive immunity to Candida albicans infections. PMID:25607781

  20. Adaptive immune responses to Candida albicans infection.

    Science.gov (United States)

    Richardson, Jonathan P; Moyes, David L

    2015-01-01

    Fungal infections are becoming increasingly prevalent in the human population and contribute to morbidity and mortality in healthy and immunocompromised individuals respectively. Candida albicans is the most commonly encountered fungal pathogen of humans, and is frequently found on the mucosal surfaces of the body. Host defense against C. albicans is dependent upon a finely tuned implementation of innate and adaptive immune responses, enabling the host to neutralise the invading fungus. Central to this protection are the adaptive Th1 and Th17 cellular responses, which are considered paramount to successful immune defense against C. albicans infections, and enable tissue homeostasis to be maintained in the presence of colonising fungi. This review will highlight the recent advances in our understanding of adaptive immunity to Candida albicans infections.

  1. A human type 5 adenovirus-based tuberculosis vaccine induces robust T cell responses in humans despite preexisting anti-adenovirus immunity.

    Science.gov (United States)

    Smaill, Fiona; Jeyanathan, Mangalakumari; Smieja, Marek; Medina, Maria Fe; Thanthrige-Don, Niroshan; Zganiacz, Anna; Yin, Cindy; Heriazon, Armando; Damjanovic, Daniela; Puri, Laura; Hamid, Jemila; Xie, Feng; Foley, Ronan; Bramson, Jonathan; Gauldie, Jack; Xing, Zhou

    2013-10-02

    There is an urgent need to develop new tuberculosis (TB) vaccines to safely and effectively boost Bacille Calmette-Guérin (BCG)-triggered T cell immunity in humans. AdHu5Ag85A is a recombinant human type 5 adenovirus (AdHu5)-based TB vaccine with demonstrated efficacy in a number of animal species, yet it remains to be translated to human applications. In this phase 1 study, we evaluated the safety and immunogenicity of AdHu5Ag85A in both BCG-naïve and previously BCG-immunized healthy adults. Intramuscular immunization of AdHu5Ag85A was safe and well tolerated in both trial volunteer groups. Moreover, although AdHu5Ag85A was immunogenic in both trial volunteer groups, it much more potently boosted polyfunctional CD4(+) and CD8(+) T cell immunity in previously BCG-vaccinated volunteers. Furthermore, despite prevalent preexisting anti-AdHu5 humoral immunity in most of the trial volunteers, we found little evidence that such preexisting anti-AdHu5 immunity significantly dampened the potency of AdHu5Ag85A vaccine. This study supports further clinical investigations of the AdHu5Ag85A vaccine for human applications. It also suggests that the widely perceived negative effect of preexisting anti-AdHu5 immunity may not be universally applied to all AdHu5-based vaccines against different types of human pathogens.

  2. Dual Pressure from Antiretroviral Therapy and Cell-Mediated Immune Response on the Human Immunodeficiency Virus Type 1 Protease Gene

    Science.gov (United States)

    Karlsson, Annika C.; Deeks, Steven G.; Barbour, Jason D.; Heiken, Brandon D.; Younger, Sophie R.; Hoh, Rebecca; Lane, Meghan; Sällberg, Matti; Ortiz, Gabriel M.; Demarest, James F.; Liegler, Teri; Grant, Robert M.; Martin, Jeffrey N.; Nixon, Douglas F.

    2003-01-01

    Human immunodeficiency virus (HIV)-specific CD8+ T-lymphocyte pressure can lead to the development of viral escape mutants, with consequent loss of immune control. Antiretroviral drugs also exert selection pressures on HIV, leading to the emergence of drug resistance mutations and increased levels of viral replication. We have determined a minimal epitope of HIV protease, amino acids 76 to 84, towards which a CD8+ T-lymphocyte response is directed. This epitope, which is HLA-A2 restricted, includes two amino acids that commonly mutate (V82A and I84V) in the face of protease inhibitor therapy. Among 29 HIV-infected patients who were treated with protease inhibitors and who had developed resistance to these drugs, we show that the wild-type PR82V76-84 epitope is commonly recognized by cytotoxic T lymphocytes (CTL) in HLA-A2-positive patients and that the CTL directed to this epitope are of high avidity. In contrast, the mutant PR82A76-84 epitope is generally not recognized by wild-type-specific CTL, or when recognized it is of low to moderate avidity, suggesting that the protease inhibitor-selected V82A mutation acts both as a CTL and protease inhibitor escape mutant. Paradoxically, the absence of a mutation at position 82 was associated with the presence of a high-avidity CD8+ T-cell response to the wild-type virus sequence. Our results indicate that both HIV type 1-specific CD8+ T cells and antiretroviral drugs provide complex pressures on the same amino acid sequence of the HIV protease gene and, thus, can influence viral sequence evolution. PMID:12767994

  3. Innate immune sensing and response to influenza.

    Science.gov (United States)

    Pulendran, Bali; Maddur, Mohan S

    2015-01-01

    Influenza viruses pose a substantial threat to human and animal health worldwide. Recent studies in mouse models have revealed an indispensable role for the innate immune system in defense against influenza virus. Recognition of the virus by innate immune receptors in a multitude of cell types activates intricate signaling networks, functioning to restrict viral replication. Downstream effector mechanisms include activation of innate immune cells and, induction and regulation of adaptive immunity. However, uncontrolled innate responses are associated with exaggerated disease, especially in pandemic influenza virus infection. Despite advances in the understanding of innate response to influenza in the mouse model, there is a large knowledge gap in humans, particularly in immunocompromised groups such as infants and the elderly. We propose here, the need for further studies in humans to decipher the role of innate immunity to influenza virus, particularly at the site of infection. These studies will complement the existing work in mice and facilitate the quest to design improved vaccines and therapeutic strategies against influenza.

  4. Human CD8+ T cells mediate protective immunity induced by a human malaria vaccine in human immune system mice.

    Science.gov (United States)

    Li, Xiangming; Huang, Jing; Zhang, Min; Funakoshi, Ryota; Sheetij, Dutta; Spaccapelo, Roberta; Crisanti, Andrea; Nussenzweig, Victor; Nussenzweig, Ruth S; Tsuji, Moriya

    2016-08-31

    A number of studies have shown that CD8+ T cells mediate protective anti-malaria immunity in a mouse model. However, whether human CD8+ T cells play a role in protection against malaria remains unknown. We recently established human immune system (HIS) mice harboring functional human CD8+ T cells (HIS-CD8 mice) by transduction with HLA-A∗0201 and certain human cytokines using recombinant adeno-associated virus-based gene transfer technologies. These HIS-CD8 mice mount a potent, antigen-specific HLA-A∗0201-restricted human CD8+ T-cell response upon immunization with a recombinant adenovirus expressing a human malaria antigen, the Plasmodium falciparum circumsporozoite protein (PfCSP), termed AdPfCSP. In the present study, we challenged AdPfCSP-immunized HIS-CD8 mice with transgenic Plasmodium berghei sporozoites expressing full-length PfCSP and found that AdPfCSP-immunized (but not naïve) mice were protected against subsequent malaria challenge. The level of the HLA-A∗0201-restricted, PfCSP-specific human CD8+ T-cell response was closely correlated with the level of malaria protection. Furthermore, depletion of human CD8+ T cells from AdPfCSP-immunized HIS-CD8 mice almost completely abolished the anti-malaria immune response. Taken together, our data show that human CD8+ T cells mediate protective anti-malaria immunity in vivo.

  5. cDNA immunization of mice with human thyroglobulin generates both humoral and T cell responses: a novel model of thyroid autoimmunity.

    Directory of Open Access Journals (Sweden)

    Eric M Jacobson

    Full Text Available Thyroglobulin (Tg represents one of the largest known self-antigens involved in autoimmunity. Numerous studies have implicated it in triggering and perpetuating the autoimmune response in autoimmune thyroid diseases (AITD. Indeed, traditional models of autoimmune thyroid disease, experimental autoimmune thyroiditis (EAT, are generated by immunizing mice with thyroglobulin protein in conjunction with an adjuvant, or by high repeated doses of Tg alone, without adjuvant. These extant models are limited in their experimental flexibility, i.e. the ability to make modifications to the Tg used in immunizations. In this study, we have immunized mice with a plasmid cDNA encoding the full-length human Tg (hTG protein, in order to generate a model of Hashimoto's thyroiditis which is closer to the human disease and does not require adjuvants to breakdown tolerance. Human thyroglobulin cDNA was injected and subsequently electroporated into skeletal muscle using a square wave generator. Following hTg cDNA immunizations, the mice developed both B and T cell responses to Tg, albeit with no evidence of lymphocytic infiltration of the thyroid. This novel model will afford investigators the means to test various hypotheses which were unavailable with the previous EAT models, specifically the effects of hTg sequence variations on the induction of thyroiditis.

  6. Human immune responsiveness to Lolium perenne pollen allergen Lol p III (rye III) is associated with HLA-DR3 and DR5.

    Science.gov (United States)

    Ansari, A A; Freidhoff, L R; Meyers, D A; Bias, W B; Marsh, D G

    1989-05-01

    A well-characterized allergen of Lolium perenne (perennial rye grass) pollen, Lol p III, has been used as a model antigen to study the genetic control of the human immune response. Associations between HLA type and IgE or IgG antibody (Ab) responsiveness to Lol p III were studied in two groups of skin-test-positive Caucasoid adults (N = 135 and 67). We found by nonparametric and parametric analyses that immune responsiveness to Lol p III was significantly associated with HLA-DR3 and DR5. No association was found between any DQ type and immune responsiveness to Lol p III. Geometric mean IgE or IgG Ab levels to Lol p III were not different between B8+, DR3+ subjects and B8-, DR3+ subjects, showing that HLA-B8 had no influence on the association. Lol p III IgG Ab data obtained on subjects after grass antigen immunotherapy showed that 100% of DR3 subjects and 100% of DR5 subjects were Ab+. A comparison of all the available protein sequences of DRB gene products showed that the first hypervariable region of DR3 and DR5 (and DRw6), and no other region, contains the sequence Glu9-Tyr-Ser-Thr-Ser13. Our observations are consistent with the possibility that immune responsiveness to the allergen Lol p III is associated with this amino acid sequence in the first hypervariable region of the DR beta 1 polypeptide chain.

  7. Pepper mild mottle virus, a plant virus associated with specific immune responses, Fever, abdominal pains, and pruritus in humans.

    Directory of Open Access Journals (Sweden)

    Philippe Colson

    Full Text Available BACKGROUND: Recently, metagenomic studies have identified viable Pepper mild mottle virus (PMMoV, a plant virus, in the stool of healthy subjects. However, its source and role as pathogen have not been determined. METHODS AND FINDINGS: 21 commercialized food products containing peppers, 357 stool samples from 304 adults and 208 stool samples from 137 children were tested for PMMoV using real-time PCR, sequencing, and electron microscopy. Anti-PMMoV IgM antibody testing was concurrently performed. A case-control study tested the association of biological and clinical symptoms with the presence of PMMoV in the stool. Twelve (57% food products were positive for PMMoV RNA sequencing. Stool samples from twenty-two (7.2% adults and one child (0.7% were positive for PMMoV by real-time PCR. Positive cases were significantly more likely to have been sampled in Dermatology Units (p<10(-6, to be seropositive for anti-PMMoV IgM antibodies (p = 0.026 and to be patients who exhibited fever, abdominal pains, and pruritus (p = 0.045, 0.038 and 0.046, respectively. CONCLUSIONS: Our study identified a local source of PMMoV and linked the presence of PMMoV RNA in stool with a specific immune response and clinical symptoms. Although clinical symptoms may be imputable to another cofactor, including spicy food, our data suggest the possibility of a direct or indirect pathogenic role of plant viruses in humans.

  8. Risk factors for discordant immune response among HIV-infected ...

    African Journals Online (AJOL)

    2012-11-02

    Nov 2, 2012 ... had a discordant immune response and 7% (n=67) a discordant virological response. On multivariate analysis ... initial rapid increase of memory CD4 cells, succeeded by a slow ... were obtained from the Human Research.

  9. Immunoblot detection of class-specific humoral immune response to outer membrane proteins isolated from Salmonella typhi in humans with typhoid fever.

    OpenAIRE

    Ortiz, V; Isibasi, A; García-Ortigoza, E; Kumate, J.

    1989-01-01

    The studies reported here were undertaken to assess the ability of the outer membrane proteins (OMPs) of Salmonella typhi to induce a humoral immune response in humans with typhoid fever. OMPs were isolated with the nonionic detergent Triton X-100 and were found to be contaminated with approximately 4% lipopolysaccharide. Sodium dodecyl sulfate-polyacrylamide gel electrophoresis patterns showed protein bands with molecular size ranges from 17 to 70 kilodaltons; the major groups of proteins we...

  10. The Human Immune Response to HIV and its Impact in the Potential Development of an Inactivated HIV Vaccine.

    Science.gov (United States)

    Rios, Adan; Pottet, Ethan C; Siwak, Edward B; Anderson, Dallas W; Yao, Qizhi C

    2016-01-01

    There is evidence that the transmission and acute phase of HIV infection triggers an immune response capable of controlling HIV subverted by the process of virus integration, essential to the replicative cycle of retroviruses. We review here two aspects that deserve consideration in light of recent developments concerning HIV transmission and vaccine development: vaccines directed against transmitted/founder viruses, and a reconsideration of inactivation as a viable means to obtain a preventive HIV vaccine. Since 80% of sexually transmitted HIV infections are caused by a single transmitted/founder variant, it is appropriate to target transmitted/founder viruses for vaccine development. Transmitted/founder virus transmission is subject to strong natural selection based on conserved signatures present in all forms of transmitted/founder HIV viruses. This provides an opportunity to pursue inactivation methods of vaccine development that allow antigenic preservation of HIV transmitted/founder viruses. The presentation to the immune system of an inactivated but antigenically preserved transmitted/founder virus should allow the development of an effective immune response against transmitted/founder viruses. This could be the base for an inactivated transmitted/founder virus HIV vaccine. We have devised a method of inactivation of HIV reverse transcriptase through the use of a novel photo-labeling procedure based on the use of photo-labeled analogs of antiretroviral compounds with specific affinity for HIV reverse transcriptase. We believe this method fulfills the required conditions for an effective preventive vaccine development: inactivation and antigenic preservation.

  11. DNA encoding an HIV-1 Gag/human lysosome-associated membrane protein-1 chimera elicits a broad cellular and humoral immune response in Rhesus macaques.

    Directory of Open Access Journals (Sweden)

    Priya Chikhlikar

    Full Text Available Previous studies of HIV-1 p55Gag immunization of mice have demonstrated the usefulness of targeting antigens to the cellular compartment containing the major histocompatibility complex type II (MHC II complex molecules by use of a DNA antigen formulation encoding Gag as a chimera with the mouse lysosome-associated membrane protein (mLAMP/gag. In the present study, we have analyzed the magnitude and breadth of Gag-specific T-lymphocyte and antibody responses elicited in Rhesus macaques after immunization with DNA encoding a human LAMP/gag (hLAMP/gag chimera. ELISPOT analyses indicated that the average Gag-specific IFN-gamma response elicited by the hLAMP/gag chimera was detectable after only two or three naked DNA immunizations in all five immunized macaques and reached an average of 1000 spot-forming cells (SFC/10(6 PBMCs. High IFN-gamma ELISPOT responses were detected in CD8(+-depleted cells, indicating that CD4(+ T-cells play a major role in these responses. The T-cell responses of four of the macaques were also tested by use of ELISPOT to 12 overlapping 15-amino acids (aa peptide pools containing ten peptides each, encompassing the complete Gag protein sequence. The two Mamu 08 immunized macaques responded to eight and twelve of the pools, the Mamu B01 to six, and the other macaque to five pools indicating that the hLAMP/gag DNA antigen formulation elicits a broad T-cell response against Gag. Additionally, there was a strong HIV-1-specific IgG response. The IgG antibody titers increased after each DNA injection, indicating a strong amnestic B-cell response, and were highly elevated in all the macaques after three immunizations. Moreover, the serum of each macaque recognized 13 of the 49 peptides of a 20-aa peptide library covering the complete Gag amino acid sequence. In addition, HIV-1-specific IgA antibodies were present in the plasma and external secretions, including nasal washes. These data support the findings of increased

  12. Abnormal humoral immune response to influenza vaccination in pediatric type-1 human immunodeficiency virus infected patients receiving highly active antiretroviral therapy.

    Science.gov (United States)

    Montoya, Carlos J; Toro, Maria F; Aguirre, Carlos; Bustamante, Alberto; Hernandez, Mariluz; Arango, Liliana P; Echeverry, Marta; Arango, Ana E; Prada, Maria C; Alarcon, Herminia del P; Rojas, Mauricio

    2007-06-01

    Given that highly active antiretroviral therapy (HAART) has been demonstrated useful to restore immune competence in type-1 human immunodeficiency virus (HIV-1)-infected subjects, we evaluated the specific antibody response to influenza vaccine in a cohort of HIV-1-infected children on HAART so as to analyze the quality of this immune response in patients under antiretroviral therapy. Sixteen HIV-1-infected children and 10 HIV-1 seronegative controls were immunized with a commercially available trivalent inactivated influenza vaccine containing the strains A/H1N1, A/H3N2, and B. Serum hemagglutinin inhibition (HI) antibody titers were determined for the three viral strains at the time of vaccination and 1 month later. Immunization induced a significantly increased humoral response against the three influenza virus strains in controls, and only against A/H3N2 in HIV-1-infected children. The comparison of post-vaccination HI titers between HIV-1+ patients and HIV-1 negative controls showed significantly higher HI titers against the three strains in controls. In addition, post vaccination protective HI titers (defined as equal to or higher than 1:40) against the strains A/H3N2 and B were observed in a lower proportion of HIV-1+ children than in controls, while a similar proportion of individuals from each group achieved protective HI titers against the A/H1N1 strain. The CD4+ T cell count, CD4/CD8 T cells ratio, and serum viral load were not affected by influenza virus vaccination when pre- vs post-vaccination values were compared. These findings suggest that despite the fact that HAART is efficient in controlling HIV-1 replication and in increasing CD4+ T cell count in HIV-1-infected children, restoration of immune competence and response to cognate antigens remain incomplete, indicating that additional therapeutic strategies are required to achieve a full reconstitution of immune functions.

  13. Abnormal humoral immune response to influenza vaccination in pediatric type-1 human immunodeficiency virus infected patients receiving highly active antiretroviral therapy

    Directory of Open Access Journals (Sweden)

    Carlos J Montoya

    2007-06-01

    Full Text Available Given that highly active antiretroviral therapy (HAART has been demonstrated useful to restore immune competence in type-1 human immunodeficiency virus (HIV-1-infected subjects, we evaluated the specific antibody response to influenza vaccine in a cohort of HIV-1-infected children on HAART so as to analyze the quality of this immune response in patients under antiretroviral therapy. Sixteen HIV-1-infected children and 10 HIV-1 seronegative controls were immunized with a commercially available trivalent inactivated influenza vaccine containing the strains A/H1N1, A/H3N2, and B. Serum hemagglutinin inhibition (HI antibody titers were determined for the three viral strains at the time of vaccination and 1 month later. Immunization induced a significantly increased humoral response against the three influenza virus strains in controls, and only against A/H3N2 in HIV-1-infected children. The comparison of post-vaccination HI titers between HIV-1+ patients and HIV-1 negative controls showed significantly higher HI titers against the three strains in controls. In addition, post vaccination protective HI titers (defined as equal to or higher than 1:40 against the strains A/H3N2 and B were observed in a lower proportion of HIV-1+ children than in controls, while a similar proportion of individuals from each group achieved protective HI titers against the A/H1N1 strain. The CD4+ T cell count, CD4/CD8 T cells ratio, and serum viral load were not affected by influenza virus vaccination when pre- vs post-vaccination values were compared. These findings suggest that despite the fact that HAART is efficient in controlling HIV-1 replication and in increasing CD4+ T cell count in HIV-1-infected children, restoration of immune competence and response to cognate antigens remain incomplete, indicating that additional therapeutic strategies are required to achieve a full reconstitution of immune functions.

  14. Broad blockade antibody responses in human volunteers after immunization with a multivalent norovirus VLP candidate vaccine: immunological analyses from a phase I clinical trial.

    Directory of Open Access Journals (Sweden)

    Lisa C Lindesmith

    2015-03-01

    Full Text Available Human noroviruses (NoVs are the primary cause of acute gastroenteritis and are characterized by antigenic variation between genogroups and genotypes and antigenic drift of strains within the predominant GII.4 genotype. In the context of this diversity, an effective NoV vaccine must elicit broadly protective immunity. We used an antibody (Ab binding blockade assay to measure the potential cross-strain protection provided by a multivalent NoV virus-like particle (VLP candidate vaccine in human volunteers.Sera from ten human volunteers immunized with a multivalent NoV VLP vaccine (genotypes GI.1/GII.4 were analyzed for IgG and Ab blockade of VLP interaction with carbohydrate ligand, a potential correlate of protective immunity to NoV infection and illness. Immunization resulted in rapid rises in IgG and blockade Ab titers against both vaccine components and additional VLPs representing diverse strains and genotypes not represented in the vaccine. Importantly, vaccination induced blockade Ab to two novel GII.4 strains not in circulation at the time of vaccination or sample collection. GII.4 cross-reactive blockade Ab titers were more potent than responses against non-GII.4 VLPs, suggesting that previous exposure history to this dominant circulating genotype may impact the vaccine Ab response. Further, antigenic cartography indicated that vaccination preferentially activated preexisting Ab responses to epitopes associated with GII.4.1997. Study interpretations may be limited by the relevance of the surrogate neutralization assay and the number of immunized participants evaluated.Vaccination with a multivalent NoV VLP vaccine induces a broadly blocking Ab response to multiple epitopes within vaccine and non-vaccine NoV strains and to novel antigenic variants not yet circulating at the time of vaccination. These data reveal new information about complex NoV immune responses to both natural exposure and to vaccination, and support the potential

  15. [Immune response to influenza vaccination].

    Science.gov (United States)

    Alvarez, I; Corral, J; Arranz, A; Foruria, A; Landa, V; Lejarza, J R; Marijuán, L; Martínez, J M

    1989-01-01

    The present study investigated the level of immunity of the population against three strains of the influenza virus (A Chile/1/83 -A Philippines/2/82 and B URSS/100/83) before and three months after vaccination, and the immune response to whole virus vaccine as compared with fragmented virus vaccine. A high percentage of the population had titers greater than or equal to 1/10 before vaccination for the Chile (54%) and Philippines (65.7%) strains, while titers against the URSS strain were lower (25.4%). There was a definitive increase in antibody titer in the vaccinated population, although it was lower than expected. The overall response to both vaccines, with protecting titers greater than or equal to 1/40 after vaccination was 65.2% for the Chile strain, 74.6% for the Philippines strain, and 15% for the URSS strain. No differences in the overall immune response were found between the groups vaccinated with whole and fragmented virus.

  16. Characterization of Mucosal Immune Responses to Enterotoxigenic Escherichia coli Vaccine Antigens in a Human Challenge Model: Response Profiles after Primary Infection and Homologous Rechallenge with Strain H10407.

    Science.gov (United States)

    Chakraborty, Subhra; Harro, Clayton; DeNearing, Barbara; Ram, Malathi; Feller, Andrea; Cage, Alicia; Bauers, Nicole; Bourgeois, A Louis; Walker, Richard; Sack, David A

    2015-11-18

    Enterotoxigenic Escherichia coli (ETEC) bacteria are the most common bacterial cause of diarrhea in children in resource-poor settings as well as in travelers. Although there are several approaches to develop an effective vaccine for ETEC, no licensed vaccines are currently available. A significant challenge to successful vaccine development is our poor understanding of the immune responses that correlate best with protection against ETEC illness. In this study, ETEC-specific mucosal immune responses were characterized and compared in subjects challenged with ETEC strain H10407 and in subjects rechallenged with the homologous organism. IgA responses to lipopolysaccharide (LPS), heat-labile toxin B subunit (LTB), and colonization factor antigen I (CFA/I) in antibody in lymphocyte supernatant (ALS), feces, lavage fluid, and saliva samples were evaluated. In all assay comparisons, ALS was the most sensitive indicator of a local immune response, but serum IgA was also a useful indirect marker of immune response to oral antigens. Volunteers challenged and then rechallenged with strain H10407 were protected from illness following rechallenge. Comparing mucosal antibody responses after primary and homologous rechallenge, protection against disease was reflected in reduced antibody responses to key ETEC antigens and in reduced fecal shedding of the H10407 challenge strain. Subjects challenged with strain H10407 mounted stronger antibody responses to LPS and LTB than subjects in the rechallenge group, while responses to CFA/I in the rechallenge group were higher than in the challenge group. We anticipate that this study will help provide an immunological benchmark for the evaluation of ETEC vaccines and immunization regimens in the future.

  17. Immune Response to Lipoproteins in Atherosclerosis

    OpenAIRE

    Sonia Samson; Lakshmi Mundkur; Kakkar, Vijay V

    2012-01-01

    Atherosclerosis, the underlying cause of cardiovascular disease, is characterized by chronic inflammation and altered immune response. Cholesterol is a well-known risk factor associated with the development of cardiovascular diseases. Elevated serum cholesterol is unique because it can lead to development of atherosclerosis in animals and humans even in the absence of other risk factors. Modifications of low-density lipoproteins mediated by oxidation, enzymatic degradation, and aggregation re...

  18. Immune Responses in the Central Nervous System Are Anatomically Segregated in a Non-Human Primate Model of Human Immunodeficiency Virus Infection

    Directory of Open Access Journals (Sweden)

    Barbara Tavano

    2017-03-01

    Full Text Available The human immunodeficiency virus (HIV accesses the central nervous system (CNS early during infection, leading to HIV-associated cognitive impairment and establishment of a viral reservoir. Here, we describe a dichotomy in inflammatory responses in different CNS regions in simian immunodeficiency virus (SIV-infected macaques, a model for HIV infection. We found increased expression of inflammatory genes and perivascular leukocyte infiltration in the midbrain of SIV-infected macaques. Conversely, the frontal lobe showed downregulation of inflammatory genes associated with interferon-γ and interleukin-6 pathways, and absence of perivascular cuffing. These immunologic alterations were not accompanied by differences in SIV transcriptional activity within the tissue. Altered expression of genes associated with neurotoxicity was observed in both midbrain and frontal lobe. The segregation of inflammatory responses to specific regions of the CNS may both account for HIV-associated neurological symptoms and constitute a critical hurdle for HIV eradication by shielding the CNS viral reservoir from antiviral immunity.

  19. Cellular Immune Responses in Humans Induced by Two Serogroup B Meningococcal Outer Membrane Vesicle Vaccines Given Separately and in Combination.

    Science.gov (United States)

    Oftung, Fredrik; Korsvold, Gro Ellen; Aase, Audun; Næss, Lisbeth M

    2016-04-01

    MenBvac and MeNZB are safe and efficacious outer membrane vesicle (OMV) vaccines against serogroup B meningococcal disease. Antibody responses have previously been investigated in a clinical trial with these two OMV vaccines given separately (25 μg/dose) or in combination (12.5 and 12.5 μg/dose) in three doses administered at 6-week intervals. Here, we report the results from analyzing cellular immune responses against MenBvac and MeNZB OMVs in terms of antigen-specific CD4(+)T cell proliferation and secretion of cytokines. The proliferative CD4(+)T cell responses to the combined vaccine were of the same magnitude as the homologous responses observed for each individual vaccine. The results also showed cross-reactivity in the sense that both vaccine groups receiving separate vaccines responded to both homologous and heterologous OMV antigen when assayed for antigen-specific cellular proliferation. In addition, a multiplex bead array assay was used to analyze the presence of Th1 and Th2 cytokines in cell culture supernatants. The results showed that gamma interferon, interleukin-4 (IL-4), and IL-10 responses could be detected as a result of vaccination with both the MenBvac and the MeNZB vaccines given separately, as well as when given in combination. With respect to cross-reactivity, the cytokine results paralleled the observations made for proliferation. In conclusion, the results demonstrate that cross-reactive cellular immune responses involving both Th1 and Th2 cytokines can be induced to the same extent by different tailor-made OMV vaccines given either separately or in combination with half the dose of each vaccine. Copyright © 2016, American Society for Microbiology. All Rights Reserved.

  20. Immune Responses and Lassa Virus Infection

    Directory of Open Access Journals (Sweden)

    Sylvain Baize

    2012-11-01

    Full Text Available Lassa fever is a hemorrhagic fever endemic to West Africa and caused by Lassa virus, an Old World arenavirus. It may be fatal, but most patients recover from acute disease and some experience asymptomatic infection. The immune mechanisms associated with these different outcomes have not yet been fully elucidated, but considerable progress has recently been made, through the use of in vitro human models and nonhuman primates, the only relevant animal model that mimics the pathophysiology and immune responses induced in patients. We discuss here the roles of the various components of the innate and adaptive immune systems in Lassa virus infection and in the control of viral replication and pathogenesis.

  1. The Memory Immune Response to Tuberculosis.

    Science.gov (United States)

    Kirman, Joanna R; Henao-Tamayo, Marcela I; Agger, Else Marie

    2016-12-01

    Immunological memory is a central feature of the adaptive immune system and a prerequisite for generating effective vaccines. Understanding long-term memory responses to Mycobacterium tuberculosis will thus provide us with valuable insights that can guide us in the search for a novel vaccine against tuberculosis (TB). For many years, triggering CD4 T cells and, in particular, those secreting interferon-γ has been the goal of most TB vaccine research, and numerous data from animals and humans support the key role of this subset in protective immunity. More recently, we have learned that the memory response required for effective control of M. tuberculosis is much more complex, probably involving several phenotypically different CD4 T cell subsets as well as other cell types that are yet to be defined. Herein, we describe recent insights into memory immunity to TB in the context of both animal models and the human infection. With the increasing amount of data generated from clinical testing of novel TB vaccines, we also summarize recent knowledge of vaccine-induced memory immunity.

  2. Human immune system mice immunized with Plasmodium falciparum circumsporozoite protein induce protective human humoral immunity against malaria.

    Science.gov (United States)

    Huang, Jing; Li, Xiangming; Coelho-dos-Reis, Jordana G A; Zhang, Min; Mitchell, Robert; Nogueira, Raquel Tayar; Tsao, Tiffany; Noe, Amy R; Ayala, Ramses; Sahi, Vincent; Gutierrez, Gabriel M; Nussenzweig, Victor; Wilson, James M; Nardin, Elizabeth H; Nussenzweig, Ruth S; Tsuji, Moriya

    2015-12-01

    In this study, we developed human immune system (HIS) mice that possess functional human CD4+ T cells and B cells, named HIS-CD4/B mice. HIS-CD4/B mice were generated by first introducing HLA class II genes, including DR1 and DR4, along with genes encoding various human cytokines and human B cell activation factor (BAFF) to NSG mice by adeno-associated virus serotype 9 (AAV9) vectors, followed by engrafting human hematopoietic stem cells (HSCs). HIS-CD4/B mice, in which the reconstitution of human CD4+ T and B cells resembles to that of humans, produced a significant level of human IgG against Plasmodium falciparum circumsporozoite (PfCS) protein upon immunization. CD4+ T cells in HIS-CD4/B mice, which possess central and effector memory phenotypes like those in humans, are functional, since PfCS protein-specific human CD4+ T cells secreting IFN-γ and IL-2 were detected in immunized HIS-CD4/B mice. Lastly, PfCS protein-immunized HIS-CD4/B mice were protected from in vivo challenge with transgenic P. berghei sporozoites expressing the PfCS protein. The immune sera collected from protected HIS-CD4/B mice reacted against transgenic P. berghei sporozoites expressing the PfCS protein and also inhibited the parasite invasion into hepatocytes in vitro. Taken together, these studies show that our HIS-CD4/B mice could mount protective human anti-malaria immunity, consisting of human IgG and human CD4+ T cell responses both specific for a human malaria antigen.

  3. A New Mechanism to Curb Over-reactive Immune Responses

    Institute of Scientific and Technical Information of China (English)

    2006-01-01

    @@ The human immune system is a truly amazing constellation of responses to attacks from the outside. It could defend you against millions of bacteria, microbes, viruses, toxins and parasites that would invade your body. However, there are cases where the immune response to innocuous substances is inappropriate and over-reactive, leading to diseases such as allergies and arthritis.

  4. Immune Response to Lipoproteins in Atherosclerosis

    Directory of Open Access Journals (Sweden)

    Sonia Samson

    2012-01-01

    Full Text Available Atherosclerosis, the underlying cause of cardiovascular disease, is characterized by chronic inflammation and altered immune response. Cholesterol is a well-known risk factor associated with the development of cardiovascular diseases. Elevated serum cholesterol is unique because it can lead to development of atherosclerosis in animals and humans even in the absence of other risk factors. Modifications of low-density lipoproteins mediated by oxidation, enzymatic degradation, and aggregation result in changes in their function and activate both innate and adaptive immune system. Oxidized low-density lipoprotein (LDL has been identified as one of the most important autoantigens in atherosclerosis. This escape from self-tolerance is dependent on the formation of oxidized phospholipids. The emerging understanding of the importance of immune responses against oxidized LDL in atherosclerosis has focused attention on the possibility of development of novel therapy for atherosclerosis. This review provides an overview of immune response to lipoproteins and the fascinating possibility of developing an immunomodulatory therapy for atherosclerosis.

  5. The PGRS Domain from PE_PGRS33 of Mycobacterium tuberculosis is Target of Humoral Immune Response in Mice and Humans

    Science.gov (United States)

    Cohen, Ingrid; Parada, Cristina; Acosta-Gío, Enrique; Espitia, Clara

    2014-01-01

    The PE_PGRS33 protein is a member of the PE family, which encompasses the PE and the PE_PGRS subfamilies. Among PE_PGRS’s, this protein is one of the most studied antigens and its immunomodulatory properties are influence by both PE and PGRS domains. However, the contribution of these domains to the host immune recognition of the PE_PGRS33 protein and their potential role in latent tuberculosis infection in humans is still unknown. In this study, the immunogenic properties of the complete PE_PGRS33 protein and each domain separately were evaluated in BALB/c mice and latent tuberculosis infected (LTBI) humans. In mice, PE_PGRS33 and its domains induced similar antibody production and secretion of IFN-γ. PE_PGRS33 and the PE domain stimulated higher CD4+ and CD8+ T-cell proliferation compared to the PGRS domain. This demonstrated that the principal difference in the immune recognition of the domains is the higher activation of T-cell subpopulations involved in the control of tuberculosis. In humans, the secretion of IFN-γ in response to PE_PGRS33 was detected in both LTBI and in non-infected vaccinated individuals. The same was observed for antibody response, which targets epitopes located in the PGRS domain but not in the PE domain. These observations suggest that T and B cell responses to PE_PGRS33 are induced by BCG vaccination and can be maintained for many years in non-infected individuals. This also indicates that the IFN-γ response detected might not be associated with latent tuberculosis infection. These results contribute to the elucidation of the role of the PE_PGRS33 protein and its PE and PGRS domains in the immune response against Mycobacterium tuberculosis. PMID:24904584

  6. Downstream mediators of the intratumoral interferon response suppress antitumor immunity, induce gemcitabine resistance and associate with poor survival in human pancreatic cancer.

    Science.gov (United States)

    Delitto, Daniel; Perez, Chelsey; Han, Song; Gonzalo, David H; Pham, Kien; Knowlton, Andrea E; Graves, Christina L; Behrns, Kevin E; Moldawer, Lyle L; Thomas, Ryan M; Liu, Chen; George, Thomas J; Trevino, Jose G; Wallet, Shannon M; Hughes, Steven J

    2015-12-01

    The cancer microenvironment allows tumor cells to evade immune surveillance through a variety of mechanisms. While interferon-γ (IFNγ) is central to effective antitumor immunity, its effects on the microenvironment are not as clear and have in some cancers been shown to induce immune checkpoint ligands. The heterogeneity of these responses to IFNγ remains poorly characterized in desmoplastic malignancies with minimal inflammatory cell infiltration, such as pancreatic cancer (PC). Thus, the IFNγ response within and on key cells of the PC microenvironment was evaluated. IFNγ induced expression of human leukocyte antigen (HLA) class I and II on PC cell lines, primary pancreatic cancer epithelial cells (PPCE) and patient-derived tumor-associated stroma, concomitant with an upregulation of PDL1 in the absence of CD80 and CD86 expression. As expected, IFNγ also induced high levels of CXCL10 from all cell types. In addition, significantly higher levels of CXCL10 were observed in PC specimens compared to those from chronic pancreatitis, whereby intratumoral CXCL10 concentration was an independent predictor of poor survival. Immunohistochemical analysis revealed a subset of CXCR3-positive cancer cells in over 90 % of PC specimens, as well as on a subset of cultured PC cell lines and PPCE, whereby exposure to CXCL10 induced resistance to the chemotherapeutic gemcitabine. These findings suggest that IFNγ has multiple effects on many cell types within the PC microenvironment that may lead to immune evasion, chemoresistance and shortened survival.

  7. Mathematical Modelling of Immune Response in Tissues

    Directory of Open Access Journals (Sweden)

    B. Su

    2009-01-01

    Full Text Available We have developed a spatial–temporal mathematical model (PDE to capture fundamental aspects of the immune response to antigen. We have considered terms that broadly describe intercellular communication, cell movement, and effector function (activation or inhibition. The PDE model is robust to variation in antigen load and it can account for (1 antigen recognition, (2 an innate immune response, (3 an adaptive immune response, (4 the elimination of antigen and subsequent resolution of the immune response or (5 equilibrium of the immune response to the presence of persistent antigen (chronic infection and the formation of a granuloma.

  8. Immune responses to bioengineered organs

    Science.gov (United States)

    Ochando, Jordi; Charron, Dominique; Baptista, Pedro M.; Uygun, Basak E.

    2017-01-01

    Purpose of review Organ donation in the United States registered 9079 deceased organ donors in 2015. This high percentage of donations allowed organ transplantation in 29 851 recipients. Despite increasing numbers of transplants performed in comparison with previous years, the numbers of patients that are in need for a transplant increase every year at a higher rate. This reveals that the discrepancy between the demand and availability of organs remains fundamental problem in organ transplantation. Recent findings Development of bioengineered organs represents a promising approach to increase the pool of organs for transplantation. The technology involves obtaining complex three-dimensional scaffolds that support cellular activity and functional remodeling though tissue recellularization protocols using progenitor cells. This innovative approach integrates cross-thematic approaches from specific areas of transplant immunology, tissue engineering and stem cell biology, to potentially manufacture an unlimited source of donor organs for transplantation. Summary Although bioengineered organs are thought to escape immune recognition, the potential immune reactivity toward each of its components has not been studied in detail. Here, we summarize the host immune response toward different progenitor cells and discuss the potential implications of using nonself biological scaffolds to develop bioengineered organs. PMID:27926545

  9. EVOLUTION OF THE IMMUNE RESPONSE

    Science.gov (United States)

    Papermaster, Ben W.; Condie, Richard M.; Finstad, Joanne; Good, Robert A.

    1964-01-01

    1. The California hagfish, Eptatretus stoutii, seems to be completely lacking in adaptive immunity: it forms no detectable circulating antibody despite intensive stimulation with a range of antigens; it does not show reactivity to old tuberculin following sensitization with BCG; and gives no evidence of homograft immunity. 2. Studies on the sea lamprey, Petromyzon marinus, have been limited to the response to bacteriophage T2 and hemocyanin in small groups of spawning animals. They suggest that the lamprey may have a low degree of immunologic reactivity. 3. One holostean, the bowfin (Amia calva) and the guitarfish (Rhinobatos productus), an elasmobranch, showed a low level of primary response to phage and hemocyanin. The response is slow and antibody levels low. Both the bowfin and the guitarfish showed a vigorous secondary response to phage, but neither showed much enhancement of reactivity to hemocyanin in the secondary response. The bowfin formed precipitating antibody to hemocyanin, but the guitarfish did not. Both hemagglutinating and precipitating antibody to hemocyanin were also observed in the primary response of the black bass. 4. The bowfin was successfully sensitized to Ascaris antigen, and lesions of the delayed type developed after challenge at varying intervals following sensitization. 5. The horned shark (Heterodontus franciscii) regularly cleared hemocyanin from the circulation after both primary and secondary antigenic stimulation, and regularly formed hemagglutinating antibody, but not precipitating antibody, after both primary and secondary stimulation with this antigen. These animals regularly cleared bacteriophage from the circulation after both the primary and secondary stimulation with bacteriophage T2. Significant but small amounts of antibody were produced in a few animals in the primary response, and larger amounts in the responding animals after secondary antigenic stimulation. 6. Studies by starch gel and immunoelectrophoresis show that

  10. Humoral Immune Response in Tuberculous Pleuritis

    Directory of Open Access Journals (Sweden)

    Prabha C.

    2005-01-01

    Full Text Available Tuberculous pleuritis is a good human model to understand the local and protective immune response against tuberculosis, due to the self-limitedness of the disease. Although the cellular immune response has been well characterised in tuberculous pleurisy, much less is known about the humoral immune response operating at the site of infection. To understand the humoral immune response, B cells were enumerated in peripheral blood mononuclear cells (PBMC and pleural fluid mononuclear cells (PFMC of tuberculous (TP and non-tuberculous pleuritis patients (NTP. The levels of IgG, IgA and IgM antibodies for PPD, culture filtrate (CF and sonicate antigens (Son Ag were assessed in plasma (BL and pleural fluid (PF and a western blot was carried out with the CF antigen. The percentage of CD19+B-cells was similar in PBMC and PFMC of TP patients but was significantly lower in PFMCs of NTP patients. The IgG levels for PPD and CF antigens were higher in PF of TP than NTP patients. The antigen recognition patterns did not differ in plasma and pleural fluid of the same patient in both groups pointing out the passive diffusion of the plasma to the pleura. The antigens 25, 31, 33, 70, 110, 124 and 132 kDa were recognized exclusively by the TP patients. Thus our study showed that the local humoral response in TP did not differ from the systemic response. However, the humoral response differed in TP patients when compared to NTP patients.

  11. The commensal Streptococcus salivarius K12 downregulates the innate immune responses of human epithelial cells and promotes host-microbe homeostasis.

    Science.gov (United States)

    Cosseau, Celine; Devine, Deirdre A; Dullaghan, Edie; Gardy, Jennifer L; Chikatamarla, Avinash; Gellatly, Shaan; Yu, Lorraine L; Pistolic, Jelena; Falsafi, Reza; Tagg, John; Hancock, Robert E W

    2008-09-01

    Streptococcus salivarius is an early colonizer of human oral and nasopharyngeal epithelia, and strain K12 has reported probiotic effects. An emerging paradigm indicates that commensal bacteria downregulate immune responses through the action on NF-kappaB signaling pathways, but additional mechanisms underlying probiotic actions are not well understood. Our objective here was to identify host genes specifically targeted by K12 by comparing their responses with responses elicited by pathogens and to determine if S. salivarius modulates epithelial cell immune responses. RNA was extracted from human bronchial epithelial cells (16HBE14O- cells) cocultured with K12 or bacterial pathogens. cDNA was hybridized to a human 21K oligonucleotide-based array. Data were analyzed using ArrayPipe, InnateDB, PANTHER, and oPOSSUM. Interleukin 8 (IL-8) and growth-regulated oncogene alpha (Groalpha) secretion were determined by enzyme-linked immunosorbent assay. It was demonstrated that S. salivarius K12 specifically altered the expression of 565 host genes, particularly those involved in multiple innate defense pathways, general epithelial cell function and homeostasis, cytoskeletal remodeling, cell development and migration, and signaling pathways. It inhibited baseline IL-8 secretion and IL-8 responses to LL-37, Pseudomonas aeruginosa, and flagellin in epithelial cells and attenuated Groalpha secretion in response to flagellin. Immunosuppression was coincident with the inhibition of activation of the NF-kappaB pathway. Thus, the commensal and probiotic behaviors of S. salivarius K12 are proposed to be due to the organism (i) eliciting no proinflammatory response, (ii) stimulating an anti-inflammatory response, and (iii) modulating genes associated with adhesion to the epithelial layer and homeostasis. S. salivarius K12 might thereby ensure that it is tolerated by the host and maintained on the epithelial surface while actively protecting the host from inflammation and apoptosis

  12. Attenuation of pathogenic immune responses during infection with human and simian immunodeficiency virus (HIV/SIV by the tetracycline derivative minocycline.

    Directory of Open Access Journals (Sweden)

    Julia L Drewes

    Full Text Available HIV immune pathogenesis is postulated to involve two major mechanisms: 1 chronic innate immune responses that drive T cell activation and apoptosis and 2 induction of immune regulators that suppress T cell function and proliferation. Both arms are elevated chronically in lymphoid tissues of non-natural hosts, which ultimately develop AIDS. However, these mechanisms are not elevated chronically in natural hosts of SIV infection that avert immune pathogenesis despite similarly high viral loads. In this study we investigated whether minocycline could modulate these pathogenic antiviral responses in non-natural hosts of HIV and SIV. We found that minocycline attenuated in vitro induction of type I interferon (IFN and the IFN-stimulated genes indoleamine 2,3-dioxygenase (IDO1 and TNF-related apoptosis inducing ligand (TRAIL in human plasmacytoid dendritic cells and PBMCs exposed to aldrithiol-2 inactivated HIV or infectious influenza virus. Activation-induced TRAIL and expression of cytotoxic T-lymphocyte antigen 4 (CTLA-4 in isolated CD4+ T cells were also reduced by minocycline. Translation of these in vitro findings to in vivo effects, however, were mixed as minocycline significantly reduced markers of activation and activation-induced cell death (CD25, Fas, caspase-3 but did not affect expression of IFNβ or the IFN-stimulated genes IDO1, FasL, or Mx in the spleens of chronically SIV-infected pigtailed macaques. TRAIL expression, reflecting the mixed effects of minocycline on activation and type I IFN stimuli, was reduced by half, but this change was not significant. These results show that minocycline administered after infection may protect against aspects of activation-induced cell death during HIV/SIV immune disease, but that in vitro effects of minocycline on type I IFN responses are not recapitulated in a rapid progressor model in vivo.

  13. The effects of orally administered Beta-glucan on innate immune responses in humans, a randomized open-label intervention pilot-study.

    Directory of Open Access Journals (Sweden)

    Jenneke Leentjens

    Full Text Available RATIONALE: To prevent or combat infection, increasing the effectiveness of the immune response is highly desirable, especially in case of compromised immune system function. However, immunostimulatory therapies are scarce, expensive, and often have unwanted side-effects. β-glucans have been shown to exert immunostimulatory effects in vitro and in vivo in experimental animal models. Oral β-glucan is inexpensive and well-tolerated, and therefore may represent a promising immunostimulatory compound for human use. METHODS: We performed a randomized open-label intervention pilot-study in 15 healthy male volunteers. Subjects were randomized to either the β -glucan (n = 10 or the control group (n = 5. Subjects in the β-glucan group ingested β-glucan 1000 mg once daily for 7 days. Blood was sampled at various time-points to determine β-glucan serum levels, perform ex vivo stimulation of leukocytes, and analyze microbicidal activity. RESULTS: β-glucan was barely detectable in serum of volunteers at all time-points. Furthermore, neither cytokine production nor microbicidal activity of leukocytes were affected by orally administered β-glucan. CONCLUSION: The present study does not support the use of oral β-glucan to enhance innate immune responses in humans. TRIAL REGISTRATION: ClinicalTrials.gov NCT01727895.

  14. Innate Response to Human Cancer Cells with or without IL-2 Receptor Common γ-Chain Function in NOD Background Mice Lacking Adaptive Immunity.

    Science.gov (United States)

    Nishime, Chiyoko; Kawai, Kenji; Yamamoto, Takehiro; Katano, Ikumi; Monnai, Makoto; Goda, Nobuhito; Mizushima, Tomoko; Suemizu, Hiroshi; Nakamura, Masato; Murata, Mitsuru; Suematsu, Makoto; Wakui, Masatoshi

    2015-08-15

    Immunodeficient hosts exhibit high acceptance of xenogeneic or neoplastic cells mainly due to lack of adaptive immunity, although it still remains to be elucidated how innate response affects the engraftment. IL-2R common γ-chain (IL-2Rγc) signaling is required for development of NK cells and a subset of dendritic cells producing IFN-γ. To better understand innate response in the absence of adaptive immunity, we examined amounts of metastatic foci in the livers after intrasplenic transfer of human colon cancer HCT116 cells into NOD/SCID versus NOD/SCID/IL-2Rγc (null) (NOG) hosts. The intravital microscopic imaging of livers in the hosts depleted of NK cells and/or macrophages revealed that IL-2Rγc function critically contributes to elimination of cancer cells without the need for NK cells and macrophages. In the absence of IL-2Rγc, macrophages play a role in the defense against tumors despite the NOD Sirpa allele, which allows human CD47 to bind to the encoded signal regulatory protein α to inhibit macrophage phagocytosis of human cells. Analogous experiments using human pancreas cancer MIA PaCa-2 cells provided findings roughly similar to those from the experiments using HCT116 cells except for lack of suppression of metastases by macrophages in NOG hosts. Administration of mouse IFN-γ to NOG hosts appeared to partially compensate lack of IL-2Rγc-dependent elimination of transferred HCT116 cells. These results provide insights into the nature of innate response in the absence of adaptive immunity, aiding in developing tumor xenograft models in experimental oncology.

  15. Influence of prevaccination immunity on the human B-lymphocyte response to a Haemophilus influenzae type b conjugate vaccine

    DEFF Research Database (Denmark)

    Barington, T; Kristensen, K; Henrichsen, J

    1991-01-01

    The purpose of this study was to investigate whether preexisting immunity to components of a polysaccharide-protein conjugate influences the B-lymphocyte response to vaccination with the conjugate. Thirty-two healthy adults were vaccinated once or twice with a conjugate (PRP-D) consisting...... of circulating PRP and DT antibody-secreting cells (AbSC) (postvaccination days 6 to 9). The B-cell responses (antibody response and AbSC) to both PRP and DT correlated positively with prevaccination levels of anti-DT. DT AbSC appeared earlier (peak, day 7) than PRP AbSC (peak, day 8). Individuals whose PRP Ab......SC peaked early (day 7) had higher prevaccination anti-DT levels than those who peaked later (P less than 0.05). In contrast, the prevaccination levels of anti-PRP did not correlate significantly with the magnitude of the antibody or AbSC response and did not affect the kinetics of the AbSC. Following...

  16. Cellular immune responses to respiratory viruses

    NARCIS (Netherlands)

    van Helden, M.J.G.

    2011-01-01

    When a respiratory virus successfully infects the lungs, cascades of immune responses are initiated aimed to remove the pathogen. Immediate non-specific protection is provided by the innate immune system and this reduces the viral load during the first days of infection. The adaptive immune response

  17. The insect cellular immune response

    Institute of Scientific and Technical Information of China (English)

    Michael R. Strand

    2008-01-01

    The innate immune system of insects is divided into humoral defenses that include the production of soluble effector molecules and cellular defenses like phagocytosis and encapsulation that are mediated by hemocytes. This review summarizes current understanding of the cellular immune response. Insects produce several terminally differentiated types of hemocytes that are distinguished by morphology, molecular and antigenic markers, and function. The differentiated hemocytes that circulate in larval or nymphal stage insects arise from two sources: progenitor cells produced during embryogenesis and mesodermally derived hematopoietic organs. Regulation of hematopoiesis and hemocyte differentiation also involves several different signaling pathways. Phagocytosis and encapsulation require that hemocytes first recognize a given target as foreign followed by activation of downstream signaling and effector responses. A number of humoral and cellular receptors have been identified that recognize different microbes and multicellular parasites. In turn, activation of these receptors stimulates a number of signaling pathways that regulate different hemocyte functions. Recent studies also identify hemocytes as important sources of a number of humoral effector molecules required for killing different foreign invaders.

  18. Chitin modulates innate immune responses of keratinocytes.

    Directory of Open Access Journals (Sweden)

    Barbara Koller

    Full Text Available BACKGROUND: Chitin, after cellulose the second most abundant polysaccharide in nature, is an essential component of exoskeletons of crabs, shrimps and insects and protects these organisms from harsh conditions in their environment. Unexpectedly, chitin has been found to activate innate immune cells and to elicit murine airway inflammation. The skin represents the outer barrier of the human host defense and is in frequent contact with chitin-bearing organisms, such as house-dust mites or flies. The effects of chitin on keratinocytes, however, are poorly understood. METHODOLOGY/PRINCIPAL FINDINGS: We hypothesized that chitin stimulates keratinocytes and thereby modulates the innate immune response of the skin. Here we show that chitin is bioactive on primary and immortalized keratinocytes by triggering production of pro-inflammatory cytokines and chemokines. Chitin stimulation further induced the expression of the Toll-like receptor (TLR TLR4 on keratinocytes at mRNA and protein level. Chitin-induced effects were mainly abrogated when TLR2 was blocked, suggesting that TLR2 senses chitin on keratinocytes. CONCLUSIONS/SIGNIFICANCE: We speculate that chitin-bearing organisms modulate the innate immune response towards pathogens by upregulating secretion of cytokines and chemokines and expression of MyD88-associated TLRs, two major components of innate immunity. The clinical relevance of this mechanism remains to be defined.

  19. Gene-environment interactions in multiple sclerosis: Innate and adaptive immune responses to human endogenous retrovirus and herpesvirus antigens and the lectin complement activation pathway

    DEFF Research Database (Denmark)

    Christensen, Tove; Petersen, Thor; Thiel, Steffen

    2007-01-01

    Aspects of gene-environment interactions in multiple sclerosis (MS) were analysed in serum samples from 46 MS families (25 sporadic MS cases and 42 familial MS cases): antibodies to the MS-associated human endogenous retrovirus HERV-H, and levels of three components in the innate pathogen......-associated molecular pattern recognition: mannan-binding lectin (MBL), and MASP-2 and MASP-3. For representative MS families, we also determined herpesvirus serology for HSV-1, VZV, and EBV; and tissue typed for HLA-B, and HLA DR and DQ. In MS, a significant correlation between elevated immune reactivity to HERV-H Env......-H and the antiviral immune response may play a role in MS development, and also underline the tenuous nature of specific genetic contributions to this complex disease....

  20. Gene-environment interactions in multiple sclerosis: innate and adaptive immune responses to human endogenous retrovirus and herpesvirus antigens and the lectin complement activation pathway

    DEFF Research Database (Denmark)

    Christensen, Tove; Petersen, Thor; Thiel, Steffen

    2006-01-01

    Aspects of gene-environment interactions in multiple sclerosis (MS) were analysed in serum samples from 46 MS families (25 sporadic MS cases and 42 familial MS cases): antibodies to the MS-associated human endogenous retrovirus HERV-H, and levels of three components in the innate pathogen......-associated molecular pattern recognition: mannan-binding lectin (MBL), and MASP-2 and MASP-3. For representative MS families, we also determined herpesvirus serology for HSV-1, VZV, and EBV; and tissue typed for HLA-B, and HLA DR and DQ. In MS, a significant correlation between elevated immune reactivity to HERV-H Env...... immune response may play a role in MS development, and also underline the tenuous nature of specific genetic contributions to this complex disease. Udgivelsesdato: 2007-Feb...

  1. Hepatitis C Virus Sensing by Human Trophoblasts Induces Innate Immune Responses and Recruitment of Maternal NK Cells: Potential Implications for Limiting Vertical Transmission.

    Science.gov (United States)

    Giugliano, Silvia; Petroff, Margaret G; Warren, Bryce D; Jasti, Susmita; Linscheid, Caitlin; Ward, Ashley; Kramer, Anita; Dobrinskikh, Evgenia; Sheiko, Melissa A; Gale, Michael; Golden-Mason, Lucy; Winn, Virginia D; Rosen, Hugo R

    2015-10-15

    Hepatitis C virus (HCV) is the world's most common blood-borne viral infection for which there is no vaccine. The rates of vertical transmission range between 3 and 6% with odds 90% higher in the presence of HIV coinfection. Prevention of vertical transmission is not possible because of lack of an approved therapy for use in pregnancy or an effective vaccine. Recently, HCV has been identified as an independent risk factor for preterm delivery, perinatal mortality, and other complications. In this study, we characterized the immune responses that contribute to the control of viral infection at the maternal-fetal interface (MFI) in the early gestational stages. In this study, we show that primary human trophoblast cells and an extravillous trophoblast cell line (HTR8), from first and second trimester of pregnancy, express receptors relevant for HCV binding/entry and are permissive for HCV uptake. We found that HCV-RNA sensing by human trophoblast cells induces robust upregulation of type I/III IFNs and secretion of multiple chemokines that elicit recruitment and activation of decidual NK cells. Furthermore, we observed that HCV-RNA transfection induces a proapoptotic response within HTR8 that could affect the morphology of the placenta. To our knowledge, for the first time, we demonstrate that HCV-RNA sensing by human trophoblast cells elicits a strong antiviral response that alters the recruitment and activation of innate immune cells at the MFI. This work provides a paradigm shift in our understanding of HCV-specific immunity at the MFI as well as novel insights into mechanisms that limit vertical transmission but may paradoxically lead to virus-related pregnancy complications.

  2. Comparison of in vivo immune responses following transplantation of vascularized and non-vascularized human dermo-epidermal skin substitutes.

    Science.gov (United States)

    Klar, Agnes S; Biedermann, Thomas; Simmen-Meuli, Claudia; Reichmann, Ernst; Meuli, Martin

    2017-03-01

    Autologous bio-engineered dermo-epidermal skin substitutes (DESS) represent an alternative therapeutic option for a definitive treatment of skin defects in human patients. Largely, the interaction of host immune cells with transplanted DESS is considered to be essential for the granulation tissue formation, graft take, and its functionality. The aim of this study was to compare the spatiotemporal distribution and density of host-derived monocytes/macrophages and granulocytes in vascularized (vascDESS) versus non-vascularized DESS (non-vascDESS) in a rat model. Keratinocytes and the stromal vascular fraction (SVF) were derived from human skin or human adipose tissue, respectively. Human SVF containing both endothelial and mesenchymal/stromal progenitors was used to develop a vascularized collagen type I-based dermal component in vitro. The donor-matched, monolayer-expanded adipose stromal cells lacking endothelial cells were used as a negative control. Subsequently, human keratinocytes were seeded on top of hydrogels to build dermo-epidermal skin grafts. After transplantation onto full-thickness skin wounds on the back of immuno-incompetent rats, grafts were excised and analyzed after 1 and 3 weeks. The expression of distinct inflammatory cell markers specific for host-derived monocytes/macrophages (CD11b, CD68) or granulocytes (HIS48) was analyzed by immunofluorescence microscopy. All skin grafts were infiltrated by host-derived monocytes/macrophages (CD11b(+), CD68(+)) and granulocytes (HIS48(+)) between 1-3 week post-transplantation. When compared to non-vascDESS, the vascDESS showed an increased granulocyte infiltration at all time points analyzed with the majority of cells scattered throughout the whole dermal part. Whereas a moderate number of rat monocytes/macrophages (CD11b(+), CD68(+)) were found in vascDESS at 1 week, only a few cells were detected in non-vascDESS. We observed a time-dependent decrease of monocytes/macrophages in all transplants at 3

  3. Probiotic Lactobacillus rhamnosus GG enhanced Th1 cellular immunity but did not affect antibody responses in a human gut microbiota transplanted neonatal gnotobiotic pig model.

    Directory of Open Access Journals (Sweden)

    Ke Wen

    Full Text Available This study aims to establish a human gut microbiota (HGM transplanted gnotobiotic (Gn pig model of human rotavirus (HRV infection and diarrhea, and to verify the dose-effects of probiotics on HRV vaccine-induced immune responses. Our previous studies using the Gn pig model found that probiotics dose-dependently regulated both T cell and B cell immune responses induced by rotavirus vaccines. We generated the HGM transplanted neonatal Gn pigs through daily feeding of neonatal human fecal suspension to germ-free pigs for 3 days starting at 12 hours after birth. We found that attenuated HRV (AttHRV vaccination conferred similar overall protection against rotavirus diarrhea and virus shedding in Gn pigs and HGM transplanted Gn pigs. HGM promoted the development of the neonatal immune system, as evidenced by the significantly enhanced IFN-γ producing T cell responses and reduction of regulatory T cells and their cytokine production in the AttHRV-vaccinated pigs. The higher dose Lactobacillus rhamnosus GG (LGG feeding (14 doses, up to 109 colony-forming-unit [CFU]/dose effectively increased the LGG counts in the HGM Gn pig intestinal contents and significantly enhanced HRV-specific IFN-γ producing T cell responses to the AttHRV vaccine. Lower dose LGG (9 doses, up to 106 CFU/dose was ineffective. Neither doses of LGG significantly improved the protection rate, HRV-specific IgA and IgG antibody titers in serum, or IgA antibody titers in intestinal contents compared to the AttHRV vaccine alone, suggesting that an even higher dose of LGG is needed to overcome the influence of the microbiota to achieve the immunostimulatory effect in the HGM pigs. This study demonstrated that HGM Gn pig is an applicable animal model for studying immune responses to rotavirus vaccines and can be used for studying interventions (i.e., probiotics and prebiotics that may enhance the immunogenicity and protective efficacy of vaccines through improving the gut microbiota.

  4. Rhodiola inhibits dengue virus multiplication by inducing innate immune response genes RIG-I, MDA5 and ISG in human monocytes.

    Science.gov (United States)

    Diwaker, Drishya; Mishra, K P; Ganju, Lilly; Singh, S B

    2014-08-01

    Recognition of virus infection by retinoic acid-inducible gene (RIG) I and melanoma differentiation-associated protein (MDA) 5, which are RNA helicases, and interferon-stimulated gene (ISG) 15 activates cascades of signal transduction pathways leading to production of type I interferons and proinflammatory cytokines that orchestrate the elimination of the viruses. However, it has been demonstrated that RNA-helicase-mediated innate immunity plays an essential role in defending the host from infection. In our efforts to identify plant-derived antivirals that selectively enhance ISG- and RNA-helicase-mediated antiviral immune responses, we identified a plant, rhodiola, that significantly promoted ISG, RIG-I and MDA 5 gene expression and an antiviral immune response against dengue virus (DENV) infection. Rhodiola induced interferon (IFN) β and other cytokines, including IL-1β, TNF-α, IL-6 and IL-8, in infected cells. It was also found that rhodiola upregulated phosphorylated eIF-2α, PKR and NF-kB in infected cells. In addition, the number of NK cells was also increased by rhodiola treatment in dengue-virus-infected human PBMCs. Treatment with a crude extract of rhodiola (RAE) resulted in effects in the 20 % range, which is similar to the magnitude of the same effects observed in DENV infections. Taken together, our results imply that rhodiola induces pharmacological modulation of RIG-I, MDA 5 and ISG signal transduction pathways in favor of the induction of a beneficial antiviral immune response against dengue virus, which can be a novel therapeutic strategy for management of infection.

  5. TLR4 Asp299Gly and Thr399Ile polymorphisms: no impact on human immune responsiveness to LPS or respiratory syncytial virus.

    Directory of Open Access Journals (Sweden)

    Renée N Douville

    Full Text Available BACKGROUND: A broad variety of natural environmental stimuli, genotypic influences and timing all contribute to expression of protective versus maladaptive immune responses and the resulting clinical outcomes in humans. The role of commonly co-segregating Toll-like receptor 4 (TLR4 non-synonymous single nucleotide polymorphisms Asp299Gly and Thr399Ile in this process remains highly controversial. Moreover, what differential impact these polymorphisms might have in at risk populations with respiratory dysfunction, such as current asthma or a history of infantile bronchiolitis, has never been examined. Here we determine the importance of these polymorphisms in modulating LPS and respiratory syncytial virus (RSV--driven cytokine responses. We focus on both healthy children and those with clinically relevant respiratory dysfunction. METHODOLOGY: To elucidate the impact of TLR4 Asp299Gly and Thr399Ile on cytokine production, we assessed multiple immune parameters in over 200 pediatric subjects aged 7-9. Genotyping was followed by quantification of pro- and anti-inflammatory cytokine responses by fresh peripheral blood mononuclear cells upon acute exposure to LPS or RSV. PRINCIPAL FINDINGS: In contrast to early reports, neither SNP influenced immune responses evoked by LPS exposure or RSV infection, as measured by the intermediate phenotype of pro- and anti-inflammatory cytokine responses to these ubiquitous agents. There is no evidence of altered sensitivity in populations with "at risk" clinical phenotypes. CONCLUSIONS/SIGNIFICANCE: Genomic medicine seeks to inform clinical practice. Determination of the TLR4 Asp299Gly/Thr399Ile haplotype is of no clinical benefit in predicting the nature or intensity of cytokine production in children whether currently healthy or among specific at-risk groups characterized by prior infantile broncholitis or current asthma.

  6. Surface structure characterization of Aspergillus fumigatus conidia mutated in the melanin synthesis pathway and their human cellular immune response.

    Science.gov (United States)

    Bayry, Jagadeesh; Beaussart, Audrey; Dufrêne, Yves F; Sharma, Meenu; Bansal, Kushagra; Kniemeyer, Olaf; Aimanianda, Vishukumar; Brakhage, Axel A; Kaveri, Srini V; Kwon-Chung, Kyung J; Latgé, Jean-Paul; Beauvais, Anne

    2014-08-01

    In Aspergillus fumigatus, the conidial surface contains dihydroxynaphthalene (DHN)-melanin. Six-clustered gene products have been identified that mediate sequential catalysis of DHN-melanin biosynthesis. Melanin thus produced is known to be a virulence factor, protecting the fungus from the host defense mechanisms. In the present study, individual deletion of the genes involved in the initial three steps of melanin biosynthesis resulted in an altered conidial surface with masked surface rodlet layer, leaky cell wall allowing the deposition of proteins on the cell surface and exposing the otherwise-masked cell wall polysaccharides at the surface. Melanin as such was immunologically inert; however, deletion mutant conidia with modified surfaces could activate human dendritic cells and the subsequent cytokine production in contrast to the wild-type conidia. Cell surface defects were rectified in the conidia mutated in downstream melanin biosynthetic pathway, and maximum immune inertness was observed upon synthesis of vermelone onward. These observations suggest that although melanin as such is an immunologically inert material, it confers virulence by facilitating proper formation of the A. fumigatus conidial surface.

  7. Role of yqiC in the Pathogenicity of Salmonella and Innate Immune Responses of Human Intestinal Epithelium

    Science.gov (United States)

    Wang, Ke-Chuan; Huang, Chih-Hung; Ding, Shih-Min; Chen, Ching-Kuo; Fang, Hsu-Wei; Huang, Ming-Te; Fang, Shiuh-Bin

    2016-01-01

    The yqiC gene of Salmonella enterica serovar Typhimurium (S. Typhimurium) regulates bacterial growth at different temperatures and mice survival after infection. However, the role of yqiC in bacterial colonization and host immunity remains unknown. We infected human LS174T, Caco-2, HeLa, and THP-1 cells with S. Typhimurium wild-type SL1344, its yqiC mutant, and its complemented strain. Bacterial colonization and internalization in the four cell lines significantly reduced on yqiC depletion. Post-infection production of interleukin-8 and human β-defensin-3 in LS174T cells significantly reduced because of yqiC deleted in S. Typhimurium. The phenotype of yqiC mutant exhibited few and short flagella, fimbriae on the cell surface, enhanced biofilm formation, upregulated type-1 fimbriae expression, and reduced bacterial motility. Type-1 fimbriae, flagella, SPI-1, and SPI-2 gene expression was quantified using real-time PCR. The data show that deletion of yqiC upregulated fimA and fimZ expression and downregulated flhD, fliZ, invA, and sseB expression. Furthermore, thin-layer chromatography and high-performance liquid chromatography revealed the absence of menaquinone in the yqiC mutant, thus validating the importance of yqiC in the bacterial electron transport chain. Therefore, YqiC can negatively regulate FimZ for type-1 fimbriae expression and manipulate the functions of its downstream virulence factors including flagella, SPI-1, and SPI-2 effectors. PMID:27777572

  8. Ability of Interleukin-33- and Immune Complex-Triggered Activation of Human Mast Cells to Down-Regulate Monocyte-Mediated Immune Responses.

    Science.gov (United States)

    Rivellese, Felice; Suurmond, Jolien; Habets, Kim; Dorjée, Annemarie L; Ramamoorthi, Nandhini; Townsend, Michael J; de Paulis, Amato; Marone, Gianni; Huizinga, Tom W J; Pitzalis, Costantino; Toes, René E M

    2015-09-01

    Mast cells have been implicated in the pathogenesis of rheumatoid arthritis (RA). In particular, their activation by interleukin-33 (IL-33) has been linked to the development of arthritis in animal models. The aim of this study was to evaluate the functional responses of human mast cells to IL-33 in the context of RA. Human mast cells were stimulated with IL-33 combined with plate-bound IgG or IgG anti-citrullinated protein antibodies (ACPAs), and their effects on monocyte activation were evaluated. Cellular interactions of mast cells in RA synovium were assessed by immunofluorescence analysis, and the expression of messenger RNA (mRNA) for mast cell-specific genes was evaluated in synovial biopsy tissue from patients with early RA who were naive to treatment with disease-modifying antirheumatic drugs. IL-33 induced the up-regulation of Fcγ receptor type IIa and enhanced the activation of mast cells by IgG, including IgG ACPAs, as indicated by the production of CXCL8/IL-8. Intriguingly, mast cell activation triggered with IL-33 and IgG led to the release of mediators such as histamine and IL-10, which inhibited monocyte activation. Synovial mast cells were found in contact with CD14+ monocyte/macrophages. Finally, mRNA levels of mast cell-specific genes were inversely associated with disease severity, and IL-33 mRNA levels showed an inverse correlation with the levels of proinflammatory markers. When human mast cells are activated by IL-33, an immunomodulatory phenotype develops, with human mast cells gaining the ability to suppress monocyte activation via the release of IL-10 and histamine. These findings, together with the presence of synovial mast cell-monocyte interactions and the inverse association between the expression of mast cell genes at the synovial level and disease activity, suggest that these newly described mast cell-mediated inhibitory pathways might have a functional relevance in the pathogenesis of RA. © 2015, American College of Rheumatology.

  9. A rapid immunization strategy with a live attenuated tetravalent dengue vaccine elicits protective neutralizing antibody responses in non-human primates

    Directory of Open Access Journals (Sweden)

    Yuping eAmbuel

    2014-06-01

    Full Text Available Dengue viruses (DENVs cause approximately 390 million cases of DENV infections annually and over 3 billion people worldwide are at risk of infection. No dengue vaccine is currently available nor is there an antiviral therapy for DENV infections. We have developed a tetravalent live-attenuated DENV vaccine (TDV that consists of a molecularly characterized attenuated DENV-2 strain (TDV-2 and three chimeric viruses containing the pre-membrane and envelope genes of DENV-1, -3 and -4 expressed in the context of the TDV-2 genome. To impact dengue vaccine delivery in endemic areas and immunize travelers, a simple and rapid immunization strategy (RIS is preferred. We investigated RIS consisting of two full vaccine doses being administered subcutaneously or intradermally on the initial vaccination visit (day 0 at two different anatomical locations with a needle-free disposable syringe jet injection (DSJI delivery devices (PharmaJet in non-human primates (NHP. This vaccination strategy resulted in efficient priming and induction of neutralizing antibody responses to all four DENV serotypes comparable to those elicited by the traditional prime and boost (two months later vaccination schedule. In addition, the vaccine induced CD4+ and CD8+ T cells producing IFN-γ, IL-2, and TNF-α, and targeting the DENV-2 NS1, NS3 and NS5 proteins. Moreover, vaccine-specific T cells were cross-reactive with the non-structural NS3 and NS5 proteins of DENV-4. When animals were challenged with DENV-2 they were protected with no detectable viremia, and exhibited sterilizing immunity (no increase of neutralizing titers post- challenge. RIS could decrease vaccination visits and provide quick immune response to all four DENV serotypes. This strategy could increase vaccination compliance and would be especially advantageous for travelers into endemic areas.

  10. Hantaan virus infection induces both Th1 and ThGranzyme B+ cell immune responses that associated with viral control and clinical outcome in humans.

    Directory of Open Access Journals (Sweden)

    Ying Ma

    2015-04-01

    Full Text Available Hantaviruses infection causing severe emerging diseases with high mortality rates in humans has become public health concern globally. The potential roles of CD4(+T cells in viral control have been extensively studied. However, the contribution of CD4(+T cells to the host response against Hantaan virus (HTNV infection remains unclear. Here, based on the T-cell epitopes mapped on HTNV glycoprotein, we studied the effects and characteristics of CD4(+T-cell responses in determining the outcome of hemorrhagic fever with renal syndrome. A total of 79 novel 15-mer T-cell epitopes on the HTNV glycoprotein were identified, among which 20 peptides were dominant target epitopes. Importantly, we showed the presence of both effective Th1 responses with polyfunctional cytokine secretion and ThGranzyme B(+ cell responses with cytotoxic mediators production against HTNV infection. The HTNV glycoprotein-specific CD4(+T-cell responses inversely correlated with the plasma HTNV RNA load in patients. Individuals with milder disease outcomes showed broader epitopes targeted and stronger CD4(+T-cell responses against HTNV glycoproteins compared with more severe patients. The CD4(+T cells characterized by broader antigenic repertoire, stronger polyfunctional responses, better expansion capacity and highly differentiated effector memory phenotype(CD27-CD28-CCR7-CD45RA-CD127(hi would elicit greater defense against HTNV infection and lead to much milder outcome of the disease. The host defense mediated by CD4(+T cells may through the inducing antiviral condition of the host cells and cytotoxic effect of ThGranzyme B+ cells. Thus, these findings highlight the efforts of CD4(+T-cell immunity to HTNV control and provide crucial information to better understand the immune defense against HTNV infection.

  11. Innate immune responses of Drosophila melanogaster are altered by spaceflight.

    Directory of Open Access Journals (Sweden)

    Oana Marcu

    Full Text Available Alterations and impairment of immune responses in humans present a health risk for space exploration missions. The molecular mechanisms underpinning innate immune defense can be confounded by the complexity of the acquired immune system of humans. Drosophila (fruit fly innate immunity is simpler, and shares many similarities with human innate immunity at the level of molecular and genetic pathways. The goals of this study were to elucidate fundamental immune processes in Drosophila affected by spaceflight and to measure host-pathogen responses post-flight. Five containers, each containing ten female and five male fruit flies, were housed and bred on the space shuttle (average orbit altitude of 330.35 km for 12 days and 18.5 hours. A new generation of flies was reared in microgravity. In larvae, the immune system was examined by analyzing plasmatocyte number and activity in culture. In adults, the induced immune responses were analyzed by bacterial clearance and quantitative real-time polymerase chain reaction (qPCR of selected genes following infection with E. coli. The RNA levels of relevant immune pathway genes were determined in both larvae and adults by microarray analysis. The ability of larval plasmatocytes to phagocytose E. coli in culture was attenuated following spaceflight, and in parallel, the expression of genes involved in cell maturation was downregulated. In addition, the level of constitutive expression of pattern recognition receptors and opsonins that specifically recognize bacteria, and of lysozymes, antimicrobial peptide (AMP pathway and immune stress genes, hallmarks of humoral immunity, were also reduced in larvae. In adults, the efficiency of bacterial clearance measured in vivo following a systemic infection with E. coli post-flight, remained robust. We show that spaceflight altered both cellular and humoral immune responses in Drosophila and that the disruption occurs at multiple interacting pathways.

  12. HYPOTHALAMIC NEUROHORMONES AND IMMUNE RESPONSES

    Directory of Open Access Journals (Sweden)

    J. Luis eQuintanar

    2013-08-01

    Full Text Available The aim of this review is to provide a comprehensive examination of the current literature describing the neural-immune interactions, with emphasis on the most recent findings of the effects of neurohormones on immune system. Particularly, the role of hypothalamic hormones such as Thyrotropin-releasing hormone, Corticotropin-releasing hormone and Gonadotropin-releasing hormone. In the past few years, interest has been raised in extrapituitary actions of these neurohormones due to their receptors have been found in many non-pituitary tissues. Also, the receptors are present in immune cells, suggesting an autocrine or paracrine role within the immune system. In general, these neurohormones have been reported to exert immunomodulatory effects on cell proliferation, immune mediators release and cell function. The implications of these findings in understanding the network of hypothalamic neuropeptides and immune system are discussed.

  13. Immune Response of Amebiasis and Immune Evasion by Entamoeba histolytica

    Science.gov (United States)

    Nakada-Tsukui, Kumiko; Nozaki, Tomoyoshi

    2016-01-01

    Entamoeba histolytica is a protozoan parasite and the causative agent of amebiasis. It is estimated approximately 1% of humans are infected with E. histolytica, resulting in an estimate of 100,000 deaths annually. Clinical manifestations of amebic infection range widely from asymptomatic to severe symptoms, including dysentery and extra-intestinal abscesses. Like other infectious diseases, it is assumed that only ~20% of infected individuals develop symptoms, and genetic factors of both the parasite and humans as well as the environmental factors, e.g., microbiota, determine outcome of infection. There are multiple essential steps in amebic infection: degradation of and invasion into the mucosal layer, adherence to the intestinal epithelium, invasion into the tissues, and dissemination to other organs. While the mechanisms of invasion and destruction of the host tissues by the amebae during infection have been elucidated at the molecular levels, it remains largely uncharacterized how the parasite survive in the host by evading and attacking host immune system. Recently, the strategies for immune evasion by the parasite have been unraveled, including immunomodulation to suppress IFN-γ production, elimination of immune cells and soluble immune mediators, and metabolic alterations against reactive oxygen and nitrogen species to fend off the attack from immune system. In this review, we summarized the latest knowledge on immune reaction and immune evasion during amebiasis. PMID:27242782

  14. Immune Response of Amebiasis and Immune Evasion by Entamoeba histolytica.

    Science.gov (United States)

    Nakada-Tsukui, Kumiko; Nozaki, Tomoyoshi

    2016-01-01

    Entamoeba histolytica is a protozoan parasite and the causative agent of amebiasis. It is estimated approximately 1% of humans are infected with E. histolytica, resulting in an estimate of 100,000 deaths annually. Clinical manifestations of amebic infection range widely from asymptomatic to severe symptoms, including dysentery and extra-intestinal abscesses. Like other infectious diseases, it is assumed that only ~20% of infected individuals develop symptoms, and genetic factors of both the parasite and humans as well as the environmental factors, e.g., microbiota, determine outcome of infection. There are multiple essential steps in amebic infection: degradation of and invasion into the mucosal layer, adherence to the intestinal epithelium, invasion into the tissues, and dissemination to other organs. While the mechanisms of invasion and destruction of the host tissues by the amebae during infection have been elucidated at the molecular levels, it remains largely uncharacterized how the parasite survive in the host by evading and attacking host immune system. Recently, the strategies for immune evasion by the parasite have been unraveled, including immunomodulation to suppress IFN-γ production, elimination of immune cells and soluble immune mediators, and metabolic alterations against reactive oxygen and nitrogen species to fend off the attack from immune system. In this review, we summarized the latest knowledge on immune reaction and immune evasion during amebiasis.

  15. Type I strain of Toxoplasma gondii from chicken induced different immune responses with that from human, cat and swine in chicken

    Institute of Scientific and Technical Information of China (English)

    Zhao Guang-wei; Xu Li-xin; LI Xiang-rui; WanG Shuai; WanG Wang; ZhanG Zhen-chao; XIe Qing; ZhanG Meng; I a hassan; Yan Ruo-feng; SonG Xiao-kai

    2015-01-01

    In this study, four strains of Toxoplasma gondi with the same genetic type (Type I) originated from chicken, human, cat and swine were used to compare the immune responses in resistant chicken host to investigate the relationships between the parasite origins and the pathogenicity in certain host. A total of 300, 10-day-old chickens were al ocated randomly into ifve groups which named JS (from chicken), CAT (from cat), CN (from swine), RH (from human) and a negative control group (–Ve) with 60 birds in each group. Tachyzoites of four different T. gondi strains (JS, CAT, CN and RH) were inocu-lated intraperitoneal y with the dose of 1×107 in the four designed groups, respectively. The negative control (–Ve) group was mockly inoculated with phosphate-buffered saline (PBS) alone. Blood and spleen samples were obtained on the day of inoculation (day 0) and at days 4, 11, 25, 39 and 53 post-infection to screen the immunopathological changes. The results demonstrated some different immune characters of T. gondi infected chickens with that of mice or swine previous reported. These differences included up-regulation of major histocompatibility complex class II (MHC II) molecules in the early stage of infection, early peak expressions of interleukin (IL)-12 (IL-12) and-10 (IL-10) and long keep of IL-17. These might partial y contribute to the resistance of chicken to T. gondi infection. Comparisons to chickens infected with strains from human, cat and swine, chickens infected with strain from chicken showed signiifcant high levels of CD4+and CD8+T cel s, interferon gamma (IFN-γ), IL-12 and IL-10. It suggested that the strain from chicken had different ability to stimulate cel ular immunity in chicken.

  16. Immune response in human chromoblastomycosis and eumycetoma - focusing on human interleukin-17A, interferon-gamma, tumour necrosis factor-alpha, interleukin-1 beta and human beta-defensin-2.

    Science.gov (United States)

    Leeyaphan, Charussri; Hau, Carren; Takeoka, Shintaro; Tada, Yayoi; Bunyaratavej, Sumanas; Pattanaprichakul, Penvadee; Sitthinamsuwan, Panitta; Chaiprasert, Angkana; Sasajima, Yuko; Makimura, Koichi; Watanabe, Shinichi

    2016-07-12

    Knowledge regarding host immune response to chromoblastomycosis and eumycetoma is limited, particularly concerning cytokines and antimicrobial peptides production. This was a retrospective study of 12 paraffin-embedded tissue samples from patients diagnosed with chromoblastomycosis or eumycetoma from histological findings and tissue culture. DNA extraction and polymerase chain reaction (PCR) from tissues were done to evaluate human interleukin-17A (IL-17A), interferon-gamma (IFN-γ), tumour necrosis factor-alpha (TNF-α), interleukin-1 beta (IL-1β) and human beta-defensin-2 (HBD-2) expressions. Human beta-actin primer was used for confirming DNA detection, and DNA extracted from psoriasis lesional skin samples was used as positive controls. The twelve paraffin-embedded sections used in this study consisted of five chromoblastomycosis and seven eumycetoma tissues. All PCR reactions showed beta-actin band at 51 bp in all clinical specimens, confirming adequate DNA levels in each reaction. As positive control, the psoriasis skin samples revealed bands for IL-17A at 174 bp, IFN-γ at 273 bp, TNF-α at 360 bp, IL-1β at 276 bp and HBD-2 at 255 bp. For the chromoblastomycosis and eumycetoma tissues, PCR analyses showed IL-17A band at 174 bp in two eumycetoma tissues and HBD-2 band at 255 bp in a chromoblastomycosis tissue. This study demonstrated IL-17A expression in human eumycetoma and HBD-2 expression in human chromoblastomycosis for the first time. However, their role in immune response remains to be elucidated. © 2016 Blackwell Verlag GmbH.

  17. Innate immune response to viral infection.

    Science.gov (United States)

    Koyama, Shohei; Ishii, Ken J; Coban, Cevayir; Akira, Shizuo

    2008-09-01

    In viral infections the host innate immune system is meant to act as a first line defense to prevent viral invasion or replication before more specific protection by the adaptive immune system is generated. In the innate immune response, pattern recognition receptors (PRRs) are engaged to detect specific viral components such as viral RNA or DNA or viral intermediate products and to induce type I interferons (IFNs) and other pro-inflammatory cytokines in the infected cells and other immune cells. Recently these innate immune receptors and their unique downstream pathways have been identified. Here, we summarize their roles in the innate immune response to virus infection, discrimination between self and viral nucleic acids and inhibition by virulent factors and provide some recent advances in the coordination between innate and adaptive immune activation.

  18. Probiotics and lung immune responses.

    Science.gov (United States)

    Forsythe, Paul

    2014-01-01

    There is increasing interest in the potential for microbe-based therapeutic approaches to asthma and respiratory infection. However, to date, clinical trials of probiotics in the treatment of respiratory disease have met with limited success. It is becoming clear that to identify the true therapeutic potential of microbes we must move away from a purely empirical approach to clinical trials and adopt knowledge-based selection of candidate probiotics strains, dose, and means of administration. Animal models have played a key role in the identification of mechanisms underlying the immunomodulatory capacity of specific bacteria. Microbe-induced changes in dendritic cell phenotype and function appear key to orchestrating the multiple pathways, involving inter alia, T cells, natural killer cells, and alveolar macrophages, associated with the protective effect of probiotics. Moving forward, the development of knowledge-based strategies for microbe-based therapeutics in respiratory disease will be aided by greater understanding of how specific bacterial structural motifs activate unique combinations of pattern recognition receptors on dendritic cells and thus direct desired immune responses.

  19. Insoluble β-glucan from the cell wall of Candida albicans induces immune responses of human THP-1 monocytes through Dectin-1

    Institute of Scientific and Technical Information of China (English)

    LI Min; LIU Ze-hu; CHEN Qing; ZHOU Wu-qing; YU Mei-wen; L(U) Gui-xia; L(U) Xue-lian; SHEN Yong-nian; LIU Wei-da; WU Shao-xi

    2009-01-01

    Background β-glucan is the major structure component of Candida albicans (C. albicans) cell wall. It has been demonstrated that Dectin-1 as the principal C-type lectin pattern-recognition receptor (PRR) can recognize fungal β-glucan and induce immune responses. In this study, we sought to clarify whether insoluble β-glucan from the cell wall of C. albicans (CalG) could induce immune responses in human THP-1 monocytes (a human acute monocytic leukemia cell line) and to determine the underlying mechanisms.Methods Human THP-1 monocytes were challenged with CalG in vitro. The mRNA expression of Dectin-1, Toll-like receptors (TLR2), proinflammatory cytokine (TNF-α) and chemokine (IL-8) was assayed by real-time reverse transcription polymerase chain reaction (RT-PCR). The secretion of TNF-α and IL-8 were measured by enzyme-linked immunosorbent assay (ELISA). H2O2 release was determined by microplate fluorescent assay. Western blotting was used to analyze IkB-α phosphorylation and degradation.Results Exposure of THP-1 monocytes to CalG led to increased gene expression and secretion of TNF-α and IL-8.CalG induced H2O2 release in a time-dependent manner. CalG hydrolyzed with zymolyase failed to induce gene expression and secretion of TNF-α, IL-8 and H2O2 release. CalG up-regulated the mRNA of Dectin-1, whereas the mRNA level of TLR2 was not altered. THP-1 monocytes challenged with CalG resulted in the activation of NF-KB in a time-dependent manner. Dectin-1 inhibitor laminarin blocked the CalG-induced production of TNF-α and H2O2 in THP-1 monocytes, but no such effect was observed in pretreatment with anti-TLR2 neutralizing antibody and the LPS inhibitor (polymyxin B).Conclusion CalG may play a role in activation of immune responses in human THP-1 cells through Dectin-1, not TLR2.This work was supported by a grant from National Natural ScienceFoundation of China (No. 30671893).

  20. Polarization of immune responses in fish

    NARCIS (Netherlands)

    Wiegertjes, Geert F.; Wentzel, Annelieke S.; Spaink, Herman P.; Elks, Philip M.; Fink, Inge R.

    2016-01-01

    In this review, we support taking polarized immune responses in teleost fish from a 'macrophage first' point of view, a hypothesis that reverts the dichotomous T helper (TH)1 and TH2 driving forces by building on the idea of conservation of innate immune responses in lower v

  1. DNA Damage Response and Immune Defence: Links and Mechanisms

    Directory of Open Access Journals (Sweden)

    Björn Schumacher

    2016-08-01

    Full Text Available DNA damage plays a causal role in numerous human pathologies including cancer, premature aging and chronic inflammatory conditions. In response to genotoxic insults, the DNA damage response (DDR orchestrates DNA damage checkpoint activation and facilitates the removal of DNA lesions. The DDR can also arouse the immune system by for example inducing the expression of antimicrobial peptides as well as ligands for receptors found on immune cells. The activation of immune signalling is triggered by different components of the DDR including DNA damage sensors, transducer kinases, and effectors. In this review, we describe recent advances on the understanding of the role of DDR in activating immune signalling. We highlight evidence gained into (i which molecular and cellular pathways of DDR activate immune signalling, (ii how DNA damage drives chronic inflammation, and (iii how chronic inflammation causes DNA damage and pathology in humans.

  2. Immune response associated with nonmelanoma skin cancer.

    Science.gov (United States)

    Strickland, F M; Kripke, M L

    1997-10-01

    It is now clear that UV radiation causes nonmelanoma skin cancer in at least two ways: by causing permanent changes in the genetic code and by preventing immunologic recognition of mutant cells. These are interacting rather than separate mechanisms. Damage to DNA results in disregulation of cellular proliferation and initiates immune suppression by stimulating the production of suppressive cytokines. These cytokines contribute to the loss of immunosurveillance. Ultraviolet radiation has both local and systemic immunosuppressive effects. Locally, it depletes and alters antigen-presenting LC at the site of UV irradiation. Systemic suppression results when Ts cells are induced, by altered LC, by inflammatory macrophages that enter the skin following UV irradiation, or by the action of cytokines. Damage to DNA appears to be one of the triggering events in inducing systemic immunosuppression via the release of immunosuppressive cytokines and mediators. Immunologic approaches to treating skin cancers so far have concentrated on nonspecifically stimulating immune cells that infiltrate these tumors, but induction of specific immune responses against these tumors with antitumor vaccines has received little attention as yet. Preventive measures include sun avoidance and the use of sunscreens to prevent DNA damage by UV light. Future strategies may employ means to reverse UV-induced immunosuppression by using anti-inflammatory agents, biologicals that accelerate DNA repair or prevent the generation of immunosuppressive cytokines, and specific immunotherapy with tumor antigens. New approaches for studying the immunology of human skin cancers are needed to accelerate progress in this field.

  3. Size- and shape-dependent foreign body immune response to materials implanted in rodents and non-human primates

    Science.gov (United States)

    Veiseh, Omid; Doloff, Joshua C.; Ma, Minglin; Vegas, Arturo J.; Tam, Hok Hei; Bader, Andrew R.; Li, Jie; Langan, Erin; Wyckoff, Jeffrey; Loo, Whitney S.; Jhunjhunwala, Siddharth; Chiu, Alan; Siebert, Sean; Tang, Katherine; Hollister-Lock, Jennifer; Aresta-Dasilva, Stephanie; Bochenek, Matthew; Mendoza-Elias, Joshua; Wang, Yong; Qi, Merigeng; Lavin, Danya M.; Chen, Michael; Dholakia, Nimit; Thakrar, Raj; Lacík, Igor; Weir, Gordon C.; Oberholzer, Jose; Greiner, Dale L.; Langer, Robert; Anderson, Daniel G.

    2015-06-01

    The efficacy of implanted biomedical devices is often compromised by host recognition and subsequent foreign body responses. Here, we demonstrate the role of the geometry of implanted materials on their biocompatibility in vivo. In rodent and non-human primate animal models, implanted spheres 1.5 mm and above in diameter across a broad spectrum of materials, including hydrogels, ceramics, metals and plastics, significantly abrogated foreign body reactions and fibrosis when compared with smaller spheres. We also show that for encapsulated rat pancreatic islet cells transplanted into streptozotocin-treated diabetic C57BL/6 mice, islets prepared in 1.5-mm alginate capsules were able to restore blood-glucose control for up to 180 days, a period more than five times longer than for transplanted grafts encapsulated within conventionally sized 0.5-mm alginate capsules. Our findings suggest that the in vivo biocompatibility of biomedical devices can be significantly improved simply by tuning their spherical dimensions.

  4. Immunoblot detection of class-specific humoral immune response to outer membrane proteins isolated from Salmonella typhi in humans with typhoid fever.

    Science.gov (United States)

    Ortiz, V; Isibasi, A; García-Ortigoza, E; Kumate, J

    1989-07-01

    The studies reported here were undertaken to assess the ability of the outer membrane proteins (OMPs) of Salmonella typhi to induce a humoral immune response in humans with typhoid fever. OMPs were isolated with the nonionic detergent Triton X-100 and were found to be contaminated with approximately 4% lipopolysaccharide. Sodium dodecyl sulfate-polyacrylamide gel electrophoresis patterns showed protein bands with molecular size ranges from 17 to 70 kilodaltons; the major groups of proteins were those that correspond to the porins and OmpA of gram-negative bacteria. Rabbit antiserum to OMPs or to S. typhi recognized OMPs after absorption with lipopolysaccharide. Sera from patients with typhoid fever contained immunoglobulin M antibodies which reacted with a protein of 28 kilodaltons and immunoglobulin G antibodies which reacted mainly with the porins, as determined by immunoblotting. These results indicate that the porins are the major immunogenic OMPs from S. typhi and that the immune response induced in the infection could be related to the protective status.

  5. Immunoblot detection of class-specific humoral immune response to outer membrane proteins isolated from Salmonella typhi in humans with typhoid fever.

    Science.gov (United States)

    Ortiz, V; Isibasi, A; García-Ortigoza, E; Kumate, J

    1989-01-01

    The studies reported here were undertaken to assess the ability of the outer membrane proteins (OMPs) of Salmonella typhi to induce a humoral immune response in humans with typhoid fever. OMPs were isolated with the nonionic detergent Triton X-100 and were found to be contaminated with approximately 4% lipopolysaccharide. Sodium dodecyl sulfate-polyacrylamide gel electrophoresis patterns showed protein bands with molecular size ranges from 17 to 70 kilodaltons; the major groups of proteins were those that correspond to the porins and OmpA of gram-negative bacteria. Rabbit antiserum to OMPs or to S. typhi recognized OMPs after absorption with lipopolysaccharide. Sera from patients with typhoid fever contained immunoglobulin M antibodies which reacted with a protein of 28 kilodaltons and immunoglobulin G antibodies which reacted mainly with the porins, as determined by immunoblotting. These results indicate that the porins are the major immunogenic OMPs from S. typhi and that the immune response induced in the infection could be related to the protective status. Images PMID:2768450

  6. Moraxella catarrhalis decreases antiviral innate immune responses by down-regulation of TLR3 via inhibition of p53 in human bronchial epithelial cells.

    Science.gov (United States)

    Heinrich, Annina; Haarmann, Helge; Zahradnik, Sabrina; Frenzel, Katrin; Schreiber, Frauke; Klassert, Tilman E; Heyl, Kerstin A; Endres, Anne-Sophie; Schmidtke, Michaela; Hofmann, Jörg; Slevogt, Hortense

    2016-06-01

    Chronic obstructive pulmonary disease (COPD) is complicated by infectious exacerbations with acute worsening of respiratory symptoms. Coinfections of bacterial and viral pathogens are associated with more severe exacerbations. Moraxella catarrhalis is one of the most frequent lower respiratory tract pathogens detected in COPD. We therefore studied the impact of M. catarrhalis on the antiviral innate immune response that is mediated via TLR3 and p53. Molecular interactions between M. catarrhalis and normal human bronchial epithelial (NHBE) cells as well as Beas-2B cells were studied using flow cytometry, quantitative PCR analysis, chromatin immunoprecipitation, RNA interference, and ELISA. M. catarrhalis induces a significant down-regulation of TLR3 in human bronchial epithelial cells. In M. catarrhalis-infected cells, expression of p53 was decreased. We detected a reduced binding of p53 to the tlr3 promoter, resulting in reduced TLR3 gene transcription. M. catarrhalis diminished the TLR3-dependent secretion of IFN-β, IFN-λ, and chemokine (C-X-C motif) ligand 8. In addition in M. catarrhalis infected cells, expression of rhinovirus type 1A RNA was increased compared with uninfected cells. M. catarrhalis reduces antiviral defense functions of bronchial epithelial cells, which may increase susceptibility to viral infections.-Heinrich, A., Haarmann, H., Zahradnik, S., Frenzel, K., Schreiber, F., Klassert, T. E., Heyl, K. A., Endres, A.-S., Schmidtke, M., Hofmann, J., Slevogt, H. Moraxella catarrhalis decreases antiviral innate immune responses by down-regulation of TLR3 via inhibition of p53 in human bronchial epithelial cells.

  7. A change in inflammatory footprint precedes plaque instability: a systematic evaluation of cellular aspects of the adaptive immune response in human atherosclerosis.

    Science.gov (United States)

    van Dijk, R A; Duinisveld, A J F; Schaapherder, A F; Mulder-Stapel, A; Hamming, J F; Kuiper, J; de Boer, O J; van der Wal, A C; Kolodgie, F D; Virmani, R; Lindeman, J H N

    2015-03-26

    Experimental studies characterize adaptive immune response as a critical factor in the progression and complications of atherosclerosis. Yet, it is unclear whether these observations translate to the human situation. This study systematically evaluates cellular components of the adaptive immune response in a biobank of human aortas covering the full spectrum of atherosclerotic disease. A systematic analysis was performed on 114 well-characterized perirenal aortic specimens with immunostaining for T-cell subsets (CD3/4/8/45RA/45RO/FoxP3) and the Th1/non-Th1/Th17 ratio (CD4(+)T-bet(+)/CD4(+)T-bet(-)/CD4(+)/interleukin-17(+) double staining). CD20 and CD138 were used to identify B cells and plasma cells, while B-cell maturation was evaluated by AID/CD21 staining and expression of lymphoid homeostatic CXCL13. Scattered CD4 and CD8 cells with a T memory subtype were found in normal aorta and early, nonprogressive lesions. The total number of T cells increases in progressive atherosclerotic lesions (≈1:5 CD4/CD8 T-cell ratio). A further increase in medial and adventitial T cells is found upon progression to vulnerable lesions.This critical stage is further hallmarked by de novo formation of adventitial lymphoidlike structures containing B cells and plasma cells, a process accompanied by transient expression of CXCL13. A dramatic reduction of T-cell subsets, disappearance of lymphoid structures, and loss of CXCL13 expression characterize postruptured lesions. FoxP3 and Th17 T cells were minimally present throughout the atherosclerotic process. Transient CXCL13 expression, restricted presence of B cells in human atherosclerosis, along with formation of nonfunctional extranodal lymphoid structures in the phase preceding plaque rupture, indicates a "critical" change in the inflammatory footprint before and during plaque destabilization. © 2015 The Authors. Published on behalf of the American Heart Association, Inc., by Wiley Blackwell.

  8. Acquired immune heterogeneity and its sources in human helminth infection.

    Science.gov (United States)

    Bourke, C D; Maizels, R M; Mutapi, F

    2011-02-01

    Similarities in the immunobiology of different parasitic worm infections indicate that co-evolution of humans and helminths has shaped a common anti-helminth immune response. However, recent in vitro and immuno-epidemiological studies highlight fundamental differences and plasticity within host-helminth interactions. The 'trade-off' between immunity and immunopathology inherent in host immune responses occurs on a background of genetic polymorphism, variable exposure patterns and infection history. For the parasite, variation in life-cycle and antigen expression can influence the effector responses directed against them. This is particularly apparent when comparing gastrointestinal and tissue-dwelling helminths. Furthermore, insights into the impact of anti-helminthic treatment and co-infection on acquired immunity suggest that immune heterogeneity arises not from hosts and parasites in isolation, but also from the environment in which immune responses develop. Large-scale differences observed in the epidemiology of human helminthiases are a product of complex host-parasite-environment interactions which, given potential for exposure to parasite antigens in utero, can arise even before a parasite interacts with its human host. This review summarizes key differences identified in human acquired immune responses to nematode and trematode infections of public health importance and explores the factors contributing to these variations.

  9. Adeno-associated virus activates an innate immune response in normal human cells but not in osteosarcoma cells.

    Science.gov (United States)

    Laredj, Leila N; Beard, Peter

    2011-12-01

    Adeno-associated virus (AAV) is a small, DNA-containing dependovirus with promising potential as a gene delivery vehicle. Given the variety of applications of AAV-based vectors in the treatment of genetic disorders, numerous studies have focused on the immunogenicity of recombinant AAV. In general, AAV vectors appear not to induce strong inflammatory responses. We have found that AAV2, when it infects the osteosarcoma cells U2OS, can initiate part of its replicative cycle in the absence of helper virus. This does not occur in untransformed cells. We set out to test whether the cellular innate antiviral defenses control this susceptibility and found that, in nonimmune normal human fibroblasts, AAV2 induces type I interferon production and release and the accumulation of nuclear promyelocytic leukemia bodies. AAV fails to mobilize this defense pathway in the U2OS cells. This permissiveness is in large part due to impairment of the viral sensing machinery in these cells. Our investigations point to Toll-like receptor 9 as a potential intracellular sensor that detects AAV2 and triggers the antiviral state in AAV-infected untransformed cells. Efficient sensing of the AAV genome and the ensuing activation of an innate antiviral response are thus crucial cellular events dictating the parvovirus infectivity in host cells.

  10. A distinct role of Riplet-mediated K63-Linked polyubiquitination of the RIG-I repressor domain in human antiviral innate immune responses.

    Directory of Open Access Journals (Sweden)

    Hiroyuki Oshiumi

    Full Text Available The innate immune system is essential for controlling viral infections, but several viruses have evolved strategies to escape innate immunity. RIG-I is a cytoplasmic viral RNA sensor that triggers the signal to induce type I interferon production in response to viral infection. RIG-I activation is regulated by the K63-linked polyubiquitin chain mediated by Riplet and TRIM25 ubiquitin ligases. TRIM25 is required for RIG-I oligomerization and interaction with the IPS-1 adaptor molecule. A knockout study revealed that Riplet was essential for RIG-I activation. However the molecular mechanism underlying RIG-I activation by Riplet remains unclear, and the functional differences between Riplet and TRIM25 are also unknown. A genetic study and a pull-down assay indicated that Riplet was dispensable for RIG-I RNA binding activity but required for TRIM25 to activate RIG-I. Mutational analysis demonstrated that Lys-788 within the RIG-I repressor domain was critical for Riplet-mediated K63-linked polyubiquitination and that Riplet was required for the release of RIG-I autorepression of its N-terminal CARDs, which leads to the association of RIG-I with TRIM25 ubiquitin ligase and TBK1 protein kinase. Our data indicate that Riplet is a prerequisite for TRIM25 to activate RIG-I signaling. We investigated the biological importance of this mechanism in human cells and found that hepatitis C virus (HCV abrogated this mechanism. Interestingly, HCV NS3-4A proteases targeted the Riplet protein and abrogated endogenous RIG-I polyubiquitination and association with TRIM25 and TBK1, emphasizing the biological importance of this mechanism in human antiviral innate immunity. In conclusion, our results establish that Riplet-mediated K63-linked polyubiquitination released RIG-I RD autorepression, which allowed the access of positive factors to the RIG-I protein.

  11. Expression map of the human exome in CD34+ cells and blood cells: increased alternative splicing in cell motility and immune response genes.

    Directory of Open Access Journals (Sweden)

    Sylvie Tondeur

    Full Text Available BACKGROUND: Hematopoietic cells are endowed with very specific biological functions, including cell motility and immune response. These specific functions are dramatically altered during hematopoietic cell differentiation, whereby undifferentiated hematopoietic stem and progenitor cells (HSPC residing in bone marrow differentiate into platelets, red blood cells and immune cells that exit into the blood stream and eventually move into lymphoid organs or inflamed tissues. The contribution of alternative splicing (AS to these functions has long been minimized due to incomplete knowledge on AS events in hematopoietic cells. PRINCIPAL FINDINGS: Using Human Exon ST 1.0 microarrays, the entire exome expression profile of immature CD34+ HSPC and mature whole blood cells was mapped, compared to a collection of solid tissues and made freely available as an online exome expression atlas (Amazonia Exon! : http://amazonia.transcriptome.eu/exon.php. At a whole transcript level, HSPC strongly expressed EREG and the pluripotency marker DPPA4. Using a differential splicing index scheme (dsi, a list of 849 transcripts differentially expressed between hematopoietic cells and solid tissues was computed, that included NEDD9 and CD74. Some of these genes also underwent alternative splicing events during hematopoietic differentiation, such as INPP4B, PTPLA or COMMD6, with varied contribution of CD3+ T cells, CD19+ B cells, CD14+ or CD15+ myelomonocytic populations. Strikingly, these genes were significantly enriched for genes involved in cell motility, cell adhesion, response to wounding and immune processes. CONCLUSION: The relevance and the precision provided by this exon expression map highlights the contribution of alternative splicing to key feature of blood cells differentiation and function.

  12. Defensins: natural component of human innate immunity.

    Science.gov (United States)

    Jarczak, Justyna; Kościuczuk, Ewa M; Lisowski, Paweł; Strzałkowska, Nina; Jóźwik, Artur; Horbańczuk, Jarosław; Krzyżewski, Józef; Zwierzchowski, Lech; Bagnicka, Emilia

    2013-09-01

    The widespread use of antibiotics has contributed to a huge increase in the number of resistant bacteria. New classes of drugs are therefore being developed of which defensins are a potential source. Defensins are a group of antimicrobial peptides found in different living organisms, involved in the first line of defense in their innate immune response against pathogens. This review summarizes the results of studies of this family of human antimicrobial peptides (AMPs). There is a special emphasis on describing the entire group and individual peptides, history of their discovery, their functions and expression sites. The results of the recent studies on the use of the biologically active peptides in human medicine are also presented. The pharmaceutical potential of human defensins cannot be ignored, especially considering their strong antimicrobial activity and properties such as low molecular weight, reduced immunogenicity, broad activity spectrum and resistance to proteolysis, but there are still many challenges and questions regarding the possibilities of their practical application.

  13. Maturation of the immune response

    NARCIS (Netherlands)

    Altena, van S.E.C.; Meijer, B.; Savelkoul, H.F.J.

    2014-01-01

    The innate immune system depends on features like extracellular and intracellular pattern recognition receptors (PRR) that recognize general molecular patterns. Different types of PRR have been described, identifying microbe-, pathogen-, and danger-associated molecular patterns (abbreviated as MAMP,

  14. Female postmating immune responses, immune system evolution and immunogenic males.

    Science.gov (United States)

    Morrow, Edward H; Innocenti, Paolo

    2012-08-01

    Females in many taxa experience postmating activation of their immune system, independently of any genital trauma or pathogenic attack arising from male-female genital contact. This response has always been interpreted as a product of natural selection as it either prepares the female immune system for antigens arising from an implanted embryo (in the case of placental mammals), or is a "pre-emptive strike" against infection or injury acquired during mating. While the first hypothesis has empirical support, the second is not entirely satisfactory. Recently, studies that have experimentally dissected the postmating responses of Drosophila melanogaster females point to a different explanation: male reproductive peptides/proteins that have evolved in response to postmating male-male competition are directly responsible for activating particular elements of the female immune system. Thus, in a broad sense, males may be said to be immunogenic to females. Here, we discuss a possible direct role of sexual selection/sexual conflict in immune system evolution, in contrast to indirect trade-offs with other life-history traits, presenting the available evidence from a range of taxa and proposing ways in which the competing hypotheses could be tested. The major implication of this review is that immune system evolution is not only a product of natural selection but also that sexual selection and potentially sexual conflict enforces a direct selective pressure. This is a significant shift, and will compel researchers studying immune system evolution and ecological immunity to look beyond the forces generated by parasites and pathogens to those generated by the male ejaculate.

  15. Cervical Carcinogenesis and Immune Response Gene Polymorphisms: A Review

    Directory of Open Access Journals (Sweden)

    Akash M. Mehta

    2017-01-01

    Full Text Available The local immune response is considered a key determinant in cervical carcinogenesis after persistent infection with oncogenic, high-risk human papillomavirus (HPV infections. Genetic variation in various immune response genes has been shown to influence risk of developing cervical cancer, as well as progression and survival among cervical cancer patients. We reviewed the literature on associations of immunogenetic single nucleotide polymorphism, allele, genotype, and haplotype distributions with risk and progression of cervical cancer. Studies on HLA and KIR gene polymorphisms were excluded due to the abundance on literature on that subject. We show that multiple genes and loci are associated with variation in risk of cervical cancer. Rather than one single gene being responsible for cervical carcinogenesis, we postulate that variations in the different immune response genes lead to subtle differences in the effectiveness of the antiviral and antitumour immune responses, ultimately leading to differences in risk of developing cervical cancer and progressive disease after HPV infection.

  16. Cervical Carcinogenesis and Immune Response Gene Polymorphisms: A Review

    Science.gov (United States)

    Mooij, Merel

    2017-01-01

    The local immune response is considered a key determinant in cervical carcinogenesis after persistent infection with oncogenic, high-risk human papillomavirus (HPV) infections. Genetic variation in various immune response genes has been shown to influence risk of developing cervical cancer, as well as progression and survival among cervical cancer patients. We reviewed the literature on associations of immunogenetic single nucleotide polymorphism, allele, genotype, and haplotype distributions with risk and progression of cervical cancer. Studies on HLA and KIR gene polymorphisms were excluded due to the abundance on literature on that subject. We show that multiple genes and loci are associated with variation in risk of cervical cancer. Rather than one single gene being responsible for cervical carcinogenesis, we postulate that variations in the different immune response genes lead to subtle differences in the effectiveness of the antiviral and antitumour immune responses, ultimately leading to differences in risk of developing cervical cancer and progressive disease after HPV infection. PMID:28280748

  17. Innate immune responses in raccoons after raccoon rabies virus infection.

    Science.gov (United States)

    Srithayakumar, Vythegi; Sribalachandran, Hariharan; Rosatte, Rick; Nadin-Davis, Susan A; Kyle, Christopher J

    2014-01-01

    Zoonotic wildlife diseases pose significant health risks not only to their primary vectors but also to humans and domestic animals. Rabies is a lethal encephalitis caused by rabies virus (RV). This RNA virus can infect a range of terrestrial mammals but each viral variant persists in a particular reservoir host. Active management of these host vectors is needed to minimize the negative impacts of this disease, and an understanding of the immune response to RV infection aids strategies for host vaccination. Current knowledge of immune responses to RV infection comes primarily from rodent models in which an innate immune response triggers activation of several genes and signalling pathways. It is unclear, however, how well rodent models represent the immune response of natural hosts. This study investigates the innate immune response of a primary host, the raccoon, to a peripheral challenge using the raccoon rabies virus (RRV). The extent and temporal course of this response during RRV infection was analysed using genes predicted to be upregulated during infection (IFNs; IFN regulatory factors; IL-6; Toll like receptor-3; TNF receptor). We found that RRV activated components of the innate immune system, with changes in levels of transcripts correlated with presence of viral RNA. Our results suggest that natural reservoirs of rabies may not mimic the immune response triggered in rodent models, highlighting the need for further studies of infection in primary hosts.

  18. Regulation of corticotropin releasing hormone receptor type 1 messenger RNA level in Y-79 retinoblastoma cells: potential implications for human stress response and immune/inflammatory reaction

    Directory of Open Access Journals (Sweden)

    N. C. Vamvakopoulos

    1996-01-01

    Full Text Available We report the regulation of type 1 receptor mRNA in Y-79 human retinoblastoma cells, grown in the absence or presence of pharmacological levels of phorbol esters, forskolin, glucocorticoids and their combinations. To control for inducibility and for assessing the sensitivity of the Y-79 system to glucocorticoids, corticotropin releasing hormone mRNA levels were measured in parallel. All treatments stimulated corticotropin releasing hormone receptor type 1 gene expression relative to baseline. A weak suppression of corticotropin releasing hormone mRNA level was observed during dexamethasone treatment. The cell line expressed ten-fold excess of receptor to ligand mRNA under basal conditions. The findings predict the presence of functional phorbol ester, cyclic AMP and glucocorticoid response elements in the promoter region of corticotropin releasing hormone receptor type 1 gene and support a potential role for its product during chronic stress and immune/inflammatory reaction.

  19. EBV Infection of Mice with Reconstituted Human Immune System Components.

    Science.gov (United States)

    Münz, Christian

    2015-01-01

    Epstein-Barr virus (EBV) was discovered 50 years ago as the first candidate human tumor virus. Since then, we have realized that this human γ-herpesvirus establishes persistent infection in the majority of adult humans, but fortunately causes EBV-associated diseases only in few individuals. This is an incredible success story of the human immune system, which controls EBV infection and its transforming capacity for decades. A better understanding of this immune control would not only benefit patients with EBV-associated malignancies, but could also provide clues how to establish such a potent, mostly cell-mediated immune control against other pathogens and tumors. However, the functional relevance of EBV-specific immune responses can only be addressed in vivo, and mice with reconstituted human immune system components (huMice) constitute a small animal model to interrogate the protective value of immune compartments during EBV infection, but also might provide a platform to test EBV-specific vaccines. This chapter will summarize the insights into EBV immunobiology that have already been gained in these models and provide an outlook into promising future avenues to develop this in vivo model of EBV infection and human immune responses further.

  20. Evaluation of Immune Responses Mediated by Listeria-Stimulated Human Dendritic Cells: Implications for Cancer Vaccine Therapy

    Science.gov (United States)

    2015-09-01

    biospecimens followed protocols approved by the Institutional Review Board of Memorial Sloan Kettering Cancer Center (MSKCC). Leukocyte concentrates...Antitumor Immunity and Checkpoint Immunotherapy. Cancer immunology research 2, 926-936 (2014). 17. Wherry, E.J. T cell exhaustion. Nat Immunol 12, 492... Cancer Vaccine Therapy PRINCIPAL INVESTIGATOR: David J. Chung, MD, PhD CONTRACTING ORGANIZATION: Sloan-Kettering Institute for Cancer Research New

  1. Dietary rice bran protects against rotavirus diarrhea and promotes Th1-type immune responses to human rotavirus vaccine in gnotobiotic pigs.

    Science.gov (United States)

    Yang, Xingdong; Wen, Ke; Tin, Christine; Li, Guohua; Wang, Haifeng; Kocher, Jacob; Pelzer, Kevin; Ryan, Elizabeth; Yuan, Lijuan

    2014-10-01

    Rice bran (RB) contains a distinct stoichiometry of phytochemicals that can promote gut mucosal immune responses against enteric pathogens. The effects of RB on rotavirus diarrhea and immunogenicity of an attenuated human rotavirus (HRV) vaccine were evaluated in gnotobiotic pigs. The four treatment groups studied were RB plus vaccine, vaccine only, RB only, and mock control. Pigs in the RB groups were fed the amount of RB that replaced 10% of the pigs' total daily calorie intake from milk starting from 5 days of age until they were euthanized. Pigs in the vaccine groups were orally inoculated with two doses of the attenuated HRV vaccine. A subset of pigs from each group was orally challenged with the homologous virulent HRV on postinoculation day 28. Diarrhea and virus shedding were monitored daily from postchallenge day 0 to day 7. RB feeding significantly protected against diarrhea upon virulent HRV challenge and enhanced the protective rate of the vaccine against rotavirus diarrhea. Consistent with protection, RB significantly increased gamma interferon (IFN-γ)-producing CD4(+) and CD8(+) T cell responses in intestinal and systemic lymphoid tissues. Furthermore, RB also increased the number of total IgM- and IgA-secreting cells, total serum IgM, IgG, and IgA titers, and HRV-specific IgA titers in intestinal contents. RB reduced the numbers of intestinal and systemic HRV-specific IgA and IgG antibody-secreting cells and reduced serum HRV-specific IgA and IgG antibody titers before the challenge. These results demonstrate clear beneficial effects of RB in protection against rotavirus diarrhea and stimulation of nonspecific and HRV-specific immune responses, as well as its biased Th1-type adjuvant effect for the vaccine.

  2. Altered Allogeneic Immune Responses in Middle-Aged Mice

    Institute of Scientific and Technical Information of China (English)

    Yimin Sun; Hanhan Li; Alan N. Langnas; Yong Zhao

    2004-01-01

    It is well known that leukocyte composition, T cell phenotypes and immune function change in aged mice and humans. However, limited and conflicting results on the age-related immune changes in middle-aged mice were reported. Identification of the characteristics of allogeneic immune responses in aging mice may offer important information for transplantation immunology. The major age-related changes in the immune cell phenotypes and function of 12 months old mice include: 1) the significantly decreased CD4+ cell population in the peripheral blood, the major peripheral CD4+ cells is CD45RBlowCD62Llow memory phenotype; 2) the in vitro responses to alloantigens and Con A of splenocytes markedly reduced; 3) the in vivo secondary humoral immune responses to alloantigens significantly declined; 4) the age-related alteration in the thymus mainly occurred in CD4/CD8 double positive (DP) stage; and 5) increased CD80+ and MHC class Ⅱ+ cell population in spleens. Thus, the major age-related immune changes in 12 months old mice occurred in CD4+ T cells in the periphery and DP stage in the thymus, which may subsequently lead to the decreased allogeneic immune responses and the different sensitivity to immunosuppressive drugs and treatments. Further studies on the characteristics of allogeneic immunity in aging individuals may help to determine the appropriated treatment for transplant aging individuals. Cellular & Molecular Immunology. 2004; 1(6) :440-446.

  3. Altered Allogeneic Immune Responses in Middle-Aged Mice

    Institute of Scientific and Technical Information of China (English)

    YiminSun; HanhanLi; AlanN.Langnas

    2004-01-01

    It is well known that leukocyte composition, T cell phenotypes and immune function change in aged mice and humans. However, limited and conflicting results on the age-related immune changes in middle-aged mice were reported. Identification of the characteristics of allogeneic immune responses in aging mice may offer important information for transplantation immunology. The major age-related changes in the immune cell phenotypes and function of 12 months old mice include: 1) the significantly decreased CD4+ cell population in the peripheral blood, the major peripheral CD4+ cells is CD45RBlowCD62Llow memory phenotype; 2) the in vitro responses to alloantigens and Con A of splenocytes markedly reduced; 3) the in vivo secondary humoral immune responses to alloantigens significantly declined; 4) the age-related alteration in the thymus mainly occurred in CD4/CD8 double positive (DP) stage; and 5) increased CD80+ and MHC class II+ cell population in spleens. Thus, the major age-related immune changes in 12 months old mice occurred in CD4+ T cells in the periphery and DP stage in the thymus, which may subsequently lead to the decreased allogeneic immune responses and the different sensitivity to immunosuppressive drugs and treatments. Further studies on the characteristics of allogeneic immunity in aging individuals may help to determine the appropriated treatment for transplant aging individuals. Cellular & Molecular Immunology. 2004;1(6):440-446.

  4. Neuroendocrine and Immune System Responses with Spaceflights

    Science.gov (United States)

    Tipton, Charles M.; Greenleaf, John E.; Jackson, Catherine G. R.

    1996-01-01

    Despite the fact that the first human was in space during 1961 and individuals have existed in a microgravity environment for more than a year, there are limited spaceflight data available on the responses of the neuroendocrine and immune systems. Because of mutual interactions between these respective integrative systems, it is inappropriate to assume that the responses of one have no impact on functions of the other. Blood and plasma volume consistently decrease with spaceflight; hence, blood endocrine and immune constituents will be modified by both gravitational and measurement influences. The majority of the in-flight data relates to endocrine responses that influence fluids and electrolytes during the first month in space. Adrenocorticotropin (ACTH), aldo-sterone. and anti-diuretic hormone (ADH) appear to be elevated with little change in the atrial natriuretic peptides (ANP). Flight results longer than 60 d show increased ADH variability with elevations in angiotensin and cortisol. Although post-flight results are influenced by reentry and recovery events, ACTH and ADH appear to be consistently elevated with variable results being reported for the other hormones. Limited in-flight data on insulin and growth hormone levels suggest they are not elevated to counteract the loss in muscle mass. Post-flight results from short- and long-term flights indicate that thyroxine and insulin are increased while growth hormone exhibits minimal change. In-flight parathyroid hormone (PTH) levels are variable for several weeks after which they remain elevated. Post-flight PTH was increased on missions that lasted either 7 or 237 d, whereas calcitonin concentrations were increased after 1 wk but decreased after longer flights. Leukocytes are elevated in flights of various durations because of an increase in neutrophils. The majority of post-flight data indicates immunoglobulin concentrations are not significantly changed from pre-flight measurements. However, the numbers of T

  5. Partial Sleep Restriction Activates Immune Response-Related Gene Expression Pathways: Experimental and Epidemiological Studies in Humans

    Science.gov (United States)

    Rantanen, Ville; Kronholm, Erkki; Surakka, Ida; van Leeuwen, Wessel M. A.; Lehto, Maili; Matikainen, Sampsa; Ripatti, Samuli; Härmä, Mikko; Sallinen, Mikael; Salomaa, Veikko; Jauhiainen, Matti; Alenius, Harri; Paunio, Tiina; Porkka-Heiskanen, Tarja

    2013-01-01

    Epidemiological studies have shown that short or insufficient sleep is associated with increased risk for metabolic diseases and mortality. To elucidate mechanisms behind this connection, we aimed to identify genes and pathways affected by experimentally induced, partial sleep restriction and to verify their connection to insufficient sleep at population level. The experimental design simulated sleep restriction during a working week: sleep of healthy men (N = 9) was restricted to 4 h/night for five nights. The control subjects (N = 4) spent 8 h/night in bed. Leukocyte RNA expression was analyzed at baseline, after sleep restriction, and after recovery using whole genome microarrays complemented with pathway and transcription factor analysis. Expression levels of the ten most up-regulated and ten most down-regulated transcripts were correlated with subjective assessment of insufficient sleep in a population cohort (N = 472). Experimental sleep restriction altered the expression of 117 genes. Eight of the 25 most up-regulated transcripts were related to immune function. Accordingly, fifteen of the 25 most up-regulated Gene Ontology pathways were also related to immune function, including those for B cell activation, interleukin 8 production, and NF-κB signaling (P<0.005). Of the ten most up-regulated genes, expression of STX16 correlated negatively with self-reported insufficient sleep in a population sample, while three other genes showed tendency for positive correlation. Of the ten most down-regulated genes, TBX21 and LGR6 correlated negatively and TGFBR3 positively with insufficient sleep. Partial sleep restriction affects the regulation of signaling pathways related to the immune system. Some of these changes appear to be long-lasting and may at least partly explain how prolonged sleep restriction can contribute to inflammation-associated pathological states, such as cardiometabolic diseases. PMID:24194869

  6. Partial sleep restriction activates immune response-related gene expression pathways: experimental and epidemiological studies in humans.

    Directory of Open Access Journals (Sweden)

    Vilma Aho

    Full Text Available Epidemiological studies have shown that short or insufficient sleep is associated with increased risk for metabolic diseases and mortality. To elucidate mechanisms behind this connection, we aimed to identify genes and pathways affected by experimentally induced, partial sleep restriction and to verify their connection to insufficient sleep at population level. The experimental design simulated sleep restriction during a working week: sleep of healthy men (N = 9 was restricted to 4 h/night for five nights. The control subjects (N = 4 spent 8 h/night in bed. Leukocyte RNA expression was analyzed at baseline, after sleep restriction, and after recovery using whole genome microarrays complemented with pathway and transcription factor analysis. Expression levels of the ten most up-regulated and ten most down-regulated transcripts were correlated with subjective assessment of insufficient sleep in a population cohort (N = 472. Experimental sleep restriction altered the expression of 117 genes. Eight of the 25 most up-regulated transcripts were related to immune function. Accordingly, fifteen of the 25 most up-regulated Gene Ontology pathways were also related to immune function, including those for B cell activation, interleukin 8 production, and NF-κB signaling (P<0.005. Of the ten most up-regulated genes, expression of STX16 correlated negatively with self-reported insufficient sleep in a population sample, while three other genes showed tendency for positive correlation. Of the ten most down-regulated genes, TBX21 and LGR6 correlated negatively and TGFBR3 positively with insufficient sleep. Partial sleep restriction affects the regulation of signaling pathways related to the immune system. Some of these changes appear to be long-lasting and may at least partly explain how prolonged sleep restriction can contribute to inflammation-associated pathological states, such as cardiometabolic diseases.

  7. Innate immune functions of microglia isolated from human glioma patients

    Directory of Open Access Journals (Sweden)

    Grimm Elizabeth

    2006-03-01

    Full Text Available Abstract Background Innate immunity is considered the first line of host defense and microglia presumably play a critical role in mediating potent innate immune responses to traumatic and infectious challenges in the human brain. Fundamental impairments of the adaptive immune system in glioma patients have been investigated; however, it is unknown whether microglia are capable of innate immunity and subsequent adaptive anti-tumor immune responses within the immunosuppressive tumor micro-environment of human glioma patients. We therefore undertook a novel characterization of the innate immune phenotype and function of freshly isolated human glioma-infiltrating microglia (GIM. Methods GIM were isolated by sequential Percoll purification from patient tumors immediately after surgical resection. Flow cytometry, phagocytosis and tumor cytotoxicity assays were used to analyze the phenotype and function of these cells. Results GIM expressed significant levels of Toll-like receptors (TLRs, however they do not secrete any of the cytokines (IL-1β, IL-6, TNF-α critical in developing effective innate immune responses. Similar to innate macrophage functions, GIM can mediate phagocytosis and non-MHC restricted cytotoxicity. However, they were statistically less able to mediate tumor cytotoxicity compared to microglia isolated from normal brain. In addition, the expression of Fas ligand (FasL was low to absent, indicating that apoptosis of the incoming lymphocyte population may not be a predominant mode of immunosuppression by microglia. Conclusion We show for the first time that despite the immunosuppressive environment of human gliomas, GIM are capable of innate immune responses such as phagocytosis, cytotoxicity and TLR expression but yet are not competent in secreting key cytokines. Further understanding of these innate immune functions could play a critical role in understanding and developing effective immunotherapies to malignant human gliomas.

  8. Immune Response in Hepatitis B Virus Infection

    Science.gov (United States)

    Tan, Anthony; Koh, Sarene; Bertoletti, Antonio

    2015-01-01

    Hepatitis B virus (HBV) can replicate within hepatocytes without causing direct cell damage. The host immune response is, therefore, not only essential to control the spread of virus infection, but it is also responsible for the inflammatory events causing liver pathologies. In this review, we discuss how HBV deals with host immunity and how we can harness it to achieve virus control and suppress liver damage. PMID:26134480

  9. Age of recipient and number of doses differentially impact human B and T cell immune memory responses to HPV vaccination.

    Science.gov (United States)

    Smolen, Kinga K; Gelinas, Laura; Franzen, Lisa; Dobson, Simon; Dawar, Meena; Ogilvie, Gina; Krajden, Mel; Fortuno, Edgardo S; Kollmann, Tobias R

    2012-05-21

    Vaccination is one of the most effective medical interventions. However, optimization of existing as well as design of new vaccines is still mostly conducted empirically; a rational approach to vaccine design is largely prohibited by the lack of insight into the relevant mechanisms underlying immune-mediated protection. To delineate the impact of variables on immune memory formation following vaccination, we took advantage of a trial assessing the role of the age of the recipient and the number of administered doses of the quadrivalent HPV vaccine in a well-characterized longitudinal cohort of girls and young women. We found that age of the recipient and the number of doses administered differentially impact the development of B and T cell memory. Specifically, age of the recipient significantly impacted generation of HPV 18-specific B cell memory, while the number of vaccine doses displayed a significant effect on the development of HPV-specific T cell memory. Our data indicate that rational design of vaccines has to be tailored according to the desired induction of B and/or T cell memory. Copyright © 2012 Elsevier Ltd. All rights reserved.

  10. Exosomes in the Immune Response and Tolerance

    Institute of Scientific and Technical Information of China (English)

    修方明; 曹雪涛

    2004-01-01

    Exosomes, secreted by many live cells, are small non-cell vesicles with nanoparticle-grade size. In addition to the original function of discarding the uselessful membrane molecules, exosomes are involved in a range of immunoregulatory functions. Dendritic cell-derived exosomes and tumor-derived exosomes are the best characterized vesicles with potent antitumor effect by efficienfly inducing immune response. Down-regtdation of immune response or induction of immune tolerance is another interesting function of exosomes, Further functional studies of the exosomes will shed light on the application of exosomes。

  11. Nanomaterial Induced Immune Responses and Cytotoxicity.

    Science.gov (United States)

    Ali, Ashraf; Suhail, Mohd; Mathew, Shilu; Shah, Muhammad Ali; Harakeh, Steve M; Ahmad, Sultan; Kazmi, Zulqarnain; Alhamdan, Mohammed Abdul Rahman; Chaudhary, Adeel; Damanhouri, Ghazi Abdullah; Qadri, Ishtiaq

    2016-01-01

    Nanomaterials are utilized in a wide array of end user products such as pharmaceuticals, electronics, clothes and cosmetic products. Due to its size (< 100 nm), nanoparticles have the propensity to enter through the airway and skin, making its path perilous with the potential to cause damages of varying severity. Once within the body, these particles have unconstrained access to different tissues and organs including the brain, liver, and kidney. As a result, nanomaterials may cause the perturbation of the immune system eliciting an inflammatory response and cytotoxicity. This potential role is dependent on many factors such as the characteristics of the nanomaterials, presence or absence of diseases, and genetic predisposition. Cobalt and nickel nanoparticles, for example, were shown to have inflammogenic properties, while silver nanoparticles were shown to reduce allergic inflammation. Just as asbestos fibers, carbon nanotubes were shown to cause lungs damage. Some nanomaterials were shown, based on animal studies, to result in cell damage, leading to the formation of pre-cancerous lesions. This review highlights the impact of nanomaterials on immune system and its effect on human health with toxicity consideration. It recommends the development of suitable animal models to study the toxicity and bio-clearance of nanomaterials and propose safety guidelines.

  12. Filaggrin silencing by shRNA directly impairs the skin barrier function of normal human epidermal keratinocytes and then induces an immune response

    Energy Technology Data Exchange (ETDEWEB)

    Dang, N.N. [Department of Dermatology, Jinan Central Hospital Affiliated to Shandong University, Jinan, Shandong Province (China); College of Life Science, Shandong Normal University, Jinan, Shandong Province (China); Pang, S.G. [Department of Endocrinology, Jinan Central Hospital Affiliated to Shandong University, Jinan, Shandong Province (China); Song, H.Y. [Department of Dermatology, Jinan Central Hospital Affiliated to Shandong University, Jinan, Shandong Province (China); An, L.G. [College of Life Science, Shandong Normal University, Jinan, Shandong Province (China); Ma, X.L. [Central Laboratory, Jinan Central Hospital Affiliated to Shandong University, Jinan, Shandong Province (China)

    2014-11-14

    The objective of this study was to investigate whether a single defect in skin barrier function simulated by filaggrin silencing could induce Th2-predominant inflammation. Filaggrin gene expression was silenced in cultured normal human epidermal keratinocytes (NHEKs) using small hairpin RNA (shRNA, GTTGGCTCAAGCATATTATTT). The efficacy of silencing was confirmed by polymerase chain reaction (PCR) and Western blotting. Filaggrin-silenced cells (LV group), shRNA control cells (NC group), and noninfected cells (Blank group) were evaluated. The expression of cornified cell envelope-related proteins, including cytokeratin (CK)-5, -10, -14, loricrin, involucrin, and transglutaminase (TGM)-1, was detected by Western blotting. Interleukins (IL)-2, IL-4, IL-5, IL-12p70, IL-13, and interferon-gamma (IFN-γ) were detected by enzyme-linked immunosorbent assay (ELISA). After filaggrin was successfully silenced by shRNA, the expressions of CK-5, -10, -14, involucrin, and TGM-1 in NHEKs were significantly downregulated compared to the Blank and NC groups (P<0.05 or P<0.01); only loricrin expression was markedly upregulated (P<0.01). Filaggrin silencing also resulted in significant increases of IL-2, IL-4, IL-5, and IL-13 (P<0.05 or P<0.01), and significant decreases of IL-12p70 and IFN-γ (P<0.01) compared with cells in the Blank and NC groups. Filaggrin silencing impaired normal skin barrier function mainly by targeting the cornified cell envelope. The immune response after filaggrin silencing was characterized by Th2 cells, mainly because of the inhibition of IFN-γ expression. Lack of filaggrin may directly impair skin barrier function and then further induce the immune response.

  13. Natural immunity has significant impact on immune responses against cancer.

    Science.gov (United States)

    Rubin, B

    2009-03-01

    The immune system defends the host against pathogenic attacks by micro-organisms and their products. It does not react against self-components due to the relatively efficient negative selection of developing T lymphocytes in the thymus. This process does permit T cells with low avidity against self to be present in the T cell repertoire. Such cells play an important physiological role as the host needs so-called autoimmune reactions in order to eliminate dying cells or transformed tumour cells. One of the mysteries in immunology is how the host maintains beneficial autoimmune reactions and avoids pathogenic autoimmune reactions. Activation of the adaptive T lymphocytes is mediated by the low avidity interaction between T-cell antigen receptors and antigenic peptides associated with major histocompatibility complex class I or class II molecules. This interaction is strengthened by T-cell co-receptors such as CD2, CD4, CD8, CD28 and CD154, which react with ligands expressed by cells of the innate immune system. In recent years, the importance of pre-activation of the innate immune system for initiation of adaptive T-cell immune responses has been appreciated. In the present review, I will summarize our work on how natural immunity plays an important role in determining the level of beneficial autoimmune reactions against cancer.

  14. Escaping Deleterious Immune Response in Their Hosts: Lessons from Trypanosomatids

    Science.gov (United States)

    Geiger, Anne; Bossard, Géraldine; Sereno, Denis; Pissarra, Joana; Lemesre, Jean-Loup; Vincendeau, Philippe; Holzmuller, Philippe

    2016-01-01

    The Trypanosomatidae family includes the genera Trypanosoma and Leishmania, protozoan parasites displaying complex digenetic life cycles requiring a vertebrate host and an insect vector. Trypanosoma brucei gambiense, Trypanosoma cruzi, and Leishmania spp. are important human pathogens causing human African trypanosomiasis (HAT or sleeping sickness), Chagas’ disease, and various clinical forms of Leishmaniasis, respectively. They are transmitted to humans by tsetse flies, triatomine bugs, or sandflies, and affect millions of people worldwide. In humans, extracellular African trypanosomes (T. brucei) evade the hosts’ immune defenses, allowing their transmission to the next host, via the tsetse vector. By contrast, T. cruzi and Leishmania sp. have developed a complex intracellular lifestyle, also preventing several mechanisms to circumvent the host’s immune response. This review seeks to set out the immune evasion strategies developed by the different trypanosomatids resulting from parasite–host interactions and will focus on: clinical and epidemiological importance of diseases; life cycles: parasites–hosts–vectors; innate immunity: key steps for trypanosomatids in invading hosts; deregulation of antigen-presenting cells; disruption of efficient specific immunity; and the immune responses used for parasite proliferation. PMID:27303406

  15. Cytokines and immune surveillance in humans

    Science.gov (United States)

    Sonnenfeld, Gerald

    1994-01-01

    Evidence from both human and rodent studies has indicated that alterations in immunological parameters occur after space flight. Among the parameters shown, by us and others, to be affected is the production of interferons. Interferons are a family of cytokines that are antiviral and play a major role in regulating immune responses that control resistance to infection. Alterations in interferon and other cytokine production and activity could result in changes in immunity and a possible compromise of host defenses against both opportunistic and external infections. The purpose of the present study is to explore further the effects of space flight on cyotokines and cytokine-directed immunological function. Among the tests carried out are interferon-alpha production, interferon-gamma production, interleukin-1 and -2 production, signal transduction in neutrophils, signal transduction in monocytes, and monocyte phagocytic activity. The experiments will be performed using peripheral blood obtained from human subjects. It is our intent to eventually carry out these experiments using astronauts as subjects to determine the effects of space flight on cytokine production and activity. However, these subjects are not currently available. Until they become available, we will carry out these experiments using subjects maintained in the bed-rest model for microgravity.

  16. The immune landscape of human tumors

    Science.gov (United States)

    Bindea, Gabriela; Mlecnik, Bernhard; Angell, Helen K; Galon, Jérôme

    2014-01-01

    Understanding the spontaneous immune response of cancer patients is critical for the design of efficient anticancer immunotherapies. The power of integrative tumor immunology approaches allowed for a comprehensive view of the immune system evolution in the course of tumor progression and recurrence. We have demonstrated that tumor-infiltrating immune cells are spatiotemporally regulated, a finding that has profound implications for the development of efficient anticancer immunotherapies. PMID:24800163

  17. Enhancement of human adaptive immune responses by administration of a high-molecular-weight polysaccharide extract from the cyanobacterium Arthrospira platensis

    DEFF Research Database (Denmark)

    Pedersen, Morten Løbner; Walsted, Anette; Larsen, Rune

    2008-01-01

    The effect of consumption of Immulina, a high-molecular-weight polysaccharide extract from the cyanobacterium Arthrospira platensis, on adaptive immune responses was investigated by evaluation of changes in leukocyte responsiveness to two foreign recall antigens, Candida albicans (CA) and tetanus...

  18. Human intestinal dendritic cells as controllers of mucosal immunity

    Directory of Open Access Journals (Sweden)

    David Bernardo

    2013-06-01

    Full Text Available Dendritic cells are the most potent, professional antigen-presenting cells in the body; following antigen presentation they control the type (proinflammatory/regulatory of immune response that will take place, as well as its location. Given their high plasticity and maturation ability in response to local danger signals derived from innate immunity, dendritic cells are key actors in the connection between innate immunity and adaptive immunity responses. In the gut dendritic cells control immune tolerance mechanisms against food and/or commensal flora antigens, and are also capable of initiating an active immune response in the presence of invading pathogens. Dendritic cells are thus highly efficient in controlling the delicate balance between tolerance and immunity in an environment so rich in antigens as the gut, and any factor involving these cells may impact their function, ultimately leading to the development of bowel conditions such as celiac disease or inflammatory bowel disease. In this review we shall summarize our understanding of human intestinal dendritic cells, their ability to express and induce migration markers, the various environmental factors modulating their properties, their subsets in the gut, and the problems entailed by their study, including identification strategies, differences between humans and murine models, and phenotypical variations along the gastrointestinal tract.

  19. Expression of IL-8, IL-6 and IL-1β in tears as a main characteristic of the immune response in human microbial keratitis.

    Science.gov (United States)

    Santacruz, Concepcion; Linares, Marisela; Garfias, Yonathan; Loustaunau, Luisa M; Pavon, Lenin; Perez-Tapia, Sonia Mayra; Jimenez-Martinez, Maria C

    2015-03-03

    Corneal infections are frequent and potentially vision-threatening diseases, and despite the significance of the immunological response in animal models of microbial keratitis (MK), it remains unclear in humans. The aim of this study was to describe the cytokine profile of tears in patients with MK. Characteristics of ocular lesions such as size of the epithelial defect, stromal infiltration, and hypopyon were analyzed. Immunological evaluation included determination of interleukine (IL)-1β, IL-6, IL-8, IL-10, IL-12 and tumor necrosis factor (TNF)-α in tear samples obtained from infected eyes of 28 patients with MK and compared with their contralateral non-infected eyes. Additionally, frequency of CD4+, CD8+, CD19+ and CD3-CD56+ cells was also determined in peripheral blood mononuclear cells in patients with MK, and compared with 48 healthy controls. Non-significant differences were observed in the size of the epithelial defect, stromal infiltration, and hypopyon. Nevertheless, we found an immunological profile apparently related to MK etiology. IL-8 > IL-6 in patients with bacterial keratitis; IL-8 > IL-6 > IL-1β and increased frequency of circulating CD3-CD56+ NK cells in patients with gram-negative keratitis; and IL-8 = IL-6 > IL-1β in patients with fungal keratitis. Characterization of tear cytokines from patients with MK could aid our understanding of the immune pathophysiological mechanisms underlying corneal damage in humans.

  20. Echovirus 6 Infects Human Exocrine and Endocrine Pancreatic Cells and Induces Pro-Inflammatory Innate Immune Response

    Directory of Open Access Journals (Sweden)

    Luis Sarmiento

    2017-01-01

    Full Text Available Human enteroviruses (HEV, especially coxsackievirus serotype B (CVB and echovirus (E, have been associated with diseases of both the exocrine and endocrine pancreas, but so far evidence on HEV infection in human pancreas has been reported only in islets and ductal cells. This study aimed to investigate the capability of echovirus strains to infect human exocrine and endocrine pancreatic cells. Infection of explanted human islets and exocrine cells with seven field strains of E6 caused cytopathic effect, virus titer increase and production of HEV protein VP1 in both cell types. Virus particles were found in islets and acinar cells infected with E6. No cytopathic effect or infectious progeny production was observed in exocrine cells exposed to the beta cell-tropic strains of E16 and E30. Endocrine cells responded to E6, E16 and E30 by upregulating the transcription of interferon-induced with helicase C domain 1 (IF1H1, 2'-5'-oligoadenylate synthetase 1 (OAS1, interferon-β (IFN-β, chemokine (C–X–C motif ligand 10 (CXCL10 and chemokine (C–C motif ligand 5 (CCL5. Echovirus 6, but not E16 or E30, led to increased transcription of these genes in exocrine cells. These data demonstrate for the first time that human exocrine cells represent a target for E6 infection and suggest that certain HEV serotypes can replicate in human pancreatic exocrine cells, while the pancreatic endocrine cells are permissive to a wider range of HEV.

  1. Human Pancreatic Cancer Cells Induce a MyD88-Dependent Stromal Response to Promote a Tumor-Tolerant Immune Microenvironment.

    Science.gov (United States)

    Delitto, Daniel; Delitto, Andrea E; DiVita, Bayli B; Pham, Kien; Han, Song; Hartlage, Emily R; Newby, Brittney N; Gerber, Michael H; Behrns, Kevin E; Moldawer, Lyle L; Thomas, Ryan M; George, Thomas J; Brusko, Todd M; Mathews, Clayton E; Liu, Chen; Trevino, Jose G; Hughes, Steven J; Wallet, Shannon M

    2017-02-01

    Cancer cells exert mastery over the local tumor-associated stroma (TAS) to configure protective immunity within the tumor microenvironment. The immunomodulatory character of pancreatic lysates of patients with cancer differs from those with pancreatitis. In this study, we evaluated the cross-talk between pancreatic cancer and its TAS in primary human cell culture models. Upon exposure of TAS to pancreatic cancer cell-conditioned media, we documented robust secretion of IL6 and IL8. This TAS response was MyD88-dependent and sufficient to directly suppress both CD4(+) and CD8(+) T-cell proliferation, inducing Th17 polarization at the expense of Th1. We found that patients possessed a similar shift in circulating effector memory Th17:Th1 ratios compared with healthy controls. The TAS response also directly suppressed CD8(+) T-cell-mediated cytotoxicity. Overall, our results demonstrate how TAS contributes to the production of an immunosuppressive tumor microenvironment in pancreatic cancer. Cancer Res; 77(3); 672-83. ©2016 AACR.

  2. Association of HLA-DR3 with human immune response to Lol p I and Lol p II allergens in allergic subjects.

    Science.gov (United States)

    Freidhoff, L R; Ehrlich-Kautzky, E; Meyers, D A; Ansari, A A; Bias, W B; Marsh, D G

    1988-04-01

    Associations between HLA type and IgE or IgG antibody (Ab) responses to two well-characterized, antigenetically non-crossreactive components of Lolium perenne (rye grass) pollen extract, Lol p I (Rye I) and Lol p II (Rye II) were studied in two groups of skin-test positive (ST+) Caucasoid adults. By both nonparametric and parametric statistical methods, significant associations were found between Ab responses to both Lol I and Lol II and the possession of HLA-DR3. In view of the well-known associations of both DR3 and B8 (which are in linkage disequilibrium) with many autoimmune diseases, differences in anti-Lol I and anti-Lol II mean log[Ab] levels between B8+, DR3- vs B8-, DR3- subjects and B8+, DR3+ vs B8-, DR3+ subjects were investigated. No differences were found. Our data, along with recent RFLP and DNA sequence studies, suggest that an Ia molecule involved in immune recognition of a similar major Ia recognition site of both the Lol molecules may consist of a DR3 alpha-beta I pair. Abbreviations used: Ab: Antibody. HLA: Human leukocyte antigen. Lol p I, Lol I: Group I allergen from Lolium perenne pollen (Rye I). Lol p II, Lol II: Group II allergen from Lolium perenne pollen (Rye II). Mr: Relative molecular mass. Rx: Immunotherapy with grass pollen extracts. ST: Skin test.

  3. Effect of short-term intralipid infusion on the immune response during low-dose endotoxemia in humans

    DEFF Research Database (Denmark)

    Krogh-Madsen, R.; Plomgaard, P.; Åkerström, Thorbjörn

    2008-01-01

    on the inflammatory response to a low dose of endotoxin. Fourteen healthy male volunteers underwent the following two trials in a randomized crossover design: 1) continuous infusion of 20% Intralipid [0.7 ml.kg(-1).h(-1) (1.54 g/kg)] for 11 h, and 2) infusion of isotonic saline for 11 h (control). In each trial....... The systemic inflammatory response to endotoxin was significantly pronounced during Intralipid infusion. Short-term hyperlipidemia enhances the inflammatory response to endotoxin, and skeletal muscle and adipose tissue are capable of producing essential inflammatory mediators after endotoxin stimulation......Novel anti-inflammatory effects of insulin have recently been described, and insulin therapy to maintain euglycemia suppresses the plasma levels of free fatty acids (FFA) and increases the survival of critically ill patients. We aimed to explore the effect of short-term high levels of plasma FFA...

  4. Enhancement of human adaptive immune responses by administration of a high-molecular-weight polysaccharide extract from the cyanobacterium Arthrospira platensis

    DEFF Research Database (Denmark)

    Løbner, Morten; Walsted, Anette; Larsen, Rune

    2008-01-01

    administration for 3 days (P TNF-alpha, IFN-gamma, and IL-6 responses to TT were enhanced after 8 and 14 days (P responses increased significantly within 3 days (P ... below baseline levels after 14 days (P responses to both CA and TT (P responses were observed. Upon addition to normal mononuclear cells in vitro, Immulina elicited strong TNF-alpha, IL-1......beta, and IL-6 responses, indicating that it acts by inducing a pro-inflammatory state. Taken together, the data suggest that Immulina causes an age-dependent, temporary enhancement of adaptive immune responses....

  5. Influence of prevaccination immunity on the human B-lymphocyte response to a Haemophilus influenzae type b conjugate vaccine

    DEFF Research Database (Denmark)

    Barington, T; Kristensen, K; Henrichsen, J

    1991-01-01

    of Haemophilus influenzae type b capsular polysaccharide (PRP) and diphtheria toxoid (DT), and the response was related to the prevaccination levels of PRP and DT antibodies. Positive correlations were found between increases in plasma PRP (median, 32.0 micrograms/ml) and DT (1.14 IU/ml) antibodies and numbers...... of circulating PRP and DT antibody-secreting cells (AbSC) (postvaccination days 6 to 9). The B-cell responses (antibody response and AbSC) to both PRP and DT correlated positively with prevaccination levels of anti-DT. DT AbSC appeared earlier (peak, day 7) than PRP AbSC (peak, day 8). Individuals whose PRP Ab......SC peaked early (day 7) had higher prevaccination anti-DT levels than those who peaked later (P less than 0.05). In contrast, the prevaccination levels of anti-PRP did not correlate significantly with the magnitude of the antibody or AbSC response and did not affect the kinetics of the AbSC. Following...

  6. [Cellular immunity in human periapical granuloma].

    Science.gov (United States)

    Terrié, B; Grégoire, G

    1991-03-01

    Numerous authors have produced different types of immunoglobulins in analyses of the human periapical granuloma. The present study examines the cellular immunity of the human periapical granuloma, and in particular the distribution of the lymphocyte sub-populations and the macrophage population. The technique used was that of cell surface marking, using monoclonal antibodies on frozen sections. The results reveal equal proportions of inductor T lymphocytes and suppressor T lymphocytes (whereas healthy tissue shows a ratio of 2/1), which explains the chronic nature of the lesion as far as the immune reaction is concerned. The presence of numerous macrophage cells shows that there are important local immune reactions.

  7. Senescence of T Lymphocytes: Implications for Enhancing Human Immunity.

    Science.gov (United States)

    Akbar, Arne N; Henson, Sian M; Lanna, Alessio

    2016-12-01

    As humans live longer, a central concern is to find ways to maintain their health as they age. Immunity declines during ageing, as shown by the increased susceptibility to infection by both previously encountered and new pathogens and by the decreased efficacy of vaccination. It is therefore crucial to understand the mechanisms responsible for this decrease in immunity and to develop new strategies to enhance immune function in older humans. We discuss here how the induction of senescence alters leukocyte, and specifically T cell, function. An emerging concept is that senescence and nutrient sensing-signalling pathways within T cells converge to regulate functional responses, and the manipulation of these pathways may offer new ways to enhance immunity during ageing. Copyright © 2016 Elsevier Ltd. All rights reserved.

  8. Liver immune-pathogenesis and therapy of human liver tropic virus infection in humanized mouse models.

    Science.gov (United States)

    Bility, Moses T; Li, Feng; Cheng, Liang; Su, Lishan

    2013-08-01

    Hepatitis B virus (HBV) and hepatitis C virus (HCV) infect and replicate primarily in human hepatocytes. Few reliable and easy accessible animal models are available for studying the immune system's contribution to the liver disease progression during hepatitis virus infection. Humanized mouse models reconstituted with human hematopoietic stem cells (HSCs) have been developed to study human immunology, human immunodeficiency virus 1 infection, and immunopathogenesis. However, a humanized mouse model engrafted with both human immune and human liver cells is needed to study infection and immunopathogenesis of HBV/HCV infection in vivo. We have recently developed the humanized mouse model with both human immune and human liver cells (AFC8-hu HSC/Hep) to study immunopathogenesis and therapy of HCV infection in vivo. In this review, we summarize the current models of HBV/HCV infection and their limitations in immunopathogenesis. We will then present our recent findings of HCV infection and immunopathogenesis in the AFC8-hu HSC/Hep mouse, which supports HCV infection, human T-cell response and associated liver pathogenesis. Inoculation of humanized mice with primary HCV isolates resulted in long-term HCV infection. HCV infection induced elevated infiltration of human immune cells in the livers of HCV-infected humanized mice. HCV infection also induced HCV-specific T-cell immune response in lymphoid tissues of humanized mice. Additionally, HCV infection induced liver fibrosis in humanized mice. Anti-human alpha smooth muscle actin (αSMA) staining showed elevated human hepatic stellate cell activation in HCV-infected humanized mice. We discuss the limitation and future improvements of the AFC8-hu HSC/Hep mouse model and its application in evaluating novel therapeutics, as well as studying both HCV and HBV infection, human immune responses, and associated human liver fibrosis and cancer.

  9. Human tumor-derived genomic DNA transduced into a recipient cell induces tumor-specific immune responses ex vivo

    OpenAIRE

    2002-01-01

    This article describes a DNA-based vaccination strategy evaluated ex vivo with human cells. The vaccine was prepared by transferring tumor-derived genomic DNA to PCI-13 cells, a highly immunogenic tumor cell line (“recipient cell”), which had been genetically modified to secrete IL-2 (PCI-13/IL-2). PCI-13 cells expressed class I MHC determinants (HLA-A2) shared with the tumor from which the DNA was obtained as well as allogeneic determinants. DNA from a gp100+ melanoma ce...

  10. Prostaglandin E2 and IL-23 plus IL-1β differentially regulate the Th1/Th17 immune response of human CD161(+) CD4(+) memory T cells.

    Science.gov (United States)

    Barrie, Arthur; Khare, Anupriya; Henkel, Matthew; Zhang, Yingze; Barmada, M Michael; Duerr, Richard; Ray, Anuradha

    2011-08-01

    Prostaglandin E2 (PGE2), interleukin (IL)-23, and IL-1beta (β) propagate inflammatory bowel disease (IBD) by enhancing the development and function of IL-17 producing CD4(+) T helper (Th17) cells. CD4(+) T cells that express the C-type lectin-like receptor CD161 have been proposed to be the physiologic pool of circulating Th17 cells implicated in IBD. We sought to understand how PGE2, alone and in combination with IL-23 and IL-1β, modulate human peripheral CD161(+) CD4(+) memory T cells. We found that CD161(+) cells comprise a significant proportion of human peripheral CD4(+) memory T cells. PGE2 and IL-23 plus IL-1β synergistically induced early IL-17A secretion from CD161(+) CD4(+) memory T cells and the selective enrichment of IL-17A(+) CD161(+) CD4(+) memory T cells in culture. Conversely, IL-23 plus IL-1β partially opposed the PGE2-mediated repression of early interferon gamma (IFN-γ) secretion from CD161(+) cells, as well as the PGE2-mediated depletion of IFN-γ(+) CD161(+) cells. Our results suggest that PGE2 and IL-23 plus IL-1β induce the Th17 immune response preferentially in CD161(+) CD4(+) memory T cells, while divergently regulating their ability to express IFN-γ. We hypothesize that Th17-mediated chronic inflammation in IBD depends on the net response of CD161(+) CD4(+) memory T cells to both PGE2 and IL-23 plus IL-1β. © 2011 Wiley Periodicals, Inc.

  11. Transforming Growth Factor Beta Is a Major Regulator of Human Neonatal Immune Responses following Respiratory Syncytial Virus Infection▿ †

    Science.gov (United States)

    Thornburg, Natalie J.; Shepherd, Bryan; Crowe, James E.

    2010-01-01

    Respiratory syncytial virus (RSV) is a major cause of morbidity and mortality. Previous studies have suggested that T-cell responses may contribute to RSV immunopathology, which could be driven by dendritic cells (DCs). DCs are productively infected by RSV, and during RSV infections, there is an increase of DCs in the lungs with a decrease in the blood. Pediatric populations are particularly susceptible to severe RSV infections; however, DC responses to RSV from pediatric populations have not been examined. In this study, primary isolated DCs from cord blood and adult peripheral blood were compared after RSV infection. Transcriptional profiling and biological network analysis identified transforming growth factor beta (TGF-β) and associated signaling molecules as differentially regulated in the two age groups. TGF-β1 was decreased in RSV-infected adult-blood DCs but increased in RSV-infected cord blood DCs. Coculture of adult RSV-infected DCs with autologous T cells induced secretion of gamma interferon (IFN-γ), interleukin 12p70 (IL-12p70), IL-2, and tumor necrosis factor alpha (TNF-α). Conversely, coculture of cord RSV-infected DCs and autologous T cells induced secretion of IL-4, IL-6, IL-1β, and IL-17. Addition of purified TGF-β1 to adult DC-T-cell cocultures reduced secretion of IFN-γ, IL-12p70, IL-2, and TNF-α, while addition of a TGF-β chemical inhibitor to cord DC-T-cell cocultures increased secretion of IL-12p70. These data suggest that TGF-β acts as a major regulator of RSV DC-T-cell responses, which could contribute to immunopathology during infancy. PMID:20926560

  12. Autophagy suppresses host adaptive immune responses toward Borrelia burgdorferi

    NARCIS (Netherlands)

    Buffen, Kathrin; Oosting, Marije; Li, Yang; Kanneganti, Thirumala-Devi; Netea, Mihai G.; Joosten, Leo A. B.

    2016-01-01

    Inhibition of autophagy increases the severity of murine Lyme arthritis and human adaptive immune responses against B. burgdorferi. We have previously demonstrated that inhibition of autophagy increased the Borrelia burgdorferi induced innate cytokine production in vitro, but little is known regardi

  13. Immune Response to Ebola Virus Infection

    Directory of Open Access Journals (Sweden)

    Alain Alonso Remedios

    2016-06-01

    Full Text Available Ebola virus belongs to the family Filoviridae and causes a highly lethal hemorrhagic fever. Affected patients show an impaired immune response as a result of the evasion mechanisms employed by the virus. Cathepsin is an enzyme present in the granules of phagocytes which cleaves viral surface glycoproteins, allowing virus entry into the host cell. In addition, this virus is resistant to the antiviral effects of type I interferon, promotes the synthesis of proinflammatory cytokines and induces apoptosis of monocytes and lymphocytes. It also induces an incomplete activation of dendritic cells, thus avoiding the presentation of viral antigens. Although specific antibodies are produced after the first week, their neutralizing capacity is doubtful. The virus evades the immune response and replicates uncontrollably in the host. This paper aims to summarize the main characteristics of the immune response to Ebola virus infection.

  14. Balancing immune protection and immune pathology by CD8+ T cell responses to influenza infection

    Directory of Open Access Journals (Sweden)

    Susu eDuan

    2016-02-01

    Full Text Available Influenza A virus (IAV is a significant human pathogen causing annual epidemics and periodic pandemics. CD8+ cytotoxic T lymphocyte (CTL-mediated immunity contributes to clearance of virus-infected cells; CTL immunity targeting the conserved internal proteins of IAVs is a key protection mechanism when neutralizing antibodies are absent during heterosubtypic IAV infection. However, CTL infiltration into the airways, their cytotoxicity, and the effects of produced pro-inflammatory cytokines can cause severe lung tissue injury, thereby contributing to immunopathology. Studies have discovered complicated and exquisite stimulatory and inhibitory mechanisms that regulate CTL magnitude and effector activities during IAV infection. Here, we review the state of knowledge on the roles of IAV-specific CTLs in immune protection and immunopathology during IAV infection in animal models, highlighting the key findings of various requirements and constraints regulating the balance of immune protection and pathology involved in CTL immunity. We also discuss the evidence of cross-reactive CTL immunity as a positive correlate of cross-subtype protection during secondary IAV infection in both animal and human studies. We argue that the effects of CTL immunity on protection and immunopathology depend on multiple layers of host and viral factors, including complex host mechanisms to regulate CTL magnitude and effector activity, the pathogenic nature of the IAV, the innate response milieu, and the host historical immune context of influenza infection. Future efforts are needed to further understand these key host and viral factors, especially to differentiate those that constrain optimally effective CTL anti-viral immunity from those necessary to restrain CTL-mediated nonspecific immunopathology in the various contexts of IAV infection, in order to develop better vaccination and therapeutic strategies for modifying protective CTL immunity.

  15. Radiation triggering immune response and inflammation.

    Science.gov (United States)

    Hekim, Nezih; Cetin, Zafer; Nikitaki, Zacharenia; Cort, Aysegul; Saygili, Eyup Ilker

    2015-11-28

    Radiation therapy (RT) is a well-established but still under optimization branch of Cancer Therapy (CT). RT uses electromagnetic waves or charged particles in order to kill malignant cells, by accumulating the energy onto these cells. The issue at stake for RT, as well as for any other Cancer Therapy technique, is always to kill only cancer cells, without affecting the surrounding healthy ones. This perspective of CT is usually described under the terms "specificity" and "selectivity". Specificity and selectivity are the ideal goal, but the ideal is never entirely achieved. Thus, in addition to killing healthy cells, changes and effects are observed in the immune system after irradiation. In this review, we mainly focus on the effects of ionizing radiation on the immune system and its components like bone marrow. Additionally, we are interested in the effects and benefits of low-dose ionizing radiation on the hematopoiesis and immune response. Low dose radiation has been shown to induce biological responses like inflammatory responses, innate immune system activation and DNA repair (adaptive response). This review reveals the fact that there are many unanswered questions regarding the role of radiation as either an immune-activating (low dose) or immunosuppressive (high dose) agent.

  16. The immune responses of the coral

    Directory of Open Access Journals (Sweden)

    C Toledo-Hernández

    2014-11-01

    Full Text Available Corals are among the most ancient extant animals on earth. Currently, coral viability is threatened, due in part to the increased number of diseases affecting them in recent decades. Understanding how the innate immune systems of corals function is important if we want to predict the fate of corals and their response to the environmental and biological changes they face. In this review we discuss the latest findings regarding the innate immune systems of corals. The review is organized following the chronology of steps taken by corals from the initial encounter with a potential pathogen and recognition of threats to the orchestration of a response. We begin with the literature describing the repertory of immune-related receptors involved in the recognition of threats and the subsequent pathways leading to an immune response. We then review the effector responses that eliminate the threats described for corals. Finally, we acknowledge the literature of coral microbiology to access the potential role of microbes as an essential constituent of the coral immune system.

  17. Probiotics, antibiotics and the immune responses to vaccines.

    Science.gov (United States)

    Praharaj, Ira; John, Sushil M; Bandyopadhyay, Rini; Kang, Gagandeep

    2015-06-19

    Orally delivered vaccines have been shown to perform poorly in developing countries. There are marked differences in the structure and the luminal environment of the gut in developing countries resulting in changes in immune and barrier function. Recent studies using newly developed technology and analytic methods have made it increasingly clear that the intestinal microbiota activate a multitude of pathways that control innate and adaptive immunity in the gut. Several hypotheses have been proposed for the underperformance of oral vaccines in developing countries, and modulation of the intestinal microbiota is now being tested in human clinical trials. Supplementation with specific strains of probiotics has been shown to have modulatory effects on intestinal and systemic immune responses in animal models and forms the basis for human studies with vaccines. However, most studies published so far that have evaluated the immune response to vaccines in children and adults have been small and results have varied by age, antigen, type of antibody response and probiotic strain. Use of anthelminthic drugs in children has been shown to possibly increase immunogenicity following oral cholera vaccination, lending further support to the rationale for modulation of the immune response to oral vaccination through the intestinal microbiome. © 2015 The Author(s) Published by the Royal Society. All rights reserved.

  18. Restoration of Immune Response by a Cationic Amphiphilic Drug (AY 9944) In Vitro: A New Approach To Chemotherapy against Human Immunodeficiency Virus Type 1

    Science.gov (United States)

    Achour, Ammar; Landureau, Jean-Charles; Salerno-Concalves, Rosangela; Mazière, Jean-Claude; Zagury, Daniel

    1998-01-01

    AY 9944 [AY; trans-1,4-bis(chlorobenzylaminomethyl)-cyclohexane dihydrochloride], an inhibitor of sterol synthesis, was found to help restore the normal mitogenic responses and cytokine profiles of peripheral mononuclear cells (PBMCs) from AIDS patients in vitro. Compared to untreated cells, the human immunodeficiency virus type 1 (HIV-1)-infected PBMCs precultured in the presence of AY exhibited a normal rate of either mitogen-induced or recall- and superantigen-induced proliferation. After 2 weeks in the presence of the drug, the percentage of dead CD4+ cells in HIV-1-infected cultures was comparable to that observed in uninfected cultures, while over the same time interval it increased by three- to fivefold in HIV-1-infected cultures maintained in the absence of AY. AY also stimulated by 2- to 12-fold interleukin-12 (IL-12) and (gamma interferon production. For IL-12, this effect appears to be related to an increase in corresponding IL-12 p35 and IL-12 p40 mRNA levels. Moreover, AY restored the expression of the IL-2 receptor, which was severely impaired in HIV-1-infected PBMCs. Although the drug has no direct antiviral effect (it does not significantly inhibit reverse transcriptase activity measured in vitro), it might be considered a potential therapeutic agent for HIV-infected patients, in that it may correct viral infection-related immune system defects by indirectly enhancing the level of resistance to HIV and opportunistic infections. PMID:9756745

  19. Immunity to viruses: learning from successful human vaccines.

    Science.gov (United States)

    Pulendran, Bali; Oh, Jason Z; Nakaya, Helder I; Ravindran, Rajesh; Kazmin, Dmitri A

    2013-09-01

    For more than a century, immunologists and vaccinologists have existed in parallel universes. Immunologists have for long reveled in using 'model antigens', such as chicken egg ovalbumin or nitrophenyl haptens, to study immune responses in model organisms such as mice. Such studies have yielded many seminal insights about the mechanisms of immune regulation, but their relevance to humans has been questioned. In another universe, vaccinologists have relied on human clinical trials to assess vaccine efficacy, but have done little to take advantage of such trials for studying the nature of immune responses to vaccination. The human model provides a nexus between these two universes, and recent studies have begun to use this model to study the molecular profile of innate and adaptive responses to vaccination. Such 'systems vaccinology' studies are beginning to provide mechanistic insights about innate and adaptive immunity in humans. Here, we present an overview of such studies, with particular examples from studies with the yellow fever and the seasonal influenza vaccines. Vaccination with the yellow fever vaccine causes a systemic acute viral infection and thus provides an attractive model to study innate and adaptive responses to a primary viral challenge. Vaccination with the live attenuated influenza vaccine causes a localized acute viral infection in mucosal tissues and induces a recall response, since most vaccinees have had prior exposure to influenza, and thus provides a unique opportunity to study innate and antigen-specific memory responses in mucosal tissues and in the blood. Vaccination with the inactivated influenza vaccine offers a model to study immune responses to an inactivated immunogen. Studies with these and other vaccines are beginning to reunite the estranged fields of immunology and vaccinology, yielding unexpected insights about mechanisms of viral immunity. Vaccines that have been proven to be of immense benefit in saving lives offer us a new

  20. A nonequilibrium phase transition in immune response

    Institute of Scientific and Technical Information of China (English)

    Zhang Wei; Qi An-Shen

    2004-01-01

    The dynamics of immune response correlated to signal transduction in immune thymic cells (T cells) is studied.In particular, the problem of the phosphorylation of the immune-receptor tyrosine-based activation motifs (ITAM) is explored. A nonlinear model is established on the basis of experimental observations. The behaviours of the model can be well analysed using the concepts of nonequilibrium phase transitions. In addition, the Riemann-Hugoniot cusp catastrophe is demonstrated by the model. Due to the application of the theory of nonequilibrium phase transitions,the biological phenomena can be clarified more precisely. The results can also be used to further explain the signal transduction and signal discrimination of an important type of immune T cell.

  1. The immune response against Candida spp. and Sporothrix schenckii.

    Science.gov (United States)

    Martínez-Álvarez, José A; Pérez-García, Luis A; Flores-Carreón, Arturo; Mora-Montes, Héctor M

    2014-01-01

    Candida albicans is the main causative agent of systemic candidiasis, a condition with high mortality rates. The study of the interaction between C. albicans and immune system components has been thoroughly studied and nowadays there is a model for the anti-C. albicans immune response; however, little is known about the sensing of other pathogenic species of the Candida genus. Sporothrix schenckii is the causative agent of sporotrichosis, a subcutaneous mycosis, and thus far there is limited information about its interaction with the immune system. In this paper, we review the most recent information about the immune sensing of species from genus Candida and S. schenckii. Thoroughly searches in scientific journal databases were performed, looking for papers addressing either Candida- or Sporothrix-immune system interactions. There is a significant advance in the knowledge of non-C. albicans species of Candida and Sporothrix immune sensing; however, there are still relevant points to address, such as the specific contribution of pathogen-associated molecular patterns (PAMPs) for sensing by different immune cells and the immune receptors involved in such interactions. This manuscript is part of the series of works presented at the "V International Workshop: Molecular genetic approaches to the study of human pathogenic fungi" (Oaxaca, Mexico, 2012).

  2. Mice with human immune system components as in vivo models for infections with human pathogens.

    Science.gov (United States)

    Rämer, Patrick C; Chijioke, Obinna; Meixlsperger, Sonja; Leung, Carol S; Münz, Christian

    2011-03-01

    Many pathogens relevant to human disease do not infect other animal species. Therefore, animal models that reconstitute or harbor human tissues are explored as hosts for these. In this review, we will summarize recent advances to utilize mice with human immune system components, reconstituted from hematopoietic progenitor cells in vivo. Such mice can be used to study human pathogens that replicate in leukocytes. In addition to studying the replication of these pathogens, the reconstituted human immune system components can also be analyzed for initiating immune responses and control against these infections. Moreover, these new animal models of human infectious disease should replicate the reactivity of the human immune system to vaccine candidates and, especially, the adjuvants contained in them, more faithfully.

  3. [Immune system evolution. (From cells to humans)].

    Science.gov (United States)

    Belek, A S

    1992-01-01

    The great variety of cells and molecules observed in the mammalian immune system can be explained by stepwise acquisition of them during phylogeny. Self/nonself discrimination and cell-mediated immunity have been present since the early stages of evolution. Although some inducible antimicrobial molecules have been demonstrated in invertebrates, immunoglobulins appear in vertebrates. T and B cell diversity, development of the lymphoid organs, MHC molecules, complement and cytokines are the characteristics that appear through the evolution of vertebrates. Further knowledge that will be obtained from phylogenetic studies will improve our understanding of the immune system of human.

  4. Crosstalk between microbiota, pathogens and the innate immune responses.

    Science.gov (United States)

    Günther, Claudia; Josenhans, Christine; Wehkamp, Jan

    2016-08-01

    Research in the last decade has convincingly demonstrated that the microbiota is crucial in order to prime and orchestrate innate and adaptive immune responses of their host and influence barrier function as well as multiple developmental and metabolic parameters of the host. Reciprocally, host reactions and immune responses instruct the composition of the microbiota. This review summarizes recent evidence from experimental and human studies which supports these arms of mutual relationship and crosstalk between host and resident microbiota, with a focus on innate immune responses in the gut, the role of cell death pathways and antimicrobial peptides. We also provide some recent examples on how dysbiosis and pathogens can act in concert to promote intestinal infection, inflammatory pathologies and cancer. The future perspectives of these combined research efforts include the discovery of protective species within the microbiota and specific traits and factors of microbes that weaken or enforce host intestinal homeostasis.

  5. Enhancing Immune Responses for Cancer Therapy

    Institute of Scientific and Technical Information of China (English)

    Shao-An Xue; Hans J Stauss

    2007-01-01

    Although the immune system possesses the means to respond to cancer, it often fails to control the spread of malignancy. Nonetheless, equipping endogenous immunity to release a strong antitumor response has significant advantages over conventional therapies. This review explores some of the options available to accomplish this,focusing first on vaccinations with tumor antigens to stimulate the immune system and empower stronger antitumor responses. We then compare and contrast the so-far limited clinical success of vaccination with the well-documented curative potential of adoptive therapy using T lymphocytes transfer. Finally, we highlight novel approaches using T cell receptor (TCR) gene transfer strategy to exploit allogeneic T cell repertoires in conjunction with receptors selected in vitro for defined MHC/peptide combinations, as a basis for antigen-specific gene therapy of cancers.

  6. Human dendritic cell DC-SIGN and TLR-2 mediate complementary immune regulatory activities in response to Lactobacillus rhamnosus JB-1.

    Science.gov (United States)

    Konieczna, Patrycja; Schiavi, Elisa; Ziegler, Mario; Groeger, David; Healy, Selena; Grant, Ray; O'Mahony, Liam

    2015-01-01

    The microbiota is required for optimal host development and ongoing immune homeostasis. Lactobacilli are common inhabitants of the mammalian large intestine and immunoregulatory effects have been described for certain, but not all, strains. The mechanisms underpinning these protective effects are beginning to be elucidated. One such protective organism is Lactobacillus rhamnosus JB-1 (Lb. rhamnosus JB-1). Lb. murinus has no such anti-inflammatory protective effects and was used as a comparator organism. Human monocyte-derived dendritic cells (MDDCs) were co-incubated with bacteria and analysed over time for bacterial adhesion and intracellular processing, costimulatory molecule expression, cytokine secretion and induction of lymphocyte polarization. Neutralising antibodies were utilized to identify the responsible MDDC receptors. Lb. rhamnosus JB-1 adhered to MDDCs, but internalization and intracellular processing was significantly delayed, compared to Lb. murinus which was rapidly internalized and processed. Lb. murinus induced CD80 and CD86 expression, accompanied by high levels of cytokine secretion, while Lb. rhamnosus JB-1 was a poor inducer of costimulatory molecule expression and cytokine secretion. Lb. rhamnosus JB-1 primed MDDCs induced Foxp3 expression in autologous lymphocytes, while Lb. murinus primed MDDCs induced Foxp3, T-bet and Ror-γt expression. DC-SIGN was required for Lb. rhamnosus JB-1 adhesion and influenced IL-12 secretion, while TLR-2 influenced IL-10 and IL-12 secretion. Here we demonstrate that the delayed kinetics of bacterial processing by MDDCs correlates with MDDC activation and stimulation of lymphocytes. Thus, inhibition or delay of intracellular processing may be a novel strategy by which certain commensals may avoid the induction of proinflammatory responses.

  7. CD47(low status on CD4 effectors is necessary for the contraction/resolution of the immune response in humans and mice.

    Directory of Open Access Journals (Sweden)

    Vu Quang Van

    Full Text Available How do effector CD4 T cells escape cell death during the contraction of the immune response (IR remain largely unknown. CD47, through interactions with thrombospondin-1 (TSP-1 and SIRP-α, is implicated in cell death and phagocytosis of malignant cells. Here, we reported a reduction in SIRP-α-Fc binding to effector memory T cells (T(EM and in vitro TCR-activated human CD4 T cells that was linked to TSP-1/CD47-induced cell death. The reduced SIRP-α-Fc binding (CD47(low status was not detected when CD4 T cells were stained with two anti-CD47 mAbs, which recognize distinct epitopes. In contrast, increased SIRP-α-Fc binding (CD47(high status marked central memory T cells (T(CM as well as activated CD4 T cells exposed to IL-2, and correlated with resistance to TSP-1/CD47-mediated killing. Auto-aggressive CD4 effectors, which accumulated in lymph nodes and at mucosal sites of patients with Crohn's disease, displayed a CD47(high status despite a high level of TSP-1 release in colonic tissues. In mice, CD47 (CD47(low status was required on antigen (Ag-specific CD4 effectors for the contraction of the IR in vivo, as significantly lower numbers of Ag-specific CD47(+/+CD4 T cells were recovered when compared to Ag-specific CD47(-/- CD4 T cells. In conclusion, we demonstrate that a transient change in the status of CD47, i.e. from CD47(high to CD47(low, on CD4 effectors regulates the decision-making process that leads to CD47-mediated cell death and contraction of the IR while maintenance of a CD47(high status on tissue-destructive CD4 effectors prevents the resolution of the inflammatory response.

  8. Human dendritic cell DC-SIGN and TLR-2 mediate complementary immune regulatory activities in response to Lactobacillus rhamnosus JB-1.

    Directory of Open Access Journals (Sweden)

    Patrycja Konieczna

    Full Text Available The microbiota is required for optimal host development and ongoing immune homeostasis. Lactobacilli are common inhabitants of the mammalian large intestine and immunoregulatory effects have been described for certain, but not all, strains. The mechanisms underpinning these protective effects are beginning to be elucidated. One such protective organism is Lactobacillus rhamnosus JB-1 (Lb. rhamnosus JB-1. Lb. murinus has no such anti-inflammatory protective effects and was used as a comparator organism. Human monocyte-derived dendritic cells (MDDCs were co-incubated with bacteria and analysed over time for bacterial adhesion and intracellular processing, costimulatory molecule expression, cytokine secretion and induction of lymphocyte polarization. Neutralising antibodies were utilized to identify the responsible MDDC receptors. Lb. rhamnosus JB-1 adhered to MDDCs, but internalization and intracellular processing was significantly delayed, compared to Lb. murinus which was rapidly internalized and processed. Lb. murinus induced CD80 and CD86 expression, accompanied by high levels of cytokine secretion, while Lb. rhamnosus JB-1 was a poor inducer of costimulatory molecule expression and cytokine secretion. Lb. rhamnosus JB-1 primed MDDCs induced Foxp3 expression in autologous lymphocytes, while Lb. murinus primed MDDCs induced Foxp3, T-bet and Ror-γt expression. DC-SIGN was required for Lb. rhamnosus JB-1 adhesion and influenced IL-12 secretion, while TLR-2 influenced IL-10 and IL-12 secretion. Here we demonstrate that the delayed kinetics of bacterial processing by MDDCs correlates with MDDC activation and stimulation of lymphocytes. Thus, inhibition or delay of intracellular processing may be a novel strategy by which certain commensals may avoid the induction of proinflammatory responses.

  9. Role of AKT and ERK pathways in controlling sensitivity to ionizing radiation and adaptive response induced by low-dose radiation in human immune cells.

    Science.gov (United States)

    Park, Hyung Sun; You, Ga Eun; Yang, Kwang Hee; Kim, Ji Young; An, Sungkwan; Song, Jie-Young; Lee, Su-Jae; Lim, Young-Khi; Nam, Seon Young

    2015-12-01

    Despite many studies of the effect of ionizing radiation, biological mechanisms of action might differ greatly depend on dose, dose rate, and cell type. This study was performed to explore the effects of low- and high-dose radiation in human immune cell lines. We examined cell sensitivity after irradiation with 0.05, 0.1, or 2Gy in two normal cell lines and three tumor cell lines. Low-dose radiation of 0.05 and 0.1Gy had no effect on cell survival in any tested cell line, with the exception of IM-9 cells, whose viability was transiently increased. However, IM-9 and C1R-sB7 cells were very sensitive to high-dose radiation-induced cell death, whereas Jurkat and JM1 cells showed moderate sensitivity, and THP-1 cells were completely resistant. This radiosensitivity was correlated with basal AKT activation, which is induced by phosphorylation. In radiosensitive IM-9 cells, priming with chronic low-dose irradiation blocked cell death induced by high-dose radiation challenge via inhibition of caspase activation and PARP cleavage. AKT phosphorylation was not altered in IM-9 cells, but ERK phosphorylation was greatly elevated immediately after chronic low-dose irradiation. Taken together, our results suggest that the different responses of normal and tumor cells to low-dose and high-dose radiation depend on AKT activation, which is regulated by protein phosphatase 2 (PP2A). In radiosensitive normal cells lacking basal AKT activity, chronic low-dose radiation increases activation of the ERK pathway, which plays an important role in the adaptive response to radiation, providing a very important insight into understanding the effects of ionizing radiation on health. Copyright © 2015 Elsevier GmbH. All rights reserved.

  10. Stochastic optimal therapy for enhanced immune response.

    Science.gov (United States)

    Stengel, Robert F; Ghigliazza, Raffaele

    2004-10-01

    Therapeutic enhancement of humoral immune response to microbial attack is addressed as the stochastic optimal control of a dynamic system. Without therapy, the modeled immune response depends upon the initial concentration of pathogens in a simulated attack. Immune response can be augmented by agents that kill the pathogen directly, that stimulate the production of plasma cells or antibodies, or that enhance organ health. Using a generic mathematical model of immune response to the infection (i.e., of the dynamic state of the system), previous papers demonstrated optimal (open-loop) and neighboring-optimal (closed-loop) control solutions that defeat the pathogen and preserve organ health, given initial conditions that otherwise would be lethal [Optimal Contr. Appl. Methods 23 (2002) 91, Bioinformatics 18 (2002) 1227]. Therapies based on separate and combined application of the agents were derived by minimizing a quadratic cost function that weighted both system response and drug usage, providing implicit control over harmful side effects. Here, we focus on the effects that corrupted or incomplete measurements of the dynamic state may have on neighboring-optimal feedback control. Imperfect measurements degrade the precision of feedback adjustments to therapy; however, optimal state estimation allows the feedback strategy to be implemented with incomplete measurements and minimizes the expected effects of measurement error. Complete observability of the perturbed state for this four state example is provided by measurement of four of the six possible pairs of two variables, either set of three variables, or all four variables. The inclusion of state estimation extends the applicability of optimal control theory for developing new therapeutic protocols to enhance immune response.

  11. Differential regional immune response in Chagas disease.

    Directory of Open Access Journals (Sweden)

    Juliana de Meis

    Full Text Available Following infection, lymphocytes expand exponentially and differentiate into effector cells to control infection and coordinate the multiple effector arms of the immune response. Soon after this expansion, the majority of antigen-specific lymphocytes die, thus keeping homeostasis, and a small pool of memory cells develops, providing long-term immunity to subsequent reinfection. The extent of infection and rate of pathogen clearance are thought to determine both the magnitude of cell expansion and the homeostatic contraction to a stable number of memory cells. This straight correlation between the kinetics of T cell response and the dynamics of lymphoid tissue cell numbers is a constant feature in acute infections yielded by pathogens that are cleared during the course of response. However, the regional dynamics of the immune response mounted against pathogens that are able to establish a persistent infection remain poorly understood. Herein we discuss the differential lymphocyte dynamics in distinct central and peripheral lymphoid organs following acute infection by Trypanosoma cruzi, the causative agent of Chagas disease. While the thymus and mesenteric lymph nodes undergo a severe atrophy with massive lymphocyte depletion, the spleen and subcutaneous lymph nodes expand due to T and B cell activation/proliferation. These events are regulated by cytokines, as well as parasite-derived moieties. In this regard, identifying the molecular mechanisms underlying regional lymphocyte dynamics secondary to T. cruzi infection may hopefully contribute to the design of novel immune intervention strategies to control pathology in this infection.

  12. SUMO-Enriched Proteome for Drosophila Innate Immune Response

    Science.gov (United States)

    Handu, Mithila; Kaduskar, Bhagyashree; Ravindranathan, Ramya; Soory, Amarendranath; Giri, Ritika; Elango, Vijay Barathi; Gowda, Harsha; Ratnaparkhi, Girish S.

    2015-01-01

    Small ubiquitin-like modifier (SUMO) modification modulates the expression of defense genes in Drosophila, activated by the Toll/nuclear factor-κB and immune-deficient/nuclear factor-κB signaling networks. We have, however, limited understanding of the SUMO-modulated regulation of the immune response and lack information on SUMO targets in the immune system. In this study, we measured the changes to the SUMO proteome in S2 cells in response to a lipopolysaccharide challenge and identified 1619 unique proteins in SUMO-enriched lysates. A confident set of 710 proteins represents the immune-induced SUMO proteome and analysis suggests that specific protein domains, cellular pathways, and protein complexes respond to immune stress. A small subset of the confident set was validated by in-bacto SUMOylation and shown to be bona-fide SUMO targets. These include components of immune signaling pathways such as Caspar, Jra, Kay, cdc42, p38b, 14-3-3ε, as well as cellular proteins with diverse functions, many being components of protein complexes, such as prosß4, Rps10b, SmD3, Tango7, and Aats-arg. Caspar, a human FAF1 ortholog that negatively regulates immune-deficient signaling, is SUMOylated at K551 and responds to treatment with lipopolysaccharide in cultured cells. Our study is one of the first to describe SUMO proteome for the Drosophila immune response. Our data and analysis provide a global framework for the understanding of SUMO modification in the host response to pathogens. PMID:26290570

  13. Protective immune responses in lawsonia intracellularis infections

    DEFF Research Database (Denmark)

    Cordes, Henriette; Riber, Ulla; Boutrup, Torsten;

    and no increase in acute phase response after challenge with a pathogenic isolate. Here we show results from measurements of serology as well as cell-mediated immune responses from this experiment. We found that Lawsonia-specific IgA peaked in serum around day 17-24 after a primary infection in experimentally......Lawsonia intracellularis is the cause of porcine proliferative enteropathy, one of the major causes of antibiotics usage in modern pig production. L. intracellularis is an obligate intracellular bacterium preferable infecting epithelial cells of pigs intestine. We have demonstrated earlier......, but exhibited a high, but short-lasting peak after re-infection. Specific IFN responses were also measured using a whole blood IFN-γ assay. These were very high in challenge infected and re-infected animals as compared to controls. These specific immune responses may contribute to the explanation of mechanisms...

  14. HPV - immune response to infection and vaccination

    Directory of Open Access Journals (Sweden)

    Stanley Margaret

    2010-10-01

    Full Text Available Abstract HPV infection in the genital tract is common in young sexually active individuals, the majority of whom clear the infection without overt clinical disease. However most of those who develop benign lesions eventually mount an effective cell mediated immune (CMI response and the lesions regress. Failure to develop effective CMI to clear or control infection results in persistent infection and, in the case of the oncogenic HPVs, an increased probability of progression to CIN3 and invasive carcinoma. The prolonged duration of infection associated with HPV seems to be associated with effective evasion of innate immunity thus delaying the activation of adaptive immunity. Natural infections in animals show that neutralising antibody to the virus coat protein L1 is protective suggesting that this would be an effective prophylactic vaccine strategy. The current prophylactic HPV VLP vaccines are delivered i.m. circumventing the intra-epithelial immune evasion strategies. These vaccines generate high levels of antibody and both serological and B cell memory as evidenced by persistence of antibody and robust recall responses. However there is no immune correlate - no antibody level that correlates with protection. Recent data on how HPV infects basal epithelial cells and how antibody can prevent this provides a mechanistic explanation for the effectiveness of HPV VLP vaccines.

  15. Mass Cytometry of the Human Mucosal Immune System Identifies Tissue- and Disease-Associated Immune Subsets.

    Science.gov (United States)

    van Unen, Vincent; Li, Na; Molendijk, Ilse; Temurhan, Mine; Höllt, Thomas; van der Meulen-de Jong, Andrea E; Verspaget, Hein W; Mearin, M Luisa; Mulder, Chris J; van Bergen, Jeroen; Lelieveldt, Boudewijn P F; Koning, Frits

    2016-05-17

    Inflammatory intestinal diseases are characterized by abnormal immune responses and affect distinct locations of the gastrointestinal tract. Although the role of several immune subsets in driving intestinal pathology has been studied, a system-wide approach that simultaneously interrogates all major lineages on a single-cell basis is lacking. We used high-dimensional mass cytometry to generate a system-wide view of the human mucosal immune system in health and disease. We distinguished 142 immune subsets and through computational applications found distinct immune subsets in peripheral blood mononuclear cells and intestinal biopsies that distinguished patients from controls. In addition, mucosal lymphoid malignancies were readily detected as well as precursors from which these likely derived. These findings indicate that an integrated high-dimensional analysis of the entire immune system can identify immune subsets associated with the pathogenesis of complex intestinal disorders. This might have implications for diagnostic procedures, immune-monitoring, and treatment of intestinal diseases and mucosal malignancies.

  16. Microarray Analysis of Mercury-Induced Changes in Gene Expression in Human Liver Carcinoma (HepG2 Cells: Importance in Immune Responses

    Directory of Open Access Journals (Sweden)

    Paul B. Tchounwou

    2006-06-01

    p = 0.05 according to the Welch’s ANOVA/Welch’s t-test. Further analyses of affected genes identified genes located on all human chromosomes except chromosome 22 with higher than normal effects on genes found on chromosomes 1-14, 17-20 (sex-determining region Y-box18SRY, 21 (splicing factor, arginine/serine-rich 15 and ATP-binding, and X (including BCL6-co-repressor. These genes are categorized as control and regulatory genes for metabolic pathways involving the cell cycle (cyclin-dependent kinases, apoptosis, cytokine expression, Na+/K+ ATPase, stress responses, G-protein signal transduction, transcription factors, DNA repair as well as metal-regulatory transcription factor 1, MTF1 HGNC, chondroitin sulfate proteoglycan 5 (neuroglycan C, ATPbinding cassette, sub-family G (WHITE, cytochrome b-561 family protein, CDC-like kinase 1 (CLK1 HGNC (protein tyrosine kinase STY, Na+/H+ exchanger regulatory factor (NHERF HGNC, potassium voltage-gated channel subfamily H member 2 (KCNH2, putative MAPK activating protein (PM20, PM21, ras homolog gene family, polymerase (DNA directed, δ regulatory subunit (50kDa, leptin receptor involved in hematopoietin/interferon-class (D200-domain cytokine receptor activity and thymidine kinase 2, mitochondrial TK2 HGNC and related genes. Significant alterations in these specific genes provide new directions for deeper mechanistic investigations that would lead to a better understanding of the molecular basis of mercury-induced toxicity and human diseases that may result from disturbances in the immune system.

  17. A novel mouse model for stable engraftment of a human immune system and human hepatocytes.

    Directory of Open Access Journals (Sweden)

    Helene Strick-Marchand

    Full Text Available Hepatic infections by hepatitis B virus (HBV, hepatitis C virus (HCV and Plasmodium parasites leading to acute or chronic diseases constitute a global health challenge. The species tropism of these hepatotropic pathogens is restricted to chimpanzees and humans, thus model systems to study their pathological mechanisms are severely limited. Although these pathogens infect hepatocytes, disease pathology is intimately related to the degree and quality of the immune response. As a first step to decipher the immune response to infected hepatocytes, we developed an animal model harboring both a human immune system (HIS and human hepatocytes (HUHEP in BALB/c Rag2-/- IL-2Rγc-/- NOD.sirpa uPAtg/tg mice. The extent and kinetics of human hepatocyte engraftment were similar between HUHEP and HIS-HUHEP mice. Transplanted human hepatocytes were polarized and mature in vivo, resulting in 20-50% liver chimerism in these models. Human myeloid and lymphoid cell lineages developed at similar frequencies in HIS and HIS-HUHEP mice, and splenic and hepatic compartments were humanized with mature B cells, NK cells and naïve T cells, as well as monocytes and dendritic cells. Taken together, these results demonstrate that HIS-HUHEP mice can be stably (> 5 months and robustly engrafted with a humanized immune system and chimeric human liver. This novel HIS-HUHEP model provides a platform to investigate human immune responses against hepatotropic pathogens and to test novel drug strategies or vaccine candidates.

  18. A novel mouse model for stable engraftment of a human immune system and human hepatocytes.

    Science.gov (United States)

    Strick-Marchand, Helene; Dusséaux, Mathilde; Darche, Sylvie; Huntington, Nicholas D; Legrand, Nicolas; Masse-Ranson, Guillemette; Corcuff, Erwan; Ahodantin, James; Weijer, Kees; Spits, Hergen; Kremsdorf, Dina; Di Santo, James P

    2015-01-01

    Hepatic infections by hepatitis B virus (HBV), hepatitis C virus (HCV) and Plasmodium parasites leading to acute or chronic diseases constitute a global health challenge. The species tropism of these hepatotropic pathogens is restricted to chimpanzees and humans, thus model systems to study their pathological mechanisms are severely limited. Although these pathogens infect hepatocytes, disease pathology is intimately related to the degree and quality of the immune response. As a first step to decipher the immune response to infected hepatocytes, we developed an animal model harboring both a human immune system (HIS) and human hepatocytes (HUHEP) in BALB/c Rag2-/- IL-2Rγc-/- NOD.sirpa uPAtg/tg mice. The extent and kinetics of human hepatocyte engraftment were similar between HUHEP and HIS-HUHEP mice. Transplanted human hepatocytes were polarized and mature in vivo, resulting in 20-50% liver chimerism in these models. Human myeloid and lymphoid cell lineages developed at similar frequencies in HIS and HIS-HUHEP mice, and splenic and hepatic compartments were humanized with mature B cells, NK cells and naïve T cells, as well as monocytes and dendritic cells. Taken together, these results demonstrate that HIS-HUHEP mice can be stably (> 5 months) and robustly engrafted with a humanized immune system and chimeric human liver. This novel HIS-HUHEP model provides a platform to investigate human immune responses against hepatotropic pathogens and to test novel drug strategies or vaccine candidates.

  19. Sublingual nucleotides and immune response to exercise

    Directory of Open Access Journals (Sweden)

    Ostojic Sergej M

    2012-07-01

    Full Text Available Abstract Evidence exists regarding the potential role of exogenous nucleotides as regulators of the immune function in physically active humans, yet the potential use of nucleotides has been hindered by their low bioavailability after oral administration. We conducted a double-blind, placebo-controlled, randomized trial to assess the effect of sublingual nucleotides (50 mg/day on salivary and serum immunity indicators as compared to placebo, both administered to healthy males aged 20 to 25 years for 14 days. Sublingual administration of nucleotides for 14 days increased serum immunoglobulin A, natural killer cells count and cytotoxic activity, and offset the post-exercise drop of salivary immunoglobulins and lactoferrin (P  0.05. It seems that sublingual administration of nucleotides for two weeks considerably affected immune function in healthy males.

  20. Innate immune responses in hepatitis C virus infection.

    Science.gov (United States)

    Li, Kui; Lemon, Stanley M

    2013-01-01

    Hepatitis C virus (HCV) is a major causative agent of chronic hepatitis and hepatocellular carcinoma worldwide and thus poses a significant public health threat. A hallmark of HCV infection is the extraordinary ability of the virus to persist in a majority of infected people. Innate immune responses represent the front line of defense of the human body against HCV immediately after infection. They also play a crucial role in orchestrating subsequent HCV-specific adaptive immunity that is pivotal for viral clearance. Accumulating evidence suggests that the host has evolved multifaceted innate immune mechanisms to sense HCV infection and elicit defense responses, while HCV has developed elaborate strategies to circumvent many of these. Defining the interplay of HCV with host innate immunity reveals mechanistic insights into hepatitis C pathogenesis and informs approaches to therapy. In this review, we summarize recent advances in understanding innate immune responses to HCV infection, focusing on induction and effector mechanisms of the interferon antiviral response as well as the evasion strategies of HCV.

  1. Readapting the adaptive immune response - therapeutic strategies for atherosclerosis.

    Science.gov (United States)

    Sage, Andrew P; Mallat, Ziad

    2017-01-04

    Cardiovascular diseases remain a major global health issue, with the development of atherosclerosis as a major underlying cause. Our treatment of cardiovascular disease has improved greatly over the past three decades, but much remains to be done reduce disease burden. Current priorities include reducing atherosclerosis advancement to clinically significant stages and preventing plaque rupture or erosion. Inflammation and involvement of the adaptive immune system influences all these aspects and therefore is one focus for future therapeutic development. The atherosclerotic vascular wall is now recognized to be invaded from both sides (arterial lumen and adventitia), for better or worse, by the adaptive immune system. Atherosclerosis is also affected at several stages by adaptive immune responses, overall providing many opportunities to target these responses and to reduce disease progression. Protective influences that may be defective in diseased individuals include humoral responses to modified LDL and regulatory T cell responses. There are many strategies in development to boost these pathways in humans, including vaccine-based therapies. The effects of various existing adaptive immune targeting therapies, such as blocking critical co-stimulatory pathways or B cell depletion, on cardiovascular disease are beginning to emerge with important consequences for both autoimmune disease patients and the potential for wider use of such therapies. Entering the translation phase for adaptive immune targeting therapies is an exciting and promising prospect.

  2. Ovine model for studying pulmonary immune responses

    Energy Technology Data Exchange (ETDEWEB)

    Joel, D.D.; Chanana, A.D.

    1984-11-25

    Anatomical features of the sheep lung make it an excellent model for studying pulmonary immunity. Four specific lung segments were identified which drain exclusively to three separate lymph nodes. One of these segments, the dorsal basal segment of the right lung, is drained by the caudal mediastinal lymph node (CMLN). Cannulation of the efferent lymph duct of the CMLN along with highly localized intrabronchial instillation of antigen provides a functional unit with which to study factors involved in development of pulmonary immune responses. Following intrabronchial immunization there was an increased output of lymphoblasts and specific antibody-forming cells in efferent CMLN lymph. Continuous divergence of efferent lymph eliminated the serum antibody response but did not totally eliminate the appearance of specific antibody in fluid obtained by bronchoalveolar lavage. In these studies localized immunization of the right cranial lobe served as a control. Efferent lymphoblasts produced in response to intrabronchial antigen were labeled with /sup 125/I-iododeoxyuridine and their migrational patterns and tissue distribution compared to lymphoblasts obtained from the thoracic duct. The results indicated that pulmonary immunoblasts tend to relocate in lung tissue and reappear with a higher specific activity in pulmonary lymph than in thoracic duct lymph. The reverse was observed with labeled intestinal lymphoblasts. 35 references, 2 figures, 3 tables.

  3. Cytokines and Immune Responses in Murine Atherosclerosis.

    Science.gov (United States)

    Kusters, Pascal J H; Lutgens, Esther

    2015-01-01

    Atherosclerosis is an inflammatory disease of the vessel wall characterized by activation of the innate immune system, with macrophages as the main players, as well as the adaptive immune system, characterized by a Th1-dominant immune response. Cytokines play a major role in the initiation and regulation of inflammation. In recent years, many studies have investigated the role of these molecules in experimental models of atherosclerosis. While some cytokines such as TNF or IFNγ clearly had atherogenic effects, others such as IL-10 were found to be atheroprotective. However, studies investigating the different cytokines in experimental atherosclerosis revealed that the cytokine system is complex with both disease stage-dependent and site-specific effects. In this review, we strive to provide an overview of the main cytokines involved in atherosclerosis and to shed light on their individual role during atherogenesis.

  4. Polysaccharides isolated from Acai fruit induce innate immune responses.

    Directory of Open Access Journals (Sweden)

    Jeff Holderness

    Full Text Available The Açaí (Acai fruit is a popular nutritional supplement that purportedly enhances immune system function. These anecdotal claims are supported by limited studies describing immune responses to the Acai polyphenol fraction. Previously, we characterized γδ T cell responses to both polyphenol and polysaccharide fractions from several plant-derived nutritional supplements. Similar polyphenol and polysaccharide fractions are found in Acai fruit. Thus, we hypothesized that one or both of these fractions could activate γδ T cells. Contrary to previous reports, we did not identify agonist activity in the polyphenol fraction; however, the Acai polysaccharide fraction induced robust γδ T cell stimulatory activity in human, mouse, and bovine PBMC cultures. To characterize the immune response to Acai polysaccharides, we fractionated the crude polysaccharide preparation and tested these fractions for activity in human PBMC cultures. The largest Acai polysaccharides were the most active in vitro as indicated by activation of myeloid and γδ T cells. When delivered in vivo, Acai polysaccharide induced myeloid cell recruitment and IL-12 production. These results define innate immune responses induced by the polysaccharide component of Acai and have implications for the treatment of asthma and infectious disease.

  5. Interleukin 10 promotes immune response by increasing the survival of activated CD8(+) T cells in human papillomavirus 16-infected cervical cancer.

    Science.gov (United States)

    Li, Li; Ma, Yan; Liu, Shuang; Zhang, Jin; Xu, Xin-Yan

    2016-10-11

    Human papillomavirus (HPV)-specific CD8(+) T cells are present in HPV-infected cervical cancer patients and have demonstrated potent antitumor properties. However, these cells cannot control tumor progression in most patients. To investigate the underlying mechanisms involved in suppressing or promoting CD8(+) T cell functions, we focused on interleukin 10 (IL-10), a pleiotropic cytokine with controversial roles in antitumor immunity. We found that compared to healthy controls, circulating CD8(+) T cells in HPV 16-infected cervical cancer patients expressed significantly higher levels of IL-10. Interestingly, these CD8(+) T cells from cervical cancer patients, but not those from healthy controls, responded to HPV 16 E6/E7 peptide stimulation by increasing IL-10 expression, demonstrating an antigen-specific IL-10 release. Addition of exogenous IL-10 improved the survival, but did not increase the proliferation, of peptide-stimulated CD8(+) T cells. CD8(+) T cells cultured in the presence of IL-10 also resulted in significantly higher interferon gamma (IFN-gamma) and granzyme B concentration, primarily due to improved cell survival. In resected cervical tumors, the frequency of tumor-infiltrating IL-10(+) CD8(+) T cells was positively correlated with the frequency of tumor-infiltrating IFN-gamma(+) and granzyme B(+) CD8(+) T cells. Tumor-associated macrophages were more potent than peripheral blood monocyte-derived macrophages at inducing IL-10 expression in CD8(+) T cells, possibly explaining the elevated IL-10(+) CD8(+) T cell frequency in cervical cancer patients. Together, these results are consistent with an immunostimulatory role of IL-10, which promoted CD8(+) T cell response by increasing the survival of activated CD8(+) T cells.

  6. Pre-existing adenovirus immunity modifies a complex mixed Th1 and Th2 cytokine response to an Ad5/HIV-1 vaccine candidate in humans.

    Directory of Open Access Journals (Sweden)

    Samuel O Pine

    Full Text Available The results of the recent Step Study highlight a need to clarify the effects of pre-existing natural immunity to a vaccine vector on vaccine-induced T-cell responses. To investigate this interaction, we examined the relationship between pre-existing Ad5 immunity and T-cell cytokine response profiles in healthy, HIV-uninfected recipients of MRKAd5 HIV-1 gag vaccine (HVTN 050, ClinicalTrials.gov #NCT00849732. Participants were grouped by baseline Ad5 neutralizing antibody titer as either Ad5-seronegative (titer ≤18; n = 36 or Ad5-seropositive (titer >200; n = 34. Samples from vaccine recipients were analyzed for immune responses to either HIV-1 Gag peptide pools or Ad5 empty vector using an ex vivo assay that measures thirty cytokines in the absence of long-term culture. The overall profiles of cytokine responses to Gag and Ad5 had similar combinations of induced Th1- and Th2-type cytokines, including IFN-γ, IL-2, TNF-α, IP-10, IL-13, and IL-10, although the Ad5-specific responses were uniformly higher than the Gag-specific responses (p<0.0001 for 9 out of 11 significantly expressed analytes. At the peak response time point, PBMC from Ad5-seronegative vaccinees secreted significantly more IP-10 in response to Gag (p = 0.008, and significantly more IP-10 (p = 0.0009, IL-2 (p = 0.006 and IL-10 (p = 0.05 in response to Ad5 empty vector than PBMC from Ad5-seropositive vaccinees. Additionally, similar responses to the Ad5 vector prior to vaccination were observed in almost all subjects, regardless of Ad5 neutralizing antibody status, and the levels of secreted IFN-γ, IL-10, IL-1Ra and GM-CSF were blunted following vaccination. The cytokine response profile of Gag-specific T cells mirrored the Ad5-specific response present in all subjects before vaccination, and included a number of Th1- and Th2-associated cytokines not routinely assessed in current vaccine trials, such as IP-10, IL-10, IL-13, and GM-CSF. Together, these

  7. Viral infections in mice with reconstituted human immune system components.

    Science.gov (United States)

    Münz, Christian

    2014-09-01

    Pathogenic viruses are often difficult to study due to their exclusive tropism for humans. The development of mice with human immune system components opens the possibility to study those human pathogens with a tropism for the human hematopoietic lineage in vivo. These include HCMV, EBV, KSHV, HIV, HTLV-1, dengue virus and JC virus. Furthermore, some human pathogens, like HSV-2, adenovirus, HCV, HBV and influenza A virus, with an additional tropism for somatic mouse tissues or for additional transplanted human tissues, mainly liver, have been explored in these models. The cellular tropism of these viruses, their associated diseases and primarily cell-mediated immune responses to these viral infections will be discussed in this review. Already some exciting information has been gained from these novel chimeric in vivo models and future avenues to gain more insights into the pathology, but also potential therapies, will be outlined. Although the respective in vivo models of human immune responses can still be significantly improved, they already provide preclinical systems for in vivo studies of important viral pathogens of humans.

  8. Microgravity and immune responsiveness: implications for space travel.

    Science.gov (United States)

    Borchers, Andrea T; Keen, Carl L; Gershwin, M Eric

    2002-10-01

    To date, several hundred cosmonauts and astronauts have flown in space, yet knowledge about the adaptation of their immune system to space flight is rather limited. It is evident that a variety of immune parameters are changed during and after space flight, but the magnitude and pattern of these changes can differ dramatically between missions and even between crew members on the same mission. A literature search was conducted involving a total of 335 papers published between 1972 and 2002 that dealt with the key words immune response, microgravity and astronauts/cosmonauts, isolation, gravity, and human health. The data from multiple studies suggested that major discrepancies in outcome are due to methodologic differences. However, the data also suggested major factors that affect and modulate the immune response during space travel. In part at least, these discrepancies can be attributed to methodologic differences. In addition, a variety of other features, in particular the types and extent of stressors encountered during space missions, are likely to contribute to the variability of immune responses during and after space flight. That stress plays an important role in the effects of space flight on immunologic parameters is suggested by the frequent findings that stress hormones are upregulated during and after space flight. Unfortunately, however, the existing data on hormonal parameters are almost as varied as those on immunologic changes, and correlations between the two datasets have only rarely been attempted. The functional implications of space flight-induced alterations in immune response largely remain to be elucidated, but the data suggest that long-term travel will be associated with the development of immune-compromised hosts.

  9. Immune Responses and Lassa Virus Infection

    OpenAIRE

    Sylvain Baize; Marion Russier; Delphine Pannetier

    2012-01-01

    Lassa fever is a hemorrhagic fever endemic to West Africa and caused by Lassa virus, an Old World arenavirus. It may be fatal, but most patients recover from acute disease and some experience asymptomatic infection. The immune mechanisms associated with these different outcomes have not yet been fully elucidated, but considerable progress has recently been made, through the use of in vitro human models and nonhuman primates, the only relevant animal model that mimics the pathophysiology and i...

  10. Protective host immune responses to Salmonella infection

    OpenAIRE

    Pham, Oanh H.; McSorley, Stephen J.

    2015-01-01

    Salmonella enterica serovars Typhi and Paratyphi are the causative agents of human typhoid fever. Current typhoid vaccines are ineffective and are not widely used in endemic areas. Greater understanding of host–pathogen interactions during Salmonella infection should facilitate the development of improved vaccines to combat typhoid and nontyphoidal Salmonellosis. This review will focus on our current understanding of Salmonella pathogenesis and the major host immune components that participat...

  11. Protective immune responses to fungal infections.

    Science.gov (United States)

    Rivera, A

    2014-09-01

    The incidence of fungal infections has been on the rise over several decades. Fungal infections threaten animals, plants and humans alike and are thus of significant concern to scientists across disciplines. Over the last decade, significant advances on fungal immunology have lead to a better understanding of important mechanisms of host protection against fungi. In this article, I review recent advances of relevant mechanisms of immune-mediated protection to fungal infections.

  12. The innate and adaptive immune response to avian influenza virus

    Science.gov (United States)

    Protective immunity against viruses is mediated by the early innate immune responses and later on by the adaptive immune responses. The early innate immunity is designed to contain and limit virus replication in the host, primarily through cytokine and interferon production. Most all cells are cap...

  13. 人体对人乳头瘤病毒感染免疫应答的研究进展%Research Progress of Immune Response of Body on Human Papillomavirus

    Institute of Scientific and Technical Information of China (English)

    陈婷婷; 周乔; 俞明豪; 朱宁

    2014-01-01

    After Human papillomavirus (HPV) has infected the body, the immune system of defense against virus infection will produce a series of immune response. Nonspecific immune factors, such as mechanical and chemical barrier, mononuclear phagocyte and natural killer cell, inflammation and fever reaction, age and physiological status, and specific immune factors, such as cell-mediated immunity and humoral immunity, affected the HPV infection cleared or into a persistent infection directly or indirectly.%人乳头瘤病毒感染机体后,防御病毒感染的免疫系统会产生一系列免疫应答。非特异性因素(机械和化学屏障、单核吞噬细胞和自然杀伤细胞、炎症和发热反应、年龄与生理状态)及特异性因素(细胞免疫、体液免疫)直接或间接影响到HPV感染是否被清除或转化为持续性感染。

  14. The host immune response to Clostridium difficile infection

    Science.gov (United States)

    2013-01-01

    Clostridium difficile infection (CDI) is the most common infectious cause of healthcare-acquired diarrhoea. Outcomes of C. difficile colonization are varied, from asymptomatic carriage to fulminant colitis and death, due in part to the interplay between the pathogenic virulence factors of the bacterium and the counteractive immune responses of the host. Secreted toxins A and B are the major virulence factors of C. difficile and induce a profound inflammatory response by intoxicating intestinal epithelial cells causing proinflammatory cytokine release. Host cell necrosis, vascular permeability and neutrophil infiltration lead to an elevated white cell count, profuse diarrhoea and in severe cases, dehydration, hypoalbuminaemia and toxic megacolon. Other bacterial virulence factors, including surface layer proteins and flagella proteins, are detected by host cell surface signal molecules that trigger downstream cell-mediated immune pathways. Human studies have identified a role for serum and faecal immunoglobulin levels in protection from disease, but the recent development of a mouse model of CDI has enabled studies into the precise molecular interactions that trigger the immune response during infection. Key effector molecules have been identified that can drive towards a protective anti-inflammatory response or a damaging proinflammatory response. The limitations of current antimicrobial therapies for CDI have led to the development of both active and passive immunotherapies, none of which have, as yet been formally approved for CDI. However, recent advances in our understanding of the molecular basis of host immune protection against CDI may provide an exciting opportunity for novel therapeutic developments in the future. PMID:25165542

  15. Immune Modulation in Normal Human Peripheral Blood Mononuclear Cells (PBMCs) (Lymphocytes) in Response to Benzofuran-2-Carboxylic Acid Derivative KMEG during Spaceflight

    Science.gov (United States)

    Okoro, Elvis; Mann, Vivek; Ellis, Ivory; Mansoor, Elvedina; Olamigoke, Loretta; Marriott, Karla Sue; Denkins, Pamela; Williams, Willie; Sundaresan, Alamelu

    2017-08-01

    Microgravity and radiation exposure during space flight have been widely reported to induce the suppression of normal immune system function, and increase the risk of cancer development in humans. These findings pose a serious risk to manned space missions. Interestingly, recent studies have shown that benzofuran-2-carboxylic acid derivatives can inhibit the progression of some of these devastating effects on earth and in modeled microgravity. However, these studies had not assessed the impacts of benzofuran-2- carboxylic acid and its derivatives on global gene expression under spaceflight conditions. In this study, the ability of a specific benzofuran-2-carboxylic acid derivative (KMEG) to confer protection from radiation and restore normal immune function was investigated following exposure to space flight conditions on the ISS. Normal human peripheral blood mononuclear cells (lymphocytes) treated with 10 µ g/ml of KMEG together with untreated control samples were flown on Nanoracks hardware on Spacex-3 flight. The Samples were returned one month later and gene expression was analyzed. A 1g-ground control experiment was performed in parallel at the Kennedy spaceflight center. The first overall subtractive unrestricted analysis revealed 78 genes, which were differentially expressed in space flight KMEG, untreated lymphocytes as compared to the corresponding ground controls. However, in KMEG-treated space flight lymphocytes, there was an increased expression of a group of genes that mediate increased transcription, translation and innate immune system mediating functions of lymphocytes as compared to KMEG-untreated samples. Analysis of genes related to T cell proliferation in spaceflight KMEG-treated lymphocytes compared to 1g-ground KMEG- treated lymphocytes revealed six T cell proliferation and signaling genes to be significantly upregulated (p mitochondria from the accumulation of oxidatively damaged membrane proteins. Overall, our analysis indicates that KMEG

  16. Genetic restriction of humoral immune response

    Directory of Open Access Journals (Sweden)

    L. L. Golovkina

    2014-09-01

    Full Text Available The review provides information about immune response initiation against foreign agents. Significance of separate molecules of major histocompatibility complex in antibodies formation after blood transfusion, during pregnancy, after organ transplantation due to incompatibility of the antigenic structures of donor and recipient, mother and child was shown. Detailed description of platelet antigens protein structure significance in immunocompetent cells recognition of them is provided.

  17. Genetic restriction of humoral immune response

    Directory of Open Access Journals (Sweden)

    L. L. Golovkina

    2014-01-01

    Full Text Available The review provides information about immune response initiation against foreign agents. Significance of separate molecules of major histocompatibility complex in antibodies formation after blood transfusion, during pregnancy, after organ transplantation due to incompatibility of the antigenic structures of donor and recipient, mother and child was shown. Detailed description of platelet antigens protein structure significance in immunocompetent cells recognition of them is provided.

  18. Cellular immune responses towards regulatory cells.

    Science.gov (United States)

    Larsen, Stine Kiær

    2016-01-01

    This thesis describes the results from two published papers identifying spontaneous cellular immune responses against the transcription factors Foxp3 and Foxo3. The tumor microenvironment is infiltrated by cells that hinder effective tumor immunity from developing. Two of these cell types, which have been linked to a bad prognosis for patients, are regulatory T cells (Treg) and tolerogenic dendritic cells (DC). Tregs inhibit effector T cells from attacking the tumor through various mechanisms, including secreted factors and cell-to-cell contact. Tregs express the transcription factor Foxp3, which is necessary for their development and suppressive activities. Tolerogenic DCs participate in creating an environment in the tumor where effector T cells become tolerant towards the tumor instead of attacking it. The transcription factor Foxo3 was recently described to be highly expressed by tolerogenic DCs and to programme their tolerogenic influence. This thesis describes for the first time the existence of spontaneous cellular immune responses against peptides derived from Foxp3 and Foxo3. We have detected the presence of cytotoxic T cells that recognise these peptides in an HLA-A2 restricted manner in cancer patients and for Foxp3 in healthy donors as well. In addition, we have demonstrated that the Foxp3- and Foxo3-specific CTLs recognize Foxp3- and Foxo3-expressing cancer cell lines and importantly, suppressive immune cells, namely Tregs and in vitro generated DCs. Cancer immunotherapy is recently emerging as an important treatment modality improving the survival of selected patients. The current progress is largely owing to targeting of the immune suppressive milieu that is dominating the tumor microenvironment. This is being done through immune checkpoint blockade with CTLA-4 and PD-1/PD-L1 antibodies and through lymphodepleting conditioning of patients and ex vivo activation of TILs in adoptive cell transfer. Several strategies are being explored for depletion of

  19. The Integrated Impact of Diet On Human Immune Response, the Gut Microbiota, and Nutritional Status During Adaptation to a Spaceflight Analog

    Science.gov (United States)

    Douglas, G. L.; Zwart, S. R.; Young, M.; Kloeris, V.; Crucian, B.; Smith, S. M.; Lorenzi, H.

    2017-01-01

    Spaceflight impacts human physiology, including well documented immune system dysregulation. Diet, immune function, and the microbiome are interlinked, but diet is the only one of these factors that we have the ability to easily, and significantly, alter on Earth or during flight. As we understand dietary impacts on physiology more thoroughly, we may then improve the spaceflight diet to improve crew health and potentially reduce flight-associated physiological alterations. It is expected that increasing the consumption of fruits and vegetables and bioactive compounds (e.g.,omega-3 fatty acids, lycopene, flavonoids) and therefore enhancing overall nutritional intake from the nominal shelf-stable, fully-processed space food system could serve as a countermeasure to improve human immunological profiles, the taxonomic profile of the gut microbiota, and nutritional status, especially where currently dysregulated during spaceflight. This interdisciplinary study will determine the effect of the current shelf-stable spaceflight diet compared to an "enhanced" shelf-stable spaceflight diet (25% more foods rich in omega-3 fatty acids, lycopene, flavonoids, fruits, and vegetables). The NASA Human Exploration Research Analog (HERA) 2017 missions, consisting of closed chamber confinement, realistic mission simulation, in a high-fidelity mock space vehicle, will serve as a platform to replicate mission stressors and the dysregulated physiology observed in astronauts. Biosampling of crew members will occur at selected intervals, with complete dietary tracking. Outcome measures will include immune markers (e.g., peripheral leukocyte distribution, inflammatory cytokine profiles, T cell function), the taxonomic and metatranscriptomic profile of the gut microbiome, and nutritional status biomarkers and metabolites. Data collection will also include complete dietary tracking. Statistical evaluations will determine physiological and biochemical shifts in relation to nutrient in take and

  20. Protective immune responses in lawsonia intracellularis infections

    DEFF Research Database (Denmark)

    Cordes, Henriette; Riber, Ulla; Boutrup, Torsten;

    , that a primary L. intracellularis experimental infection in pigs protects against re-colonisation (re-infection) with a virulent L. intracellularis isolate. After re-infection the animals had reduced L. intracellularis colonisation of the intestinal mucosa compared to controls, no bacterial shedding......, but exhibited a high, but short-lasting peak after re-infection. Specific IFN responses were also measured using a whole blood IFN-γ assay. These were very high in challenge infected and re-infected animals as compared to controls. These specific immune responses may contribute to the explanation of mechanisms...... behind the observed protection against re-infection with L. intracellularis....

  1. [Influence of natural gut flora on immune response].

    Science.gov (United States)

    Strzępa, Anna; Szczepanik, Marian

    2013-08-29

    Our intestines are habitat for trillions of microorganisms such as bacteria, viruses and eukaryotes, known as microbiota. They are indispensable for our well-being due to their metabolic activities. Microbiota digests complex plant polysaccharides, which are normally unprocessed by humans; as well it retrieves other essential nutrients. It is well established that microbiota is crucial for proper development of intestinal as well systemic immune compartments. Recent results indicate that composition of natural gut flora is responsible for shaping of immune response. Alerted bacterial profile, known as dysbiosis precedes development of allergy in children. Many autoimmune conditions are associated with shift in intestinal bacterial profile. Apart of direct association between gut flora and systemic immune compartment little is known about the mechanisms by which microbiota exerts its immunoregulatory function. At the moment several bacterial strains as well some bacterial products were recognized as immunomodulators. This review describes the composition of normal gut flora as well disease-associated microbiota. It deals with unique mechanisms, found in GALT, that favor induction of tolerance towards orally administrated antigens as well discriminate between commensal and pathogens to minimize induction of inflammatory response. Further, the review tries to establish the connection between microbiota and systemic immune response. Finally the factors that modulate the composition of our gut flora are described.

  2. High-Risk Human Papillomavirus Targets Crossroads in Immune Signaling

    Science.gov (United States)

    Tummers, Bart; Van Der Burg, Sjoerd H.

    2015-01-01

    Persistent infections with a high-risk type human papillomavirus (hrHPV) can progress to cancer. High-risk HPVs infect keratinocytes (KCs) and successfully suppress host immunity for up to two years despite the fact that KCs are well equipped to detect and initiate immune responses to invading pathogens. Viral persistence is achieved by active interference with KCs innate and adaptive immune mechanisms. To this end hrHPV utilizes proteins encoded by its viral genome, as well as exploits cellular proteins to interfere with signaling of innate and adaptive immune pathways. This results in impairment of interferon and pro-inflammatory cytokine production and subsequent immune cell attraction, as well as resistance to incoming signals from the immune system. Furthermore, hrHPV avoids the killing of infected cells by interfering with antigen presentation to antigen-specific cytotoxic T lymphocytes. Thus, hrHPV has evolved multiple mechanisms to avoid detection and clearance by both the innate and adaptive immune system, the molecular mechanisms of which will be dealt with in detail in this review. PMID:26008697

  3. Ebola haemorrhagic fever virus: pathogenesis, immune responses, potential prevention.

    Science.gov (United States)

    Marcinkiewicz, Janusz; Bryniarski, Krzysztof; Nazimek, Katarzyna

    2014-01-01

    Ebola zoonotic RNA filovirus represents human most virulent and lethal pathogens, which induces acute hemorrhagic fever and death within few days in a range of 60-90% of symptomatic individuals. Last outbreak in 2014 in West Africa caused panic that Ebola epidemic can be spread to other continents. Number of deaths in late December reached almost 8,000 individuals out of more than 20,000 symptomatic patients. It seems that only a coordinated international response could counteract the further spread of Ebola. Major innate immunity mechanisms against Ebola are associated with the production of interferons, that are inhibited by viral proteins. Activation of host NK cells was recognized as a leading immune function responsible for recovery of infected people. Uncontrolled cell infection by Ebola leads to an impairment of immunity with cytokine storm, coagulopathy, systemic bleeding, multi-organ failure and death. Tested prevention strategies to induce antiviral immunity include: i. recombinant virus formulations (vaccines); ii. cocktail of monoclonal antibodies (serotherapy); iii. alternative RNA-interference-based antiviral methods. Maintaining the highest standards of aseptic and antiseptic precautions is equally important. Present brief review summarizes a current knowledge concerning pathogenesis of Ebola hemorrhagic disease and the virus interaction with the immune system and discusses recent advances in prevention of Ebola infection by vaccination and serotherapy.

  4. Evaluation of Mucosal and Systemic Immune Responses Elicited by GPI-0100-Adjuvanted Influenza Vaccine Delivered by Different Immunization Strategies

    NARCIS (Netherlands)

    Liu, Heng; Patil, Harshad P.; de Vries-Idema, Jacqueline; Wilschut, Jan; Huckriede, Anke

    2013-01-01

    Vaccines for protection against respiratory infections should optimally induce a mucosal immune response in the respiratory tract in addition to a systemic immune response. However, current parenteral immunization modalities generally fail to induce mucosal immunity, while mucosal vaccine delivery

  5. Immune response triggered by Brucella abortus following infection or vaccination.

    Science.gov (United States)

    Dorneles, Elaine M S; Teixeira-Carvalho, Andréa; Araújo, Márcio S S; Sriranganathan, Nammalwar; Lage, Andrey P

    2015-07-17

    Brucella abortus live vaccines have been used successfully to control bovine brucellosis worldwide for decades. However, due to some limitations of these live vaccines, efforts are being made for the development of new safer and more effective vaccines that could also be used in other susceptible species. In this context, understanding the protective immune responses triggered by B. abortus is critical for the development of new vaccines. Such understandings will enhance our knowledge of the host/pathogen interactions and enable to develop methods to evaluate potential vaccines and innovative treatments for animals or humans. At present, almost all the knowledge regarding B. abortus specific immunological responses comes from studies in mice. Active participation of macrophages, dendritic cells, IFN-γ producing CD4(+) T-cells and cytotoxic CD8(+) T-cells are vital to overcome the infection. In this review, we discuss the characteristics of the immune responses triggered by vaccination versus infection by B. abortus, in different hosts.

  6. Immune response and protection in raccoons (Procyon lotor) following consumption of baits containing ONRAB®, a human adenovirus rabies glycoprotein recombinant vaccine.

    Science.gov (United States)

    Brown, L J; Rosatte, R C; Fehlner-Gardiner, C; Taylor, J S; Davies, J C; Donovan, D

    2012-10-01

    We investigated the immune response and protection conferred in raccoons (Procyon lotor) following consumption of ONRAB(®) oral rabies vaccine baits. Forty-two wild-caught, captive raccoons were each offered an ONRAB vaccine bait; 21 controls received no vaccine baits. Blood samples collected from all raccoons before treatment, and each week posttreatment for 16 wk, were assessed for the presence of rabies virus antibody. In the bait group, an individual was considered to have responded to vaccination if serum samples from three or more consecutive weeks were antibody-positive. Using this criterion, 77% (20/26) of raccoons that consumed ONRAB baits with no observed vaccine spillage (full dose) demonstrated a humoral immune response. In the group that received a partial dose (0.05-0.90 mL vaccine recovered), 50% (8/16) of raccoons responded to vaccination. Regardless of the vaccine dose received, among the 28 raccoons that responded to vaccination 18 had antibody initially detectable at week 2 and 22 remained antibody-positive for at least 10 consecutive weeks. Kinetics of the humoral immune response suggest that the best time to conduct postbaiting surveillance for evidence of vaccination would be 6-13 wk following bait deployment, with the highest antibody prevalence expected between weeks 8-10. A sub-sample of 29 raccoons (20 ONRAB, 9 controls) was challenged with raccoon rabies virus variant 350 days posttreatment. Eight of nine controls (89%) developed rabies whereas 15/20 vaccinates (75%) survived. Survival following rabies challenge was significantly higher in raccoons presented ONRAB vaccine baits.

  7. The immune system in the aging human.

    Science.gov (United States)

    Rymkiewicz, Paulina Dominika; Heng, Yi Xiong; Vasudev, Anusha; Larbi, Anis

    2012-09-01

    With the improvement of medical care and hygienic conditions, there has been a tremendous increment in human lifespan. However, many of the elderly (>65 years) display chronic illnesses, and a majority requires frequent and longer hospitalization. The robustness of the immune system to eliminate or control infections is often eroded with advancing age. Nevertheless, some elderly individuals do cope better than others. The origin of these inter-individual differences may come from genetic, lifestyle conditions (nutrition, socio-economic parameters), as well as the type, number and recurrence of pathogens encountered during life. The theory we are supporting is that chronic infections, through life, will induce profound changes in the immune system probably due to unbalanced inflammatory profiles. Persistent viruses such a cytomegalovirus are not eliminated and are a driven force to immune exhaustion. Because of their age, elderly individuals may have seen more of these chronic stimulators and have experienced more reactivation episodes ultimately leading to shrinkage of their repertoire and overall immune robustness. This review integrates updates on immunity with advancing age and its impact on associated clinical conditions.

  8. A Tetravalent Sub-unit Dengue Vaccine Formulated with Ionizable Cationic Lipid Nanoparticle induces Significant Immune Responses in Rodents and Non-Human Primates.

    Science.gov (United States)

    Swaminathan, Gokul; Thoryk, Elizabeth A; Cox, Kara S; Smith, Jeffrey S; Wolf, Jayanthi J; Gindy, Marian E; Casimiro, Danilo R; Bett, Andrew J

    2016-10-05

    Dengue virus has emerged as an important arboviral infection worldwide. As a complex pathogen, with four distinct serotypes, the development of a successful Dengue virus vaccine has proven to be challenging. Here, we describe a novel Dengue vaccine candidate that contains truncated, recombinant, Dengue virus envelope protein from all four Dengue virus serotypes (DEN-80E) formulated with ionizable cationic lipid nanoparticles (LNPs). Immunization studies in mice, Guinea pigs, and in Rhesus macaques, revealed that LNPs induced high titers of Dengue virus neutralizing antibodies, with or without co-administration or encapsulation of a Toll-Like Receptor 9 agonist. Importantly, LNPs were also able to boost DEN-80E specific CD4+ and CD8+ T cell responses. Cytokine and chemokine profiling revealed that LNPs induced strong chemokine responses without significant induction of inflammatory cytokines. In addition to being highly efficacious, the vaccine formulation proved to be well-tolerated, demonstrating no elevation in any of the safety parameters evaluated. Notably, reduction in cationic lipid content of the nanoparticle dramatically reduced the LNP's ability to boost DEN-80E specific immune responses, highlighting the crucial role for the charge of the LNP. Overall, our novel studies, across multiple species, reveal a promising tetravalent Dengue virus sub-unit vaccine candidate.

  9. A Tetravalent Sub-unit Dengue Vaccine Formulated with Ionizable Cationic Lipid Nanoparticle induces Significant Immune Responses in Rodents and Non-Human Primates

    Science.gov (United States)

    Swaminathan, Gokul; Thoryk, Elizabeth A.; Cox, Kara S.; Smith, Jeffrey S.; Wolf, Jayanthi J.; Gindy, Marian E.; Casimiro, Danilo R.; Bett, Andrew J.

    2016-01-01

    Dengue virus has emerged as an important arboviral infection worldwide. As a complex pathogen, with four distinct serotypes, the development of a successful Dengue virus vaccine has proven to be challenging. Here, we describe a novel Dengue vaccine candidate that contains truncated, recombinant, Dengue virus envelope protein from all four Dengue virus serotypes (DEN-80E) formulated with ionizable cationic lipid nanoparticles (LNPs). Immunization studies in mice, Guinea pigs, and in Rhesus macaques, revealed that LNPs induced high titers of Dengue virus neutralizing antibodies, with or without co-administration or encapsulation of a Toll-Like Receptor 9 agonist. Importantly, LNPs were also able to boost DEN-80E specific CD4+ and CD8+ T cell responses. Cytokine and chemokine profiling revealed that LNPs induced strong chemokine responses without significant induction of inflammatory cytokines. In addition to being highly efficacious, the vaccine formulation proved to be well-tolerated, demonstrating no elevation in any of the safety parameters evaluated. Notably, reduction in cationic lipid content of the nanoparticle dramatically reduced the LNP’s ability to boost DEN-80E specific immune responses, highlighting the crucial role for the charge of the LNP. Overall, our novel studies, across multiple species, reveal a promising tetravalent Dengue virus sub-unit vaccine candidate. PMID:27703172

  10. Vault nanocapsules as adjuvants favor cell-mediated over antibody-mediated immune responses following immunization of mice.

    Directory of Open Access Journals (Sweden)

    Upendra K Kar

    Full Text Available BACKGROUND: Modifications of adjuvants that induce cell-mediated over antibody-mediated immunity is desired for development of vaccines. Nanocapsules have been found to be viable adjuvants and are amenable to engineering for desired immune responses. We previously showed that natural nanocapsules called vaults can be genetically engineered to elicit Th1 immunity and protection from a mucosal bacterial infection. The purpose of our study was to characterize immunity produced in response to OVA within vault nanoparticles and compare it to another nanocarrier. METHODOLOGY AND PRINCIPAL FINDINGS: We characterized immunity resulting from immunization with the model antigen, ovalbumin (OVA encased in vault nanocapsules and liposomes. We measured OVA responsive CD8(+ and CD4(+ memory T cell responses, cytokine production and antibody titers in vitro and in vivo. We found that immunization with OVA contain in vaults induced a greater number of anti-OVA CD8(+ memory T cells and production of IFNγ plus CD4(+ memory T cells. Also, modification of the vault body could change the immune response compared to OVA encased in liposomes. CONCLUSIONS/SIGNIFICANCE: These experiments show that vault nanocapsules induced strong anti-OVA CD8(+ and CD4(+ T cell memory responses and modest antibody production, which markedly differed from the immune response induced by liposomes. We also found that the vault nanocapsule could be modified to change antibody isotypes in vivo. Thus it is possible to create a vault nanocapsule vaccine that can result in the unique combination of immunogen-responsive CD8(+ and CD4(+ T cell immunity coupled with an IgG1 response for future development of vault nanocapsule-based vaccines against antigens for human pathogens and cancer.

  11. Immune Response among Patients Exposed to Molds

    Directory of Open Access Journals (Sweden)

    Jordan N. Fink

    2009-12-01

    Full Text Available Macrocyclic trichothecenes, mycotoxins produced by Stachybotrys chartarum, have been implicated in adverse reactions in individuals exposed to mold-contaminated environments. Cellular and humoral immune responses and the presence of trichothecenes were evaluated in patients with mold-related health complaints. Patients underwent history, physical examination, skin prick/puncture tests with mold extracts, immunological evaluations and their sera were analyzed for trichothecenes. T-cell proliferation, macrocyclic trichothecenes, and mold specific IgG and IgA levels were not significantly different than controls; however 70% of the patients had positive skin tests to molds. Thus, IgE mediated or other non-immune mechanisms could be the cause of their symptoms.

  12. Evasion of influenza A viruses from innate and adaptive immune responses

    NARCIS (Netherlands)

    C.E. van de Sandt (Carolien); J.H.C.M. Kreijtz (Joost); G.F. Rimmelzwaan (Guus)

    2012-01-01

    textabstractThe influenza A virus is one of the leading causes of respiratory tract infections in humans. Upon infection with an influenza A virus, both innate and adaptive immune responses are induced. Here we discuss various strategies used by influenza A viruses to evade innate immune responses a

  13. Evasion of influenza A viruses from innate and adaptive immune responses

    NARCIS (Netherlands)

    C.E. van de Sandt (Carolien); J.H.C.M. Kreijtz (Joost); G.F. Rimmelzwaan (Guus)

    2012-01-01

    textabstractThe influenza A virus is one of the leading causes of respiratory tract infections in humans. Upon infection with an influenza A virus, both innate and adaptive immune responses are induced. Here we discuss various strategies used by influenza A viruses to evade innate immune responses

  14. The Mycoplasma hominis P120 membrane protein contains a 216 amino acid hypervariable domain that is recognized by the human humoral immune response

    DEFF Research Database (Denmark)

    Nyvold, Charlotte Guldborg; Birkelund, Svend; Christiansen, Gunna

    1997-01-01

    domain. Based on restriction endonuclease cleavage patterns of the hypervariable domain the 18 isolates could be divided into four cases. Reactivity with both mAb 26.7D and pAb 121 confirmed these classes. The hypervariable, but not the constant, part of P120 was recognized by the human humoral immune...... and found to have a sequence identity of 91% with the gene of strain 7488. One hypervariable and two semivariable regions were detected. The epitope for mAb 26.7D was mapped to the hypervariable domain by expression of various parts of this domain in Escherichia coli using expression vector systems....... A polyclonal antiserum (pAb 121) generated against the hypervariable region of P120 from PG21 identified the P120 homologue in M. hominis PG21. Fusion proteins of the hypervariable and constant parts of the proteins were constructed and tested for reactivity with 21 human sera. Twelve sera reacted...

  15. [Types of immune response in advanced suppurative peritonitis].

    Science.gov (United States)

    Borisov, A G; Savchenko, A A; Cherdantsev, D V; Zdzitovetsky, D E; Pervova, O V; Kudryavtsev, I V; Belenyuk, V D; Shapkina, V A

    to assess types of immune response in patients with advanced suppurative peritonitis and course of disease. We examined 79 patients with acute surgical abdominal diseases and injuries complicated by advanced suppurative peritonitis. Blood immunological parameters were estimated using flowing cytometry and enzyme immunoassay. It was concluded that functional parameters of immune system are very various in patients with advanced suppurative peritonitis. Cluster analysis defined 4 immune types which are determined by different state of congenital and acquired immunity. Immunodeficient and unreactive immune types are unfavorable. Immune types with activation of congenital and acquired immunity are the most favourable. This stratification personifies diagnosis and treatment of immune disorders in patients with advanced suppurative peritonitis.

  16. Host immune status and response to hepatitis E virus infection.

    Science.gov (United States)

    Krain, Lisa J; Nelson, Kenrad E; Labrique, Alain B

    2014-01-01

    Hepatitis E virus (HEV), identified over 30 years ago, remains a serious threat to life, health, and productivity in developing countries where access to clean water is limited. Recognition that HEV also circulates as a zoonotic and food-borne pathogen in developed countries is more recent. Even without treatment, most cases of HEV-related acute viral hepatitis (with or without jaundice) resolve within 1 to 2 months. However, HEV sometimes leads to acute liver failure, chronic infection, or extrahepatic symptoms. The mechanisms of pathogenesis appear to be substantially immune mediated. This review covers the epidemiology of HEV infection worldwide, the humoral and cellular immune responses to HEV, and the persistence and protection of antibodies produced in response to both natural infection and vaccines. We focus on the contributions of altered immune states (associated with pregnancy, human immunodeficiency virus [HIV], and immunosuppressive agents used in cancer and transplant medicine) to the elevated risks of chronic infection (in immunosuppressed/immunocompromised patients) and acute liver failure and mortality (among pregnant women). We conclude by discussing outstanding questions about the immune response to HEV and interactions with hormones and comorbid conditions. These questions take on heightened importance now that a vaccine is available.

  17. Induction of oxidative burst response in human neutrophils by immune complexes made in vitro of lipopolysaccharide and hyperimmune serum from chronically infected patients

    DEFF Research Database (Denmark)

    Kronborg, G; Fomsgaard, A; Jensen, E T;

    1993-01-01

    in human neutrophil granulocytes (PMN)s measured by chemiluminescence (CL). This was also the case using hyperimmune CF serum alone. In contrast, P. aeruginosa LPS together with CF serum did induce a CL response. The CL responses varied depending on the sera used for IC formation, and were reduced when...... protein A preabsorbed sera were used. PEG precipitation of the ICs from the mixture increased the CL response. These findings indicate that the CL responses induced by the mixture of P. aeruginosa LPS and CF serum were due to IC formation and an Fc-mediated stimulation of the PMNs. It is concluded...

  18. Immune Modulation in Normal Human Peripheral Blood Mononuclear Cells (PBMCs) (Lymphocytes) in Response to Benzofuran-2-Carboxylic Acid Derivative KMEG during Spaceflight

    Science.gov (United States)

    Okoro, Elvis; Mann, Vivek; Ellis, Ivory; Mansoor, Elvedina; Olamigoke, Loretta; Marriott, Karla Sue; Denkins, Pamela; Williams, Willie; Sundaresan, Alamelu

    2017-07-01

    Microgravity and radiation exposure during space flight have been widely reported to induce the suppression of normal immune system function, and increase the risk of cancer development in humans. These findings pose a serious risk to manned space missions. Interestingly, recent studies have shown that benzofuran-2-carboxylic acid derivatives can inhibit the progression of some of these devastating effects on earth and in modeled microgravity. However, these studies had not assessed the impacts of benzofuran-2- carboxylic acid and its derivatives on global gene expression under spaceflight conditions. In this study, the ability of a specific benzofuran-2-carboxylic acid derivative (KMEG) to confer protection from radiation and restore normal immune function was investigated following exposure to space flight conditions on the ISS. Normal human peripheral blood mononuclear cells (lymphocytes) treated with 10 µ g/ml of KMEG together with untreated control samples were flown on Nanoracks hardware on Spacex-3 flight. The Samples were returned one month later and gene expression was analyzed. A 1g-ground control experiment was performed in parallel at the Kennedy spaceflight center. The first overall subtractive unrestricted analysis revealed 78 genes, which were differentially expressed in space flight KMEG, untreated lymphocytes as compared to the corresponding ground controls. However, in KMEG-treated space flight lymphocytes, there was an increased expression of a group of genes that mediate increased transcription, translation and innate immune system mediating functions of lymphocytes as compared to KMEG-untreated samples. Analysis of genes related to T cell proliferation in spaceflight KMEG-treated lymphocytes compared to 1g-ground KMEG- treated lymphocytes revealed six T cell proliferation and signaling genes to be significantly upregulated (p C-myc related proliferation, promote antiapoptotic activity and protects mitochondria from the accumulation of

  19. Mucosal immunization of cynomolgus macaques with the VSVDeltaG/ZEBOVGP vaccine stimulates strong ebola GP-specific immune responses.

    Directory of Open Access Journals (Sweden)

    Xiangguo Qiu

    Full Text Available BACKGROUND: Zaire ebolavirus (ZEBOV produces a lethal viral hemorrhagic fever in humans and non-human primates. METHODOLOGY/PRINCIPAL FINDINGS: We demonstrate that the VSVDeltaG/ZEBOVGP vaccine given 28 days pre-challenge either intranasally (IN, orally (OR, or intramuscularly (IM protects non-human primates against a lethal systemic challenge of ZEBOV, and induces cellular and humoral immune responses. We demonstrated that ZEBOVGP-specific T-cell and humoral responses induced in the IN and OR groups, following an immunization and challenge, produced the most IFN-gamma and IL-2 secreting cells, and long term memory responses. CONCLUSIONS/SIGNIFICANCE: We have shown conclusively that mucosal immunization can protect from systemic ZEBOV challenge and that mucosal delivery, particularly IN immunization, seems to be more potent than IM injection in the immune parameters we have tested. Mucosal immunization would be a huge benefit in any emergency mass vaccination campaign during a natural outbreak, or following intentional release, or for mucosal immunization of great apes in the wild.

  20. MECHANISMS OF IMMUNE RESPONSES IN CNIDARIANS

    Directory of Open Access Journals (Sweden)

    Iván Darío Ocampo

    2014-12-01

    Full Text Available The immune system maintains the integrity of the organisms through a complex network of molecules, cells, and tissues that recognize internal or external antigenic substances to neutralized and eliminate them. The mechanisms of immune response have evolved in a modular fashion, where members of a given module interact strongly among them, but weakly with members of other modules, providing robustness and evolvability to the immune system. Ancestral modules are the raw material for the generation of new modules through evolution. Thus, the study of immune systems in basal metazoans such as cnidarians seeks to determine the basic tool kit from which the metazoans started to construct their immune systems. In addition, understanding the immune mechanisms in cnidarians contributes to decipher the etiopathology of coral diseases of infectious nature that are affecting coral reefs worldwide.RESUMENEl sistema inmune mantiene la integridad de los organismos vivos por medio de una red compleja de moléculas, células y tejidos que reconocen sustancias antigénicas internas o externas para neutralizarlas y eliminarlas. Los mecanismos de respuesta inmune han evolucionado de una manera modular, en donde miembros de un módulo dado interactúan fuertemente entre sí, pero débilmente con componentes de otros módulos, otorgando así robustez y potencial evolutivo al sistema inmune. Módulos ancestrales representan el material básico para la generación de nuevos módulos durante el proceso evolutivo. Así, el estudio de sistemas inmunes en metazoarios basales como los cnidarios busca determinar cuales son los módulos ancestrales a partir de los cuales se constituyen los sistemas inmunes de animales derivados. Adicionalmente, el entendimiento de los mecanismos de respuesta inmune en cnidarios eventualmente contribuirá a descifrar la etiopatología de las enfermedades de corales de carácter infeccioso que está afectando los corales en el mundo.

  1. Immune response in Dobrava-Belgrade virus infections.

    Science.gov (United States)

    Tsergouli, Katerina; Papa, Anna

    2016-12-01

    Dobrava-Belgrade virus (DOBV) is a hantavirus that causes a disease in humans known as hemorrhagic fever with renal syndrome. Hallmarks of hantaviral infections are increased vascular permeability due to dysregulation of the endothelial cell barrier and acute thrombocytopenia. In order to gain insight into the immune response in DOBV infections, the serum levels of 27 cytokines in 24 hospitalized Greek HFRS patients were evaluated. Compared to the control group, significantly higher IL-1ra, IL-6, IL-8, IL-9, IL-10, GM-CSF, IP-10, MIP-1b, TNF-α and VEGF levels were found in severe cases, while in non-severe cases, IL-13 and TNF-α levels were significantly higher (p < 0.05). In all groups, IP-10 was increased and RANTES was decreased. Significant and time- (after onset of illness) dependent differences among fatal, severe and non-severe cases were seen. VEGF was positively associated with disease severity. A strong immune response was seen during the first week of illness, especially in severe cases, while the response in non-severe cases was weaker and delayed. The Th1 response was strong in non-severe cases and weak in the fatal case, while a mixed Th1/Th2 immune response was seen in the survivors of severe disease.

  2. Dyshidrotic eczema: relevance to the immune response in situ

    Directory of Open Access Journals (Sweden)

    Frank J. Pinto

    2009-08-01

    Full Text Available Context: Pompholyx (called dyshidrosis by some is one of the most common conditions and its immune response is presently poorly understood. Case report: We describe a 58 year old African American female with a clinical history of rheumatoid arthritis and type II diabetes who presented a chronic five-year, itchy vesicular/blistering rash involving her hands and feet. A lesional skin biopsy was taken for hematoxylin and eosin (H & E analysis. In addition, a multicolor direct immunofluorescence (MDIF and immunohistochemistry (IHC studies were performed. The major findings to be reported were: the H & E examination revealed spongiotic dermatitis and pompholix. IHC and MDIF studies demonstrated focally deposits of positive CD45, CD3, CD8, anti myeloperoxidase (MPO, and anti-human IgE, C3C, C3D and anti-human-fibrinogen within the epidermal spongiotic process, as well as around the blood vessels surrounding the inflammatory process especially at the sweat glands and respective ductus. The patient began mycophenolate mofetil therapy, with successful clearing of the palms and soles. Conclusion: The significance of our findings indicates a complex immunological process including complement, MPO and T-cell immune response. In addition, possibly a secondary allergic process for the presence of IgE immune response and possibly aggravation by application of other medicines. Further immunological studies on pompholyx are needed

  3. Dyshidrotic eczema: Relevance to the immune response in situ

    Directory of Open Access Journals (Sweden)

    Ana Maria Abreu Velez

    2009-01-01

    Full Text Available Context: Pompholyx (called dyshidrosis by some is one of the most common conditions and its immune response is presently poorly understood. Case report: We describe a 58 year old African American female with a clinical history of rheumatoid arthritis and type II diabetes who presented a chronic five-year, itchy vesicular/blistering rash involving her hands and feet. A lesional skin biopsy was taken for hematoxylin and eosin (H & E analysis. In addition, a multicolor direct immunofluorescence (MDIF and immunohistochemistry (IHC studies were performed. The major findings to be reported were: the H & E examination revealed spongiotic dermatitis and pompholix. IHC and MDIF studies demonstrated focally deposits of positive CD45, CD3, CD8, anti myeloperoxidase (MPO, and anti-human IgE, C3C, C3D and anti-human-fibrinogen within the epidermal spongiotic process, as well as around the blood vessels surrounding the inflammatory process especially at the sweat glands and respective ductus. The patient began mycophenolate mofetil therapy, with successful clearing of the palms and soles. Conclusion : The significance of our findings indicates a complex immunological process including complement, MPO and T-cell immune response. In addition, possibly a secondary allergic process for the presence of IgE immune response and possibly aggravation by application of other medicines. Further immunological studies on pompholyx are needed. (Abreu Velez AM, Pinto FJ, Howard MS.

  4. Original Antigenic Sin Response to RNA Viruses and Antiviral Immunity

    Science.gov (United States)

    Park, Mee Sook; Kim, Jin Il; Park, Sehee; Lee, Ilseob

    2016-01-01

    The human immune system has evolved to fight against foreign pathogens. It plays a central role in the body's defense mechanism. However, the immune memory geared to fight off a previously recognized pathogen, tends to remember an original form of the pathogen when a variant form subsequently invades. This has been termed 'original antigenic sin'. This adverse immunological effect can alter vaccine effectiveness and sometimes cause enhanced pathogenicity or additional inflammatory responses, according to the type of pathogen and the circumstances of infection. Here we aim to give a simplified conceptual understanding of virus infection and original antigenic sin by comparing and contrasting the two examples of recurring infections such as influenza and dengue viruses in humans. PMID:27799871

  5. The Integrated Impact of Diet on Human Immune Response, the Gut Microbiota, and Nutritional Status During Adaptation to a Spaceflight Analog

    Science.gov (United States)

    Douglas, G. L.; Zwart, S. R.; Young, M.; Kloeris, V.; Crucian, B.; Smith, S. M.; Lorenzi, H.

    2018-01-01

    Spaceflight impacts human physiology, including well documented immune system dysregulation. Diet, immune function, and the microbiome are interlinked, but diet is the only one of these factors that we have the ability to easily, and significantly, alter on Earth or during flight. As we understand dietary impacts on physiology more thoroughly, we may then improve the spaceflight diet to improve crew health and potentially reduce spaceflight-associated physiological alterations. It is expected that increasing the consumption of fruits and vegetables and bioactive compounds (e.g., omega-3 fatty acids, lycopene, flavonoids) and therefore enhancing overall nutritional intake from the nominal shelf-stable, fully-processed space food system could serve as a countermeasure to improve human immunological profiles, the taxonomic profile of the gut microbiota, and nutritional status, especially where currently dysregulated during spaceflight. This interdisciplinary study will determine the effect of the current shelf-stable spaceflight diet compared to an "enhanced" shelf-stable spaceflight diet (25% more foods rich in omega-3 fatty acids, lycopene, flavonoids, and more fruits, and vegetables in general). The NASA Human Exploration Research Analog (HERA) 2017 missions, consisting of four 45-day missions with closed chamber confinement and realistic mission simulation in a high-fidelity mock space vehicle, will serve as a platform to replicate mission stressors and the effects on crew biochemistry, immunology, and the gut microbiome. Bio sampling of crewmembers is scheduled for selected intervals pre- and in-mission. Data collection also includes dietary intake recording. Outcome measures will include immune markers (e.g., peripheral leukocyte distribution, inflammatory cytokine profiles, T cell function), the taxonomic and metatranscriptomic profile of the gut microbiome, and nutritional status biomarkers and metabolites. Statistical evaluations will determine physiological

  6. Genetic adaptation of the antibacterial human innate immunity network

    Directory of Open Access Journals (Sweden)

    Lazarus Ross

    2011-07-01

    Full Text Available Abstract Background Pathogens have represented an important selective force during the adaptation of modern human populations to changing social and other environmental conditions. The evolution of the immune system has therefore been influenced by these pressures. Genomic scans have revealed that immune system is one of the functions enriched with genes under adaptive selection. Results Here, we describe how the innate immune system has responded to these challenges, through the analysis of resequencing data for 132 innate immunity genes in two human populations. Results are interpreted in the context of the functional and interaction networks defined by these genes. Nucleotide diversity is lower in the adaptors and modulators functional classes, and is negatively correlated with the centrality of the proteins within the interaction network. We also produced a list of candidate genes under positive or balancing selection in each population detected by neutrality tests and showed that some functional classes are preferential targets for selection. Conclusions We found evidence that the role of each gene in the network conditions the capacity to evolve or their evolvability: genes at the core of the network are more constrained, while adaptation mostly occurred at particular positions at the network edges. Interestingly, the functional classes containing most of the genes with signatures of balancing selection are involved in autoinflammatory and autoimmune diseases, suggesting a counterbalance between the beneficial and deleterious effects of the immune response.

  7. Influence of diabetes mellitus on immunity to human tuberculosis.

    Science.gov (United States)

    Kumar Nathella, Pavan; Babu, Subash

    2017-09-01

    Type 2 diabetes mellitus(DM) is a major risk factor for the development of active pulmonary tuberculosis (TB), with development of DM pandemic in countries where TB is also endemic. Understanding the impact of DM on TB and the determinants of co-morbidity is essential in responding to this growing public health problem with improved therapeutic approaches. Despite the clinical and public health significance posed by the dual burden of TB and DM, little is known about the immunological and biochemical mechanisms of susceptibility. One possible mechanism is that an impaired immune response in patients with DM facilitates either primary infection with Mycobacterium tuberculosis or reactivation of latent TB. Diabetes is associated with immune dysfunction and alterations in the components of the immune system, including altered levels of specific cytokines and chemokines. Some effects of DM on adaptive immunity that are potentially relevant to TB defence have been identified in humans. In this review, we summarize current findings regarding the alterations in the innate and adaptive immune responses and immunological mechanisms of susceptibility of patients with DM to M. tuberculosis infection and disease. © 2017 John Wiley & Sons Ltd.

  8. The n-hexane and chloroform fractions of Piper betle L. trigger different arms of immune responses in BALB/c mice and exhibit antifilarial activity against human lymphatic filarid Brugia malayi.

    Science.gov (United States)

    Singh, Meghna; Shakya, Shilpy; Soni, Vishal Kumar; Dangi, Anil; Kumar, Nikhil; Bhattacharya, Shailja-Misra

    2009-06-01

    Modulation of immune functions by using herbal plants and their products has become fundamental regime of therapeutic approach. Piper betle Linn. (Piperaceae) is a widely distributed plant in the tropical and subtropical regions of the world and has been attributed as traditional herbal remedy for many diseases. We have recently reported the antifilarial and antileishmanial efficacy in the leaf extract of Bangla Mahoba landrace of P. betle which is a female plant. The present report describes the in vivo immunomodulatory efficacy of the crude methanolic extract and its n-hexane, chloroform, n-butanol fractions of the female plant at various dose levels ranging between 0.3 and 500 mg/kg in BALB/c. Attempts were also made to observe antifilarial activity of the active extracts and correlate it with the antigen specific immune responses in another rodent Mastomys coucha infected with human lymphatic filarial parasite Brugia malayi. The crude methanol extract and n-hexane fraction were found to potentiate significant (p<0.001) enhancement of both humoral (plaque forming cells, hemagglutination titre) as well as cell-mediated (lymphoproliferation, macrophage activation, delayed type hypersensitivity) immune responses in mice. The flow cytometric analysis of splenocytes of treated mice indicated enhanced population of T-cells (CD4(+), CD8(+)) and B-cells (CD19(+)). The n-hexane fraction (3 mg/kg) was found to induce biased type 2 cytokine response as revealed by increased IL-4(+) and decreased IFN-gamma(+) T-cell population while the chloroform fraction (10 mg/kg) produced a predominant type 1 cytokines. Crude methanolic extract (100 mg/kg) demonstrated a mixed type 1 and type 2 cytokine responses thus suggesting a remarkable immunomodulatory property in this plant. The induction of differential T-helper cell immune response appears ideal to overcome immunosuppression as observed in case of lymphatic, filarial Brugia malayi infection which may also be extended to other

  9. Up-regulation of Human Leukocyte Antigen G Expression in Primary Cutaneous Malignant Melanoma Associated with Host-vs-tumor Immune Response

    Institute of Scientific and Technical Information of China (English)

    Xianfeng FANG; Xuxin ZHANG; Jiawen LI

    2008-01-01

    Human leukocyte antigen G (HLA-G) is one of the molecules implicated in immunotolerance. To investigate the role of HLA-G in primary cutaneous malignant melanoma (CMM), a series of 47 skin melanocytic lesions were immunohistochemicaily evaluated. The correlation between HLA-G expression and CMM clinicohistopahtologicai data and Bcl-2 expression was also analyzed.HLA-G expression was detected in a variety of cell types. No significant difference in HLA-G expression was observed between malignant and non-malignant melanocytic lesions. HLA-G expres- sion was significantly correlated with the inflammatory infiltration and Bel-2 expression, whereas no significant correlation with ulceration, tumor thickness, clinical stage, histopathologicai subtypes were observed. HLA-G expression may be the result of host immune reaction in tumor microenvi- ronment rather than a malignant feature of CMM.

  10. Evasion of Influenza A Viruses from Innate and Adaptive Immune Responses

    Directory of Open Access Journals (Sweden)

    Guus F. Rimmelzwaan

    2012-09-01

    Full Text Available The influenza A virus is one of the leading causes of respiratory tract infections in humans. Upon infection with an influenza A virus, both innate and adaptive immune responses are induced. Here we discuss various strategies used by influenza A viruses to evade innate immune responses and recognition by components of the humoral and cellular immune response, which consequently may result in reduced clearing of the virus and virus-infected cells. Finally, we discuss how the current knowledge about immune evasion can be used to improve influenza A vaccination strategies.

  11. Human cell mediated immunity to porins from Salmonella typhi.

    Science.gov (United States)

    Blanco, F; Isibasi, A; Raúl González, C; Ortiz, V; Paniagua, J; Arreguín, C; Kumate, J

    1993-01-01

    The current studies were undertaken to assess the role of the porins and outer membrane proteins (OMP) in the human immune response to Salmonella typhi 9, 12 Vi:d. Experiments were performed to determinate the lymphocyte activation response to porins in individuals who had been vaccinated against typhoid fever. 10 healthy volunteers were studied before and 10 days after oral or subcutaneous immunisation. Five patients with typhoid fever were also studied. Lymphocyte activation was measured by the 3H thymidine incorporation assay. Individuals with typhoid fever as well as those immunised with oral vaccine responded well to porins and outer membrane proteins, as opposed to those immunised with the subcutaneous vaccine. These results suggest that the porins and OMP play a role in the cellular immune response against Salmonella typhi.

  12. Rotavirus Antagonism of the Innate Immune Response

    Directory of Open Access Journals (Sweden)

    Michelle M. Arnold

    2009-11-01

    Full Text Available Rotavirus is a primary cause of severe dehydrating gastroenteritis in infants and young children. The virus is sensitive to the antiviral effects triggered by the interferon (IFN-signaling pathway, an important component of the host cell innate immune response. To counteract these effects, rotavirus encodes a nonstructural protein (NSP1 that induces the degradation of proteins involved in regulating IFN expression, such as members of the IFN regulatory factor (IRF family. In some instances, NSP1 also subverts IFN expression by causing the degradation of a component of the E3 ubiquitin ligase complex responsible for activating NF-κB. By antagonizing multiple components of the IFN-induction pathway, NSP1 aids viral spread and contributes to rotavirus pathogenesis.

  13. Baculovirus capsid display potentiates OVA cytotoxic and innate immune responses.

    Directory of Open Access Journals (Sweden)

    Paula Molinari

    Full Text Available Baculoviruses (BV are DNA viruses that are pathogenic for insects. Although BV infect a range of mammalian cell types, they do not replicate in these cells. Indeed, the potential effects of these insect viruses on the immune responses of mammals are only just beginning to be studied. We show in this paper that a recombinant Autographa californica multiple nuclear polyhedrosis virus carrying a fragment of ovalbumin (OVA on the VP39 capsid protein (BV-OVA has the capacity to act as an adjuvant and vector of antigens in mice, thereby promoting specific CD4 and cytotoxic T cell responses against OVA. BV also induced in vivo maturation of dendritic cells and the production of inflammatory cytokines, thus promoting innate and adaptive immune responses. The OVA-specific response induced by BV-OVA was strong enough to reject a challenge with OVA-expressing melanoma cells (MO5 cells and effectively prolonged survival of MO5 bearing mice. All these findings, together with the absence of pre-existing immunity to BV in humans and the lack of viral gene expression in mammalian cells, make BV a candidate for vaccination.

  14. Immunity to pathogens taught by specialized human dendritic cell subsets.

    Directory of Open Access Journals (Sweden)

    Jens A. E. Geginat

    2015-10-01

    Full Text Available Dendritic cells (DC are specialized antigen-presenting cells (APC that have a key role in immune responses, because they bridge the innate and adaptive arms of the immune system. They mature upon recognition of pathogens and up-regulate MHC molecules and co-stimulatory receptors to activate antigen-specific CD4+ and CD8+ T-cells. It is now well established that DC are not a homogeneous population, but are composed of different subsets with specialized functions in immune responses to specific pathogens. Upon viral infections, plasmacytoid DC (pDC rapidly produce large amounts of IFN-α, which has potent anti-viral functions and activates several other immune cells. However, pDC are not particularly potent APC and induce the tolerogenic cytokine IL-10 in CD4+ T-cells. In contrast, myeloid DC (mDC are very potent APC and possess the unique capacity to prime naïve T-cells and consequently to initiate a primary adaptive immune response. Different subsets of myeloid DC with specialized functions have been identified. In mice, CD8α+ mDC capture antigenic material from necrotic cells, secrete high levels of IL-12, and prime Th1 and cytotoxic T cell responses to control intracellular pathogens. Conversely, CD8α- mDC preferentially prime CD4+ T-cells and promote Th2 or Th17 differentiation. BDCA-3+ mDC2 are the human homologue of CD8α+ mDC, since they share the expression of several key molecules, the capacity to cross-present antigens to CD8+ T-cells and to produce IFN-λ. However, although several features of the DC network are conserved between humans and mice, the expression of several relevant toll-like receptors as well as the production of cytokines that regulate T-cell differentiation are different. Intriguingly, recent data suggests specific roles for human DC subsets in immune responses against individual pathogens. The biology of human DC subsets holds the promise to be exploitable in translational medicine, in particular for the

  15. Impact of nutrition on immune function and the inflammatory response

    Science.gov (United States)

    The review utilizes data on three micronutrients (vitamin A, zinc and iron), anthropometrically defined undernutrition (stunting, wasting and underweight) and obesity to evaluate the effect on immune function, recovery of immune function in response to nutritional interventions, related health outco...

  16. Mx bio adjuvant for enhancing immune responses against influenza virus

    Directory of Open Access Journals (Sweden)

    Sina Soleimani

    2015-06-01

    Conclusion: These data revealed that Mx1 as biological adjuvant was able to increase antibody titer and induction memory immune responses against influenza immunization without causing any side effects.

  17. Unique human immune signature of Ebola virus disease in Guinea.

    Science.gov (United States)

    Ruibal, Paula; Oestereich, Lisa; Lüdtke, Anja; Becker-Ziaja, Beate; Wozniak, David M; Kerber, Romy; Korva, Miša; Cabeza-Cabrerizo, Mar; Bore, Joseph A; Koundouno, Fara Raymond; Duraffour, Sophie; Weller, Romy; Thorenz, Anja; Cimini, Eleonora; Viola, Domenico; Agrati, Chiara; Repits, Johanna; Afrough, Babak; Cowley, Lauren A; Ngabo, Didier; Hinzmann, Julia; Mertens, Marc; Vitoriano, Inês; Logue, Christopher H; Boettcher, Jan Peter; Pallasch, Elisa; Sachse, Andreas; Bah, Amadou; Nitzsche, Katja; Kuisma, Eeva; Michel, Janine; Holm, Tobias; Zekeng, Elsa-Gayle; García-Dorival, Isabel; Wölfel, Roman; Stoecker, Kilian; Fleischmann, Erna; Strecker, Thomas; Di Caro, Antonino; Avšič-Županc, Tatjana; Kurth, Andreas; Meschi, Silvia; Mély, Stephane; Newman, Edmund; Bocquin, Anne; Kis, Zoltan; Kelterbaum, Anne; Molkenthin, Peter; Carletti, Fabrizio; Portmann, Jasmine; Wolff, Svenja; Castilletti, Concetta; Schudt, Gordian; Fizet, Alexandra; Ottowell, Lisa J; Herker, Eva; Jacobs, Thomas; Kretschmer, Birte; Severi, Ettore; Ouedraogo, Nobila; Lago, Mar; Negredo, Anabel; Franco, Leticia; Anda, Pedro; Schmiedel, Stefan; Kreuels, Benno; Wichmann, Dominic; Addo, Marylyn M; Lohse, Ansgar W; De Clerck, Hilde; Nanclares, Carolina; Jonckheere, Sylvie; Van Herp, Michel; Sprecher, Armand; Xiaojiang, Gao; Carrington, Mary; Miranda, Osvaldo; Castro, Carlos M; Gabriel, Martin; Drury, Patrick; Formenty, Pierre; Diallo, Boubacar; Koivogui, Lamine; Magassouba, N'Faly; Carroll, Miles W; Günther, Stephan; Muñoz-Fontela, César

    2016-05-01

    Despite the magnitude of the Ebola virus disease (EVD) outbreak in West Africa, there is still a fundamental lack of knowledge about the pathophysiology of EVD. In particular, very little is known about human immune responses to Ebola virus. Here we evaluate the physiology of the human T cell immune response in EVD patients at the time of admission to the Ebola Treatment Center in Guinea, and longitudinally until discharge or death. Through the use of multiparametric flow cytometry established by the European Mobile Laboratory in the field, we identify an immune signature that is unique in EVD fatalities. Fatal EVD was characterized by a high percentage of CD4(+) and CD8(+) T cells expressing the inhibitory molecules CTLA-4 and PD-1, which correlated with elevated inflammatory markers and high virus load. Conversely, surviving individuals showed significantly lower expression of CTLA-4 and PD-1 as well as lower inflammation, despite comparable overall T cell activation. Concomitant with virus clearance, survivors mounted a robust Ebola-virus-specific T cell response. Our findings suggest that dysregulation of the T cell response is a key component of EVD pathophysiology.

  18. Resources, stress, and immunity: an ecological perspective on human psychoneuroimmunology.

    Science.gov (United States)

    Segerstrom, Suzanne C

    2010-08-01

    Ecological immunology provides a broad theoretical perspective on phenotypic plasticity in immunity, that is, changes related to the value of immunity across different situations, including stressful situations. Costs of a maximally efficient immune response may at times outweigh benefits, and some aspects of immunity may be adaptively suppressed. This review provides a basic overview of the tenets of ecological immunology and the energetic costs of immunity and relates them to the literature on stress and immunity. Sickness behavior preserves energy for use by the immune system, acute stress mobilizes "first-line" immune defenders while suppressing more costly responses, and chronic stress may suppress costly responses in order to conserve energy to counteract the resource loss associated with stress. Unexpected relationships between stress "buffers" and immune functions demonstrate phenotypic plasticity related to resource pursuit or preservation. In conclusion, ecological models may aid in understanding the relationship between stress and immunity.

  19. Anti-PD-L1 prolongs survival and triggers T cell but not humoral anti-tumor immune responses in a human MUC1-expressing preclinical ovarian cancer model.

    Science.gov (United States)

    Mony, Jyothi Thyagabhavan; Zhang, Lixin; Ma, Tianzhou; Grabosch, Shannon; Tirodkar, Tejas S; Brozick, Joan; Tseng, George; Elishaev, Esther; Edwards, Robert P; Huang, Xin; Vlad, Anda M

    2015-09-01

    Monoclonal antibodies that block inhibitory immune checkpoint molecules and enhance anti-tumor responses show clinical promise in advanced solid tumors. Most of the preliminary evidence on therapeutic efficacy of immune checkpoint blockers comes from studies in melanoma, lung and renal cancer. To test the in vivo potential of programmed death-ligand 1 (PD-L1) blockade in ovarian cancer, we recently generated a new transplantable tumor model using human mucin 1 (MUC1)-expressing 2F8 cells. The MUC1 transgenic (MUC1.Tg) mice develop large number of intraperitoneal (IP) tumors following IP injection of 8 × 10(5) syngeneic 2F8 cells. The tumors are aggressive and display little T cell infiltration. Anti-PD-L1 antibody was administered IP every 2 weeks (200 μg/dose) for a total of three doses. Treatment was started 21 days post-tumor challenge, a time point which corresponds to late tumor stage. The anti-PD-L1 treatment led to substantial T cell infiltration within the tumor and significantly increased survival (p = 0.001) compared to isotype control-treated mice. When the same therapy was administered to wild-type mice challenged with 2F8 tumors, no survival benefit was observed, despite the presence of high titer anti-MUC1 antibodies. However, earlier treatment (day 11) and higher frequency of IP injections restored the T cell responses and led to prolonged survival. Splenocyte profiling via Nanostring using probes for 511 immune genes revealed a treatment-induced immune gene signature consistent with increased T cell-mediated immunity. These findings strongly support further preclinical and clinical strategies exploring PD-L1 blockade in ovarian cancer.

  20. Enhancement of anamnestic immunospecific antibody response in orally immunized chickens

    DEFF Research Database (Denmark)

    Mayo, Susan; Carlsson, Hans-Erik; Zagon, Andrea

    2008-01-01

    of the immunization in week 18, demonstrating the presence of memory cells following the two initial oral immunizations. Considering that oral immunization results in approximately ten times lower concentrations of immunospecific antibodies in the egg yolk, compared to traditional subcutaneous immunization schemes......Production of immunospecific egg yolk antibodies (IgY antibodies) in egg laying hens through oral immunization is an attractive alternative to conventional antibody production in mammals for economic reasons as well as for animal welfare reasons. Oral immunization results in a systemic humoral...... response, but oral booster immunizations lack efficiency. The aim of the present study was to develop immunization schemes in which the concentration of immunospecific IgY would increase following oral booster immunizations. Two groups of egg laying hens (5 in each group) were immunized orally (each...

  1. The IL23R R381Q gene variant protects against immune-mediated diseases by impairing IL-23-induced Th17 effector response in humans.

    Directory of Open Access Journals (Sweden)

    Paola Di Meglio

    Full Text Available IL-23 and Th17 cells are key players in tissue immunosurveillance and are implicated in human immune-mediated diseases. Genome-wide association studies have shown that the IL23R R381Q gene variant protects against psoriasis, Crohn's disease and ankylosing spondylitis. We investigated the immunological consequences of the protective IL23R R381Q gene variant in healthy donors. The IL23R R381Q gene variant had no major effect on Th17 cell differentiation as the frequency of circulating Th17 cells was similar in carriers of the IL23R protective (A and common (G allele. Accordingly, Th17 cells generated from A and G donors produced similar amounts of Th17 cytokines. However, IL-23-mediated Th17 cell effector function was impaired, as Th17 cells from A allele carriers had significantly reduced IL-23-induced IL-17A production and STAT3 phosphorylation compared to G allele carriers. Our functional analysis of a human disease-associated gene variant demonstrates that IL23R R381Q exerts its protective effects through selective attenuation of IL-23-induced Th17 cell effector function without interfering with Th17 differentiation, and highlights its importance in the protection against IL-23-induced tissue pathologies.

  2. Wolbachia symbiosis and insect immune response

    Institute of Scientific and Technical Information of China (English)

    Stefanos Siozios; Panagiotis Sapountzis; Panagiotis Ioannidis; Kostas Bourtzis

    2008-01-01

    Bacterial intracellular symbiosis is very common in insects, having significant consequences in promoting the evolution of life and biodiversity. The bacterial group that has recently attracted particular attention is Wolbachia pipientis which probably represents the most ubiquitous endosymbiont on the planet. W. pipientis is a Gram-negative obligatory intracellular and maternally transmitted α-proteobacterium, that is able to establish symbiotic associations with arthropods and nematodes. In arthropods, Wolbachia pipientis infections have been described in Arachnida, in Isopoda and mainly in Insecta. They have been reported in almost all major insect orders including Diptera, Coleoptera, Hemiptera,Hymenoptera, Orthoptera and Lepidoptera. To enhance its transmission, W. pipientis can manipulate host reproduction by inducing parthenogenesis, feminization, male killing and cytoplasmic incompatibility. Several polymerase chain reaction surveys have indicated that up to 70% of all insect species may be infected with W. pipientis. How does W. pipientis manage to get established in diverse insect host species? How is this intracellular bacterial symbiont species so successful in escaping the host immune response? The present review presents recent advances and ongoing scientific efforts in the field. The current body of knowledge in the field is summarized, revelations from the available genomic information are presented and as yet unanswered questions are discussed in an attempt to present a comprehensive picture of the unique ability of W. pipientis to establish symbiosis and to manipulate reproduction while evading the host's immune system.

  3. The immune response and its therapeutic modulation in bronchiectasis.

    Science.gov (United States)

    Daheshia, Massoud; Prahl, James D; Carmichael, Jacob J; Parrish, John S; Seda, Gilbert

    2012-01-01

    Bronchiectasis (BC) is a chronic pulmonary disease with tremendous morbidity and significant mortality. As pathogen infection has been advocated as a triggering insult in the development of BC, a central role for the immune response in this process seems obvious. Inflammatory cells are present in both the airways as well as the lung parenchyma, and multiple mediators of immune cells including proteases and cytokines or their humoral products are increased locally or in the periphery. Interestingly, a defect in the immune system or suppression of immune response during conditions such as immunodeficiency may well predispose one to the devastating effects of BC. Thus, the outcome of an active immune response as detrimental or protective in the pathogenesis of BC may be dependent on the state of the patient's immunity, the severity of infection, and the magnitude of immune response. Here we reassess the function of the innate and acquired immunity in BC, the major sites of immune response, and the nature of the bioactive mediators. Furthermore, the potential link(s) between an ongoing immune response and structural alterations accompanying the disease and the success of therapies that can modulate the nature and extent of immune response in BC are elaborated upon.

  4. 21 CFR 640.100 - Immune Globulin (Human).

    Science.gov (United States)

    2010-04-01

    ... 21 Food and Drugs 7 2010-04-01 2010-04-01 false Immune Globulin (Human). 640.100 Section 640.100 Food and Drugs FOOD AND DRUG ADMINISTRATION, DEPARTMENT OF HEALTH AND HUMAN SERVICES (CONTINUED) BIOLOGICS ADDITIONAL STANDARDS FOR HUMAN BLOOD AND BLOOD PRODUCTS Immune Globulin (Human) § 640.100...

  5. Defence mechanisms and immune evasion in the interplay between the humane immune system and Plasmodium falciparum

    DEFF Research Database (Denmark)

    Theander, T G

    1992-01-01

    Immunity to P. falciparum malaria is developed as a result of long term exposure to the parasite and depends on immunological memory. The key directors in immune recognition and regulation of the immunological responses are the T-cells. It seems reasonable to propose that immunity is acquired when......) Immune recognition is hampered by the extraordinary diversity of antigen phenotypes in the parasite population. 3) Immune regulation is obstructed by immune suppression. During P. falciparum malaria such suppression is characterized by a profoundly diminished in vitro proliferative response to malaria...

  6. Probing Human NK Cell Biology Using Human Immune System (HIS) Mice.

    Science.gov (United States)

    Li, Yan; Di Santo, James P

    2016-01-01

    Our incomplete understanding of the mechanisms that orchestrate human lymphocyte differentiation and condition human immune responses is in part due to the limited access to normal human tissue samples that can inform on these complex processes. In addition, in vitro culture conditions fail to recapitulate the three-dimensional microenvironments that influence cell-cell interactions and impact on immune outcomes. Small animals provide a preclinical model to dissect and probe immunity and over the past decades, development of immunodeficient hosts that can be engrafted with human hematopoietic precursors and mature cells have led to the development of new in vivo models to study human lymphocyte development and function. Natural killer (NK) cells are implicated in the recognition and elimination of pathogen-infected and transformed cells and belong to a family of diverse innate lymphoid cells (ILCs) that provide early immune defense against disease. Here, we summarize the use of humanized mouse models for the study of NK cell and group 1 ILCs and their respective roles in immunity and tissue homeostasis.

  7. Flavobacterium psychrophilum - Experimental challenge and immune response

    DEFF Research Database (Denmark)

    Henriksen, Maya Maria Mihályi

    use of antibiotics, further knowledge of the disease is needed. Previous studies focusing on various types of aquacultures demonstrated the presence of F. psychrophilum in all examined farms. The bacterium was demonstrated in gills, skin, internal organs and wounds both during RTFS outbreaks......) Establish an experimental infection model imitating natural infection, 2) examine the immune response in blood and selected organs, and 3) examine potential portals of entry for the bacterium. Previous experimental immersion-challenges involving F. psychrophilum have resulted in none or low mortality...... in rainbow trout fry, unless the fish are stressed or have their surface compromised through e.g. injuries to the skin. The effect of a range of hydrogen peroxide (H2O2) concentrations was tested on fry in order to assess mortality. An appropriate dose was subsequently combined with immersion in a diluted...

  8. Early Rise of Blood T Follicular Helper Cell Subsets and Baseline Immunity as Predictors of Persisting Late Functional Antibody Responses to Vaccination in Humans.

    Directory of Open Access Journals (Sweden)

    Fabiana Spensieri

    Full Text Available CD4+ T follicular helper cells (T(FH have been identified as the T-cell subset specialized in providing help to B cells for optimal activation and production of high affinity antibody. We recently demonstrated that the expansion of peripheral blood influenza-specific CD4(+IL-21(+ICOS1(+ T helper (T(H cells, three weeks after vaccination, associated with and predicted the rise of protective neutralizing antibodies to avian H5N1. In this study, healthy adults were vaccinated with plain seasonal trivalent inactivated influenza vaccine (TIIV, MF59(®-adjuvanted TIIV (ATIIV, or saline placebo. Frequencies of circulating CD4(+ T(FH1 ICOS(+ T(FH cells and H1N1-specific CD4(+-IL-21(+ICOS(+ CXCR5(+ T(FH and CXCR5(- T(H cell subsets were determined at various time points after vaccination and were then correlated with hemagglutination inhibition (HI titers. All three CD4(+ T cell subsets expanded in response to TIIV and ATIIV, and peaked 7 days after vaccination. To demonstrate that these T(FH cell subsets correlated with functional antibody titers, we defined an alternative endpoint metric, decorrelated HI (DHI, which removed any correlation between day 28/day 168 and day 0 HI titers, to control for the effect of preexisting immunity to influenza vaccine strains. The numbers of total circulating CD4(+T(FH1 ICOS(+ cells and of H1N1-specific CD4(+IL-21(+ICOS(+ CXCR5(+, measured at day 7, were significantly associated with day 28, and day 28 and 168 DHI titers, respectively. Altogether, our results show that CD4(+ T(FH subsets may represent valuable biomarkers of vaccine-induced long-term functional immunity.

  9. Early Rise of Blood T Follicular Helper Cell Subsets and Baseline Immunity as Predictors of Persisting Late Functional Antibody Responses to Vaccination in Humans

    Science.gov (United States)

    Borgogni, Erica; Zedda, Luisanna; Cantisani, Rocco; Chiappini, Nico; Schiavetti, Francesca; Rosa, Domenico; Castellino, Flora; Montomoli, Emanuele; Bodinham, Caroline L.; Lewis, David J.; Medini, Duccio; Bertholet, Sylvie; Del Giudice, Giuseppe

    2016-01-01

    CD4+ T follicular helper cells (TFH) have been identified as the T-cell subset specialized in providing help to B cells for optimal activation and production of high affinity antibody. We recently demonstrated that the expansion of peripheral blood influenza-specific CD4+IL-21+ICOS1+ T helper (TH) cells, three weeks after vaccination, associated with and predicted the rise of protective neutralizing antibodies to avian H5N1. In this study, healthy adults were vaccinated with plain seasonal trivalent inactivated influenza vaccine (TIIV), MF59®-adjuvanted TIIV (ATIIV), or saline placebo. Frequencies of circulating CD4+ TFH1 ICOS+ TFH cells and H1N1-specific CD4+IL-21+ICOS+ CXCR5+ TFH and CXCR5- TH cell subsets were determined at various time points after vaccination and were then correlated with hemagglutination inhibition (HI) titers. All three CD4+ T cell subsets expanded in response to TIIV and ATIIV, and peaked 7 days after vaccination. To demonstrate that these TFH cell subsets correlated with functional antibody titers, we defined an alternative endpoint metric, decorrelated HI (DHI), which removed any correlation between day 28/day 168 and day 0 HI titers, to control for the effect of preexisting immunity to influenza vaccine strains. The numbers of total circulating CD4+ TFH1 ICOS+ cells and of H1N1-specific CD4+IL-21+ICOS+ CXCR5+, measured at day 7, were significantly associated with day 28, and day 28 and 168 DHI titers, respectively. Altogether, our results show that CD4+ TFH subsets may represent valuable biomarkers of vaccine-induced long-term functional immunity. Trial Registration ClinicalTrials.gov NCT01771367 PMID:27336786

  10. FEATURES OF THE IMMUNE RESPONSE DURING VIRAL INFECTION

    Directory of Open Access Journals (Sweden)

    G. A. Borisov

    2015-01-01

    Full Text Available The aim of the investigation was to select using cluster analysis and comparatively characterize immune disorders types in acute and chronic viral infections. Patients with acute and chronic viral infections (n = 896 were examined: 77 patients with acute viral hepatitis B, 94 — chronic viral hepatitis B, 119 — chronic hepatitis C, 531 — recurrent herpes, 75 — human papillomavirus infection. Healthy persons (n = 466 were examined as control. The research of blood lymphocyte phenotype was performed by flow cytometry. Four-color immunophenotyping were used in the following panels: Т-lymphocytes (CD3+CD19–CD16/56–CD45+, Т-helpers (CD3+CD4+CD45+, cytotoxic Т-cells (CD3+CD8+CD45+, NKcells (CD3–CD16/56+CD45+, B-lymphocytes (CD3–CD19+CD16/56+CD45+. Absolute values were obtained on a dualplatform technology using the results of haematological analysis. The immunoglobulin concentrations were determined by ELISA. The clustering was performed by a single linkage method. The number of clusters was determined on the basis of calculating the values of the Euclidean distance between the mean group values. It was found that the parameters, characterizing the functional state of the various parts of the immune system in acute and chronic viral infections, considerable diversity values. Custer analysis allows to allocate 6 immunotypes defined different states of innate and adaptive immunity: characterized by activation of the innate (increasing the number of neutrophils and NK-cells and adaptive immunity humoral response (increasing the concentration of IgG, characterized by hyperreaction of adaptive immunity (a significant increase in the concentration of IgG, discoordinated (multidirectional changes in the values of immunological parameters, immunodeficiency and unresponsiveness (did not differ from the control parameters immunotypes. It is proved that in patients with viral infections most often determined by the

  11. Danger Signals Activating the Immune Response after Trauma

    Directory of Open Access Journals (Sweden)

    Stefanie Hirsiger

    2012-01-01

    Full Text Available Sterile injury can cause a systemic inflammatory response syndrome (SIRS that resembles the host response during sepsis. The inflammatory response following trauma comprises various systems of the human body which are cross-linked with each other within a highly complex network of inflammation. Endogenous danger signals (danger-associated molecular patterns; DAMPs; alarmins as well as exogenous pathogen-associated molecular patterns (PAMPs play a crucial role in the initiation of the immune response. With popularization of the “danger theory,” numerous DAMPs and PAMPs and their corresponding pathogen-recognition receptors have been identified. In this paper, we highlight the role of the DAMPs high-mobility group box protein 1 (HMGB1, interleukin-1α (IL-1α, and interleukin-33 (IL-33 as unique dual-function mediators as well as mitochondrial danger signals released upon cellular trauma and necrosis.

  12. Innate and Adaptive Cellular Immune Responses to Mycobacterium tuberculosis Infection.

    Science.gov (United States)

    Mayer-Barber, Katrin D; Barber, Daniel L

    2015-07-17

    Host resistance to Mycobacterium tuberculosis (Mtb) infection requires the coordinated efforts of innate and adaptive immune cells. Diverse pulmonary myeloid cell populations respond to Mtb with unique contributions to both host-protective and potentially detrimental inflammation. Although multiple cell types of the adaptive immune system respond to Mtb infection, CD4 T cells are the principal antigen-specific cells responsible for containment of Mtb infection, but they can also be major contributors to disease during Mtb infection in several different settings. Here, we will discuss the role of different myeloid populations as well as the dual nature of CD4 T cells in Mtb infection with a primary focus on data generated using in vivo cellular immunological studies in experimental animal models and in humans when available. Copyright © 2015 Cold Spring Harbor Laboratory Press; all rights reserved.

  13. Immune response hinders therapy for lysosomal storage diseases.

    Science.gov (United States)

    Ponder, Katherine P

    2008-08-01

    Enzyme replacement therapy (ERT) for the lysosomal storage disease mucopolysaccharidosis I (MPS I) involves i.v. injection of alpha-l-iduronidase, which can be taken up by cells throughout the body. While a significant immune response to ERT has been shown in patients with MPS I, little is known about what effect anti-enzyme antibodies have on treatment efficacy. In this issue of the JCI, Dickson et al. demonstrate that anti-enzyme antibodies inhibit enzyme uptake and substantially limit the therapeutic efficacy of ERT in canines with MPS I (see the related article beginning on page 2868). Furthermore, the induction of immune tolerance--via oral delivery of cyclosporine A and azathioprine for two months at the time of initiation of ERT with recombinant human alpha-L-iduronidase--improved enzyme uptake in organs. Therefore, transient immunosuppression may enhance ERT for lysosomal storage diseases.

  14. Consumption of purple sweet potato leaves modulates human immune response: T-lymphocyte functions, lytic activity of natural killer cell and antibody production

    Institute of Scientific and Technical Information of China (English)

    Chiao-Ming Chen; Sing-Chung Li; Ya-Ling Lin; Ching-Yun Hsu; Ming-Jer Shieh; Jen-Fang Liu

    2005-01-01

    AIM: To study the immunological effects of physiological doses of purple sweet potato leaves (PSPL).METHODS: The randomized crossover study (two periods,each lasting for 2 wk) involved 16 healthy non-smoking adults of normal weight. The 6-wk study consisted of a run-in (wk 1) PSPL diet (daily consumption of 200 g PSPL) or a control diet (low polyphenols, with the amount of carotenoids adjusted to the same level as that of PSPL) (wk 2-3), washout diet (wk 4), and switched diet (wk 5-6). Fasting blood was collected weekly in the morning. T-lymphocyte function was assessed via the proliferation and secretion of immunoreactive cytokines.Salivary IgA secretion and the specific cytotoxic activities of cytotoxic T lymphocytes and natural killer (NK) cells were determined.RESULTS: The plasma β-carotene level increased with time in both groups, while the plasma polyphenol level decreased in the control group, and no significant difference was detected between the two groups.Although plasma polyphenol levels did not significantly increase in the PSPL group at the end of the study, they were significantly elevated in urine. PSPL consumption produced a significant increase in proliferation responsiveness of peripheral blood mononuclear cells (PBMC) and their secretion of immunoreactive IL-2 and IL-4. As well, lytic activity in NK cells was elevated in a time-dependent fashion. Salivary TgA secretion significantly decreased in control group after 2 wk, and returned to baseline following dietary switch to PSPL.CONCLUSION: Consumption of PSPL modulates various immune functions including increased proliferation responsiveness of PBMC, secretion of cytokines IL-2 and IL-4, and the lytic activity of NK cells. The responsible determinants of PSPL remain to be elucidated, as does the biological significance of the present observations.

  15. CTA1-DD adjuvant promotes strong immunity against human immunodeficiency virus type 1 envelope glycoproteins following mucosal immunization.

    Science.gov (United States)

    Sundling, Christopher; Schön, Karin; Mörner, Andreas; Forsell, Mattias N E; Wyatt, Richard T; Thorstensson, Rigmor; Karlsson Hedestam, Gunilla B; Lycke, Nils Y

    2008-12-01

    Strategies to induce potent and broad antibody responses against the human immunodeficiency virus type 1 (HIV-1) envelope glycoproteins (Env) at both systemic and mucosal sites represent a central goal for HIV-1 vaccine development. Here, we show that the non-toxic CTA1-DD adjuvant promoted mucosal and systemic humoral and cell-mediated immune responses following intranasal (i.n.) immunizations with trimeric or monomeric forms of HIV-1 Env in mice and in non-human primates. Env-specific IgG subclasses in the serum of immunized mice reflected a balanced Th1/Th2 type of response. Strikingly, i.n. immunizations with Env and the CTA1-DD adjuvant induced substantial levels of mucosal anti-Env IgA in bronchial alveolar lavage and also detectable levels in vaginal secretions. By contrast, parenteral immunizations of Env formulated in Ribi did not stimulate mucosal IgA responses, while the two adjuvants induced a similar distribution of Env-specific IgG-subclasses in serum. A single parenteral boost with Env in Ribi adjuvant into mice previously primed i.n. with Env and CTA1-DD, augmented the serum anti-Env IgG levels to similar magnitudes as those observed after three intraperitoneal immunizations with Env in Ribi. The augmenting potency of CTA1-DD was similar to that of LTK63 or CpG oligodeoxynucleotides (ODN). However, in contrast to CpG ODN, the effect of CTA1-DD and LTK63 appeared to be independent of MyD88 and toll-like receptor signalling. This is the first demonstration that CTA1-DD augments specific immune responses also in non-human primates, suggesting that this adjuvant could be explored further as a clinically safe mucosal vaccine adjuvant for humoral and cell-mediated immunity against HIV-1 Env.

  16. Alphacoronavirus protein 7 modulates host innate immune response.

    Science.gov (United States)

    Cruz, Jazmina L G; Becares, Martina; Sola, Isabel; Oliveros, Juan Carlos; Enjuanes, Luis; Zúñiga, Sonia

    2013-09-01

    Innate immune response is the first line of antiviral defense resulting, in most cases, in pathogen clearance with minimal clinical consequences. Viruses have developed diverse strategies to subvert host defense mechanisms and increase their survival. In the transmissible gastroenteritis virus (TGEV) as a model, we previously reported that accessory gene 7 counteracts the host antiviral response by associating with the catalytic subunit of protein phosphatase 1 (PP1c). In the present work, the effect of the absence of gene 7 on the host cell, during infection, was further analyzed by transcriptomic analysis. The pattern of gene expression of cells infected with a recombinant mutant TGEV, lacking gene 7 expression (rTGEV-Δ7), was compared to that of cells infected with the parental virus (rTGEV-wt). Genes involved in the immune response, the interferon response, and inflammation were upregulated during TGEV infection in the absence of gene 7. An exacerbated innate immune response during infection with rTGEV-Δ7 virus was observed both in vitro and in vivo. An increase in macrophage recruitment and activation in lung tissues infected with rTGEV-Δ7 virus was observed compared to cells infected with the parental virus. In summary, the absence of protein 7 both in vitro and in vivo led to increased proinflammatory responses and acute tissue damage after infection. In a porcine animal model, which is immunologically similar to humans, we present a novel example of how viral proteins counteract host antiviral pathways to determine the infection outcome and pathogenesis.

  17. Mast cells and basophils in cutaneous immune responses.

    Science.gov (United States)

    Otsuka, A; Kabashima, K

    2015-02-01

    Mast cells and basophils share some functions in common and are generally associated with T helper 2 (Th2) immune responses, but taking basophils as surrogate cells for mast cell research or vice versa for several decades is problematic. Thus far, their in vitro functions have been well studied, but their in vivo functions remained poorly understood. New research tools for their functional analysis in vivo have revealed previously unrecognized roles for mast cells and basophils in several skin disorders. Newly developed mast cell-deficient mice provided evidence that mast cells initiate contact hypersensitivity via activating dendritic cells. In addition, studies using basophil-deficient mice have revealed that basophils were responsible for cutaneous Th2 skewing to haptens and peptide antigens but not to protein antigens. Moreover, human basophils infiltrate different skin lesions and have been implicated in the pathogenesis of skin diseases ranging from atopic dermatitis to autoimmune diseases. In this review, we will discuss the recent advances related to mast cells and basophils in human and murine cutaneous immune responses.

  18. Candida albicans Yeast and Germ Tube Forms Interfere Differently with Human Monocyte Differentiation into Dendritic Cells: a Novel Dimorphism-Dependent Mechanism To Escape the Host's Immune Response

    Science.gov (United States)

    Torosantucci, Antonella; Romagnoli, Giulia; Chiani, Paola; Stringaro, Annarita; Crateri, Pasqualina; Mariotti, Sabrina; Teloni, Raffaela; Arancia, Giuseppe; Cassone, Antonio; Nisini, Roberto

    2004-01-01

    The ability of Candida albicans to convert from the yeast (Y) form to mycelial forms through germ tube (GT) formation is considered a key feature of the transition of the organism from commensalism to virulence. We show here that human monocytes cultured with granulocyte-macrophage colony-stimulating factor and interleukin-4 (IL-4) after phagocytosis of Y forms did not differentiate into dendritic cells (DCs); they retained CD14, did not acquire CD1a, and were unable to express the maturation markers CD83 and CCR7. Moreover, they did not produce IL-12p70 but secreted IL-10. In addition, they spontaneously expressed high levels of tumor necrosis factor alpha (TNF-α), IL-6, and IL-8 mRNA transcripts and were able to induce proliferation of alloreactive memory but not naïve T lymphocytes. Conversely, monocytes that had phagocytosed GT forms differentiated into mature CD83+ and CCR7+ DCs; however, there was no up-regulation of CD40, CD80, and major histocompatibility complex class II, irrespective of lipopolysaccharide (LPS) treatment. In addition, these cells were unable to produce IL-12 even after LPS stimulation, but they were not functionally exhausted, as shown by their capacity to express TNF-α and IL-8 mRNA transcripts. These cells were able to prime naïve T cells but not to induce their functional polarization into effector cells. These data indicate that phagocytosis of Y and GT forms has profound and distinct effects on the differentiation pathway of monocytes. Thus, the differentiation of human monocytes into DCs appears to be tunable and exploitable by C. albicans to elude immune surveillance. PMID:14742527

  19. Paramyxovirus activation and inhibition of innate immune responses.

    Science.gov (United States)

    Parks, Griffith D; Alexander-Miller, Martha A

    2013-12-13

    Paramyxoviruses represent a remarkably diverse family of enveloped nonsegmented negative-strand RNA viruses, some of which are the most ubiquitous disease-causing viruses of humans and animals. This review focuses on paramyxovirus activation of innate immune pathways, the mechanisms by which these RNA viruses counteract these pathways, and the innate response to paramyxovirus infection of dendritic cells (DC). Paramyxoviruses are potent activators of extracellular complement pathways, a first line of defense that viruses must face during natural infections. We discuss mechanisms by which these viruses activate and combat complement to delay neutralization. Once cells are infected, virus replication drives type I interferon (IFN) synthesis that has the potential to induce a large number of antiviral genes. Here we describe four approaches by which paramyxoviruses limit IFN induction: by limiting synthesis of IFN-inducing aberrant viral RNAs, through targeted inhibition of RNA sensors, by providing viral decoy substrates for cellular kinase complexes, and through direct blocking of the IFN promoter. In addition, paramyxoviruses have evolved diverse mechanisms to disrupt IFN signaling pathways. We describe three general mechanisms, including targeted proteolysis of signaling factors, sequestering cellular factors, and upregulation of cellular inhibitors. DC are exceptional cells with the capacity to generate adaptive immunity through the coupling of innate immune signals and T cell activation. We discuss the importance of innate responses in DC following paramyxovirus infection and their consequences for the ability to mount and maintain antiviral T cells.

  20. Spaceflight and immune responses of rhesus monkeys

    Science.gov (United States)

    Sonnenfeld, Gerald; Morton, Darla S.; Swiggett, Jeanene P.; Hakenewerth, Anne M.; Fowler, Nina A.

    1995-01-01

    The effects of restraint on immunological parameters was determined in an 18 day ARRT (adult rhesus restraint test). The monkeys were restrained for 18 days in the experimental station for the orbiting primate (ESOP), the chair of choice for Space Shuttle experiments. Several immunological parameters were determined using peripheral blood, bone marrow, and lymph node specimens from the monkeys. The parameters included: response of bone marrow cells to GM-CSF (granulocyte-macrophage colony stimulating factor), leukocyte subset distribution, and production of IFN-a (interferon-alpha) and IFN-gamma (interferon-gamma). The only parameter changed after 18 days of restraint was the percentage of CD8+ T cells. No other immunological parameters showed changes due to restraint. Handling and changes in housing prior to the restraint period did apparently result in some restraint-independent immunological changes. Handling must be kept to a minimum and the animals allowed time to recover prior to flight. All experiments must be carefully controlled. Restraint does not appear to be a major issue regarding the effects of space flight on immune responses.

  1. Spaceflight and Immune Responses of Rhesus Monkeys

    Science.gov (United States)

    Sonnenfeld, Gerald

    1997-01-01

    In the grant period, we perfected techniques for determination of interleukin production and leukocyte subset analysis of rhesus monkeys. These results are outlined in detail in publication number 2, appended to this report. Additionally, we participated in the ARRT restraint test to determine if restraint conditions for flight in the Space Shuttle could contribute to any effects of space flight on immune responses. All immunological parameters listed in the methods section were tested. Evaluation of the data suggests that the restraint conditions had minimal effects on the results observed, but handling of the monkeys could have had some effect. These results are outlined in detail in manuscript number 3, appended to this report. Additionally, to help us develop our rhesus monkey immunology studies, we carried out preliminary studies in mice to determine the effects of stressors on immunological parameters. We were able to show that there were gender-based differences in the response of immunological parameters to a stressor. These results are outlined in detail in manuscript number 4, appended to this report.

  2. Antigen-specific acquired immunity in human brucellosis: implications for diagnosis, prognosis, and vaccine development

    Directory of Open Access Journals (Sweden)

    Anthony P Cannella

    2012-02-01

    Full Text Available Brucella spp. are facultative intracellular Gram negative bacteria with specific tropism for monocytes/macrophages. Clinical manifestations of brucellosis are primarily immune-mediated and not thought to be due to bacterial virulence factors. Acquired immunity to brucellosis has been studied through observations of naturally infected hosts (cattle, goats, laboratory mouse models, and human infection. Cell-mediated immunity drives the clinical manifestations of human disease after exposure to Brucella species but high antibody responses are not associated with protective immunity. The precise mechanisms by which cell-mediated immune responses confer protection or lead to disease manifestations remain poorly understood. Descriptive studies of immune responses in human brucellosis show that TH1 (interferon-gamma are associated with dominant immune responses, findings consistent with animal studies. Whether these T cell responses are protective, or determine the different clinical responses associated with brucellosis is unknown, especially with regard to undulant fever manifestations, relapsing disease, or are associated with responses to distinct sets of Brucella spp. antigens are unknown. Few data regarding T cell responses in terms of specific recognition of Brucella spp. protein antigens and peptidic epitopes, either by CD4+ or CD8+ T cells, have been identified in human brucellosis patients. Additionally because current attenuated Brucella vaccines used in animals cause human disease, there is a true need for a recombinant protein subunit vaccine for human brucellosis, as well as for improved diagnostics in terms of prognosis and identification of unusual forms of brucellosis. This review will focus on current understandings of antigen-specific immune responses induced by Brucella protein antigens that has promise for yielding new insights into vaccine and diagnostics development, and for understanding pathogenetic mechanisms of human

  3. Meningococcal C specific immune responses: immunity in an era of immunization with vaccine

    NARCIS (Netherlands)

    de Voer, R.M.

    2010-01-01

    Meningococcal serogroup C conjugate immunization was introduced in the Dutch national immunization schedule at the age of 14 months, together with a large catch-up campaign in 2002. After introduction of this MenC immunization, the incidence of MenC completely disappeared from the immunized populati

  4. Innate Cellular Immune Responses in Aedes caspius (Diptera: Culicidae) Mosquitoes.

    Science.gov (United States)

    Soliman, D E; Farid, H A; Hammad, R E; Gad, A M; Bartholomay, L C

    2016-03-01

    Mosquitoes transmit a variety of pathogens that have devastating consequences for global public and veterinary health. Despite their capacity to serve as vectors, these insects have a robust capacity to respond to invading organisms with strong cellular and humoral immune responses. In Egypt, Aedes caspius (Pallas, 1771) has been suspected to act as a bridge vector of Rift Valley Fever virus between animals and humans. Microscopic analysis of Ae. caspius hemolymph revealed the presence of phagocytic cells called granulocytes. We further evaluated cellular immune responses produced by Ae. caspius as a result of exposure to a Gram-negative, and Gram-positive bacterium, and to latex beads. After challenge, a rapid and strong phagocytic response against either a natural or synthetic invader was evident. Hemocyte integrity in bacteria-inoculated mosquitoes was not morphologically affected. The number of circulating granulocytes decreased with age, reducing the overall phagocytic capacity of mosquitoes over time. The magnitude and speed of the phagocytic response suggested that granulocytes act as an important force in the battle against foreign invaders, as has been characterized in other important mosquito vector species.

  5. Immune complex stimulation of human neutrophils involves a novel Ca2+/H+ exchanger that participates in the regulation of cytoplasmic pH: flow cytometric analysis of Ca2+/pH responses by subpopulations.

    Science.gov (United States)

    Bernardo, John; Hartlaub, Hilary; Yu, Xin; Long, Heidi; Simons, Elizabeth R

    2002-12-01

    The activation of human phagocytic leukocytes by immune complexes (IC) or opsonized microbes via their Fc and complement receptors has been well-described. The mechanisms involved in this process are complex and depend on the receptors involved. The biochemical events that lead to the destruction of invading organisms in turn display varying degrees of interdependence, but the controlling elements that lead to the ultimate killing of ingested organisms within phagosomes by lysosomal enzymes and reactive oxygen intermediates are still not completely understood. We have addressed these mechanisms by following and correlating the kinetics of responses by individual cells, using multiparameter flow cytometry. Using nonopsonized IC as stimuli, we document here the presence of a novel Ca(2)(+)/H(+) voltage-independent channel in human neutrophils, which helps to control their cytoplasmic pH.

  6. Good CoP, bad CoP? Interrogating the immune responses to primate lentiviral vaccines.

    Science.gov (United States)

    Klasse, Per Johan; Moore, John P

    2012-10-01

    Correlates of protection (CoPs) against infection by primate lentiviruses remain undefined. Modest protection against HIV-1 was observed in one human vaccine trial, whereas previous trials and vaccine-challenge experiments in non-human primates have yielded inconsistent but intriguing results. Although high levels of neutralizing antibodies are known to protect macaques from mucosal and intravenous viral challenges, antibody or other adaptive immune responses associated with protection might also be mere markers of innate immunity or susceptibility. Specific strategies for augmenting the design of both human trials and animal experiments could help to identify mechanistic correlates of protection and clarify the influences of confounding factors. Robust protection may, however, require the combined actions of immune responses and other host factors, thereby limiting what inferences can be drawn from statistical associations. Here, we discuss how to analyze immune protection against primate lentiviruses, and how host factors could influence both the elicitation and effectiveness of vaccine-induced responses.

  7. Transcriptional analysis reveals gender-specific changes in the aging of the human immune system.

    Science.gov (United States)

    Marttila, Saara; Jylhävä, Juulia; Nevalainen, Tapio; Nykter, Matti; Jylhä, Marja; Hervonen, Antti; Tserel, Liina; Peterson, Pärt; Hurme, Mikko

    2013-01-01

    Aging and gender have a strong influence on the functional capacity of the immune system. In general, the immune response in females is stronger than that in males, but there is scant information about the effect of aging on the gender difference in the immune response. To address this question, we performed a transcriptomic analysis of peripheral blood mononuclear cells derived from elderly individuals (nonagenarians, n = 146) and young controls (aged 19-30 years, n = 30). When compared to young controls, we found 339 and 248 genes that were differentially expressed (p1.5 or human immune system are significantly different in males and females.

  8. Innate immune defences in the human endometrium

    Directory of Open Access Journals (Sweden)

    Kelly Rodney W

    2003-11-01

    Full Text Available Abstract The human endometrium is an important site of innate immune defence, giving protection against uterine infection. Such protection is critical to successful implantation and pregnancy. Infection is a major cause of preterm birth and can also cause infertility and ectopic pregnancy. Natural anti-microbial peptides are key mediators of the innate immune system. These peptides, between them, have anti-bacterial, anti-fungal and anti-viral activity and are expressed at epithelial surfaces throughout the female genital tract. Two families of natural anti-microbials, the defensins and the whey acidic protein (WAP motif proteins, appear to be prominent in endometrium. The human endometrial epithelium expresses beta-defensins 1–4 and the WAP motif protein, secretory leukocyte protease inhibitor. Each beta-defensin has a different expression profile in relation to the stage of the menstrual cycle, providing potential protection throughout the cycle. Secretory leukocyte protease inhibitor is expressed during the secretory phase of the cycle and has a range of possible roles including anti-protease and anti-microbial activity as well as having effects on epithelial cell growth. The leukocyte populations in the endometrium are also a source of anti-microbial production. Neutrophils are a particularly rich source of alpha-defensins, lactoferrin, lysozyme and the WAP motif protein, elafin. The presence of neutrophils during menstruation will enhance anti-microbial protection at a time when the epithelial barrier is disrupted. Several other anti-microbials including the natural killer cell product, granulysin, are likely to have a role in endometrium. The sequential production of natural anti-microbial peptides by the endometrium throughout the menstrual cycle and at other sites in the female genital tract will offer protection from many pathogens, including those that are sexually transmitted.

  9. Innate immune response development in nestling tree swallows

    Science.gov (United States)

    Stambaugh, T.; Houdek, B.J.; Lombardo, M.P.; Thorpe, P.A.; Caldwell, Hahn D.

    2011-01-01

    We tracked the development of innate immunity in nestling Tree Swallows (Tachycineta bicolor) and compared it to that of adults using blood drawn from nestlings during days 6, 12, and 18 of the ???20-day nestling period and from adults. Innate immunity was characterized using an in vitro assay of the ability of whole blood to kill Escherichia coli. The ability of whole blood to kill E. coli increased as nestlings matured. Neither this component of innate immunity nor right wing chord length on day18 were as developed as in adults indicating that development of the innate immune system and growth both continued after fledging. Narrow sense heritability analyses suggest that females with strong immune responses produced nestlings with strong immune responses. These data suggest nestling Tree Swallows allocated sufficient energy to support rapid growth to enable fledging by day 18, but that further development of innate immunity occurred post-fledging. ?? 2011 by the Wilson Ornithological Society.

  10. MicroRNAs in inflammation and immune responses.

    Science.gov (United States)

    Contreras, J; Rao, D S

    2012-03-01

    MicroRNAs (miRNAs) are important regulators of gene expression in the immune system. In a few short years, their mechanism of action has been described in various cell lineages within the immune system, targets have been defined and their unique contributions to immune cell function have been examined. Certain miRNAs serve in important negative feedback loops in the immune system, whereas others serve to amplify the response of the immune system by repressing inhibitors of the response. Here, we review some of the better understood mechanisms as well as some emerging concepts of miRNA function. Future work will likely involve defining the function of specific miRNAs in specific immune cell lineages and to utilize them in the design of therapeutic strategies for diseases involving the immune system.

  11. PI3K p110δ regulates T cell cytokine production during primary and secondary immune responses in mice and humans

    Science.gov (United States)

    Soond, Dalya R.; Bjørgo, Elisa; Moltu, Kristine; Dale, Verity Q; Patton, Daniel T; Torgersen, Knut Martin; Galleway, Fiona; Twomey, Breda; Clark, Jonathan; Gaston, JS Hill; Taskén, Kjetil; Bunyard, Peter; Okkenhaug, Klaus

    2013-01-01

    We have previously described critical and non-redundant roles for the PI3K p110δ during the activation and differentiation of naïve T cells and p110δ inhibitors are currently being developed for clinical use. However, to effectively treat established inflammatory or autoimmune diseases it is important to be able to inhibit previously activated or memory T cells. In this study, using the isoform-selective inhibitor IC87114, we show that sustained p110δ activity is required for IFNγ production. Moreover, acute inhibition of p110δ inhibits cytokine production and reduces hypersensitivity responses in mice. Whether p110δ played a similar role in human T cells was unknown. Here we show that IC87114 potently blocked TCR-induced PI3K signaling by both naïve and effector/memory human T cells. Importantly, IC87114 reduced cytokine production by memory T cells from healthy and allergic donors and from inflammatory arthritis patients. These studies establish that previously activated memory T cells are at least as sensitive to p110δ inhibition as naïve T cells and show that mouse models accurately predict p110δ function in human T cells. There is therefore a strong rationale for p110δ inhibitors to be considered for therapeutic use in T cell-mediated autoimmune and inflammatory diseases. PMID:20081091

  12. Immunohistochemical study of the cellular immune response in human Pneumocystis carinii pneumonia Estudo imuno-histoquímico da resposta imune celular na pneumonia humana por Pneumocystis carinii

    Directory of Open Access Journals (Sweden)

    Leandro Mantovani de Castro

    2006-02-01

    Full Text Available OBJECTIVES: It has been experimentally demonstrated that host defense against Pneumocystis carinii depends on complex interactions within host immune response, mainly CD4 lymphocytes and alveolar macrophages. Since this is an important agent related to immunodeficiency, our purpose was to characterize the inflammatory immune response in lung from necropsy of AIDS patients. PROCEDURES: Twenty-five necropsies with diagnosis of Pneumocystis carinii pneumonia were selected for immunohistochemical investigation of CD4 and CD8 lymphocytes, macrophages (CD68+, NK cells (CD57+ and cells expressing TNF-alpha. The immunostained cells were quantified and statistically analyzed. RESULTS: All specimens presented a great number of cysts of Pneumocystis carinii in alveoli, as well as septal enlargement with inflammatory infiltrate constituted predominantly by lymphocytes and macrophages. CD4+ T cells were decreased in number, and CD8+ T cells, NK cells and macrophages predominated. Cells expressing TNF-alpha were frequently observed in septal inflammatory infiltrate. CONCLUSIONS: The immunosupression related to AIDS induces a reduction in the number of CD4+ T cells and influences high-level parasitism. The cell components that characterize the inflammatory infiltrate contribute to the severe lung injury of those patients.OBJETIVO: Trabalhos experimentais demonstram que as defesas do hospedeiro frente ao Pneumocystis carinii incluem interações complexas entre as células imunes, principalmente linfócitos TCD4+ e macrófagos alveolares. Sendo esse um agente importante associado às imunodeficiências, nosso objetivo foi caracterizar a resposta inflamatória em pulmão de necrópsias de pacientes com AIDS. MÉTODOS: Foram selecionadas 25 necrópsias com diagnóstico de pneumonia por Pneumocystis carinii para pesquisa imuno-histoquímica de linfócitos TCD4+, TCD8+, macrófagos CD68+, células NK CD57+ e células com expressão de TNF-alfa. As c

  13. Importins and exportins regulating allergic immune responses.

    Science.gov (United States)

    Aggarwal, Ankita; Agrawal, Devendra K

    2014-01-01

    Nucleocytoplasmic shuttling of macromolecules is a well-controlled process involving importins and exportins. These karyopherins recognize and bind to receptor-mediated intracellular signals through specific signal sequences that are present on cargo proteins and transport into and out of the nucleus through nuclear pore complexes. Nuclear localization signals (NLS) present on cargo molecules to be imported while nuclear export signals (NES) on the molecules to be exported are recognized by importins and exportins, respectively. The classical NLS are found on many transcription factors and molecules that are involved in the pathogenesis of allergic diseases. In addition, several immune modulators, including corticosteroids and vitamin D, elicit their cellular responses by regulating the expression and activity of importin molecules. In this review article, we provide a comprehensive list of importin and exportin molecules and their specific cargo that shuttled between cytoplasm and the nucleus. We also critically review the role and regulation of specific importin and exportin involved in the transport of activated transcription factors in allergic diseases, the underlying molecular mechanisms, and the potential target sites for developing better therapeutic approaches.

  14. Importins and Exportins Regulating Allergic Immune Responses

    Directory of Open Access Journals (Sweden)

    Ankita Aggarwal

    2014-01-01

    Full Text Available Nucleocytoplasmic shuttling of macromolecules is a well-controlled process involving importins and exportins. These karyopherins recognize and bind to receptor-mediated intracellular signals through specific signal sequences that are present on cargo proteins and transport into and out of the nucleus through nuclear pore complexes. Nuclear localization signals (NLS present on cargo molecules to be imported while nuclear export signals (NES on the molecules to be exported are recognized by importins and exportins, respectively. The classical NLS are found on many transcription factors and molecules that are involved in the pathogenesis of allergic diseases. In addition, several immune modulators, including corticosteroids and vitamin D, elicit their cellular responses by regulating the expression and activity of importin molecules. In this review article, we provide a comprehensive list of importin and exportin molecules and their specific cargo that shuttled between cytoplasm and the nucleus. We also critically review the role and regulation of specific importin and exportin involved in the transport of activated transcription factors in allergic diseases, the underlying molecular mechanisms, and the potential target sites for developing better therapeutic approaches.

  15. A role for immune responses against non-CS components in the cross-species protection induced by immunization with irradiated malaria sporozoites.

    Directory of Open Access Journals (Sweden)

    Marjorie Mauduit

    Full Text Available Immunization with irradiated Plasmodium sporozoites induces sterile immunity in rodents, monkeys and humans. The major surface component of the sporozoite the circumsporozoite protein (CS long considered as the antigen predominantly responsible for this immunity, thus remains the leading candidate antigen for vaccines targeting the parasite's pre-erythrocytic (PE stages. However, this role for CS was questioned when we recently showed that immunization with irradiated sporozoites (IrrSpz of a P. berghei line whose endogenous CS was replaced by that of P. falciparum still conferred sterile protection against challenge with wild type P. berghei sporozoites. In order to investigate the involvement of CS in the cross-species protection recently observed between the two rodent parasites P. berghei and P. yoelii, we adopted our gene replacement approach for the P. yoelii CS and exploited the ability to conduct reciprocal challenges. Overall, we found that immunization led to sterile immunity irrespective of the origin of the CS in the immunizing or challenge sporozoites. However, for some combinations, immune responses to CS contributed to the acquisition of protective immunity and were dependent on the immunizing IrrSpz dose. Nonetheless, when data from all the cross-species immunization/challenges were considered, the immune responses directed against non-CS parasite antigens shared by the two parasite species played a major role in the sterile protection induced by immunization with IrrSpz. This opens the perspective to develop a single vaccine formulation that could protect against multiple parasite species.

  16. The natural immunity to evolutionary atavistic endotoxin for human cancer.

    Science.gov (United States)

    Moncevičiūtė-Eringienė, Elena; Rotkevič, Kristina; Grikienis, Ruta Grikienyte

    2015-11-01

    We propose a new theory of the immunological control of cancer corresponding to the hypothesis that the specific natural immunity to evolutionary atavistic endotoxin has a potential role in human cancer prevention. The results of our studies have shown that IgMNAE, i.e. endogenous or spontaneous IgM class antibodies to enterobacterial lipopolysaccharide molecules (lipid A), control the immune mechanisms responsible for the internal medium stability not only against the damaging impact of the carcinogenic factors, but also against the malignant transformation of its own degenerated cells. Among people who in 1979 and 1982 had IgMNAE in their blood serum, after 15-30years fell ill with cancer 10%, versus 15% among people who had no IgMNAE (pimmunity to endotoxin it is possible to see the formation of the respective evolutionary protective reactions which protect the damaged cells from acquiring resistance to damaging factors and thus from becoming an independent new parasitic population. Thereby the presented theory of the immunological control of cancer has a causal connection with our evolutionary resistance theory of the origin of cancer. Collectively, these data suggest that activation of natural immunity to endotoxin and production of vaccines against evolutionary atavistic endotoxin or gram-negative bacterial endotoxin can be helpful when applied in cancer prophylaxis for persons with a low level of natural immunity to endotoxin and perhaps in creating immunotherapeutic methods for stopping the endogenous parasitism of tumour cells by binding IgMNAE to atavistic endotoxin in cancer patients.

  17. The Immune Response Induced by Hepatitis B Virus Principal Antigens

    Institute of Scientific and Technical Information of China (English)

    Chien-Fu Huang; Shih-Shen Lin; Yung-Chyuan Ho; Fong-Ling Chen; Chi-Chiang Yang

    2006-01-01

    Hepatitis B virus (HBV) infection occurs primarily in hepatocytes in the liver with release of infectious virions and non-infectious empty surface antigen particles into the bloodstream. HBV replication is non-cytopathic. Transient infections run a course of several months, and chronic infections are often life-long. Chronic infections can lead to liver failure with cirrhosis and hepatocellular carcinoma. It is generally accepted that neutralizing anti-HBs antibodies plays a key role in recovery from HBV infection by containing the spread of infection in the infected host and facilitating the removal and destruction of viral particles. However, the immune response initiated by the T-cell response to viral antigens is also important for viral clearance and disease pathogenesis in HBV infection.The three structural forms of the viral proteins, the HBsAg, the particulate HBcAg, and the nonparticulate HBeAg,may preferentially elicit different Th cell subsets. The different IgG subclass profiles of anti-HBs, anti-HBc, and anti-HBe in different HBV infection status were revealed. Moreover, the different IgG subclass profiles in chronic carriers did not change with different ALT and AST levels and may reflect the difference between stimulating antigens, immune response, and the stages of viral disease and provide the basis for the use of vaccines and prophylactic treatments for individuals at high risk of human HBV infection. This review elucidates the detailed understanding of the immune responses induced during transient and persistent infection, and the development of immunotherapy and immunodiagnosis in patients with HBV infection, and possible means of reducing the liver damage.

  18. Tetraspanins in the immune response against cancer

    NARCIS (Netherlands)

    Veenbergen, S.; Spriel, A.B. van

    2011-01-01

    The role of the immune system in the defense against cancer, a process termed tumor immunosurveillance, has been extensively studied. Evidence is accumulating that the molecular organization of proteins and lipids in the plasma membrane of immune cells is of critical importance. Tetraspanin proteins

  19. Immunization of rabbits with highly purified, soluble, trimeric human immunodeficiency virus type 1 envelope glycoprotein induces a vigorous B cell response and broadly cross-reactive neutralization.

    Directory of Open Access Journals (Sweden)

    Gerald V Quinnan

    Full Text Available Previously we described induction of cross-reactive HIV-1 neutralizing antibody responses in rabbits using a soluble HIV-1 gp140 envelope glycoprotein (Env in an adjuvant containing monophosphoryl lipid A (MPL and QS21 (AS02A. Here, we compared different forms of the same HIV-1 strain R2 Env for antigenic and biophysical characteristics, and in rabbits characterized the extent of B cell induction for specific antibody expression and secretion and neutralizing responses. The forms of this Env that were produced in and purified from stably transformed 293T cells included a primarily dimeric gp140, a trimeric gp140 appended to a GCN4 trimerization domain (gp140-GCN4, gp140-GCN4 with a 15 amino acid flexible linker between the gp120 and gp41 ectodomain (gp140-GCN4-L, also trimeric, and a gp140 with the flexible linker purified from cell culture supernatants as either dimer (gp140-L(D or monomer (gp140-L(M. Multimeric states of the Env proteins were assessed by native gel electrophoresis and analytical ultracentrifugation. The different forms of gp140 bound broadly cross-reactive neutralizing (BCN human monoclonal antibodies (mAbs similarly in ELISA and immunoprecipitation assays. All Envs bound CD4i mAbs in the presence and absence of sCD4, as reported for the R2 Env. Weak neutralization of some strains of HIV-1 was seen after two additional doses in AS02A. Rabbits that were given a seventh dose of gp140-GCN4-L developed BCN responses that were weak to moderate, similar to our previous report. The specificity of these responses did not appear similar to that of any of the known BCN human mAbs. Induction of spleen B cell and plasma cells producing immunoglobulins that bound trimeric gp140-GCN4-L was vigorous, based on ELISpot and flow cytometry analyses. The results demonstrate that highly purified gp140-GCN4-L trimer in adjuvant elicits BCN responses in rabbits accompanied by vigorous B cell induction.

  20. Modelling viral infections using zebrafish: Innate immune response and antiviral research.

    Science.gov (United States)

    Varela, Mónica; Figueras, Antonio; Novoa, Beatriz

    2017-03-01

    Zebrafish possess a highly developed immune system that is remarkably similar to the human one. Therefore, it is expected that the majority of the signalling pathways and molecules involved in the immune response of mammals exist and behave similarly in fish. The innate antiviral response depends on the recognition of viral components by host cells. Pattern recognition receptors initiate antimicrobial defence mechanisms via several well-conserved signalling pathways. In this paper, we review current knowledge of the antiviral innate immune response in zebrafish by considering the main molecules that have been characterized and the infection models used for the in vivo study of the antiviral innate immune response. We next summarize published studies in which larval and adult zebrafish were used to study viral diseases of fish, then provide a similar review of studies of human viral diseases in zebrafish and experience with antiviral drug screening in this model organism. Copyright © 2016 Elsevier B.V. All rights reserved.

  1. Food preservatives sodium benzoate and propionic acid and colorant curcumin suppress Th1-type immune response in vitro.

    Science.gov (United States)

    Maier, Elisabeth; Kurz, Katharina; Jenny, Marcel; Schennach, Harald; Ueberall, Florian; Fuchs, Dietmar

    2010-07-01

    Food preservatives sodium benzoate and propionic acid and colorant curcumin are demonstrated to suppress in a dose-dependent manner Th1-type immune response in human peripheral blood mononuclear cells (PBMC) in vitro. Results show an anti-inflammatory property of compounds which however could shift the Th1-Th2-type immune balance towards Th2-type immunity.

  2. Evaluating immune responses after sipuleucel-T therapy.

    Science.gov (United States)

    Strauss, Julius; Madan, Ravi A; Figg, William D

    2015-01-01

    Following FDA approval of sipuleucel-T in 2010 for metastatic castration resistant prostate cancer (mCRPC), several studies have described the effect of sipuleucel-T on peripheral immune responses. Retrospective associations have also been made with immune responses and survival. A recently published study by Fong et al. was the first to characterize the immune response of sipuleucel-T in the tumor microenvironment. The findings of this study have been hypothesis generating, yet it remains unclear whether the peri-tumor immune response described is predictive of survival. Increasing evidence suggests that radiographic or PSA progression does not accurately reflect survival with sipuleucel-T and other immunotherapies. Finding an immune biomarker which can accurately reflect clinical benefit and validating it prospectively offers the potential for a predictive indicator of response in an area where none currently exists.

  3. Immune markers and correlates of protection for vaccine induced immune responses

    DEFF Research Database (Denmark)

    Thakur, Aneesh; Pedersen, Lasse Eggers; Jungersen, Gregers

    2012-01-01

    of an appropriate humoral response currently remain the best validated correlates of protective immunity after vaccination. Despite advancements in the field of immunology over the past few decades currently there are, however, no sufficiently validated immune correlates of vaccine induced protection against...... of antigen-specific polyfunctional T cells capable of producing a triad of relevant cytokines, as a better correlate of sustained protective immunity against this type of infections. Also the possibilities to measure antigen-specific cytotoxic T cells (CTL) during infection or in response to vaccination......, through recombinant major histocompatibility complex (MHC) class I tetramers loaded with relevant peptides, has opened a new vista to include CTL responses in the evaluation of protective immune responses. Here, we review different immune markers and new candidates for correlates of a protective vaccine...

  4. Humoral and Cellular Immune Response in Canine Hypothyroidism.

    Science.gov (United States)

    Miller, J; Popiel, J; Chełmońska-Soyta, A

    2015-07-01

    Hypothyroidism is one of the most common endocrine diseases in dogs and is generally considered to be autoimmune in nature. In human hypothyroidism, the thyroid gland is destroyed by both cellular (i.e. autoreactive helper and cytotoxic T lymphocytes) and humoral (i.e. autoantibodies specific for thyroglobulin, thyroxine and triiodothyronine) effector mechanisms. Other suggested factors include impaired peripheral immune suppression (i.e. the malfunction of regulatory T cells) or an additional pro-inflammatory effect of T helper 17 lymphocytes. The aim of this study was to evaluate immunological changes in canine hypothyroidism. Twenty-eight clinically healthy dogs, 25 hypothyroid dogs without thyroglobulin antibodies and eight hypothyroid dogs with these autoantibodies were enrolled into the study. There were alterations in serum proteins in hypothyroid dogs compared with healthy controls (i.e. raised concentrations of α-globulins, β2- and γ-globulins) as well as higher concentration of acute phase proteins and circulating immune complexes. Hypothyroid animals had a lower CD4:CD8 ratio in peripheral blood compared with control dogs and diseased dogs also had higher expression of interferon γ (gene and protein expression) and CD28 (gene expression). Similar findings were found in both groups of hypothyroid dogs. Canine hypothyroidism is therefore characterized by systemic inflammation with dominance of a cellular immune response.

  5. Porcine Rotaviruses: Epidemiology, Immune Responses and Control Strategies

    Science.gov (United States)

    Vlasova, Anastasia N.; Amimo, Joshua O.; Saif, Linda J.

    2017-01-01

    Rotaviruses (RVs) are a major cause of acute viral gastroenteritis in young animals and children worldwide. Immunocompetent adults of different species become resistant to clinical disease due to post-infection immunity, immune system maturation and gut physiological changes. Of the 9 RV genogroups (A–I), RV A, B, and C (RVA, RVB, and RVC, respectively) are associated with diarrhea in piglets. Although discovered decades ago, porcine genogroup E RVs (RVE) are uncommon and their pathogenesis is not studied well. The presence of porcine RV H (RVH), a newly defined distinct genogroup, was recently confirmed in diarrheic pigs in Japan, Brazil, and the US. The complex epidemiology, pathogenicity and high genetic diversity of porcine RVAs are widely recognized and well-studied. More recent data show a significant genetic diversity based on the VP7 gene analysis of RVB and C strains in pigs. In this review, we will summarize previous and recent research to provide insights on historic and current prevalence and genetic diversity of porcine RVs in different geographic regions and production systems. We will also provide a brief overview of immune responses to porcine RVs, available control strategies and zoonotic potential of different RV genotypes. An improved understanding of the above parameters may lead to the development of more optimal strategies to manage RV diarrheal disease in swine and humans. PMID:28335454

  6. Evaluation of the Long-Term Anti-Human Papillomavirus 6 (HPV6), 11, 16, and 18 Immune Responses Generated by the Quadrivalent HPV Vaccine

    DEFF Research Database (Denmark)

    Nygård, Mari; Saah, Alfred; Munk, Christian;

    2015-01-01

    This quadrivalent human papillomavirus (qHPV) (HPV6, -11, -16, and -18) vaccine long-term follow-up (LTFU) study is an ongoing extension of a pivotal clinical study (FUTURE II) taking place in the Nordic region. The LTFU study was designed to evaluate the effectiveness, immunogenicity, and safety...... of the qHPV vaccine (Gardasil) for at least 10 years following completion of the base study. The current report presents immunogenicity data from testing samples of the year 5 LTFU visit (approximately 9 years after vaccination). FUTURE II vaccination arm subjects, who consented to being followed...... the proportion based on cLIA, especially for anti-HPV18. As expected, the anti-HPV serum IgG and cLIA responses were strongly correlated for all HPV types. Anti-HPV GMTs and the proportion of vaccinated individuals who are seropositive remain high for up to 9 years of follow-up after vaccination....

  7. In vivo protein synthesis determinations in human immune cells

    OpenAIRE

    Januszkiewicz, Anna

    2005-01-01

    Intact immune responses are essential for defeating severe infections in individual patients. Insufficient function of the immune system contributes to a poor prognosis in these patients, in particular the ICU patients. Nevertheless, the immune system function is not easily monitored and evaluated. The ongoing metabolic activity of immune competent cells is reflected by their in vivo protein synthesis rate. The aim of this thesis was to apply in vivo protein synthesis measur...

  8. Effect of oral administration of Lactobacillus paracasei L9 on mouse systemic immunity and the immune response in the intestine

    Directory of Open Access Journals (Sweden)

    Zhu Yuanbo

    2016-01-01

    Full Text Available A probiotic strain Lactobacillus paracasei L9,which was isolated from human intestine, was investigated for its immunomodulatory activity in vivo. Results showed that L9 improved systemic immunity by enhancing the phagocytic activity of peritoneal macrophages, the proliferation ratio of splenocytes, the IgG level in the serum and the level of IgA in the mucosa. Further, L9induced theTh1-polarized immune response by elevating the IFN-γ/IL-4 ratio in the mucosa. This effect was confirmed by the enhanced IL-12-inducing activity of macrophages after in vitro stimulation of L9. Also detected was increased expression of TLR-2mRNA in the mucosa. We predict that L9 could enhance innate immunity by activating TLR-2 in the mucosa, and enhance acquired immunity by promoting Th1 polarization through induced production of IL-12 by macrophages.

  9. Immune response induction in the central nervous system

    DEFF Research Database (Denmark)

    Owens, Trevor; Babcock, Alicia

    2002-01-01

    The primary function of the immune response is protection of the host against infection with pathogens, including viruses. Since viruses can infect any tissue of the body, including the central nervous system (CNS), it is logical that cells of the immune system should equally have access to all...... tissues. Nevertheless, the brain and spinal cord are noted for their lack of immune presence. Relative to other organ systems, the CNS appears immunologically privileged. Furthermore, when immune responses do occur in the CNS, they are frequently associated with deleterious effects such as inflammatory...

  10. Enhancement of In Vivo and In Vitro Immune Functions by a Conformationally-Biased, Response-Selective Agonist of Human C5a: Implications for a Novel Adjuvant in Vaccine Design

    Science.gov (United States)

    Morgan, Edward L.; Morgan, Brandon N.; Stein, Elisabeth A.; Vitrs, Elizabeth L.; Thoman, Marilyn L.; Sanderson, Sam D.; Phillips, Joy A.

    2009-01-01

    A conformationally-biased, agonist of human C5a65–74 (EP67) was assessed for its adjuvant activities in vitro and in vivo. EP67 induced the release of the inflammatory (Th1) type cytokines from C5a receptor (CD88)-bearing antigen presenting cells (APC). Serum from mice immunized with EP67-ovalbumin (OVA) contained high OVA-specific antibody (Ab) titers [IgG1, IgG2a (IGg2c), IgG2b]. Mice receiving OVA alone produced only IgG1 Abs, indicating the ability of EP67 to induce a Th1-like antibody (A)b class switch. Spleen cell cultures from wild type mice but not CD88−/− mice showed an enhanced OVA-specific proliferative response in vitro. These results indicate the ability of EP67 to drive a Th1-mediated immune response and its potential use as a unique adjuvant PMID:19836478

  11. Analysis of immune responses against H pylori in rabbits

    Institute of Scientific and Technical Information of China (English)

    Khademul Islam; Ibrahim Khalil; Chowdhury Rafiqul Ahsan; Mahmuda Yasmin; Jamalun Nessa

    2007-01-01

    AIM: To investigate the immunogenicity of H pylori proteins, to evaluate the production rate of anti H pylori IgG antibodies in relation to time and to demonstrate the fidelity of newly optimized in-house enzymelinked immunosorbent assay (ELISA) technique as an alternative for H pylori infection assay.METHODS: In the present study, 100 μg of formalinfixed H pylori whole cell antigens was injected into an experimental animal (New Zealand white female rabbit) intramuscularly on d 0, 16, 27 and 36. The first two doses were injected with adjuvants. On d 0,a serum sample was collected from the rabbit before immunization and this pre-immunized serum was used as a negative control for the whole study. To evaluate the immunogenic responses of the injected antigen,serum samples were collected from the rabbit at regular intervals up to d 42. The sera were analyzed using inhouse ELISA and Western blot techniques.RESULTS: The production of anti H pylori IgG antibodies in the rabbit in response to the injected antigen increased almost exponentially up to d 14 and after that it was maintained at the same level until the last day (d 42). By analyzing the immune profiles of immunized sera, 11 proteins were identified to be immunogenic,among them 2 (approximately 100 kDa and 85 kDa)were most prominent.CONCLUSION: Analysis of the immune responses against pathogenic microorganisms like H pylori is necessary for the development of various diagnostic and preventive approaches. The results of this experiment reveal that the formalin-fixed H pylori whole cell antigens injected into the rabbit are highly immunogenic. These prominent proteins (approximately 100 kDa and 85 kDa)might have higher immunogenic effects among humans infected with H pylori and some of these immunogenic proteins can be included in diagnostic approaches based on serology and also for vaccine formulation. The inhouse ELISA is a promising alternative compared to invasive techniques.

  12. Traumatic spinal cord injury in mice with human immune systems.

    Science.gov (United States)

    Carpenter, Randall S; Kigerl, Kristina A; Marbourg, Jessica M; Gaudet, Andrew D; Huey, Devra; Niewiesk, Stefan; Popovich, Phillip G

    2015-09-01

    Mouse models have provided key insight into the cellular and molecular control of human immune system function. However, recent data indicate that extrapolating the functional capabilities of the murine immune system into humans can be misleading. Since immune cells significantly affect neuron survival and axon growth and also are required to defend the body against infection, it is important to determine the pathophysiological significance of spinal cord injury (SCI)-induced changes in human immune system function. Research projects using monkeys or humans would be ideal; however, logistical and ethical barriers preclude detailed mechanistic studies in either species. Humanized mice, i.e., immunocompromised mice reconstituted with human immune cells, can help overcome these barriers and can be applied in various experimental conditions that are of interest to the SCI community. Specifically, newborn NOD-SCID-IL2rg(null) (NSG) mice engrafted with human CD34(+) hematopoietic stem cells develop normally without neurological impairment. In this report, new data show that when mice with human immune systems receive a clinically-relevant spinal contusion injury, spontaneous functional recovery is indistinguishable from that achieved after SCI using conventional inbred mouse strains. Moreover, using routine immunohistochemical and flow cytometry techniques, one can easily phenotype circulating human immune cells and document the composition and distribution of these cells in the injured spinal cord. Lesion pathology in humanized mice is typical of mouse contusion injuries, producing a centralized lesion epicenter that becomes occupied by phagocytic macrophages and lymphocytes and enclosed by a dense astrocytic scar. Specific human immune cell types, including three distinct subsets of human monocytes, were readily detected in the blood, spleen and liver. Future studies that aim to understand the functional consequences of manipulating the neuro-immune axis after SCI

  13. Yersinia type III effectors perturb host innate immune responses

    Science.gov (United States)

    Pha, Khavong; Navarro, Lorena

    2016-01-01

    The innate immune system is the first line of defense against invading pathogens. Innate immune cells recognize molecular patterns from the pathogen and mount a response to resolve the infection. The production of proinflammatory cytokines and reactive oxygen species, phagocytosis, and induced programmed cell death are processes initiated by innate immune cells in order to combat invading pathogens. However, pathogens have evolved various virulence mechanisms to subvert these responses. One strategy utilized by Gram-negative bacterial pathogens is the deployment of a complex machine termed the type III secretion system (T3SS). The T3SS is composed of a syringe-like needle structure and the effector proteins that are injected directly into a target host cell to disrupt a cellular response. The three human pathogenic Yersinia spp. (Y. pestis, Y. enterocolitica, and Y. pseudotuberculosis) are Gram-negative bacteria that share in common a 70 kb virulence plasmid which encodes the T3SS. Translocation of the Yersinia effector proteins (YopE, YopH, YopT, YopM, YpkA/YopO, and YopP/J) into the target host cell results in disruption of the actin cytoskeleton to inhibit phagocytosis, downregulation of proinflammatory cytokine/chemokine production, and induction of cellular apoptosis of the target cell. Over the past 25 years, studies on the Yersinia effector proteins have unveiled tremendous knowledge of how the effectors enhance Yersinia virulence. Recently, the long awaited crystal structure of YpkA has been solved providing further insights into the activation of the YpkA kinase domain. Multisite autophosphorylation by YpkA to activate its kinase domain was also shown and postulated to serve as a mechanism to bypass regulation by host phosphatases. In addition, novel Yersinia effector protein targets, such as caspase-1, and signaling pathways including activation of the inflammasome were identified. In this review, we summarize the recent discoveries made on Yersinia

  14. Yersinia type Ⅲ effectors perturb host innate immune responses

    Institute of Scientific and Technical Information of China (English)

    Khavong Pha; Lorena Navarro

    2016-01-01

    The innate immune system is the first line of defense against invading pathogens. Innate immune cells recognize molecular patterns from the pathogen and mount a response to resolve the infection. The production of proinflammatory cytokines and reactive oxygen species, phagocytosis, and induced programmed cell death are processes initiated by innate immune cells in order to combat invading pathogens. However, pathogens have evolved various virulence mechanisms to subvert these responses. One strategy utilized by Gram-negative bacterial pathogens is the deployment of a complex machine termed the type Ⅲ secretion system(T3SS). The T3SS is composed of a syringe-like needle structure and the effector proteins that are injected directly into a target host cell to disrupt a cellular response. The three human pathogenic Yersinia spp.(Y. pestis, Y. enterocolitica, and Y. pseudotuberculosis) are Gramnegative bacteria that share in common a 70 kb virulence plasmid which encodes the T3 SS. Translocation of the Yersinia effector proteins(YopE, YopH, YopT, YopM, YpkA/YopO, and YopP/J) into the target host cell results in disruption of the actin cytoskeleton to inhibit phagocytosis, downregulation of proinflammatory cytokine/chemokine production, and induction of cellular apoptosis of the target cell. Over the past 25 years, studies on the Yersinia effector proteins have unveiled tremendous knowledge of how the effectors enhance Yersinia virulence. Recently, the long awaited crystal structure of YpkA has been solved providing further insights into the activation of the YpkA kinase domain. Multisite autophosphorylation by YpkA to activate its kinase domain was also shown and postulated to serve as a mechanism to bypass regulation by host phosphatases. In addition, novel Yersinia effector protein targets, such as caspase-1, and signaling pathways including activation of the inflammasome were identified. In this review, we summarize the recent discoveries made on Yersinia effector

  15. The innate immune response during urinary tract infection and pyelonephritis.

    Science.gov (United States)

    Spencer, John David; Schwaderer, Andrew L; Becknell, Brian; Watson, Joshua; Hains, David S

    2014-07-01

    Despite its proximity to the fecal flora, the urinary tract is considered sterile. The precise mechanisms by which the urinary tract maintains sterility are not well understood. Host immune responses are critically important in the antimicrobial defense of the urinary tract. During recent years, considerable advances have been made in our understanding of the mechanisms underlying immune homeostasis of the kidney and urinary tract. Dysfunctions in these immune mechanisms may result in acute disease, tissue destruction and overwhelming infection. The objective of this review is to provide an overview of the innate immune response in the urinary tract in response to microbial assault. In doing so, we focus on the role of antimicrobial peptides-a ubiquitous component of the innate immune response.

  16. The changing shape of vaccination: improving immune responses through geometrical variations of a microdevice for immunization

    Science.gov (United States)

    Crichton, Michael Lawrence; Muller, David Alexander; Depelsenaire, Alexandra Christina Isobel; Pearson, Frances Elizabeth; Wei, Jonathan; Coffey, Jacob; Zhang, Jin; Fernando, Germain J. P.; Kendall, Mark Anthony Fernance

    2016-06-01

    Micro-device use for vaccination has grown in the past decade, with the promise of ease-of-use, painless application, stable solid formulations and greater immune response generation. However, the designs of the highly immunogenic devices (e.g. the gene gun, Nanopatch or laser adjuvantation) require significant energy to enter the skin (30–90 mJ). Within this study, we explore a way to more effectively use energy for skin penetration and vaccination. These modifications change the Nanopatch projections from cylindrical/conical shapes with a density of 20,000 per cm2 to flat-shaped protrusions at 8,000 per cm2, whilst maintaining the surface area and volume that is placed within the skin. We show that this design results in more efficient surface crack initiations, allowing the energy to be more efficiently be deployed through the projections into the skin, with a significant overall increase in penetration depth (50%). Furthermore, we measured a significant increase in localized skin cell death (>2 fold), and resultant infiltrate of cells (monocytes and neutrophils). Using a commercial seasonal trivalent human influenza vaccine (Fluvax 2014), our new patch design resulted in an immune response equivalent to intramuscular injection with approximately 1000 fold less dose, while also being a practical device conceptually suited to widespread vaccination.

  17. The changing shape of vaccination: improving immune responses through geometrical variations of a microdevice for immunization

    Science.gov (United States)

    Crichton, Michael Lawrence; Muller, David Alexander; Depelsenaire, Alexandra Christina Isobel; Pearson, Frances Elizabeth; Wei, Jonathan; Coffey, Jacob; Zhang, Jin; Fernando, Germain J. P.; Kendall, Mark Anthony Fernance

    2016-01-01

    Micro-device use for vaccination has grown in the past decade, with the promise of ease-of-use, painless application, stable solid formulations and greater immune response generation. However, the designs of the highly immunogenic devices (e.g. the gene gun, Nanopatch or laser adjuvantation) require significant energy to enter the skin (30–90 mJ). Within this study, we explore a way to more effectively use energy for skin penetration and vaccination. These modifications change the Nanopatch projections from cylindrical/conical shapes with a density of 20,000 per cm2 to flat-shaped protrusions at 8,000 per cm2, whilst maintaining the surface area and volume that is placed within the skin. We show that this design results in more efficient surface crack initiations, allowing the energy to be more efficiently be deployed through the projections into the skin, with a significant overall increase in penetration depth (50%). Furthermore, we measured a significant increase in localized skin cell death (>2 fold), and resultant infiltrate of cells (monocytes and neutrophils). Using a commercial seasonal trivalent human influenza vaccine (Fluvax 2014), our new patch design resulted in an immune response equivalent to intramuscular injection with approximately 1000 fold less dose, while also being a practical device conceptually suited to widespread vaccination. PMID:27251567

  18. Social Behavior, Prolactin and the Immune Response

    Science.gov (United States)

    1989-04-01

    on the immune processes. (Locke, Ader, Besedovsky, Hall, Solomon & Strom, 1985). The term psychoneuroimmunology has been coined by researchers to...34mind and immunity" covering a five year period (Locke and Hornig-Rohan, 1983) and a collection of seminal papers on psychoneuroimmunology (Locke, et...In: Psychoneuroimmunology (R. Ader, ed.), Academic Press, NY, 1981, 609-617. Friedman, S. B., Glasgow, L. A. and Ader, R. Psychological factors

  19. The X-files in immunity: sex-based differences predispose immune responses.

    Science.gov (United States)

    Fish, Eleanor N

    2008-09-01

    Despite accumulating evidence in support of sex-based differences in innate and adaptive immune responses, in the susceptibility to infectious diseases and in the prevalence of autoimmune diseases, health research and clinical practice do not address these distinctions, and most research studies of immune responses do not stratify by sex. X-linked genes, hormones and societal context are among the many factors that contribute to disparate immune responses in males and females. It is crucial to address sex-based differences in disease pathogenesis and in the pharmacokinetics and pharmacodynamics of therapeutic medications to provide optimal disease management for both sexes.

  20. Innate immune response to viral infection of the lungs.

    Science.gov (United States)

    See, Hayley; Wark, Peter

    2008-12-01

    Viral respiratory tract infections are the most common infectious illnesses, though they are usually self-limiting and confined to the respiratory tract. The rapid identification of viruses and their effective elimination with minimal local and systemic inflammation is a testament to the efficiency of the innate immune response within the airways and lungs. A failure of this response appears to occur in those with asthma and chronic obstructive pulmonary disease, where viral infection is an important trigger for acute exacerbations. The innate immune response to viruses requires their early detection through pathogen recognition receptors and the recruitment of the efficient antiviral response that is centred around the release of type 1 interferons. The airway epithelium provides both a barrier and an early detector for viruses, and interacts closely with cells of the innate immune response, especially macrophages and dendritic cells, to eliminate infection and trigger a specific adaptive immune response.

  1. Disorders of innate immunity in human ageing and effects of nutraceutical administration.

    Science.gov (United States)

    Magrone, Thea; Jirillo, Emilio

    2014-01-01

    Immune decline with ageing accounts for the increased risk of infections, inflammatory chronic disease, autoimmunity and cancer in humans. Both innate and adaptive immune functions are compromised in aged people and, therefore, attempts to correct these dysfunctions represent a major goal of modern medicine. In this review, special emphasis will be placed on the aged innate immunity with special reference to polymorphonuclear cell, monocyte/ macrophage, dendritic cell and natural killer cell functions. As potential modifiers of the impaired innate immunity, some principal nutraceuticals will be illustrated, such as micronutrients, pre-probiotics and polyphenols. In elderly, clinical trials with the above products are scanty, however, some encouraging effects on the recovery of innate immune cells have been reported. In addition, our own results obtained with symbiotics and polyphenols extracted from red wine or fermented grape marc suggest the potential ability of these substances to modulate the innate immune response in ageing, thus reducing the inflammaging which characterizes immune senescence.

  2. The immune response to Trypanoplasma borreli: kinetics of immune gene expression and polyclonal lymphocyte activation

    NARCIS (Netherlands)

    Saeij, J.P.J.; Vries, de B.J.; Wiegertjes, G.F.

    2003-01-01

    Although Trypanoplasma borreli induces the production of non-specific antibodies, survival of infection is associated with the production of T. borreli specific antibodies, able to lyse this parasite in the presence of complement. During the lag phase of this acquired immune response, innate immune

  3. Gene-environment interactions in multiple sclerosis: Innate and adaptive immune responses to human endogenous retrovirus and herpesvirus antigens and the lectin complement activation pathway

    DEFF Research Database (Denmark)

    Christensen, Tove; Petersen, Thor; Thiel, Steffen;

    2007-01-01

    -associated molecular pattern recognition: mannan-binding lectin (MBL), and MASP-2 and MASP-3. For representative MS families, we also determined herpesvirus serology for HSV-1, VZV, and EBV; and tissue typed for HLA-B, and HLA DR and DQ. In MS, a significant correlation between elevated immune reactivity to HERV-H Env...

  4. Immunomodulator-based enhancement of anti smallpox immune responses.

    Science.gov (United States)

    Martínez, Osmarie; Miranda, Eric; Ramírez, Maite; Santos, Saritza; Rivera, Carlos; Vázquez, Luis; Sánchez, Tomás; Tremblay, Raymond L; Ríos-Olivares, Eddy; Otero, Miguel

    2015-01-01

    The current live vaccinia virus vaccine used in the prevention of smallpox is contraindicated for millions of immune-compromised individuals. Although vaccination with the current smallpox vaccine produces protective immunity, it might result in mild to serious health complications for some vaccinees. Thus, there is a critical need for the production of a safe virus-free vaccine against smallpox that is available to everyone. For that reason, we investigated the impact of imiquimod and resiquimod (Toll-like receptors agonists), and the codon-usage optimization of the vaccinia virus A27L gene in the enhancement of the immune response, with intent of producing a safe, virus-free DNA vaccine coding for the A27 vaccinia virus protein. We analyzed the cellular-immune response by measuring the IFN-γ production of splenocytes by ELISPOT, the humoral-immune responses measuring total IgG and IgG2a/IgG1 ratios by ELISA, and the TH1 and TH2 cytokine profiles by ELISA, in mice immunized with our vaccine formulation. The proposed vaccine formulation enhanced the A27L vaccine-mediated production of IFN-γ on mouse spleens, and increased the humoral immunity with a TH1-biased response. Also, our vaccine induced a TH1 cytokine milieu, which is important against viral infections. These results support the efforts to find a new mechanism to enhance an immune response against smallpox, through the implementation of a safe, virus-free DNA vaccination platform.

  5. Interplay between behavioural thermoregulation and immune response in mealworms.

    Science.gov (United States)

    Catalán, Tamara P; Niemeyer, Hermann M; Kalergis, Alexis M; Bozinovic, Francisco

    2012-11-01

    Since the preferential body temperature should positively correlate with physiological performance, behavioural fever should enhance an organism's immune response under an immune challenge. Here we have studied the preferential body temperature (T(p)) and its consequences on immune response performance after an immune challenge in larvae of Tenebrio molitor. We evaluated T(p) and immune responses of larvae following a challenge with various concentrations of lipopolysaccharide (LPS), and we studied the correlation between T(p) and two immune traits, namely antibacterial and phenoloxidase (PO) activities. Larvae that were immune challenged with higher LPS concentrations (C(50) and C(100)) preferred in average, warmer temperatures than did larvae challenged with lower concentrations (C(0) and C(25)). T(p) of C(25)-C(100) (challenged)-mealworms was 2.3°C higher than of C(0) (control) larvae. At lower LPS concentration immune challenge (C(0) and C(25)) antibacterial activity correlated positively with T(p), but at C(50) and C(100) correlation was lose. PO activity was higher at higher LPS concentration, but its magnitude of response did not correlate with T(p) Our data suggest that behavioural fever may have a positive effect on host performance by enhancing antibacterial response under a low pathogen load situation.

  6. Study of the integrated immune response induced by an inactivated EV71 vaccine.

    Directory of Open Access Journals (Sweden)

    Longding Liu

    Full Text Available UNLABELLED: Enterovirus 71 (EV71, a major causative agent of hand-foot-and-mouth disease (HFMD, causes outbreaks among children in the Asia-Pacific region. A vaccine is urgently needed. Based on successful pre-clinical work, phase I and II clinical trials of an inactivated EV71 vaccine, which included the participants of 288 and 660 respectively, have been conducted. In the present study, the immune response and the correlated modulation of gene expression in the peripheral blood mononuclear cells (PBMCs of 30 infants (6 to 11 months immunized with this vaccine or placebo and consented to join this study in the phase II clinical trial were analyzed. The results showed significantly greater neutralizing antibody and specific T cell responses in vaccine group after two inoculations on days 0 and 28. Additionally, more than 600 functional genes that were up- or down-regulated in PBMCs were identified by the microarray assay, and these genes included 68 genes associated with the immune response in vaccine group. These results emphasize the gene expression profile of the immune system in response to an inactivated EV71 vaccine in humans and confirmed that such an immune response was generated as the result of the positive mobilization of the immune system. Furthermore, the immune response was not accompanied by the development of a remarkable inflammatory response. CLINICAL TRIAL REGISTRATION: NCT01391494 and NCT01512706.

  7. The invisible enemy - how human papillomaviruses avoid recognition and clearance by the host immune system.

    Science.gov (United States)

    Grabowska, Agnieszka K; Riemer, Angelika B

    2012-01-01

    Human papillomavirus (HPV) needs to persist in squamous epithelia for a certain amount of time to complete its reproductive cycle. Therefore, the virus has evolved multiple immune evasion strategies. The interplay of these immune evasion mechanisms with the host immune system decides whether a HPV infection is cleared or becomes persistent. Clearance of HPV-induced lesions is mediated by a cellular immune response, consisting of both cytotoxic T lymphocyte and T helper cell responses. Persistent HPV infection, on the other hand, is the single most important risk factor for the development of HPV-associated premalignant lesions and HPV-driven cancers. This article reviews the immune evasion mechanisms employed by high-risk HPVs to escape host immune recognition and attack.

  8. Compartmentalized Immune Response in Leishmaniasis: Changing Patterns throughout the Disease.

    Directory of Open Access Journals (Sweden)

    Alhelí Rodríguez-Cortés

    Full Text Available Visceral leishmaniasis (VL is characterized by loss of T-cell responsiveness and absence of Leishmania-specific IFN-γ production by peripheral blood mononuclear cells. However, the expressions of IFN-γ and TNF-α are up-regulated in the tissues and plasma of VL patients. There is a paucity of information regarding the cytokine profile expressed by different target tissues in the same individual and the changes it undergoes throughout the course of infection. In this work we evaluated IFN-γ, TNF-α, IL-10, and TGF-β mRNA expression using real-time RT-PCR in 5 target tissues at 6 months and 16 months post-infection (PI in a canine experimental model which mimics many aspects of human VL. The spleen and liver of Leishmania infantum experimentally-infected dogs elicited a pro- and anti- inflammatory response and high parasite density at 6 and 16 months PI. The popliteal lymph node, however, showed an up-regulation of IFN-γ cytokin at commencement of the study and was at the chronic phase when the IL-10 and TGF-β expression appeared. In spite of skin parasite invasion, local cytokine response was absent at 6 months PI. Parasite growth and onset of clinical disease both correlated with dermal up-regulation of all the studied cytokines. Our VL model suggests that central target organs, such as the spleen and liver, present a mixed cytokine immune response early on infection. In contrast, an anti-inflammatory/regulatory immune response in peripheral tissues is activated in the later chronic-patent stages of the disease.

  9. Compartmentalized Immune Response in Leishmaniasis: Changing Patterns throughout the Disease

    Science.gov (United States)

    Carrillo, Eugenia; Martorell, Susanna; Todolí, Felicitat; Martínez-Flórez, Alba; Urniza, Alicia; Moreno, Javier

    2016-01-01

    Visceral leishmaniasis (VL) is characterized by loss of T-cell responsiveness and absence of Leishmania-specific IFN-γ production by peripheral blood mononuclear cells. However, the expressions of IFN-γ and TNF-α are up-regulated in the tissues and plasma of VL patients. There is a paucity of information regarding the cytokine profile expressed by different target tissues in the same individual and the changes it undergoes throughout the course of infection. In this work we evaluated IFN-γ, TNF-α, IL-10, and TGF-β mRNA expression using real-time RT-PCR in 5 target tissues at 6 months and 16 months post-infection (PI) in a canine experimental model which mimics many aspects of human VL. The spleen and liver of Leishmania infantum experimentally-infected dogs elicited a pro- and anti- inflammatory response and high parasite density at 6 and 16 months PI. The popliteal lymph node, however, showed an up-regulation of IFN-γ cytokin at commencement of the study and was at the chronic phase when the IL-10 and TGF-β expression appeared. In spite of skin parasite invasion, local cytokine response was absent at 6 months PI. Parasite growth and onset of clinical disease both correlated with dermal up-regulation of all the studied cytokines. Our VL model suggests that central target organs, such as the spleen and liver, present a mixed cytokine immune response early on infection. In contrast, an anti-inflammatory/regulatory immune response in peripheral tissues is activated in the later chronic-patent stages of the disease. PMID:27171409

  10. The Murine Humoral Immune Response to Hepatitis B Surface Antigen: Idiotype Network Pathways.

    Science.gov (United States)

    Schick, Michael Roy

    networks within the humoral immune response to HBsAg; how the anti-HBs response is regulated; and to possible mechanisms to enhance or alter the human immune response to HBV infection.

  11. The Role of the Immune Response in Merkel Cell Carcinoma

    Energy Technology Data Exchange (ETDEWEB)

    Triozzi, Pierre L., E-mail: triozzp@ccf.org [Taussig Cancer Institute, Cleveland Clinic Foundation, 9500 Euclid Avenue, Cleveland, OH 44195 (United States); Fernandez, Anthony P. [Departments of Dermatology and Anatomic Pathology, Cleveland Clinic Foundation, 9500 Euclid Avenue, Cleveland, OH 44195 (United States)

    2013-02-28

    Merkel cell carcinoma (MCC) is an aggressive neuroendocrine skin cancer. The Merkel cell polyomavirus (MCPyV) is implicated in its pathogenesis. Immune mechanisms are also implicated. Patients who are immunosuppressed have an increased risk. There is evidence that high intratumoral T-cell counts and immune transcripts are associated with favorable survival. Spontaneous regressions implicate immune effector mechanisms. Immunogenicity is also supported by observation of autoimmune paraneoplastic syndromes. Case reports suggest that immune modulation, including reduction of immune suppression, can result in tumor regression. The relationships between MCPyV infection, the immune response, and clinical outcome, however, remain poorly understood. Circulating antibodies against MCPyV antigens are present in most individuals. MCPyV-reactive T cells have been detected in both MCC patients and control subjects. High intratumoral T-cell counts are also associated with favorable survival in MCPyV-negative MCC. That the immune system plays a central role in preventing and controlling MCC is supported by several observations. MCCs often develop, however, despite the presence of humoral and cellular immune responses. A better understanding on how MCPyV and MCC evade the immune response will be necessary to develop effective immunotherapies.

  12. Chemical Tools To Monitor and Manipulate Adaptive Immune Responses.

    Science.gov (United States)

    Doran, Todd M; Sarkar, Mohosin; Kodadek, Thomas

    2016-05-18

    Methods to monitor and manipulate the immune system are of enormous clinical interest. For example, the development of vaccines represents one of the earliest and greatest accomplishments of the biomedical research enterprise. More recently, drugs capable of "reawakening" the immune system to cancer have generated enormous excitement. But, much remains to be done. All drugs available today that manipulate the immune system cannot distinguish between "good" and "bad" immune responses and thus drive general and systemic immune suppression or activation. Indeed, with the notable exception of vaccines, our ability to monitor and manipulate antigen-specific immune responses is in its infancy. Achieving this finer level of control would be highly desirable. For example, it might allow the pharmacological editing of pathogenic immune responses without restricting the ability of the immune system to defend against infection. On the diagnostic side, a method to comprehensively monitor the circulating, antigen-specific antibody population could provide a treasure trove of clinically useful biomarkers, since many diseases expose the immune system to characteristic molecules that are deemed foreign and elicit the production of antibodies against them. This Perspective will discuss the state-of-the-art of this area with a focus on what we consider seminal opportunities for the chemistry community to contribute to this important field.

  13. Global analysis of the immune response

    Science.gov (United States)

    Ribeiro, Leonardo C.; Dickman, Ronald; Bernardes, Américo T.

    2008-10-01

    The immune system may be seen as a complex system, characterized using tools developed in the study of such systems, for example, surface roughness and its associated Hurst exponent. We analyze densitometric (Panama blot) profiles of immune reactivity, to classify individuals into groups with similar roughness statistics. We focus on a population of individuals living in a region in which malaria endemic, as well as a control group from a disease-free region. Our analysis groups individuals according to the presence, or absence, of malaria symptoms and number of malaria manifestations. Applied to the Panama blot data, our method proves more effective at discriminating between groups than principal-components analysis or super-paramagnetic clustering. Our findings provide evidence that some phenomena observed in the immune system can be only understood from a global point of view. We observe similar tendencies between experimental immune profiles and those of artificial profiles, obtained from an immune network model. The statistical entropy of the experimental profiles is found to exhibit variations similar to those observed in the Hurst exponent.

  14. dlk1/FA1 regulates the function of human bone marrow mesenchymal stem cells by modulating gene expression of pro-inflammatory cytokines and immune response-related factors

    DEFF Research Database (Denmark)

    Abdallah, Basem M.; Boissy, Patrice; Tan, Qihua

    2007-01-01

    dlk1/FA1 (delta-like 1/fetal antigen-1) is a member of the epidermal growth factor-like homeotic protein family whose expression is known to modulate the differentiation signals of mesenchymal and hematopoietic stem cells in bone marrow. We have demonstrated previously that Dlk1 can maintain...... the human bone marrow mesenchymal stem cells (hMSC) in an undifferentiated state. To identify the molecular mechanisms underlying these effects, we compared the basal gene expression pattern in Dlk1-overexpressing hMSC cells (hMSC-dlk1) versus control hMSC (negative for Dlk1 expression) by using Affymetrix......, apoptosis, and cell adhesion. Also, addition of purified FA1 to hMSC up-regulated the same factors in a dose-dependent manner. As biological consequences of up-regulating these immune response-related factors, we showed that the inhibitory effects of dlk1 on osteoblast and adipocyte differentiation of h...

  15. The responses of immune cells to iron oxide nanoparticles.

    Science.gov (United States)

    Xu, Yaolin; Sherwood, Jennifer A; Lackey, Kimberly H; Qin, Ying; Bao, Yuping

    2016-04-01

    Immune cells play an important role in recognizing and removing foreign objects, such as nanoparticles. Among various parameters, surface coatings of nanoparticles are the first contact with biological system, which critically affect nanoparticle interactions. Here, surface coating effects on nanoparticle cellular uptake, toxicity and ability to trigger immune response were evaluated on a human monocyte cell line using iron oxide nanoparticles. The cells were treated with nanoparticles of three types of coatings (negatively charged polyacrylic acid, positively charged polyethylenimine and neutral polyethylene glycol). The cells were treated at various nanoparticle concentrations (5, 10, 20, 30, 50 μg ml(-1) or 2, 4, 8, 12, 20 μg cm(-2)) with 6 h incubation or treated at a nanoparticle concentration of 50 μg ml(-1) (20 μg cm(-2)) at different incubation times (6, 12, 24, 48 or 72 h). Cell viability over 80% was observed for all nanoparticle treatment experiments, regardless of surface coatings, nanoparticle concentrations and incubation times. The much lower cell viability for cells treated with free ligands (e.g. ~10% for polyethylenimine) suggested that the surface coatings were tightly attached to the nanoparticle surfaces. The immune responses of cells to nanoparticles were evaluated by quantifying the expression of toll-like receptor 2 and tumor necrosis factor-α. The expression of tumor necrosis factor-α and toll-like receptor 2 were not significant in any case of the surface coatings, nanoparticle concentrations and incubation times. These results provide useful information to select nanoparticle surface coatings for biological and biomedical applications.

  16. Defence mechanisms and immune evasion in the interplay between the humane immune system and Plasmodium falciparum

    DEFF Research Database (Denmark)

    Theander, T G

    1992-01-01

    Immunity to P. falciparum malaria is developed as a result of long term exposure to the parasite and depends on immunological memory. The key directors in immune recognition and regulation of the immunological responses are the T-cells. It seems reasonable to propose that immunity is acquired when...... a critical mass of T-cells, recognizing relevant malaria antigens, has been developed. These T-cells mediate immunity by regulating macrophage and B-cell activity, but they may also act directly as cytotoxic cells on infected hepatocytes and through production of parasite-toxic cytokines. The potential...... with development of immunity. Several mechanisms seem to be operating. 1) Induction of the immune response to some macromolecules is avoided because the parasites are living inside host cells during part of their life cycle, and the reaction to other molecules is apparently avoided by mimicry of host molecules. 2...

  17. Microbial Degradation of Cellular Kinases Impairs Innate Immune Signaling and Paracrine TNFα Responses.

    Science.gov (United States)

    Barth, Kenneth; Genco, Caroline Attardo

    2016-10-04

    The NFκB and MAPK signaling pathways are critical components of innate immunity that orchestrate appropriate immune responses to control and eradicate pathogens. Their activation results in the induction of proinflammatory mediators, such as TNFα a potent bioactive molecule commonly secreted by recruited inflammatory cells, allowing for paracrine signaling at the site of an infection. In this study we identified a novel mechanism by which the opportunistic pathogen Porphyromonas gingivalis dampens innate immune responses by disruption of kinase signaling and degradation of inflammatory mediators. The intracellular immune kinases RIPK1, TAK1, and AKT were selectively degraded by the P. gingivalis lysine-specific gingipain (Kgp) in human endothelial cells, which correlated with dysregulated innate immune signaling. Kgp was also observed to attenuate endothelial responsiveness to TNFα, resulting in a reduction in signal flux through AKT, ERK and NFκB pathways, as well as a decrease in downstream proinflammatory mRNA induction of cytokines, chemokines and adhesion molecules. A deficiency in Kgp activity negated decreases to host cell kinase protein levels and responsiveness to TNFα. Given the essential role of kinase signaling in immune responses, these findings highlight a unique mechanism of pathogen-induced immune dysregulation through inhibition of cell activation, paracrine signaling, and dampened cellular proinflammatory responses.

  18. Influenza vaccine induces intracellular immune memory of human NK cells.

    Directory of Open Access Journals (Sweden)

    Yaling Dou

    Full Text Available Influenza vaccines elicit antigen-specific antibodies and immune memory to protect humans from infection with drift variants. However, what supports or limits vaccine efficacy and duration is unclear. Here, we vaccinated healthy volunteers with annual vaccine formulations and investigated the dynamics of T cell, natural killer (NK cell and antibody responses upon restimulation with heterologous or homologous influenza virus strains. Influenza vaccines induced potential memory NK cells with increased antigen-specific recall IFN-γ responses during the first 6 months. In the absence of significant changes in other NK cell markers (CD45RO, NKp44, CXCR6, CD57, NKG2C, CCR7, CD62L and CD27, influenza vaccines induced memory NK cells with the distinct feature of intracellular NKp46 expression. Indeed, surface NKp46 was internalized, and the dynamic increase in NKp46(intracellular+CD56dim NK cells positively correlated with increased IFN-γ production to influenza virus restimulation after vaccination. In addition, anti-NKp46 antibodies blocked IFN-γ responses. These findings provide insights into a novel mechanism underlying vaccine-induced immunity and NK-related diseases, which may help to design persisting and universal vaccines in the future.

  19. Influenza vaccine induces intracellular immune memory of human NK cells.

    Science.gov (United States)

    Dou, Yaling; Fu, Binqing; Sun, Rui; Li, Wenting; Hu, Wanfu; Tian, Zhigang; Wei, Haiming

    2015-01-01

    Influenza vaccines elicit antigen-specific antibodies and immune memory to protect humans from infection with drift variants. However, what supports or limits vaccine efficacy and duration is unclear. Here, we vaccinated healthy volunteers with annual vaccine formulations and investigated the dynamics of T cell, natural killer (NK) cell and antibody responses upon restimulation with heterologous or homologous influenza virus strains. Influenza vaccines induced potential memory NK cells with increased antigen-specific recall IFN-γ responses during the first 6 months. In the absence of significant changes in other NK cell markers (CD45RO, NKp44, CXCR6, CD57, NKG2C, CCR7, CD62L and CD27), influenza vaccines induced memory NK cells with the distinct feature of intracellular NKp46 expression. Indeed, surface NKp46 was internalized, and the dynamic increase in NKp46(intracellular)+CD56dim NK cells positively correlated with increased IFN-γ production to influenza virus restimulation after vaccination. In addition, anti-NKp46 antibodies blocked IFN-γ responses. These findings provide insights into a novel mechanism underlying vaccine-induced immunity and NK-related diseases, which may help to design persisting and universal vaccines in the future.

  20. Carbohydrate Mimetic Peptides Augment Carbohydrate-Reactive Immune Responses in the Absence of Immune Pathology

    OpenAIRE

    Thomas Kieber-Emmons; Anastas Pashov; Behjatolah Monzavi-Karbassi; Fariba Jousheghany; Cecile Artaud; Leah Hennings

    2011-01-01

    Among the most challenging of clinical targets for cancer immunotherapy are Tumor Associated Carbohydrate Antigens (TACAs). To augment immune responses to TACA we are developing carbohydrate mimetic peptides (CMPs) that are sufficiently potent to activate broad-spectrum anti-tumor reactivity. However, the activation of immune responses against terminal mono- and disaccharide constituents of TACA raises concerns regarding the balance between “tumor destruction” and “tissue damage”, as mono- an...

  1. Role of Activin A in Immune Response to Breast Cancer

    Science.gov (United States)

    2015-12-01

    2014;124:2246–59. 41. Postow MA, Callahan MK, Wolchok JD. The antitumor immunity of ipilimumab: (T-cell) memories to last a lifetime? Clin Cancer Res 2012;18...Lagorce-Pages C, et al. Type, density, and location of immune cells within human colorectal tumors predict clinical outcome. Science 2006;313:1960–4...4] Pagès F, Galon J, Dieu-Nosjean MC, Tartour E, Sautès-Fridman C, Fridman WH. Immune infiltration in human tumors: a prognostic factor that should

  2. Modulation of primary immune response by different vaccine adjuvants

    Directory of Open Access Journals (Sweden)

    Annalisa Ciabattini

    2016-10-01

    Full Text Available Adjuvants contribute to enhancing and shaping the vaccine immune response through different modes of action. Since the primary immune response can influence the overall quality of the response generated, here we investigate early biomarkers of adjuvanticity after primary immunization with four different adjuvants combined with the chimeric tuberculosis vaccine antigen H56. C57BL/6 mice were immunized by the subcutaneous route with different vaccine formulations, and the modulation of primary CD4+ T cell and B cell responses was assessed within draining lymph nodes, blood and spleen, 7 and 12 days after priming. Vaccine formulations containing the liposome system CAF01 or a squalene-based oil-in-water emulsion (o/w Squalene, but not aluminum hydroxide (Alum or CpG ODN 1826, elicited a significant primary antigen-specific CD4+ T cell response compared to antigen alone, 7 days after immunization. The effector function of activated CD4+ T cells was skewed towards a Th1/Th17 response by CAF01, while a Th1/Th2 response was elicited by o/w Squalene. Differentiation of B cells in short-lived plasma cells, and subsequent early H56-specific IgG secretion, was observed in mice immunized with o/w Squalene or CpG adjuvants. Tested adjuvants promoted the germinal centre reaction with different magnitude. These results show that the immunological activity of different adjuvants can be characterized by profiling early immunization biomarkers after primary immunization. These data and this approach could give an important contribution to the rational development of heterologous prime-boost vaccine immunization protocols.

  3. Carbohydrate Mimetic Peptides Augment Carbohydrate-Reactive Immune Responses in the Absence of Immune Pathology

    Energy Technology Data Exchange (ETDEWEB)

    Hennings, Leah; Artaud, Cecile; Jousheghany, Fariba; Monzavi-Karbassi, Behjatolah; Pashov, Anastas; Kieber-Emmons, Thomas, E-mail: tke@uams.edu [W