Hsia, Te-Chun; Huang, Yi-Ping; Jiang, Yi-Wen; Chen, Hsin-Yu; Cheng, Zheng-Yu; Hsiao, Yung-Ting; Chen, Cheng-Yen; Peng, Shu-Fen; Chueh, Fu-Shin; Chou, Yu-Cheng; Chung, Jing-Gung
2018-04-01
Some lung cancer patients treated with gefitinib develop resistance to this drug resulting in unsatisfactory treatment outcomes. Phenethyl isothiocyanate (PEITC), present in our common cruciferous vegetables, exhibits anticancer activities in many human cancer cell lines. Currently, there is no available information on the possible modification of gefitinib resistance of lung cancer in vitro by PEITC. Thus, the effects of PEITC on gefitinib resistant lung cancer NCI-H460 cells were investigated in vitro. The total cell viability, apoptotic cell death, production of reactive oxygen species (ROS) and Ca 2+ , levels of mitochondria membrane potential (ΔΨ m ) and caspase-3, -8 and -9 activities were measured by flow cytometry assay. PEITC induced chromatin condensation was examined by DAPI staining. PEITC-induced cell morphological changes, decreased total viable cell number and induced apoptotic cell death in NCI-H460 and NCI-H460/G cells. PEITC decreased ROS production in NCI-H460 cells, but increased production in NCI-H460/G cells. PEITC increased Ca 2+ production, decreased the levels of ΔΨ m and increased caspase-3, -8 and -9 activities in both NCI-H460 and NCI-H460/G cells. Western blotting was used to examine the effect of apoptotic cell death associated protein expression in NCI-H460 NCI-H460/G cells after exposure to PEITC. Results showed that PEITC increased expression of cleaved caspase-3, PARP, GADD153, Endo G and pro-apoptotic protein Bax in NCI-H460/G cells. Based on these results, we suggest that PEITC induces apoptotic cell death via the caspase- and mitochondria-dependent pathway in NCI-H460/G cells. Copyright© 2018, International Institute of Anticancer Research (Dr. George J. Delinasios), All rights reserved.
Wang, Huan-qin; Jin, Jian-jun; Wang, Jing
2014-01-01
Arctigenin, a dibenzylbutyrolactone lignan, enhances cisplatin-mediated cell apoptosis in cancer cells. Here, we sought to investigate the effects of arctigenin on cisplatin-treated non-small-cell lung cancer (NSCLC) H460 cells. The 3-(4,5-dimethylthiazol-2-yl)-2,5-diphenyltetrazolium bromide assay and annexin-V/propidium iodide staining were performed to analyze the proliferation and apoptosis of H460 cells. Arctigenin dose-dependently suppressed cell proliferation and potentiated cell apoptosis, coupled with increased cleavage of caspase-3 and poly(ADP-ribose) polymerase. Moreover, arctigenin sensitized H460 cells to cisplatin-induced proliferation inhibition and apoptosis. Arctigenin alone or in combination with cisplatin had a significantly lower amount of survivin. Ectopic expression of survivin decreased cell apoptosis induced by arctigenin (P arctigenin (P arctigenin has a therapeutic potential in combina-tion with chemotherapeutic agents for NSLC. © 2013 Wiley Periodicals, Inc.
Radiosensitizing effect of PSMC5, a 19S proteasome ATPase, in H460 lung cancer cells
International Nuclear Information System (INIS)
Yim, Ji-Hye; Yun, Hong Shik; Lee, Su-Jae; Baek, Jeong-Hwa; Lee, Chang-Woo; Song, Ji-Young; Um, Hong-Duck; Park, Jong Kuk; Kim, Jae-Sung; Park, In-Chul; Hwang, Sang-Gu
2016-01-01
The function of PSMC5 (proteasome 26S subunit, ATPase 5) in tumors, particularly with respect to cancer radioresistance, is not known. Here, we identified PSMC5 as a novel radiosensitivity biomarker, demonstrating that radiosensitive H460 cells were converted to a radioresistance phenotype by PSMC5 depletion. Exposure of H460 cells to radiation induced a marked accumulation of cell death-promoting reactive oxygen species, but this effect was blocked in radiation-treated H460 PSMC5-knockdown cells through downregulation of the p53-p21 pathway. Interestingly, PSMC5 depletion in H460 cells enhanced both AKT activation and MDM2 transcription, thereby promoting the degradation of p53 and p21 proteins. Furthermore, specific inhibition of AKT with triciribine or knockdown of MDM2 with small interfering RNA largely restored p21 expression in PSMC5-knockdown H460 cells. Our data suggest that PSMC5 facilitates the damaging effects of radiation in radiation-responsive H460 cancer cells and therefore may serve as a prognostic indicator for radiotherapy and molecular targeted therapy in lung cancer patients. - Highlights: • PSMC5 is a radiation-sensitive biomarker in H460 cells. • PSMC5 depletion inhibits radiation-induced apoptosis in H460 cells. • PSMC5 knockdown blocks ROS generation through inhibition of the p53-p21 pathway. • PSMC5 knockdown enhances p21 degradation via AKT-dependent MDM2 stabilization.
Directory of Open Access Journals (Sweden)
Sarah Fernandes Teixeira
2013-12-01
Full Text Available OBJECTIVE: To test the effectiveness of combining conventional antineoplastic drugs (cisplatin and etoposide with metformin in the treatment of non-small cell lung cancer in the NCI-H460 cell line, in order to develop new therapeutic options with high efficacy and low toxicity.METHODS: We used the 3-(4,5-dimethylthiazol-2-yl-2,5-diphenyltetrazolium bromide (MTT assay and calculated the combination index for the drugs studied.RESULTS: We found that the use of metformin as monotherapy reduced the metabolic viability of the cell line studied. Combining metformin with cisplatin or etoposide produced a synergistic effect and was more effective than was the use of cisplatin or etoposide as monotherapy.CONCLUSIONS: Metformin, due to its independent effects on liver kinase B1, had antiproliferative effects on the NCI-H460 cell line. When metformin was combined with cisplatin or etoposide, the cell death rate was even higher.
International Nuclear Information System (INIS)
Wang Yong; Wang Yan; Du Liqing; Yang Qingshan; Wang Yueying; Fan Feiyue
2009-01-01
Objective: To investigate the possible radiosensitive effect of human Lactotransferrin (hLF) high expression in lung cancer cell, we hereby constructed and transfected a recombinant vector pBC1 containing exogenous hLF gene. Methods: Firstly the recombinant plasmid pBC1-hLF was transferred into H460 and the hLF expression was evaluated by western blotting. Then we test the cell viability, apoptosis and clone formation after radiation along with the standard hLF treatment control. Results: The results showed that the hLF gene had been successfully transfect into H460 cells and hLF high expression can reduce the clone formation after radiation (P<0.01), and inhibit the cell proliferation with induced apoptosis (P<0.01). And the sensitization ratio of hLF treated and pBC1-hLF transfected were 1.29, 1.59. Conclusion: Our primary data shows that hLF high expression can radio sensitize the H460 cell in vitro. (authors)
Wattanathamsan, Onsurang; Treesuwan, Surassawadee; Sritularak, Boonchoo; Pongrakhananon, Varisa
2018-03-01
The life-threatening potential of lung cancer has increased over the years due to its acquisition of chemotherapeutic resistance, especially to cisplatin, a first-line therapy. In response to this development, researchers have turned their attention to several compounds derived from natural origins, including cypripedin (CYP), a phenanthrenequinone substance extracted from Dendrobium densiflorum. The aim of the present study was to investigate the ability of CYP to induce apoptosis and enhance cisplatin-mediated death of human lung cancer NCI-H460 cells using cell viability and apoptosis assays. The induction of apoptosis by CYP was observed at a concentration of > 50 μM with the appearance of morphological changes, including DNA condensation and chromatin fragmentation. Together with, CYP was able to activate caspase-3 and downregulate the anti-apoptotic proteins Bcl-2 and Bcl-xL. Also, a non-cytotoxic dose of CYP synergistically potentiated the effect of cisplatin in non-small cell lung cancer line H460 cells, which clearly exhibited the apoptotic phenotype. Western blot analysis revealed that the underlying mechanism involved the downregulation of anti-apoptotic Bcl-xL, whereas the levels of other apoptotic regulatory proteins were not altered. This study provides interesting information on the potent effect of CYP as a chemotherapeutic sensitizer that could be further developed to improve the clinical outcomes of lung cancer patients.
Directory of Open Access Journals (Sweden)
Chang HB
2015-08-01
Full Text Available Hong-Bin Chang,1 Bing-Huei Chen1,21Department of Food Science, 2Graduate Institute of Medicine, Fu Jen Catholic University, Taipei, TaiwanAbstract: The objectives of this study were to explore the inhibition mechanism of lung cancer cells A549 and H460 by curcuminoid extracts and nanoemulsions prepared from Curcuma longa Linnaeus. In addition, human bronchus epithelial cell line BEAS-2B (normal cell was selected for comparison. A high-performance liquid chromatography (HPLC method was developed to separate and quantify the various curcuminoids in C. longa extract, including curcumin (1,714.5 µg/mL, demethoxycurcumin (1,147.4 µg/mL, and bisdemethoxycurcumin (190.2 µg/mL. A high-stability nanoemulsion composed of Tween 80, water, and curcuminoid extract was prepared, with mean particle size being 12.6 nm. The cell cycle was retarded at G2/M for both the curcuminoid extract and nanoemulsion treatments; however, the inhibition pathway may be different. H460 cells were more susceptible to apoptosis than A549 cells for both curcuminoid extract and nanoemulsion treatments. Growth of BEAS-2B remained unaffected for both the curcuminoid extract and nanoemulsion treatments, with a concentration range from 1 to 4 µg/mL. Also, the activities of caspase-3, caspase-8, and caspase-9 followed a dose-dependent increase for both A549 and H460 cells for both the treatments, accompanied by a dose-dependent increase in cytochrome C expression and a dose-dependent decrease in CDK1 expression. Interestingly, a dose-dependent increase in cyclin B expression was shown for A549 cells for both the treatments, while a reversed trend was found for H460 cells. Both mitochondria and death receptor pathways may be responsible for apoptosis of both A549 and H460 cells.Keywords: curcuminoid extract, curcuminoid nanoemulsion, Curcuma longa Linnaeus, lung cancer cell, cell cycle, apoptosis mechanism
Srinual, Songpol; Chanvorachote, Pithi; Pongrakhananon, Varisa
2017-04-01
Cancer stem cells (CSCs) have been reported as a major cause of cancer metastasis and the failure of cancer treatment. Cumulative studies have indicated that protein kinase B (Akt) and its downstream signaling pathway, including CSC markers, play a critical role in the aggressive behavior of this cancer. In this study, we investigated whether vanillin, a major component in Vanilla planifolia seed, could suppress cancer stemness phenotypes and related proteins in the human non-small cell lung cancer NCI‑H460 cell line. A non-toxic concentration of vanillin suppressed spheroid and colony formation, two hallmarks of the cancer stemness phenotype, in vitro in NCI‑H460 cells. Western blot analysis revealed that the CSC markers CD133 and ALDH1A1 and the associated transcription factors, Oct4 and Nanog, were extensively downregulated by vanillin. Vanillin also attenuated the expression and activity of Akt, a transcription regulator upstream of CSCs, an action that was confirmed by treatment with the Akt inhibitor perifosine. Furthermore, the ubiquitination of Akt was elevated in response to vanillin treatment prior to proteasomal degradation. This finding indicates that vanillin can inhibit cancer stem cell-like behavior in NCI‑H460 cells through the induction of Akt-proteasomal degradation and reduction of downstream CSC transcription factors. This inhibitory effect of vanillin may be an alternative approach in the treatment against lung cancer metastasis and its resistance to chemotherapy.
Chang, Hong-Bin; Chen, Bing-Huei
2015-01-01
The objectives of this study were to explore the inhibition mechanism of lung cancer cells A549 and H460 by curcuminoid extracts and nanoemulsions prepared from Curcuma longa Linnaeus. In addition, human bronchus epithelial cell line BEAS-2B (normal cell) was selected for comparison. A high-performance liquid chromatography (HPLC) method was developed to separate and quantify the various curcuminoids in C. longa extract, including curcumin (1,714.5 μg/mL), demethoxycurcumin (1,147.4 μg/mL), and bisdemethoxycurcumin (190.2 μg/mL). A high-stability nanoemulsion composed of Tween 80, water, and curcuminoid extract was prepared, with mean particle size being 12.6 nm. The cell cycle was retarded at G2/M for both the curcuminoid extract and nanoemulsion treatments; however, the inhibition pathway may be different. H460 cells were more susceptible to apoptosis than A549 cells for both curcuminoid extract and nanoemulsion treatments. Growth of BEAS-2B remained unaffected for both the curcuminoid extract and nanoemulsion treatments, with a concentration range from 1 to 4 μg/mL. Also, the activities of caspase-3, caspase-8, and caspase-9 followed a dose-dependent increase for both A549 and H460 cells for both the treatments, accompanied by a dose-dependent increase in cytochrome C expression and a dose-dependent decrease in CDK1 expression. Interestingly, a dose-dependent increase in cyclin B expression was shown for A549 cells for both the treatments, while a reversed trend was found for H460 cells. Both mitochondria and death receptor pathways may be responsible for apoptosis of both A549 and H460 cells.
Chlorella vulgaris Induces Apoptosis of Human Non-Small Cell Lung Carcinoma (NSCLC) Cells.
Zhang, Zhi-Dong; Liang, Kai; Li, Kun; Wang, Guo-Quan; Zhang, Ke-Wei; Cai, Lei; Zhai, Shui-Ting; Chou, Kuo-Chen
2017-01-01
Chlorella vulgaris (C. vulgaris), a unicellular green microalga, has been widely used as a food supplement and reported to have antioxidant and anticancer properties. The current study was designed to assess the cytotoxic, apoptotic, and DNA-damaging effects of C. vulgaris growth factor (CGF), hot water C. vulgaris extracts, inlung tumor A549 and NCI-H460 cell lines. A549 cells, NCI-H460 cells, and normal human fibroblasts were treated with CGF at various concentrations (0-300 μg/ml) for 24 hr. The comet assay and γH2AX assay showed DNA damage in A549 and NCI-H460 cells upon CGF exposure. Evaluation of apoptosis by the TUNEL assay and DNA fragmentation analysis by agarose gel electrophoresis showed that CGF induced apoptosis in A549 and NCI-H460 cells. Chlorella vulgaris hot water extract induced apoptosis and DNA damage in human lung carcinoma cells. CGF can thus be considered a potential cytotoxic or genotoxic drug for treatment of lung carcinoma. Copyright© Bentham Science Publishers; For any queries, please email at epub@benthamscience.org.
Choi, Seon Young; Kim, Hang-Rae; Ryu, Pan Dong; Lee, So Yeong
2017-02-21
Side-population (SP) cells that exclude anti-cancer drugs have been found in various tumor cell lines. Moreover, SP cells have a higher proliferative potential and drug resistance than main population cells (Non-SP cells). Also, several ion channels are responsible for the drug resistance and proliferation of SP cells in cancer. To confirm the expression and function of voltage-gated potassium (Kv) channels of SP cells, these cells, as well as highly expressed ATP-binding cassette (ABC) transporters and stemness genes, were isolated from a gefitinib-resistant human lung adenocarcinoma cell line (NCI-H460), using Hoechst 33342 efflux. In the present study, we found that mRNA expression of Kv channels in SP cells was different compared to Non-SP cells, and the resistance of SP cells to gefitinib was weakened with a combination treatment of gefitinib and Kv channel blockers or a Kv7 opener, compared to single-treatment gefitinib, through inhibition of the Ras-Raf signaling pathway. The findings indicate that Kv channels in SP cells could be new targets for reducing the resistance to gefitinib.
Directory of Open Access Journals (Sweden)
Chun-Nun Chao
Full Text Available Lung adenocarcinoma, the most commonly diagnosed type of lung cancer, has a poor prognosis even with combined surgery, chemotherapy, or molecular targeted therapies. Most patients are diagnosed with an in-operable advanced or metastatic disease, both pointing to the necessity of developing effective therapies for lung adenocarcinoma. Surfactant protein B (SP-B has been found to be overexpressed in lung adenocarcinoma. In addition, it has also been demonstrated that human lung adenocarcinoma cells are susceptible to the JC polyomavirus (JCPyV infection. Therefore, we designed that the JCPyV virus-like particle (VLP packaged with an SP-B promoter-driven thymidine kinase suicide gene (pSPB-tk for possible gene therapy of human lung adenocarcinoma. Plasmids expressing the GFP (pSPB-gfp or thymidine kinase gene (pSPB-tk under the control of the human SP-B promoter were constructed. The promoter's tissue specificity was tested by transfection of pSPB-gfp into A549, CH27, and H460 human lung carcinoma cells and non-lung cells. The JCPyV VLP's gene transfer efficiency and the selective cytotoxicity of pSPB-tk combined with ganciclovir (GCV were tested in vitro and in a xenograft mouse model. In the current study, we found that SP-B promoter-driven GFP was specifically expressed in human lung adenocarcinoma (A549 and large cell carcinoma (H460 cells. JCPyV VLPs were able to deliver a GFP reporter gene into A549 cells for expression. Selective cytotoxicity was observed in A549 but not non-lung cells that were transfected with pSPB-tk or infected with pSPB-tk-carrying JCPyV VLPs. In mice injected with pSPB-tk-carrying JCPyV VLPs through the tail vein and treated with ganciclovir (GCV, a potent 80% inhibition of growth of human lung adenocarcinoma nodules resulted. The JCPyV VLPs combined with the use of SP-B promoter demonstrates effectiveness as a potential gene therapy against human lung adenocarcinoma.
Chao, Chun-Nun; Lin, Mien-Chun; Fang, Chiung-Yao; Chen, Pei-Lain; Chang, Deching; Shen, Cheng-Huang; Wang, Meilin
2016-01-01
Lung adenocarcinoma, the most commonly diagnosed type of lung cancer, has a poor prognosis even with combined surgery, chemotherapy, or molecular targeted therapies. Most patients are diagnosed with an in-operable advanced or metastatic disease, both pointing to the necessity of developing effective therapies for lung adenocarcinoma. Surfactant protein B (SP-B) has been found to be overexpressed in lung adenocarcinoma. In addition, it has also been demonstrated that human lung adenocarcinoma cells are susceptible to the JC polyomavirus (JCPyV) infection. Therefore, we designed that the JCPyV virus-like particle (VLP) packaged with an SP-B promoter-driven thymidine kinase suicide gene (pSPB-tk) for possible gene therapy of human lung adenocarcinoma. Plasmids expressing the GFP (pSPB-gfp) or thymidine kinase gene (pSPB-tk) under the control of the human SP-B promoter were constructed. The promoter's tissue specificity was tested by transfection of pSPB-gfp into A549, CH27, and H460 human lung carcinoma cells and non-lung cells. The JCPyV VLP's gene transfer efficiency and the selective cytotoxicity of pSPB-tk combined with ganciclovir (GCV) were tested in vitro and in a xenograft mouse model. In the current study, we found that SP-B promoter-driven GFP was specifically expressed in human lung adenocarcinoma (A549) and large cell carcinoma (H460) cells. JCPyV VLPs were able to deliver a GFP reporter gene into A549 cells for expression. Selective cytotoxicity was observed in A549 but not non-lung cells that were transfected with pSPB-tk or infected with pSPB-tk-carrying JCPyV VLPs. In mice injected with pSPB-tk-carrying JCPyV VLPs through the tail vein and treated with ganciclovir (GCV), a potent 80% inhibition of growth of human lung adenocarcinoma nodules resulted. The JCPyV VLPs combined with the use of SP-B promoter demonstrates effectiveness as a potential gene therapy against human lung adenocarcinoma.
Directory of Open Access Journals (Sweden)
Sikdar Sourav
2014-03-01
Full Text Available Objectives: In homeopathy, it is claimed that more homeopathically-diluted potencies render more protective/curative effects against any disease condition. Potentized forms of Condurango are used successfully to treat digestive problems, as well as esophageal and stomach cancers. However, the comparative efficacies of Condurango 6C and 30C, one diluted below and one above Avogadro’s limit (lacking original drug molecule, respectively, have not been critically analyzed for their cell-killing (apoptosis efficacy against lung cancer cells in vitro, and signalling cascades have not been studied. Hence, the present study was undertaken. Methods: 3-(4,5-dimethylthiazol-2-yl-2,5-diphenylte- trazolium bromide (MTT assays were conducted on H460-non-small-cell lung cancer (NSCLC cells by using a succussed ethyl alcohol vehicle (placebo as a control. Studies on cellular morphology, cell cycle regulation, generation of reactive oxygen species (ROS, changes in mitochondrial membrane potential (MMP, and DNA-damage were made, and expressions of related signaling markers were studied. The observations were done in a “blinded” manner. Results: Both Condurango 6C and 30C induced apoptosis via cell cycle arrest at subG0/G1 and altered expressions of certain apoptotic markers significantly in H460 cells. The drugs induced oxidative stress through ROS elevation and MMP depolarization at 18-24 hours. These events presumably activated a caspase-3-mediated signalling cascade, as evidenced by reverse transcriptase- polymerase chain reaction (RT-PCR, western blot and immunofluorescence studies at a late phase (48 hours in which cells were pushed towards apoptosis. Conclusion: Condurango 30C had greater apoptotic effect than Condurango 6C as claimed in the homeopathic doctrine.
Gigantol Inhibits Epithelial to Mesenchymal Process in Human Lung Cancer Cells
Directory of Open Access Journals (Sweden)
Thitita Unahabhokha
2016-01-01
Full Text Available Lung cancer remains a leading public health problem as evidenced by its increasing death rate. The main cause of death in lung cancer patients is cancer metastasis. The metastatic behavior of lung cancer cells becomes enhanced when cancer cells undergo epithelial to mesenchymal transition (EMT. Gigantol, a bibenzyl compound extracted from the Thai orchid, Dendrobium draconis, has been shown to have promising therapeutic potential against cancer cells, which leads to the hypothesis that gigantol may be able to inhibit the fundamental EMT process in cancer cells. This study has demonstrated for the first time that gigantol possesses the ability to suppress EMT in non-small cell lung cancer H460 cells. Western blot analysis has revealed that gigantol attenuates the activity of ATP-dependent tyrosine kinase (AKT, thereby inhibiting the expression of the major EMT transcription factor, Slug, by both decreasing its transcription and increasing its degradation. The inhibitory effects of gigantol on EMT result in a decrease in the level of migration in H460 lung cancer cells. The results of this study emphasize the potential of gigantol for further development against lung cancer metastasis.
Kang, Kyoung Ah; Piao, Mei Jing; Madduma Hewage, Susara Ruwan Kumara; Ryu, Yea Seong; Oh, Min Chang; Kwon, Taeg Kyu; Chae, Sungwook; Hyun, Jin Won
2016-07-01
Fisetin (3,3',4',7-tetrahydroxyflavone), a dietary flavonoid compound, is currently being investigated for its anticancer effect in various cancer models, including lung cancer. Recent studies show that fisetin induces cell growth inhibition and apoptosis in the human non-small cell lung cancer line NCI-H460. In this study, we investigated whether fisetin can induce endoplasmic reticulum (ER) stress-mediated apoptosis in NCI-H460 cells. Fisetin induced mitochondrial reactive oxygen species (ROS) and characteristic signs of ER stress: ER staining; mitochondrial Ca(2+) overload; expression of ER stress-related proteins; glucose-regulated protein (GRP)-78, phosphorylation of protein kinase RNA (PKR)-like endoplasmic reticulum kinase (PERK) and phosphorylation of eukaryotic initiation factor-2 α subunit; cleavage of activating transcription factor-6; phosphorylation of inositol-requiring kinase-1 and splicing of X-box transcription factor-1; induction of C/EBP homologous protein and cleaved caspase-12. siRNA-mediated knockdown of CHOP and ATF-6 attenuated fisetin-induced apoptotic cell death. In addition, fisetin induced phosphorylation of ERK, JNK, and p38 MAPK. Moreover, silencing of the MAPK signaling pathway prevented apoptotic cell death. In summary, our results indicate that, in NCI-H460 cells, fisetin induces apoptosis and ER stress that is mediated by induction of the MAPK signaling pathway.
International Nuclear Information System (INIS)
Kumar, Naresh; Park, Ji Hoon; Jeon, Su Nam; Park, Bong Sang; Choi, Eun Ha; Attri, Pankaj
2016-01-01
In the present work, we have generated reactive species (RS) through microsecond-pulsed plasma (MPP) in the cell culture media using a Marx generator with point–point electrodes of approximately 0.06 J discharge energy/pulse. RS generated in culture media through MPP have a selective action between growth of the H460 lung cancer cells and L132 normal lung cells. We observed that MPP-activated media (MPP-AM) induced apoptosis on H460 lung cancer cells through an oxidative DNA damage cascade. Additionally, we studied the apoptosis-related mRNA expression, DNA oxidation and polymerase-1 (PARP-1) cleaved analysis from treated cancer cells. The result proves that radicals generated through MPP play a pivotal role in the activation of media that induces the selective killing effect. (paper)
Role of Insulin-Like Growth Factor-1 Signaling Pathway in Cisplatin-Resistant Lung Cancer Cells
International Nuclear Information System (INIS)
Sun Yunguang; Zheng Siyuan; Torossian, Artour; Speirs, Christina K.; Schleicher, Stephen; Giacalone, Nicholas J.; Carbone, David P.; Zhao Zhongming; Lu Bo
2012-01-01
Purpose: The development of drug-resistant phenotypes has been a major obstacle to cisplatin use in non–small-cell lung cancer. We aimed to identify some of the molecular mechanisms that underlie cisplatin resistance using microarray expression analysis. Methods and Materials: H460 cells were treated with cisplatin. The differences between cisplatin-resistant lung cancer cells and parental H460 cells were studied using Western blot, MTS, and clonogenic assays, in vivo tumor implantation, and microarray analysis. The cisplatin-R cells were treated with human recombinant insulin-like growth factor (IGF) binding protein-3 and siRNA targeting IGF-1 receptor. Results: Cisplatin-R cells illustrated greater expression of the markers CD133 and aldehyde dehydrogenase, more rapid in vivo tumor growth, more resistance to cisplatin- and etoposide-induced apoptosis, and greater survival after treatment with cisplatin or radiation than the parental H460 cells. Also, cisplatin-R demonstrated decreased expression of insulin-like growth factor binding protein-3 and increased activation of IGF-1 receptor signaling compared with parental H460 cells in the presence of IGF-1. Human recombinant IGF binding protein-3 reversed cisplatin resistance in cisplatin-R cells and targeting of IGF-1 receptor using siRNA resulted in sensitization of cisplatin-R-cells to cisplatin and radiation. Conclusions: The IGF-1 signaling pathway contributes to cisplatin-R to cisplatin and radiation. Thus, this pathway represents a potential target for improved lung cancer response to treatment.
Role of Insulin-Like Growth Factor-1 Signaling Pathway in Cisplatin-Resistant Lung Cancer Cells
Energy Technology Data Exchange (ETDEWEB)
Sun Yunguang [Department of Radiation Oncology, Vanderbilt University Medical Center, Nashville, TN (United States); Zheng Siyuan [Department of Biomedical Informatics, Vanderbilt University Medical Center, Nashville, TN (United States); Torossian, Artour; Speirs, Christina K.; Schleicher, Stephen; Giacalone, Nicholas J. [Department of Radiation Oncology, Vanderbilt University Medical Center, Nashville, TN (United States); Carbone, David P. [Department of Hematology and Oncology, Vanderbilt University Medical Center, Nashville, TN (United States); Zhao Zhongming, E-mail: zhongming.zhao@vanderbilt.edu [Department of Biomedical Informatics, Vanderbilt University Medical Center, Nashville, TN (United States); Lu Bo, E-mail: bo.lu@vanderbilt.edu [Department of Radiation Oncology, Vanderbilt University Medical Center, Nashville, TN (United States)
2012-03-01
Purpose: The development of drug-resistant phenotypes has been a major obstacle to cisplatin use in non-small-cell lung cancer. We aimed to identify some of the molecular mechanisms that underlie cisplatin resistance using microarray expression analysis. Methods and Materials: H460 cells were treated with cisplatin. The differences between cisplatin-resistant lung cancer cells and parental H460 cells were studied using Western blot, MTS, and clonogenic assays, in vivo tumor implantation, and microarray analysis. The cisplatin-R cells were treated with human recombinant insulin-like growth factor (IGF) binding protein-3 and siRNA targeting IGF-1 receptor. Results: Cisplatin-R cells illustrated greater expression of the markers CD133 and aldehyde dehydrogenase, more rapid in vivo tumor growth, more resistance to cisplatin- and etoposide-induced apoptosis, and greater survival after treatment with cisplatin or radiation than the parental H460 cells. Also, cisplatin-R demonstrated decreased expression of insulin-like growth factor binding protein-3 and increased activation of IGF-1 receptor signaling compared with parental H460 cells in the presence of IGF-1. Human recombinant IGF binding protein-3 reversed cisplatin resistance in cisplatin-R cells and targeting of IGF-1 receptor using siRNA resulted in sensitization of cisplatin-R-cells to cisplatin and radiation. Conclusions: The IGF-1 signaling pathway contributes to cisplatin-R to cisplatin and radiation. Thus, this pathway represents a potential target for improved lung cancer response to treatment.
Kolostova, Katarina; Zhang, Yong; Hoffman, Robert M; Bobek, Vladimir
2014-09-01
In the present study, we demonstrate an animal model and recently introduced size-based exclusion method for circulating tumor cells (CTCs) isolation. The methodology enables subsequent in vitro CTC-culture and characterization. Human lung cancer cell line H460, expressing red fluorescent protein (H460-RFP), was orthotopically implanted in nude mice. CTCs were isolated by a size-based filtration method and successfully cultured in vitro on the separating membrane (MetaCell®), analyzed by means of time-lapse imaging. The cultured CTCs were heterogeneous in size and morphology even though they originated from a single tumor. The outer CTC-membranes were blebbing in general. Abnormal mitosis resulting in three daughter cells was frequently observed. The expression of RFP ensured that the CTCs originated from lung tumor. These readily isolatable, identifiable and cultivable CTCs can be used to characterize individual patient cancers and for screening of more effective treatment.
Multi-Modal Imaging in a Mouse Model of Orthotopic Lung Cancer
Patel, Priya; Kato, Tatsuya; Ujiie, Hideki; Wada, Hironobu; Lee, Daiyoon; Hu, Hsin-pei; Hirohashi, Kentaro; Ahn, Jin Young; Zheng, Jinzi; Yasufuku, Kazuhiro
2016-01-01
Background Investigation of CF800, a novel PEGylated nano-liposomal imaging agent containing indocyanine green (ICG) and iohexol, for real-time near infrared (NIR) fluorescence and computed tomography (CT) image-guided surgery in an orthotopic lung cancer model in nude mice. Methods CF800 was intravenously administered into 13 mice bearing the H460 orthotopic human lung cancer. At 48 h post-injection (peak imaging agent accumulation time point), ex vivo NIR and CT imaging was performed. A cli...
Plasmalemmal V-H+-ATPases regulate intracellular pH in human lung microvascular endothelial cells
International Nuclear Information System (INIS)
Rojas, Jose D.; Sennoune, Souad R.; Maiti, Debasish; Martinez, Gloria M.; Bakunts, Karina; Wesson, Donald E.; Martinez-Zaguilan, Raul
2004-01-01
The lung endothelium layer is exposed to continuous CO 2 transit which exposes the endothelium to a substantial acid load that could be detrimental to cell function. The Na + /H + exchanger and HCO 3 - -dependent H + -transporting mechanisms regulate intracellular pH (pH cyt ) in most cells. Cells that cope with high acid loads might require additional primary energy-dependent mechanisms. V-H + -ATPases localized at the plasma membranes (pmV-ATPases) have emerged as a novel pH regulatory system. We hypothesized that human lung microvascular endothelial (HLMVE) cells use pmV-ATPases, in addition to Na + /H + exchanger and HCO 3 - -based H + -transporting mechanisms, to maintain pH cyt homeostasis. Immunocytochemical studies revealed V-H + -ATPase at the plasma membrane, in addition to the predicted distribution in vacuolar compartments. Acid-loaded HLMVE cells exhibited proton fluxes in the absence of Na + and HCO 3 - that were similar to those observed in the presence of either Na + , or Na + and HCO 3 - . The Na + - and HCO 3 - -independent pH cyt recovery was inhibited by bafilomycin A 1 , a V-H + -ATPase inhibitor. These studies show a Na + - and HCO 3 - -independent pH cyt regulatory mechanism in HLMVE cells that is mediated by pmV-ATPases
Wang, Qiong; Xiao, Zhuya; Lin, Zhenyu; Zhou, Jie; Chen, Weihong; Jie, Wuyun; Cao, Xing; Yin, Zhongyuan; Cheng, Jing
2017-06-01
To investigate the impact of autophagy on the low-dose hyper-radiosensitivity (HRS) of human lung adenocarcinoma cells via MLH1 regulation. Immunofluorescent staining, Western blotting, and electron microscopy were utilized to detect autophagy in A549 and H460 cells. shRNA was used to silence MLH1 expression. The levels of MLH1, mTOR, p-mTOR, BNIP3, and Beclin-1 were measured by real-time polymerase chain reaction (PCR) and Western blotting. A549 cells, which have low levels of MLH1 expression, displayed HRS/induced radioresistance (IRR). Conversely, the radiosensitivity of H460 cells, which express high levels of MLH1, conformed to the linear-quadratic (LQ) model. After down-regulating MLH1 expression, A549 cells showed increased HRS and inhibition of autophagy, whereas H460 cells exhibited HRS/IRR. The levels of mTOR, p-mTOR, and BNIP3 were reduced in cells harboring MLH1 shRNA, and the changes in the mTOR/p-mTOR ratio mirrored those in MLH1 expression. Low MLH1-expressing A549 cells may exhibit HRS. Both the mTOR/p-mTOR and BNIP3/Beclin-1 signaling pathways were found to be related to HRS, but only mTOR/p-mTOR is involved in the regulation of HRS via MLH1 and autophagy.
Knepper, Jessica; Schierhorn, Kristina L; Becher, Anne; Budt, Matthias; Tönnies, Mario; Bauer, Torsten T; Schneider, Paul; Neudecker, Jens; Rückert, Jens C; Gruber, Achim D; Suttorp, Norbert; Schweiger, Brunhilde; Hippenstiel, Stefan; Hocke, Andreas C; Wolff, Thorsten
2013-10-08
A novel influenza A virus (IAV) of the H7N9 subtype has been isolated from severely diseased patients with pneumonia and acute respiratory distress syndrome and, apparently, from healthy poultry in March 2013 in Eastern China. We evaluated replication, tropism, and cytokine induction of the A/Anhui/1/2013 (H7N9) virus isolated from a fatal human infection and two low-pathogenic avian H7 subtype viruses in a human lung organ culture system mimicking infection of the lower respiratory tract. The A(H7N9) patient isolate replicated similarly well as a seasonal IAV in explanted human lung tissue, whereas avian H7 subtype viruses propagated poorly. Interestingly, the avian H7 strains provoked a strong antiviral type I interferon (IFN-I) response, whereas the A(H7N9) virus induced only low IFN levels. Nevertheless, all viruses analyzed were detected predominantly in type II pneumocytes, indicating that the A(H7N9) virus does not differ in its cellular tropism from other avian or human influenza viruses. Tissue culture-based studies suggested that the low induction of the IFN-β promoter correlated with an efficient suppression by the viral NS1 protein. These findings demonstrate that the zoonotic A(H7N9) virus is unusually well adapted to efficient propagation in human alveolar tissue, which most likely contributes to the severity of lower respiratory tract disease seen in many patients. Humans are usually not infected by avian influenza A viruses (IAV), but this large group of viruses contributes to the emergence of human pandemic strains. Transmission of virulent avian IAV to humans is therefore an alarming event that requires assessment of the biology as well as pathogenic and pandemic potentials of the viruses in clinically relevant models. Here, we demonstrate that an early virus isolate from the recent A(H7N9) outbreak in Eastern China replicated as efficiently as human-adapted IAV in explanted human lung tissue, whereas avian H7 subtype viruses were unable to
Breviscapine suppresses the growth of non-small cell lung cancer
Indian Academy of Sciences (India)
Breviscapine (BVP) has previously been shown to inhibit the proliferation of hepatocellular carcinoma cells.However, little is known about the effects of BVP on non-small cell lung cancer (NSCLC) growth. Here, we aimedto study the effects of BVP on human NSCLC growth. We employed A549, NCL-H460 and A549 cells ...
Directory of Open Access Journals (Sweden)
Yuen Kit M
2009-10-01
Full Text Available Abstract Background Highly pathogenic avian influenza (HPAI H5N1 virus is entrenched in poultry in Asia and Africa and continues to infect humans zoonotically causing acute respiratory disease syndrome and death. There is evidence that the virus may sometimes spread beyond respiratory tract to cause disseminated infection. The primary target cell for HPAI H5N1 virus in human lung is the alveolar epithelial cell. Alveolar epithelium and its adjacent lung microvascular endothelium form host barriers to the initiation of infection and dissemination of influenza H5N1 infection in humans. These are polarized cells and the polarity of influenza virus entry and egress as well as the secretion of cytokines and chemokines from the virus infected cells are likely to be central to the pathogenesis of human H5N1 disease. Aim To study influenza A (H5N1 virus replication and host innate immune responses in polarized primary human alveolar epithelial cells and lung microvascular endothelial cells and its relevance to the pathogenesis of human H5N1 disease. Methods We use an in vitro model of polarized primary human alveolar epithelial cells and lung microvascular endothelial cells grown in transwell culture inserts to compare infection with influenza A subtype H1N1 and H5N1 viruses via the apical or basolateral surfaces. Results We demonstrate that both influenza H1N1 and H5N1 viruses efficiently infect alveolar epithelial cells from both apical and basolateral surface of the epithelium but release of newly formed virus is mainly from the apical side of the epithelium. In contrast, influenza H5N1 virus, but not H1N1 virus, efficiently infected polarized microvascular endothelial cells from both apical and basolateral aspects. This provides a mechanistic explanation for how H5N1 virus may infect the lung from systemic circulation. Epidemiological evidence has implicated ingestion of virus-contaminated foods as the source of infection in some instances and our
Small Molecular TRAIL Inducer ONC201 Induces Death in Lung Cancer Cells: A Preclinical Study
Feng, Yuan; Zhou, Jihong; Li, Zhanhua; Jiang, Ying; Zhou, Ying
2016-01-01
Tumor necrosis factor (TNF)-related apoptosis-inducing ligand (TRAIL) selectively targets cancer cells. The present preclinical study investigated the anti-cancer efficiency of ONC201, a first-in-class small molecule TRAIL inducer, in lung cancer cells. We showed that ONC201 was cytotoxic and anti-proliferative in both established (A549 and H460 lines) and primary human lung cancer cells. It was yet non-cytotoxic to normal lung epithelial cells. Further, ONC201 induced exogenous apoptosis act...
Energy Technology Data Exchange (ETDEWEB)
Wu, Tzu-Chin [Chest Clinic, Chung Shan Medical University Hospital, Taichung, Taiwan (China); Lin, Yi-Chin [Department of Nutritional Science, Chung Shan Medical University, Taichung, Taiwan (China); Chen, Hsiao-Ling [Department of Health and Nutrition Biotechnology, Asia University, Taichung, Taiwan (China); Huang, Pei-Ru; Liu, Shang-Yu [Department of Nutritional Science, Chung Shan Medical University, Taichung, Taiwan (China); Yeh, Shu-Lan, E-mail: suzyyeh@csmu.edu.tw [Department of Nutritional Science, Chung Shan Medical University, Taichung, Taiwan (China); Department of Nutrition, Chung Shan Medical University Hospital, Taichung, Taiwan (China)
2016-02-01
Genistein has been shown to enhance the antitumor activity of trichostatin A (TSA) in human lung carcinoma A549 cells. However, whether the combined treatment exerts the same effect in other lung cancer cells is unclear. In the present study we first compared the enhancing effect of genistein on the antitumor effect of TSA in ABC-1, NCI-H460 (H460) and A549 cells. Second, we investigated whether the effects of genistein are associated with increased histone/non-histone protein acetylation. We found that the enhancing effect of genistein on cell-growth-arrest in ABC-1 cells (p53 mutant) was less than in A549 and H460 cells. Genistein enhanced TSA induced apoptosis in A549 and H460 cells rather than in ABC-1 cells. After silencing p53 expression in A549 and H460 cells, the enhancing effect of genistein was diminished. In addition, genistein increased TSA-induced histone H3/H4 acetylation in A549 and H460 cells. Genistein also increased p53 acetylation in H460 cells. The inhibitor of acetyltransferase, anacardic acid, diminished the enhancing effect of genistein on all TSA-induced histone/p53 acetylation and apoptosis. Genistein in combination with TSA increased the expression of p300 protein, an acetyltransferase, in A549 and NCI-H460 cells. Furthermore, we demonstrated that genistein also enhanced the antitumor effect of genistein in A549-tumor-bearing mice. Taken together, these results suggest that the enhancing effects of genistein on TSA-induced apoptosis in lung cancer cells were p53-dependent and were associated with histone/non-histone protein acetylation. - Highlights: • Genistein enhances the antitumor effect of TSA through p53-associated pathways. • Genistein enhances TSA-induced histone acetylation commonly. • An acetyltransferase inhibitor diminishes the antitumor effect of genistein + TSA. • TSA in combination with genistein increases the expression of p300. • Genistein given by i.p. injection increases the antitumor effect of TSA in vivo.
International Nuclear Information System (INIS)
Wu, Tzu-Chin; Lin, Yi-Chin; Chen, Hsiao-Ling; Huang, Pei-Ru; Liu, Shang-Yu; Yeh, Shu-Lan
2016-01-01
Genistein has been shown to enhance the antitumor activity of trichostatin A (TSA) in human lung carcinoma A549 cells. However, whether the combined treatment exerts the same effect in other lung cancer cells is unclear. In the present study we first compared the enhancing effect of genistein on the antitumor effect of TSA in ABC-1, NCI-H460 (H460) and A549 cells. Second, we investigated whether the effects of genistein are associated with increased histone/non-histone protein acetylation. We found that the enhancing effect of genistein on cell-growth-arrest in ABC-1 cells (p53 mutant) was less than in A549 and H460 cells. Genistein enhanced TSA induced apoptosis in A549 and H460 cells rather than in ABC-1 cells. After silencing p53 expression in A549 and H460 cells, the enhancing effect of genistein was diminished. In addition, genistein increased TSA-induced histone H3/H4 acetylation in A549 and H460 cells. Genistein also increased p53 acetylation in H460 cells. The inhibitor of acetyltransferase, anacardic acid, diminished the enhancing effect of genistein on all TSA-induced histone/p53 acetylation and apoptosis. Genistein in combination with TSA increased the expression of p300 protein, an acetyltransferase, in A549 and NCI-H460 cells. Furthermore, we demonstrated that genistein also enhanced the antitumor effect of genistein in A549-tumor-bearing mice. Taken together, these results suggest that the enhancing effects of genistein on TSA-induced apoptosis in lung cancer cells were p53-dependent and were associated with histone/non-histone protein acetylation. - Highlights: • Genistein enhances the antitumor effect of TSA through p53-associated pathways. • Genistein enhances TSA-induced histone acetylation commonly. • An acetyltransferase inhibitor diminishes the antitumor effect of genistein + TSA. • TSA in combination with genistein increases the expression of p300. • Genistein given by i.p. injection increases the antitumor effect of TSA in vivo.
Growth inhibitory effects of miR-221 and miR-222 in non-small cell lung cancer cells
International Nuclear Information System (INIS)
Yamashita, Ryo; Sato, Mitsuo; Kakumu, Tomohiko; Hase, Tetsunari; Yogo, Naoyuki; Maruyama, Eiichi; Sekido, Yoshitaka; Kondo, Masashi; Hasegawa, Yoshinori
2015-01-01
Both pro- and anti-oncogenic roles of miR-221 and miR-222 microRNAs are reported in several types of human cancers. A previous study suggested their oncogenic role in invasiveness in lung cancer, albeit only one cell line (H460) was used. To further evaluate involvement of miR-221 and miR-222 in lung cancer, we investigated the effects of miR-221 and miR-222 overexpression on six lung cancer cell lines, including H460, as well as one immortalized normal human bronchial epithelial cell line, HBEC4. miR-221 and miR-222 induced epithelial-to-mesenchymal transition (EMT)-like changes in a minority of HBEC4 cells but, unexpectedly, both the microRNAs rather suppressed their invasiveness. Consistent with the prior report, miR-221 and miR-222 promoted growth in H460; however, miR-221 suppressed growth in four other cell lines with no effects in one, and miR-222 suppressed growth in three cell lines but promoted growth in two. These are the first results to show tumor-suppressive effects of miR-221 and miR-222 in lung cancer cells, and we focused on clarifying the mechanisms. Cell cycle and apoptosis analyses revealed that growth suppression by miR-221 and miR-222 occurred through intra-S-phase arrest and/or apoptosis. Finally, lung cancer cell lines transfected with miR-221 or miR-222 became more sensitive to the S-phase targeting drugs, possibly due to an increased S-phase population. In conclusion, our data are the first to show tumor-suppressive effects of miR-221 and miR-222 on lung cancer, warranting testing their potential as therapeutics for the disease
Effects of Monoclonal Antibody Cetuximab on Proliferation of Non-small Cell Lung Cancer Cell lines
Directory of Open Access Journals (Sweden)
Zhen CHEN
2010-08-01
Full Text Available Background and objective The epidermal growth factor receptor (EGFR monoclonal antibody cetuximab has been used widely in non-small cell lung cancer patients. The aim of this study is to explore the effect of lung cancer cells (A549, H460, H1299, SPC-A-1 which were treated by cetuximab in vitro. Methods We studied the effects of increasing concentrations of cetuximab (1 nmol/L-625 nmol/L in four human lung cancer cell lines (A549, SPC-A-1, H460, H1229. CCK8 measured the inhibition of cell proliferation in each group. A549, SPC-A-1 were marked by PI and the statuses of apoptosis were observed. Western blot were used to detect the proliferation-related signaling protein and apoptosis-related protein in A549. Results The treatment with cetuximab resulted in the effect on cell proliferation and apoptosis in a time- and dosedependent manner. The expression of activated key enzymes (p-AKT, p-EGFR, p-MAPK in EGFR signaling transduction pathway were down-regulated more obviously. Conclusion Cetuximab is an effective targeted drug in the treatment of lung cancer cell lines, tissues, most likely to contribute to the inhibition of key enzymes in EGFR signaling transduction pathway.
Discrepancy of biologic behavior influenced by bone marrow derived cells in lung cancer.
Zhang, Jie; Niu, Xiao-Min; Liao, Mei-Lin; Liu, Yun; Sha, Hui-Fang; Zhao, Yi; Yu, Yong-Feng; Tan, Qiang; Xiang, Jia-Qing; Fang, Jing; Lv, Dan-Dan; Li, Xue-Bing; Lu, Shun; Chen, Hai-Quan
2010-11-01
Disseminated cancer cells may initially require local nutrients and growth factors to thrive and survive in bone marrow. However, data on the influence of bone marrow derived cells (BMDC, also called bone stromal cells in some publications) on lung cancer cells is largely unexplored. This study explored the mechanism of how bone stromal factors contribute to the bone tropism in lung cancer. The difference among lung cancer cell lines in their abilities to metastasize to bone was found using the SCID animal model. Supernatant of bone marrow aspiration (BM) and condition medium from human bone stromal cells (BSC) were used to study the activity of bone stromal factors. We found bone stromal factors significantly increased the proliferation, invasion, adhesion and expression of angiogenosis-related factors, and inhibited the apoptosis for high bone metastasis H460 lung cancer cells. These biologic effects were not seen in SPC-A1 or A549 cells, which are low bone metastasis lung cancer cells. Adhesion of H460 cells to surface coated with bone stromal cells can activate some signal transduction pathways, and alter the expression of adhesion associated factors, including integrin β 3 and ADAMTS-1, two potential targets related with bone metastasis. We concluded that bone marrow derived cells had a profound effect on biological behavior of lung cancers, therefore favoring the growth of lung cancer cells in bone.
International Nuclear Information System (INIS)
Ji Xiaoqin; Ji Jiang; Chen Yongbing; Shan Fang; Lu Xueguan
2014-01-01
Objective: To investigate the effect of human lung cancer-associated fibroblasts (CAF) on the radiosensitivity of lung cancer cells when CAF is placed in direct contact co-culture with lung cancer cells. Methods: Human lung CAF was obtained from fresh human lung adenocarcinoma tissue specimens by primary culture and subculture and was then identified by immunofluorescence staining. The CAF was placed in direct contact co-culture with lung cancer A 549 and H 1299 cells, and the effects of CAF on the radiosensitivity of A 549 and H 1299 cells were evaluated by colony-forming assay. Results: The human lung CAF obtained by adherent culture could stably grow and proliferate, and it had specific expression of α-smooth muscle actin, vimentin, and fibroblast activation protein,but without expression of cytokeratin-18. The plating efficiency (PE, %) of A 549 cells at 0 Gy irradiation was (20.0 ± 3.9)% when cultured alone versus (32.3 ± 5.5)% when co-cultured with CAF (t=3.16, P<0.05), and the PE of H 1299 cells at 0 Gy irradiation was (20.6 ± 3.1)% when cultured alone versus (35.2 ± 2.3)% when co-cultured with CAF (t=6.55, P<0.05). The cell survival rate at 2 Gy irradiation (SF 2 ) of A 549 cells was 0.727 ±0.061 when cultured alone versus 0.782 ± 0.089 when co-cultured with CAF (t=0.88, P>0.05), and the SF 2 of H 1299 cells was 0.692 ±0.065 when cultured alone versus 0.782 ± 0.037 when co-cultured with CAF (t=2.08, P>0.05). The protection enhancement ratios of human lung CAF for A 549 cells and H 1299 cells were 1.29 and 1.25, respectively. Conclusions: Human lung CAF reduces the radiosensitivity of lung cancer cells when placed in direct contact co-culture with them, and the radioprotective effect may be attributed to CAF promoting the proliferation of lung cancer cells. (authors)
42 CFR 460.182 - Medicaid payment.
2010-10-01
... 42 Public Health 4 2010-10-01 2010-10-01 false Medicaid payment. 460.182 Section 460.182 Public Health CENTERS FOR MEDICARE & MEDICAID SERVICES, DEPARTMENT OF HEALTH AND HUMAN SERVICES (CONTINUED...) Payment § 460.182 Medicaid payment. (a) Under a PACE program agreement, the State administering agency...
Directory of Open Access Journals (Sweden)
Lingling Tang
2018-02-01
Full Text Available Lung squamous cell carcinoma (LSCC is a common histological lung cancer subtype, but unlike lung adenocarcinoma, limited therapeutic options are available for treatment. Curcumin, a natural compound, may have anticancer effects in various cancer cells, but how it may be used to treat LSCC has not been well studied. Here, we applied curcumin to a human NCI-H292 LSCC cell line to test anticancer effects and explored underlying potential mechanisms of action. Curcumin treatment inhibited NCI-H292 cell growth and increased FOXA2 expression in a time-dependent manner. FOXA2 expression was decreased in LSCC tissues compared with adjacent normal tissues and knockdown of FOXA2 increased NCI-H292 cells proliferation. Inhibition of cell proliferation by curcumin was attenuated by FOXA2 knockdown. Moreover inhibition of STAT3 pathways by curcumin increased FOXA2 expression in NCI-H292 cells whereas a STAT3 activator (IL-6 significantly inhibited curcumin-induced FOXA2 expression. Also, SOCS1 and SOCS3, negative regulators of STAT3 activity, were upregulated by curcumin treatment. Thus, curcumin inhibited human NCI-H292 cells growth by increasing FOXA2 expression via regulation of STAT3 signaling pathways.
Detection of Apoptosis and Necrosis in Normal Human Lung Cells Using 1H NMR Spectroscopy
Shih, Chwen-Ming; Ko, Wun-Chang; Yang, Liang-Yo; Lin, Chien-Ju; Wu, Jui-Sheng; Lo, Tsui-Yun; Wang, Shwu-Huey; Chen, Chien-Tsu
2005-05-01
This study aimed to detect apoptosis and necrosis in MRC-5, a normal human lung cell line, by using noninvasive proton nuclear magnetic resonance (1H NMR). Live MRC-5 cells were processed first for 1H NMR spectroscopy; subsequently their types and the percentage of cell death were assessed on a flow cytometer. Cadmium (Cd) and mercury (Hg) induced apoptosis and necrosis in MRC-5 cells, respectively, as revealed by phosphatidylserine externalization on a flow cytometer. The spectral intensity ratio of methylene (CH2) resonance (at 1.3 ppm) to methyl (CH3) resonance (at 0.9 ppm) was directly proportional to the percentage of apoptosis and strongly and positively correlated with PI staining after Cd treatment (r2 = 0.9868, P In contrast, this ratio only increased slightly within 2-h Hg treatment, and longer Hg exposure failed to produce further increase. Following 2-h Hg exposure, the spectral intensity of choline resonance (at 3.2 ppm) was abolished, but this phenomenon was absent in Cd-induced apoptosis. These findings together demonstrate that 1H NMR is a novel tool with a quantitative potential to distinguish apoptosis from necrosis as early as the onset of cell death in normal human lung cells.
Effect of increases in lung volume on clearance of aerosolized solute from human lungs
Energy Technology Data Exchange (ETDEWEB)
Marks, J.D.; Luce, J.M.; Lazar, N.M.; Wu, J.N.; Lipavsky, A.; Murray, J.F.
1985-10-01
To study the effect of increases in lung volume on solute uptake, we measured clearance of /sup 99m/Tc-diethylenetriaminepentaacetic acid (Tc-DTPA) at different lung volumes in 19 healthy humans. Seven subjects inhaled aerosols (1 micron activity median aerodynamic diam) at ambient pressure; clearance and functional residual capacity (FRC) were measured at ambient pressure (control) and at increased lung volume produced by positive pressure (12 cmH2O continuous positive airway pressure (CPAP)) or negative pressure (voluntary breathing). Six different subjects inhaled aerosol at ambient pressure; clearance and FRC were measured at ambient pressure and CPAP of 6, 12, and 18 cmH2O pressure. Six additional subjects inhaled aerosol at ambient pressure or at CPAP of 12 cmH2O; clearance and FRC were determined at CPAP of 12 cmH2O. According to the results, Tc-DTPA clearance from human lungs is accelerated exponentially by increases in lung volume, this effect occurs whether lung volume is increased by positive or negative pressure breathing, and the effect is the same whether lung volume is increased during or after aerosol administration. The effect of lung volume must be recognized when interpreting the results of this method.
Effect of increases in lung volume on clearance of aerosolized solute from human lungs
International Nuclear Information System (INIS)
Marks, J.D.; Luce, J.M.; Lazar, N.M.; Wu, J.N.; Lipavsky, A.; Murray, J.F.
1985-01-01
To study the effect of increases in lung volume on solute uptake, we measured clearance of /sup 99m/Tc-diethylenetriaminepentaacetic acid (Tc-DTPA) at different lung volumes in 19 healthy humans. Seven subjects inhaled aerosols (1 micron activity median aerodynamic diam) at ambient pressure; clearance and functional residual capacity (FRC) were measured at ambient pressure (control) and at increased lung volume produced by positive pressure [12 cmH 2 O continuous positive airway pressure (CPAP)] or negative pressure (voluntary breathing). Six different subjects inhaled aerosol at ambient pressure; clearance and FRC were measured at ambient pressure and CPAP of 6, 12, and 18 cmH 2 O pressure. Six additional subjects inhaled aerosol at ambient pressure or at CPAP of 12 cmH 2 O; clearance and FRC were determined at CPAP of 12 cmH 2 O. According to the results, Tc-DTPA clearance from human lungs is accelerated exponentially by increases in lung volume, this effect occurs whether lung volume is increased by positive or negative pressure breathing, and the effect is the same whether lung volume is increased during or after aerosol administration. The effect of lung volume must be recognized when interpreting the results of this method
Pongjit, Kanittha; Chanvorachote, Pithi
2011-12-01
Caveolin-1 (Cav-1) expression frequently found in lung cancer was linked with disease prognosis and progression. This study reveals for the first time that Cav-1 sensitizes cisplatin-induced lung carcinoma cell death by the mechanism involving oxidative stress modulation. We established stable Cav-1 overexpressed (H460/Cav-1) cells and investigated their cisplatin susceptibility in comparison with control-transfected cells and found that Cav-1 expression significantly enhanced cisplatin-mediated cell death. Results indicated that the different response to cisplatin between these cells was resulted from different level of superoxide anion induced by cisplatin. Inhibitory study revealed that superoxide anion inhibitor MnTBAP could inhibit cisplatin-mediated toxicity only in H460/Cav-1 cells while had no effect on H460 cells. Further, superoxide anion detected by DHE probe indicated that H460/Cav-1 cells generated significantly higher superoxide anion level in response to cisplatin than that of control cells. The role of Cav-1 in regulating cisplatin sensitivity was confirmed in shRNA-mediated Cav-1 down-regulated (H460/shCav-1) cells and the cells exhibited decreased cisplatin susceptibility and superoxide generation. In summary, these findings reveal novel aspects regarding role of Cav-1 in modulating oxidative stress induced by cisplatin, possibly providing new insights for cancer biology and cisplatin-based chemotherapy.
International Nuclear Information System (INIS)
Rathos, Maggie J; Khanwalkar, Harshal; Joshi, Kavita; Manohar, Sonal M; Joshi, Kalpana S
2013-01-01
In the present study, we show that the combination of doxorubicin with the cyclin-dependent kinase inhibitor P276-00 was synergistic at suboptimal doses in the non-small cell lung carcinoma (NSCLC) cell lines and induces extensive apoptosis than either drug alone in H-460 human NSCLC cells. Synergistic effects of P276-00 and doxorubicin on growth inhibition was studied using the Propidium Iodide (PI) assay. The doses showing the best synergistic effect was determined and these doses were used for further mechanistic studies such as western blotting, cell cycle analysis and RT-PCR. The in vivo efficacy of the combination was evaluated using the H-460 xenograft model. The combination of 100 nM doxorubicin followed by 1200 nM P276-00 showed synergistic effect in the p53-positive and p53-mutated cell lines H-460 and H23 respectively as compared to the p53-null cell line H1299. Abrogation of doxorubicin-induced G2/M arrest and induction of apoptosis was observed in the combination treatment. This was associated with induction of tumor suppressor protein p53 and reduction of anti-apoptotic protein Bcl-2. Furthermore, doxorubicin alone greatly induced COX-2, a NF-κB target and Cdk-1, a target of P276-00, which was downregulated by P276-00 in the combination. Doxorubicin when combined with P276-00 in a sequence-specific manner significantly inhibited tumor growth, compared with either doxorubicin or P276-00 alone in H-460 xenograft model. These findings suggest that this combination may increase the therapeutic index over doxorubicin alone and reduce systemic toxicity of doxorubicin most likely via an inhibition of doxorubicin-induced chemoresistance involving NF-κB signaling and inhibition of Cdk-1 which is involved in cell cycle progression
International Nuclear Information System (INIS)
Cho, Christina; Horzempa, Carol; Jones, David; McKeown-Longo, Paula J.
2016-01-01
Fibronectin is a mechanically sensitive protein which is organized in the extracellular matrix as a network of interacting fibrils. The lung tumor stroma is enriched for fibronectin which is thought to contribute to metastasis and drug resistance. Fibronectin is an elastic, multi-modular protein made up of individually folded domains, some of which can stretch in response to increased mechanical tension. Very little is known about the relationship of fibronectin’s unfolded domains to lung cancer resistance to chemotherapy. In the present study, we evaluated the impact of unfolding the first Type III domain of fibronectin (FnIII-1c) on TNF-related apoptosis inducing ligand (TRAIL) resistance. NCI-H460 non-small cell lung cancer cells were treated with FnIII-1c then assessed for TRAIL-induced apoptosis. Subsequent analysis of FnIII-1c-mediated signaling pathways was also completed. Human non-small cell lung cancer tissue sections were assessed for the expression of vitronectin by immunohistochemistry. FnIII-1c inhibited TRAIL-induced activation of caspase 8 and subsequent apoptosis in NCI-H460 lung cancer cells. FnIII-1c treatment was associated with the activation of the phosphatidylinositol-3-kinase/alpha serine/threonine kinase (PI3K/Akt) pathway and the αvβ5 integrin receptor for vitronectin, both of which were required for TRAIL resistance. Immunohistochemical staining of sections from non-small cell lung cancers showed that vitronectin was localized around blood vessels and in the tumor-stroma interface. Unfolding of Type III domains within the fibronectin matrix may promote TRAIL resistance through the activation of a PI3K/Akt/αvβ5 signaling axis and point to a novel mechanism by which changes in secondary structure of fibronectin contribute to cancer cell resistance to apoptosis
42 CFR 460.98 - Service delivery.
2010-10-01
... 42 Public Health 4 2010-10-01 2010-10-01 false Service delivery. 460.98 Section 460.98 Public Health CENTERS FOR MEDICARE & MEDICAID SERVICES, DEPARTMENT OF HEALTH AND HUMAN SERVICES (CONTINUED..., national origin, religion, sex, age, sexual orientation, mental or physical disability, or source of...
Radiosensitization of C225 on human non-small cell lung cancer cell line H-520
International Nuclear Information System (INIS)
Zhang Yingdong; Wang Junjie; Liu Feng; Zhao Yong
2008-01-01
Objective: To investigate the efficacy of C225 (cetuximab), a chimeric human-mouse anti-epithelial growth factor receptor monoclonal antibody, combined with 60 Co gamma irradiation against human non-small cell lung cancer cell line H-520. Methods: H-520 cells were treated either with different dose of 60 Co irradiation (1,2,4,6,8 and 10 Gy)alone or together with C225 (100 nmol/L). Colony forming capacity was determined to create the survival curve 10 days after the treatment. Cells in different groups were harvested 72 hours after irradiation for apoptosis analysis or 48 hours after irradiation for cell cycle analysis by flow cytometry assay. Results: The clone number in combinational treatment group was less than that in irradiation only group, which suggested that the cell survival rate in the combinational treatment group was significantly decreased comparing with irradiation only group (F=6.36, P O + G 1 phases for C225 treatment, in G 2 + M phases for 60 Co irradiation, and in both G 0 + G 1 and G 2 + M phases for C225 in combination with 60 Co irradiation. Conclusions: C225 has radiosensitizing effects on H-520 cells, which may through the enhancement of 60 Co irradiation-induced cell death and cell cycle arrest. This study provides a supportive evidence for clinical treatment in non-small cell lung cancer. (authors)
Autoradiographic visualization of muscarinic receptor subtypes in human and guinea pig lung
International Nuclear Information System (INIS)
Mak, J.C.; Barnes, P.J.
1990-01-01
Muscarinic receptor subtypes have been localized in human and guinea pig lung sections by an autoradiographic technique, using [3H](-)quinuclidinyl benzilate [( 3H]QNB) and selective muscarinic antagonists. [3H]QNB was incubated with tissue sections for 90 min at 25 degrees C, and nonspecific binding was determined by incubating adjacent serial sections in the presence of 1 microM atropine. Binding to lung sections had the characterization expected for muscarinic receptors. Autoradiography revealed that muscarinic receptors were widely distributed in human lung, with dense labeling over submucosal glands and airway ganglia, and moderate labeling over nerves in intrapulmonary bronchi and of airway smooth muscle of large and small airways. In addition, alveolar walls were uniformly labeled. In guinea pig lung, labeling of airway smooth muscle was similar, but in contrast to human airways, epithelium was labeled but alveolar walls were not. The muscarinic receptors of human airway smooth muscle from large to small airways were entirely of the M3-subtype, whereas in guinea pig airway smooth muscle, the majority were the M3-subtype with a very small population of the M2-subtype present. In human bronchial submucosal glands, M1- and M3-subtypes appeared to coexist in the proportions of 36 and 64%, respectively. In human alveolar walls the muscarinic receptors were entirely of the M1-subtype, which is absent from the guinea pig lung. No M2-receptors were demonstrated in human lung. The localization of M1-receptors was confirmed by direct labeling with [3H]pirenzepine. With the exception of the alveolar walls in human lung, the localization of muscarinic receptor subtypes on structures in the lung is consistent with known functional studies
International Nuclear Information System (INIS)
Kubota, Tetsuro; Nakamura, Kayoko; Kubo, Atsushi; Hashimoto, Shozo; Watanabe, Masahiko; Ishibiki, Kyuya; Abe, Osahiko
1989-01-01
NCC-ST-433 monoclonal antibody raised against human gastric carcinoma xenograft (St-4) was labeled with l25 I using enzymatic and Iodogen methods. While labeling efficiency of the antibody was more excellent by enzymatic method, specific radioactivity of the antibody labeled by Iodogen method was higher than that by enzymatic method. The labeled antibody was stable in vitro and in vivo, and the labeled NCC-ST-433 was specifically accumulated in NCC-ST-433 antigen positive human tumor cell lines in vitro. The specificity of 125 I-NCC-ST-433 in vivo was found to be more excellent when this antibody was labeled by Iodogen method and acutually excellent images of H-69, a human small cell lung carcioma, were obtained 5 days after injection of 7 μg of 125 I-NCC-ST-433 per mouse. This method seemed to be promising for imaging human lung small cell carcinoma. (author)
International Nuclear Information System (INIS)
Toulany, Mahmoud; Mihatsch, Julia; Holler, Marina; Chaachouay, Hassan; Rodemann, H. Peter
2014-01-01
Background and purpose: Cisplatin activates ataxia-telangiectasia-mutated (ATM), a protein with roles in DNA repair, cell cycle progression and autophagy. We investigated the radiosensitizing effect of cisplatin with respect to its effect on ATM pathway activation. Material and methods: Non-small cell lung cancer cells (NSCLC) cell lines (A549, H460) and human fibroblast (ATM-deficient AT5, ATM-proficient 1BR3) cells were used. The effects of cisplatin combined with irradiation on ATM pathway activity, clonogenicity, DNA double-strand break (DNA-DSB) repair and cell cycle progression were analyzed with Western blotting, colony formation and γ-H2AX foci assays as well as FACS analysis, respectively. Results: Cisplatin radiosensitized H460 cells, but not A549 cells. Radiosensitization of H460 cells was not due to impaired DNA-DSB repair, increased apoptosis or cell cycle dysregulation. The lack of radiosensitization demonstrated for A549 cells was associated with cisplatin-mediated stimulation of ATM (S1981) and AMPKα (T172) phosphorylation and autophagy. However, in both cell lines inhibition of ATM and autophagy by KU-55933 and chloroquine diphosphate (CQ) respectively resulted in a significant radiosensitization. Combined treatment with the AMPK inhibitor compound-C led to radiosensitization of A549 but not of H460 cells. As compared to the treatment with KU-55933 alone, radiosensitivity of A549 cells was markedly stimulated by the combination of KU-55933 and cisplatin. However, the combination of CQ and cisplatin did not modulate the pattern of radiation sensitivity of A549 or H460 cells. In accordance with the results that cisplatin via stimulation of ATM activity can abrogate its radiosensitizing effect, ATM deficient cells were significantly sensitized to ionizing radiation by cisplatin. Conclusion: The results obtained indicate that ATM targeting can potentiate cisplatin-induced radiosensitization
Ke, Mengyun; Wang, Hui; Zhang, Min; Tian, Yuwei; Wang, Yizhou; Li, Bing; Yu, Jie; Dou, Jie; Xi, Tao; Zhou, Changlin
2014-05-01
Strongylocentrotus nudus egg polysaccharide (SEP) has been reported to display antitumor activity. However, the effects of SEP and its underlying mechanism in the treatment of lung cancer remain unclear, particularly with an immunodeficient mouse model of human non-small cell lung cancer (NSCLC). In the present study, we investigated the anti-lung cancer effects of SEP and its underlying mechanism of action in both Lewis lung cancer (LLC)-bearing C57/BL6J mice and human NSCLC H460-bearing nude mice. Although SEP showed no inhibitory effects on tumor cells in vitro, it markedly stimulated the percentage of CD3-NK1.1(+) cells and natural killer (NK) cell cytotoxicity in the spleens of nude mice and C57/BL6J mice. In LLC-bearing mice, SEP not only inhibited tumor growth but also promoted NK-mediated cytotoxicity, the NK1.1(+) cell population, and IL-2 and IFN-γ secretion. SEP significantly suppressed H460 growth in nude mice, which was abrogated by the selective depletion of NK cells via the intraperitoneal injection of anti-asialo GM-1 antibodies. Furthermore, anti-TLR2/4 antibodies blocked both SEP and NK cell binding and SEP-induced perforin secretion. SEP-induced proliferation and IFN-γ secretion by NK cells in wild type mice were partially impaired in TLR2 or TLR4 knockout mice. These results suggest that SEP-promoted NK cytotoxicity, which was partially mediated via TLR2 and TLR4, was the main contributing factor to lung cancer inhibition in vivo and that SEP may be a potential immunotherapy candidate for the treatment of lung cancer. Copyright © 2014 Elsevier Inc. All rights reserved.
Effect of Flavopiridol on Radiation-induced Apoptosis of Human Laryngeal and Lung Cancer Cells
International Nuclear Information System (INIS)
Kim, Suzy; Kwon, Eun Kyung; Lee, B. S.; Lee, Seung Hee; Park, B. S.; Wu, Hong Gyun
2007-01-01
Purpose: To investigate the flavopiridol effect on radiation-induced apoptosis and expression of apoptosisrelated genes of human laryngeal and lung cancer cells. Materials and Methods: A human laryngeal cancer cell line, AMC-HN3 and a human lung cancer cell line, NCI-H460, were used in the study. The cells were divided into four groups according to the type of treatment: 1) control groups; 2) cells that were only irradiated; 3) cells treated only with flavopiridol; 4) cells treated with flavopiridol and radiation simultaneously. The cells were irradiated with 10 Gy of X-rays using a 4 MV linear accelerator. Flavopiridol was administered to the media at a concentration of 100 nM for 24 hours. We compared the fraction of apoptotic cells of each group 24 hours after the initiation of treatment. The fraction of apoptotic cells was detected by measurement of the sub-G1 fractions from a flow cytometric analysis. The expression of apoptosis-regulating genes, including cleaved caspase-3, cleaved PARP (poly (ADP-ribose) polymerase), p53, p21, cyclin D1, and phosphorylated Akt (protein kinase B) were analyzed by Western blotting. Results: The sub-G1 fraction of cells was significantly increased in the combination treatment group, as compared to cells exposed to radiation alone or flavopiridol alone. Western blotting also showed an increased expression of cleaved caspase-3 and cleaved PARP expression in cells of the combination treatment group, as compared with cells exposed to radiation alone or flavopiridol alone. Treatment with flavopiridol down regulated cyclin D1 expression of both cell lines but its effect on p53 and p21 expression was different according to each individual cell line. Flavopiridol did not affect the expression of phophorylated Akt in both cell lines. Conclusion: Treatment with flavopiridol increased radiation-induced apoptosis of both the human laryngeal and lung cancer cell lines. Flavopiridol effects on p53 and p21 expression were different according
Wang, Jiarui; Zhang, Jinhui; Zhang, Lichuan; Zhao, Long; Fan, Sufang; Yang, Zhonghai; Gao, Fei; Kong, Ying; Xiao, Gary Guishan; Wang, Qi
2011-11-01
This study aimed to determine the relationship between the endogenous levels of P-glycoprotein (P-gp), multidrug resistance-associated protein (MRP), lung resistance-related protein (LRP), glutathione-s-transferase-π (GST‑π) and topoisomerase IIα (TopoIIα) and intrinsic drug resistance in four human lung cancer cell lines, SK-MES-1, SPCA-1, NCI-H-460 and NCI-H-446, of different histological types. The expression of P-gp, MRP, LRP, GST-π and TopoIIα was measured by immunofluorescence, Western blotting and RT-PCR. Drug resistance to cisplatin, doxorubicin and VP-16 was determined using MTT assays. The correlation between expression of the resistance-related proteins and their roles in the resistance to drugs in these cancer cell lines was analyzed. We found that the endogenous levels of P-gp, MRP, LRP, GST-π and TopoIIα in the four cell lines varied. The level of GST-π in the SK-MES-1 cells was the highest, whereas the level of P-gp in the SPCA-1 cells was the lowest. The chemoresistance to cisplatin, doxorubicin and VP-16 in the four cell lines was different. The SPCA-1 cell line was most resistance to cisplatin; SK-MES-1 was most resistance to VP-16; whereas SK-MES-1 was most sensitive to doxorubicin. There was a positive correlation between GST-π expression and resistance to cisplatin, between TopoIIα expression and resistance to VP-16; and a negative correlation was noted between TopoIIα expression and resistance to doxorubicin. In summary, the endogenous expression of P-gp, MRP, LRP, GST-π and TopoIIα was different in the four human lung cancer cell lines of different histological types, and this variance may be associated with the variation in chemosensitivity to cisplatin, doxorubicin and VP-16. Among the related proteins, GST-π may be useful for the prediction of the intrinsic resistance to cisplatin, whereas TopoIIα may be useful to predict resistance to doxorubicin and VP-16 in human lung cancer cell lines.
42 CFR 460.90 - PACE benefits under Medicare and Medicaid.
2010-10-01
... 42 Public Health 4 2010-10-01 2010-10-01 false PACE benefits under Medicare and Medicaid. 460.90 Section 460.90 Public Health CENTERS FOR MEDICARE & MEDICAID SERVICES, DEPARTMENT OF HEALTH AND HUMAN... FOR THE ELDERLY (PACE) PACE Services § 460.90 PACE benefits under Medicare and Medicaid. If a Medicare...
Directory of Open Access Journals (Sweden)
Xiaolin He
Full Text Available BACKGROUND: Interaction between the coagulation and inflammation systems plays an important role in the development of acute respiratory distress syndrome (ARDS. Anti-coagulation is an attractive option for ARDS treatment, and this has promoted development of new antibodies. However, preclinical trials for these antibodies are often limited by the high cost and availability of non-human primates. In the present study, we developed a novel alternative method to test the role of a humanized anti-tissue factor mAb in acute lung injury with transgenic mice. METHODOLOGY/PRINCIPAL FINDINGS: Human tissue factor knock-in (hTF-KI transgenic mice and a novel humanized anti-human tissue factor mAb (anti-hTF mAb, CNTO859 were developed. The hTF-KI mice showed a normal and functional expression of hTF. The anti-hTF mAb specifically blocked the pro-coagulation activity of brain extracts from the hTF-KI mice and human, but not from wild type mice. An extrapulmonary ARDS model was used by intestinal ischemia-reperfusion. Significant lung tissue damage in hTF-KI mice was observed after 2 h reperfusion. Administration of CNTO859 (5 mg/kg, i.v. attenuated the severity of lung tissue injury, decreased the total cell counts and protein concentration in bronchoalveolar lavage fluid, and reduced Evans blue leakage. In addition, the treatment significantly reduced alveolar fibrin deposition, and decreased tissue factor and plasminogen activator inhibitor-1 activity in the serum. This treatment also down-regulated cytokine expression and reduced cell death in the lung. CONCLUSIONS: This novel anti-hTF antibody showed beneficial effects on intestinal ischemia-reperfusion induced acute lung injury, which merits further investigation for clinical usage. In addition, the use of knock-in transgenic mice to test the efficacy of antibodies against human-specific proteins is a novel strategy for preclinical studies.
Iso-suillin from Suillus flavus Induces Apoptosis in Human Small Cell Lung Cancer H446 Cell Line.
Zhao, Jun-Xia; Zhang, Qing-Shuang; Chen, Ying; Yao, Sheng-Jie; Yan, Yong-Xin; Wang, Ying; Zhang, Jin-Xiu; Wang, Li-An
2016-05-20
The suillin isoform iso-suillin is a natural substance isolated from a petroleum ether extract of the fruiting bodies of the mushroom Suillus flavus. Previous studies have found its inhibition effect on some cancer cells, and we aimed to study its effects on human small cell lung cancer H446 cell line. Cell viability was measured by 3-(4,5-dimethyl-2-thiazolyl)-2,5-diphenyl-2-H-tetrazolium bromide assay. Cellular morphological changes (apoptosis and necrosis) were evaluated using an electron microscope and Hoechst 33258 staining detected by the inverted microscope. Flow cytometry was used to detect cell apoptosis, cell cycle distribution, and mitochondrial membrane potential. Protein expression was determined by Western blotting analysis. Here, we describe the ability of iso-suillin to inhibit the growth of H446 cells in time- and dose-dependent way. Iso-suillin had no obvious impact on normal human lymphocyte proliferation at low concentrations (9.09, 18.17, or 36.35 μmol/L) but promoted lymphocyte proliferation at a high concentration (72.70 μmol/L). After treatment of different concentrations of iso-suillin (6.82, 13.63, or 20.45 μmol/L), the apoptosis rate of H446 cells increased with increasing concentrations of iso-suillin (16.70%, 35.54%, and 49.20%, respectively, all P iso-suillin could induce H446 cell apoptosis through the mitochondrial pathway and the death-receptor pathway. Therefore, iso-suillin might have a potential application as a novel drug for lung cancer treatment.
Energy Technology Data Exchange (ETDEWEB)
Sun, Haiyan; Kamkaew, Anyanee; Jiang, Dawei; Yang, Yunan [University of Wisconsin-Madison, Department of Radiology, Madison, WI (United States); England, Christopher G.; Hernandez, Reinier; Graves, Stephen A.; Barnhart, Todd E. [University of Wisconsin-Madison, Department of Medical Physics, Madison, WI (United States); Majewski, Rebecca L. [University of Wisconsin-Madison, Department of Biomedical Engineering, Madison, WI (United States); Cai, Weibo [University of Wisconsin-Madison, Department of Radiology, Madison, WI (United States); University of Wisconsin-Madison, Department of Medical Physics, Madison, WI (United States); University of Wisconsin-Madison, Department of Biomedical Engineering, Madison, WI (United States); University of Wisconsin Carbone Cancer Center, Madison, WI (United States)
2016-11-15
Overexpression of CD146 in solid tumors has been linked to disease progression, invasion, and metastasis. We describe the generation of a {sup 64}Cu-labeled CD146-specific antibody and its use for quantitative immunoPET imaging of CD146 expression in six lung cancer models. The anti-CD146 antibody (YY146) was conjugated to 1,4,7-triazacyclononane-triacetic acid (NOTA) and radiolabeled with {sup 64}Cu. CD146 expression was evaluated in six human lung cancer cell lines (A549, NCI-H358, NCI-H522, HCC4006, H23, and NCI-H460) by flow cytometry and quantitative western blot studies. The biodistribution and tumor uptake of {sup 64}Cu-NOTA-YY146 was assessed by sequential PET imaging in athymic nude mice bearing subcutaneous lung cancer xenografts. The correlation between CD146 expression and tumor uptake of {sup 64}Cu-NOTA-YY146 was evaluated by graphical software while ex vivo biodistribution and immunohistochemistry studies were performed to validate the accuracy of PET data and spatial expression of CD146. Flow cytometry and western blot studies showed similar findings with H460 and H23 cells showing high levels of expression of CD146. Small differences in CD146 expression levels were found among A549, H4006, H522, and H358 cells. Tumor uptake of {sup 64}Cu-NOTA-YY146 was highest in CD146-expressing H460 and H23 tumors, peaking at 20.1 ± 2.86 and 11.6 ± 2.34 %ID/g at 48 h after injection (n = 4). Tumor uptake was lowest in the H522 model (4.1 ± 0.98 %ID/g at 48 h after injection; n = 4), while H4006, A549 and H358 exhibited similar uptake of {sup 64}Cu-NOTA-YY146. A positive correlation was found between tumor uptake of {sup 64}Cu-NOTA-YY146 (%ID/g) and relative CD146 expression (r {sup 2} = 0.98, p < 0.01). Ex vivo biodistribution confirmed the accuracy of the PET data. The strong correlation between tumor uptake of {sup 64}Cu-NOTA-YY146 and CD146 expression demonstrates the potential use of this radiotracer for imaging tumors that elicit varying levels of CD146
Directory of Open Access Journals (Sweden)
Chon-Kit Chou
2018-06-01
Full Text Available Unfolded protein response (UPR is a cytoprotective mechanism that alleviates the protein-folding burden in eukaryotic organisms. Moderate activation of UPR is required for maintaining endoplasmic reticulum (ER homeostasis and profoundly contributes to tumorigenesis. Defects in UPR signaling are implicated in the attenuation of various malignant phenotypes including cell proliferation, migration, and invasion, as well as angiogenesis. This suggests UPR as a promising target in cancer therapy. The pharmacological effects of the plant Scindapsus cf. hederaceus on human cancer cell lines is not understood. In this study, we identified an ethyl acetate extract from Scindapsus cf. hederaceus (SH-EAE, which markedly altered the protein expression of UPR-related genes in human non-small cell lung cancer (NSCLC cells. Treatment with the SH-EAE led to the dose-dependent suppression of colony forming ability of both H1299 and H460 cells, but not markedly in normal bronchial epithelial BEAS-2B cells. SH-EAE treatment also attenuated the migration and invasion ability of H1299 and H460 cells. Moreover, SH-EAE strikingly suppressed the protein expression of two ER stress sensors, including inositol requiring enzyme-1α (IRE-1α and protein kinase R-like ER kinase (PERK, and antagonized the induction of C/EBP homologous protein (CHOP expression by thapsigargin, an ER stress inducer. SH-EAE induced the formation of massive vacuoles which are probably derived from ER. Importantly, SH-EAE impaired the formation of intersegmental vessels (ISV in zebrafish larvae, an index of angiogenesis, but had no apparent effect on the rate of larval development. Together, our findings demonstrate, for the first time, that the ability of SH-EAE specifically targets the two sensors of UPR, with significant anti-proliferation and anti-migration activities as a crude extract in human NSCLC cells. Our finding also indicates potential applications of SH-EAE in preventing UPR
45 CFR 170.460 - Good standing as an ONC-ATCB.
2010-10-01
....460 Public Welfare DEPARTMENT OF HEALTH AND HUMAN SERVICES HEALTH INFORMATION TECHNOLOGY HEALTH INFORMATION TECHNOLOGY STANDARDS, IMPLEMENTATION SPECIFICATIONS, AND CERTIFICATION CRITERIA AND CERTIFICATION PROGRAMS FOR HEALTH INFORMATION TECHNOLOGY Temporary Certification Program for HIT § 170.460 Good standing...
Energy Technology Data Exchange (ETDEWEB)
Brechbuhl, Heather M. [Pediatrics, National Jewish Health, Denver, Colorado (United States); Kachadourian, Remy; Min, Elysia [Department of Medicine, National Jewish Health, Denver, Colorado (United States); Chan, Daniel [Medical Oncology, University of Colorado Denver Health Sciences Center (United States); Day, Brian J., E-mail: dayb@njhealth.org [Department of Medicine, University of Colorado Denver Health Sciences Center (United States); Immunology, University of Colorado Denver Health Sciences Center (United States); Pharmaceutical Sciences, University of Colorado Denver Health Sciences Center (United States); Department of Medicine, National Jewish Health, Denver, Colorado (United States)
2012-01-01
We hypothesized that flavonoid-induced glutathione (GSH) efflux through multi-drug resistance proteins (MRPs) and subsequent intracellular GSH depletion is a viable mechanism to sensitize cancer cells to chemotherapies. This concept was demonstrated using chrysin (5–25 μM) induced GSH efflux in human non-small cell lung cancer lines exposed to the chemotherapeutic agent, doxorubicin (DOX). Treatment with chrysin resulted in significant and sustained intracellular GSH depletion and the GSH enzyme network in the four cancer cell types was predictive of the severity of chrysin induced intracellular GSH depletion. Gene expression data indicated a positive correlation between basal MRP1, MRP3 and MRP5 expression and total GSH efflux before and after chrysin exposure. Co-treating the cells for 72 h with chrysin (5–30 μM) and DOX (0.025–3.0 μM) significantly enhanced the sensitivity of the cells to DOX as compared to 72-hour DOX alone treatment in all four cell lines. The maximum decrease in the IC{sub 50} values of cells treated with DOX alone compared to co-treatment with chrysin and DOX was 43% in A549 cells, 47% in H157 and H1975 cells and 78% in H460 cells. Chrysin worked synergistically with DOX to induce cancer cell death. This approach could allow for use of lower concentrations and/or sensitize cancer cells to drugs that are typically resistant to therapy. -- Graphical abstract: Possible mechanisms by which chrysin enhances doxorubicin-induced toxicity in cancer cells. Highlights: ► Chyrsin sustains a significant depletion of GSH levels in lung cancer cells. ► Chyrsin synergistically potentiates doxorubicin-induced cancer cell cytotoxicity. ► Cancer cell sensitivity correlated with GSH and MRP gene network expression. ► This approach could allow for lower side effects and targeting resistant tumors.
Petpiroon, Nareerat; Sritularak, Boonchoo; Chanvorachote, Pithi
2017-12-29
The conversion of the epithelial phenotype of cancer cells into cells with a mesenchymal phenotype-so-called epithelial-mesenchymal transition (EMT)-has been shown to enhance the capacity of the cells to disseminate throughout the body. EMT is therefore becoming a potential target for anti-cancer drug discovery. Here, we showed that phoyunnanin E, a compound isolated from Dendrobium venustum, possesses anti-migration activity and addressed its mechanism of action. The cytotoxic and proliferative effects of phoyunnanin E on human non-small cell lung cancer-derived H460, H292, and A549 cells and human keratinocyte HaCaT cells were investigated by MTT assay. The effect of phoyunnanin E on EMT was evaluated by determining the colony formation and EMT markers. The migration and invasion of H460, H292, A549 and HaCaT cells was evaluated by wound healing assay and transwell invasion assay, respectively. EMT markers, integrins and migration-associated proteins were examined by western blot analysis. Phoyunnanin E at the concentrations of 5 and 10 μM, which are non-toxic to H460, H292, A549 and HaCaT cells showed good potential to inhibit the migratory activity of three types of human lung cancer cells. The anti-migration effect of phoyunnanin E was shown to relate to the suppressed EMT phenotypes, including growth in anchorage-independent condition, cell motility, and EMT-specific protein markers (N-cadherin, vimentin, slug, and snail). In addition to EMT suppression, we found that phoyunnanin E treatment with 5 and 10 μM could decrease the cellular level of integrin αv and integrin β3, these integrins are frequently up-regulated in highly metastatic tumor cells. We further characterized the regulatory proteins in cell migration and found that the cells treated with phoyunnanin E exhibited a significantly lower level of phosphorylated focal adhesion kinase (p-FAK) and phosphorylated ATP-dependent tyrosine kinase (p-AKT), and their downstream effectors (including
21 CFR 111.460 - What requirements apply to holding in-process material?
2010-04-01
... 21 Food and Drugs 2 2010-04-01 2010-04-01 false What requirements apply to holding in-process material? 111.460 Section 111.460 Food and Drugs FOOD AND DRUG ADMINISTRATION, DEPARTMENT OF HEALTH AND HUMAN SERVICES (CONTINUED) FOOD FOR HUMAN CONSUMPTION CURRENT GOOD MANUFACTURING PRACTICE IN...
Directory of Open Access Journals (Sweden)
Israel L. Medeiros
2012-09-01
Full Text Available OBJECTIVE: Experimental studies on lung preservation have always been performed using animal models. We present ex vivo lung perfusion as a new model for the study of lung preservation. Using human lungs instead of animal models may bring the results of experimental studies closer to what could be expected in clinical practice. METHOD: Brain-dead donors whose lungs had been declined by transplantation teams were used. The cases were randomized into two groups. In Group 1, Perfadex®was used for pulmonary preservation, and in Group 2, LPDnac, a solution manufactured in Brazil, was used. An ex vivo lung perfusion system was used, and the lungs were ventilated and perfused after 10 hours of cold ischemia. The extent of ischemic-reperfusion injury was measured using functional and histological parameters. RESULTS: After reperfusion, the mean oxygenation capacity was 405.3 mmHg in Group 1 and 406.0 mmHg in Group 2 (p = 0.98. The mean pulmonary vascular resistance values were 697.6 and 378.3 dyn·s·cm-5, respectively (p =0.035. The mean pulmonary compliance was 46.8 cm H20 in Group 1 and 49.3 ml/cm H20 in Group 2 (p =0.816. The mean wet/dry weight ratios were 2.06 and 2.02, respectively (p=0.87. The mean Lung Injury Scores for the biopsy performed after reperfusion were 4.37 and 4.37 in Groups 1 and 2, respectively (p = 1.0, and the apoptotic cell counts were 118.75/mm² and 137.50/mm², respectively (p=0.71. CONCLUSION: The locally produced preservation solution proved to be as good as Perfadex®. The clinical use of LPDnac may reduce costs in our centers. Therefore, it is important to develop new models to study lung preservation.
Metabolic profiling of human lung cancer blood plasma using 1H NMR spectroscopy
Kokova, Daria; Dementeva, Natalia; Kotelnikov, Oleg; Ponomaryova, Anastasia; Cherdyntseva, Nadezhda; Kzhyshkowska, Juliya
2017-11-01
Lung cancer (both small cell and non-small cell) is the second most common cancer in both men and women. The article represents results of evaluating of the plasma metabolic profiles of 100 lung cancer patients and 100 controls to investigate significant metabolites using 400 MHz 1H NMR spectrometer. The results of multivariate statistical analysis show that a medium-field NMR spectrometer can obtain the data which are already sufficient for clinical metabolomics.
Multi-Modal Imaging in a Mouse Model of Orthotopic Lung Cancer.
Patel, Priya; Kato, Tatsuya; Ujiie, Hideki; Wada, Hironobu; Lee, Daiyoon; Hu, Hsin-Pei; Hirohashi, Kentaro; Ahn, Jin Young; Zheng, Jinzi; Yasufuku, Kazuhiro
2016-01-01
Investigation of CF800, a novel PEGylated nano-liposomal imaging agent containing indocyanine green (ICG) and iohexol, for real-time near infrared (NIR) fluorescence and computed tomography (CT) image-guided surgery in an orthotopic lung cancer model in nude mice. CF800 was intravenously administered into 13 mice bearing the H460 orthotopic human lung cancer. At 48 h post-injection (peak imaging agent accumulation time point), ex vivo NIR and CT imaging was performed. A clinical NIR imaging system (SPY®, Novadaq) was used to measure fluorescence intensity of tumor and lung. Tumor-to-background-ratios (TBR) were calculated in inflated and deflated states. The mean Hounsfield unit (HU) of lung tumor was quantified using the CT data set and a semi-automated threshold-based method. Histological evaluation using H&E, the macrophage marker F4/80 and the endothelial cell marker CD31, was performed, and compared to the liposomal fluorescence signal obtained from adjacent tissue sections. The fluorescence TBR measured when the lung is in the inflated state (2.0 ± 0.58) was significantly greater than in the deflated state (1.42 ± 0.380 (n = 7, p<0.003). Mean fluorescent signal in tumor was highly variable across samples, (49.0 ± 18.8 AU). CT image analysis revealed greater contrast enhancement in lung tumors (a mean increase of 110 ± 57 HU) when CF800 is administered compared to the no contrast enhanced tumors (p = 0.0002). Preliminary data suggests that the high fluorescence TBR and CT tumor contrast enhancement provided by CF800 may have clinical utility in localization of lung cancer during CT and NIR image-guided surgery.
Directory of Open Access Journals (Sweden)
Leyre Larzabal
Full Text Available Cancer stem cells (CSCs are thought to be responsible for tumor initiation and recurrence after chemotherapy. Targeting CSCs and non-CSCs with specific compounds may be an effective approach to reduce lung cancer growth and metastasis. The aim of this study was to investigate the effect of salinomycin, a selective inhibitor of CSCs, with or without combination with paclitaxel, in a metastatic model. To evaluate the effect of these drugs in metastasis and tumor microenvironment we took advantage of the immunocompetent and highly metastatic LLC mouse model. Aldefluor assays were used to analyze the ALDH+/- populations in murine LLC and human H460 and H1299 lung cancer cells. Salinomycin reduced the proportion of ALDH+ CSCs in LLC cells, whereas paclitaxel increased such population. The same effect was observed for the H460 and H1299 cell lines. Salinomycin reduced the tumorsphere formation capacity of LLC by more than 7-fold, but paclitaxel showed no effect. In in vivo experiments, paclitaxel reduced primary tumor volume but increased the number of metastatic nodules (p<0.05, whereas salinomycin had no effect on primary tumors but reduced lung metastasis (p<0.05. Combination of both drugs did not improve the effect of single therapies. ALDH1A1, SOX2, CXCR4 and SDF-1 mRNA levels were higher in metastatic lesions than in primary tumors, and were significantly elevated in both locations by paclitaxel treatment. On the contrary, such levels were reduced (or in some cases did not change when mice were administered with salinomycin. The number of F4/80+ and CD11b+ cells was also reduced upon administration of both drugs, but particularly in metastasis. These results show that salinomycin targets ALDH+ lung CSCs, which has important therapeutic effects in vivo by reducing metastatic lesions. In contrast, paclitaxel (although reducing primary tumor growth promotes the selection of ALDH+ cells that likely modify the lung microenvironment to foster
Directory of Open Access Journals (Sweden)
Zhang R
2017-09-01
Full Text Available Rongrong Zhang, Yun Ru, Yiping Gao, Jinyin Li, Shilong Mao Department of Pharmacy, Shanghai Xuhui District Central Hospital, Zhongshan Hospital Affiliated to Fudan University Xuhui Hospital, Shanghai, People’s Republic of China Purpose: Cisplatin plus gemcitabine (GEM is a standard regimen for the first-line treatment of advanced non-small cell lung cancer. The aim of this study was to prepare biocompatible and biodegradable polymeric prodrugs and construct nanoparticles (NPs with layer-by-layer (LbL technique. Methods: Platinum (Pt (IV complex with a carboxyl group was conjugated to the amino group of chitosan (CH, resulting in a CH-Pt conjugation with positive charge. GEM with amino group was conjugated to the carboxyl group of hyaluronic acid (HA, resulting in a HA-GEM conjugation with negative charge. Novel LbL NPs consisting of the CH-Pt core and the HA-GEM layer, named as HA-GEM/CH-Pt NPs, were constructed. The physicochemical properties of the HA-GEM/CH-Pt NPs were investigated. In vitro cytotoxicity against human non-small lung cancer cells (NCl-H460 cells was investigated, and in vivo antitumor efficiency was evaluated on mice bearing NCl-H460 cells xenografts. Results: HA-GEM/CH-Pt NPs have a size of about 187 nm, a zeta potential value of -21 mV and high drug encapsulation efficiency of 90%. The drug release of HA-GEM/CH-Pt NPs exhibited a sustained behavior. HA-GEM/CH-Pt NPs could significantly enhance in vitro cytotoxicity and in vivo antitumor effect against lung cancer animal model compared to the single-drug-loaded NPs and free drug solutions. Conclusion: The results demonstrated that the HA-GEM/CH-Pt NPs might be a promising system for the synergetic treatment of lung carcinoma. Keywords: lung cancer, combination chemotherapy, cisplatin, gemcitabine, layer-by-layer technology
Monoclonal Antibody L1Mab-13 Detected Human PD-L1 in Lung Cancers.
Yamada, Shinji; Itai, Shunsuke; Nakamura, Takuro; Yanaka, Miyuki; Chang, Yao-Wen; Suzuki, Hiroyoshi; Kaneko, Mika K; Kato, Yukinari
2018-04-01
Programmed cell death ligand-1 (PD-L1) is a type I transmembrane glycoprotein expressed on antigen-presenting cells. It is also expressed in several tumor cells such as melanoma and lung cancer cells. A strong correlation has been reported between human PD-L1 (hPD-L1) expression in tumor cells and negative prognosis in cancer patients. Here, a novel anti-hPD-L1 monoclonal antibody (mAb) L 1 Mab-13 (IgG 1 , kappa) was produced using a cell-based immunization and screening (CBIS) method. We investigated hPD-L1 expression in lung cancer using flow cytometry, Western blot, and immunohistochemical analyses. L 1 Mab-13 specifically reacted hPD-L1 of hPD-L1-overexpressed Chinese hamster ovary (CHO)-K1 cells and endogenous hPD-L1 of KMST-6 (human fibroblast) in flow cytometry and Western blot. Furthermore, L 1 Mab-13 reacted with lung cancer cell lines (EBC-1, Lu65, and Lu99) in flow cytometry and stained lung cancer tissues in a membrane-staining pattern in immunohistochemical analysis. These results indicate that a novel anti-hPD-L1 mAb, L 1 Mab-13, is very useful for detecting hPD-L1 of lung cancers in flow cytometry, Western blot, and immunohistochemical analyses.
Cannonball lung metastases as a presenting feature of ectopic hCG expression
Directory of Open Access Journals (Sweden)
Rong-Hsin Yang
2016-08-01
Full Text Available Cannonball metastases refer to well-defined spherical nodules scattered over both lungs, being a classical presentation of hematogenous tumor spreading. Striking progression of lung metastases without established primary malignancy can raise a diagnostic challenge. We herein report three cases with cannonball metastases at initial presentation. Two patients ended up having a choriocarcinoma but no awareness of the presence of primary tumors, and the third had abrupt lung metastases of endometrial cancer while she was being asymptomatic. Relentless progression was illustrated by clinical and radiographic changes. Ectopic expression of human chorionic gonadotropin (hCG would seemingly go some way responsible for fulminant cancer spreading associated with poor prognosis in our patients. The goal of this presentation is to raise awareness of ectopic hCG expression in patients presenting with similar astonishing scenarios.
International Nuclear Information System (INIS)
Morales-Morales, Alejo; Duconge, Jorge; Caballero-Torres, Idania; Nunez-Gandolff, Gilda; Fernandez, Eduardo; Iznaga-Escobar, Normando
1999-01-01
The anti-human epidermal growth factor receptor (EGF-R) humanized monoclonal antibody (MAb) h-R3 is an (IgG 1 ), which binds to an extracellular domain of EGF-R. It was used to evaluate the biodistribution on nude mice xenografted with H-125 human lung adenocarcinoma cell line. Results were compared with its murine version of the MAb ior-egf/r3. Twenty-one athymic female 4NMRI nu/nu mice were injected intraperitoneally with 10 μg/100 μCi of 99m Tc-labeled MAbs. Immunoreactivity of 99m Tc-labeled MAbs were measured by enzyme-linked immunosorbent assay (ELISA) on H-125 cell line and the immunoreactive fractions was determined by the Lindmo method. Among all organs, significant accumulation was found in serum (27.05 ± 2.08 %ID/g) and tumor (3.903 ± 0.89 %ID/g) at 4 h after injection. These values decreased to 5.03 ± 0.50 %ID/g and 2.19 ± 0.56 %ID/g for serum and tumor, respectively. The immunoreactive fraction was found to be 0.70, with a correlation coefficient r=0.9984. With the good biodistribution and tumor uptake of the 99m Tc-labeled humanized antibody h-R3, a phase I diagnostic clinical trial of tumor with epithelial origin should be pursued
Directory of Open Access Journals (Sweden)
Yan Li
2016-10-01
Full Text Available Abstract Background The avian influenza virus (AIV can cross species barriers and expand its host range from birds to mammals, even humans. Avian influenza is characterized by pronounced activation of the proinflammatory cytokine cascade, which perpetuates the inflammatory response, leading to persistent systemic inflammatory response syndrome and pulmonary infection in animals and humans. There are currently no specific treatment strategies for avian influenza. Methods We hypothesized that mesenchymal stromal cells (MSCs would have beneficial effects in the treatment of H9N2 AIV-induced acute lung injury in mice. Six- to 8-week-old C57BL/6 mice were infected intranasally with 1 × 104 MID50 of A/HONG KONG/2108/2003 [H9N2 (HK] H9N2 virus to induce acute lung injury. After 30 min, syngeneic MSCs were delivered through the caudal vein. Three days after infection, we measured the survival rate, lung weight, arterial blood gas, and cytokines in both bronchoalveolar lavage fluid (BALF and serum, and assessed pathological changes to the lungs. Results MSC administration significantly palliated H9N2 AIV-induced pulmonary inflammation by reducing chemokines and proinflammatory cytokines levels, as well as reducing inflammatory cell recruit into the lungs. Thus, H9N2 AIV-induced lung injury was markedly alleviated in mice treated with MSCs. Lung histopathology and arterial blood gas analysis were improved in mice with H9N2 AIV-induced lung injury following MSC treatment. Conclusions MSC treatment significantly reduces H9N2 AIV-induced acute lung injury in mice and is associated with reduced pulmonary inflammation. These results indicate a potential role for MSC therapy in the treatment of clinical avian influenza.
4-Methoxyestradiol-induced oxidative injuries in human lung epithelial cells
International Nuclear Information System (INIS)
Cheng Yahsin; Chang, Louis W.; Cheng Lichuan; Tsai, M.-H.; Lin Pinpin
2007-01-01
Epidemiological studies indicated that people exposed to dioxins were prone to the development of lung diseases including lung cancer. Animal studies demonstrated that 2,3,7,8-tetrachlorodibenzo-p-dioxin (TCDD) increased liver tumors and promoted lung metaplasia in females. Metabolic changes in 17β-estradiol (E 2 ) resulted from an interaction between TCDD and E 2 could be associated with gender difference. Previously, we reported that methoxylestradiols (MeOE 2 ), especially 4-MeOE 2 , accumulated in human lung cells (BEAS-2B) co-treated with TCDD and E 2 . In the present study, we demonstrate unique accumulation of 4-MeOE 2 , as a result of TCDD/E 2 interaction and revealed its bioactivity in human lung epithelial cell line (H1355). 4-Methoxyestradiol treatment significantly decreased cell growth and increased mitotic index. Elevation of ROS and SOD activity, with a concomitant decrease in the intracellular GSH/GSSG ratio, was also detected in 4-MeOE 2 -treated cells. Quantitative comet assay showed increased oxidative DNA damage in the 4-MeOE 2 -treated H1355 cells, which could be significantly reduced by the anti-oxidant N-acetylcysteine (NAC). However, inhibition of cell growth and increase in mitotic arrest induced by 4-MeOE 2 were unaffected by NAC. We concluded that 4-MeOE 2 accumulation resulting from TCDD and E 2 interaction would contribute to the higher vulnerability on lung pathogenesis in females when exposed to TCDD
A new in vitro screening system for anticancer drugs for the treatment of non-small cell lung cancer
International Nuclear Information System (INIS)
Hanauske, U.; Hanauske, A.R.; Clark, G.M.; Tsen, D.; Buchok, J.; Hoff, D.D. von
1989-01-01
We have evaluated a semiautomated radiometric assay (BACTEC 460 system) for screening of activity of anticancer drugs against human non-small cell lung cancer cell lines. Cells from seven cell lines were exposed to standard antineoplastic agents at four different concentrations using a 1-h incubation. Alpha 2-interferon was tested using a continuous incubation. In vitro drug activity was analyzed as a function of the clinically achievable serum concentration. Our results indicate that two cell lines (CALU-3, SK-MES-1) exhibit in vitro drug sensitivity patterns closest to those observed in clinical studies. These two cell lines might therefore be most useful for screening new anticancer compounds for activity against non-small cell lung cancer. The radiometric assay is a semiautomated system which has advantages over other, more time-consuming screening systems
Explant culture of human peripheral lung. I. Metabolism of benzo[alpha]pyrene
DEFF Research Database (Denmark)
Stoner, G.D.; Harris, C.C.; Autrup, Herman
1978-01-01
the predominant alveolar epithelial cell type. Lamellar inclusion bodies were released from the type 2 cells and accumulated in the alveolar spaces. The metabolism of benzo[alpha]pyrene (BP) in human lung explants cultured for up to 7 days was investigated. Human lung explants had measurable aryl hydrocarbon......Human lung explants have been maintained in vitro for a period of 25 days. Autoradiographic studies indicated that the broncholar epithelial cells, type 2 alveolar epithelial cells, and stromal fibroblasts incorporated 3H-thymidine during the culture. After 7 to 10 days, type 2 cells were...... hydroxylase activity and could metabolize BP into forms that were bound to cellular DNA and protein. Peripheral lung had significantly lower aryl hydrocarbon hydroxylase activity than cultured bronchus but both tissues had similar binding levels of BP to DNA. Radioautographic studies indicated that all cell...
Small Molecular TRAIL Inducer ONC201 Induces Death in Lung Cancer Cells: A Preclinical Study.
Feng, Yuan; Zhou, Jihong; Li, Zhanhua; Jiang, Ying; Zhou, Ying
2016-01-01
Tumor necrosis factor (TNF)-related apoptosis-inducing ligand (TRAIL) selectively targets cancer cells. The present preclinical study investigated the anti-cancer efficiency of ONC201, a first-in-class small molecule TRAIL inducer, in lung cancer cells. We showed that ONC201 was cytotoxic and anti-proliferative in both established (A549 and H460 lines) and primary human lung cancer cells. It was yet non-cytotoxic to normal lung epithelial cells. Further, ONC201 induced exogenous apoptosis activation in lung cancer cells, which was evidenced by TRAIL/death receptor-5 (DR5) induction and caspase-8 activation. The caspase-8 inhibitor or TRAIL/DR5 siRNA knockdown alleviated ONC201's cytotoxicity against lung cancer cells. Molecularly, ONC201 in-activated Akt-S6K1 and Erk signalings in lung cancer cells, causing Foxo3a nuclear translocation. For the in vivo studies, intraperitoneal injection of ONC201 at well-tolerated doses significantly inhibited xenografted A549 tumor growth in severe combined immunodeficient (SCID) mice. Further, ONC201 administration induced TRAIL/DR5 expression, yet inactivated Akt-S6K1 and Erk in tumor tissues. These results of the study demonstrates the potent anti-lung cancer activity by ONC201.
Small Molecular TRAIL Inducer ONC201 Induces Death in Lung Cancer Cells: A Preclinical Study.
Directory of Open Access Journals (Sweden)
Yuan Feng
Full Text Available Tumor necrosis factor (TNF-related apoptosis-inducing ligand (TRAIL selectively targets cancer cells. The present preclinical study investigated the anti-cancer efficiency of ONC201, a first-in-class small molecule TRAIL inducer, in lung cancer cells. We showed that ONC201 was cytotoxic and anti-proliferative in both established (A549 and H460 lines and primary human lung cancer cells. It was yet non-cytotoxic to normal lung epithelial cells. Further, ONC201 induced exogenous apoptosis activation in lung cancer cells, which was evidenced by TRAIL/death receptor-5 (DR5 induction and caspase-8 activation. The caspase-8 inhibitor or TRAIL/DR5 siRNA knockdown alleviated ONC201's cytotoxicity against lung cancer cells. Molecularly, ONC201 in-activated Akt-S6K1 and Erk signalings in lung cancer cells, causing Foxo3a nuclear translocation. For the in vivo studies, intraperitoneal injection of ONC201 at well-tolerated doses significantly inhibited xenografted A549 tumor growth in severe combined immunodeficient (SCID mice. Further, ONC201 administration induced TRAIL/DR5 expression, yet inactivated Akt-S6K1 and Erk in tumor tissues. These results of the study demonstrates the potent anti-lung cancer activity by ONC201.
Energy Technology Data Exchange (ETDEWEB)
Morales-Morales, Alejo; Duconge, Jorge; Caballero-Torres, Idania; Nunez-Gandolff, Gilda; Fernandez, Eduardo; Iznaga-Escobar, Normando E-mail: normando@ict.cim.sld.cu
1999-04-01
The anti-human epidermal growth factor receptor (EGF-R) humanized monoclonal antibody (MAb) h-R3 is an (IgG{sub 1}), which binds to an extracellular domain of EGF-R. It was used to evaluate the biodistribution on nude mice xenografted with H-125 human lung adenocarcinoma cell line. Results were compared with its murine version of the MAb ior-egf/r3. Twenty-one athymic female 4NMRI nu/nu mice were injected intraperitoneally with 10 {mu}g/100 {mu}Ci of {sup 99m}Tc-labeled MAbs. Immunoreactivity of {sup 99m}Tc-labeled MAbs were measured by enzyme-linked immunosorbent assay (ELISA) on H-125 cell line and the immunoreactive fractions was determined by the Lindmo method. Among all organs, significant accumulation was found in serum (27.05 {+-} 2.08 %ID/g) and tumor (3.903 {+-} 0.89 %ID/g) at 4 h after injection. These values decreased to 5.03 {+-} 0.50 %ID/g and 2.19 {+-} 0.56 %ID/g for serum and tumor, respectively. The immunoreactive fraction was found to be 0.70, with a correlation coefficient r=0.9984. With the good biodistribution and tumor uptake of the {sup 99m}Tc-labeled humanized antibody h-R3, a phase I diagnostic clinical trial of tumor with epithelial origin should be pursued.
Energy Technology Data Exchange (ETDEWEB)
Lingappan, Krithika, E-mail: lingappa@bcm.edu [Department of Pediatrics, Section of Neonatology, Texas Children' s Hospital, Baylor College of Medicine, 1102 Bates Avenue, MC: FC530.01, Houston, TX 77030 (United States); Jiang, Weiwu; Wang, Lihua; Couroucli, Xanthi I. [Department of Pediatrics, Section of Neonatology, Texas Children' s Hospital, Baylor College of Medicine, 1102 Bates Avenue, MC: FC530.01, Houston, TX 77030 (United States); Barrios, Roberto [Department of Pathology and Genomic Medicine, The Methodist Hospital Physician Organization, 6565 Fannin Street, Suite M227, Houston, TX 77030 (United States); Moorthy, Bhagavatula [Department of Pediatrics, Section of Neonatology, Texas Children' s Hospital, Baylor College of Medicine, 1102 Bates Avenue, MC: FC530.01, Houston, TX 77030 (United States)
2013-10-15
Sex-specific differences in pulmonary morbidity in humans are well documented. Hyperoxia contributes to lung injury in experimental animals and humans. The mechanisms responsible for sex differences in the susceptibility towards hyperoxic lung injury remain largely unknown. In this investigation, we tested the hypothesis that mice will display sex-specific differences in hyperoxic lung injury. Eight week-old male and female mice (C57BL/6J) were exposed to 72 h of hyperoxia (FiO{sub 2} > 0.95). After exposure to hyperoxia, lung injury, levels of 8-iso-prostaglandin F{sub 2} alpha (8-iso-PGF 2α) (LC–MS/MS), apoptosis (TUNEL) and inflammatory markers (suspension bead array) were determined. Cytochrome P450 (CYP)1A expression in the lung was assessed using immunohistochemistry and western blotting. After exposure to hyperoxia, males showed greater lung injury, neutrophil infiltration and apoptosis, compared to air-breathing controls than females. Pulmonary 8-iso-PGF 2α levels were higher in males than females after hyperoxia exposure. Sexually dimorphic increases in levels of IL-6 (F > M) and VEGF (M > F) in the lungs were also observed. CYP1A1 expression in the lung was higher in female mice compared to males under hyperoxic conditions. Overall, our results support the hypothesis that male mice are more susceptible than females to hyperoxic lung injury and that differences in inflammatory and oxidative stress markers contribute to these sex-specific dimorphic effects. In conclusion, this paper describes the establishment of an animal model that shows sex differences in hyperoxic lung injury in a temporal manner and thus has important implications for lung diseases mediated by hyperoxia in humans. - Highlights: • Male mice were more susceptible to hyperoxic lung injury than females. • Sex differences in inflammatory markers were observed. • CYP1A expression was higher in females after hyperoxia exposure.
International Nuclear Information System (INIS)
Lingappan, Krithika; Jiang, Weiwu; Wang, Lihua; Couroucli, Xanthi I.; Barrios, Roberto; Moorthy, Bhagavatula
2013-01-01
Sex-specific differences in pulmonary morbidity in humans are well documented. Hyperoxia contributes to lung injury in experimental animals and humans. The mechanisms responsible for sex differences in the susceptibility towards hyperoxic lung injury remain largely unknown. In this investigation, we tested the hypothesis that mice will display sex-specific differences in hyperoxic lung injury. Eight week-old male and female mice (C57BL/6J) were exposed to 72 h of hyperoxia (FiO 2 > 0.95). After exposure to hyperoxia, lung injury, levels of 8-iso-prostaglandin F 2 alpha (8-iso-PGF 2α) (LC–MS/MS), apoptosis (TUNEL) and inflammatory markers (suspension bead array) were determined. Cytochrome P450 (CYP)1A expression in the lung was assessed using immunohistochemistry and western blotting. After exposure to hyperoxia, males showed greater lung injury, neutrophil infiltration and apoptosis, compared to air-breathing controls than females. Pulmonary 8-iso-PGF 2α levels were higher in males than females after hyperoxia exposure. Sexually dimorphic increases in levels of IL-6 (F > M) and VEGF (M > F) in the lungs were also observed. CYP1A1 expression in the lung was higher in female mice compared to males under hyperoxic conditions. Overall, our results support the hypothesis that male mice are more susceptible than females to hyperoxic lung injury and that differences in inflammatory and oxidative stress markers contribute to these sex-specific dimorphic effects. In conclusion, this paper describes the establishment of an animal model that shows sex differences in hyperoxic lung injury in a temporal manner and thus has important implications for lung diseases mediated by hyperoxia in humans. - Highlights: • Male mice were more susceptible to hyperoxic lung injury than females. • Sex differences in inflammatory markers were observed. • CYP1A expression was higher in females after hyperoxia exposure
Directory of Open Access Journals (Sweden)
Xiaoyan Zhang
2013-05-01
Full Text Available Objective(s: Although tumor necrosis factor-related apoptosis-inducing ligand (TRAIL can selectively induce apoptosis in tumor cells, more than half of tumors including non-small cell lung cancer (NSCLC exhibit TRAIL-resistance. The purpose of this study was to determine whether subtoxic-dose cisplatin and TRAIL could synergistically enhance apoptosis on NSCLC cells and investigate its underlying mechanisms. Materials and Methods:NCI-H460 and A549 cells were treated with TRAIL alone, cisplatin alone or combination treatment in this study. The cytotoxicity was evaluated according to Sulforhodamine B assay, and apoptosis was examined using Hoechst 33342 staining and flow cytometry. The mRNA and protein levels of TRAIL receptors and apoptotic proteins including caspase-8, caspase-9, Bcl-2 and Bax were determined by RT-PCR and Western blotting, respectively. Results:Our results showed that NCI-H460 cells were sensitive to TRAIL, whereas A549 cells were resistant. However, subtoxic-dose cisplatin could enhance the both cells to TRAIL-mediated cell proliferation inhibition and apoptosis. The underlying mechanisms might be associated with the down-regulation of DcR2 and up-regulation of Caspase-8, Caspase-9 and Bax. Conclusion:Subtoxic-dose cisplatin could enhance both TRAIL- sensitive and TRAIL- resistant NSCLC cells to TRAIL-mediated apoptosis. These findings motivated further studies to evaluate such a combinatory therapeutic strategy against NSCLC in the animal models.
International Nuclear Information System (INIS)
Sun Jin; Liu Lu; Zhu Xiaoli; Chen Daozhen; Gao Wen; Jiang Xinyu; Huang Ying
2008-01-01
Objective: 17-allylamino-17-demethoxygeldanamycin (17-AAG) has been developed as a novel heat shock protein 90 (HSP90) inhibitor being used in clinical trials. HSP90 is known as a molecular target for tumor therapy. The goal of this study was to investigate the inhibitive effects of 131 I labeled 17-AAG on human non-small cell lung cancer in xenograft-bearing nude mice. Methods: 17-AAG was labeled with 131 I. Twenty-eight BALB/c nude mice bearing H460 human non-small cell lung carcinoma tumor xenograft were randomly divided into seven groups, one control group and six treatment groups according to the route of administration (via tail vein injection or intratumoral injection) and the doses of injected radio-activity (5.5 MBq x 2 with 8 d interval, 11.0 MBq and 5.5 MBq). Two additional mice were treated with intratumoral injection of Na 131 I solution that was served as seintigraphic imaging controls. In each group two mice underwent scintigraphy at 2 h, 6 h, 24 h, 2 d, 3 d, 7 d, 10 d and 16 d. After 16 d the tumor inhibition rate was calculated. Then all of the mice were sacrificed and the tumor tissues were obtained for histological examination and immunohistochemical assay. Results: Persistent accumulation of 131 I-17-AAG in the tumors was seen on seintigraphic images. Tumor inhibiting effect was demonstrated in all treatment groups with varying degrees. The highest tumor inhibition rate (86.77 ± 4.57)% was shown in the group with interval intratumoral injection (5.5 MBq x 2). There was no significant difference of tumor inhibition rates between 5.5 MBq x 2 group (via tail vein injection) and 11.0 MBq group( via tail vein injection, q=1.67, P>0.05). While among the other treatment groups, there was significant difference in tumor inhibition rates( q=3.16-24.34, all P 131 I-17-AAG may effectively inhibit the tumor growth and expression of HSP90α antigen expression in non-small cell lung cancer bearing nude mice. The more prominent anti-tumor effect may be
International Nuclear Information System (INIS)
Matthews, Q; Jirasek, A; Lum, J J; Brolo, A G
2011-01-01
This work applies noninvasive single-cell Raman spectroscopy (RS) and principal component analysis (PCA) to analyze and correlate radiation-induced biochemical changes in a panel of human tumour cell lines that vary by tissue of origin, p53 status and intrinsic radiosensitivity. Six human tumour cell lines, derived from prostate (DU145, PC3 and LNCaP), breast (MDA-MB-231 and MCF7) and lung (H460), were irradiated in vitro with single fractions (15, 30 or 50 Gy) of 6 MV photons. Remaining live cells were harvested for RS analysis at 0, 24, 48 and 72 h post-irradiation, along with unirradiated controls. Single-cell Raman spectra were acquired from 20 cells per sample utilizing a 785 nm excitation laser. All spectra (200 per cell line) were individually post-processed using established methods and the total data set for each cell line was analyzed with PCA using standard algorithms. One radiation-induced PCA component was detected for each cell line by identification of statistically significant changes in the PCA score distributions for irradiated samples, as compared to unirradiated samples, in the first 24-72 h post-irradiation. These RS response signatures arise from radiation-induced changes in cellular concentrations of aromatic amino acids, conformational protein structures and certain nucleic acid and lipid functional groups. Correlation analysis between the radiation-induced PCA components separates the cell lines into three distinct RS response categories: R1 (H460 and MCF7), R2 (MDA-MB-231 and PC3) and R3 (DU145 and LNCaP). These RS categories partially segregate according to radiosensitivity, as the R1 and R2 cell lines are radioresistant (SF 2 > 0.6) and the R3 cell lines are radiosensitive (SF 2 < 0.5). The R1 and R2 cell lines further segregate according to p53 gene status, corroborated by cell cycle analysis post-irradiation. Potential radiation-induced biochemical response mechanisms underlying our RS observations are proposed, such as (1) the
2010-10-01
... 42 Public Health 4 2010-10-01 2010-10-01 false Marketing. 460.82 Section 460.82 Public Health... Administrative Requirements § 460.82 Marketing. (a) Information that a PACE organization must include in its marketing materials. (1) A PACE organization must inform the public about its program and give prospective...
Directory of Open Access Journals (Sweden)
Cheng-Yuan Wang
2010-02-01
Full Text Available Toona sinensis extracts have been shown to exhibit anti-cancer effects in human ovarian cancer cell lines, human promyelocytic leukemia cells and human lung adenocarcinoma. Its safety has also been confirmed in animal studies. However, its anti-cancer properties in human lung large cell carcinoma have not been studied. Here, we used a powder obtained by freeze-drying the super-natant of centrifuged crude extract from Toona sinensis leaves (TSL-1 to treat the human lung carcinoma cell line H661. Cell viability was evaluated by the 3-(4-,5-dimethylthiazol-2-yl-2,5-diphenyl tetrazolium bromide assay. Flow cytometry analysis revealed that TSL-1 blocked H661 cell cycle progression. Western blot analysis showed decreased expression of cell cycle proteins that promote cell cycle progression, including cyclin-dependent kinase 4 and cyclin D1, and increased the expression of proteins that inhibit cell cycle progression, including p27. Furthermore, flow cytometry analysis showed that TSL-1 induced H661 cell apoptosis. Western blot analysis showed that TSL-1 reduced the expression of the anti-apoptotic protein B-cell lymphoma 2, and degraded the DNA repair protein, poly(ADP-ribose polymerase. TSL-1 shows potential as a novel therapeutic agent or for use as an adjuvant for treating human lung large cell carcinoma.
Lifescience Database Archive (English)
Full Text Available SL (Link to library) SLC460 (Link to dictyBase) - - - - SLC460Z (Link to Original site) - - SLC4...60Z 333 - - - - Show SLC460 Library SL (Link to library) Clone ID SLC460 (Link to dictyBase) At...las ID - NBRP ID - dictyBase ID - Link to Contig - Original site URL http://dictycdb.biol.tsukuba.ac.jp/CSM/SL/SLC4-C/SLC4...60Q.Seq.d/ Representative seq. ID SLC460Z (Link to Original site) R...epresentative DNA sequence >SLC460 (SLC460Q) /CSM/SL/SLC4-C/SLC460Q.Seq.d/ XXXXXXXXXXAATTATTATTGTGTAATTCCTGT
2010-04-01
... 21 Food and Drugs 6 2010-04-01 2010-04-01 false Penicillin. 558.460 Section 558.460 Food and Drugs... Animal Feeds § 558.460 Penicillin. (a) Specifications. As penicillin procaine G or feed grade penicillin.... (1) It is used as follows: Penicillin in grams per ton Combination in grams per ton Indications for...
Reversal of cisplatin resistance in non-small cell lung cancer stem cells by Taxus chinensis var.
Jiang, Y Q; Xu, X P; Guo, Q M; Xu, X C; Liu, Q Y; An, S H; Xu, J L; Su, F; Tai, J B
2016-09-02
Drug resistance in cells is a major impedance to successful treatment of lung cancer. Taxus chinensis var. inhibits the growth of tumor cells and promotes the synthesis of interleukins 1 and 2 and tumor necrosis factor, enhancing immune function. In this study, T. chinensis var.-induced cell death was analyzed in lung cancer cells (H460) enriched for stem cell growth in a defined serum-free medium. Taxus-treated stem cells were also analyzed for Rhodamine 123 (Rh-123) expression by flow cytometry, and used as a standard functional indicator of MDR. The molecular basis of T. chinensis var.-mediated drug resistance was established by real-time PCR analysis of ABCC1, ABCB1, and lung resistance-related protein (LRP) mRNA, and western blot analysis of MRP1, MDR1, and LRP. Our results revealed that stem cells treated with higher doses of T. chinensis var. showed significantly lower growth inhibition rates than did H460 cells (P var. and cisplatin was also significantly inhibited (P var. (P var.-treated stem cells showed significant downregulation of the ABCC1, ABCB1, and LRP mRNA and MRP1, MDR1, and LRP (P var.-mediated downregulation of MRP1, MDR1, and LRP might contribute to the reversal of drug resistance in non-small cell lung cancer stem cells.
Cole, Aidan J.; McGarry, Conor K.; Butterworth, Karl T.; McMahon, Stephen J.; Hounsell, Alan R.; Prise, Kevin M.; O'Sullivan, Joe M.
2013-12-01
Respiratory motion introduces complex spatio-temporal variations in the dosimetry of radiotherapy and may contribute towards uncertainties in radiotherapy planning. This study investigates the potential radiobiological implications occurring due to tumour motion in areas of geometric miss in lung cancer radiotherapy. A bespoke phantom and motor-driven platform to replicate respiratory motion and study the consequences on tumour cell survival in vitro was constructed. Human non-small-cell lung cancer cell lines H460 and H1299 were irradiated in modulated radiotherapy configurations in the presence and absence of respiratory motion. Clonogenic survival was calculated for irradiated and shielded regions. Direction of motion, replication of dosimetry by multi-leaf collimator (MLC) manipulation and oscillating lead shielding were investigated to confirm differences in cell survival. Respiratory motion was shown to significantly increase survival for out-of-field regions for H460/H1299 cell lines when compared with static irradiation (p < 0.001). Significantly higher survival was found in the in-field region for the H460 cell line (p < 0.030). Oscillating lead shielding also produced these significant differences. Respiratory motion and oscillatory delivery of radiation dose to human tumour cells has a significant impact on in- and out-of-field survival in the presence of non-uniform irradiation in this in vitro set-up. This may have important radiobiological consequences for modulated radiotherapy in lung cancer.
Lung Cancer Susceptibility and hOGG1 Ser326Cys Polymorphism: A Meta-Analysis
International Nuclear Information System (INIS)
Kiyohara, Chikako; Takayama, Koichi; Nakanishi, Yoichi
2010-01-01
Recent lung cancer studies have focused on identifying the effects of single nucleotide polymorphisms (SNPs) in candidate genes, among which DNA repair genes are increasingly being studied. Genetic variations in DNA repair genes are thought to modulate DNA repair capacity and are suggested to be related to lung cancer risk. In this study, we tried to assess reported studies of association between polymorphism of human 8-oxoguanine DNA glycosylase 1 (hOGG1) Ser326Cys and lung cancer. We conducted MEDLINE, Current Contents and Web of Science searches using 'hOGG1', 'lung cancer' and 'polymorphism' as keywords to search for papers published (from January 1995 through August 2010). Data were combined using both a fixed effects (the inverse variance-weighted method) and a random effects (DerSimonian and Laird method) models. The Cochran Q test was used for the assessment of heterogeneity. Publication bias was assessed by both Begg’s and Egger’s tests. We identified 20 case-control studies in 21 different ethnic populations. As two studies were not in the Hardy-Weinberg equilibrium, 18 case-control studies in 19 different ethnic populations (7,792 cases and 9,358 controls) were included in our meta-analysis. Summary frequencies of the Cys allele among Caucasians and Asians based on the random effects model were 20.9% (95% confidence interval (CI) = 18.9–22.9) and 46.1% (95% CI = 40.2–52.0), respectively. The distribution of the Cys allele was significantly different between Asians and Caucasians (P < 0.001). The Cys/Cys genotype was significantly associated with lung cancer risk in Asian populations (odds ratio = 1.27, 95% CI = 1.09–1.48) but not in Caucasian populations. This ethnic difference in lung cancer risk may be due to environmental factors such as cigarette smoking and dietary factors. Although the summary risk for developing lung cancer may not be large, lung cancer is such a common malignancy that even a small increase
Lung Cancer Susceptibility and hOGG1 Ser326Cys Polymorphism: A Meta-Analysis
Energy Technology Data Exchange (ETDEWEB)
Kiyohara, Chikako, E-mail: chikako@phealth.med.kyushu-u.ac.jp [Department of Preventive Medicine, Graduate School of Medical Sciences, Kyushu University, 3-1-1 Maidashi, Higashi-ku, Fukuoka 812-8582 (Japan); Takayama, Koichi; Nakanishi, Yoichi [Research Institute for Diseases of the Chest, Graduate School of Medical Sciences, Kyushu University, 3-1-1 Maidashi, Higashi-ku, Fukuoka 812-8582 (Japan)
2010-10-28
Recent lung cancer studies have focused on identifying the effects of single nucleotide polymorphisms (SNPs) in candidate genes, among which DNA repair genes are increasingly being studied. Genetic variations in DNA repair genes are thought to modulate DNA repair capacity and are suggested to be related to lung cancer risk. In this study, we tried to assess reported studies of association between polymorphism of human 8-oxoguanine DNA glycosylase 1 (hOGG1) Ser326Cys and lung cancer. We conducted MEDLINE, Current Contents and Web of Science searches using 'hOGG1', 'lung cancer' and 'polymorphism' as keywords to search for papers published (from January 1995 through August 2010). Data were combined using both a fixed effects (the inverse variance-weighted method) and a random effects (DerSimonian and Laird method) models. The Cochran Q test was used for the assessment of heterogeneity. Publication bias was assessed by both Begg’s and Egger’s tests. We identified 20 case-control studies in 21 different ethnic populations. As two studies were not in the Hardy-Weinberg equilibrium, 18 case-control studies in 19 different ethnic populations (7,792 cases and 9,358 controls) were included in our meta-analysis. Summary frequencies of the Cys allele among Caucasians and Asians based on the random effects model were 20.9% (95% confidence interval (CI) = 18.9–22.9) and 46.1% (95% CI = 40.2–52.0), respectively. The distribution of the Cys allele was significantly different between Asians and Caucasians (P < 0.001). The Cys/Cys genotype was significantly associated with lung cancer risk in Asian populations (odds ratio = 1.27, 95% CI = 1.09–1.48) but not in Caucasian populations. This ethnic difference in lung cancer risk may be due to environmental factors such as cigarette smoking and dietary factors. Although the summary risk for developing lung cancer may not be large, lung cancer is such a common malignancy that even a small increase
Energy Technology Data Exchange (ETDEWEB)
Winkler-Heil, R.; Hofmann, W. [University of Salzburg, Division of Physics and Biophysics, Department of Materials Research and Physics, Salzburg (Austria); Hussain, M. [University of Salzburg, Division of Physics and Biophysics, Department of Materials Research and Physics, Salzburg (Austria); Higher Education Commission of Pakistan, Islamabad (Pakistan)
2015-05-15
Laboratory rats are frequently used in inhalation studies as a surrogate for human exposures. The objective of the present study was therefore to develop a stochastic dosimetry model for inhaled radon progeny in the rat lung, to predict bronchial dose distributions and to compare them with corresponding dose distributions in the human lung. The most significant difference between human and rat lungs is the branching structure of the bronchial tree, which is relatively symmetric in the human lung, but monopodial in the rat lung. Radon progeny aerosol characteristics used in the present study encompass conditions typical for PNNL and COGEMA rat inhalation studies, as well as uranium miners and human indoor exposure conditions. It is shown here that depending on exposure conditions and modeling assumptions, average bronchial doses in the rat lung ranged from 5.4 to 7.3 mGy WLM{sup -1}. If plotted as a function of airway generation, bronchial dose distributions exhibit a significant maximum in large bronchial airways. If, however, plotted as a function of airway diameter, then bronchial doses are much more uniformly distributed throughout the bronchial tree. Comparisons between human and rat exposures indicate that rat bronchial doses are slightly higher than human bronchial doses by about a factor of 1.3, while lung doses, averaged over the bronchial (BB), bronchiolar (bb) and alveolar-interstitial (AI) regions, are higher by about a factor of about 1.6. This supports the current view that the rat lung is indeed an appropriate surrogate for the human lung in case of radon-induced lung cancers. Furthermore, airway diameter seems to be a more appropriate morphometric parameter than airway generations to relate bronchial doses to bronchial carcinomas. (orig.)
Lifescience Database Archive (English)
Full Text Available SS (Link to library) SSF460 (Link to dictyBase) - - - Contig-U03803-1 SSF460Z (Link... to Original site) - - SSF460Z 453 - - - - Show SSF460 Library SS (Link to library) Clone ID SSF460 (Link to...ycdb.biol.tsukuba.ac.jp/CSM/SS/SSF4-C/SSF460Q.Seq.d/ Representative seq. ID SSF46...0Z (Link to Original site) Representative DNA sequence >SSF460 (SSF460Q) /CSM/SS/SSF4-C/SSF460Q.Seq.d/ XXXXX...s) Value SSM309 (SSM309Q) /CSM/SS/SSM3-A/SSM309Q.Seq.d/ 424 e-118 SSH196 (SSH196Q) /CSM/SS/SSH1-D/SSH196Q.Seq.d/ 424 e-118 SSF4
New estimates for human lung dimensions
International Nuclear Information System (INIS)
Kennedy, Christine; Sidavasan, Sivalal; Kramer, Gary
2008-01-01
Full text: The currently used lung dimensions in dosimetry were originally estimated in the 1940s from Army recruits. This study provides new estimates of lung dimensions based on images acquired from a sample from the general population (varying age and sex). Building accurate models, called phantoms, of the human lung requires that the spatial dimensions (length, width, and depth) be quantified, in addition to volume. Errors in dose estimates may result from improperly sized lungs as the counting efficiency of externally mounted detectors (e.g., in a lung counter) is dependent on the position of internally deposited radioactive material (i.e., the size of the lung). This study investigates the spatial dimensions of human lungs. Lung phantoms have previously been made in one of two sizes. The Lawrence Livermore National Laboratory Torso Phantom (LLNL) has deep, short lungs whose dimensions do not comply well with the data published in Report 23 (Reference Man) issued by the International Commission on Radiological Protection (ICRP). The Japanese Atomic Energy Research Institute Torso Phantom(JAERI), has longer, shallower lungs that also deviate from the ICRP values. However, careful examination of the ICRP recommended values shows that they are soft. In fact, they have been dropped from the ICRP's Report 89 which updates Report 23. Literature surveys have revealed a wealth of information on lung volume, but very little data on the spatial dimensions of human lungs. Better lung phantoms need to be constructed to more accurately represent a person so that dose estimates may be quantified more accurately in view of the new, lower, dose limits for occupationally exposed workers and the general public. Retrospective chest images of 60 patients who underwent imaging of the chest- lungs as part of their healthy persons occupational screening for lung disease were chosen. The chosen normal lung images represent the general population). Ages, gender and weight of the
Antiproliferative Activity and Chemical Constituents of Hypericum dyeri. Rehder
International Nuclear Information System (INIS)
Ali, M.; Arfan, M.; Zaman, K.
2013-01-01
The antiproliferative activity of hexane (F1), ethyl acetate (F2), butanol (F3) and water (F4) extracts of Hypericum dyeri were tested in vitro for their anti- proliferative (anticancer) activity on the cell lines: HT-29 human colon adenocarcinoma, NCI-H460 human non-small cell lung carcinoma, MCF-7 human breast cancer, OVCAR-3 human ovarian adenocarcinoma and RXF-393 human renal cell carcinoma with etoposide as positive control. Among the various extracts the F1 showed relatively potent anti-proliferative activity (IC50, 17.20 +- 4.80 micro g/mL) on NCI-H460 human non-small cell lung carcinoma cell growth. Six compounds were also isolated for the first time from this source. These phytochemicals were identified as 1-Octatriacontanol (1), Hexacosyl tetracosanoate (2), Geddic acid (3), Octacosanoic acid (4), Ceric acid (5) and Sitosterol (6) on the basis of spectroscopic studies such as 1H NMR ,13C NMR, 2D NMR and Mass spectroscopy as well as established with help of reported literature. (author)
42 CFR 460.76 - Transportation services.
2010-10-01
... 42 Public Health 4 2010-10-01 2010-10-01 false Transportation services. 460.76 Section 460.76... ELDERLY (PACE) PACE Administrative Requirements § 460.76 Transportation services. (a) Safety, accessibility, and equipment. A PACE organization's transportation services must be safe, accessible, and...
Characterization of the human pH- and PKA-activated ClC-2G(2 alpha) Cl- channel.
Sherry, A M; Stroffekova, K; Knapp, L M; Kupert, E Y; Cuppoletti, J; Malinowska, D H
1997-08-01
A ClC-2G(2 alpha) Cl- channel was identified to be present in human lung and stomach, and a partial cDNA for this Cl- channel was cloned from a human fetal lung library. A full-length expressible human ClC-2G(2 alpha) cDNA was constructed by ligation of mutagenized expressible rabbit ClC-2G(2 alpha) cDNA with the human lung ClC-2G(2 alpha) cDNA, expressed in oocytes, and characterized at the single-channel level. Adenosine 3',5'-cyclic monophosphate-dependent protein kinase (PKA) treatment increased the probability of opening of the channel (Po). After PKA activation, the channel exhibited a linear (r = 0.99) current-voltage curve with a slope conductance of 22.1 +/- 0.8 pS in symmetric 800 mM tetraethylammonium chloride (TEACl; pH 7.4). Under fivefold gradient conditions of TEACl, a reversal potential of +21.5 +/- 2.8 mV was measured demonstrating anion-to-cation discrimination. As previously demonstrated for the rabbit ClC-2G(2 alpha) Cl- channel, the human analog, hClC-2G(2 alpha), was active at pH 7.4 as well as when the pH of the extracellular face of the channel (trans side of the bilayer; pHtrans) was asymmetrically reduced to pH 3.0. The extent of PKA activation was dependent on pHtrans. With PKA treatment, Po increased fourfold with a pHtrans of 7.4 and eightfold with a pHtrans of 3.0. Effects of sequential PKA addition followed by pHtrans reduction on the same channel suggested that the PKA- and pH-dependent increases in channel Po were separable and cumulative. Northern analysis showed ClC-2G(2 alpha) mRNA to be present in human adult and fetal lung and adult stomach, and quantitative reverse transcriptase-polymerase chain reaction showed this channel to be present in the adult human lung and stomach at about one-half the level found in fetal lung. The findings of the present study suggest that the ClC-2G(2 alpha) Cl- channel may play an important role in Cl- transport in the fetal and adult human lung.
Expression of hPNAS-4 Radiosensitizes Lewis Lung Cancer
International Nuclear Information System (INIS)
Zeng Hui; Yuan Zhu; Zhu Hong; Li Lei; Shi Huashan; Wang Zi; Fan Yu; Deng Qian; Zeng Jianshuang; He Yinbo; Xiao Jianghong; Li Zhiping
2012-01-01
Purpose: This study aimed to transfer the hPNAS-4 gene, a novel apoptosis-related human gene, into Lewis lung cancer (LL2) and observe its radiosensitive effect on radiation therapy in vitro and in vivo. Methods and Materials: The hPNAS-4 gene was transfected into LL2 cells, and its expression was detected via western blot. Colony formation assay and flow cytometry were used to detect the growth and apoptosis of cells treated with irradiation/PNAS-4 in vitro. The hPNAS-4 gene was transferred into LL2-bearing mice through tail vein injection of the liposome/gene complex. The tumor volumes were recorded after radiation therapy. Proliferating cell nuclear antigen (PCNA) immunohistochemistry staining and terminal deoxynucleotidyl transferase-mediated dUTP nick end labeling (TUNEL) assay were performed to detect the tumor cell growth and apoptosis in vivo. Results: The hPNAS-4 gene was successfully transferred into LL2 cells and tumor tissue, and its overexpressions were confirmed via western blot analysis. Compared with the control, empty plasmid, hPNAS-4, radiation, and empty plasmid plus radiation groups, the hPNAS-4 plus radiation group more significantly inhibited growth and enhanced apoptosis of LL2 cells in vitro and in vivo (P<.05). Conclusions: The hPNAS-4 gene was successfully transferred into LL2 cells and tumor tissue and was expressed in both LL2 cell and tumor tissue. The hPNAS-4 gene therapy significantly enhanced growth inhibition and apoptosis of LL2 tumor cells by radiation therapy in vitro and in vivo. Therefore, it may be a potential radiosensitive treatment of radiation therapy for lung cancer.
42 CFR 460.208 - Financial statements.
2010-10-01
... 42 Public Health 4 2010-10-01 2010-10-01 false Financial statements. 460.208 Section 460.208... ELDERLY (PACE) Data Collection, Record Maintenance, and Reporting § 460.208 Financial statements. (a... must submit a certified financial statement that includes appropriate footnotes. (2) The financial...
Wang, Qiao; Zhu, Hong; Zhou, Wu-Gang; Guo, Xiao-Can; Wu, Min-Juan; Xu, Zhen-Yu; Jiang, Jun-feng; Shen, Ce; Liu, Hou-Qi
2013-08-01
The transplantation of mesenchymal stem cells (MSCs) has been reported to be a promising approach in the treatment of acute lung injury. However, the poor efficacy of transplanted MSCs is one of the serious handicaps in the progress of MSC-based therapy. Therefore, the purpose of this study was to investigate whether the pretreatment of human embryonic MSCs (hMSCs) with an antioxidant, namely N-acetylcysteine (NAC), can improve the efficacy of hMSC transplantation in lung injury. In vitro, the antioxidant capacity of NAC-pretreated hMSCs was assessed using intracellular reactive oxygen species (ROS) and glutathione assays and cell adhesion and spreading assays. In vivo, the therapeutic potential of NAC-pretreated hMSCs was assessed in a bleomycin-induced model of lung injury in nude mice. The pretreatment of hMSCs with NAC improved antioxidant capacity to defend against redox imbalances through the elimination of cellular ROS, increasing cellular glutathione levels, and the enhancement of cell adhesion and spreading when exposed to oxidative stresses in vitro. In addition, the administration of NAC-pretreated hMSCs to nude mice with bleomycin-induced lung injury decreased the pathological grade of lung inflammation and fibrosis, hydroxyproline content and numbers of neutrophils and inflammatory cytokines in bronchoalveolar lavage fluid and apoptotic cells, while enhancing the retention and proliferation of hMSCs in injured lung tissue and improving the survival rate of mice compared with results from untreated hMSCs. The pretreatment of hMSCs with NAC could be a promising therapeutic approach to improving cell transplantation and, therefore, the treatment of lung injury.
2010-07-01
... 38 Pensions, Bonuses, and Veterans' Relief 1 2010-07-01 2010-07-01 false Death pension. 3.460 Section 3.460 Pensions, Bonuses, and Veterans' Relief DEPARTMENT OF VETERANS AFFAIRS ADJUDICATION Pension, Compensation, and Dependency and Indemnity Compensation Apportionments § 3.460 Death pension. Death pension...
42 CFR 460.72 - Physical environment.
2010-10-01
... 42 Public Health 4 2010-10-01 2010-10-01 false Physical environment. 460.72 Section 460.72 Public...) PACE Administrative Requirements § 460.72 Physical environment. (a) Space and equipment—(1) Safe design..., sanitary, functional, accessible, and comfortable environment for the delivery of services that protects...
42 CFR 460.74 - Infection control.
2010-10-01
... 42 Public Health 4 2010-10-01 2010-10-01 false Infection control. 460.74 Section 460.74 Public...) PACE Administrative Requirements § 460.74 Infection control. (a) Standard procedures. The PACE organization must follow accepted policies and standard procedures with respect to infection control, including...
Bano, Shaista; Siddiqui, Bina Shaheen; Farooq, Ahsana Dar; Begum, Sabira; Siddiqui, Faheema; Kashif, Muhammad; Azhar, Mudassar
2017-12-01
Several Euphorbia species have been used in folklore as cancer remedies, however, scientific studies on the cytotoxicity (in vitro studies) of Euphorbia caducifolia are lacking. In present study, anticancer potential of E. caducifolia aerial parts ethanol extract and its fractions were evaluated against human lung (NCI-H460), breast (MCF-7), prostate (PC-3) and cervical (HeLa) cancer cell lines, using sulphorhodamine-B in vitro cytotoxicity (in vitro studies) assay. The ethanol extract demonstrated growth inhibitory effect against all aforementioned cancer cell lines with IC 50 , 19-135 μg/mL and LC 50 , ~220 μg/mL, and its petroleum ether fraction obtained on bioactivity guided fraction showed highest activity with IC 50 , 28-70 μg/mL and LC 50 , 71 μg/mL against NCI-H460 and MCF-7 cell lines. Its phytochemicals were analysed by gas chromatography-mass spectrometry (GC-MS). The present study provides scientific justification for its traditional use against cancer.
Lee, Ju-Kyung; Kim, Keun-Cheol
2013-09-06
3-Deazaneplanocin A (DZNep), an epigenetic anticancer drug, leads to the indirect suppression of S-adenosyl methionine-dependent cellular methylations by inhibiting S-adenosyl homocystein (AdoHcy) hydrolase. Although it is well known that DZNep targets the degradation of EZH2 protein, H3K27me3 HMTase, there are still uncertainties about the regulation of other types of HMTases during cell death. In this study, we describe that SETDB1 gene expression was regulated by DZNep treatment in human lung cancer cells. We confirm that DZNep induced growth inhibition and increased the dead cell population of lung cancer cells. DZNep treatment affected histone methylations, including H3K27me3 and H3K9me3, but not H3K4me3. Reduced levels of H3K27me3 and H3K9me3 were related with the decreased EZH2 and SETDB1 proteins. Real time PCR analysis showed that SETDB1 gene expression was decreased by DZNep treatment, but no effect was observed for EZH2 gene expression. We cloned the promoter region of SETDB1 and SUV39H1 genes, and performed luciferase assays. The promoter activity of SETDB1 gene was down regulated by DZNep treatment, whereas no effect on SUV39H1 promoter activity was observed. In conclusion, we suggest that DZNep regulates not only on H3K27me3 HMTase EZH2, but also H3K9 HMTase SETDB1 gene expression at the transcription level, implicating that the mechanism of action of DZNep targets multiple HMTases during the death of lung cancer cells. Copyright © 2013 Elsevier Inc. All rights reserved.
42 CFR 460.152 - Enrollment process.
2010-10-01
... 42 Public Health 4 2010-10-01 2010-10-01 false Enrollment process. 460.152 Section 460.152 Public...) Participant Enrollment and Disenrollment § 460.152 Enrollment process. (a) Intake process. Intake is an intensive process during which PACE staff members make one or more visits to a potential participant's place...
42 CFR 460.100 - Emergency care.
2010-10-01
... 42 Public Health 4 2010-10-01 2010-10-01 false Emergency care. 460.100 Section 460.100 Public...) PROGRAMS OF ALL-INCLUSIVE CARE FOR THE ELDERLY (PACE) PROGRAMS OF ALL-INCLUSIVE CARE FOR THE ELDERLY (PACE) PACE Services § 460.100 Emergency care. (a) Written plan. A PACE organization must establish and...
42 CFR 460.62 - Governing body.
2010-10-01
... 42 Public Health 4 2010-10-01 2010-10-01 false Governing body. 460.62 Section 460.62 Public Health... Administrative Requirements § 460.62 Governing body. (a) Governing body. A PACE organization must be operating under the control of an identifiable governing body (for example, a board of directors) or a designated...
Energy Technology Data Exchange (ETDEWEB)
Seki, Yasuhiro [Graduate School of Arts and Sciences, The University of Tokyo, Tokyo (Japan); Research Center for Stem Cell Engineering, National Institute of Advanced Industrial Science and Technology (AIST), Tsukuba (Japan); Yoshida, Yukihiro [Department of Surgery, Asahi General Hospital, Chiba (Japan); Department of Thoracic Surgery, The University of Tokyo, Graduate School of Medicine, Tokyo (Japan); Ishimine, Hisako [Research Center for Stem Cell Engineering, National Institute of Advanced Industrial Science and Technology (AIST), Tsukuba (Japan); Graduate School of Life and Environmental Sciences, The University of Tsukuba, Tsukuba, Ibaraki (Japan); Shinozaki-Ushiku, Aya [Department of Pathology, Graduate School of Medicine, The University of Tokyo, Hongo, Tokyo (Japan); Ito, Yoshimasa [Research Center for Stem Cell Engineering, National Institute of Advanced Industrial Science and Technology (AIST), Tsukuba (Japan); Sumitomo, Kenya [Department of Internal Medicine, JA Kochi Hospital, Kochi (Japan); Nakajima, Jun [Department of Thoracic Surgery, The University of Tokyo, Graduate School of Medicine, Tokyo (Japan); Fukayama, Masashi [Department of Pathology, Graduate School of Medicine, The University of Tokyo, Hongo, Tokyo (Japan); Michiue, Tatsuo [Graduate School of Arts and Sciences, The University of Tokyo, Tokyo (Japan); Asashima, Makoto, E-mail: asashi@bio.c.u-tokyo.ac.jp [Graduate School of Arts and Sciences, The University of Tokyo, Tokyo (Japan); Research Center for Stem Cell Engineering, National Institute of Advanced Industrial Science and Technology (AIST), Tsukuba (Japan); Life Science Center of Tsukuba Advanced Research Alliance (TARA), The University of Tsukuba, Tsukuba, Ibaraki (Japan); Kurisaki, Akira, E-mail: akikuri@hotmail.com [Research Center for Stem Cell Engineering, National Institute of Advanced Industrial Science and Technology (AIST), Tsukuba (Japan); Graduate School of Life and Environmental Sciences, The University of Tsukuba, Tsukuba, Ibaraki (Japan)
2014-01-24
Highlights: • Most of the adenocarcinomas and bronchioloalveolar carcinomas were LIPH-positive. • LIPH is necessary for the proliferation of lung cancer cells in vitro. • A high level of LIPH in serum is correlated with better survival in early phase lung-cancer patients after surgery. - Abstract: Lung cancer is one of the most frequent causes of cancer-related death worldwide. However, molecular markers for lung cancer have not been well established. To identify novel genes related to lung cancer development, we surveyed publicly available DNA microarray data on lung cancer tissues. We identified lipase member H (LIPH, also known as mPA-PLA1) as one of the significantly upregulated genes in lung adenocarcinoma. LIPH was expressed in several adenocarcinoma cell lines when they were analyzed by quantitative real-time polymerase chain reaction (qPCR), western blotting, and sandwich enzyme-linked immunosorbent assay (ELISA). Immunohistochemical analysis detected LIPH expression in most of the adenocarcinomas and bronchioloalveolar carcinomas tissue sections obtained from lung cancer patients. LIPH expression was also observed less frequently in the squamous lung cancer tissue samples. Furthermore, LIPH protein was upregulated in the serum of early- and late-phase lung cancer patients when they were analyzed by ELISA. Interestingly, high serum level of LIPH was correlated with better survival in early phase lung cancer patients after surgery. Thus, LIPH may be a novel molecular biomarker for lung cancer, especially for adenocarcinoma and bronchioloalveolar carcinoma.
International Nuclear Information System (INIS)
Seki, Yasuhiro; Yoshida, Yukihiro; Ishimine, Hisako; Shinozaki-Ushiku, Aya; Ito, Yoshimasa; Sumitomo, Kenya; Nakajima, Jun; Fukayama, Masashi; Michiue, Tatsuo; Asashima, Makoto; Kurisaki, Akira
2014-01-01
Highlights: • Most of the adenocarcinomas and bronchioloalveolar carcinomas were LIPH-positive. • LIPH is necessary for the proliferation of lung cancer cells in vitro. • A high level of LIPH in serum is correlated with better survival in early phase lung-cancer patients after surgery. - Abstract: Lung cancer is one of the most frequent causes of cancer-related death worldwide. However, molecular markers for lung cancer have not been well established. To identify novel genes related to lung cancer development, we surveyed publicly available DNA microarray data on lung cancer tissues. We identified lipase member H (LIPH, also known as mPA-PLA1) as one of the significantly upregulated genes in lung adenocarcinoma. LIPH was expressed in several adenocarcinoma cell lines when they were analyzed by quantitative real-time polymerase chain reaction (qPCR), western blotting, and sandwich enzyme-linked immunosorbent assay (ELISA). Immunohistochemical analysis detected LIPH expression in most of the adenocarcinomas and bronchioloalveolar carcinomas tissue sections obtained from lung cancer patients. LIPH expression was also observed less frequently in the squamous lung cancer tissue samples. Furthermore, LIPH protein was upregulated in the serum of early- and late-phase lung cancer patients when they were analyzed by ELISA. Interestingly, high serum level of LIPH was correlated with better survival in early phase lung cancer patients after surgery. Thus, LIPH may be a novel molecular biomarker for lung cancer, especially for adenocarcinoma and bronchioloalveolar carcinoma
2013-05-07
... DEPARTMENT OF HEALTH AND HUMAN SERVICES Health Resources and Services Administration Non-Competitive One-Year Extension With Funds for Black Lung/Coal Miner Clinics Program (H37) Current Grantee..., 2013), announcing the issuing of a non-competitive one-year extension with funds for the Black Lung...
2010-01-01
... 16 Commercial Practices 1 2010-01-01 2010-01-01 false Tax claims. 460.22 Section 460.22 Commercial Practices FEDERAL TRADE COMMISSION TRADE REGULATION RULES LABELING AND ADVERTISING OF HOME INSULATION § 460.22 Tax claims. Do not say or imply that your product qualifies for a tax benefit unless it is true. ...
International Nuclear Information System (INIS)
Xu Zumin; Wang Jin; Zuo Yufang; Yu Zhonghua; Peng Fang; Hu Xiao; Zhou Qichao; Ma Honglian; Bao Yong; Chen Ming
2014-01-01
Objective: To investigate the effects of regulator and the underlying molecular mechanisms of G-protein signaling 5 (RGS5) on radiation response in human lung cancer cells. Methods: The effects of RGS5 on viability were determined by MTT assay, and apoptosis rate was detected by flow cytometry, in human lung cancer cells. The combined effect of ionizing radiation and RGS5 on tumor cells was detected by colony formation assay. The protein expression was detected by Western blot. Results: RGS5 overexpression remarkably inhibited the survival of human lung cancer cells, and the growth inhibition rate of RGS5 overexpression on A549 and Calu-3 cells were 44.4% (F = 29.18, P < 0.05) and 39.27% (F = 23.04, P < 0.05) at 48 h, and 54.3%(F = 103.45, P < 0.05), 44.7%(F = 108.02, P < 0.05) at 72 h post-irradiation, respectively. RGS5 might exert its inhibitory effects on human lung cancer cells by inducing tumor cell apoptosis, while the apoptotic cells rate in A549 and Calu-3 cells in control group, pTRiEX group and pTRiEX-RGS5 group were (1.3±0.2)%, (3.4±0.6)%, (19.6±2.3)% (F = 86.62, P < 0.05), and (3.2±0.8)%, (3.0±0.9)%, (12.8±1.8)% (F = 28.80, P < 0.05) at 36 h post-irradiation, respectively. Furthermore, RGS5 could sensitize the lung cancer cells to radiation. Conclusions: RGS5 might play an inhibitory role in human lung cancer cell proliferation, which may explain the pathoclinical observation thet high expression of RGSS is a favorable prognostic factor in NSCLC patients. In addition, RGS5 also enhance the anti-tumor effects of radiation in human lung cancer cells. (authors)
International Nuclear Information System (INIS)
Bhakta, Kushal Y.; Jiang, Weiwu; Couroucli, Xanthi I.; Fazili, Inayat S.; Muthiah, Kathirvel; Moorthy, Bhagavatula
2008-01-01
Supplemental oxygen, used to treat pulmonary insufficiency in newborns, contributes to the development of bronchopulmonary dysplasia (BPD). Cytochrome P4501A enzymes are induced by hyperoxia in animal models, but their role in human systems is unknown. Here we investigated the molecular mechanisms of induction of CYP1A1 by hyperoxia in human lung cell lines. Three human lung cell lines were exposed to hyperoxia (95% O2) for 0-72 h, and CYP1A1 activities, apoprotein contents, and mRNA levels were determined. Hyperoxia significantly induced CYP1A1 activity and protein contents (2-4 fold), and mRNA levels (30-40 fold) over control in each cell line. Transfection of a CYP1A1 promoter/luciferase reporter construct, followed by hyperoxia (4-72 h), showed marked (2-6 fold) induction of luciferase expression. EMSA and siRNA experiments strongly suggest that the Ah receptor (AHR) is involved in the hyperoxic induction of CYP1A1. MTT reduction assays showed attenuation of cell injury with the CYP1A1 inducer beta-naphthoflavone (BNF). Our results strongly suggest that hyperoxia transcriptionally activates CYP1A1 expression in human lung cell lines by AHR-dependent mechanisms, and that CYP1A1 induction is associated with decreased toxicity. This novel finding of induction of CYP1A1 in the absence of exogenous AHR ligands could lead to novel interventions in the treatment of BPD
Chan, Michael C W; Kuok, Denise I T; Leung, Connie Y H; Hui, Kenrie P Y; Valkenburg, Sophie A; Lau, Eric H Y; Nicholls, John M; Fang, Xiaohui; Guan, Yi; Lee, Jae W; Chan, Renee W Y; Webster, Robert G; Matthay, Michael A; Peiris, J S Malik
2016-03-29
Influenza can cause acute lung injury. Because immune responses often play a role, antivirals may not ensure a successful outcome. To identify pathogenic mechanisms and potential adjunctive therapeutic options, we compared the extent to which avian influenza A/H5N1 virus and seasonal influenza A/H1N1 virus impair alveolar fluid clearance and protein permeability in an in vitro model of acute lung injury, defined the role of virus-induced soluble mediators in these injury effects, and demonstrated that the effects are prevented or reduced by bone marrow-derived multipotent mesenchymal stromal cells. We verified the in vivo relevance of these findings in mice experimentally infected with influenza A/H5N1. We found that, in vitro, the alveolar epithelium's protein permeability and fluid clearance were dysregulated by soluble immune mediators released upon infection with avian (A/Hong Kong/483/97, H5N1) but not seasonal (A/Hong Kong/54/98, H1N1) influenza virus. The reduced alveolar fluid transport associated with down-regulation of sodium and chloride transporters was prevented or reduced by coculture with mesenchymal stromal cells. In vivo, treatment of aged H5N1-infected mice with mesenchymal stromal cells increased their likelihood of survival. We conclude that mesenchymal stromal cells significantly reduce the impairment of alveolar fluid clearance induced by A/H5N1 infection in vitro and prevent or reduce A/H5N1-associated acute lung injury in vivo. This potential adjunctive therapy for severe influenza-induced lung disease warrants rapid clinical investigation.
Wang, Hao; Meng, Ai-Min; Li, Sheng-Hua; Zhou, Xiao-Liang
2017-07-01
Carcinoembryonic antigen (CEA) is a biomarker and therapy target for non‑small cell lung cancer (NSCLC), which is the most common type of lung cancer. Nanobodies with high target specificity are promising candidates to function as anti‑CEA probes. In the present study, the targeting effects of an anti‑CEA nanobody obtained from phage display were investigated using technetium‑99 m (99mTc) and fluorescence labeling. In vitro binding and immunofluorescent staining assays, as well as in vivo blood clearance and biodistribution assays were performed. High specificity and affinity of the nanobody for CEA‑positive H460 cells was observed in vitro. The pharmacokinetics assay of the 99mTc‑nanobody in Wistar rats demonstrated that the nanobody had appropriate T1/2α and T1/2β, which were 20.2 and 143.5 min, respectively. The biodistribution assay using H460 xenograft‑bearing nude mice demonstrated a high ratio of signal in tumor compared with background, which confirmed that the nanobody may be useful as a molecular probe for CEA‑positive cancer, particularly in NSCLC.
2010-01-01
... 14 Aeronautics and Space 4 2010-01-01 2010-01-01 false Security. 460.53 Section 460.53 Aeronautics and Space COMMERCIAL SPACE TRANSPORTATION, FEDERAL AVIATION ADMINISTRATION, DEPARTMENT OF....53 Security. An operator must implement security requirements to prevent any space flight participant...
Higgins, Brian; Kolinsky, Kenneth; Smith, Melissa; Beck, Gordon; Rashed, Mohammad; Adames, Violeta; Linn, Michael; Wheeldon, Eric; Gand, Laurent; Birnboeck, Herbert; Hoffmann, Gerhard
2004-06-01
Our objective was the preclinical assessment of the pharmacokinetics, monotherapy and combined antitumor activity of the epidermal growth factor receptor (HER1/EGFR) tyrosine kinase inhibitor erlotinib in athymic nude mice bearing non-small cell lung cancer (NSCLC) xenograft models. Immunohistochemistry determined the HER1/EGFR status of the NSCLC tumor models. Pharmacokinetic studies assessed plasma drug concentrations of erlotinib in tumor- and non-tumor-bearing athymic nude mice. These were followed by maximum tolerated dose (MTD) studies for erlotinib and each chemotherapy. Erlotinib was then assessed alone and in combination with these chemotherapies in the NSCLC xenograft models. Complete necropsies were performed on most of the animals in each study to further assess antitumor or toxic effects. Erlotinib monotherapy dose-dependently inhibited tumor growth in the H460a tumor model, correlating with circulating levels of drug. There was antitumor activity at the MTD with each agent tested in both the H460a and A549 tumor models (erlotinib 100 mg/kg: 71 and 93% tumor growth inhibition; gemcitabine 120 mg/kg: 93 and 75% tumor growth inhibition; cisplatin 6 mg/kg: 81 and 88% tumor growth inhibition). When each compound was given at a fraction of the MTD, tumor growth inhibition was suboptimal. Combinations of gemcitabine or cisplatin with erlotinib were assessed at 25% of the MTD to determine efficacy. In both NSCLC models, doses of gemcitabine (30 mg/kg) or cisplatin (1.5 mg/kg) with erlotinib (25 mg/kg) at 25% of the MTD were well tolerated. For the slow growing A549 tumor, there was significant tumor growth inhibition in the gemcitabine/erlotinib and cisplatin/erlotinib combinations (above 100 and 98%, respectively), with partial regressions. For the faster growing H460a tumor, there was significant but less remarkable tumor growth inhibition in these same combinations (86 and 53% respectively). These results show that in NSCLC xenograft tumors with similar
Lifescience Database Archive (English)
Full Text Available AF (Link to library) AFA460 (Link to dictyBase) - - - Contig-U15574-1 AFA460Z (Link... to Original site) - - AFA460Z 170 - - - - Show AFA460 Library AF (Link to library) Clone ID AFA460 (Link to dict...yBase) Atlas ID - NBRP ID - dictyBase ID - Link to Contig Contig-U15574-1 Original site URL http://dict...date 2001. 6. 2 Translated Amino Acid sequence ---QIHQTIQVVKITLSSASSSSSSSSSSILNKTRICTYINSNSTHSLXXNIYKYKLPK T...it* Frame B: ---QIHQTIQVVKITLSSASSSSSSSSSSILNKTRICTYINSNSTHSLXXNIYKYKLPK Frame C:
Ma, Li; Han, Xiao-hong; Wang, Shuai; Wang, Jian-fei; Shi, Yuan-kai
2012-09-25
To explore the effects of icotinib on the proliferation and apoptosis of various lung cancer cell lines. Human lung cancer cell lines HCC827, H1650, H1975, A549 and human epidermal cancer cell line A431 were treated in vitro with icotinib or gefitinib at a concentration gradient of 0 - 40 µmol/L. Their proliferation effects were analyzed by the thiazolyl blue (MTT) assay and the apoptotic effects detected by flow cytometer. The downstream signaling proteins were detected by Western blot. The median inhibitory concentrations (IC(50)) of icotinib for A431 and HCC827 cell lines were (0.04 ± 0.02) and (0.15 ± 0.06) µmol/L respectively. No significant differences existed between the inhibitions of gefitinib and icotinib on A431, HCC827, H1650, H1975 and A549 cell lines (all P > 0.05). Compared with H1650, H1975 and A549 cell lines, icotinib significantly inhibited A431 (P = 0.009, 0.005 and 0.000) and HCC827 (P = 0.001, 0.001 and 0.000) cell lines. And it lowered the expressions of p-AKT, p-ERK and survivin protein expression through the inhibited activity of p-EGFR protein. Icotinib can arrest the proliferation of lung adenocarcinoma cells with EGFR mutation or over-expression by inhibiting the signal pathways of AKT-ERK and survivin.
COX-2 and PPAR-γ confer cannabidiol-induced apoptosis of human lung cancer cells.
Ramer, Robert; Heinemann, Katharina; Merkord, Jutta; Rohde, Helga; Salamon, Achim; Linnebacher, Michael; Hinz, Burkhard
2013-01-01
The antitumorigenic mechanism of cannabidiol is still controversial. This study investigates the role of COX-2 and PPAR-γ in cannabidiol's proapoptotic and tumor-regressive action. In lung cancer cell lines (A549, H460) and primary cells from a patient with lung cancer, cannabidiol elicited decreased viability associated with apoptosis. Apoptotic cell death by cannabidiol was suppressed by NS-398 (COX-2 inhibitor), GW9662 (PPAR-γ antagonist), and siRNA targeting COX-2 and PPAR-γ. Cannabidiol-induced apoptosis was paralleled by upregulation of COX-2 and PPAR-γ mRNA and protein expression with a maximum induction of COX-2 mRNA after 8 hours and continuous increases of PPAR-γ mRNA when compared with vehicle. In response to cannabidiol, tumor cell lines exhibited increased levels of COX-2-dependent prostaglandins (PG) among which PGD(2) and 15-deoxy-Δ(12,14)-PGJ(2) (15d-PGJ(2)) caused a translocation of PPAR-γ to the nucleus and induced a PPAR-γ-dependent apoptotic cell death. Moreover, in A549-xenografted nude mice, cannabidiol caused upregulation of COX-2 and PPAR-γ in tumor tissue and tumor regression that was reversible by GW9662. Together, our data show a novel proapoptotic mechanism of cannabidiol involving initial upregulation of COX-2 and PPAR-γ and a subsequent nuclear translocation of PPAR-γ by COX-2-dependent PGs.
Patel, Eshan; Lynch, Christine; Ruff, Victoria; Reynolds, Mindy
2012-02-01
Nickel and cobalt are heavy metals found in land, water, and air that can enter the body primarily through the respiratory tract and accumulate to toxic levels. Nickel compounds are known to be carcinogenic to humans and animals, while cobalt compounds produce tumors in animals and are probably carcinogenic to humans. People working in industrial and manufacturing settings have an increased risk of exposure to these metals. The cytotoxicity of nickel and cobalt has individually been demonstrated; however, the underlying mechanisms of co-exposure to these heavy metals have not been explored. In this study, we investigated the effect of exposure of H460 human lung epithelial cells to nickel and cobalt, both alone and in combination, on cell survival, apoptotic mechanisms, and the generation of reactive oxygen species and double strand breaks. For simultaneous exposure, cells were exposed to a constant dose of 150 μM cobalt or nickel, which was found to be relatively nontoxic in single exposure experiments. We demonstrated that cells exposed simultaneously to cobalt and nickel exhibit a dose-dependent decrease in survival compared to the cells exposed to a single metal. The decrease in survival was the result of enhanced caspase 3 and 7 activation and cleavage of poly (ADP-ribose) polymerase. Co-exposure increased the production of ROS and the formation of double strand breaks. Pretreatment with N-acetyl cysteine alleviated the toxic responses. Collectively, this study demonstrates that co-exposure to cobalt and nickel is significantly more toxic than single exposure and that toxicity is related to the formation of ROS and DSB. Copyright © 2011 Elsevier Inc. All rights reserved.
International Nuclear Information System (INIS)
Liu, Zhiguo; Wang, Yi; Sun, Yusheng; Ren, Luqing; Huang, Yi; Cai, Yuepiao; Weng, Qiaoyou; Shen, Xueqian; Li, Xiaokun; Liang, Guang
2013-01-01
Recent advances have highlighted the importance of the endoplasmic reticulum (ER) in cell death processes. Pharmacological interventions that effectively enhance tumor cell death through activating ER stress have attracted a great deal of attention for anti-cancer therapy. A bio-evaluation on 113 curcumin analogs against four cancer cell lines was performed through MTT assay. Furthermore, real time cell assay and flow cytometer were used to evaluate the apoptotic induction of (1E,4E)-1,5-bis(5-bromo-2-ethoxyphenyl)penta-1,4-dien-3-one (B82). Western blot, RT-qPCR, and siRNA were then utilized to confirm whether B82-induced apoptosis is mediated through activating ER stress pathway. Finally, the in vivo anti-tumor effect of B82 was evaluated. B82 exhibited strong anti-tumor activity in non-small cell lung cancer (NSCLC) H460 cells. Treatment with B82 significantly induced apoptosis in H460 cells in vitro and inhibited H460 tumor growth in vivo. Further studies demonstrated that the B82-induced apoptosis is mediated by activating ER stress both in vitro and in vivo. A new monocarbonyl analog of curcumin, B82, exhibited anti-tumor effects on H460 cells via an ER stress-mediated mechanism. B82 could be further explored as a potential anticancer agent for the treatment of NSCLC
42 CFR 460.46 - Civil money penalties.
2010-10-01
... 42 Public Health 4 2010-10-01 2010-10-01 false Civil money penalties. 460.46 Section 460.46 Public...) Sanctions, Enforcement Actions, and Termination § 460.46 Civil money penalties. (a) CMS may impose civil money penalties up to the following maximum amounts: (1) For each violation regarding enrollment or...
42 CFR 460.60 - PACE organizational structure.
2010-10-01
... 42 Public Health 4 2010-10-01 2010-10-01 false PACE organizational structure. 460.60 Section 460... ELDERLY (PACE) PACE Administrative Requirements § 460.60 PACE organizational structure. (a) A PACE organization must be, or be a distinct part of, one of the following: (1) An entity of city, county, State, or...
46 CFR 153.460 - Fire protection systems.
2010-10-01
... 46 Shipping 5 2010-10-01 2010-10-01 false Fire protection systems. 153.460 Section 153.460... Requirements for Flammable Or Combustible Cargoes § 153.460 Fire protection systems. Each self-propelled ship... protection system listed beside the cargo in Table 1 and described in the footnotes to Table 1. (b) The...
42 CFR 460.106 - Plan of care.
2010-10-01
... 42 Public Health 4 2010-10-01 2010-10-01 false Plan of care. 460.106 Section 460.106 Public Health... ALL-INCLUSIVE CARE FOR THE ELDERLY (PACE) PROGRAMS OF ALL-INCLUSIVE CARE FOR THE ELDERLY (PACE) PACE Services § 460.106 Plan of care. (a) Basic requirement. The interdisciplinary team must promptly develop a...
International Nuclear Information System (INIS)
Mak, J.C.; Barnes, P.J.
1988-01-01
125 I-Human calcitonin gene-related peptide (hCGRP) binding sites were localized in human and guinea pig lungs by an autoradiographic method. Scatchard analysis of saturation experiments from slide-mounted sections of guinea pig lung displayed specific 125 I-hCGRP binding sites with a dissociation constant (Kd) of 0.72 +/- 0.05 nM (mean +/- S.E.M., n = 3) and a maximal number of binding sites (Bmax) of 133.4 +/- 5.6 fmol/mg protein. In both human and guinea pig lung, autoradiography revealed that CGRP binding sites were widely distributed, with particularly dense labeling over bronchial and pulmonary blood vessels of all sizes and alveolar walls. Airway smooth muscle and epithelium of large airways was sparsely labeled but no labeling was found over submucosal glands. This localization corresponds well to the reported pattern of CGRP-like immunoreactive innervation. The findings of localization of CGRP binding sites on bronchial and pulmonary blood vessels indicate that CGRP may be important in the regulation of airway and pulmonary blood flow
Directory of Open Access Journals (Sweden)
Wei JIA
2010-04-01
Full Text Available Background and objective PET/CT imaging is expensive, so searching the tumor imaging agent for SPECT/CT is necessary. 99Tcm-N(NOEt2 [bis (N-ethoxy-N-ethyl dithiocarbamato nitrido99Tcm (V] can be uptaken by lung cancer cells and other cells alike. The aim of this study is to evaluate the distinctive value in lung tumor with 99Tcm-N(NOEt2, the difference in its uptake kinetics in human embryonic lung diploid fibroblasts KMB17 and several kinds of lung cancer cells lines. Methods Firstly, six different cell culture medium which contained YTMLC Gejiu human lung squamous carcinoma cell, SPC-A1 human lung adenocarcinoma cell, AGZY low metastatic human lung adenocarcinoma, 973 high metastatic human lung adenocarcinoma cell, GLC-82 Gejiu human lung adenocarcinoma cell, and KMB17 human embryonic lung diploid fibroblast, respectively with equal cell density of 1×106/mL and the same volume were prepared; secondly, the same radioactive dose of 99Tcm-N(NOEt2 was added into each sample and then 300 μL mixed sample was taken out respectively and cultured in 37 oC culture box; Finally, 5 min, 15 min, 30 min, 45 min, 60 min, 75 min, 90 min after cultivation, centrifuged each cultured sample and determined the intracellular radiocounts of each sample, calculated each cell sample’s uptake rate of 99Tcm-N(NOEt2 at different time. Results Statistical difference was found among six cell samples, and the uptake rate sequence from high to low is 973 and SPC-A1>YTMLC>GLC-82>AGZY>KMB17 respectively; furthermore, 30 min-45 min after culture, the uptake rate reached stability, and the 45 min uptake rate of each sample was higher than its 96.7% uptake peak. Conclusion Based on the results above mentioned, it is supposed that there are discriminative clinical value when using 99Tcm-N(NOEt2 as a tumor targeting imaging agent, and 30 min or so after injection may be the best imaging time in the early imaging stage.
16 CFR 460.8 - R-value tolerances.
2010-01-01
... 16 Commercial Practices 1 2010-01-01 2010-01-01 false R-value tolerances. 460.8 Section 460.8... INSULATION § 460.8 R-value tolerances. If you are a manufacturer of home insulation, no individual specimen of the insulation you sell can have an R-value more than 10% below the R-value shown in a label, fact...
2010-01-01
... 16 Commercial Practices 1 2010-01-01 2010-01-01 false Labels. 460.12 Section 460.12 Commercial....12 Labels. If you are a manufacturer, you must label all packages of your insulation. The labels must... chart. Labels for these products must state the minimum net weight of the insulation in the package. You...
International Nuclear Information System (INIS)
Little, M.P.; Wakeford, R.
2002-01-01
Bystander effects following exposure to α-particles have been observed in C3H 10T 1/2 cells and in other experimental systems, and imply that linearly extrapolating low-dose risks from high-dose data might materially underestimate risk. The ratio of lung cancer risk among persons exposed to low and high doses of radon daughters is 2.4-4.0, with an upper 95% confidence limit (CL) of about 14. Assuming that the bystander effect observed in the C3H 10T 1/2 data applies to human lung cells in vivo, the epidemiological data imply that the number of neighbouring cells that can contribute to the bystander effect is between 0 and 1, with an upper 95% CL of about 7. As a consequence, the bystander effect observed in the C3H 10T 1/2 system probably does not play a large part in the process of radon-induced lung carcinogenesis in humans. Other experimental data relating to the bystander effect after α-particle exposure are surveyed; some of these data are more compatible with the epidemiological data. (author)
International Nuclear Information System (INIS)
He Wenqian; Liu Zhonghua
2007-01-01
Objective: To study the effect of bcl-2 antisense oligodexynucleotides on chemotherapy efficacy of Vp-16 on human small cell lung cancer cell line NCI-H69. Methods: Cultured NCI-H69 cells were derided into 4 groups: bcl-2 antisense oligodexynucleotides (ASODN) added, sense oligodexynucleotides (SODN) added, nonsense oligodexynucleotides (NSODN) added and control (no nucleotides added), the oligodexynucleotides were transfected into the cultured cells with oligofectamine. The cellular expression of Bcl-2 protein 72h later was examined with Western-Blot. The four different groups of cultured tumor cells were treated with etopside(Vp-16) at different concentrations (0, 0.25, 0.5, 1.0, 2.0 and 4.0 μg/ml) for 48hr then the cell survival fraction was assessed with MTY test. Results: The apoptotic rate of cells in the ASODN group was significantly higher than that of the control group, also, the survival fraction of cells in ASODN group was significantly lower than that of the control group. The Bcl-2 protein expression in ASODN group was significantly lower than that in the control group, but no inhibition was observed in SODN and NSODN groups. Conclusion: The bcl-2 ASODN could enhance the sensitivity to chemotherapy with Vp-16 in small cell lung cancer cell line NCI-H69 by effectively blocking bcl-2 gene expression. (authors)
A study of radiation sensitivity and drug-resistance by DNA methylation in human tumor cell lines
International Nuclear Information System (INIS)
Jung, Il Lae; Kim, In Gyu; Kim, Kug Chan
2009-12-01
It has recently been known that functional loss of tumor suppressive genes may com from DNA methylation on the chromosome. This kind of tumorigenesis has became one of the major field related to the epigenetics, whose study would be an important fundamental approach in cancer therapy market. In this study, we firstly selected two radiation-resistant mutant H460 cells, which doesn't show any significant cytotoxic effect compared to their parental wild type H460. We found that the two mutants has decreased level of PTEN, whose expression has known to be related to the cell differentiation and growth. We also found that the level of PTEN was greatly different in two lung adenocarcinoma, H460 and A549, in which more radiation-resistant A549 cells showed the decreased PTEN expression. This difference in PTEN expression between two cells was resulted from their different methylation on 5 CpG islands. We expect to know more profoundly through investigating the PTEN-related downstream genes
Bystander effects of exposure to low-dose-rate 125I seeds on human lung cancers cells in vitro
International Nuclear Information System (INIS)
Jia Rongfei; Chen Honghong; Yu Lei; Zhao Meijia; Shao Chunlin; Cheng Wenying
2007-01-01
The bystander effects induced by continuous low-dose-rate (LDR) 125 I seeds radiation on damage of human lung cancer cells were investigated. Human adenocarcinoma cell line A549 and human small cell lung cancer cell line NCI-H446, which have different sensitivities to high-dose rate (HDR) external irradiation, were exposed directly to 125 I seeds in vitro and co-cultured with unirradiated cells for 24 h. Using cytokinesis-blocking micronucleus method and γ H2AX fluorescence immunoassay, bystander effects induced by 2Gy and 4Gy 125 I seed irradiation on micronucleus formation and DNA double-strand breaks (DSBs) of human lung cancer cells were detected and evaluated. The results showed that irradiation with 125 I seeds can induce medium-mediated bystander effects in A549 cells and NCI-H446 cells, exhibiting that both micronuclei formation and γ H2AX focus formation in bystander cells were increased significantly compared with non-irradiated cells. The extent of DNA damage induced by bystander effects was correlated with accumulated radiation dose and radiosensitive of tumor cells. NCI-H446 cells that were sensitive to HDR γ irradiation were more sensitive to continuous LDR irradiation and bystander effects than A549. However, a comparison between the bystander effects and direct effects elicits the intensity of bystander responses of A549 cells was higher than that of NCI-H446 cells. A dose-related reduction in bystander responses was observed both in A549 cells and NCI-H446 cells, suggesting that the signaling factors involved in the bystander signaling pathways may decrease with the increase of cell damages. (authors)
13 CFR 130.460 - Budget justification.
2010-01-01
... 13 Business Credit and Assistance 1 2010-01-01 2010-01-01 false Budget justification. 130.460 Section 130.460 Business Credit and Assistance SMALL BUSINESS ADMINISTRATION SMALL BUSINESS DEVELOPMENT...) Cost principles. Principles for determining allowable costs are contained in OMB Circulars A-21 (cost...
Directory of Open Access Journals (Sweden)
Anastasia Velalopoulou
2017-11-01
Full Text Available Radiation therapy for the treatment of thoracic malignancies has improved significantly by directing of the proton beam in higher doses on the targeted tumor while normal tissues around the tumor receive much lower doses. Nevertheless, exposure of normal tissues to protons is known to pose a substantial risk in long-term survivors, as confirmed by our work in space-relevant exposures of murine lungs to proton radiation. Thus, radioprotective strategies are being sought. We established that LGM2605 is a potent protector from radiation-induced lung toxicity and aimed in the current study to extend the initial findings of space-relevant, proton radiation-associated late lung damage in mice by looking at acute changes in human lung. We used an ex vivo model of organ culture where tissue slices of donor living human lung were kept in culture and exposed to proton radiation. We exposed donor human lung precision-cut lung sections (huPCLS, pretreated with LGM2605, to 4 Gy proton radiation and evaluated them 30 min and 24 h later for gene expression changes relevant to inflammation, oxidative stress, and cell cycle arrest, and determined radiation-induced senescence, inflammation, and oxidative tissue damage. We identified an LGM2605-mediated reduction of proton radiation-induced cellular senescence and associated cell cycle changes, an associated proinflammatory phenotype, and associated oxidative tissue damage. This is a first report on the effects of proton radiation and of the radioprotective properties of LGM2605 on human lung.
42 CFR 460.18 - CMS evaluation of applications.
2010-10-01
... 42 Public Health 4 2010-10-01 2010-10-01 false CMS evaluation of applications. 460.18 Section 460... ELDERLY (PACE) PACE Organization Application and Waiver Process § 460.18 CMS evaluation of applications. CMS evaluates an application for approval as a PACE organization on the basis of the following...
Tiny plastic lung mimics human pulmonary function
Careers Inclusion & Diversity Work-Life Balance Career Resources Apply for a Job Postdocs Students Goals Recycling Green Purchasing Pollution Prevention Reusing Water Resources Environmental Management Releases - 2016 » April » Tiny plastic lung mimics human pulmonary function Tiny plastic lung mimics
Wang, Qian; Acharya, Narayan; Liu, Zhongwei; Zhou, Xianmei; Cromie, Meghan; Zhu, Jia; Gao, Weimin
2018-05-10
Experience-based herbal medicine as a complementary to modern western medicine has triggered an array of studies in quest of novel anticancer drugs. Scutellaria barbata D. Don (SB) is commonly used to treat different types of cancers, but its molecular mechanism of action is not clearly understood. In this study, we attempted to elucidate the mode of action of a traditional Chinese medicine prescription with a total of 14 components, named Lian-Jia-San-Jie-Fang (LJSJF, in Chinese), where SB works as the "principle" against non-small cell lung cancer (NSCLC) cells. Four different NSCLC cell lines (A549, H460, H1650, and H1975) were used. Cytotoxicity, in vitro tumorigenicity, gene expression, and protein expression were analyzed by MTT assay, soft agar assay, real-time PCR, and Western blots, respectively. Among the 14 components in LJSJF, SB was the only one to possess cytotoxic effects at its pharmacologically relevant doses. Additionally, we observed synergistically dose-dependent cytotoxic effects of SB in combination with other LJSJF components. After SB or LJSJF treatment, significant reductions in colony number and/or size were observed in A549 and H460; a notable dose-dependent decrease in EGFR was observed in A549, H460, and H1650; significant downregulation in EGFR and its downstream signaling targets mTOR and p38MAPK were also observed in A549 and H460; and p53 and p21 were significantly increased while survivin, cyclin D1, and MDM2 were significantly decreased in A549. Additionally, p53, p21, and Mettl7b were decreased, but p73 was increased in H460. Neither EGFR nor p53 was changed in H1975. Therefore, SB or LJSJF may induce cytotoxic effects by regulating multiple and/or distinct apoptotic pathways in different NSCLC cells. LJSJF exerts more pronounced cytotoxic effects against NSCLC cells than SB does by synergistically regulating the underlining molecular mechanisms including EGFR and/or p53 signaling pathways. Copyright © 2018 Elsevier B.V. All
Restoration of normal pH triggers ischemia-reperfusion injury in lung by Na+/H+ exchange activation.
Moore, T M; Khimenko, P L; Taylor, A E
1995-10-01
The effects of acidotic extracellular pH and Na+/H+ exchange inhibition on ischemia-reperfusion (I/R)-induced microvascular injury were studied in the isolated, buffer-perfused rat lung. When lungs were subjected to 45 min of ischemia followed by 30 min of reperfusion, the capillary filtration coefficient (Kfc) increased significantly, resulting in a change in Kfc (delta Kfc) of 0.360 +/- 0.09 ml.min-1.cmH2O-1.100 g-1. Addition of hydrochloric acid to the perfusate before ischemia at a concentration sufficient to reduce perfusate pH from 7.38 +/- 0.03 to 7.09 +/- 0.04 completely prevented the increase in Kfc associated with I/R (delta Kfc = 0.014 +/- 0.034 ml.min-1.cmH2O-1.100 g-1). Addition of a Na+/H+ exchange inhibitor, 5-(N,N-dimethyl)-amiloride, to the perfusate either before ischemia or at reperfusion also prevented the I/R-induced permeability increase (delta Kfc = 0.01 +/- 0.02 and -0.001 +/- 0.02 ml.min-1.cmH2O-1.100 g-1, respectively). We conclude that restoration of flow at physiological pH to the postischemic lung activates the Na+/H+ exchange system, which may represent the "triggering mechanism" responsible for initiating reperfusion-induced microvascular injury.
International Nuclear Information System (INIS)
Zhi, Xiuyi; Giroux-Leprieur, Etienne; Wislez, Marie; Hu, Mu; Zhang, Yi; Shi, Huaiyin; Du, Kaiqi; Wang, Lei
2015-01-01
Human RNA polymerase II (RNAPII)-associated factor 1 complex (hPAF1C) plays a crucial role in protein-coding gene transcription. Overexpression of hPAF1C has been implicated in the initiation and progression of various human cancers. However, the molecular pathways involved in tumorigenesis through hPAF1C remain to be elucidated. The current study suggested hPAF1C expression as a prognostic biomarker for early stage non-small cell lung cancer (NSCLC) and patients with low hPAF1C expression levels had significantly better overall survival. Furthermore, the expression of hPAF1C was found to be positively correlated with c-MYC expression in patient tumor samples and in cancer cell lines. Mechanistic studies indicated that hPAF1C could promote lung cancer cell proliferation through regulating c-MYC transcription. These results demonstrated the prognostic value of hPAF1C in early-stage NSCLC and the role of hPAF1C in the transcriptional regulation of c-MYC oncogene during NSCLC tumorigenesis. - Highlights: • hPAF1C expression is a prognostic biomarker for early stage non-small cell lung cancer. • The expression of hPAF1C was positively correlated with c-MYC in tumor samples of patients and in several NSCLC cell lines. • hPAF1C could promote lung cancer cell proliferation through regulating c-MYC transcription.
42 CFR 460.20 - Notice of CMS determination.
2010-10-01
... 42 Public Health 4 2010-10-01 2010-10-01 false Notice of CMS determination. 460.20 Section 460.20... ELDERLY (PACE) PACE Organization Application and Waiver Process § 460.20 Notice of CMS determination. (a... application to CMS, CMS takes one of the following actions: (1) Approves the application. (2) Denies the...
Human models of acute lung injury
Directory of Open Access Journals (Sweden)
Alastair G. Proudfoot
2011-03-01
Full Text Available Acute lung injury (ALI is a syndrome that is characterised by acute inflammation and tissue injury that affects normal gas exchange in the lungs. Hallmarks of ALI include dysfunction of the alveolar-capillary membrane resulting in increased vascular permeability, an influx of inflammatory cells into the lung and a local pro-coagulant state. Patients with ALI present with severe hypoxaemia and radiological evidence of bilateral pulmonary oedema. The syndrome has a mortality rate of approximately 35% and usually requires invasive mechanical ventilation. ALI can follow direct pulmonary insults, such as pneumonia, or occur indirectly as a result of blood-borne insults, commonly severe bacterial sepsis. Although animal models of ALI have been developed, none of them fully recapitulate the human disease. The differences between the human syndrome and the phenotype observed in animal models might, in part, explain why interventions that are successful in models have failed to translate into novel therapies. Improved animal models and the development of human in vivo and ex vivo models are therefore required. In this article, we consider the clinical features of ALI, discuss the limitations of current animal models and highlight how emerging human models of ALI might help to answer outstanding questions about this syndrome.
Expression and function of human hemokinin-1 in human and guinea pig airways.
Grassin-Delyle, Stanislas; Naline, Emmanuel; Buenestado, Amparo; Risse, Paul-André; Sage, Edouard; Advenier, Charles; Devillier, Philippe
2010-10-07
Human hemokinin-1 (hHK-1) and endokinins are peptides of the tachykinin family encoded by the TAC4 gene. TAC4 and hHK-1 expression as well as effects of hHK-1 in the lung and airways remain however unknown and were explored in this study. RT-PCR analysis was performed on human bronchi to assess expression of tachykinin and tachykinin receptors genes. Enzyme immunoassay was used to quantify hHK-1, and effects of hHK-1 and endokinins on contraction of human and guinea pig airways were then evaluated, as well as the role of hHK-1 on cytokines production by human lung parenchyma or bronchi explants and by lung macrophages. In human bronchi, expression of the genes that encode for hHK-1, tachykinin NK1-and NK2-receptors was demonstrated. hHK-1 protein was found in supernatants from explants of human bronchi, lung parenchyma and lung macrophages. Exogenous hHK-1 caused a contractile response in human bronchi mainly through the activation of NK2-receptors, which blockade unmasked a NK1-receptor involvement, subject to a rapid desensitization. In the guinea pig trachea, hHK-1 caused a concentration-dependant contraction mainly mediated through the activation of NK1-receptors. Endokinin A/B exerted similar effects to hHK-1 on both human bronchi and guinea pig trachea, whereas endokinins C and D were inactive. hHK-1 had no impact on the production of cytokines by explants of human bronchi or lung parenchyma, or by human lung macrophages. We demonstrate endogenous expression of TAC4 in human bronchi, the encoded peptide hHK-1 being expressed and involved in contraction of human and guinea pig airways.
Expression and function of human hemokinin-1 in human and guinea pig airways
Directory of Open Access Journals (Sweden)
Sage Edouard
2010-10-01
Full Text Available Abstract Background Human hemokinin-1 (hHK-1 and endokinins are peptides of the tachykinin family encoded by the TAC4 gene. TAC4 and hHK-1 expression as well as effects of hHK-1 in the lung and airways remain however unknown and were explored in this study. Methods RT-PCR analysis was performed on human bronchi to assess expression of tachykinin and tachykinin receptors genes. Enzyme immunoassay was used to quantify hHK-1, and effects of hHK-1 and endokinins on contraction of human and guinea pig airways were then evaluated, as well as the role of hHK-1 on cytokines production by human lung parenchyma or bronchi explants and by lung macrophages. Results In human bronchi, expression of the genes that encode for hHK-1, tachykinin NK1-and NK2-receptors was demonstrated. hHK-1 protein was found in supernatants from explants of human bronchi, lung parenchyma and lung macrophages. Exogenous hHK-1 caused a contractile response in human bronchi mainly through the activation of NK2-receptors, which blockade unmasked a NK1-receptor involvement, subject to a rapid desensitization. In the guinea pig trachea, hHK-1 caused a concentration-dependant contraction mainly mediated through the activation of NK1-receptors. Endokinin A/B exerted similar effects to hHK-1 on both human bronchi and guinea pig trachea, whereas endokinins C and D were inactive. hHK-1 had no impact on the production of cytokines by explants of human bronchi or lung parenchyma, or by human lung macrophages. Conclusions We demonstrate endogenous expression of TAC4 in human bronchi, the encoded peptide hHK-1 being expressed and involved in contraction of human and guinea pig airways.
International Nuclear Information System (INIS)
Liao, Hui-Fen; Kuo Cheng-Deng; Yang, Yuh-Cheng; Lin, Chin-Ping; Tai, Hung-Chi; Chen, Yu-Jen; Chen, Yu-Yawn
2005-01-01
Resveratrol, a polyphenol in red wine, possesses many pharmacological activities including cardio-protection, chemoprevention, anti-tumor effects, and nuclear factor-kappa B (NF-κB) inactivation. The present study was designed to evaluate the effects and possible mechanism of resveratrol in enhancing radiosensitivity of lung cancer cells. Human non-small cell lung cancer NCI-H838 cells were irradiated with or without resveratrol pretreatment. The surviving fraction and sensitizer enhancement ratio (SER) were estimated by using a colony formation assay and linear-quadratic model. The cell-cycle distribution was evaluated by using prospidium iodide staining and flow cytometry. An enzyme-linked immunosorbent assay (ELISA)-based assay with immobilized oligonucleotide was performed to assess the DNA binding activity of NF-κB. Resveratrol had no direct growth-inhibitory effect on NCI-H838 cells treated for 24 hours with doses up to 25 μM. Pretreatment with resveratrol significantly enhanced cell killing by radiation, with an SER up to 2.2. Radiation activated NF-κB, an effect reversed by resveratrol pretreatment. Resveratrol resulted in a decrease of cells in the G 0 /G 1 phase and an increase in the S phase. Our results demonstrate that resveratrol enhances the radiosensitivity of NCI-H838 cells accompanied by NF-κB inhibition and S-phase arrest. (author)
A human lung xenograft mouse model of Nipah virus infection.
Directory of Open Access Journals (Sweden)
Gustavo Valbuena
2014-04-01
Full Text Available Nipah virus (NiV is a member of the genus Henipavirus (family Paramyxoviridae that causes severe and often lethal respiratory illness and encephalitis in humans with high mortality rates (up to 92%. NiV can cause Acute Lung Injury (ALI in humans, and human-to-human transmission has been observed in recent outbreaks of NiV. While the exact route of transmission to humans is not known, we have previously shown that NiV can efficiently infect human respiratory epithelial cells. The molecular mechanisms of NiV-associated ALI in the human respiratory tract are unknown. Thus, there is an urgent need for models of henipavirus infection of the human respiratory tract to study the pathogenesis and understand the host responses. Here, we describe a novel human lung xenograft model in mice to study the pathogenesis of NiV. Following transplantation, human fetal lung xenografts rapidly graft and develop mature structures of adult lungs including cartilage, vascular vessels, ciliated pseudostratified columnar epithelium, and primitive "air" spaces filled with mucus and lined by cuboidal to flat epithelium. Following infection, NiV grows to high titers (10(7 TCID50/gram lung tissue as early as 3 days post infection (pi. NiV targets both the endothelium as well as respiratory epithelium in the human lung tissues, and results in syncytia formation. NiV infection in the human lung results in the production of several cytokines and chemokines including IL-6, IP-10, eotaxin, G-CSF and GM-CSF on days 5 and 7 pi. In conclusion, this study demonstrates that NiV can replicate to high titers in a novel in vivo model of the human respiratory tract, resulting in a robust inflammatory response, which is known to be associated with ALI. This model will facilitate progress in the fundamental understanding of henipavirus pathogenesis and virus-host interactions; it will also provide biologically relevant models for other respiratory viruses.
21 CFR 522.460 - Cloprostenol sodium.
2010-04-01
... 21 Food and Drugs 6 2010-04-01 2010-04-01 false Cloprostenol sodium. 522.460 Section 522.460 Food... Cloprostenol sodium. (a)(1) Specifications. Each milliliter of the aqueous solution contains 263 micrograms of cloprostenol sodium (equivalent to 250 micrograms of cloprostenol) in a sodium citrate, anhydrous citric acid...
Lee, Youn Ju; Lim, Taeho; Han, Min Su; Lee, Sun-Hwa; Baek, Suk-Hwan; Nan, Hong-Yan; Lee, Chuhee
2017-02-01
TAM receptor tyrosine kinases (RTKs), Tyro3, Axl and MerTK, transduce diverse signals responsible for cell survival, growth, proliferation and anti-apoptosis. In the present study, we demonstrated the effect of luteolin, a flavonoid with antioxidant, anti-inflammatory and anticancer activities, on the expression and activation of TAM RTKs and the association with its cytotoxicity in non-small cell lung cancer (NSCLC) cells. We observed the cytotoxic effect of luteolin in parental A549 and H460 cells as well as in cisplatin-resistant A549/CisR and H460/CisR cells. Exposure of these cells to luteolin also resulted in a dose‑dependent decrease in clonogenic ability. Next, luteolin was found to decrease the protein levels of all three TAM RTKs in the A549 and A549/CisR cells in a dose‑dependent manner. In a similar manner, in H460 and H460/CisR cells, the protein levels of Axl and Tyro3 were decreased following luteolin treatment. In addition, Axl promoter activity was decreased by luteolin, indicating that luteolin suppresses Axl expression at the transcriptional level. We next found that luteolin abrogated Axl phosphorylation in response to growth arrest-specific 6 (Gas6), its ligand, implying the inhibitory effect of luteolin on Gas6-induced Axl activation. Ectopic expression of Axl was observed to attenuate the antiproliferative effect of luteolin, while knockdown of the Axl protein level using a gold nanoparticle-assisted gene delivery system increased its cytotoxicity. In contrast to the inhibitory effect of luteolin on the expression of TAM RTKs, interleukin-8 (IL-8) production was not decreased by luteolin in H460 and H460/CisR cells, while IL-8 production/cell was increased. Collectively, our data suggest that TAM RTKs, but not IL-8, are promising therapeutic targets of luteolin to abrogate cell proliferation and to overcome chemoresistance in NSCLC cells.
16 CFR 460.11 - Rounding off R-values.
2010-01-01
... 16 Commercial Practices 1 2010-01-01 2010-01-01 false Rounding off R-values. 460.11 Section 460.11... INSULATION § 460.11 Rounding off R-values. R-values shown in labels, fact sheets, ads, or other promotional materials must be rounded to the nearest tenth. However, R-values of 10 or more may be rounded to the...
Particulate deposition in the human lung under lunar habitat conditions.
Darquenne, Chantal; Prisk, G Kim
2013-03-01
Lunar dust may be a toxic challenge to astronauts. While deposition in reduced gravity is less than in normal gravity (1 G), reduced gravitational sedimentation causes particles to penetrate deeper in the lung, potentially causing more harm. The likely design of the lunar habitat has a reduced pressure environment and low-density gas has been shown to reduce upper airway deposition and increase peripheral deposition. Breathing air and a reduced-density gas approximating the density of the proposed lunar habitat atmosphere, five healthy subjects inhaled 1 -microm diameter aerosol boluses at penetration volumes (V(p)) of 200 ml (central airways), 500 ml, and 1000 ml (lung periphery) in microgravity during parabolic flight, and in 1 G. Deposition in the lunar habitat was significantly less than for Earth conditions (and less than in 1 G with the low-density gas) with a relative decrease in deposition of -59.1 +/- 14.0% (-46.9 +/- 11.7%), -50.7 +/- 9.2% (-45.8 +/- 11.2%), and -46.0 +/- 8.3% (-45.3 +/- 11.1%) at V(p) = 200, 500, and 1000 ml, respectively. There was no significant effect of reduced density on deposition in 1 G. While minimally affected by gas density, deposition was significantly less in microgravity than in 1 G for both gases, with a larger portion of particles depositing in the lung periphery under lunar conditions than Earth conditions. Thus, gravity, and not gas properties, mainly affects deposition in the peripheral lung, suggesting that studies of aerosol transport in the lunar habitat need not be performed at the low density proposed for the atmosphere in that environment.
Protein clearance from the air spaces and lungs of unanesthetized sheep over 144 h
International Nuclear Information System (INIS)
Berthiaume, Y.; Albertine, K.H.; Grady, M.; Fick, G.; Matthay, M.A.
1989-01-01
We studied the rate, the routes, and the mechanisms for protein clearance from the air spaces and lungs of 20 unanesthetized sheep over 144 h. We instilled 100 ml of autologous serum labeled with 125I-albumin into one lung. At the end of 24, 48, 96, or 144 h, the lungs were removed and the residual native protein and 125I-albumin in the air spaces were determined by bronchoalveolar lavage. Also the fraction of the instilled 125I-albumin remaining in the rest of the lung was measured in the lung homogenate. Clearance of the 125I-albumin from the lung into the plasma, lymph, thyroid, urine, and feces was also determined. The removal of both the 125I-albumin and the native protein from the air spaces was slow, following a monoexponential decline. The removal rate of the 125I-albumin from the air spaces was slightly but significantly faster (1.6%/h) than the clearance rate of the native protein (0.9%/h). Clearance of the 125I-albumin from the lung also followed a slow monoexponential decline at a rate of 1.4%/h. At all time periods, 75% of the 125I-albumin remaining in the lung was located in the air spaces, thus indicating that the pulmonary epithelium is the principal barrier to protein clearance from the normal lung. Macrophages appeared to play a minor role in alveolar protein clearance because the quantity of 125I-albumin present in the phagocytic cells in the air spaces was less than 1% of the instilled 125I-albumin at all time periods. However, macrophages may play some role in protein clearance after 48 h because we visualized phagolysosomes in macrophages, and there was an increase in free iodine in lung lavage, urine, thyroid, and feces after 48 h. However, gel electrophoretic studies showed that most of the 125I-albumin was cleared from the lung as an intact molecule, although only 24.7 +/- 4.7% of the 125I-albumin was cleared by the lymphatics
Asmussen, Sven; Ito, Hiroshi; Traber, Daniel L; Lee, Jae W; Cox, Robert A; Hawkins, Hal K; McAuley, Daniel F; McKenna, David H; Traber, Lillian D; Zhuo, Hanjing; Wilson, Jennifer; Herndon, David N; Prough, Donald S; Liu, Kathleen D; Matthay, Michael A; Enkhbaatar, Perenlei
2014-09-01
Human bone marrow-derived mesenchymal stem (stromal) cells (hMSCs) improve survival in mouse models of acute respiratory distress syndrome (ARDS) and reduce pulmonary oedema in a perfused human lung preparation injured with Escherichia coli bacteria. We hypothesised that clinical grade hMSCs would reduce the severity of acute lung injury (ALI) and would be safe in a sheep model of ARDS. Adult sheep (30-40 kg) were surgically prepared. After 5 days of recovery, ALI was induced with cotton smoke insufflation, followed by instillation of live Pseudomonas aeruginosa (2.5×10(11) CFU) into both lungs under isoflurane anaesthesia. Following the injury, sheep were ventilated, resuscitated with lactated Ringer's solution and studied for 24 h. The sheep were randomly allocated to receive one of the following treatments intravenously over 1 h in one of the following groups: (1) control, PlasmaLyte A, n=8; (2) lower dose hMSCs, 5×10(6) hMSCs/kg, n=7; and (3) higher-dose hMSCs, 10×10(6) hMSCs/kg, n=4. By 24 h, the PaO2/FiO2 ratio was significantly improved in both hMSC treatment groups compared with the control group (control group: PaO2/FiO2 of 97±15 mm Hg; lower dose: 288±55 mm Hg (p=0.003); higher dose: 327±2 mm Hg (p=0.003)). The median lung water content was lower in the higher-dose hMSC-treated group compared with the control group (higher dose: 5.0 g wet/g dry [IQR 4.9-5.8] vs control: 6.7 g wet/g dry [IQR 6.4-7.5] (p=0.01)). The hMSCs had no adverse effects. Human MSCs were well tolerated and improved oxygenation and decreased pulmonary oedema in a sheep model of severe ARDS. NCT01775774 for Phase 1. NCT02097641 for Phase 2. Published by the BMJ Publishing Group Limited. For permission to use (where not already granted under a licence) please go to http://group.bmj.com/group/rights-licensing/permissions.
Absence of death receptor translocation into lipid rafts in acquired TRAIL-resistant NSCLC cells.
Ouyang, Wen; Yang, Chunxu; Zhang, Simin; Liu, Yu; Yang, Bo; Zhang, Junhong; Zhou, Fuxiang; Zhou, Yunfeng; Xie, Conghua
2013-02-01
Resistance to tumor necrosis factor-related apoptosis-inducing ligand (TRAIL) is a major limitation for its clinical use. The mechanisms of TRAIL resistance have been mostly studied in the context of cell lines that are intrinsically resistant to TRAIL. However, little is known about the molecular alterations that contribute to the development of acquired resistance during treatment with TRAIL. In this study, we established H460R, an isogenic cell line with acquired TRAIL resistance, from the TRAIL‑sensitive human lung cancer cell line H460 to investigate the mechanisms of acquired resistance. The acquired TRAIL‑resistant H460R cells remained sensitive to cisplatin. The mRNA and protein expression levels of death receptor 4 (DR4) and death receptor 5 (DR5) were not altered in either of the TRAIL-treated cell lines. Nevertheless, tests in which the DR4 or DR5 gene was overexpressed or silenced suggest that death receptor expression is necessary but not sufficient for TRAIL‑induced apoptosis. Compared with parental TRAIL-sensitive H460 cells, H460R cells showed a decreased TRAIL-induced translocation of DR4/DR5 into lipid rafts. Further studies showed that nystatin partially prevented lipid raft aggregation and DR4 and DR5 clustering and reduced apoptosis in H460 cells again. Analysis of apoptotic molecules showed that more pro-caspase-8, FADD, caspase-3 and Bid, but less cFLIP in H460 cells than in H460R cells. Our findings suggest that the lack of death receptor redistribution negatively impacts DISC assembly in lipid rafts, which at least partially leads to the development of acquired resistance to TRAIL in H460R cells.
Dare, Ryan; Sanghavi, Sonali; Bullotta, Arlene; Keightley, Maria-Cristina; George, Kirsten St; Wadowsky, Robert M; Paterson, David L; McCurry, Kenneth R; Reinhart, Todd A; Husain, Shahid; Rinaldo, Charles R
2007-02-01
Human metapneumovirus (hMPV) is a recently discovered paramyxovirus that is known to cause respiratory tract infections in children and immunocompromised individuals. Given the difficulties of identifying hMPV by conventional culture, molecular techniques could improve the detection of this virus in clinical specimens. In this study, we developed a real-time reverse transcription-PCR (RT-PCR) assay designed to detect the four genetic lineages of hMPV. This assay and a commercial real-time nucleic acid sequence-based amplification (NASBA) assay (bioMérieux, Durham, NC) were used to determine the prevalence of hMPV in 114 immunosuppressed asymptomatic and symptomatic lung transplant recipients and 232 pediatric patients who were being evaluated for pertussis. hMPV was detected in 4.3% of the immunosuppressed lung transplant recipients and in 9.9% of children evaluated for pertussis. Both RT-PCR and NASBA assays were efficient in detection of hMPV infection in respiratory specimens. Even though hMPV was detected in a small number of the lung transplant recipients, it was still the most prevalent etiologic agent detected in patients with respiratory symptoms. In both of these diverse patient populations, hMPV infection was the most frequent viral respiratory tract infection identified. Given our findings, infection with hMPV infection should be determined as part of the differential diagnosis of respiratory illnesses.
Dare, Ryan; Sanghavi, Sonali; Bullotta, Arlene; Keightley, Maria-Cristina; George, Kirsten St.; Wadowsky, Robert M.; Paterson, David L.; McCurry, Kenneth R.; Reinhart, Todd A.; Husain, Shahid; Rinaldo, Charles R.
2007-01-01
Human metapneumovirus (hMPV) is a recently discovered paramyxovirus that is known to cause respiratory tract infections in children and immunocompromised individuals. Given the difficulties of identifying hMPV by conventional culture, molecular techniques could improve the detection of this virus in clinical specimens. In this study, we developed a real-time reverse transcription-PCR (RT-PCR) assay designed to detect the four genetic lineages of hMPV. This assay and a commercial real-time nucleic acid sequence-based amplification (NASBA) assay (bioMérieux, Durham, NC) were used to determine the prevalence of hMPV in 114 immunosuppressed asymptomatic and symptomatic lung transplant recipients and 232 pediatric patients who were being evaluated for pertussis. hMPV was detected in 4.3% of the immunosuppressed lung transplant recipients and in 9.9% of children evaluated for pertussis. Both RT-PCR and NASBA assays were efficient in detection of hMPV infection in respiratory specimens. Even though hMPV was detected in a small number of the lung transplant recipients, it was still the most prevalent etiologic agent detected in patients with respiratory symptoms. In both of these diverse patient populations, hMPV infection was the most frequent viral respiratory tract infection identified. Given our findings, infection with hMPV infection should be determined as part of the differential diagnosis of respiratory illnesses. PMID:17065270
Metzger, Michael W; Walser, Sandra M; Dedic, Nina; Aprile-Garcia, Fernando; Jakubcakova, Vladimira; Adamczyk, Marek; Webb, Katharine J; Uhr, Manfred; Refojo, Damian; Schmidt, Mathias V; Friess, Elisabeth; Steiger, Axel; Kimura, Mayumi; Chen, Alon; Holsboer, Florian; Arzt, Eduardo; Wurst, Wolfgang; Deussing, Jan M
2017-11-29
A single nucleotide polymorphism substitution from glutamine (Gln, Q) to arginine (Arg, R) at codon 460 of the purinergic P2X7 receptor (P2X7R) has repeatedly been associated with mood disorders. The P2X7R-Gln460Arg variant per se is not compromised in its function. However, heterologous expression of P2X7R-Gln460Arg together with wild-type P2X7R has recently been demonstrated to impair receptor function. Here we show that this also applies to humanized mice coexpressing both human P2X7R variants. Primary hippocampal cells derived from heterozygous mice showed an attenuated calcium uptake upon agonist stimulation. While humanized mice were unaffected in their behavioral repertoire under basal housing conditions, mice that harbor both P2X7R variants showed alterations in their sleep quality resembling signs of a prodromal disease stage. Also healthy heterozygous human subjects showed mild changes in sleep parameters. These results indicate that heterozygosity for the wild-type P2X7R and its mood disorder-associated variant P2X7R-Gln460Arg represents a genetic risk factor, which is potentially able to convey susceptibility to mood disorders. SIGNIFICANCE STATEMENT Depression and bipolar disorder are the most common mood disorders. The P2X7 receptor (P2X7R) regulates many cellular functions. Its polymorphic variant Gln460Arg has repeatedly been associated with mood disorders. Genetically engineered mice, with human P2X7R, revealed that heterozygous mice (i.e., they coexpress the disease-associated Gln460Arg variant together with its normal version) have impaired receptor function and showed sleep disturbances. Human participants with the heterozygote genotype also had subtle alterations in their sleep profile. Our findings suggest that altered P2X7R function in heterozygote individuals disturbs sleep and might increase the risk for developing mood disorders. Copyright © 2017 the authors 0270-6474/17/3711688-13$15.00/0.
Analytic Intermodel Consistent Modeling of Volumetric Human Lung Dynamics.
Ilegbusi, Olusegun; Seyfi, Behnaz; Neylon, John; Santhanam, Anand P
2015-10-01
Human lung undergoes breathing-induced deformation in the form of inhalation and exhalation. Modeling the dynamics is numerically complicated by the lack of information on lung elastic behavior and fluid-structure interactions between air and the tissue. A mathematical method is developed to integrate deformation results from a deformable image registration (DIR) and physics-based modeling approaches in order to represent consistent volumetric lung dynamics. The computational fluid dynamics (CFD) simulation assumes the lung is a poro-elastic medium with spatially distributed elastic property. Simulation is performed on a 3D lung geometry reconstructed from four-dimensional computed tomography (4DCT) dataset of a human subject. The heterogeneous Young's modulus (YM) is estimated from a linear elastic deformation model with the same lung geometry and 4D lung DIR. The deformation obtained from the CFD is then coupled with the displacement obtained from the 4D lung DIR by means of the Tikhonov regularization (TR) algorithm. The numerical results include 4DCT registration, CFD, and optimal displacement data which collectively provide consistent estimate of the volumetric lung dynamics. The fusion method is validated by comparing the optimal displacement with the results obtained from the 4DCT registration.
Cigarette smoke induces an unfolded protein response in the human lung: a proteomic approach.
Kelsen, Steven G; Duan, Xunbao; Ji, Rong; Perez, Oscar; Liu, Chunli; Merali, Salim
2008-05-01
Cigarette smoking, which exposes the lung to high concentrations of reactive oxidant species (ROS) is the major risk factor for chronic obstructive pulmonary disease (COPD). Recent studies indicate that ROS interfere with protein folding in the endoplasmic reticulum and elicit a compensatory response termed the "unfolded protein response" (UPR). The importance of the UPR lies in its ability to alter expression of a variety of genes involved in antioxidant defense, inflammation, energy metabolism, protein synthesis, apoptosis, and cell cycle regulation. The present study used comparative proteomic technology to test the hypothesis that chronic cigarette smoking induces a UPR in the human lung. Studies were performed on lung tissue samples obtained from three groups of human subjects: nonsmokers, chronic cigarette smokers, and ex-smokers. Proteomes of lung samples from chronic cigarette smokers demonstrated 26 differentially expressed proteins (20 were up-regulated, 5 were down-regulated, and 1 was detected only in the smoking group) compared with nonsmokers. Several UPR proteins were up-regulated in smokers compared with nonsmokers and ex-smokers, including the chaperones, glucose-regulated protein 78 (GRP78) and calreticulin; a foldase, protein disulfide isomerase (PDI); and enzymes involved in antioxidant defense. In cultured human airway epithelial cells, GRP78 and the UPR-regulated basic leucine zipper, transcription factors, ATF4 and Nrf2, which enhance expression of important anti-oxidant genes, increased rapidly (< 24 h) with cigarette smoke extract. These data indicate that cigarette smoke induces a UPR response in the human lung that is rapid in onset, concentration dependent, and at least partially reversible with smoking cessation. We speculate that activation of a UPR by cigarette smoke may protect the lung from oxidant injury and the development of COPD.
International Nuclear Information System (INIS)
Ali, Waqas; Raza, Muhammad Usman; Iqbal, Samir M; Moghaddam, Fatemeh Jalvhei; Bui, Loan; Sayles, Bailey; Kim, Young-Tae
2016-01-01
Tumor cells are malignant derivatives of normal cells. There are characteristic differences in the mechanophysical properties of normal and tumor cells, and these differences stem from the changes that occur in the cell cytoskeleton during cancer progression. There is a need for viable whole blood processing techniques for rapid and reliable tumor cell detection that do not require tagging. Micropore biosensors have previously been used to differentiate tumor cells from normal cells and we have used a micropore-based electromechanical transducer to differentiate one type of tumor cells from the other types. This device generated electrical signals that were characteristic of the cell properties. Three non-small cell lung cancer (NSCLC) cell lines, NCl-H1155, A549 and NCI-H460, were successfully differentiated. NCI-H1155, due to their comparatively smaller size, were found to be the quickest in translocating through the micropore. Their translocation through a 15 μm micropore caused electrical pulses with an average translocation time of 101 ± 9.4 μs and an average peak amplitude of 3.71 ± 0.42 μA, whereas translocation of A549 and NCI-H460 caused pulses with average translocation times of 126 ± 17.9 μs and 148 ± 13.7 μs and average peak amplitudes of 4.58 ± 0.61 μA and 5.27 ± 0.66 μA, respectively. This transformation of the differences in cell properties into differences in the electrical profiles (i.e. the differences in peak amplitudes and translocation times) with this electromechanical transducer is a quantitative way to differentiate these lung cancer cells. The solid-state micropore device processed whole biological samples without any pre-processing requirements and is thus ideal for point-of-care applications. (paper)
Lectin enhancement of the lipofection efficiency in human lung carcinoma cells.
Yanagihara, K; Cheng, P W
1999-10-18
Poor transfection efficiency of human lung carcinoma cells by lipofection begs further development of more efficient gene delivery strategies. The purpose of this study was to determine whether lectins can improve the lipofection efficiency in lung carcinoma cells. A549, Calu3, and H292 cells grown to 90% confluence were transfected for 18 h with a plasmid DNA containing a beta-galactosidase reporter gene (pCMVlacZ) using lipofectin plus a lectin as the vector. Ten different lectins, which exhibit a wide range of carbohydrate-binding specificities, were examined for their abilities to enhance the efficiency of lipofection. The transfected cells were assessed for transfection efficiency by beta-galactosidase activity (units/microg protein) and % blue cells following X-Gal stain. Lipofectin supplemented with Griffonia simplicifolia-I (GS-I) yields largest enhancement of the lipofection efficiency in A549 and Calu3 cells (5.3- and 28-fold, respectively). Maackia amurensis gives the largest enhancement (6.5-fold) of lipofection efficiency in H292 cells. The transfection efficiency correlates with the amounts of DNA delivered to the nucleus. Binding of FITC-labeled GS-I and the enhancement of the lipofection efficiency by GS-I were inhibited by alpha-methyl-D-galactopyranoside, indicating an alpha-galactoside-mediated gene transfer to lung carcinoma cells. We conclude that lectin-facilitated lipofection is an efficient gene delivery strategy. Employment of cell type-specific lectins may allow for efficient cell type-specific gene targeting.
Expression analysis of asthma candidate genes during human and murine lung development.
Melén, Erik; Kho, Alvin T; Sharma, Sunita; Gaedigk, Roger; Leeder, J Steven; Mariani, Thomas J; Carey, Vincent J; Weiss, Scott T; Tantisira, Kelan G
2011-06-23
Little is known about the role of most asthma susceptibility genes during human lung development. Genetic determinants for normal lung development are not only important early in life, but also for later lung function. To investigate the role of expression patterns of well-defined asthma susceptibility genes during human and murine lung development. We hypothesized that genes influencing normal airways development would be over-represented by genes associated with asthma. Asthma genes were first identified via comprehensive search of the current literature. Next, we analyzed their expression patterns in the developing human lung during the pseudoglandular (gestational age, 7-16 weeks) and canalicular (17-26 weeks) stages of development, and in the complete developing lung time series of 3 mouse strains: A/J, SW, C57BL6. In total, 96 genes with association to asthma in at least two human populations were identified in the literature. Overall, there was no significant over-representation of the asthma genes among genes differentially expressed during lung development, although trends were seen in the human (Odds ratio, OR 1.22, confidence interval, CI 0.90-1.62) and C57BL6 mouse (OR 1.41, CI 0.92-2.11) data. However, differential expression of some asthma genes was consistent in both developing human and murine lung, e.g. NOD1, EDN1, CCL5, RORA and HLA-G. Among the asthma genes identified in genome wide association studies, ROBO1, RORA, HLA-DQB1, IL2RB and PDE10A were differentially expressed during human lung development. Our data provide insight about the role of asthma susceptibility genes during lung development and suggest common mechanisms underlying lung morphogenesis and pathogenesis of respiratory diseases.
Directory of Open Access Journals (Sweden)
Laura Espana-Serrano
2016-01-01
Full Text Available Lung cancer is the leading cause of cancer deaths in both men and women in the United States accounting for about 27% of all cancer deceases. In our effort to develop newer therapy for lung cancer, we evaluated the combinatory antitumor effect of siRNA targeting VEGF and the PI3K/mTOR dual inhibitor PF-04691502. We analyzed the anticancer effect of siRNA VEGF and PF-04691502 combination on proliferation, colony formation and migration of A549 and H460 lung cancer cells. Additionally, we assessed the combination treatment antiangiogenic effect on human umbilical vein endothelial cells. Here, we show for the first time that the antiangiogenic siRNA VEGF potentiates the PF-04691502 anticancer activity against non–small-cell lung cancer. We observed a significant (P < 0.05 decrease in cell viability, colony formation, and migration for the combination comparing with the single drug treatment. We also showed a significant (P < 0.05 enhanced effect of the combination treatment inhibiting angiogenesis progression and tube formation organization compared to the single drug treatment groups. Our findings demonstrated an enhanced synergistic anticancer effect of siRNA VEGF and PF-04691502 combination therapy by targeting two main pathways involved in lung cancer cell survival and angiogenesis which will be useful for future preclinical studies and potentially for lung cancer patient management.
International Nuclear Information System (INIS)
Wörmann, Xenia; Lesch, Markus; Welke, Robert-William; Okonechnikov, Konstantin; Abdurishid, Mirshat; Sieben, Christian; Geissner, Andreas; Brinkmann, Volker; Kastner, Markus; Karner, Andreas; Zhu, Rong; Hinterdorfer, Peter; Anish, Chakkumkal; Seeberger, Peter H.; Herrmann, Andreas
2016-01-01
The 2009 influenza pandemic originated from a swine-origin H1N1 virus, which, although less pathogenic than anticipated, may acquire additional virulence-associated mutations in the future. To estimate the potential risk, we sequentially passaged the isolate A/Hamburg/04/2009 in A549 human lung epithelial cells. After passage 6, we observed a 100-fold increased replication rate. High-throughput sequencing of viral gene segments identified five dominant mutations, whose contribution to the enhanced growth was analyzed by reverse genetics. The increased replication rate was pinpointed to two mutations within the hemagglutinin (HA) gene segment (HA_1 D130E, HA_2 I91L), near the receptor binding site and the stem domain. The adapted virus also replicated more efficiently in mice in vivo. Enhanced replication rate correlated with increased fusion pH of the HA protein and a decrease in receptor affinity. Our data might be relevant for surveillance of pre-pandemic strains and development of high titer cell culture strains for vaccine production. - Highlights: • We observed a spontaneous mutation of a 2009-pandemic H1N1 influenza virus in vitro. • The adaptation led to a 100-fold rise in replication rate in human A549 cells. • Adaptation was caused by two mutations in the HA gene segment. • Adaptation correlates with increased fusion pH and decreased receptor affinity.
Energy Technology Data Exchange (ETDEWEB)
Wörmann, Xenia [Department of Molecular Biology, Max Planck Institute for Infection Biology, Berlin (Germany); Lesch, Markus [Department of Molecular Biology, Max Planck Institute for Infection Biology, Berlin (Germany); Steinbeis Innovation gGmbH, Center for Systems Biomedicine, Falkensee (Germany); Welke, Robert-William [Department of Biology, Molecular Biophysics, IRI Life Sciences, Humboldt-Universität zu Berlin (Germany); Okonechnikov, Konstantin; Abdurishid, Mirshat [Department of Molecular Biology, Max Planck Institute for Infection Biology, Berlin (Germany); Sieben, Christian [Department of Biology, Molecular Biophysics, IRI Life Sciences, Humboldt-Universität zu Berlin (Germany); Geissner, Andreas [Department for Biomolecular Systems, Max Planck Institute for Colloids and Interfaces, Potsdam (Germany); Institute of Chemistry and Biochemistry, Free University, Berlin (Germany); Brinkmann, Volker [Department of Molecular Biology, Max Planck Institute for Infection Biology, Berlin (Germany); Kastner, Markus [Institute for Biophysics, Johannes Kepler University, Linz (Austria); Karner, Andreas [Center for Advanced Bioanalysis GmbH (CBL), Linz (Austria); Zhu, Rong; Hinterdorfer, Peter [Institute for Biophysics, Johannes Kepler University, Linz (Austria); Anish, Chakkumkal [Department for Biomolecular Systems, Max Planck Institute for Colloids and Interfaces, Potsdam (Germany); Seeberger, Peter H. [Department for Biomolecular Systems, Max Planck Institute for Colloids and Interfaces, Potsdam (Germany); Institute of Chemistry and Biochemistry, Free University, Berlin (Germany); Herrmann, Andreas [Department of Biology, Molecular Biophysics, IRI Life Sciences, Humboldt-Universität zu Berlin (Germany); and others
2016-05-15
The 2009 influenza pandemic originated from a swine-origin H1N1 virus, which, although less pathogenic than anticipated, may acquire additional virulence-associated mutations in the future. To estimate the potential risk, we sequentially passaged the isolate A/Hamburg/04/2009 in A549 human lung epithelial cells. After passage 6, we observed a 100-fold increased replication rate. High-throughput sequencing of viral gene segments identified five dominant mutations, whose contribution to the enhanced growth was analyzed by reverse genetics. The increased replication rate was pinpointed to two mutations within the hemagglutinin (HA) gene segment (HA{sub 1} D130E, HA{sub 2} I91L), near the receptor binding site and the stem domain. The adapted virus also replicated more efficiently in mice in vivo. Enhanced replication rate correlated with increased fusion pH of the HA protein and a decrease in receptor affinity. Our data might be relevant for surveillance of pre-pandemic strains and development of high titer cell culture strains for vaccine production. - Highlights: • We observed a spontaneous mutation of a 2009-pandemic H1N1 influenza virus in vitro. • The adaptation led to a 100-fold rise in replication rate in human A549 cells. • Adaptation was caused by two mutations in the HA gene segment. • Adaptation correlates with increased fusion pH and decreased receptor affinity.
Gene Expression Analysis to Assess the Relevance of Rodent Models to Human Lung Injury.
Sweeney, Timothy E; Lofgren, Shane; Khatri, Purvesh; Rogers, Angela J
2017-08-01
The relevance of animal models to human diseases is an area of intense scientific debate. The degree to which mouse models of lung injury recapitulate human lung injury has never been assessed. Integrating data from both human and animal expression studies allows for increased statistical power and identification of conserved differential gene expression across organisms and conditions. We sought comprehensive integration of gene expression data in experimental acute lung injury (ALI) in rodents compared with humans. We performed two separate gene expression multicohort analyses to determine differential gene expression in experimental animal and human lung injury. We used correlational and pathway analyses combined with external in vitro gene expression data to identify both potential drivers of underlying inflammation and therapeutic drug candidates. We identified 21 animal lung tissue datasets and three human lung injury bronchoalveolar lavage datasets. We show that the metasignatures of animal and human experimental ALI are significantly correlated despite these widely varying experimental conditions. The gene expression changes among mice and rats across diverse injury models (ozone, ventilator-induced lung injury, LPS) are significantly correlated with human models of lung injury (Pearson r = 0.33-0.45, P human lung injury. Predicted therapeutic targets, peptide ligand signatures, and pathway analyses are also all highly overlapping. Gene expression changes are similar in animal and human experimental ALI, and provide several physiologic and therapeutic insights to the disease.
Inhibition of human lung cancer cell proliferation and survival by wine
2014-01-01
Background Compounds of plant origin and food components have attracted scientific attention for use as agents for cancer prevention and treatment. Wine contains polyphenols that were shown to have anti-cancer and other health benefits. The survival pathways of Akt and extracellular signal-regulated kinase (Erk), and the tumor suppressor p53 are key modulators of cancer cell growth and survival. In this study, we examined the effects of wine on proliferation and survival of human Non-small cell lung cancer (NSCLC) cells and its effects on signaling events. Methods Human NSCLC adenocarcinoma A549 and H1299 cells were used. Cell proliferation was assessed by thymidine incorporation. Clonogenic assays were used to assess cell survival. Immunoblotting was used to examine total and phosphorylated levels of Akt, Erk and p53. Results In A549 cells red wine inhibited cell proliferation and reduced clonogenic survival at doses as low as 0.02%. Red wine significantly reduced basal and EGF-stimulated Akt and Erk phosphorylation while it increased the levels of total and phosphorylated p53 (Ser15). Control experiments indicated that the anti-proliferative effects of wine were not mediated by the associated contents of ethanol or the polyphenol resveratrol and were independent of glucose transport into cancer cells. White wine also inhibited clonogenic survival, albeit at a higher doses (0.5-2%), and reduced Akt phosphorylation. The effects of both red and white wine on Akt phosphorylation were also verified in H1299 cells. Conclusions Red wine inhibits proliferation of lung cancer cells and blocks clonogenic survival at low concentrations. This is associated with inhibition of basal and EGF-stimulated Akt and Erk signals and enhancement of total and phosphorylated levels of p53. White wine mediates similar effects albeit at higher concentrations. Our data suggest that wine may have considerable anti-tumour and chemoprevention properties in lung cancer and deserves further
The detection, diagnosis and therapy of human lung cancer
International Nuclear Information System (INIS)
1978-01-01
The Cancergram covers clinical aspects of cancers of the lung and tracheo-bronchial tree, i.e., the lower respiratory tract. This includes primary lung cancer in both early and advanced disease status. The topic includes clinically relevant aspects of the prevention, detection, diagnosis, evaluation, and therapy of lung cancer. Certain aspects of metastatic lung disease treatment or therapy which involve aspects of interest to primary lung cancer are included. With certain exceptions, general pre-clinical or animal studies not directly related to the primary human disease are excluded
26 CFR 1.460-0 - Outline of regulations under section 460.
2010-04-01
... Step One. (i) Hypothetical reallocation of income among prior tax years. (ii) Treatment of estimated... tax liability that generated a subsequent refund. (d) Simplified marginal impact method. (1...) INCOME TAX (CONTINUED) INCOME TAXES Taxable Year for Which Items of Gross Income Included § 1.460-0...
International Nuclear Information System (INIS)
Liu Liang
1992-01-01
Monoclonal antibodies (Lc86a-C5, Lc86a-H8) directed against human lung adenocarcinoma cell line LTEP-a-2 and normal BALB/c IgG were labelled with iodine-131 by chloramine T. The 131 I-McAbs and 131 I-IgG were respectively injected into the peritoneal cavities of nude mice bearing transplanted human lung adenocarcinoma cell line LTEP-a-2. After 72 h, the tumor tissue in nude mice injected with 131 I-McAbs was distinguishable from normal tissues as a very clear image obtained during gamma scintigraphy. No difference was found between tumor and normal tissues in the nude mice injected with 131 I-IgG. The tumor: blood ration was 3.1:1 in nude injected with 131 I McAb(H8) and 0.9:1 in nude mice injected with 131 I-IgG respectively. This indicates that the tumor tissue image was the result of specific binding of the 131 I-McAbs, which have high specificity and affinity both in vitro and in vivo, to tumor cells, and these monoclonal antibodies may serve as potential agents in tumor diagnosis and treatment
Paracytosis of Haemophilus influenzae through cell layers of NCI-H292 lung epithelial cells
van Schilfgaarde, M.; van Alphen, L.; Eijk, P.; Everts, V.; Dankert, J.
1995-01-01
Haemophilus influenzae penetrates the respiratory epithelium during carriage and invasive disease, including respiratory tract infections. We developed an in vitro model system consisting of lung epithelial NCI-H292 cells on permeable supports to study the passage of H. influenzae through lung
[Effects of 17-AAG on the proliferation and apoptosis of human lung cancer A549 and H446 cells].
Niu, Ben; Lin, Jingshuang; Feng, Tao
2015-04-01
To observe the effect of 17-(allylamino)-17-demethoxygeldanamycin (17-AAG) on the apoptosis of human lung cancer cell lines A549 and H446, and to investigate the potential mechanisms. Proliferation inhibition and apoptosis assays, and the cell cycles were detected by MTT and flow cytometry respectively. Western blot was used to determine the expression level of proteins such as Hsp90, Hsp70, AKt, Her-2, Bcl-2 and Bax. After treated with 17-AAG, the proliferation of both A549 and H446 cells was inhibited significantly in a dose-dependent manner; as the concentration of 17-AAG was from 50 to 500 nmol/L, the IC₅₀ values to A549 and H446 cell lines were (222 ± 13) nmol/L and (189 ± 7) nmol/L respectively at 48 h. Cell cycle assays showed that 17-AAG was able to arrest cell cycles of A549 and H446 cell lines at the G₂/M phase. Apoptosis assay showed that 17-AAG was capable of inducing apoptosis in A549 and H446 cell lines. After treated with 17-AAG for 48 h, there were significant differences between the 400 nmol/L groups(46.3% for A549 cell line and 56.9% for H446 cell line) and the control group (11.9% for A549 cell line and 6.9% for H446 cell line, P AAG treatment: Akt and Her-2 decreased significantly while the expression of Hsp70 increased. Meanwhile, the expression of Bcl-2 decreased but that of Bax increased, indicating that 17-AAG was able to promote apoptosis mode in A549 and H446 cells. 17-AAG can regulate the expression level of apoptosis-related proteins such as Bax and Bcl-2 by Hsp90 signaling pathway in A549 and H446 cells, and ultimately inhibit cell proliferation and induce apoptosis.
International Nuclear Information System (INIS)
Patel, Eshan; Lynch, Christine; Ruff, Victoria; Reynolds, Mindy
2012-01-01
Nickel and cobalt are heavy metals found in land, water, and air that can enter the body primarily through the respiratory tract and accumulate to toxic levels. Nickel compounds are known to be carcinogenic to humans and animals, while cobalt compounds produce tumors in animals and are probably carcinogenic to humans. People working in industrial and manufacturing settings have an increased risk of exposure to these metals. The cytotoxicity of nickel and cobalt has individually been demonstrated; however, the underlying mechanisms of co-exposure to these heavy metals have not been explored. In this study, we investigated the effect of exposure of H460 human lung epithelial cells to nickel and cobalt, both alone and in combination, on cell survival, apoptotic mechanisms, and the generation of reactive oxygen species and double strand breaks. For simultaneous exposure, cells were exposed to a constant dose of 150 μM cobalt or nickel, which was found to be relatively nontoxic in single exposure experiments. We demonstrated that cells exposed simultaneously to cobalt and nickel exhibit a dose-dependent decrease in survival compared to the cells exposed to a single metal. The decrease in survival was the result of enhanced caspase 3 and 7 activation and cleavage of poly (ADP-ribose) polymerase. Co-exposure increased the production of ROS and the formation of double strand breaks. Pretreatment with N-acetyl cysteine alleviated the toxic responses. Collectively, this study demonstrates that co-exposure to cobalt and nickel is significantly more toxic than single exposure and that toxicity is related to the formation of ROS and DSB. -- Highlights: ► Decreased survival following simultaneous exposure to NiCl 2 and CoCl 2 . ► Enhanced caspase and PARP cleavage following co-exposure. ► Increased formation of ROS in dual exposed cells. ► N-acetyl cysteine pretreatment decreases Co and Ni toxicity. ► Co-exposure to Ni and Co enhances the formation of double strand
Influence of pH on extracellular matrix preservation during lung decellularization.
Tsuchiya, Tomoshi; Balestrini, Jenna L; Mendez, Julio; Calle, Elizabeth A; Zhao, Liping; Niklason, Laura E
2014-12-01
The creation of decellularized organs for use in regenerative medicine requires the preservation of the organ extracellular matrix (ECM) as a means to provide critical cues for differentiation and migration of cells that are seeded onto the organ scaffold. The purpose of this study was to assess the influence of varying pH levels on the preservation of key ECM components during the decellularization of rat lungs. Herein, we show that the pH of the 3-[(3-cholamidopropyl)dimethylammonio]-1-propanesulfonate (CHAPS)-based decellularization solution influences ECM retention, cell removal, and also the potential for host response upon implantation of acellular lung tissue. The preservation of ECM components, including elastin, fibronectin, and laminin, were better retained in the lower pH conditions that were tested (pH ranges tested: 8, 10, 12); glycosaminoglycans were preserved to a higher extent in the lower pH groups as well. The DNA content following decellularization of the rat lung was inversely correlated with the pH of the decellularization solution. Despite detectible levels of cyotoskeletal proteins and significant residual DNA, tissues decellularized at pH 8 demonstrated the greatest tissue architecture maintenance and the least induction of host response of all acellular conditions. These results highlight the effect of pH on the results obtained by organ decellularization and suggest that altering the pH of the solutions used for decellularization may influence the ability of cells to properly differentiate and home to appropriate locations within the scaffold, based on the preservation of key ECM components and implantation results.
Colon cancer proliferating desulfosinigrin in wasabi (Wasabia japonica).
Weil, Marvin J; Zhang, Yanjun; Nair, Muraleedharan G
2004-01-01
A reduced incidence of different types of cancer has been linked to consumption of Brassica vegetables, and there is evidence that glucosinolates (GSLs) and their hydrolysis products play a role in reducing cancer risk. Wasabi (Wasabia japonica) and horseradish (Armoracia rusticana), both Brassica vegetables, are widely used condiments both in Japanese cuisine and in the United States. Desulfosinigrin (DSS) (1) was isolated from a commercially available wasabi powder and from fresh wasabi roots. Sinigrin (2) was isolated from horseradish roots. DSS and sinigrin were evaluated for their inhibitory effects on cyclooxygenase-1 (COX-1) and cyclooxygenase-2 (COX-2) enzymes, on lipid peroxidation, and on the proliferation of human colon (HCT-116), breast (MCF-7), lung (NCIH460), and central nervous system (CNS, SF-268) cancer cell lines. DSS did not inhibit COX enzymes or lipid peroxidation at 250 microg/ml. Sinigrin inhibited lipid peroxidation by 71% at 250 microg/ml. However, DSS promoted the growth of HCT-116 (colon) and NCI H460 (lung) human cancer cells as determined by the MTT assay in a concentration-dependent manner. At 3.72 microg/ml, a 27% increase in the number of viable human HCT-116 colon cancer cells was observed; the corresponding increases at 7.50 and 15 microg/ml were 42 and 69%, respectively. At 60 microg/ml, DSS doubled the number of HCT-16 colon cancer cells. For NCI H460 human lung cancer cells, DSS at 60 microg/ml increased the cell number by 20%. Sinigrin showed no proliferating effect on the tumor cells tested. This is the first report of the tumor cell-proliferating activity by a desulfoglucosinolate, the biosynthetic precursor of GSLs found in Brassica spp.
Vidaña, Beatriz; Martínez, Jorge; Martorell, Jaime; Montoya, María; Córdoba, Lorena; Pérez, Mónica; Majó, Natàlia
2016-11-08
Severe cases after pH1N1 infection are consequence of interstitial pneumonia triggered by alveolar viral replication and an exacerbated host immune response, characterized by the up-regulation of pro-inflammatory cytokines and the influx of inflammatory leukocytes to the lungs. Different lung cell populations have been suggested as culprits in the unregulated innate immune responses observed in these cases. This study aims to clarify this question by studying the different induction of innate immune molecules by the distinct lung anatomic compartments (vascular, alveolar and bronchiolar) of ferrets intratracheally infected with a human pH1N1 viral isolate, by means of laser microdissection techniques. The obtained results were then analysed in relation to viral quantification in the different anatomic areas and the histopathological lesions observed. More severe lung lesions were observed at 24 h post infection (hpi) correlating with viral antigen detection in bronchiolar and alveolar epithelial cells. However, high levels of viral RNA were detected in all anatomic compartments throughout infection. Bronchiolar areas were the first source of IFN-α and most pro-inflammatory cytokines, through the activation of RIG-I. In contrast, vascular areas contributed with the highest induction of CCL2 and other pro-inflammatory cytokines, through the activation of TLR3.
Directory of Open Access Journals (Sweden)
Mi Ra Kim
2017-03-01
Full Text Available Vascular cell adhesion molecule-1 (VCAM-1 is closely associated with tumor progression and metastasis. However, the relevance and role of VCAM-1 in lung cancer have not been clearly elucidated. In this study, we found that VCAM-1 was highly overexpressed in lung cancer tissue compared with that of normal lung tissue, and high VCAM-1 expression correlated with poor survival in lung cancer patients. VCAM-1 knockdown reduced migration of A549 human lung cancer cells into Matrigel, and competitive blocking experiments targeting the Ig-like domain 6 of VCAM-1 (VCAM-1-D6 demonstrated that the VCAM-1-D6 domain was critical for VCAM-1 mediated A549 cell migration into Matrigel. Next, we developed a human monoclonal antibody specific to human and mouse VCAM-1-D6 (VCAM-1-D6 huMab, which was isolated from a human synthetic antibody library using phage display technology. Finally, we showed that VCAM-1-D6 huMab had a nanomolar affinity for VCAM-1-D6 and that it potently suppressed the migration of A549 and NCI-H1299 lung cancer cell lines into Matrigel. Taken together, these results suggest that VCAM-1-D6 is a key domain for regulating VCAM-1-mediated lung cancer invasion and that our newly developed VCAM-1-D6 huMab will be a useful tool for inhibiting VCAM-1-expressing lung cancer cell invasion.
A decade of lung expansion. A review of ventilation-weighted 1H lung MRI
International Nuclear Information System (INIS)
Kjoerstad, Aasmund; Fiehler, Jens; Sedlacik, Jan; Regier, Marc
2017-01-01
In 2006, a novel method for extracting functional ventilation-weighted lung images using MRI was published. The method exploited the naturally occurring density changes in the lung during breathing and the resulting images showed a clear clinical potential. A decade later, the method has been adapted and further developed by several research groups and has led to many encouraging pre-clinical studies, both in animals and in humans. In this paper we show the development of the method and summarize the current state-of-the-art, aiming to both inform and motivate students and researchers with an interest in this exciting field.
Du, Ping; Suhaeri, Muhammad; Ha, Sang Su; Oh, Seung Ja; Kim, Sang-Heon; Park, Kwideok
2017-05-01
Extracellular matrix (ECM) is crucial to many aspects of vascular morphogenesis and maintenance of vasculature function. Currently the recapitulation of angiogenic ECM microenvironment is still challenging, due mainly to its diverse components and complex organization. Here we investigate the angiogenic potential of human lung fibroblast-derived matrix (hFDM) in creating a three-dimensional (3D) vascular construct. hFDM was obtained via decellularization of in vitro cultured human lung fibroblasts and analyzed via immunofluorescence staining and ELISA, which detect multiple ECM macromolecules and angiogenic growth factors (GFs). Human umbilical vein endothelial cells (HUVECs) morphology was more elongated and better proliferative on hFDM than on gelatin-coated substrate. To prepare 3D construct, hFDM is collected, quantitatively analyzed, and incorporated in collagen hydrogel (Col) with HUVECs. Capillary-like structure (CLS) formation at 7day was significantly better with the groups containing higher doses of hFDM compared to the Col group (control). Moreover, the group (Col/hFDM/GFs) with both hFDM and angiogenic GFs (VEGF, bFGF, SDF-1) showed the synergistic activity on CLS formation and found much larger capillary lumen diameters with time. Further analysis of hFDM via angiogenesis antibody array kit reveals abundant biochemical cues, such as angiogenesis-related cytokines, GFs, and proteolytic enzymes. Significantly up-regulated expression of VE-cadherin and ECM-specific integrin subunits was also noticed in Col/hFDM/GFs. In addition, transplantation of Col/hFMD/GFs with HUVECs in skin wound model presents more effective re-epithelialization, many regenerated hair follicles, better transplanted cells viability, and advanced neovascularization. We believe that current system is a very promising platform for 3D vasculature construction in vitro and for cell delivery toward therapeutic applications in vivo. Functional 3D vasculature construction in vitro is still
14 CFR 460.9 - Informing crew of risk.
2010-01-01
... 14 Aeronautics and Space 4 2010-01-01 2010-01-01 false Informing crew of risk. 460.9 Section 460.9 Aeronautics and Space COMMERCIAL SPACE TRANSPORTATION, FEDERAL AVIATION ADMINISTRATION, DEPARTMENT OF... risk. An operator must inform in writing any individual serving as crew that the United States...
Axin gene methylation status correlates with radiosensitivity of lung cancer cells
International Nuclear Information System (INIS)
Yang, Lian-He; Stoecker, Maggie; Wang, Endi; Xu, Ke; Wang, En-Hua; Han, Yang; Li, Guang; Xu, Hong-Tao; Jiang, Gui-Yang; Miao, Yuan; Zhang, Xiu-Peng; Zhao, Huan-Yu; Xu, Zheng-Fan
2013-01-01
We previously reported that Axin1 (Axin) is down-regulated in many cases of lung cancer, and X-ray irradiation increased Axin expression and inhibited lung cancer cells. The mechanisms, however, were not clear. Four lung cancer cell lines were used to detect the methylation status of Axin with or without X-ray treatment. Real-time PCR was used to quantify the expression of Axin, and western blot analysis was applied to measure protein levels of Axin, β-catenin, Cyclin D1, MMP-7, DNMTS, MeCP2 and acetylated histones. Flow cytometric analysis, colony formation assay, transwell assay and xenograft growth experiment were used to study the biological behavior of the cells with hypermethylated or unmethylated Axin gene after X-ray treatment. Hypermethylated Axin gene was detected in 2 of 4 cell lines, and it correlated inversely with Axin expression. X-ray treatment significantly up-regulated Axin expression in H446 and H157 cells, which possess intrinsic hypermethylation of the Axin gene (P<0.01), but did not show up-regulation in LTE and H460 cells, which have unmethylated Axin gene. 2Gy X-ray significantly reduced colony formation (from 71% to 10.5%) in H157 cells, while the reduction was lower in LTE cells (from 71% to 20%). After X-ray irradiation, xenograft growth was significantly decreased in H157 cells (from 1.15 g to 0.28 g) in comparison with LTE cells (from 1.06 g to 0.65 g). Significantly decreased cell invasiveness and increased apoptosis were also observed in H157 cells treated with X-ray irradiation (P<0.01). Down-regulation of DNMTs and MeCP2 and up-regulation of acetylated histones could be detected in lung cancer cells. X-ray-induced inhibition of lung cancer cells may be mediated by enhanced expression of Axin via genomic DNA demethylation and histone acetylation. Lung cancer cells with a different methylation status of the Axin gene showed different radiosensitivity, suggesting that the methylation status of the Axin gene may be one important factor
16 CFR 460.2 - What is home insulation.
2010-01-01
... 16 Commercial Practices 1 2010-01-01 2010-01-01 false What is home insulation. 460.2 Section 460.2 Commercial Practices FEDERAL TRADE COMMISSION TRADE REGULATION RULES LABELING AND ADVERTISING OF HOME..., semirigid, flexible, or loose-fill form. Home insulation is for use in old or new homes, condominiums...
International Nuclear Information System (INIS)
Seo, Mi Ran; Nam, Hyo-Jung; Kim, So-Young; Juhnn, Yong-Sung
2009-01-01
Inhibitory heterotrimeric GTP-binding proteins (Gi proteins) mediate a variety of signaling pathways by coupling receptors and effectors to regulate cellular proliferation, differentiation, and apoptosis. However, the role of Gi proteins in the modulation of hydrogen peroxide-induced apoptosis is not clearly understood. Thus, we investigated the effect of Gi proteins on hydrogen peroxide-induced apoptosis and the underlying mechanisms in H1299 human lung cancer cells. The stable expression of constitutively active alpha subunits of Gi1 (Gαi1QL), Gi2, or Gi3 inhibited hydrogen peroxide-induced apoptosis. The expression of Gαi1QL up-regulated Bcl-2 expression, and the knockdown of Bcl-2 with siRNA abolished the anti-apoptotic effect of Gαi1QL. Gαi1 induced the transcription of Bcl-2 by activation of NF-κB, which resulted from an increase in NF-κB p50 protein. We conclude that Gαi1 inhibits hydrogen peroxide-induced apoptosis of H1299 lung cancer cells by up-regulating the transcription of Bcl-2 through a p50-mediated NF-κB activation.
Radiation-Induced Differentiation in Human Lung Fibroblast
International Nuclear Information System (INIS)
Park, Sa-Rah; Ahn, Ji-Yeon; Han, Young-Soo; Shim, Jie-Young; Yun, Yeon-Sook; Song, Jie-Young
2007-01-01
One of the most common tumors in many countries is lung cancer and patients with lung cancer may take radiotherapy. Although radiotherapy may have its own advantages, it can also induce serious problems such as acute radiation pneumonitis and pulmonary fibrosis. Pulmonary fibrosis is characterized by excessive production of α-SMA and accumulation of extracellular matrix (ECM) such as collagen and fibronectin. There has been a great amount of research about fibrosis but the exact mechanism causing the reaction is not elucidated especially in radiation-induced fibrosis. Until now it has been known that several factors such as transforming growth factor (TGF-β), tumor necrosis factor (TNF), interleukin (IL)-1, IL-6, platelet-derived growth factor (PDGF) and fibroblast growth factor (FGF) are related to fibrosis. Among them TGF-β with Smad signaling is known to be the main stream and other signaling molecules such as MAPK, ERK and JNK (3) also participates in the process. In addition to those above factors, it is thought that more diverse and complicate mechanisms may involve in the radiationinduced fibrosis. Therefore, to investigate the underlying mechanisms in radiation induced fibrosis, first of all, we confirmed whether radiation induces trans differentiation in human normal lung fibroblasts. Here, we suggest that not only TGF-β but also radiation can induce trans differentiation in human lung fibroblast WI-38 and IMR-90
Human lung mast cells modulate the functions of airway smooth muscle cells in asthma.
Alkhouri, H; Hollins, F; Moir, L M; Brightling, C E; Armour, C L; Hughes, J M
2011-09-01
Activated mast cell densities are increased on the airway smooth muscle in asthma where they may modulate muscle functions and thus contribute to airway inflammation, remodelling and airflow obstruction. To determine the effects of human lung mast cells on the secretory and proliferative functions of airway smooth muscle cells from donors with and without asthma. Freshly isolated human lung mast cells were stimulated with IgE/anti-IgE. Culture supernatants were collected after 2 and 24 h and the mast cells lysed. The supernatants/lysates were added to serum-deprived, subconfluent airway smooth muscle cells for up to 48 h. Released chemokines and extracellular matrix were measured by ELISA, proliferation was quantified by [(3) H]-thymidine incorporation and cell counting, and intracellular signalling by phospho-arrays. Mast cell 2-h supernatants reduced CCL11 and increased CXCL8 and fibronectin production from both asthmatic and nonasthmatic muscle cells. Leupeptin reversed these effects. Mast cell 24-h supernatants and lysates reduced CCL11 release from both muscle cell types but increased CXCL8 release by nonasthmatic cells. The 24-h supernatants also reduced asthmatic, but not nonasthmatic, muscle cell DNA synthesis and asthmatic cell numbers over 5 days through inhibiting extracellular signal-regulated kinase (ERK) and phosphatidylinositol (PI3)-kinase pathways. However, prostaglandins, thromboxanes, IL-4 and IL-13 were not involved in reducing the proliferation. Mast cell proteases and newly synthesized products differentially modulated the secretory and proliferative functions of airway smooth muscle cells from donors with and without asthma. Thus, mast cells may modulate their own recruitment and airway smooth muscle functions locally in asthma. © 2011 John Wiley & Sons A/S.
Directory of Open Access Journals (Sweden)
Linghan Jia
Full Text Available Lung cancer or pulmonary carcinoma is primarily derived from epithelial cells that are thin and line on the alveolar surfaces of the lung for gas exchange. ANO1/TMEM16A, initially identified from airway epithelial cells, is a member of Ca2+-activated Cl- channels (CaCCs that function to regulate epithelial secretion and cell volume for maintenance of ion and tissue homeostasis. ANO1/TMEM16A has recently been shown to be highly expressed in several epithelium originated carcinomas. However, the role of ANO1 in lung cancer remains unknown. In this study, we show that inhibition of calcium-activated chloride channel ANO1/TMEM16A suppresses tumor growth and invasion in human lung cancer. ANO1 is upregulated in different human lung cancer cell lines. Knocking-down ANO1 by small hairpin RNAs inhibited proliferation, migration and invasion of GLC82 and NCI-H520 cancel cells evaluated by CCK-8, would-healing, transwell and 3D soft agar assays. ANO1 protein is overexpressed in 77.3% cases of human lung adenocarcinoma tissues detected by immunohistochemistry. Furthermore, the tumor growth in nude mice implanted with GLC82 cells was significantly suppressed by ANO1 silencing. Taken together, our findings provide evidence that ANO1 overexpression contributes to tumor growth and invasion of lung cancer; and suppressing ANO1 overexpression may have therapeutic potential in lung cancer therapy.
International Nuclear Information System (INIS)
He Pengfei; Borland, Michael G.; Zhu Bokai; Sharma, Arun K.; Amin, Shantu; El-Bayoumy, Karam; Gonzalez, Frank J.; Peters, Jeffrey M.
2008-01-01
There is compelling evidence that peroxisome proliferator-activated receptor-β/δ (PPARβ/δ) mediates terminal differentiation and is associated with inhibition of cell growth. However, it was recently suggested that growth of two human lung cancer cell lines is enhanced by PPARβ/δ. The goal of the present study was to provide insight in resolving this controversy. Therefore, the effect of ligand activation of PPARβ/δ in A549 and H1838 human lung cancer cell lines was examined using two high affinity PPARβ/δ ligands. Ligand activation of PPARβ/δ caused up-regulation of a known PPARβ/δ target gene, angiopoietin-like 4 (Angptl4) but did not influence expression of phosphatase and tensin homolog (PTEN) or phosphorylation of protein kinase B (Akt), and did not affect cell growth. Results from this study demonstrate that two human lung cancer cell lines respond to ligand activation of PPARβ/δ by modulation of target gene expression (Angptl4), but fail to exhibit significant modulation of cell proliferation
Kumar, Amit; Ghate, Vinayak; Kim, Min-Jeong; Zhou, Weibiao; Khoo, Gek Hoon; Yuk, Hyun-Gyun
2017-05-01
The objective of this study was to investigate the effect of 460 nm light-emitting diode (LED) on the inactivation of foodborne bacteria. Additionally, the change in the endogenous metabolic profile of LED illuminated cells was analyzed to understand the bacterial response to the LED illumination. Six different species of bacteria (Bacillus cereus, Listeria monocytogenes, Staphylococcus aureus, Escherichia coli O157:H7, Pseudomonas aeruginosa and Salmonella Typhimurium) were illuminated with 460 nm LED to a maximum dose of 4080 J/cm 2 at 4, 10 and 25 °C. Inactivation curves were modeled using Hom model. Metabolic profiling of the non-illuminated and illuminated cells was performed using a Liquid chromatography-mass spectrometry system. Results indicate that the 460 nm LED significantly (p illuminated cells indicated that several metabolites e.g. 11-deoxycortisol, actinonin, coformycin, tyramine, chitobiose etc. were regulated during LED illumination. These results elucidate the effectiveness of 460 nm LED against foodborne bacteria and hence, its suitability as a novel antimicrobial control method to ensure food safety. Copyright © 2016 Elsevier Ltd. All rights reserved.
Directory of Open Access Journals (Sweden)
Arul Vadivel
Full Text Available Bronchopulmonary dysplasia (BPD, the chronic lung disease of prematurity, remains a major health problem. BPD is characterized by impaired alveolar development and complicated by pulmonary hypertension (PHT. Currently there is no specific treatment for BPD. Hydrogen sulfide (H2S, carbon monoxide and nitric oxide (NO, belong to a class of endogenously synthesized gaseous molecules referred to as gasotransmitters. While inhaled NO is already used for the treatment of neonatal PHT and currently tested for the prevention of BPD, H2S has until recently been regarded exclusively as a toxic gas. Recent evidence suggests that endogenous H2S exerts beneficial biological effects, including cytoprotection and vasodilatation. We hypothesized that H2S preserves normal alveolar development and prevents PHT in experimental BPD.We took advantage of a recently described slow-releasing H2S donor, GYY4137 (morpholin-4-ium-4-methoxyphenyl(morpholino phosphinodithioate to study its lung protective potential in vitro and in vivo.In vitro, GYY4137 promoted capillary-like network formation, viability and reduced reactive oxygen species in hyperoxia-exposed human pulmonary artery endothelial cells. GYY4137 also protected mitochondrial function in alveolar epithelial cells. In vivo, GYY4137 preserved and restored normal alveolar growth in rat pups exposed from birth for 2 weeks to hyperoxia. GYY4137 also attenuated PHT as determined by improved pulmonary arterial acceleration time on echo-Doppler, pulmonary artery remodeling and right ventricular hypertrophy. GYY4137 also prevented pulmonary artery smooth muscle cell proliferation.H2S protects from impaired alveolar growth and PHT in experimental O2-induced lung injury. H2S warrants further investigation as a new therapeutic target for alveolar damage and PHT.
Acetyl-CoA Carboxylase-α Inhibitor TOFA Induces Human Cancer Cell Apoptosis
Wang, Chun; Xu, Canxin; Sun, Mingwei; Luo, Dixian; Liao, Duan-fang; Cao, Deliang
2009-01-01
Acetyl-CoA carboxylase-α (ACCA) is a rate-limiting enzyme in long chain fatty acid synthesis, playing a critical role in cellular energy storage and lipid synthesis. ACCA is upregulated in multiple types of human cancers and small interfering RNA-mediated ACCA silencing in human breast and prostate cancer cells results in oxidative stress and apoptosis. This study reports for the first time that TOFA (5-tetradecyloxy-2-furoic acid), an allosteric inhibitor of ACCA, is cytotoxic to lung cancer cells NCI-H460 and colon carcinoma cells HCT-8 and HCT-15, with an IC50 at approximately 5.0, 5.0, and 4.5 μg/ml, respectively. TOFA at 1.0–20.0 μg/ml effectively blocked fatty acid synthesis and induced cell death in a dose-dependent manner. The cell death was characterized with PARP cleavage, DNA fragmentation, and annexin-V staining, all of which are the features of the apoptosis. Supplementing simultaneously the cells with palmitic acids (100 μM), the end-products of the fatty acid synthesis pathway, prevented the apoptosis induced by TOFA. Taken together, these data suggest that TOFA is a potent cytotoxic agent to lung and colon cancer cells, inducing apoptosis through disturbing their fatty acid synthesis. PMID:19450551
Acetyl-CoA carboxylase-alpha inhibitor TOFA induces human cancer cell apoptosis.
Wang, Chun; Xu, Canxin; Sun, Mingwei; Luo, Dixian; Liao, Duan-Fang; Cao, Deliang
2009-07-31
Acetyl-CoA carboxylase-alpha (ACCA) is a rate-limiting enzyme in long chain fatty acid synthesis, playing a critical role in cellular energy storage and lipid synthesis. ACCA is upregulated in multiple types of human cancers and small interfering RNA-mediated ACCA silencing in human breast and prostate cancer cells results in oxidative stress and apoptosis. This study reports for the first time that TOFA (5-tetradecyloxy-2-furoic acid), an allosteric inhibitor of ACCA, is cytotoxic to lung cancer cells NCI-H460 and colon carcinoma cells HCT-8 and HCT-15, with an IC(50) at approximately 5.0, 5.0, and 4.5 microg/ml, respectively. TOFA at 1.0-20.0 microg/ml effectively blocked fatty acid synthesis and induced cell death in a dose-dependent manner. The cell death was characterized with PARP cleavage, DNA fragmentation, and annexin-V staining, all of which are the features of the apoptosis. Supplementing simultaneously the cells with palmitic acids (100 microM), the end-products of the fatty acid synthesis pathway, prevented the apoptosis induced by TOFA. Taken together, these data suggest that TOFA is a potent cytotoxic agent to lung and colon cancer cells, inducing apoptosis through disturbing their fatty acid synthesis.
First clinical evaluation of radioimmunoimaging using anti-human lung cancer monoclonal antibodies
International Nuclear Information System (INIS)
Zhou Qian
1991-01-01
Anti-human large cell lung cancer monoclonal antibodies (McAb) 2E3 and 6D1 were produced in the laboratory. Immunohistochemical studies and radiobinding assay showed these antibodies possessed high specificity against lung cancer cells. 28 patients with lung masses were investigated with 131 I-labeled McAb 6D1 and/or 2E3 scintigraphy. 19 of them were histologically proven and 13 were diagnosed primary lung carcinoma. Radioimmunoimaging visualized 10/13 of the primary lung cancers with a detection rate of 77%. Only 1 case of the non-cancer patients and a false localization, giving a true negative rate of 83%. Pathologically the squamous cell lung carcinoma had the highest localization and the small cell lung carcinoma next, but the detection rate was 100% for both. The adenocarcinoma of lung was less sensitive to these McAbs, with a detection rate of only 33% (1 of 3 cases). We conclude that radioimmunoimaging with anti-human large cell lung cancer McAbs is more specific and effective in detecting primary lung cancers and differentiating lung masses than with antibodies against other tumor associated antigens
Diffusion on Networks and Diffusion Weighted NMR of the Human Lung
DEFF Research Database (Denmark)
Buhl, Niels
2011-01-01
of the diffusion propagator to general properties of the underlying graph. Diffusion weighted NMR of the human lung with hyperpolarized noble gases, which over the last decade has been demonstrated to be a very promising way of detecting and quantifying lung diseases like emphysema, represent an obvious...... application of the above mentioned theory, given that the human lung consists of a large network of bifurcating tube like airways. 90-95% of the gas in a human lung resides in the ~30000 pulmonary acini, each of these consists of ~500 airways, which are connected as the edges in a binary tree. We model...... diffusion in the pulmonary acini as diffusion on metric graphs with this structure. The metric graph for each individual pulmonary acinus is embedded in three dimensional space via line segments. By considering an isotropic distribution of acini and a symmetric branching geometry for the line segments...
Wu, Shu-Jing; Chang, Shun-Pang; Lin, Doung-Liang; Wang, Shyh-Shyan; Hou, Fwu-Feuu; Ng, Lean-Teik
2009-06-01
Physalis peruviana L. (PP) is a popular folk medicine used for treating cancer, leukemia, hepatitis, rheumatism and other diseases. In this study, our objectives were to examine the total flavonoid and phenol content of different PP extracts (aqueous: HWEPP; ethanolic: EEPP; supercritical carbon dioxide: SCEPP-0, SCEPP-4 and SCEPP-5) and their antiproliferative effects in human lung cancer H661 cells. Among all the extracts tested, results showed that SCEPP-5 possessed the highest total flavonoid (226.19 +/- 4.15 mg/g) and phenol (100.82 +/- 6.25 mg/g) contents. SCEPP-5 also demonstrated the most potent inhibitory effect on H661 cell proliferation. Using DNA ladder and flow cytometry analysis, SCEPP-5 effectively induced H661 cell apoptosis as demonstrated by the accumulation of Sub-G1 peak and fragmentation of DNA. SCEPP-5 not only induced cell cycle arrest at S phase, it also up-regulated the expression of pro-apoptotic protein (Bax) and down-regulated the inhibitor of apoptosis protein (IAP). Furthermore, the apoptotic induction in H661 cells was found to associate with an elevated p53 protein expression, cytochrome c release, caspase-3 activation and PARP cleavage. Taken together, these results conclude that SCEPP-5 induced cell cycle arrest at S phase, and its apoptotic induction could be mediated through the p53-dependent pathway and modification of Bax and XIAP proteins expression. The results have also provided important pharmacological backgrounds for the potential use of PP supercritical fluid extract as products for cancer prevention.
A decade of lung expansion. A review of ventilation-weighted {sup 1}H lung MRI
Energy Technology Data Exchange (ETDEWEB)
Kjoerstad, Aasmund; Fiehler, Jens; Sedlacik, Jan [Univ. Medical Center Hamburg-Eppendorf, Hamburg (Germany). Dept. of Neuroradiology; Regier, Marc [Univ. Medical Center Hamburg-Eppendorf, Hamburg (Germany). Dept. of Radiology
2017-10-01
In 2006, a novel method for extracting functional ventilation-weighted lung images using MRI was published. The method exploited the naturally occurring density changes in the lung during breathing and the resulting images showed a clear clinical potential. A decade later, the method has been adapted and further developed by several research groups and has led to many encouraging pre-clinical studies, both in animals and in humans. In this paper we show the development of the method and summarize the current state-of-the-art, aiming to both inform and motivate students and researchers with an interest in this exciting field.
A 3D human tissue-engineered lung model to study influenza A infection.
Bhowmick, Rudra; Derakhshan, Mina; Liang, Yurong; Ritchey, Jerry; Liu, Lin; Gappa-Fahlenkamp, Heather
2018-05-05
Influenza A virus (IAV) claims approximately 250,000-500,000 lives annually worldwide. Currently, there are a few in vitro models available to study IAV immunopathology. Monolayer cultures of cell lines and primary lung cells (2D cell culture) is the most commonly used tool, however, this system does not have the in vivo-like structure of the lung and immune responses to IAV as it lacks the three-dimensional (3D) tissue structure. To recapitulate the lung physiology in vitro, a system that contains multiple cell types within a 3D environment that allows cell movement and interaction, would provide a critical tool. In this study, as a first step in designing a 3D-Human Tissue-Engineering Lung Model (3D-HTLM), we described the 3D culture of primary human small airway epithelial cells (HSAEpCs), and determined the immunophenotype of this system in response to IAV infections. We constructed a 3D chitosan-collagen scaffold and cultured HSAEpCs on these scaffolds at air-liquid interface (ALI). These 3D cultures were compared with 2D-cultured HSAEpCs for viability, morphology, marker protein expression, and cell differentiation. Results showed that the 3D-cultured HSAEpCs at ALI yielded maximum viable cells and morphologically resembled the in vivo lower airway epithelium. There were also significant increases in aquaporin-5 and cytokeratin-14 expression for HSAEpCs cultured in 3D compared to 2D. The 3D culture system was used to study the infection of HSAEpCs with two major IAV strains, H1N1 and H3N2.The HSAEpCs showed distinct changes in marker protein expression, both at mRNA and protein levels, and the release of proinflammatory cytokines. This study is the first step in the development of the 3D-HTLM, which will have wide applicability in studying pulmonary pathophysiology and therapeutics development.
42 CFR 460.40 - Violations for which CMS may impose sanctions.
2010-10-01
... 42 Public Health 4 2010-10-01 2010-10-01 false Violations for which CMS may impose sanctions. 460... for which CMS may impose sanctions. In addition to other remedies authorized by law, CMS may impose any of the sanctions specified in §§ 460.42 and 460.46 if CMS determines that a PACE organization...
Ashwin, Bosco Christin Maria Arputham; Sivaraman, Gandhi; Stalin, Thambusamy; Yuvakkumar, Rathinam; Muthu Mareeswaran, Paulpandian
2018-05-03
The efficient fluorescent property of coumarin 460 (C460) is utilized to sense the Pd 2+ selectively and sensitively. Fabrication of a sensor strip using commercial adhesive tape is achieved and the detection of Pd 2+ is attempted using a handy UV torch. The naked eye detection in solution state using UV chamber is also attempted. The calculated high binding constant values support the strong stable complex formation of Pd 2+ with C460. The detection limit up to 2.5 × 10 -7 M is achieved using fluorescence spectrometer, which is considerably low from the WHO's recommendation. The response of coumarin 460 with various cations also studied. The quenching is further studied by the lifetime measurements. The binding mechanism is clearly explained by the 1 H NMR titration. The sensing mechanism is established as ICT. C460 strip's Pd 2+ quenching detection is further confirmed by solid-state PL study. The in-vitro response of Pd 2+ in a living cell is also studied using fluorescent imaging studies by means of HeLa cell lines and this probe is very compatible with biological environments. It could be applicable to sense trace amounts of a Pd 2+ ion from various industries. Compared with previous reports, this one is very cheap, sensitive, selective and suitable for biological systems. Copyright © 2018 Elsevier B.V. All rights reserved.
Immune and Inflammatory Cell Composition of Human Lung Cancer Stroma.
Directory of Open Access Journals (Sweden)
G-Andre Banat
Full Text Available Recent studies indicate that the abnormal microenvironment of tumors may play a critical role in carcinogenesis, including lung cancer. We comprehensively assessed the number of stromal cells, especially immune/inflammatory cells, in lung cancer and evaluated their infiltration in cancers of different stages, types and metastatic characteristics potential. Immunohistochemical analysis of lung cancer tissue arrays containing normal and lung cancer sections was performed. This analysis was combined with cyto-/histomorphological assessment and quantification of cells to classify/subclassify tumors accurately and to perform a high throughput analysis of stromal cell composition in different types of lung cancer. In human lung cancer sections we observed a significant elevation/infiltration of total-T lymphocytes (CD3+, cytotoxic-T cells (CD8+, T-helper cells (CD4+, B cells (CD20+, macrophages (CD68+, mast cells (CD117+, mononuclear cells (CD11c+, plasma cells, activated-T cells (MUM1+, B cells, myeloid cells (PD1+ and neutrophilic granulocytes (myeloperoxidase+ compared with healthy donor specimens. We observed all of these immune cell markers in different types of lung cancers including squamous cell carcinoma, adenocarcinoma, adenosquamous cell carcinoma, small cell carcinoma, papillary adenocarcinoma, metastatic adenocarcinoma, and bronchioloalveolar carcinoma. The numbers of all tumor-associated immune cells (except MUM1+ cells in stage III cancer specimens was significantly greater than those in stage I samples. We observed substantial stage-dependent immune cell infiltration in human lung tumors suggesting that the tumor microenvironment plays a critical role during lung carcinogenesis. Strategies for therapeutic interference with lung cancer microenvironment should consider the complexity of its immune cell composition.
Lung Cancer and Human Papilloma Viruses (HPVs: Examining the Molecular Evidence
Directory of Open Access Journals (Sweden)
Priya R. Prabhu
2012-01-01
Full Text Available Human papilloma virus (HPV, known to be an etiological agent for genital cancers, has been suggested also to be a possible contributory agent for lung cancer. Alternatively, lung cancer, formerly considered to be solely a smoker's disease, may now be more appropriately categorised into never smoker's and smoker's lung cancer. Through this paper we attempt to bring forth the current knowledge regarding mechanisms of HPV gaining access into the lung tissue, various strategies involved in HPV-associated tumorigenesis in lung tissue.
LENUS (Irish Health Repository)
Alam, Mahmood
2012-02-03
BACKGROUND: Cyclooxygenase-2 enzyme (COX-2) is overexpressed in human non-small cell lung cancer (NSCLC) but is not expressed in small cell lung cancer. Selective COX-2 inhibitors have been shown to induce apoptosis in NSCLC cells, an effect which is associated with the regulation of intracellular MAP kinase (MAPK) signal pathways. Our aims were to characterize the effects of COX-2 inhibition by rofecoxib on apoptosis in human NSCLC and small cell lung cancer cell lines. METHODS: The human NSCLC cell line NCI-H2126 and small cell lung cancer cell line DMS-79 were used. Constitutive COX-2 protein levels were first determined by Western blot test. Levels of apoptosis were evaluated by using propidium iodide staining on FACScan analysis after incubation of NCI-H2126 and DMS-79 with p38 MAPK inhibitor SB202190 (25 ?microM), NF-kappaB inhibitor SN50 (75 microg\\/mL), and rofecoxib at 100 and 250 microM. All statistical analysis was performed by analysis of variance. RESULTS: Western blot test confirmed the presence of COX-2 enzyme in NCI-H2126 and absence in DMS-79. Interestingly, rofecoxib treatment demonstrated a dose-dependent increase in apoptosis in both cell lines. Given this finding, the effect of rofecoxib on NF-kappaB and p38 MAPK pathways was also examined. Apoptosis in both cell lines was unaltered by SN50, either alone or in combination with rofecoxib. A similar phenomenon was observed in NCI-H2126 cells treated with SB202190, either alone or in combination with rofecoxib. In contrast, p38 MAPK inhibition greatly upregulated DMS-79 apoptosis in a manner that was unaltered by the addition of rofecoxib. CONCLUSIONS: Rofecoxib led to a dose-dependent increase in apoptosis in both tumor cell lines. This effect occurred independently of COX-2, NF-kappaB, and p38 MAPK pathways in DMS-79 cells. As such, rofecoxib must act on alternative pathways to regulate apoptosis in human small cell lung cancer cells.
International Nuclear Information System (INIS)
Liao Weiting; Lin Pinpin; Cheng, T.-S.; Yu, H.-S.; Chang, Louis W.
2007-01-01
Epidemiological evidence indicated that residents, especially cigarette smokers, in arseniasis areas had significantly higher lung cancer risk than those living in non-arseniasis areas. Thus, an interaction between arsenic and cigarette smoking in lung carcinogenesis was suspected. p53 dysfunction or mutation in lung epithelial cells was frequently observed in cigarette smokers. Our present study was to explore the differential effects by arsenic on H1355 cells (human lung adenocarcinoma cell line with mutation in p53), BEAS-2B (immortalized lung epithelial cell with functional p53) and pifithrin-α-treated BEAS-2B cells (p53-inhibited cells). These cells were treated with different doses of sodium arsenite (0, 0.1, 1, 5 and 10 μM) for 48 h. A greater reduction in cell viability was observed in the BEAS-2B cells vs. p53 compromised cells (H1355 or p53-inhibited BEAS-2B). Similar observation was also made on 7-day cell survival (growth) study. TUNEL analysis confirmed that there was indeed a significantly reduced arsenite-induced apoptosis found in p53-compromised cells. Centrosomal abnormality has been attributed to eventual chromosomal missegregation, aneuploidy and tumorigenesis. In our present study, reduced p21 and Gadd45a expressions and increased centrosomal abnormality (atopic and multiple centrosomes) were observed in both arsenite-treated H1355 and p53-inhibited BEAS-2B cells as compared with similarly treated BEAS-2B cells. Increased anchorage-independent growth (colony formation) of BEAS-2B cells co-treated with pifithrin-α and 5 μM sodium arsenite was also observed in soft agar. Our present investigation demonstrated that arsenic would act specifically on p53 compromised cells (either with p53 dysfunction or inhibited) to induce centrosomal abnormality and colony formation. These findings provided strong evidence on the carcinogenic promotional role of arsenic, especially under the condition of p53 dysfunction
Genetic variants of the human H+/dipeptide transporter PEPT2
DEFF Research Database (Denmark)
Pinsonneault, Julia; Nielsen, Carsten Uhd; Sadée, Wolfgang
2004-01-01
. We have conducted a haplotype analysis of 27 single nucleotide polymorphisms located in or near exons of the human gene encoding hPEPT2 (SLC15A2), using genotyping data from 247 genomic DNA samples from the Coriell collection. Our analysis reveals that hPEPT2 has a >6-kilobase sequence block......PEPT2 is a high-affinity H+/dipeptide transporter expressed in kidney, brain, lung, and mammary gland. The physiological role of PEPT2 in kidney is to reabsorb small peptides generated by luminal peptidases. PEPT2 is also a transporter for peptide-like drugs such as penicillins and cephalosporins...... with at least 10 abundant polymorphisms in almost complete linkage disequilibrium. As a result, only two main hPEPT2 variants exist (hPEPT2*1 and *2) with several phased amino acid substitutions, present in substantial frequencies in all ethnic groups tested. When expressed in Chinese hamster ovary cells, h...
Human pericytes adopt myofibroblast properties in the microenvironment of the IPF lung.
Sava, Parid; Ramanathan, Anand; Dobronyi, Amelia; Peng, Xueyan; Sun, Huanxing; Ledesma-Mendoza, Adrian; Herzog, Erica L; Gonzalez, Anjelica L
2017-12-21
Idiopathic pulmonary fibrosis (IPF) is a fatal disease of unknown etiology characterized by a compositionally and mechanically altered extracellular matrix. Poor understanding of the origin of α-smooth muscle actin (α-SMA) expressing myofibroblasts has hindered curative therapies. Though proposed as a source of myofibroblasts in mammalian tissues, identification of microvascular pericytes (PC) as contributors to α-SMA-expressing populations in human IPF and the mechanisms driving this accumulation remain unexplored. Here, we demonstrate enhanced detection of α-SMA+ cells coexpressing the PC marker neural/glial antigen 2 in the human IPF lung. Isolated human PC cultured on decellularized IPF lung matrices adopt expression of α-SMA, demonstrating that these cells undergo phenotypic transition in response to direct contact with the extracellular matrix (ECM) of the fibrotic human lung. Using potentially novel human lung-conjugated hydrogels with tunable mechanical properties, we decoupled PC responses to matrix composition and stiffness to show that α-SMA+ PC accumulate in a mechanosensitive manner independent of matrix composition. PC activated with TGF-β1 remodel the normal lung matrix, increasing tissue stiffness to facilitate the emergence of α-SMA+ PC via MKL-1/MTRFA mechanotranduction. Nintedanib, a tyrosine-kinase inhibitor approved for IPF treatment, restores the elastic modulus of fibrotic lung matrices to reverse the α-SMA+ phenotype. This work furthers our understanding of the role that microvascular PC play in the evolution of IPF, describes the creation of an ex vivo platform that advances the study of fibrosis, and presents a potentially novel mode of action for a commonly used antifibrotic therapy that has great relevance for human disease.
Yoshino, Hironori; Iwabuchi, Miyu; Kazama, Yuka; Furukawa, Maho; Kashiwakura, Ikuo
2018-04-01
Retinoic acid-inducible gene-I (RIG-I)-like receptors (RLRs) are pattern-recognition receptors that recognize pathogen-associated molecular patterns and induce antiviral immune responses. Recent studies have demonstrated that RLR activation induces antitumor immunity and cytotoxicity against different types of cancer, including lung cancer. However a previous report has demonstrated that ionizing radiation exerts a limited effect on RLR in human monocytic cell-derived macrophages, suggesting that RLR agonists may be used as effective immunostimulants during radiation therapy. However, it is unclear whether ionizing radiation affects the cytotoxicity of RLR agonists against cancer cells. Therefore, in the present study the effects of cotreatment with ionizing radiation and RLR agonists on cytotoxicity against human non-small cell lung cancer cells A549 and H1299 was investigated. Treatment with RLR agonist poly(I:C)/LyoVec™ [poly(I:C)] exerted cytotoxic effects against human non-small cell lung cancer. The cytotoxic effects of poly(I:C) were enhanced by cotreatment with ionizing radiation, and poly(I:C) pretreatment resulted in the radiosensitization of non-small cell lung cancer. Furthermore, cotreatment of A549 and H1299 cells with poly(I:C) and ionizing radiation effectively induced apoptosis in a caspase-dependent manner compared with treatment with poly(I:C) or ionizing radiation alone. These results indicate that RLR agonists and ionizing radiation cotreatment effectively exert cytotoxic effects against human non-small cell lung cancer through caspase-mediated apoptosis.
16 CFR 460.7 - Which test version to use.
2010-01-01
... 16 Commercial Practices 1 2010-01-01 2010-01-01 false Which test version to use. 460.7 Section 460.7 Commercial Practices FEDERAL TRADE COMMISSION TRADE REGULATION RULES LABELING AND ADVERTISING OF... automatically replace the old one in these rules 90 days after ASTM first publishes the change. However, the...
Directory of Open Access Journals (Sweden)
Richa Dubey
Full Text Available STAT6 transcription factor has become a potential molecule for therapeutic intervention because it regulates broad range of cellular processes in a large variety of cell types. Although some target genes and interacting partners of STAT6 have been identified, its exact mechanism of action needs to be elucidated. In this study, we sought to further characterize the molecular interactions, networks, and functions of STAT6 by profiling the mRNA expression of STAT6 silenced human lung cells (NCI-H460 using microarrays. Our analysis revealed 273 differentially expressed genes after STAT6 silencing. Analysis of the gene expression data with Ingenuity Pathway Analysis (IPA software revealed Gene expression, Cell death, Lipid metabolism as the functions associated with highest rated network. Cholesterol biosynthesis was among the most enriched pathways in IPA as well as in PANTHER analysis. These results have been validated by real-time PCR and cholesterol assay using scrambled siRNA as a negative control. Similar findings were also observed with human type II pulmonary alveolar epithelial cells, A549. In the present study we have, for the first time, shown the inverse relationship of STAT6 with the cholesterol biosynthesis in lung cancer cells. The present findings are potentially significant to advance the understanding and design of therapeutics for the pathological conditions where both STAT6 and cholesterol biosynthesis are implicated viz. asthma, atherosclerosis etc.
Busquets, Núria; Segalés, Joaquim; Córdoba, Lorena; Mussá, Tufaria; Crisci, Elisa; Martín-Valls, Gerard E; Simon-Grifé, Meritxell; Pérez-Simó, Marta; Pérez-Maíllo, Monica; Núñez, Jose I; Abad, Francesc X; Fraile, Lorenzo; Pina, Sonia; Majó, Natalia; Bensaid, Albert; Domingo, Mariano; Montoya, María
2010-01-01
The recent pandemic caused by human influenza virus A(H1N1) 2009 contains ancestral gene segments from North American and Eurasian swine lineages as well as from avian and human influenza lineages. The emergence of this A(H1N1) 2009 poses a potential global threat for human health and the fact that it can infect other species, like pigs, favours a possible encounter with other influenza viruses circulating in swine herds. In Europe, H1N1, H1N2 and H3N2 subtypes of swine influenza virus currently have a high prevalence in commercial farms. To better assess the risk posed by the A(H1N1) 2009 in the actual situation of swine farms, we sought to analyze whether a previous infection with a circulating European avian-like swine A/Swine/Spain/53207/2004 (H1N1) influenza virus (hereafter referred to as SwH1N1) generated or not cross-protective immunity against a subsequent infection with the new human pandemic A/Catalonia/63/2009 (H1N1) influenza virus (hereafter referred to as pH1N1) 21 days apart. Pigs infected only with pH1N1 had mild to moderate pathological findings, consisting on broncho-interstitial pneumonia. However, pigs inoculated with SwH1N1 virus and subsequently infected with pH1N1 had very mild lung lesions, apparently attributed to the remaining lesions caused by SwH1N1 infection. These later pigs also exhibited boosted levels of specific antibodies. Finally, animals firstly infected with SwH1N1 virus and latter infected with pH1N1 exhibited undetectable viral RNA load in nasal swabs and lungs after challenge with pH1N1, indicating a cross-protective effect between both strains. © INRA, EDP Sciences, 2010.
Mycobacterium tuberculosis Invasion of the Human Lung: First Contact
Directory of Open Access Journals (Sweden)
Jeroen Maertzdorf
2018-06-01
Full Text Available Early immune responses to Mycobacterium tuberculosis (Mtb invasion of the human lung play a decisive role in the outcome of infection, leading to either rapid clearance of the pathogen or stable infection. Despite their critical impact on health and disease, these early host–pathogen interactions at the primary site of infection are still poorly understood. In vitro studies cannot fully reflect the complexity of the lung architecture and its impact on host–pathogen interactions, while animal models have their own limitations. In this study, we have investigated the initial responses in human lung tissue explants to Mtb infection, focusing primarily on gene expression patterns in different tissue-resident cell types. As first cell types confronted with pathogens invading the lung, alveolar macrophages, and epithelial cells displayed rapid proinflammatory chemokine and cytokine responses to Mtb infection. Other tissue-resident innate cells like gamma/delta T cells, mucosal associated invariant T cells, and natural killer cells showed partially similar but weaker responses, with a high degree of variability across different donors. Finally, we investigated the responses of tissue-resident innate lymphoid cells to the inflammatory milieu induced by Mtb infection. Our infection model provides a unique approach toward host–pathogen interactions at the natural port of Mtb entry and site of its implantation, i.e., the human lung. Our data provide a first detailed insight into the early responses of different relevant pulmonary cells in the alveolar microenvironment to contact with Mtb. These results can form the basis for the identification of host markers that orchestrate early host defense and provide resistance or susceptibility to stable Mtb infection.
Seo, Kyung Hye; Ryu, Hyung Won; Park, Mi Jin; Park, Ki Hun; Kim, Jin Hyo; Lee, Mi-Ja; Kang, Hyeon Jung; Kim, Sun Lim; Lee, Jin Hwan; Seo, Woo Duck
2015-11-01
Mangosenone F (MSF), a natural xanthone, was isolated form Carcinia mangotana, and a few studies have reported its glycosidase inhibitor effect. In this study we investigated the anti lung cancer effect of MSF both in vitro and in vivo. MSF inhibited cancer cell cytotoxicity and induced and induced apoptosis via reactive oxygen species (ROS) generation in NCI-H460. MSF treatment also showed in pronounced release of apoptogenic cytochrome c from the mitochondria to the cytosol, downregulation of Bcl-2 and Bcl-xL, and upregulation of Bax, suggesting that caspase-mediated pathways were involved in MSF-induced apoptosis. ROS activation of the mitogen-activated protein kinase signaling pathway was shown to play a predominant role in the apoptosis mechanism of MSF. Compared with cisplatin treatment, MSF treatment showed significantly increased inhibition of the growth of NCI-H460 cells xenografted in nude mice. Together, these results indicate the potential of MSF as a candidate natural anticancer drug by promoting ROS production. Copyright © 2015 John Wiley & Sons, Ltd.
Xu, Lu-Lu; Guo, Shu-Liang; Ma, Su-Ren; Luo, Yong-Ai
2012-01-01
Mammalian mediator (MED) is a multi-protein coactivator that has been identified by several research groups. The involvement of the MED complex subunit 19 (MED 19) in the metastasis of lung adenocarcinoma cell line (H1299), which expresses the MED 19 subunit, was here investigated. When MED 19 expression was decreased by RNA interference H1299 cells demonstrated reduced clone formation, arrest in the S phase of the cell cycle, and lowered metastatic capacity. Thus, MED 19 appears to play important roles in the biological behavior of non-small cell lung carcinoma cells. These findings may be important for the development of novel lung carcinoma treatments.
Ashmore, Joseph H; Luo, Shaman; Watson, Christy J W; Lazarus, Philip
2018-05-17
4-(Methylnitrosamino)-1-(3-pyridyl)-1-butanone (NNK) is the most abundant and carcinogenic tobacco-specific nitrosamine in tobacco and tobacco smoke. The major metabolic pathway for NNK is carbonyl reduction to form the (R) and (S) enantiomers of 4-(methylnitrosamino)-1-(3-pyridyl)-1-butanol (NNAL) which, like NNK, is a potent lung carcinogen. The goal of the present study was to characterize NNAL enantiomer formation in human lung and identify the enzymes responsible for this activity. While (S)-NNAL was the major enantiomer of NNAL formed in incubations with NNK in lung cytosolic fractions, (R)-NNAL comprised ~60 and ~95% of the total NNAL formed in lung whole cell lysates and microsomes, respectively. In studies examining the role of individual recombinant reductase enzymes in lung NNAL enantiomer formation, AKR1C1, AKR1C2, AKR1C3, AKR1C4 and CBR1 all exhibited (S)-NNAL formation activity. To identify the microsomal enzymes responsible for (R)-NNAL formation, 28 microsomal reductase enzymes were screened for expression by real-time PCR in normal human lung. HSD17β6, HSD17β12, KDSR, NSDHL, RDH10, RDH11 and SDR16C5 were all expressed at levels >HSD11β1, the only previously reported microsomal reductase enzyme with NNK-reducing activity, with HSD17β12 the most highly expressed. Of these lung-expressing enzymes, only HSD17β12 exhibited activity against NNK, forming primarily (>95%) (R)-NNAL, a pattern consistent with that observed in lung microsomes. siRNA knockdown of HSD17β12 resulted in significant decreases in (R)-NNAL formation activity in HEK293 cells. These data suggest that both cytosolic and microsomal enzymes are active against NNK and that HSD17β12 is the major active microsomal reductase that contributes to (R)-NNAL formation in human lung.
Directory of Open Access Journals (Sweden)
Cappello Francesco
2007-03-01
Full Text Available Abstract Background Exposure to cigarette smoke is considered a major risk factor for the development of lung diseases, since its causative role has been assessed in the induction and maintenance of an inflamed state in the airways. Lung fibroblasts can contribute to these processes, due to their ability to produce proinflammatory chemotactic molecules and extracellular matrix remodelling proteinases. Among proteolytic enzymes, gelatinases A and B have been studied for their role in tissue breakdown and mobilisation of matrix-derived signalling molecules. Multiple reports linked gelatinase deregulation and overexpression to the development of inflammatory chronic lung diseases such as COPD. Methods In this study we aimed to determine variations in the gelatinolytic pattern of human lung fibroblasts (HFL-1 cell line exposed to cigarette smoke extract (CSE. Gelatinolytic activity levels were determined by using gelatin zymography for the in-gel detection of the enzymes (proenzyme and activated forms, and the subsequent semi-quantitative densitometric evaluation of lytic bands. Expression of gelatinases was evaluated also by RT-PCR, zymography of the cell lysates and by western blotting. Results CSE exposure at the doses used (1–10% did not exert any significant cytotoxic effects on fibroblasts. Zymographic analysis showed that CSE exposure resulted in a linear decrease of the activity of gelatinase A. Control experiments allowed excluding a direct inhibitory effect of CSE on gelatinases. Zymography of cell lysates confirmed the expression of MMP-2 in all conditions. Semi-quantitative evaluation of mRNA expression allowed assessing a reduced transcription of the enzyme, as well as an increase in the expression of TIMP-2. Statistical analyses showed that the decrease of MMP-2 activity in conditioned media reached the statistical significance (p = 0.0031 for 24 h and p = 0.0012 for 48 h, while correlation analysis showed that this result was
Nickel, Sabrina; Selo, Mohammed Ali; Fallack, Juliane; Clerkin, Caoimhe G; Huwer, Hanno; Schneider-Daum, Nicole; Lehr, Claus-Michael; Ehrhardt, Carsten
2017-12-01
Breast cancer resistance protein (BCRP/ABCG2) has previously been identified with high expression levels in human lung. The subcellular localisation and functional activity of the transporter in lung epithelia, however, remains poorly investigated. The aim of this project was to study BCRP expression and activity in freshly isolated human alveolar epithelial type 2 (AT2) and type 1-like (AT1-like) cells in primary culture, and to compare these findings with data obtained from the NCI-H441 cell line. BCRP expression levels in AT2 and AT1-like cells and in different passages of NCI-H441 cells were determined using q-PCR and immunoblot. Transporter localisation was confirmed by confocal laser scanning microscopy. Efflux and transport studies using the BCRP substrate BODIPY FL prazosin and the inhibitor Ko143 were carried out to assess BCRP activity in the different cell models. BCRP expression decreased during transdifferentiation from AT2 to AT1-like phenotype. Culturing NCI-H441 cells at an air-liquid interface or submersed did not change BCRP abundance, however, BCRP levels increased with passage number. BCRP was localised to the apical membrane and cytosol in NCI-H441 cells. In primary cells, the protein was found predominantly in the nucleus. Functional studies were consistent with expression data. BCRP is differently expressed in AT2 and AT1-like cells with lower abundance and activity in the latter ones. Nuclear BCRP might play a transcriptional role in distal lung epithelium. In NCI-H441 cells, BCRP is expressed in apical cell membranes and its activity is consistent with the localisation pattern.
Energy Technology Data Exchange (ETDEWEB)
Sundarraj, Shenbagamoorthy, E-mail: sundarrajbu09@gmail.com [Proteomics and Molecular Cell Physiology Laboratory, Department of Zoology, Bharathiar University, Coimbatore 641 046, TN (India); Thangam, Ramar [Proteomics and Molecular Cell Physiology Laboratory, Department of Zoology, Bharathiar University, Coimbatore 641 046, TN (India); Department of Virology, King Institute of Preventive Medicine and Research, Guindy, Chennai 600 032, TN (India); Sujitha, Mohanan V.; Vimala, Karuppaiya [Proteomics and Molecular Cell Physiology Laboratory, Department of Zoology, Bharathiar University, Coimbatore 641 046, TN (India); Kannan, Soundarapandian, E-mail: skperiyaruniv@gmail.com [Proteomics and Molecular Cell Physiology Laboratory, Department of Zoology, Bharathiar University, Coimbatore 641 046, TN (India); Department of Zoology, Periyar University, Salem 636 011, TN (India)
2014-03-15
Epidermal growth factor receptor antibody (EGFRAb) conjugated silica nanorattles (SNs) were synthesized and used to develop receptor mediated endocytosis for targeted drug delivery strategies for cancer therapy. The present study determined that the rate of internalization of silica nanorattles was found to be high in lung cancer cells when compared with the normal lung cells. EGFRAb can specifically bind to EGFR, a receptor that is highly expressed in lung cancer cells, but is expressed at low levels in other normal cells. Furthermore, in vitro studies clearly substantiated that the cPLA{sub 2}α activity, arachidonic acid release and cell proliferation were considerably reduced by pyrrolidine-2 loaded EGFRAb-SN in H460 cells. The cytotoxicity, cell cycle arrest and apoptosis were significantly induced by the treatment of pyrrolidine-2 loaded EGFRAb-SN when compared with free pyrrolidine-2 and pyrrolidine-2 loaded SNs in human non-small cell lung cancer cells. An in vivo toxicity assessment showed that silica nanorattles and EGFRAb-SN-pyrrolidine-2 exhibited low systemic toxicity in healthy Balb/c mice. The EGFRAb-SN-pyrrolidine-2 showed a much better antitumor activity (38%) with enhanced tumor inhibition rate than the pyrrolidine-2 on the non-small cell lung carcinoma subcutaneous model. Thus, the present findings validated the low toxicity and high therapeutic potentials of EGFRAb-SN-pyrrolidine-2, which may provide a convincing evidence of the silica nanorattles as new potential carriers for targeted drug delivery systems. - Highlights: • EGFRAb-SN developed for receptor-mediated Drug delivery system (DDS). • EGFRAb-SN-pyrrolidine-2 targeted DDS for cPLA2α inhibition in NSLC. • Study indicates EGFRAb-SN-pyrrolidine-2 as an efficient in target dug delivery carrier. • Study explains entire efficiency of EGFRAb-SN-pyrrolidine-2 in vitro and in vivo models.
International Nuclear Information System (INIS)
Sundarraj, Shenbagamoorthy; Thangam, Ramar; Sujitha, Mohanan V.; Vimala, Karuppaiya; Kannan, Soundarapandian
2014-01-01
Epidermal growth factor receptor antibody (EGFRAb) conjugated silica nanorattles (SNs) were synthesized and used to develop receptor mediated endocytosis for targeted drug delivery strategies for cancer therapy. The present study determined that the rate of internalization of silica nanorattles was found to be high in lung cancer cells when compared with the normal lung cells. EGFRAb can specifically bind to EGFR, a receptor that is highly expressed in lung cancer cells, but is expressed at low levels in other normal cells. Furthermore, in vitro studies clearly substantiated that the cPLA 2 α activity, arachidonic acid release and cell proliferation were considerably reduced by pyrrolidine-2 loaded EGFRAb-SN in H460 cells. The cytotoxicity, cell cycle arrest and apoptosis were significantly induced by the treatment of pyrrolidine-2 loaded EGFRAb-SN when compared with free pyrrolidine-2 and pyrrolidine-2 loaded SNs in human non-small cell lung cancer cells. An in vivo toxicity assessment showed that silica nanorattles and EGFRAb-SN-pyrrolidine-2 exhibited low systemic toxicity in healthy Balb/c mice. The EGFRAb-SN-pyrrolidine-2 showed a much better antitumor activity (38%) with enhanced tumor inhibition rate than the pyrrolidine-2 on the non-small cell lung carcinoma subcutaneous model. Thus, the present findings validated the low toxicity and high therapeutic potentials of EGFRAb-SN-pyrrolidine-2, which may provide a convincing evidence of the silica nanorattles as new potential carriers for targeted drug delivery systems. - Highlights: • EGFRAb-SN developed for receptor-mediated Drug delivery system (DDS). • EGFRAb-SN-pyrrolidine-2 targeted DDS for cPLA2α inhibition in NSLC. • Study indicates EGFRAb-SN-pyrrolidine-2 as an efficient in target dug delivery carrier. • Study explains entire efficiency of EGFRAb-SN-pyrrolidine-2 in vitro and in vivo models
Epidermal growth factor receptor in primary human lung cancer
International Nuclear Information System (INIS)
Yu Xueyan; Hu Guoqiang; Tian Keli; Wang Mingyun
1996-01-01
Cell membranes were prepared from 12 human lung cancers for the study of the expression of epidermal growth factor receptors (EGFR). EGFR concentration was estimated by ligand binding studies using 125 I-radiolabeled EGF. The dissociation constants of the high affinity sites were identical, 1.48 nmol and 1.1 nmol in cancer and normal lung tissues, the EGFR contents were higher in lung cancer tissues (range: 2.25 to 19.39 pmol·g -1 membrane protein) than that in normal tissues from the same patients (range: 0.72 to 7.43 pmol·g -1 membrane protein). These results suggest that EGF and its receptor may play a role in the regulatory mechanisms in the control of lung cellular growth and tumor promotion
Xu, Li; Fu, Yingya; Li, Youlun; Han, Xiaoli
2017-08-01
Change of multidrug resistance-related genes (e.g., lung resistance protein, LRP) and overexpression of anti-apoptotic genes (Bcl-2, Bcl-Xl, XIAP, Survivin) are responsible for cisplatin resistance. In our study, we investigated the mechanism by which cisplatin induces LRP, Bcl-2, Bcl-xL, XIAP, and Survivin expression in human lung adenocarcinoma A549 cells and human H446 small cell lung cancer cells at mRNA and protein levels. In our study, cell proliferation was assessed with CCK-8 assays, and cell apoptosis was assessed with flow cytometric analysis and Annexin-V/PI staining. qPCR was used to complete RNA experiments. Protein expression was assessed with Western blotting. Cisplatin increased Bcl-2, LRP, and Survivin expression, but decreased Bcl-xL and XIAP expression in a dose-dependent manner. Preincubation with JNK-specific inhibitor, SP600125, significantly inhibited these genes' expression at mRNA and protein levels, enhanced chemosensitivity of lung cancer cells to cisplatin, and promoted cisplatin-induced apoptosis. Our data suggest that the JNK signaling pathway plays an important role in cisplatin resistance. Lung resistance protein (LRP) and anti-apoptotic genes (Bcl-2, Bcl-Xl, XIAP, Survivin) are involved in the process. The results reminded us of a novel therapy target for lung cancer treatment.
Directory of Open Access Journals (Sweden)
Iniesta Pilar
2011-08-01
Full Text Available Abstract Background Mortality rates for advanced lung cancer have not declined for decades, even with the implementation of novel chemotherapeutic regimens or the use of tyrosine kinase inhibitors. Cancer Stem Cells (CSCs are thought to be responsible for resistance to chemo/radiotherapy. Therefore, targeting CSCs with novel compounds may be an effective approach to reduce lung tumor growth and metastasis. We have isolated and characterized CSCs from non-small cell lung cancer (NSCLC cell lines and measured their telomerase activity, telomere length, and sensitivity to the novel telomerase inhibitor MST312. Results The aldehyde dehydrogenase (ALDH positive lung cancer cell fraction is enriched in markers of stemness and endowed with stem cell properties. ALDH+ CSCs display longer telomeres than the non-CSC population. Interestingly, MST312 has a strong antiproliferative effect on lung CSCs and induces p21, p27 and apoptosis in the whole tumor population. MST312 acts through activation of the ATM/pH2AX DNA damage pathway (short-term effect and through decrease in telomere length (long-term effect. Administration of this telomerase inhibitor (40 mg/kg in the H460 xenograft model results in significant tumor shrinkage (70% reduction, compared to controls. Combination therapy consisting of irradiation (10Gy plus administration of MST312 did not improve the therapeutic efficacy of the telomerase inhibitor alone. Treatment with MST312 reduces significantly the number of ALDH+ CSCs and their telomeric length in vivo. Conclusions We conclude that antitelomeric therapy using MST312 mainly targets lung CSCs and may represent a novel approach for effective treatment of lung cancer.
Directory of Open Access Journals (Sweden)
Zheng Wang
2016-09-01
Full Text Available Cordycepin is an active component of the traditional Chinese medicine Cordyceps sinensis and Cordyceps militaris with notable anticancer activity. Though the prominent inhibitory activity was reported in different kinds of cancer cell lines, the concrete mechanisms remain elusive. It was reported that cordycepin could be converted into tri-phosphates in vivo to confuse a number of enzymes and interfere the normal cell function. For the inhibitory mechanism of EGFR inhibitors and the structure similarity of ATP and tri-phosphated cordycepin, human lung cancer cell line H1975 was employed to investigate the inhibitory effect of cordycepin. The results showed that cordycepin could inhibit cell proliferation and induce apoptosis in a dose-dependent manner. Cell cycle analysis revealed that H1975 cells could be arrested at the G0/G1 phase after cordycepin treatment. The expression levels of apoptosis-related protein Caspase-3 and Bcl-2 and phosphorylated expression levels of EGFR, AKT and ERK1/2 were all decreased compared with the control group stimulated with EGF. However, the protein expression levels of proapoptotic protein Bax and cleaved caspase-3 were increased. These results implied that cordycepin could inhibit cell proliferation and induce apoptosis via the EGFR signaling pathway. Our results indicated that there was potential to seek a novel EGFR inhibitor from cordycepin and its chemical derivatives.
KL-6, a human MUC1 mucin, promotes proliferation and survival of lung fibroblasts
International Nuclear Information System (INIS)
Ohshimo, Shinichiro; Yokoyama, Akihito; Hattori, Noboru; Ishikawa, Nobuhisa; Hirasawa, Yutaka; Kohno, Nobuoki
2005-01-01
The serum level of KL-6, a MUC1 mucin, is a clinically useful marker for various interstitial lung diseases. Previous studies demonstrated that KL-6 promotes chemotaxis of human fibroblasts. However, the pathophysiological role of KL-6 remains poorly understood. Here, we further investigate the functional aspects of KL-6 in proliferation and apoptosis of lung fibroblasts. KL-6 accelerated the proliferation and inhibited the apoptosis of all human lung fibroblasts examined. An anti-KL-6 monoclonal antibody counteracted both of these effects induced by KL-6 on human lung fibroblasts. The pro-fibroproliferative and anti-apoptotic effects of KL-6 are greater than and additive to those of the maximum effective concentrations of platelet-derived growth factor, basic fibroblast growth factor, and transforming growth factor-β. These findings indicate that increased levels of KL-6 in the epithelial lining fluid may stimulate fibrotic processes in interstitial lung diseases and raise the possibility of applying an anti-KL-6 antibody to treat interstitial lung diseases
Measurement of histamine release from human lung tissue ex vivo by microdialysis technique
DEFF Research Database (Denmark)
Nissen, Dan; Petersen, Lars Jelstrup; Nolte, H
1998-01-01
OBJECTIVE AND DESIGN: Currently no method is available for measurement of mediator release from intact human lung. In this study, a microdialysis technique was used to measure histamine release from mast cells in human lung tissue ex vivo. MATERIAL: Microdialysis fibers of 216 microm were inserted...... responses were observed but data could be reproduced within individual donors. Monocyte chemoattractant protein-1, a potent basophil secretagogue, did not induce histamine release in lung tissue which indicated mast cells to be the histamine source. Substance P did not release histamine in the lung tissue....... CONCLUSIONS: The microdialysis technique allowed measurements of histamine release from mast cells in intact lung ex vivo. The method may prove useful since a number of experiments can be performed in a few hours in intact lung tissue without any dispersion or enzymatic treatment....
Directory of Open Access Journals (Sweden)
Amie L. Holmes
2013-11-01
Full Text Available Nickel is a well-known human lung carcinogen with the particulate form being the most potent; however, the carcinogenic mechanism remains largely unknown. Few studies have investigated the genotoxicity and carcinogenicity of nickel in its target cell, human bronchial epithelial cells. Thus, the goal of this study was to investigate the effects of particulate nickel in human lung epithelial cells. We found that nickel subsulfide induced concentration- and time-dependent increases in both cytotoxicity and genotoxicity in human lung epithelial cells (BEP2D. Chronic exposure to nickel subsulfide readily induced cellular transformation, inducing 2.55, 2.9 and 2.35 foci per dish after exposure to 1, 2.5 and 5 μg/cm2 nickel subsulfide, respectively. Sixty-one, 100 and 70 percent of the foci isolated from 1, 2.5, and 5 μg/cm2 nickel subsulfide treatments formed colonies in soft agar and the degree of soft agar colony growth increased in a concentration-dependent manner. Thus, chronic exposure to particulate nickel induces genotoxicity and cellular transformation in human lung epithelial cells.
Hunt, A P; Frier, M; Johnson, R A; Berezenko, S; Perkins, A C
2006-01-01
Human serum albumin (HSA) extracted from pooled blood taken from human donors is used in the production of (99m)Tc-labelled macroaggregated albumin (MAA) for lung perfusion imaging. However, concerns for the safety of blood-derived products due to potential contamination by infective agents (e.g. new variant CJD), make alternative production methods necessary. Recombinant DNA technology is a promising method of albumin production avoiding problems associated with human-derived HSA. This paper presents results comparing MAA prepared from recombinant human albumin (rHA, Recombumin) (rMAA) with in-house produced HSA MAA (hMAA) and commercially available MAA (cMAA). (99m)Tc-MAA was prepared using previously published production methods by heating a mixture of albumin and stannous chloride in acetate buffer (pH 5.4) at 70 degrees C for 20 min. Parameters investigated include aggregate size, radiolabelling efficiency, radiochemical and aggregate stability at 4 degrees C and in vitro (in whole human blood) at 37 degrees C and biodistribution studies. Results showed that rMAA could be produced with similar morphology, labelling efficiency and stability to hMAA and cMAA. Our findings confirm that rHA shows significant potential as a direct replacement for HSA in commercially available MAA.
Popp, A.; Wendel, M.; Knels, L.; Knuschke, P.; Mehner, M.; Koch, T.; Boller, D.; Koch, P.; Koch, E.
2005-08-01
A compact common path Fourier domain optical coherence tomography (FD-OCT) system based on a broadband superluminescence diode is used for biomedical imaging. The epidermal thickening of human skin after exposure to ultraviolet radiation is measured to proof the feasibility of FD-OCT for future substitution of invasive biopsies in a long term study on natural UV skin protection. The FD-OCT system is also used for imaging lung parenchyma. FD-OCT images of a formalin fixated lung show the same alveolar structure as scanning electron microscopy images. In the ventilated and blood-free perfused isolated rabbit lung FD-OCT is used for real-time cross-sectional image capture of alveolar mechanics throughout tidal ventilation. The alveolar mechanics changing from alternating recruitment-derecruitment at zero positive end-expiratory pressure (PEEP) to persistent recruitment after applying a PEEP of 5 cm H2O is observed in the OCT images.
Zeng, Huawei; Taussig, David P; Cheng, Wen-Hsing; Johnson, LuAnn K; Hakkak, Reza
2017-01-01
Butyrate, an intestinal microbiota metabolite of dietary fiber, exhibits chemoprevention effects on colon cancer development. However, the mechanistic action of butyrate remains to be determined. We hypothesize that butyrate inhibits cancerous cell proliferation but to a lesser extent in noncancerous cells through regulating apoptosis and cellular-signaling pathways. We tested this hypothesis by exposing cancerous HCT116 or non-cancerous NCM460 colon cells to physiologically relevant doses of butyrate. Cellular responses to butyrate were characterized by Western analysis, fluorescent microscopy, acetylation, and DNA fragmentation analyses. Butyrate inhibited cell proliferation, and led to an induction of apoptosis, genomic DNA fragmentation in HCT116 cells, but to a lesser extent in NCM460 cells. Although butyrate increased H3 histone deacetylation and p21 tumor suppressor expression in both cell types, p21 protein level was greater with intense expression around the nuclei in HCT116 cells when compared with that in NCM460 cells. Furthermore, butyrate treatment increased the phosphorylation of extracellular-regulated kinase 1/2 (p-ERK1/2), a survival signal, in NCM460 cells while it decreased p-ERK1/2 in HCT116 cells. Taken together, the activation of survival signaling in NCM460 cells and apoptotic potential in HCT116 cells may confer the increased sensitivity of cancerous colon cells to butyrate in comparison with noncancerous colon cells.
H2S Attenuates LPS-Induced Acute Lung Injury by Reducing Oxidative/Nitrative Stress and Inflammation
Directory of Open Access Journals (Sweden)
Hong-Xia Zhang
2016-12-01
Full Text Available Background: Hydrogen sulfide (H2S, known as the third endogenous gaseous transmitter, has received increasing attention because of its diverse effects, including angiogenesis, vascular relaxation and myocardial protection.We aimed to investigate the role of H2S in oxidative/nitrative stress and inflammation in acute lung injury (ALI induced by endotoxemia. Methods: Male ICR mice were divided in six groups: (1 Control group; (2 GYY4137treatment group; (3 L-NAME treatment group; (4 lipopolysaccharide (LPS treatment group; (5 LPS with GYY4137 treatment group; and (6 LPS with L-NAME treatment group. The lungs were analysed by histology, NO production in the mouse lungs determined by modified Griess (Sigma-Aldrich reaction, cytokine levels utilizing commercialkits, and protein abundance by Western blotting. Results: GYY4137, a slowly-releasing H2S donor, improved the histopathological changes in the lungs of endotoxemic mice. Treatment with NG-nitro-L-arginine methyl ester (L-NAME, a nitric oxide synthase (NOS inhibitor, increased anti-oxidant biomarkers such as thetotal antioxidant capacity (T-AOC and theactivities of catalase (CAT and superoxide dismutase (SOD but decreased a marker of peroxynitrite (ONOO- action and 3-nitrotyrosine (3-NT in endotoxemic lung. L-NAME administration also suppressed inflammation in endotoxemic lung, as evidenced by the decreased pulmonary levels of interleukin (IL-6, IL-8, and myeloperoxidase (MPO and the increased level of anti-inflammatory cytokine IL-10. GYY4137 treatment reversed endotoxin-induced oxidative/nitrative stress, as evidenced by a decrease in malondialdehyde (MDA, hydrogenperoxide (H2O2 and 3-NT and an increase in the antioxidant biomarker ratio of reduced/oxidized glutathione(GSH/GSSG ratio and T-AOC, CAT and SOD activity. GYY4137 also attenuated endotoxin-induced lung inflammation. Moreover, treatment with GYY4137 inhibited inducible NOS (iNOS expression and nitric oxide (NO production in the
International Nuclear Information System (INIS)
Cross, F.T.
1991-03-01
The usefulness of experimental systems for studying human lung carcinogenesis lies in the ease of studying components of a total problem. As an example, the main thrust of attack on possible synergistic interactions between radiation, cigarette smoke, and other irritants must be by means of research on animals. Because animals can be serially sacrificed, a systematic search can be made for progressive lung changes, thereby improving our understanding of carcinogenesis. The mechanisms of radiation-induced carcinogenesis have not yet been delineated, but modern concepts of molecular and cellular biology and of radiation dosimetry are being increasingly applied to both in vivo and in vitro exposure to determine the mechanisms of radiation-induced carcinogenesis, to elucidate human data, and to aid in extrapolating experimental animal data to human exposures. In addition, biologically based mathematical models of carcinogenesis are being developed to describe the nature of the events leading to malignancy; they are also an essential part of a rational approach to quantitative cancer risk assessment. This paper summarizes recent experimental and modeling data on radon-induced lung cancer and includes the confounding effects of cigarette-smoke exposures. The applicability of these data to understanding human exposures is emphasized, and areas of future research on human radiation-induced carcinogenesis are discussed. 7 refs., 2 figs., 3 tabs
Directory of Open Access Journals (Sweden)
Meyerhans Andreas
2010-09-01
Full Text Available Abstract Background Investigations on pulmonary macrophages (MΦ mostly focus on alveolar MΦ (AM as a well-defined cell population. Characteristics of MΦ in the interstitium, referred to as lung interstitial MΦ (IM, are rather ill-defined. In this study we therefore aimed to elucidate differences between AM and IM obtained from human lung tissue. Methods Human AM and IM were isolated from human non-tumor lung tissue from patients undergoing lung resection. Cell morphology was visualized using either light, electron or confocal microscopy. Phagocytic activity was analyzed by flow cytometry as well as confocal microscopy. Surface marker expression was measured by flow cytometry. Toll-like receptor (TLR expression patterns as well as cytokine expression upon TLR4 or TLR9 stimulation were assessed by real time RT-PCR and cytokine protein production was measured using a fluorescent bead-based immunoassay. Results IM were found to be smaller and morphologically more heterogeneous than AM, whereas phagocytic activity was similar in both cell types. HLA-DR expression was markedly higher in IM compared to AM. Although analysis of TLR expression profiles revealed no differences between the two cell populations, AM and IM clearly varied in cell reaction upon activation. Both MΦ populations were markedly activated by LPS as well as DNA isolated from attenuated mycobacterial strains (M. bovis H37Ra and BCG. Whereas AM expressed higher amounts of inflammatory cytokines upon activation, IM were more efficient in producing immunoregulatory cytokines, such as IL10, IL1ra, and IL6. Conclusion AM appear to be more effective as a non-specific first line of defence against inhaled pathogens, whereas IM show a more pronounced regulatory function. These dissimilarities should be taken into consideration in future studies on the role of human lung MΦ in the inflammatory response.
Biondo, Natalha; Schaefer, Rejane; Gava, Danielle; Cantão, Mauricio E; Silveira, Simone; Mores, Marcos A Z; Ciacci-Zanella, Janice R; Barcellos, David E S N
2014-01-10
Influenza is a viral disease that affects human and several animal species. In Brazil, H1N1, H3N2 and 2009 pandemic H1N1 A(H1N1)pdm09 influenza A viruses (IAV) circulate in domestic swine herds. Wild boars are also susceptible to IAV infection but in Brazil until this moment there are no reports of IAV infection in wild boars or in captive wild boars populations. Herein the occurrence of IAV in captive wild boars with the presence of lung consolidation lesions during slaughter was investigated. Lung samples were screened by RT-PCR for IAV detection. IAV positive samples were further analyzed by quantitative real-time PCR (qRRT-PCR), virus isolation, genomic sequencing, histopathology and immunohistochemistry (IHC). Eleven out of 60 lungs (18.3%) were positive for IAV by RT-PCR and seven out of the eleven were also positive for A(H1N1)pdm09 by qRRT-PCR. Chronic diffuse bronchopneumonia was observed in all samples and IHC analysis was negative for influenza A antigen. Full genes segments of H1N2 IAV were sequenced using Illumina's genome analyzer platform (MiSeq). The genomic analysis revealed that the HA and NA genes clustered with IAVs of the human lineage and the six internal genes were derived from the H1N1pdm09 IAV. This is the first report of a reassortant human-like H1N2 influenza virus infection in captive wild boars in Brazil and indicates the need to monitor IAV evolution in Suidae populations. Copyright © 2013 Elsevier B.V. All rights reserved.
Comments on the rat lung as a human surrogate in inhalation studies
International Nuclear Information System (INIS)
Koblinger, L.
1988-01-01
The laboratory rat is often used as a surrogate to estimate the hazard to human health following inhalation exposure to ambient aerosols. Extrapolation of rat deposition data to humans depends, however, on the similarities and differences between the morphometric structures of the two airway systems. The main structural difference between the lungs of the two species, aside from dimensions per se, is their respective airway branching pattern : while the human lung is a rather symmetrically, dichotomously dividing system, the rat network is a more monopodial branching structure. In our stochastic modelling approach to defining suitable morphologies for human and rat lung, we utilise measured morphometric dimensions as the data base upon which a rigorous statistical analysis is performed, instead of forcing them into a formalised, average pathway scheme. This stochastic approach allows us, therefore, to account for structural irregularities, such as asymmetric branching, monopodial structure, and inter and intra-subject variability
Ng-Blichfeldt, John-Poul; Alçada, Joana; Montero, M Angeles; Dean, Charlotte H; Griesenbach, Uta; Griffiths, Mark J; Hind, Matthew
2017-06-01
Molecular pathways that regulate alveolar development and adult repair represent potential therapeutic targets for emphysema. Signalling via retinoic acid (RA), derived from vitamin A, is required for mammalian alveologenesis, and exogenous RA can induce alveolar regeneration in rodents. Little is known about RA signalling in the human lung and its potential role in lung disease. To examine regulation of human alveolar epithelial and endothelial repair by RA, and characterise RA signalling in human emphysema. The role of RA signalling in alveolar epithelial repair was investigated with a scratch assay using an alveolar cell line (A549) and primary human alveolar type 2 (AT2) cells from resected lung, and the role in angiogenesis using a tube formation assay with human lung microvascular endothelial cells (HLMVEC). Localisation of RA synthetic (RALDH-1) and degrading (cytochrome P450 subfamily 26 A1 (CYP26A1)) enzymes in human lung was determined by immunofluorescence. Regulation of RA pathway components was investigated in emphysematous and control human lung tissue by quantitative real-time PCR and Western analysis. RA stimulated HLMVEC angiogenesis in vitro; this was partially reproduced with a RAR-α agonist. RA induced mRNA expression of vascular endothelial growth factor A (VEGFA) and VEGFR2. RA did not modulate AT2 repair. CYP26A1 protein was identified in human lung microvasculature, whereas RALDH-1 partially co-localised with vimentin-positive fibroblasts. CYP26A1 mRNA and protein were increased in emphysema. RA regulates lung microvascular angiogenesis; the endothelium produces CYP26A1 which is increased in emphysema, possibly leading to reduced RA availability. These data highlight a role for RA in maintenance of the human pulmonary microvascular endothelium. Published by the BMJ Publishing Group Limited. For permission to use (where not already granted under a licence) please go to http://www.bmj.com/company/products-services/rights-and-licensing/.
International Nuclear Information System (INIS)
Willey, Christopher D.; Xiao Dakai; Tu Tianxiang; Kim, Kwang Woon; Moretti, Luigi; Niermann, Kenneth J.; Tawtawy, Mohammed N.; Quarles, Chad C. Ph.D.; Lu Bo
2010-01-01
Purpose: Angiogenesis has generated interest in oncology because of its important role in cancer growth and progression, particularly when combined with cytotoxic therapies, such as radiotherapy. Among the numerous pathways influencing vascular growth and stability, inhibition of protein kinase B(Akt) or protein kinase C(PKC) can influence tumor blood vessels within tumor microvasculature. Therefore, we wanted to determine whether PKC inhibition could sensitize lung tumors to radiation. Methods and Materials: The combination of the selective PKCβ inhibitor Enzastaurin (ENZ, LY317615) and ionizing radiation were used in cell culture and a mouse model of lung cancer. Lung cancer cell lines and human umbilical vascular endothelial cells (HUVEC) were examined using immunoblotting, cytotoxic assays including cell proliferation and clonogenic assays, and Matrigel endothelial tubule formation. In vivo, H460 lung cancer xenografts were examined for tumor vasculature and proliferation using immunohistochemistry. Results: ENZ effectively radiosensitizes HUVEC within in vitro models. Furthermore, concurrent ENZ treatment of lung cancer xenografts enhanced radiation-induced destruction of tumor vasculature and proliferation by IHC. However, tumor growth delay was not enhanced with combination treatment compared with either treatment alone. Analysis of downstream effectors revealed that HUVEC and the lung cancer cell lines differed in their response to ENZ and radiation such that only HUVEC demonstrate phosphorylated S6 suppression, which is downstream of mTOR. When ENZ was combined with the mTOR inhibitor, rapamycin, in H460 lung cancer cells, radiosensitization was observed. Conclusion: PKC appears to be crucial for angiogenesis, and its inhibition by ENZ has potential to enhance radiotherapy in vivo.
Potent selective nonpeptidic inhibitors of human lung tryptase
Burgess, Laurence E.; Newhouse, Bradley J.; Ibrahim, Prabha; Rizzi, James; Kashem, Mohammed A.; Hartman, Ann; Brandhuber, Barbara J.; Wright, Clifford D.; Thomson, David S.; Vigers, Guy P. A.; Koch, Kevin
1999-01-01
Human lung tryptase, a homotetrameric serine protease unique to mast cell secretory granules, has been implicated in the pathogenesis of asthma. A hypothesis that tethered symmetrical inhibitors might bridge two adjacent active sites was explored via a rationally designed series of bisbenzamidines. These compounds demonstrated a remarkable distanced-defined structure–activity relationship against human tryptase with one series possessing subnanomolar potencies. Additional evidence supporting ...
2010-04-01
... THE TREASURY LIQUORS LABELING AND ADVERTISING OF WINE Advertising of Wine § 4.60 Application. No... disseminated by radio or television broadcast, or in any newspaper, periodical, or any publication, by any sign... advertising is in, or is calculated to induce sale in, interstate or foreign commerce, or is disseminated by...
International Nuclear Information System (INIS)
Zamora, P.O.; Bender, H.; Biersack, H.J.; Knapp, F.F. Jr.
1995-01-01
The purpose of this study was to evaluate the therapeutic efficacy of Re-188-RC-160 in experimental models of human small cell lung carcinomas which mimic the clinical presentation. In the experimental model, cells from the human small cell lung carcinoma cell line NCI-H69 cells were inoculated into the thoracic cavity of athymic mice and rats. Subsequently, the biodistribution of Re-188-RC-160 after injection into the pleural cavity, a radiolabeled somatostatin analogue, was monitored as was the effect on the subsequent growth of tumors. The results presented here, and which are a part of a larger series of studies, suggest that Re-188-RC-160 can be effectively used in this animal model to restrict the growth of small cell lung carcinoma in the thoracic cavity
Radiopotentiation by the oral platinum agent, JM216: role of repair inhibition
International Nuclear Information System (INIS)
Amorino, George P.; Freeman, Michael L.; Carbone, David P.; Lebwohl, David E.; Choy, Hak
1999-01-01
Purpose: To test for in vitro radiopotentiation by the orally-administered platinum (IV) complex, JM216; to compare these results to cisplatin and carboplatin; and to investigate whether the mechanism of radiopotentiation involves repair inhibition of radiation-induced DNA damage. Methods and Materials: H460 human lung carcinoma cells were incubated with the drugs for 1 h at 37 deg. C, irradiated at room temperature, and returned to 37 deg. C for 20 min. Cells were then rinsed and colony forming ability was assessed. Wild-type V79 Chinese hamster cells and radiosensitive, DNA repair-deficient mutant cells (XR-V15B) were also studied along with H460 cells. Ku86 cDNA, which encodes part of a protein involved in DNA repair, was transfected into XR-V15B cells as previously described. The effect of JM216 on sublethal damage repair (SLDR) was also assessed using split-dose recovery. Results: Using equally cytotoxic doses of JM216, cisplatin, and carboplatin, the radiation dose enhancement ratios (DER) were 1.39, 1.31, and 1.20, respectively; the DER with 20 μM JM216 was 1.57. JM216 (20 μM) did not significantly change the final slope of radiation survival curves, but greatly reduced the survival curve shoulder. V79 cells also showed radioenhancement using 20 μM JM216, but no enhancement occurred using XR-V15B cells. Transfection of Ku86 cDNA into XR-V15B cells restored radiopotentiation by JM216 to wild-type V79 levels. In addition, 20 μM JM216 completely inhibited sublethal damage repair in H460 cells. Conclusion: Our results show that JM216 can potentiate the effects of radiation in human lung cancer cells, and that the mechanism of this effect is probably inhibition of DNA repair by JM216
Quantification of human lung structure and physiology using hyperpolarized 129Xe.
Chang, Yulin V; Quirk, James D; Ruset, Iulian C; Atkinson, Jeffrey J; Hersman, F William; Woods, Jason C
2014-01-01
To present in vivo, human validation of a previously proposed method to measure key pulmonary parameters related to lung microstructure and physiology. Some parameters, such as blood-air barrier thickness, cannot be measured readily by any other noninvasive modality. Healthy volunteers (n = 12) were studied in 1.5T and 3T whole body human scanners using hyperpolarized xenon. Xenon uptake by lung parenchyma and blood was measured using a chemical shift saturation recovery sequence. Both dissolved-xenon peaks at 197 ppm and 217-218 ppm were fitted against a model of xenon exchange (MOXE) as functions of exchange time. Parameters related to lung function and structure can be obtained by fitting to this model. The following results were obtained from xenon uptake (averaged over all healthy volunteers): surface-area-to-volume ratio = 210 ± 50 cm(-1) ; total septal wall thickness = 9.2 ± 6.5 μm; blood-air barrier thickness = 1.0 ± 0.3 μm; hematocrit = 27 ± 4%; pulmonary capillary blood transit time = 1.3 ± 0.3 s, in good agreement with literature values from invasive experiments. More detailed fitting results are listed in the text. The initial in vivo human results demonstrate that our proposed methods can be used to noninvasively determine lung physiology by simultaneous quantification of a few important pulmonary parameters. This method is highly promising to become a versatile screening method for lung diseases. Copyright © 2013 Wiley Periodicals, Inc.
Mutation and Expression of the DCC Gene in Human Lung Cancer
Directory of Open Access Journals (Sweden)
Takashi Kohno
2000-07-01
Full Text Available Chromosome 18q is frequently deleted in lung cancers, a common region of 18q deletions was mapped to chromosome 18g21. Since the DCC candidate tumor suppressor gene has been mapped in this region, mutation and expression of the DCC gene were examined in 46 lung cancer cell lines, consisting of 14 small cell lung carcinomas (SCLCs and 32 non-small cell lung carcinomas (NSCLCs, to elucidate the pathogenetic significance of DCC alterations in human lung carcinogenesis. A heterozygous missense mutation was detected in a NSCLC cell line, Ma26, while homozygous deletion was not detected in any of the cell lines. The DCC gene was expressed in 11 (24% of the 46 cell lines, the incidence of DCC expression was significantly higher in SCLCs (7/14, 50% than in NSCLCs (4/32, 13% (P = .01, Fisher's exact test. Therefore, genetic alterations of DCC are infrequent; however, the levels of DCC expression vary among lung cancer cells, in particular, between SCLCs and NSCLCs. The present result does not implicate DCC as a specific mutational target of 18q deletions in human lung cancer; however, it suggests that DCC is a potential target of inactivation by genetic defects including intron or promoter mutations and/or epigenetic alterations. The present result also suggests that DCC expression is associated with some properties of SCLCs, such as a neuroendocrine (NE feature.
International Nuclear Information System (INIS)
Li, Qingchang; Dong, Qianze; Wang, Enhua
2012-01-01
Highlights: ► Rsf-1 expression is elevated in non-small cell lung cancers. ► Rsf-1 depletion inhibits proliferation and increased apoptosis in lung cancer cells. ► Rsf-1 depletion decreases the level of cyclinD1 and phosphor-ERK expression. -- Abstract: Rsf-1 (HBXAP) was recently reported to be overexpressed in various cancers and associated with the malignant behavior of cancer cells. However, the expression of Rsf-1 in primary lung cancer and its biological roles in non-small cell lung cancer (NSCLC) have not been reported. The molecular mechanism of Rsf-1 in cancer aggressiveness remains ambiguous. In the present study, we analyzed the expression pattern of Rsf-1 in NSCLC tissues and found that Rsf-1 was overexpressed at both the mRNA and protein levels. There was a significant association between Rsf-1 overexpression and TNM stage (p = 0.0220) and poor differentiation (p = 0.0013). Furthermore, knockdown of Rsf-1 expression in H1299 and H460 cells with high endogenous Rsf-1 expression resulted in a decrease of colony formation ability and inhibition of cell cycle progression. Rsf-1 knockdown also induced apoptosis in these cell lines. Further analysis showed that Rsf-1 knockdown decreased cyclin D1 expression and phospho-ERK levels. In conclusion, Rsf-1 is overexpressed in NSCLC and contributes to malignant cell growth by cyclin D1 and ERK modulation, which makes Rsf-1 a candidate therapeutic target in lung cancer.
Directory of Open Access Journals (Sweden)
Xinyue Liang
2016-01-01
Full Text Available Hormesis and adaptive responses are 2 important biological effects of low-dose ionizing radiation (LDR. In normal tissue, LDR induces hormesis as evinced by increased cell proliferation; however, whether LDR also increases tumor cell proliferation needs to be investigated. In this study, cell proliferation was assayed by total cell numbers and the Cell Counting Kit 8 assay. Mitogen-activated protein kinases (MAPK/extracellular signal-regulated kinase (ERK and phosphatidylinositol 3′ -kinase(PI3K-Akt (PI3K/AKT phosphorylation were determined by Western blot analysis. Human embryonic lung fibroblast 2BS and lung cancer NCI-H446 cell lines were irradiated with LDR at different doses (20-100 mGy. In response to 20 to 75 mGy X-rays, cell proliferation was significantly increased in 2BS but not in NCI-H446 cells. In 2BS cells, LDR at 20 to 75 mGy also stimulated phosphorylation of MAPK/ERK pathway proteins including ERK, MEK, and Raf and of the PI3K/AKT pathway protein AKT. To test whether ERK1/2 and AKT pathway activation was involved in the stimulation of cell proliferation in 2BS cells, the MAPK/ERK and PI3K/AKT pathways were inhibited using their specific inhibitors, U0126 and LY294002. U0126 decreased the phosphorylation of ERK1/2, and LY294002 decreased the phosphorylation of AKT; each could significantly inhibit LDR-induced 2BS cell proliferation. However, LDR did not stimulate these kinases, and kinase inhibitors also did not affect cell proliferation in the NCI-H446 cells. These results suggest that LDR stimulates cell proliferation via the activation of both MAPK/ERK and PI3K/AKT signaling pathways in 2BS but not in NCI-H446 cells. This finding implies the potential for applying LDR to protect normal tissues from radiotherapy without diminishing the efficacy of tumor therapy.
20 CFR 655.460 - Non-applicability of the Equal Access to Justice Act.
2010-04-01
... Justice Act. 655.460 Section 655.460 Employees' Benefits EMPLOYMENT AND TRAINING ADMINISTRATION... Attestations § 655.460 Non-applicability of the Equal Access to Justice Act. A proceeding under subpart D or E of this part is not subject to the Equal Access to Justice Act, as amended, 5 U.S.C. 504. In such a...
The replication of Bangladeshi H9N2 avian influenza viruses carrying genes from H7N3 in mammals.
Shanmuganatham, Karthik K; Jones, Jeremy C; Marathe, Bindumadhav M; Feeroz, Mohammed M; Jones-Engel, Lisa; Walker, David; Turner, Jasmine; Rabiul Alam, S M; Kamrul Hasan, M; Akhtar, Sharmin; Seiler, Patrick; McKenzie, Pamela; Krauss, Scott; Webby, Richard J; Webster, Robert G
2016-04-20
H9N2 avian influenza viruses are continuously monitored by the World Health Organization because they are endemic; they continually reassort with H5N1, H7N9 and H10N8 viruses; and they periodically cause human infections. We characterized H9N2 influenza viruses carrying internal genes from highly pathogenic H7N3 viruses, which were isolated from chickens or quail from live-bird markets in Bangladesh between 2010 and 2013. All of the H9N2 viruses used in this study carried mammalian host-specific mutations. We studied their replication kinetics in normal human bronchoepithelial cells and swine tracheal and lung explants, which exhibit many features of the mammalian airway epithelium and serve as a mammalian host model. All H9N2 viruses replicated to moderate-to-high titers in the normal human bronchoepithelial cells and swine lung explants, but replication was limited in the swine tracheal explants. In Balb/c mice, the H9N2 viruses were nonlethal, replicated to moderately high titers and the infection was confined to the lungs. In the ferret model of human influenza infection and transmission, H9N2 viruses possessing the Q226L substitution in hemagglutinin replicated well without clinical signs and spread via direct contact but not by aerosol. None of the H9N2 viruses tested were resistant to the neuraminidase inhibitors. Our study shows that the Bangladeshi H9N2 viruses have the potential to infect humans and highlights the importance of monitoring and characterizing this influenza subtype to better understand the potential risk these viruses pose to humans.
Radiation sensitivity of human lung cancer cell lines
International Nuclear Information System (INIS)
Carmichael, J.; Degraff, W.G.; Gamson, J.; Russo, G.; Mitchell, J.B.; Gazdar, A.F.; Minna, J.D.; Levitt, M.L.
1989-01-01
X-Ray survival curves were determined using a panel of 17 human lung cancer cell lines, with emphasis on non-small cell lung cancer (NSCLC). In contrast to classic small cell lung cancer (SCLC) cell lines, NSCLC cell lines were generally less sensitive to radiation as evidenced by higher radiation survival curve extrapolation numbers, surviving fraction values following a 2Gy dose (SF2) and the mean inactivation dose values (D) values. The spectrum of in vitro radiation responses observed was similar to that expected in clinical practice, although mesothelioma was unexpectedly sensitive in vitro. Differences in radiosensitivity were best distinguished by comparison of SF2 values. Some NSCLC lines were relatively sensitive, and in view of this demonstrable variability in radiation sensitivity, the SF2 value may be useful for in vitro predictive assay testing of clinical specimens. (author)
42 CFR 460.136 - Internal quality assessment and performance improvement activities.
2010-10-01
... 42 Public Health 4 2010-10-01 2010-10-01 false Internal quality assessment and performance improvement activities. 460.136 Section 460.136 Public Health CENTERS FOR MEDICARE & MEDICAID SERVICES....136 Internal quality assessment and performance improvement activities. (a) Quality assessment and...
Use of bactec 460 TB system in the diagnosis of tuberculosis
Directory of Open Access Journals (Sweden)
Rodrigues C
2007-01-01
Full Text Available Purpose : To evaluate, the efficacy of BACTEC 460 TB system for the diagnosis of tuberculosis in a tertiary care hospital in Mumbai, India. Methods : We compared 12,726 clinical specimens using BACTEC 460 TB system and conventional method for detection of Mycobacterium tuberculosis over a period of six years. Result: The overall recovery rate was 39% by BACTEC technique and 29% using Lowenstein-Jensen (LJ medium. An average detection time for B actec0 460 TB system was found to be 13.3 days and 15.3 days as against 31.2 days and 35.3 days by LJ method for respiratory and nonrespiratory specimens respectively. The average reporting time for drug susceptibility results ranged from 6-10 days for the BACTEC 460 TB system. Conclusions: The BACTEC system is a good system for level II laboratories, especially in the diagnosis of extrapulmonary and smear negative tuberculosis.
Viral infection of human lung macrophages increases PDL1 expression via IFNβ.
Directory of Open Access Journals (Sweden)
Karl J Staples
Full Text Available Lung macrophages are an important defence against respiratory viral infection and recent work has demonstrated that influenza-induced macrophage PDL1 expression in the murine lung leads to rapid modulation of CD8+ T cell responses via the PD1 receptor. This PD1/PDL1 pathway may downregulate acute inflammatory responses to prevent tissue damage. The aim of this study was to investigate the mechanisms of PDL1 regulation by human macrophages in response to viral infection. Ex-vivo viral infection models using influenza and RSV were established in human lung explants, isolated lung macrophages and monocyte-derived macrophages (MDM and analysed by flow cytometry and RT-PCR. Incubation of lung explants, lung macrophages and MDM with X31 resulted in mean cellular infection rates of 18%, 18% and 29% respectively. Viral infection significantly increased cell surface expression of PDL1 on explant macrophages, lung macrophages and MDM but not explant epithelial cells. Infected MDM induced IFNγ release from autologous CD8+ T cells, an effect enhanced by PDL1 blockade. We observed increases in PDL1 mRNA and IFNβ mRNA and protein release by MDM in response to influenza infection. Knockdown of IFNβ by siRNA, resulted in a 37.5% reduction in IFNβ gene expression in response to infection, and a significant decrease in PDL1 mRNA. Furthermore, when MDM were incubated with IFNβ, this cytokine caused increased expression of PDL1 mRNA. These data indicate that human macrophage PDL1 expression modulates CD8+ cell IFNγ release in response to virus and that this expression is regulated by autologous IFNβ production.
International Nuclear Information System (INIS)
Wen Qinglian; Meng Maobin; Tu Lingli; Jia Li; Zhou Lin; Xu Yong; Lu You; Yang Bo
2009-01-01
The purpose of this paper is to determine the efficacy of combining radiation therapy with endostar, a recombined humanized endostatin, in human nasopharyngeal carcinoma and human lung adenocarcinoma xenografts. Tumor xenografts were established in the hind limb of male athymic nude mice (BALB/c-nu) by subcutaneous transplantation. The tumor-bearing mice were assigned into four treatment groups: sham therapy (control), endostar (20 mg/kg, once daily for 10 days), radiation therapy (6 Gray per day to 30 Gray, once a day for 1 week), and endostar plus radiation therapy (combination). The experiment was repeated and mice were killed at days 3, 6, and 10 after initiation therapy, and the tumor tissues and blood samples were collected to analyze the kinetics of antitumor, antiangiogenesis, and antivascularization responses of different therapies. In human nasopharyngeal carcinoma and human lung adenocarcinoma xenografts, endostar significantly enhanced the effects of tumor growth inhibition, endothelial cell and tumor cell apoptosis induction, and improved tumor cell hypoxia of radiation therapy. Histological analyses demonstrated that endostar plus radiation also induced a significant reduction in microvascular density, microvascular area, and vascular endothelial growth factor and matrix metalloproteinase-2 expression compared with radiation and endostar alone respectively. We concluded that endostar significantly sensitized the function of radiation in antitumor and antiangiogenesis in human nasopharyngeal carcinoma and human lung adenocarcinoma xenografts by increasing the apoptosis of the endothelial cell and tumor cell, improving the hypoxia of the tumor cell, and changing the proangiogenic factors. These data provided a rational basis for clinical practice of this multimodality therapy. (author)
In-vivo counting of 241Am in human lungs and tracheobronchial lymph nodes
International Nuclear Information System (INIS)
Northcutt, A.R.; Binney, S.E.; Palmer, H.E.
1988-01-01
A study was conducted of a human male who had inhaled a mixture of 241 Am and Pu. To distinguish 241 Am deposited in the subject's lungs from translocated activity deposited in the tracheobronchial lymph nodes (TBLN), two intrinsic Ge detectors were collimated with 0.3-cm Pb sheeting. A tissue-equivalent phantom containing either 22.9 kBq (620 nCi) of 241 Am in the lungs or a 81.4 kBq (2200 nCi) 241 Am point source in the TBLN was measured. Calibration curves observed from lateral differential scans on the phantom were compared to data obtained by the same detection system for a human male with a measured lung deposition of 89 Bq (2.4 nCi) of 241 Am. Comparison of the human data to the calibration curves indicated the activity was restricted primarily to the lungs. The calibration curves demonstrate that this method is useful in determining the distribution of inhaled radioactivity between the lungs and TBLN. The measured activity from the male subject generally supported the ICRP Publication 30 model translocation prediction for class Y compounds
Okayama, Y; Hiroi, J; Lau, L C; Church, M K
1995-12-01
We have examined the effects of a new anti-allergic drug, quinotolast [sodium 5-(4-oxo-1-phenoxy-4H-quinolizine-3-carboxamido) yetrazolate monohydrate], in inhibiting the release of histamine and the generation of leukotriene (LT) C4 and prostaglandin (PG) D2 from dispersed human lung cells and compared this with those of its active metabolite in the rat, hydroxy quinotolast, and reference drugs, tranilast and sodium cromoglycate (SCG). Quinotolast in the concentration range of 1-100 micrograms/ml inhibited histamine and LTC4 release in a concentration-dependent manner. The inhibitory effect of quinotolast on histamine release from dispersed lung cells was largely independent of the preincubation period, no tachyphylaxis being observed. Hydroxy quinotolast and tranilast showed a weak inhibition of histamine release only when the drugs were added to the cells simultaneously with anti-IgE challenge. Quinotolast, 100 micrograms/ml, and SCG, 1 mM, significantly inhibited PGD2 and LTC4 release. Quinotolast inhibited PGD2 release by 100% and LTC4 release by 54%, whereas SCG inhibited PDG2 release by 33% and LTC4 release by 100%. No cross-tachyphylaxis between quinotolast and SCG was observed. The results demonstrated that quinotolast showed a significant inhibition of inflammatory mediators from human dispersed lung cells, suggesting that quinotolast is a good candidate for a clinical anti-allergic drug.
Latif, Rana K; VanHorne, Edgar M; Kandadai, Sunitha Kanchi; Bautista, Alexander F; Neamtu, Aurel; Wadhwa, Anupama; Carter, Mary B; Ziegler, Craig H; Memon, Mohammed Faisal; Akça, Ozan
2016-01-20
Lung isolation skills, such as correct insertion of double lumen endobronchial tube and bronchial blocker, are essential in anesthesia training; however, how to teach novices these skills is underexplored. Our aims were to determine (1) if novices can be trained to a basic proficiency level of lung isolation skills, (2) whether video-didactic and simulation-based trainings are comparable in teaching lung isolation basic skills, and (3) whether novice learners' lung isolation skills decay over time without practice. First, five board certified anesthesiologist with experience of more than 100 successful lung isolations were tested on Human Airway Anatomy Simulator (HAAS) to establish Expert proficiency skill level. Thirty senior medical students, who were naive to bronchoscopy and lung isolation techniques (Novice) were randomized to video-didactic and simulation-based trainings to learn lung isolation skills. Before and after training, Novices' performances were scored for correct placement using pass/fail scoring and a 5-point Global Rating Scale (GRS); and time of insertion was recorded. Fourteen novices were retested 2 months later to assess skill decay. Experts' and novices' double lumen endobronchial tube and bronchial blocker passing rates showed similar success rates after training (P >0.99). There were no differences between the video-didactic and simulation-based methods. Novices' time of insertion decayed within 2 months without practice. Novices could be trained to basic skill proficiency level of lung isolation. Video-didactic and simulation-based methods we utilized were found equally successful in training novices for lung isolation skills. Acquired skills partially decayed without practice.
Genetic Modification of the Lung Directed Toward Treatment of Human Disease.
Sondhi, Dolan; Stiles, Katie M; De, Bishnu P; Crystal, Ronald G
2017-01-01
Genetic modification therapy is a promising therapeutic strategy for many diseases of the lung intractable to other treatments. Lung gene therapy has been the subject of numerous preclinical animal experiments and human clinical trials, for targets including genetic diseases such as cystic fibrosis and α1-antitrypsin deficiency, complex disorders such as asthma, allergy, and lung cancer, infections such as respiratory syncytial virus (RSV) and Pseudomonas, as well as pulmonary arterial hypertension, transplant rejection, and lung injury. A variety of viral and non-viral vectors have been employed to overcome the many physical barriers to gene transfer imposed by lung anatomy and natural defenses. Beyond the treatment of lung diseases, the lung has the potential to be used as a metabolic factory for generating proteins for delivery to the circulation for treatment of systemic diseases. Although much has been learned through a myriad of experiments about the development of genetic modification of the lung, more work is still needed to improve the delivery vehicles and to overcome challenges such as entry barriers, persistent expression, specific cell targeting, and circumventing host anti-vector responses.
42 CFR 460.168 - Reinstatement in other Medicare and Medicaid programs.
2010-10-01
... 42 Public Health 4 2010-10-01 2010-10-01 false Reinstatement in other Medicare and Medicaid programs. 460.168 Section 460.168 Public Health CENTERS FOR MEDICARE & MEDICAID SERVICES, DEPARTMENT OF... Reinstatement in other Medicare and Medicaid programs. To facilitate a participant's reinstatement in other...
Potent selective nonpeptidic inhibitors of human lung tryptase
Burgess, Laurence E.; Newhouse, Bradley J.; Ibrahim, Prabha; Rizzi, James; Kashem, Mohammed A.; Hartman, Ann; Brandhuber, Barbara J.; Wright, Clifford D.; Thomson, David S.; Vigers, Guy P. A.; Koch, Kevin
1999-01-01
Human lung tryptase, a homotetrameric serine protease unique to mast cell secretory granules, has been implicated in the pathogenesis of asthma. A hypothesis that tethered symmetrical inhibitors might bridge two adjacent active sites was explored via a rationally designed series of bisbenzamidines. These compounds demonstrated a remarkable distanced-defined structure–activity relationship against human tryptase with one series possessing subnanomolar potencies. Additional evidence supporting the concept of active-site bridging is also presented. PMID:10411878
The cytotoxicity and genotoxicity of soluble and particulate cobalt in human lung fibroblast cells
Energy Technology Data Exchange (ETDEWEB)
Smith, Leah J.; Holmes, Amie L. [Wise Laboratory of Environmental and Genetic Toxicology, University of Southern Maine, 96 Falmouth St., P.O. Box 9300, Portland, ME 04101-9300 (United States); Maine Center for Environmental Toxicology and Health, University of Southern Maine, 96 Falmouth St., P.O. Box 9300, Portland, ME 04101-9300 (United States); Department of Applied Medical Science, University of Southern Maine, 96 Falmouth St., P.O. Box 9300, Portland, ME 04101-9300 (United States); Kandpal, Sanjeev Kumar; Mason, Michael D. [Department of Chemical and Biological Engineering, University of Maine, Orono, ME (United States); Zheng, Tongzhang [Department of Environmental Health Sciences, Yale School of Public Health, New Haven, CT (United States); Wise, John Pierce, E-mail: John.Wise@usm.maine.edu [Wise Laboratory of Environmental and Genetic Toxicology, University of Southern Maine, 96 Falmouth St., P.O. Box 9300, Portland, ME 04101-9300 (United States); Maine Center for Environmental Toxicology and Health, University of Southern Maine, 96 Falmouth St., P.O. Box 9300, Portland, ME 04101-9300 (United States); Department of Applied Medical Science, University of Southern Maine, 96 Falmouth St., P.O. Box 9300, Portland, ME 04101-9300 (United States)
2014-08-01
Cobalt exposure is increasing as cobalt demand rises worldwide due to its use in enhancing rechargeable battery efficiency, super-alloys, and magnetic products. Cobalt is considered a possible human carcinogen with the lung being a primary target. However, few studies have considered cobalt-induced toxicity in human lung cells. Therefore, in this study, we sought to determine the cytotoxicity and genotoxicity of particulate and soluble cobalt in human lung cells. Cobalt oxide and cobalt chloride were used as representative particulate and soluble cobalt compounds, respectively. Exposure to both particulate and soluble cobalt induced a concentration-dependent increase in cytotoxicity, genotoxicity, and intracellular cobalt ion levels. Based on intracellular cobalt ion levels, we found that soluble cobalt was more cytotoxic than particulate cobalt while particulate and soluble cobalt induced similar levels of genotoxicity. However, soluble cobalt induced cell cycle arrest indicated by the lack of metaphases at much lower intracellular cobalt concentrations compared to cobalt oxide. Accordingly, we investigated the role of particle internalization in cobalt oxide-induced toxicity and found that particle-cell contact was necessary to induce cytotoxicity and genotoxicity after cobalt exposure. These data indicate that cobalt compounds are cytotoxic and genotoxic to human lung fibroblasts, and solubility plays a key role in cobalt-induced lung toxicity. - Highlights: • Particulate and soluble cobalt are cytotoxic and genotoxic to human lung cells. • Soluble cobalt induces more cytotoxicity compared to particulate cobalt. • Soluble and particulate cobalt induce similar levels of genotoxicity. • Particle-cell contact is required for particulate cobalt-induced toxicity.
42 CFR 460.102 - Interdisciplinary team.
2010-10-01
... ELDERLY (PACE) PACE Services § 460.102 Interdisciplinary team. (a) Basic requirement. A PACE organization... the following: (i) Managing a participant's medical situations. (ii) Overseeing a participant's use of.... (iii) Documenting changes of a participant's condition in the participant's medical record consistent...
LungMAP: The Molecular Atlas of Lung Development Program.
Ardini-Poleske, Maryanne E; Clark, Robert F; Ansong, Charles; Carson, James P; Corley, Richard A; Deutsch, Gail H; Hagood, James S; Kaminski, Naftali; Mariani, Thomas J; Potter, Steven S; Pryhuber, Gloria S; Warburton, David; Whitsett, Jeffrey A; Palmer, Scott M; Ambalavanan, Namasivayam
2017-11-01
The National Heart, Lung, and Blood Institute is funding an effort to create a molecular atlas of the developing lung (LungMAP) to serve as a research resource and public education tool. The lung is a complex organ with lengthy development time driven by interactive gene networks and dynamic cross talk among multiple cell types to control and coordinate lineage specification, cell proliferation, differentiation, migration, morphogenesis, and injury repair. A better understanding of the processes that regulate lung development, particularly alveologenesis, will have a significant impact on survival rates for premature infants born with incomplete lung development and will facilitate lung injury repair and regeneration in adults. A consortium of four research centers, a data coordinating center, and a human tissue repository provides high-quality molecular data of developing human and mouse lungs. LungMAP includes mouse and human data for cross correlation of developmental processes across species. LungMAP is generating foundational data and analysis, creating a web portal for presentation of results and public sharing of data sets, establishing a repository of young human lung tissues obtained through organ donor organizations, and developing a comprehensive lung ontology that incorporates the latest findings of the consortium. The LungMAP website (www.lungmap.net) currently contains more than 6,000 high-resolution lung images and transcriptomic, proteomic, and lipidomic human and mouse data and provides scientific information to stimulate interest in research careers for young audiences. This paper presents a brief description of research conducted by the consortium, database, and portal development and upcoming features that will enhance the LungMAP experience for a community of users. Copyright © 2017 the American Physiological Society.
Abscess of residual lobe after pulmonary resection for lung cancer.
Ligabue, Tommaso; Voltolini, Luca; Ghiribelli, Claudia; Luzzi, Luca; Rapicetta, Cristian; Gotti, Giuseppe
2008-04-01
Abscess of the residual lobe after lobectomy is a rare but potentially lethal complication. Between January 1975 and December 2006, 1,460 patients underwent elective pulmonary lobectomy for non-small-cell lung cancer at our institution. Abscess of the residual lung parenchyma occurred in 5 (0.3%) cases (4 bilobectomies and 1 lobectomy). Postoperative chest radiography showed incomplete expansion and consolidation of residual lung parenchyma. Flexible bronchoscopy revealed persistent bronchial occlusion from purulent secretions and/or bronchial collapse. Computed tomography in 3 patients demonstrated lung abscess foci. Surgical treatment included completion right pneumonectomy in 3 patients and a middle lobectomy in one. Complications after repeat thoracotomy comprised contralateral pneumonia and sepsis in 1 patient. Residual lobar abscess after lobectomy should be suspected in patients presenting with fever, leukocytosis, bronchial obstruction and lung consolidation despite antibiotic therapy, physiotherapy and bronchoscopy. Computed tomography is mandatory for early diagnosis. Surgical resection of the affected lobe is recommended.
Histogram analysis for age change of human lung with computed tomography
International Nuclear Information System (INIS)
Shirabe, Ichiju
1990-01-01
In order to evaluate physiological changes of normal lung with aging by computed tomography (CT), the peak position (PP) and full width half maximum (FWHM) of CT-histogram were studied in 77 normal human lung. Above 30 years old, PP tended to be seen in the lower attenuation value with advancing ages, with the result that the follow equation was obtained. CT attenuation value of PP=-0.87 x age -815. The peak position shifted to the range of higher CT attenuation in 30's. FWHM did not change with advancing ages. There were no differences of peak value and FWHM among the upper, middle and lower lung field. In this study, physiological changes of lung were evaluated quantitatively. Furthermore, this study was considered to be useful for diagnosis and treatment in lung diseases. (author)
Modeling of the Nitric Oxide Transport in the Human Lungs.
Karamaoun, Cyril; Van Muylem, Alain; Haut, Benoît
2016-01-01
In the human lungs, nitric oxide (NO) acts as a bronchodilatator, by relaxing the bronchial smooth muscles and is closely linked to the inflammatory status of the lungs, owing to its antimicrobial activity. Furthermore, the molar fraction of NO in the exhaled air has been shown to be higher for asthmatic patients than for healthy patients. Multiple models have been developed in order to characterize the NO dynamics in the lungs, owing to their complex structure. Indeed, direct measurements in the lungs are difficult and, therefore, these models are valuable tools to interpret experimental data. In this work, a new model of the NO transport in the human lungs is proposed. It belongs to the family of the morphological models and is based on the morphometric model of Weibel (1963). When compared to models published previously, its main new features are the layered representation of the wall of the airways and the possibility to simulate the influence of bronchoconstriction (BC) and of the presence of mucus on the NO transport in lungs. The model is based on a geometrical description of the lungs, at rest and during a respiratory cycle, coupled with transport equations, written in the layers composing an airway wall and in the lumen of the airways. First, it is checked that the model is able to reproduce experimental information available in the literature. Second, the model is used to discuss some features of the NO transport in healthy and unhealthy lungs. The simulation results are analyzed, especially when BC has occurred in the lungs. For instance, it is shown that BC can have a significant influence on the NO transport in the tissues composing an airway wall. It is also shown that the relation between BC and the molar fraction of NO in the exhaled air is complex. Indeed, BC might lead to an increase or to a decrease of this molar fraction, depending on the extent of the BC and on the possible presence of mucus. This should be confirmed experimentally and might
Directory of Open Access Journals (Sweden)
Jiang X
2012-02-01
Full Text Available Danbo Yang1, Sang Van2, Yingyi Shu1, Xiaoqing Liu1, Yangfeng Ge1, Xinguo Jiang3, Yi Jin2, Lei Yu1,21Biomedical Engineering and Technology Institute, Institutes for Advanced Interdisciplinary Research, East China Normal University, Shanghai, People’s Republic of China; 2Biomedical Group, Nitto Denko Technical Corporation, CA, USA; 3School of Pharmacy, Fudan University, Shanghai, People’s Republic of ChinaAim: This work is intended to develop and evaluate a biopolymeric poly(L-γ-glutamyl-glutamine (PGG–docetaxel (DTX conjugate that can spontaneously self-assemble in aqueous solutions to become nanoparticles.Methods: DTX was covalently attached to hydrophilic PGG by direct esterification, and the conjugate was characterized by proton nuclear magnetic resonance spectroscopy, molecular weight gel permeation chromatography, solubility, size distribution and morphology, and hemolysis. Conjugated DTX was found to have 2000 times improved water solubility compared with free DTX. Dynamic light scattering, transmission electron microscopy, and atomic force microscopy revealed the particle size, distribution and morphology of the PGG–DTX conjugate. In addition, the conjugate was further tested for in vitro cytotoxicity and in vivo antitumor efficacy on the human non-small cell lung cancer cell line NCI-H460.Results: Conjugated DTX was found to have 2000 times improved water solubility compared with free DTX. The conjugate formed nanoparticles with an average diameter of 30 nm in spherical shape and unimodal particle size distribution. The conjugate exhibited about 2% hemolysis at 10 mg/mL, compared with 56% for Tween 80® at 0.4 mg/mL, and 33% for Cremophor EL® at 10 mg/mL. In addition, the conjugate was further tested for in vitro cytotoxicity and in vivo antitumor efficacy on the human non-small cell lung cancer cell line NCI-H460. As expected, conjugated DTX exhibited lower cytotoxicity compared to that of free DTX, in concentration
42 CFR 460.124 - Additional appeal rights under Medicare or Medicaid.
2010-10-01
... 42 Public Health 4 2010-10-01 2010-10-01 false Additional appeal rights under Medicare or Medicaid. 460.124 Section 460.124 Public Health CENTERS FOR MEDICARE & MEDICAID SERVICES, DEPARTMENT OF HEALTH... or Medicaid. A PACE organization must inform a participant in writing of his or her appeal rights...
Zhao, Zhi-Hong; Wang, Sheng-Fa; Yu, Liang; Wang, Ju; Cong, De-Gang; Chang, Hao; Wang, Xue-Feng; Zhang, Tie-Wa; Zhang, Jian; Fu, Kai; Jiang, Jiu-Yang
2008-04-29
To investigate the correlation between Pokemon gene and cisplatin mechanism. Human lung adenocarcinoma cells of the lines A549 and AGZY83-a, human lung squamous carcinoma cells of the line HE-99, and human giant cell lung cancer cells of the line 95D were cultured and cisplatin was added into the medium. Other lung cancer cells of the above mentioned lines were cultured in the medium without cisplatin and were used as control groups. RT-PCR and Western blotting were used to detect the mRNA and protein expression of Pokemon. Pokemon mRNA and protein were expressed highly in all the 4 cell lines. The Pokemon gene expression did not changed significantly after cisplatin treatment groups. There were not significant differences in the mRNA and protein expression of Pokemon among the 4 experiment groups and the control groups (all P > 0.05). Cisplatin has no effect on the Pokemon gene expression of the human lung cancer cells.
Regulated gene expression in cultured type II cells of adult human lung
Ballard, Philip L.; Lee, Jae W.; Fang, Xiaohui; Chapin, Cheryl; Allen, Lennell; Segal, Mark R.; Fischer, Horst; Illek, Beate; Gonzales, Linda W.; Kolla, Venkatadri; Matthay, Michael A.
2010-01-01
Alveolar type II cells have multiple functions, including surfactant production and fluid clearance, which are critical for lung function. Differentiation of type II cells occurs in cultured fetal lung epithelial cells treated with dexamethasone plus cAMP and isobutylmethylxanthine (DCI) and involves increased expression of 388 genes. In this study, type II cells of human adult lung were isolated at ∼95% purity, and gene expression was determined (Affymetrix) before and after culturing 5 days...
Kim, Ki Young; Ahn, Jin Hee; Cheon, Hyae Gyeong
2007-09-01
Peroxisome proliferator-activated receptor (PPAR)-gamma ligands have been shown to inhibit human lung cancers by inducing apoptosis and differentiation. In the present study, we elucidated the apoptotic mechanism of PPARgamma activation in human lung cancers by using a novel PPARgamma agonist, 1-(trans-methylimino-N-oxy)-6-(2-morpholinoethoxy)-3-phenyl-(1H-indene-2-carboxylic acid ethyl ester (KR-62980), and rosiglitazone. PPARgamma activation selectively inhibited cell viability of non-small-cell lung cancer with little effect on small-cell lung cancer and normal lung cells. The cell death induced by PPARgamma activation presented apoptotic features of oligonucleosomal DNA fragmentation in A549 human non-small-cell lung cancer cell line. Reactive oxygen species (ROS) production was accompanied by increased expression of proline oxidase (POX), a redox enzyme expressed in mitochondria, upon incubation with the agonists. POX RNA interference treatment blocked PPARgamma-induced ROS formation and cytotoxicity, suggesting that POX plays a functional role in apoptosis through ROS formation. The apoptotic effects by the agonists were antagonized by bisphenol A diglycidyl ether, a PPARgamma antagonist, and by knockdown of PPARgamma expression, indicating the involvement of PPARgamma in these actions. The results of the present study suggest that PPARgamma activation induces apoptotic cell death in non-small-cell lung carcinoma mainly through ROS formation via POX induction.
Sun, E L; Liu, C X; Ma, Z X; Mou, X Y; Mu, X A; Ni, Y H; Li, X L; Zhang, D; Ju, Y R
2017-01-01
Small cell lung cancer (SCLC) is characterized by rapid growth rate and a tendency to metastasize to distinct sites of patients' bodies. The human serine/threonine kinase 33 (STK33) gene has shown its potency as a therapeutic target for prevention of lung carcinomas including non-small cell lung cancer (NSCLC), but its function in the oncogenesis and development of SCLC remains unrevealed. In the current study, it was hypothesized that STK33 played a key role in the proliferation, survival, and invasion of SCLC cells. The expression of STK33 in human SCLC cell lines NCI-H466 and DMS153 was inhibited by specific shRNA. The cell proliferation, cell apoptosis, and cell invasion of the cells were assessed with a series of in vitro assays. To explore the mechanism through which STK33 gene exerted its function in the carcinogenesis of SCLC cells, the effect of STK33 knockdown on the activity of S6K1/RPS6/BAD signaling was detected. Then the results were further confirmed with STK33 inhibitor ML281 and in vivo assays. The results demonstrated that inhibition of STK33 in SCLC cells suppressed the cell proliferation and invasion while induced cell apoptosis. Associated with the change in the phenotypic features, knockdown of STK33 also decreased the phosphorylation of RPS6 and BAD while increased the expression of cleaved caspase 9, indicating that apoptosis induced by STK33 suppression was mediated via mitochondrial pathway. Similar to the results of STK33 knockdown, incubating NCI-H466 cells with STK33 inhibitor also reduced the cell viability by suppressing RPS6/BAD pathways. Additionally, STK33 knockdown also inhibited tumor growth and RPS6/BAD activity in mice models. Findings outlined in our study were different from that in NSCLC to some extent: knockdown of STK33 in SCLC cells induced the apoptosis through mitochondrial pathway but independent of S6K1 function, inferring that the function of STK33 might be cancer type specific.
Follistatin is a novel biomarker for lung adenocarcinoma in humans.
Directory of Open Access Journals (Sweden)
Fangfang Chen
Full Text Available Follistatin (FST, a single chain glycoprotein, is originally isolated from follicular fluid of ovary. Previous studies have revealed that serum FST served as a biomarker for pregnancy and ovarian mucinous tumor. However, whether FST can serve as a biomarker for diagnosis in lung adenocarcinoma of humans remains unclear.The study population consisted of 80 patients with lung adenocarcinoma, 40 patients with ovarian adenocarcinoma and 80 healthy subjects. Serum FST levels in patients and healthy subjects were measured using ELISA. The results showed that the positive ratio of serum FST levels was 51.3% (41/80, which was comparable to the sensitivity of FST in 40 patients with ovarian adenocarcinoma (60%, 24/40 using the 95th confidence interval for the healthy subject group as the cut-off value. FST expressions in lung adenocarcinoma were examined by immunohistochemical staining, we found that lung adenocarcinoma could produce FST and there was positive correlation between the level of FST expression and the differential degree of lung adenocarcinoma. Furthermore, the results showed that primary cultured lung adenocarcinoma cells could secrete FST, while cells derived from non-tumor lung tissues almost did not produce FST. In addition, the results of CCK8 assay and flow cytometry showed that using anti-FST monoclonal antibody to neutralize endogenous FST significantly augmented activin A-induced lung adenocarcinoma cells apoptosis.These data indicate that lung adenocarcinoma cells can secret FST into serum, which may be beneficial to the survival of adenocarcinoma cells by neutralizing activin A action. Thus, FST can serve as a promising biomarker for diagnosis of lung adenocarcinoma and a useful biotherapy target for lung adenocarcinoma.
Role of Nrf2 in preventing oxidative stress induced chloride current alteration in human lung cells.
Canella, Rita; Benedusi, Mascia; Martini, Marta; Cervellati, Franco; Cavicchio, Carlotta; Valacchi, Giuseppe
2018-08-01
The lung tissue is one of the main targets of oxidative stress due to external sources and respiratory activity. In our previous work, we have demonstrated in that O 3 exposure alters the Cl - current-voltage relationship, with the appearance of a large outward rectifier component mainly sustained by outward rectifier chloride channels (ORCCs) in human lung epithelial cells (A549 line). In the present study, we have performed patch clamp experiments, in order to identify which one of the O 3 byproducts (4hydroxynonenal (HNE) and/or H 2 O 2 ) was responsible for chloride current change. While 4HNE exposition (up to 25 μM for 30' before electrophysiological analysis) did not reproduce O 3 effect, H 2 O 2 produced by glucose oxidase 10 mU for 24 hr before electrophysiological analysis mimicked O 3 response. This result was confirmed treating the cell with catalase (CAT) before O 3 exposure (1,000 U/ml for 2 hr): CAT was able to rescue Cl - current alteration. Since CAT is regulated by Nrf2 transcription factor, we pre-treated the cells with the Nrf2 activators, resveratrol and tBHQ. Immunochemical and immunocytochemical results showed Nrf2 activation with both substances that lead to prevent OS effect on Cl - current. These data bring new insights into the mechanisms involved in OS-induced lung tissue damage, pointing out the role of H 2 O 2 in chloride current alteration and the ability of Nfr2 activation in preventing this effect. © 2017 Wiley Periodicals, Inc.
42 CFR 460.42 - Suspension of enrollment or payment by CMS.
2010-10-01
... 42 Public Health 4 2010-10-01 2010-10-01 false Suspension of enrollment or payment by CMS. 460.42... enrollment or payment by CMS. (a) Enrollment. If a PACE organization commits one or more violations specified in § 460.40, CMS may suspend enrollment of Medicare beneficiaries after the date CMS notifies the...
Escaffre, Olivier; Saito, Tais B; Juelich, Terry L; Ikegami, Tetsuro; Smith, Jennifer K; Perez, David D; Atkins, Colm; Levine, Corri B; Huante, Matthew B; Nusbaum, Rebecca J; Endsley, Janice J; Freiberg, Alexander N; Rockx, Barry
2017-08-01
Nipah virus (NiV) is a zoonotic emerging paramyxovirus that can cause fatal respiratory illness or encephalitis in humans. Despite many efforts, the molecular mechanisms of NiV-induced acute lung injury (ALI) remain unclear. We previously showed that NiV replicates to high titers in human lung grafts in NOD-SCID/γ mice, resulting in a robust inflammatory response. Interestingly, these mice can undergo human immune system reconstitution by the bone marrow, liver, and thymus (BLT) reconstitution method, in addition to lung tissue engraftment, giving altogether a realistic model to study human respiratory viral infections. Here, we characterized NiV Bangladesh strain (NiV-B) infection of human lung grafts from human immune system-reconstituted mice in order to identify the overall effect of immune cells on NiV pathogenesis of the lung. We show that NiV-B replicated to high titers in human lung grafts and caused similar cytopathic effects irrespective of the presence of human leukocytes in mice. However, the human immune system interfered with virus spread across lung grafts, responded to infection by leukocyte migration to small airways and alveoli of the lung grafts, and accelerated oxidative stress in lung grafts. In addition, the presence of human leukocytes increased the expression of cytokines and chemokines that regulate inflammatory influx to sites of infection and tissue damage. These results advance our understanding of how the immune system limits NiV dissemination and contributes to ALI and inform efforts to identify therapeutic targets. IMPORTANCE Nipah virus (NiV) is an emerging paramyxovirus that can cause a lethal respiratory and neurological disease in humans. Only limited data are available on NiV pathogenesis in the human lung, and the relative contribution of the innate immune response and NiV to acute lung injury (ALI) is still unknown. Using human lung grafts in a human immune system-reconstituted mouse model, we showed that the NiV Bangladesh
Interplay between the lung microbiome and lung cancer.
Mao, Qixing; Jiang, Feng; Yin, Rong; Wang, Jie; Xia, Wenjie; Dong, Gaochao; Ma, Weidong; Yang, Yao; Xu, Lin; Hu, Jianzhong
2018-02-28
The human microbiome confers benefits or disease susceptibility to the human body through multiple pathways. Disruption of the symbiotic balance of the human microbiome is commonly found in systematic diseases such as diabetes, obesity, and chronic gastric diseases. Emerging evidence has suggested that dysbiosis of the microbiota may also play vital roles in carcinogenesis at multiple levels, e.g., by affecting metabolic, inflammatory, or immune pathways. Although the impact of the gut microbiome on the digestive cancer has been widely explored, few studies have investigated the interplay between the microbiome and lung cancer. Some recent studies have shown that certain microbes and microbiota dysbiosis are correlated with development of lung cancer. In this mini-review, we briefly summarize current research findings describing the relationship between the lung microbiome and lung cancer. We further discuss the potential mechanisms through which the lung microbiome may play a role in lung carcinogenesis and impact lung cancer treatment. A better knowledge of the interplay between the lung microbiome and lung cancer may promote the development of innovative strategies for early prevention and personalized treatment in lung cancer. Copyright © 2017 Elsevier B.V. All rights reserved.
Synthesis and Antitumor Activities of Phenanthrene-Based Alkaloids
Directory of Open Access Journals (Sweden)
Zhanyou Wang
2009-12-01
Full Text Available A series of phenanthrene-based tylophorine derivatives (PBTs were synthesized and their cytotoxic activities against the H460 human large-cell lung carcinoma cell line were evaluated. Among these compounds, N-(3-hydroxy-2,6,7-tri-methoxyphenanthr-9-ylmethyl-L-prolinol (5a, and N-(3-hydroxy-2,6,7-trimethoxy-phenanthr-9-ylmethyl-L-valinol (9 exhibited good activities, with IC50 values of 11.6 and 6.1 mM, respectively.
42 CFR 460.70 - Contracted services.
2010-10-01
...: (1) Name of contractor. (2) Services furnished (including work schedule if appropriate). (3) Payment... authorized by the PACE interdisciplinary team. (ii) Accept payment from the PACE organization as payment in... sound as defined in § 460.80(a) of this part and has demonstrated competence with the PACE model as...
Zeng, Huawei; Trujillo, Olivia N; Moyer, Mary P; Botnen, James H
2011-01-01
Sulforaphane (SFN) is a naturally occurring chemopreventive agent; the induction of cell cycle arrest and apoptosis is a key mechanism by which SFN exerts its colon cancer prevention. However, little is known about the differential effects of SFN on colon cancer and normal cells. In this study, we demonstrated that SFN (15 μmol/L) exposure (72 h) inhibited cell proliferation by up to 95% in colon cancer cells (HCT116) and by 52% in normal colon mucosa-derived (NCM460) cells. Our data also showed that SFN exposure (5 and 10 μmol/L) led to the reduction of G1 phase cell distribution and an induction of apoptosis in HCT116 cells, but to a much lesser extent in NCM460 cells. Furthermore, the examination of mitogen-activated protein kinase (MAPK) signaling status revealed that SFN upregulated the phosphorylation of extracellular-regulated kinase 1/2 (ERK1/2) in NCM460 cells but not in HCT116 cells. In contrast, SFN enhanced the phosphorylation of stress-activated protein kinase (SAPK) and decreased cellular myelocytomatosis oncogene (c-Myc) expression in HCT116 cells but not NCM460 cells. Taken together, the activation of survival signaling in NCM460 cells and apoptotic signaling in HCT116 cells may play a critical role in SFN's stronger potential of inhibiting cell proliferation in colon cancer cells than in normal colon cells. Copyright © 2011, Taylor & Francis Group, LLC
Toxic response of nickel nanoparticles in human lung epithelial A549 cells.
Ahamed, Maqusood
2011-06-01
Nickel nanoparticle (Ni NP) is increasingly used in modern industries such as catalysts, sensors and electronic applications. Due to wide-spread industrial applications the inhalation is the primary source of exposure to Ni NPs. However, data demonstrating the effect of Ni NPs on the pulmonary system remain scarce. The present study was designed to examine the toxic effect of human lung epithelial A549 cells treated with well characterized Ni NPs at the concentrations of 0, 1, 2, 5, 10 and 25 μg/ml for 24 and 48 h. Mitochondrial function (MTT assay), membrane leakage of lactate dehydrogenase (LDH assay), reduced glutathione (GSH), reactive oxygen species (ROS), membrane lipid peroxidation (LPO) and caspase-3 activity were assessed as toxicity end points. Results showed that Ni NPs reduced mitochondrial function and induced the leakage of LDH in dose and time-dependent manner. Ni NPs were also found to induce oxidative stress in dose and time-dependent manner indicated by depletion of GSH and induction of ROS and LPO. Further, activity of caspase-3 enzyme, marker of apoptosis was significantly higher in treated cells with time and Ni NPs dosage. The results exhibited significant toxicity of Ni NPs in human lung epithelial A549 cells which is likely to be mediated through oxidative stress. This study warrants more careful assessment of Ni NPs before their industrial applications. Copyright © 2011 Elsevier Ltd. All rights reserved.
Neurotrophins expression is decreased in lungs of human infants with congenital diaphragmatic hernia
Directory of Open Access Journals (Sweden)
O'Hanlon LD
2014-02-01
Full Text Available Lynn D O'Hanlon, Sherry M Mabry, Ikechukwu I EkekezieChildren's Mercy Hospitals/University of Missouri-Kansas City School of Medicine, Department of Pediatrics, Section of Neonatal-Perinatal Medicine, Kansas City, MO, USAObjectives: To evaluate neurotrophin (NT (nerve growth factor [NGF], NT-3, and brain-derived neurotrophic factor [BDNF] expression in autopsy lung tissues of human congenital diaphragmatic hernia (CDH infants versus that of infants that expired with: 1 "normal" lungs (controls; 2 chronic lung disease (CLD; and 3 pulmonary hypertension (PPHN.Hypothesis: NT expression will be significantly altered in CDH lung tissue compared with normal lung tissue and other neonatal lung diseases.Study design: Immunohistochemical studies for NT proteins NGF, BDNF, and NT-3 were applied to human autopsy neonatal lung tissue samples.Subject selection: The samples included a control group of 18 samples ranging from 23-week gestational age to term, a CDH group of 15 samples, a PPHN group of six samples, and a CLD group of 12 samples.Methodology: The tissue samples were studied, and four representative slide fields of alveoli/saccules and four of bronchioles were recorded from each sample. These slide fields were then graded (from 0 to 3 by three blinded observers for intensity of staining.Results: BDNF, NGF, and NT-3 immunostaining intensity scores were significantly decreased in the CDH lung tissue (n=15 compared with normal neonatal lung tissue (n=18 (P<0.001. The other neonatal pulmonary diseases that were studied, CLD and PPHN, were much less likely to be affected and were much more variable in their neurotrophin expression.Conclusion: NT expression is decreased in CDH lungs. The decreased expression of NT in CDH lung tissue may suggest they contribute to the abnormality in this condition.Keywords: nerve growth factor, NGF, brain-derived neurotrophic factor, BDNF, neurotrophin-3, NT-3, chronic lung disease, persistent pulmonary hypertension, lung
In vitro studies of human lung carcinogenesis.
Harris, C C; Lechner, J F; Yoakum, G H; Amstad, P; Korba, B E; Gabrielson, E; Grafstrom, R; Shamsuddin, A; Trump, B F
1985-01-01
Advances in the methodology to culture normal human lung cells have provided opportunities to investigate fundamental problems in biomedical research, including the mechanism(s) of carcinogenesis. Using the strategy schematically shown in Figure 1, we have initiated studies of the effects of carcinogens on the normal progenitor cells of the human cancers caused by these carcinogens. Extended lifespans and aneuploidy were found after exposure of mesothelial cells to asbestos and bronchial epithelial cells to nickel sulfate. These abnormal cells may be considered to be preneoplastic and at an intermediate position in the multistage process of carcinogenesis. Human bronchial epithelial cells can also be employed to investigate the role of specific oncogenes in carcinogenesis and tumor progression. Using the protoplast fusion method for high frequency gene transfection, vHa-ras oncogene initiates a cascade of events in the normal human bronchial cells leading to their apparent immortality, aneuploidy, and tumorigenicity in athymic nude mice. These results suggest that oncogenes may play an important role in human carcinogenesis.
46 CFR 154.460 - Design criteria.
2010-10-01
... GUARD, DEPARTMENT OF HOMELAND SECURITY (CONTINUED) CERTAIN BULK DANGEROUS CARGOES SAFETY STANDARDS FOR... Barrier § 154.460 Design criteria. At static angles of heel up through 30°, a secondary barrier must (a) If a complete secondary barrier is required in § 154.459, hold all of the liquid cargo in the cargo...
Directory of Open Access Journals (Sweden)
Ze-Qun Jiang
2018-02-01
Full Text Available Luteolin (LTL exerts remarkable tumor suppressive activity on various types of cancers, including non-small cell lung cancer (NSCLC. However, it is not completely understood whether the mechanism of its action against NSCLC is related to microRNAs (miRNAs. In the present study, we investigated the anti-tumor effects of LTL on NSCLC in vitro and in vivo. The results revealed that LTL could inhibit cell proliferation and induce apoptosis in both A549 and H460 cells. In a H460 xenograft tumor model of nude mice, LTL significantly suppressed tumor growth, inhibited cell proliferation, and induced apoptosis. miRNA microarray and quantitative PCR (qPCR analysis indicated that miR-34a-5p was dramatically upregulated upon LTL treatment in tumor tissues. Furthermore, MDM4 was proved to be a direct target of miR-34a-5p by luciferase reporter gene assay. LTL treatment was associated with increased p53 and p21 protein expressions and decreased MDM4 protein expression in both NSCLC cells and tumor tissues. When miR-34a-5p was inhibited in vitro, the protein expressions of Bcl-2 and MDM4 were recovered, while that of p53, p21, and Bax were attenuated. Moreover, caspase-3 and caspase-9 activation induced by LHL treatment in vitro were also suppressed by miR-34a-5p inhibition. Overall, LTL could inhibit tumorigenesis and induce apoptosis of NSCLC cells by upregulation of miR-34a-5p via targeting MDM4. These findings provide novel insight into the molecular functions of LTL that suggest its potential as a therapeutic agent for human NSCLC.
DEFF Research Database (Denmark)
Rolandsson, Sara; Andersson Sjöland, Annika; Brune, Jan C
2014-01-01
BACKGROUND: Mesenchymal stem cells (MSC) have not only been implicated in the development of lung diseases, but they have also been proposed as a future cell-based therapy for lung diseases. However, the cellular identity of the primary MSC in human lung tissues has not yet been reported. This st......BACKGROUND: Mesenchymal stem cells (MSC) have not only been implicated in the development of lung diseases, but they have also been proposed as a future cell-based therapy for lung diseases. However, the cellular identity of the primary MSC in human lung tissues has not yet been reported...
Directory of Open Access Journals (Sweden)
Ryohei Miyazaki
Full Text Available Epidermal growth factor receptor-tyrosine kinase inhibitors (EGFR-TKIs and anaplastic lymphoma kinase (ALK inhibitors have dramatically changed the strategy of medical treatment of lung cancer. Patients should be screened for the presence of the EGFR mutation or echinoderm microtubule-associated protein-like 4 (EML4-ALK fusion gene prior to chemotherapy to predict their clinical response. The succinate dehydrogenase inhibition (SDI test and collagen gel droplet embedded culture drug sensitivity test (CD-DST are established in vitro drug sensitivity tests, which may predict the sensitivity of patients to cytotoxic anticancer drugs. We applied in vitro drug sensitivity tests for cyclopedic prediction of clinical responses to different molecular targeting drugs.The growth inhibitory effects of erlotinib and crizotinib were confirmed for lung cancer cell lines using SDI and CD-DST. The sensitivity of 35 cases of surgically resected lung cancer to erlotinib was examined using SDI or CD-DST, and compared with EGFR mutation status.HCC827 (Exon19: E746-A750 del and H3122 (EML4-ALK cells were inhibited by lower concentrations of erlotinib and crizotinib, respectively than A549, H460, and H1975 (L858R+T790M cells were. The viability of the surgically resected lung cancer was 60.0 ± 9.8 and 86.8 ± 13.9% in EGFR-mutants vs. wild types in the SDI (p = 0.0003. The cell viability was 33.5 ± 21.2 and 79.0 ± 18.6% in EGFR mutants vs. wild-type cases (p = 0.026 in CD-DST.In vitro drug sensitivity evaluated by either SDI or CD-DST correlated with EGFR gene status. Therefore, SDI and CD-DST may be useful predictors of potential clinical responses to the molecular anticancer drugs, cyclopedically.
Directory of Open Access Journals (Sweden)
Senchuan Song
2013-12-01
Full Text Available Attempting to improve the anticancer activity and solubility of evodiamine in simulated gastric fluid (SGF and simulated intestinal fluid (SIF solutions, thirty-eight N13-substituted evodiamine derivatives were designed, synthesized and tested for antitumor activities against six kinds of human cancer cell lines, namely prostate cancer (DU-145 and PC-3, lung cancer (H460, breast cancer (MCF-7, colon cancer (HCT-5 and glioblastoma (SF-268. The solubility of these compounds in SGF and SIF solutions was evaluated, and apoptosis induced by 2-2, 2-3, 2-16 and 3-2 was determined. The results showed: (1 among all compounds examined, 2-16 showed the highest antitumor activity and a broader spectrum of activity, with IC50 values ranging from 1–2 µM; (2 their solubility was obviously improved; (3 2-3, 2-16 and 3-2 had a significant impact inducing apoptosis in some cancer cell lines. The preliminary structure-activity relationships of these derivatives were discussed.
Construction of a T7 Human Lung Cancer cDNA Library
Directory of Open Access Journals (Sweden)
Wentao YUE
2008-10-01
Full Text Available Background and objective Currently, only a limited numbers of tumor markers for non small lung cancer (NSCLC diagnosis, new biomarker, such as serum autoantibody may improve the early detection of lung cancer. Our objective is construction human lung squamous carcinoma and adenocarcinoma T7 phage display cDNA library from the tissues of NSCLC patients. Methods mRNA was isolated from a pool of total RNA extract from NSCLC tissues obtained from 5 adenocarcinomas and 5 squamous carcinomas, and then mRNA was reverse transcribed into double stranded cDNA. After digestion, the cDNA was inserted into T7Select 10-3 vector. The phage display cDNA library was constructed by package reaction in vitro and plate proliferation. Plaque assay and PCR were used to evaluate the library.Results Two T7 phage display cDNA library were established. Plaque assay show the titer of lung squamas carcinoma library was 1.8×106 pfu, and the adenocarcinoma library was 5×106 pfu. The phage titer of the amplified library were 3.2×1010 pfu/mL and 2.5×1010 pfu/mL. PCR amplification of random plaque show insert ratio were 100% (24/24 in adenocarcinoma library and 95.8% in human lung squamas carcinoma library (23/24. Insert range from 300 bp to 1 500 bp. Conclusion Two phage display cDNA library from NSCLC were constructed.
Fernández, Andrea G.; Bonetto, Josefina; Giambartolomei, Guillermo H.; Fossati, Carlos A.; Baldi, Pablo C.
2015-01-01
Both CCL20 and human β-defensin 2 (hBD2) interact with the same membrane receptor and display chemotactic and antimicrobial activities. They are produced by airway epithelia in response to infectious agents and proinflammatory cytokines. Whereas Brucella spp. can infect humans through inhalation, their ability to induce CCL20 and hBD2 in lung cells is unknown. Here we show that B. abortus induces CCL20 expression in human alveolar (A549) or bronchial (Calu-6) epithelial cell lines, primary alveolar epithelial cells, primary human monocytes, monocyte-derived macrophages and the monocytic cell line THP-1. CCL20 expression was mainly mediated by JNK1/2 and NF-kB in both Calu-6 and THP-1 cells. CCL20 secretion was markedly induced in A549, Calu-6 and THP-1 cells by heat-killed B. abortus or a model Brucella lipoprotein (L-Omp19) but not by the B. abortus lipopolysaccharide (LPS). Accordingly, CCL20 production by B. abortus-infected cells was strongly TLR2-dependent. Whereas hBD2 expression was not induced by B. abortus infection, it was significantly induced in A549 cells by conditioned media from B. abortus-infected THP-1 monocytes (CMB). A similar inducing effect was observed on CCL20 secretion. Experiments using blocking agents revealed that IL-1β, but not TNF-α, was involved in the induction of hBD2 and CCL20 secretion by CMB. In the in vitro antimicrobial assay, the lethal dose (LD) 50 of CCL20 for B. abortus (>50 μg/ml) was markedly higher than that against E. coli (1.5 μg/ml) or a B. abortus mutant lacking the O polysaccharide in its LPS (8.7 ug/ml). hBD2 did not kill any of the B. abortus strains at the tested concentrations. These results show that human lung epithelial cells secrete CCL20 and hBD2 in response to B. abortus and/or to cytokines produced by infected monocytes. Whereas these molecules do not seem to exert antimicrobial activity against this pathogen, they could recruit immune cells to the infection site. PMID:26448160
Receptor tyrosine kinase EphA5 is a functional molecular target in human lung cancer.
Staquicini, Fernanda I; Qian, Ming D; Salameh, Ahmad; Dobroff, Andrey S; Edwards, Julianna K; Cimino, Daniel F; Moeller, Benjamin J; Kelly, Patrick; Nunez, Maria I; Tang, Ximing; Liu, Diane D; Lee, J Jack; Hong, Waun Ki; Ferrara, Fortunato; Bradbury, Andrew R M; Lobb, Roy R; Edelman, Martin J; Sidman, Richard L; Wistuba, Ignacio I; Arap, Wadih; Pasqualini, Renata
2015-03-20
Lung cancer is often refractory to radiotherapy, but molecular mechanisms of tumor resistance remain poorly defined. Here we show that the receptor tyrosine kinase EphA5 is specifically overexpressed in lung cancer and is involved in regulating cellular responses to genotoxic insult. In the absence of EphA5, lung cancer cells displayed a defective G1/S cell cycle checkpoint, were unable to resolve DNA damage, and became radiosensitive. Upon irradiation, EphA5 was transported into the nucleus where it interacted with activated ATM (ataxia-telangiectasia mutated) at sites of DNA repair. Finally, we demonstrate that a new monoclonal antibody against human EphA5 sensitized lung cancer cells and human lung cancer xenografts to radiotherapy and significantly prolonged survival, thus suggesting the likelihood of translational applications. © 2015 by The American Society for Biochemistry and Molecular Biology, Inc.
Isolation and Characterization of Human Lung Lymphatic Endothelial Cells
Lorusso, Bruno; Falco, Angela; Madeddu, Denise; Frati, Caterina; Cavalli, Stefano; Graiani, Gallia; Gervasi, Andrea; Rinaldi, Laura; Lagrasta, Costanza; Maselli, Davide; Gnetti, Letizia; Silini, Enrico M.; Quaini, Eugenio; Ampollini, Luca; Carbognani, Paolo; Quaini, Federico
2015-01-01
Characterization of lymphatic endothelial cells from the respiratory system may be crucial to investigate the role of the lymphatic system in the normal and diseased lung. We describe a simple and inexpensive method to harvest, isolate, and expand lymphatic endothelial cells from the human lung (HL-LECs). Fifty-five samples of healthy lung selected from patients undergoing lobectomy were studied. A two-step purification tool, based on paramagnetic sorting with monoclonal antibodies to CD31 and Podoplanin, was employed to select a pure population of HL-LECs. The purity of HL-LECs was assessed by morphologic criteria, immunocytochemistry, flow cytometry, and functional assays. Interestingly, these cells retain in vitro several receptor tyrosine kinases (RTKs) implicated in cell survival and proliferation. HL-LECs represent a clinically relevant cellular substrate to study lymphatic biology, lymphoangiogenesis, interaction with microbial agents, wound healing, and anticancer therapy. PMID:26137493
16 CFR 460.18 - Insulation ads.
2010-01-01
... Commercial Practices FEDERAL TRADE COMMISSION TRADE REGULATION RULES LABELING AND ADVERTISING OF HOME INSULATION § 460.18 Insulation ads. (a) If your ad gives an R-value, you must give the type of insulation and... your ad gives a price, you must give the type of insulation, the R-value at a specific thickness, the...
2010-01-01
... INSULATION § 460.13 Fact sheets. If you are a manufacturer, you must give retailers and installers fact... uses. (b) A heading: “This is ____ insulation.” Fill in the blank with the type and form of your... compressed during installation.” (e) After the chart and any statement dealing with the specific type of...
Energy Technology Data Exchange (ETDEWEB)
Mohan, Vijay [School of Life Sciences, Central University of Gujarat, Gandhinagar, Gujarat (India); Agarwal, Rajesh [Department of Pharmaceutical Sciences, School of Pharmacy, University of Colorado Denver, Aurora, CO (United States); Singh, Rana P., E-mail: ranaps@hotmail.com [School of Life Sciences, Central University of Gujarat, Gandhinagar, Gujarat (India); Cancer Biology Laboratory, School of Life Sciences, Jawaharlal Nehru University, New Delhi (India)
2016-09-02
Lung cancer is the most frequently diagnosed malignancy that contributes to high proportion of deaths globally among patients who die due to cancer. Chemotherapy remains the common mode of treatment for lung cancer patients though with limited success. We assessed the biological effects and associated molecular changes of evodiamine, a plant alkaloid, on human lung cancer A549 and H1299 cells along with other epithelial cancer and normal lung SAEC cells. Our data showed that 20–40 μM evodiamine treatment for 24–48 h strongly (up to 73%, P < 0.001) reduced the growth and survival of these cancer cells. However, it also moderately inhibited growth and survival of SAEC cells. A strong inhibition (P < 0.001) was observed on clonogenicity of A549 cells. Further, evodiamine increased (4-fold) mitochondrial membrane depolarization with 6-fold increase in apoptosis and a slight increase in Bax/Bcl-2 ratio. It increased the cytochrome-c release from mitochondria into the cytosol as well as nucleus. Cytosolic cytochrome-c activated cascade of caspase-9 and caspase-3 intrinsic pathway, however, DR5 and caspase-8 extrinsic pathway was also activated which could be due to nuclear cytochrome-c. Pan-caspase inhibitor (z-VAD.fmk) partially reversed evodiamine induced apoptosis. An increase in p53 as well as its serine 15 phosphorylation was also observed. Pifithrin-α, a p53 inhibitor, slightly inhibited growth of A549 cells and under p53 inhibitory condition evodiamine-induced apoptosis could not be reversed. Together these findings suggest that evodiamine is a strong inducer of apoptosis in lung epithelial cancer cells independent of their p53 status and that could involve both intrinsic as well as extrinsic pathway of apoptosis. Thus evodiamine could be a potential anticancer agent against lung cancer. - Highlights: • Evodiamine, a novel plant alkaloid, relatively selectively inhibited growth and survival of human lung cancer cells. • Increased cancer cell
EGFR inhibitor C225 increases the radiosensitivity of human lung squamous cancer cells
Directory of Open Access Journals (Sweden)
Yang Ruijie
2010-10-01
Full Text Available Abstract Background The purpose of the present study is to investigate the direct biological effects of the epidermal growth factor receptor (EGFR inhibitor C225 on the radiosensitivity of human lung squamous cancer cell-H520. H520 cells were treated with different dosage of 60Co γ ray irradiation (1.953 Gy/min in the presence or absence of C225. The cellular proliferation, colony forming capacity, apoptosis, the cell cycle distribution as well as caspase-3 were analyzed in vitro. Results We found that C225 treatment significantly increased radiosensitivity of H-520 cells to irradiation, and led to cell cycle arrest in G1 phase, whereas 60Co γ ray irradiation mainly caused G2 phase arrest. H-520 cells thus displayed both the G1 and G2 phase arrest upon treatment with C225 in combination with 60Co γ ray irradiation. Moreover, C225 treatment significantly increased the apoptosis percentage of H-520 cells (13.91% ± 1.88% compared with the control group (5.75% ± 0.64%, P Conclusion In this regard, C225 treatment may make H-520 cells more sensitive to irradiation through the enhancement of caspase-3 mediated tumor cell apoptosis and cell cycle arrest.
Human Organotypic Lung Tumor Models: Suitable For Preclinical 18F-FDG PET-Imaging.
Directory of Open Access Journals (Sweden)
David Fecher
Full Text Available Development of predictable in vitro tumor models is a challenging task due to the enormous complexity of tumors in vivo. The closer the resemblance of these models to human tumor characteristics, the more suitable they are for drug-development and -testing. In the present study, we generated a complex 3D lung tumor test system based on acellular rat lungs. A decellularization protocol was established preserving the architecture, important ECM components and the basement membrane of the lung. Human lung tumor cells cultured on the scaffold formed cluster and exhibited an up-regulation of the carcinoma-associated marker mucin1 as well as a reduced proliferation rate compared to respective 2D culture. Additionally, employing functional imaging with 2-deoxy-2-[18F]fluoro-D-glucose positron emission tomography (FDG-PET these tumor cell cluster could be detected and tracked over time. This approach allowed monitoring of a targeted tyrosine kinase inhibitor treatment in the in vitro lung tumor model non-destructively. Surprisingly, FDG-PET assessment of single tumor cell cluster on the same scaffold exhibited differences in their response to therapy, indicating heterogeneity in the lung tumor model. In conclusion, our complex lung tumor test system features important characteristics of tumors and its microenvironment and allows monitoring of tumor growth and -metabolism in combination with functional imaging. In longitudinal studies, new therapeutic approaches and their long-term effects can be evaluated to adapt treatment regimes in future.
Anticancer effects of saponin and saponin–phospholipid complex of Panax notoginseng grown in Vietnam
Thu Dang Kim; Hai Nguyen Thanh; Duong Nguyen Thuy; Loi Vu Duc; Thu Vu Thi; Hung Vu Manh; Patcharee Boonsiri; Tung Bui Thanh
2016-01-01
Objective: To evaluate the antitumor activity both in vitro and in vivo of saponin–phospholipid complex of Panax notoginseng. Methods: The in vitro cytotoxic effect of saponins extract and saponin–phospholipid complex against human lung cancer NCI-H460 and breast cancer cell lines BT474 was examined using MTS assay. For in vivo evaluation of antitumor potential, saponin and saponin–phospholipid complex were administered orally in rats induced mammary carcinogenesis by 7,12-dimethylbenz(a)a...
Directory of Open Access Journals (Sweden)
Yunguang Sun
Full Text Available Understanding the mutations that confer radiation resistance is crucial to developing mechanisms to subvert this resistance. Here we describe the creation of a radiation resistant cell line and characterization of a novel p53 mutation. Treatment with 20 Gy radiation was used to induce mutations in the H460 lung cancer cell line; radiation resistance was confirmed by clonogenic assay. Limited sequencing was performed on the resistant cells created and compared to the parent cell line, leading to the identification of a novel mutation (del at the end of the DNA binding domain of p53. Levels of p53, phospho-p53, p21, total caspase 3 and cleaved caspase 3 in radiation resistant cells and the radiation susceptible (parent line were compared, all of which were found to be similar. These patterns held true after analysis of p53 overexpression in H460 cells; however, H1299 cells transfected with mutant p53 did not express p21, whereas those given WT p53 produced a significant amount, as expected. A luciferase assay demonstrated the inability of mutant p53 to bind its consensus elements. An MTS assay using H460 and H1299 cells transfected with WT or mutant p53 showed that the novel mutation did not improve cell survival. In summary, functional characterization of a radiation-induced p53 mutation in the H460 lung cancer cell line does not implicate it in the development of radiation resistance.
Directory of Open Access Journals (Sweden)
Jason H. Gill
2004-11-01
Full Text Available Matrix metalloproteinase (MMP-mediated degradation of the extracellular matrix is a major factor for tumor development and expansion. This study analysed MMP-10 protein expression and activity in human lung tumors of various grade, stage, and type to address the relationship between MMP-10 and tumor characteristics and to evaluate MMP-10 as a therapeutic target in non small cell lung carcinoma (NSCLC. Unlike the majority of MMPs, MMP-10 was located in the tumor mass as opposed to tumor stroma. MMP-10 protein was observed at low levels in normal human lung tissues and at significantly higher levels in all types of NSCLC. No correlation was observed between MMP-10 protein expression and tumor type, stage, or lymph node invasion. To discriminate between active and inactive forms of MMP-10 in samples of human NSCLC, we have developed an ex vivo fluorescent assay. Measurable MMP-10 activity was detected in 42 of 50 specimens of lung cancer and only 2 of 10 specimens of histologically normal lung tissue. No relationship was observed between MMP-10 activity levels and clinicopathologic characteristics. Our results suggest that MMP-10 is expressed and active at high levels in human NSCLC compared to normal lung tissues, and, as such, is a potential target for the development of novel therapeutics for lung cancer treatment.
Morpho-Functional 1H-MRI of the Lung in COPD: Short-Term Test-Retest Reliability.
Directory of Open Access Journals (Sweden)
Bertram J Jobst
Full Text Available Non-invasive end-points for interventional trials and tailored treatment regimes in chronic obstructive pulmonary disease (COPD for monitoring regionally different manifestations of lung disease instead of global assessment of lung function with spirometry would be valuable. Proton nuclear magnetic resonance imaging (1H-MRI allows for a radiation-free assessment of regional structure and function. The aim of this study was to evaluate the short-term reproducibility of a comprehensive morpho-functional lung MRI protocol in COPD.20 prospectively enrolled COPD patients (GOLD I-IV underwent 1H-MRI of the lung at 1.5T on two consecutive days, including sequences for morphology, 4D contrast-enhanced perfusion, and respiratory mechanics. Image quality and COPD-related morphological and functional changes were evaluated in consensus by three chest radiologists using a dedicated MRI-based visual scoring system. Test-retest reliability was calculated per each individual lung lobe for the extent of large airway (bronchiectasis, wall thickening, mucus plugging and small airway abnormalities (tree in bud, peripheral bronchiectasis, mucus plugging, consolidations, nodules, parenchymal defects and perfusion defects. The presence of tracheal narrowing, dystelectasis, pleural effusion, pulmonary trunk ectasia, right ventricular enlargement and, finally, motion patterns of diaphragma and chest wall were addressed.Median global scores [10(Q1:8.00;Q3:16.00 vs.11(Q1:6.00;Q3:15.00] as well as category subscores were similar between both timepoints, and kappa statistics indicated "almost perfect" global agreement (ĸ = 0.86, 95%CI = 0.81-0.91. Most subscores showed at least "substantial" agreement of MRI1 and MRI2 (ĸ = 0.64-1.00, whereas the agreement for the diagnosis of dystelectasis/effusion (ĸ = 0.42, 95%CI = 0.00-0.93 was "moderate" and of tracheal abnormalities (ĸ = 0.21, 95%CI = 0.00-0.75 "fair". Most MRI acquisitions showed at least diagnostic quality at
SEGEL: A Web Server for Visualization of Smoking Effects on Human Lung Gene Expression.
Xu, Yan; Hu, Brian; Alnajm, Sammy S; Lu, Yin; Huang, Yangxin; Allen-Gipson, Diane; Cheng, Feng
2015-01-01
Cigarette smoking is a major cause of death worldwide resulting in over six million deaths per year. Cigarette smoke contains complex mixtures of chemicals that are harmful to nearly all organs of the human body, especially the lungs. Cigarette smoking is considered the major risk factor for many lung diseases, particularly chronic obstructive pulmonary diseases (COPD) and lung cancer. However, the underlying molecular mechanisms of smoking-induced lung injury associated with these lung diseases still remain largely unknown. Expression microarray techniques have been widely applied to detect the effects of smoking on gene expression in different human cells in the lungs. These projects have provided a lot of useful information for researchers to understand the potential molecular mechanism(s) of smoke-induced pathogenesis. However, a user-friendly web server that would allow scientists to fast query these data sets and compare the smoking effects on gene expression across different cells had not yet been established. For that reason, we have integrated eight public expression microarray data sets from trachea epithelial cells, large airway epithelial cells, small airway epithelial cells, and alveolar macrophage into an online web server called SEGEL (Smoking Effects on Gene Expression of Lung). Users can query gene expression patterns across these cells from smokers and nonsmokers by gene symbols, and find the effects of smoking on the gene expression of lungs from this web server. Sex difference in response to smoking is also shown. The relationship between the gene expression and cigarette smoking consumption were calculated and are shown in the server. The current version of SEGEL web server contains 42,400 annotated gene probe sets represented on the Affymetrix Human Genome U133 Plus 2.0 platform. SEGEL will be an invaluable resource for researchers interested in the effects of smoking on gene expression in the lungs. The server also provides useful information
[Apoptosis of human lung carcinoma cell line GLC-82 induced by high power electromagnetic pulse].
Cao, Xiao-zhe; Zhao, Mei-lan; Wang, De-wen; Dong, Bo
2002-09-01
Electromagnetic pulse (EMP) could be used for sterilization of food and the efficiency is higher than 2450 MHz continuous microwave done. This study was designed to evaluate the effect of electromagnetic pulse (EMP) on apoptosis of human lung carcinoma cell line GLC-82, so that to explore and develop therapeutic means for cancer. The injury changes in GLC-82 cells after irradiated with EMP (electric field intensity was 60 kV/m, 5 pulses/2 min) were analyzed by cytometry, MTT chronometry, and flow cytometry. The immunohistochemical SP staining was used to determine the expressions of bcl-2 protein and p53 protein. The stained positive cells were analyzed by CMIAS-II image analysis system at a magnification 400. All data were analyzed by SPSS8.0 software. EMP could obviously inhibited proliferation and activity of lung carcinoma cell line GLC-82. The absorbance value (A570) of MTT decreased immediately, at 0 h, 1 h, and 6 h after the GLC-82 cells irradiated by EMP as compared with control group. The highest apoptosis rate was found to reach 13.38% by flow cytometry at 6 h after EMP irradiation. Down-regulation of bcl-2 expression and up-regulation of p53 expression were induced by EMP. EMP promotes apoptosis of GLC-82 cells. At same time, EMP can down-regulate bcl-2 expression and up-regulate p53 expression in GLC-82 cells. The bcl-2 and the p53 protein may involve the apoptotic process.
Directory of Open Access Journals (Sweden)
Yongjun Yin
2016-05-01
Full Text Available Activating mutations in fibroblast growth factor receptor 3 (FGFR3 have been identified in multiple types of human cancer and in congenital birth defects. In human lung cancer, fibroblast growth factor 9 (FGF9, a high-affinity ligand for FGFR3, is overexpressed in 10% of primary resected non-small cell lung cancer (NSCLC specimens. Furthermore, in a mouse model where FGF9 can be induced in lung epithelial cells, epithelial proliferation and ensuing tumorigenesis is dependent on FGFR3. To develop new customized therapies for cancers that are dependent on FGFR3 activation, we have used this mouse model to evaluate a human monoclonal antibody (D11 with specificity for the extracellular ligand-binding domain of FGFR3, that recognizes both human and mouse forms of the receptor. Here, we show that D11 effectively inhibits signaling through FGFR3 in vitro, inhibits the growth of FGFR3-dependent FGF9-induced lung adenocarcinoma in mice, and reduces tumor-associated morbidity. Given the potency of FGF9 in this mouse model and the absolute requirement for signaling through FGFR3, this study validates the D11 antibody as a potentially useful and effective reagent for treating human cancers or other pathologies that are dependent on activation of FGFR3.
Phenotype abnormality: 460 [Arabidopsis Phenome Database[Archive
Lifescience Database Archive (English)
Full Text Available 460 http://metadb.riken.jp/db/SciNetS_ria224i/cria224u1ria224u964i pale green whole plant in environment... of low light intensity regimen in environment of low light intensity regimen http://m
Molecular characterization of radon-induced rat lung tumors
International Nuclear Information System (INIS)
Guillet Bastide, K.
2008-11-01
The radon gas is a well known lung carcinogenic factor in human at high doses but the cancer risk at low doses is not established. Indeed, epidemiological studies at low doses are difficult to conduct because of the human exposure to other lung carcinogenic factors. These data underlined the necessity to conduct experiments on lung tumors developed on animal model. The aim of this work was to characterize rat lung tumors by working on a series of radon-induced tumors that included adenocarcinomas (A.C.), squamous cell carcinomas (S.C.C.) and adeno-squamous carcinomas (A.S.C.), that are mixed tumors with both A.C. and S.C.C. cellular components. A C.G.H. analysis of the three types of tumors allowed us to define chromosomal recurrent unbalances and to target candidate genes potentially implicated in lung carcinogenesis, as p16Ink4a, p19Arf, Rb1, K-Ras or c-Myc. A more precise analysis of the p16Ink4a/Cdk4/Rb1 and p19Arf/Mdm2/Tp53 pathways was performed and indicated that the Rb1 pathway was frequently inactivated through an absence of p16 Ink4a protein expression, indicating that it has a major role in rat lung carcinogenesis. Finally, a comparative transcriptomic analysis of the three types of tumors allowed us to show for the first time that the complex tumors A.S.C. have a transcriptomic profile in accordance with their mixed nature but that they also display their own expression profiles specificities. This work allowed us to find molecular characteristics common to murine and human lung tumors, indicating that the model of lung tumors in rat is pertinent to search for radiation-induced lung tumors specificities and to help for a better molecular identification of this type of tumors in human. (author)
RECONSTRUCTION OF HUMAN LUNG MORPHOLOGY MODELS FROM MAGNETIC RESONANCE IMAGES
Reconstruction of Human Lung Morphology Models from Magnetic Resonance ImagesT. B. Martonen (Experimental Toxicology Division, U.S. EPA, Research Triangle Park, NC 27709) and K. K. Isaacs (School of Public Health, University of North Carolina, Chapel Hill, NC 27514)
Tomato Lycopene and Lung Cancer Prevention: From Experimental to Human Studies
Energy Technology Data Exchange (ETDEWEB)
Palozza, Paola, E-mail: p.palozza@rm.unicatt.it; Simone, Rossella E.; Catalano, Assunta [Institute of General Pathology, School of Medicine, Catholic University, L. Go F. Vito, Rome 1 00168 (Italy); Mele, Maria Cristina [Institute of Biochemistry and Clinical Biochemistry, School of Medicine, Catholic University, L. Go F. Vito, Rome 1 00168 (Italy)
2011-05-11
Increasing evidence suggests that tomato lycopene may be preventive against the formation and the development of lung cancer. Experimental studies demonstrated that lycopene may inhibit the growth of several cultured lung cancer cells and prevent lung tumorigenesis in animal models through various mechanisms, including a modulation of redox status, cell cycle arrest and/or apoptosis induction, a regulation of growth factor signaling, changes in cell growth-related enzymes, an enhancement of gap junction communication and a prevention of smoke-induced inflammation. In addition, lycopene also inhibited cell invasion, angiogenesis, and metastasis. Several lycopene metabolites have been identified, raising the question as to whether the preventive effects of lycopene on cancer risk is, at least in part, due to its metabolites. Despite these promising reports, it is difficult at the moment to directly relate available experimental data to human pathophysiology. More well controlled clinical intervention trials are needed to further clarify the exact role of lycopene in the prevention of lung cancer cell growth. Such studies should take into consideration subject selection, specific markers of analysis, the levels of carotenoids being tested, metabolism and isomerization of lycopene, interaction with other bioactive food components. This article reviews data on the cancer preventive activities of lycopene, possible mechanisms involved, and the relationship between lycopene consumption and human cancer risk.
Tomato Lycopene and Lung Cancer Prevention: From Experimental to Human Studies
International Nuclear Information System (INIS)
Palozza, Paola; Simone, Rossella E.; Catalano, Assunta; Mele, Maria Cristina
2011-01-01
Increasing evidence suggests that tomato lycopene may be preventive against the formation and the development of lung cancer. Experimental studies demonstrated that lycopene may inhibit the growth of several cultured lung cancer cells and prevent lung tumorigenesis in animal models through various mechanisms, including a modulation of redox status, cell cycle arrest and/or apoptosis induction, a regulation of growth factor signaling, changes in cell growth-related enzymes, an enhancement of gap junction communication and a prevention of smoke-induced inflammation. In addition, lycopene also inhibited cell invasion, angiogenesis, and metastasis. Several lycopene metabolites have been identified, raising the question as to whether the preventive effects of lycopene on cancer risk is, at least in part, due to its metabolites. Despite these promising reports, it is difficult at the moment to directly relate available experimental data to human pathophysiology. More well controlled clinical intervention trials are needed to further clarify the exact role of lycopene in the prevention of lung cancer cell growth. Such studies should take into consideration subject selection, specific markers of analysis, the levels of carotenoids being tested, metabolism and isomerization of lycopene, interaction with other bioactive food components. This article reviews data on the cancer preventive activities of lycopene, possible mechanisms involved, and the relationship between lycopene consumption and human cancer risk
Tomato Lycopene and Lung Cancer Prevention: From Experimental to Human Studies
Directory of Open Access Journals (Sweden)
Assunta Catalano
2011-05-01
Full Text Available Increasing evidence suggests that tomato lycopene may be preventive against the formation and the development of lung cancer. Experimental studies demonstrated that lycopene may inhibit the growth of several cultured lung cancer cells and prevent lung tumorigenesis in animal models through various mechanisms, including a modulation of redox status, cell cycle arrest and/or apoptosis induction, a regulation of growth factor signaling, changes in cell growth-related enzymes, an enhancement of gap junction communication and a prevention of smoke-induced inflammation. In addition, lycopene also inhibited cell invasion, angiogenesis, and metastasis. Several lycopene metabolites have been identified, raising the question as to whether the preventive effects of lycopene on cancer risk is, at least in part, due to its metabolites. Despite these promising reports, it is difficult at the moment to directly relate available experimental data to human pathophysiology. More well controlled clinical intervention trials are needed to further clarify the exact role of lycopene in the prevention of lung cancer cell growth. Such studies should take into consideration subject selection, specific markers of analysis, the levels of carotenoids being tested, metabolism and isomerization of lycopene, interaction with other bioactive food components. This article reviews data on the cancer preventive activities of lycopene, possible mechanisms involved, and the relationship between lycopene consumption and human cancer risk.
N-isopropyl-p-iodoamphetamine receptors in normal and cancerous tissue of the human lung
Energy Technology Data Exchange (ETDEWEB)
Tanaka, Eiko; Mishima, Michiaki; Kawakami, Kenzo; Sakai, Naoki; Sugiura, Naoharu; Kuno, Kenshi [Kyoto Univ. (Japan). Dept. of Clinical Physiology; Taniguchi, Takashi [Kyoto Pharmaceutical Univ. (Japan). Dept. of Neurobiology
1993-04-01
N-Isopropyl-p-iodoamphetamine (IMP) receptors in normal human lung tissue were characterized using a radioligand binding assay with iodine-125 IMP as the ligand. Saturation binding studies revealed the presence of two binding sites with dissociation constant (K[sub d]) values of 53[+-]2 and 4687[+-]124 nM and maximum binding capacity (Bmax) values of 7[+-]1 and 133[+-]27 pmol/mg protein (n=5) respectively. The IC[sub 50] values of various amines were as follows: IMP, 9x10[sup -5] M; propranolol, 5x10[sup -4] M; haloperidol, 6x10[sup -4] M; ketamine, 9x10[sup -3] M; dopamine, 1x10[sup -2] M. The IMP receptors of cancerous tissue obtained from human lung also had two binding sites with K[sub d] values of 54[+-]2 and 5277[+-]652 nM and Bmax values of 7[+-]1 and 103[+-]21 pmol/mg protein (n=3) respectively. There was no significant difference in binding parameters between normal and cancerous lung tissue. These results demonstrate the existence of IMP receptors and suggest that cancer does not affect the nature of IMP receptors in human lung tissue. (orig.).
Estimation of lung volume and pulmonary blood volume from radioisotopic images
International Nuclear Information System (INIS)
Kanazawa, Minoru
1989-01-01
Lung volume and pulmonary blood volume in man were estimated from the radioisotopic image using single photon emission computed tomography (SPECT). Six healthy volunteers were studied in a supine position with normal and altered lung volumes by applying continuous negative body-surface pressure (CNP) and by positive end-expiratory pressure (PEEP). 99m Tc labeled human serum albumin was administered as an aerosol to image the lungs. The CNP caused the diaphragm to be lowered and it increased the mean lung tissue volume obtained by SPECT from 3.09±0.49 l for baseline to 3.67±0.62 l for 10 cmH 2 O (p 2 O (p 2 O), respectively. The PEEP also increased the lung tissue volume to 3.68±0.68 l for 10 cmH 2 O as compared with the baseline (p 2 O PEEP. The lung tissue volume obtained by SPECT showed a positive correlation with functional residual capacity measured by the He dilution method (r=0.91, p 99m Tc-labeled red blood cells. The L/H ratio decreased after either the CNP or PEEP, suggesting a decrease in the blood volume per unit lung volume. However, it was suggested that the total pulmonary blood volume increased slightly either on the CNP (+7.4% for 10 cmH 2 O, p 2 O,p<0.05) when we extrapolated the L/H ratio to the whole lungs by multiplying the lung tissue volume obtained by SPECT. We concluded that SPECT could offer access to the estimation of lung volume and pulmonary blood volume in vivo. (author)
Human Lung Mast Cell Products Regulate Airway Smooth Muscle CXCL10 Levels.
Alkhouri, H; Cha, V; Tong, K; Moir, L M; Armour, C L; Hughes, J M
2014-01-01
In asthma, the airway smooth muscle (ASM) produces CXCL10 which may attract CXCR3(+) mast/T cells to it. Our aim was to investigate the effects of mast cell products on ASM cell CXCL10 production. ASM cells from people with and without asthma were stimulated with IL-1 β , TNF- α , and/or IFN γ and treated with histamine (1-100 μ M) ± chlorpheniramine (H1R antagonist; 1 μ M) or ranitidine (H2R antagonist; 50 μ M) or tryptase (1 nM) ± leupeptin (serine protease inhibitor; 50 μ M), heat-inactivated tryptase, or vehicle for 4 h or 24 h. Human lung mast cells (MC) were isolated and activated with IgE/anti-IgE and supernatants were collected after 2 h or 24 h. The supernatants were added to ASM cells for 48 h and ASM cell CXCL10 production detected using ELISA (protein) and real-time PCR (mRNA). Histamine reduced IL-1 β /TNF- α -induced CXCL10 protein, but not mRNA, levels independent of H1 and H2 receptor activation, whereas tryptase and MC 2 h supernatants reduced all cytokine-induced CXCL10. Tryptase also reduced CXCL10 levels in a cell-free system. Leupeptin inhibited the effects of tryptase and MC 2 h supernatants. MC 24 h supernatants contained TNF- α and amplified IFN γ -induced ASM cell CXCL10 production. This is the first evidence that MC can regulate ASM cell CXCL10 production and its degradation. Thus MC may regulate airway myositis in asthma.
Pulmonary haptoglobin (pHp) is part of the surfactant system in the human lung.
Abdullah, Mahdi; Goldmann, Torsten
2012-11-20
Since the existence of pHp was demonstrated, it has been shown that this molecule and its receptor CD163 are regulated by different stimuli. Furthermore, a comparably fast secretion of pHp was described as well as the immuno-stimulatory effects. The intention of this study was to elucidate the role of pHp in the human lungs further. Here we show, by means of confocal microscopy and immune-electron-microscopy, a clear co-localization of pHp with surfactant protein-B in lamellar bodies of alveolar epithelial cells type II. These results are underlined by immunohistochemical stainings in differently fixed human lung tissues, which show pHp in vesicular and released form. The images of the released form resemble the intended position of surfactant in the human alveolus. pHp is secreted by Alveolar epithelial cells type II as previously shown. Moreover, pHp is co-localized with Surfactant protein-B. We conclude that the presented data shows that pHp is a native part of the surfactant system in the human lung. http://www.diagnosticpathology.diagnomx.eu/vs/2563584738239912.
DEFF Research Database (Denmark)
Poulsen, T.T.; Pedersen, N.; Juel, H.
2008-01-01
Transcriptionally targeted gene therapy is a promising experimental modality for treatment of systemic malignancies such as small cell lung cancer (SCLC). We have identified the human achaete-scute homolog 1 (hASH1) and enhancer of zeste homolog 2 (EZH2) genes as highly upregulated in SCLC compar...
Rossi, Raffaella; Granoff, Dan M; Beernink, Peter T
2013-11-04
Factor H-binding protein (fHbp) is a component of a meningococcal vaccine recently licensed in Europe for prevention of serogroup B disease, and a second vaccine in clinical development. The protein specifically binds human factor H (fH), which down-regulates complement activation and enhances resistance to bactericidal activity. There are conflicting data from studies in human fH transgenic mice on whether binding of human fH to fHbp vaccines decreases immunogenicity, and whether mutant fHbp vaccines with decreased fH binding have enhanced immunogenicity. fHbp can be classified into two sub-families based on sequence divergence and immunologic cross-reactivity. Previous studies of mutant fHbp vaccines with low fH binding were from sub-family B, which account for approximately 60% of serogroup B case isolates. In the present study, we evaluated the immunogenicity of two mutant sub-family A fHbp vaccines containing single substitutions, T221A or D211A, which resulted in 15- or 30-fold lower affinity for human fH, respectively, than the corresponding control wild-type fHbp vaccine. In transgenic mice with high serum concentrations of human fH, both mutant vaccines elicited significantly higher IgG titers and higher serum bactericidal antibody responses than the control fHbp vaccine that bound human fH. Thus, mutations introduced into a sub-family A fHbp antigen to decrease fH binding can increase protective antibody responses in human fH transgenic mice. Collectively the data suggest that mutant fHbp antigens with decreased fH binding will result in superior vaccines in humans. Copyright © 2013 Elsevier Ltd. All rights reserved.
Jiang, Li; Luo, Man; Liu, Dan; Chen, Bojiang; Zhang, Wen; Mai, Lin; Zeng, Jing; Huang, Na; Huang, Yi; Mo, Xianming; Li, Weimin
2013-06-01
The pro-apoptotic Bcl-2 protein BAD initiated apoptosis in human cells and has been identified as a prognostic marker in non-small cell lung cancer (NSCLC). In this study, we aimed to explore the functions of BAD in NSCLC. Overexpression of BAD was performed by transfecting different NSCLC cell lines with wild-type BAD. Cell proliferation, cell cycle, apoptosis, and invasion were characterized in vitro. Tumorigenicity was analyzed in vivo. Western blot was performed to determine the effects of BAD overexpression on the Bcl-2 family proteins and apoptosis-related proteins. Overexpression of BAD significantly inhibited cell proliferation in H1299, H292, and SPC-A1 but not in SK-MES-1 and H460 cell lines in vitro. BAD overexpression also reduced the tumorigenicity of H1299/SPC-A1 cell in vivo. However, no appreciable effects on cell cycle distribution and invasion were observed in all these cell lines. BAD overexpression also induced apoptosis in all cell types, in which process expression of mitochondrial cytochrom c (cyto-c) and caspase 3 were increased, whereas Bcl-xl, Bcl-2, Bax and caspase 8 expressions did not changed. These findings indicated that a mitochondrial pathway, in which process cyto-c was released from mitochondrial to activate caspase 3, was involved in BAD overexpression-mediated apoptosis. Our data suggested that increased expression of BAD enhance apoptosis and has negative influence on cell proliferation and tumor growth in NSCLC. Bad is a new potential target for tumor interventions.
Anti-EGFR therapy radiosensitizes human lung adenocarcinoma xenograft in nude mouse
International Nuclear Information System (INIS)
Wang Hui; Li Tianran; Tian Jiahe; Qu Baolin; Zhu Hui
2008-01-01
Objective: To investigate the effect of Gefitinib on radiosensitivity of human lung adenocarcinoma xenograft in nude mouse. Methods: Human lung adenocarcinoma cell line A549 was used to establish nude mouse xenograft tumor model. The mice were derided into 4 groups: control, irradiation alone, Gefinitib alone and radiation combined with Genifitib. Radiation schedule was 3 fractions of 5 Gy, once daily. Gefitinib was daily administered by gavage at 100 mg/(kg·day -1 ) for 14 days. In the combination group, radiotherapy was performed 2 hours after Gefitinib administration. Tumor diameter was measured every other day. Percentage of tumor growth inhibition, growth delay time and regrowth delay time were evaluated. Results: For A549 xenografts in radiation alone, gefitinib alone and combination therapy groups, the percentage of tumor growth inhibition was 22.7%, 12.4% and 38.2%, respectively (F=25.75, P=0.000). Tumor growth delay time was 6.0, 7.8 and 21.6 days, respectively (F=70.49, P=0.000). Tumor regrowth delay time in combination therapy and irradiation alone groups was 23.4 and 10.2 days. (F=174.24, P= 0.000). Sensitizing enhancement ratio of combination group was 1.5 in growth and 1.7 in regrowth. Conclusions: Anti-EGFR therapy enhances the radiosensitivity of human lung adenocarcinoma xenograft in nude mouse. (authors)
International Nuclear Information System (INIS)
Shah, Jinesh N; Shao, Genze; Hei, Tom K; Zhao, Yongliang
2008-01-01
Hypermethylation of the TGFBI promoter has been shown to correlate with decreased expression of this gene in human tumor cell lines. In this study, we optimized a methylation-specific polymerase chain reaction (MSP) method and investigated the methylation status of the TGFBI promoter in human lung and prostate cancer specimens. Methylation-specific primers were designed based on the methylation profiles of the TGFBI promoter in human tumor cell lines, and MSP conditions were optimized for accurate and efficient amplification. Genomic DNA was isolated from lung tumors and prostatectomy tissues of prostate cancer patients, bisulfite-converted, and analyzed by MSP. Among 50 lung cancer samples, 44.0% (22/50) harbored methylated CpG sites in the TGFBI promoter. An analysis correlating gene methylation status with clinicopathological cancer features revealed that dense methylation of the TGFBI promoter was associated with a metastatic phenotype, with 42.9% (6/14) of metastatic lung cancer samples demonstrating dense methylation vs. only 5.6% (2/36) of primary lung cancer samples (p < 0.05). Similar to these lung cancer results, 82.0% (41/50) of prostate cancer samples harbored methylated CpG sites in the TGFBI promoter, and dense methylation of the promoter was present in 38.9% (7/18) of prostate cancer samples with the feature of locoregional invasiveness vs. only 19.4% (6/31) of prostate cancer samples without locoregional invasiveness (p < 0.05). Furthermore, promoter hypermethylation correlated with highly reduced expression of the TGFBI gene in human lung and prostate tumor cell lines. We successfully optimized a MSP method for the precise and efficient screening of TGFBI promoter methylation status. Dense methylation of the TGFBI promoter correlated with the extent of TGFBI gene silencing in tumor cell lines and was related to invasiveness of prostate tumors and metastatic status of lung cancer tumors. Thus, TGFBI promoter methylation can be used as a potential
Dong, Wen; Yang, Kun; Xu, Quanli; Liu, Lin; Chen, Juan
2017-10-24
A large number (n = 460) of A(H7N9) human infections have been reported in China from March 2013 through December 2014, and H7N9 outbreaks in humans became an emerging issue for China health, which have caused numerous disease outbreaks in domestic poultry and wild bird populations, and threatened human health severely. The aims of this study were to investigate the directional trend of the epidemic and to identify the significant presence of spatial-temporal clustering of influenza A(H7N9) human cases between March 2013 and December 2014. Three distinct epidemic phases of A(H7N9) human infections were identified in this study. In each phase, standard deviational ellipse analysis was conducted to examine the directional trend of disease spreading, and retrospective space-time permutation scan statistic was then used to identify the spatio-temporal cluster patterns of H7N9 outbreaks in humans. The ever-changing location and the increasing size of the three identified standard deviational ellipses showed that the epidemic moved from east to southeast coast, and hence to some central regions, with a future epidemiological trend of continue dispersing to more central regions of China, and a few new human cases might also appear in parts of the western China. Furthermore, A(H7N9) human infections were clustering in space and time in the first two phases with five significant spatio-temporal clusters (p < 0.05), but there was no significant cluster identified in phase III. There was a new epidemiologic pattern that the decrease in significant spatio-temporal cluster of A(H7N9) human infections was accompanied with an obvious spatial expansion of the outbreaks during the study period, and identification of the spatio-temporal patterns of the epidemic can provide valuable insights for better understanding the spreading dynamics of the disease in China.
Cellular morphometry of the bronchi of human and dog lungs
International Nuclear Information System (INIS)
Robbins, E.S.
1991-09-01
One hundred and forty-seven bronchial samples (generations 3--6) from 66 patients (62 usable; 36 female, 26 male; median age 61) have been dissected by generation from fixed surgical lung specimens obtained after the removal of pathological lesions. In addition, one hundred and fifty-six mongol dog bronchi (generations 2--6) dissected from different lobes of 26 dog lungs have also been similarly prepared. One hundred and twenty-seven human samples have been completely processed for electron microscopy and have yielded 994 electron micrographs of which 655 have been entered into the Computerized Stereological Analysis System (COSAS) and been used for the measurement of the distances of basal and mucous cell nuclei to the epithelial free surface. Similarly 328 micrographs of dog epithelium from 33 bronchial samples have been used to measure the distances of basal and mucous cell nuclei to the epithelial free surface and have been entered into COSAS. Using the COSAS planimetry program, we continue to expand our established data bases which describe the volume density and nuclear numbers per electron micrograph for 5 cell types of the human bronchial epithelial lining of men and women, as well as smokers, non-smokers and ex-smokers and similar parameters for the same 5 epithelial cell types of dog bronchi. Our micrographs of human bronchial epithelium have allowed us to analyze the recent suggestion that the DNA of lymphocytes may be subject to significant damage from Rn progeny while within the lung. Since the last progress report three papers have been submitted for publication. 17 refs., 4 tabs
Directory of Open Access Journals (Sweden)
Chenggang Li
Full Text Available BACKGROUND: The 2009 influenza pandemic affected people in almost all countries in the world, especially in younger age groups. During this time, the debate over whether to use corticosteroid treatment in severe influenza H1N1 infections patients resurfaced and was disputed by clinicians. There is an urgent need for a susceptible animal model of 2009 H1N1 infection that can be used to evaluate the pathogenesis and the therapeutic effect of corticosteroid treatment during infection. METHODOLOGY/PRINCIPAL FINDINGS: We intranasally inoculated two groups of C57BL/6 and BALB/c mice (using 4- or 6-to 8-week-old mice to compare the pathogenesis of several different H1N1 strains in mice of different ages. Based on the results, a very susceptible 4-week-old C57BL/6 mouse model of Beijing 501 strain of 2009 H1N1 virus infection was established, showing significantly elevated lung edema and cytokine levels compared to controls. Using our established animal model, the cytokine production profile and lung histology were assessed at different times post-infection, revealing increased lung lesions in a time-dependent manner. In additional,the mice were also treated with dexamethasone, which significantly improved survival rate and lung lesions in infected mice compared to those in control mice. Our data showed that corticosteroid treatment ameliorated acute lung injury induced by the 2009 A/H1N1 virus in mice and suggested that corticosteroids are valid drugs for treating 2009 A/H1N1 infection. CONCLUSIONS/SIGNIFICANCE: Using the established, very susceptible 2009 Pandemic Influenza A (H1N1 mouse model, our studies indicate that corticosteroids are a potential therapeutic remedy that may address the increasing concerns over future 2009 A/H1N1 pandemics.
Sterols of Pneumocystis carinii hominis organisms isolated from human lungs
DEFF Research Database (Denmark)
Kaneshiro, E S; Amit, Z; Chandra, Jan Suresh
1999-01-01
in conjunction with analyses of chemically synthesized authentic standards. The sterol composition of isolated P. carinii hominis organisms has yet to be reported. If P. carinii from animal models is to be used for identifying potential drug targets and for developing chemotherapeutic approaches to clear human...... infections, it is important to determine whether the 24-alkylsterols of organisms found in rats are also present in organisms in humans. In the present study, sterol analyses of P. carinii hominis organisms isolated from cryopreserved human P. carinii-infected lungs and from bronchoalveolar lavage fluid were...
Ameliorating Effect of Dietary Xylitol on Human Respiratory Syncytial Virus (hRSV) Infection.
Xu, Mei Ling; Wi, Ga Ram; Kim, Hyoung Jin; Kim, Hong-Jin
2016-01-01
Human respiratory syncytial virus (hRSV) is the most common cause of bronchiolitis and pneumonia in infants. The lack of proper prophylactics and therapeutics for controlling hRSV infection has been of great concern worldwide. Xylitol is a well-known sugar substitute and its effect against bacteria in the oral cavity is well known. However, little is known of its effect on viral infections. In this study, the effect of dietary xylitol on hRSV infection was investigated in a mouse model for the first time. Mice received xylitol for 14 d prior to virus challenge and for a further 3 d post challenge. Significantly larger reductions in lung virus titers were observed in the mice receiving xylitol than in the controls receiving phosphate-buffered saline (PBS). In addition, fewer CD3(+) and CD3(+)CD8(+) lymphocytes, whose numbers reflect inflammatory status, were recruited in the mice receiving xylitol. These results indicate that dietary xylitol can ameliorate hRSV infections and reduce inflammation-associated immune responses to hRSV infection.
Directory of Open Access Journals (Sweden)
Kuo Liu
Full Text Available BACKGROUND: No clear consensus has been reached on the alpha-adducin polymorphism (Gly460Trp and essential hypertension risk. We performed a meta-analysis in an effort to systematically summarize the possible association. METHODOLOGY/PRINCIPAL FINDINGS: Studies were identified by searching MEDLINE and EMBASE databases complemented with perusal of bibliographies of retrieved articles and correspondence with original authors. The fixed-effects model and the random-effects model were applied for dichotomous outcomes to combine the results of the individual studies. We selected 22 studies that met the inclusion criteria including a total of 14303 hypertensive patients and 15961 normotensive controls. Overall, the 460Trp allele showed no statistically significant association with hypertension risk compared to Gly460 allele (P = 0.69, OR = 1.02, 95% CI 0.94-1.10, P(heterogeneity<0.0001 in all subjects. Meta-analysis under other genetic contrasts still did not reveal any significant association in all subjects, Caucasians, East Asians and others. The results were similar but heterogeneity did not persist when sensitivity analyses were limited to these studies. CONCLUSIONS/SIGNIFICANCE: Our meta-analysis failed to provide evidence for the genetic association of α-adducin gene Gly460Trp polymorphism with hypertension. Further studies investigating the effect of genetic networks, environmental factors, individual biological characteristics and their mutual interactions are needed to elucidate the possible mechanism for hypertension in humans.
Lee, Hyun-Wook; Park, Sung-Hyun; Weng, Mao-wen; Wang, Hsiang-Tsui; Huang, William C.; Lepor, Herbert; Wu, Xue-Ru; Chen, Lung-Chi; Tang, Moon-shong
2018-01-01
Significance E-cigarette smoke (ECS) delivers nicotine through aerosols without burning tobacco. ECS is promoted as noncarcinogenic. We found that ECS induces DNA damage in mouse lung, bladder, and heart and reduces DNA-repair functions and proteins in lung. Nicotine and its nitrosation product 4-(methylnitrosamine)-1-(3-pyridyl)-1-butanone can cause the same effects as ECS and enhance mutations and tumorigenic cell transformation in cultured human lung and bladder cells. These results indica...
Transcriptome and H3K27 tri-methylation profiling of Ezh2-deficient lung epithelium
Directory of Open Access Journals (Sweden)
Aliaksei Z. Holik
2015-09-01
Full Text Available The adaptation of the lungs to air breathing at birth requires the fine orchestration of different processes to control lung morphogenesis and progenitor cell differentiation. However, there is little understanding of the role that epigenetic modifiers play in the control of lung development. We found that the histone methyl transferase Ezh2 plays a critical role in lung lineage specification and survival at birth. We performed a genome-wide transcriptome study combined with a genome-wide analysis of the distribution of H3K27 tri-methylation marks to interrogate the role of Ezh2 in lung epithelial cells. Lung cells isolated from Ezh2-deficient and control mice at embryonic day E16.5 were sorted into epithelial and mesenchymal populations based on EpCAM expression. This enabled us to dissect the transcriptional and epigenetic changes induced by the loss of Ezh2 specifically in the lung epithelium. Here we provide a detailed description of the analysis of the RNA-seq and ChIP-seq data, including quality control, read mapping, differential expression and differential binding analyses, as well as visualisation methods used to present the data. These data can be accessed from the Gene Expression Omnibus database (super-series accession number GSE57393.
34 CFR 460.1 - What is the purpose of the Adult Education Act?
2010-07-01
... sufficient basic education to enable them to benefit from job training and retraining programs and obtain and... 34 Education 3 2010-07-01 2010-07-01 false What is the purpose of the Adult Education Act? 460.1 Section 460.1 Education Regulations of the Offices of the Department of Education (Continued) OFFICE OF...
Biologic characteristics of the side population of human small cell lung cancer cell line H446.
Wang, Bo; Yang, Huan; Huang, Yu-Zheng; Yan, Ru-Hong; Liu, Fen-Ju; Zhang, Jun-Ning
2010-03-01
Recently, the theory of cancer stem cells (CSCs) has presented new targets and orientations for tumor therapy. The major difficulties in researching CSCs include their isolation and purification. The aim of this study is to identify and characterize the side population (SP) cells in small cell lung cancer (SCLC) cell line H446, which lays the foundation for the isolation and purification of CSCs. Fluorescence-activated cell sorting (FACS) was used to sort SP and non-SP (NSP) cells from H446. Both subgroups were cultivated to survey the capacity to form into suspended tumor cell spheres. Reverse transcription-polymerase chain reaction (RT-PCR) and real-time PCR were used to evaluate the expression levels of the mRNA of CD133, ABCG2, and nucleostemin in both subgroups. The capacity of proliferation and the differences in drug resistance of both subgroups and unsorted cells were tested by the MTT method. The differentiation ability of both subgroups was determined by FACS. Proliferation was determined by subcutaneous tumor formation in nude mice. The percent of Hoechst 33342 negative cells was about (5.1 +/- 0.2)% in H446 by fluorescence microscopy. The percent of SP cells was (6.3 +/- 0.1)% by flow cytometry. SP cells had a stronger capability of forming into tumor spheres than NSP cells. The mRNA expression levels of ABCG2, CD133, and nucleostemin in SP cells were 21.60 +/- 0.26, 7.10 +/- 0.14, and 1.02 +/- 0.08 folds higher than that in NSP cells (P 0.05, respectively). In vivo, SP cells showed better proliferative ability and tougher viability when treated with drugs. SP cells can differentiate into NSP cells, but NSP cells cannot differentiate into SP cells. SP cells had a greater ability to form tumors. The H446 cell line contained some SP cells with stem cell properties. CD133 and ABCG2 may be cancer stem cell markers of SCLC.
Design and validation of a clinical-scale bioreactor for long-term isolated lung culture.
Charest, Jonathan M; Okamoto, Tatsuya; Kitano, Kentaro; Yasuda, Atsushi; Gilpin, Sarah E; Mathisen, Douglas J; Ott, Harald C
2015-06-01
The primary treatment for end-stage lung disease is lung transplantation. However, donor organ shortage remains a major barrier for many patients. In recent years, techniques for maintaining lungs ex vivo for evaluation and short-term (advance to more complex interventions for lung repair and regeneration, the need for a long-term organ culture system becomes apparent. Herein we describe a novel clinical scale bioreactor capable of maintaining functional porcine and human lungs for at least 72 h in isolated lung culture (ILC). The fully automated, computer controlled, sterile, closed circuit system enables physiologic pulsatile perfusion and negative pressure ventilation, while gas exchange function, and metabolism can be evaluated. Creation of this stable, biomimetic long-term culture environment will enable advanced interventions in both donor lungs and engineered grafts of human scale. Copyright © 2015 Elsevier Ltd. All rights reserved.
In vivo measurement of actinides in the human lung
International Nuclear Information System (INIS)
Anderson, A.L.; Campbell, G.W.; Griffith, R.V.
1979-01-01
The problems associated with the in vivo detection and measurement of actinides in the human lung are discussed together with various measurement systems currently in use. In particular, the methods and calibration procedures employed at the Lawrence Livermore Laboratory, namely, the use of twin Phoswich detectors and a new, more realistic, tissue-equivalent phantom, are described. Methods for the measurement of chest-wall thickness, fat content, and normal human background counts are also discussed. Detection-efficiency values and minimum detectable activity estimates are given for three common actinides, 238 Pu, 239 Pu, and 241 Am
Directory of Open Access Journals (Sweden)
Xihan Guo
2016-09-01
Full Text Available The fruit of Phyllanthus emblica Linn. (PE has been widely consumed as a functional food and folk medicine in Southeast Asia due to its remarkable nutritional and pharmacological effects. Previous research showed PE delays mitotic progress and increases genomic instability (GIN in human colorectal cancer cells. This study aimed to investigate the similar effects of PE by the biomarkers related to spindle assembly checkpoint (SAC, mitotic aberrations and GIN in human NCM460 normal colon epithelial cells. Cells were treated with PE and harvested differently according to the biomarkers observed. Frequencies of micronuclei (MN, nucleoplasmic bridge (NPB and nuclear bud (NB in cytokinesis-block micronucleus assay were used as indicators of GIN. Mitotic aberrations were assessed by the biomarkers of chromosome misalignment, multipolar division, chromosome lagging and chromatin bridge. SAC activity was determined by anaphase-to- metaphase ratio (AMR and the expression of core SAC gene budding uninhibited by benzimidazoles related 1 (BubR1. Compared with the control, PE-treated cells showed (1 decreased incidences of MN, NPB and NB (p < 0.01; (2 decreased frequencies of all mitotic aberration biomarkers (p < 0.01; and (3 decreased AMR (p < 0.01 and increased BubR1 expression (p < 0.001. The results revealed PE has the potential to protect human normal colon epithelial cells from mitotic and genomic damages partially by enhancing the function of SAC.
Effect of lung resection on pleuro-pulmonary mechanics and fluid balance.
Salito, C; Bovio, D; Orsetti, G; Salati, M; Brunelli, A; Aliverti, A; Miserocchi, G
2016-01-15
The aim of the study was to determine in human patients the effect of lung resection on lung compliance and on pleuro-pulmonary fluid balance. Pre and post-operative values of compliance were measured in anesthetized patients undergoing resection for lung cancer (N=11) through double-lumen bronchial intubation. Lung compliance was measured for 10-12 cm H2O increase in alveolar pressure from 5 cm H2O PEEP in control and repeated after resection. No air leak was assessed and pleural fluid was collected during hospital stay. A significant negative correlation (r(2)=0.68) was found between compliance at 10 min and resected mass. Based on the pre-operative estimated lung weight, the decrease in compliance following lung resection exceeded by 10-15% that expected from resected mass. Significant negative relationships were found by relating pleural fluid drainage flow to the remaining lung mass and to post-operative lung compliance. Following lung re-expansion, data suggest a causative relationship between the decrease in compliance and the perturbation in pleuro-pulmonary fluid balance. Copyright © 2015 Elsevier B.V. All rights reserved.
International Nuclear Information System (INIS)
El-Kolaly, M.T.; Amin, A.; Raieh, M.; El-Mohty, A.
1996-01-01
A modified procedure is reported for the labelling of human serum albumin microspheres (HSAM) with 99m Tc. Albumin microspheres were first soaked in Sn-methylene diphosphonate (Sn-MDP) solution, then heated in a boiling water both for 10-15 minutes. The Sn-MDP coated HSAM were washed twice with saline containing poly sorbate-80 to remove the excess Sn-MDP solution. The coated albumin microspheres were then labelled with 99m Tc. More than 95% labelling yield are achieved by using the following quantities: 10 mg dry albumin microspheres, 5 mg MDP, 0.05 mg Sn Cl 2 .2 H 2 O, 0.1 mg ascorbic acid. The biological distribution of the labelled microspheres in mice has been studied and more than 85% lung uptake is achieved after 10 min of injection and the lung/liver ratio was 62. 8 tabs
Ochola, Donasian O.; Sharif, Rabab; Bedford, Joel S.; Keefe, Thomas J.; Kato, Takamitsu A.; Fallgren, Christina M.; Demant, Peter; Costes, Sylvain V.; Weil, Michael M.
2018-01-01
The risk of developing radiation-induced lung cancer differs between different strains of mice, but the underlying cause of the strain differences is unknown. Strains of mice also differ in their ability to efficiently repair DNA double strand breaks resulting from radiation exposure. We phenotyped mouse strains from the CcS/Dem recombinant congenic strain set for their efficacy in repairing DNA double strand breaks during protracted radiation exposures. We monitored persistent gamma-H2AX radiation induced foci (RIF) 24 hours after exposure to chronic gamma-rays as a surrogate marker for repair deficiency in bronchial epithelial cells for 17 of the CcS/Dem strains and the BALB/cHeN founder strain. We observed a very strong correlation R2 = 79.18%, P cancer percent incidence measured in the same strains. Interestingly, spontaneous levels of foci in non-irradiated strains also showed good correlation with lung cancer incidence (R2=32.74%, P =0.013). These results suggest that genetic differences in DNA repair capacity largely account for differing susceptibilities to radiation-induced lung cancer among CcS/Dem mouse strains and that high levels of spontaneous DNA damage is also a relatively good marker of cancer predisposition. In a smaller pilot study, we found that the repair capacity measured in peripheral blood leucocytes also correlated well with radiogenic lung cancer susceptibility, raising the possibility that such phenotyping assay could be used to detect radiogenic lung cancer susceptibility in humans.
International Nuclear Information System (INIS)
Nair, Parveen; Malhotra, A.; Dhawan, D.K.
2010-01-01
Full text: Lung cancer is responsible for most of the cancer related deaths and calls for new approaches to control the menace. In the present study chemopreventive efficacy of curcumin and quercetin was investigated against benzo(a)pyrene (BP) induced lung carcinogenesis. The mice were segregated into five groups which included normal control, BP treated, BP+curcumin treated, BP+quercetin treated and BP+curcumin+quercetin treated groups. The morphological and histological analyses of tumor nodules confirmed lung carcinogenesis, after 22 weeks of single i.p. injection of BP at a dose of 100 mg/Kg body weight to mice. Tumor incidence and tumor multiplicity were observed to be 88% and 1.75, respectively in the BP treated mice. A statistically significant increase in the uptake of 3 H thymidine indicative of increased DNA synthesis which in turn is the marker of uncontrolled cancer cell proliferation, was observed in the lung slices of BP treated mice. Further, BP treatment resulted in marked disruption in the histoarchitecture of lungs. Nuclei were enlarged, thickening of epithelium was seen. Structure-less masses of cells were visible all over. Nuclear pleomorphism and decreased cytoplasmic contents were also observed in BP treated mice. Squamous epithelial metaplasia, severe epithelial thickening and alveolar vocuolizations in distal airways indicative of lung carcinogensis were also observed in the BP treated mice. Supplementation with curcumin alone resulted in a significant decrease in the tumor incidence as well as tumor multicity which were observed to be 77% and 1.42 respectively. Also, quercetin significantly decreased tumor incidence and tumor multiplicity to 70% and 1.28 respectively. However, upon combined supplementation with phytochemicals, an appreciable decrease in the tumor incidence and multiplicity was observed which was found to be 60% and 1.00 respectively. Further, Supplementation with curcumin alone to BP treated mice resulted in statistically
Energy Technology Data Exchange (ETDEWEB)
Person, Rachel J.; Olive Ngalame, Ntube N.; Makia, Ngome L.; Bell, Matthew W.; Waalkes, Michael P.; Tokar, Erik J., E-mail: tokare@niehs.nih.gov
2015-07-01
Inorganic arsenic is a human lung carcinogen. We studied the ability of chronic inorganic arsenic (2 μM; as sodium arsenite) exposure to induce a cancer phenotype in the immortalized, non-tumorigenic human lung peripheral epithelial cell line, HPL-1D. After 38 weeks of continuous arsenic exposure, secreted matrix metalloproteinase-2 (MMP2) activity increased to over 200% of control, levels linked to arsenic-induced cancer phenotypes in other cell lines. The invasive capacity of these chronic arsenic-treated lung epithelial (CATLE) cells increased to 320% of control and colony formation increased to 280% of control. CATLE cells showed enhanced proliferation in serum-free media indicative of autonomous growth. Compared to control cells, CATLE cells showed reduced protein expression of the tumor suppressor gene PTEN (decreased to 26% of control) and the putative tumor suppressor gene SLC38A3 (14% of control). Morphological evidence of epithelial-to-mesenchymal transition (EMT) occurred in CATLE cells together with appropriate changes in expression of the EMT markers vimentin (VIM; increased to 300% of control) and e-cadherin (CDH1; decreased to 16% of control). EMT is common in carcinogenic transformation of epithelial cells. CATLE cells showed increased KRAS (291%), ERK1/2 (274%), phosphorylated ERK (p-ERK; 152%), and phosphorylated AKT1 (p-AKT1; 170%) protein expression. Increased transcript expression of metallothioneins, MT1A and MT2A and the stress response genes HMOX1 (690%) and HIF1A (247%) occurred in CATLE cells possibly in adaptation to chronic arsenic exposure. Thus, arsenic induced multiple cancer cell characteristics in human peripheral lung epithelial cells. This model may be useful to assess mechanisms of arsenic-induced lung cancer. - Highlights: • Chronic arsenic exposure transforms a human peripheral lung epithelia cell line. • Cells acquire characteristics in common with human lung adenocarcinoma cells. • These transformed cells provide a
Inhibition of human carboxylesterases hCE1 and hiCE by cholinesterase inhibitors.
Tsurkan, Lyudmila G; Hatfield, M Jason; Edwards, Carol C; Hyatt, Janice L; Potter, Philip M
2013-03-25
Carboxylesterases (CEs) are ubiquitously expressed proteins that are responsible for the detoxification of xenobiotics. They tend to be expressed in tissues likely to be exposed to such agents (e.g., lung and gut epithelia, liver) and can hydrolyze numerous agents, including many clinically used drugs. Due to the considerable structural similarity between cholinesterases (ChE) and CEs, we have assessed the ability of a series of ChE inhibitors to modulate the activity of the human liver (hCE1) and the human intestinal CE (hiCE) isoforms. We observed inhibition of hCE1 and hiCE by carbamate-containing small molecules, including those used for the treatment of Alzheimer's disease. For example, rivastigmine resulted in greater than 95% inhibition of hiCE that was irreversible under the conditions used. Hence, the administration of esterified drugs, in combination with these carbamates, may inadvertently result in decreased hydrolysis of the former, thereby limiting their efficacy. Therefore drug:drug interactions should be carefully evaluated in individuals receiving ChE inhibitors. Copyright © 2012 Elsevier Ireland Ltd. All rights reserved.
Energy Technology Data Exchange (ETDEWEB)
Kim, In Gyu, E-mail: igkim@kaeri.re.kr [Department of Radiation Biology, Environmental Radiation Research Group, Korea Atomic Energy Research Institute, P.O. Box 105, Yuseong, Daejeon 305-600 (Korea, Republic of); Department of Radiation Biotechnology and Applied Radioisotope, University of Science and Technology (UST), 989-111 Daedeok-daero, Yuseong-gu, Daejeon 305-353 (Korea, Republic of); Kim, Seo Yoen [Department of Radiation Biology, Environmental Radiation Research Group, Korea Atomic Energy Research Institute, P.O. Box 105, Yuseong, Daejeon 305-600 (Korea, Republic of); Biomedical Translational Research Center, Korea Research Institute of Bioscience and Biotechnology, 125 Gwahak-ro, Yuseong-gu, Daejeon 305-806 (Korea, Republic of); Kim, Hyun A; Kim, Jeong Yul [Department of Radiation Biology, Environmental Radiation Research Group, Korea Atomic Energy Research Institute, P.O. Box 105, Yuseong, Daejeon 305-600 (Korea, Republic of); Lee, Jae Ha; Choi, Soo Im [Department of Radiation Biology, Environmental Radiation Research Group, Korea Atomic Energy Research Institute, P.O. Box 105, Yuseong, Daejeon 305-600 (Korea, Republic of); Department of Radiation Biotechnology and Applied Radioisotope, University of Science and Technology (UST), 989-111 Daedeok-daero, Yuseong-gu, Daejeon 305-353 (Korea, Republic of); Han, Jeong Ran; Kim, Kug Chan [Department of Radiation Biology, Environmental Radiation Research Group, Korea Atomic Energy Research Institute, P.O. Box 105, Yuseong, Daejeon 305-600 (Korea, Republic of); Cho, Eun Wie [Biomedical Translational Research Center, Korea Research Institute of Bioscience and Biotechnology, 125 Gwahak-ro, Yuseong-gu, Daejeon 305-806 (Korea, Republic of)
2014-01-03
Highlights: •DKK1 was expressed differently among non-small-cell lung cancer cell lines. •DKK1 negatively regulated ROMO1 gene expression. •Disturbance of DKK1 level induced the imbalance of cellular ROS. •DKK1/ROMO1-induced ROS imbalance is involved in cell survival in NSCLC. -- Abstract: Dickkopf1 (DKK1), a secreted protein involved in embryonic development, is a potent inhibitor of the Wnt signaling pathway and has been postulated to be a tumor suppressor or tumor promoter depending on the tumor type. In this study, we showed that DKK1 was expressed differently among non-small-cell lung cancer cell lines. The DKK1 expression level was much higher in A549 cells than in H460 cells. We revealed that blockage of DKK1 expression by silencing RNA in A549 cells caused up-regulation of intracellular reactive oxygen species (ROS) modulator (ROMO1) protein, followed by partial cell death, cell growth inhibition, and loss of epithelial–mesenchymal transition property caused by ROS, and it also increased γ-radiation sensitivity. DKK1 overexpression in H460 significantly inhibited cell survival with the decrease of ROMO1 level, which induced the decrease of cellular ROS. Thereafter, exogenous N-acetylcysteine, an antioxidant, or hydrogen peroxide, a pro-oxidant, partially rescued cells from death and growth inhibition. In each cell line, both overexpression and blockage of DKK1 not only elevated p-RB activation, which led to cell growth arrest, but also inactivated AKT/NF-kB, which increased radiation sensitivity and inhibited cell growth. This study is the first to demonstrate that strict modulation of DKK1 expression in different cell types partially maintains cell survival via tight regulation of the ROS-producing ROMO1 and radiation resistance.
International Nuclear Information System (INIS)
Kim, In Gyu; Kim, Seo Yoen; Kim, Hyun A; Kim, Jeong Yul; Lee, Jae Ha; Choi, Soo Im; Han, Jeong Ran; Kim, Kug Chan; Cho, Eun Wie
2014-01-01
Highlights: •DKK1 was expressed differently among non-small-cell lung cancer cell lines. •DKK1 negatively regulated ROMO1 gene expression. •Disturbance of DKK1 level induced the imbalance of cellular ROS. •DKK1/ROMO1-induced ROS imbalance is involved in cell survival in NSCLC. -- Abstract: Dickkopf1 (DKK1), a secreted protein involved in embryonic development, is a potent inhibitor of the Wnt signaling pathway and has been postulated to be a tumor suppressor or tumor promoter depending on the tumor type. In this study, we showed that DKK1 was expressed differently among non-small-cell lung cancer cell lines. The DKK1 expression level was much higher in A549 cells than in H460 cells. We revealed that blockage of DKK1 expression by silencing RNA in A549 cells caused up-regulation of intracellular reactive oxygen species (ROS) modulator (ROMO1) protein, followed by partial cell death, cell growth inhibition, and loss of epithelial–mesenchymal transition property caused by ROS, and it also increased γ-radiation sensitivity. DKK1 overexpression in H460 significantly inhibited cell survival with the decrease of ROMO1 level, which induced the decrease of cellular ROS. Thereafter, exogenous N-acetylcysteine, an antioxidant, or hydrogen peroxide, a pro-oxidant, partially rescued cells from death and growth inhibition. In each cell line, both overexpression and blockage of DKK1 not only elevated p-RB activation, which led to cell growth arrest, but also inactivated AKT/NF-kB, which increased radiation sensitivity and inhibited cell growth. This study is the first to demonstrate that strict modulation of DKK1 expression in different cell types partially maintains cell survival via tight regulation of the ROS-producing ROMO1 and radiation resistance
Detection of EGFR mutations with mutation-specific antibodies in stage IV non-small-cell lung cancer
Directory of Open Access Journals (Sweden)
Viteri Santiago
2010-12-01
Full Text Available Abstract Background Immunohistochemistry (IHC with mutation-specific antibodies may be an ancillary method of detecting EGFR mutations in lung cancer patients. Methods EGFR mutation status was analyzed by DNA assays, and compared with IHC results in five non-small-cell lung cancer (NSCLC cell lines and tumor samples from 78 stage IV NSCLC patients. Results IHC correctly identified del 19 in the H1650 and PC9 cell lines, L858R in H1975, and wild-type EGFR in H460 and A549, as well as wild-type EGFR in tumor samples from 22 patients. IHC with the mAb against EGFR with del 19 was highly positive for the protein in all 17 patients with a 15-bp (ELREA deletion in exon 19, whereas in patients with other deletions, IHC was weakly positive in 3 cases and negative in 9 cases. IHC with the mAb against the L858R mutation showed high positivity for the protein in 25/27 (93% patients with exon 21 EGFR mutations (all with L858R but did not identify the L861Q mutation in the remaining two patients. Conclusions IHC with mutation-specific mAbs against EGFR is a promising method for detecting EGFR mutations in NSCLC patients. However these mAbs should be validated with additional studies to clarify their possible role in routine clinical practice for screening EGFR mutations in NSCLC patients.
Yanagihara, K; Cheng, H; Cheng, P W
2000-01-01
Poor transfection efficiency is the major drawback of lipofection. We showed previously that addition of transferrin (TF) to Lipofectin enhanced the expression of a reporter gene in HeLa cells by 120-fold and achieved close to 100% transfection efficiency. The purpose of this study was to determine whether TF and other ligands could improve the efficiency of lipofection in lung carcinoma cells. Confluent A549, Calu3, and H292 cells were transfected for 18 hours with a plasmid DNA (pCMVlacZ) using Lipofectin plus TF, insulin, or epidermal growth factor as the vector. The transfected cells were assessed for transfection efficiency by beta-galactosidase activity (light units/microg protein) and the percentage of blue cells following 5-bromo-4-chloro-3-indolyl beta-D-galactopyranoside staining. Lipofectin supplemented with epidermal growth factor yielded the largest enhancement of lipofection efficiency (lipofection efficiency in A549 and Calu3 cells but not in H292 cells, whereas TF showed significant lipofection efficiency-enhancing effect in Calu3 and H292 cells but not in A549 cells. The transfection efficiency correlated well with the amounts of DNA delivered to the nucleus as well as the amounts of the receptor. These results indicate that the gene delivery strategy employing ligand-facilitated lipofection can achieve high transfection efficiency in human lung carcinoma cells. In addition, enhancement of the expression of the receptor may be a possible strategy for increasing the efficiency of gene targeting.
High NOTCH activity induces radiation resistance in non small cell lung cancer
International Nuclear Information System (INIS)
Theys, Jan; Yahyanejad, Sanaz; Habets, Roger; Span, Paul; Dubois, Ludwig; Paesmans, Kim; Kattenbeld, Bo; Cleutjens, Jack; Groot, Arjan J.; Schuurbiers, Olga C.J.; Lambin, Philippe; Bussink, Jan; Vooijs, Marc
2013-01-01
Background and purpose: Patients with advanced NSCLC have survival rates <15%. The NOTCH pathway plays an important role during lung development and physiology but is often deregulated in lung cancer, making it a potential therapeutic target. We investigated NOTCH signaling in NSCLC and hypothesized that high NOTCH activity contributes to radiation resistance. Materials and methods: NOTCH signaling in NSCLC patient samples was investigated using quantitative RT-PCR. H460 NSCLC cells with either high or blocked NOTCH activity were generated and their radiation sensitivity monitored using clonogenic assays. In vivo, xenograft tumors were irradiated and response assessed using growth delay. Microenvironmental parameters were analyzed by immunohistochemistry. Results: Patients with high NOTCH activity in tumors showed significantly worse disease-free survival. In vitro, NOTCH activity did not affect the proliferation or intrinsic radiosensitivity of NSCLC cells. In contrast, xenografts with blocked NOTCH activity grew slower than wild type tumors. Tumors with high NOTCH activity grew significantly faster, were more hypoxic and showed a radioresistant phenotype. Conclusions: We demonstrate an important role for NOTCH in tumor growth and correlate high NOTCH activity with poor prognosis and radioresistance. Blocking NOTCH activity in NSCLC might be a promising intervention to improve outcome after radiotherapy
Intersections of lung progenitor cells, lung disease and lung cancer.
Kim, Carla F
2017-06-30
The use of stem cell biology approaches to study adult lung progenitor cells and lung cancer has brought a variety of new techniques to the field of lung biology and has elucidated new pathways that may be therapeutic targets in lung cancer. Recent results have begun to identify the ways in which different cell populations interact to regulate progenitor activity, and this has implications for the interventions that are possible in cancer and in a variety of lung diseases. Today's better understanding of the mechanisms that regulate lung progenitor cell self-renewal and differentiation, including understanding how multiple epigenetic factors affect lung injury repair, holds the promise for future better treatments for lung cancer and for optimising the response to therapy in lung cancer. Working between platforms in sophisticated organoid culture techniques, genetically engineered mouse models of injury and cancer, and human cell lines and specimens, lung progenitor cell studies can begin with basic biology, progress to translational research and finally lead to the beginnings of clinical trials. Copyright ©ERS 2017.
Intersections of lung progenitor cells, lung disease and lung cancer
Directory of Open Access Journals (Sweden)
Carla F. Kim
2017-06-01
Full Text Available The use of stem cell biology approaches to study adult lung progenitor cells and lung cancer has brought a variety of new techniques to the field of lung biology and has elucidated new pathways that may be therapeutic targets in lung cancer. Recent results have begun to identify the ways in which different cell populations interact to regulate progenitor activity, and this has implications for the interventions that are possible in cancer and in a variety of lung diseases. Today's better understanding of the mechanisms that regulate lung progenitor cell self-renewal and differentiation, including understanding how multiple epigenetic factors affect lung injury repair, holds the promise for future better treatments for lung cancer and for optimising the response to therapy in lung cancer. Working between platforms in sophisticated organoid culture techniques, genetically engineered mouse models of injury and cancer, and human cell lines and specimens, lung progenitor cell studies can begin with basic biology, progress to translational research and finally lead to the beginnings of clinical trials.
International Nuclear Information System (INIS)
McClay, Joseph L.; Adkins, Daniel E.; Isern, Nancy G.; O'Connell, Thomas M.; Wooten, Jan B.; Zedler, Barbara K.; Dasika, Madhukar S.; Webb, B.T.; Webb-Robertson, Bobbie-Jo M.; Pounds, Joel G.; Murrelle, Edward L.; Leppert, Mark F.; van den Oord, Edwin J.
2010-01-01
Chronic obstructive pulmonary disease (COPD), characterized by chronic airflow limitation, is a serious and growing public health concern. The major environmental risk factor for COPD is tobacco smoking, but the biological mechanisms underlying COPD are not well understood. In this study, we used proton nuclear magnetic resonance (1H-NMR) spectroscopy to identify and quantify metabolites associated with lung function in COPD. Plasma and urine were collected from 197 adults with COPD and from 195 adults without COPD. Samples were assayed using a 600 MHz NMR spectrometer, and the resulting spectra were analyzed against quantitative spirometric measures of lung function. After correcting for false discoveries and adjusting for covariates (sex, age, smoking) several spectral regions in urine were found to be significantly associated with baseline lung function. These regions correspond to the metabolites trigonelline, hippurate and formate. Concentrations of each metabolite, standardized to urinary creatinine, were associated with baseline lung function (minimum p-value = 0.0002 for trigonelline). No significant associations were found with plasma metabolites. Two of the three urinary metabolites positively associated with baseline lung function, i.e. hippurate and formate, are often related to gut microflora. This suggests that the microbiome composition is variable between individuals with different lung function. Alternatively, the nature and origins of all three associated metabolites may reflect lifestyle differences affecting overall health. Our results will require replication and validation, but demonstrate the utility of NMR metabolomics as a screening tool for identifying novel biomarkers of lung disease or disease risk.
Evaluation of concentrations of major and trace elements in human lung using INAA and PIXE
International Nuclear Information System (INIS)
Altaf, W.J.; Spyrou, N.M.
1997-01-01
The elemental concentrations of Br, Ca, Ce, Cl, Co, Cr, Cs, F, Fe, Hf, K, Mg, Mn, Na, O, Rb, Sb, Sc, Se, V and Zn in 15 human lung autopsy samples, taken from subjects aged more than fifty years old, were determined by instrumental neutron activation analysis (INAA) using reactor neutrons in conjunction with a high resolution detection system. Two modes of irradiation and counting were applied; namely cyclic neutron activation analysis (CNAA) and conventional neutron activation analysis. Proton induced X-ray emission (PIXE) analysis, using a proton beam emerging from a 2 MV Van de Graaff accelerator, was additionally employed and Ge, Ni, P and Ti were also identified in the lung tissue. Detection of the X-ray spectra was performed using a high resolution Si(Li) semiconductor. The relevance of these results, including a comparison between the concentrations of elements measured in a pig's lung using CNAA and those found in the human lung is discussed. (author)
Comparative microscopic study of human and rat lungs after overexposure to welding fume.
Antonini, James M; Roberts, Jenny R; Schwegler-Berry, Diane; Mercer, Robert R
2013-11-01
particles were metal complexes with iron, chromium, and nickel being the most common metals present. In conclusion, long-term exposure to specific welding fume can lead to serious chronic lung disease characterized by significant particle deposition and persistence as demonstrated in both a human case study and rat model. Not only were the lung responses similar in the human and rat lungs, as evidenced by inflammatory cell influx and pulmonary disease, but the composition of individual welding particles and agglomerations in situ was comparable.
Pereira, Joana M; Peixoto, Vanessa; Teixeira, Alexandra; Sousa, Diana; Barros, Lillian; Ferreira, Isabel C F R; Vasconcelos, M Helena
2018-06-05
The cell growth inhibitory activity of the hydroethanolic extract of Achillea millefolium was studied in human tumor cell lines (NCI-H460 and HCT-15) and its mechanism of action was investigated. The GI 50 concentration was determined with the sulforhodamine B assay and cell cycle and apoptosis were analyzed by flow cytometry following incubation with PI or Annexin V FITC/PI, respectively. The expression levels of proteins involved in cell cycle and apoptosis were analyzed by Western blot. The extracts were characterized regarding their phenolic composition by LC-DAD-ESI/MS. 3,5-O-Dicaffeoylquinic acid, followed by 5-O-caffeoylquinic acid, were the main phenolic acids, while, luteolin-O-acetylhexoside and apigenin-O-acetylhexoside were the main flavonoids. This extract decreased the growth of the tested cell lines, being more potent in HCT-15 and then in NCI-H460 cells. Two different concentrations of the extract (75 and 100 μg/mL) caused alterations in cell cycle profile and increased apoptosis levels in HCT-15 and NCI-H460 cells. Moreover, the extract caused an increase in p53 and p21 expression in NCI-H460 cells (which have wt p53), and reduced XIAP levels in HCT-15 cells (with mutant p53). This work enhances the importance of A. millefolium as source of bioactive phenolic compounds, particularly of XIAP inhibitors. Copyright © 2018 Elsevier Ltd. All rights reserved.
Yang, Ji-Rong; Chen, Chih-Yuan; Kuo, Chuan-Yi; Cheng, Chieh-Yu; Lee, Min-Shiuh; Cheng, Ming-Chu; Yang, Yu-Chih; Wu, Chia-Ying; Wu, Ho-Sheng; Liu, Ming-Tsan; Hsiao, Pei-Wen
2016-02-01
Avian influenza A(H6N1) virus is one of the most common viruses isolated from migrating birds and domestic poultry in many countries. The first and only known case of human infection by H6N1 virus in the world was reported in Taiwan in 2013. This led to concern that H6N1 virus may cause a threat to public health. In this study, we engineered a recombinant H6N1 virus-like particle (VLP) and investigated its vaccine effectiveness compared to the traditional egg-based whole inactivated virus (WIV) vaccine. The H6N1-VLPs exhibited similar morphology and functional characteristics to influenza viruses. Prime-boost intramuscular immunization in mice with unadjuvanted H6N1-VLPs were highly immunogenic and induced long-lasting antibody immunity. The functional activity of the VLP-elicited IgG antibodies was proved by in vitro seroprotective hemagglutination inhibition and microneutralization titers against the homologous human H6N1 virus, as well as in vivo viral challenge analyses which showed H6N1-VLP immunization significantly reduced viral load in the lung, and protected against human H6N1 virus infection. Of particular note, the H6N1-VLPs but not the H6N1-WIVs were able to confer cross-reactive humoral immunity; antibodies induced by H6N1-VLP vaccine robustly inhibited the hemagglutination activities and in vitro replication of distantly-related heterologous avian H6N1 viruses. Furthermore, the H6N1-VLPs were found to elicit significantly greater anti-HA2 antibody responses in immunized mice than H6N1-WIVs. Collectively, we demonstrated for the first time a novel H6N1-VLP vaccine that effectively provides broadly protective immunity against both human and avian H6N1 viruses. These results, which uncover the underlying mechanisms for induction of wide-range immunity against influenza viruses, may be useful for future influenza vaccine development. Copyright © 2015 Elsevier B.V. All rights reserved.
Nicotine transport in lung and non-lung epithelial cells.
Takano, Mikihisa; Kamei, Hidetaka; Nagahiro, Machi; Kawami, Masashi; Yumoto, Ryoko
2017-11-01
Nicotine is rapidly absorbed from the lung alveoli into systemic circulation during cigarette smoking. However, mechanism underlying nicotine transport in alveolar epithelial cells is not well understood to date. In the present study, we characterized nicotine uptake in lung epithelial cell lines A549 and NCI-H441 and in non-lung epithelial cell lines HepG2 and MCF-7. Characteristics of [ 3 H]nicotine uptake was studied using these cell lines. Nicotine uptake in A549 cells occurred in a time- and temperature-dependent manner and showed saturation kinetics, with a Km value of 0.31mM. Treatment with some organic cations such as diphenhydramine and pyrilamine inhibited nicotine uptake, whereas treatment with organic cations such as carnitine and tetraethylammonium did not affect nicotine uptake. Extracellular pH markedly affected nicotine uptake, with high nicotine uptake being observed at high pH up to 11.0. Modulation of intracellular pH with ammonium chloride also affected nicotine uptake. Treatment with valinomycin, a potassium ionophore, did not significantly affect nicotine uptake, indicating that nicotine uptake is an electroneutral process. For comparison, we assessed the characteristics of nicotine uptake in another lung epithelial cell line NCI-H441 and in non-lung epithelial cell lines HepG2 and MCF-7. Interestingly, these cell lines showed similar characteristics of nicotine uptake with respect to pH dependency and inhibition by various organic cations. The present findings suggest that a similar or the same pH-dependent transport system is involved in nicotine uptake in these cell lines. A novel molecular mechanism of nicotine transport is proposed. Copyright © 2017 Elsevier Inc. All rights reserved.
2013-12-16
... DEPARTMENT OF TRANSPORTATION Federal Highway Administration Supplemental Environmental Impact Statement for the Route 460 Location Study, Prince George County to Suffolk, Virginia AGENCY: Federal... roughly parallel to the existing Route 460 corridor between Interstate 295 in Prince George County and...
Ramer, Robert; Fischer, Sascha; Haustein, Maria; Manda, Katrin; Hinz, Burkhard
2014-09-15
Cannabinoids inhibit tumor neovascularization as part of their tumorregressive action. However, the underlying mechanism is still under debate. In the present study the impact of cannabinoids on potential tumor-to-endothelial cell communication conferring anti-angiogenesis was studied. Cellular behavior of human umbilical vein endothelial cells (HUVEC) associated with angiogenesis was evaluated by Boyden chamber, two-dimensional tube formation and fibrin bead assay, with the latter assessing three-dimensional sprout formation. Viability was quantified by the WST-1 test. Conditioned media (CM) from A549 lung cancer cells treated with cannabidiol, Δ(9)-tetrahydrocannabinol, R(+)-methanandamide or the CB2 agonist JWH-133 elicited decreased migration as well as tube and sprout formation of HUVEC as compared to CM of vehicle-treated cancer cells. Inhibition of sprout formation was further confirmed for cannabinoid-treated A549 cells co-cultured with HUVEC. Using antagonists to cannabinoid-activated receptors the antimigratory action was shown to be mediated via cannabinoid receptors or transient receptor potential vanilloid 1. SiRNA approaches revealed a cannabinoid-induced expression of tissue inhibitor of matrix metalloproteinases-1 (TIMP-1) as well as its upstream trigger, the intercellular adhesion molecule-1, to be causally linked to the observed decrease of HUVEC migration. Comparable anti-angiogenic effects were not detected following direct exposure of HUVEC to cannabinoids, but occurred after addition of recombinant TIMP-1 to HUVEC. Finally, antimigratory effects were confirmed for CM of two other cannabinoid-treated lung cancer cell lines (H460 and H358). Collectively, our data suggest a pivotal role of the anti-angiogenic factor TIMP-1 in intercellular tumor-endothelial cell communication resulting in anti-angiogenic features of endothelial cells. Copyright © 2014 Elsevier Inc. All rights reserved.
2010-07-01
... medical shelf-life items held for national emergency purposes? 102-36.460 Section 102-36.460 Public... Disposal Requires Special Handling Shelf-Life Items § 102-36.460 Do we report excess medical shelf-life items held for national emergency purposes? When the remaining shelf life of any medical materials or...
Directory of Open Access Journals (Sweden)
Lee Chun
2006-05-01
Full Text Available Abstract Background Human β-defensin (hBD-2, antimicrobial peptide primarily induced in epithelial cells, is a key factor in the innate immune response of the respiratory tract. Several studies showed increased defensin levels in both inflammatory lung diseases, such as cystic fibrosis, diffuse panbronchiolitis, idiopathic pulmonary fibrosis and acute respiratory distress syndrome, and infectious diseases. Recently, epidemiologic studies have demonstrated acute and serious adverse effects of particulate air pollution on respiratory health, especially in people with pre-existing inflammatory lung disease. To elucidate the effect of diesel exhaust particles (DEP on pulmonary innate immune response, we investigated the hBD-2 and interleukin-8 (IL-8 expression to DEP exposure in interleukin-1 beta (IL-1β-stimulated A549 cells. Results IL-1β markedly up-regulated the hBD-2 promoter activity, and the subsequent DEP exposure increased dose-dependently the expression of hBD-2 and inflammatory cytokine IL-8 at the transcriptional level. In addition, DEP further induced the NF-κB activation in IL-1β-stimulated A549 cells more rapidly than in unstimulated control cells, which was showed by nuclear translocation of p65 NF-κB and degradation of IκB-α. The experiment using two NF-κB inhibitors, PDTC and MG132, confirmed that this increase of hBD-2 expression following DEP exposure was regulated through NF-κB-mediated pathway. Conclusion These results demonstrated that DEP exposure increases the expression of antimicrobial peptide and inflammatory cytokine at the transcriptional level in IL-1β-primed A549 epithelial cells and suggested that the increase is mediated at least partially through NF-κB activation. Therefore, DEP exposure may contribute to enhance the airway-responsiveness especially on the patients suffering from chronic respiratory disease.
Chemoprevention of Lung Cancer: Prospects and Disappointments in Human Clinical Trials
Directory of Open Access Journals (Sweden)
William N. Rom
2013-01-01
Full Text Available Decreasing the risk of lung cancer, or preventing its development in high-risk individuals, would have a huge impact on public health. The most effective means to decrease lung cancer incidence is to eliminate exposure to carcinogens. However, with recent advances in the understanding of pulmonary carcinogenesis and the identification of intermediate biomarkers, the prospects for the field of chemoprevention research have improved dramatically. Here we review the most recent research in lung cancer chemoprevention—focusing on those agents that have been investigated in human clinical trials. These agents fall into three major categories. First, oxidative stress plays an important role in pulmonary carcinogenesis; and therefore, antioxidants (including vitamins, selenium, green tea extracts, and isothiocyanates may be particularly effective in preventing the development of lung cancer. Second, inflammation is increasingly accepted as a crucial factor in carcinogenesis, and many investigators have focused on anti-inflammatory agents, such as glucocorticoids, NSAIDs, statins, and PPARγ agonists. Finally, the PI3K/AKT/mTOR pathway is recognized to play a central role in tobacco-induced carcinogenesis, and inhibitors of this pathway, including myoinositol and metformin, are promising agents for lung cancer prevention. Successful chemoprevention will likely require targeting of multiple pathways to carcinogenesis—both to minimize toxicity and maximize efficacy.
Xia, Rongmu; Xu, Gang; Huang, Yue; Sheng, Xin; Xu, Xianlin; Lu, Hongling
2018-05-15
The present study aimed to investigate the ability of hesperidin to suppress the migration and invasion of A549 cells, and to investigate the role of the SDF-1/CXCR-4 cascade in this suppression. We performed a Transwell migration assay to measure the migratory capability of A549 cells treated with 0.5% DMSO, SDF-1α, AMD3100 or hesperidin. The SDF-1 level in the culture medium was determined by an enzyme-linked immunosorbent assay (ELISA) to detect whether different concentrations of hesperidin affected SDF-1 secretion. A wound-healing assay was performed to determine the effects of different concentrations of hesperidin on the migration inhibition of A549, H460 and H1975 cells. Additionally, the effect of various hesperidin concentrations on the rate of A549 cell invasion and migration was examined with and without Matrigel in Transwell assays, respectively. Western blot analysis was used to evaluate the protein levels of CXCR-4, MMP-9, CK-19, Vimentin, p65, p-p65, p-IκB, IκB, p-Akt and Akt. RT-qPCR was used to detect the mRNA levels of CXCR-4, MMP-9, CK-19, Vimentin, p65, IκB, SDF-1 and Akt. The Transwell migration assay indicated that SDF-1α promoted A549 cell migration, while AMD3100 and hesperidin significantly inhibited the migratory capability. The wound-healing assay demonstrated that hesperidin treatment significantly reduced the rate of wound closure compared with the control group in a dose-dependent manner. Similarly, the migration and invasive abilities of A549 cells, H460 and H1975 cells treated with hesperidin were significantly decreased compared with the control group. The ELISA data suggested that hesperidin attenuated the secretion of SDF-1 from A549 cells in a dose-dependent manner. Furthermore, western blot analysis indicated that SDF-1α treatment significantly increased the levels of CXCR-4, p-p65, p-IκB and p-Akt in A549 cells. In contrast, AMD3100 or hesperidin reversed the effect induced by SDF-1α through decreasing the expression
Pusterla, Orso; Bauman, Grzegorz; Wielpütz, Mark O; Nyilas, Sylvia; Latzin, Philipp; Heussel, Claus P; Bieri, Oliver
2017-09-01
To introduce a reproducible, nonenhanced 1H MRI method for rapid in vivo functional assessment of the whole lung at 1.5 Tesla (T). At different respiratory volumes, the pulmonary signal of ultra-fast steady-state free precession (ufSSFP) follows an adapted sponge model, characterized by a respiratory index α. From the model, α reflects local ventilation-related information, is virtually independent from the lung density and thus from the inspiratory phase and breathing amplitude. Respiratory α-mapping is evaluated for healthy volunteers and patients with obstructive lung disease from a set of five consecutive 3D ultra-fast steady-state free precession (ufSSFP) scans performed in breath-hold and at different inspiratory volumes. For the patients, α-maps were compared with CT, dynamic contrast-enhanced MRI (DCE-MRI), and Fourier decomposition (FD). In healthy volunteers, respiratory α-maps showed good reproducibility and were homogeneous on iso-gravitational planes, but showed a gravity-dependent respiratory gradient. In patients with obstructive pulmonary disease, the functional impairment observed in respiratory α-maps was associated with emphysematous regions present on CT images, perfusion defects observable on DCE-MRI, and impairments visualized on FD ventilation and perfusion maps. Respiratory α-mapping derived from multivolumetric ufSSFP provides insights into functional lung impairment and may serve as a reproducible and normative measure for clinical studies. Magn Reson Med 78:1059-1069, 2017. © 2016 International Society for Magnetic Resonance in Medicine. © 2016 International Society for Magnetic Resonance in Medicine.
Directory of Open Access Journals (Sweden)
Hong Young Jun
Full Text Available This study was designed to identify potential radiosensitizing (RS agents for combined radio- and chemotherapy in a murine model of human lung carcinoma, and to evaluate the in vivo effect of the RS agents using diffusion-weighted magnetic resonance imaging (DW-MRI. Radioresistance-associated genes in A549 and H460 cells were isolated on the basis of their gene expression profiles. Celastrol was selected as a candidate RS by using connectivity mapping, and its efficacy in lung cancer radiotherapy was tested. Mice inoculated with A549 carcinoma cells were treated with single ionizing radiation (SIR, single celastrol (SC, or celastrol-combined ionizing radiation (CCIR. Changes in radiosensitization over time were assessed using DW-MRI before and at 3, 6, and 12 days after therapy initiation. The tumors were stained with hematoxylin and eosin at 6 and 12 days after therapy. The percentage change in the apparent diffusion coefficient (ADC value in the CCIR group was significantly higher than that in the SC and SIR group on the 12th day (Mann-Whitney U-test, p = 0.05; Kruskal-Wallis test, p < 0.05. A significant correlation (Spearman's rho correlation coefficient of 0.713, p = 0.001 was observed between the mean percentage tumor necrotic area and the mean ADC values after therapy initiation. These results suggest that the novel radiosensitizing agent celastrol has therapeutic effects when combined with ionizing radiation (IR, thereby maximizing the therapeutic effect of radiation in non-small cell lung carcinoma. In addition, DW-MRI is a useful noninvasive tool to monitor the effects of RS agents by assessing cellularity changes and sequential therapeutic responses.
Schwaiberger, David; Pickerodt, Philipp A; Pomprapa, Anake; Tjarks, Onno; Kork, Felix; Boemke, Willehad; Francis, Roland C E; Leonhardt, Steffen; Lachmann, Burkhard
2018-06-01
Adherence to low tidal volume (V T ) ventilation and selected positive end-expiratory pressures are low during mechanical ventilation for treatment of the acute respiratory distress syndrome. Using a pig model of severe lung injury, we tested the feasibility and physiological responses to a novel fully closed-loop mechanical ventilation algorithm based on the "open lung" concept. Lung injury was induced by surfactant washout in pigs (n = 8). Animals were ventilated following the principles of the "open lung approach" (OLA) using a fully closed-loop physiological feedback algorithm for mechanical ventilation. Standard gas exchange, respiratory- and hemodynamic parameters were measured. Electrical impedance tomography was used to quantify regional ventilation distribution during mechanical ventilation. Automatized mechanical ventilation provided strict adherence to low V T -ventilation for 6 h in severely lung injured pigs. Using the "open lung" approach, tidal volume delivery required low lung distending pressures, increased recruitment and ventilation of dorsal lung regions and improved arterial blood oxygenation. Physiological feedback closed-loop mechanical ventilation according to the principles of the open lung concept is feasible and provides low tidal volume ventilation without human intervention. Of importance, the "open lung approach"-ventilation improved gas exchange and reduced lung driving pressures by opening atelectasis and shifting of ventilation to dorsal lung regions.
Goodwin, T. J.; McCarthy, M.; Albrecht, T.; Cohrs, R.
2009-01-01
The old adage we are our own worst enemies may perhaps be the most profound statement ever made when applied to man s desire for extraterrestrial exploration and habitation of Space. Consider the immune system protects the integrity of the entire human physiology and is comprised of two basic elements the adaptive or circulating and the innate immune system. Failure of the components of the adaptive system leads to venerability of the innate system from opportunistic microbes; viral, bacteria, and fungal, which surround us, are transported on our skin, and commonly inhabit the human physiology as normal and imunosuppressed parasites. The fine balance which is maintained for the preponderance of our normal lives, save immune disorders and disease, is deregulated in microgravity. Thus analogue systems to study these potential Risks are essential for our progress in conquering Space exploration and habitation. In this study we employed two known physiological target tissues in which the reactivation of hCMV and VZV occurs, human neural and lung systems created for the study and interaction of these herpes viruses independently and simultaneously on the innate immune system. Normal human neural and lung tissue analogues called tissue like assemblies (TLAs) were infected with low MOIs of approximately 2 x 10(exp -5) pfu hCMV or VZV and established active but prolonged low grade infections which spanned .7-1.5 months in length. These infections were characterized by the ability to continuously produce each of the viruses without expiration of the host cultures. Verification and quantification of viral replication was confirmed via RT_PCR, IHC, and confocal spectral analyses of the respective essential viral genomes. All host TLAs maintained the ability to actively proliferate throughout the entire duration of the experiments as is analogous to normal in vivo physiological conditions. These data represent a significant advance in the ability to study the triggering
Nicotine prevents the apoptosis induced by menadione in human lung cancer cells
International Nuclear Information System (INIS)
Zhang Tao; Lu Heng; Shang Xuan; Tian Yihao; Zheng Congyi; Wang Shiwen; Cheng Hanhua; Zhou Rongjia
2006-01-01
Approximately 50% of long-term cigarette smokers die prematurely from the adverse effects of smoking, including on lung cancer and other illnesses. Nicotine is a main component in tobacco and has been implicated as a potential factor in the pathogenesis of human lung cancer. However, the mechanism of nicotine action in the development of lung cancer remains largely unknown. In the present study, we designed a nicotine-apoptosis system, by pre-treatment of nicotine making lung cancer cell A549 to be in a physiological nicotine environment, and observed that nicotine promoted cell proliferation and prevented the menadione-induced apoptosis, and exerts its role of anti-apoptosis by shift of apoptotic stage induced by menadione from late apoptotic stage to early apoptotic stage, in which NF-κB was up-regulated. Interference analysis of NF-κB in A549 cells showed that knock down of NF-κB resulted in apoptosis promotion and counteracted the protective effect of nicotine. The findings suggest that nicotine has potential effect in lung cancer genesis, especially in patients with undetectable early tumor development and development of specific NF-κB inhibitors would represent a potentially exciting new pharmacotherapy for tobacco-related lung cancer
Clark, Amelia M; Nogales, Aitor; Martinez-Sobrido, Luis; Topham, David J; DeDiego, Marta L
2017-09-01
In 2009, a novel H1N1 influenza virus emerged in humans, causing a global pandemic. It was previously shown that the NS1 protein from this human 2009 pandemic H1N1 (pH1N1) virus was an effective interferon (IFN) antagonist but could not inhibit general host gene expression, unlike other NS1 proteins from seasonal human H1N1 and H3N2 viruses. Here we show that the NS1 protein from currently circulating pH1N1 viruses has evolved to encode 6 amino acid changes (E55K, L90I, I123V, E125D, K131E, and N205S) with respect to the original protein. Notably, these 6 residue changes restore the ability of pH1N1 NS1 to inhibit general host gene expression, mainly by their ability to restore binding to the cellular factor CPSF30. This is the first report describing the ability of the pH1N1 NS1 protein to naturally acquire mutations that restore this function. Importantly, a recombinant pH1N1 virus containing these 6 amino acid changes in the NS1 protein (pH1N1/NSs-6mut) inhibited host IFN and proinflammatory responses to a greater extent than that with the parental virus (pH1N1/NS1-wt), yet virus titers were not significantly increased in cell cultures or in mouse lungs, and the disease was partially attenuated. The pH1N1/NSs-6mut virus grew similarly to pH1N1/NSs-wt in mouse lungs, but infection with pH1N1/NSs-6mut induced lower levels of proinflammatory cytokines, likely due to a general inhibition of gene expression mediated by the mutated NS1 protein. This lower level of inflammation induced by the pH1N1/NSs-6mut virus likely accounts for the attenuated disease phenotype and may represent a host-virus adaptation affecting influenza virus pathogenesis. IMPORTANCE Seasonal influenza A viruses (IAVs) are among the most common causes of respiratory infections in humans. In addition, occasional pandemics are caused when IAVs circulating in other species emerge in the human population. In 2009, a swine-origin H1N1 IAV (pH1N1) was transmitted to humans, infecting people then and up
International Nuclear Information System (INIS)
Yasuda, Shin; Yasuda, Tomoko; Liu, Ming-Yih; Shetty, Sreerama; Idell, Steven; Boggaram, Vijayakumar; Suiko, Masahito; Sakakibara, Yoichi; Fu Jian; Liu, Ming-Cheh
2011-01-01
During inflammation, potent reactive oxidants formed may cause chlorination and nitration of both free and protein-bound tyrosine. In addition to serving as biomarkers of inflammation-mediated oxidative stress, elevated levels of chlorotyrosine and nitrotyrosine have been linked to the pathogenesis of lung and vascular disorders. The current study was designed to investigate whether the lung cells are equipped with mechanisms for counteracting these tyrosine derivatives. By metabolic labeling, chlorotyrosine O-[ 35 S]sulfate and nitrotyrosine O-[ 35 S]sulfate were found to be generated and released into the labeling media of human lung endothelial and epithelial cells labeled with [ 35 S]sulfate in the presence of added chlorotyrosine and nitrotyrosine. Enzymatic assays using the eleven known human cytosolic sulfotransferases (SULTs) revealed SULT1A3 as the enzyme responsible for catalyzing the sulfation of chlorotyrosine and nitrotyrosine. Reverse transcription-polymerase chain reaction (RT-PCR) analysis demonstrated the expression of SULT1A3 in the lung endothelial and epithelial cells used in this study. Kinetic constants of the sulfation of chlorotyrosine and nitrotyrosine by SULT1A3 were determined. Collectively, these results suggest that sulfation by SULT1A3 in lung endothelial and epithelial cells may play a role in the inactivation and/or disposal of excess chlorotyrosine and nitrotyrosine generated during inflammation.
Directory of Open Access Journals (Sweden)
Hiroshi Kondo
2015-01-01
Full Text Available Stem cell therapy appears to be promising for restoring damaged or irreparable lung tissue. However, establishing a simple and reproducible protocol for preparing lung progenitor populations is difficult because the molecular basis for alveolar epithelial cell differentiation is not fully understood. We investigated an in vitro system to analyze the regulatory mechanisms of alveolus-specific gene expression using a human alveolar epithelial type II (ATII cell line, A549. After cloning A549 subpopulations, each clone was classified into five groups according to cell morphology and marker gene expression. Two clones (B7 and H12 were further analyzed. Under serum-free culture conditions, surfactant protein C (SPC, an ATII marker, was upregulated in both H12 and B7. Aquaporin 5 (AQP5, an ATI marker, was upregulated in H12 and significantly induced in B7. When the RAS/MAPK pathway was inhibited, SPC and thyroid transcription factor-1 (TTF-1 expression levels were enhanced. After treatment with dexamethasone (DEX, 8-bromoadenosine 3′5′-cyclic monophosphate (8-Br-cAMP, 3-isobutyl-1-methylxanthine (IBMX, and keratinocyte growth factor (KGF, surfactant protein B and TTF-1 expression levels were enhanced. We found that A549-derived clones have plasticity in gene expression of alveolar epithelial differentiation markers and could be useful in studying ATII maintenance and differentiation.
Del-1 overexpression potentiates lung cancer cell proliferation and invasion
Energy Technology Data Exchange (ETDEWEB)
Lee, Seung-Hwan; Kim, Dong-Young; Jing, Feifeng; Kim, Hyesoon [Department of Biomedical Sciences, University of Ulsan College of Medicine, Seoul (Korea, Republic of); Yun, Chae-Ok [Department of Bioengineering, College of Engineering, Hanyang University, Seoul (Korea, Republic of); Han, Deok-Jong [Department of Surgery, Asan Medical Center, University of Ulsan College of Medicine, Seoul (Korea, Republic of); Choi, Eun Young, E-mail: choieun@ulsan.ac.kr [Department of Biomedical Sciences, University of Ulsan College of Medicine, Seoul (Korea, Republic of)
2015-12-04
Developmental endothelial locus-1 (Del-1) is an endogenous anti-inflammatory molecule that is highly expressed in the lung and the brain and limits leukocyte migration to these tissues. We previously reported that the expression of Del-1 is positively regulated by p53 in lung endothelial cells. Although several reports have implicated the altered expression of Del-1 gene in cancer patients, little is known about its role in tumor cells. We here investigated the effect of Del-1 on the features of human lung carcinoma cells. Del-1 mRNA was found to be significantly decreased in the human lung adenocarcinoma cell lines A549 (containing wild type of p53), H1299 (null for p53) and EKVX (mutant p53), compared to in human normal lung epithelial BEAS-2B cells and MRC-5 fibroblasts. The decrease of Del-1 expression was dependent on the p53 activity in the cell lines, but not on the expression of p53. Neither treatment with recombinant human Del-1 protein nor the introduction of adenovirus expressing Del-1 altered the expression of the apoptosis regulators BAX, PUMA and Bcl-2. Unexpectedly, the adenovirus-mediated overexpression of Del-1 gene into the lung carcinoma cell lines promoted proliferation and invasion of the lung carcinoma cells, as revealed by BrdU incorporation and transwell invasion assays, respectively. In addition, overexpression of the Del-1 gene enhanced features of epithelial–mesenchymal transition (EMT), such as increasing vimentin while decreasing E-cadherin in A549 cells, and increases in the level of Slug, an EMT-associated transcription regulator. Our findings demonstrated for the first time that there are deleterious effects of high levels of Del-1 in lung carcinoma cells, and suggest that Del-1 may be used as a diagnostic or prognostic marker for cancer progression, and as a novel therapeutic target for lung carcinoma. - Highlights: • Developmental Endothelial Locus-1 (Del-1) expression is downregulated in human lung cancer cells.
Del-1 overexpression potentiates lung cancer cell proliferation and invasion
International Nuclear Information System (INIS)
Lee, Seung-Hwan; Kim, Dong-Young; Jing, Feifeng; Kim, Hyesoon; Yun, Chae-Ok; Han, Deok-Jong; Choi, Eun Young
2015-01-01
Developmental endothelial locus-1 (Del-1) is an endogenous anti-inflammatory molecule that is highly expressed in the lung and the brain and limits leukocyte migration to these tissues. We previously reported that the expression of Del-1 is positively regulated by p53 in lung endothelial cells. Although several reports have implicated the altered expression of Del-1 gene in cancer patients, little is known about its role in tumor cells. We here investigated the effect of Del-1 on the features of human lung carcinoma cells. Del-1 mRNA was found to be significantly decreased in the human lung adenocarcinoma cell lines A549 (containing wild type of p53), H1299 (null for p53) and EKVX (mutant p53), compared to in human normal lung epithelial BEAS-2B cells and MRC-5 fibroblasts. The decrease of Del-1 expression was dependent on the p53 activity in the cell lines, but not on the expression of p53. Neither treatment with recombinant human Del-1 protein nor the introduction of adenovirus expressing Del-1 altered the expression of the apoptosis regulators BAX, PUMA and Bcl-2. Unexpectedly, the adenovirus-mediated overexpression of Del-1 gene into the lung carcinoma cell lines promoted proliferation and invasion of the lung carcinoma cells, as revealed by BrdU incorporation and transwell invasion assays, respectively. In addition, overexpression of the Del-1 gene enhanced features of epithelial–mesenchymal transition (EMT), such as increasing vimentin while decreasing E-cadherin in A549 cells, and increases in the level of Slug, an EMT-associated transcription regulator. Our findings demonstrated for the first time that there are deleterious effects of high levels of Del-1 in lung carcinoma cells, and suggest that Del-1 may be used as a diagnostic or prognostic marker for cancer progression, and as a novel therapeutic target for lung carcinoma. - Highlights: • Developmental Endothelial Locus-1 (Del-1) expression is downregulated in human lung cancer cells.
Directory of Open Access Journals (Sweden)
G. P. Malinovsky
2017-01-01
Full Text Available The aim of the study: to analyze the risk of lung cancer caused by exposure to indoor radon using an environmental study, taking into account recent data on the possible effect of Human Papillomavirus, based on lung cancer mortality and radon exposure in the Russian regions.Materials and methods: in the analysis, linear dependencies of lung cancer against influencing factors were used. The average radon concentration for the regions of Russia was earlier reconstructed on the basis of the annual reports of the form 4-DOZ. Information on morbidity and mortality from malignant neoplasms in Russia was obtained from annual reports issued by the Р. Hertsen Moscow Oncology Research Institute. As a surrogate of the level of infection with Human Papillomavirus, the incidence of cervix cancer was used. The smoking prevalence was estimated applying data on the incidence of tongue cancer.Results: taking into account smoking and infection with Human Papillomavirus, it is possible to obtain estimates of lung cancer excess relative risk when induced by radon in dwellings consistent with the results of case-control studies.Conclusion: the analysis of regionally aggregated data on deaths from lung cancer in Russia, the average level of indoor radon concentrations and significant risk factors for lung cancer confirms the linear threshold-free concept of radiation-induced carcinogenesis.
33 CFR 157.460 - Additional operational requirements for tank barges.
2010-07-01
... OF HOMELAND SECURITY (CONTINUED) POLLUTION RULES FOR THE PROTECTION OF THE MARINE ENVIRONMENT... Hulls Carrying Petroleum Oils § 157.460 Additional operational requirements for tank barges. (a...
Bisig, Christoph; Roth, Michèle; Müller, Loretta; Comte, Pierre; Heeb, Norbert; Mayer, Andreas; Czerwinski, Jan; Petri-Fink, Alke; Rothen-Rutishauser, Barbara
2016-11-01
Ethanol can be produced from biomass and as such is renewable, unlike petroleum-based fuel. Almost all gasoline cars can drive with fuel containing 10% ethanol (E10), flex-fuel cars can even use 85% ethanol (E85). Brazil and the USA already include 10-27% ethanol in their standard fuel by law. Most health effect studies on car emissions are however performed with diesel exhausts, and only few data exists for other fuels. In this work we investigated possible toxic effects of exhaust aerosols from ethanol-gasoline blends using a multi-cellular model of the human lung. A flex-fuel passenger car was driven on a chassis dynamometer and fueled with E10, E85, or pure gasoline (E0). Exhausts obtained from a steady state cycle were directly applied for 6h at a dilution of 1:10 onto a multi-cellular human lung model mimicking the bronchial compartment composed of human bronchial cells (16HBE14o-), supplemented with human monocyte-derived dendritic cells and monocyte-derived macrophages, cultured at the air-liquid interface. Biological endpoints were assessed after 6h post incubation and included cytotoxicity, pro-inflammation, oxidative stress, and DNA damage. Filtered air was applied to control cells in parallel to the different exhausts; for comparison an exposure to diesel exhaust was also included in the study. No differences were measured for the volatile compounds, i.e. CO, NO x , and T.HC for the different ethanol supplemented exhausts. Average particle number were 6×10 2 #/cm 3 (E0), 1×10 5 #/cm 3 (E10), 3×10 3 #/cm 3 (E85), and 2.8×10 6 #/cm 3 (diesel). In ethanol-gasoline exposure conditions no cytotoxicity and no morphological changes were observed in the lung cell cultures, in addition no oxidative stress - as analyzed with the glutathione assay - was measured. Gene expression analysis also shows no induction in any of the tested genes, including mRNA levels of genes related to oxidative stress and pro-inflammation, as well as indoleamine 2,3-dioxygenase 1
Directory of Open Access Journals (Sweden)
Jana Reiter
2017-10-01
Full Text Available Garlic (Allium sativum has potent antimicrobial activity due to allicin (diallylthiosulfinate synthesized by enzyme catalysis in damaged garlic tissues. Allicin gives crushed garlic its characteristic odor and its volatility makes it potentially useful for combating lung infections. Allicin was synthesized (>98% pure by oxidation of diallyl disulfide by H2O2 using formic acid as a catalyst and the growth inhibitory effect of allicin vapor and allicin in solution to clinical isolates of lung pathogenic bacteria from the genera Pseudomonas, Streptococcus, and Staphylococcus, including multi-drug resistant (MDR strains, was demonstrated. Minimal inhibitory (MIC and minimal bactericidal concentrations (MBC were determined and compared to clinical antibiotics using standard European Committee on Antimicrobial Susceptibility Testing (EUCAST procedures. The cytotoxicity of allicin to human lung and colon epithelial and murine fibroblast cells was tested in vitro and shown to be ameliorated by glutathione (GSH. Similarly, the sensitivity of rat precision-cut lung slices (PCLS to allicin was decreased by raising the [GSH] to the approximate blood plasma level of 1 mM. Because allicin inhibited bacterial growth as a vapor, it could be used to combat bacterial lung infections via direct inhalation. Since there are no volatile antibiotics available to treat pulmonary infections, allicin, particularly at sublethal doses in combination with oral antibiotics, could make a valuable addition to currently available treatments.
Prophylactic and therapeutic efficacy of human monoclonal antibodies against H5N1 influenza.
Directory of Open Access Journals (Sweden)
Cameron P Simmons
2007-05-01
Full Text Available New prophylactic and therapeutic strategies to combat human infections with highly pathogenic avian influenza (HPAI H5N1 viruses are needed. We generated neutralizing anti-H5N1 human monoclonal antibodies (mAbs and tested their efficacy for prophylaxis and therapy in a murine model of infection.Using Epstein-Barr virus we immortalized memory B cells from Vietnamese adults who had recovered from infections with HPAI H5N1 viruses. Supernatants from B cell lines were screened in a virus neutralization assay. B cell lines secreting neutralizing antibodies were cloned and the mAbs purified. The cross-reactivity of these antibodies for different strains of H5N1 was tested in vitro by neutralization assays, and their prophylactic and therapeutic efficacy in vivo was tested in mice. In vitro, mAbs FLA3.14 and FLD20.19 neutralized both Clade I and Clade II H5N1 viruses, whilst FLA5.10 and FLD21.140 neutralized Clade I viruses only. In vivo, FLA3.14 and FLA5.10 conferred protection from lethality in mice challenged with A/Vietnam/1203/04 (H5N1 in a dose-dependent manner. mAb prophylaxis provided a statistically significant reduction in pulmonary virus titer, reduced associated inflammation in the lungs, and restricted extrapulmonary dissemination of the virus. Therapeutic doses of FLA3.14, FLA5.10, FLD20.19, and FLD21.140 provided robust protection from lethality at least up to 72 h postinfection with A/Vietnam/1203/04 (H5N1. mAbs FLA3.14, FLD21.140 and FLD20.19, but not FLA5.10, were also therapeutically active in vivo against the Clade II virus A/Indonesia/5/2005 (H5N1.These studies provide proof of concept that fully human mAbs with neutralizing activity can be rapidly generated from the peripheral blood of convalescent patients and that these mAbs are effective for the prevention and treatment of H5N1 infection in a mouse model. A panel of neutralizing, cross-reactive mAbs might be useful for prophylaxis or adjunctive treatment of human cases of H5N1
The In Vitro Anti-Tumor Activity of Phycocyanin against Non-Small Cell Lung Cancer Cells
Directory of Open Access Journals (Sweden)
Shuai Hao
2018-05-01
Full Text Available Phycocyanin, a type of functional food colorant, is shown to have a potent anti-cancer property. Non-small cell lung cancer (NSCLC is one of the most aggressive form of cancers with few effective therapeutic options. Previous studies have demonstrated that phycocyanin exerts a growth inhibitory effect on NSCLC A549 cells. However, its biological function and underlying regulatory mechanism on other cells still remain unknown. Here, we investigated the in vitro function of phycocyanin on three typical NSCLC cell lines, NCI-H1299, NCI-H460, and LTEP-A2, for the first time. The results showed that phycocyanin could significantly induce apoptosis, cell cycle arrest, as well as suppress cell migration, proliferation, and the colony formation ability of NSCLC cells through regulating multiple key genes. Strikingly, phycocyanin was discovered to affect the cell phenotype through regulating the NF-κB signaling of NSCLC cells. Our findings demonstrated the anti-neoplastic function of phycocyanin and provided valuable information for the regulation of phycocyanin in NSCLC cells.
Hou, Chen; Peng, Danyi; Gao, Li; Tian, Daiyin; Dai, Jihong; Luo, Zhengxiu; Liu, Enmei; Chen, Hong; Zou, Lin; Fu, Zhou
2018-01-08
The incidence and mortality rates of bronchopulmonary dysplasia (BPD) remain very high. Therefore, novel therapies are imminently needed to improve the outcome of this disease. Human umbilical cord-derived mesenchymal stem cells (UC-MSCs) show promising therapeutic effects on oxygen-induced model of BPD. In our experiment, UC-MSCs were intratracheally delivered into the newborn rats exposed to hyperoxia, a well-established BPD model. This study demonstrated that UC-MSCs reduce elastin expression stimulated by 90% O 2 in human lung fibroblasts-a (HLF-a), and inhibit HLF-a transdifferentiation into myofibroblasts. In addition, the therapeutic effects of UC-MSCs in neonatal rats with BPD, UC-MSCs could inhibit lung elastase activity and reduce aberrant elastin expression and deposition in the lung of BPD rats. Overall, this study suggested that UC-MSCs could ameliorate aberrant elastin expression in the lung of hyperoxia-induced BPD model which may be associated with suppressing increased TGFβ1 activation. Copyright © 2017. Published by Elsevier Inc.
Kim, H J; Chae, H Z; Kim, Y J; Kim, Y H; Hwangs, T S; Park, E M; Park, Y M
2003-10-01
Transient/chronic microenvironmental hypoxia that exists within a majority of solid tumors has been suggested to have a profound influence on tumor growth and therapeutic outcome. Since the functions of novel antioxidant proteins, peroxiredoxin I (Prx I) and II, have been implicated in regulating cell proliferation, differentiation, and apoptosis, it was of our special interest to probe a possible role of Prx I and II in the context of hypoxic tumor microenvironment. Since both Prx I and II use thioredoxin (Trx) as an electron donor and Trx is a substrate for thioredoxin reductase (TrxR), we investigated the regulation of Trx and TrxR as well as Prx expression following hypoxia. Here we show a dynamic change of glutathione homeostasis in lung cancer A549 cells and an up-regulation of Prx I and Trx following hypoxia. Western blot analysis of 10 human lung cancer and paired normal lung tissues also revealed an elevated expression of Prx I and Trx proteins in lung cancer tissues. Immunohistochemical analysis of the lung cancer tissues confirmed an augmented Prx I and Trx expression in cancer cells with respect to the parenchymal cells in adjacent normal lung tissue. Based on these results, we suggest that the redox changes in lung tumor microenvironment could have acted as a trigger for the up-regulation of Prx I and Trx in lung cancer cells. Although the clinical significance of our finding awaits more rigorous future study, preferential augmentation of the Prx I and Trx in lung cancer cells may well represent an attempt of cancer cells to manipulate a dynamic redox change in tumor microenvironment in a manner that is beneficial for their proliferation and malignant progression.
Measurement of lung fluid volumes and albumin exclusion in sheep
International Nuclear Information System (INIS)
Pou, N.A.; Roselli, R.J.; Parker, R.E.; Clanton, J.A.; Harris, T.R.
1989-01-01
A radioactive tracer technique was used to determine interstitial diethylenetriaminepentaacetic acid (DTPA) and albumin distribution volume in sheep lungs. 125 I- and/or 131 I-labeled albumin were injected intravenously and allowed to equilibrate for 24 h. 99m Tc-labeled DTPA and 51 Cr-labeled erythrocytes were injected and allowed to equilibrate (2 h and 15 min, respectively) before a lethal dose of thiamylal sodium. Two biopsies (1-3 g) were taken from each lung and the remaining tissue was homogenized for wet-to-dry lung weight and volume calculations. Estimates of distribution volumes from whole lung homogenized samples were statistically smaller than biopsy samples for extravascular water, interstitial 99m Tc-DTPA, and interstitial albumin. The mean fraction of the interstitium (Fe), which excludes albumin, was 0.68 +/- 0.04 for whole lung samples compared with 0.62 +/- 0.03 for biopsy samples. Hematocrit may explain the consistent difference. To make the Fe for biopsy samples match that for homogenized samples, a mean hematocrit, which was 82% of large vessel hematocrit, was required. Excluded volume fraction for exogenous sheep albumin was compared with that of exogenous human albumin in two sheep, and no difference was found at 24 h
26 CFR 1.460-6 - Look-back method.
2010-04-01
...) for the redetermination year, as adjusted for past applications of the look-back method and taking... the year in question with respect to other contracts. Notwithstanding the look-back method, the...) INCOME TAXES Taxable Year for Which Items of Gross Income Included § 1.460-6 Look-back method. (a) In...
Ax, M; Sanchez-Crespo, A; Lindahl, S G E; Mure, M; Petersson, J
2017-06-01
Previous studies in humans have shown that gravity has little influence on the distribution of lung blood flow while changing posture from supine to prone. This study aimed to evaluate the maximal influence of posture by comparison of regional lung blood flow in the upright and head-down posture in 8 healthy volunteers, using a tilt table. Regional lung blood flow was marked by intravenous injection of macroaggregates of human albumin labeled with 99m Tc or 113m In, in the upright and head-down posture, respectively, during tidal breathing. Both radiotracers remain fixed in the lung after administration. The distribution of radioactivity was mapped using quantitative single photon emission computed tomography (SPECT) corrected for attenuation and scatter. All images were obtained supine during tidal breathing. A shift from upright to the head-down posture caused a clear redistribution of blood flow from basal to apical regions. We conclude that posture plays a role for the distribution of lung blood flow in upright humans, and that the influence of posture, and thereby gravity, is much greater in the upright and head-down posture than in horizontal postures. However, the results of the study demonstrate that lung structure is the main determinant of regional blood flow and gravity is a secondary contributor to the distribution of lung blood flow in the upright and head-down positions. NEW & NOTEWORTHY Using a dual-isotope quantitative SPECT method, we demonstrated that although a shift in posture redistributes blood flow in the direction of gravity, the results are also consistent with lung structure being a greater determinant of regional blood flow than gravity. To our knowledge, this is the first study to use modern imaging methods to quantify the shift in regional lung blood flow in humans at a change between the upright and head-down postures. Copyright © 2017 the American Physiological Society.
P120-catenin isoforms 1A and 3A differently affect invasion and proliferation of lung cancer cells
International Nuclear Information System (INIS)
Liu Yang; Dong Qianze; Zhao Yue; Dong Xinjun; Miao Yuan; Dai Shundong; Yang Zhiqiang; Zhang Di; Wang Yan; Li Qingchang; Zhao Chen; Wang Enhua
2009-01-01
Different isoforms of p120-catenin (p120ctn), a member of the Armadillo gene family, are variably expressed in different tissues as a result of alternative splicing and the use of multiple translation initiation codons. When expressed in cancer cells, these isoforms may confer different properties with respect to cell adhesion and invasion. We have previously reported that the p120ctn isoforms 1 and 3 were the most highly expressed isoforms in normal lung tissues, and their expression level was reduced in lung tumor cells. To precisely define their biological roles, we transfected p120ctn isoforms 1A and 3A into the lung cancer cell lines A549 and NCI-H460. Enhanced expression of p120ctn isoform 1A not only upregulated E-cadherin and β-catenin, but also downregulated the Rac1 activity, and as a result, inhibited the ability of cells to invade. In contrast, overexpression of p120ctn isoform 3A led to the inactivation of Cdc42 and the activation of RhoA, and had a smaller influence on invasion. However, we found that isoform 3A had a greater ability than isoform 1A in both inhibiting the cell cycle and reducing tumor cell proliferation. The present study revealed that p120ctn isoforms 1A and 3A differently regulated the adhesive, proliferative, and invasive properties of lung cancer cells through distinct mechanisms
Lung retention and metabolic fate of inhaled benzo(a)pyrene associated with diesel exhaust particles
International Nuclear Information System (INIS)
Sun, J.D.; Wolff, R.K.; Kanapilly, G.M.; McClellan, R.O.
1984-01-01
The effect of ultrafine, insoluble, carrier particles on the lung retention and metabolic fate of inhaled PAHs was investigated with a radiolabeled model PAH, [ 3 H]benzo(a)pyrene ( 3 H-BaP). Fischer-344 rats were exposed (30 min) by nose-only inhalation to 3 H-BaP adsorbed (approximately 0.1% by mass) onto diesel engine exhaust particles. The total mass concentration of these aerosols was 4-6 micrograms/liter of air with a mass median diameter of 0.14 micron. Lung clearance of the inhaled particle-associated 3 H radioactivity occurred in two phases. The initially rapid clearance of this inhaled radiolabel had a half-time of less than 1 hr. The second, long-term component of lung clearance had a half-time of 18 +/- 2 days and represented 50 +/- 2% of the 3 H radioactivity that had initially deposited in lungs. In contrast, previous inhalation studies with a pure 3 H-BaP aerosol showed that greater than 99% of the 3 H radioactivity deposited in lungs was cleared within 2 hr after exposure. By HPLC analysis, the majority of diesel soot-associated 3 H radioactivity retained in lungs was BaP (65-76%) with smaller amounts of BaP-phenol (13-17%) and BaP-quinone (5-18%) metabolites also being detected. No other metabolites of BaP were detected in lungs of exposed rats. Tissue distribution and excretion patterns of 3 H radioactivity were qualitatively similar to previous inhalation studies with 3 H-BaP coated Ga2O3 aerosols. These findings suggest that inhaled PAHs may be retained in lungs for a greater period of time when these compounds are associated with diesel engine exhaust particles. These results may have significant implications for the health risks that may be involved with human exposure to particle-associated organic pollutants
Long-term persistence of human donor alveolar macrophages in lung transplant recipients
DEFF Research Database (Denmark)
Eguíluz-Gracia, Ibon; Schultz, Hans Henrik Lawaetz; Sikkeland, Liv I. B.
2016-01-01
and life span of human AMFs is scarce. METHODS: To follow the origin and longevity of AMFs in patients with lung transplantation for more than 100 weeks, we obtained transbronchial biopsies from 10 gender-mismatched patients with lung transplantation. These were subjected to combined in situ hybridisation...... transplantation we found that recipient monocytes seeded the alveoli early after transplantation, and showed subsequent phenotypical changes consistent with differentiation into proliferating mature AMFs. This resulted in a stable mixed chimerism between donor and recipient AMFs throughout the 2-year period...
Stone, Matthew L; Zhao, Yunge; Robert Smith, J; Weiss, Mark L; Kron, Irving L; Laubach, Victor E; Sharma, Ashish K
2017-12-21
Lung ischemia-reperfusion (IR) injury after transplantation as well as acute shortage of suitable donor lungs are two critical issues impacting lung transplant patients. This study investigates the anti-inflammatory and immunomodulatory role of human mesenchymal stromal cells (MSCs) and MSC-derived extracellular vesicles (EVs) to attenuate lung IR injury and improve of ex-vivo lung perfusion (EVLP)-mediated rehabilitation in donation after circulatory death (DCD) lungs. C57BL/6 wild-type (WT) mice underwent sham surgery or lung IR using an in vivo hilar-ligation model with or without MSCs or EVs. In vitro studies used primary iNKT cells and macrophages (MH-S cells) were exposed to hypoxia/reoxygenation with/without co-cultures with MSCs or EVs. Also, separate groups of WT mice underwent euthanasia and 1 h of warm ischemia and stored at 4 °C for 1 h followed by 1 h of normothermic EVLP using Steen solution or Steen solution containing MSCs or EVs. Lungs from MSCs or EV-treated mice had significant attenuation of lung dysfunction and injury (decreased edema, neutrophil infiltration and myeloperoxidase levels) compared to IR alone. A significant decrease in proinflammatory cytokines (IL-17, TNF-α, CXCL1 and HMGB1) and upregulation of keratinocyte growth factor, prostaglandin E2 and IL-10 occurred in the BAL fluid from MSC or EV-treated mice after IR compared to IR alone. Furthermore, MSCs or EVs significantly downregulated iNKT cell-produced IL-17 and macrophage-produced HMGB1 and TNF-α after hypoxia/reoxygenation. Finally, EVLP of DCD lungs with Steen solution including MSCs or EVs provided significantly enhanced protection versus Steen solution alone. Co-cultures of MSCs or EVs with lung endothelial cells prevents neutrophil transendothelial migration after exposure to hypoxia/reoxygenation and TNF-α/HMGB1 cytomix. These results suggest that MSC-derived EVs can attenuate lung inflammation and injury after IR as well as enhance EVLP-mediated reconditioning of
Directory of Open Access Journals (Sweden)
Yasuha Arai
2016-04-01
Full Text Available A major determinant in the change of the avian influenza virus host range to humans is the E627K substitution in the PB2 polymerase protein. However, the polymerase activity of avian influenza viruses with a single PB2-E627K mutation is still lower than that of seasonal human influenza viruses, implying that avian viruses require polymerase mutations in addition to PB2-627K for human adaptation. Here, we used a database search of H5N1 clade 2.2.1 virus sequences with the PB2-627K mutation to identify other polymerase adaptation mutations that have been selected in infected patients. Several of the mutations identified acted cooperatively with PB2-627K to increase viral growth in human airway epithelial cells and mouse lungs. These mutations were in multiple domains of the polymerase complex other than the PB2-627 domain, highlighting a complicated avian-to-human adaptation pathway of avian influenza viruses. Thus, H5N1 viruses could rapidly acquire multiple polymerase mutations that function cooperatively with PB2-627K in infected patients for optimal human adaptation.
Directory of Open Access Journals (Sweden)
Marion Engel
Full Text Available Changes in microbial community composition in the lung of patients suffering from moderate to severe COPD have been well documented. However, knowledge about specific microbiome structures in the human lung associated with CT defined abnormalities is limited.Bacterial community composition derived from brush samples from lungs of 16 patients suffering from different CT defined subtypes of COPD and 9 healthy subjects was analyzed using a cultivation independent barcoding approach applying 454-pyrosequencing of 16S rRNA gene fragment amplicons.We could show that bacterial community composition in patients with changes in CT (either airway or emphysema type changes, designated as severe subtypes was different from community composition in lungs of patients without visible changes in CT as well as from healthy subjects (designated as mild COPD subtype and control group (PC1, Padj = 0.002. Higher abundance of Prevotella in samples from patients with mild COPD subtype and from controls and of Streptococcus in the severe subtype cases mainly contributed to the separation of bacterial communities of subjects. No significant effects of treatment with inhaled glucocorticoids on bacterial community composition were detected within COPD cases with and without abnormalities in CT in PCoA. Co-occurrence analysis suggests the presence of networks of co-occurring bacteria. Four communities of positively correlated bacteria were revealed. The microbial communities can clearly be distinguished by their associations with the CT defined disease phenotype.Our findings indicate that CT detectable structural changes in the lung of COPD patients, which we termed severe subtypes, are associated with alterations in bacterial communities, which may induce further changes in the interaction between microbes and host cells. This might result in a changed interplay with the host immune system.
Engel, Marion; Endesfelder, David; Schloter-Hai, Brigitte; Kublik, Susanne; Granitsiotis, Michael S; Boschetto, Piera; Stendardo, Mariarita; Barta, Imre; Dome, Balazs; Deleuze, Jean-François; Boland, Anne; Müller-Quernheim, Joachim; Prasse, Antje; Welte, Tobias; Hohlfeld, Jens; Subramanian, Deepak; Parr, David; Gut, Ivo Glynne; Greulich, Timm; Koczulla, Andreas Rembert; Nowinski, Adam; Gorecka, Dorota; Singh, Dave; Gupta, Sumit; Brightling, Christopher E; Hoffmann, Harald; Frankenberger, Marion; Hofer, Thomas P; Burggraf, Dorothe; Heiss-Neumann, Marion; Ziegler-Heitbrock, Loems; Schloter, Michael; Zu Castell, Wolfgang
2017-01-01
Changes in microbial community composition in the lung of patients suffering from moderate to severe COPD have been well documented. However, knowledge about specific microbiome structures in the human lung associated with CT defined abnormalities is limited. Bacterial community composition derived from brush samples from lungs of 16 patients suffering from different CT defined subtypes of COPD and 9 healthy subjects was analyzed using a cultivation independent barcoding approach applying 454-pyrosequencing of 16S rRNA gene fragment amplicons. We could show that bacterial community composition in patients with changes in CT (either airway or emphysema type changes, designated as severe subtypes) was different from community composition in lungs of patients without visible changes in CT as well as from healthy subjects (designated as mild COPD subtype and control group) (PC1, Padj = 0.002). Higher abundance of Prevotella in samples from patients with mild COPD subtype and from controls and of Streptococcus in the severe subtype cases mainly contributed to the separation of bacterial communities of subjects. No significant effects of treatment with inhaled glucocorticoids on bacterial community composition were detected within COPD cases with and without abnormalities in CT in PCoA. Co-occurrence analysis suggests the presence of networks of co-occurring bacteria. Four communities of positively correlated bacteria were revealed. The microbial communities can clearly be distinguished by their associations with the CT defined disease phenotype. Our findings indicate that CT detectable structural changes in the lung of COPD patients, which we termed severe subtypes, are associated with alterations in bacterial communities, which may induce further changes in the interaction between microbes and host cells. This might result in a changed interplay with the host immune system.
Ko, Jen-Chung; Zheng, Hao-Yu; Chen, Wen-Ching; Peng, Yi-Shuan; Wu, Chia-Hung; Wei, Chia-Li; Chen, Jyh-Cheng; Lin, Yun-Wei
2016-12-15
Salinomycin, a polyether antibiotic, acts as a highly selective potassium ionophore and has anticancer activity on various cancer cell lines. Cisplatin has been proved as chemotherapy drug for advanced human non-small cell lung cancer (NSCLC). Thymidylate synthase (TS) is a key enzyme in the pyrimidine salvage pathway, and increased expression of TS is thought to be associated with resistance to cisplatin. In this study, we showed that salinomycin (0.5-2μg/mL) treatment down-regulating of TS expression in an AKT inactivation manner in two NSCLC cell lines, human lung adenocarcinoma A549 and squamous cell carcinoma H1703 cells. Knockdown of TS using small interfering RNA (siRNA) or inhibiting AKT activity with PI3K inhibitor LY294002 enhanced the cytotoxicity and cell growth inhibition of salinomycin. A combination of cisplatin and salinomycin resulted in synergistic enhancement of cytotoxicity and cell growth inhibition in NSCLC cells, accompanied with reduced activation of phospho-AKT, and TS expression. Overexpression of a constitutive active AKT (AKT-CA) expression vector reversed the salinomycin and cisplatin-induced synergistic cytotoxicity. In contrast, pretreatment with LY294002 further decreased the cell viability in salinomycin and cisplatin cotreated cells. Our findings suggested that the down-regulation of AKT-mediated TS expression by salinomycin enhanced the cisplatin-induced cytotoxicity in NSCLC cells. These results may provide a rationale to combine salinomycin with cisplatin for lung cancer treatment. Copyright © 2016 Elsevier Inc. All rights reserved.
Gerloff, Janice; Sundar, Isaac K; Freter, Robert; Sekera, Emily R; Friedman, Alan E; Robinson, Risa; Pagano, Todd; Rahman, Irfan
2017-03-01
Recent studies suggest that electronic cigarette (e-cig) flavors can be harmful to lung tissue by imposing oxidative stress and inflammatory responses. The potential inflammatory response by lung epithelial cells and fibroblasts exposed to e-cig flavoring chemicals in addition to other risk-anticipated flavor enhancers inhaled by e-cig users is not known. The goal of this study was to evaluate the release of the proinflammatory cytokine (interleukin-8 [IL-8]) and epithelial barrier function in response to different e-cig flavoring chemicals identified in various e-cig e-liquid flavorings and vapors by chemical characterization using gas chromatography-mass spectrometry analysis. Flavorings, such as acetoin (butter), diacetyl, pentanedione, maltol (malt), ortho-vanillin (vanilla), coumarin, and cinnamaldehyde in comparison with tumor necrosis factor alpha (TNFα), were used in this study. Human bronchial epithelial cells (Beas2B), human mucoepidermoid carcinoma epithelial cells (H292), and human lung fibroblasts (HFL-1) were treated with each flavoring chemical for 24 hours. The cells and conditioned media were then collected and analyzed for toxicity (viability %), lung epithelial barrier function, and proinflammatory cytokine IL-8 release. Cell viability was not significantly affected by any of the flavoring chemicals tested at a concentration of 10 μM to 1 mM. Acetoin and diacetyl treatment induced IL-8 release in Beas2B cells. Acetoin- and pentanedione-treated HFL-1 cells produced a differential, but significant response for IL-8 release compared to controls and TNFα. Flavorings, such as ortho-vanillin and maltol, induced IL-8 release in Beas2B cells, but not in H292 cells. Of all the flavoring chemicals tested, acetoin and maltol were more potent inducers of IL-8 release than TNFα in Beas2B and HFL-1 cells. Flavoring chemicals rapidly impaired epithelial barrier function in human bronchial epithelial cells (16-HBE) as measured by electric cell surface
Relative biological effectiveness if alpha radiation for human lung exposure
International Nuclear Information System (INIS)
Yarmoshenko, I.; Kirdin, I.; Zhukovsky, M.
2006-01-01
estimates for cases of indoor radon alpha exposure and exposure to implanted plutonium can be seen. Difference in biological effectiveness of inhaled radon and implanted plutonium may appear due to different distribution of short-lived radon progeny and long lived plutonium within lung tissues. Low RBE value for alpha particle exposures of human lung tissues may be a reason of known inconsistency of dose conversion factors for radon estimates based on dosimetric and epidemiologic approaches. (authors)
Application of a neutral community model to assess structuring of the human lung microbiome.
Venkataraman, Arvind; Bassis, Christine M; Beck, James M; Young, Vincent B; Curtis, Jeffrey L; Huffnagle, Gary B; Schmidt, Thomas M
2015-01-20
DNA from phylogenetically diverse microbes is routinely recovered from healthy human lungs and used to define the lung microbiome. The proportion of this DNA originating from microbes adapted to the lungs, as opposed to microbes dispersing to the lungs from other body sites and the atmosphere, is not known. We use a neutral model of community ecology to distinguish members of the lung microbiome whose presence is consistent with dispersal from other body sites and those that deviate from the model, suggesting a competitive advantage to these microbes in the lungs. We find that the composition of the healthy lung microbiome is consistent with predictions of the neutral model, reflecting the overriding role of dispersal of microbes from the oral cavity in shaping the microbial community in healthy lungs. In contrast, the microbiome of diseased lungs was readily distinguished as being under active selection. We also assessed the viability of microbes from lung samples by cultivation with a variety of media and incubation conditions. Bacteria recovered by cultivation from healthy lungs represented species that comprised 61% of the 16S rRNA-encoding gene sequences derived from bronchoalveolar lavage samples. Neutral distribution of microbes is a distinguishing feature of the microbiome in healthy lungs, wherein constant dispersal of bacteria from the oral cavity overrides differential growth of bacteria. No bacterial species consistently deviated from the model predictions in healthy lungs, although representatives of many of the dispersed species were readily cultivated. In contrast, bacterial populations in diseased lungs were identified as being under active selection. Quantification of the relative importance of selection and neutral processes such as dispersal in shaping the healthy lung microbiome is a first step toward understanding its impacts on host health. Copyright © 2015 Venkataraman et al.
Directory of Open Access Journals (Sweden)
Nan Hua
Full Text Available Lung cancers express the cholinergic autocrine loop, which facilitates the progression of cancer cells. The antagonists of mAChRs have been demonstrated to depress the growth of small cell lung cancers (SCLCs. In this study we intended to investigate the growth inhibitory effect of R2HBJJ, a novel muscarinic antagonist, on non-small cell lung cancer (NSCLC cells and the possible mechanisms. The competitive binding assay revealed that R2HBJJ had a high affinity to M3 and M1 AChRs. R2HBJJ presented a strong anticholinergic activity on carbachol-induced contraction of guinea-pig trachea. R2HBJJ markedly suppressed the growth of NSCLC cells, such as H1299, H460 and H157. In H1299 cells, both R2HBJJ and its leading compound R2-PHC displayed significant anti-proliferative activity as M3 receptor antagonist darifenacin. Exogenous replenish of ACh could attenuate R2HBJJ-induced growth inhibition. Silencing M3 receptor or ChAT by specific-siRNAs resulted in a growth inhibition of 55.5% and 37.9% on H1299 cells 96 h post transfection, respectively. Further studies revealed that treatment with R2HBJJ arrested the cell cycle in G0/G1 by down-regulation of cyclin D1-CDK4/6-Rb. Therefore, the current study reveals that NSCLC cells express an autocrine and paracrine cholinergic system which stimulates the growth of NSCLC cells. R2HBJJ, as a novel mAChRs antagonist, can block the local cholinergic loop by antagonizing predominantly M3 receptors and inhibit NSCLC cell growth, which suggest that M3 receptor antagonist might be a potential chemotherapeutic regimen for NSCLC.
International Nuclear Information System (INIS)
Shapiro, S.D.; Endicott, S.K.; Province, M.A.; Pierce, J.A.; Campbell, E.J.
1991-01-01
Normal structure and function of the lung parenchyma depend upon elastic fibers. Amorphous elastin is biochemically stable in vitro, and may provide a metabolically stable structural framework for the lung parenchyma. To test the metabolic stability of elastin in the normal human lung parenchyma, we have (a) estimated the time elapsed since the synthesis of the protein through measurement of aspartic acid racemization and (b) modeled the elastin turnover through measurement of the prevalence of nuclear weapons-related 14 C. Elastin purified by a new technique from normal lung parenchyma was hydrolyzed; then the prevalences of D-aspartate and 14 C were measured by gas chromatography and accelerator-mass spectrometry, respectively. D-aspartate increased linearly with age; Kasp (1.76 x 10 - 3 yr - 1 ) was similar to that previously found for extraordinarily stable human tissues, indicating that the age of lung parenchymal elastin corresponded with the age of the subject. Radiocarbon prevalence data also were consistent with extraordinary metabolic stability of elastin; the calculated mean carbon residence time in elastin was 74 yr (95% confidence limits, 40-174 yr). These results indicate that airspace enlargement characteristic of 'aging lung' is not associated with appreciable new synthesis of lung parenchymal elastin. The present study provides the first tissue-specific evaluation of turnover of an extracellular matrix component in humans and underscores the potential importance of elastin for maintenance of normal lung structure. Most importantly, the present work provides a foundation for strategies to directly evaluate extracellular matrix injury and repair in diseases of lung (especially pulmonary emphysema), vascular tissue, and skin
The kinetics of repair in mouse lung after fractionated irradiation
International Nuclear Information System (INIS)
Travis, E.L.; Thames, H.D.; Watkins, T.L.; Kiss, I.
1987-01-01
The kinetics of repair of sublethal damage in mouse lung was studied after fractionated doses of 137 Cs γ-rays. A wide range of doses per fraction (1.7-12 Gy) was given with interfraction intervals ranging from 0.5 to 24 h. Data were analysed by a direct method of analysis using the incomplete repair model. The half-time of repair (Tsub(1/2)) was 0.76 h for the pneumonitis phase of damage (up to 8 months) and 0.65 h for the later phase of damage up to 12 months. Rate of repair was dependent on fraction size for both phases of lung damage and was faster after large dose fractions than after small fractions. Tsub(1/2) was 0.6 h (95% c.1. 0.53, 0.69) for doses per fraction greater than 5 Gy and 0.83 h (95% c.1. 0.76, 0.92) for doses per fraction of 2 Gy. Repair was nearly complete by 6 h at least for the pneumonitis phase of damage. If extrapolated to humans, these results imply that treatments with multiple fractions per day involving the lung will not be limited by the necessity for interfraction intervals much longer than 6 h. (author)
Powell, Joshua D.; Dlugolenski, Daniel; Nagy, Tamas; Gabbard, Jon; Lee, Christopher; Tompkins, Stephen M.; Tripp, Ralph A.
2014-01-01
Swine-origin H3N2v, a variant of H3N2 influenza virus, is a concern for novel reassortment with circulating pandemic H1N1 influenza virus (H1N1pdm09) in swine because this can lead to the emergence of a novel pandemic virus. In this study, the reassortment prevalence of H3N2v with H1N1pdm09 was determined in swine cells. Reassortants evaluated showed that the H1N1pdm09 polymerase (PA) segment occurred within swine H3N2 with ∼80% frequency. The swine H3N2-human H1N1pdm09 PA reassortant (swH3N2-huPA) showed enhanced replication in swine cells, and was the dominant gene constellation. Ferrets infected with swH3N2-huPA had increased lung pathogenicity compared to parent viruses; however, swH3N2-huPA replication in normal human bronchoepithelial cells was attenuated - a feature linked to expression of IFN-β and IFN-λ genes in human but not swine cells. These findings indicate that emergence of novel H3N2v influenza constellations require more than changes in the viral polymerase complex to overcome barriers to cross-species transmission. Additionally, these findings reveal that while the ferret model is highly informative for influenza studies, slight differences in pathogenicity may not necessarily be indicative of human outcomes after infection. PMID:25330303
International Nuclear Information System (INIS)
Stevens, R.L.; Austen, K.F.; Fox, C.C.; Lichtenstein, L.M.
1988-01-01
The predominant subclasses of mast cells in both the rat and the mouse can be distinguished from one another by their preferential synthesis of 35 S-labeled proteoglycans that contain either heparin or oversulfated chondroitin sulfate glycosaminoglycans. Although [ 35 S]heparin proteoglycans have been isolated from human lung mast cells of 40-70% purity and from a skin biopsy specimen of a patient with urticaria pigmentosa, no highly sulfated chondroitin sulfate proteoglycan has been isolated from any enriched or highly purified population of human mast cells. The authors demonstrate that human lung mast cells of 96% purity incorporate [ 35 S]sulfate into separate heparin and chondroitin sulfate proteoglycans in an ∼2:1 ratio. As assessed by HPLC of the chondroitinase ABC digests, the chondroitin [ 35 S]sulfate proteoglycans isolated from these human lung mast cells contain the same unusual chondroitin sulfate E disaccharide that is present in proteoglycans produced by interleukin 3-dependent mucosal-like mouse mast cells. Both the chondroitin [ 35 S]sulfate E proteoglycans and the [ 35 S]heparin proteoglycans were exocytosed from the [ 35 S]sulfate-labeled cells via perturbation of the IgE receptor, indicating that both types of 35 S-labeled proteoglycans reside in the secretory granules of these human lung mast cells
Joshi, Suchita; Kotecha, Sailesh
2007-12-01
Human lung growth starts as a primitive lung bud in early embryonic life and undergoes several morphological stages which continue into postnatal life. Each stage of lung growth is a result of complex and tightly regulated events governed by physical, environmental, hormonal and genetic factors. Fetal lung liquid and fetal breathing movements are by far the most important determinants of lung growth. Although timing of the stages of lung growth in animals do not mimic that of human, numerous animal studies, mainly on sheep and rat, have given us a better understanding of the regulators of lung growth. Insight into the genetic basis of lung growth has helped us understand and improve management of complex life threatening congenital abnormalities such as congenital diaphragmatic hernia and pulmonary hypoplasia. Although advances in perinatal medicine have improved survival of preterm infants, premature birth is perhaps still the most important factor for adverse lung growth.
Directory of Open Access Journals (Sweden)
Guo Zong-Lun
2010-02-01
Full Text Available Abstract Background The crude extract of the fruit bearing plant, Physalis peruviana (golden berry, demonstrated anti-hepatoma and anti-inflammatory activities. However, the cellular mechanism involved in this process is still unknown. Methods Herein, we isolated the main pure compound, 4β-Hydroxywithanolide (4βHWE derived from golden berries, and investigated its antiproliferative effect on a human lung cancer cell line (H1299 using survival, cell cycle, and apoptosis analyses. An alkaline comet-nuclear extract (NE assay was used to evaluate the DNA damage due to the drug. Results It was shown that DNA damage was significantly induced by 1, 5, and 10 μg/mL 4βHWE for 2 h in a dose-dependent manner (p p 50 of 4βHWE in H1299 cells for 24 and 48 h were 0.6 and 0.71 μg/mL, respectively, suggesting it could be a potential therapeutic agent against lung cancer. In a flow cytometric analysis, 4βHWE produced cell cycle perturbation in the form of sub-G1 accumulation and slight arrest at the G2/M phase with 1 μg/mL for 12 and 24 h, respectively. Using flow cytometric and annexin V/propidium iodide immunofluorescence double-staining techniques, these phenomena were proven to be apoptosis and complete G2/M arrest for H1299 cells treated with 5 μg/mL for 24 h. Conclusions In this study, we demonstrated that golden berry-derived 4βHWE is a potential DNA-damaging and chemotherapeutic agent against lung cancer.
Selective Biological Responses of Phagocytes and Lungs to Purified Histones.
Fattahi, Fatemeh; Grailer, Jamison J; Lu, Hope; Dick, Rachel S; Parlett, Michella; Zetoune, Firas S; Nuñez, Gabriel; Ward, Peter A
2017-01-01
Histones invoke strong proinflammatory responses in many different organs and cells. We assessed biological responses to purified or recombinant histones, using human and murine phagocytes and mouse lungs. H1 had the strongest ability in vitro to induce cell swelling independent of requirements for toll-like receptors (TLRs) 2 or 4. These responses were also associated with lactate dehydrogenase release. H3 and H2B were the strongest inducers of [Ca2+]i elevations in phagocytes. Cytokine and chemokine release from mouse and human phagocytes was predominately a function of H2A and H2B. Double TLR2 and TLR4 knockout (KO) mice had dramatically reduced cytokine release induced in macrophages exposed to individual histones. In contrast, macrophages from single TLR-KO mice showed few inhibitory effects on cytokine production. Using the NLRP3 inflammasome protocol, release of mature IL-1β was predominantly a feature of H1. Acute lung injury following the airway delivery of histones suggested that H1, H2A, and H2B were linked to alveolar leak of albumin and the buildup of polymorphonuclear neutrophils as well as the release of chemokines and cytokines into bronchoalveolar fluids. These results demonstrate distinct biological roles for individual histones in the context of inflammation biology and the requirement of both TLR2 and TLR4. © 2017 S. Karger AG, Basel.
International Nuclear Information System (INIS)
Peng Fang; Wang Jin; Zou Yi; Bao Yong; Huang Wenlin; Chen Guangming; Luo Xianrong; Chen Ming
2011-01-01
Objective: To investigate whether recombinant human endostatin can create a time window of vascular normalization prior to vascular pruning to alleviate hypoxia in Lewis lung carcinoma in mice. Methods: Kinetic changes in morphology of tumor vasculature in response to recombinant human endostatin were detected under a confocal microscope with immunofluorescent staining in Lewis lung carcinomas in mice. The hypoxic cell fraction of different time was assessed with immunohistochemical staining . Effects on tumor growth were monitored as indicated in the growth curve of tumors . Results: Compared with the control group vascularity of the tumors was reduced over time by recombinant human endostatin treatment and significantly regressed for 9 days. During the treatment, pericyte coverage increased at day 3, increased markedly at day 5, and fell again at day 7. The vascular basement membrane was thin and closely associated with endothelial cells after recombinant human endostatin treatment, but appeared thickened, loosely associated with endothelial cells in control tumors. The decrease in hypoxic cell fraction at day 5 after treatment was also found. Tumor growth was not accelerated 5 days after recombinant human endostatin treatment. Conclusions: Recombinant human endostatin can normalize tumor vasculature within day 3 to 7, leading to improved tumor oxygenation. The results provide important experimental basis for combining recombinant human endostatin with radiation therapy in human tumors. (authors)
Chokradjaroen, Chayanaphat; Rujiravanit, Ratana; Theeramunkong, Sewan; Saito, Nagahiro
2018-01-01
Chitosan is a polysaccharide that has been extensively studied in the field of biomedicine, especially its water-soluble degraded products called chitooligosaccharides (COS). In this study, COS were produced by the degradation of chitosan hydrogel dispersed in a dilute solution (i.e., 1.55 mM) of various kinds of carboxylic acids using a non-thermal plasma technology called solution plasma (SP). The degradation rates of chitosan were influenced by the type of carboxylic acids, depending on the interaction between chitosan and each carboxylic acid. After SP treatment, the water-soluble degraded products containing COS could be easily separated from the water-insoluble residue of chitosan hydrogel by centrifugation. The production yields of the COS were mostly higher than 55%. Furthermore, the obtained COS products were evaluated for their inhibitory effect as well as their selectivity against human lung cancer cells (H460) and human lung normal cells (MRC-5).
Anti-lung cancer effects of novel ginsenoside 25-OCH(3)-PPD.
Wang, Wei; Rayburn, Elizabeth R; Hang, Jie; Zhao, Yuqing; Wang, Hui; Zhang, Ruiwen
2009-09-01
20(S)-25-methoxyl-dammarane-3beta, 12beta, 20-triol (25-OCH(3)-PPD), a newly identified natural product from Panax notoginseng, exhibits activity against a variety of cancer cells. Herein, we report the effects of this compound on human A549, H358, and H838 lung cancer cells, and compare these effects with a control lung epithelial cell line, BEAS-2B. 25-OCH(3)-PPD decreased survival, inhibited proliferation, and induced apoptosis and G1 cell cycle arrest in the lung cancer cell lines. The P. notoginseng compound also decreased the levels of proteins associated with cell proliferation and cell survival. Moreover, 25-OCH(3)-PPD inhibited the growth of A549 lung cancer xenograft tumors. 25-OCH(3)-PPD demonstrated low toxicity to non-cancer cells, and no observable toxicity was seen when the compound was administered to animals. In conclusion, our preclinical data indicate that 25-OCH(3)-PPD is a potential therapeutic agent in vitro and in vivo, and further preclinical and clinical development of this agent for lung cancer is warranted.
Pseudomonas aeruginosa vesicles associate with and are internalized by human lung epithelial cells
Directory of Open Access Journals (Sweden)
Kuehn Meta J
2009-02-01
Full Text Available Abstract Background Pseudomonas aeruginosa is the major pathogen associated with chronic and ultimately fatal lung infections in patients with cystic fibrosis (CF. To investigate how P. aeruginosa-derived vesicles may contribute to lung disease, we explored their ability to associate with human lung cells. Results Purified vesicles associated with lung cells and were internalized in a time- and dose-dependent manner. Vesicles from a CF isolate exhibited a 3- to 4-fold greater association with lung cells than vesicles from the lab strain PAO1. Vesicle internalization was temperature-dependent and was inhibited by hypertonic sucrose and cyclodextrins. Surface-bound vesicles rarely colocalized with clathrin. Internalized vesicles colocalized with the endoplasmic reticulum (ER marker, TRAPα, as well as with ER-localized pools of cholera toxin and transferrin. CF isolates of P. aeruginosa abundantly secrete PaAP (PA2939, an aminopeptidase that associates with the surface of vesicles. Vesicles from a PaAP knockout strain exhibited a 40% decrease in cell association. Likewise, vesicles from PAO1 overexpressing PaAP displayed a significant increase in cell association. Conclusion These data reveal that PaAP promotes the association of vesicles with lung cells. Taken together, these results suggest that P. aeruginosa vesicles can interact with and be internalized by lung epithelial cells and contribute to the inflammatory response during infection.
Multiscale image-based modeling and simulation of gas flow and particle transport in the human lungs
Tawhai, Merryn H; Hoffman, Eric A
2013-01-01
Improved understanding of structure and function relationships in the human lungs in individuals and sub-populations is fundamentally important to the future of pulmonary medicine. Image-based measures of the lungs can provide sensitive indicators of localized features, however to provide a better prediction of lung response to disease, treatment and environment, it is desirable to integrate quantifiable regional features from imaging with associated value-added high-level modeling. With this objective in mind, recent advances in computational fluid dynamics (CFD) of the bronchial airways - from a single bifurcation symmetric model to a multiscale image-based subject-specific lung model - will be reviewed. The interaction of CFD models with local parenchymal tissue expansion - assessed by image registration - allows new understanding of the interplay between environment, hot spots where inhaled aerosols could accumulate, and inflammation. To bridge ventilation function with image-derived central airway structure in CFD, an airway geometrical modeling method that spans from the model ‘entrance’ to the terminal bronchioles will be introduced. Finally, the effects of turbulent flows and CFD turbulence models on aerosol transport and deposition will be discussed. CFD simulation of airflow and particle transport in the human lung has been pursued by a number of research groups, whose interest has been in studying flow physics and airways resistance, improving drug delivery, or investigating which populations are most susceptible to inhaled pollutants. The three most important factors that need to be considered in airway CFD studies are lung structure, regional lung function, and flow characteristics. Their correct treatment is important because the transport of therapeutic or pollutant particles is dependent on the characteristics of the flow by which they are transported; and the airflow in the lungs is dependent on the geometry of the airways and how ventilation
Clearance of 99mTc-labeled albumin from lungs in anesthetized guinea pigs
International Nuclear Information System (INIS)
Connelly, J.C.; Peterson, B.T.
1993-01-01
Gamma imaging was used to measure the rate of clearance of aerosolized 99m Tc-human serum albumin (HSA) from the lungs of control guinea pigs and guinea pigs that received increased lung inflation or lung injury. Anesthetized guinea pigs were ventilated for 6 min with an aerosol of HSA and the radioactivity in the chest was monitored for 2 h with a gamma camera to determine whether the clearance rate would be a reliable assessment of lung epithelial permeability. Increased lung volumes were effected by application of 5 or 7 cm H 2 O positive end-expired pressure (5-PEEP and 7-PEEP, respectively). Lung injury was induced either by intravenous oleic acid (OA, 27-73 μl/kg) or inhalation of nitrogen dioxide (NO 2 , 80-100 ppm) for 2 h. Postmortem extravascular lung water volume (EVLW) provided an assessment of the degree of lung injury. Tracer clearance rates in animals receiving 5 or 7 cm H 2 O PEEP were not significantly different from controls (K = 0.15 ± 0.05 and 0.24 ± 0.10 vs 0.12 ± 0.03%/min, respectively, p > .05). Animals exposed to NO 2 had faster tracer clearance rates (K = 0.33 ± 0.21%/min, p 2 -exposed guinea pigs correlated well with injury as assessed by EVLW (r = .93, p 2 O PEEP (K = 0.58 ± 0.41%/min, EVLW = 8.1 ± 0.8 mL/g dry lung tissue, p < .05), but there was no correlation between these parameters in this injury model. It is concluded that imaging of the disappearance of radiolabeled HSA in the guinea pig can be a useful index of lung epithelial permeability, but this technique is limited to certain models of lung injury. 33 refs
Gonzalez, D.
2017-12-01
Inhalation of fine particulate matter (PM2.5) has long been associated with adverse health outcomes. However, the causative agents and underlying mechanisms for these health effects have yet to be identified. One hypothesis is that PM2.5 deposited in the alveoli produce an excess of highly reactive radicals, leading to oxidative stress. The OH radical may be the most physiologically damaging, capable of oxidizing of lipids, proteins and DNA. Due to the variability and uncertainty in PM2.5 composition, the components that contribute to OH formation are not well understood. Soluble Fe is a component of PM2.5that produces OH under physiological conditions. Humic-like substances are water soluble organics found in biomass burning and tobacco smoke. Humic-like substances are capable of binding to Fe and enhancing OH formation, but this chemistry is not well understood. In this work, we use soil derived fulvic acid as a surrogate for Humic-like substances and investigate its effect on OH formation from Fe(II) under conditions relevant to the lungs. We use a fluorescent OH trapping probe, chemical kinetics and thermodynamic modeling to investigate OH formation from fulvic acid and Fe(II) dissolved in simulated and human lung fluids. In simulated lung fluid, we find that fulvic acid binds to Fe(II) and enhances the rate of key reactions that form OH. When fulvic acid is added to human lung fluids containing Fe(II), an enhancement of OH formation is observed. In human lung fluid, fulvic acid and metal binding proteins compete for Fe binding. These metal binding proteins are typically not found in simulated lung fluids. Results show that fulvic acid strongly binds Fe(II) and catalyzes key reactions that form OH in both simulated and human lung fluids. These results may help explain the role of Humic-like substances and Fe in oxidative stress and adverse health outcomes. Furthermore, we suggest that future studies employ simulated lung fluids containing metal binding proteins
Lu, Xing; Wu, Yi-Ming; Yang, Jing-Mei; Ma, Feng-E; Li, Liang-Ping; Chen, Sheng; Zhang, Ye; Ni, Qing-Ling; Pan, Ying-Ming; Hong, Xue; Peng, Yan
2018-05-10
A series of 2(1H)-quinolinone derivatives and their rhodium (III) complexes were designed and synthesized. All the rhodium (III) complexes exhibited higher in vitro cytotoxicity for Hep G2, HeLa 229, MGC80-3, and NCI-H460 human tumor cell lines than their ligands and cisplatin, and among them complex 9 was found to be selectively cytotoxic to tumor cells. Further investigation revealed that complex 9 caused cell cycle arrest at the G2/M phase and induced apoptosis, and inhibited the proliferation of Hep G2 cells by impeding the phosphorylation of epidermal growth factor receptor (EGFR) and its downstream enzymes. Complex 9 also up-regulated the proapoptotic proteins Bak, Bax, and Bim, which altogether activated caspase-3/9 to initiate cell apoptosis. Notably, complex 9 effectively inhibited tumor growth in the NCI-H460 xenograft mouse model with less adverse effect than cisplatin. Copyright © 2018 Elsevier Masson SAS. All rights reserved.
42 CFR 460.204 - Financial recordkeeping and reporting requirements.
2010-10-01
... 42 Public Health 4 2010-10-01 2010-10-01 false Financial recordkeeping and reporting requirements...-INCLUSIVE CARE FOR THE ELDERLY (PACE) Data Collection, Record Maintenance, and Reporting § 460.204 Financial... financial statements. (c) Accepted reporting practices. Except as specified under Medicare principles of...
Switalla, S; Lauenstein, L; Prenzler, F; Knothe, S; Förster, C; Fieguth, H-G; Pfennig, O; Schaumann, F; Martin, C; Guzman, C A; Ebensen, T; Müller, M; Hohlfeld, J M; Krug, N; Braun, A; Sewald, K
2010-08-01
Prediction of lung innate immune responses is critical for developing new drugs. Well-established immune modulators like lipopolysaccharides (LPS) can elicit a wide range of immunological effects. They are involved in acute lung diseases such as infections or chronic airway diseases such as COPD. LPS has a strong adjuvant activity, but its pyrogenicity has precluded therapeutic use. The bacterial lipopeptide MALP-2 and its synthetic derivative BPPcysMPEG are better tolerated. We have compared the effects of LPS and BPPcysMPEG on the innate immune response in human precision-cut lung slices. Cytokine responses were quantified by ELISA, Luminex, and Meso Scale Discovery technology. The initial response to LPS and BPPcysMPEG was marked by coordinated and significant release of the mediators IL-1β, MIP-1β, and IL-10 in viable PCLS. Stimulation of lung tissue with BPPcysMPEG, however, induced a differential response. While LPS upregulated IFN-γ, BPPcysMPEG did not. This traces back to their signaling pathways via TLR4 and TLR2/6. The calculated exposure doses selected for LPS covered ranges occurring in clinical studies with human beings. Correlation of obtained data with data from human BAL fluid after segmental provocation with endotoxin showed highly comparable effects, resulting in a coefficient of correlation >0.9. Furthermore, we were interested in modulating the response to LPS. Using dexamethasone as an immunosuppressive drug for anti-inflammatory therapy, we found a significant reduction of GM-CSF, IL-1β, and IFN-γ. The PCLS-model offers the unique opportunity to test the efficacy and toxicity of biological agents intended for use by inhalation in a complex setting in humans. Copyright © 2010 Elsevier Inc. All rights reserved.
Chen, Su-Yu; Chang, Chao-Lin; Chen, Teng-Hai; Chang, Ya-Wen; Lin, Shwu-Bin
2016-10-01
Three pentacyclic triterpene dilactones were isolated from the fruiting bodies of Ganoderma colossum, a medicinal mushroom. Colossolactone H (colo H) as a new compound and the most cytotoxic among the isolates was studied for its anticancer mechanism and the potential use in cancer therapy. Gene expression profiling analysis indicated that treatment of lung cancer cells with colo H caused upregulation of 252 genes and downregulation of 398 genes. Gene ontology enrichment analysis indicated that the downregulated genes were the most significantly enriched in cell cycle progression, and the upregulated genes were significantly enriched in metabolic process, cellular response to stimulus, and oxidation reduction. Accordingly, colo H was found to halt cell growth and induce cell apoptosis via the elevation of cellular reactive oxygen species to cause DNA damage and the increase of tumor suppressor p53 protein. These events facilitate additive cytotoxicity of colo H and gefitinib for gefitinib-resistant H1650 lung cancer cells. Furthermore, combination of colo H and gefitinib effectively inhibited the growth of tumor xenografts in athymic mice. In addition to the efficacy in adjunctive cancer therapy, we have also demonstrated the isolation of colo H from cultivated G. colossum. Thus it is feasible to use colo H or Ganoderma colossum for cancer therapy. Copyright © 2016. Published by Elsevier B.V.
Nuclear magnetic resonance relaxation times for human lung cancer and lung tissues
International Nuclear Information System (INIS)
Matsuura, Yoshifumi; Shioya, Sumie; Kurita, Daisaku; Ohta, Takashi; Haida, Munetaka; Ohta, Yasuyo; Suda, Syuichi; Fukuzaki, Minoru.
1994-01-01
We investigated the nuclear magnetic resonance (NMR) relaxation times, T 1 and T 2 , for lung cancer tissue, and other samples of lung tissue obtained from surgical specimens. The samples were nine squamous cell carcinomas, five necrotic squamous cell carcinomas, 15 adenocarcinomas, two benign mesotheliomas, and 13 fibrotic lungs. The relaxation times were measured with a 90 MHz NMR spectrometer and the results were correlated with histological changes. The values of T 1 and T 2 for squamous cell carcinoma and mesothelioma were significantly longer than those of adenocarcinoma and fibrotic lung tissue. There were no significant differences in values of T 1 and T 2 between adenocarcinoma and lung tissue. The values of T 1 and T 2 for benign mesothelioma were similar to those of squamous cell carcinoma, which suggested that increases in T 1 and T 2 are not specific to malignant tissues. (author)
Assessment of immunotoxicity induced by chemicals in human precision-cut lung slices (PCLS).
Lauenstein, L; Switalla, S; Prenzler, F; Seehase, S; Pfennig, O; Förster, C; Fieguth, H; Braun, A; Sewald, K
2014-06-01
Occupational asthma can be induced by a number of chemicals at the workplace. Risk assessment of potential sensitizers is mostly performed in animal experiments. With increasing public demand for alternative methods, human precision-cut lung slices (PCLS) have been developed as an ex vivo model. Human PCLS were exposed to increasing concentrations of 20 industrial chemicals including 4 respiratory allergens, 11 contact allergens, and 5 non-sensitizing irritants. Local respiratory irritation was characterized and expressed as 75% (EC25) and 50% (EC50) cell viability with respect to controls. Dose-response curves of all chemicals except for phenol were generated. Local respiratory inflammation was quantified by measuring the production of cytokines and chemokines. TNF-α and IL-1α were increased significantly in human PCLS after exposure to the respiratory sensitizers trimellitic anhydride (TMA) and ammonium hexachloroplatinate (HClPt) at subtoxic concentrations, while contact sensitizers and non-sensitizing irritants failed to induce the release of these cytokines to the same extent. Interestingly, significant increases in T(H)1/T(H)2 cytokines could be detected only after exposure to HClPt at a subtoxic concentration. In conclusion, allergen-induced cytokines were observed but not considered as biomarkers for the differentiation between respiratory and contact sensitizers. Our preliminary results show an ex vivo model which might be used for prediction of chemical-induced toxicity, but is due to its complex three-dimensional structure not applicable for a simple screening of functional and behavior changes of certain cell populations such as dendritic cells and T-cells in response to allergens. Copyright © 2014 The Authors. Published by Elsevier Ltd.. All rights reserved.
2010-04-01
... 20 Employees' Benefits 3 2010-04-01 2010-04-01 false What restrictions are there on the assignment of eligible applicants for nonresidential enrollment in Job Corps? 670.460 Section 670.460 Employees... WORKFORCE INVESTMENT ACT Recruitment, Eligibility, Screening, Selection and Assignment, and Enrollment § 670...
Srivastava, Ritesh Kumar; Rahman, Qamar; Kashyap, Mahendra Pratap; Lohani, Mohtashim; Pant, Aditya Bhushan
2011-01-01
We study the ameliorative potential of dimetylthiourea (DMTU), an OH• radical trapper and N-acetylcysteine (NAC), a glutathione precursor/H2O2 scavenger against titanium dioxide nanoparticles (TiO2-NPs) and multi-walled carbon nanotubes (MWCNTs) induced cyto-genotoxicity in cultured human lung cancer cells-A549. Cytogenotoxicity was induced by exposing the cells to selected concentrations (10 and 50 µg/ml) of either of TiO2-NPs or MWCNTs for 24 h. Anti-cytogenotoxicity effects of DMTU and NAC were studied in two groups, i.e., treatment of 30 minutes prior to toxic insult (short term exposure), while the other group received DMTU and NAC treatment during nanoparticles exposure, i.e., 24 h (long term exposure). Investigations were carried out for cell viability, generation of reactive oxygen species (ROS), micronuclei (MN), and expression of markers of oxidative stress (HSP27, CYP2E1), genotoxicity (P53) and CYP2E1 dependent n- nitrosodimethylamine-demethylase (NDMA-d) activity. In general, the treatment of both DMTU and NAC was found to be effective significantly against TiO2-NPs and MWCNTs induced cytogenotoxicity in A549 cells. Long-term treatment of DMTU and NAC during toxic insults has shown better prevention than short-term pretreatment. Although, cells responded significantly to both DMTU and NAC, but responses were chemical specific. In part, TiO2-NPs induced toxic responses were mediated through OH• radicals generation and reduction in the antioxidant defense system. While in the case of MWCNTs, adverse effects were primarily due to altering/hampering the enzymatic antioxidant system. Data indicate the applicability of human lung cancer cells-A549 as a pre-screening tool to identify the target specific prophylactic and therapeutic potential of drugs candidate molecules against nanoparticles induced cellular damages. PMID:21980536
Yen, Ching-Yu; Chiu, Chien-Chih; Chang, Fang-Rong; Chen, Jeff Yi-Fu; Hwang, Chi-Ching; Hseu, You-Cheng; Yang, Hsin-Ling; Lee, Alan Yueh-Luen; Tsai, Ming-Tz; Guo, Zong-Lun; Cheng, Yu-Shan; Liu, Yin-Chang; Lan, Yu-Hsuan; Chang, Yu-Ching; Ko, Ying-Chin; Chang, Hsueh-Wei; Wu, Yang-Chang
2010-02-18
The crude extract of the fruit bearing plant, Physalis peruviana (golden berry), demonstrated anti-hepatoma and anti-inflammatory activities. However, the cellular mechanism involved in this process is still unknown. Herein, we isolated the main pure compound, 4beta-Hydroxywithanolide (4betaHWE) derived from golden berries, and investigated its antiproliferative effect on a human lung cancer cell line (H1299) using survival, cell cycle, and apoptosis analyses. An alkaline comet-nuclear extract (NE) assay was used to evaluate the DNA damage due to the drug. It was shown that DNA damage was significantly induced by 1, 5, and 10 microg/mL 4betaHWE for 2 h in a dose-dependent manner (p < 0.005). A trypan blue exclusion assay showed that the proliferation of cells was inhibited by 4betaHWE in both dose- and time-dependent manners (p < 0.05 and 0.001 for 24 and 48 h, respectively). The half maximal inhibitory concentrations (IC50) of 4betaHWE in H1299 cells for 24 and 48 h were 0.6 and 0.71 microg/mL, respectively, suggesting it could be a potential therapeutic agent against lung cancer. In a flow cytometric analysis, 4betaHWE produced cell cycle perturbation in the form of sub-G1 accumulation and slight arrest at the G2/M phase with 1 microg/mL for 12 and 24 h, respectively. Using flow cytometric and annexin V/propidium iodide immunofluorescence double-staining techniques, these phenomena were proven to be apoptosis and complete G2/M arrest for H1299 cells treated with 5 microg/mL for 24 h. In this study, we demonstrated that golden berry-derived 4betaHWE is a potential DNA-damaging and chemotherapeutic agent against lung cancer.
International Nuclear Information System (INIS)
Yen, Ching-Yu; Guo, Zong-Lun; Cheng, Yu-Shan; Liu, Yin-Chang; Lan, Yu-Hsuan; Chang, Yu-Ching; Ko, Ying-Chin; Chang, Hsueh-Wei; Wu, Yang-Chang; Chiu, Chien-Chih; Chang, Fang-Rong; Chen, Jeff Yi-Fu; Hwang, Chi-Ching; Hseu, You-Cheng; Yang, Hsin-Ling; Lee, Alan Yueh-Luen; Tsai, Ming-Tz
2010-01-01
The crude extract of the fruit bearing plant, Physalis peruviana (golden berry), demonstrated anti-hepatoma and anti-inflammatory activities. However, the cellular mechanism involved in this process is still unknown. Herein, we isolated the main pure compound, 4β-Hydroxywithanolide (4βHWE) derived from golden berries, and investigated its antiproliferative effect on a human lung cancer cell line (H1299) using survival, cell cycle, and apoptosis analyses. An alkaline comet-nuclear extract (NE) assay was used to evaluate the DNA damage due to the drug. It was shown that DNA damage was significantly induced by 1, 5, and 10 μg/mL 4βHWE for 2 h in a dose-dependent manner (p < 0.005). A trypan blue exclusion assay showed that the proliferation of cells was inhibited by 4βHWE in both dose- and time-dependent manners (p < 0.05 and 0.001 for 24 and 48 h, respectively). The half maximal inhibitory concentrations (IC 50 ) of 4βHWE in H1299 cells for 24 and 48 h were 0.6 and 0.71 μg/mL, respectively, suggesting it could be a potential therapeutic agent against lung cancer. In a flow cytometric analysis, 4βHWE produced cell cycle perturbation in the form of sub-G 1 accumulation and slight arrest at the G 2 /M phase with 1 μg/mL for 12 and 24 h, respectively. Using flow cytometric and annexin V/propidium iodide immunofluorescence double-staining techniques, these phenomena were proven to be apoptosis and complete G 2 /M arrest for H1299 cells treated with 5 μg/mL for 24 h. In this study, we demonstrated that golden berry-derived 4βHWE is a potential DNA-damaging and chemotherapeutic agent against lung cancer
2010-01-01
Background The crude extract of the fruit bearing plant, Physalis peruviana (golden berry), demonstrated anti-hepatoma and anti-inflammatory activities. However, the cellular mechanism involved in this process is still unknown. Methods Herein, we isolated the main pure compound, 4β-Hydroxywithanolide (4βHWE) derived from golden berries, and investigated its antiproliferative effect on a human lung cancer cell line (H1299) using survival, cell cycle, and apoptosis analyses. An alkaline comet-nuclear extract (NE) assay was used to evaluate the DNA damage due to the drug. Results It was shown that DNA damage was significantly induced by 1, 5, and 10 μg/mL 4βHWE for 2 h in a dose-dependent manner (p < 0.005). A trypan blue exclusion assay showed that the proliferation of cells was inhibited by 4βHWE in both dose- and time-dependent manners (p < 0.05 and 0.001 for 24 and 48 h, respectively). The half maximal inhibitory concentrations (IC50) of 4βHWE in H1299 cells for 24 and 48 h were 0.6 and 0.71 μg/mL, respectively, suggesting it could be a potential therapeutic agent against lung cancer. In a flow cytometric analysis, 4βHWE produced cell cycle perturbation in the form of sub-G1 accumulation and slight arrest at the G2/M phase with 1 μg/mL for 12 and 24 h, respectively. Using flow cytometric and annexin V/propidium iodide immunofluorescence double-staining techniques, these phenomena were proven to be apoptosis and complete G2/M arrest for H1299 cells treated with 5 μg/mL for 24 h. Conclusions In this study, we demonstrated that golden berry-derived 4βHWE is a potential DNA-damaging and chemotherapeutic agent against lung cancer. PMID:20167063
Lung cells support osteosarcoma cell migration and survival.
Yu, Shibing; Fourman, Mitchell Stephen; Mahjoub, Adel; Mandell, Jonathan Brendan; Crasto, Jared Anthony; Greco, Nicholas Giuseppe; Weiss, Kurt Richard
2017-01-25
Osteosarcoma (OS) is the most common primary bone tumor, with a propensity to metastasize to the lungs. Five-year survival for metastatic OS is below 30%, and has not improved for several decades despite the introduction of multi-agent chemotherapy. Understanding OS cell migration to the lungs requires an evaluation of the lung microenvironment. Here we utilized an in vitro lung cell and OS cell co-culture model to explore the interactions between OS and lung cells, hypothesizing that lung cells would promote OS cell migration and survival. The impact of a novel anti-OS chemotherapy on OS migration and survival in the lung microenvironment was also examined. Three human OS cell lines (SJSA-1, Saos-2, U-2) and two human lung cell lines (HULEC-5a, MRC-5) were cultured according to American Type Culture Collection recommendations. Human lung cell lines were cultured in growth medium for 72 h to create conditioned media. OS proliferation was evaluated in lung co-culture and conditioned media microenvironment, with a murine fibroblast cell line (NIH-3 T3) in fresh growth medium as controls. Migration and invasion were measured using a real-time cell analysis system. Real-time PCR was utilized to probe for Aldehyde Dehydrogenase (ALDH1) expression. Osteosarcoma cells were also transduced with a lentivirus encoding for GFP to permit morphologic analysis with fluorescence microscopy. The anti-OS efficacy of Disulfiram, an ALDH-inhibitor previously shown to inhibit OS cell proliferation and metastasis in vitro, was evaluated in each microenvironment. Lung-cell conditioned medium promoted osteosarcoma cell migration, with a significantly higher attractive effect on all three osteosarcoma cell lines compared to basic growth medium, 10% serum containing medium, and NIH-3 T3 conditioned medium (p cell conditioned medium induced cell morphologic changes, as demonstrated with GFP-labeled cells. OS cells cultured in lung cell conditioned medium had increased alkaline
Zhang, Jing-Xi; Han, Yi-Ping; Bai, Chong; Li, Qiang
2015-01-01
Previous studies have shown that Astragalus polysaccharide (APS) can be applied to anti-cancer. However, the mechanism by which APS mediate this effect is unclear. In the present study, APS-mediated NSCLC cell apoptosis was investigated through the regulation of the notch signaling pathway. The cell viability was detected by the CCK8 assay. The mRNA and protein expression of notch1/3 and tumor suppressors were analyzed by RT-PCR and western blotting, respectively. The mRNA and protein of notch1 and notch3 were significantly up-regulated in tumor tissues as compared to non-tumor adjacent tissues. Treatment of human NSCLC cells with APS induced cell death in a dose-and time-dependent manner by using CCK8 assay. The mRNA and protein expression of notch1 and notch3 were significantly lower in NSCLC cells with APS treatment than that in control group. Moreover, western blotting analysis showed that treatment of H460 cells with APS significantly increased the pro-apoptotic Bax and caspase 8 levels, decreased the anti-apoptotic Bcl-2 level. Furthermore, p53, p21 and p16 were obviously up-regulated by APS treatment in H460 cell. This study demonstrated that APS-treated could inhibit proliferation and promote cell apoptosis, at least partially, through suppressing the expression of notch1 and notch3 and up-regulating the expression of tumor suppressors in H460 NSCLC cell lines.
Park, Woo Hyun
2018-02-01
Reactive oxygen species (ROS), especially hydrogen peroxide (H2O2), induce apoptosis in cancer cells by regulating mitogen-activated protein kinase (MAPK) signaling pathways. The present study investigated the effects of MAPK inhibitors on cell growth and death as well as changes in ROS and glutathione (GSH) levels in H2O2-treated Calu-6 and A549 lung cancer cells. H2O2 inhibited growth and induced death of Calu-6 and A549 lung cancer cells. All MAPK inhibitors appeared to enhance growth inhibition in H2O2-treated Calu-6 and A549 lung cancer cells and increased the percentage of Annexin V-FITC-positive cells in these cancer cells. Among the MAPK inhibitors, a JNK inhibitor significantly augmented the loss of mitochondrial membrane potential (MMP; ΔΨm) in H2O2-treated Calu-6 and A549 lung cancer cells. Intracellular ROS levels were significantly increased in the H2O2-treated cells at 1 and 24 h. Only the JNK inhibitor increased ROS levels in the H2O2-treated cells at 1 h and all MAPK inhibitors raised superoxide anion levels in these cells at 24 h. In addition, H2O2 induced GSH depletion in Calu-6 and A549 cells and the JNK inhibitor significantly enhanced GSH depletion in H2O2‑treated cells. Each of the MAPK inhibitors altered ROS and GSH levels differently in the Calu-6 and A549 control cells. In conclusion, H2O2 induced growth inhibition and death in lung cancer cells through oxidative stress and depletion of GSH. The enhanced effect of MAPK inhibitors, especially the JNK inhibitor, on cell death in H2O2-treated lung cancer cells was correlated with increased O2•- levels and GSH depletion.
Rivera, R T; Pasion, S G; Wong, D T; Fei, Y B; Biswas, D K
1989-06-01
A clonal strain of human lung tumor cells in culture (ChaGo), derived from a bronchogenic carcinoma, synthesizes and secretes large amounts of alpha (alpha) and a comparatively lower level of beta (beta) subunit of the glycoprotein hormone, human chorionic gonadotropin (HCG). ChaGo cells lost their characteristic anchorage-independent growth phenotype in the presence of anti-alpha-HCG antibody. The effect of the antibody was partially reversed by addition of alpha-HCG to the culture medium. ChaGo cells were transfected with an expression vector (pRSV-anti-alpha-HCG), that directs synthesis of RNA complementary to alpha-HCG mRNA. The transfectants produced alpha-HCG antisense RNA which was associated with the reduced level of alpha-HCG. Transfectants also displayed several altered phenotypic properties, including altered morphology, less mitosis, reduced growth rate, loss of anchorage-independent growth, and loss of tumorigenicity in nude mice. Treatment of transfectants with 8,bromo-cAMP resulted in increased accumulation of alpha-HCG mRNA, no change in the level of alpha-HCG antisense RNA, release of the inhibition of [3H]thymidine incorporation, and restoration of anchorage-independent growth phenotype. The overexpression of c-myc, observed in ChaGo cells, was unaffected by the reduced level of alpha-HCG. These results suggest that ectopic synthesis of the alpha subunit of HCG plays a functional role in the transformation of these human lung cells.
Aluminum is More Cytotoxic than Lunar Dust in Human Skin and Lung Fibroblasts
Hammond, D.; Shehata, T.; Hammond, D.; Shehata, T.; Wise, J.P.; Martino, J; Wise, J.P.; Wise, J.P.
2009-01-01
NASA plans to build a permanent space station on the moon to explore its surface. The surface of the moon is covered in lunar dust, which consists of fine particles that contain silicon, aluminum and titanium, among others. Because this will be a manned base, the potential toxicity of this dust has to be studied. Also, toxicity standards for potential exposure have to be set. To properly address the potential toxicity of lunar dust we need to understand the toxicity of its individual components, as well as their combined effects. In order to study this we compared NASA simulant JSC-1AVF (volcanic ash particles), that simulates the dust found on the moon, to aluminum, the 3rd most abundant component in lunar dust. We tested the cytotoxicity of both compounds on human lung and skin fibroblasts (WTHBF-6 and BJhTERT cell lines, respectively). Aluminum oxide was more cytotoxic than lunar dust to both cell lines. In human lung fibroblasts 5, 10 and 50 g/sq cm of aluminum oxide induced 85%, 61% and 30% relative survival, respectively. For human skin fibroblasts the same concentrations induced 58%, 41% and 58% relative survival. Lunar dust was also cytotoxic to both cell lines, but its effects were seen at higher concentrations: 50, 100, 200 and 400 g/sq cm of lunar dust induced a 69%, 46%, 35% and 30% relative survival in the skin cells and 53%, 16%, 8% and 2% on the lung cells. Overall, for both compounds, lung cells were more sensitive than skin cells. This work was supported by a NASA EPSCoR grant through the Maine Space Grant Consortium (JPW), the Maine Center for Toxicology and Environmental Health., a Fulbright Grant (JM) and a Delta Kappa Gamma Society International World Fellowship (JM).
Directory of Open Access Journals (Sweden)
Yang Cao
2017-05-01
Full Text Available Aim: The contribution of the inflammatory mediator interleukin-17 (IL-17 in nonsmall cell lung cancer (NSCLC malignancy has been reported in the literature. MicroRNA-181a-5p (miR-181a-5p acts as a tumor suppressor which can regulate target gene at the posttranscriptional level. Our study aimed to investigate the interaction between IL-17 and miR-181a-5p in NSCLC. Methods: 35 patients with NSCLC and 24 COPD controls were selected and examined in our study. In vitro, H226 and H460 cell lines were exposed to different doses (20, 40, 60, and 80 ng/mL of IL-17 to examine the effect of IL-17 on miR-181a-5p and vascular cell adhesion molecule 1 (VCAM-1 expression. MiR-181 mimic and miR-181a-5p inhibitor were transfected to explore the regulation of VCAM-1 as well as tumor cell proliferation and migration. Results: miR-181a-5p expression was downregulated, and IL-17 and VCAM-1 expression was upregulated in NSCLC tissues. Furthermore, IL-17 decreased miR-181a-5p expression but increased VCAM-1 expression in H226 and H460 cells. MiR-181 regulated VCAM-1 expression through binding to 3’-UTR sequence. MiR-181 attenuated tumor cell proliferation and migration. IL-17 modulated miR-181a-5p expression through activating NF-κB but not Stat3. Conclusion: Taken together, our data show the regulation of VCAM-1 expression by miR-181a-5p under IL-17 exposure, predicting a potential way for counteracting cancer metastasis.
Screening and Establishment of Human Lung Cancer Cell Lines with Organ-specific Metastasis Potential
Directory of Open Access Journals (Sweden)
Qinghua ZHOU
2014-03-01
Full Text Available Background and objective Cancer metastasis is not only the malignant marker and characteristics, but also the main cause of failure to cure and lose their life in the patients with lung cancer. Lung cancer metastasis has organ-specific characteristics. The most common sites of lung cancer metastasis are mediastinal lymph node, brain, bone, liver and adrenal gland. The aim of this study is to screen and establish lung cancer cell model with organ-specific metastasis potential with human high-metastatic large cell lung cancer cell line L9981 established by our laboratory previously, and to provide cell models for studying the mechanisms and signal regulation of organ-specific metastasis of lung cancer. Materials and methods The parent lung cancer cell line, L9981-Luc, was inoculated in the armpit of nude mice. The live animal imaging system, IVIS-200, was used to detect the lung cancer organ-specific metastasis every week. When the organ-specific metastasis were established, the nude mices bearing the lung cancer were sacrificed when they became moribund. Under sterile conditions, the organs (mediastinal lymph nodes, lung, spinal column and brain with lung cancer organ-specific metastasis were removed and the metastasized nodules were dissected free of connective tissue and blood clots, and rinsed twice with medium. The metastasized nodules were finely minced using sterile scalpel blades in medium, and the cells were seeded in tissue culture dishes. Then, the cells with organ-specific metastasis potential were reinoculated into the armpit of nude mice, respectively. This processes were repeated to establish the organ-specific metastatic sublines of L9981-Luc cell line more than 10 times. Finally, the organ-specific metastasis sublines of L9981-Luc were screened and established, which the four cell lines have the characteristics only metastasized to brian, lung, bone and mediastinal lymph node. Results A group of organ-specific metastasis cell
Walker, Douglas G; Whetzel, Alexis M; Serrano, Geidy; Sue, Lucia I; Lue, Lih-Fen; Beach, Thomas G
2016-09-01
Many factors affect the integrity of messenger RNA from human autopsy tissues including postmortem interval (PMI) between death and tissue preservation and the pre-mortem agonal and disease states. In this communication, we describe RNA isolation and characterization of 389 samples from 18 different tissues from elderly donors who were participants in a rapid whole-body autopsy program located in Sun City, Arizona ( www.brainandbodydonationprogram.org ). Most tissues were collected within a PMI of 2-6 h (median 3.15 h; N = 455), but for this study, tissue from cases with longer PMIs (1.25-29.25 h) were included. RNA quality was assessed by RNA integrity number (RIN) and total yield (ng RNA/mg tissue). RIN correlated with PMI for heart (r = -0.531, p = 0.009) and liver (r = -558, p = 0.0017), while RNA yield correlated with PMI for colon (r = -485, p = 0.016) and skin (r = -0.460, p = 0.031). RNAs with the lowest integrity were from skin and cervix where 22.7 and 31.4 % of samples respectively failed to produce intact RNA; by contrast all samples from esophagus, lymph node, jejunum, lung, stomach, submandibular gland and kidney produced RNA with measurable RINs. Expression levels in heart RNA of 4 common housekeeping normalization genes showed significant correlations of Ct values with RIN, but only one gene, glyceraldehyde-3 phosphate dehydrogenase, showed a correlation of Ct with PMI. There were no correlations between RIN values obtained for liver, adrenal, cervix, esophagus and lymph node and those obtained from corresponding brain samples. We show that high quality RNA can be produced from most human autopsy tissues, though with significant differences between tissues and donors. The RNA stability and yield did not depend solely on PMI; other undetermined factors are involved, but these do not include the age of the donor.
Abraham, Thomas; Kayra, Damian; Zhang, Angela; Suzuki, Masaru; McDonough, John; Elliott, W. M.; Cooper, Joel D.; Hogg, James C.
2013-02-01
Lung is a complex gas exchanger with interfacial area (where the gas exchange takes place) is about the size of a tennis court. Respiratory function is linked to the biomechanical stability of the gas exchange or alveolar regions which directly depends on the spatial distributions of the extracellular matrix fibers such fibrillar collagens and elastin fibers. It is very important to visualize and quantify these fibers at their native and inflated conditions to have correct morphometric information on differences between control and diseased states. This can be only achieved in the ex vivo states by imaging directly frozen lung specimens inflated to total lung capacity. Multiphoton microscopy, which uses ultra-short infrared laser pulses as the excitation source, produces multiphoton excitation fluorescence (MPEF) signals from endogenously fluorescent proteins (e.g. elastin) and induces specific second harmonic generation (SHG) signals from non-centrosymmetric proteins such as fibrillar collagens in fresh human lung tissues [J. Struct. Biol. (2010)171,189-196]. Here we report for the first time 3D image data obtained directly from thick frozen inflated lung specimens (~0.7- 1.0 millimeter thick) visualized at -60°C without prior fixation or staining in healthy and diseased states. Lung specimens donated for transplantation and released for research when no appropriate recipient was identified served as controls, and diseased lung specimens donated for research by patients receiving lung transplantation for very severe COPD (n=4) were prepared as previously described [N. Engl. J. Med. (2011) 201, 1567]. Lung slices evenly spaced between apex and base were examined using multiphoton microscopy while maintained at -60°C using a temperature controlled cold stage with a temperature resolution of 0.1°C. Infrared femto-second laser pulses tuned to 880nm, dry microscopic objectives, and non-de-scanned detectors/spectrophotometer located in the reflection geometry were
46 CFR 182.460 - Ventilation of spaces containing machinery powered by, or fuel tanks for, gasoline.
2010-10-01
... 46 Shipping 7 2010-10-01 2010-10-01 false Ventilation of spaces containing machinery powered by, or fuel tanks for, gasoline. 182.460 Section 182.460 Shipping COAST GUARD, DEPARTMENT OF HOMELAND..., gasoline. (a) A space containing machinery powered by, or fuel tanks for, gasoline must have a ventilation...
Directory of Open Access Journals (Sweden)
Song Zuoqing
2013-01-01
Full Text Available Our aim was to validate the effectiveness of steep pulse irreversible electroporation technology in human large cell lung cancer cells and to screen the optimal treatment of parameters for human large cell lung cancer cells. Three different sets of steep pulse therapy parameters were applied on the lung cancer cell line L9981. The cell line L9981 inhibition rate and proliferation capacity were detected by Vi-Cell vitality analysis and MTT. Steep pulsed irreversible electroporation technology for large cell lung cancer L9981 presents killing effects with various therapy parameters. The optimal treatment parameters are at a voltage amplitude of 2000V/cm, pulse width of 100μs, pulse frequency of 1 Hz, pulse number 10. With this group of parameters, steep pulse could have the best tumor cell-killing effects.
Cigarette smoke alters the secretome of lung epithelial cells.
Mossina, Alessandra; Lukas, Christina; Merl-Pham, Juliane; Uhl, Franziska E; Mutze, Kathrin; Schamberger, Andrea; Staab-Weijnitz, Claudia; Jia, Jie; Yildirim, Ali Ö; Königshoff, Melanie; Hauck, Stefanie M; Eickelberg, Oliver; Meiners, Silke
2017-01-01
Cigarette smoke is the most relevant risk factor for the development of lung cancer and chronic obstructive pulmonary disease. Many of its more than 4500 chemicals are highly reactive, thereby altering protein structure and function. Here, we used subcellular fractionation coupled to label-free quantitative MS to globally assess alterations in the proteome of different compartments of lung epithelial cells upon exposure to cigarette smoke extract. Proteomic profiling of the human alveolar derived cell line A549 revealed the most pronounced changes within the cellular secretome with preferential downregulation of proteins involved in wound healing and extracellular matrix organization. In particular, secretion of secreted protein acidic and rich in cysteine, a matricellular protein that functions in tissue response to injury, was consistently diminished by cigarette smoke extract in various pulmonary epithelial cell lines and primary cells of human and mouse origin as well as in mouse ex vivo lung tissue cultures. Our study reveals a previously unrecognized acute response of lung epithelial cells to cigarette smoke that includes altered secretion of proteins involved in extracellular matrix organization and wound healing. This may contribute to sustained alterations in tissue remodeling as observed in lung cancer and chronic obstructive pulmonary disease. © 2016 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim.
Directory of Open Access Journals (Sweden)
Joshua D Powell
Full Text Available Swine-origin H3N2v, a variant of H3N2 influenza virus, is a concern for novel reassortment with circulating pandemic H1N1 influenza virus (H1N1pdm09 in swine because this can lead to the emergence of a novel pandemic virus. In this study, the reassortment prevalence of H3N2v with H1N1pdm09 was determined in swine cells. Reassortants evaluated showed that the H1N1pdm09 polymerase (PA segment occurred within swine H3N2 with ∼ 80% frequency. The swine H3N2-human H1N1pdm09 PA reassortant (swH3N2-huPA showed enhanced replication in swine cells, and was the dominant gene constellation. Ferrets infected with swH3N2-huPA had increased lung pathogenicity compared to parent viruses; however, swH3N2-huPA replication in normal human bronchoepithelial cells was attenuated - a feature linked to expression of IFN-β and IFN-λ genes in human but not swine cells. These findings indicate that emergence of novel H3N2v influenza constellations require more than changes in the viral polymerase complex to overcome barriers to cross-species transmission. Additionally, these findings reveal that while the ferret model is highly informative for influenza studies, slight differences in pathogenicity may not necessarily be indicative of human outcomes after infection.
Gil Cano, A; Gracia Romero, M; Monge García, M I; Guijo González, P; Ruiz Campos, J
2017-04-01
A study is made of the influence of preemptive hemodynamic intervention restricting fluid administration upon the development of oleic acid-induced lung injury. A randomized in vivo study in rabbits was carried out. University research laboratory. Sixteen anesthetized, mechanically ventilated rabbits. Hemodynamic measurements obtained by transesophageal Doppler signal. Respiratory mechanics computed by a least square fitting method. Lung edema assessed by the ratio of wet weight to dry weight of the right lung. Histological examination of the left lung. Animals were randomly assigned to either the early protective lung strategy (EPLS) (n=8) or the early protective hemodynamic strategy (EPHS) (n=8). In both groups, lung injury was induced by the intravenous infusion of oleic acid (OA) (0.133mlkg -1 h -1 for 2h). At the same time, the EPLS group received 15mlkg -1 h -1 of Ringer lactate solution, while the EPHS group received 30mlkg -1 h -1 . Measurements were obtained at baseline and 1 and 2h after starting OA infusion. After 2h, the cardiac index decreased in the EPLS group (p<0.05), whereas in the EPHS group it remained unchanged. Lung compliance decreased significantly only in the EPHS group (p<0.05). Lung edema was greater in the EPHS group (p<0.05). Histological damage proved similar in both groups (p=0.4). In this experimental model of early lung injury, lung edema progression was attenuated by preemptively restricting the administration of fluids. Copyright © 2016 Elsevier España, S.L.U. y SEMICYUC. All rights reserved.
International Nuclear Information System (INIS)
Wang Lu; Zou Yue; Jiang Qisheng; Li Wei; Song Xiujun; Zhou Xiangyan; Wang Cuilan
2011-01-01
Objective: To study the dose-and time-effects of X-ray irradiation on the expression of Pokemon gene in A549 cells of human lung adenocarcinoma. Methods: A549 cells were cultured in vitro and exposed to X-rays with the doses of 2, 4, 6 and 8 Gy, respectively. Untreated A549 cells were used as control group. The relative levels of Pokemon mRNA expression in the cells were detected by using quantitative real-time PCR at 2, 4, 8, 12, 24, 48 and 72 h after irradiation. Results: The Pokemon mRNA expression levels decreased in the early period after irradiation (except 2 and 4 h after irradiation in 2 Gy group) and then increased in the later stage (48 h after irradiation) with significant statistical differences at the most time points in comparison with the control group (t=3.40-154.76, P<0.05). Conclusions: Higher doses of X-rays may degrade the expression of Pokemon mRNA in the human A549 cells and induce apoptosis in the early period, hut also may upgrade its expression in the later period, which might be correlated with the cell cycle regulation and DNA damage repair in the A549 cells. (authors)
Poerschke, Robyn L.; Moos, Philip J.
2010-01-01
Thioredoxin reductase (TR1) is a selenoprotein that is involved in cellular redox status control and deoxyribonucleotide biosynthesis. Many cancers, including lung, overexpress TR1, making it a potential cancer therapy target. Previous work has shown that TR1 knockdown enhances the sensitivity of cancer cells to anticancer treatments, as well as certain selenocompounds. However, it is unknown if TR1 knockdown produces similar effect on the sensitivity of human lung cancer cells. To further elucidate the role of TR1 in the mechanism of selenocompounds in lung cancer, a lentiviral microRNA delivery system to knockdown TR1 expression in A549 human lung adenocarcinoma cells was utilized. Cell viability was assessed after 48 hr treatment with the selenocysteine prodrug selenazolidines 2-butylselenazolidine-4(R)-carboxylic acid (BSCA) and 2-cyclohexylselenazolidine-4-(R)-carboxylic acid (ChSCA), selenocystine (SECY), methylseleninic acid (MSA), 1,4-phenylenebis(methylene)selenocyanate (p-XSC), and selenomethionine (SEM). TR1 knockdown increased the cytotoxicity of BSCA, ChSCA, and SECY but did not sensitize cells to MSA, SEM, or p-XSC. GSH and TR1 depletion together decreased cell viability, while no change was observed with GSH depletion alone. Reactive oxygen species generation was induced only in TR1 knockdown cells treated with the selenazolidines or SECY. These three compounds also decreased total intracellular glutathione levels and oxidized thioredoxin, but in a TR1 independent manner. TR1 knockdown increased selenazolidine and SECY-induced mitochondrial membrane depolarization, as well as DNA strand breaks and AIF translocation from the mitochondria. These results indicate the ability of TR1 to modulate the cytotoxic effects of BSCA, ChSCA and SECY in human lung cancer cells through mitochondrial dysfunction. PMID:20920480
26 CFR 1.460-2 - Long-term manufacturing contracts.
2010-04-01
... time normally required to design and manufacture the first unit of an item for which the taxpayer... manufacture a new type of industrial equipment. C reasonably expects the normal production period for this... 26 Internal Revenue 6 2010-04-01 2010-04-01 false Long-term manufacturing contracts. 1.460-2...
Aging effects on airflow dynamics and lung function in human bronchioles.
Kim, JongWon; Heise, Rebecca L; Reynolds, Angela M; Pidaparti, Ramana M
2017-01-01
The mortality rate for patients requiring mechanical ventilation is about 35% and this rate increases to about 53% for the elderly. In general, with increasing age, the dynamic lung function and respiratory mechanics are compromised, and several experiments are being conducted to estimate these changes and understand the underlying mechanisms to better treat elderly patients. Human tracheobronchial (G1 ~ G9), bronchioles (G10 ~ G22) and alveolar sacs (G23) geometric models were developed based on reported anatomical dimensions for a 50 and an 80-year-old subject. The aged model was developed by altering the geometry and material properties of the model developed for the 50-year-old. Computational simulations using coupled fluid-solid analysis were performed for geometric models of bronchioles and alveolar sacs under mechanical ventilation to estimate the airflow and lung function characteristics. The airway mechanical characteristics decreased with aging, specifically a 38% pressure drop was observed for the 80-year-old as compared to the 50-year-old. The shear stress on airway walls increased with aging and the highest shear stress was observed in the 80-year-old during inhalation. A 50% increase in peak strain was observed for the 80-year-old as compared to the 50-year-old during exhalation. The simulation results indicate that there is a 41% increase in lung compliance and a 35%-50% change in airway mechanical characteristics for the 80-year-old in comparison to the 50-year-old. Overall, the airway mechanical characteristics as well as lung function are compromised due to aging. Our study demonstrates and quantifies the effects of aging on the airflow dynamics and lung capacity. These changes in the aging lung are important considerations for mechanical ventilation parameters in elderly patients. Realistic geometry and material properties need to be included in the computational models in future studies.
Directory of Open Access Journals (Sweden)
Chow Katherine S
2011-07-01
Full Text Available Abstract Background Outdoor air pollution, given its demonstrated negative effects on the respiratory system, is a growing public health concern worldwide, particularly in urban cities. Human exposure to pollutants such as ozone, nitrogen oxides, combustion-related particulate matter and oxides of sulfur is responsible for significant cardiopulmonary morbidity and mortality in both adults and children. Several antioxidants have shown an ability to partially attenuate the negative physiological and functional impacts of air pollutants. This study systematically presents current data on the potential benefits of antioxidant supplementation on lung function outcomes associated with air pollutant exposures in intact humans. Methods Electronic databases (MEDLINE, EMBASE, BIOSIS Previews, Web of Sciences, Environmental Sciences & Pollution Management and TOXNET were systematically searched for all studies published up to April 2009. Search terms relating to the concepts of respiratory tract diseases, respiratory function tests, air pollution, and antioxidants were used. Data was systematically abstracted from original articles that satisfied selection criteria for inclusion. For inclusion, the studies needed to have evaluated human subjects, given supplemental antioxidants, under conditions of known levels of air pollutants with measured lung function before and after antioxidant administration and/or air pollution exposure. Selected studies were summarized and conclusions presented. Results Eight studies investigated the role of antioxidant supplementation on measured lung function outcomes after subject exposure to air pollutants under controlled conditions; 5 of these studies concluded that pollutant-induced airway hyper-responsiveness and diminution in lung function measurements were attenuated by antioxidant supplementation. The remaining five studies took place under ambient (uncontrolled exposures and unanimously concluded that antioxidant
Age related changes in steroid receptors on cultured lung fibroblasts
International Nuclear Information System (INIS)
Barile, F.A.; Bienkowski, R.S.
1986-01-01
The number of high affinity glucocorticoid receptors (Ro) on human fetal lung fibroblasts decreases as the cells age in vitro, and it has been suggested that these cell systems may be useful models of age-related changes in vivo. They examined the relation between change in Ro with in vitro aging and donor age. Confluent monolayers of lung fibroblasts at various population doubling levels (PDL), were incubated with ( 3 H)-dexamethasone (( 3 H)Dex) either alone or with excess (.01 mM) Dex. Specific binding was calculated as the difference between radioactivity in cells incubated with and without unlabeled Dex; Scatchard plots were used to analyze the data. Ro, measured as fmol ( 3 H)Dex/10 6 cells, for two lines of human fetal cells (HFL-1 and MRC-5) decreased with increasing age in vitro. However, human newborn (CRL-1485) and adult (CCL-201) cells and fetal rabbit cells (FAB-290), showed increases in Ro with continuous passage. For each cell line, the affinity constant (K/sub d/) did not change significantly with passage. They conclude that the direction of changes in steroid receptor levels on cells aging in vitro is influenced by donor age and species. Caution should be used in applying results obtained from model systems to aging organisms
A 3D Human Lung Tissue Model for Functional Studies on Mycobacterium tuberculosis Infection.
Braian, Clara; Svensson, Mattias; Brighenti, Susanna; Lerm, Maria; Parasa, Venkata R
2015-10-05
Tuberculosis (TB) still holds a major threat to the health of people worldwide, and there is a need for cost-efficient but reliable models to help us understand the disease mechanisms and advance the discoveries of new treatment options. In vitro cell cultures of monolayers or co-cultures lack the three-dimensional (3D) environment and tissue responses. Herein, we describe an innovative in vitro model of a human lung tissue, which holds promise to be an effective tool for studying the complex events that occur during infection with Mycobacterium tuberculosis (M. tuberculosis). The 3D tissue model consists of tissue-specific epithelial cells and fibroblasts, which are cultured in a matrix of collagen on top of a porous membrane. Upon air exposure, the epithelial cells stratify and secrete mucus at the apical side. By introducing human primary macrophages infected with M. tuberculosis to the tissue model, we have shown that immune cells migrate into the infected-tissue and form early stages of TB granuloma. These structures recapitulate the distinct feature of human TB, the granuloma, which is fundamentally different or not commonly observed in widely used experimental animal models. This organotypic culture method enables the 3D visualization and robust quantitative analysis that provides pivotal information on spatial and temporal features of host cell-pathogen interactions. Taken together, the lung tissue model provides a physiologically relevant tissue micro-environment for studies on TB. Thus, the lung tissue model has potential implications for both basic mechanistic and applied studies. Importantly, the model allows addition or manipulation of individual cell types, which thereby widens its use for modelling a variety of infectious diseases that affect the lungs.
Ito, Yoko; Correll, Kelly; Schiel, John A; Finigan, Jay H; Prekeris, Rytis; Mason, Robert J
2014-07-01
There are 190,600 cases of acute lung injury/acute respiratory distress syndrome (ALI/ARDS) each year in the United States, and the incidence and mortality of ALI/ARDS increase dramatically with age. Patients with ALI/ARDS have alveolar epithelial injury, which may be worsened by high-pressure mechanical ventilation. Alveolar type II (ATII) cells are the progenitor cells for the alveolar epithelium and are required to reestablish the alveolar epithelium during the recovery process from ALI/ARDS. Lung fibroblasts (FBs) migrate and proliferate early after lung injury and likely are an important source of growth factors for epithelial repair. However, how lung FBs affect epithelial wound healing in the human adult lung has not been investigated in detail. Hepatocyte growth factor (HGF) is known to be released mainly from FBs and to stimulate both migration and proliferation of primary rat ATII cells. HGF is also increased in lung tissue, bronchoalveolar lavage fluid, and serum in patients with ALI/ARDS. Therefore, we hypothesized that HGF secreted by FBs would enhance wound closure in alveolar epithelial cells (AECs). Wound closure was measured using a scratch wound-healing assay in primary human AEC monolayers and in a coculture system with FBs. We found that wound closure was accelerated by FBs mainly through HGF/c-Met signaling. HGF also restored impaired wound healing in AECs from the elderly subjects and after exposure to cyclic stretch. We conclude that HGF is the critical factor released from FBs to close wounds in human AEC monolayers and suggest that HGF is a potential strategy for hastening alveolar repair in patients with ALI/ARDS. Copyright © 2014 the American Physiological Society.
Qi, Li; Pujanauski, Lindsey M; Davis, A Sally; Schwartzman, Louis M; Chertow, Daniel S; Baxter, David; Scherler, Kelsey; Hartshorn, Kevan L; Slemons, Richard D; Walters, Kathie-Anne; Kash, John C; Taubenberger, Jeffery K
2014-11-18
Zoonotic avian influenza virus infections may lead to epidemics or pandemics. The 1918 pandemic influenza virus has an avian influenza virus-like genome, and its H1 hemagglutinin was identified as a key mammalian virulence factor. A chimeric 1918 virus expressing a contemporary avian H1 hemagglutinin, however, displayed murine pathogenicity indistinguishable from that of the 1918 virus. Here, isogenic chimeric avian influenza viruses were constructed on an avian influenza virus backbone, differing only by hemagglutinin subtype expressed. Viruses expressing the avian H1, H6, H7, H10, and H15 subtypes were pathogenic in mice and cytopathic in normal human bronchial epithelial cells, in contrast to H2-, H3-, H5-, H9-, H11-, H13-, H14-, and H16-expressing viruses. Mouse pathogenicity was associated with pulmonary macrophage and neutrophil recruitment. These data suggest that avian influenza virus hemagglutinins H1, H6, H7, H10, and H15 contain inherent mammalian virulence factors and likely share a key virulence property of the 1918 virus. Consequently, zoonotic infections with avian influenza viruses bearing one of these hemagglutinins may cause enhanced disease in mammals. Influenza viruses from birds can cause outbreaks in humans and may contribute to the development of pandemics. The 1918 pandemic influenza virus has an avian influenza virus-like genome, and its main surface protein, an H1 subtype hemagglutinin, was identified as a key mammalian virulence factor. In a previous study, a 1918 virus expressing an avian H1 gene was as virulent in mice as the reconstructed 1918 virus. Here, a set of avian influenza viruses was constructed, differing only by hemagglutinin subtype. Viruses with the avian H1, H6, H7, H10, and H15 subtypes caused severe disease in mice and damaged human lung cells. Consequently, infections with avian influenza viruses bearing one of these hemagglutinins may cause enhanced disease in mammals, and therefore surveillance for human infections
16 CFR 460.15 - How installers must handle fact sheets.
2010-01-01
... ADVERTISING OF HOME INSULATION § 460.15 How installers must handle fact sheets. If you are an installer, you... from you, you must show them the fact sheet(s) for the type(s) of insulation they want. You can decide...
Dim light adaptation attenuates acute melatonin suppression in humans.
Jasser, Samar A; Hanifin, John P; Rollag, Mark D; Brainard, George C
2006-10-01
Abstract Studies in rodents with retinal degeneration indicated that neither the rod nor the cone photoreceptors obligatorily participate in circadian responses to light, including melatonin suppression and photoperiodic response. Yet there is a residual phase-shifting response in melanopsin knockout mice, which suggests an alternate or redundant means for light input to the SCN of the hypothalamus. The findings of Aggelopoulos and Meissl suggest a complex, dynamic interrelationship between the classic visual photoreceptors and SCN cell sensitivity to light stimuli, relative to various adaptive lighting conditions. These studies raised the possibility that the phototransductive physiology of the retinohypothalamic tract in humans might be modulated by the visual rod and cone photoreceptors. The aim of the following two-part study was to test the hypothesis that dim light adaptation will dampen the subsequent suppression of melatonin by monochromatic light in healthy human subjects. Each experiment included 5 female and 3 male human subjects between the ages of 18 and 30 years, with normal color vision. Dim white light and darkness adaptation exposures occurred between midnight and 0200 h, and a full-field 460-nm light exposure subsequently occurred between 0200 and 0330-h for each adaptation condition, at 2 different intensities. Plasma samples were drawn following the 2-h adaptation, as well as after the 460-nm monochromatic light exposure, and melatonin was measured by radioimmunoassay. Comparison of melatonin suppression responses to monochromatic light in both studies revealed a loss of significant suppression after dim white light adaptation compared with dark adaptation (p light exposure, varying with the conditions of light adaptation prior to exposure.
Quality Assurance program plan - plutonium stabilization and handling project W-460
International Nuclear Information System (INIS)
SCHULTZ, J.W.
1999-01-01
This Quality Assurance Program Plan (QAPP) identifies Project Quality Assurance (QA) program requirements for all parties participating in the design, procurement, demolition, construction, installation, inspection and testing for Project W-460
Directory of Open Access Journals (Sweden)
Su Xue-Feng
2010-05-01
Full Text Available Abstract Background Lung epithelial Na+ channels (ENaC are regulated by cell Ca2+ signal, which may contribute to calcium antagonist-induced noncardiogenic lung edema. Although K+ channel modulators regulate ENaC activity in normal lungs, the therapeutical relevance and the underlying mechanisms have not been completely explored. We hypothesized that K+ channel openers may restore calcium channel blocker-inhibited alveolar fluid clearance (AFC by up-regulating both apical and basolateral ion transport. Methods Verapamil-induced depression of heterologously expressed human αβγ ENaC in Xenopus oocytes, apical and basolateral ion transport in monolayers of human lung epithelial cells (H441, and in vivo alveolar fluid clearance were measured, respectively, using the two-electrode voltage clamp, Ussing chamber, and BSA protein assays. Ca2+ signal in H441 cells was analyzed using Fluo 4AM. Results The rate of in vivo AFC was reduced significantly (40.6 ± 6.3% of control, P Ca3.1 (1-EBIO and KATP (minoxidil channel openers significantly recovered AFC. In addition to short-circuit current (Isc in intact H441 monolayers, both apical and basolateral Isc levels were reduced by verapamil in permeabilized monolayers. Moreover, verapamil significantly altered Ca2+ signal evoked by ionomycin in H441 cells. Depletion of cytosolic Ca2+ in αβγ ENaC-expressing oocytes completely abolished verapamil-induced inhibition. Intriguingly, KV (pyrithione-Na, K Ca3.1 (1-EBIO, and KATP (minoxidil channel openers almost completely restored the verapamil-induced decrease in Isc levels by diversely up-regulating apical and basolateral Na+ and K+ transport pathways. Conclusions Our observations demonstrate that K+ channel openers are capable of rescuing reduced vectorial Na+ transport across lung epithelial cells with impaired Ca2+ signal.
Rajavel, Tamilselvam; Packiyaraj, Pandian; Suryanarayanan, Venkatesan; Singh, Sanjeev Kumar; Ruckmani, Kandasamy; Pandima Devi, Kasi
2018-02-01
β-Sitosterol (BS), a major bioactive constituent present in plants and vegetables has shown potent anticancer effect against many human cancer cells, but the underlying mechanism remain elusive on NSCLC cancers. We found that BS significantly inhibited the growth of A549 cells without harming normal human lung and PBMC cells. Further, BS treatment triggered apoptosis via ROS mediated mitochondrial dysregulation as evidenced by caspase-3 & 9 activation, Annexin-V/PI positive cells, PARP inactivation, loss of MMP, Bcl-2-Bax ratio alteration and cytochrome c release. Moreover, generation of ROS species and subsequent DNA stand break were found upon BS treatment which was reversed by addition of ROS scavenger (NAC). Indeed BS treatment increased p53 expression and its phosphorylation at Ser15, while silencing the p53 expression by pifithrin-α, BS induced apoptosis was reduced in A549 cells. Furthermore, BS induced apoptosis was also observed in NCI-H460 cells (p53 wild) but not in the NCI-H23 cells (p53 mutant). Down-regulation of Trx/Trx1 reductase contributed to the BS induced ROS accumulation and mitochondrial mediated apoptotic cell death in A549 and NCI-H460 cells. Taken together, our findings provide evidence for the novel anti-cancer mechanism of BS which could be developed as a promising chemotherapeutic drug against NSCLC cancers.
Leonard, Bobby E.; Thompson, Richard E.; Beecher, Georgia C.
2010-01-01
In the prior Part I, the potential influence of the low level alpha radiation induced bystander effect (BE) on human lung cancer risks was examined. Recent analysis of adaptive response (AR) research results with a Microdose Model has shown that single low LET radiation induced charged particles traversals through the cell nucleus activates AR. We have here conducted an analysis based on what is presently known about adaptive response and the bystander effect (BE) and what new research is needed that can assist in the further evaluation human cancer risks from radon. We find that, at the UNSCEAR (2000) worldwide average human exposures from natural background and man-made radiations, the human lung receives about a 25% adaptive response protection against the radon alpha bystander damage. At the UNSCEAR (2000) minimum range of background exposure levels, the lung receives minimal AR protection but at higher background levels, in the high UNSCEAR (2000) range, the lung receives essentially 100% protection from both the radon alpha damage and also the endogenic, spontaneously occurring, potentially carcinogenic, lung cellular damage. PMID:22461760
Cellular morphometry of the bronchi of human and dog lungs
International Nuclear Information System (INIS)
Robbins, E.S.
1991-03-01
One hundred and thirty-one bronchial samples from 62 patients have been dissected by generation from fixed surgical lung specimens obtained after the removal of pathological lesions. Complete patient records including occupational and smoking histories, as well as possible exposure to radon, are obtained. In addition, one hundred and sixty-two mongol dog bronchi dissected from different lobes of 23 dog lungs have also been similarly prepared. Ninety-four human samples have been completely processed for electron microscopy and have yielded 994 electron micrographs of which 532 have been entered into the Computerized Stereological Analysis System (COSAS) and been used for the measurement of the distances of basal and mucous cell nuclei to the epithelial free surface. Similarly 240 micrographs of dog epithelium from 31 bronchial samples have been entered into COSAS. We have, using the COSAS planimetry program, established data bases which describe the volume density and nuclear numbers per electron micrograph for 5 cell types of the human bronchial epithelial lining of men and women, as well as smokers, non-smokers and ex-smokers and similar parameters for the epithelial cell types of dog bronchi. The data are being used to develop weighting factors for dosimetry and radon risk analysis. 26 refs., 7 figs., 4 tabs
DEPOSITION DISTRICUTION AMONG THE PARALLEL PATHWAYS IN THE HUMAN LUNG CONDUCTING AIRWAY STRUCTURE.
DEPOSITION DISTRIBUTION AMONG THE PARALLEL PATHWAYS IN THE HUMAN LUNG CONDUCTING AIRWAY STRUCTURE. Chong S. Kim*, USEPA National Health and Environmental Effects Research Lab. RTP, NC 27711; Z. Zhang and C. Kleinstreuer, Department of Mechanical and Aerospace Engineering, North C...
DEFF Research Database (Denmark)
Garnett, E S; Webber, C E; Coates, G
1977-01-01
The density of a defined volume of the human lung can be measured in vivo by a new noninvasive technique. A beam of gamma-rays is directed at the lung and, by measuring the scattered gamma-rays, lung density is calculated. The density in the lower lobe of the right lung in normal man during quiet...... breathing in the sitting position ranged from 0.25 to 0.37 g.cm-3. Subnormal values were found in patients with emphsema. In patients with pulmonary congestion and edema, lung density values ranged from 0.33 to 0.93 g.cm-3. The lung density measurement correlated well with the findings in chest radiographs...... but the lung density values were more sensitive indices. This was particularly evident in serial observations of individual patients....
Al-Sheddi, Ebtesam Saad; Farshori, Nida Nayyar; Al-Oqail, Mai Mohammad; Musarrat, Javed; Al-Khedhairy, Abdulaziz Ali; Siddiqui, Maqsood Ahmed
2015-01-01
Portulaca oleracea (Family: Portulacaceae), is well known for its anti-inflammatory, antioxidative, anti- bacterial, and anti-tumor activities. However, cytotoxic effects of seed oil of Portulaca oleracea against human liver cancer (HepG2) and human lung cancer (A-549) cell lines have not been studied previously. Therefore, the present study was designed to investigate the cytotoxic effects of Portulaca oleracea seed oil on HepG2 and A-549 cell lines. Both cell lines were exposed to various concentrations of Portulaca oleracea seed oil for 24h. After the exposure, percentage cell viability was studied by (3-(4,5-dimethylthiazol-2-yl)-2,5-diphenyltetrazolium bromide) (MTT), neutral red uptake (NRU) assays, and cellular morphology by phase contrast inverted microscopy. The results showed a concentration-dependent significant reduction in the percentage cell viability and an alteration in the cellular morphology of HepG2 and A-549 cells. The percentage cell viability was recorded as 73%, 63%, and 54% by MTT assay and 76%, 61%, and 50% by NRU assay at 250, 500, and 1000 μg/ml, respectively in HepG2 cells. Percentage cell viability was recorded as 82%, 72%, and 64% by MTT assay and 83%, 68%, and 56% by NRU assay at 250, 500, and 1000 μg/ml, respectively in A-549 cells. The 100 μg/ml and lower concentrations were found to be non cytotoxic to A-549 cells, whereas decrease of 14% and 12% were recorded by MTT and NRU assay, respectively in HepG2 cells. Both HepG2 and A-549 cell lines exposed to 250, 500, and 1000 μg/ ml of Portulaca oleracea seed oil lost their normal morphology, cell adhesion capacity, become rounded, and appeared smaller in size. The data from this study showed that exposure to seed oil of Portulaca oleracea resulted in significant cytotoxicity and inhibition of growth of the human liver cancer (HepG2) and human lung cancer (A-549) cell lines.
International Nuclear Information System (INIS)
Fujii, Tadashige; Tanaka, Masao; Yazaki, Yoshikazu; Kitabayashi, Hiroshi; Koizumi, Tomonori; Sekiguchi, Morie; Gomi, Tsutomu; Yano, Kesato; Itoh, Atsuko.
1997-01-01
123 I-metaiodobenzylguanidine (MIBG) myocardial scintigraphy was performed in 64 patients with heart and lung diseases. Distribution of MIBG in the chest was evaluated by planar images, using counts ratios of the heart to the mediastinum (H/M) and the unilateral lung to the mediastinum (Lu/M). Most of patients with heart diseases showed obvious lung uptake of MIBG. The ratios of H/M were 1.75±0.20 in the group without heart failure and 1.55±0.19 in the group with heart failure. The ratios of Lu/M in the right and left lung were 1.56±0.16 and 1.28±0.16 in the group without heart failure. And those were 1.45±0.16 and 1.19±0.15 in the group with heart failure. But 3 patients complicated with chronic pulmonary emphysema and one patient with interstitial pneumonia due to dermatomyositis showed markedly decreased lung uptake. The ratios of Lu/M in the right and left lung of these patients were 1.20, 1.17; 1.17, 1.13; 1.01, 0.97 and 1.27, 0.94, respectively. These results suggest that the lung uptake of MIBG may reflect the state of pulmonary endothelial cell function in clinical situations, considering that it has been demonstrated that MIBG may be useful as a marker of pulmonary endothelial cell function in the isolated rat lung. (author)
Proteasome inhibitors block DNA repair and radiosensitize non-small cell lung cancer.
Directory of Open Access Journals (Sweden)
Kyle R Cron
Full Text Available Despite optimal radiation therapy (RT, chemotherapy and/or surgery, a majority of patients with locally advanced non-small cell lung cancer (NSCLC fail treatment. To identify novel gene targets for improved tumor control, we performed whole genome RNAi screens to identify knockdowns that most reproducibly increase NSCLC cytotoxicity. These screens identified several proteasome subunits among top hits, including the topmost hit PSMA1, a component of the core 20 S proteasome. Radiation and proteasome inhibition showed synergistic effects. Proteasome inhibition resulted in an 80-90% decrease in homologous recombination (HR, a 50% decrease in expression of NF-κB-inducible HR genes BRCA1 and FANCD2, and a reduction of BRCA1, FANCD2 and RAD51 ionizing radiation-induced foci. IκBα RNAi knockdown rescued NSCLC radioresistance. Irradiation of mice with NCI-H460 xenografts after inducible PSMA1 shRNA knockdown markedly increased murine survival compared to either treatment alone. Proteasome inhibition is a promising strategy for NSCLC radiosensitization via inhibition of NF-κB-mediated expression of Fanconi Anemia/HR DNA repair genes.
Human airway organoid engineering as a step toward lung regeneration and disease modeling.
Tan, Qi; Choi, Kyoung Moo; Sicard, Delphine; Tschumperlin, Daniel J
2017-01-01
Organoids represent both a potentially powerful tool for the study cell-cell interactions within tissue-like environments, and a platform for tissue regenerative approaches. The development of lung tissue-like organoids from human adult-derived cells has not previously been reported. Here we combined human adult primary bronchial epithelial cells, lung fibroblasts, and lung microvascular endothelial cells in supportive 3D culture conditions to generate airway organoids. We demonstrate that randomly-seeded mixed cell populations undergo rapid condensation and self-organization into discrete epithelial and endothelial structures that are mechanically robust and stable during long term culture. After condensation airway organoids generate invasive multicellular tubular structures that recapitulate limited aspects of branching morphogenesis, and require actomyosin-mediated force generation and YAP/TAZ activation. Despite the proximal source of primary epithelium used in the airway organoids, discrete areas of both proximal and distal epithelial markers were observed over time in culture, demonstrating remarkable epithelial plasticity within the context of organoid cultures. Airway organoids also exhibited complex multicellular responses to a prototypical fibrogenic stimulus (TGF-β1) in culture, and limited capacity to undergo continued maturation and engraftment after ectopic implantation under the murine kidney capsule. These results demonstrate that the airway organoid system developed here represents a novel tool for the study of disease-relevant cell-cell interactions, and establishes this platform as a first step toward cell-based therapy for chronic lung diseases based on de novo engineering of implantable airway tissues. Copyright © 2016 Elsevier Ltd. All rights reserved.
International Nuclear Information System (INIS)
Qiang, Xuhong; Bijlaard, Frans S.K.; Kolstein, Henk
2012-01-01
Highlights: ► Mechanical properties of S460N under transient state fire condition are obtained. ► Elevated-temperature mechanical properties of steels are dependent on steel grades. ► No design standard is applicable to HSS S460N under transient state fire condition. ► Specific statements on various HSS in fire should be proposed in design standards. ► Research results offer accurate material property for structural design engineers. -- Abstract: 911 World Trade Centre Tragedy put fire safety of constructional steel structures into question. Since then, more and more research attention has been paid to the elevated-temperature mechanical properties of structural steels, which is a critical basis of evaluating the fire performance of steel structures. In the literature the available mechanical properties of structural steels under fire conditions were mainly obtained from steady state test method, as steady state test method is easier to perform than transient state test method and offers stress–strain curves directly. However, the transient state fire condition is considered to be more realistic to represent the real condition when constructions are exposed to fire. In order to reveal the deterioration of mechanical properties of the commonly used high strength structural steel S460N under transient state fire condition, tensile tests were conducted under various constant stress levels up to 800 MPa. The reduction factors of elastic modulus, yield and ultimate strengths of S460N under transient state fire condition were obtained and compared with current leading design standards and available literature. The application of such accurate elevated-temperature mechanical properties reduction factors of S460N can ensure a safe fire-resistance design and evaluation of steel structures with high strength steel S460N under transient state fire condition. This experimental study also supports other relative research on fire performance of steel structures with
Functional analyses of ATM, ATR and Fanconi anemia proteins in lung carcinoma
International Nuclear Information System (INIS)
Beumer, Jan H.; Fu, Katherine Y.; Anyang, Bean N.; Siegfried, Jill M.; Bakkenist, Christopher J.
2015-01-01
ATM and ATR are kinases implicated in a myriad of DNA-damage responses. ATM kinase inhibition radiosensitizes cells and selectively kills cells with Fanconi anemia (FA) gene mutations. ATR kinase inhibition sensitizes cells to agents that induce replication stress and selectively kills cells with ATM and TP53 mutations. ATM mutations and FANCF promoter-methylation are reported in lung carcinomas. We undertook functional analyses of ATM, ATR, Chk1 and FA proteins in lung cancer cell lines. We included Calu6 that is reported to be FANCL-deficient. In addition, the cancer genome atlas (TCGA) database was interrogated for alterations in: 1) ATM, MRE11A, RAD50 and NBN; 2) ATR, ATRIP and TOPBP1; and 3) 15 FA genes. No defects in ATM, ATR or Chk1 kinase activation, or FANCD2 monoubiquitination were identified in the lung cancer cell lines examined, including Calu6, and major alterations in these pathways were not identified in the TCGA database. Cell lines were radiosensitized by ATM kinase inhibitor KU60019, but no cell killing by ATM kinase inhibitor alone was observed. While no synergy between gemcitabine or carboplatin and ATR kinase inhibitor ETP-46464 was observed, synergy between gemcitabine and Chk1 kinase inhibitor UCN-01 was observed in 54 T, 201 T and H460, and synergy between carboplatin and Chk1 kinase inhibitor was identified in 201 T and 239 T. No interactions between ATM, ATR and FA activation were observed by either ATM or ATR kinase inhibition in the lung cancer cell lines. Analyses of ATM serine 1981 and Chk1 serine 345 phosphorylation, and FANCD2 monoubiquitination revealed that ATM and ATR kinase activation and FA pathway signaling are intact in the lung cancer cell lines examined. As such, these posttranslational modifications may have utility as biomarkers for the integrity of DNA damage signaling pathways in lung cancer. Different sensitization profiles between gemcitabine and carboplatin and ATR kinase inhibitor ETP-46464 and Chk1 kinase inhibitor
Lung Transcriptomics during Protective Ventilatory Support in Sepsis-Induced Acute Lung Injury.
Directory of Open Access Journals (Sweden)
Marialbert Acosta-Herrera
Full Text Available Acute lung injury (ALI is a severe inflammatory process of the lung. The only proven life-saving support is mechanical ventilation (MV using low tidal volumes (LVT plus moderate to high levels of positive end-expiratory pressure (PEEP. However, it is currently unknown how they exert the protective effects. To identify the molecular mechanisms modulated by protective MV, this study reports transcriptomic analyses based on microarray and microRNA sequencing in lung tissues from a clinically relevant animal model of sepsis-induced ALI. Sepsis was induced by cecal ligation and puncture (CLP in male Sprague-Dawley rats. At 24 hours post-CLP, septic animals were randomized to three ventilatory strategies: spontaneous breathing, LVT (6 ml/kg plus 10 cmH2O PEEP and high tidal volume (HVT, 20 ml/kg plus 2 cmH2O PEEP. Healthy, non-septic, non-ventilated animals served as controls. After 4 hours of ventilation, lung samples were obtained for histological examination and gene expression analysis using microarray and microRNA sequencing. Validations were assessed using parallel analyses on existing publicly available genome-wide association study findings and transcriptomic human data. The catalogue of deregulated processes differed among experimental groups. The 'response to microorganisms' was the most prominent biological process in septic, non-ventilated and in HVT animals. Unexpectedly, the 'neuron projection morphogenesis' process was one of the most significantly deregulated in LVT. Further support for the key role of the latter process was obtained by microRNA studies, as four species targeting many of its genes (Mir-27a, Mir-103, Mir-17-5p and Mir-130a were found deregulated. Additional analyses revealed 'VEGF signaling' as a central underlying response mechanism to all the septic groups (spontaneously breathing or mechanically ventilated. Based on this data, we conclude that a co-deregulation of 'VEGF signaling' along with 'neuron projection
Lung Transcriptomics during Protective Ventilatory Support in Sepsis-Induced Acute Lung Injury
Acosta-Herrera, Marialbert; Lorenzo-Diaz, Fabian; Pino-Yanes, Maria; Corrales, Almudena; Valladares, Francisco; Klassert, Tilman E.; Valladares, Basilio; Slevogt, Hortense; Ma, Shwu-Fan
2015-01-01
Acute lung injury (ALI) is a severe inflammatory process of the lung. The only proven life-saving support is mechanical ventilation (MV) using low tidal volumes (LVT) plus moderate to high levels of positive end-expiratory pressure (PEEP). However, it is currently unknown how they exert the protective effects. To identify the molecular mechanisms modulated by protective MV, this study reports transcriptomic analyses based on microarray and microRNA sequencing in lung tissues from a clinically relevant animal model of sepsis-induced ALI. Sepsis was induced by cecal ligation and puncture (CLP) in male Sprague-Dawley rats. At 24 hours post-CLP, septic animals were randomized to three ventilatory strategies: spontaneous breathing, LVT (6 ml/kg) plus 10 cmH2O PEEP and high tidal volume (HVT, 20 ml/kg) plus 2 cmH2O PEEP. Healthy, non-septic, non-ventilated animals served as controls. After 4 hours of ventilation, lung samples were obtained for histological examination and gene expression analysis using microarray and microRNA sequencing. Validations were assessed using parallel analyses on existing publicly available genome-wide association study findings and transcriptomic human data. The catalogue of deregulated processes differed among experimental groups. The ‘response to microorganisms’ was the most prominent biological process in septic, non-ventilated and in HVT animals. Unexpectedly, the ‘neuron projection morphogenesis’ process was one of the most significantly deregulated in LVT. Further support for the key role of the latter process was obtained by microRNA studies, as four species targeting many of its genes (Mir-27a, Mir-103, Mir-17-5p and Mir-130a) were found deregulated. Additional analyses revealed 'VEGF signaling' as a central underlying response mechanism to all the septic groups (spontaneously breathing or mechanically ventilated). Based on this data, we conclude that a co-deregulation of 'VEGF signaling' along with 'neuron projection
P-glycoprotein confers acquired resistance to 17-DMAG in lung cancers with an ALK rearrangement
International Nuclear Information System (INIS)
Kim, Hee Joung; Lee, Kye Young; Kim, Young Whan; Choi, Yun Jung; Lee, Jung-Eun; Choi, Chang Min; Baek, In-Jeoung; Rho, Jin Kyung; Lee, Jae Cheol
2015-01-01
Because anaplastic lymphoma kinase (ALK) is dependent on Hsp90 for protein stability, Hsp90 inhibitors are effective in controlling growth of lung cancer cells with ALK rearrangement. We investigated the mechanism of acquired resistance to 17-(Dimethylaminoethylamino)-17-demethoxygeldanamycin (17-DMAG), a geldanamycin analogue Hsp90 inhibitor, in H3122 and H2228 non-small cell lung cancer cell lines with ALK rearrangement. Resistant cell lines (H3122/DR-1, H3122/DR-2 and H2228/DR) were established by repeated exposure to increasing concentrations of 17-DMAG. Mechanisms for resistance by either NAD(P)H/quinone oxidoreductase 1 (NQO1), previously known as a factor related to 17-DMAG resistance, or P-glycoprotein (P-gp; ABCB1/MDR1) were queried using RT-PCR, western blot analysis, chemical inhibitors, the MTT cell proliferation/survival assay, and cellular efflux of rhodamine 123. The resistant cells showed no cross-resistance to AUY922 or ALK inhibitors, suggesting that ALK dependency persists in cells with acquired resistance to 17-DMAG. Although expression of NQO1 was decreased in H3122/DR-1 and H3122/DR-2, NQO1 inhibition by dicumarol did not affect the response of parental cells (H2228 and H3122) to 17-DMAG. Interestingly, all resistant cells showed the induction of P-gp at the protein and RNA levels, which was associated with an increased efflux of the P-gp substrate rhodamine 123 (Rho123). Transfection with siRNA directed against P-gp or treatment with verapamil, an inhibitor of P-gp, restored the sensitivity to the drug in all cells with acquired resistance to 17-DMAG. Furthermore, we also observed that the growth-inhibitory effect of 17-DMAG was decreased in A549/PR and H460/PR cells generated to over-express P-gp by long-term exposure to paclitaxel, and these cells recovered their sensitivity to 17-DMAG through the inhibition of P-gp. P-gp over-expression is a possible mechanism of acquired resistance to 17-DMAG in cells with ALK rearrangement. The online
Avian and human influenza A virus receptors in trachea and lung of animals.
Thongratsakul, Sukanya; Suzuki, Yasuo; Hiramatsu, Hiroaki; Sakpuaram, Thavajchai; Sirinarumitr, Theerapol; Poolkhet, Chaithep; Moonjit, Pattra; Yodsheewan, Rungrueang; Songserm, Thaweesak
2010-12-01
Influenza A viruses are capable of crossing the specific barrier between human beings and animals resulting in interspecies transmission. The important factor of potential infectivity of influenza A viruses is the suitability of the receptor binding site of the host and viruses. The affinities of avian and human influenza virus to bind with the receptors and the distributions of receptors in animals are different. This study aims to investigate the anatomical distribution of avian and human influenza virus receptors using the double staining lectin histochemistry method. Double staining of lectin histochemistry was performed to identify both SA alpha2,3 Gal and SA alpha2,6 Gal receptors in trachea and lung tissue of dogs, cats, tigers, ferret, pigs, ducks and chickens. We have demonstrated that avian and human influenza virus receptors were abundantly present in trachea, bronchus and bronchiole, but in alveoli of dogs, cats and tigers showed SA alpha2,6 Gal only. Furthermore, endothelial cells in lung tissues showed presence of SA alpha2,3 Gal. The positive sites of both receptors in respiratory tract, especially in the trachea, suggest that all mammalian species studied can be infected with avian influenza virus. These findings suggested that dogs and cats in close contact with humans should be of greater concern as an intermediate host for avian influenza A in which there is the potential for viral adaptation and reassortment.
International Nuclear Information System (INIS)
Chen, Jinfeng; Xie, Fei; Zhang, Lijian; Jiang, Wen G
2010-01-01
iASPP is a key inhibitor of tumour suppressor p53 and is found to be up-regulated in certain malignant conditions. The present study investigated the expression of iASPP in clinical lung cancer, a leading cancer type in the world, and the biological impact of this molecule on lung cancer cells. iASPP protein levels in lung cancer tissues were evaluated using an immunohistochemical method. In vitro, iASPP gene expression was suppressed with a lentvirus-mediated shRNA method and the biological impact after knocking down iASSP on lung cancer cell lines was investigated in connection with the p53 expression status. We showed here that the expression of iASPP was significantly higher in lung cancer tissues compared with the adjacent normal tissues. iASPP shRNA treatment resulted in a down-regulation of iASPP in lung cancer cells. There was a subsequent reduction of cell proliferation of the two lung tumour cell lines A459 and 95D both of which had wild-type p53 expression. In contrast, reduction of iASPP in H1229 cells, a cell with little p53 expression, had no impact on its growth rate. iASPP regulates the proliferation and motility of lung cancer cells. This effect is intimately associated with the p53 pathway. Together with the pattern of the over-expression in clinical lung cancers, it is concluded that iASPP plays an pivotal role in the progression of lung cancer and is a potential target for lung cancer therapy
Directory of Open Access Journals (Sweden)
Frances E Lennon
Full Text Available Recent epidemiologic studies implying differences in cancer recurrence based on anesthetic regimens raise the possibility that the mu opioid receptor (MOR can influence cancer progression. Based on our previous observations that overexpression of MOR in human non-small cell lung cancer (NSCLC cells increased tumor growth and metastasis, this study examined whether MOR regulates growth factor receptor signaling and epithelial mesenchymal transition (EMT in human NSCLC cells. We utilized specific siRNA, shRNA, chemical inhibitors and overexpression vectors in human H358 NSCLC cells that were either untreated or treated with various concentrations of DAMGO, morphine, fentanyl, EGF or IGF. Cell function assays, immunoblot and immunoprecipitation assays were then performed. Our results indicate MOR regulates opioid and growth factor-induced EGF receptor signaling (Src, Gab-1, PI3K, Akt and STAT3 activation which is crucial for consequent human NSCLC cell proliferation and migration. In addition, human NSCLC cells treated with opioids, growth factors or MOR overexpression exhibited an increase in snail, slug and vimentin and decrease ZO-1 and claudin-1 protein levels, results consistent with an EMT phenotype. Further, these effects were reversed with silencing (shRNA or chemical inhibition of MOR, Src, Gab-1, PI3K, Akt and STAT3 (p<0.05. Our data suggest a possible direct effect of MOR on opioid and growth factor-signaling and consequent proliferation, migration and EMT transition during lung cancer progression. Such an effect provides a plausible explanation for the epidemiologic findings.
International Nuclear Information System (INIS)
Li, Xiaoou; Liu, Lian; Shen, Yongchun; Wang, Tao; Chen, Lei; Xu, Dan; Wen, Fuqiang
2014-01-01
Highlights: • Endogenous miR-26a inhibits TGF-beta 1 induced proliferation of lung fibroblasts. • miR-26a induces G1 arrest through directly targeting 3′-UTR of CCND2. • TGF indispensable receptor, TGF-beta R I, is regulated by miR-26a. • miR-26a acts through inhibiting TGF-beta 2 feedback loop to reduce TGF-beta 1. • Collagen type I and connective tissue growth factor are suppressed by miR-26a. - Abstract: MicroRNA-26a is a newly discovered microRNA that has a strong anti-tumorigenic capacity and is capable of suppressing cell proliferation and activating tumor-specific apoptosis. However, whether miR-26a can inhibit the over-growth of lung fibroblasts remains unclear. The relationship between miR-26a and lung fibrosis was explored in the current study. We first investigated the effect of miR-26a on the proliferative activity of human lung fibroblasts with or without TGF-beta1 treatment. We found that the inhibition of endogenous miR-26a promoted proliferation and restoration of mature miR-26a inhibited the proliferation of human lung fibroblasts. We also examined that miR-26a can block the G1/S phase transition via directly targeting 3′-UTR of CCND2, degrading mRNA and decreasing protein expression of Cyclin D2. Furthermore, we showed that miR-26a mediated a TGF-beta 2-TGF-beta 1 feedback loop and inhibited TGF-beta R I activation. In addition, the overexpression of miR-26a also significantly suppressed the TGF-beta 1-interacting-CTGF–collagen fibrotic pathway. In summary, our studies indicated an essential role of miR-26a in the anti-fibrotic mechanism in TGF-beta1-induced proliferation in human lung fibroblasts, by directly targeting Cyclin D2, regulating TGF-beta R I as well as TGF-beta 2, and suggested the therapeutic potential of miR-26a in ameliorating lung fibrosis
Energy Technology Data Exchange (ETDEWEB)
Li, Xiaoou [Division of Pulmonary Diseases, State Key Laboratory of Biotherapy of China, West China Hospital, West China School of Medicine, Sichuan University, Chengdu, Sichuan (China); Department of Respiratory Medicine, West China Hospital, West China School of Medicine, Sichuan University, Chengdu, Sichuan (China); Liu, Lian [Division of Pulmonary Diseases, State Key Laboratory of Biotherapy of China, West China Hospital, West China School of Medicine, Sichuan University, Chengdu, Sichuan (China); Shen, Yongchun; Wang, Tao; Chen, Lei; Xu, Dan [Division of Pulmonary Diseases, State Key Laboratory of Biotherapy of China, West China Hospital, West China School of Medicine, Sichuan University, Chengdu, Sichuan (China); Department of Respiratory Medicine, West China Hospital, West China School of Medicine, Sichuan University, Chengdu, Sichuan (China); Wen, Fuqiang, E-mail: wenfuqiang.scu@gmail.com [Division of Pulmonary Diseases, State Key Laboratory of Biotherapy of China, West China Hospital, West China School of Medicine, Sichuan University, Chengdu, Sichuan (China); Department of Respiratory Medicine, West China Hospital, West China School of Medicine, Sichuan University, Chengdu, Sichuan (China)
2014-11-28
Highlights: • Endogenous miR-26a inhibits TGF-beta 1 induced proliferation of lung fibroblasts. • miR-26a induces G1 arrest through directly targeting 3′-UTR of CCND2. • TGF indispensable receptor, TGF-beta R I, is regulated by miR-26a. • miR-26a acts through inhibiting TGF-beta 2 feedback loop to reduce TGF-beta 1. • Collagen type I and connective tissue growth factor are suppressed by miR-26a. - Abstract: MicroRNA-26a is a newly discovered microRNA that has a strong anti-tumorigenic capacity and is capable of suppressing cell proliferation and activating tumor-specific apoptosis. However, whether miR-26a can inhibit the over-growth of lung fibroblasts remains unclear. The relationship between miR-26a and lung fibrosis was explored in the current study. We first investigated the effect of miR-26a on the proliferative activity of human lung fibroblasts with or without TGF-beta1 treatment. We found that the inhibition of endogenous miR-26a promoted proliferation and restoration of mature miR-26a inhibited the proliferation of human lung fibroblasts. We also examined that miR-26a can block the G1/S phase transition via directly targeting 3′-UTR of CCND2, degrading mRNA and decreasing protein expression of Cyclin D2. Furthermore, we showed that miR-26a mediated a TGF-beta 2-TGF-beta 1 feedback loop and inhibited TGF-beta R I activation. In addition, the overexpression of miR-26a also significantly suppressed the TGF-beta 1-interacting-CTGF–collagen fibrotic pathway. In summary, our studies indicated an essential role of miR-26a in the anti-fibrotic mechanism in TGF-beta1-induced proliferation in human lung fibroblasts, by directly targeting Cyclin D2, regulating TGF-beta R I as well as TGF-beta 2, and suggested the therapeutic potential of miR-26a in ameliorating lung fibrosis.
The accumulation of nickel in human lungs.
Edelman, D A; Roggli, V L
1989-01-01
Using data from published studies, lung concentrations of nickel were compare for persons with and without occupational exposure to nickel. As expected, the concentrations were much higher for persons with occupational exposure. To estimate the effects of nickel-containing tobacco smoke and nickel in the ambient air on the amount of nickel accumulated in lungs over time, a model was derived that took into account various variables related to the deposition of nickel in lungs. The model predic...
Comparison of three tracers for detecting lung epithelial injury in anesthetized sheep
International Nuclear Information System (INIS)
Peterson, B.T.; Dickerson, K.D.; James, H.L.; Miller, E.J.; McLarty, J.W.; Holiday, D.B.
1989-01-01
We compared the ability of three aerosolized tracers to discriminate among control, lung inflation with a positive end expired pressure of 10 cmH 2 O, lung vascular hypertension and edema without lung injury, and lung edema with lung injury due to intravenous oleic acid. The tracers were 99m Tc-diethylenetriaminepentaacetate ( 99m Tc-DTPA, mol wt 492), 99m Tc-human serum albumin ( 99m Tc-ALB, mol wt 69,000), and 99m Tc-aggregated albumin ( 99m Tc-AGG ALB, mol wt 383,000). 99m Tc-DTPA clearance measurements were not able to discriminate lung injury from lung inflation. The 99m Tc-AGG ALB clearance rate was unchanged by lung inflation and increased slightly with lung injury. The 99mTc-ALB clearance rate (0.06 +/- 0.02%/min) was unchanged by lung inflation (0.09 +/- 0.02%/min, P greater than 0.05) or 4 h of hypertension without injury (0.09 +/- 0.04%/min, P greater than 0.05). Deposition of 99m Tc-ALB within 15 min of the administration of the oleic acid increased the clearance rate to 0.19 +/- 0.06%/min, which correlated well with the postmortem lung water volume (r = 0.92, P less than 0.01). This did not occur when there was a 60-min delay in the deposition of 99m Tc-ALB. We conclude that 99m Tc-ALB is the best indicator for studying the effects of lung epithelial injury on protein and fluid transport into and out of the air spaces of the lungs in a minimally invasive manner
The Role of Serotonin Transporter in Human Lung Development and in Neonatal Lung Disorders
Directory of Open Access Journals (Sweden)
E. C. C. Castro
2017-01-01
Full Text Available Introduction. Failure of the vascular pulmonary remodeling at birth often manifests as pulmonary hypertension (PHT and is associated with a variety of neonatal lung disorders including a uniformly fatal developmental disorder known as alveolar capillary dysplasia with misalignment of pulmonary veins (ACD/MPV. Serum serotonin regulation has been linked to pulmonary vascular function and disease, and serotonin transporter (SERT is thought to be one of the key regulators in these processes. We sought to find evidence of a role that SERT plays in the neonatal respiratory adaptation process and in the pathomechanism of ACD/MPV. Methods. We used histology and immunohistochemistry to determine the timetable of SERT protein expression in normal human fetal and postnatal lungs and in cases of newborn and childhood PHT of varied etiology. In addition, we tested for a SERT gene promoter defect in ACD/MPV patients. Results. We found that SERT protein expression begins at 30 weeks of gestation, increases to term, and stays high postnatally. ACD/MPV patients had diminished SERT expression without SERT promoter alteration. Conclusion. We concluded that SERT/serotonin pathway is crucial in the process of pulmonary vascular remodeling/adaptation at birth and plays a key role in the pathobiology of ACD/MPV.
Rocha, CM; Barros, AS; Goodfellow, BJ; Carreira, IM; Gomes, AA; Sousa, V; Bernardo, J; Carvalho, L; Gil, AM; Duarte, IF
2015-01-01
Lung tumour subtyping, particularly the distinction between adenocarcinoma (AdC) and squamous cell carcinoma (SqCC), is a critical diagnostic requirement. In this work, the metabolic signatures of lung carcinomas were investigated through (1)H NMR metabolomics, with a view to provide additional criteria for improved diagnosis and treatment planning. High Resolution Magic Angle Spinning Nuclear Magnetic Resonance (NMR) spectroscopy was used to analyse matched tumour and adjacent control tissue...
Energy Technology Data Exchange (ETDEWEB)
Harder, Samantha J.; Isabelle, Martin; DeVorkin, Lindsay; Smazynski, Julian; Beckham, Wayne; Brolo, Alexandre; Lum, Julian; Jirasek, Andrew [BC Cancer Agency/ Vancouver Island Cancer Centre, Gloucestershire Hospitals NHS Foundation Trust, BC Cancer Agency/ Vancouver Island Cancer Centre, BC Cancer Agency/ Vancouver Island Cancer Centre, BC Cancer Agency/ Vancouver Island Cancer Centre, University of Victoria/ Department of Chemistry, BC Cancer Agency/ Vancouver Island Cancer Centre, University of British Columbia Okanagan (Canada)
2016-08-15
Purpose: This study presents the novel application of Raman spectroscopy (RS) to identify biochemical signatures of radiation response in human non-small cell lung cancer (NSCLC) xenografts, irradiated in vivo. Methods: Human NSCLC cells (H460) were subcutaneously injected into the flanks of 12 mice. Tumours were treated with single fraction radiation doses (0, 5 or 15 Gy) and harvested at 3 days post irradiation. A Renishaw inVia Raman microscope coupled to a 785 nm laser was used to collect Raman spectral maps for each tumour. Immunohistochemistry (IHC) staining for CAIX was used to visualize hypoxia, and co-registration between IHC fluorescence and Raman images was carried out. Results: Principal component analysis revealed radiation induced spectral signatures linked to changes in protein, nucleic acid, lipid and carbohydrates. In particular, a marked increase in glycogen for irradiated tumours was observed. Spatial mapping revealed intra-tumoural heterogeneity in the distribution of glycogen within the tumour, suggesting tumour response to radiation is not globally uniform. Furthermore, co-registration of Raman glycogen maps with CAIX IHC staining showed a correlation between glycogen rich and hypoxic regions of the tissue. Conclusions: We identify glycogen as a unique radiation induced response in NSCLC tumour xenografts, which may reflect inherent metabolic changes associated with radiation response in tissue. This study provides unique insight into the biochemical response of tumours, irradiated in vivo, and demonstrates the potential of RS for detecting radiobiological responses in tumours.
International Nuclear Information System (INIS)
Harder, Samantha J.; Isabelle, Martin; DeVorkin, Lindsay; Smazynski, Julian; Beckham, Wayne; Brolo, Alexandre; Lum, Julian; Jirasek, Andrew
2016-01-01
Purpose: This study presents the novel application of Raman spectroscopy (RS) to identify biochemical signatures of radiation response in human non-small cell lung cancer (NSCLC) xenografts, irradiated in vivo. Methods: Human NSCLC cells (H460) were subcutaneously injected into the flanks of 12 mice. Tumours were treated with single fraction radiation doses (0, 5 or 15 Gy) and harvested at 3 days post irradiation. A Renishaw inVia Raman microscope coupled to a 785 nm laser was used to collect Raman spectral maps for each tumour. Immunohistochemistry (IHC) staining for CAIX was used to visualize hypoxia, and co-registration between IHC fluorescence and Raman images was carried out. Results: Principal component analysis revealed radiation induced spectral signatures linked to changes in protein, nucleic acid, lipid and carbohydrates. In particular, a marked increase in glycogen for irradiated tumours was observed. Spatial mapping revealed intra-tumoural heterogeneity in the distribution of glycogen within the tumour, suggesting tumour response to radiation is not globally uniform. Furthermore, co-registration of Raman glycogen maps with CAIX IHC staining showed a correlation between glycogen rich and hypoxic regions of the tissue. Conclusions: We identify glycogen as a unique radiation induced response in NSCLC tumour xenografts, which may reflect inherent metabolic changes associated with radiation response in tissue. This study provides unique insight into the biochemical response of tumours, irradiated in vivo, and demonstrates the potential of RS for detecting radiobiological responses in tumours.
Jahani, Nariman; Choi, Sanghun; Choi, Jiwoong; Iyer, Krishna; Hoffman, Eric A; Lin, Ching-Long
2015-11-15
This study aims to assess regional ventilation, nonlinearity, and hysteresis of human lungs during dynamic breathing via image registration of four-dimensional computed tomography (4D-CT) scans. Six healthy adult humans were studied by spiral multidetector-row CT during controlled tidal breathing as well as during total lung capacity and functional residual capacity breath holds. Static images were utilized to contrast static vs. dynamic (deep vs. tidal) breathing. A rolling-seal piston system was employed to maintain consistent tidal breathing during 4D-CT spiral image acquisition, providing required between-breath consistency for physiologically meaningful reconstructed respiratory motion. Registration-derived variables including local air volume and anisotropic deformation index (ADI, an indicator of preferential deformation in response to local force) were employed to assess regional ventilation and lung deformation. Lobar distributions of air volume change during tidal breathing were correlated with those of deep breathing (R(2) ≈ 0.84). Small discrepancies between tidal and deep breathing were shown to be likely due to different distributions of air volume change in the left and the right lungs. We also demonstrated an asymmetric characteristic of flow rate between inhalation and exhalation. With ADI, we were able to quantify nonlinearity and hysteresis of lung deformation that can only be captured in dynamic images. Nonlinearity quantified by ADI is greater during inhalation, and it is stronger in the lower lobes (P < 0.05). Lung hysteresis estimated by the difference of ADI between inhalation and exhalation is more significant in the right lungs than that in the left lungs. Copyright © 2015 the American Physiological Society.
Directory of Open Access Journals (Sweden)
Jiapeng YANG
2015-07-01
Full Text Available Background and objective The high incidence of lung cancer in Xuanwei, China, has become an important restricting factor for livelihood development, thus exerting local social and economic impacts. Coal is the main fuel of the local community and also the main source of indoor pollution. This study aims to explore the coal combustion inhalable fine particulate matter (PM2.5 and its component output differences in different areas of Xuanwei, Yunnan. Moreover, the aim of this study is to investigate the relationship between inhalation of fine particles and high incidence of local lung cancer. Methods For combustion test, coal mines designated as C1, K7 and M30 were collected from LaoLin Colliery of Laibing Town, Huchang Colliery of Baoshan Town, and Taiping Colliery of Wenxing Town in Xuanwei, respectively. PM2.5 of indoor air was weighed, analyzed for elemental composition, and morphologically compared. The pathological specimen of lung cancer patients in Xuanwei who underwent operation was observed through electron microscope. Results The PM2.5 concentrations in indoor air were (8.244 ±1.460 mg/m3 (C1, (5.066±0.984 mg/m3 (K7, and (5.071±1.460 mg/m3 (M30. The differences among pairwise comparisons were statistically significant (P=0.029. The filter impurities of C1 coal seam primarily include Si- and O-enriched compounds. Moreover, three membranes that comprised other elements, including C, S, and Si, were observed. These membranes were evident from the aggregation of silica and a Ca-Al membrane. Compared with that of other coal seams, C1 coal generated a mass of impurities, in which several particles have irregular shape. We found nanoscale fine particles in some specimens of Xuanwei lung cancer patients. Conclusion The produced combustion of C1 coal was different from that of K7 and M30 coal. PM2.5 composition may be associated with the high local incidence of lung cancer.
International Nuclear Information System (INIS)
Perkins, Timothy N.; Dentener, Mieke A.; Stassen, Frank R.; Rohde, Gernot G.; Mossman, Brooke T.; Wouters, Emiel F.M.; Reynaert, Niki L.
2016-01-01
Growth and development of the mature lung is a complex process orchestrated by a number of intricate developmental signaling pathways. Wingless-type MMTV-integration site (WNT) signaling plays critical roles in controlling branching morphogenesis cell differentiation, and formation of the conducting and respiratory airways. In addition, WNT pathways are often re-activated in mature lungs during repair and regeneration. WNT- signaling has been elucidated as a crucial contributor to the development of idiopathic pulmonary fibrosis as well as other hyper-proliferative lung diseases. Silicosis, a detrimental occupational lung disease caused by excessive inhalation of crystalline silica dust, is hallmarked by repeated cycles of damaging inflammation, epithelial hyperplasia, and formation of dense, hyalinized nodules of whorled collagen. However, mechanisms of epithelial cell hyperplasia and matrix deposition are not well understood, as most research efforts have focused on the pronounced inflammatory response. Microarray data from our previous studies has revealed a number of WNT-signaling and WNT-target genes altered by crystalline silica in human lung epithelial cells. In the present study, we utilize pathway analysis to designate connections between genes altered by silica in WNT-signaling networks. Furthermore, we confirm microarray findings by QRT-PCR and demonstrate both activation of canonical (β-catenin) and down-regulation of non-canonical (WNT5A) signaling in immortalized (BEAS-2B) and primary (PBEC) human bronchial epithelial cells. These findings suggest that WNT-signaling and cross-talk with other pathways (e.g. Notch), may contribute to proliferative, fibrogenic and inflammatory responses to silica in lung epithelial cells. - Highlights: • Pathway analysis reveals silica-induced WNT-signaling in lung epithelial cells. • Silica-induced canonical WNT-signaling is mediated by autocrine/paracrine signals. • Crystalline silica decreases non-canonical WNT
Energy Technology Data Exchange (ETDEWEB)
Perkins, Timothy N.; Dentener, Mieke A. [Department of Respiratory Medicine, Maastricht University Medical Centre +, Maastricht University Maastricht (Netherlands); Stassen, Frank R. [Department of Medical Microbiology, Maastricht University Medical Centre +, Maastricht University Maastricht (Netherlands); Rohde, Gernot G. [Department of Respiratory Medicine, Maastricht University Medical Centre +, Maastricht University Maastricht (Netherlands); Mossman, Brooke T. [Department of Pathology, University of Vermont College of Medicine, Burlington, VT (United States); Wouters, Emiel F.M. [Department of Respiratory Medicine, Maastricht University Medical Centre +, Maastricht University Maastricht (Netherlands); Reynaert, Niki L., E-mail: n.reynaert@maastrichtuniversity.nl [Department of Respiratory Medicine, Maastricht University Medical Centre +, Maastricht University Maastricht (Netherlands)
2016-06-15
Growth and development of the mature lung is a complex process orchestrated by a number of intricate developmental signaling pathways. Wingless-type MMTV-integration site (WNT) signaling plays critical roles in controlling branching morphogenesis cell differentiation, and formation of the conducting and respiratory airways. In addition, WNT pathways are often re-activated in mature lungs during repair and regeneration. WNT- signaling has been elucidated as a crucial contributor to the development of idiopathic pulmonary fibrosis as well as other hyper-proliferative lung diseases. Silicosis, a detrimental occupational lung disease caused by excessive inhalation of crystalline silica dust, is hallmarked by repeated cycles of damaging inflammation, epithelial hyperplasia, and formation of dense, hyalinized nodules of whorled collagen. However, mechanisms of epithelial cell hyperplasia and matrix deposition are not well understood, as most research efforts have focused on the pronounced inflammatory response. Microarray data from our previous studies has revealed a number of WNT-signaling and WNT-target genes altered by crystalline silica in human lung epithelial cells. In the present study, we utilize pathway analysis to designate connections between genes altered by silica in WNT-signaling networks. Furthermore, we confirm microarray findings by QRT-PCR and demonstrate both activation of canonical (β-catenin) and down-regulation of non-canonical (WNT5A) signaling in immortalized (BEAS-2B) and primary (PBEC) human bronchial epithelial cells. These findings suggest that WNT-signaling and cross-talk with other pathways (e.g. Notch), may contribute to proliferative, fibrogenic and inflammatory responses to silica in lung epithelial cells. - Highlights: • Pathway analysis reveals silica-induced WNT-signaling in lung epithelial cells. • Silica-induced canonical WNT-signaling is mediated by autocrine/paracrine signals. • Crystalline silica decreases non-canonical WNT
p53-Independent thermosensitization by mitomycin C in human non-small cell lung carcinoma cells
International Nuclear Information System (INIS)
Jin, Z.-H.; Matsumoto, H.; Hayashi, S.; Shioura, H.; Kitai, R.; Kano, E.; Hatashita, M.
2003-01-01
The combined treatment with hyperthermia and chemotherapeutic drugs such as cisplatin (CDDP), doxorubicin (DOX) and mitomycin C (MMC) has been widely adopted as a strategy of interdisciplinary cancer therapy to obtain greater therapeutic benefits. However, the involved mechanisms of the interactive cytotoxic effects of hyperthermia and MMC remain unclear. To elucidate the relationship between p53 functions and the interactive effects of the combined treatment with mild-hyperthermia and MMC, we examined the potentiation of cytotoxic effects, the induction of apoptosis, the changes in cell cycles and the accumulation of Hsp72 after the combined treatment with hyperthermia at 42 degree C and MMC using human non-small cell lung carcinoma H1299 transfectants with either null, wild-type (wt) or mutant (m) p53 gene. H1299/null, H1299/wtp53 and H1299/mp53 cells showed similar sensitivities to either hyperthermia at 42 degree C alone or MMC alone. The combined treatment resulted in a synergistically enhanced cytotoxicity in H1299 transfectants in a p53-independent manner. The mechanisms involved an enhancement of heat-induced apoptosis and a modulation of the cell cycle distribution by the combined treatment. The accumulation of Hsp72 was not suppressed by the combined treatment, as is not the case of the combined treatment with hyperthermia and either CDDP (1) or bleomycin (2). Our findings demonstrate a p53-independent mechanism for a synergistically cytotoxic enhancement by the combined treatment with mild-hyperthermia and MMC
Global gene expression profiling in human lung cells exposed to cobalt
Energy Technology Data Exchange (ETDEWEB)
Malard, V.; Berenguer, F.; Prat, O.; Ruat, S.; Steinmetz, G.; Quemeneur, E. [CEA VALRHO, Serv Biochim and Toxicol Nucl, DSV, iBEB, F-30207 Bagnols Sur Ceze (France)
2007-06-06
It has been estimated that more than 1 million workers in the United States are exposed to cobalt. Occupational exposure to {sup 59}Co occurs mainly via inhalation and leads to various lung diseases. Cobalt is classified by the IARC as a possible human carcinogen (group 2B). Although there is evidence for in vivo and in vitro toxicity, the mechanisms of cobalt-induced lung toxicity are not fully known. The purpose of this work was to identify potential signatures of acute cobalt exposure using a toxico-genomic approach. Data analysis focused on some cellular processes and protein targets that are thought to be relevant for carcinogenesis, transport and bio-marker research. Results: A time course transcriptome analysis was performed on A549 human pulmonary cells, leading to the identification of 85 genes which are repressed or induced in response to soluble 59 Co. A group of 29 of these genes, representing the main biological functions, was assessed by quantitative RT-PCR. The expression profiles of six of them were then tested by quantitative RT-PCR in a time-dependent manner and three modulations were confirmed by Western blotting. The 85 modulated genes include potential cobalt carriers (FBXL2, ZNT1, SLC12A5), tumor suppressors or transcription factors (MAZ, DLG1, MYC, AXL) and genes linked to the stress response (UBC, HSPCB, BN1P3L). We also identified nine genes coding for secreted proteins as candidates for bio-marker research. Of those, T1MP2 was found to be down-regulated and this modulation was confirmed, in a dose-dependent manner, at protein level in the supernatant of exposed cells. Conclusion: Most of these genes have never been described as related to cobalt stress and provide original hypotheses for further study of the effects of this metal ion on human lung epithelial cells. A putative bio-marker of cobalt toxicity was identified. (authors)
[Establishment of human multidrug-resistant lung carcinoma cell line (D6/MVP)].
Ma, Sheng-lin; Feng, Jian-guo; Gu, Lin-hui; Ling, Yu-tian
2003-03-01
To establish human multidrug-resistant lung carcinoma cell line (D6/MVP) with its characteristics studied. Intermittent administration of high-dose MMC, VDS and DDP (MVP) was used to induce human lung carcinoma cell line (D6) to a multidrug-resistant variety (D6/MVP). MTT assay was used to study the multidrug resistance of D6/MVP to multianticarcinogen. Flow cytometry was used to study the cell cycle distribution and the expression of P-gp, multidrug resistance-associated protein (MRP) and GSH/GST. 1. D6/MVP was resistant to many anti-tumor agents, with the IC(50) 13.3 times higher and the drug resistance 2 - 6 times higher than D6, 2. The multiplication time of D6/MVP was prolonged and the cell number of S-phase decreased while that of G1- and G(2)-phase increased and 3. The expression of P-gp and MRP was enhanced significantly (96.2% vs 51.7%), but the expression of GSH/GST kept stable. D6/MVP is a multidrug-resistant cell line possessing the basic characteristics of drug-resistance.
International Nuclear Information System (INIS)
Desai, Amar; Webb, Bryan; Gerson, Stanton L.
2014-01-01
Background: Radioresistance in human tumors has been linked in part to a subset of cells termed cancer stem cells (CSCs). The prominin 1 (CD133) cell surface protein is proposed to be a marker enriching for CSCs. We explore the importance of DNA repair in contributing to radioresistance in CD133+ lung cancer cells. Materials and methods: A549 and H1299 lung cancer cell lines were used. Sorted CD133+ cells were exposed to either single 4 Gy or 8 Gy doses and clonogenic survival measured. ϒ-H2AX immunofluorescence and quantitative real time PCR was performed on sorted CD133+ cells both in the absence of IR and after two single 4 Gy doses. Lentiviral shRNA was used to silence repair genes. Results: A549 but not H1299 cells expand their CD133+ population after single 4 Gy exposure, and isolated A549 CD133+ cells demonstrate IR resistance. This resistance corresponded with enhanced repair of DNA double strand breaks (DSBs) and upregulated expression of DSB repair genes in A549 cells. Prior IR exposure of two single 4 Gy doses resulted in acquired DNA repair upregulation and improved repair proficiency in both A549 and H1299. Finally Exo1 and Rad51 silencing in A549 cells abrogated the CD133+ IR expansion phenotype and induced IR sensitivity in sorted CD133+ cells. Conclusions: CD133 identifies a population of cells within specific tumor types containing altered expression of DNA repair genes that are inducible upon exposure to chemotherapy. This altered gene expression contributes to enhanced DSB resolution and the radioresistance phenotype of these cells. We also identify DNA repair genes which may serve as promising therapeutic targets to confer radiosensitivity to CSCs
Lung-derived growth factors: possible paracrine effectors of fetal lung development
International Nuclear Information System (INIS)
Montes, A.M.
1985-01-01
A potential role for paracrine secretions in lung organogenesis has been hypothesized (Alescio and Piperno, 1957). These studies present direct support for the paracrine model by demonstrating the presence of locally produced mitogenic/maturational factors in fetal rat lung tissue. Conditioned serum free medium (CSFM) from nineteen-day fetal rat lung cultures was shown to contain several bioactive peptides as detected by 3 H-Thymidine incorporation into chick embryo and rat lung fibroblasts, as well as 14 C-choline incorporation into surfactant in mixed cell cultures. Using ion-exchange chromatography and Sephadex gel filtration, a partially purified mitogen, 11-III, was obtained. The partially purified 11-III stimulates mitosis in chick embryo fibroblasts and post-natal rat lung fibroblasts. Multiplication in fetal rat lung fibroblasts cultures is stimulated only when these are pre-incubated with a competence factor or unprocessed CSFM. This suggests the existence of an endogenously produced competence factor important in the regulation of fetal lung growth. Preparation 11-III does not possess surfactant stimulating activity as assessed by 3 H-choline incorporation into lipids in predominantly type-II cell cultures. These data demonstrate the presence of a maturational/mitogenic factor, influencing type-II mixed cell cultures. In addition, 11-III had been shown to play an autocrine role stimulating the proliferation of fetal lung fibroblasts. Finally, these data suggest the existence of a local produced competence factor
Chen, Yixiang; Meng, Xueqiong; Liu, Qi; Huang, Xia; Huang, Shengbin; Liu, Cuiquan; Shi, Kaichuang; Guo, Jiangang; Chen, Fangfang; Hu, Liping
2008-04-01
Our aim in this study was to determine the genetic characterization and probable origin of the H1N2 swine influenza virus (A/Swine/Guangxi/13/2006) (Sw/GX/13/06) from lung tissue of a pig in Guangxi province, China. Eight genes of Sw/GX/13/06 were cloned and genetically analyzed. The hemagglutinin (HA), nucleoprotein (NP), matrix (M) and non-structural (NS) genes of Sw/GX/13/06 were most closely related to genes from the classical swine H1N1 influenza virus lineage. The neuraminidase (NA) and PB1 genes were most closely related to the corresponding genes from the human influenza H3N2 virus lineage. The remaining two genes PA and PB2 polymerase genes were most closely related to the genes from avian influenza virus lineage. Phylogenetic analyses revealed that Sw/GX/13/06 was a human/swine/avian H1N2 virus, and closely related to H1N2 viruses isolated from pigs in United States (1999-2001) and Korea (2002). To our knowledge, Sw/GX/13/06 was the first triple-reassortant H1N2 influenza A virus isolated from a pig in China. Whether the Sw/GX/13/06 has a potential threat to breeding farm and human health remains to be further investigated.
Evaluation of lung immunity in chimpanzees
International Nuclear Information System (INIS)
Bice, D.E.; Harris, D.L.; Muggenburg, B.A.; Bowen, J.A.
1980-01-01
The effects of inhaled pollutants on the immune defenses in the lung can be studied in several animal species. To assure that the data obtained can be extrapolated to man, it is essential that the development of lung immunity is similar in the experimental animal selected and in humans. Because of the similarity of immune responses in chimpanzees and in humans, the development of immunity in the chimpanzee after lung immunization was evaluated. The results from the chimpanzees were qualitatively the same as those from previous studies in which single lung lobes of dogs were immunized. It was concluded that immunotoxicology data obtained in dogs can be used to estimate the effects of inhaled pollutants on the immune defense mechanism in the human lung
International Nuclear Information System (INIS)
Yue-Hua Wang; De-jie Chen; Tie-Nan Yi
2010-01-01
To study the relationship between the infection of human papillomavirus (HPV) type 16, type 18, the expression of survivin, and the mutation of p53 gene in lung squamous carcinoma tissue for the research of pathogenesis of lung carcinoma.This study was carried out at the Laboratory of Molecular Biology, Xiangfan Central Hospital of Hubei Province, China from September 2008 to May 2010. Forty-five specimens of lung squamous carcinoma tissue confirmed by histopathology were the excisional specimens taken by the Thoracic Surgery of Xiangfan Central Hospital. Normal tissue, closely adjacent to the fresh carcinoma specimens, was used as the control group for p53 gene mutation analysis. Sixteen surgical excisional specimens of benign lung disease were used as a control group of non-carcinomatous diseases. Human papillomavirus DNA were detected by polymerase chain reaction (PCR), and we used the PCR-single-strand conformation polymorphism-ethidium bromide (PCR-SSCP-EB) method to detect the mutations of the p53 gene. The expression of the survivin gene was detected by immunohistochemistry methods. Approximately 68.9% of 45 lung squamous carcinoma tissue had p53 gene mutations. The mutation rate of exon 5-8 p53 were 15.6%, 17.8%, 15.6% and 20%. Approximately 42.2% of lung squamous cell carcinoma samples were shown to be positive for HPV DNA expression and 62.2% were positive for survivin expression. There was an inverse correlation between the presence of HPV infections and mutations of p53 gene; and the mutations of p53 gene and expression of survivin had a positive relationship. Mutation of p53 gene and HPV infection may facilitate each other in the generation of lung squamous cell carcinoma. Abnormal expression of the survivin gene may take part in the onset and progression of lung squamous cell carcinoma (Author).
de Castro, Ligia Lins; Xisto, Debora Gonçalves; Kitoko, Jamil Zola; Cruz, Fernanda Ferreira; Olsen, Priscilla Christina; Redondo, Patricia Albuquerque Garcia; Ferreira, Tatiana Paula Teixeira; Weiss, Daniel Jay; Martins, Marco Aurélio; Morales, Marcelo Marcos; Rocco, Patricia Rieken Macedo
2017-06-24
Asthma is a chronic inflammatory disease that can be difficult to treat due to its complex pathophysiology. Most current drugs focus on controlling the inflammatory process, but are unable to revert the changes of tissue remodeling. Human mesenchymal stromal cells (MSCs) are effective at reducing inflammation and tissue remodeling; nevertheless, no study has evaluated the therapeutic effects of extracellular vesicles (EVs) obtained from human adipose tissue-derived MSCs (AD-MSC) on established airway remodeling in experimental allergic asthma. C57BL/6 female mice were sensitized and challenged with ovalbumin (OVA). Control (CTRL) animals received saline solution using the same protocol. One day after the last challenge, each group received saline, 10 5 human AD-MSCs, or EVs (released by 10 5 AD-MSCs). Seven days after treatment, animals were anesthetized for lung function assessment and subsequently euthanized. Bronchoalveolar lavage fluid (BALF), lungs, thymus, and mediastinal lymph nodes were harvested for analysis of inflammation. Collagen fiber content of airways and lung parenchyma were also evaluated. In OVA animals, AD-MSCs and EVs acted differently on static lung elastance and on BALF regulatory T cells, CD3 + CD4 + T cells, and pro-inflammatory mediators (interleukin [IL]-4, IL-5, IL-13, and eotaxin), but similarly reduced eosinophils in lung tissue, collagen fiber content in airways and lung parenchyma, levels of transforming growth factor-β in lung tissue, and CD3 + CD4 + T cell counts in the thymus. No significant changes were observed in total cell count or percentage of CD3 + CD4 + T cells in the mediastinal lymph nodes. In this immunocompetent mouse model of allergic asthma, human AD-MSCs and EVs effectively reduced eosinophil counts in lung tissue and BALF and modulated airway remodeling, but their effects on T cells differed in lung and thymus. EVs may hold promise for asthma; however, further studies are required to elucidate the different
Baćmaga, Małgorzata; Wyszkowska, Jadwiga; Kucharski, Jan
2016-10-01
Fungicides are considered to be effective crop protection chemicals in modern agriculture. However, they can also exert toxic effects on non-target organisms, including soil-dwelling microbes. Therefore, the environmental fate of fungicides has to be closely monitored. The aim of this study was to evaluate the influence of the Falcon 460 EC fungicide on microbial diversity, enzyme activity and resistance, and plant growth. Samples of sandy loam with pH KCl 7.0 were collected for laboratory analyses on experimental days 30, 60 and 90. Falcon 460 EC was applied to soil in the following doses: control (soil without the fungicide), dose recommended by the manufacturer, 30-fold higher than the recommended dose, 150-fold higher than the recommended dose and 300-fold higher than the recommended dose. The observed differences in the values of the colony development index and the eco-physiological index indicate that the mixture of spiroxamine, tebuconazole and triadimenol modified the biological diversity of the analyzed groups of soil microorganisms. Bacteria of the genus Bacillus and fungi of the genera Penicillium and Rhizopus were isolated from fungicide-contaminated soil. The tested fungicide inhibited the activity of dehydrogenases, catalase, urease, acid phosphatase and alkaline phosphatase. The greatest changes were induced by the highest fungicide dose 300-fold higher than the recommended dose. Dehydrogenases were most resistant to soil contamination. The Phytotoxkit test revealed that the analyzed fungicide inhibits seed germination capacity and root elongation. The results of this study indicate that excessive doses of the Falcon 460 EC fungicide 30-fold higher than the recommended dose to 300-fold higher than the recommended dose) can induce changes in the biological activity of soil. The analyzed microbiological and biochemical parameters are reliable indicators of the fungicide's toxic effects on soil quality.
Interstitial lung disease associated with human papillomavirus vaccination
Directory of Open Access Journals (Sweden)
Yasushi Yamamoto
2015-01-01
Full Text Available Vaccinations against the human papillomavirus (HPV have been recommended for the prevention of cervical cancer. HPV-16/18 AS04-adjuvanted vaccines (Cervarix are said to have favourable safety profiles. Interstitial lung diseases (ILDs can occur following exposure to a drug or a biological agent. We report a case of ILD associated with a Cervarix vaccination. A woman in her 40's, with a history of conisation, received three inoculations of Cervarix. Three months later, she presented with a cough and shortness of breath. Findings from a computed tomography of the chest and a transbronchial lung biopsy were consistent with non-specific interstitial pneumonia. Workup eliminated all other causes of the ILD, except for the vaccination. Over the 11 months of the follow-up period, her symptoms resolved without steroid therapy. The onset and spontaneous resolution of the ILD showed a chronological association with the HPV vaccination. The semi-quantitative algorithm revealed that the likelihood of an adverse drug reaction to Cervarix was “Probable”. The outcome was relatively good, but more attention should be paid to a potential risk for HPV vaccinations to cause ILDs. Wherever possible, chest radiographic examinations should be performed in order not to overlook any ILDs.
Interactive lung segmentation in abnormal human and animal chest CT scans
International Nuclear Information System (INIS)
Kockelkorn, Thessa T. J. P.; Viergever, Max A.; Schaefer-Prokop, Cornelia M.; Bozovic, Gracijela; Muñoz-Barrutia, Arrate; Rikxoort, Eva M. van; Brown, Matthew S.; Jong, Pim A. de; Ginneken, Bram van
2014-01-01
Purpose: Many medical image analysis systems require segmentation of the structures of interest as a first step. For scans with gross pathology, automatic segmentation methods may fail. The authors’ aim is to develop a versatile, fast, and reliable interactive system to segment anatomical structures. In this study, this system was used for segmenting lungs in challenging thoracic computed tomography (CT) scans. Methods: In volumetric thoracic CT scans, the chest is segmented and divided into 3D volumes of interest (VOIs), containing voxels with similar densities. These VOIs are automatically labeled as either lung tissue or nonlung tissue. The automatic labeling results can be corrected using an interactive or a supervised interactive approach. When using the supervised interactive system, the user is shown the classification results per slice, whereupon he/she can adjust incorrect labels. The system is retrained continuously, taking the corrections and approvals of the user into account. In this way, the system learns to make a better distinction between lung tissue and nonlung tissue. When using the interactive framework without supervised learning, the user corrects all incorrectly labeled VOIs manually. Both interactive segmentation tools were tested on 32 volumetric CT scans of pigs, mice and humans, containing pulmonary abnormalities. Results: On average, supervised interactive lung segmentation took under 9 min of user interaction. Algorithm computing time was 2 min on average, but can easily be reduced. On average, 2.0% of all VOIs in a scan had to be relabeled. Lung segmentation using the interactive segmentation method took on average 13 min and involved relabeling 3.0% of all VOIs on average. The resulting segmentations correspond well to manual delineations of eight axial slices per scan, with an average Dice similarity coefficient of 0.933. Conclusions: The authors have developed two fast and reliable methods for interactive lung segmentation in
Umachandran, Meera; Ioannides, Costas
2006-07-05
The objective of the present study was to evaluate the stability of cytochrome P450 enzymes and of the conjugation enzyme systems epoxide hydrolase, glucuronosyl transferase, sulphotransferase and glutathione S-transferase in precision-cut rat lung slices incubated in RPMI media for different time periods up to 72 h. Moreover, the effect of culturing of lung slices on total glutathione levels and glutathione reductase was also investigated. Monitoring of cytochrome P450 activity was achieved using established diagnostic probes, but when activity in the lung was low the maintenance of the various enzymes in culture was determined immunologically using Western blotting. The dealkylation of pentoxyresorufin declined markedly during the first 4h of incubation but in the case of ethoxyresorufin loss of activity was more gradual and less severe. Western blot analysis revealed that the rate of decrease in cytochrome P450 apoprotein levels was isoform-specific with CYP2E1 being the most stable and CYP3A the least stable. Generally, phase II activities, especially cytosolic sulphotransferase, were relatively more stable throughout the incubation period compared with cytochromes P450. Finally, glutathione reductase activity and total glutathione levels were maintained throughout the 72 h incubation. The present studies indicate that xenobiotic-metabolising enzymes in precision-cut rat lung slices decline in culture, but the rate of loss differs and depends on the nature of the enzyme.
Comparison of lung protective ventilation strategies in a rabbit model of acute lung injury.
Rotta, A T; Gunnarsson, B; Fuhrman, B P; Hernan, L J; Steinhorn, D M
2001-11-01
To determine the impact of different protective and nonprotective mechanical ventilation strategies on the degree of pulmonary inflammation, oxidative damage, and hemodynamic stability in a saline lavage model of acute lung injury. A prospective, randomized, controlled, in vivo animal laboratory study. Animal research facility of a health sciences university. Forty-six New Zealand White rabbits. Mature rabbits were instrumented with a tracheostomy and vascular catheters. Lavage-injured rabbits were randomized to receive conventional ventilation with either a) low peak end-expiratory pressure (PEEP; tidal volume of 10 mL/kg, PEEP of 2 cm H2O); b) high PEEP (tidal volume of 10 mL/kg, PEEP of 10 cm H2O); c) low tidal volume with PEEP above Pflex (open lung strategy, tidal volume of 6 mL/kg, PEEP set 2 cm H2O > Pflex); or d) high-frequency oscillatory ventilation. Animals were ventilated for 4 hrs. Lung lavage fluid and tissue samples were obtained immediately after animals were killed. Lung lavage fluid was assayed for measurements of total protein, elastase activity, tumor necrosis factor-alpha, and malondialdehyde. Lung tissue homogenates were assayed for measurements of myeloperoxidase activity and malondialdehyde. The need for inotropic support was recorded. Animals that received a lung protective strategy (open lung or high-frequency oscillatory ventilation) exhibited more favorable oxygenation and lung mechanics compared with the low PEEP and high PEEP groups. Animals ventilated by a lung protective strategy also showed attenuation of inflammation (reduced tracheal fluid protein, tracheal fluid elastase, tracheal fluid tumor necrosis factor-alpha, and pulmonary leukostasis). Animals treated with high-frequency oscillatory ventilation had attenuated oxidative injury to the lung and greater hemodynamic stability compared with the other experimental groups. Both lung protective strategies were associated with improved oxygenation, attenuated inflammation, and
Yamada, Shinji; Itai, Shunsuke; Nakamura, Takuro; Chang, Yao-Wen; Harada, Hiroyuki; Suzuki, Hiroyoshi; Kaneko, Mika K; Kato, Yukinari
2017-12-01
Human epidermal growth factor receptor 2 (HER2) is overexpressed in breast cancer and is associated with poor clinical outcomes. In addition, HER2 expression has been reported in other cancers, such as gastric, colorectal, lung, and pancreatic cancers. An anti-HER2 humanized antibody, trastuzumab, leads to significant survival benefits in patients with HER2-overexpressing breast cancers and gastric cancers. Herein, we established a novel anti-HER2 monoclonal antibody (mAb), H 2 Mab-119 (IgG 1 , kappa), and characterized its efficacy against pancreatic cancers using flow cytometry, Western blot, and immunohistochemical analyses. H 2 Mab-119 reacted with pancreatic cancer cell lines, such as KLM-1, Capan-2, and MIA PaCa-2, but did not react with PANC-1 in flow cytometry analysis. Western blot analysis also revealed a moderate signal for KLM-1 and a weak signal for MIA PaCa-2, although H 2 Mab-119 reacted strongly with LN229/HER2 cells. Finally, immunohistochemical analyses with H 2 Mab-119 revealed sensitive and specific reactions against breast and colon cancers but did not react with pancreatic cancers, indicating that H 2 Mab-119 is useful for detecting HER2 overexpression in pancreatic cancers using flow cytometry and Western blot analyses.
Directory of Open Access Journals (Sweden)
Perkins Timothy N
2012-02-01
Full Text Available Abstract Background Exposure to respirable crystalline silica particles, as opposed to amorphous silica, is associated with lung inflammation, pulmonary fibrosis (silicosis, and potentially with lung cancer. We used Affymetrix/GeneSifter microarray analysis to determine whether gene expression profiles differed in a human bronchial epithelial cell line (BEAS 2B exposed to cristobalite vs. amorphous silica particles at non-toxic and equal surface areas (75 and 150 × 106μm2/cm2. Bio-Plex analysis was also used to determine profiles of secreted cytokines and chemokines in response to both particles. Finally, primary human bronchial epithelial cells (NHBE were used to comparatively assess silica particle-induced alterations in gene expression. Results Microarray analysis at 24 hours in BEAS 2B revealed 333 and 631 significant alterations in gene expression induced by cristobalite at low (75 and high (150 × 106μm2/cm2 amounts, respectively (p 6μm2/cm2 induced 108 significant gene changes. Bio-Plex analysis of 27 human cytokines and chemokines revealed 9 secreted mediators (p FOS, ATF3, IL6 and IL8 early and over time (2, 4, 8, and 24 h. Patterns of gene expression in NHBE cells were similar overall to BEAS 2B cells. At 75 × 106μm2/cm2, there were 339 significant alterations in gene expression induced by cristobalite and 42 by amorphous silica. Comparison of genes in response to cristobalite (75 × 106μm2/cm2 revealed 60 common, significant gene alterations in NHBE and BEAS 2B cells. Conclusions Cristobalite silica, as compared to synthetic amorphous silica particles at equal surface area concentrations, had comparable effects on the viability of human bronchial epithelial cells. However, effects on gene expression, as well as secretion of cytokines and chemokines, drastically differed, as the crystalline silica induced more intense responses. Our studies indicate that toxicological testing of particulates by surveying viability and
The HSP90 Inhibitor Ganetespib Radiosensitizes Human Lung Adenocarcinoma Cells
Directory of Open Access Journals (Sweden)
Roberto Gomez-Casal
2015-05-01
Full Text Available The molecular chaperone HSP90 is involved in stabilization and function of multiple client proteins, many of which represent important oncogenic drivers in NSCLC. Utilization of HSP90 inhibitors as radiosensitizing agents is a promising approach. The antitumor activity of ganetespib, HSP90 inhibitor, was evaluated in human lung adenocarcinoma (AC cells for its ability to potentiate the effects of IR treatment in both in vitro and in vivo. The cytotoxic effects of ganetespib included; G2/M cell cycle arrest, inhibition of DNA repair, apoptosis induction, and promotion of senescence. All of these antitumor effects were both concentration- and time-dependent. Both pretreatment and post-radiation treatment with ganetespib at low nanomolar concentrations induced radiosensitization in lung AC cells in vitro. Ganetespib may impart radiosensitization through multiple mechanisms: such as down regulation of the PI3K/Akt pathway; diminished DNA repair capacity and promotion of cellular senescence. In vivo, ganetespib reduced growth of T2821 tumor xenografts in mice and sensitized tumors to IR. Tumor irradiation led to dramatic upregulation of β-catenin expression in tumor tissues, an effect that was mitigated in T2821 xenografts when ganetespib was combined with IR treatments. These data highlight the promise of combining ganetespib with IR therapies in the treatment of AC lung tumors.
Allardet-Servent, Jérôme; Bregeon, Fabienne; Delpierre, Stéphane; Steinberg, Jean-Guillaume; Payan, Marie-José; Ravailhe, Sylvie; Papazian, Laurent
2008-01-01
To test the effects of high-frequency percussive ventilation (HFPV) compared with high-frequency oscillatory ventilation (HFOV) and low-volume conventional mechanical ventilation (LVCMV), on lung injury course in a gastric juice aspiration model. Prospective, randomized, controlled, in-vivo animal study. University animal research laboratory. Forty-three New Zealand rabbits. Lung injury was induced by intratracheal instillation of human gastric juice in order to achieve profound hypoxaemia (PaO2/FIO2ventilated for 4h after randomization in one of the following four groups: HFPV (median pressure 15cmH2O); LVCMV (VT 6mlkg(-1) and PEEP set to reach 15cmH2O plateau pressure); HFOV (mean pressure 15cmH2O); and a high-volume control group HVCMV (VT 12ml kg(-1) and ZEEP). Static respiratory compliance increased after the ventilation period in the HFPV, LVMCV and HFOV groups, in contrast with the HVCMV group. PaO2/FIO2 improved similarly in the HFPV, LVCMV and HFOV groups, and remained lower in the HVCMV group than in the three others. Lung oedema, myeloperoxidase and histological lung injury score were higher in the HVCMV group, but not different among all others. Arterial lactate markedly increased after 4h of ventilation in the HVCMV group, while lower but similar levels were observed in the three other groups. HFPV, like HFOV and protective CMV, improves respiratory mechanics and oxygenation, and attenuates lung damage. The HFPV provides attractive lung protection, but further studies should confirm these results before introducing HFPV into the clinical arena.
Hsieh, Ching-Lin; Tseng, Andrew; He, Hongxuan; Kuo, Chih-Jung; Wang, Xuannian; Chang, Yung-Fu
2017-01-01
Leptospira immunoglobulin-like protein B (LigB), a surface adhesin, is capable of mediating the attachment of pathogenic leptospira to the host through interaction with various components of the extracellular matrix (ECM). Human tropoelastin (HTE), the building block of elastin, confers resilience and elasticity to lung, and other tissues. Previously identified Ig-like domains of LigB, including LigB4 and LigB12, bind to HTE, which is likely to promote Leptospira adhesion to lung tissue. However, the molecular mechanism that mediates the LigB-HTE interaction is unclear. In this study, the LigB-binding site on HTE was further pinpointed to a N-terminal region of the 20th exon of HTE (HTE20N). Alanine mutants of basic and aromatic residues on HTE20N significantly reduced binding to the LigB. Additionally, HTE-binding site was narrowed down to the first β-sheet of LigB12. On this binding surface, residues F1054, D1061, A1065, and D1066 were critical for the association with HTE. Most importantly, the recombinant HTE truncates could diminish the binding of LigB to human lung fibroblasts (WI-38) by 68%, and could block the association of LigA-expressing L. biflexa to lung cells by 61%. These findings should expand our understanding of leptospiral pathogenesis, particularly in pulmonary manifestations of leptospirosis.
Directory of Open Access Journals (Sweden)
Ching-Lin Hsieh
2017-05-01
Full Text Available Leptospira immunoglobulin-like protein B (LigB, a surface adhesin, is capable of mediating the attachment of pathogenic leptospira to the host through interaction with various components of the extracellular matrix (ECM. Human tropoelastin (HTE, the building block of elastin, confers resilience and elasticity to lung, and other tissues. Previously identified Ig-like domains of LigB, including LigB4 and LigB12, bind to HTE, which is likely to promote Leptospira adhesion to lung tissue. However, the molecular mechanism that mediates the LigB-HTE interaction is unclear. In this study, the LigB-binding site on HTE was further pinpointed to a N-terminal region of the 20th exon of HTE (HTE20N. Alanine mutants of basic and aromatic residues on HTE20N significantly reduced binding to the LigB. Additionally, HTE-binding site was narrowed down to the first β-sheet of LigB12. On this binding surface, residues F1054, D1061, A1065, and D1066 were critical for the association with HTE. Most importantly, the recombinant HTE truncates could diminish the binding of LigB to human lung fibroblasts (WI-38 by 68%, and could block the association of LigA-expressing L. biflexa to lung cells by 61%. These findings should expand our understanding of leptospiral pathogenesis, particularly in pulmonary manifestations of leptospirosis.
Hwang, Jung-Ah; Kim, Yujin; Hong, Seung-Hyun; Lee, Jieun; Cho, Yong Gu; Han, Ji-Youn; Kim, Young-Ho; Han, Joungho; Shim, Young Mog; Lee, Yeon-Su; Kim, Duk-Hwan
2013-01-01
Background This study was aimed at investigating the functional significance of heparan sulfate (glucosamine) 3-O-sulfotransferase 2 (HS3ST2) hypermethylation in non-small cell lung cancer (NSCLC). Methodology/ Principal Findings HS3ST2 hypermethylation was characterized in six lung cancer cell lines, and its clinical significance was analyzed using 298 formalin-fixed paraffin-embedded tissues and 26 fresh-frozen tissues from 324 NSCLC patients. MS-HRM (methylation-specific high-resolution melting) and EpiTYPERTM assays showed substantial hypermethylation of CpG island at the promoter region of HS3ST2 in six lung cancer cell lines. The silenced gene was demethylated and re-expressed by treatment with 5-aza-2′-deoxycytidine (5-Aza-dC). A promoter assay also showed the core promoter activity of HS3ST2 was regulated by methylation. Exogenous expression of HS3ST2 in lung cancer cells H460 and H23 inhibited cell migration, invasion, cell proliferation and whereas knockdown of HS3ST2 in NHBE cells induced cell migration, invasion, and cell proliferation in vitro. A negative correlation was observed between mRNA and methylation levels of HS3ST2 in 26 fresh-frozen tumors tissues (ρ = -0.51, P = 0.009; Spearman’s rank correlation). HS3ST2 hypermethylation was found in 95 (32%) of 298 primary NSCLCs. Patients with HS3ST2 hypermethylation in 193 node-negative stage I-II NSCLCs with a median follow-up period of 5.8 years had poor overall survival (hazard ratio = 2.12, 95% confidence interval = 1.25–3.58, P = 0.005) compared to those without HS3ST2 hypermethylation, after adjusting for age, sex, tumor size, adjuvant therapy, recurrence, and differentiation. Conclusions/ Significance The present study suggests that HS3ST2 hypermethylation may be an independent prognostic indicator for overall survival in node-negative stage I-II NSCLC. PMID:24265783
Lung cancer, intracellular signaling pathways, and preclinical models
International Nuclear Information System (INIS)
Mordant, P.
2012-01-01
Non-small cell lung cancer (NSCLC) is the leading cause of cancer-related mortality worldwide. Activation of phosphatidylinositol-3-kinase (PI3K)-AKT and Kirsten rat sarcoma viral oncogene homologue (KRAS) can induce cellular immortalization, proliferation, and resistance to anticancer therapeutics such as epidermal growth factor receptor inhibitors or chemotherapy. This study assessed the consequences of inhibiting these two pathways in tumor cells with activation of KRAS, PI3K-AKT, or both. We investigated whether the combination of a novel RAF/vascular endothelial growth factor receptor inhibitor, RAF265, with a mammalian target of rapamycin (mTOR) inhibitor, RAD001 (everolimus), could lead to enhanced anti-tumoral effects in vitro and in vivo. To address this question, we used cell lines with different status regarding KRAS, PIK3CA, and BRAF mutations, using immunoblotting to evaluate the inhibitors, and MTT and clonogenic assays for effects on cell viability and proliferation. Subcutaneous xenografts were used to assess the activity of the combination in vivo. RAD001 inhibited mTOR downstream signaling in all cell lines, whereas RAF265 inhibited RAF downstream signaling only in BRAF mutant cells. In vitro, addition of RAF265 to RAD001 led to decreased AKT, S6, and Eukaryotic translation initiation factor 4E binding protein 1 phosphorylation in HCT116 cells. In vitro and in vivo, RAD001 addition enhanced the anti-tumoral effect of RAF265 in HCT116 and H460 cells (both KRAS mut, PIK3CA mut); in contrast, the combination of RAF265 and RAD001 yielded no additional activity in A549 and MDAMB231 cells. The combination of RAF and mTOR inhibitors is effective for enhancing anti-tumoral effects in cells with deregulation of both RAS-RAF and PI3K, possibly through the cross-inhibition of 4E binding protein 1 and S6 protein. We then focus on animal models. Preclinical models of NSCLC require better clinical relevance to study disease mechanisms and innovative
Lisciandro, Gregory R; Fosgate, Geoffrey T; Fulton, Robert M
2014-01-01
Lung ultrasound is superior to lung auscultation and supine chest radiography for many respiratory conditions in human patients. Ultrasound diagnoses are based on easily learned patterns of sonographic findings and artifacts in standardized images. By applying the wet lung (ultrasound lung rockets or B-lines, representing interstitial edema) versus dry lung (A-lines with a glide sign) concept many respiratory conditions can be diagnosed or excluded. The ultrasound probe can be used as a visual stethoscope for the evaluation of human lungs because dry artifacts (A-lines with a glide sign) predominate over wet artifacts (ultrasound lung rockets or B-lines). However, the frequency and number of wet lung ultrasound artifacts in dogs with radiographically normal lungs is unknown. Thus, the primary objective was to determine the baseline frequency and number of ultrasound lung rockets in dogs without clinical signs of respiratory disease and with radiographically normal lung findings using an 8-view novel regionally based lung ultrasound examination called Vet BLUE. Frequency of ultrasound lung rockets were statistically compared based on signalment, body condition score, investigator, and reasons for radiography. Ten left-sided heart failure dogs were similarly enrolled. Overall frequency of ultrasound lung rockets was 11% (95% confidence interval, 6-19%) in dogs without respiratory disease versus 100% (95% confidence interval, 74-100%) in those with left-sided heart failure. The low frequency and number of ultrasound lung rockets observed in dogs without respiratory disease and with radiographically normal lungs suggests that Vet BLUE will be clinically useful for the identification of canine respiratory conditions. © 2014 American College of Veterinary Radiology.
van Wieren-de Wijer, Diane B M A; Maitland-van der Zee, Anke-Hilse; de Boer, Anthonius; Kroon, Abraham A; de Leeuw, Peter W; Schiffers, Paul; Janssen, Rob G J H; Psaty, Bruce M; van Duijn, Cornelia M; Stricker, Bruno H Ch; Klungel, Olaf H
INTRODUCTION: The Gly460Trp variant of the alpha-adducin gene has been associated with the salt-sensitive and diuretic responsive form of hypertension. OBJECTIVE: The aim of the study was to determine whether the alpha-adducin 460Trp variant allele modifies the risk-lowering effect of diuretics on
Role of ATM in bystander signaling between human monocytes and lung adenocarcinoma cells.
Ghosh, Somnath; Ghosh, Anu; Krishna, Malini
2015-12-01
The response of a cell or tissue to ionizing radiation is mediated by direct damage to cellular components and indirect damage mediated by radiolysis of water. Radiation affects both irradiated cells and the surrounding cells and tissues. The radiation-induced bystander effect is defined by the presence of biological effects in cells that were not themselves in the field of irradiation. To establish the contribution of the bystander effect in the survival of the neighboring cells, lung carcinoma A549 cells were exposed to gamma-irradiation, 2Gy. The medium from the irradiated cells was transferred to non-irradiated A549 cells. Irradiated A549 cells as well as non-irradiated A549 cells cultured in the presence of medium from irradiated cells showed decrease in survival and increase in γ-H2AX and p-ATM foci, indicating a bystander effect. Bystander signaling was also observed between different cell types. Phorbol-12-myristate-13-acetate (PMA)-stimulated and gamma-irradiated U937 (human monocyte) cells induced a bystander response in non-irradiated A549 (lung carcinoma) cells as shown by decreased survival and increased γ-H2AX and p-ATM foci. Non-stimulated and/or irradiated U937 cells did not induce such effects in non-irradiated A549 cells. Since ATM protein was activated in irradiated cells as well as bystander cells, it was of interest to understand its role in bystander effect. Suppression of ATM with siRNA in A549 cells completely inhibited bystander effect in bystander A549 cells. On the other hand suppression of ATM with siRNA in PMA stimulated U937 cells caused only a partial inhibition of bystander effect in bystander A549 cells. These results indicate that apart from ATM, some additional factor may be involved in bystander effect between different cell types. Copyright © 2015 Elsevier B.V. All rights reserved.
Slater, Tessa; Eckerle, Isabella; Chang, Kin-Chow
2018-04-10
With the recent discovery of novel H17N10 and H18N11 influenza viral RNA in bats and report on high frequency of avian H9 seroconversion in a species of free ranging bats, an important issue to address is the extent bats are susceptible to conventional avian and human influenza A viruses. To this end, three bat species (Eidolon helvum, Carollia perspicillata and Tadarida brasiliensis) of lung epithelial cells were separately infected with two avian and two human influenza viruses to determine their relative host innate immune resistance to infection. All three species of bat cells were more resistant than positive control Madin-Darby canine kidney (MDCK) cells to all four influenza viruses. TB1-Lu cells lacked sialic acid α2,6-Gal receptors and were most resistant among the three bat species. Interestingly, avian viruses were relatively more replication permissive in all three bat species of cells than with the use of human viruses which suggest that bats could potentially play a role in the ecology of avian influenza viruses. Chemical inhibition of the JAK-STAT pathway in bat cells had no effect on virus production suggesting that type I interferon signalling is not a major factor in resisting influenza virus infection. Although all three species of bat cells are relatively more resistant to influenza virus infection than control MDCK cells, they are more permissive to avian than human viruses which suggest that bats could have a contributory role in the ecology of avian influenza viruses.
International Nuclear Information System (INIS)
Akimoto, Tetsuo; Mitsuhashi, Norio; Saito, Yoshihiro; Ebara, Takeshi; Niibe, Hideo
1998-01-01
Purpose: To investigate the effect of radiation on E-cadherin and α-catenin expression in a human lung cancer cell line, and also evaluate invasive capacity in the membrane invasion culture system using the Boyden Chamber. Materials and Methods: The immunoblot and immunofluorescence analyses were performed using the human lung cancer cell line A549 to examine altered expression of E-cadherin and α-catenin after irradiation. We also compared invasive capacity of untreated cells with that of irradiated cells. Results: Immunoblot analysis revealed that the expression of E-cadherin increased after irradiation. In a time-course analysis, the expression was increased 6 h after irradiation with 10 Gy and reached its peak level at 24 h, being 2.3 times the control value, whereas expression at 1 and 3 h after irradiation was almost equivalent to that of the control. A slight increase in expression was observed after irradiation of 2 Gy and the expression reached peak levels after 5 Gy. After fractionated irradiation, the increase in expression of both E-cadherin and α-catenin was observed, and the alteration of α-catenin was more prominent than that after a single irradiation of the same total dose. In the immunofluorescence study for E-cadherin antibody analyzed by confocal laser scanning microscopy, increased intensity in irradiated cells produced as a nondisrupted and continuous line at cell-cell contact sites. In an invasive assay, the number of migrated cells in irradiated cells after a dose of 5 and 10 Gy was reduced significantly compared to untreated cells. Conclusion: The results indicate that irradiation of A549 increased the expression of E-cadherin, possibly preserving their functional property
Directory of Open Access Journals (Sweden)
Angel Quispe M
2006-10-01
Full Text Available Objetivos: Determinar la actividad citotóxica selectiva de muricin H en la línea celular H460 (cáncer de pulmón de células grandes. Materiales y métodos: Las líneas H460 y 3T3 (fibroblastos normales de ratón, fueron expuestas a seis concentraciones de muricin H (62,5, 15,6, 3,9, 0,98, 0,24, 0,06 µg/mL, e iguales concentraciones de 5-fluorouracilo (5-FU usado como control positivo. Se hallaron los porcentajes de crecimiento en 48 horas, luego se determinó la concentración inhibitoria de crecimiento 50 (CI50 mediante análisis de regresión linear y se obtuvieron los coeficientes de correlación de Pearson. Finalmente se calculó el índice de selectividad de cada muestra. Resultados: Los CI50 en µg/mL de muricin H fueron <0,06 (r = -0,96; p<0,005 para H460; y 6,16 (r = -0,96; p<0,025 para 3T3. Los CI50 de 5-fluorouracilo fueron 0,46 (r = -0,95; p<0,005 para H460 y 0,29 (r = -0,88; p =0,01 para 3T3. Los índices de selectividad para muricin H y 5-FU fueron: 102,6 y 0,63 respectivamente. Conclusiones: Se demostró la acción citotóxica selectiva in vitro del muricin H, porque tuvo mayor efecto citotóxico para la línea H460, y menor para la línea 3T3 en relación con el 5-fluorouracilo.
Spieth, P M; Güldner, A; Carvalho, A R; Kasper, M; Pelosi, P; Uhlig, S; Koch, T; Gama de Abreu, M
2011-09-01
Setting and strategies of mechanical ventilation with positive end-expiratory pressure (PEEP) in acute lung injury (ALI) remains controversial. This study compares the effects between lung-protective mechanical ventilation according to the Acute Respiratory Distress Syndrome Network recommendations (ARDSnet) and the open lung approach (OLA) on pulmonary function and inflammatory response. Eighteen juvenile pigs were anaesthetized, mechanically ventilated, and instrumented. ALI was induced by surfactant washout. Animals were randomly assigned to mechanical ventilation according to the ARDSnet protocol or the OLA (n=9 per group). Gas exchange, haemodynamics, pulmonary blood flow (PBF) distribution, and respiratory mechanics were measured at intervals and the lungs were removed after 6 h of mechanical ventilation for further analysis. PEEP and mean airway pressure were higher in the OLA than in the ARDSnet group [15 cmH(2)O, range 14-18 cmH(2)O, compared with 12 cmH(2)O; 20.5 (sd 2.3) compared with 18 (1.4) cmH(2)O by the end of the experiment, respectively], and OLA was associated with improved oxygenation compared with the ARDSnet group after 6 h. OLA showed more alveolar overdistension, especially in gravitationally non-dependent regions, while the ARDSnet group was associated with more intra-alveolar haemorrhage. Inflammatory mediators and markers of lung parenchymal stress did not differ significantly between groups. The PBF shifted from ventral to dorsal during OLA compared with ARDSnet protocol [-0.02 (-0.09 to -0.01) compared with -0.08 (-0.12 to -0.06), dorsal-ventral gradients after 6 h, respectively]. According to the OLA, mechanical ventilation improved oxygenation and redistributed pulmonary perfusion when compared with the ARDSnet protocol, without differences in lung inflammatory response.
International Nuclear Information System (INIS)
Wang Enzhong
1991-01-01
An in vitro drug sensitivity test was developed to evaluate the lethal effects of drugs on human pulmonary carcinoma cells (HPCC). This method was a variant and combination of Human Tumor Stem (HTSCA) and a short-term test using 3 H-TdR incorporation. It consisted of a cell containing liquid top layer and a soft agar bottom layer in 24-well microplates. The medium was RPMI 1640 supplemented with 20% malignant pleural effusion, which could enhance 3 H-TdR incorporation into malignant cells. When 50%, 40%, 30% and 30% of cell survival rate defined as sensitivity-threshold for VCR, MMC, DDP and ADM respectively, in the vitro effectiveness were close to those of clinical single-drug treatment in HPCC by Wright et al. This method was also compared with HTSCA in ten human lung cancer cell lines and four pulmonary carcinoma tissues. The agreement rates were 83% and 100% respectively. Thus we presume this system is more useful for oncological clinics than the others
International Nuclear Information System (INIS)
Wang Yuxia; Ticu Boeck, Andreea; Duysen, Ellen G.; Van Keuren, Margaret; Saunders, Thomas L.; Lockridge, Oksana
2004-01-01
Organophosphorus toxicants (OP) include chemical nerve agents and pesticides. The goal of this work was to find out whether an animal could be made resistant to OP toxicity by genetic engineering. The human butyrylcholinesterase (BChE) mutant G117H was chosen for study because it has the unusual ability to hydrolyze OP as well as acetylcholine, and it is resistant to inhibition by OP. Human G117H BChE, under the control of the ROSA26 promoter, was expressed in all tissues of transgenic mice. A stable transgenic mouse line expressed 0.5 μg/ml of human G117H BChE in plasma as well as 2 μg/ml of wild-type mouse BChE. Intestine, kidneys, stomach, lungs, heart, spleen, liver, brain, and muscle expressed 0.6-0.15 μg/g of G117H BChE. Transgenic mice were normal in behavior and fertility. The LD50 dose of echothiophate for wild-type mice was 0.1 mg/kg sc. This dose caused severe cholinergic signs of toxicity and lethality in wild-type mice, but caused no deaths and only mild toxicity in transgenic animals. The mechanism of protection was investigated by measuring acetylcholinesterase (AChE) and BChE activity. It was found that AChE and endogenous BChE were inhibited to the same extent in echothiophate-treated wild type and transgenic mice. This led to the hypothesis that protection against echothiophate toxicity was not explained by hydrolysis of echothiophate. In conclusion, the transgenic G117H BChE mouse demonstrates the factors required to achieve protection from OP toxicity in a vertebrate animal
International Nuclear Information System (INIS)
Belov, Pavel
2013-06-01
A combination is presented of the inclusive neutral current e ± p scattering cross section data collected by the H1 and ZEUS collaborations during the last months of the HERA II operation period with proton beam energies E p of 460 and 575 GeV. The kinematic range of the cross section data covers low absolute four-momentum transfers squared, 1.5 GeV 2 ≤ Q 2 ≤ 110 GeV 2 , small values of Bjorken-x, 2.8.10 -5 ≤ x ≤ 1.5.10 -2 , and high inelasticity y ≤ 0.85. The combination algorithm is based on the method of least squares and takes into account correlations of the systematic uncertainties. The combined data are used in the QCD fits to extract the parton distribution functions. The phenomenological low-x dipole models are tested and parameters of the models are obtained. A good description of the data by the dipole model taking into account the evolution of the gluon distribution is observed. The longitudinal structure function F L is extracted from the combination of the currently used H1 and ZEUS reduced proton beam energy data with previously published H1 nominal proton beam energy data of 920 GeV. A precision of the obtained values of F L is improved at medium Q 2 compared to the published results of the H1 collaboration.
International Nuclear Information System (INIS)
Poulain, Stéphane; Lacomme, Stéphanie; Battaglia-Hsu, Shyue-Fang; Manoir, Stanislas du; Brochin, Lydia; Vignaud, Jean-Michel; Martinet, Nadine
2009-01-01
Retinoid Receptors are involved in development and cell homeostasis. Alterations of their expressions have been observed in lung cancer. However, retinoid chemoprevention trials in populations at risk to develop such tumors have failed. Therefore, the pertinence of new clinical trials using second generation retinoid requires prior better understanding of retinoid signalling. This is our aim when validating extensively research tools, focused on Retinoic Acid Receptor beta, whose major role in lung cancer is documented. Biocomputing was used to assess the genomic organization of RAR beta. Its putative RAR-beta1' promoter features were investigated experimentally. Specific measures realized, with qRT-PCR Syber Green assays and a triplex of Taqman probes, were extensively validated to establish Retinoid Receptors mRNAs reference values for in vivo normal human bronchial cells, lung tumors and cell lines. Finally, a pan-RAR-beta antibody was generated and extensively validated by western-blot and immunoprecipitation. No promoter-like activity was found for RAR-beta1'. RAR-beta2 mRNAs increase signs the normal differentiation of the human bronchial epithelium while a decrease is observed in most lung cancer cell lines. Accordingly, it is also, along with RXR beta, down-regulated in lung tumors. When using nuclear extracts of BEAS-2B and normal lung cells, only the RAR-beta2 long protein isoform was recognized by our antibody. Rigorous samples processing and extensive biocomputing, were the key factors for this study. mRNA reference values and validated tools can now be used to advance researches on retinoid signalling in the lung
Ambrosio, Aline M; Luo, Rubin; Fantoni, Denise T; Gutierres, Claudia; Lu, Qin; Gu, Wen-Jie; Otsuki, Denise A; Malbouisson, Luiz M S; Auler, Jose O C; Rouby, Jean-Jacques
2012-12-01
In acute lung injury positive end-expiratory pressure (PEEP) and recruitment maneuver are proposed to optimize arterial oxygenation. The aim of the study was to evaluate the impact of such a strategy on lung histological inflammation and hyperinflation in pigs with acid aspiration-induced lung injury. Forty-seven pigs were randomly allocated in seven groups: (1) controls spontaneously breathing; (2) without lung injury, PEEP 5 cm H2O; (3) without lung injury, PEEP titration; (4) without lung injury, PEEP titration + recruitment maneuver; (5) with lung injury, PEEP 5 cm H2O; (6) with lung injury, PEEP titration; and (7) with lung injury, PEEP titration + recruitment maneuver. Acute lung injury was induced by intratracheal instillation of hydrochloric acid. PEEP titration was performed by incremental and decremental PEEP from 5 to 20 cm H2O for optimizing arterial oxygenation. Three recruitment maneuvers (pressure of 40 cm H2O maintained for 20 s) were applied to the assigned groups at each PEEP level. Proportion of lung inflammation, hemorrhage, edema, and alveolar wall disruption were recorded on each histological field. Mean alveolar area was measured in the aerated lung regions. Acid aspiration increased mean alveolar area and produced alveolar wall disruption, lung edema, alveolar hemorrhage, and lung inflammation. PEEP titration significantly improved arterial oxygenation but simultaneously increased lung inflammation in juxta-diaphragmatic lung regions. Recruitment maneuver during PEEP titration did not induce additional increase in lung inflammation and alveolar hyperinflation. In a porcine model of acid aspiration-induced lung injury, PEEP titration aimed at optimizing arterial oxygenation, substantially increased lung inflammation. Recruitment maneuvers further improved arterial oxygenation without additional effects on inflammation and hyperinflation.
Qi, Wenbao; Jia, Weixin; Liu, Di; Li, Jing; Bi, Yuhai; Xie, Shumin; Li, Bo; Hu, Tao; Du, Yingying; Xing, Li; Zhang, Jiahao; Zhang, Fuchun; Wei, Xiaoman; Eden, John-Sebastian; Li, Huanan; Tian, Huaiyu; Li, Wei; Su, Guanming; Lao, Guangjie; Xu, Chenggang; Xu, Bing; Liu, Wenjun; Zhang, Guihong; Ren, Tao; Holmes, Edward C; Cui, Jie; Shi, Weifeng; Gao, George F; Liao, Ming
2018-01-15
Since its emergence in 2013, the H7N9 low-pathogenic avian influenza virus (LPAIV) has been circulating in domestic poultry in China, causing five waves of human infections. A novel H7N9 highly pathogenic avian influenza virus (HPAIV) variant possessing multiple basic amino acids at the cleavage site of the hemagglutinin (HA) protein was first reported in two cases of human infection in January 2017. More seriously, those novel H7N9 HPAIV variants have been transmitted and caused outbreaks on poultry farms in eight provinces in China. Herein, we demonstrate the presence of three different amino acid motifs at the cleavage sites of these HPAIV variants which were isolated from chickens and humans and likely evolved from the preexisting LPAIVs. Animal experiments showed that these novel H7N9 HPAIV variants are both highly pathogenic in chickens and lethal to mice. Notably, human-origin viruses were more pathogenic in mice than avian viruses, and the mutations in the PB2 gene associated with adaptation to mammals (E627K, A588V, and D701N) were identified by next-generation sequencing (NGS) and Sanger sequencing of the isolates from infected mice. No polymorphisms in the key amino acid substitutions of PB2 and HA in isolates from infected chicken lungs were detected by NGS. In sum, these results highlight the high degree of pathogenicity and the valid transmissibility of this new H7N9 variant in chickens and the quick adaptation of this new H7N9 variant to mammals, so the risk should be evaluated and more attention should be paid to this variant. IMPORTANCE Due to the recent increased numbers of zoonotic infections in poultry and persistent human infections in China, influenza A(H7N9) virus has remained a public health threat. Most of the influenza A(H7N9) viruses reported previously have been of low pathogenicity. Now, these novel H7N9 HPAIV variants have caused human infections in three provinces and outbreaks on poultry farms in eight provinces in China. We analyzed
16 CFR 460.17 - What installers must tell their customers.
2010-01-01
... 16 Commercial Practices 1 2010-01-01 2010-01-01 false What installers must tell their customers... AND ADVERTISING OF HOME INSULATION § 460.17 What installers must tell their customers. If you are an installer, you must give your customers a contract or receipt for the insulation you install. For all...
Barr, Martin P.; Gray, Steven G.; Hoffmann, Andreas C.; Hilger, Ralf A.; Thomale, Juergen; O’Flaherty, John D.; Fennell, Dean A.; Richard, Derek; O’Leary, John J.; O’Byrne, Kenneth J.
2013-01-01
Introduction Inherent and acquired cisplatin resistance reduces the effectiveness of this agent in the management of non-small cell lung cancer (NSCLC). Understanding the molecular mechanisms underlying this process may result in the development of novel agents to enhance the sensitivity of cisplatin. Methods An isogenic model of cisplatin resistance was generated in a panel of NSCLC cell lines (A549, SKMES-1, MOR, H460). Over a period of twelve months, cisplatin resistant (CisR) cell lines were derived from original, age-matched parent cells (PT) and subsequently characterized. Proliferation (MTT) and clonogenic survival assays (crystal violet) were carried out between PT and CisR cells. Cellular response to cisplatin-induced apoptosis and cell cycle distribution were examined by FACS analysis. A panel of cancer stem cell and pluripotent markers was examined in addition to the EMT proteins, c-Met and β-catenin. Cisplatin-DNA adduct formation, DNA damage (γH2AX) and cellular platinum uptake (ICP-MS) was also assessed. Results Characterisation studies demonstrated a decreased proliferative capacity of lung tumour cells in response to cisplatin, increased resistance to cisplatin-induced cell death, accumulation of resistant cells in the G0/G1 phase of the cell cycle and enhanced clonogenic survival ability. Moreover, resistant cells displayed a putative stem-like signature with increased expression of CD133+/CD44+cells and increased ALDH activity relative to their corresponding parental cells. The stem cell markers, Nanog, Oct-4 and SOX-2, were significantly upregulated as were the EMT markers, c-Met and β-catenin. While resistant sublines demonstrated decreased uptake of cisplatin in response to treatment, reduced cisplatin-GpG DNA adduct formation and significantly decreased γH2AX foci were observed compared to parental cell lines. Conclusion Our results identified cisplatin resistant subpopulations of NSCLC cells with a putative stem-like signature, providing
Directory of Open Access Journals (Sweden)
Martin P Barr
Full Text Available Inherent and acquired cisplatin resistance reduces the effectiveness of this agent in the management of non-small cell lung cancer (NSCLC. Understanding the molecular mechanisms underlying this process may result in the development of novel agents to enhance the sensitivity of cisplatin.An isogenic model of cisplatin resistance was generated in a panel of NSCLC cell lines (A549, SKMES-1, MOR, H460. Over a period of twelve months, cisplatin resistant (CisR cell lines were derived from original, age-matched parent cells (PT and subsequently characterized. Proliferation (MTT and clonogenic survival assays (crystal violet were carried out between PT and CisR cells. Cellular response to cisplatin-induced apoptosis and cell cycle distribution were examined by FACS analysis. A panel of cancer stem cell and pluripotent markers was examined in addition to the EMT proteins, c-Met and β-catenin. Cisplatin-DNA adduct formation, DNA damage (γH2AX and cellular platinum uptake (ICP-MS was also assessed.Characterisation studies demonstrated a decreased proliferative capacity of lung tumour cells in response to cisplatin, increased resistance to cisplatin-induced cell death, accumulation of resistant cells in the G0/G1 phase of the cell cycle and enhanced clonogenic survival ability. Moreover, resistant cells displayed a putative stem-like signature with increased expression of CD133+/CD44+cells and increased ALDH activity relative to their corresponding parental cells. The stem cell markers, Nanog, Oct-4 and SOX-2, were significantly upregulated as were the EMT markers, c-Met and β-catenin. While resistant sublines demonstrated decreased uptake of cisplatin in response to treatment, reduced cisplatin-GpG DNA adduct formation and significantly decreased γH2AX foci were observed compared to parental cell lines.Our results identified cisplatin resistant subpopulations of NSCLC cells with a putative stem-like signature, providing a further understanding of the
Directory of Open Access Journals (Sweden)
Ritesh Kumar Srivastava
Full Text Available We study the ameliorative potential of dimetylthiourea (DMTU, an OH• radical trapper and N-acetylcysteine (NAC, a glutathione precursor/H₂O₂ scavenger against titanium dioxide nanoparticles (TiO₂-NPs and multi-walled carbon nanotubes (MWCNTs induced cyto-genotoxicity in cultured human lung cancer cells-A549. Cytogenotoxicity was induced by exposing the cells to selected concentrations (10 and 50 µg/ml of either of TiO₂-NPs or MWCNTs for 24 h. Anti-cytogenotoxicity effects of DMTU and NAC were studied in two groups, i.e., treatment of 30 minutes prior to toxic insult (short term exposure, while the other group received DMTU and NAC treatment during nanoparticles exposure, i.e., 24 h (long term exposure. Investigations were carried out for cell viability, generation of reactive oxygen species (ROS, micronuclei (MN, and expression of markers of oxidative stress (HSP27, CYP2E1, genotoxicity (P⁵³ and CYP2E1 dependent n- nitrosodimethylamine-demethylase (NDMA-d activity. In general, the treatment of both DMTU and NAC was found to be effective significantly against TiO₂-NPs and MWCNTs induced cytogenotoxicity in A549 cells. Long-term treatment of DMTU and NAC during toxic insults has shown better prevention than short-term pretreatment. Although, cells responded significantly to both DMTU and NAC, but responses were chemical specific. In part, TiO₂-NPs induced toxic responses were mediated through OH• radicals generation and reduction in the antioxidant defense system. While in the case of MWCNTs, adverse effects were primarily due to altering/hampering the enzymatic antioxidant system. Data indicate the applicability of human lung cancer cells-A549 as a pre-screening tool to identify the target specific prophylactic and therapeutic potential of drugs candidate molecules against nanoparticles induced cellular damages.