WorldWideScience

Sample records for human glyceraldehyde-3-phosphate dehydrogenase

  1. Immunoaffinity purification and characterization of glyceraldehyde-3-phosphate dehydrogenase from human erythrocytes

    Institute of Scientific and Technical Information of China (English)

    Driss Mountassif; Tarik Baibai; Latifa Fourrat; Adnane Moutaouakkil; Abdelghani Iddar; M'Hammed Sa(i)d El Kebbaj; Abdelaziz Soukri

    2009-01-01

    A new procedure utilizing immunoaffinity column chromatography has been used for the purification of glyceraldehyde-3-phosphate dehydrogenase(GAPDH,EC 1.2.1.12)from human erythrocytes.The comparison between this rapid method(one step)and the traditional procedure including ammonium sulfate fractionation followed by Blue Sepharose CL-6B chromatography shows that the new method gives a highest specific activity with a highest yield in a short time.The characterization of the purified GAPDH reveals that the native enzyme is a homotetramer of ~150 kDa with an absolute specificity for the oxidized form of nicotinamide adenine dinucleotide(NAD+).Western blot analysis using purified monospecific poly clonal antibodies raised against the purified GAPDH showed a singie 36 kDa band corresponding to the enzyme subunit.Studies on the effect of temperature and pH on enzyme activity revealed optimal values of about 43℃ and 8.5, respectively.The kinetic par ameters were also calculated:the Vmax was 4.3 U/mg and the Km values against G3P and NAD+ were 20.7and 17.8μM,respectively.The new protocol described represents a simple,economic,and reproducible tool for the purification Of GAPDH and can be used for other proteins.

  2. Buformin suppresses the expression of glyceraldehyde 3-phosphate dehydrogenase.

    Science.gov (United States)

    Yano, Akiko; Kubota, Masafumi; Iguchi, Kazuhiro; Usui, Shigeyuki; Hirano, Kazuyuki

    2006-05-01

    The biguanides metformin and buformin, which are clinically used for diabetes mellitus, are known to improve resistance to insulin in patients. Biguanides were reported to cause lactic acidosis as a side effect. Since the mechanism of the side effect still remains obscure, we have examined genes whose expression changes by treating HepG2 cells with buformin in order to elucidate the mechanisms of the side effect. A subtraction cDNA library was constructed by the method of suppressive subtractive hybridization and the screening of the library was performed with cDNA probes prepared from HepG2 cells treated with or without buformin for 12 h. The expression of the gene and the protein obtained by the screening was monitored by real-time RT-PCR with specific primers and Western blotting with specific antibody. The amounts of ATP and NAD+ were determined with luciferase and alcohol dehydrogenase, respectively. We found that expression of the glyceraldehyde 3-phosphate dehydrogenase (GAPD) gene was suppressed by treating HepG2 cells with 0.25 mM buformin for 12 h as a result of the library screening. The decrease in the expression depended on the treatment period. The amount of GAPD protein also decreased simultaneously with the suppression of the gene expression by the treatment with buformin. The amount of ATP and NAD+ in the HepG2 cells treated with buformin decreased to 10 and 20% of the control, respectively. These observations imply that the biguanide causes deactivation of the glycolytic pathway and subsequently the accumulation of pyruvate and NADH and a decrease in NAD+. Therefore, the reaction equilibrium catalyzed by lactate dehydrogenase leans towards lactate production and this may result in lactic acidosis.

  3. Role of secreted glyceraldehyde-3-phosphate dehydrogenase in the infection mechanism of enterohemorrhagic and enteropathogenic Escherichia coli: interaction of the extracellular enzyme with human plasminogen and fibrinogen.

    Science.gov (United States)

    Egea, L; Aguilera, L; Giménez, R; Sorolla, M A; Aguilar, J; Badía, J; Baldoma, L

    2007-01-01

    Glyceraldehyde-3-phosphate dehydrogenase (GAPDH) (EC 1.2.1.12) is an anchorless, multifunctional protein displayed on the surface of several fungi and Gram-positive pathogens, which contributes to their adhesion and virulence. To date a role for extracellular GAPDH in the pathogenesis of Gram-negative bacteria has not been described. The aim of this study was to analyze the extracellular localization of GAPDH in enterohemorrhagic (EHEC) and enteropathogenic (EPEC) Escherichia coli strains and to examine its interaction with host components that could be related to the infection mechanism. Recombinant E. coli GAPDH was purified and polyclonal antibodies were obtained. Western blotting and immunoelectron microscopy showed that GAPDH is located on the bacterial surface and released to the culture medium of EHEC and EPEC strains. GAPDH export in these Gram-negative pathogens depends on the external medium, is not mediated by vesicles and leads to an extracellular active enzyme. Non-pathogenic E. coli strains do not secrete GAPDH. Two-dimensional electrophoresis analysis showed that in E. coli GAPDH is present at least in two major forms with different isoelectric points. Of these forms, the more basic is secreted. Purified GAPDH was found to bind human plasminogen and fibrinogen in Far-Western blot and ELISA-based assays. In addition, GAPDH remained associated with colonic Caco-2 epithelial cells after adhesion of EHEC or EPEC. These observations indicate that exported GAPDH may act as a virulence factor which could contribute to EHEC and EPEC pathogenesis. This is the first description of an extracellular localization for this enzyme, with a function other than its glycolytic role in Gram-negative pathogens.

  4. Heme binding properties of glyceraldehyde-3-phosphate dehydrogenase.

    Science.gov (United States)

    Hannibal, Luciana; Collins, Daniel; Brassard, Julie; Chakravarti, Ritu; Vempati, Rajesh; Dorlet, Pierre; Santolini, Jérôme; Dawson, John H; Stuehr, Dennis J

    2012-10-30

    Glyceraldehyde-3-phosphate dehydrogenase (GAPDH) is a glycolytic enzyme that also functions in transcriptional regulation, oxidative stress, vesicular trafficking, and apoptosis. Because GAPDH is required for the insertion of cellular heme into inducible nitric oxide synthase [Chakravarti, R., et al. (2010) Proc. Natl. Acad. Sci. U.S.A. 107, 18004-18009], we extensively characterized the heme binding properties of GAPDH. Substoichiometric amounts of ferric heme bound to GAPDH (one heme per GAPDH tetramer) to form a low-spin complex with UV-visible maxima at 362, 418, and 537 nm and when reduced to ferrous gave maxima at 424, 527, and 559 nm. Ferric heme association and dissociation rate constants at 10 °C were as follows: k(on) = 17800 M(-1) s(-1), k(off1) = 7.0 × 10(-3) s(-1), and k(off2) = 3.3 × 10(-4) s(-1) (giving approximate affinities of 19-390 nM). Ferrous heme bound more poorly to GAPDH and dissociated with a k(off) of 4.2 × 10(-3) s(-1). Magnetic circular dichroism, resonance Raman, and electron paramagnetic resonance spectroscopic data on the ferric, ferrous, and ferrous-CO complexes of GAPDH showed that the heme is bis-ligated with His as the proximal ligand. The distal ligand in the ferric complex was not displaced by CN(-) or N(3)(-) but in the ferrous complex could be displaced by CO at a rate of 1.75 s(-1) (for >0.2 mM CO). Studies with heme analogues revealed selectivity toward the coordinating metal and porphyrin ring structure. The GAPDH-heme complex was isolated from bacteria induced to express rabbit GAPDH in the presence of δ-aminolevulinic acid. Our finding of heme binding to GAPDH expands the protein's potential roles. The strength, selectivity, reversibility, and redox sensitivity of heme binding to GAPDH are consistent with it performing heme sensing or heme chaperone-like functions in cells.

  5. Fusion of phospholipid vesicles induced by muscle glyceraldehyde-3-phosphate dehydrogenase in the absence of calcium.

    Science.gov (United States)

    Morero, R D; Viñals, A L; Bloj, B; Farías, R N

    1985-04-01

    Ca2+-induced fusion of phospholipid vesicles (phosphatidylcholine/phosphatidic acid, 9:1 mol/mol) prepared by ethanolic injection was followed by five different procedures: resonance energy transfer, light scattering, electron microscopy, intermixing of aqueous content, and gel filtration through Sepharose 4-B. The five methods gave concordant results, showing that vesicles containing only 10% phosphatidic acid can be induced to fuse by millimolar concentrations of Ca2+. When the fusing capability of several soluble proteins was assayed, it was found that concanavalin A, bovine serum albumin, ribonuclease, and protease were inactive. On the other hand, lysozyme, L-lactic dehydrogenase, and muscle and yeast glyceraldehyde-3-phosphate dehydrogenase were capable of inducing vesicle fusion. Glyceraldehyde-3-phosphate dehydrogenase from rabbit muscle, the most extensively studied protein, proved to be very effective: 0.1 microM was enough to induce complete intermixing of bilayer phospholipid vesicles. Under conditions used in this work, fusion was accompanied by leakage of internal contents. The fusing capability of glyceraldehyde-3-phosphate dehydrogenase was not affected by 5 mM ethylenediaminetetraacetic acid. The Ca2+ concentration in the medium, as determined by atomic absorption spectroscopy, was 5 ppm. Heat-denatured enzyme was incapable of inducing fusion. We conclude that glyceraldehyde-3-phosphate dehydrogenase is a soluble protein inherently endowed with the capability of fusing phospholipid vesicles.

  6. Statistical Measure of a Gene Evolution The Case of Glyceraldehyde-3-Phosphate Dehydrogenase Gene

    CERN Document Server

    Chattopadhyay, S; Chakrabarti, J; Chattopadhyay, Sujay; Sahoo, Satyabrata; Chakrabarti, Jayprokas

    2000-01-01

    The enzyme Glyceraldehyde-3-Phosphate Dehydrogenase (GAPDH) catalyses the decomposition of glucose. The gene that produces the GAPDH is therefore present in a wide class of organisms. We show that for this gene the average value of the fluctuations in nucleotide distribution in the codons, normalized to strand bias, provides a reasonable measure of how the gene has evolved in time.

  7. Catalysis of nitrite generation from nitroglycerin by glyceraldehyde-3-phosphate dehydrogenase (GAPDH).

    Science.gov (United States)

    Seabra, Amedea B; Ouellet, Marc; Antonic, Marija; Chrétien, Michelle N; English, Ann M

    2013-11-30

    Vascular relaxation to nitroglycerin (glyceryl trinitrate; GTN) requires its bioactivation by mechanisms that remain controversial. We report here that glyceraldehyde-3-phosphate dehydrogenase (GAPDH) catalyzes the release of nitrite from GTN. In assays containing dithiothreitol (DTT) and NAD(+), the GTN reductase activity of purified GAPDH produces nitrite and 1,2-GDN as the major products. A vmax of 2.6nmolmin(-)(1)mg(-)(1) was measured for nitrite production by GAPDH from rabbit muscle and a GTN KM of 1.2mM. Reductive denitration of GTN in the absence of DTT results in dose- and time-dependent inhibition of GAPDH dehydrogenase activity. Disulfiram, a thiol-modifying drug, inhibits both the dehydrogenase and GTN reductase activity of GAPDH, while DTT or tris(2-carboxyethyl)phosphine reverse the GTN-induced inhibition. Incubation of intact human erythrocytes or hemolysates with 2mM GTN for 60min results in 50% inhibition of GAPDH's dehydrogenase activity, indicating that GTN is taken up by these cells and that the dehydrogenase is a target of GTN. Thus, erythrocyte GAPDH may contribute to GTN bioactivation.

  8. Inhibition of glyceraldehyde-3-phosphate dehydrogenase by peptide and protein peroxides generated by singlet oxygen attack

    DEFF Research Database (Denmark)

    Morgan, Philip E; Dean, Roger T; Davies, Michael Jonathan

    2002-01-01

    the active-site thiol of the enzyme and the peroxide. A number of low-molecular-mass compounds including thiols and ascorbate, but not Trolox C, can prevent inhibition by removing the initial peroxide, or species derived from it. In contrast, glutathione reductase and lactate dehydrogenase are poorly......Reaction of certain peptides and proteins with singlet oxygen (generated by visible light in the presence of rose bengal dye) yields long-lived peptide and protein peroxides. Incubation of these peroxides with glyceraldehyde-3-phosphate dehydrogenase, in the absence of added metal ions, results...

  9. Sequestration of Glyceraldehyde-3-phosphate Dehydrogenase to Aggregates Formed by Mutant Huntingtin

    Institute of Scientific and Technical Information of China (English)

    Junchao WU; Fang LIN; Zhenghong QIN

    2007-01-01

    Glyceraldehyde-3-phosphate dehydrogenase (GAPDH) has been reported to interact with proteins containing the polyglutamine (polyQ) domain. The present study was undertaken to evaluate the potential contributions of the polyQ and polyproline (polyP) domains to the co-localization of mutant huntingtin (htt) and GAPDH. Overexpression of N-terminal htt (1-969 amino acids) with 100Q and 46Q (htt1-969-100Q and httl-969-46Q, mutant htt) in human mammary gland carcinoma MCF-7 cells formed more htt aggregates than that of htt1-969-18Q (wild-type htt). The co-localization of GAPDH with htt aggregates was found in the cells expressing mutant but not wild-type htt. Deletion of the polyp region in the N-terminal htt had no effect on the co-localization of GAPDH and mutant htt aggregates. These results suggest that the polyQ domain, but not the polyp domain, plays a role in the sequestration of GAPDH to aggregates by mutant htt. This effect might contribute to the dysfunction of neurons caused by mutant htt in Huntington's disease.

  10. Characterization of an Arabidopsis thaliana mutant lacking a cytosolic non-phosphorylating glyceraldehyde-3-phosphate dehydrogenase.

    Science.gov (United States)

    Rius, Sebastián P; Casati, Paula; Iglesias, Alberto A; Gomez-Casati, Diego F

    2006-08-01

    Non-phosphorylating glyceraldehyde- 3-phosphate dehydrogenase (NP-GAPDH) is a conserved cytosolic protein found in higher plants. In photosynthetic cells, the enzyme is involved in a shuttle transfer mechanism to export NADPH from the chloroplast to the cytosol. To investigate the role of this enzyme in plant tissues, we characterized a mutant from Arabidopsis thaliana having an insertion at the NP-GAPDH gene locus. The homozygous mutant was determined to be null respect to NP-GAPDH, as it exhibited undetectable levels of both transcription of NP-GAPDH mRNA, protein expression and enzyme activity. Transcriptome analysis demonstrated that the insertion mutant plant shows altered expression of several enzymes involved in carbohydrate metabolism. Significantly, cytosolic phosphorylating (NAD-dependent) glyceraldehyde-3-phosphate dehydrogenase mRNA levels are induced in the mutant, which correlates with an increase in enzyme activity. mRNA levels and enzymatic activity of glucose-6-phosphate dehydrogenase were also elevated, correlating with an increase in NADPH concentration. Moreover, increased ROS levels were measured in the mutant plants. Down-regulation of several glycolytic and photosynthetic genes suggests that NP-GAPDH is important for the efficiency of both metabolic processes. The results presented demonstrate that NP-GAPDH has a relevant role in plant growth and development.

  11. Cloning and Characterization of Glyceraldehyde-3-phosphate Dehydrogenase Encoding Gene in Gracilaria/Gracilariopsis lemaneiformis

    Institute of Scientific and Technical Information of China (English)

    REN Xueying; SUI Zhenghong; ZHANG Xuecheng

    2006-01-01

    Glyceraldehyde-3-phosphate dehydrogenase (GAPDH) plays important roles in various cellular processes. A cytosolic GAPDH encoding gene (gpd) of Gracilaria/Gracilariopsis lemaneiformis was cloned and characterized. Deduced amino acid sequence of the enzyme of G. lemaneiformis had high homology with those of seven red algae. The 5'-untranslated regions of the GAPDHs encoding genes of these red algae varied greatly. GAPDHs of these red algae shared the highly conserved glyceraldehyde 3-phosphate dehydrogenase active site ASCTTNCL. However, such active site of Cyanidium caldarium was different from those of the other six algae at the last two residues (CL to LF), thus the spatial structure of its GAPDH active center may be different from those of the other six. Phylogenetic analysis indicated that GAPDH of G. lemaneiformis might have undergone an evolution similar to those of Porphyra yezoensis, Chondrus crispus, and Gracilaria verrucosa. C. caldarium had a closer evolutionary relationship with Cyanidioschyzon merolae than with Cyanidium sp. Virtual Northern blot analysis revealed that gpd of G. lemaneiformis expressed constitutively, which suggested that it might be house-keeping and could be adapted as an inner control in gene expression analysis of G. lemaneiformis.

  12. Disruption of NAD~+ binding site in glyceraldehyde 3-phosphate dehydrogenase affects its intranuclear interactions

    Institute of Scientific and Technical Information of China (English)

    Manali; Phadke; Natalia; Krynetskaia; Anurag; Mishra; Carlos; Barrero; Salim; Merali; Scott; A; Gothe; Evgeny; Krynetskiy

    2015-01-01

    AIM:To characterize phosphorylation of human glyceraldehyde 3-phosphate dehydrogenase(GAPDH),and mobility of GAPDH in cancer cells treated with chemotherapeutic agents. METHODS:We used proteomics analysis to detect and characterize phosphorylation sites within human GAPDH. Site-specific mutagenesis and alanine scanning was then performed to evaluate functional significance of phosphorylation sites in the GAPDH polypeptide chain. Enzymatic properties of mutated GAPDH variants were assessed using kinetic studies. Intranuclear dynamics parameters(diffusion coefficient and the immobile fraction) were estimated using fluorescence recovery after photobleaching(FRAP) experiments and confocal microscopy. Molecular modeling experiments were performed to estimate the effects of mutations on NAD+ cofactor binding.RESULTS:Using MALDI-TOF analysis,we identified novel phosphorylation sites within the NAD+ binding center of GAPDH at Y94,S98,and T99. Using polyclonal antibody specific to phospho-T99-containing peptide within GAPDH,we demonstrated accumulation of phospho-T99-GAPDH inthe nuclear fractions of A549,HCT116,and SW48 cancer cel s after cytotoxic stress. We performed site-mutagenesis,and estimated enzymatic properties,intranuclear distribution,and intranuclear mobility of GAPDH mutated variants. Site-mutagenesis at positions S98 and T99 in the NAD+ binding center reduced enzymatic activity of GAPDH due to decreased affinity to NAD+(Km = 741 ± 257 μmol/L in T99 I vs 57 ± 11.1 μmol/L in wild type GAPDH. Molecular modeling experiments revealed the effect of mutations on NAD+ binding with GAPDH. FRAP(fluorescence recovery after photo bleaching) analysis showed that mutations in NAD+ binding center of GAPDH abrogated its intranuclear interactions. CONCLUSION:Our results suggest an important functional role of phosphorylated amino acids in the NAD+ binding center in GAPDH interactions with its intranuclear partners.

  13. Structure of Streptococcus agalactiae glyceraldehyde-3-phosphate dehydrogenase holoenzyme reveals a novel surface.

    Science.gov (United States)

    Ayres, Chapelle A; Schormann, Norbert; Senkovich, Olga; Fry, Alexandra; Banerjee, Surajit; Ulett, Glen C; Chattopadhyay, Debasish

    2014-10-01

    Glyceraldehyde-3-phosphate dehydrogenase (GAPDH) is a conserved cytosolic enzyme, which plays a key role in glycolysis. GAPDH catalyzes the oxidative phosphorylation of D-glyceraldehyde 3-phosphate using NAD or NADP as a cofactor. In addition, GAPDH localized on the surface of some bacteria is thought to be involved in macromolecular interactions and bacterial pathogenesis. GAPDH on the surface of group B streptococcus (GBS) enhances bacterial virulence and is a potential vaccine candidate. Here, the crystal structure of GBS GAPDH from Streptococcus agalactiae in complex with NAD is reported at 2.46 Å resolution. Although the overall structure of GBS GAPDH is very similar to those of other GAPDHs, the crystal structure reveals a significant difference in the area spanning residues 294-307, which appears to be more acidic. The amino-acid sequence of this region of GBS GAPDH is also distinct compared with other GAPDHs. This region therefore may be of interest as an immunogen for vaccine development.

  14. Glyceraldehyde-3-phosphate dehydrogenase is a surface-associated, fibronectin-binding protein of Trichomonas vaginalis.

    Science.gov (United States)

    Lama, A; Kucknoor, A; Mundodi, V; Alderete, J F

    2009-07-01

    Trichomonas vaginalis colonizes the urogenital tract of humans and causes trichomonosis, the most prevalent nonviral sexually transmitted disease. We have shown an association of T. vaginalis with basement membrane extracellular matrix components, a property which we hypothesize is important for colonization and persistence. In this study, we identify a fibronectin (FN)-binding protein of T. vaginalis. A monoclonal antibody (MAb) from a library of hybridomas that inhibited the binding of T. vaginalis organisms to immobilized FN was identified. The MAb (called ws1) recognized a 39-kDa protein and was used to screen a cDNA expression library of T. vaginalis. A 1,086-bp reactive cDNA clone that encoded a protein of 362 amino acids with identity to glyceraldehyde-3-phosphate dehydrogenase (GAPDH) was obtained. The gapdh gene was cloned, and recombinant GAPDH (rGAPDH) was expressed in Escherichia coli cells. Natural GAPDH and rGAPDH bound to immobilized FN and to plasminogen and collagen but not to laminin. MAb ws1 inhibited binding to FN. GAPDH was detected on the surface of trichomonads and was upregulated in synthesis and surface expression by iron. Higher levels of binding to FN were seen for organisms grown in iron-replete medium than for organisms grown in iron-depleted medium. In addition, decreased synthesis of GAPDH by antisense transfection of T. vaginalis gave lower levels of organisms bound to FN and had no adverse effect on growth kinetics. Finally, GAPDH did not associate with immortalized vaginal epithelial cells (VECs), and neither GAPDH nor MAb ws1 inhibited the adherence of trichomonads to VECs. These results indicate that GAPDH is a surface-associated protein of T. vaginalis with alternative functions.

  15. Glyceraldehyde-3-phosphate dehydrogenase interacts with proapoptotic kinase mst1 to promote cardiomyocyte apoptosis.

    Directory of Open Access Journals (Sweden)

    Bei You

    Full Text Available Mammalian sterile 20-like kinase 1 (Mst1 is a critical component of the Hippo signaling pathway, which regulates a variety of biological processes ranging from cell contact inhibition, organ size control, apoptosis and tumor suppression in mammals. Mst1 plays essential roles in the heart disease since its activation causes cardiomyocyte apoptosis and dilated cardiomyopathy. However, the mechanism underlying Mst1 activation in the heart remains unknown. In a yeast two-hybrid screen of a human heart cDNA library with Mst1 as bait, glyceraldehyde-3-phosphate dehydrogenase (GAPDH was identified as an Mst1-interacting protein. The interaction of GAPDH with Mst1 was confirmed by co-immunoprecipitation in both co-transfected HEK293 cells and mouse heart homogenates, in which GAPDH interacted with the kinase domain of Mst1, whereas the C-terminal catalytic domain of GAPDH mediated its interaction with Mst1. Moreover, interaction of Mst1 with GAPDH caused a robust phosphorylation of GAPDH and markedly increased the Mst1 activity in cells. Chelerythrine, a potent inducer of apoptosis, substantially increased the nuclear translocation and interaction of GAPDH and Mst1 in cardiomyocytes. Overexpression of GAPDH significantly augmented the Mst1 mediated apoptosis, whereas knockdown of GAPDH markedly attenuated the Mst1 activation and cardiomyocyte apoptosis in response to either chelerythrine or hypoxia/reoxygenation. These findings reveal a novel function of GAPDH in Mst1 activation and cardiomyocyte apoptosis and suggest that disruption of GAPDH interaction with Mst1 may prevent apoptosis related heart diseases such as heart failure and ischemic heart disease.

  16. Structural basis for regulation of stability and activity in glyceraldehyde-3-phosphate dehydrogenases. Differential scanning calorimetry and molecular dynamics.

    Science.gov (United States)

    Makshakova, Olga N; Semenyuk, Pavel I; Kuravsky, Mikhail L; Ermakova, Elena A; Zuev, Yuriy F; Muronetz, Vladimir I

    2015-05-01

    Tissue specific isoforms of human glyceraldehyde-3-phosphate dehydrogenase, somatic (GAPD) and sperm-specific (GAPDS), have been reported to display different levels of both stability and catalytic activity. Here we apply MD simulations to investigate molecular basis of this phenomenon. The protein is a tetramer where each subunit consists of two domains - catalytic and NAD-binding one. We demonstrated key residues responsible for intersubunit and interdomain interactions. Effect of several residues was studied by point mutations. Overall we considered three mutations (Glu96Gln, Glu244Gln and Asp311Asn) disrupting GAPDS-specific salt bridges. Comparison of calculated interaction energies with calorimetric enthalpies confirmed that intersubunit interactions were responsible for enhanced thermostability of GAPDS whereas interdomain interactions had indirect influence on intersubunit contacts. Mutation Asp311Asn was around 10Å far from the active center and corresponded to the closest natural substitution in the isoenzymes. MD simulations revealed that this residue had slight interaction with catalytic residues but influenced the hydrogen bond net and dynamics in active site. These effects can be responsible for a strong influence of this residue on catalytic activity. Overall, our results provide new insight into glyceraldehyde-3-phosphate dehydrogenase structure-function relationships and can be used for the engineering of mutant proteins with modified properties and for development of new inhibitors with indirect influence on the catalytic site. Copyright © 2015 Elsevier Inc. All rights reserved.

  17. Succination of proteins by fumarate: mechanism of inactivation of glyceraldehyde-3-phosphate dehydrogenase in diabetes.

    Science.gov (United States)

    Blatnik, Matthew; Thorpe, Suzanne R; Baynes, John W

    2008-04-01

    S-(2-succinyl)cysteine (2SC) is a chemical modification of proteins formed by a Michael addition reaction between the Krebs cycle intermediate, fumarate, and thiol groups in protein--a process known as succination of protein. Succination causes irreversible inactivation of glyceraldehyde-3-phosphate dehydrogenase (GAPDH) in vitro. GAPDH was immunoprecipitated from muscle of diabetic rats, then analyzed by ultra-performance liquid chromatography-electrospray ionization-mass spectroscopy. Succination of GAPDH was increased in muscle of diabetic rats, and the extent of succination correlated strongly with the decrease in specific activity of the enzyme. We propose that 2SC is a biomarker of mitochondrial and oxidative stress in diabetes and that succination of GAPDH and other thiol proteins may provide the chemical link between glucotoxicity and the pathogenesis of diabetic complications.

  18. Screening of Trypanosoma cruzi glycosomal glyceraldehyde-3-phosphate dehydrogenase enzyme inhibitors

    Directory of Open Access Journals (Sweden)

    Ana C. Leite

    2009-03-01

    Full Text Available The inhibitory activity of crude extracts of Meliaceae and Rutaceae plants on glycosomal glyceraldehyde-3-phosphate dehydrogenase (gGAPDH enzyme from Trypanosoma cruzi was evaluated at 100 μg/mL. Forty-six extracts were tested and fifteen of them showed significant inhibitory activity (IA % > 50. The majority of the assayed extracts of Meliaceae plants (Cedrela fissilis, Cipadessa fruticosa and Trichilia ramalhoi showed high ability to inhibit the enzymatic activity. The fractionation of the hexane extract from branches of C. fruticosa led to the isolation of three flavonoids: flavone, 7-methoxyflavone and 3',4',5',5,7-pentamethoxyflavone. The two last compounds showed high ability to inhibit the gGAPDH activity. Therefore, the assayed Meliaceae species could be considered as a promising source of lead compounds against Chagas' disease.

  19. Pattern Recognition Techniques Applied to the Study of Leishmanial Glyceraldehyde-3-Phosphate Dehydrogenase Inhibition

    Directory of Open Access Journals (Sweden)

    Norka B. H. Lozano

    2014-02-01

    Full Text Available Chemometric pattern recognition techniques were employed in order to obtain Structure-Activity Relationship (SAR models relating the structures of a series of adenosine compounds to the affinity for glyceraldehyde 3-phosphate dehydrogenase of Leishmania mexicana (LmGAPDH. A training set of 49 compounds was used to build the models and the best ones were obtained with one geometrical and four electronic descriptors. Classification models were externally validated by predictions for a test set of 14 compounds not used in the model building process. Results of good quality were obtained, as verified by the correct classifications achieved. Moreover, the results are in good agreement with previous SAR studies on these molecules, to such an extent that we can suggest that these findings may help in further investigations on ligands of LmGAPDH capable of improving treatment of leishmaniasis.

  20. Several novel transcripts of glyceraldehyde-3-phosphate dehydrogenase expressed in adult chicken testis.

    Science.gov (United States)

    Mezquita, J; Pau, M; Mezquita, C

    1998-10-01

    Glyceraldehyde-3-phosphate dehydrogenase (GAPDH), in addition to being a classic glycolytic enzyme, is a multifunctional protein involved in relevant cell functions such as DNA replication, DNA repair, translational control of gene expression, and apoptosis. Although the multifunctional nature of GAPDH suggests versatility in the mechanisms regulating its expression, no major qualitative changes and few quantitative changes in the GAPDH transcripts have been reported. While studying the expression of GAPDH during spermatogenesis, we detected alternative initiations to TATA box and alternative splicings in the 5' region of the pre-mRNA, resulting in at least six different types of mRNAs. The amount and the polyadenylation of the GAPDH transcripts increased in mature testis in relation to immature testis and further increased when cell suspensions from mature testis were exposed to heat shock. These results suggest that alternative initiation, alternative splicing, and polyadenylation could provide the necessary versatility to the regulation of the expression of this multifunctional protein during spermatogenesis.

  1. Molecular cloning and characterization of the glyceraldehyde-3-phosphate dehydrogenase gene from Penicillium expansum PE-12.

    Science.gov (United States)

    Zhang, T; Qi, Z; Yu, Q S; Tang, K X

    2013-07-15

    Penicillium expansum produces large amounts of lipase, which is widely used in laundry detergent and leather industry. We isolated the glyceraldehyde-3-phosphate dehydrogenase gene (PeGPD) from P. expansum PE-12 through reverse transcriptase PCR and 5'-3' rapid amplification of cDNA ends (RACE-PCR). The gene is 1266 bp long, including an ORF of 1014 bp, encoding a polypeptide chain of 337 amino acids. A phylogenetic tree based on GPD proteins showed that P. expansum is close to Aspergillus species, but comparatively distant from P. marneffei. Southern blot results revealed a single copy of PeGPD, and expression analysis gave evidence of high expression levels. PeGPD genes have potential for genetic engineering of P. expansum for industrial lipase production.

  2. Sperm-Specific Glyceraldehyde-3-Phosphate Dehydrogenase - An Evolutionary Acquisition of Mammals.

    Science.gov (United States)

    Muronetz, V I; Kuravsky, M L; Barinova, K V; Schmalhausen, E V

    2015-12-01

    This review is focused on the mammalian sperm-specific glyceraldehyde-3-phosphate dehydrogenase (GAPDS). GAPDS plays the major role in the production of energy required for sperm cell movement and does not perform non-glycolytic functions that are characteristic of the somatic isoenzyme of glyceraldehyde-3-phosphate dehydrogenase. The GAPDS sequence is composed of 408 amino acid residues and includes an additional N-terminal region of 72 a.a. that binds the protein to the sperm tail cytoskeleton. GAPDS is present only in the sperm cells of mammals and lizards, possibly providing them with certain evolutionary advantages in reproduction. In this review, studies concerning the problems of GAPDS isolation, its catalytic properties, and its structural features are described in detail. GAPDS is much more stable compared to the somatic isoenzyme, perhaps due to the necessity of maintaining the enzyme function in the absence of protein expression. The site-directed mutagenesis approach revealed the two GAPDS-specific proline residues, as well as three salt bridges, which seem to be the basis of the increased stability of this protein. As distinct from the somatic isoenzyme, GAPDS exhibits positive cooperativity in binding of the coenzyme NAD+. The key role in transduction of structural changes induced by NAD+ is played by the salt bridge D311-H124. Disruption of this salt bridge cancels GAPDS cooperativity and twofold increases its enzymatic activity instead. The expression of GAPDS was detected in some melanoma cells as well. Its role in the development of certain pathologies, such as cancer and neurodegenerative diseases, is discussed.

  3. Expression, purification, crystallization and preliminary X-ray analysis of an NAD-dependent glyceraldehyde-3-phosphate dehydrogenase from Helicobacter pylori

    Energy Technology Data Exchange (ETDEWEB)

    Elliott, Paul R.; Mohammad, Shabaz; Melrose, Helen J.; Moody, Peter C. E., E-mail: pcem1@leicester.ac.uk [Henry Wellcome Laboratories for Structural Biology, University of Leicester, Leicester LE1 9HN (United Kingdom)

    2008-08-01

    Glyceraldehyde-3-phosphate dehydrogenase B from H. pylori has been cloned, expressed, purified and crystallized in the presence of NAD. Crystals of GAPDHB diffracted to 2.8 Å resolution and belonged to space group P6{sub 5}22, with unit-cell parameters a = b = 166.1, c = 253.1 Å. Helicobacter pylori is a dangerous human pathogen that resides in the upper gastrointestinal tract. Little is known about its metabolism and with the onset of antibiotic resistance new treatments are required. In this study, the expression, purification, crystallization and preliminary X-ray diffraction of an NAD-dependent glyceraldehyde-3-phosphate dehydrogenase from H. pylori are reported.

  4. Comparative molecular analysis of evolutionarily distant glyceraldehyde-3-phosphate dehydrogenase from Sardina pilchardus and Octopus vulgaris.

    Science.gov (United States)

    Baibai, Tarik; Oukhattar, Laila; Mountassif, Driss; Assobhei, Omar; Serrano, Aurelio; Soukri, Abdelaziz

    2010-12-01

    The NAD(+)-dependent cytosolic glyceraldehyde-3-phosphate dehydrogenase (GAPDH, EC 1.2.1.12), which is recognized as a key to central carbon metabolism in glycolysis and gluconeogenesis and as an important allozymic polymorphic biomarker, was purified from muscles of two marine species: the skeletal muscle of Sardina pilchardus Walbaum (Teleost, Clupeida) and the incompressible arm muscle of Octopus vulgaris (Mollusca, Cephalopoda). Comparative biochemical studies have revealed that they differ in their subunit molecular masses and in pI values. Partial cDNA sequences corresponding to an internal region of the GapC genes from Sardina and Octopus were obtained by polymerase chain reaction using degenerate primers designed from highly conserved protein motifs. Alignments of the deduced amino acid sequences were used to establish the 3D structures of the active site of two enzymes as well as the phylogenetic relationships of the sardine and octopus enzymes. These two enzymes are the first two GAPDHs characterized so far from teleost fish and cephalopod, respectively. Interestingly, phylogenetic analyses indicated that the sardina GAPDH is in a cluster with the archetypical enzymes from other vertebrates, while the octopus GAPDH comes together with other molluscan sequences in a distant basal assembly closer to bacterial and fungal orthologs, thus suggesting their different evolutionary scenarios.

  5. Glyceraldehyde 3-phosphate dehydrogenase-telomere association correlates with redox status in Trypanosoma cruzi.

    Directory of Open Access Journals (Sweden)

    Ricardo Pariona-Llanos

    Full Text Available Glyceraldehyde 3-phosphate dehydrogenase (GAPDH is a classical metabolic enzyme involved in energy production and plays a role in additional nuclear functions, including transcriptional control, recognition of misincorporated nucleotides in DNA and maintenance of telomere structure. Here, we show that the recombinant protein T. cruzi GAPDH (rTcGAPDH binds single-stranded telomeric DNA. We demonstrate that the binding of GAPDH to telomeric DNA correlates with the balance between oxidized and reduced forms of nicotinamide adenine dinucleotides (NAD+/NADH. We observed that GAPDH-telomere association and NAD+/NADH balance changed throughout the T. cruzi life cycle. For example, in replicative epimastigote forms of T. cruzi, which show similar intracellular concentrations of NAD+ and NADH, GAPDH binds to telomeric DNA in vivo and this binding activity is inhibited by exogenous NAD+. In contrast, in the T. cruzi non-proliferative trypomastigote forms, which show higher NAD+ concentration, GAPDH was absent from telomeres. In addition, NAD+ abolishes physical interaction between recombinant GAPDH and synthetic telomere oligonucleotide in a cell free system, mimicking exogenous NAD+ that reduces GAPDH-telomere interaction in vivo. We propose that the balance in the NAD+/NADH ratio during T. cruzi life cycle homeostatically regulates GAPDH telomere association, suggesting that in trypanosomes redox status locally modulates GAPDH association with telomeric DNA.

  6. Purification and Characterization of Cytosolic Glyceraldehyde-3-phosphate Dehydrogenase from the Dromedary Camel

    Institute of Scientific and Technical Information of China (English)

    Latifa FOURRAT; Abdelghani IDDAR; Abdelaziz SOUKRI

    2007-01-01

    Glyceraldehyde-3-phosphate dehydrogenase (GAPDH) (EC 1.2.1.12), a key enzyme of carbon metabolism, was purified and characterized to homogeneity from skeletal muscle of Camelus dromedarius. The protein was purified approximately 26.8 folds by conventional ammonium sulphate fractionation followed by Blue Sepharose CL-6B chromatography, and its physical and kinetic properties were investigated. The native protein is a homotetramer with an apparent molecular weight of approximately 146 kDa. Isoelectric focusing analysis showed the presence of only one GAPDH isoform with an isoelectric point of 7.2. The optimum pH of the purified enzyme was 7.8. Studies on the effect of temperature on enzyme activity revealed an optimal value of approximately 28-32 ℃ with activation energy of 4.9 kcal/mol.The apparent Km values for NAD+ and DL-glyceraldehyde-3-phophate were estimated to be 0.025±0.040 mM and 0.21±0.08 mM, respectively. The Vmax of the purified protein was estimated to be 52.7±5.9 U/mg.These kinetic parameter values were different from those described previously, reflecting protein differences between species.

  7. Different Thermostability of Skeletal Muscle Glyceraldehyde-3-phosphate Dehydrogenase from Hibernating and Euthermic Jerboa (Jaculus orientalis)

    Institute of Scientific and Technical Information of China (English)

    IDDAR Abdelghani; CAMPOS Luis A.; SANCHO Javier; SERRANO Aurelio; SOUKRI Abdelaziz

    2003-01-01

    In previous study, we demonstrated that the specific activity of D-glyceraldehyde-3-phosphate dehydrogenase (GAPDH, EC 1.2.1.12) in skeletal muscle of induced hibernating jerboa (hibernating GAPDH) was 3-4 folds lower than that of the one in the skeletal muscle of the euthermic jerboa (euthermic GAPDH). A significant decrease in both GAPDH protein and GapC mRNA levels occurs when hibernating, but the purified hibernating GAPDH is less active than the euthermic GAPDH. To investigate the physico-chemical basis of this lower activity, the behaviour during thermal inactivation of skeletal muscle GAPDH from hibernating and euthermic tissues was examined by a variety of spectroscopic techniques, including fluorescence emission, circular dichroism and ultraviolet absorption. A clear resistance to thermal denaturation was observed in the hibernating GAPDH compared with the euthermic GAPDH. The different temperature of denaturation found in these proteins by both fluorimetry and circular dichroism indicates that there might exist conformational changes of GAPDH upon hibernation that could affect the stability of this enzyme.

  8. Glyceraldehyde-3-phosphate dehydrogenase: a universal internal control for Western blots in prokaryotic and eukaryotic cells.

    Science.gov (United States)

    Wu, Yonghong; Wu, Min; He, Guowei; Zhang, Xiao; Li, Weiguang; Gao, Yan; Li, Zhihui; Wang, Zhaoyan; Zhang, Chenggang

    2012-04-01

    In the current study, we examined the expression level of glyceraldehyde-3-phosphate dehydrogenase (GAPDH) protein in a number of organisms and the stability of GAPDH under various conditions. Our results revealed that GAPDH is present in multiple Escherichia coli strains, the yeast strain GS115, Caenorhabditis elegans, rat PC12 cells, and both mouse and rat brain. Furthermore, GAPDH was stably expressed under different concentrations of inducer and at different times of induction in E. coli (BL21) cells and yeast GS115 cells. Stable expression of GAPDH protein was also observed in C.elegans and PC12 cells that were treated with different concentrations of paraquat or sodium sulfite, respectively. In addition, we were able to detect and identify the endogenous gapA protein in E.coli via immunoprecipitation and MALDI-TOF-MS analysis. Endogenous gapA protein and exogenously expressed (subcloned) GAPDH proteins were detected in E. coli BL21 but not for gapC. With the exception of gapC in E. coli, the various isoforms of GAPDH possessed enzymatic activity. Finally, sequence analysis revealed that the GAPDH proteins were 76% identical, with the exception of E. coli gapC. Taken together, our results indicate that GAPDH could be universally used as an internal control for the Western blot analysis of prokaryotic and eukaryotic samples.

  9. The glyceraldehyde-3-phosphate dehydrogenase and the small GTPase Rab 2 are crucial for Brucella replication.

    Directory of Open Access Journals (Sweden)

    Emilie Fugier

    2009-06-01

    Full Text Available The intracellular pathogen Brucella abortus survives and replicates inside host cells within an endoplasmic reticulum (ER-derived replicative organelle named the "Brucella-containing vacuole" (BCV. Here, we developed a subcellular fractionation method to isolate BCVs and characterize for the first time the protein composition of its replicative niche. After identification of BCV membrane proteins by 2 dimensional (2D gel electrophoresis and mass spectrometry, we focused on two eukaryotic proteins: the glyceraldehyde-3-phosphate dehydrogenase (GAPDH and the small GTPase Rab 2 recruited to the vacuolar membrane of Brucella. These proteins were previously described to localize on vesicular and tubular clusters (VTC and to regulate the VTC membrane traffic between the endoplasmic reticulum (ER and the Golgi. Inhibition of either GAPDH or Rab 2 expression by small interfering RNA strongly inhibited B. abortus replication. Consistent with this result, inhibition of other partners of GAPDH and Rab 2, such as COPI and PKC iota, reduced B. abortus replication. Furthermore, blockage of Rab 2 GTPase in a GDP-locked form also inhibited B. abortus replication. Bacteria did not fuse with the ER and instead remained in lysosomal-associated membrane vacuoles. These results reveal an essential role for GAPDH and the small GTPase Rab 2 in B. abortus virulence within host cells.

  10. Oxidative modifications of glyceraldehyde 3-phosphate dehydrogenase regulate metabolic reprogramming of stored red blood cells.

    Science.gov (United States)

    Reisz, Julie A; Wither, Matthew J; Dzieciatkowska, Monika; Nemkov, Travis; Issaian, Aaron; Yoshida, Tatsuro; Dunham, Andrew J; Hill, Ryan C; Hansen, Kirk C; D'Alessandro, Angelo

    2016-09-22

    Glyceraldehyde 3-phosphate dehydrogenase (GAPDH) plays a key regulatory function in glucose oxidation by mediating fluxes through glycolysis or the pentose phosphate pathway (PPP) in an oxidative stress-dependent fashion. Previous studies documented metabolic reprogramming in stored red blood cells (RBCs) and oxidation of GAPDH at functional residues upon exposure to pro-oxidants diamide and H2O2 Here we hypothesize that routine storage of erythrocyte concentrates promotes metabolic modulation of stored RBCs by targeting functional thiol residues of GAPDH. Progressive increases in PPP/glycolysis ratios were determined via metabolic flux analysis after spiking (13)C1,2,3-glucose in erythrocyte concentrates stored in Additive Solution-3 under blood bank conditions for up to 42 days. Proteomics analyses revealed a storage-dependent oxidation of GAPDH at functional Cys152, 156, 247, and His179. Activity loss by oxidation occurred with increasing storage duration and was progressively irreversible. Irreversibly oxidized GAPDH accumulated in stored erythrocyte membranes and supernatants through storage day 42. By combining state-of-the-art ultra-high-pressure liquid chromatography-mass spectrometry metabolic flux analysis with redox and switch-tag proteomics, we identify for the first time ex vivo functionally relevant reversible and irreversible (sulfinic acid; Cys to dehydroalanine) oxidations of GAPDH without exogenous supplementation of excess pro-oxidant compounds in clinically relevant blood products. Oxidative and metabolic lesions, exacerbated by storage under hyperoxic conditions, were ameliorated by hypoxic storage. Storage-dependent reversible oxidation of GAPDH represents a mechanistic adaptation in stored erythrocytes to promote PPP activation and generate reducing equivalents. Removal of irreversibly oxidized, functionally compromised GAPDH identifies enhanced vesiculation as a self-protective mechanism in ex vivo aging erythrocytes.

  11. Diacylglycerol pyrophosphate binds and inhibits the glyceraldehyde-3-phosphate dehydrogenase in barley aleurone.

    Science.gov (United States)

    Astorquiza, Paula Luján; Usorach, Javier; Racagni, Graciela; Villasuso, Ana Laura

    2016-04-01

    The aleurona cell is a model that allows the study of the antagonistic effect of gibberellic acid (GA) and abscisic acid (ABA). Previous results of our laboratory demonstrated the involvement of phospholipids during the response to ABA and GA. ABA modulates the levels of diacylglycerol, phosphatidic acid and diacylglycerol pyrophosphate (DAG, PA, DGPP) through the activities of phosphatidate phosphatases, phospholipase D, diacylglycerol kinase and phosphatidate kinase (PAP, PLD, DGK and PAK). PA and DGPP are key phospholipids in the response to ABA, since both are capable of modifying the hydrolitic activity of the aleurona. Nevertheless, little is known about the mechanism of action of these phospholipids during the ABA signal. DGPP is an anionic phospholipid with a pyrophosphate group attached to diacylglycerol. The ionization of the pyrophosphate group may be important to allow electrostatic interactions between DGPP and proteins. To understand how DGPP mediates cell functions in barley aleurone, we used a DGPP affinity membrane assay to isolate DGPP-binding proteins from Hordeum vulgare, followed by mass spectrometric sequencing. A cytosolic glyceraldehyde-3-phosphate dehydrogenase (GAPDH, EC 1.2.1.12) was identified for being bound to DGPP. To validate our method, the relatively abundant GAPDH was characterized with respect to its lipid-binding properties, by fat western blot. GAPDH antibody interacts with proteins that only bind to DGPP and PA. We also observed that ABA treatment increased GAPDH abundance and enzyme activity. The presence of phospholipids during GAPDH reaction modulated the GAPDH activity in ABA treated aleurone. These data suggest that DGPP binds to GAPDH and this DGPP and GAPDH interaction provides new evidences in the study of DGPP-mediated ABA responses in barley aleurone.

  12. Glyceraldehyde-3-phosphate Dehydrogenase Aggregates Accelerate Amyloid-β Amyloidogenesis in Alzheimer Disease*

    Science.gov (United States)

    Itakura, Masanori; Nakajima, Hidemitsu; Kubo, Takeya; Semi, Yuko; Kume, Satoshi; Higashida, Shusaku; Kaneshige, Akihiro; Kuwamura, Mitsuru; Harada, Naoki; Kita, Akinori; Azuma, Yasu-Taka; Yamaji, Ryoichi; Inui, Takashi; Takeuchi, Tadayoshi

    2015-01-01

    Alzheimer disease (AD) is a progressive neurodegenerative disorder characterized by loss of neurons and formation of pathological extracellular deposits induced by amyloid-β peptide (Aβ). Numerous studies have established Aβ amyloidogenesis as a hallmark of AD pathogenesis, particularly with respect to mitochondrial dysfunction. We have previously shown that glycolytic glyceraldehyde-3-phosphate dehydrogenase (GAPDH) forms amyloid-like aggregates upon exposure to oxidative stress and that these aggregates contribute to neuronal cell death. Here, we report that GAPDH aggregates accelerate Aβ amyloidogenesis and subsequent neuronal cell death both in vitro and in vivo. Co-incubation of Aβ40 with small amounts of GAPDH aggregates significantly enhanced Aβ40 amyloidogenesis, as assessed by in vitro thioflavin-T assays. Similarly, structural analyses using Congo red staining, circular dichroism, and atomic force microscopy revealed that GAPDH aggregates induced Aβ40 amyloidogenesis. In PC12 cells, GAPDH aggregates augmented Aβ40-induced cell death, concomitant with disruption of mitochondrial membrane potential. Furthermore, mice injected intracerebroventricularly with Aβ40 co-incubated with GAPDH aggregates exhibited Aβ40-induced pyramidal cell death and gliosis in the hippocampal CA3 region. These observations were accompanied by nuclear translocation of apoptosis-inducing factor and cytosolic release of cytochrome c from mitochondria. Finally, in the 3×Tg-AD mouse model of AD, GAPDH/Aβ co-aggregation and mitochondrial dysfunction were consistently detected in an age-dependent manner, and Aβ aggregate formation was attenuated by GAPDH siRNA treatment. Thus, this study suggests that GAPDH aggregates accelerate Aβ amyloidogenesis, subsequently leading to mitochondrial dysfunction and neuronal cell death in the pathogenesis of AD. PMID:26359500

  13. Glyceraldehyde-3-phosphate dehydrogenase of Xanthomonas campestris pv. campestris is required for extracellular polysaccharide production and full virulence.

    Science.gov (United States)

    Lu, Guang-Tao; Xie, Jia-Ri; Chen, Lei; Hu, Jiang-Ru; An, Shi-Qi; Su, Hui-Zhao; Feng, Jia-Xun; He, Yong-Qiang; Jiang, Bo-Le; Tang, Dong-Jie; Tang, Ji-Liang

    2009-05-01

    Glyceraldehyde-3-phosphate dehydrogenase (GAPDH) plays an important role in glucose catabolism, converting glyceraldehyde 3-phosphates to 1,3-bisphosphoglycerates. Open reading frame (ORF) XC_0972 in the genome of Xanthomonas campestris pv. campestris (Xcc) strain 8004 is the only ORF in this strain annotated to encode a GAPDH. In this work, we have demonstrated genetically that this ORF encodes a unique GAPDH in Xcc strain 8004, which seems to be constitutively expressed. A GAPDH-deficient mutant could still grow in medium with glucose or other sugars as the sole carbon source, and no phosphofructokinase activity was detectable in strain 8004. These facts suggest that Xcc may employ the Entner-Doudoroff pathway, but not glycolysis, to utilize glucose. The mutant could not utilize pyruvate as sole carbon source, whereas the wild-type could, implying that the GAPDH of Xcc is involved in gluconeogenesis. Furthermore, inactivation of the Xcc GAPDH resulted in impairment of bacterial growth and virulence in the host plant, and reduction of intracellular ATP and extracellular polysaccharide (EPS). This reveals that GAPDH is required for EPS production and full pathogenicity of Xcc.

  14. The influence of oxygen on radiation-induced structural and functional changes in glyceraldehyde-3-phosphate dehydrogenase and lactate dehydrogenase

    Science.gov (United States)

    Rodacka, Aleksandra; Serafin, Eligiusz; Bubinski, Michal; Krokosz, Anita; Puchala, Mieczyslaw

    2012-07-01

    Proteins are major targets for oxidative damage due to their abundance in cells and high reactivity with free radicals. In the present study we examined the influence of oxygen on radiation-induced inactivation and structural changes of glyceraldehyde-3-phosphate dehydrogenase (GAPDH) and lactate dehydrogenase (LDH). We chose these two enzymes because they occur at high concentrations and participate in the most important processes in organisms; furthermore, they show considerable similarity in their structure. Protein solutions were irradiated with X-rays in doses ranging from 0.1 to 0.7 kGy, in air and N2O. The much higher radiation inactivation of GAPDH as compared to LDH is correlated with substantially greater structural changes in this protein, mainly involving the loss of free thiol groups (-SH). Of lesser importance in the differentiation of the radiosensitivity of the studied enzymes are tryptophan residues. Molecular oxygen, present during irradiation, increased to a significantly greater extent the inactivation and structural changes of GAPDH than that of LDH. The results suggest that the greater effect of oxygen on GAPDH is due to the higher efficiency of the superoxide radical, the higher amount of hydroperoxides generated, and the higher degree of unfolding of this protein.

  15. Expression, purification, crystallization and preliminary X-ray analysis of an NADP-dependent glyceraldehyde-3-phosphate dehydrogenase from Helicobacter pylori

    Energy Technology Data Exchange (ETDEWEB)

    Elliott, Paul R.; Evans, Daniel; Greenwood, Jacqueline A.; Moody, Peter C. E., E-mail: pcem1@leicester.ac.uk [Henry Wellcome Laboratories for Structural Biology, Department of Biochemistry, University of Leicester, Leicester LE1 9HN (United Kingdom)

    2008-08-01

    Glyceraldehyde-3-phosphate dehydrogenase A has been cloned, expressed and purified. Apoprotein crystals have been grown which diffracted to 1.75 Å resolution and belonged to space group P2{sub 1}; holo crystals were grown in the presence of NADP, diffracted to 2.6 Å resolution and belonged to space group P3{sub 2}. The classical glycolytic pathway contains an NAD-dependent glyceraldehyde-3-phosphate dehydrogenase, with NADP-dependent forms reserved for photosynthetic organisms and archaea. Here, the cloning, expression, purification, crystallization and preliminary X-ray analysis of an NADP-dependent glyceraldehyde-3-phosphate dehydrogenase from Helicobacter pylori is reported; crystals of the protein were grown both in the presence and the absence of NADP.

  16. Identification of Electronic and Structural Descriptors of Adenosine Analogues Related to Inhibition of Leishmanial Glyceraldehyde-3-Phosphate Dehydrogenase

    Directory of Open Access Journals (Sweden)

    Norka B. H. Lozano

    2013-04-01

    Full Text Available Quantitative structure–activity relationship (QSAR studies were performed in order to identify molecular features responsible for the antileishmanial activity of 61 adenosine analogues acting as inhibitors of the enzyme glyceraldehyde 3-phosphate dehydrogenase of Leishmania mexicana (LmGAPDH. Density functional theory (DFT was employed to calculate quantum-chemical descriptors, while several structural descriptors were generated with Dragon 5.4. Variable selection was undertaken with the ordered predictor selection (OPS algorithm, which provided a set with the most relevant descriptors to perform PLS, PCR and MLR regressions. Reliable and predictive models were obtained, as attested by their high correlation coefficients, as well as the agreement between predicted and experimental values for an external test set. Additional validation procedures were carried out, demonstrating that robust models were developed, providing helpful tools for the optimization of the antileishmanial activity of adenosine compounds.

  17. Overexpression and nuclear accumulation of glyceraldehyde-3-phosphate dehydrogenase in a transgenic mouse model of Huntington's disease.

    Science.gov (United States)

    Senatorov, Vladimir V; Charles, Vinod; Reddy, P H; Tagle, Dan A; Chuang, De-Maw

    2003-03-01

    Huntington's disease is due to an expansion of CAG repeats in the huntingtin gene. Huntingtin interacts with several proteins including glyceraldehyde-3-phosphate dehydrogenase (GAPDH). We performed immunohistochemical analysis of GAPDH expression in the brains of transgenic mice carrying the huntingtin gene with 89 CAG repeats. In all wild-type animals examined, GAPDH was evenly distributed among the different cell types throughout the brain. In contrast, the majority of transgenic mice showed GAPDH overexpression, with the most prominent GAPDH changes observed in the caudate putamen, globus pallidus, neocortex, and hippocampal formation. Double staining for NeuN and GFAP revealed that GAPDH overexpression occurred exclusively in neurons. Nissl staining analysis of the neocortex and caudate putamen indicated 24 and 27% of cell loss in transgenic mice, respectively. Subcellular fluorescence analysis revealed a predominant increase in GAPDH immunostaining in the nucleus. Thus, we conclude that mutation of huntingtin is associated with GAPDH overexpression and nuclear translocation in discrete populations of brain neurons.

  18. Over-expression of PsGPD, a mushroom glyceraldehyde-3-phosphate dehydrogenase gene, enhances salt tolerance in rice plants.

    Science.gov (United States)

    Cho, Jung-Il; Lim, Hye-Min; Siddiqui, Zamin Shaheed; Park, Sung-Han; Kim, A-Ram; Kwon, Taek-Ryoun; Lee, Seong-Kon; Park, Soo-Chul; Jeong, Mi-Jeong; Lee, Gang-Seob

    2014-08-01

    Transgenic potatoes expressing glyceraldehyde-3-phosphate dehydrogenase (GPD), isolated from the oyster mushroom, Pleurotus sajor-caju, had increased tolerance to salt stress (Jeong et al. Biochem Biophys Res Commun 278:192-196, 2000). To examine the physiological mechanisms enhancing salt tolerance in GPD-transgenic rice plants, the salt tolerance of five GPD transgenic rice lines (T1-T5) derived from Dongjin rice cultivar were evaluated in a fixed 150 mM saline environment in comparison to two known wild-type rice cultivars, Dongjin (salt sensitive) and Pokali (salt tolerant). Transgenic lines, T2, T3, and T5, had a substantial increase in biomass and relative water content compared to Dongjin. Stomatal conductance and osmotic potential were higher in the GPD transgenic lines and were similar to those in Pokali. The results are discussed based on the comparative physiological response of GPD transgenic lines with those of the salt-sensitive and salt-tolerant rice cultivars.

  19. The sweet side of RNA regulation: glyceraldehyde-3-phosphate dehydrogenase as a noncanonical RNA-binding protein.

    Science.gov (United States)

    White, Michael R; Garcin, Elsa D

    2016-01-01

    The glycolytic protein, glyceraldehyde-3-phosphate dehydrogenase (GAPDH), has a vast array of extraglycolytic cellular functions, including interactions with nucleic acids. GAPDH has been implicated in the translocation of transfer RNA (tRNA), the regulation of cellular messenger RNA (mRNA) stability and translation, as well as the regulation of replication and gene expression of many single-stranded RNA viruses. A growing body of evidence supports GAPDH-RNA interactions serving as part of a larger coordination between intermediary metabolism and RNA biogenesis. Despite the established role of GAPDH in nucleic acid regulation, it is still unclear how and where GAPDH binds to its RNA targets, highlighted by the absence of any conserved RNA-binding sequences. This review will summarize our current understanding of GAPDH-mediated regulation of RNA function. WIREs RNA 2016, 7:53-70. doi: 10.1002/wrna.1315 For further resources related to this article, please visit the WIREs website.

  20. Glyceraldehyde 3-phosphate dehydrogenase augments the intercellular transmission and toxicity of polyglutamine aggregates in a cell model of Huntington disease.

    Science.gov (United States)

    Mikhaylova, Elena R; Lazarev, Vladimir F; Nikotina, Alina D; Margulis, Boris A; Guzhova, Irina V

    2016-03-01

    The common feature of Huntington disease is the accumulation of oligomers or aggregates of mutant huntingtin protein (mHTT), which causes the death of a subset of striatal neuronal populations. The cytotoxic species can leave neurons and migrate to other groups of cells penetrating and damaging them in a prion-like manner. We hypothesized that the glycolytic enzyme glyceraldehyde 3-phosphate dehydrogenase (GAPDH), previously shown to elevate the aggregation of mHTT, is associated with an increased efficiency of intercellular propagation of mHTT. GAPDH, on its own or together with polyglutamine species, was shown to be released into the extracellular milieu mainly from dying cells as assessed by a novel enzyme immunoassay, western blotting, and ultrafiltration. The conditioned medium of cells with growing GAPDH-polyQ aggregates was toxic to naïve cells, whereas depletion of the aggregates from the medium lowered this cytotoxicity. The GAPDH component of the aggregates was found to increase their toxicity by two-fold in comparison with polyQ alone. Furthermore, GAPDH-polyQ complexes were shown to penetrate acceptor cells and to increase the capacity of polyQ to prionize its intracellular homolog containing a repeat of 25 glutamine residues. Finally, inhibitors of intracellular transport showed that polyQ-GAPDH complexes, as well as GAPDH itself, penetrated cells using clathrin-mediated endocytosis. This suggested a pivotal role of the enzyme in the intercellular transmission of Huntington disease pathogenicity. In conclusion, GAPDH occurring in complexes with polyglutamine strengthens the prion-like activity and toxicity of the migrating aggregates. Aggregating polygluatmine tracts were shown to release from the cells over-expressing mutant huntingtin in a complex with glyceraldehyde 3-phosphate dehydrogenase (GAPDH). The enzyme enhances the intracellular transport of aggregates to healthy cells, prionization of normal cellular proteins and finally cell death, thus

  1. Purification and properties of glyceraldehyde-3-phosphate dehydrogenase from the skeletal muscle of the hibernating ground squirrel, Ictidomys tridecemlineatus

    Directory of Open Access Journals (Sweden)

    Ryan A.V. Bell

    2014-10-01

    Full Text Available Glyceraldehyde-3-phosphate dehydrogenase (GAPDH from the skeletal muscle of euthermic and torpid Ictidomys tridecemlineatus was purified to electrophoretic homogeneity using a novel method involving Blue-agarose and Phenyl-agarose chromatography. Kinetic analysis of the enzymes isolated from the two conditions suggested the existence of two structurally distinct proteins, with GAPDH V max being 40–60% less for the enzyme from the torpid condition (in both glycolytic and gluconeogenic directions as compared to the euthermic enzyme form. Thermal denaturation, in part determined by differential scanning fluorimetry, revealed that purified GAPDH from the torpid animals was significantly more stable that the enzyme from the euthermic condition. Mass spectrometry combined with Western blot analyses of purified GAPDH indicate that the cellular GAPDH population is extensively modified, with posttranslational phosphorylation, acetylation and methylation being detected. Global reduction in GAPDH tyrosine phosphorylation during torpor as well as site specific alterations in methylation sites suggests that that the stable changes observed in kinetic and structural GAPDH properties may be due to posttranslational modification of this enzyme during torpor. Taken together, these results suggest a stable suppression of GAPDH (possibly by some reversible posttranslational modification during ground squirrel torpor, which likely contributes to the overall reduction in carbohydrate metabolism when these animals switch to lipid fuels during dormancy.

  2. Glyceraldehyde-3-phosphate dehydrogenase aggregation inhibitor peptide: A potential therapeutic strategy against oxidative stress-induced cell death.

    Science.gov (United States)

    Itakura, Masanori; Nakajima, Hidemitsu; Semi, Yuko; Higashida, Shusaku; Azuma, Yasu-Taka; Takeuchi, Tadayoshi

    2015-11-13

    The glycolytic enzyme glyceraldehyde-3-phosphate dehydrogenase (GAPDH) has multiple functions, including mediating oxidative stress-induced neuronal cell death. This process is associated with disulfide-bonded GAPDH aggregation. Some reports suggest a link between GAPDH and the pathogenesis of several oxidative stress-related diseases. However, the pathological significance of GAPDH aggregation in disease pathogenesis remains unclear due to the lack of an effective GAPDH aggregation inhibitor. In this study, we identified a GAPDH aggregation inhibitor (GAI) peptide and evaluated its biological profile. The decapeptide GAI specifically inhibited GAPDH aggregation in a concentration-dependent manner. Additionally, the GAI peptide did not affect GAPDH glycolytic activity or cell viability. The GAI peptide also exerted a protective effect against oxidative stress-induced cell death in SH-SY5Y cells. This peptide could potentially serve as a tool to investigate GAPDH aggregation-related neurodegenerative and neuropsychiatric disorders and as a possible therapy for diseases associated with oxidative stress-induced cell death. Copyright © 2015 Elsevier Inc. All rights reserved.

  3. Synergistic interaction of glyceraldehydes-3-phosphate dehydrogenase and ArsJ, a novel organoarsenical efflux permease, confers arsenate resistance.

    Science.gov (United States)

    Chen, Jian; Yoshinaga, Masafumi; Garbinski, Luis D; Rosen, Barry P

    2016-06-01

    Microbial biotransformations are major contributors to the arsenic biogeocycle. In parallel with transformations of inorganic arsenic, organoarsenicals pathways have recently been recognized as important components of global cycling of arsenic. The well-characterized pathway of resistance to arsenate is reduction coupled to arsenite efflux. Here, we describe a new pathway of arsenate resistance involving biosynthesis and extrusion of an unusual pentavalent organoarsenical. A number of arsenic resistance (ars) operons have two genes of unknown function that are linked in these operons. One, gapdh, encodes the glycolytic enzyme glyceraldehyde-3-phosphate dehydrogenase. The other, arsJ, encodes a major facilitator superfamily (MFS) protein. The two genes were cloned from the chromosome of Pseudomonas aeruginosa. When expressed together, but not alone, in Escherichia coli, gapdh and arsJ specifically conferred resistance to arsenate and decreased accumulation of As(V). Everted membrane vesicles from cells expressing arsJ accumulated As(V) in the presence of purified GAPDH, D-glceraldehylde 3-phosphate (G3P) and NAD(+) . GAPDH forms the unstable organoarsenical 1-arseno-3-phosphoglycerate (1As3PGA). We propose that ArsJ is an efflux permease that extrudes 1As3PGA from cells, where it rapidly dissociates into As(V) and 3-phosphoglycerate (3PGA), creating a novel pathway of arsenate resistance.

  4. Characterization of the highly active fragment of glyceraldehyde-3-phosphate dehydrogenase gene promoter for recombinant protein expression in Pleurotus ostreatus.

    Science.gov (United States)

    Yin, Chaomin; Zheng, Liesheng; Zhu, Jihong; Chen, Liguo; Ma, Aimin

    2015-03-01

    Developing efficient native promoters is important for improving recombinant protein expression by fungal genetic engineering. The promoter region of glyceraldehyde-3-phosphate dehydrogenase gene in Pleurotus ostreatus (Pogpd) was isolated and optimized by upstream truncation. The activities of these promoters with different lengths were further confirmed by fluorescence, quantitative real-time PCR and Western blot analysis. A truncated Pogpd-P2 fragment (795 bp) drove enhanced green fluorescence protein (egfp) gene expression in P. ostreatus much more efficiently than full-length Pogpd-P1. Further truncating Pogpd-P2 to 603, 403 and 231 bp reduced the eGFP expression significantly. However, the 403-bp fragment between -356 bp and the start codon was the minimal but sufficient promoter element for eGFP expression. Compact native promoters for genetic engineering of P. ostreatus were successfully developed and validated in this study. This will broaden the preexisting repertoire of fungal promoters for biotechnology application. © FEMS 2015. All rights reserved. For permissions, please e-mail: journals.permissions@oup.com.

  5. SIRT1 interacts with and protects glyceraldehyde-3-phosphate dehydrogenase (GAPDH) from nuclear translocation: Implications for cell survival after irradiation

    Energy Technology Data Exchange (ETDEWEB)

    Joo, Hyun-Yoo [Division of Radiation Cancer Research, Korea Institute of Radiological and Medical Sciences, Seoul 139-706 (Korea, Republic of); Laboratory of Biochemistry, School of Life Sciences and Biotechnology, Korea University, Seoul 136-713 (Korea, Republic of); Woo, Seon Rang; Shen, Yan-Nan; Yun, Mi Yong; Shin, Hyun-Jin; Park, Eun-Ran; Kim, Su-Hyeon; Park, Jeong-Eun; Ju, Yeun-Jin; Hong, Sung Hee; Hwang, Sang-Gu [Division of Radiation Cancer Research, Korea Institute of Radiological and Medical Sciences, Seoul 139-706 (Korea, Republic of); Cho, Myung-Haing [Laboratory of Toxicology, College of Veterinary Medicine, Seoul National University, Seoul 151-742 (Korea, Republic of); Kim, Joon, E-mail: joonkim@korea.ac.kr [Laboratory of Biochemistry, School of Life Sciences and Biotechnology, Korea University, Seoul 136-713 (Korea, Republic of); Lee, Kee-Ho, E-mail: khlee@kirams.re.kr [Division of Radiation Cancer Research, Korea Institute of Radiological and Medical Sciences, Seoul 139-706 (Korea, Republic of)

    2012-08-10

    Highlights: Black-Right-Pointing-Pointer SIRT1 serves to retain GAPDH in the cytosol, preventing GAPDH nuclear translocation. Black-Right-Pointing-Pointer When SIRT1 is depleted, GAPDH translocation occurs even in the absence of stress. Black-Right-Pointing-Pointer Upon irradiation, SIRT1 interacts with GAPDH. Black-Right-Pointing-Pointer SIRT1 prevents irradiation-induced nuclear translocation of GAPDH. Black-Right-Pointing-Pointer SIRT1 presence rather than activity is essential for inhibiting GAPDH translocation. -- Abstract: Upon apoptotic stimulation, glyceraldehyde-3-phosphate dehydrogenase (GAPDH), a cytosolic enzyme normally active in glycolysis, translocates into the nucleus and activates an apoptotic cascade therein. In the present work, we show that SIRT1 prevents nuclear translocation of GAPDH via interaction with GAPDH. SIRT1 depletion triggered nuclear translocation of cytosolic GAPDH even in the absence of apoptotic stress. Such translocation was not, however, observed when SIRT1 enzymatic activity was inhibited, indicating that SIRT1 protein per se, rather than the deacetylase activity of the protein, is required to inhibit GAPDH translocation. Upon irradiation, SIRT1 prevented irradiation-induced nuclear translocation of GAPDH, accompanied by interaction of SIRT1 and GAPDH. Thus, SIRT1 functions to retain GAPDH in the cytosol, protecting the enzyme from nuclear translocation via interaction with these two proteins. This serves as a mechanism whereby SIRT1 regulates cell survival upon induction of apoptotic stress by means that include irradiation.

  6. A hypothesis for the evolution of nuclear-encoded, plastid-targeted glyceraldehyde-3-phosphate dehydrogenase genes in "chromalveolate" members.

    Directory of Open Access Journals (Sweden)

    Kiyotaka Takishita

    Full Text Available Eukaryotes bearing red alga-derived plastids--photosynthetic alveolates (dinoflagellates plus the apicomplexan Toxoplasma gondii plus the chromerid Chromera velia, photosynthetic stramenopiles, haptophytes, and cryptophytes--possess unique plastid-targeted glyceraldehyde-3-phosphate dehydrogenases (henceforth designated as "GapC1". Pioneering phylogenetic studies have indicated a single origin of the GapC1 enzymes in eukaryotic evolution, but there are two potential idiosyncrasies in the GapC1 phylogeny: Firstly, the GapC1 tree topology is apparently inconsistent with the organismal relationship among the "GapC1-containing" groups. Secondly, four stramenopile GapC1 homologues are consistently paraphyletic in previously published studies, although these organisms have been widely accepted as monophyletic. For a closer examination of the above issues, in this study GapC1 gene sampling was improved by determining/identifying nine stramenopile and two cryptophyte genes. Phylogenetic analyses of our GapC1 dataset, which is particularly rich in the stramenopile homologues, prompt us to propose a new scenario that assumes multiple, lateral GapC1 gene transfer events to explain the incongruity between the GapC1 phylogeny and the organismal relationships amongst the "GapC1-containing" groups. Under our new scenario, GapC1 genes uniquely found in photosynthetic alveolates, photosynthetic stramenopiles, haptophytes, and cryptopyhytes are not necessarily a character vertically inherited from a common ancestor.

  7. In Silico Identification and in Vitro Activity of Novel Natural Inhibitors of Trypanosoma brucei Glyceraldehyde-3-phosphate-dehydrogenase

    Directory of Open Access Journals (Sweden)

    Fabian C. Herrmann

    2015-09-01

    Full Text Available As part of our ongoing efforts to identify natural products with activity against pathogens causing neglected tropical diseases, we are currently performing an extensive screening of natural product (NP databases against a multitude of protozoan parasite proteins. Within this project, we screened a database of NPs from a commercial supplier, AnalytiCon Discovery (Potsdam, Germany, against Trypanosoma brucei glyceraldehyde-3-phosphate dehydrogenase (TbGAPDH, a glycolytic enzyme whose inhibition deprives the parasite of energy supply. NPs acting as potential inhibitors of the mentioned enzyme were identified using a pharmacophore-based virtual screening and subsequent docking of the identified hits into the active site of interest. In a set of 700 structures chosen for the screening, 13 (1.9% were predicted to possess significant affinity towards the enzyme and were therefore tested in an in vitro enzyme assay using recombinant TbGAPDH. Nine of these in silico hits (69% showed significant inhibitory activity at 50 µM, of which two geranylated benzophenone derivatives proved to be particularly active with IC50 values below 10 µM. These compounds also showed moderate in vitro activity against T. brucei rhodesiense and may thus represent interesting starting points for further optimization.

  8. A new bianthron glycoside as inhibitor of Trypanosoma cruzi glyceraldehyde 3-phosphate dehydrogenase activity

    Energy Technology Data Exchange (ETDEWEB)

    Macedo, Edangelo M.S. de; Silva, Maria G.V. [Universidade Federal do Ceara (UFC), Fortaleza, CE (Brazil). Dept. de Quimica Analitica e Fisico-Quimica; Wiggers, Helton J.; Montanari, Carlos A. [Universidade de Sao Paulo (USP), SP (Brazil). Inst. de Quimica; Braz-Filho, Raimundo [Universidade Estadual do Norte Fluminense, Campos dos Goytacazes, RJ, (Brazil). Setor de Quimica de Produtos Naturais; Andricopulo, Adriano D. [Universidade de Sao Paulo (USP), Sao Carlos SP (Brazil). Inst. de Fisica

    2009-07-01

    A phytochemical investigation of the ethanolic extract of stalks of Senna martiana Benth. (Leguminoseae), native specie of northeast Brazil, resulted in the isolation and spectroscopic characterization of a new bianthrone glycoside, martianine 1 (10,10'-il-chrysophanol-10-oxi- 10,10'-bi-glucosyl). Its identification was established by HRMS, IR and 2D NMR experiments. The evaluation of martianine trypanocidal activity was carried out against gliceraldehyde 3-phosphate dehydrogenase enzyme from Trypanosoma cruzi. Its inhibitory constant (K{sub i}) is in the low micromolar concentration and it was determined by isothermal titration calorimetry to be 27.3 +-2.47 {mu}mol L{sup -1}. The non-competitive mechanism is asserted to be putative of the mode of action martianine displays against T. cruzi GAPDH. Results show that martianine has a great potential to become new lead molecule by inhibiting this key enzyme and for the development of new drugs against Chagas disease. (author)

  9. Glyceraldehyde 3-phosphate dehydrogenase and galectin from Dirofilaria immitis participate in heartworm disease endarteritis via plasminogen/plasmin system.

    Science.gov (United States)

    González-Miguel, Javier; Larrazabal, Carmen; Loa-Mesón, Diana; Siles-Lucas, Mar; Simón, Fernando; Morchón, Rodrigo

    2016-06-15

    The interaction between parasitic protozoa and helminths, both in the blood and in tissues and the fibrinolytic system of their hosts is usually considered as a survival parasite mechanism since this system is the physiological route responsible for degrading fibrin clots. The broad-range proteolytic activity of plasmin, the final enzyme of the route, implies that its recruitment by these parasites is an important mechanism that mediates their invasion and establishment in the hosts. However, recent studies have proposed a dual role for plasmin by linking its over-production with pathological mechanisms at vascular level. Most of these studies have been conducted in Dirofilaria immitis, a blood-borne parasite that survives in the pulmonary arteries of its host for years while it produces a chronic inflammatory disease, whose main pathogenic mechanism is the appearance of proliferative endarteritis. Recently, the participation of two proteins from D. immitis, glyceraldehyde 3-phosphate dehydrogenase (DiGAPDH) and galectin (DiGAL), in the activation of the fibrinolytic system of its host has been demonstrated, which has been a priori associated with parasite survival mechanisms. The aim of the present paper was to study the role of plasmin generated by these proteins in the emergence of proliferative endarteritis. An in vitro model of canine endothelial and smooth muscle cells, as well as the two parasitic recombinant proteins were employed. The results show that DiGAPDH and DiGAL stimulate the proliferation and migration of both cell types, as well as the degradation of the extracellular matrix (ECM) via plasminogen (PLG)/plasmin system, being all of these mechanisms related to the appearance of proliferative endarteritis. Due to the high degree of evolutionary conservation of these antigens, these data support the hypothesis of the survival/pathology ambivalence in the interactions between parasites and the fibrinolytic system of their hosts and represent an

  10. Functional divergence and convergent evolution in the plastid-targeted glyceraldehyde-3-phosphate dehydrogenases of diverse eukaryotic algae.

    Science.gov (United States)

    Gaston, Daniel; Roger, Andrew J

    2013-01-01

    Glyceraldehyde-3-phosphate dehydrogenase (GAPDH) is a key enzyme of the glycolytic pathway, reversibly catalyzing the sixth step of glycolysis and concurrently reducing the coenzyme NAD(+) to NADH. In photosynthetic organisms a GAPDH paralog (Gap2 in Cyanobacteria, GapA in most photosynthetic eukaryotes) functions in the Calvin cycle, performing the reverse of the glycolytic reaction and using the coenzyme NADPH preferentially. In a number of photosynthetic eukaryotes that acquired their plastid by the secondary endosymbiosis of a eukaryotic red alga (Alveolates, haptophytes, cryptomonads and stramenopiles) GapA has been apparently replaced with a paralog of the host's own cytosolic GAPDH (GapC1). Plastid GapC1 and GapA therefore represent two independent cases of functional divergence and adaptations to the Calvin cycle entailing a shift in subcellular targeting and a shift in binding preference from NAD(+) to NADPH. We used the programs FunDi, GroupSim, and Difference Evolutionary-Trace to detect sites involved in the functional divergence of these two groups of GAPDH sequences and to identify potential cases of convergent evolution in the Calvin-cycle adapted GapA and GapC1 families. Sites identified as being functionally divergent by all or some of these programs were then investigated with respect to their possible roles in the structure and function of both glycolytic and plastid-targeted GAPDH isoforms. In this work we found substantial evidence for convergent evolution in GapA/B and GapC1. In many cases sites in GAPDHs of these groups converged on identical amino acid residues in specific positions of the protein known to play a role in the function and regulation of plastid-functioning enzymes relative to their cytosolic counterparts. In addition, we demonstrate that bioinformatic software like FunDi are important tools for the generation of meaningful biological hypotheses that can then be tested with direct experimental techniques.

  11. Active site cysteine-null glyceraldehyde-3-phosphate dehydrogenase (GAPDH) rescues nitric oxide-induced cell death.

    Science.gov (United States)

    Kubo, Takeya; Nakajima, Hidemitsu; Nakatsuji, Masatoshi; Itakura, Masanori; Kaneshige, Akihiro; Azuma, Yasu-Taka; Inui, Takashi; Takeuchi, Tadayoshi

    2016-02-29

    Glyceraldehyde-3-phosphate dehydrogenase (GAPDH), a homotetrameric enzyme involved in a key step of glycolysis, also has a role in mediating cell death under nitrosative stress. Our previous reports suggest that nitric oxide-induced intramolecular disulfide-bonding GAPDH aggregation, which occurs through oxidation of the active site cysteine (Cys-152), participates in a mechanism to account for nitric oxide-induced death signaling in some neurodegenerative/neuropsychiatric disorders. Here, we demonstrate a rescue strategy for nitric oxide-induced cell death accompanied by GAPDH aggregation in a mutant with a substitution of Cys-152 to alanine (C152A-GAPDH). Pre-incubation of purified wild-type GAPDH with C152A-GAPDH under exposure to nitric oxide inhibited wild-type GAPDH aggregation in a concentration-dependent manner in vitro. Several lines of structural analysis revealed that C152A-GAPDH extensively interfered with nitric oxide-induced GAPDH-amyloidogenesis. Overexpression of doxycycline-inducible C152A-GAPDH in SH-SY5Y neuroblastoma significantly rescued nitric oxide-induced death, concomitant with the decreased formation of GAPDH aggregates. Further, both co-immunoprecipitation assays and simulation models revealed a heterotetramer composed of one dimer each of wild-type GAPDH and C152A-GAPDH. These results suggest that the C152A-GAPDH mutant acts as a dominant-negative molecule against GAPDH aggregation via the formation of this GAPDH heterotetramer. This study may contribute to a new therapeutic approach utilizing C152A-GAPDH against brain damage in nitrosative stress-related disorders.

  12. Glyceraldehyde-3-phosphate dehydrogenase is largely unresponsive to low regulatory levels of hydrogen peroxide in Saccharomyces cerevisiae

    Directory of Open Access Journals (Sweden)

    Sousa-Lopes Ana

    2010-12-01

    Full Text Available Abstract Background The reversible oxidation of protein SH groups has been considered to be the basis of redox regulation by which changes in hydrogen peroxide (H2O2 concentrations may control protein function. Several proteins become S-glutathionylated following exposure to H2O2 in a variety of cellular systems. In yeast, when using a high initial H2O2 dose, glyceraldehyde-3-phosphate dehydrogenase (GAPDH was identified as the major target of S-glutathionylation which leads to reversible inactivation of the enzyme. GAPDH inactivation by H2O2 functions to reroute carbohydrate flux to produce NADPH. Here we report the effect of low regulatory H2O2 doses on GAPDH activity and expression in Saccharomyces cerevisiae. Results A calibrated and controlled method of H2O2 delivery - the steady-state titration - in which cells are exposed to constant, low, and known H2O2 concentrations, was used in this study. This technique, contrary to the common bolus addition, allows determining which H2O2 concentrations trigger specific biological responses. This work shows that both in exponential- and stationary-phase cells, low regulatory H2O2 concentrations induce a large upregulation of catalase, a fingerprint of the cellular oxidative stress response, but GAPDH oxidation and the ensuing activity decrease are only observed at death-inducing high H2O2 doses. GAPDH activity is constant upon incubation with sub-lethal H2O2 doses, but in stationary-phase cells there is a differential response in the expression of the three GAPDH isoenzymes: Tdh1p is strongly upregulated while Tdh2p/Tdh3p are slightly downregulated. Conclusions In yeast GAPDH activity is largely unresponsive to low to moderate H2O2 doses. This points to a scenario where (a cellular redoxins efficiently cope with levels of GAPDH oxidation induced by a vast range of sub-lethal H2O2 concentrations, (b inactivation of GAPDH cannot be considered a sensitive biomarker of H2O2-induced oxidation in vivo

  13. Detection of a mutation in the intron of Sperm-specific glyceraldehyde-3-phosphate dehydrogenase gene in patients with fibrous sheath dysplasia of the sperm flagellum.

    Science.gov (United States)

    Elkina, Y L; Kuravsky, M L; Bragina, E E; Kurilo, L F; Khayat, S S; Sukhomlinova, M Y; Schmalhausen, E V

    2017-03-01

    The fibrous sheath is a unique cytoskeletal structure surrounding the axoneme and outer dense fibres of the sperm flagellum. Dysplasia of the fibrous sheath (DFS) is a defect of spermatozoa observed in severe asthenozoospermic patients and characterised by morphologically abnormal flagella with distorted fibrous sheaths. Sperm-specific glyceraldehyde-3-phosphate dehydrogenase (GAPDS) is a glycolytic enzyme that is tightly associated with the fibrous sheath of the sperm flagellum. The enzymatic activity of GAPDS was investigated in sperm samples of seven patients with DFS and compared to that of normal spermatozoa (n = 10). The difference in GAPDS activity in DFS and normal spermatozoa was statistically significant (0.19 ± 0.11 and 0.75 ± 0.11 μmol NADH per min per mg protein respectively). Immunochemical staining revealed irregular distribution of GAPDS in the flagellum of DFS spermatozoa. Other five samples with typical alterations in the fibrous sheath were assayed for mutations within human GAPDS gene. In all five cases, a replacement of guanine by adenine was revealed in the intron region between the sixth and the seventh exons of GAPDS. It is assumed that the deficiency in GAPDS observed in most DFS sperm samples is ascribable to a disorder in the regulation of GAPDS expression caused by the mutation in the intron region of GAPDS gene.

  14. The glyceraldehyde-3-phosphate dehydrogenase promoter of the food yeast Candida utilis strain NRRL Y-660 is functional in Agrobacterium tumefaciens.

    Science.gov (United States)

    González, Tania; Eng, Felipe; Fraga, Reinaldo; Fonseca, Jennifer; Amores, Isis

    2013-11-01

    The glyceraldehyde-3-phosphate dehydrogenase promoter of the food yeast Candida utilis strain NRRL Y-660 was cloned to create a novel integrative vector for Agrobacterium tumefaciens-mediated transformation. The new binary vector harbors β-glucuronidase activity as reporter and kanamicin/geneticin resistance as selection marker. Recombinant clones of A. tumefaciens show kanamycin resistance and high β-glucuronidase activity under the control of the C. utilis promoter. This finding can be explained by the presence of a prokaryotic core in the yeast promoter, predicted by in silico analysis of the sequence. This is the first report about functionality of a yeast promoter in A. tumefaciens.

  15. Protein S-Bacillithiolation Functions in Thiol Protection and Redox Regulation of the Glyceraldehyde-3-Phosphate Dehydrogenase Gap in Staphylococcus aureus Under Hypochlorite Stress.

    Science.gov (United States)

    Imber, Marcel; Huyen, Nguyen Thi Thu; Pietrzyk-Brzezinska, Agnieszka J; Loi, Vu Van; Hillion, Melanie; Bernhardt, Jörg; Thärichen, Lena; Kolšek, Katra; Saleh, Malek; Hamilton, Chris J; Adrian, Lorenz; Gräter, Frauke; Wahl, Markus C; Antelmann, Haike

    2017-01-18

    Bacillithiol (BSH) is the major low-molecular-weight thiol of the human pathogen Staphylococcus aureus. In this study, we used OxICAT and Voronoi redox treemaps to quantify hypochlorite-sensitive protein thiols in S. aureus USA300 and analyzed the role of BSH in protein S-bacillithiolation. The OxICAT analyses enabled the quantification of 228 Cys residues in the redox proteome of S. aureus USA300. Hypochlorite stress resulted in >10% increased oxidation of 58 Cys residues (25.4%) in the thiol redox proteome. Among the highly oxidized sodium hypochlorite (NaOCl)-sensitive proteins are five S-bacillithiolated proteins (Gap, AldA, GuaB, RpmJ, and PpaC). The glyceraldehyde-3-phosphate (G3P) dehydrogenase Gap represents the most abundant S-bacillithiolated protein contributing 4% to the total Cys proteome. The active site Cys151 of Gap was very sensitive to overoxidation and irreversible inactivation by hydrogen peroxide (H2O2) or NaOCl in vitro. Treatment with H2O2 or NaOCl in the presence of BSH resulted in reversible Gap inactivation due to S-bacillithiolation, which could be regenerated by the bacilliredoxin Brx (SAUSA300_1321) in vitro. Molecular docking was used to model the S-bacillithiolated Gap active site, suggesting that formation of the BSH mixed disulfide does not require major structural changes. Conclusion and Innovation: Using OxICAT analyses, we identified 58 novel NaOCl-sensitive proteins in the pathogen S. aureus that could play protective roles against the host immune defense and include the glycolytic Gap as major target for S-bacillithiolation. S-bacillithiolation of Gap did not require structural changes, but efficiently functions in redox regulation and protection of the active site against irreversible overoxidation in S. aureus. Antioxid. Redox Signal. 00, 000-000.

  16. Crystal structure of Trypanosoma cruzi glyceraldehyde-3-phosphate dehydrogenase complexed with an analogue of 1,3-bisphospho-d-glyceric acid.

    Science.gov (United States)

    Ladame, Sylvain; Castilho, Marcelo S; Silva, Carlos H T P; Denier, Colette; Hannaert, Véronique; Périé, Jacques; Oliva, Glaucius; Willson, Michèle

    2003-11-01

    We report here the first crystal structure of a stable isosteric analogue of 1,3-bisphospho-d-glyceric acid (1,3-BPGA) bound to the catalytic domain of Trypanosoma cruzi glycosomal glyceraldehyde-3-phosphate dehydrogenase (gGAPDH) in which the two phosphoryl moieties interact with Arg249. This complex possibly illustrates a step of the catalytic process by which Arg249 may induce compression of the product formed, allowing its expulsion from the active site. Structural modifications were introduced into this isosteric analogue and the respective inhibitory effects of the resulting diphosphorylated compounds on T. cruzi and Trypanosoma brucei gGAPDHs were investigated by enzymatic inhibition studies, fluorescence spectroscopy, site-directed mutagenesis, and molecular modelling. Despite the high homology between the two trypanomastid gGAPDHs (> 95%), we have identified specific interactions that could be used to design selective irreversible inhibitors against T. cruzi gGAPDH.

  17. Identification of Glyceraldehyde-3-phosphate dehydrogenase (GAPDH as a binding protein for a 68-kDa Bacillus thuringiensis parasporal protein cytotoxic against leukaemic cells

    Directory of Open Access Journals (Sweden)

    Nadarajah Vishna

    2010-11-01

    Full Text Available Abstract Background Bacillus thuringiensis (Bt, an ubiquitous gram-positive spore-forming bacterium forms parasporal proteins during the stationary phase of its growth. Recent findings of selective human cancer cell-killing activity in non-insecticidal Bt isolates resulted in a new category of Bt parasporal protein called parasporin. However, little is known about the receptor molecules that bind parasporins and the mechanism of anti-cancer activity. A Malaysian Bt isolate, designated Bt18 produces parasporal protein that exhibit preferential cytotoxic activity for human leukaemic T cells (CEM-SS but is non-cytotoxic to normal T cells or other cancer cell lines such as human cervical cancer (HeLa, human breast cancer (MCF-7 and colon cancer (HT-29 suggesting properties similar to parasporin. In this study we aim to identify the binding protein for Bt18 in human leukaemic T cells. Methods Bt18 parasporal protein was separated using Mono Q anion exchange column attached to a HPLC system and antibody was raised against the purified 68-kDa parasporal protein. Receptor binding assay was used to detect the binding protein for Bt18 parasporal protein in CEM-SS cells and the identified protein was sent for N-terminal sequencing. NCBI protein BLAST was used to analyse the protein sequence. Double immunofluorescence staining techniques was applied to localise Bt18 and binding protein on CEM-SS cell. Results Anion exchange separation of Bt18 parasporal protein yielded a 68-kDa parasporal protein with specific cytotoxic activity. Polyclonal IgG (anti-Bt18 for the 68-kDa parasporal protein was successfully raised and purified. Receptor binding assay showed that Bt18 parasporal protein bound to a 36-kDa protein from the CEM-SS cells lysate. N-terminal amino acid sequence of the 36-kDa protein was GKVKVGVNGFGRIGG. NCBI protein BLAST revealed that the binding protein was Glyceraldehyde-3-phosphate dehydrogenase (GAPDH. Double immunofluorescence staining showed

  18. Antitrypanosomal compounds from the essential oil and extracts of Keetia leucantha leaves with inhibitor activity on Trypanosoma brucei glyceraldehyde-3-phosphate dehydrogenase.

    Science.gov (United States)

    Bero, J; Beaufay, C; Hannaert, V; Hérent, M-F; Michels, P A; Quetin-Leclercq, J

    2013-02-15

    Keetia leucantha is a West African tree used in traditional medicine to treat several diseases among which parasitic infections. The dichloromethane extract of leaves was previously shown to possess growth-inhibitory activities on Plasmodium falciparum, Trypanosoma brucei brucei and Leishmania mexicana mexicana with low or no cytotoxicity (>100 μg/ml on human normal fibroblasts) (Bero et al. 2009, 2011). In continuation of our investigations on the antitrypanosomal compounds from this dichloromethane extract, we analyzed by GC-FID and GC-MS the essential oil of its leaves obtained by hydrodistillation and the major triterpenic acids in this extract by LC-MS. Twenty-seven compounds were identified in the oil whose percentages were calculated using the normalization method. The essential oil, seven of its constituents and the three triterpenic acids were evaluated for their antitrypanosomal activity on Trypanosoma brucei brucei bloodstream forms (Tbb BSF) and procyclic forms (Tbb PF) to identify an activity on the glycolytic process of trypanosomes. The oil showed an IC(50) of 20.9 μg/ml on Tbb BSF and no activity was observed on Tbb PF. The best antitrypanosomal activity was observed for ursolic acid with IC(50) of 2.5 and 6.5 μg/ml respectively on Tbb BSF and Tbb PF. The inhibitory activity on a glycolytic enzyme of T. brucei, glyceraldehyde-3-phosphate dehydrogenase (GAPDH), was also evaluated for betulinic acid, olenaolic acid, ursolic acid, phytol, α-ionone and β-ionone. The three triterpenic acids and β-ionone showed inhibitory activities on GAPDH with oleanolic acid being the most active with an inhibition of 72.63% at 20 μg/ml. This paper reports for the first time the composition and antitrypanosomal activity of the essential oil of Keetia leucantha. Several of its constituents and three triterpenic acids present in the dichloromethane leaves extract showed a higher antitrypanosomal activity on bloodstream forms of Tbb as compared to procyclic forms

  19. Improved production of 2,3-butanediol in Bacillus amyloliquefaciens by over-expression of glyceraldehyde-3-phosphate dehydrogenase and 2,3-butanediol dehydrogenase.

    Directory of Open Access Journals (Sweden)

    Taowei Yang

    Full Text Available BACKGROUND: Previously, a safe strain, Bacillus amyloliquefaciens B10-127 was identified as an excellent candidate for industrial-scale microbial fermentation of 2,3-butanediol (2,3-BD. However, B. amyloliquefaciens fermentation yields large quantities of acetoin, lactate and succinate as by-products, and the 2,3-BD yield remains prohibitively low for commercial production. METHODOLOGY/PRINCIPAL FINDINGS: In the 2,3-butanediol metabolic pathway, glyceraldehyde-3-phosphate dehydrogenase (GAPDH catalyzes the conversion of 3-phosphate glyceraldehyde to 1,3-bisphosphoglycerate, with concomitant reduction of NAD(+ to NADH. In the same pathway, 2,3-BD dehydrogenase (BDH catalyzes the conversion of acetoin to 2,3-BD with concomitant oxidation of NADH to NAD(+. In this study, to improve 2,3-BD production, we first over-produced NAD(+-dependent GAPDH and NADH-dependent BDH in B. amyloliquefaciens. Excess GAPDH reduced the fermentation time, increased the 2,3-BD yield by 12.7%, and decreased the acetoin titer by 44.3%. However, the process also enhanced lactate and succinate production. Excess BDH increased the 2,3-BD yield by 16.6% while decreasing acetoin, lactate and succinate production, but prolonged the fermentation time. When BDH and GAPDH were co-overproduced in B. amyloliquefaciens, the fermentation time was reduced. Furthermore, in the NADH-dependent pathways, the molar yield of 2,3-BD was increased by 22.7%, while those of acetoin, lactate and succinate were reduced by 80.8%, 33.3% and 39.5%, relative to the parent strain. In fed-batch fermentations, the 2,3-BD concentration was maximized at 132.9 g/l after 45 h, with a productivity of 2.95 g/l·h. CONCLUSIONS/SIGNIFICANCE: Co-overexpression of bdh and gapA genes proved an effective method for enhancing 2,3-BD production and inhibiting the accumulation of unwanted by-products (acetoin, lactate and succinate. To our knowledge, we have attained the highest 2,3-BD fermentation yield thus far

  20. Comparison of the regulation, metabolic functions, and roles in virulence of the glyceraldehyde-3-phosphate dehydrogenase homologues gapA and gapB in Staphylococcus aureus.

    Science.gov (United States)

    Purves, Joanne; Cockayne, Alan; Moody, Peter C E; Morrissey, Julie A

    2010-12-01

    The Gram-positive bacterium Staphylococcus aureus contains two glyceraldehyde-3-phosphate dehydrogenase (GAPDH) homologues known as GapA and GapB. GapA has been characterized as a functional GAPDH protein, but currently there is no biological evidence for the role of GapB in metabolism in S. aureus. In this study we show through a number of complementary methods that S. aureus GapA is essential for glycolysis while GapB is essential in gluconeogenesis. These proteins are reciprocally regulated in response to glucose concentrations, and both are influenced by the glycolysis regulator protein GapR, which is the first demonstration of the role of this regulator in S. aureus and the first indication that GapR homologues control genes other than those within the glycolytic operon. Furthermore, we show that both GapA and GapB are important in the pathogenesis of S. aureus in a Galleria mellonella model of infection, showing for the first time in any bacteria that both glycolysis and gluconeogenesis have important roles in virulence.

  1. A Phytophthora sojae gene of glyceraldehyde-3-phosphate dehydrogenase (GAPDH) induced in host infection and its anti-oxidative function in yeast

    Institute of Scientific and Technical Information of China (English)

    ZENG Juan; WANG Yuanchao; SHEN Gui; ZHENG Xiaobo

    2006-01-01

    Glyceraldehyde-3-phosphate dehydrogenase (GAPDH) is a multifunctional protein well defined in eukaryotes, especially in mammalian and Saccharomyces cerevisiae. Using the method of suppression subtractive hybridization (SSH), we identified a Phytophthora sojae cDNA coding GAPDH, which was up-regulated during the early stage of soybean infection. The termed PsGapdh gene possessed three copies in the P. sojae genome. Its amino acid sequence harbored overall conserved domain of GADPH, homologous closest to GapC1 of Achlya bisexualis (oomycete) and adjoined to GapC2s of Odontella sinensis and Phaeodactylum tricornutum (diatom), on the C-Ⅱbranch of subfamily GapC in phylogeny tree of GAPDH. The transcriptional level of PsGapdh was up-regulated throughout early infection. Heterogenous expression of PsGapdh in the yeast tdh1-deleted mutant could rescue growth arrest under continuous exposure to H2O2. These results indicated active roles of PsGapdh in pathogen-host interaction and anti-oxidation.

  2. Taurine chloramine is more selective than hypochlorous acid at targeting critical cysteines and inactivating creatine kinase and glyceraldehyde-3-phosphate dehydrogenase.

    Science.gov (United States)

    Peskin, Alexander V; Winterbourn, Christine C

    2006-01-01

    Hypochlorous acid (HOCl) and chloramines are produced by the neutrophil enzyme, myeloperoxidase. Both react readily with thiols, although chloramines differ from HOCl in discriminating between low molecular weight thiols on the basis of their pKa. Here, we have compared the reactivity of HOCl and taurine chloramine with thiol proteins by examining inactivation of creatine kinase (CK) and glyceraldehyde-3-phosphate dehydrogenase (GAPDH). With both enzymes, loss of activity paralleled thiol loss. For CK both were complete at a 1:1 taurine chloramine:thiol mole ratio. For GAPDH each chloramine oxidized two thiols. Three times more HOCl than taurine chloramine was required for inactivation, indicating that HOCl is less thiol specific. Competition studies showed that thiols of CK were 4 times more reactive with taurine chloramine than thiols of GAPDH (rate constants of 1200 and 300 M-1s-1 respectively). These compare with 205 M-1s-1 for cysteine and are consistent with their lower pKa's. Both enzymes were equally susceptible to HOCl. GSH competed directly with the enzyme thiols for taurine chloramine and protected against oxidative inactivation. At lower GSH concentrations, mixed disulfides were formed. We propose that chloramines should preferentially attack proteins with low pKa thiols and this could be important in regulatory processes.

  3. Glyceraldehyde-3-phosphate dehydrogenase (GAPDH interaction with 3' ends of Japanese encephalitis virus RNA and colocalization with the viral NS5 protein

    Directory of Open Access Journals (Sweden)

    Chou Shih-Jie

    2009-04-01

    Full Text Available Abstract Replication of the Japanese encephalitis virus (JEV genome depends on host factors for successfully completing their life cycles; to do this, host factors have been recruited and/or relocated to the site of viral replication. Glyceraldehyde-3-phosphate dehydrogenase (GAPDH, a cellular metabolic protein, was found to colocalize with viral RNA-dependent RNA polymerase (NS5 in JEV-infected cells. Subcellular fractionation further indicated that GAPDH remained relatively constant in the cytosol, while increasing at 12 to 24 hours postinfection (hpi and decreasing at 36 hpi in the nuclear fraction of infected cells. In contrast, the redistribution patterns of GAPDH were not observed in the uninfected cells. Co-immunoprecipitation of GAPDH and JEV NS5 protein revealed no direct protein-protein interaction; instead, GAPDH binds to the 3' termini of plus- and minus-strand RNAs of JEV by electrophoretic mobility shift assays. Accordingly, GAPDH binds to the minus strand more efficiently than to the plus strand of JEV RNAs. This study highlights the findings that infection of JEV changes subcellular localization of GAPDH suggesting that this metabolic enzyme may play a role in JEV replication.

  4. Comparison of the Regulation, Metabolic Functions, and Roles in Virulence of the Glyceraldehyde-3-Phosphate Dehydrogenase Homologues gapA and gapB in Staphylococcus aureus▿

    Science.gov (United States)

    Purves, Joanne; Cockayne, Alan; Moody, Peter C. E.; Morrissey, Julie A.

    2010-01-01

    The Gram-positive bacterium Staphylococcus aureus contains two glyceraldehyde-3-phosphate dehydrogenase (GAPDH) homologues known as GapA and GapB. GapA has been characterized as a functional GAPDH protein, but currently there is no biological evidence for the role of GapB in metabolism in S. aureus. In this study we show through a number of complementary methods that S. aureus GapA is essential for glycolysis while GapB is essential in gluconeogenesis. These proteins are reciprocally regulated in response to glucose concentrations, and both are influenced by the glycolysis regulator protein GapR, which is the first demonstration of the role of this regulator in S. aureus and the first indication that GapR homologues control genes other than those within the glycolytic operon. Furthermore, we show that both GapA and GapB are important in the pathogenesis of S. aureus in a Galleria mellonella model of infection, showing for the first time in any bacteria that both glycolysis and gluconeogenesis have important roles in virulence. PMID:20876289

  5. Involvement of a cytoplasmic glyceraldehyde-3-phosphate dehydrogenase GapC-2 in low-phosphate-induced anthocyanin accumulation in Arabidopsis

    Institute of Scientific and Technical Information of China (English)

    WANG XiYao; CHEN YiFang; ZOU JunJie; WU WeiHua

    2007-01-01

    Phosphorous is one of the essential mineral elements for plant growth and development. Typically,the shoots of plant seedlings usually turn a dark-brown or purple colour under low-Pi stress. Using protein 2-D gel and peptide mass fingerprinting mapping (PMF) methods,a cytoplasmic glyceraldehyde-3-phosphate dehydrogenase GapC-2 was identified as a low-Pi responsive protein in Arabidopsis plants. Expression of AtGapC-2 protein was significantly decreased after 4 d of low-Pi stress. Two independent T-DNA insertion lines of GapC-2 gene (At1g13440) showed a hypersensitive phenotype in response to low-Pi stress compared with wild type plants,while the transgenic complementation lines of the mutants showed a similar phenotype to the wild type. These results indicate that AtGapC-2 may play an important role in Arabidopsis responses to low-Pi stress,possibly by regulation of glycolysis-associated "Pi-pool" and accumulation of anthocyanin pigments in plants.

  6. A de novo NADPH generation pathway for improving lysine production of Corynebacterium glutamicum by rational design of the coenzyme specificity of glyceraldehyde 3-phosphate dehydrogenase.

    Science.gov (United States)

    Bommareddy, Rajesh Reddy; Chen, Zhen; Rappert, Sugima; Zeng, An-Ping

    2014-09-01

    Engineering the cofactor availability is a common strategy of metabolic engineering to improve the production of many industrially important compounds. In this work, a de novo NADPH generation pathway is proposed by altering the coenzyme specificity of a native NAD-dependent glyceraldehyde 3-phosphate dehydrogenase (GAPDH) to NADP, which consequently has the potential to produce additional NADPH in the glycolytic pathway. Specifically, the coenzyme specificity of GAPDH of Corynebacterium glutamicum is systematically manipulated by rational protein design and the effect of the manipulation for cellular metabolism and lysine production is evaluated. By a combinatorial modification of four key residues within the coenzyme binding sites, different GAPDH mutants with varied coenzyme specificity were constructed. While increasing the catalytic efficiency of GAPDH towards NADP enhanced lysine production in all of the tested mutants, the most significant improvement of lysine production (~60%) was achieved with the mutant showing similar preference towards both NAD and NADP. Metabolic flux analysis with (13)C isotope studies confirmed that there was no significant change of flux towards the pentose phosphate pathway and the increased lysine yield was mainly attributed to the NADPH generated by the mutated GAPDH. The present study highlights the importance of protein engineering as a key strategy in de novo pathway design and overproduction of desired products.

  7. Characterization of Arabidopsis lines deficient in GAPC-1, a cytosolic NAD-dependent glyceraldehyde-3-phosphate dehydrogenase.

    Science.gov (United States)

    Rius, Sebastián P; Casati, Paula; Iglesias, Alberto A; Gomez-Casati, Diego F

    2008-11-01

    Phosphorylating glyceraldehyde-3-P dehydrogenase (GAPC-1) is a highly conserved cytosolic enzyme that catalyzes the conversion of glyceraldehyde-3-P to 1,3-bis-phosphoglycerate; besides its participation in glycolysis, it is thought to be involved in additional cellular functions. To reach an integrative view on the many roles played by this enzyme, we characterized a homozygous gapc-1 null mutant and an as-GAPC1 line of Arabidopsis (Arabidopsis thaliana). Both mutant plant lines show a delay in growth, morphological alterations in siliques, and low seed number. Embryo development was altered, showing abortions and empty embryonic sacs in basal and apical siliques, respectively. The gapc-1 line shows a decrease in ATP levels and reduced respiratory rate. Furthermore, both lines exhibit a decrease in the expression and activity of aconitase and succinate dehydrogenase and reduced levels of pyruvate and several Krebs cycle intermediates, as well as increased reactive oxygen species levels. Transcriptome analysis of the gapc-1 mutants unveils a differential accumulation of transcripts encoding for enzymes involved in carbon partitioning. According to these studies, some enzymes involved in carbon flux decreased (phosphoenolpyruvate carboxylase, NAD-malic enzyme, glucose-6-P dehydrogenase) or increased (NAD-malate dehydrogenase) their activities compared to the wild-type line. Taken together, our data indicate that a deficiency in the cytosolic GAPC activity results in modifications of carbon flux and mitochondrial dysfunction, leading to an alteration of plant and embryo development with decreased number of seeds, indicating that GAPC-1 is essential for normal fertility in Arabidopsis plants.

  8. Characterization of Arabidopsis Lines Deficient in GAPC-1, a Cytosolic NAD-Dependent Glyceraldehyde-3-Phosphate Dehydrogenase1[C

    Science.gov (United States)

    Rius, Sebastián P.; Casati, Paula; Iglesias, Alberto A.; Gomez-Casati, Diego F.

    2008-01-01

    Phosphorylating glyceraldehyde-3-P dehydrogenase (GAPC-1) is a highly conserved cytosolic enzyme that catalyzes the conversion of glyceraldehyde-3-P to 1,3-bis-phosphoglycerate; besides its participation in glycolysis, it is thought to be involved in additional cellular functions. To reach an integrative view on the many roles played by this enzyme, we characterized a homozygous gapc-1 null mutant and an as-GAPC1 line of Arabidopsis (Arabidopsis thaliana). Both mutant plant lines show a delay in growth, morphological alterations in siliques, and low seed number. Embryo development was altered, showing abortions and empty embryonic sacs in basal and apical siliques, respectively. The gapc-1 line shows a decrease in ATP levels and reduced respiratory rate. Furthermore, both lines exhibit a decrease in the expression and activity of aconitase and succinate dehydrogenase and reduced levels of pyruvate and several Krebs cycle intermediates, as well as increased reactive oxygen species levels. Transcriptome analysis of the gapc-1 mutants unveils a differential accumulation of transcripts encoding for enzymes involved in carbon partitioning. According to these studies, some enzymes involved in carbon flux decreased (phosphoenolpyruvate carboxylase, NAD-malic enzyme, glucose-6-P dehydrogenase) or increased (NAD-malate dehydrogenase) their activities compared to the wild-type line. Taken together, our data indicate that a deficiency in the cytosolic GAPC activity results in modifications of carbon flux and mitochondrial dysfunction, leading to an alteration of plant and embryo development with decreased number of seeds, indicating that GAPC-1 is essential for normal fertility in Arabidopsis plants. PMID:18820081

  9. Glyceraldehyde-3-phosphate dehydrogenase-monoamine oxidase B-mediated cell death-induced by ethanol is prevented by rasagiline and 1-R-aminoindan.

    Science.gov (United States)

    Ou, Xiao-Ming; Lu, Deyin; Johnson, Chandra; Chen, Kevin; Youdim, Moussa B H; Rajkowska, Grazyna; Shih, Jean C

    2009-08-01

    The inhibitors of monoamine oxidase B (MAO B) are effectively used as therapeutic drugs for neuropsychiatric and neurodegenerative diseases. However, their mechanism of action is not clear, since the neuroprotective effect of MAO B inhibitors is associated with the blockage of glyceraldehyde-3-phosphate dehydrogenase (GAPDH)-death cascade, rather than the inhibition of MAO B. Here, we provide evidence that GAPDH potentiates the ethanol-induced activity of MAO B and brain cell toxicity. The levels of nuclear GAPDH and MAO B activity are significantly increased in brain-derived cell lines upon 75 mM ethanol-induced cell death. Over-expression of GAPDH in cells enhances ethanol-induced cell death, and also increases the ethanol-induced activation of MAO B. In contrast, the MAO B inhibitors rasagiline and selegiline (0.25 nM) and the rasagiline metabolite, 1-R-aminoindan (1 muM) decreases the ethanol-induced MAO B, prevents nuclear translocation of GAPDH and reduces cell death. In addition, GAPDH interacts with transforming growth factor-beta-inducible early gene (TIEG2), a transcriptional activator for MAO B, and this interaction is increased in the nucleus by ethanol but reduced by MAO B inhibitors and 1-R-aminoindan. Furthermore, silencing TIEG2 using RNAi significantly reduces GAPDH-induced MAO B upregulation and neurotoxicity. In summary, ethanol-induced cell death, attenuated by MAO B inhibitors, may result from disrupting the movement of GAPDH with the transcriptional activator into the nucleus and secondly inhibit MAO B gene expression. Thus, the neuroprotective effects of rasagiline or 1-R-aminoindan on ethanol-induced cell death mediated by a novel GAPDH-MAO B pathway may provide a new insight in the treatment of neurobiological diseases including alcohol-use disorders.

  10. Inter-species variation in the oligomeric states of the higher plant Calvin cycle enzymes glyceraldehyde-3-phosphate dehydrogenase and phosphoribulokinase.

    Science.gov (United States)

    Howard, Thomas P; Lloyd, Julie C; Raines, Christine A

    2011-07-01

    In darkened leaves the Calvin cycle enzymes glyceraldehyde-3-phosphate dehydrogenase (GAPDH) and phosphoribulokinase (PRK) form a regulatory multi-enzyme complex with the small chloroplast protein CP12. GAPDH also forms a high molecular weight regulatory mono-enzyme complex. Given that there are different reports as to the number and subunit composition of these complexes and that enzyme regulatory mechanisms are known to vary between species, it was reasoned that protein-protein interactions may also vary between species. Here, this variation is investigated. This study shows that two different tetramers of GAPDH (an A2B2 heterotetramer and an A4 homotetramer) have the capacity to form part of the PRK/GAPDH/CP12 complex. The role of the PRK/GAPDH/CP12 complex is not simply to regulate the 'non-regulatory' A4 GAPDH tetramer. This study also demonstrates that the abundance and nature of PRK/GAPDH/CP12 interactions are not equal in all species and that whilst NAD enhances complex formation in some species, this is not sufficient for complex formation in others. Furthermore, it is shown that the GAPDH mono-enzyme complex is more abundant as a 2(A2B2) complex, rather than the larger 4(A2B2) complex. This smaller complex is sensitive to cellular metabolites indicating that it is an important regulatory isoform of GAPDH. This comparative study has highlighted considerable heterogeneity in PRK and GAPDH protein interactions between closely related species and the possible underlying physiological basis for this is discussed.

  11. A recombinant plasmid of composite cysteine proteinase inhibitor/glyceraldehyde-3-phosphate dehydrogenase gene of periodic Brugia malayi functions on DNA immunity in the host

    Directory of Open Access Journals (Sweden)

    Z Fang

    2016-01-01

    Full Text Available Objectives: Both cysteine proteinase inhibitors (CPIs and glyceraldehyde-3-phosphate dehydrogenase (GAPDH play important roles in the pathogenesis of parasites and their relationship with the hosts. We constructed a new eukaryotic recombinant expression plasmid pcDNA3.1(+-BmCPI/BmGAPDH of periodic Brugia malayi for investigation of the DNA vaccine-elicited immune responses. Materials and Methods: We cloned a gene encoding the CPIs and GAPDH from periodic B. malayi into vector pcDNA3.1. The composited plasmid or the control was injected into the tibialis anterior muscle of the hind leg in BALB/c mice, respectively. The target genes were detected by reverse transcription-polymerase chain reaction in muscle tissues. The stimulation index (SI of T-lymphocyte proliferation and the levels of interferon-gamma (INF-g and interleukin-4 ( IL-4 in serum were detected by thiazolyl blue tetrazolium blue and enzyme-linked immunosorbent assays. Results: The pcDNA3.1(+-BmCPI/BmGAPDH was amplified from muscle tissues of the mice after immunisation. The SI of the immunised group was significantly higher than that of the two control groups (P < 0.05. The levels of INF-g and IL-4 of pcDNA3.1(+-BmCPI/BmGAPDH group were both higher than those of the two control groups (P < 0.05. The level of INF-g of pcDNA3.1(+-BmCPI/BmGAPDH group was significantly higher than that of pcDNA3.1(+-BmCPI/CpG group (P < 0.05. Conclusions: We conclude that the recombinant plasmid pcDNA3.1(+-BmCPI/BmGAPDH could elicit specific humoural and cellular immune responses in mice.

  12. Oxygen transfer as a tool for fine-tuning recombinant protein production by Pichia pastoris under glyceraldehyde-3-phosphate dehydrogenase promoter.

    Science.gov (United States)

    Güneş, Hande; Çalık, Pınar

    2016-07-01

    Effects of oxygen transfer on recombinant protein production by Pichia pastoris under glyceraldehyde-3-phosphate dehydrogenase promoter were investigated. Recombinant glucose isomerase was chosen as the model protein. Two groups of oxygen transfer strategies were applied, one of which was based on constant oxygen transfer rate where aeration rate was Q O/V = 3 and 10 vvm, and agitation rate was N = 900 min(-1); while the other one was based on constant dissolved oxygen concentrations, C DO = 5, 10, 15, 20 and 40 % in the fermentation broth, by using predetermined exponential glucose feeding with μ o = 0.15 h(-1). The highest cell concentration was obtained as 44 g L(-1) at t = 9 h of the glucose fed-batch phase at C DO = 20 % operation while the highest volumetric and specific enzyme activities were obtained as 4440 U L(-1) and 126 U g(-1) cell, respectively at C DO = 15 % operation. Investigation of specific enzyme activities revealed that keeping C DO at 15 % was more advantageous with an expense of relatively higher by-product formation and lower specific cell growth rate. For this strategy, the highest oxygen transfer coefficient and oxygen uptake rate were K L a = 0.045 s(-1) and OUR = 8.91 mmol m(-3) s(-1), respectively.

  13. Pleurocidin Peptide Enhances Grouper Anti-Vibrio harveyi Immunity Elicited by Poly(lactide-co-glycolide-Encapsulated Recombinant Glyceraldehyde-3-phosphate Dehydrogenase

    Directory of Open Access Journals (Sweden)

    Shu-Chun Chuang

    2014-05-01

    Full Text Available Outer membrane proteins, such as glyceraldehyde-3-phosphate dehydrogenase (GAPDH, are considered immunodominant antigens for eliciting protective immunity against Vibrio harveyi, the main etiological agent of vibriosis in fish. Cationic antimicrobial peptides (AMPs, such as pleurocidin (PLE, play important roles in activating and recruiting immune cells, thereby contributing to subsequent innate and adaptive immune responses. In the present study, we aimed to use PLE peptide as a potent adjuvant to improve the immunogenicity of V. harveyi recombinant GAPDH (rGAPDH. In order to prepare a controlled-release vaccine, PLE peptide and rGAPDH protein were simultaneously encapsulated into polymeric microparticles made from the biodegradable poly(lactide-co-glycolide (PLG polymer. The resulting PLG-encapsulated PLE plus rGAPDH (PLG-PLE/rGAPDH microparticles, 3.21–6.27 μm in diameter, showed 72%–83% entrapment efficiency and durably released both PLE and rGAPDH for a long 30-day period. Following peritoneal immunization in grouper (Epinephelus coioides, PLG-PLE/rGAPDH microparticles resulted in significantly higher (p < 0.05, nested design long-lasting GAPDH-specific immunity (serum titers and lymphocyte proliferation than PLG-encapsulated rGAPDH (PLG-rGAPDH microparticles. After an experimental challenge of V. harveyi, PLG-PLE/rGAPDH microparticles conferred a high survival rate (85%, which was significantly higher (p < 0.05, chi-square test than that induced by PLG-rGAPDH microparticles (67%. In conclusion, PLE peptide exhibits an efficacious adjuvant effect to elicit not only improved immunity, but also enhanced protection against V. harveyi in grouper induced by rGAPDH protein encapsulated in PLG microparticles.

  14. The non-phosphorylating glyceraldehyde-3-phosphate dehydrogenase (GAPN) of Sulfolobus solfataricus: a key-enzyme of the semi-phosphorylative branch of the Entner-Doudoroff pathway

    NARCIS (Netherlands)

    Ettema, T.J.G.; Ahmed, H.; Geerling, A.C.M.; Oost, van der J.; Siebers, B.

    2008-01-01

    Archaea utilize a branched modification of the classical Entner¿Doudoroff (ED) pathway for sugar degradation. The semi-phosphorylative branch merges at the level of glyceraldehyde 3-phosphate (GAP) with the lower common shunt of the Emden-Meyerhof-Parnas pathway. In Sulfolobus solfataricus two

  15. An unexpected phosphate binding site in Glyceraldehyde 3-Phosphate Dehydrogenase: Crystal structures of apo, holo and ternary complex of Cryptosporidium parvum enzyme

    Directory of Open Access Journals (Sweden)

    Chattopadhyay Debasish

    2009-02-01

    Full Text Available Abstract Background The structure, function and reaction mechanism of glyceraldehyde 3-phosphate dehydrogenase (GAPDH have been extensively studied. Based on these studies, three anion binding sites have been identified, one 'Ps' site (for binding the C-3 phosphate of the substrate and two sites, 'Pi' and 'new Pi', for inorganic phosphate. According to the original flip-flop model, the substrate phosphate group switches from the 'Pi' to the 'Ps' site during the multistep reaction. In light of the discovery of the 'new Pi' site, a modified flip-flop mechanism, in which the C-3 phosphate of the substrate binds to the 'new Pi' site and flips to the 'Ps' site before the hydride transfer, was proposed. An alternative model based on a number of structures of B. stearothermophilus GAPDH ternary complexes (non-covalent and thioacyl intermediate proposes that in the ternary Michaelis complex the C-3 phosphate binds to the 'Ps' site and flips from the 'Ps' to the 'new Pi' site during or after the redox step. Results We determined the crystal structure of Cryptosporidium parvum GAPDH in the apo and holo (enzyme + NAD state and the structure of the ternary enzyme-cofactor-substrate complex using an active site mutant enzyme. The C. parvum GAPDH complex was prepared by pre-incubating the enzyme with substrate and cofactor, thereby allowing free movement of the protein structure and substrate molecules during their initial encounter. Sulfate and phosphate ions were excluded from purification and crystallization steps. The quality of the electron density map at 2Å resolution allowed unambiguous positioning of the substrate. In three subunits of the homotetramer the C-3 phosphate group of the non-covalently bound substrate is in the 'new Pi' site. A concomitant movement of the phosphate binding loop is observed in these three subunits. In the fourth subunit the C-3 phosphate occupies an unexpected site not seen before and the phosphate binding loop remains in

  16. 顶复门原虫3-磷酸甘油醛脱氢酶功能及其应用研究进展%Research Advances on the Function and Applization of Glyceraldehydes-3-phosphate Dehydrogenase in Apicomplexa

    Institute of Scientific and Technical Information of China (English)

    廖申权; 戚南山; 吴彩艳; 吕敏娜; 袁建丰; 余劲术; 孙铭飞

    2012-01-01

    Glycolysis exists in various organisms. It is the major energetic process in apicomplexan parasites. Glyceralde-hyde-3-phosphate dehydrogenase (GAPDH) plays an important role in glycolysis,which closely related to the survival of parasites. GAPDH is proposed to be a potential target for antiparasitic drugs. This review will focus on glycolysis and the genetic analysis,mechanism and application of glyceraldehydes-3-phosphate dehydrogenase in Apicomplexa.%糖酵解途径广泛存在于各类生物中,是顶复门原虫的主要供能方式.3-磷酸甘油醛脱氢酶是糖酵解途径的重要酶,与顶复门原虫的生存密切相关,可以作为抗寄生虫药物研发的重要靶标.文章主要从顶复门原虫糖酵解途径、3-磷酸甘油醛脱氢酶的基因分析、作用机理及应用等方面进行综述.

  17. Inactivation of glyceraldehyde-3-phosphate dehydrogenase by fumarate in diabetes: formation of S-(2-succinyl)cysteine, a novel chemical modification of protein and possible biomarker of mitochondrial stress.

    Science.gov (United States)

    Blatnik, Matthew; Frizzell, Norma; Thorpe, Suzanne R; Baynes, John W

    2008-01-01

    (2-succinyl)cysteine (2SC) is formed by a Michael addition reaction of the Krebs cycle intermediate, fumarate, with cysteine residues in protein. We investigated the role of fumarate in chemical modification and inhibition of the sulfhydryl enzyme, glyceraldehyde-3-phosphate dehydrogenase (GAPDH), in vitro and in tissues of diabetic rats. GAPDH was incubated with fumarate in PBS to assess effects of fumarate on enzyme activity in vitro. Sites of 2SC formation were determined by analysis of tryptic peptides by high-performance liquid chromatography-quadrupole/time-of-flight mass spectrometry. 2SC and fumarate in gastrocnemius muscle of control and streptozotocin-induced diabetic rats were measured by liquid chromatography/tandem mass spectrometry and by gas chromatography/mass spectrometry, respectively. GAPDH was isolated from muscle by immunoprecipitation, and sites of modification of GAPDH were determined by mass spectrometry analysis. 2SC was found, both in vitro and in vivo, about equally at active-site Cys-149 and nucleophilic Cys-244. Inactivation of GAPDH by fumarate in vitro correlated with formation of 2SC. In diabetic compared with control rats, fumarate and 2SC concentration increased approximately fivefold, accompanied by an approximately 25% decrease in GAPDH specific activity. The fractional modification of GAPDH by 2SC was significantly increased in diabetic versus control animals, consistent with the decreased specific activity of GAPDH in muscle of diabetic animals. Fumarate contributes to inactivation of GAPDH in diabetes. 2SC may be a useful biomarker of mitochondrial stress in diabetes. Modification of GAPDH and other enzymes and proteins by fumarate may contribute to the metabolic changes underlying the development of diabetes complications.

  18. 青海湖裸鲤三磷酸甘油醛脱氢酶基因的克隆和表达特性%Expression and cloning of two glyceraldehyde 3-phosphate dehydrogenase mRNAs from Gymnocypris przewalskii in Qinghai Lake

    Institute of Scientific and Technical Information of China (English)

    卫福磊; 李长忠; 史建全; 祁得林; 梁健; 谢保胜; 赵兰英; 祁洪芳

    2013-01-01

    Objective Gymnocypris przewalskii (naked carp) , a unique economic fish species distributed in Qinghai Lake and its periphery area on Qinghai-Tibet plateau , plays a key role in the ecosystem composed mainly of fish, birds and meadow. Research concerning Gymnocypris przewalskii biological characteristics and molecular mechanism adapted to hypoxia, low temperature and salinity stress will contribute to discovering the basic regular pattern of vital activity and provide theoretical support to conservation and artificial reproduction of this species. Methods In this study, two complete cDNA sequences of glyceraldehyde-3-phosphate dehydrogenase ( GPDH) paralogue isoforms, which were named as Gp-GAPDHα (JX287372) and Gp-GAPDHβ (JX287373) , respectively, were obtained from the naked carp through reverse transcriptase polymerase chain reaction (RT-PCR) and rapid amplification of cDNA ends (RACE). The transcription levels were determined based on semi-quantitative RT-PCR analysis. Results The transcription levels of Gp-GAPDHα and Gp-GAPDHβ were unstable in different organ tissues and during different periods of embryogenesis. Both two deduced nu-cleotide sequences have an identity of 72% , and show high similarity with GPDH sequences of other species. Most interestingly, Gp-GAPDHa displays a significant difference at different stages of embryogenesis. Conclusion Gp-GAPDHa is unsuitable to be used as a control for the molecular study in embryogenesis, and the functions of the paralogs need to be further confirmed.%目的 开展青海湖裸鲤基础生物学特征和适应低氧、低温、高盐度的分子机理的研究,揭示青海湖裸鲤的基本生命活动规律,为该鱼种的资源保护和人工增殖放流提供理论依据.方法通过RT-PCR和RACE技术,得到了青海湖裸鲤三磷酸甘油醛脱氢酶(Gp-GAPDH)两种旁系同源体的完整编码序列,分别命名为Gp-GAPDHα (JX287372)和Gp-GAPDHβ (JX287373).通过半定量RT-PCR分析Gp-GAPDHα

  19. 内参基因GAPDH在3T3-L1脂肪细胞分化中的表达变化%Change of reference gene glyceraldehyde-3-phosphate dehydrogenase expression during 3T3-L1 adipocyte differentiation

    Institute of Scientific and Technical Information of China (English)

    张娟; 唐红菊; 王晓; 王宁; 邓儒元; 建方方; 刘赟; 李凤英; 周丽斌

    2012-01-01

    目的 观察甘油醛-3-磷酸脱氢酶(GAPDH)在3T3-L1脂肪细胞分化过程中表达水平是否存在变化,并与其他常用的内参基因相比较.方法 以实时定量PCR检测3T3-L1脂肪细胞分化0、1、3、5、7d几种不同常见内参基因的表达是否存在变化,并以Western印迹方法进行证实.结果 (1)内参基因GAPDH和转铁蛋白受体(TFRC)在脂肪细胞分化过程中基因表达水平逐渐明显升高,其中GAPDH mRNA 在脂肪细胞分化1、3、5、7d分别增加5.7、7.6、22.0和24.5倍(均P<0.01),β-actin、α-微管蛋白(α-tubulin)、肽酰脯氨酰异构酶(PIPA)和18S mRNA表达水平未见明显改变;采用实时定量PCR检测脂肪细胞分化的关键转录因子PPARγ2、CCAAT/增强结合蛋白(C/EBP)α和C/EBPβ的表达时,以GAPDH作内参明显低估他们的表达变化;GAPDH蛋白表达也随着脂肪细胞分化逐渐增加,β-actin、α-tubulin蛋白表达未见明显变化;(2)小檗碱明显抑制脂肪细胞分化过程中GAPDH mRNA和蛋白的表达,在脂肪细胞分化5、7d时GAPDH mRNA表达水平分别降低68.1%和66.3%(P<0.05或P<0.01),但小檗碱对其他内参基因的表达无明显改变.结论 GAPDH在3T3-L1脂肪细胞分化过程中表达增加,不适合作为内参.%Objective To observe the change of glyceraldehyde-3-phosphate dehydrogenase (GAPDH) gene expression during 3T3-L1 adipocyte differentiation as well as other reference gene expressions.Methods The mRNA expressions of several common reference genes were detected by real time-PCR on day 0,1,3,5,and 7 of 3T3-L1 adipocyte differentiation.Western blot was used to confirm the protein expressions of three common reference genes.Results (1) GAPDH and transferrin receptor(TFRC) mRNA expressions were significantly increased during adipocyte differentiation.GAPDH mRNA level was increased by 5.7,7.6,22.0,and 24.5 folds on day 1,3,5,and 7 after induction of adipocyte differentiation,but no apparent changes of

  20. 杜氏盐藻甘油醛-3-磷酸脱氢酶基因启动子驱动氯霉素乙酰转移酶基因的表达及其活性检测%Expression and activity detection of chloramphenicol acetyltransferase gene driven by the glyceraldehyde-3-phosphate dehydrogenase gene of Dunaliella salina

    Institute of Scientific and Technical Information of China (English)

    张小毅; 刘巨源; 邱乐乐; 贾岩龙

    2012-01-01

    目的 为建立稳定高效的盐藻生物反应器寻找合适的内源性启动子驱动表达外源基因.方法 克隆鉴定了盐藻甘油醛-3-磷酸脱氢酶(GAPDH)基因5 ′上游区序列并成功构建由盐藻GAPDH基因启动子驱动的氯霉素乙酰转移酶(CAT)基因表达载体pUC-Gcat.利用构建的表达载体电击转化盐藻并在含有氯霉素的培养基中筛选转化藻株.随机挑选稳定转化的盐藻藻株进行CAT酶联免疫吸附测定分析.结果 获得3株稳定转化的盐藻藻株.聚合酶链式反应鉴定和CAT酶联免疫吸附测定分析结果表明,CAT基因已整合到了转化的盐藻基因组中.结论 本研究所克隆的内源性盐藻GAPDH基因启动子能够驱动CAT基因在盐藻中表达.%Objective To explore expression of foreign gene driven by a strong endogenous promoter in order to construct stable and high-performance bioreactors in Dunaliella salina. Methods In the present study, the upstream sequence of glyceraldehyde phosphate dehydrogenase of Dunaliella salina was cloned and identificated. Using electroporation, the alga was transformed with a plasmid pUC-Ccat containing giyceraldehyde-3-phosphate dehydrogenase ( GAPDH) gene promoter of Du-naliella salina and chloramphenicol acetyltransferase ( CAT) gene as a seletable gene. Using the expression vector, the Dunaliella salina cell was translated and the transformational strain was screened in nutrient medium containing chloramphenicol. The stable transformational strain was selected randomly to undertake CAT enzyme linked immunosorbent assay (ELISA). Results Three stable transformational strain were obtained. The results of polymerase chain reaction and CAT ELISA indicated that the CAT gene had been transferred to the alga. Conclusion The results of this paper suggest that the GAPDH gene promoter can work for genetic transformation of Dunaliella salina.

  1. Bioreaction Engineering Leading to Efficient Synthesis of L-Glyceraldehyd-3-Phosphate.

    Science.gov (United States)

    Molla, Getachew S; Kinfu, Birhanu M; Chow, Jennifer; Streit, Wolfgang; Wohlgemuth, Roland; Liese, Andreas

    2017-03-01

    Enantiopure L-glyceraldehyde-3-phosphate (L-GAP) is a useful building block in natural biological and synthetic processes. A biocatalytic process using glycerol kinase from Cellulomonas sp. (EC 2.7.1.30) catalyzed phosphorylation of L-glyceraldehyde (L-GA) by ATP is used for the synthesis of L-GAP. L-GAP has a half-life of 6.86 h under reaction conditions. The activity of this enzyme depends on the Mg(2+) to ATP molar ratio showing maximum activity at the optimum molar ratio of 0.7. A kinetic model is developed and validated showing a 2D correlation of 99.9% between experimental and numerical data matrices. The enzyme exhibits inhibition by ADP, AMP, methylglyoxal and Ca(2+) , but not by L-GAP and inorganic orthophosphate. Moreover, equal amount of Ca(2+) exerts a different degree of inhibition relative to the activity without the addition of Ca(2+) depending on the Mg(2+) to ATP molar ratio. If the Mg(2+) to ATP molar ratio is set to be at the optimum value or less, inorganic hexametaphosphate (PPi6) suppresses the enzyme activity; otherwise PPi6 enhances the enzyme activity. Based on reaction engineering parameters such as conversion, selectivity and specific productivity, evaluation of different reactor types reveals that batchwise operation via stirred-tank reactor is the most efficient process for the synthesis of L-GAP.

  2. Disparate sequence characteristics of the Erysiphe graminis f.sp. hordei glyceraldehyde-3-phosphate dehydrogenase gene

    DEFF Research Database (Denmark)

    Christiansen, S.K.; Justesen, A.F.; Giese, H.

    1997-01-01

    to be similar for all four genes. The results of the codon-usage analysis suggest that Egh is more flexible than other fungi in the choice of nucleotides at the wobble position. Codon-usage preferences in Egh and barley genes indicate a level of difference which may be exploited to discriminate between fungal...... and plant genes in sequence mixtures. The Egh gpd promoter appears to be superior to that of the Egh beta-tubulin gene (tub2) for driving the E. coli beta-glucuronidase (GUS) gene in transformation experiments....

  3. Glyceraldehyde-3-phosphate dehydrogenase has no control over glycolytic flux in Lactococcus lactis MG1363

    DEFF Research Database (Denmark)

    Solem, Christian; Købmann, Brian Jensen; Jensen, Peter Ruhdal

    2003-01-01

    that the glycolytic flux was unchanged in the mutants overproducing GAPDH. Also, a decrease in the GAPDH activity had very little effect on the growth rate and the glycolytic flux until 25% activity was reached. Below this activity level, the glycolytic flux decreased proportionally with decreasing GAPDH activity....... These data show that GAPDH activity has no control over the glycolytic flux (flux control coefficient = 0.0) at the wild-type enzyme level and that the enzyme is present in excess capacity by a factor of 3 to 4. The early experiments by Poolman and coworkers were performed with cells resuspended in buffer, i...

  4. Effects of organic solvents on the enzyme activity of Trypanosoma cruzi glyceraldehyde-3-phosphate dehydrogenase in calorimetric assays

    DEFF Research Database (Denmark)

    Wiggers, Henrik; Cheleski, J; Zottis, A

    2007-01-01

    .0% for MeOH and up to 7.5% for DMSO. The results show that when GAPDH is assayed in the presence of DMSO (5%, v/v) using the ITC experiment, the enzyme exhibits approximately twofold higher activity than that of GAPDH with no cosolvent added. When MeOH (5%, v/v) is the cosolvent, the GAPDH activity...... is sixfold higher. The favorable effects of the organic solvents on the Michaelis-Menten enzyme-substrate complex formation ensure the consistency of the biological assays, structural integrity of the protein, and reproducibility over the measurement time. The reaction was also kinetically monitored......In drug discovery programs, dimethyl sulfoxide (DMSO) is a standard solvent widely used in biochemical assays. Despite the extensive use and study of enzymes in the presence of organic solvents, for some enzymes the effect of organic solvent is unknown. Macromolecular targets may be affected...

  5. Proteome analysis of a Lactococcus lactis strain overexpressing gapA suggests that the gene product is an auxiliary glyceraldehyde 3-phosphate dehydrogenase

    DEFF Research Database (Denmark)

    Willemoes, Martin; Kilstrup, Mogens; Roepstorff, P.;

    2002-01-01

    strain that overexpessed the gapA gene derived from MG1363 upon nisin induction. Compared to the wild-type, the overexpressing strain had a 3.4-fold elevated level of specific GAPDH activity when grown in the presence of nisin. In both MG 1363 and the gapA overexpressing strain the GAPDH activity...

  6. Proteome analysis of a Lactococcus lactis strain overexpressing gapA suggests that the gene product is an auxiliary glyceraldehyde 3-phosphate dehydrogenase

    DEFF Research Database (Denmark)

    Willemoës, Martin; Kilstrup, Mogens; Roepstorff, Peter;

    2002-01-01

    strain that overexpessed the gapA gene derived from MG1363 upon nisin induction. Compared to the wild-type, the overexpressing strain had a 3.4-fold elevated level of specific GAPDH activity when grown in the presence of nisin. In both MG1363 and the gapA overexpressing strain the GAPDH activity...

  7. Induction of the gap-pgk operon encoding glyceraldehyde-3-phosphate dehydrogenase and 3-phosphoglycerate kinase of Xanthobacter flavus requires the LysR-type transcriptional activator CbbR

    NARCIS (Netherlands)

    Meijer, W.G; van den Bergh, E.R E; Smith, L.M

    1996-01-01

    In a previous study, a gene (pgk) encoding phosphoglycerate kinase was isolated from a genomic labrid of Xanthobacter flavus. Although this gene is essential for autotrophic growth, it is not located within the cbb operon encoding other Calvin cycle enzymes. An analysis of the nucleotide sequence up

  8. Accelerated cellular senescence phenotype of GAPDH-depleted human lung carcinoma cells

    Energy Technology Data Exchange (ETDEWEB)

    Phadke, Manali; Krynetskaia, Natalia [Temple University School of Pharmacy, Philadelphia, PA 19140 (United States); Mishra, Anurag [Jayne Haines Center for Pharmacogenomics, Temple University School of Pharmacy, Philadelphia, PA 19140 (United States); Krynetskiy, Evgeny, E-mail: ekrynets@temple.edu [Temple University School of Pharmacy, Philadelphia, PA 19140 (United States); Jayne Haines Center for Pharmacogenomics, Temple University School of Pharmacy, Philadelphia, PA 19140 (United States)

    2011-07-29

    Highlights: {yields} We examined the effect of glyceraldehyde 3-phosphate (GAPDH) depletion on proliferation of human carcinoma A549 cells. {yields} GAPDH depletion induces accelerated senescence in tumor cells via AMPK network, in the absence of DNA damage. {yields} Metabolic and genetic rescue experiments indicate that GAPDH has regulatory functions linking energy metabolism and cell cycle. {yields} Induction of senescence in LKB1-deficient lung cancer cells via GAPDH depletion suggests a novel strategy to control tumor cell proliferation. -- Abstract: Glyceraldehyde 3-phosphate dehydrogenase (GAPDH) is a pivotal glycolytic enzyme, and a signaling molecule which acts at the interface between stress factors and the cellular apoptotic machinery. Earlier, we found that knockdown of GAPDH in human carcinoma cell lines resulted in cell proliferation arrest and chemoresistance to S phase-specific cytotoxic agents. To elucidate the mechanism by which GAPDH depletion arrests cell proliferation, we examined the effect of GAPDH knockdown on human carcinoma cells A549. Our results show that GAPDH-depleted cells establish senescence phenotype, as revealed by proliferation arrest, changes in morphology, SA-{beta}-galactosidase staining, and more than 2-fold up-regulation of senescence-associated genes DEC1 and GLB1. Accelerated senescence following GAPDH depletion results from compromised glycolysis and energy crisis leading to the sustained AMPK activation via phosphorylation of {alpha} subunit at Thr172. Our findings demonstrate that GAPDH depletion switches human tumor cells to senescent phenotype via AMPK network, in the absence of DNA damage. Rescue experiments using metabolic and genetic models confirmed that GAPDH has important regulatory functions linking the energy metabolism and the cell cycle networks. Induction of senescence in LKB1-deficient non-small cell lung cancer cells via GAPDH depletion suggests a novel strategy to control tumor cell proliferation.

  9. Interactions of surface-displayed glycolytic enzymes of Mycoplasma pneumoniae with components of the human extracellular matrix.

    Science.gov (United States)

    Gründel, Anne; Jacobs, Enno; Dumke, Roger

    2016-12-01

    Mycoplasma pneumoniae is a major cause of community-acquired respiratory infections worldwide. Due to the strongly reduced genome, the number of virulence factors expressed by this cell wall-less pathogen is limited. To further understand the processes during host colonization, we investigated the interactions of the previously confirmed surface-located glycolytic enzymes of M. pneumoniae (pyruvate dehydrogenase A-C [PdhA-C], glyceraldehyde-3-phosphate dehydrogenase [GapA], lactate dehydrogenase [Ldh], phosphoglycerate mutase [Pgm], pyruvate kinase [Pyk] and transketolase [Tkt]) to the human extracellular matrix (ECM) proteins fibrinogen (Fn), fibronectin (Fc), lactoferrin (Lf), laminin (Ln) and vitronectin (Vc), respectively. Concentration-dependent interactions between Fn and Vc and all eight recombinant proteins derived from glycolytic enzymes, between Ln and PdhB-C, GapA, Ldh, Pgm, Pyk and Tkt, between Lf and PdhA-C, GapA and Pyk, and between Fc and PdhC and GapA were demonstrated. In most cases, these associations are significantly influenced by ionic forces and by polyclonal sera against recombinant proteins. In immunoblotting, the complex of human plasminogen, activator (tissue-type or urokinase plasminogen activator) and glycolytic enzyme was not able to degrade Fc, Lf and Ln, respectively. In contrast, degradation of Vc was confirmed in the presence of all eight enzymes tested. Our data suggest that the multifaceted associations of surface-localized glycolytic enzymes play a potential role in the adhesion and invasion processes during infection of human respiratory mucosa by M. pneumoniae.

  10. Proteomic analysis of effluents from perfused human heart for transplantation: identification of potential biomarkers for ischemic heart damage

    Directory of Open Access Journals (Sweden)

    Li Hong

    2012-03-01

    Full Text Available Abstract Background Biomarkers released from the heart at early stage of ischemia are very important to diagnosis of ischemic heart disease and salvage myocytes from death. Known specific markers for blood tests including CK-MB, cardiac troponin T (cTnT and cardiac troponin I (cTnI are released after the onset of significant necrosis instead of early ischemia. Thus, they are not good biomarkers to diagnose myocardial injury before necrosis happens. Therefore, in this study, we performed proteomic analysis on effluents from perfused human hearts of donors at different ischemic time. Results After global ischemia for 0 min, 30 min and 60 min at 4°C, effluents from five perfused hearts were analyzed respectively, by High performance liquid chromatography-Chip-Mass spectrometry (HPLC-Chip-MS system. Total 196 highly reliable proteins were identified. 107 proteins were identified at the beginning of ischemia, 174 and 175 proteins at ischemic 30 min and ischemic 60 min, respectively. With the exception of cardiac troponin I and T, all known biomarkers for myocardial ischemia were detected in our study. However, there were four glycolytic enzymes and two targets of matrix metalloproteinase released significantly from the heart when ischemic time was increasing. These proteins were L-lactate dehydrogenase B(LDHB, glyceraldehyde-3-phosphate dehydrogenase, glucose-6-phosphate isomerase (GPI, phosphoglycerate mutase 2 (PGAM2, gelsolin and isoform 8 of titin. PGAM2, LDHB and titin were measured with enzyme-linked immunosorbent assays kits. The mean concentrations of LDHB and PGAM2 in samples showed an increasing trend when ischemic time was extending. In addition, 33% identified proteins are involved in metabolism. Protein to protein interaction network analysis showed glycolytic enzymes, such as isoform alpha-enolase of alpha-enolase, isoform 1 of triosephosphate isomerase and glyceraldehyde-3-phosphate dehydrogenase, had more connections than other

  11. Transport of 3-bromopyruvate across the human erythrocyte membrane.

    Science.gov (United States)

    Sadowska-Bartosz, Izabela; Soszyński, Mirosław; Ułaszewski, Stanisław; Ko, Young; Bartosz, Grzegorz

    2014-06-01

    3-Bromopyruvic acid (3-BP) is a promising anticancer compound because it is a strong inhibitor of glycolytic enzymes, especially glyceraldehyde 3-phosphate dehydrogenase. The Warburg effect means that malignant cells are much more dependent on glycolysis than normal cells. Potential complications of anticancer therapy with 3-BP are side effects due to its interaction with normal cells, especially erythrocytes. Transport into cells is critical for 3-BP to have intracellular effects. The aim of our study was the kinetic characterization of 3-BP transport into human erythrocytes. 3-BP uptake by erythrocytes was linear within the first 3 min and pH-dependent. The transport rate decreased with increasing pH in the range of 6.0-8.0. The Km and Vm values for 3-BP transport were 0.89 mM and 0.94 mmol/(l cells x min), respectively. The transport was inhibited competitively by pyruvate and significantly inhibited by DIDS, SITS, and 1-cyano-4-hydroxycinnamic acid. Flavonoids also inhibited 3-BP transport: the most potent inhibition was found for luteolin and quercetin.

  12. Comparative analysis of reference gene stability in human mesenchymal stromal cells during osteogenic differentiation.

    Science.gov (United States)

    Jacobi, Angela; Rauh, Juliane; Bernstein, Peter; Liebers, Cornelia; Zou, Xuenong; Stiehler, Maik

    2013-01-01

    Mesenchymal stromal cells (MSCs) are one of the most frequently used cell sources for tissue engineering strategies. Cultivation of osteogenic MSCs is a prerequisite for cell-based concepts that aim at bone regeneration. Quantitative real time reverse transcription polymerase chain reaction (qRT-PCR) analysis is a commonly used method for the examination of mRNA expression levels. However, data on suitable reference genes for osteogenically cultivated MSCs is scarce. Hence, the aim of the study was to compare the regulation of different potential reference genes in osteogenically stimulated MSCs. Human MSCs were isolated from bone marrow aspirates of N = 6 hematologically healthy individuals, expanded by polystyrene-adherence, and maintained with and without osteogenic supplements for 14 days. Cellular proliferation and osteogenic differentiation were assessed by total DNA quantification, cell-specific alkaline phosphatase (ALP) activity and by qualitative staining for ALP and alizarin red, respectively. mRNA expression levels of N = 32 potential reference genes were quantified using the human Endogenous Control TaqMan® assays. mRNA expression stability was calculated using geNorm. The combined use of the most stable reference genes and DNA-damage-inducible alpha, Pumilio homolog 1, and large ribosomal protein P0 significantly improved gene expression accuracy as compared to the use of the commonly used reference genes beta actin and glyceraldehyde-3-phosphate dehydrogenase during qRT-PCR-based target gene expression analysis of osteogenically stimulated MSCs. © 2013 American Institute of Chemical Engineers.

  13. Constitutive expression of human pancreatic lipase-related protein 1 in Pichia pastoris.

    Science.gov (United States)

    Aloulou, Ahmed; Grandval, Philippe; De Caro, Josiane; De Caro, Alain; Carrière, Frédéric

    2006-06-01

    High-level constitutive expression of the human pancreatic lipase-related protein 1 (HPLRP1) was achieved using the methylotrophic yeast Pichia pastoris. The HPLRP1 cDNA, including its original leader sequence, was subcloned into the pGAPZB vector and further integrated into the genome of P. pastoris X-33 under the control of the glyceraldehyde 3-phosphate dehydrogenase (GAP) constitutive promoter. A major protein with a molecular mass of 50 kDa was found to be secreted into the culture medium and was identified using anti-HPLRP1 polyclonal antibodies as HPLRP1 recombinant protein. The level of expression reached 100-120 mg of HPLRP1 per liter of culture medium after 40 h, as attested by specific and quantitative enzyme-linked immunosorbent assay. A single cation-exchange chromatography sufficed to obtain a highly purified recombinant HPLRP1 after direct batch adsorption onto S-Sepharose of the HPLRP1 present in the culture medium, at pH 5.5. N-terminal sequencing and mass spectrometry analysis were carried out to monitor the production of the mature protein and to confirm that its signal peptide was properly processed.

  14. Human GAPDH Is a Target of Aspirin's Primary Metabolite Salicylic Acid and Its Derivatives.

    Science.gov (United States)

    Choi, Hyong Woo; Tian, Miaoying; Manohar, Murli; Harraz, Maged M; Park, Sang-Wook; Schroeder, Frank C; Snyder, Solomon H; Klessig, Daniel F

    2015-01-01

    The plant hormone salicylic acid (SA) controls several physiological processes and is a key regulator of multiple levels of plant immunity. To decipher the mechanisms through which SA's multiple physiological effects are mediated, particularly in immunity, two high-throughput screens were developed to identify SA-binding proteins (SABPs). Glyceraldehyde 3-Phosphate Dehydrogenase (GAPDH) from plants (Arabidopsis thaliana) was identified in these screens. Similar screens and subsequent analyses using SA analogs, in conjunction with either a photoaffinity labeling technique or surface plasmon resonance-based technology, established that human GAPDH (HsGAPDH) also binds SA. In addition to its central role in glycolysis, HsGAPDH participates in several pathological processes, including viral replication and neuronal cell death. The anti-Parkinson's drug deprenyl has been shown to suppress nuclear translocation of HsGAPDH, an early step in cell death and the resulting cell death induced by the DNA alkylating agent N-methyl-N'-nitro-N-nitrosoguanidine. Here, we demonstrate that SA, which is the primary metabolite of aspirin (acetyl SA) and is likely responsible for many of its pharmacological effects, also suppresses nuclear translocation of HsGAPDH and cell death. Analysis of two synthetic SA derivatives and two classes of compounds from the Chinese medicinal herb Glycyrrhiza foetida (licorice), glycyrrhizin and the SA-derivatives amorfrutins, revealed that they not only appear to bind HsGAPDH more tightly than SA, but also exhibit a greater ability to suppress translocation of HsGAPDH to the nucleus and cell death.

  15. Over-expression of GAPDH in human colorectal carcinoma as a preferred target of 3-bromopyruvate propyl ester.

    Science.gov (United States)

    Tang, Zhenjie; Yuan, Shuqiang; Hu, Yumin; Zhang, Hui; Wu, Wenjing; Zeng, Zhaolei; Yang, Jing; Yun, Jingping; Xu, Ruihua; Huang, Peng

    2012-02-01

    It has long been observed that many cancer cells exhibit increased aerobic glycolysis and rely more on this pathway to generate ATP and metabolic intermediates for cell proliferation. Glyceraldehyde-3-phosphate dehydrogenase (GAPDH) is a key enzyme in glycolysis and has been known as a housekeeping molecule. In the present study, we found that GAPDH expression was significantly up-regulated in human colorectal carcinoma tissues compared to the adjacent normal tissues, and also increased in colon cancer cell lines compared to the non-tumor colon mucosa cells in culture. The expression of GAPDH was further elevated in the liver metastatic tissues compared to the original colon cancer tissue of the same patients, suggesting that high expression of GAPDH might play an important role in colon cancer development and metastasis. Importantly, we found that 3-bromopyruvate propyl ester (3-BrOP) preferentially inhibited GAPDH and exhibited potent activity in inducing colon cancer cell death by causing severe depletion of ATP. 3-BrOP at low concentrations (1-10 μM) inhibited GAPDH and a much higher concentration (300 μM) was required to inhibit hexokinase-2. The cytotoxic effect of 3-BrOP was associated with its inhibition of GAPDH, and colon cancer cells with loss of p53 were more sensitive to this compound. Our study suggests that GAPDH may be a potential target for colon cancer therapy.

  16. Changes in the activities of some membrane-associated enzymes during in vivo ageing of the normal human erythrocyte.

    Science.gov (United States)

    Kadlubowski, M; Agutter, P S

    1977-09-01

    Human erythrocytes from healthy male donors were fractionated with respect to in vivo age by simple centrifugation in order to characterize changes in the functional integrity of the membrane during the life-span of the cell. The three enzymes, Na/K-ATPase, glyceraldehyde-3-phosphate dehydrogenase and NADH-ferricyanide reductase, were found not to change with age, but significant age-dependent decreases were observed in the cases of acetylcholinesterase, phosphoglycerate kinase, purine nucleoside phosphorylase, adenylate kinase, Mg-ATPase and alkaline phosphatase. The possibility that these changes were attributable to mechanisms other than age-related inactivation, such as reticulocyte contamination, differential resealing and crypticity, was investigated. Only the decrease in acetylcholinesterase could be explained wholly in terms of reticulocyte contamination. A decrease in membrane integrity on ageing was observed, which accounted for approximately half the change in alkaline phosphatase and may have contributed to the other enzyme activity changes. This membrane integrity effect masked a real decrease in the highly cryptic NADH-ferricyanide reductase, this decrease being apparent only after total disaggregation of the membrane with nonionic surfactant.

  17. Identification of appropriate reference genes for human mesenchymal stem cell analysis by quantitative real-time PCR.

    Science.gov (United States)

    Li, Xiuying; Yang, Qiwei; Bai, Jinping; Xuan, Yali; Wang, Yimin

    2015-01-01

    Normalization to a reference gene is the method of choice for quantitative reverse transcription-PCR (RT-qPCR) analysis. The stability of reference genes is critical for accurate experimental results and conclusions. We have evaluated the expression stability of eight commonly used reference genes found in four different human mesenchymal stem cells (MSC). Using geNorm, NormFinder and BestKeeper algorithms, we show that beta-2-microglobulin and peptidyl-prolylisomerase A were the optimal reference genes for normalizing RT-qPCR data obtained from MSC, whereas the TATA box binding protein was not suitable due to its extensive variability in expression. Our findings emphasize the significance of validating reference genes for qPCR analyses. We offer a short list of reference genes to use for normalization and recommend some commercially-available software programs as a rapid approach to validate reference genes. We also demonstrate that the two reference genes, β-actin and glyceraldehyde-3-phosphate dehydrogenase, are frequently used are not always successful in many cases.

  18. Daidzin: a potent, selective inhibitor of human mitochondrial aldehyde dehydrogenase.

    OpenAIRE

    Keung, W M; Vallee, B L

    1993-01-01

    Human mitochondrial aldehyde dehydrogenase (ALDH-I) is potently, reversibly, and selectively inhibited by an isoflavone isolated from Radix puerariae and identified as daidzin, the 7-glucoside of 4',7-dihydroxyisoflavone. Kinetic analysis with formaldehyde as substrate reveals that daidzin inhibits ALDH-I competitively with respect to formaldehyde with a Ki of 40 nM, and uncompetitively with respect to the coenzyme NAD+. The human cytosolic aldehyde dehydrogenase isozyme (ALDH-II) is nearly 3...

  19. Immunoreactive proteins of Bifidobacterium longum ssp. longum CCM 7952 and Bifidobacterium longum ssp. longum CCDM 372 identified by gnotobiotic mono-colonized mice sera, immune rabbit sera and nonimmune human sera.

    Directory of Open Access Journals (Sweden)

    Sabina Górska

    2016-09-01

    Full Text Available The Bifidobacteria show great diversity in the cell surface architecture which may influence the physicochemical properties of the bacterial cell and strain specific properties. The immunomodulatory role of bifidobacteria has been extensively studied, however studies on the immunoreactivity of their protein molecules are very limited. Here, we compared six different methods of protein isolation and purification and we report identification of immunogenic and immunoreactive protein of two human Bifidobacterium longum ssp. longum strains. We evaluated potential immunoreactive properties of proteins employing polyclonal sera obtained from germ free mouse, rabbit and human. The protein yield was isolation method-dependent and the reactivity of proteins detected by SDS-PAGE and Western blotting was heterogeneous and varied between different serum samples. The proteins with the highest immunoreactivity were isolated, purified and have them sequenced. Among the immunoreactive proteins we identified enolase, aspartokinase, pyruvate kinase, DnaK (B. longum ssp. longum CCM 7952 and sugar ABC transporter ATP-binding protein, phosphoglycerate kinase, peptidoglycan synthethase penicillin-binding protein 3, transaldolase, ribosomal proteins and glyceraldehyde 3-phosphate dehydrogenase (B. longum ssp. longum CCDM 372.

  20. Short-term exposure of nontumorigenic human bronchial epithelial cells to carcinogenic chromium(VI) compromises their respiratory capacity and alters their bioenergetic signature.

    Science.gov (United States)

    Cerveira, Joana F; Sánchez-Aragó, María; Urbano, Ana M; Cuezva, José M

    2014-01-01

    Previous studies on the impact of hexavalent chromium [Cr(VI)] on mammalian cell energetics revealed alterations suggestive of a shift to a more fermentative metabolism. Aiming at a more defined understanding of the metabolic effects of Cr(VI) and of their molecular basis, we assessed the impact of a mild Cr(VI) exposure on critical bioenergetic parameters (lactate production, oxygen consumption and intracellular ATP levels). Cells derived from normal human bronchial epithelium (BEAS-2B cell line), the main in vivo target of Cr(VI) carcinogenicity, were subjected for 48 h to 1 μM Cr(VI). We could confirm a shift to a more fermentative metabolism, resulting from the simultaneous inhibition of respiration and stimulation of glycolysis. This shift was accompanied by a decrease in the protein levels of the catalytic subunit (subunit β) of the mitochondrial H(+)-ATP synthase (β-F1-ATPase) and a concomitant marked increase in those of glyceraldehyde-3-phosphate dehydrogenase (GAPDH). The corresponding alteration in the β-F1-ATPase/GAPDH protein ratio (viewed as a bioenergetic signature) upon Cr(VI) exposure was in agreement with the observed attenuation of cellular respiration and enhancement of glycolytic flux. Altogether, these results constitute a novel finding in terms of the molecular mechanisms of Cr(VI) effects.

  1. Short-term exposure of nontumorigenic human bronchial epithelial cells to carcinogenic chromium(VI compromises their respiratory capacity and alters their bioenergetic signature

    Directory of Open Access Journals (Sweden)

    Joana F. Cerveira

    2014-01-01

    Full Text Available Previous studies on the impact of hexavalent chromium [Cr(VI] on mammalian cell energetics revealed alterations suggestive of a shift to a more fermentative metabolism. Aiming at a more defined understanding of the metabolic effects of Cr(VI and of their molecular basis, we assessed the impact of a mild Cr(VI exposure on critical bioenergetic parameters (lactate production, oxygen consumption and intracellular ATP levels. Cells derived from normal human bronchial epithelium (BEAS-2B cell line, the main in vivo target of Cr(VI carcinogenicity, were subjected for 48 h to 1 μM Cr(VI. We could confirm a shift to a more fermentative metabolism, resulting from the simultaneous inhibition of respiration and stimulation of glycolysis. This shift was accompanied by a decrease in the protein levels of the catalytic subunit (subunit β of the mitochondrial H+-ATP synthase (β-F1-ATPase and a concomitant marked increase in those of glyceraldehyde-3-phosphate dehydrogenase (GAPDH. The corresponding alteration in the β-F1-ATPase/GAPDH protein ratio (viewed as a bioenergetic signature upon Cr(VI exposure was in agreement with the observed attenuation of cellular respiration and enhancement of glycolytic flux. Altogether, these results constitute a novel finding in terms of the molecular mechanisms of Cr(VI effects.

  2. Malate dehydrogenase activity in human seminal plasma and spermatozoa homogenates

    Directory of Open Access Journals (Sweden)

    Hulya Leventerler

    2013-08-01

    Full Text Available Purpose: Malate Dehydrogenase is an important enzyme of the Krebs cycle, most cells require this enzyme for their metabolic activity. We evaluated the Malate Dehydrogenase (NAD/NADP activity in human seminal plasma and sperm homogenates in normozoospermic, fertile and infertile males. Also glucose and fructose concentrations were determined in the seminal plasma samples. Material and Methods: Malate Dehydrogenase (NAD/NADP activity in human seminal plasma and sperm homogenates of normozoospermic and infertile males was determined by spectrophotometric method. Semen analysis was considered according to the WHO Criteria. Results: Malat Dehydrogenase-NAD value in seminal plasma (the mean ± SD, mU/ml of asthenoteratospermic (40.0±25.7 and azospermic (38.0±43.6 groups were significantly lower than normozoospermic, (93.9±52.1 males. Malat Dehydrogenase-NAD value in sperm homogenates (the mean ± SD, mU/ 20x106 sperm of teratospermic group (136.8±61.8 was significantly higher compared to the normozoospermic (87.3±26.5 males. Glucose concentration (mg/dl in asthenoteratospermic (4.0±1.4 and azospermic (15.4±6.4 groups were significantly higher than fertile (2.0±2.1 males. Also fructose concentration (mg/dl in asthenoteratospermic (706.6±143.3 and azospermic (338.1±228.2 groups were significantly high compared to the normozoospermic (184.7±124.8 group. Conclusion: Sperm may be some part of the source of Malat Dehydrogenase activity in semen. Malat Dehydrogenase activity in seminal plasma has an important role on energy metabolism of sperm. Intermediate substrates of Krebs cycle might have been produced under the control of Malat Dehydrogenase and these substrates may be important for sperm motility and male infertility. [Cukurova Med J 2013; 38(4.000: 648-658

  3. Cell type and transfection reagent-dependent effects on viability, cell content, cell cycle and inflammation of RNAi in human primary mesenchymal cells

    DEFF Research Database (Denmark)

    Yang, Hsiao Yin; Vonk, Lucienne A.; Licht, Ruud;

    2014-01-01

    application. In the current study, we selected two synthetic transfection reagents, a cationic lipid-based commercial reagent Lipofectamine RNAiMAX and polyethylenimine (PEI), and two naturally-derived transfection reagents, namely the polysaccharides chitosan (98% deacetylation) and hyaluronic acid (20......% amidation), for siRNA delivery into primary mesenchymal cells including nucleus pulposus cells, articular chondrocytes and mesenchymal stem cells (MSCs). Glyceraldehyde-3-phosphate dehydrogenase (GAPDH) was used as an endogenous model gene to evaluate the extent of silencing by 20 nM or 200 nM siRNA at day...

  4. Stereoselective reactivity of the SH groups of yeast glyceraldehydephosphate dehydrogenase in the allosteric T and R states.

    Science.gov (United States)

    Eisele, B; Wallenfels, K

    1968-07-01

    Yeast glyceraldehyde-3-phosphate dehydrogenase as a typical SH enzyme is inactivated by the antipodes of a-iodopropionic acid and its amide at different rates. The apoenzyme reacts faster with the D(+) antipode of the free a-iodopropionic acid (k(D)/k(L) = 6.8) and the L(-) antipode of the amide (k(L)/k(D) = 3). On addition of NAD(+) the stereoselectivity of the SH group towards a-iodopropionic acid is inverted, that towards the amide is enlarged, the rate relationships depending on the NAD(+) concentration.The results were interpreted by the assumption, that the allosteric T state of the enzyme reacts most rapidly with the D(+) antipodes, whereas the R state favours the L(-) antipodes of the alkylation reagents. The dependence of the reaction rates on the NAD(+) concentration could be fitted to the allosteric function of state R.

  5. Loss of Thiol Repair Systems in Human Cataractous Lenses

    Science.gov (United States)

    Wei, Min; Xing, Kui-Yi; Fan, Yin-Chuan; Libondi, Teodosio; Lou, Marjorie F.

    2015-01-01

    Purpose. The purpose of this study was to investigate the thiol repair systems of thioltransferase (TTase) and thioredoxin (Trx) and oxidation-damaged proteins in human cataractous lenses. Methods. Cataractous lenses in humans (57–85 years of age) were classified into cortical, nuclear, mixed, mature, and hypermature cataract types by using a lens opacity classification system, and were obtained by extracapsular cataract extraction (ECCE) procedure. Cortical and nuclear cataracts were grouped by decreasing order of visual acuity into optical chart reading (R), counting fingers (CF), hand motion (HM), and light perception (LP). ECCE lens homogenate was analyzed for glutathione (GSH) level and enzyme activities of TTase, glutathione reductase (GR), Trx, and thioredoxin reductase (TR). Cortical and nuclear cataractous lenses (8 of each) with visual acuity better than HM were each dissected into cortical and nuclear portions for measurement of glyceraldehyde 3-phosphate dehydrogenase (G3PD) activity. Clear lenses (in humans 49–71 years of age) were used as control. Results. Compared with control, all cataractous lenses lost more than 80% GSH and 70% GR; TR and Trx activity; and 40% to 70% TTase activity, corroborated with the loss in visual acuity. Among cataracts with R and CF visual acuity, cortical cataract lost more cortical G3PD activity (18% of control) than that of nuclear cataract (50% of control), whereas GSH depletion and TTase inactivation were similar in both cataracts. Conclusions. Thiol repair systems were damaged in all types of cataracts. Cortical and nuclear cataracts showed differential G3PD inactivation in the cortex, implying those 2 type of cataracts might be formed through different mechanisms. PMID:25537203

  6. Silencing nc886, a Non-Coding RNA, Induces Apoptosis of Human Endometrial Cancer Cells-1A In Vitro

    Science.gov (United States)

    Hu, Zhuoying; Zhang, Hongyu; Tang, Liangdan; Lou, Meng; Geng, Yanqing

    2017-01-01

    Background The role that nc886, a non-coding microRNA, plays in human endometrial cancer is unknown. The present study aimed to describe the functional role of nc886 in human endometrial cancer-1A (HEC-1A) cell line, which may provide another target for human endometrial cancer treatment. Material/Methods The expression levels of nv886 in normal human endometrial tissue and the early phase and late phase of human endometrial cancer tissues were determined and compared by fluorescence in situ hybridization (FISH). Small interference RNA (siRNA) was used to inhibit nc886, and cell proliferation was evaluated with the MTT test. mRNA levels of PKR, NF-κB, vascular endothelial growth factor (VEGF), and caspase-3 were determined against glyceraldehyde 3-phosphate dehydrogenase (GAPDH between the HEC-1A control group and the silenced group (nc886 silenced with siRNA) by real-time reverse transcription polymerase chain reaction (RT-PCR). The protein levels of PKR (total and phosphorylated form), NF-κB, VEGF, and caspase-3 were determined against GAPDH by Western blotting, and cell apoptosis was determined by flow cytometry. Results Our results indicated that a higher level of nc886 was expressed in the late phase of human endometrial cancer tissue, less than in the early phase but still higher than in normal human endometrial tissue. After nc886 was silenced, protein levels of p-PKR (phosphorylated PKR) and caspase-3 were increased, whereas NF-κB and VEGF were decreased. Conclusions The rate of apoptosis in the silenced group was increased and the rate of cell proliferation was slower in comparison to the control. PMID:28298621

  7. Identification of valid reference genes for the normalization of RT qPCR gene expression data in human brain tissue

    Directory of Open Access Journals (Sweden)

    Ravid Rivka

    2008-05-01

    Full Text Available Abstract Background Studies of gene expression in post mortem human brain can contribute to understanding of the pathophysiology of neurodegenerative diseases, including Alzheimer's disease (AD, Parkinson's disease (PD and dementia with Lewy bodies (DLB. Quantitative real-time PCR (RT qPCR is often used to analyse gene expression. The validity of results obtained using RT qPCR is reliant on accurate data normalization. Reference genes are generally used to normalize RT qPCR data. Given that expression of some commonly used reference genes is altered in certain conditions, this study aimed to establish which reference genes were stably expressed in post mortem brain tissue from individuals with AD, PD or DLB. Results The present study investigated the expression stability of 8 candidate reference genes, (ubiquitin C [UBC], tyrosine-3-monooxygenase [YWHAZ], RNA polymerase II polypeptide [RP II], hydroxymethylbilane synthase [HMBS], TATA box binding protein [TBP], β-2-microglobulin [B2M], glyceraldehyde-3-phosphate dehydrogenase [GAPDH], and succinate dehydrogenase complex-subunit A, [SDHA] in cerebellum and medial temporal gyrus of 6 AD, 6 PD, 6 DLB subjects, along with 5 matched controls using RT qPCR (TaqMan® Gene Expression Assays. Gene expression stability was analysed using geNorm to rank the candidate genes in order of decreasing stability in each disease group. The optimal number of genes recommended for accurate data normalization in each disease state was determined by pairwise variation analysis. Conclusion This study identified validated sets of mRNAs which would be appropriate for the normalization of RT qPCR data when studying gene expression in brain tissue of AD, PD, DLB and control subjects.

  8. Daidzin: a potent, selective inhibitor of human mitochondrial aldehyde dehydrogenase.

    Science.gov (United States)

    Keung, W M; Vallee, B L

    1993-02-15

    Human mitochondrial aldehyde dehydrogenase (ALDH-I) is potently, reversibly, and selectively inhibited by an isoflavone isolated from Radix puerariae and identified as daidzin, the 7-glucoside of 4',7-dihydroxyisoflavone. Kinetic analysis with formaldehyde as substrate reveals that daidzin inhibits ALDH-I competitively with respect to formaldehyde with a Ki of 40 nM, and uncompetitively with respect to the coenzyme NAD+. The human cytosolic aldehyde dehydrogenase isozyme (ALDH-II) is nearly 3 orders of magnitude less sensitive to daidzin inhibition. Daidzin does not inhibit human class I, II, or III alcohol dehydrogenases, nor does it have any significant effect on biological systems that are known to be affected by other isoflavones. Among more than 40 structurally related compounds surveyed, 12 inhibit ALDH-I, but only prunetin and 5-hydroxydaidzin (genistin) combine high selectivity and potency, although they are 7- to 15-fold less potent than daidzin. Structure-function relationships have established a basis for the design and synthesis of additional ALDH inhibitors that could both be yet more potent and specific.

  9. Isolation and characterization of an inducible NAD-dependent butyraldehyde dehydrogenase from clostridium acetobutylicum

    Energy Technology Data Exchange (ETDEWEB)

    Schreiber, W.; Duerre, P. [Universitaet Ulm (Germany)

    1996-12-31

    A NAD-dependent butyraldehyde dehydrogenase (BAD) has been purified from C. acetobutylicum DSM 792 and DSM 173 1. This key enzyme of butanol production, catalyzing the conversion of butyryl-CoA to butyraldehyde, was induced shortly before the onset of butanol production and proved to be oxygen-sensitive. A one step purification procedure on reactive green 19 allowed to purify the enzyme to homogeneity. The purified protein was found to be extremely unstable and could only partially be stabilized by addition of mercaptoethanol and storage below -20{degrees}C. The enzyme subunit had a molecular mass of 39.5 kDa. In the reverse reaction (butyryl-CoA-forming) the apparent pH optimum was 9.75 and Vmax was significantly higher with butyraldehyde and propionaldehyde than with acetaldehyde. BAD could also use NADP+, but NAD+ was the preferred coenzyme for the reverse reaction. The N-terminal amino acid sequence of the C. acetobutylicurn DSM 792 protein showed high homology to glyceraldehyde-3-phosphate dehydrogenases (GAP), especially to the protein of C. pasteurianum. Genomic libraries of C. acetobutylicum DSM 792 were screened by hybridization using PCR-generated heterologous probes encoding the gap gene of C. pasteurianum. Sequence analysis of the positive clones revealed high homology, but no identity to the N-terminal amino acid sequence of the butyraldehyde dehydrogenase. Thus, BAD from C. acetobutylicum is distinctly different from other reported aldehyde dehydrogenases with butyraldehyde dehydrogenase activity.

  10. Characterization of interactions of dihydrolipoamide dehydrogenase with its binding protein in the human pyruvate dehydrogenase complex

    Energy Technology Data Exchange (ETDEWEB)

    Park, Yun-Hee [Department of Biochemistry, School of Medicine and Biomedical Sciences, University at Buffalo, State University of New York, Buffalo, NY 14214 (United States); Patel, Mulchand S., E-mail: mspatel@buffalo.edu [Department of Biochemistry, School of Medicine and Biomedical Sciences, University at Buffalo, State University of New York, Buffalo, NY 14214 (United States)

    2010-05-07

    Unlike pyruvate dehydrogenase complexes (PDCs) from prokaryotes, PDCs from higher eukaryotes have an additional structural component, E3-binding protein (BP), for binding of dihydrolipoamide dehydrogenase (E3) in the complex. Based on the 3D structure of the subcomplex of human (h) E3 with the di-domain (L3S1) of hBP, the amino acid residues (H348, D413, Y438, and R447) of hE3 for binding to hBP were substituted singly by alanine or other residues. These substitutions did not have large effects on hE3 activity when measured in its free form. However, when these hE3 mutants were reconstituted in the complex, the PDC activity was significantly reduced to 9% for Y438A, 20% for Y438H, and 18% for D413A. The binding of hE3 mutants with L3S1 determined by isothermal titration calorimetry revealed that the binding affinities of the Y438A, Y438H, and D413A mutants to L3S1 were severely reduced (1019-, 607-, and 402-fold, respectively). Unlike wild-type hE3 the binding of the Y438A mutant to L3S1 was accompanied by an unfavorable enthalpy change and a large positive entropy change. These results indicate that hE3-Y438 and hE3-D413 play important roles in binding of hE3 to hBP.

  11. Effect of experimental treatment on GAPDH mRNA expression as a housekeeping gene in human diploid fibroblasts

    Directory of Open Access Journals (Sweden)

    Zainuddin Azalina

    2010-08-01

    Full Text Available Abstract Background Several genes have been used as housekeeping genes and choosing an appropriate reference gene is important for accurate quantitative RNA expression in real time RT-PCR technique. The expression levels of reference genes should remain constant between the cells of different tissues and under different experimental conditions. The purpose of this study was to determine the effect of different experimental treatments on the expression of glyceraldehyde 3-phosphate dehydrogenase (GAPDH mRNA so that the reliability of GAPDH as reference gene for quantitative real time RT-PCR in human diploid fibroblasts (HDFs can be validated. HDFs in 4 different treatment groups viz; young (passage 4, senescent (passage 30, H2O2-induced oxidative stress and γ-tocotrienol (GTT-treated groups were harvested for total RNA extraction. Total RNA concentration and purity were determined prior to GAPDH mRNA quantification. Standard curve of GAPDH expression in serial diluted total RNA, melting curve analysis and agarose gel electrophoresis were used to determine the reliability of GAPDH as reference gene. Results HDFs with different experimental treatments exhibited diverse cell morphology with different expression of senescence-associated β-galactosidase (SA β-gal activity. However the expression level of GAPDH was consistent in all treatment groups. Conclusion The study demonstrated that GAPDH is reliable as reference gene for quantitative gene expression analysis in HDFs. Therefore it can be used as housekeeping gene for quantitative real time RT-PCR technique in human diploid fibroblasts particularly in studying cellular senescence.

  12. Bioprocess development for extracellular production of recombinant human interleukin-3 (hIL-3) in Pichia pastoris.

    Science.gov (United States)

    Dagar, Vikas Kumar; Adivitiya; Devi, Nirmala; Khasa, Yogender Pal

    2016-10-01

    Human interleukin-3 (hIL-3) is a therapeutically important cytokine involved in the maturation and differentiation of various cells of the immune system. The codon-optimized hIL-3 gene was cloned in fusion with the N-terminus α-mating factor signal peptide of Saccharomyces cerevisiae under an inducible alcohol oxidase 1 (AOX1) and constitutive glyceraldehyde-3-phosphate dehydrogenase (GAP) promoter. A Zeocin concentration up to 2000 mg/L was used to select hyper-producers. The shake flask cultivation studies in the Pichia pastoris GS115 host resulted a maximum recombinant hIL-3 expression level of 145 mg/L in the extracellular medium under the control of AOX1 promoter. The batch fermentation strategy allowed us to attain a fairly pure glycosylated hIL-3 protein in the culture supernatant at a final concentration of 475 mg/L with a high volumetric productivity of 4.39 mg/L/h. The volumetric product concentration achieved at bioreactor level was 3.28 folds greater than the shake flask results. The 6x His-tagged protein was purified using Ni-NTA affinity chromatography and confirmed further by western blot analysis using anti-6x His tag antibody. The glycosylation of recombinant hIL-3 protein was confirmed in a PNGase F deglycosylation reaction where it showed a molecular weight band pattern similar to E. coli produced non-glycosylated hIL-3 protein. The structural properties of recombinant hIL-3 protein were confirmed by CD and fluorescence spectroscopy where protein showed 40 % α-helix, 12 % β-sheets with an emission maxima at 343 nm. MALDI-TOF-TOF analysis was used to establish the protein identity. The biological activity of purified protein was confirmed by the human erythroleukemia TF-1 cell proliferation assay.

  13. Development of highly sensitive and specific mRNA multiplex system (XCYR1) for forensic human body fluids and tissues identification.

    Science.gov (United States)

    Xu, Yan; Xie, Jianhui; Cao, Yu; Zhou, Huaigu; Ping, Yuan; Chen, Liankang; Gu, Lihua; Hu, Wei; Bi, Gang; Ge, Jianye; Chen, Xin; Zhao, Ziqin

    2014-01-01

    The identification of human body fluids or tissues through mRNA-based profiling is very useful for forensic investigations. Previous studies have shown mRNA biomarkers are effective to identify the origin of biological samples. In this study, we selected 16 tissue specific biomarkers to evaluate their specificities and sensitivities for human body fluids and tissues identification, including porphobilinogen deaminase (PBGD), hemoglobin beta (HBB) and Glycophorin A (GLY) for circulatory blood, protamine 2 (PRM2) and transglutaminase 4 (TGM4) for semen, mucin 4 (MUC4) and human beta defensin 1(HBD1) for vaginal secretion, matrix metalloproteinases 7 and 11 (MMP7 and MMP11) for menstrual blood, keratin 4(KRT4) for oral mucosa, loricrin (LOR) and cystatin 6 (CST6) for skin, histatin 3(HTN3) for saliva, statherin (STATH) for nasal secretion, dermcidin (DCD) for sweat and uromodulin (UMOD) for urine. The above mentioned ten common forensic body fluids or tissues were used in the evaluation. Based on the evaluation, a reverse transcription (RT) PCR multiplex assay, XCYR1, which includes 12 biomarkers (i.e., HBB, GLY, HTN3, PRM2, KRT4, MMP11, MUC4, DCD, UMOD, MMP7, TGM4, and STATH) and 2 housekeeping genes [i.e., glyceraldehyde-3-phosphate dehydrogenase (GAPDH) and 18SrRNA], was developed. This assay was further validated with real casework samples and mock samples (with both single source and mixture) and it was approved that XCYR1 is effective to identify common body fluids or tissues (i.e., circulatory blood, saliva, semen, vaginal secretion, menstrual blood, oral mucosa, nasal secretion, sweat and urine) in forensic casework samples.

  14. Human GAPDH Is a Target of Aspirin's Primary Metabolite Salicylic Acid and Its Derivatives.

    Directory of Open Access Journals (Sweden)

    Hyong Woo Choi

    Full Text Available The plant hormone salicylic acid (SA controls several physiological processes and is a key regulator of multiple levels of plant immunity. To decipher the mechanisms through which SA's multiple physiological effects are mediated, particularly in immunity, two high-throughput screens were developed to identify SA-binding proteins (SABPs. Glyceraldehyde 3-Phosphate Dehydrogenase (GAPDH from plants (Arabidopsis thaliana was identified in these screens. Similar screens and subsequent analyses using SA analogs, in conjunction with either a photoaffinity labeling technique or surface plasmon resonance-based technology, established that human GAPDH (HsGAPDH also binds SA. In addition to its central role in glycolysis, HsGAPDH participates in several pathological processes, including viral replication and neuronal cell death. The anti-Parkinson's drug deprenyl has been shown to suppress nuclear translocation of HsGAPDH, an early step in cell death and the resulting cell death induced by the DNA alkylating agent N-methyl-N'-nitro-N-nitrosoguanidine. Here, we demonstrate that SA, which is the primary metabolite of aspirin (acetyl SA and is likely responsible for many of its pharmacological effects, also suppresses nuclear translocation of HsGAPDH and cell death. Analysis of two synthetic SA derivatives and two classes of compounds from the Chinese medicinal herb Glycyrrhiza foetida (licorice, glycyrrhizin and the SA-derivatives amorfrutins, revealed that they not only appear to bind HsGAPDH more tightly than SA, but also exhibit a greater ability to suppress translocation of HsGAPDH to the nucleus and cell death.

  15. Human GAPDH Is a Target of Aspirin’s Primary Metabolite Salicylic Acid and Its Derivatives

    Science.gov (United States)

    Manohar, Murli; Harraz, Maged M.; Park, Sang-Wook; Schroeder, Frank C.; Snyder, Solomon H.; Klessig, Daniel F.

    2015-01-01

    The plant hormone salicylic acid (SA) controls several physiological processes and is a key regulator of multiple levels of plant immunity. To decipher the mechanisms through which SA’s multiple physiological effects are mediated, particularly in immunity, two high-throughput screens were developed to identify SA-binding proteins (SABPs). Glyceraldehyde 3-Phosphate Dehydrogenase (GAPDH) from plants (Arabidopsis thaliana) was identified in these screens. Similar screens and subsequent analyses using SA analogs, in conjunction with either a photoaffinity labeling technique or surface plasmon resonance-based technology, established that human GAPDH (HsGAPDH) also binds SA. In addition to its central role in glycolysis, HsGAPDH participates in several pathological processes, including viral replication and neuronal cell death. The anti-Parkinson’s drug deprenyl has been shown to suppress nuclear translocation of HsGAPDH, an early step in cell death and the resulting cell death induced by the DNA alkylating agent N-methyl-N’-nitro-N-nitrosoguanidine. Here, we demonstrate that SA, which is the primary metabolite of aspirin (acetyl SA) and is likely responsible for many of its pharmacological effects, also suppresses nuclear translocation of HsGAPDH and cell death. Analysis of two synthetic SA derivatives and two classes of compounds from the Chinese medicinal herb Glycyrrhiza foetida (licorice), glycyrrhizin and the SA-derivatives amorfrutins, revealed that they not only appear to bind HsGAPDH more tightly than SA, but also exhibit a greater ability to suppress translocation of HsGAPDH to the nucleus and cell death. PMID:26606248

  16. Enzymic analysis of NADPH metabolism in beta-lactam-producing Penicillium chrysogenum: presence of a mitochondrial NADPH dehydrogenase.

    Science.gov (United States)

    Harris, Diana M; Diderich, Jasper A; van der Krogt, Zita A; Luttik, Marijke A H; Raamsdonk, Léonie M; Bovenberg, Roel A L; van Gulik, Walter M; van Dijken, Johannes P; Pronk, Jack T

    2006-03-01

    Based on assumed reaction network structures, NADPH availability has been proposed to be a key constraint in beta-lactam production by Penicillium chrysogenum. In this study, NADPH metabolism was investigated in glucose-limited chemostat cultures of an industrial P. chrysogenum strain. Enzyme assays confirmed the NADP(+)-specificity of the dehydrogenases of the pentose-phosphate pathway and the presence of NADP(+)-dependent isocitrate dehydrogenase. Pyruvate decarboxylase/NADP(+)-linked acetaldehyde dehydrogenase and NADP(+)-linked glyceraldehyde-3-phosphate dehydrogenase were not detected. Although the NADPH requirement of penicillin-G-producing chemostat cultures was calculated to be 1.4-1.6-fold higher than that of non-producing cultures, in vitro measured activities of the major NADPH-providing enzymes were the same. Isolated mitochondria showed high rates of antimycin A-sensitive respiration of NADPH, thus indicating the presence of a mitochondrial NADPH dehydrogenase that oxidises cytosolic NADPH. The presence of this enzyme in P. chrysogenum might have important implications for stoichiometric modelling of central carbon metabolism and beta-lactam production and may provide an interesting target for metabolic engineering.

  17. Comparative reactivity of the myeloperoxidase-derived oxidants hypochlorous acid and hypothiocyanous acid with human coronary artery endothelial cells.

    Science.gov (United States)

    Lloyd, Mitchell M; Grima, Michael A; Rayner, Benjamin S; Hadfield, Katrina A; Davies, Michael J; Hawkins, Clare L

    2013-12-01

    In the immune response, hypohalous acids are generated by activated leukocytes via the release of myeloperoxidase and the formation of H2O2. Although these oxidants have important bactericidal properties, they have also been implicated in causing tissue damage in inflammatory diseases, including atherosclerosis. Hypochlorous acid (HOCl) and hypothiocyanous acid (HOSCN) are the major oxidants formed by myeloperoxidase under physiological conditions, with the ratio of these oxidants dependent on diet and smoking status. HOCl is highly reactive and causes marked cellular damage, but few data are available on the effects of HOSCN on mammalian cells. In this study, we have compared the actions of HOCl and HOSCN on human coronary artery endothelial cells (HCAEC). HOCl reacts rapidly with the cells, resulting in extensive cell death by both apoptosis and necrosis, with necrosis dominating at higher oxidant doses. In contrast, HOSCN is consumed more slowly, with cell death occurring only by apoptosis. Exposure of HCAEC to HOCl and HOSCN induces changes in mitochondrial membrane permeability, which, in the case of HOSCN, is associated with mitochondrial release of proapoptotic factors, including cytochrome c, apoptosis-inducing factor, and endonuclease G. With each oxidant, apoptosis appears to be caspase-independent, with the inactivation of caspases 3/7 observed, and pretreatment of the cells with the caspase inhibitor Z-VAD-fmk having no effect on the extent of cell death. Loss of cellular thiols, depletion of glutathione, and the inactivation of thiol-dependent enzymes, including glyceraldehyde-3-phosphate dehydrogenase, were seen with both oxidants, though to a much greater extent with HOCl. The ability of myeloperoxidase-derived oxidants to induce endothelial cell apoptosis may contribute to the formation of unstable lesions in atherosclerosis. The results with HOSCN may be particularly significant for smokers, who have elevated plasma levels of SCN(-), the precursor

  18. Yeast cell-based analysis of human lactate dehydrogenase isoforms.

    Science.gov (United States)

    Mohamed, Lulu Ahmed; Tachikawa, Hiroyuki; Gao, Xiao-Dong; Nakanishi, Hideki

    2015-12-01

    Human lactate dehydrogenase (LDH) has attracted attention as a potential target for cancer therapy and contraception. In this study, we reconstituted human lactic acid fermentation in Saccharomyces cerevisiae, with the goal of constructing a yeast cell-based LDH assay system. pdc null mutant yeast (mutated in the endogenous pyruvate decarboxylase genes) are unable to perform alcoholic fermentation; when grown in the presence of an electron transport chain inhibitor, pdc null strains exhibit a growth defect. We found that introduction of the human gene encoding LDHA complemented the pdc growth defect; this complementation depended on LDHA catalytic activity. Similarly, introduction of the human LDHC complemented the pdc growth defect, even though LDHC did not generate lactate at the levels seen with LDHA. In contrast, the human LDHB did not complement the yeast pdc null mutant, although LDHB did generate lactate in yeast cells. Expression of LDHB as a red fluorescent protein (RFP) fusion yielded blebs in yeast, whereas LDHA-RFP and LDHC-RFP fusion proteins exhibited cytosolic distribution. Thus, LDHB exhibits several unique features when expressed in yeast cells. Because yeast cells are amenable to genetic analysis and cell-based high-throughput screening, our pdc/LDH strains are expected to be of use for versatile analyses of human LDH. © The Authors 2015. Published by Oxford University Press on behalf of the Japanese Biochemical Society. All rights reserved.

  19. Signaling Crosstalk: A Live in Situ Analysis of the Temporal and Spatial Regulation of Key Pathways in Human Breast Cancer Progression

    Science.gov (United States)

    2007-05-01

    flavoprotein beta-subunit P38117 27.8 8.25 1598 0.12 Sepiapterin reductase DJW121003_009 P35270 28.0 8.25 1630 0.09 Isocitrate dehydrogenase [NAD...P07741 19.5 5.79 Aldose reductase P15121 35.7 6.55 Annexin A1 P04083 38.6 6.64 Glyceraldehyde 3-phosphate dehydrogenase P04406 35.9 8.58 Annexin A2...sulfur subunit P47985 29.7 8.55 1858 0.22 3-hydroxyacyl-CoA dehydrogenase type II DJW121003_010 Q99714 26.9 7.65 Electron transfer

  20. Cytosolic malate dehydrogenase regulates senescence in human fibroblasts.

    Science.gov (United States)

    Lee, Seung-Min; Dho, So Hee; Ju, Sung-Kyu; Maeng, Jin-Soo; Kim, Jeong-Yoon; Kwon, Ki-Sun

    2012-10-01

    Carbohydrate metabolism changes during cellular senescence. Cytosolic malate dehydrogenase (MDH1) catalyzes the reversible reduction of oxaloacetate to malate at the expense of reduced nicotinamide adenine dinucleotide (NADH). Here, we show that MDH1 plays a critical role in the cellular senescence of human fibroblasts. We observed that the activity of MDH1 was reduced in old human dermal fibroblasts (HDFs) [population doublings (PD) 56], suggesting a link between decreased MDH1 protein levels and aging. Knockdown of MDH1 in young HDFs (PD 20) and the IMR90 human fibroblast cell line resulted in the appearance of significant cellular senescence features, including senescence-associated β-galactosidase staining, flattened and enlarged morphology, increased population doubling time, and elevated p16(INK4A) and p21(CIP1) protein levels. Cytosolic NAD/NADH ratios were decreased in old HDFs to the same extent as in MDH1 knockdown HDFs, suggesting that cytosolic NAD depletion is related to cellular senescence. We found that AMP-activated protein kinase, a sensor of cellular energy, was activated in MDH1 knockdown cells. We also found that sirtuin 1 (SIRT1) deacetylase, a controller of cellular senescence, was decreased in MDH1 knockdown cells. These results indicate that the decrease in MDH1 and subsequent reduction in NAD/NADH ratio, which causes SIRT1 inhibition, is a likely carbohydrate metabolism-controlled cellular senescence mechanism.

  1. Human choline dehydrogenase: medical promises and biochemical challenges.

    Science.gov (United States)

    Salvi, Francesca; Gadda, Giovanni

    2013-09-15

    Human choline dehydrogenase (CHD) is located in the inner membrane of mitochondria primarily in liver and kidney and catalyzes the oxidation of choline to glycine betaine. Its physiological role is to regulate the concentrations of choline and glycine betaine in the blood and cells. Choline is important for regulation of gene expression, the biosynthesis of lipoproteins and membrane phospholipids and for the biosynthesis of the neurotransmitter acetylcholine; glycine betaine plays important roles as a primary intracellular osmoprotectant and as methyl donor for the biosynthesis of methionine from homocysteine, a required step for the synthesis of the ubiquitous methyl donor S-adenosyl methionine. Recently, CHD has generated considerable medical attention due to its association with various human pathologies, including male infertility, homocysteinuria, breast cancer and metabolic syndrome. Despite the renewed interest, the biochemical characterization of the enzyme has lagged behind due to difficulties in the obtainment of purified, active and stable enzyme. This review article summarizes the medical relevance and the physiological roles of human CHD, highlights the biochemical knowledge on the enzyme, and provides an analysis based on the comparison of the protein sequence with that of bacterial choline oxidase, for which structural and biochemical information is available.

  2. Differential sensitivity to beta-cell secretagogues in cultured rat pancreatic islets exposed to human interleukin-1 beta.

    Science.gov (United States)

    Eizirik, D L; Sandler, S; Hallberg, A; Bendtzen, K; Sener, A; Malaisse, W J

    1989-08-01

    The early stages of insulin-dependent diabetes mellitus are characterized by a selective inability to secrete insulin in response to glucose, coupled to a better response to nonnutrient secretagogues. The deficient glucose response may be a result of the autoimmune process directed toward the beta-cells. Interleukin-1 (IL-1) has been suggested to be one possible mediator of immunological damage of the beta-cells. In the present study we characterized the sensitivity of beta-cells to different secretagogues after human recombinant IL-1 beta (rIL-1 beta) exposure. Furthermore, experiments were performed to clarify the biochemical mechanisms behind the defective insulin response observed in these islets. Rat pancreatic islets were isolated and kept in tissue culture (medium RPMI-1640 plus 10% calf serum) for 5 days. The islets were subsequently exposed to 60 pM human recombinant IL-1 beta during 48 h in the same culture conditions as above and examined immediately after IL-1 exposure. The rIL-1 beta-treated islets showed a marked reduction of glucose-stimulated insulin release. Stimulation with arginine plus different glucose concentrations, and leucine plus glutamine partially counteracted the rIL-1 beta-induced reduction of insulin release. The activities of the glycolytic enzymes hexokinase, glucokinase, and glyceraldehyde 3-phosphate dehydrogenase, were similar in control and IL-1-exposed islets. Treatment with IL-1 also did not impair the activities of NADH+- and NADPH+-dependent glutamate dehydrogenase, glutamate-aspartate transaminase, glutamate-alanine transaminase, citrate synthase, and NAD+-linked isocitrate dehydrogenase. The oxidation of D-[6-14C]glucose and L-[U-14C]leucine were decreased by 50% in IL-1-treated islets. Furthermore, there was a significant decrease in the ratios of [2-14C]pyruvate oxidation/[1-14C]pyruvate decarboxylation and L-[U-14C]leucine oxidation/L-[1-14C]leucine decarboxylation, indicating that IL-1 decreases the proportion of

  3. Structural Biology of Proteins of the Multi-enzyme Assembly Human Pyruvate Dehydrogenase Complex

    Science.gov (United States)

    2003-01-01

    Objectives and research challenges of this effort include: 1. Need to establish Human Pyruvate Dehydrogenase Complex protein crystals; 2. Need to test value of microgravity for improving crystal quality of Human Pyruvate Dehydrogenase Complex protein crystals; 3. Need to improve flight hardware in order to control and understand the effects of microgravity on crystallization of Human Pyruvate Dehydrogenase Complex proteins; 4. Need to integrate sets of national collaborations with the restricted and specific requirements of flight experiments; 5. Need to establish a highly controlled experiment in microgravity with a rigor not yet obtained; 6. Need to communicate both the rigor of microgravity experiments and the scientific value of results obtained from microgravity experiments to the national community; and 7. Need to advance the understanding of Human Pyruvate Dehydrogenase Complex structures so that scientific and commercial advance is identified for these proteins.

  4. Human kidney 11 beta-hydroxysteroid dehydrogenase: regulation by adrenocorticotropin?

    Science.gov (United States)

    Diederich, S; Quinkler, M; Miller, K; Heilmann, P; Schoneshofer, M; Oelkers, W

    1996-03-01

    In ectopic adrenocorticotropin (ACTH) syndrome (EAS) with higher ACTH levels than in pituitary Cushing's syndrome and during ACTH infusion, the ratio of cortisol to cortisone in plasma and urine is increased, suggesting inhibition of renal 11 beta-hydroxysteroid dehydrogenase (11 beta-HSD) by ACTH or by ACTH-dependent steroids. Measuring the conversion of cortisol to cortisone by human kidney slices under different conditions, we tested the possibility of 11 beta-HSD regulation by ACTH and corticosteroids. Slices prepared from unaffected parts of kidneys removed because of renal cell carcinoma were incubated with unlabeled or labeled cortisol, and cortisol and cortisone were quantitated after HPLC separation by UV or radioactive detection. The 11 beta HSD activity was not influenced by incubation with increasing concentrations (10(-12)-10(-9) mol/l) of ACTH (1-24 or 1-39) for 1 h. Among 12 ACTH-dependent steroids tested (10(-9)-10(-6) mol/l), only corticosterone (IC50 = 2 x 10(-7) mol/l), 18-OH-corticosterone and 11 beta-OH-androstenedione showed a significant dose-dependent inhibition of 11 beta-HSD activity. The percentage conversion rate of cortisol to cortisone was concentration dependent over the whole range of cortisol concentrations tested (10(-8) - 10(-5) mol/l. A direct inhibitory effect of ACTH on 11 beta-HSD is, therefore, unlikely. The only steroids inhibiting the conversion of cortisol to cortisone are natural substrates for 11 beta-HSD. Kinetic studies show a saturation of the enzyme at high cortisol concentrations. Thus, the reduced percentage renal cortisol inactivation in EAS seems to be due mainly to overload of the enzyme with endogenous substrates (cortisol, corticosterone and others) rather than to direct inhibition of 11 beta-HSD by ACTH or ACTH-dependent steroids, not being substrates of 11 beta-HSD.

  5. Structural basis of cooperativity in human UDP-glucose dehydrogenase.

    Directory of Open Access Journals (Sweden)

    Venkatachalam Rajakannan

    Full Text Available BACKGROUND: UDP-glucose dehydrogenase (UGDH is the sole enzyme that catalyzes the conversion of UDP-glucose to UDP-glucuronic acid. The product is used in xenobiotic glucuronidation in hepatocytes and in the production of proteoglycans that are involved in promoting normal cellular growth and migration. Overproduction of proteoglycans has been implicated in the progression of certain epithelial cancers, while inhibition of UGDH diminished tumor angiogenesis in vivo. A better understanding of the conformational changes occurring during the UGDH reaction cycle will pave the way for inhibitor design and potential cancer therapeutics. METHODOLOGY: Previously, the substrate-bound of UGDH was determined to be a symmetrical hexamer and this regular symmetry is disrupted on binding the inhibitor, UDP-α-D-xylose. Here, we have solved an alternate crystal structure of human UGDH (hUGDH in complex with UDP-glucose at 2.8 Å resolution. Surprisingly, the quaternary structure of this substrate-bound protein complex consists of the open homohexamer that was previously observed for inhibitor-bound hUGDH, indicating that this conformation is relevant for deciphering elements of the normal reaction cycle. CONCLUSION: In all subunits of the present open structure, Thr131 has translocated into the active site occupying the volume vacated by the absent active water and partially disordered NAD+ molecule. This conformation suggests a mechanism by which the enzyme may exchange NADH for NAD+ and repolarize the catalytic water bound to Asp280 while protecting the reaction intermediates. The structure also indicates how the subunits may communicate with each other through two reaction state sensors in this highly cooperative enzyme.

  6. A molecular analysis of the Gelechiidae (Lepidoptera, Gelechioidea) with an interpretative grouping of its taxa

    DEFF Research Database (Denmark)

    Karsholt, Ole; Mutanen, Marko; Lee, Sangmi;

    2013-01-01

    , Isocitrate dehydrogenase, Cytosolic malate dehydrogenase, Glyceraldehyde-3-phosphate dehydrogenase and Carbamoylphosphate synthase domain protein). Fifty-two taxa representing nearly all established subfamilies and tribes of Gelechiidae, and about 10% of described gelechiid genera, in addition to five...

  7. Characterization of RNA isolated from eighteen different human tissues: results from a rapid human autopsy program.

    Science.gov (United States)

    Walker, Douglas G; Whetzel, Alexis M; Serrano, Geidy; Sue, Lucia I; Lue, Lih-Fen; Beach, Thomas G

    2016-09-01

    Many factors affect the integrity of messenger RNA from human autopsy tissues including postmortem interval (PMI) between death and tissue preservation and the pre-mortem agonal and disease states. In this communication, we describe RNA isolation and characterization of 389 samples from 18 different tissues from elderly donors who were participants in a rapid whole-body autopsy program located in Sun City, Arizona ( www.brainandbodydonationprogram.org ). Most tissues were collected within a PMI of 2-6 h (median 3.15 h; N = 455), but for this study, tissue from cases with longer PMIs (1.25-29.25 h) were included. RNA quality was assessed by RNA integrity number (RIN) and total yield (ng RNA/mg tissue). RIN correlated with PMI for heart (r = -0.531, p = 0.009) and liver (r = -558, p = 0.0017), while RNA yield correlated with PMI for colon (r = -485, p = 0.016) and skin (r = -0.460, p = 0.031). RNAs with the lowest integrity were from skin and cervix where 22.7 and 31.4 % of samples respectively failed to produce intact RNA; by contrast all samples from esophagus, lymph node, jejunum, lung, stomach, submandibular gland and kidney produced RNA with measurable RINs. Expression levels in heart RNA of 4 common housekeeping normalization genes showed significant correlations of Ct values with RIN, but only one gene, glyceraldehyde-3 phosphate dehydrogenase, showed a correlation of Ct with PMI. There were no correlations between RIN values obtained for liver, adrenal, cervix, esophagus and lymph node and those obtained from corresponding brain samples. We show that high quality RNA can be produced from most human autopsy tissues, though with significant differences between tissues and donors. The RNA stability and yield did not depend solely on PMI; other undetermined factors are involved, but these do not include the age of the donor.

  8. Cell type and transfection reagent-dependent effects on viability, cell content, cell cycle and inflammation of RNAi in human primary mesenchymal cells

    DEFF Research Database (Denmark)

    Yang, Hsiao Yin; Vonk, Lucienne A.; Licht, Ruud

    2014-01-01

    The application of RNA interference (RNAi) has great therapeutic potential for degenerative diseases of cartilaginous tissues by means of fine tuning the phenotype of cells used for regeneration. However, possible non-specific effects of transfection per se might be relevant for future clinical......% amidation), for siRNA delivery into primary mesenchymal cells including nucleus pulposus cells, articular chondrocytes and mesenchymal stem cells (MSCs). Glyceraldehyde-3-phosphate dehydrogenase (GAPDH) was used as an endogenous model gene to evaluate the extent of silencing by 20 nM or 200 nM siRNA at day...... 3 and day 6 post-transfection. In addition to silencing efficiency, non-specific effects such as cytotoxicity, change in DNA content and differentiation potential of cells were evaluated. Among the four transfection reagents, the commercial liposome-based agent was the most efficient reagent for si...

  9. Proteome of human colon cancer stem cells: A comparative analysis

    Institute of Scientific and Technical Information of China (English)

    Jian Zou; Xiao-Feng Yu; Zhi-Jun Bao; Jie Dong

    2011-01-01

    AIM: To isolate and identify the biological characteristics of human colon cancer stem cells (SW1116 cells) and further study their proteome. METHODS: SW1116 cells were isolated and cultured with a serum-free medium (SFM). Sphere formation was assayed to observe the formation of colon cancer stem cell spheres. SW1116 cells were inoculated into a serum-containing medium for observing their differentiation characteristics. Proliferation curve and cross-resistance of SW1116 cells to different drugs were detected by MTT. Percentage of SP cells in SW1116 cells was detected with Hoechst33342 staining. Telomerase activity in SW1116cells was checked by polymerase chain reaction (PCR)-enzyme linked immunosorbent assay. Expressions of stem cell relevant genes and proteins were detected by reverse transcription-PCR and Western blot, respectively. Total protein was isolated from SW1116 cells by two-dimensional gel electrophoresis (2-DE) and differentially expressed proteins were identified by tandem mass spectrometry (MALDI-TOF/TOF). RESULTS: The isolated SW1116 cells presented as spheroid and suspension growths in SFM with a strong self-renewal, proliferation, differentiation and drug-resistance ability. The percentage of SP cells in SW1116 cells was 38.9%. The SW1116 cells co-expressed the CD133 and CD29 proteins. The telomerase activity in SW1116 cells was increased. The expressions of different stem cell relevant genes and proteins were detected. The proteomic analysis showed that the 26 protein spots were differently expressed in SW1116 cells and 10 protein spots were identified as ubiquitin fusiondegradation 1-like protein, nuclear chloride channel protein, tubulin b, Raichu404X, stratifin, F-actin capping protein a-1 subunit, eukaryotic translation elongation factor 1 delta isoform 2, hypothetical protein, glyceraldehyde-3-phosphate dehydrogenase and guanine nucleotide binding protein b polypeptide 2-like 1, respectively. CONCLUSION: SW1116 cells are biologically

  10. Nuclear lactate dehydrogenase modulates histone modification in human hepatocytes

    Energy Technology Data Exchange (ETDEWEB)

    Castonguay, Zachary; Auger, Christopher; Thomas, Sean C.; Chahma, M’hamed; Appanna, Vasu D., E-mail: vappanna@laurentian.ca

    2014-11-07

    Highlights: • Nuclear LDH is up-regulated under oxidative stress. • SIRT1 is co-immunoprecipitated bound to nuclear LDH. • Nuclear LDH is involved in histone deacetylation and epigenetics. - Abstract: It is becoming increasingly apparent that the nucleus harbors metabolic enzymes that affect genetic transforming events. Here, we describe a nuclear isoform of lactate dehydrogenase (nLDH) and its ability to orchestrate histone deacetylation by controlling the availability of nicotinamide adenine dinucleotide (NAD{sup +}), a key ingredient of the sirtuin-1 (SIRT1) deacetylase system. There was an increase in the expression of nLDH concomitant with the presence of hydrogen peroxide (H{sub 2}O{sub 2}) in the culture medium. Under oxidative stress, the NAD{sup +} generated by nLDH resulted in the enhanced deacetylation of histones compared to the control hepatocytes despite no discernable change in the levels of SIRT1. There appeared to be an intimate association between nLDH and SIRT1 as these two enzymes co-immunoprecipitated. The ability of nLDH to regulate epigenetic modifications by manipulating NAD{sup +} reveals an intricate link between metabolism and the processing of genetic information.

  11. Crystallization and initial X-ray diffraction analysis of human pyruvate dehydrogenase

    Science.gov (United States)

    Ciszak, E.; Korotchkina, L. G.; Hong, Y. S.; Joachimiak, A.; Patel, M. S.

    2001-01-01

    Human pyruvate dehydrogenase (E1) is a component enzyme of the pyruvate dehydrogenase complex. The enzyme catalyzes the irreversible decarboxylation of pyruvic acid and the rate-limiting reductive acetylation of the lipoyl moiety linked to the dihydrolipoamide acetyltransferase component of the pyruvate dehydrogenase complex. E1 is an alpha(2)beta(2) tetramer ( approximately 154 kDa). Crystals of this recombinant enzyme have been grown in polyethylene glycol 3350 using a vapor-diffusion method at 295 K. The crystals are characterized as orthorhombic, space group P2(1)2(1)2(1), with unit-cell parameters a = 64.2, b = 126.9, c = 190.2 A. Crystals diffracted to a minimum d spacing of 2.5 A. The asymmetric unit contains one alpha(2)beta(2) tetrameric E1 assembly; self-rotation function analysis showed a pseudo-twofold symmetry relating the two alphabeta dimers.

  12. Culture temperature affects human chondrocyte messenger RNA expression in monolayer and pellet culture systems.

    Directory of Open Access Journals (Sweden)

    Akira Ito

    Full Text Available Cell-based therapy has been explored for articular cartilage regeneration. Autologous chondrocyte implantation is a promising cell-based technique for repairing articular cartilage defects. However, there are several issues such as chondrocyte de-differentiation. While numerous studies have been designed to overcome some of these issues, only a few have focused on the thermal environment that can affect chondrocyte metabolism and phenotype. In this study, the effects of different culture temperatures on human chondrocyte metabolism- and phenotype-related gene expression were investigated in 2D and 3D environments. Human chondrocytes were cultured in a monolayer or in a pellet culture system at three different culture temperatures (32°C, 37°C, and 41°C for 3 days. The results showed that the total RNA level, normalized to the threshold cycle value of internal reference genes, was higher at lower temperatures in both culture systems. Glyceraldehyde-3-phosphate dehydrogenase (GAPDH and citrate synthase (CS, which are involved in glycolysis and the citric acid cycle, respectively, were expressed at similar levels at 32°C and 37°C in pellet cultures, but the levels were significantly lower at 41°C. Expression of the chondrogenic markers, collagen type IIA1 (COL2A1 and aggrecan (ACAN, was higher at 37°C than at 32°C and 41°C in both culture systems. However, this phenomenon did not coincide with SRY (sex-determining region Y-box 9 (SOX9, which is a fundamental transcription factor for chondrogenesis, indicating that a SOX9-independent pathway might be involved in this phenomenon. In conclusion, the expression of chondrocyte metabolism-related genes at 32°C was maintained or enhanced compared to that at 37°C. However, chondrogenesis-related genes were further induced at 37°C in both culture systems. Therefore, manipulating the culture temperature may be an advantageous approach for regulating human chondrocyte metabolic activity and

  13. Simultaneous overexpression of enzymes of the lower part of glycolysis can enhance the fermentative capacity of Saccharomyces cerevisiae

    DEFF Research Database (Denmark)

    Smits, H. P.; Hauf, J.; Muller, S.

    2000-01-01

    Recombinant S. cerevisiae strains, with elevated levels of the enzymes of lower glycolysis (glyceraldehyde-3-phosphate dehydrogenase, phosphoglycerate mutase, phosphoglycerate kinase, enolase, pyruvate kinase, pyruvate decarboxylase and alcohol dehydrogenase) were physiologically characterized...

  14. A novel gene signature for molecular diagnosis of human prostate cancer by RT-qPCR.

    Directory of Open Access Journals (Sweden)

    Federica Rizzi

    Full Text Available BACKGROUND: Prostate cancer (CaP is one of the most relevant causes of cancer death in Western Countries. Although detection of CaP at early curable stage is highly desirable, actual screening methods present limitations and new molecular approaches are needed. Gene expression analysis increases our knowledge about the biology of CaP and may render novel molecular tools, but the identification of accurate biomarkers for reliable molecular diagnosis is a real challenge. We describe here the diagnostic power of a novel 8-genes signature: ornithine decarboxylase (ODC, ornithine decarboxylase antizyme (OAZ, adenosylmethionine decarboxylase (AdoMetDC, spermidine/spermine N(1-acetyltransferase (SSAT, histone H3 (H3, growth arrest specific gene (GAS1, glyceraldehyde 3-phosphate dehydrogenase (GAPDH and Clusterin (CLU in tumour detection/classification of human CaP. METHODOLOGY/PRINCIPAL FINDINGS: The 8-gene signature was detected by retrotranscription real-time quantitative PCR (RT-qPCR in frozen prostate surgical specimens obtained from 41 patients diagnosed with CaP and recommended to undergo radical prostatectomy (RP. No therapy was given to patients at any time before RP. The bio-bank used for the study consisted of 66 specimens: 44 were benign-CaP paired from the same patient. Thirty-five were classified as benign and 31 as CaP after final pathological examination. Only molecular data were used for classification of specimens. The Nearest Neighbour (NN classifier was used in order to discriminate CaP from benign tissue. Validation of final results was obtained with 10-fold cross-validation procedure. CaP versus benign specimens were discriminated with (80+/-5% accuracy, (81+/-6% sensitivity and (78+/-7% specificity. The method also correctly classified 71% of patients with Gleason score or =7, an important predictor of final outcome. CONCLUSIONS/SIGNIFICANCE: The method showed high sensitivity in a collection of specimens in which a significant

  15. Investigation of hTERT gene expression levels in two cell lines infected by high-risk human papilloma virus

    Directory of Open Access Journals (Sweden)

    Maryam Akhtari

    2016-07-01

    Full Text Available Background: Human papilloma virus (HPV is one of the most important factors in cervical cancer. Viral sequences are integrated into the host cell genome. In mild cases the virus causes skin damages, in severe cases it leads to cancer. Like many other cancers, telomerase gene expression was increased in cervical cancer. This enzyme is a reverse transcriptase that contains two common subunits: i catalytic protein called human telomerase reverse transcriptase (hTERT and, ii RNA sequence called hTR. hTERT expression is hardly found in any somatic tissues. Detection of high telomerase activity in human cells, lead to tumor genesis. So hTERT can be used as a diagnostic tool in cancer detection. Methods: This experimental study was carried out from May 2013 to April 2014 in Nanobiotechnology Research Center, Baqiyatallah University of Medical Sciences in Tehran, Iran. Caski and Hela cancer cell lines were used which contain HPV16 and HPV18 respectively. Cell lines were cultured and total RNA was extracted. Following normalization agent glyceraldehyde-3-phosphate dehydrogenase (GADPH, hTERT expression level was determining by real-time PCR method. For each sample, the expression level of hTERT and GAPDH were quantified as copy numbers (per reaction using the standard curve. Finally, hTERT levels in Hela and Caski cell lines were compared quantitatively by t-test using GraphPad statistic software version 5 (San Diego, CA, USA. Results: According to the charts real-time PCR, hTERT gene expression in Hela and Caski cancer cell lines is significantly different (t=0.0319. Conclusion: All results confirm that hTERT expression levels in Hela and Caski cell lines are significantly different and the level of hTERT expression in the Caski cell line was slightly higher than that of Hela cell line. The significant difference between hTERT mRNA expression levels reported here could be used as a tumor marker for HPV16 and HPV18 in cervical cancer.

  16. Validation of endogenous control genes for gene expression studies on human ocular surface epithelium.

    Directory of Open Access Journals (Sweden)

    Bina Kulkarni

    Full Text Available PURPOSE: To evaluate a panel of ten known endogenous control genes (ECG with quantitative reverse transcription PCR (qPCR, for identification of stably expressed endogenous control genes in the ocular surface (OS epithelial regions including cornea, limbus, limbal epithelial crypt and conjunctiva to normalise the quantitative reverse transcription PCR data of genes of interest expressed in above-mentioned regions. METHOD: The lasermicrodissected (LMD OS epithelial regions of cryosectioned corneoscleral buttons from the cadaver eyes were processed for RNA extraction and cDNA synthesis to detect genes of interest with qPCR. Gene expression of 10 known ECG--glyceraldehyde-3-phosphate dehydrogenase (GAPDH, beta actin (ACTB, peptidylprolyl isomerase (PPIA, TATA-box binding protein (TBP1, hypoxanthine guanine phosphoribosyl transferase (HPRT1, beta glucuronidase (GUSB, Eucaryotic 18S ribosomal RNA (18S, phosphoglycerate kinase (PGK1, beta-2-microglobulin (B2M, ribosomal protein, large, P0 (RPLP0--was measured in the OS epithelial regions by qPCR method and the data collected was further analysed using geNorm software. RESULTS: The expression stability of ecgs in the os epithelial regions in increasing order as determined with genorm software is as follows: ACTB<18Shuman OS epithelium and provide evidence for the use

  17. Delivery of small interfering RNAs in human cervical cancer cells by polyethylenimine-functionalized carbon nanotubes

    Science.gov (United States)

    Huang, Yuan-Pin; Lin, I.-Jou; Chen, Chih-Chen; Hsu, Yi-Chiang; Chang, Chi-Chang; Lee, Mon-Juan

    2013-06-01

    Carbon nanotubes are capable of penetrating the cell membrane and are widely considered as potential carriers for gene or drug delivery. Because the C-C and C=C bonds in carbon nanotubes are nonpolar, functionalization is required for carbon nanotubes to interact with genes or drugs as well as to improve their biocompatibility. In this study, polyethylenimine (PEI)-functionalized single-wall (PEI-NH-SWNTs) and multiwall carbon nanotubes (PEI-NH-MWNTs) were produced by direct amination method. PEI functionalization increased the positive charge on the surface of SWNTs and MWNTs, allowing carbon nanotubes to interact electrostatically with the negatively charged small interfering RNAs (siRNAs) and to serve as nonviral gene delivery reagents. PEI-NH-MWNTs and PEI-NH-SWNTs had a better solubility in water than pristine carbon nanotubes, and further removal of large aggregates by centrifugation produced a stable suspension of reduced particle size and improved homogeneity and dispersity. The amount of grafted PEI estimated by thermogravimetric analysis was 5.08% ( w/ w) and 5.28% ( w/ w) for PEI-NH-SWNTs and PEI-NH-MWNTs, respectively. For the assessment of cytotoxicity, various concentrations of PEI-NH-SWNTs and PEI-NH-MWNTs were incubated with human cervical cancer cells, HeLa-S3, for 48 h. PEI-NH-SWNTs and PEI-NH-MWNTs induced cell deaths in a dose-dependent manner but were less cytotoxic compared to pure PEI. As determined by electrophoretic mobility shift assay, siRNAs directed against glyceraldehyde-3-phosphate dehydrogenase (siGAPDH) were completely associated with PEI-NH-SWNTs or PEI-NH-MWNTs at a PEI-NH-SWNT/siGAPDH or PEI-NH-MWNT/siGAPDH mass ratio of 80:1 or 160:1, respectively. Furthermore, PEI-NH-SWNTs and PEI-NH-MWNTs successfully delivered siGAPDH into HeLa-S3 cells at PEI-NH-SWNT/siGAPDH and PEI-NH-MWNT/siGAPDH mass ratios of 1:1 to 20:1, resulting in suppression of the mRNA level of GAPDH to an extent similar to that of DharmaFECT, a common transfection

  18. Expression in Escherichia coli of active human alcohol dehydrogenase lacking N-terminal acetylation.

    Science.gov (United States)

    Höög, J O; Weis, M; Zeppezauer, M; Jörnvall, H; von Bahr-Lindström, H

    1987-12-01

    Human alcohol dehydrogenase (ADH, beta beta isozyme of class I) was expressed in Escherichia coli, purified to homogeneity, and characterized regarding N-terminal processing. The expression system was obtained by ligation of a cDNA fragment corresponding to the beta-subunit of human liver alcohol dehydrogenase into the vector pKK 223-3 containing the tac promoter. The enzyme, detected by Western-blot analysis and ethanol oxidizing activity, constituted up to 3% of the total amount of protein. Recombinant ADH was separated from E. coli ADH by ion-exchange chromatography and the isolated enzyme was essentially pure as judged by SDS-polyacrylamide gel electrophoresis and sequence analysis. The N-terminal sequence was identical to that of the authentic beta-subunit except that the N-terminus was non-acetylated, indicating a correct removal of the initiator methionine, but lack of further processing.

  19. Trans-packaging of human immunodeficiency virus type 1 genome into Gag virus-like particles in Saccharomyces cerevisiae.

    Science.gov (United States)

    Tomo, Naoki; Goto, Toshiyuki; Morikawa, Yuko

    2013-03-26

    Yeast is recognized as a generally safe microorganism and is utilized for the production of pharmaceutical products, including vaccines. We previously showed that expression of human immunodeficiency virus type 1 (HIV-1) Gag protein in Saccharomyces cerevisiae spheroplasts released Gag virus-like particles (VLPs) extracellularly, suggesting that the production system could be used in vaccine development. In this study, we further establish HIV-1 genome packaging into Gag VLPs in a yeast cell system. The nearly full-length HIV-1 genome containing the entire 5' long terminal repeat, U3-R-U5, did not transcribe gag mRNA in yeast. Co-expression of HIV-1 Tat, a transcription activator, did not support the transcription. When the HIV-1 promoter U3 was replaced with the promoter for the yeast glyceraldehyde-3-phosphate dehydrogenase gene, gag mRNA transcription was restored, but no Gag protein expression was observed. Co-expression of HIV-1 Rev, a factor that facilitates nuclear export of gag mRNA, did not support the protein synthesis. Progressive deletions of R-U5 and its downstream stem-loop-rich region (SL) to the gag start ATG codon restored Gag protein expression, suggesting that a highly structured noncoding RNA generated from the R-U5-SL region had an inhibitory effect on gag mRNA translation. When a plasmid containing the HIV-1 genome with the R-U5-SL region was coexpressed with an expression plasmid for Gag protein, the HIV-1 genomic RNA was transcribed and incorporated into Gag VLPs formed by Gag protein assembly, indicative of the trans-packaging of HIV-1 genomic RNA into Gag VLPs in a yeast cell system. The concentration of HIV-1 genomic RNA in Gag VLPs released from yeast was approximately 500-fold higher than that in yeast cytoplasm. The deletion of R-U5 to the gag gene resulted in the failure of HIV-1 RNA packaging into Gag VLPs, indicating that the packaging signal of HIV-1 genomic RNA present in the R-U5 to gag region functions similarly in yeast cells

  20. Alcohol and aldehyde dehydrogenases: structures of the human liver enzymes, functional properties and evolutionary aspects.

    Science.gov (United States)

    Jörnvall, H; Hempel, J; von Bahr-Lindström, H; Höög, J O; Vallee, B L

    1987-01-01

    All three types of subunit of class I human alcohol dehydrogenase have been analyzed both at the protein and cDNA levels, and the structures of alpha, beta 1, beta 2, gamma 1, and gamma 2 subunits are known. The same applies to class II pi subunits. Extensive protein data are also available for class III chi subunits. In the class I human isozymes, amino acid exchanges occur at 35 positions in total, with 21-28 replacements between any pair of the alpha/beta/gamma chains. These values, compared with those from species differences between the corresponding human and horse enzymes, suggest that isozyme developments in the class I enzyme resulted from separate gene duplications after the divergence of the human and equine evolutionary lines. All subunits exhibit some unique properties, with slightly closer similarity between the human gamma and horse enzyme subunits and somewhat greater deviations towards the human alpha subunit. Differences are large also in segments close to the active site zinc ligands and other functionally important positions. Species differences are distributed roughly equally between the two types of domain in the subunit, whereas isozyme differences are considerably more common in the catalytic than in the coenzyme-binding domain. These facts illustrate a functional divergence among the isozymes but otherwise similar changes during evolution. Polymorphic forms of beta and gamma subunits are characterized by single replacements at one and two positions, respectively, explaining known deviating properties. Class II and class III subunits are considerably more divergent. Their homology with class I isozymes exhibits only 60-65% positional identity. Hence, they reflect further steps towards the development of new enzymes, with variations well above the horse/human species levels, in contrast to the class I forms. Again, functionally important residues are affected, and patterns resembling those previously established for the divergently related

  1. Effects of some drugs on human erythrocyte glucose 6-phosphate dehydrogenase: an in vitro study.

    Science.gov (United States)

    Akkemik, Ebru; Budak, Harun; Ciftci, Mehmet

    2010-12-01

    Inhibitory effects of some drugs on glucose 6-phosphate dehydrogenase from the erythrocytes of human have been investigated. For this purpose, at the beginning, erythrocyte glucose 6-phosphate dehydrogenase was purified 2256 times in a yield of 44.22% by using ammonium sulphate precipitation and 2', 5'-ADP Sepharose 4B affinity gel. Temperature of +4°C was maintained during the purification process. Enzyme activity was determined with the Beutler method by using a spectrophotometer at 340 nm. This method was utilized for all kinetic studies. Ketotifen, dacarbazine, thiocolchicoside, meloxicam, methotrexate, furosemide, olanzapine, methylprednizolone acetate, paricalcitol, ritodrine hydrochloride, and gadobenate-dimeglumine were used as drugs. All the drugs indicated the inhibitory effects on the enzyme. Ki constants for glucose 6-phosphate dehydrogenase were found by means of Lineweaver-Burk graphs. While methylprednizolone acetate showed competitive inhibition, the others displayed non-competitive inhibition. In addition, IC(50) values of the drugs were determined by plotting Activity% vs [I].

  2. Human placental glucose dehydrogenase: IEF polymorphism in two Italian populations and enzyme activity in the six common phenotypes.

    Science.gov (United States)

    Scacchi, R; Corbo, R M; Calzolari, E; Laconi, G; Palmarino, R; Lucarelli, P

    1985-01-01

    Glucose dehydrogenase (hexose-6-phosphate dehydrogenase) has been assayed qualitatively and quantitatively in more than 600 human placentae collected in two Italian populations. The gene frequencies for GDH1, GDH2 and GDH3 were, respectively, 0.66, 0.21 and 0.12 in Continental Italy and 0.65, 0.23 and 0.12 in Sardinia. Among the six common phenotypes there was no difference in catalytic activity.

  3. Dicty_cDB: VSB590 [Dicty_cDB

    Lifescience Database Archive (English)

    Full Text Available lasmid for gene expression in pichia ciferri and transformation method using the same. 125 6e-40 4 AF053300 |AF053300.1 Pichia ciferr...ii glyceraldehyde 3-phosphate dehydrogenase (GAPDH) gene

  4. Dicty_cDB: VFC590 [Dicty_cDB

    Lifescience Database Archive (English)

    Full Text Available for gene expression in pichia ciferri and transformation method using the same. ...ciparum glyceraldehyde-3-phosphate dehydrogenase mRNA, complete cds. 78 3e-49 7 BD218177 |BD218177.1 Plasmid

  5. Main: PIIATGAPB [PLACE

    Lifescience Database Archive (English)

    Full Text Available PIIATGAPB S000382 23-Sep-2001 (last modified) kehi PII found in the Arabidopsis thalia...ydrogenase(GADPH) of A.T.; GAPB; glyceraldehyde-3-phosphate dehydrogenase; light-activated transcription; Arabidopsis thaliana TTGGTTTTGATCAAAACCAA ...

  6. Reference: PIATGAPB [PLACE

    Lifescience Database Archive (English)

    Full Text Available PIATGAPB Chan CS, Guo L, Shih MC Promoter analysis of the nuclear gene encoding the... chloroplast glyceraldehyde-3-phosphate dehydrogenase B subunit of Arabidopsis thaliana Plant Mol Biol 46: 131-141 (2001) PubMed: 11442054; ...

  7. Main: PIATGAPB [PLACE

    Lifescience Database Archive (English)

    Full Text Available PIATGAPB S000381 23-Aug-2001 (last modified) uchi PI found in the Arabidopsis thalia...drogenase(GADPH) of A.T.; GAPB; glyceraldehyde-3-phosphate dehydrogenase; light-activated transcription; Arabidopsis thaliana GTGATCAC ...

  8. The human L-threonine 3-dehydrogenase gene is an expressed pseudogene

    Directory of Open Access Journals (Sweden)

    Edgar Alasdair J

    2002-10-01

    Full Text Available Abstract Background L-threonine is an indispensable amino acid. One of the major L-threonine degradation pathways is the conversion of L-threonine via 2-amino-3-ketobutyrate to glycine. L-threonine dehydrogenase (EC 1.1.1.103 is the first enzyme in the pathway and catalyses the reaction: L-threonine + NAD+ = 2-amino-3-ketobutyrate + NADH. The murine and porcine L-threonine dehydrogenase genes (TDH have been identified previously, but the human gene has not been identified. Results The human TDH gene is located at 8p23-22 and has 8 exons spanning 10 kb that would have been expected to encode a 369 residue ORF. However, 2 cDNA TDH transcripts encode truncated proteins of 157 and 230 residues. These truncated proteins are the result of 3 mutations within the gene. There is a SNP, A to G, present in the genomic DNA sequence of some individuals which results in the loss of the acceptor splice site preceding exon 4. The acceptor splice site preceding exon 6 was lost in all 23 individuals genotyped and there is an in-frame stop codon in exon 6 (CGA to TGA resulting in arginine-214 being replaced by a stop codon. These truncated proteins would be non-functional since they have lost part of the NAD+ binding motif and the COOH terminal domain that is thought to be involved in binding L-threonine. TDH mRNA was present in all tissues examined. Conclusions The human L-threonine 3-dehydrogenase gene is an expressed pseudogene having lost the splice acceptor site preceding exon 6 and codon arginine-214 (CGA is mutated to a stop codon (TGA.

  9. Triiodothyronine (T3)-associated upregulation and downregulation of nuclear T3 binding in the human fibroblast cell (MRC-5)--stimulation of malic enzyme, glucose-6-phosphate-dehydrogenase, and 6-phosphogluconate-dehydrogenase by insulin, but not by T3

    DEFF Research Database (Denmark)

    Matzen, L E; Kristensen, S R; Kvetny, J

    1991-01-01

    The specific nuclear binding of triiodothyronine (T3) (NBT3) and the activity of malic enzyme (ME), glucose-6-phosphate-dehydrogenase (G6PD), and 6-phosphogluconate-dehydrogenase (6PGD) were studied in the human fibroblast cell (MRC-5). The overall apparent binding affinity (Ka) was 2.7 x 10(9) L...

  10. Two-dimensional electrophoresis and characterization of antigens from Paracoccidioides brasiliensis.

    Science.gov (United States)

    da Fonseca, C A; Jesuino, R S; Felipe, M S; Cunha, D A; Brito, W A; Soares, C M

    2001-06-01

    Paracoccidioides brasiliensis is a fungal pathogen of humans. To identify antigens from P. brasiliensis we fractionated a crude preparation of proteins from the fungus and detected the IgG reactive proteins by immunoblot assays of yeast cellular extracts with sera of patients with paracoccidioidomycosis (PCM). We identified and characterized six new antigens by amino acid sequencing and homology search analyses with other proteins deposited in a database. The newly characterized antigens were highly homologous to catalase, fructose-1,6-biphosphate aldolase (aldolase), glyceraldehyde-3-phosphate dehydrogenase, malate dehydrogenase and triosephosphate isomerase from several sources. The characterized antigens presented preferential synthesis in yeast cells, the host fungus phase.

  11. Inhibition of stress mediated cell death by human lactate dehydrogenase B in yeast.

    Science.gov (United States)

    Sheibani, Sara; Jones, Natalie K; Eid, Rawan; Gharib, Nada; Arab, Nagla T T; Titorenko, Vladimir; Vali, Hojatollah; Young, Paul A; Greenwood, Michael T

    2015-08-01

    We report the identification of human L- lactate dehydrogenase B (LDHB) as a novel Bax suppressor. Yeast heterologously expressing LDHB is also resistant to the lethal effects of copper indicating that it is a general suppressor of stress mediated cell death. To identify potential LDHB targets, LDHB was expressed in yeast mutants defective in apoptosis, necrosis and autophagy. The absence of functional PCD regulators including MCA1, YBH3, cyclophilin (CPR3) and VMA3, as well as the absence of the pro-survival autophagic pathway (ATG1,7) did not interfere with the LDHB mediated protection against copper indicating that LDHB functions independently of known PCD regulators or by simply blocking or stimulating a common PCD promoting or inhibitory pathway. Measurements of lactate levels revealed that short-term copper stress (1.6 mM, 4 h), does not increase intracellular levels of lactate, instead a three-fold increase in extracellular lactate was observed. Thus, yeast cells resemble mammalian cells where different stresses are known to lead to increased lactate production leading to lactic acidosis. In agreement with this, we found that the addition of exogenous lactic acid to growth media was sufficient to induce cell death that could be inhibited by the expression of LDHB. Taken together our results suggest that lactate dehydrogenase is a general suppressor of PCD in yeast. © FEMS 2015. All rights reserved. For permissions, please e-mail: journals.permissions@oup.com.

  12. One-step purification of soluble recombinant human 6-phosphogluconate dehydrogenase from Escherichia coli.

    Science.gov (United States)

    Chan, Barden; Sukhatme, Vikas P

    2013-11-01

    6-Phosphogluconate dehydrogenase (6PGD), the third enzyme in the pentose phosphate pathway, was recently identified as a novel target in human lung cancer. In this report, we present an expression and purification scheme of recombinant human 6PGD from Escherichia coli. Using a DE3 derivative strain expressing tRNAs for seven rare codons in E. coli called Rosetta2 (DE3), a large quantity of soluble human 6PGD can be expressed with an N-terminal histidine tag and purified by a one-step purification procedure to near homogeneity without denaturants or refolding. Three to seven milligrams of purified protein could be obtained from 100 ml of culture. This recombinant human 6PGD follows classic Michaelis-Menton saturation kinetics with respect to both substrates NADP(+) and 6-phosphogluconate. The respective k(cat) and K(m) were comparable to those of 6PGDs purified from mammalian tissues. Using this purified 6PGD enzyme, we devised an endpoint colorimetric assay suitable for high-throughput screening for human 6PGD inhibitors.

  13. Aldehyde dehydrogenase inhibition blocks mucosal fibrosis in human and mouse ocular scarring

    Science.gov (United States)

    Ahadome, Sarah D.; Abraham, David J.; Rayapureddi, Suryanarayana; Saw, Valerie P.; Saban, Daniel R.; Calder, Virginia L.; Norman, Jill T.; Ponticos, Markella; Daniels, Julie T.; Dart, John K.

    2016-01-01

    Mucous membrane pemphigoid (MMP) is a systemic mucosal scarring disease, commonly causing blindness, for which there is no antifibrotic therapy. Aldehyde dehydrogenase family 1 (ALDH1) is upregulated in both ocular MMP (OMMP) conjunctiva and cultured fibroblasts. Application of the ALDH metabolite, retinoic acid (RA), to normal human conjunctival fibroblasts in vitro induced a diseased phenotype. Conversely, application of ALDH inhibitors, including disulfiram, to OMMP fibroblasts in vitro restored their functionality to that of normal controls. ALDH1 is also upregulated in the mucosa of the mouse model of scarring allergic eye disease (AED), used here as a surrogate for OMMP, in which topical application of disulfiram decreased fibrosis in vivo. These data suggest that progressive scarring in OMMP results from ALDH/RA fibroblast autoregulation, that the ALDH1 subfamily has a central role in immune-mediated ocular mucosal scarring, and that ALDH inhibition with disulfiram is a potential and readily translatable antifibrotic therapy. PMID:27699226

  14. Comparative Study on Sequence–Structure–Function Relationship of the Human Short-chain Dehydrogenases/Reductases Protein Family

    OpenAIRE

    Tang, Nu Thi Ngoc; Le, Ly

    2014-01-01

    Human short-chain dehydrogenases/reductases (SDRs) protein family has been the subject of recent studies for its critical role in human metabolism. Studies also found that single nucleotide polymorphisms of the SDR protein family were responsible for a variety of genetic diseases, including type II diabetes. This study reports the effect of sequence variation on the structural and functional integrities of human SDR protein family using phylogenetics and correlated mutation analysis tools. Ou...

  15. Determination of the in vivo NAD:NADH ratio in Saccharomyces cerevisiae under anaerobic conditions, using alcohol dehydrogenase as sensor reaction.

    Science.gov (United States)

    Bekers, K M; Heijnen, J J; van Gulik, W M

    2015-08-01

    With the current quantitative metabolomics techniques, only whole-cell concentrations of NAD and NADH can be quantified. These measurements cannot provide information on the in vivo redox state of the cells, which is determined by the ratio of the free forms only. In this work we quantified free NAD:NADH ratios in yeast under anaerobic conditions, using alcohol dehydrogenase (ADH) and the lumped reaction of glyceraldehyde-3-phosphate dehydrogenase and 3-phosphoglycerate kinase as sensor reactions. We showed that, with an alternative accurate acetaldehyde determination method, based on rapid sampling, instantaneous derivatization with 2,4 diaminophenol hydrazine (DNPH) and quantification with HPLC, the ADH-catalysed oxidation of ethanol to acetaldehyde can be applied as a relatively fast and simple sensor reaction to quantify the free NAD:NADH ratio under anaerobic conditions. We evaluated the applicability of ADH as a sensor reaction in the yeast Saccharomyces cerevisiae, grown in anaerobic glucose-limited chemostats under steady-state and dynamic conditions. The results found in this study showed that the cytosolic redox status (NAD:NADH ratio) of yeast is at least one order of magnitude lower, and is thus much more reduced, under anaerobic conditions compared to aerobic glucose-limited steady-state conditions. The more reduced state of the cytosol under anaerobic conditions has major implications for (central) metabolism. Accurate determination of the free NAD:NADH ratio is therefore of importance for the unravelling of in vivo enzyme kinetics and to judge accurately the thermodynamic reversibility of each redox reaction.

  16. Structural Basis for Flip-Flop Action of Thiamin-Dependent Enzymes Revealed by Crystal Structure of Human Pyruvate Dehydrogenase

    Science.gov (United States)

    Ciszak, Ewa; Korotchkina, Lioubov G.; Dominiak, Paulina M.; Sidhu, Sukdeep; Patel, Mulchand S.

    2003-01-01

    The biologically active derivative of vitamin B1; thiamin pyrophosphate; is used as cofactor by many enzymes that perform a wide range of catalytic functions in the pathways of energy production. In alpha2beta2-heterotetrameric human pyruvate dehydrogenase, the first catalytic component enzyme of human pyruvate dehydrogenase complex, this cofactor is used to cleave the C(sup alpha)-C(=0) bond of pyruvate followed by reductive acetyl transfer to lipoyl-dihydrolipoamide acetyltransferase, the second catalytic component of the complex. The dynamic nonequivalence of two, otherwise chemically equivalent, catalytic sites have puzzled researchers from earlier functional studies of this enzyme. In order to gain insight into the mechanism of action of this enzyme, we determined the crystal structure of the holoform of human pyruvate dehydrogenase at 1.958, resolution. We propose a kinetic model for the flip-flop action of this enzyme through the concerted approx. 2A, shuttle-like motion of the heterodimers. The similarity of thiamin pyrophosphate binding in human pyruvate dehydrogenase and other functionally related enzymes suggests this newly defined mechanism of shuttle-like motion of domains to be common for the family of thiamin pyrophosphate-dependent enzymes.

  17. Handling of human short-chain acyl-CoA dehydrogenase (SCAD) variant proteins in transgenic mice

    DEFF Research Database (Denmark)

    Kragh, Peter M; Pedersen, Christina B; Schmidt, Stine P;

    2007-01-01

    Abstract To investigate the in vivo handling of human short-chain acyl-CoA dehydrogenase (SCAD) variant proteins, three transgenic mouse lines were produced by pronuclear injection of cDNA encoding the wild-type, hSCAD-wt, and two disease causing folding variants hSCAD-319C > T and hSCAD-625G > A...

  18. Zearalenone Inhibits Rat and Human 11β-Hydroxysteroid Dehydrogenase Type 2

    Directory of Open Access Journals (Sweden)

    Linxi Li

    2015-01-01

    Full Text Available Zearalenone is a mycotoxin produced by Fusarium spp. 11β-Hydroxysteroid dehydrogenases, isoforms 1 (HSD11B1 and 2 (HSD11B2, have been demonstrated to be the regulators of the local level of active glucocorticoid, which has a broad range of physiological actions. In the present study, the potency of zearalenone was tested for the inhibition of HSD11B1 and HSD11B2 in rat and human tissues. Zearalenone showed potent inhibition of HSD11B2 with the half-maximal inhibitory concentration (IC50 calculated at 49.63 and 32.22 μM for the rat and human, respectively. Results showed that zearalenone competitively inhibited HSD11B2 when a steroid substrate was used. However, it served as an uncompetitive inhibitory factor when the cofactor NAD+ was used. In contrast, the potency of zearalenone to inhibit both rat and human HSD11B1 was diminished, with the concentration of 100 μM causing almost no inhibitory effect on the isoform. In conclusion, we observed that zearalenone is a selective inhibitor of HSD11B2, implying that this agent may cause excessive glucocorticoid action in local tissues such as kidney and placentas.

  19. Zearalenone Inhibits Rat and Human 11β-Hydroxysteroid Dehydrogenase Type 2.

    Science.gov (United States)

    Li, Linxi; Wu, Xiaolong; Guan, Hongguo; Mao, Baiping; Wang, Huang; Yuan, Xiaohuan; Chu, Yanhui; Sun, Jianliang; Ge, Ren-Shan

    2015-01-01

    Zearalenone is a mycotoxin produced by Fusarium spp. 11β-Hydroxysteroid dehydrogenases, isoforms 1 (HSD11B1) and 2 (HSD11B2), have been demonstrated to be the regulators of the local level of active glucocorticoid, which has a broad range of physiological actions. In the present study, the potency of zearalenone was tested for the inhibition of HSD11B1 and HSD11B2 in rat and human tissues. Zearalenone showed potent inhibition of HSD11B2 with the half-maximal inhibitory concentration (IC50) calculated at 49.63 and 32.22 μM for the rat and human, respectively. Results showed that zearalenone competitively inhibited HSD11B2 when a steroid substrate was used. However, it served as an uncompetitive inhibitory factor when the cofactor NAD(+) was used. In contrast, the potency of zearalenone to inhibit both rat and human HSD11B1 was diminished, with the concentration of 100 μM causing almost no inhibitory effect on the isoform. In conclusion, we observed that zearalenone is a selective inhibitor of HSD11B2, implying that this agent may cause excessive glucocorticoid action in local tissues such as kidney and placentas.

  20. Structural basis for the dysfunctioning of human 2-oxo acid dehydrogenase complexes

    NARCIS (Netherlands)

    Hengeveld, A.F.; Kok, de A.

    2002-01-01

    2-oxo acid dehydrogenase complexes are a ubiquitous family of multienzyme systems that catalyse the oxidative decarboxylation of various 2-oxo acid substrates. They play a key role in the primary energy metabolism: in glycolysis (pyruvate dehydrogenase complex), the citric acid cycle (2-oxoglutarate

  1. Structural basis for the dysfunctioning of human 2-oxo acid dehydrogenase complexes

    NARCIS (Netherlands)

    Hengeveld, A.F.; Kok, de A.

    2002-01-01

    2-oxo acid dehydrogenase complexes are a ubiquitous family of multienzyme systems that catalyse the oxidative decarboxylation of various 2-oxo acid substrates. They play a key role in the primary energy metabolism: in glycolysis (pyruvate dehydrogenase complex), the citric acid cycle (2-oxoglutarate

  2. Human GLUD2 glutamate dehydrogenase is expressed in neural and testicular supporting cells.

    Science.gov (United States)

    Spanaki, Cleanthe; Zaganas, Ioannis; Kleopa, Kleopas A; Plaitakis, Andreas

    2010-05-28

    Mammalian glutamate dehydrogenase (GDH) is an allosterically regulated enzyme that is expressed widely. Its activity is potently inhibited by GTP and thought to be controlled by the need of the cell for ATP. In addition to this housekeeping human (h) GDH1, humans have acquired (via a duplication event) a highly homologous isoenzyme (hGDH2) that is resistant to GTP. Although transcripts of GLUD2, the gene encoding hGDH2, have been detected in human neural and testicular tissues, data on the endogenous protein are lacking. Here, we developed an antibody specific for hGDH2 and used it to study human tissues. Western blot analyses revealed, to our surprise, that endogenous hGDH2 is more densely expressed in testis than in brain. At the subcellular level, hGDH2 localized to mitochondria. Study of testicular tissue using immunocytochemical and immunofluorescence methods revealed that the Sertoli cells were strongly labeled by our anti-hGDH2 antibody. In human cerebral cortex, a robust labeling of astrocytes was detected, with neurons showing faint hGDH2 immunoreactivity. Astrocytes and Sertoli cells are known to support neurons and germ cells, respectively, providing them with lactate that largely derives from the tricarboxylic acid cycle via conversion of glutamate to alpha-ketoglutarate (GDH reaction). As hGDH2 is not subject to GTP control, the enzyme is able to metabolize glutamate even when the tricarboxylic acid cycle generates GTP amounts sufficient to inactivate the housekeeping hGDH1 protein. Hence, the selective expression of hGDH2 by astrocytes and Sertoli cells may provide a significant biological advantage by facilitating metabolic recycling processes essential to the supportive role of these cells.

  3. Absorption and metabolism of fructose and its relationship with human health%果糖的吸收代谢以及与健康的关系

    Institute of Scientific and Technical Information of China (English)

    蔡雯雯; 李铎

    2016-01-01

    .Free fructose is absorbed directly by intestine via facilitated transport involving GULT5 transport proteins.Unabsorbed fructose in intestine can cause abdominal symptoms such as diarrhea and abdominal pain.When fructose exists in a 1∶1 ratio with glucose,it can be absorbed mostly.Unlike glucose,fructose can be metabolized in liver,where it can be partially converted into glucose,and mostly metabolized to fatty acid, and the latter can be synthesized into triacylglycerol. Fructose is firstly metabolized into fructose 1-phosphate by fructose to kinase referred to as fructolysis. Unlike glycolysis, in fructolysis the triose glyceraldehyde lacks a phosphate group.Fructose 1-phosphate then is hydrolyzed by aldose B to form dihydroxy acetone phosphate and glyceraldehyde.DHAP can either be isomerized to glyceraldehyde 3-phosphate by triosephosphate isomersae or reduced to glycerol 3-phosphate by glycerol 3-phosphate dehydrogenase. The glyceraldehyde produced may also be converted to glyceraldehyde 3-phosphate by glyceraldehyde kinase or further converted to glycerol 3-phosphate by glycerol 3-phosphate dehydrogenase.The metabolism of fructose yields intermediates in the gluconeogenic pathway leading to glycogen synthesis as well as fatty acid and triglyceride synthesis.Triacylglycerol can be accumulated in liver to cause non-alcohol fatty liver and insulin resistance in liver. Triglycerides are incorporated into very-low-density lipoproteins,which are released from the liver destined toward peripheral tissues for storage in both fat and muscle cells.Then,triacylglycerol can also be transported to other organs and tissues to increase the risk of insulin resistance,obesity and cardiovascular disease. Based on the available evidence,WHO recommends a reduced intake of free sugars throughout the life to limit free sugars intake to less than 10% of total energy intake.WHO suggests a further reduction of the intake of free sugars to below 5% of total energy intake. In conclusion

  4. NAD-dependent isocitrate dehydrogenase as a novel target of tributyltin in human embryonic carcinoma cells

    Science.gov (United States)

    Yamada, Shigeru; Kotake, Yaichiro; Demizu, Yosuke; Kurihara, Masaaki; Sekino, Yuko; Kanda, Yasunari

    2014-08-01

    Tributyltin (TBT) is known to cause developmental defects as endocrine disruptive chemicals (EDCs). At nanomoler concentrations, TBT actions were mediated by genomic pathways via PPAR/RXR. However, non-genomic target of TBT has not been elucidated. To investigate non-genomic TBT targets, we performed comprehensive metabolomic analyses using human embryonic carcinoma NT2/D1 cells. We found that 100 nM TBT reduced the amounts of α-ketoglutarate, succinate and malate. We further found that TBT decreased the activity of NAD-dependent isocitrate dehydrogenase (NAD-IDH), which catalyzes the conversion of isocitrate to α-ketoglutarate in the TCA cycle. In addition, TBT inhibited cell growth and enhanced neuronal differentiation through NAD-IDH inhibition. Furthermore, studies using bacterially expressed human NAD-IDH and in silico simulations suggest that TBT inhibits NAD-IDH due to a possible interaction. These results suggest that NAD-IDH is a novel non-genomic target of TBT at nanomolar levels. Thus, a metabolomic approach may provide new insights into the mechanism of EDC action.

  5. Design of an interface peptide as new inhibitor of human glucose-6-phosphate dehydrogenase.

    Science.gov (United States)

    Obiol-Pardo, Cristian; Alcarraz-Vizán, Gema; Díaz-Moralli, Santiago; Cascante, Marta; Rubio-Martinez, Jaime

    2014-04-01

    Glucose-6-phosphate dehydrogenase (G6PDH) is an essential enzyme involved in the first reaction of the oxidative branch of the pentose phosphate pathway (PPP). Recently, G6PDH was suggested as a novel target protein for cancer therapy as one of the final products of the PPP, ribose-5-phosphate, is necessary for nucleic acid synthesis and tumor progression. After analyzing the protein-protein interface of the crystal structure of human G6PDH by means of molecular dynamics simulations, we designed six interface peptides based on the natural sequence of the protein. The three most promising peptides, as predicted by binding free energy calculations, were synthesized and one of them was confirmed as a novel inhibitor of human G6PDH in experimental assays. Together, the active peptide found and its suggested binding mode proposes a new strategy for inhibiting this enzyme and should aid the further design of novel, potent and non-peptidic G6PDH inhibitors. Copyright © 2014 Elsevier Inc. All rights reserved.

  6. Novel non-steroidal inhibitors of human 11beta-hydroxysteroid dehydrogenase type 1.

    Science.gov (United States)

    Vicker, Nigel; Su, Xiangdong; Ganeshapillai, Dharshini; Smith, Andrew; Purohit, Atul; Reed, Michael J; Potter, Barry V L

    2007-05-01

    11beta-Hydroxysteroid dehydrogenase type 1 (11beta-HSD1) regulates glucocorticoid action at the pre-receptor stage by converting cortisone to cortisol. 11beta-HSD1 is selectively expressed in many tissues including the liver and adipose tissue where metabolic events are important. Metabolic syndrome relates to a number of metabolic abnormalities and currently has a prevalence of >20% in adult Americans. 11beta-HSD1 inhibitors are being investigated by many major pharmaceutical companies for type 2 diabetes and other abnormalities associated with metabolic syndrome. In this area of intense interest a number of structural types of 11beta-HSD1 inhibitor have been identified. It is important to have an array of structural types as the physicochemical properties of the compounds will determine tissue distribution, HPA effects, and ultimately clinical utility. Here we report the discovery and synthesis of three structurally different series of novel 11beta-HSD1 inhibitors that inhibit human 11beta-HSD1 in the low micromolar range. Docking studies with 1-3 into the crystal structure of human 11beta-HSD1 reveal how the molecules may interact with the enzyme and cofactor and give further scope for structure based drug design in the optimisation of these series.

  7. Discovery of novel inhibitors of human 11beta-hydroxysteroid dehydrogenase type 1.

    Science.gov (United States)

    Su, Xiangdong; Vicker, Nigel; Trusselle, Melanie; Halem, Heather; Culler, Michael D; Potter, Barry V L

    2009-03-25

    11beta-Hydroxysteroid dehydrogenases (11beta-HSDs) are key enzymes regulating the pre-receptor metabolism of glucocorticoid hormones, which play essential roles in various vital physiological processes. The modulation of 11beta-HSD type 1 activity with selective inhibitors has beneficial effects on various conditions including insulin resistance, dyslipidemia and obesity. Therefore, inhibition of tissue-specific glucocorticoid action by regulating 11beta-HSD1 constitutes a promising treatment for metabolic and cardiovascular diseases. Here we report the discovery of a series of novel adamantyl carboxamides as selective inhibitors of human 11beta-HSD1 in HEK-293 cells transfected with the HSD11B1 gene. Compounds 9 and 14 show inhibitory activity against 11beta-HSD1 with IC(50) values in 100nM range. Docking studies with the potent compound 8 into the crystal structure of human 11beta-HSD1 (1XU9) reveals how the molecule may interact with the enzyme and cofactor.

  8. The relationship between human skeletal muscle pyruvate dehydrogenase phosphatase activity and muscle aerobic capacity.

    Science.gov (United States)

    Love, Lorenzo K; LeBlanc, Paul J; Inglis, J Greig; Bradley, Nicolette S; Choptiany, Jon; Heigenhauser, George J F; Peters, Sandra J

    2011-08-01

    Pyruvate dehydrogenase (PDH) is a mitochondrial enzyme responsible for regulating the conversion of pyruvate to acetyl-CoA for use in the tricarboxylic acid cycle. PDH is regulated through phosphorylation and inactivation by PDH kinase (PDK) and dephosphorylation and activation by PDH phosphatase (PDP). The effect of endurance training on PDK in humans has been investigated; however, to date no study has examined the effect of endurance training on PDP in humans. Therefore, the purpose of this study was to examine differences in PDP activity and PDP1 protein content in human skeletal muscle across a range of muscle aerobic capacities. This association is important as higher PDP activity and protein content will allow for increased activation of PDH, and carbohydrate oxidation. The main findings of this study were that 1) PDP activity (r(2) = 0.399, P = 0.001) and PDP1 protein expression (r(2) = 0.153, P = 0.039) were positively correlated with citrate synthase (CS) activity as a marker for muscle aerobic capacity; 2) E1α (r(2) = 0.310, P = 0.002) and PDK2 protein (r(2) = 0.229, P =0.012) are positively correlated with muscle CS activity; and 3) although it is the most abundant isoform, PDP1 protein content only explained ∼ 18% of the variance in PDP activity (r(2) = 0.184, P = 0.033). In addition, PDP1 in combination with E1α explained ∼ 38% of the variance in PDP activity (r(2) = 0.383, P = 0.005), suggesting that there may be alternative regulatory mechanisms of this enzyme other than protein content. These data suggest that with higher muscle aerobic capacity (CS activity) there is a greater capacity for carbohydrate oxidation (E1α), in concert with higher potential for PDH activation (PDP activity).

  9. Inhibitory effects of Aphanizomenon flos-aquae constituents on human UDP-glucose dehydrogenase activity.

    Science.gov (United States)

    Scoglio, Stefano; Lo Curcio, Valeria; Catalani, Simona; Palma, Francesco; Battistelli, Serafina; Benedetti, Serena

    2016-12-01

    The purpose of this study was to investigate the in vitro inhibitory effects of the edible microalga Aphanizomenon flos-aquae (AFA) on human UDP-α-d-glucose 6-dehydrogenase (UGDH) activity, a cytosolic enzyme involved both in tumor progression and in phytochemical bioavailability. Both the hydrophilic and ethanolic AFA extracts as well as the constitutive active principles phycocyanin (PC), phycocyanobilin (PCB) and mycosporine-like amino acids (MAAs) were tested. Among AFA components, PCB presented the strongest inhibitory effect on UGDH activity, acting as a competitive inhibitor with respect to UDP-glucose and a non-competitive inhibitor with respect to NAD(+). In preliminary experiments, AFA PCB was also effective in reducing the colony formation capacity of PC-3 prostate cancer cells and FTC-133 thyroid cancer cells. Overall, these findings confirmed that AFA and its active principles are natural compounds with high biological activity. Further studies evaluating the effects of AFA PCB in reducing tumor cell growth and phytochemical glucuronidation are encouraged.

  10. Inhibitory properties of nerve-specific human glutamate dehydrogenase isozyme by chloroquine.

    Science.gov (United States)

    Choi, Myung-Min; Kim, Eun-A; Choi, Soo Young; Kim, Tae Ue; Cho, Sung-Woo; Yang, Seung-Ju

    2007-11-30

    Human glutamate dehydrogenase exists in hGDH1 (housekeeping isozyme) and in hGDH2 (nerve-specific isozyme), which differ markedly in their allosteric regulation. In the nervous system, GDH is enriched in astrocytes and is important for recycling glutamate, a major excitatory neurotransmitter during neurotransmission. Chloroquine has been known to be a potent inhibitor of house-keeping GDH1 in permeabilized liver and kidney-cortex of rabbit. However, the effects of chloroquine on nerve-specific GDH2 have not been reported yet. In the present study, we have investigated the effects of chloroquine on hGDH2 at various conditions and showed that chloroquine could inhibit the activity of hGDH2 at dose-dependent manner. Studies of the chloroquine inhibition on enzyme activity revealed that hGDH2 was relatively less sensitive to chloroquine inhibition than house-keeping hGDH1. Incubation of hGDH2 was uncompetitive with respect of NADH and non-competitive with respect of 2-oxoglutarate. The inhibitory effect of chloroquine on hGDH2 was abolished, although in part, by the presence of ADP and L-leucine, whereas GTP did not change the sensitivity to chloroquine inhibition. Our results show a possibility that chloroquine may be used in regulating GDH activity and subsequently glutamate concentration in the central nervous system.

  11. The structure of apo human glutamate dehydrogenase details subunit communication and allostery.

    Science.gov (United States)

    Smith, Thomas J; Schmidt, Timothy; Fang, Jie; Wu, Jane; Siuzdak, Gary; Stanley, Charles A

    2002-05-01

    The structure of human glutamate dehydrogenase (GDH) has been determined in the absence of active site and regulatory ligands. Compared to the structures of bovine GDH that were complexed with coenzyme and substrate, the NAD binding domain is rotated away from the glutamate-binding domain. The electron density of this domain is more disordered the further it is from the pivot helix. Mass spectrometry results suggest that this is likely due to the apo form being more dynamic than the closed form. The antenna undergoes significant conformational changes as the catalytic cleft opens. The ascending helix in the antenna moves in a clockwise manner and the helix in the descending strand contracts in a manner akin to the relaxation of an extended spring. A number of spontaneous mutations in this antenna region cause the hyperinsulinism/hyperammonemia syndrome by decreasing GDH sensitivity to the inhibitor, GTP. Since these residues do not directly contact the bound GTP, the conformational changes in the antenna are apparently crucial to GTP inhibition. In the open conformation, the GTP binding site is distorted such that it can no longer bind GTP. In contrast, ADP binding benefits by the opening of the catalytic cleft since R463 on the pivot helix is pushed into contact distance with the beta-phosphate of ADP. These results support the previous proposal that purines regulate GDH activity by altering the dynamics of the NAD binding domain. Finally, a possible structural mechanism for negative cooperativity is presented.

  12. Estrogen modification of human glutamate dehydrogenases is linked to enzyme activation state.

    Science.gov (United States)

    Borompokas, Nikolas; Papachatzaki, Maria-Martha; Kanavouras, Konstantinos; Mastorodemos, Vasileios; Zaganas, Ioannis; Spanaki, Cleanthe; Plaitakis, Andreas

    2010-10-08

    Mammalian glutamate dehydrogenase (GDH) is a housekeeping enzyme central to the metabolism of glutamate. Its activity is potently inhibited by GTP (IC(50) = 0.1-0.3 μM) and thought to be controlled by the need of the cell in ATP. Estrogens are also known to inhibit mammalian GDH, but at relatively high concentrations. Because, in addition to this housekeeping human (h) GDH1, humans have acquired via a duplication event an hGDH2 isoform expressed in human cortical astrocytes, we tested here the interaction of estrogens with the two human isoenzymes. The results showed that, under base-line conditions, diethylstilbestrol potently inhibited hGDH2 (IC(50) = 0.08 ± 0.01 μM) and with ∼18-fold lower affinity hGDH1 (IC(50) = 1.67 ± 0.06 μM; p < 0.001). Similarly, 17β-estradiol showed a ∼18-fold higher affinity for hGDH2 (IC(50) = 1.53 ± 0.24 μM) than for hGDH1 (IC(50) = 26.94 ± 1.07 μM; p < 0.001). Also, estriol and progesterone were more potent inhibitors of hGDH2 than hGDH1. Structure/function analyses revealed that the evolutionary R443S substitution, which confers low basal activity, was largely responsible for sensitivity of hGDH2 to estrogens. Inhibition of both human GDHs by estrogens was inversely related to their state of activation induced by ADP, with the slope of this correlation being steeper for hGDH2 than for hGDH1. Also, the study of hGDH1 and hGDH2 mutants displaying different states of activation revealed that the affinity of estrogen for these enzymes correlated inversely (R = 0.99; p = 0.0001) with basal catalytic activity. Because astrocytes are known to synthesize estrogens, these hormones, by interacting potently with hGDH2 in its closed state, may contribute to regulation of glutamate metabolism in brain.

  13. Sperm motility under exposure of hydrogen dioxide

    Directory of Open Access Journals (Sweden)

    V. V. Evdokimov

    2015-01-01

    Full Text Available The paper contains research data on the effect of low concentrations of hydrogen dioxide on human sperm motility and specific enzyme activity of sperms of glyceraldehyde-3-phosphate dehydrogenase. It is shown that incubation of sperms with hydrogen dioxide in a low concentration leads to a change and motility in sperm and activity of sperm enzyme. Intensity of observed effect depended on the concentration of hydrogen dioxide: active mobility increased by 17–19 % and the total mobility – 11 %. Motility changes in sperms were accompanied by increased activity of glyceraldehyde-3-phosphate dehydrogenase by 24 %, in normozoospermia response was higher than in pathozoospermia and also depended on the concentration of hydrogen dioxide. The use of sperm analyzer enabled revealing changes in the diapason of different speeds of the active fraction of sperm, which have been observed in the first 15 min of incubation with hydrogen dioxide. A possible mechanism of action of the detected effect is discussed. Reactive oxygen species easily oxidize enzyme for glyceraldehyde-3-phosphate dehydrogenase of sperms, which leads to a loss of sperm motility, for example, in varicocele. Initially low enzyme activity in varicocele (pathozoospermia may be associated with the suppression of sperm antioxidant defense. Addition of low concentrations of hydrogen dioxide into sperm samples leads to an increase in the concentration of reduced glutathione in a cell. Increase of sperm motility in this case can serve as an indicator of normal operation of the cellular antioxidant defense system. Obtained experimental results provide a background for their introduction into clinical practice in the program of assisted reproductive technologies. 

  14. Sperm motility under exposure of hydrogen dioxide

    Directory of Open Access Journals (Sweden)

    V. V. Evdokimov

    2015-04-01

    Full Text Available The paper contains research data on the effect of low concentrations of hydrogen dioxide on human sperm motility and specific enzyme activity of sperms of glyceraldehyde-3-phosphate dehydrogenase. It is shown that incubation of sperms with hydrogen dioxide in a low concentration leads to a change and motility in sperm and activity of sperm enzyme. Intensity of observed effect depended on the concentration of hydrogen dioxide: active mobility increased by 17–19 % and the total mobility – 11 %. Motility changes in sperms were accompanied by increased activity of glyceraldehyde-3-phosphate dehydrogenase by 24 %, in normozoospermia response was higher than in pathozoospermia and also depended on the concentration of hydrogen dioxide. The use of sperm analyzer enabled revealing changes in the diapason of different speeds of the active fraction of sperm, which have been observed in the first 15 min of incubation with hydrogen dioxide. A possible mechanism of action of the detected effect is discussed. Reactive oxygen species easily oxidize enzyme for glyceraldehyde-3-phosphate dehydrogenase of sperms, which leads to a loss of sperm motility, for example, in varicocele. Initially low enzyme activity in varicocele (pathozoospermia may be associated with the suppression of sperm antioxidant defense. Addition of low concentrations of hydrogen dioxide into sperm samples leads to an increase in the concentration of reduced glutathione in a cell. Increase of sperm motility in this case can serve as an indicator of normal operation of the cellular antioxidant defense system. Obtained experimental results provide a background for their introduction into clinical practice in the program of assisted reproductive technologies. 

  15. Cortisol Release From Adipose Tissue by 11β-Hydroxysteroid Dehydrogenase Type 1 in Humans

    Science.gov (United States)

    Stimson, Roland H.; Andersson, Jonas; Andrew, Ruth; Redhead, Doris N.; Karpe, Fredrik; Hayes, Peter C.; Olsson, Tommy; Walker, Brian R.

    2009-01-01

    OBJECTIVE—11β-Hydroxysteroid dehydrogenase type 1 (11β-HSD1) regenerates cortisol from cortisone. 11β-HSD1 mRNA and activity are increased in vitro in subcutaneous adipose tissue from obese patients. Inhibition of 11β-HSD1 is a promising therapeutic approach in type 2 diabetes. However, release of cortisol by 11β-HSD1 from adipose tissue and its effect on portal vein cortisol concentrations have not been quantified in vivo. RESEARCH DESIGN AND METHODS—Six healthy men underwent 9,11,12,12-[2H]4-cortisol infusions with simultaneous sampling of arterialized and superficial epigastric vein blood sampling. Four men with stable chronic liver disease and a transjugular intrahepatic porto-systemic shunt in situ underwent tracer infusion with simultaneous sampling from the portal vein, hepatic vein, and an arterialized peripheral vein. RESULTS—Significant cortisol and 9,12,12-[2H]3-cortisol release were observed from subcutaneous adipose tissue (15.0 [95% CI 0.4–29.5] and 8.7 [0.2–17.2] pmol · min−1 · 100 g−1 adipose tissue, respectively). Splanchnic release of cortisol and 9,12,12-[2H]3-cortisol (13.5 [3.6–23.5] and 8.0 [2.6–13.5] nmol/min, respectively) was accounted for entirely by the liver; release of cortisol from visceral tissues into portal vein was not detected. CONCLUSIONS—Cortisol is released from subcutaneous adipose tissue by 11β-HSD1 in humans, and increased enzyme expression in obesity is likely to increase local glucocorticoid signaling and contribute to whole-body cortisol regeneration. However, visceral adipose 11β-HSD1 activity is insufficient to increase portal vein cortisol concentrations and hence to influence intrahepatic glucocorticoid signaling. PMID:18852329

  16. An optimised system for refolding of human glucose 6-phosphate dehydrogenase

    Directory of Open Access Journals (Sweden)

    Engel Paul C

    2009-03-01

    Full Text Available Abstract Background Human glucose 6-phosphate dehydrogenase (G6PD, active in both dimer and tetramer forms, is the key entry enzyme in the pentose phosphate pathway (PPP, providing NADPH for biosynthesis and various other purposes, including protection against oxidative stress in erythrocytes. Accordingly haemolytic disease is a major consequence of G6PD deficiency mutations in man, and many severe disease phenotypes are attributed to G6PD folding problems. Therefore, a robust refolding method with high recovery yield and reproducibility is of particular importance to study those clinical mutant enzymes as well as to shed light generally on the refolding process of large multi-domain proteins. Results The effects of different chemical and physical variables on the refolding of human recombinant G6PD have been extensively investigated. L-Arg, NADP+ and DTT are all major positive influences on refolding, and temperature, protein concentration, salt types and other additives also have significant impacts. With the method described here, ~70% enzyme activity could be regained, with good reproducibility, after denaturation with Gdn-HCl, by rapid dilution of the protein, and the refolded enzyme displays kinetic and CD properties indistinguishable from those of the native protein. Refolding under these conditions is relatively slow, taking about 7 days to complete at room temperature even in the presence of cyclophilin A, a peptidylprolyl isomerase reported to increase refolding rates. The refolded protein intermediates shift from dominant monomer to dimer during this process, the gradual emergence of dimer correlating well with the regain of enzyme activity. Conclusion L-Arg is the key player in the refolding of human G6PD, preventing the aggregation of folding intermediate, and NADP+ is essential for the folding intermediate to adopt native structure. The refolding protocol can be applied to produce high recovery yield of folded protein with

  17. Identification and regional localization of a human IMP dehydrogenase-like locus (IMPHDL1) at 16p13. 13

    Energy Technology Data Exchange (ETDEWEB)

    Doggett, N.A.; Tesmer, J.G.; Duesing, L.A. (Los Alamos National Lab., NM (United States)); Callen, D.F.; Chen, Z.L.; Moore, S. (Adelaide Children' s Hospital, North Adelaide (Australia)); Stallings, R.L. (Univ. of Pittsburgh, PA (United States))

    1993-12-01

    Sequence-tagged sites (STS)s are versatile chromosomal markers for a variety of genome mapping efforts. In this report, the authors describe a randomly generated STS (323F4) from human chromosome 16 genomic DNA that has 90.0% sequence identity to the type I human inosine-5[prime]-monophosphate dehydrogenase (IMPDH1) gene and 72% identity to the type II human inosine-5[prime]-monophosphate dehydrogenase (IMPDH2) gene. Additional sequencing by primer walking has provided a total of 1380 bp of the human chromosome 16 sequence. The IMPDH-like sequence 323F4 was regionally localized by PCR analysis of a panel of somatic cell hybrids containing different portions of human chromosome 16 to 16p13.3-13.12, between the breakpoints found in hybrids CY196/CY197 and CY198. This regional mapping assignment was further refined to subband 16p13.3 by high-resolution fluorescence in situ hybridization using cosmid 323F4 as a probe. The authors conclude that a third, previously undescribed IMPDH locus, termed IMPDHL1, exists at human chromosome 16p13.13. 11 refs., 2 figs.

  18. Structural Basis for Inactivation of the Human Pyruvate Dehydrogenase Complex by Phosphorylation: Role of Disordered Phosphorylation Loops

    Energy Technology Data Exchange (ETDEWEB)

    Kato, Masato; Wynn, R. Max; Chuang, Jacinta L.; Tso, Shih-Chia; Machius, Mischa; Li, Jun; Chuang, David T. (UTSMC)

    2009-09-11

    We report the crystal structures of the phosporylated pyruvate dehydrogenase (E1p) component of the human pyruvate dehydrogenase complex (PDC). The complete phosphorylation at Ser264-{alpha} (site 1) of a variant E1p protein was achieved using robust pyruvate dehydrogenase kinase 4 free of the PDC core. We show that unlike its unmodified counterpart, the presence of a phosphoryl group at Ser264-{alpha} prevents the cofactor thiamine diphosphate-induced ordering of the two loops carrying the three phosphorylation sites. The disordering of these phosphorylation loops is caused by a previously unrecognized steric clash between the phosphoryl group at site 1 and a nearby Ser266-{alpha}, which nullifies a hydrogen-bonding network essential for maintaining the loop conformations. The disordered phosphorylation loops impede the binding of lipoyl domains of the PDC core to E1p, negating the reductive acetylation step. This results in the disruption of the substrate channeling in the PDC, leading to the inactivation of this catalytic machine.

  19. Growth hormone-induced insulin resistance in human subjects involves reduced pyruvate dehydrogenase activity

    DEFF Research Database (Denmark)

    Nellemann, Birgitte; Vendelbo, Mikkel H; Nielsen, Thomas S

    2014-01-01

    Insulin resistance induced by growth hormone (GH) is linked to promotion of lipolysis by unknown mechanisms. We hypothesized that suppression of the activity of pyruvate dehydrogenase in the active form (PDHa) underlies GH-induced insulin resistance similar to what is observed during fasting....

  20. Activation of Human Salivary Aldehyde Dehydrogenase by Sulforaphane: Mechanism and Significance

    Science.gov (United States)

    Alam, Md. Fazle; Laskar, Amaj Ahmed; Maryam, Lubna

    2016-01-01

    Cruciferous vegetables contain the bio-active compound sulforaphane (SF) which has been reported to protect individuals against various diseases by a number of mechanisms, including activation of the phase II detoxification enzymes. In this study, we show that the extracts of five cruciferous vegetables that we commonly consume and SF activate human salivary aldehyde dehydrogenase (hsALDH), which is a very important detoxifying enzyme in the mouth. Maximum activation was observed at 1 μg/ml of cabbage extract with 2.6 fold increase in the activity. There was a ~1.9 fold increase in the activity of hsALDH at SF concentration of ≥ 100 nM. The concentration of SF at half the maximum response (EC50 value) was determined to be 52 ± 2 nM. There was an increase in the Vmax and a decrease in the Km of the enzyme in the presence of SF. Hence, SF interacts with the enzyme and increases its affinity for the substrate. UV absorbance, fluorescence and CD studies revealed that SF binds to hsALDH and does not disrupt its native structure. SF binds with the enzyme with a binding constant of 1.23 x 107 M-1. There is one binding site on hsALDH for SF, and the thermodynamic parameters indicate the formation of a spontaneous strong complex between the two. Molecular docking analysis depicted that SF fits into the active site of ALDH3A1, and facilitates the catalytic mechanism of the enzyme. SF being an antioxidant, is very likely to protect the catalytic Cys 243 residue from oxidation, which leads to the increase in the catalytic efficiency and hence the activation of the enzyme. Further, hsALDH which is virtually inactive towards acetaldehyde exhibited significant activity towards it in the presence of SF. It is therefore very likely that consumption of large quantities of cruciferous vegetables or SF supplements, through their activating effect on hsALDH can protect individuals who are alcohol intolerant against acetaldehyde toxicity and also lower the risk of oral cancer

  1. Phosphatidylethanolamine N-methyltransferase and choline dehydrogenase gene polymorphisms are associated with human sperm concentration

    Institute of Scientific and Technical Information of China (English)

    Leandros Lazaros; Ioannis Georgiou; Nectaria Xita; Elissavet Hatzi; Apostolos Kaponis; Georgios Makrydimas; Atsushi Takenaka; Nikolaos Sofikitis; Theodoros Stefos; Konstantinos Zikopoulos

    2012-01-01

    Choline is a crucial factor in the regulation of sperm membrane structure and fluidity,and this nutrient plays an important role in the maturation and fertilizing capacity of spermatozoa.Transcripts of phosphatidylethanolamine N-methyltransferase (PEMT) and choline dehydrogenase (CHDH),two basic enzymes of choline metabolism,have been observed in the human testis,demonstrating their gene expression in this tissue.In the present study,we explored the contribution of the PEMTand CHDHgene variants to sperm parameters.Two hundred oligospermic and 250 normozoospermic men were recruited.DNA was extracted from the spermatozoa,and the PEMT -774G>C and CHDH +432G>T polymorphisms were genotyped.The genotype distribution of the PEMT -774G>C polymorphism did not differ between oligospermic and normozoospermic men.In contrast,in the case of the CHDH +432G>T polymorphism,oligospermic men presented the CHDH432G/G genotype more frequently than normozoospermic men (62% vs.42%,P<0.001).The PEMT774G/G genotype was associated with a higher sperm concentration compared to the PEMT774G/C and 774C/C genotypes in oligospermic men (12.5±5.6×106 spermatozoa ml-1 vs.8.3±5.2×106 spermatozoa ml-1,P<0.002) and normozoospermic men (81.5±55.6×106 vs.68.1±44.5× 106 spermatozoa ml-1,P<0.006).In addition,the CHDH432G/G genotype was associated with higher sperm concentration compared to CHDH432G/T and 432T/T genotypes in oligospermic (11.8± 5.1 × 106 VS.7.8±5.3 × 106spermatozoa ml-1,P<0.003)and normozoospermic men(98.6±62.2×106vs.58.8±33.6×106 spermatozoa ml-1,p<0.001).In our series,the PEMT-774G>C and CHDH +432G>T polymorphisms were associated with sperm concentration.This finding suggests a possible influence of these genes on sperm quality.

  2. Ethanol metabolism by HeLa cells transduced with human alcohol dehydrogenase isoenzymes: control of the pathway by acetaldehyde concentration.

    Science.gov (United States)

    Matsumoto, Michinaga; Cyganek, Izabela; Sanghani, Paresh C; Cho, Won Kyoo; Liangpunsakul, Suthat; Crabb, David W

    2011-01-01

    Human class I alcohol dehydrogenase 2 isoenzymes (encoded by the ADH1B locus) have large differences in kinetic properties; however, individuals inheriting the alleles for the different isoenzymes exhibit only small differences in alcohol elimination rates. This suggests that other cellular factors must regulate the activity of the isoenzymes. The activity of the isoenzymes expressed from ADH1B*1, ADH1B*2, and ADH1B*3 cDNAs was examined in stably transduced HeLa cell lines, including lines which expressed human low K(m) aldehyde dehydrogenase (ALDH2). The ability of the cells to metabolize ethanol was compared with that of HeLa cells expressing rat class I alcohol dehydrogenase (ADH) (HeLa-rat ADH cells), rat hepatoma (H4IIEC3) cells, and rat hepatocytes. The isoenzymes had similar protein half-lives in the HeLa cells. Rat hepatocytes, H4IIEC3 cells, and HeLa-rat ADH cells oxidized ethanol much faster than the cells expressing the ADH1B isoenzymes. This was not explained by high cellular NADH levels or endogenous inhibitors; but rather because the activity of the β1 and β2 ADHs was constrained by the accumulation of acetaldehyde, as shown by the increased rate of ethanol oxidation by cell lines expressing β2 ADH plus ALDH2. The activity of the human β2 ADH isoenzyme is sensitive to inhibition by acetaldehyde, which likely limits its activity in vivo. This study emphasizes the importance of maintaining a low steady-state acetaldehyde concentration in hepatocytes during ethanol metabolism. Copyright © 2010 by the Research Society on Alcoholism.

  3. Glucocorticoid-mediated effects on metabolism are reversed by targeting 11 beta hydroxysteroid dehydrogenase type 1 in human skeletal muscle.

    Science.gov (United States)

    Salehzadeh, Firoozeh; Al-Khalili, Lubna; Kulkarni, Sameer S; Wang, Minghan; Lönnqvist, Fredrik; Krook, Anna

    2009-03-01

    Adipose tissue and liver play important roles in mediating the metabolic actions of glucocorticoids. However, the effects of glucocorticoids on glucose and lipid metabolism in skeletal muscle are not understood completely. Intracellular glucocorticoid action is dependent on 11 beta-hydroxysteroid dehydrogenase 1 (HSD1), an enzyme that converts cortisone to active cortisol. We investigated the direct role of HSD1 in cultured primary human skeletal muscle cells using siRNA and pharmacological inhibitors of the enzyme. Primary human skeletal muscle cells were cultured in the presence of 0.5 microM cortisone or 0.5 microM cortisol for eight days. siRNA was utilized to reduce expression of either HSD1 or pyruvate dehydrogenase kinase (PDK) 4. Effects of pharmacological inhibitors of HSD1 were also studied. Exposure to cortisone or cortisol decreased basal glucose uptake and glucose incorporation into glycogen, but was without effect on the insulin-stimulated response. Glucocorticoid exposure increased palmitate oxidation, as well as the expression of PDK4. siRNA-mediated reduction or pharmacological inhibition of HSD1 prevented the effects of cortisone, but not cortisol, on metabolic responses. siRNA-mediated reduction of PDK4 prevented the effect of cortisol to attenuate glycogen synthesis. Targeted reduction or pharmacological inhibition of HSD1 in primary human skeletal muscle cells prevents the effects of cortisone, but not cortisol, on glucose metabolism and palmitate oxidation. Furthermore, the glucocorticoid-mediated reductions in glucose metabolism are dependent on PDK4.

  4. Inhibition of human alcohol and aldehyde dehydrogenases by cimetidine and assessment of its effects on ethanol metabolism.

    Science.gov (United States)

    Lai, Ching-Long; Li, Yeung-Pin; Liu, Chiu-Ming; Hsieh, Hsiu-Shan; Yin, Shih-Jiun

    2013-02-25

    Previous studies have reported that cimetidine, an H2-receptor antagonist used to treat gastric and duodenal ulcers, can inhibit alcohol dehydrogenases (ADHs) and ethanol metabolism. Human alcohol dehydrogenases and aldehyde dehydrogenases (ALDHs), the principal enzymes responsible for metabolism of ethanol, are complex enzyme families that exhibit functional polymorphisms among ethnic groups and distinct tissue distributions. We investigated the inhibition by cimetidine of alcohol oxidation by recombinant human ADH1A, ADH1B1, ADH1B2, ADH1B3, ADH1C1, ADH1C2, ADH2, and ADH4, and aldehyde oxidation by ALDH1A1 and ALDH2 at pH 7.5 and a cytosolic NAD(+) concentration. Cimetidine acted as competitive or noncompetitive inhibitors for the ADH and ALDH isozymes/allozymes with near mM inhibition constants. The metabolic interactions between cimetidine and ethanol/acetaldehyde were assessed by computer simulation using the inhibition equations and the determined kinetic constants. At therapeutic drug levels (0.015 mM) and physiologically relevant concentrations of ethanol (10 mM) and acetaldehyde (10 μM) in target tissues, cimetidine could weakly inhibit (<5%) the activities of ADH1B2 and ADH1B3 in liver, ADH2 in liver and small intestine, ADH4 in stomach, and ALDH1A1 in the three tissues, but not significantly affect ADH1A, ADH1B1, ADH1C1/2, or ALDH2. At higher drug levels, which may accumulate in cells (0.2 mM), the activities of the weakly-inhibited enzymes may be decreased more significantly. The quantitative effects of cimetidine on metabolism of ethanol and other physiological substrates of ADHs need further investigation. Copyright © 2012 Elsevier Ireland Ltd. All rights reserved.

  5. Identification of substituted 2-thio-6-oxo-1,6-dihydropyrimidines as inhibitors of human lactate dehydrogenase.

    Science.gov (United States)

    Dragovich, Peter S; Fauber, Benjamin P; Corson, Laura B; Ding, Charles Z; Eigenbrot, Charles; Ge, HongXiu; Giannetti, Anthony M; Hunsaker, Thomas; Labadie, Sharada; Liu, Yichin; Malek, Shiva; Pan, Borlan; Peterson, David; Pitts, Keith; Purkey, Hans E; Sideris, Steve; Ultsch, Mark; VanderPorten, Erica; Wei, BinQing; Xu, Qing; Yen, Ivana; Yue, Qin; Zhang, Huihui; Zhang, Xuying

    2013-06-01

    A novel 2-thio-6-oxo-1,6-dihydropyrimidine-containing inhibitor of human lactate dehydrogenase (LDH) was identified by high-throughput screening (IC50=8.1 μM). Biochemical, surface plasmon resonance, and saturation transfer difference NMR experiments indicated that the compound specifically associated with human LDHA in a manner that required simultaneous binding of the NADH co-factor. Structural variation of the screening hit resulted in significant improvements in LDHA biochemical inhibition activity (best IC50=0.48 μM). A crystal structure of an optimized compound bound to human LDHA was obtained and explained many of the observed structure-activity relationships. Copyright © 2013 Elsevier Ltd. All rights reserved.

  6. Genomic organization and expression of the human fatty aldehyde dehydrogenase gene (FALDH)

    Energy Technology Data Exchange (ETDEWEB)

    Rogers, G.R.; Markova, N.G.; Compton, J.G. [National Institutes of Health, Bethesda, MD (United States)] [and others

    1997-01-15

    Mutations in the fatty aldehyde dehydrogenase (FALDH) gene cause Sjoegren-Larsson syndrome (SLS) - a disease characterized by mental retardation, spasticity, and congenital ichthyosis. To facilitate mutation analysis in SLS and to study the pathogenesis of FALDH deficiency, we have determined the structural organization and characterized expression of the FALDH (proposed designation ALDH10) gene. The gene consists of 10 exons spanning about 30.5 kb. A TATA-less promoter is associated with the major transcription initiation site found to be 258 hp upstream of the ATG codon. The G4C-rich sequences surrounding the transcription initiation site encompassed regulatory elements that interacted with proteins in HeLa nuclear extracts and were able to promote transcription in vitro. FALDH is widely expressed as three transcripts of 2, 3.8, and 4.0 kb, which originate from multiple polyadenylation signals in the 3{prime} UTR. An alternatively spliced mRNA was detected that contains an extra exon and encodes an enzyme that is likely to have altered membrane-binding properties. The FALDH gene lies only 50-85 kb from ALDH3, an aldehyde dehydrogenase gene that has homologous sequence and intron/exon structure. 25 refs., 4 figs., 1 tab.

  7. Crystal Structure of Human Dihydrolipoamide Dehydrogenase: NAD[superscript +]/NADH Binding and the Structural Basis of Disease-causing Mutations

    Energy Technology Data Exchange (ETDEWEB)

    Brautigam, Chad A.; Chuang, Jacinta L.; Tomchick, Diana R.; Machius, Mischa; Chuang, David T. (U. of Texas-SMED)

    2010-07-13

    Human dihydrolipoamide dehydrogenase (hE3) is an enzymatic component common to the mitochondrial {alpha}-ketoacid dehydrogenase and glycine decarboxylase complexes. Mutations to this homodimeric flavoprotein cause the often-fatal human disease known as E3 deficiency. To catalyze the oxidation of dihydrolipoamide, hE3 uses two molecules: noncovalently bound FAD and a transiently bound substrate, NAD{sup +}. To address the catalytic mechanism of hE3 and the structural basis for E3 deficiency, the crystal structures of hE3 in the presence of NAD{sup +} or NADH have been determined at resolutions of 2.5 {angstrom} and 2.1 {angstrom}, respectively. Although the overall fold of the enzyme is similar to that of yeast E3, these two structures differ at two loops that protrude from the proteins and at their FAD-binding sites. The structure of oxidized hE3 with NAD{sup +} bound demonstrates that the nicotinamide moiety is not proximal to the FAD. When NADH is present, however, the nicotinamide base stacks directly on the isoalloxazine ring system of the FAD. This is the first time that this mechanistically requisite conformation of NAD{sup +} or NADH has been observed in E3 from any species. Because E3 structures were previously available only from unicellular organisms, speculations regarding the molecular mechanisms of E3 deficiency were based on homology models. The current hE3 structures show directly that the disease-causing mutations occur at three locations in the human enzyme: the dimer interface, the active site, and the FAD and NAD{sup +}-binding sites. The mechanisms by which these mutations impede the function of hE3 are discussed.

  8. Lactate dehydrogenase is not a mitochondrial enzyme in human and mouse vastus lateralis muscle

    DEFF Research Database (Denmark)

    Rasmussen, Hans N; van Hall, Gerrit; Rasmussen, Ulla F

    2002-01-01

    procedure were assayed for marker enzymes and lactate dehydrogenase (LDH). The mitochondrial fraction contained no LDH activity (detection limit approximately 0.05 % of the tissue activity) and the distribution of LDH activity among the fractions paralleled that of pyruvate kinase, i.e. LDH was fractionated...... as a cytoplasmic enzyme. Respiratory experiments with the mitochondrial fraction also indicated the absence of LDH. Lactate did not cause respiration, nor did it affect the respiration of pyruvate + malate. The major part of the native cytochrome c was retained in the isolated mitochondria, which, furthermore......, showed high specific rates of state 3 respiration. This excluded artificial loss from the mitochondria of all activity of a possible LDH. It was concluded that skeletal muscle mitochondria are devoid of LDH and unable to metabolize lactate....

  9. Adamantyl ethanone pyridyl derivatives: potent and selective inhibitors of human 11β-hydroxysteroid dehydrogenase type 1.

    Science.gov (United States)

    Su, Xiangdong; Pradaux-Caggiano, Fabienne; Vicker, Nigel; Thomas, Mark P; Halem, Heather; Culler, Michael D; Potter, Barry V L

    2011-09-05

    Elevated levels of active glucocorticoids have been implicated in the development of several phenotypes of metabolic syndrome, such as type 2 diabetes and obesity. 11β-Hydroxysteroid dehydrogenase type 1 (11β-HSD1) catalyses the intracellular conversion of inactive cortisone to cortisol. Selective 11β-HSD1 inhibitors have shown beneficial effects in various conditions, including diabetes, dyslipidemia and obesity. A series of adamantyl ethanone pyridyl derivatives has been identified, providing potent and selective inhibitors of human 11β-HSD1. Lead compounds display low nanomolar inhibition against human and mouse 11β-HSD1 and are selective for this isoform, with no activity against 11β-HSD2 and 17β-HSD1. Structure-activity relationship studies reveal that an unsubstituted pyridine tethered to an adamantyl ethanone motif through an ether or sulfoxide linker provides a suitable pharmacophore for activity. The most potent inhibitors have IC₅₀ values around 34-48 nM against human 11β-HSD1, display reasonable metabolic stability in human liver microsomes, and weak inhibition of key human CYP450 enzymes.

  10. Adamantyl Ethanone Pyridyl Derivatives: Potent and Selective Inhibitors of Human 11β-Hydroxysteroid Dehydrogenase Type 1

    Science.gov (United States)

    Su, Xiangdong; Pradaux-Caggiano, Fabienne; Vicker, Nigel; Thomas, Mark P; Halem, Heather; Culler, Michael D; Potter, Barry V L

    2011-01-01

    Elevated levels of active glucocorticoids have been implicated in the development of several phenotypes of metabolic syndrome, such as type 2 diabetes and obesity. 11β-Hydroxysteroid dehydrogenase type 1 (11β-HSD1) catalyses the intracellular conversion of inactive cortisone to cortisol. Selective 11β-HSD1 inhibitors have shown beneficial effects in various conditions, including diabetes, dyslipidemia and obesity. A series of adamantyl ethanone pyridyl derivatives has been identified, providing potent and selective inhibitors of human 11β-HSD1. Lead compounds display low nanomolar inhibition against human and mouse 11β-HSD1 and are selective for this isoform, with no activity against 11β-HSD2 and 17β-HSD1. Structure–activity relationship studies reveal that an unsubstituted pyridine tethered to an adamantyl ethanone motif through an ether or sulfoxide linker provides a suitable pharmacophore for activity. The most potent inhibitors have IC50 values around 34–48 nm against human 11β-HSD1, display reasonable metabolic stability in human liver microsomes, and weak inhibition of key human CYP450 enzymes. PMID:21714097

  11. Functional expression of a fragment of human dihydroorotate dehydrogenase by means of the baculovirus expression vector system, and kinetic investigation of the purified recombinant enzyme.

    Science.gov (United States)

    Knecht, W; Bergjohann, U; Gonski, S; Kirschbaum, B; Löffler, M

    1996-08-15

    Human mitochondrial dihydroorotate dehydrogenase (the fourth enzyme of pyrimidine de novo synthesis) has been overproduced by means of a recombinant baculovirus that contained the human cDNA fragment for this protein. After virus infection and protein expression in Trichoplusia ni cells (BTI-Tn-5B1-4), the subcellular distribution of the recombinant dihydroorotate dehydrogenase was determined by two distinct enzyme-activity assays and by Western blot analysis with anti-(dihydroorotate dehydrogenase) Ig. The targeting of the recombinant protein to the mitochondria of the insect cells was verified. The activity of the recombinant enzyme in the mitochondria of infected cells was about 740-fold above the level of dihydroorotate dehydrogenase in human liver mitochondria. In a three-step procedure, dihydroorotate dehydrogenase was purified to a specific activity of greater than 50 U/mg. Size-exclusion chromatography showed a molecular mass of 42 kDa and confirmed the existence of the fully active enzyme as a monomeric species. Fluorimetric cofactor analysis revealed the presence of FMN in recombinant dihydroorotate dehydrogenase. By kinetics analysis, Km values for dihydroorotate and ubiquinone-50 were found to be 4 microM and 9.9 microM, respectively, while Km values for dihydroorotate and decylubiquinone were 9.4 microM and 13.7 microM, respectively. The applied expression system will allow preparation of large quantities of the enzyme for structure and function studies. Purified recombinant human dihytdroorotate dehydrogenase was tested for its sensitivity to a reported inhibitor A77 1726 (2-hydroxyethyliden-cyanoacetic acid 4-trifluoromethyl anilide), which is the active metabolite of the isoxazole derivative leflunomide [5-methyl-N-(4-trifluoromethyl-phenyl)-4-isoxazole carboximide]. An IC50 value of 1 microM was determined for A77 1726. Detailed kinetics experiments revealed uncompetitive inhibition with respect to dihydroorotate (Kiu = 0.94 microM) and non

  12. The human Krebs cycle 2-oxoglutarate dehydrogenase complex creates an additional source of superoxide/hydrogen peroxide from 2-oxoadipate as alternative substrate.

    Science.gov (United States)

    Nemeria, Natalia S; Gerfen, Gary; Guevara, Elena; Nareddy, Pradeep Reddy; Szostak, Michal; Jordan, Frank

    2017-07-01

    Recently, we reported that the human 2-oxoglutarate dehydrogenase (hE1o) component of the 2-oxoglutarate dehydrogenase complex (OGDHc) could produce the reactive oxygen species superoxide and hydrogen peroxide (detected by chemical means) from its substrate 2-oxoglutarate (OG), most likely concurrently with one-electron oxidation by dioxygen of the thiamin diphosphate (ThDP)-derived enamine intermediate to a C2α-centered radical (detected by Electron Paramagnetic Resonance) [Nemeria et al., 2014 [17]; Ambrus et al. 2015 [18

  13. Telomerase prevents accelerated senescence in glucose-6-phosphate dehydrogenase (G6PD-deficient human fibroblasts

    Directory of Open Access Journals (Sweden)

    Wu Yi-Hsuan

    2009-02-01

    Full Text Available Abstract Fibroblasts derived from glucose-6-phosphate dehydrogenase (G6PD-deficient patients display retarded growth and accelerated cellular senescence that is attributable to increased accumulation of oxidative DNA damage and increased sensitivity to oxidant-induced senescence, but not to accelerated telomere attrition. Here, we show that ectopic expression of hTERT stimulates telomerase activity and prevents accelerated senescence in G6PD-deficient cells. Stable clones derived from hTERT-expressing normal and G6PD-deficient fibroblasts have normal karyotypes, and display no sign of senescence beyond 145 and 105 passages, respectively. Activation of telomerase, however, does not prevent telomere attrition in earlier-passage cells, but does stabilize telomere lengths at later passages. In addition, we provide evidence that ectopic expression of hTERT attenuates the increased sensitivity of G6PD-deficient fibroblasts to oxidant-induced senescence. These results suggest that ectopic expression of hTERT, in addition to acting in telomere length maintenance by activating telomerase, also functions in regulating senescence induction.

  14. Regulation of human cerebrospinal fluid malate dehydrogenase 1 in sporadic Creutzfeldt-Jakob disease patients

    Science.gov (United States)

    Schmitz, Matthias; Llorens, Franc; Pracht, Alexander; Thom, Tobias; Correia, Ângela; Zafar, Saima; Ferrer, Isidre; Zerr, Inga

    2016-01-01

    The identification of reliable diagnostic biomarkers in differential diagnosis of neurodegenerative diseases is an ongoing topic. A previous two-dimensional proteomic study on cerebrospinal fluid (CSF) revealed an elevated level of an enzyme, mitochondrial malate dehydrogenase 1 (MDH1), in sporadic Creutzfeldt-Jakob disease (sCJD) patients. Here, we could demonstrate the expression of MDH1 in neurons as well as in the neuropil. Its levels are lower in sCJD brains than in control brains. An examination of CSF-MDH1 in sCJD patients by ELISA revealed a significant elevation of CSF-MDH1 levels in sCJD patients (independently from the PRNP codon 129 MV genotype or the prion protein scrapie (PrPSc) type) in comparison to controls. In combination with total tau (tau), CSF-MDH1 detection exhibited a high diagnostic accuracy for sCJD diagnosis with a sensitivity of 97.5% and a specificity of 95.6%. A correlation study of MDH1 level in CSF with other neurodegenerative marker proteins revealed a significant positive correlation between MDH1 concentration with tau, 14-3-3 and neuron specific enolase level. In conclusion, our study indicated the potential of MDH1 in combination with tau as an additional biomarker in sCJD improving diagnostic accuracy of tau markedly. PMID:27852982

  15. Expression, purification and preliminary crystallographic studies of human ketohexokinase.

    Science.gov (United States)

    Kozak, M; Hayward, B; Borek, D; Bonthron, D T; Jaskólski, M

    2001-04-01

    Ketohexokinase (KHK; E.C. 2.7.1.3) catalyses the (reversible) phosphorylation of fructose to fructose-1-phosphate. KHK is the first enzyme in a specialized catabolic pathway metabolizing dietary fructose to the glycolytic intermediate glyceraldehyde-3-phosphate. Mutations inactivating KHK underlie the metabolic disorder essential fructosuria. The primary structure of KHK shows no significant homology to other mammalian hexokinases. It is most similar to prokaryotic ribokinases, but catalyses a distinct phosphorylation reaction. Recombinant human KHK has been crystallized in the orthorhombic form (space group P2(1)2(1)2 or P2(1)2(1)2(1)). Single crystals of this polymorph suitable for X-ray diffraction have been obtained by vapour diffusion using 2-propanol and MPD as precipitants (pH 7.5). The crystals have unit-cell parameters a = 93.4, b = 121.5, c = 108.4 A. Diffraction data were collected to 4.3 A resolution. The asymmetric unit contains four protein molecules.

  16. Characterisation of 11β-hydroxysteroid dehydrogenase 1 in human orbital adipose tissue: a comparison with subcutaneous and omental fat

    Science.gov (United States)

    Bujalska, Iwona J; Durrani, Omar M; Abbott, Joseph; Onyimba, Claire U; Khosla, Pamela; Moosavi, Areeb H; Reuser, Tristan T Q; Stewart, Paul M; Tomlinson, Jeremy W; Walker, Elizabeth A; Rauz, Saaeha

    2007-01-01

    Glucocorticoids (GCs) have a profound effect on adipose biology increasing tissue mass causing central obesity. The pre-receptor regulation of GCs by 11β-hydroxysteroid dehydrogenase type 1 (11β-HSD1) that activates cortisol from cortisone has been postulated as a fundamental mechanism underlying the metabolic syndrome mediating adipocyte hyperplasia and hypertrophy in the omental (OM) depot. Orbital adipose tissue (OF) is the site of intense inflammation and tissue remodelling in several orbital inflammatory disease states. In this study, we describe features of the GC metabolic pathways in normal human OF depot and compare it with subcutaneous (SC) and OM depots. Using an automated histological characterisation technique, OF adipocytes were found to be significantly smaller (parameters: area, maximum diameter and perimeter) than OM and SC adipocytes (P<0·001). Although immunohistochemical analyses demonstrated resident CD68+ cells in all three whole tissue adipose depots, OF CD68 mRNA and protein expression exceeded that of OM and SC (mRNA, P<0·05; protein, P<0·001). In addition, there was higher expression of glucocorticoid receptor (GR)α mRNA in the OF whole tissue depot (P<0·05). Conversely, 11β-HSD1 mRNA together with the markers of late adipocyte differentiation (FABP4 and G3PDH) were significantly lower in OF. Primary cultures of OF preadipocytes demonstrated predominant 11β-HSD1 oxo-reductase activity with minimal dehydrogenase activity. Orbital adipocytes are smaller, less differentiated, and express low levels of 11β-HSD1 but abundant GRα compared with SC and OM. OF harbours a large CD68+ population. These characteristics define an orbital microenvironment that has the potential to respond to sight-threatening orbital inflammatory disease. PMID:17283228

  17. Characterisation of 11beta-hydroxysteroid dehydrogenase 1 in human orbital adipose tissue: a comparison with subcutaneous and omental fat.

    Science.gov (United States)

    Bujalska, Iwona J; Durrani, Omar M; Abbott, Joseph; Onyimba, Claire U; Khosla, Pamela; Moosavi, Areeb H; Reuser, Tristan T Q; Stewart, Paul M; Tomlinson, Jeremy W; Walker, Elizabeth A; Rauz, Saaeha

    2007-02-01

    Glucocorticoids (GCs) have a profound effect on adipose biology increasing tissue mass causing central obesity. The pre-receptor regulation of GCs by 11beta-hydroxysteroid dehydrogenase type 1 (11beta-HSD1) that activates cortisol from cortisone has been postulated as a fundamental mechanism underlying the metabolic syndrome mediating adipocyte hyperplasia and hypertrophy in the omental (OM) depot. Orbital adipose tissue (OF) is the site of intense inflammation and tissue remodelling in several orbital inflammatory disease states. In this study, we describe features of the GC metabolic pathways in normal human OF depot and compare it with subcutaneous (SC) and OM depots. Using an automated histological characterisation technique, OF adipocytes were found to be significantly smaller (parameters: area, maximum diameter and perimeter) than OM and SC adipocytes (P<0 x 001). Although immunohistochemical analyses demonstrated resident CD68+ cells in all three whole tissue adipose depots, OF CD68 mRNA and protein expression exceeded that of OM and SC (mRNA, P<0 x 05; protein, P<0 x 001). In addition, there was higher expression of glucocorticoid receptor (GR)alpha mRNA in the OF whole tissue depot (P<0 x 05). Conversely, 11beta-HSD1 mRNA together with the markers of late adipocyte differentiation (FABP4 and G3PDH) were significantly lower in OF. Primary cultures of OF preadipocytes demonstrated predominant 11beta-HSD1 oxo-reductase activity with minimal dehydrogenase activity. Orbital adipocytes are smaller, less differentiated, and express low levels of 11beta-HSD1 but abundant GRalpha compared with SC and OM. OF harbours a large CD68+ population. These characteristics define an orbital microenvironment that has the potential to respond to sight-threatening orbital inflammatory disease.

  18. Inhibition of human alcohol and aldehyde dehydrogenases by acetaminophen: Assessment of the effects on first-pass metabolism of ethanol.

    Science.gov (United States)

    Lee, Yung-Pin; Liao, Jian-Tong; Cheng, Ya-Wen; Wu, Ting-Lun; Lee, Shou-Lun; Liu, Jong-Kang; Yin, Shih-Jiun

    2013-11-01

    Acetaminophen is one of the most widely used over-the-counter analgesic, antipyretic medications. Use of acetaminophen and alcohol are commonly associated. Previous studies showed that acetaminophen might affect bioavailability of ethanol by inhibiting gastric alcohol dehydrogenase (ADH). However, potential inhibitions by acetaminophen of first-pass metabolism (FPM) of ethanol, catalyzed by the human ADH family and by relevant aldehyde dehydrogenase (ALDH) isozymes, remain undefined. ADH and ALDH both exhibit racially distinct allozymes and tissue-specific distribution of isozymes, and are principal enzymes responsible for ethanol metabolism in humans. In this study, we investigated acetaminophen inhibition of ethanol oxidation with recombinant human ADH1A, ADH1B1, ADH1B2, ADH1B3, ADH1C1, ADH1C2, ADH2, and ADH4, and inhibition of acetaldehyde oxidation with recombinant human ALDH1A1 and ALDH2. The investigations were done at near physiological pH 7.5 and with a cytoplasmic coenzyme concentration of 0.5 mM NAD(+). Acetaminophen acted as a noncompetitive inhibitor for ADH enzymes, with the slope inhibition constants (Kis) ranging from 0.90 mM (ADH2) to 20 mM (ADH1A), and the intercept inhibition constants (Kii) ranging from 1.4 mM (ADH1C allozymes) to 19 mM (ADH1A). Acetaminophen exhibited noncompetitive inhibition for ALDH2 (Kis = 3.0 mM and Kii = 2.2 mM), but competitive inhibition for ALDH1A1 (Kis = 0.96 mM). The metabolic interactions between acetaminophen and ethanol/acetaldehyde were assessed by computer simulation using inhibition equations and the determined kinetic constants. At therapeutic to subtoxic plasma levels of acetaminophen (i.e., 0.2-0.5 mM) and physiologically relevant concentrations of ethanol (10 mM) and acetaldehyde (10 μm) in target tissues, acetaminophen could inhibit ADH1C allozymes (12-26%) and ADH2 (14-28%) in the liver and small intestine, ADH4 (15-31%) in the stomach, and ALDH1A1 (16-33%) and ALDH2 (8.3-19%) in all 3 tissues. The

  19. The effects of chemical and radioactive properties of Tl-201 on human erythrocyte glucose 6-phosphate dehydrogenase activity.

    Science.gov (United States)

    Sahin, Ali; Senturk, Murat; Ciftci, Mehmet; Varoglu, Erhan; Kufrevioglu, Omer Irfan

    2010-04-01

    The inhibitory effects of thallium-201 ((201)Tl) solution on human erythrocyte glucose 6-phosphate dehydrogenase (G6PD) activity were investigated. For this purpose, erythrocyte G6PD was initially purified 835-fold at a yield of 41.7% using 2',5'-Adenosine diphosphate sepharose 4B affinity gel chromatography. The purification was monitored by sodium dodecyl sulfate-polyacrylamide gel electrophoresis, which showed a single band for the final enzyme preparation. The in vitro and in vivo effects of the (201)Tl solution including Tl(+), Fe(+3) and Cu(+2) metals and the in vitro effects of the radiation effect of the (201)Tl solution and non-radioactive Tl(+), Fe(+3) and Cu(+2) metals on human erythrocyte G6PD enzyme were studied. Enzyme activity was determined with the Beutler method at 340 nm using a spectrophotometer. All purification procedures were carried out at +4 degrees C. (201)Tl solution and radiation exposure had inhibitory effects on the enzyme activity. IC(50) value of (201)Tl solution was 36.86 microl ([Tl(+)]: 0.0036 microM, [Cu(+2)]: 0.0116 microM, [Fe(+3)]: 0.0132 microM), of human erythrocytes G6PD. Seven human patients were also used for in vivo studies of (201)Tl solution. Furthermore, non-radioactive Tl(+), Fe(+3) and Cu(+2) were found not to have influenced the enzyme in vitro. Human erythrocyte G6PD activity was inhibited by exposure for up to 10 minutes to 0.057 mCi/kg (201)Tl solution. It was detected in in vitro and in vivo studies that the human erythrocyte G6PD enzyme is inhibited due to the radiation effect of (201)Tl solution. Copyright 2010 Elsevier Inc. All rights reserved.

  20. Structure-Derived Proton-Transfer Mechanism of Action Human Pyruvate Dehydrogenase

    Science.gov (United States)

    Ciszak, Ewa; Dominiak, Paulina

    2003-01-01

    The derivative of vitamin B1 thiamin pyrophosphate (TPP) is a cofactor of pyruvate dehydrogenase (E1p) that is involved in decarboxylation of pyruvate followed by reductive acetylation of lipoic acid covalently bound to a lysine residue of dihydrolipoamide acetyltransferase. The structure of E1p recently determined in our laboratory revealed patterns of association of foul subunits and specifics of two TPP binding sites. The mechanism of action in part includes a conserved hydrogen bond between the N1' atom of the aminopyrimidine ring of the cofactor and the carboxylate group of Glu59 from the beta subunits, and a V-conformation of the cofactor that brings the N4' atom of the aminopyrimidine ring to the distance of the intramolecular hydrogen bond formed with the C2-atom of the thiazolium moiety. The carboxylate group of Glu59 is the local proton acceptor that enables proton translocation within the aminopyrimidine ring and stabilization of the rare N4' - iminopyrimidine tautomer. Based on the analysis of E1p structure, we postulate that the protein environment drives N4' - amino/N4' - imino dynamics resulting in a concerted shuttle-like movement of the subunits. We also propose that this movement of the subunits is strictly coordinated with the two enzymatic reactions carried out in E1p by each of the two cofactor sites. It is proposed that these reactions are in alternating phases such that when one active site is involved in decarboxylation, the other is involved in acetylation of lipoyl noiety.

  1. Pituitary Adenoma With Paraganglioma/Pheochromocytoma (3PAs) and Succinate Dehydrogenase Defects in Humans and Mice

    Science.gov (United States)

    Xekouki, Paraskevi; Szarek, Eva; Bullova, Petra; Giubellino, Alessio; Quezado, Martha; Mastroyannis, Spyridon A.; Mastorakos, Panagiotis; Wassif, Christopher A.; Raygada, Margarita; Rentia, Nadia; Dye, Louis; Cougnoux, Antony; Koziol, Deloris; Sierra, Maria de La Luz; Lyssikatos, Charalampos; Belyavskaya, Elena; Malchoff, Carl; Moline, Jessica; Eng, Charis; Maher, Louis James; Pacak, Karel; Lodish, Maya

    2015-01-01

    Context: Germline mutations in genes coding succinate dehydrogenase (SDH) subunits A, B, C, and D have been identified in familial paragangliomas (PGLs)/pheochromocytomas (PHEOs) and other tumors. We described a GH-secreting pituitary adenoma (PA) caused by SDHD mutation in a patient with familial PGLs. Additional patients with PAs and SDHx defects have since been reported. Design: We studied 168 patients with unselected sporadic PA and with the association of PAs, PGLs, and/or pheochromocytomas, a condition we named the 3P association (3PAs) for SDHx germline mutations. We also studied the pituitary gland and hormonal profile of Sdhb+/− mice and their wild-type littermates at different ages. Results: No SDHx mutations were detected among sporadic PA, whereas three of four familial cases were positive for a mutation (75%). Most of the SDHx-deficient PAs were either prolactinomas or somatotropinomas. Pituitaries of Sdhb+/− mice older than 12 months had an increased number mainly of prolactin-secreting cells and several ultrastructural abnormalities such as intranuclear inclusions, altered chromatin nuclear pattern, and abnormal mitochondria. Igf-1 levels of mutant mice tended to be higher across age groups, whereas Prl and Gh levels varied according to age and sex. Conclusion: The present study confirms the existence of a new association that we termed 3PAs. It is due mostly to germline SDHx defects, although sporadic cases of 3PAs without SDHx defects also exist. Using Sdhb+/− mice, we provide evidence that pituitary hyperplasia in SDHx-deficient cells may be the initial abnormality in the cascade of events leading to PA formation. PMID:25695889

  2. Reference: 434 [Arabidopsis Phenome Database[Archive

    Lifescience Database Archive (English)

    Full Text Available tián P et al. 2006 Aug. Plant Mol. Biol. 61(6):945-57. Non-phosphorylating glyceraldehyde- 3-phosphate dehyd...rogenase (NP-GAPDH) is a conserved cytosolic protein found in higher plants. In photosynthetic cells, the en...ignificantly, cytosolic phosphorylating (NAD-dependent) glyceraldehyde-3-phosphat...e dehydrogenase mRNA levels are induced in the mutant, which correlates with an increase in enzyme activity....h an increase in NADPH concentration. Moreover, increased ROS levels were measured in the mutant plants. Dow

  3. Component co-expression and purification of recombinant human pyruvate dehydrogenase complex from baculovirus infected SF9 cells.

    Science.gov (United States)

    Jiang, Yong; Wang, Juan; Zhang, Guofeng; Oza, Khyati; Myers, Linda; Holbert, Marc A; Sweitzer, Sharon

    2014-05-01

    The mammalian pyruvate dehydrogenase complex (PDC) is a multi-component mitochondrial enzyme that plays a key role in the conversion of pyruvate to acetyl-CoA connecting glycolysis to the citric acid cycle. Recent studies indicate that targeting the regulation of PDC enzymatic activity might offer therapeutic opportunities by inhibiting cancer cell metabolism. To facilitate drug discovery in this area, a well defined PDC sample is needed. Here, we report a new method of producing functional, recombinant, high quality human PDC complex. All five components were co-expressed in the cytoplasm of baculovirus-infected SF9 cells by deletion of the mitochondrial localization signal sequences of all the components and E1a was FLAG-tagged to facilitate purification. The protein FLAG tagged E1a complex was purified using FLAG-M2 affinity resin, followed by Superdex 200 sizing chromatography. The E2 and E3BP components were then Lipoylated using an enzyme based in vitro process. The resulting PDC is over 90% pure and homogenous. This non-phosphorylated, lipoylated human PDC was demonstrated to produce a robust detection window when used to develop an enzyme coupled assay of PDHK.

  4. Employing FAD-dependent glucose dehydrogenase within a glucose/oxygen enzymatic fuel cell operating in human serum.

    Science.gov (United States)

    Milton, Ross D; Lim, Koun; Hickey, David P; Minteer, Shelley D

    2015-12-01

    Flavin adenine dinucleotide-dependent glucose dehydrogenase (FAD-GDH) is emerging as an oxygen-insensitive alternative to glucose oxidase (GOx) as the biocatalyst for bioelectrodes and bioanodes in glucose sensing and glucose enzymatic fuel cells (EFCs). Glucose EFCs, which utilize oxygen as the oxidant and final electron acceptor, have the added benefit of being able to be implanted within living hosts. These can then produce electrical energy from physiological glucose concentrations and power internal or external devices. EFCs were prepared with FAD-GDH and bilirubin oxidase (BOx) to evaluate the suitability of FAD-GDH within an implantable setting. Maximum current and power densities of 186.6±7.1 μA cm(-2) and 39.5±1.3 μW cm(-2) were observed when operating in human serum at 21 °C, which increased to 285.7±31.3 μA cm(-2) and 57.5±5.4 μW cm(-2) at 37 °C. Although good stability was observed with continual near-optimal operation of the EFCs in human serum at 21 °C for 24 h, device failure was observed between 13-14 h when continually operated at 37 °C.

  5. Dihydropyrimidine dehydrogenase (DPD) expression is negatively regulated by certain microRNAs in human lung tissues.

    Science.gov (United States)

    Hirota, Takeshi; Date, Yuko; Nishibatake, Yu; Takane, Hiroshi; Fukuoka, Yasushi; Taniguchi, Yuuji; Burioka, Naoto; Shimizu, Eiji; Nakamura, Hiroshige; Otsubo, Kenji; Ieiri, Ichiro

    2012-07-01

    Dihydropyrimidine dehydrogenase (DPD) is important to the antitumor effect of 5-fluorouracil (5-FU). DPD gene (DPYD) expression in tumors is correlated with sensitivity to 5-FU. Because the 5-FU accumulated in cancer cells is also rapidly converted into inactivated metabolites through catabolic pathways mediated by DPD, high DPD activity in cancer cells is an important determinant of the response to 5-FU. DPD activity is highly variable and reduced activity causes a high risk of 5-FU toxicity. Genetic variation in DPYD has been proposed as the main factor responsible for the variation in DPD activity. However, only a small proportion of the activity of DPD can be explained by DPYD mutations. In this study, we found that DPYD is a target of the following microRNAs (miRNA): miR-27a, miR-27b, miR-134, and miR-582-5p. In luciferase assays with HepG2 cells, the overexpression of these miRNAs was associated with significantly decreased reporter activity in a plasmid containing the 3'-UTR of DYPD mRNA. The level of DPD protein in MIAPaca-2 cells was also significantly decreased by the overexpression of these four miRNAs. The results suggest that miR-27a, miR-27b, miR-134, and miR-582-5p post-transcriptionally regulate DPD protein expression. The levels of miRNAs in normal lung tissue and lung tumors were compared; miR-27b and miR-134 levels were significantly lower in the tumors than normal tissue (3.64 ± 4.02 versus 9.75 ± 6.58 and 0.64 ± 0.75 versus 1.48 ± 1.39). DPD protein levels were significantly higher in the tumors. Thus, the decreased expression of miR-27b would be responsible for the high levels of DPD protein. This study is the first to show that miRNAs regulate the DPD protein, and provides new insight into 5-FU-based chemotherapy.

  6. Modulation of nuclear T3 binding by T3 in a human hepatocyte cell-line (Chang-liver) - T3 stimulation of cell growth but not of malic enzyme, glucose-6-phosphatdehydrogenase or 6-phosphogluconate-dehydrogenase

    DEFF Research Database (Denmark)

    Matzen, L E; Kristensen, S R; Kvetny, J

    1991-01-01

    The T3 modulation of nuclear T3 binding (NBT3), the T3 effect on cell growth, and the T3 and insulin effects on malic enzyme (ME), glucose-6-phosphat-dehydrogenase (G6PD) and 6-phosphogluconat-dehydrogenase (G6PD) were studied in a human hepatocyte cell-line (Chang-liver). T3 was bound to a high...

  7. Effects of methoxychlor and 2,2-bis(p-hydroxyphenyl)-1,1,1-trichloroethane on 3β-hydroxysteroid dehydrogenase and 17β-hydroxysteroid dehydrogenase-3 activities in human and rat testes.

    Science.gov (United States)

    Hu, G-X; Zhao, B; Chu, Y; Li, X-H; Akingbemi, B T; Zheng, Z-Q; Ge, R S

    2011-04-01

    Human and rat testis microsomes were used to investigate direct inhibitory activities of methoxychlor (MXC) and its metabolite 2,2-bis(p-hydroxyphenyl)-1,1,1-trichloroethane (HPTE) on 3β-hydroxysteroid dehydrogenase (3β-HSD) and 17β-hydroxysteroid dehydrogenase type 3 (17β-HSD3). The 3β-HSD and 17β-HSD3 enzymes are involved in the reactions that culminate in androgen biosynthesis in Leydig cells. The results demonstrated that MXC and HPTE inhibited human 3β-HSD activity at a concentration of 10 nm. The half maximal inhibitory concentration (IC(50) ) for MXC inhibition of 3β-HSD was 53.21 ± 15.52 μm (human) and 46.15 ± 17.94 μm (rat), and for HPTE, it was 8.29 ± 2.49 μm (human) and 13.82 ± 2.26 μm (rat). At the higher concentration of 100 μm, MXC did not affect human and rat 17β-HSD3 activity. However, the IC(50) for HPTE inhibition of 17β-HSD3 was 12.1 ± 1.9 μm (human) and 32 .0 ± 8.6 μm (rat). The mode of action of MXC and HPTE on 3β-HSD activity was non-competitive with the substrate pregnenolone, but was competitive with the cofactor NAD(+) . The mode of HPTE inhibition of 17β-HSD3 was non-competitive with the substrate androstenedione, but was competitive with the cofactor NADPH. In summary, our results showed that HPTE, which is the biologically active metabolite of MXC, has the capacity for direct inhibition of 3β-HSD and 17β-HSD3 enzyme activity. Inhibition of enzyme activity is presumably associated with suppression of steroidogenesis in gonadal tissues and has implications for testis function.

  8. Experimental determination of control of glycolysis in Lactococcus lactis

    DEFF Research Database (Denmark)

    Købmann, Brian Jensen; Andersen, Heidi Winterberg; Solem, Christian

    2002-01-01

    ), glyceraldehyde-3-phosphate dehydrogenase (GAPDH), pyruvate kinase (PYK) and lactate dehydrogenase (LDH) are shown to have no significant control on the glycolytic flux in exponentially growing cells of L. lactis MG1363. Introduction of an uncoupled ATPase activity results in uncoupling of glycolysis from biomass...

  9. Subunits of the Pyruvate Dehydrogenase Cluster of Mycoplasma pneumoniae Are Surface-Displayed Proteins that Bind and Activate Human Plasminogen.

    Directory of Open Access Journals (Sweden)

    Anne Gründel

    Full Text Available The dual role of glycolytic enzymes in cytosol-located metabolic processes and in cell surface-mediated functions with an influence on virulence is described for various micro-organisms. Cell wall-less bacteria of the class Mollicutes including the common human pathogen Mycoplasma pneumoniae possess a reduced genome limiting the repertoire of virulence factors and metabolic pathways. After the initial contact of bacteria with cells of the respiratory epithelium via a specialized complex of adhesins and release of cell-damaging factors, surface-displayed glycolytic enzymes may facilitate the further interaction between host and microbe. In this study, we described detection of the four subunits of pyruvate dehydrogenase complex (PDHA-D among the cytosolic and membrane-associated proteins of M. pneumoniae. Subunits of PDH were cloned, expressed and purified to produce specific polyclonal guinea pig antisera. Using colony blotting, fractionation of total proteins and immunofluorescence experiments, the surface localization of PDHA-C was demonstrated. All recombinant PDH subunits are able to bind to HeLa cells and human plasminogen. These interactions can be specifically blocked by the corresponding polyclonal antisera. In addition, an influence of ionic interactions on PDHC-binding to plasminogen as well as of lysine residues on the association of PDHA-D with plasminogen was confirmed. The PDHB subunit was shown to activate plasminogen and the PDHB-plasminogen complex induces degradation of human fibrinogen. Hence, our data indicate that the surface-associated PDH subunits might play a role in the pathogenesis of M. pneumoniae infections by interaction with human plasminogen.

  10. Myricetin is a novel inhibitor of human inosine 5′-monophosphate dehydrogenase with anti-leukemia activity

    Energy Technology Data Exchange (ETDEWEB)

    Pan, Huiling; Hu, Qian; Wang, Jingyuan; Liu, Zehui; Wu, Dang [Shanghai Key Laboratory of New Drug Design, School of Pharmacy, East China University of Science and Technology, 130 Mei Long Road, Shanghai 200237 (China); Lu, Weiqiang, E-mail: wqlu@bio.ecnu.edu.cn [Shanghai Key Laboratory of Regulatory Biology, Institute of Biomedical Sciences and School of Life Sciences, East China Normal University, 500 Dongchuan Road, Shanghai 200241 (China); Huang, Jin, E-mail: huangjin@ecust.edu.cn [Shanghai Key Laboratory of New Drug Design, School of Pharmacy, East China University of Science and Technology, 130 Mei Long Road, Shanghai 200237 (China)

    2016-09-02

    Human inosine 5′-monophosphate dehydrogenase (hIMPDH) is a rate-limiting enzyme in the de novo biosynthetic pathway of purine nucleotides, playing crucial roles in cellular proliferation, differentiation, and transformation. Dysregulation of hIMPDH expression and activity have been found in a variety of human cancers including leukemia. In this study, we found that myricetin, a naturally occurring phytochemical existed in berries, wine and tea, was a novel inhibitor of human type 1 and type 2 IMPDH (hIMPDH1/2) with IC{sub 50} values of 6.98 ± 0.22 μM and 4.10 ± 0.14 μM, respectively. Enzyme kinetic analysis using Lineweaver-Burk plot revealed that myricetin is a mix-type inhibitor for hIMPDH1/2. Differential scanning fluorimetry and molecular docking simulation data demonstrate that myricetin is capable of binding with hIMPDH1/2. Myricetin treatment exerts potent anti-proliferative and pro-apoptotic effects on K562 human leukemia cells in a dose-dependent manner. Importantly, cytotoxicity of myricetin on K562 cells were markedly attenuated by exogenous addition of guanosine, a salvage pathway of maintaining intracellular pool of guanine nucleotides. Taking together, these results indicate that natural product myricetin exhibits potent anti-leukemia activity by interfering with purine nucleotides biosynthetic pathway through the suppression of hIMPDH1/2 catalytic activity. - Highlights: • Myricetin, a common dietary flavonoid, is a novel inhibitor of hIMPDH1/2. • Myricetin directly binds with hIMPDH1/2 and induces cell cycle arrest and apoptosis of leukemia cells. • The cytotoxicity of myricetin on K562 cells is markedly attenuated by exogenous addition of guanosine.

  11. Altered Proteome of Burkholderia pseudomallei Colony Variants Induced by Exposure to Human Lung Epithelial Cells.

    Directory of Open Access Journals (Sweden)

    Anis Rageh Al-Maleki

    Full Text Available Burkholderia pseudomallei primary diagnostic cultures demonstrate colony morphology variation associated with expression of virulence and adaptation proteins. This study aims to examine the ability of B. pseudomallei colony variants (wild type [WT] and small colony variant [SCV] to survive and replicate intracellularly in A549 cells and to identify the alterations in the protein expression of these variants, post-exposure to the A549 cells. Intracellular survival and cytotoxicity assays were performed followed by proteomics analysis using two-dimensional gel electrophoresis. B. pseudomallei SCV survive longer than the WT. During post-exposure, among 259 and 260 protein spots of SCV and WT, respectively, 19 were differentially expressed. Among SCV post-exposure up-regulated proteins, glyceraldehyde 3-phosphate dehydrogenase, fructose-bisphosphate aldolase (CbbA and betaine aldehyde dehydrogenase were associated with adhesion and virulence. Among the down-regulated proteins, enolase (Eno is implicated in adhesion and virulence. Additionally, post-exposure expression profiles of both variants were compared with pre-exposure. In WT pre- vs post-exposure, 36 proteins were differentially expressed. Of the up-regulated proteins, translocator protein, Eno, nucleoside diphosphate kinase (Ndk, ferritin Dps-family DNA binding protein and peptidyl-prolyl cis-trans isomerase B were implicated in invasion and virulence. In SCV pre- vs post-exposure, 27 proteins were differentially expressed. Among the up-regulated proteins, flagellin, Eno, CbbA, Ndk and phenylacetate-coenzyme A ligase have similarly been implicated in adhesion, invasion. Protein profiles differences post-exposure provide insights into association between morphotypic and phenotypic characteristics of colony variants, strengthening the role of B. pseudomallei morphotypes in pathogenesis of melioidosis.

  12. Structural organization of the human short-chain acyl-CoA dehydrogenase gene

    DEFF Research Database (Denmark)

    Corydon, M J; Andresen, B S; Bross, P

    1997-01-01

    of ethylmalonic acid (EMA). To define the genetic basis of SCAD deficiency and ethylmalonic aciduria in patients, we have determined the sequence of the complete coding portion of the human SCAD gene (ACADS) and all of the intron-exon boundaries. The SCAD gene is approximately 13 kb in length and consists of 10......, 990T, 1260C) constitutes an allelic variant with a frequency of 22% in the general Danish population. Using fluorescence in-situ hybridization, we confirm the localization of the human SCAD gene to the distal part of Chromosome (Chr) 12 and suggest that the SCAD gene is a single-copy gene...

  13. 11Beta-hydroxysteroid dehydrogenase type 2 in human pregnancy and reduced expression in intrauterine growth restriction.

    Science.gov (United States)

    Shams, M; Kilby, M D; Somerset, D A; Howie, A J; Gupta, A; Wood, P J; Afnan, M; Stewart, P M

    1998-04-01

    The type 2 isoform of 11beta-hydroxysteroid dehydrogenase (11beta-HSD2), which inactivates cortisol (F) to cortisone (E), has been suggested to play a role in the ontogeny of the fetal pituitary-adrenal axis and also protect the developing fetus from the deleterious effects of circulating maternal glucocorticoids. The abundance of 11beta-HSD2 in the placenta and other fetal tissues was inferred from the F/E ratio in 17 term deliveries in both umbilical arterial (1.73 +/- 0.24, mean +/- SE) and umbilical venous blood (1.16 +/- 0.14) compared with adult peripheral venous blood (7.76 +/- 0.57, n = 70). Using sensitive assays for 11beta-HSD2 and an in-house human 11beta-HSD2 antibody, the expression and activity of this enzyme in fresh frozen human placenta increased progressively from first (8-12 weeks, n = 16) and second (13-20 weeks, n = 9) to third trimester (term) pregnancies (39-40 weeks, n = 50). Placental 11beta-HSD2 activity was significantly reduced in deliveries complicated by intrauterine growth restriction (IUGR) [25-36 weeks, n = 12, activity 380 pmol/mg/h median (225-671; 95% confidence interval)], compared with the term deliveries [888 (725-1362)] and with appropriately grown pre-term deliveries [27-36 weeks, n = 14, activity 810 (585-1269)], P < 0.05. In human pregnancy placental 11beta-HSD2 activity increases markedly in the third trimester of pregnancy at a time when maternal circulating levels of glucocorticoid are rising. The finding of attenuated placental 11beta-HSD2 activity in IUGR suggests that glucocorticoids may, in part, contribute to impaired fetal growth and that this is closely controlled in normal gestation through placental 11beta-HSD2 expression.

  14. Inhibition of human and rat 11beta-hydroxysteroid dehydrogenase type 1 by 18beta-glycyrrhetinic acid derivatives.

    Science.gov (United States)

    Su, Xiangdong; Vicker, Nigel; Lawrence, Harshani; Smith, Andrew; Purohit, Atul; Reed, Michael J; Potter, Barry V L

    2007-05-01

    11beta-Hydroxysteroid dehydrogenase type 1 (11beta-HSD1) plays an important role in regulating the cortisol availability to bind to corticosteroid receptors within specific tissue. Recent advances in understanding the molecular mechanisms of metabolic syndrome indicate that elevation of cortisol levels within specific tissues through the action of 11beta-HSD1 could contribute to the pathogenesis of this disease. Therefore, selective inhibitors of 11beta-HSD1 have been investigated as potential treatments for metabolic diseases, such as diabetes mellitus type 2 or obesity. Here we report the discovery and synthesis of some 18beta-glycyrrhetinic acid (18beta-GA) derivatives (2-5) and their inhibitory activities against rat hepatic11beta-HSD1 and rat renal 11beta-HSD2. Once the selectivity over the rat type 2 enzyme was established, these compounds' ability to inhibit human 11beta-HSD1 was also evaluated using both radioimmunoassay (RIA) and homogeneous time resolved fluorescence (HTRF) methods. The 11-modified 18beta-GA derivatives 2 and 3 with apparent selectivity for rat 11beta-HSD1 showed a high percentage inhibition for human microsomal 11beta-HSD1 at 10 microM and exhibited IC50 values of 400 and 1100 nM, respectively. The side chain modified 18beta-GA derivatives 4 and 5, although showing selectivity for rat 11beta-HSD1 inhibited human microsomal 11beta-HSD1 with IC50 values in the low micromolar range.

  15. Molecular mechanism of the allosteric regulation of the αγ heterodimer of human NAD-dependent isocitrate dehydrogenase

    Science.gov (United States)

    Ma, Tengfei; Peng, Yingjie; Huang, Wei; Ding, Jianping

    2017-01-01

    Human NAD-dependent isocitrate dehydrogenase catalyzes the decarboxylation of isocitrate (ICT) into α-ketoglutarate in the Krebs cycle. It exists as the α2βγ heterotetramer composed of the αβ and αγ heterodimers. Previously, we have demonstrated biochemically that the α2βγ heterotetramer and αγ heterodimer can be allosterically activated by citrate (CIT) and ADP. In this work, we report the crystal structures of the αγ heterodimer with the γ subunit bound without or with different activators. Structural analyses show that CIT, ADP and Mg2+ bind adjacent to each other at the allosteric site. The CIT binding induces conformational changes at the allosteric site, which are transmitted to the active site through the heterodimer interface, leading to stabilization of the ICT binding at the active site and thus activation of the enzyme. The ADP binding induces no further conformational changes but enhances the CIT binding through Mg2+-mediated interactions, yielding a synergistic activation effect. ICT can also bind to the CIT-binding subsite, which induces similar conformational changes but exhibits a weaker activation effect. The functional roles of the key residues are verified by mutagenesis, kinetic and structural studies. Our structural and functional data together reveal the molecular mechanism of the allosteric regulation of the αγ heterodimer. PMID:28098230

  16. Tributyltin induces G2/M cell cycle arrest via NAD(+)-dependent isocitrate dehydrogenase in human embryonic carcinoma cells.

    Science.gov (United States)

    Asanagi, Miki; Yamada, Shigeru; Hirata, Naoya; Itagaki, Hiroshi; Kotake, Yaichiro; Sekino, Yuko; Kanda, Yasunari

    2016-04-01

    Organotin compounds, such as tributyltin (TBT), are well-known endocrine-disrupting chemicals (EDCs). We have recently reported that TBT induces growth arrest in the human embryonic carcinoma cell line NT2/D1 at nanomolar levels by inhibiting NAD(+)-dependent isocitrate dehydrogenase (NAD-IDH), which catalyzes the irreversible conversion of isocitrate to α-ketoglutarate. However, the molecular mechanisms by which NAD-IDH mediates TBT toxicity remain unclear. In the present study, we examined whether TBT at nanomolar levels affects cell cycle progression in NT2/D1 cells. Propidium iodide staining revealed that TBT reduced the ratio of cells in the G1 phase and increased the ratio of cells in the G2/M phase. TBT also reduced cell division cycle 25C (cdc25C) and cyclin B1, which are key regulators of G2/M progression. Furthermore, apigenin, an inhibitor of NAD-IDH, mimicked the effects of TBT. The G2/M arrest induced by TBT was abolished by NAD-IDHα knockdown. Treatment with a cell-permeable α-ketoglutarate analogue recovered the effect of TBT, suggesting the involvement of NAD-IDH. Taken together, our data suggest that TBT at nanomolar levels induced G2/M cell cycle arrest via NAD-IDH in NT2/D1 cells. Thus, cell cycle analysis in embryonic cells could be used to assess cytotoxicity associated with nanomolar level exposure of EDCs.

  17. Functional and Biochemical Characterization of Three Recombinant Human Glucose-6-Phosphate Dehydrogenase Mutants: Zacatecas, Vanua-Lava and Viangchan

    Directory of Open Access Journals (Sweden)

    Saúl Gómez-Manzo

    2016-05-01

    Full Text Available Glucose-6-phosphate dehydrogenase (G6PD deficiency in humans causes severe disease, varying from mostly asymptomatic individuals to patients showing neonatal jaundice, acute hemolysis episodes or chronic nonspherocytic hemolytic anemia. In order to understand the effect of the mutations in G6PD gene function and its relation with G6PD deficiency severity, we report the construction, cloning and expression as well as the detailed kinetic and stability characterization of three purified clinical variants of G6PD that present in the Mexican population: G6PD Zacatecas (Class I, Vanua-Lava (Class II and Viangchan (Class II. For all the G6PD mutants, we obtained low purification yield and altered kinetic parameters compared with Wild Type (WT. Our results show that the mutations, regardless of the distance from the active site where they are located, affect the catalytic properties and structural parameters and that these changes could be associated with the clinical presentation of the deficiency. Specifically, the structural characterization of the G6PD Zacatecas mutant suggests that the R257L mutation have a strong effect on the global stability of G6PD favoring an unstable active site. Using computational analysis, we offer a molecular explanation of the effects of these mutations on the active site.

  18. Functional and Biochemical Characterization of Three Recombinant Human Glucose-6-Phosphate Dehydrogenase Mutants: Zacatecas, Vanua-Lava and Viangchan

    Science.gov (United States)

    Gómez-Manzo, Saúl; Marcial-Quino, Jaime; Vanoye-Carlo, America; Serrano-Posada, Hugo; González-Valdez, Abigail; Martínez-Rosas, Víctor; Hernández-Ochoa, Beatriz; Sierra-Palacios, Edgar; Castillo-Rodríguez, Rosa Angélica; Cuevas-Cruz, Miguel; Rodríguez-Bustamante, Eduardo; Arreguin-Espinosa, Roberto

    2016-01-01

    Glucose-6-phosphate dehydrogenase (G6PD) deficiency in humans causes severe disease, varying from mostly asymptomatic individuals to patients showing neonatal jaundice, acute hemolysis episodes or chronic nonspherocytic hemolytic anemia. In order to understand the effect of the mutations in G6PD gene function and its relation with G6PD deficiency severity, we report the construction, cloning and expression as well as the detailed kinetic and stability characterization of three purified clinical variants of G6PD that present in the Mexican population: G6PD Zacatecas (Class I), Vanua-Lava (Class II) and Viangchan (Class II). For all the G6PD mutants, we obtained low purification yield and altered kinetic parameters compared with Wild Type (WT). Our results show that the mutations, regardless of the distance from the active site where they are located, affect the catalytic properties and structural parameters and that these changes could be associated with the clinical presentation of the deficiency. Specifically, the structural characterization of the G6PD Zacatecas mutant suggests that the R257L mutation have a strong effect on the global stability of G6PD favoring an unstable active site. Using computational analysis, we offer a molecular explanation of the effects of these mutations on the active site. PMID:27213370

  19. Adamantyl carboxamides and acetamides as potent human 11β-hydroxysteroid dehydrogenase type 1 inhibitors.

    Science.gov (United States)

    Su, Xiangdong; Halem, Heather A; Thomas, Mark P; Moutrille, Cecile; Culler, Michael D; Vicker, Nigel; Potter, Barry V L

    2012-11-01

    The modulation of 11β-HSD1 activity with selective inhibitors has beneficial effects on various metabolic disorders including insulin resistance, dyslipidemia and obesity. Here we report the discovery of a series of novel adamantyl carboxamide and acetamide derivatives as selective inhibitors of human 11β-HSD1 in HEK-293 cells transfected with the HSD11B1 gene. Optimization based on an initially identified 11β-HSD1 inhibitor (3) led to the discovery of potent inhibitors with IC(50) values in the 100 nM range. These compounds are also highly selective 11β-HSD1 inhibitors with no activity against 11β-HSD2 and 17β-HSD1. Compound 15 (IC(50)=114 nM) with weak inhibitory activity against the key human cytochrome P450 enzymes and moderate stability in incubation with human liver microsomes is worthy of further development. Importantly, compound 41 (IC(50)=280 nM) provides a new lead that incorporates an adamantyl group surrogate and should enable further series diversification.

  20. Lactate dehydrogenase-B is silenced by promoter methylation in a high frequency of human breast cancers.

    Directory of Open Access Journals (Sweden)

    Nicola J Brown

    Full Text Available OBJECTIVE: Under normoxia, non-malignant cells rely on oxidative phosphorylation for their ATP production, whereas cancer cells rely on Glycolysis; a phenomenon known as the Warburg effect. We aimed to elucidate the mechanisms contributing to the Warburg effect in human breast cancer. EXPERIMENTAL DESIGN: Lactate Dehydrogenase (LDH isoenzymes were profiled using zymography. LDH-B subunit expression was assessed by reverse transcription PCR in cells, and by Immunohistochemistry in breast tissues. LDH-B promoter methylation was assessed by sequencing bisulfite modified DNA. RESULTS: Absent or decreased expression of LDH isoenzymes 1-4, were seen in T-47D and MCF7 cells. Absence of LDH-B mRNA was seen in T-47D cells, and its expression was restored following treatment with the demethylating agent 5'Azacytadine. LDH-B promoter methylation was identified in T-47D and MCF7 cells, and in 25/25 cases of breast cancer tissues, but not in 5/5 cases of normal breast tissues. Absent immuno-expression of LDH-B protein (<10% cells stained, was seen in 23/26 (88% breast cancer cases, and in 4/8 cases of adjacent ductal carcinoma in situ lesions. Exposure of breast cancer cells to hypoxia (1% O(2, for 48 hours resulted in significant increases in lactate levels in both MCF7 (14.0 fold, p = 0.002, and T-47D cells (2.9 fold, p = 0.009, but not in MDA-MB-436 (-0.9 fold, p = 0.229, or MCF10AT (1.2 fold, p = 0.09 cells. CONCLUSIONS: Loss of LDH-B expression is an early and frequent event in human breast cancer occurring due to promoter methylation, and is likely to contribute to an enhanced glycolysis of cancer cells under hypoxia.

  1. Research Progress on Proteomics of Human Sperm%人精子的蛋白质组学研究进展

    Institute of Scientific and Technical Information of China (English)

    吴艳青; 饶猛

    2016-01-01

    随着质谱技术不断发展,精子蛋白质的检测已实现高通量化,蛋白质组学也成为研究精子的重要工具之一.概述人正常精子的蛋白质组学、精子获能相关的蛋白质组学及临床上少、弱、畸形等异常精子的蛋白质组学三个方面的研究进展.蛋白质组学对睾丸组织特异的三磷酸甘油醛脱氢酶(glyceraldehyde-3 phosphate dehydrogenase,testis specific,GAPDHS)、外致密纤维蛋白(outer dense fiber protein,ODF)、A激酶锚定蛋白(A kinase anchoring protein,AKAP)及热休克蛋白(heat shock proteins,HSP)等蛋白结构、功能及丰度改变的深入研究,有助于增进对精子发生、精子功能及受精机制的理解;同时筛选出部分关键蛋白,如人可溶性半乳糖凝集素3结合蛋白(lectin galactoside-binding,soluble 3 binding protein,LGALS3BP)、组蛋白丛1 H2ba(histone duster1,H2ba,HIST1H2BA)、苹果酸脱氢酶2(mitochondrial malate dehydrogenase 2,MDH2)等可能成为男性不育病因分析及研究的靶标,对探索男性不育机制、探索男性避孕新靶点有潜在的意义.

  2. Widening Spectrum of Cellular and Subcellular Expression of Human GLUD1 and GLUD2 Glutamate Dehydrogenases Suggests Novel Functions.

    Science.gov (United States)

    Spanaki, Cleanthe; Kotzamani, Dimitra; Plaitakis, Andreas

    2017-01-01

    Mammalian glutamate dehydrogenase1 (GDH1) (E.C. 1.4.1.3) is a mitochondrial enzyme that catalyzes the reversible oxidative deamination of glutamate to α-ketoglutarate and ammonia while reducing NAD+ and/or NADP+ to NADH and/or NADPH. It links amino acid with carbohydrate metabolism, contributing to Krebs cycle anaplerosis, energy production, ammonia handling and redox homeostasis. Although GDH1 was one of the first major metabolic enzymes to be studied decades ago, its role in cell biology is still incompletely understood. There is however growing interest in a novel GDH2 isoenzyme that emerged via duplication in primates and underwent rapid evolutionary selection concomitant with prefrontal human cortex expansion. Also, the anaplerotic function of GDH1 and GDH2 is currently under sharp focus as this relates to the biology of glial tumors and other neoplasias. Here we used antibodies specific for human GDH1 (hGDH1) and human GDH2 (hGDH2) to study the expression of these isoenzymes in human tissues. Results revealed that both hGDH1 and hGDH2 are expressed in human brain, kidney, testis and steroidogenic organs. However, distinct hGDH1 and hGDH2 expression patterns emerged. Thus, while the Sertoli cells of human testis were strongly positive for hGDH2, they were negative for hGDH1. Conversely, hGDH1 showed very high levels of expression in human liver, but hepatocytes were virtually devoid of hGDH2. In human adrenals, both hGDHs were densely expressed in steroid-producing cells, with hGDH2 expression pattern matching that of the cholesterol side chain cleavage system involved in steroid synthesis. Similarly in human ovaries and placenta, both hGDH1 and hGDH2 were densely expressed in estrogen producing cells. In addition, hGDH1, being a housekeeping enzyme, was also expressed in cells that lack endocrine function. Regarding human brain, study of cortical sections using immunofluorescence (IF) with confocal microscopy revealed that hGDH1 and hGDH2 were both expressed

  3. The effect of pH and ADP on ammonia affinity for human glutamate dehydrogenases

    DEFF Research Database (Denmark)

    Zaganas, Ioannis; Pajecka, Kamilla; Nielsen, Camilla Wendel;

    2013-01-01

    human isoenzymes (hGDH1 and hGDH2), though highly homologous, differ markedly in their regulatory properties. Here we obtained hGDH1 and hGDH2 in recombinant form and studied their Km for ammonia in the presence of 1.0 mM ADP. The analyses showed that lowering the pH of the buffer (from 8.0 to 7.......0) increased the Km for ammonia substantially (hGDH1: from 12.8 ± 1.4 mM to 57.5 ± 1.6 mM; hGDH2: from 14.7 ± 1.6 mM to 62.2 ± 1.7 mM), thus essentially precluding reductive amination. Moreover, lowering the ADP concentration to 0.1 mM not only increased the K0.5 [NH4 (+)] of hGDH2, but also introduced...

  4. Quasi-periodicity in the autonomous glycolytic system

    Institute of Scientific and Technical Information of China (English)

    GAO Qingyu; ZHANG Lu; ZHANG Xing; WANG Jichang

    2005-01-01

    This study predicts that quasi-periodic oscilla-tions could exist in a detailed model of glycolysis that is ana-lyzed in an autonomous system. In addition to period-dou- bling, quasi-periodic and period-adding bifurcation, a new stationary branch, which lies in between the thermodynamic and flow branches, is also uncovered in the glycolytic reac-tion system. Results presented in this study illustrate that the Michaelis constant (K4GAP) of glyceraldehyde 3-phosphate dehydrogenase for glyceraldehyde 3-phosphate has great influences on glycolytic oscillations, in which increasing K4GAP widens the range of flow rate over which quasi-peri- odic oscillations exist.

  5. Structures of human cytosolic NADP-dependent isocitrate dehydrogenase reveal a novel self-regulatory mechanism of activity.

    Science.gov (United States)

    Xu, Xiang; Zhao, Jingyue; Xu, Zhen; Peng, Baozhen; Huang, Qiuhua; Arnold, Eddy; Ding, Jianping

    2004-08-06

    Isocitrate dehydrogenases (IDHs) catalyze the oxidative decarboxylation of isocitrate to alpha-ketoglutarate, and regulation of the enzymatic activity of IDHs is crucial for their biological functions. Bacterial IDHs are reversibly regulated by phosphorylation of a strictly conserved serine residue at the active site. Eukaryotic NADP-dependent IDHs (NADP-IDHs) have been shown to have diverse important biological functions; however, their regulatory mechanism remains unclear. Structural studies of human cytosolic NADP-IDH (HcIDH) in complex with NADP and in complex with NADP, isocitrate, and Ca2+ reveal three biologically relevant conformational states of the enzyme that differ substantially in the structure of the active site and in the overall structure. A structural segment at the active site that forms a conserved alpha-helix in all known NADP-IDH structures assumes a loop conformation in the open, inactive form of HcIDH; a partially unraveled alpha-helix in the semi-open, intermediate form; and an alpha-helix in the closed, active form. The side chain of Asp279 of this segment occupies the isocitrate-binding site and forms hydrogen bonds with Ser94 (the equivalent of the phosphorylation site in bacterial IDHs) in the inactive form and chelates the metal ion in the active form. The structural data led us to propose a novel self-regulatory mechanism for HcIDH that mimics the phosphorylation mechanism used by the bacterial homologs, consistent with biochemical and biological data. This mechanism might be applicable to other eukaryotic NADP-IDHs. The results also provide insights into the recognition and specificity of substrate and cofactor by eukaryotic NADP-IDHs.

  6. Oxidation of methanol, ethylene glycol, and isopropanol with human alcohol dehydrogenases and the inhibition by ethanol and 4-methylpyrazole.

    Science.gov (United States)

    Lee, Shou-Lun; Shih, Hsuan-Ting; Chi, Yu-Chou; Li, Yeung-Pin; Yin, Shih-Jiun

    2011-05-30

    Human alcohol dehydrogenases (ADHs) include multiple isozymes with broad substrate specificity and ethnic distinct allozymes. ADH catalyzes the rate-limiting step in metabolism of various primary and secondary aliphatic alcohols. The oxidation of common toxic alcohols, that is, methanol, ethylene glycol, and isopropanol by the human ADHs remains poorly understood. Kinetic studies were performed in 0.1M sodium phosphate buffer, at pH 7.5 and 25°C, containing 0.5 mM NAD(+) and varied concentrations of substrate. K(M) values for ethanol with recombinant human class I ADH1A, ADH1B1, ADH1B2, ADH1B3, ADH1C1, and ADH1C2, and class II ADH2 and class IV ADH4 were determined to be in the range of 0.12-57 mM, for methanol to be 2.0-3500 mM, for ethylene glycol to be 4.3-2600mM, and for isopropanol to be 0.73-3400 mM. ADH1B3 appeared to be inactive toward ethylene glycol, and ADH2 and ADH4, inactive with methanol. The variations for V(max) for the toxic alcohols were much less than that of the K(M) across the ADH family. 4-Methylpyrazole (4MP) was a competitive inhibitor with respect to ethanol for ADH1A, ADH1B1, ADH1B2, ADH1C1 and ADH1C2, and a noncompetitive inhibitor for ADH1B3, ADH2 and ADH4, with the slope inhibition constants (K(is)) for the whole family being 0.062-960 μM and the intercept inhibition constants (K(ii)), 33-3000 μM. Computer simulation studies using inhibition equations in the presence of alternate substrate ethanol and of dead-end inhibitor 4MP with the determined corresponding kinetic parameters for ADH family, indicate that the oxidation of the toxic alcohols up to 50mM are largely inhibited by 20 mM ethanol or by 50 μM 4MP with some exceptions. The above findings provide an enzymological basis for clinical treatment of methanol and ethylene glycol poisoning by 4MP or ethanol with pharmacogenetic perspectives. Copyright © 2010 Elsevier Ireland Ltd. All rights reserved.

  7. Alpha helical structures in the leader sequence of human GLUD2 glutamate dehydrogenase responsible for mitochondrial import.

    Science.gov (United States)

    Kotzamani, Dimitra; Plaitakis, Andreas

    2012-09-01

    Human glutamate dehydrogenase (hGDH) exists in two highly homologous isoforms with a distinct regulatory and tissue expression profile: a housekeeping hGDH1 isoprotein encoded by the GLUD1 gene and an hGDH2 isoenzyme encoded by the GLUD2 gene. There is evidence that both isoenzymes are synthesized as pro-enzymes containing a 53 amino acid long N-terminal leader peptide that is cleaved upon translocation into the mitochondria. However, this GDH signal peptide is substantially larger than that of most nuclear DNA-encoded mitochondrial proteins, the leader sequence of which typically contains 17-35 amino acids and they often form a single amphipathic α-helix. To decode the structural elements that are essential for the mitochondrial targeting of human GDHs, we performed secondary structure analyses of their leader sequence. These analyses predicted, with 82% accuracy, that both leader peptides are positively charged and that they form two to three α-helices, separated by intermediate loops. The first α-helix of hGDH2 is strongly amphipathic, displaying both a positively charged surface and a hydrophobic plane. We then constructed GLUD2-EGFP deletion mutants and used them to transfect three mammalian cell lines (HEK293, COS 7 and SHSY-5Y). Confocal laser scanning microscopy, following co-transfection with pDsRed2-Mito mitochondrial targeting vector, revealed that deletion of the entire leader sequence prevented the enzyme from entering the mitochondria, resulting in its retention in the cytoplasm. Deletion of the first strongly amphipathic α-helix only was also sufficient to prevent the mitochondrial localization of the truncated protein. Moreover, truncated leader sequences, retaining the second and/or the third putative α-helix, failed to restore the mitochondrial import of hGDH2. As such, the first N-terminal alpha helical structure is crucial for the mitochondrial import of hGDH2 and these findings may have implications in understanding the evolutionary

  8. Acute in vivo regulation of 11beta-hydroxysteroid dehydrogenase type 1 activity by insulin and intralipid infusions in humans.

    Science.gov (United States)

    Wake, Deborah J; Homer, Natalie Z M; Andrew, Ruth; Walker, Brian R

    2006-11-01

    Extraadrenal regeneration of cortisol by 11beta-hydroxysteroid dehydrogenase type 1 (11HSD1) is increased after a mixed meal. It is unknown which tissue is responsible and whether this reflects the complex transcriptional control of 11HSD1 or posttranscriptional control exerted by supply of reduced nicotinamide adenine dinucleotide phosphate from hexose-6-phosphate dehydrogenase. The objective of this study was to test whether hyperinsulinemia and/or increased serum free fatty acids increase whole-body and intraadipose 11HSD1, and whether adipose 11HSD1 switches from dehydrogenase to reductase activity. In nine healthy men, we measured whole-body cortisol regeneration (by iv infusion of 9,11,12,12-[2H]4 -cortisol) and intra-adipose interconversion of cortisol and cortisone (by sc microdialysis infusion of [3H]4 -cortisol and [3H]2 -cortisone in separate cannulae) during: 1) a hyperinsulinemic euglycemic clamp; 2) iv lipid infusion (Intralipid 20% fat emulsion); and 3) saline infusion, each for 3.5 h. Hyperinsulinemia increased rate of appearance of 9,12,12-[2H]3 -cortisol (19.3 +/- 0.8 vs. 16.7 +/- 1.1 nmol/min with saline, P adipose, the predominant reaction was reductase conversion of cortisone to cortisol (after 3.5 h of saline infusion, reaching 11.0 +/- 2.7% per hour reductase vs. 5.2 +/- 1.3 dehydrogenase, P effects on whole-body deuterated cortisol metabolism, but increased both dehydrogenase and reductase (reaching 16.7 +/- 1.8, P adipose. Hyperinsulinemia and increased free fatty acids induce acute increases in 11HSD1 activity in adipose tissue that are not attributable to a switch from dehydrogenase to reductase. Hyperinsulinemia also increases systemic cortisol regeneration. These effects may enhance intracellular cortisol concentrations after a meal.

  9. The content and distribution of troponin I, troponin T, myoglobin, and alpha-hydroxybutyric acid dehydrogenase in the human heart

    NARCIS (Netherlands)

    Swaanenburg, JCJM; Visser-VanBrummen, PJ; DeJongste, MJL; Tiebosch, ATHM

    2001-01-01

    We studied the content and distribution of heart-specific markers troponin I and troponin T in relation to conventional non-heart specific myoglobin and alpha-hydroxybutyric acid dehydrogenase (HBD) in the hearts of 34 patients who died of various causes. Tissue was obtained from the right and left

  10. Pronounced between-subject and circadian variability in thymidylate synthase and dihydropyrimidine dehydrogenase enzyme activity in human volunteers

    NARCIS (Netherlands)

    Jacobs, Bart A W; Deenen, Maarten J; Pluim, Dick; van Hasselt, J G Coen; Krähenbühl, Martin D; van Geel, Robin M J M; de Vries, Niels; Rosing, Hilde; Meulendijks, Didier; Burylo, Artur M; Cats, Annemieke; Beijnen, Jos H; Huitema, Alwin D R; Schellens, Jan H M

    2016-01-01

    AIMS: The enzymatic activity of dihydropyrimidine dehydrogenase (DPD) and thymidylate synthase (TS) are important for the tolerability and efficacy of the fluoropyrimidine drugs. In the present study, we explored between-subject variability (BSV) and circadian rhythmicity in DPD and TS activity in h

  11. Exercise training induces similar elevations in the activity of oxoglutarate dehydrogenase and peak oxygen uptake in the human quadriceps muscle

    DEFF Research Database (Denmark)

    Blomstrand, Eva; Krustrup, Peter; Søndergaard, Hans

    2011-01-01

    During exercise involving a small muscle mass, peak oxygen uptake is thought to be limited by peripheral factors, such as the degree of oxygen extraction from the blood and/or mitochondrial oxidative capacity. Previously, the maximal activity of the Krebs cycle enzyme oxoglutarate dehydrogenase has...

  12. GenBank blastx search result: AK103922 [KOME

    Lifescience Database Archive (English)

    Full Text Available AK103922 001-013-B10 M66862.1 Salmonella sp. (group IV, strain RKS 3015, isolate CDC2584-68/deep forest anim...al/Canal zone/1968) glyceraldehyde-3-phosphate dehydrogenase gene, partial cds.|BCT BCT 3e-67 +3 ...

  13. In vitro antifungal susceptibility and molecular identity of 99 clinical isolates of the opportunistic fungal genus Curvularia

    NARCIS (Netherlands)

    Cunha, da K.C.; Sutton, D.A.; Fothergill, A.W.; Gené, J.; Cano, J.; Madrid, H.; Hoog, de G.S.; Crous, P.W.; Guarro, J.

    2013-01-01

    The in vitro antifungal susceptibility of a set of 99 clinical isolates of Curvularia was tested against 9 drugs using a reference microdilution method. The isolates had been identified previously to species level by comparing their ITS rDNA and glyceraldehyde-3-phosphate dehydrogenase gene sequence

  14. Main: TBOXATGAPB [PLACE

    Lifescience Database Archive (English)

    Full Text Available TBOXATGAPB S000383 23-Aug-2001 (last modified) uchi Tbox found in the Arabidopsis thaliana (A.T.) GAPB...ions in the Tbox resulted in reductions of light-activated gene transcription; GAPB encodes the B subunit of... chloroplast glyceraldehyde-3-phosphate dehydrogenase(GADPH) of A.T.; GAPB; glyce

  15. Multilocus phylogeny and MALDI-TOF analysis of the plant pathogenic species Alternaria dauci and relatives

    DEFF Research Database (Denmark)

    Brun, Sophie; Madrid, Hugo; Gerrits Van Den Ende, Bert

    2013-01-01

    -Assisted Laser Desorption Ionisation Time of Flight (MALDI-TOF) profiling of proteins. Phylogenetic analyses were performed on three loci, i.e., the internal transcribed spacer (ITS) region of rRNA, and the glyceraldehyde-3-phosphate dehydrogenase (gpd) and Alternaria major antigen (Alt a 1) genes. Phylogenetic...

  16. Dicty_cDB: AFI703 [Dicty_cDB

    Lifescience Database Archive (English)

    Full Text Available hod using the same. 137 2e-43 3 AR411837 |AR411837.1 Sequence 5 from patent US 6638735. 137 2e-43 3 AF053300 |AF053300.1 Pichia cifer...rii glyceraldehyde 3-phosphate dehydrogenase (GAPDH) gene, complete cds. 137 2e-43

  17. GAPDH as a control gene to estimate genome copy number in Great Tits, with cross-amplification in Blue Tits

    NARCIS (Netherlands)

    Atema, E.; Van Oers, K.; Verhulst, S.

    2013-01-01

    Estimating the number of genome copies in a tissue sample can serve various purposes. For example, such an estimate serves as scaling variable when measuring telomeres with quantitative PCR. We describe the primer development and evaluation for the glyceraldehyde-3-phosphate dehydrogenase (GAPDH) ge

  18. GAPDH as a control gene to estimate genome copy number in Great Tits, with cross-amplification in Blue Tits

    NARCIS (Netherlands)

    Atema, Els; van Oers, Kees; Verhulst, Simon

    2013-01-01

    Estimating the number of genome copies in a tissue sample can serve various purposes. For example, such an estimate serves as a scaling variable when measuring telomeres with quantitative PCR. We describe the primer development and evaluation for the glyceraldehyde-3-phosphate dehydrogenase (GAPDH)

  19. Microbial production of 3-hydroxypropionic acid

    DEFF Research Database (Denmark)

    2014-01-01

    A yeast cell havinga reduced level of activity of NAD dependent glyceraldehyde-3-phosphate dehydrogenase (GAPDH) has at least one exogenous gene encoding NADP dependent GAPDH and/or has up-regulation of at least one endogenous gene expressing NADP dependent GAPDH, wherein combined expression of t...

  20. Reference: PIIATGAPB [PLACE

    Lifescience Database Archive (English)

    Full Text Available PIIATGAPB Chan CS, Guo L, Shih MC Promoter analysis of the nuclear gene encoding th...e chloroplast glyceraldehyde-3-phosphate dehydrogenase B subunit of Arabidopsis thaliana Plant Mol Biol 46: 131-141 (2001) PubMed: 11442054; ...

  1. Zymomonas with improved xylose utilization

    Science.gov (United States)

    Viitanen, Paul V [West Chester, PA; Tao, Luan [Havertown, PA; Zhang, Yuying [New Hope, PA; Caimi, Perry G [Kennett Square, PA; McCutchen, Carol M [Wilmington, DE; McCole, Laura [East Fallowfield, PA; Zhang, Min [Lakewood, CO; Chou, Yat-Chen [Lakewood, CO; Franden, Mary Ann [Centennial, CO

    2011-08-16

    Strains of Zymomonas were engineered by introducing a chimeric xylose isomerase gene that contains a mutant promoter of the Z. mobilis glyceraldehyde-3-phosphate dehydrogenase gene. The promoter directs increased expression of xylose isomerase, and when the strain is in addition engineered for expression of xylulokinase, transaldolase and transketolase, improved utilization of xylose is obtained.

  2. Bipolaris oryzae, a novel fungal opportunist causing keratitis

    NARCIS (Netherlands)

    Al-Hatmi, Abdullah

    2015-01-01

    We report a case of mycotic keratitis caused by Bipolaris oryzae with predisposing trauma from a foreign body. The fungus was identified by sequencing the internal transcribed spacer (ITS) region, translation elongation factor 1α (TEF1) gene and partial glyceraldehyde-3-phosphate dehydrogenase (GPDH

  3. Evolution and host specificity in the ectomycorrhizal genus Leccinum

    NARCIS (Netherlands)

    Bakker, den H.C.; Zuccarello, G.C.; Kuyper, T.W.; Noordeloos, M.E.

    2004-01-01

    Species of the ectomycorrhizal genus Leccinum are generally considered to be host specialists. We determined the phylogenetic relationships between species of Leccinum from Europe and North America based on second internal transcribed spacer (ITS2) and glyceraldehyde 3-phosphate dehydrogenase (Gapdh

  4. The influence of metal ions on the substrate binding pocket of human alcohol dehydrogenase β 2β 2 by molecular modeling

    Science.gov (United States)

    Liu, Hsuan-Liang; Ho, Yih; Hsu, Chia-Ming

    2003-04-01

    Based on theoretical molecular modeling performed in this study, both structural and catalytic zinc ions, Zn s and Zn a, respectively, were shown to influence the structural integrity of the substrate binding pocket of human alcohol dehydrogenase β 2β 2 in the middle and outer regions. The replacement of both Zn s and Zn a with different metal ions restricts the access of bulky substrates to the bottom of the active site by narrowing the bottleneck formed between L116 and V294, whereas it does not affect substrate binding affinity since the accessible surface area of the substrate binding pocket remains more than 80% of the wild-type.

  5. Identification of valid reference genes for gene expression studies of human stomach cancer by reverse transcription-qPCR

    Directory of Open Access Journals (Sweden)

    Lee Yeon-Su

    2010-05-01

    Full Text Available Abstract Background Reverse transcription quantitative real-time polymerase chain reaction (RT-qPCR is a powerful method for the analysis of gene expression. Target gene expression levels are usually normalized to a consistently expressed reference gene also known as internal standard, in the same sample. However, much effort has not been expended thus far in the search for reference genes suitable for the study of stomach cancer using RT-qPCR, although selection of optimal reference genes is critical for interpretation of results. Methods We assessed the suitability of six possible reference genes, beta-actin (ACTB, glyceraldehydes-3-phosphate dehydrogenase (GAPDH, hypoxanthine phosphoribosyl transferase 1 (HPRT1, beta-2-microglobulin (B2M, ribosomal subunit L29 (RPL29 and 18S ribosomal RNA (18S rRNA in 20 normal and tumor stomach tissue pairs of stomach cancer patients and 6 stomach cancer cell lines, by RT-qPCR. Employing expression stability analyses using NormFinder and geNorm algorithms we determined the order of performance of these reference genes and their variation values. Results This RT-qPCR study showed that there are statistically significant (p Conclusion This study validated RPL29 and RPL29-B2M as the best single reference genes and combination, for RT-qPCR analysis of 'all stomach tissues', and B2M and B2M-GAPDH as the best single reference gene and combination, for 'stomach cancer cell lines'. Use of these validated reference genes should provide more exact interpretation of differential gene expressions at transcription level in stomach cancer.

  6. Isolation of human umbilical cord blood aldehyde dehydrogenase-expressing progenitor cells that modulate vascular regenerative functions in vitro and in vivo.

    Science.gov (United States)

    Putman, David M; Hess, David A

    2013-01-01

    This unit describes the isolation and application of human umbilical cord blood progenitor cells to modulate vascular regenerative functions using in vitro co-culture systems and in vivo transplantation models. Using aldehyde dehydrogenase as a marker of stem cell function, blood-derived progenitors can be efficiently purified form human umbilical cord blood using flow cytometry. We describe in vitro approaches to measure cell-mediated effects on the survival, proliferation, and tube-forming function of endothelial cells using growth-rate assays and Matrigel tube-forming assays. Additionally, we provide a detailed protocol for inducing acute unilateral hindlimb ischemia in immune-deficient mice to assess progenitor cell-modulated effects on vascular regeneration by tracking the recovery of blood flow using noninvasive laser Doppler perfusion imaging. Collectively, we present combined in vitro and in vivo transplantation strategies for the pre-clinical assessment of human progenitor cell-based therapies to treat ischemic disease.

  7. Glucose-6-phosphate dehydrogenase

    Science.gov (United States)

    ... medlineplus.gov/ency/article/003671.htm Glucose-6-phosphate dehydrogenase test To use the sharing features on this page, please enable JavaScript. Glucose-6-phosphate dehydrogenase (G6PD) is a protein that helps red ...

  8. Lactate dehydrogenase test

    Science.gov (United States)

    ... this page: //medlineplus.gov/ency/article/003471.htm Lactate dehydrogenase test To use the sharing features on this page, please enable JavaScript. Lactate dehydrogenase (LDH) is a protein that helps produce energy ...

  9. T-13910 DNA variant associated with lactase persistence interacts with Oct-1 and stimulates lactase promoter activity in vitro

    DEFF Research Database (Denmark)

    Lewinsky, Rikke H.; Jensen, Tine Gro Kleinert; Møller, Jette

    2005-01-01

    Two phenotypes exist in the human population with regard to expression of lactase in adults. Lactase non-persistence (adult-type hypolactasia and lactose intolerance) is characterized by a decline in the expression of lactase-phlorizin hydrolase (LPH) after weaning. In contrast, lactase......-persistent individuals have a high LPH throughout their lifespan. Lactase persistence and non-persistence are associated with a T/C polymorphism at position -13,910 upstream the lactase gene. A nuclear factor binds more strongly to the T-13,910 variant associated with lactase persistence than the C-13,910 variant...... associated with lactase non-persistence. Oct-1 and glyceraldehyde-3-phosphate dehydrogenase were co-purified by DNA affinity purification using the sequence of the T-13,910 variant. Supershift analyses show that Oct-1 binds directly to the T-13,910 variant, and we suggest that GAPDH is co-purified due...

  10. Zinc disrupts central carbon metabolism and capsule biosynthesis in Streptococcus pyogenes.

    Science.gov (United States)

    Ong, Cheryl-lynn Y; Walker, Mark J; McEwan, Alastair G

    2015-06-01

    Neutrophils release free zinc to eliminate the phagocytosed bacterial pathogen Streptococcus pyogenes (Group A Streptococcus; GAS). In this study, we investigated the mechanisms underpinning zinc toxicity towards this human pathogen, responsible for diseases ranging from pharyngitis and impetigo, to severe invasive infections. Using the globally-disseminated M1T1 GAS strain, we demonstrate that zinc stress impairs glucose metabolism through the inhibition of the glycolytic enzymes phosphofructokinase and glyceraldehyde-3-phosphate dehydrogenase. In the presence of zinc, a metabolic shift to the tagatose-6-phosphate pathway allows conversion of D-galactose to dihydroxyacetone phosphate and glyceraldehyde phosphate, partially bypassing impaired glycolytic enzymes to generate pyruvate. Additionally, zinc inhibition of phosphoglucomutase results in decreased capsule biosynthesis. These data indicate that zinc exerts it toxicity via mechanisms that inhibit both GAS central carbon metabolism and virulence pathways.

  11. Regulatory roles of the N-terminal domain based on crystal structures of human pyruvate dehydrogenase kinase 2 containing physiological and synthetic ligands.

    Science.gov (United States)

    Knoechel, Thorsten R; Tucker, Alec D; Robinson, Colin M; Phillips, Chris; Taylor, Wendy; Bungay, Peter J; Kasten, Shane A; Roche, Thomas E; Brown, David G

    2006-01-17

    Pyruvate dehydrogenase kinase (PDHK) regulates the activity of the pyruvate dehydrogenase multienzyme complex. PDHK inhibition provides a route for therapeutic intervention in diabetes and cardiovascular disorders. We report crystal structures of human PDHK isozyme 2 complexed with physiological and synthetic ligands. Several of the PDHK2 structures disclosed have C-terminal cross arms that span a large trough region between the N-terminal regulatory (R) domains of the PDHK2 dimers. The structures containing bound ATP and ADP demonstrate variation in the conformation of the active site lid, residues 316-321, which enclose the nucleotide beta and gamma phosphates at the active site in the C-terminal catalytic domain. We have identified three novel ligand binding sites located in the R domain of PDHK2. Dichloroacetate (DCA) binds at the pyruvate binding site in the center of the R domain, which together with ADP, induces significant changes at the active site. Nov3r and AZ12 inhibitors bind at the lipoamide binding site that is located at one end of the R domain. Pfz3 (an allosteric inhibitor) binds in an extended site at the other end of the R domain. We conclude that the N-terminal domain of PDHK has a key regulatory function and propose that the different inhibitor classes act by discrete mechanisms. The structures we describe provide insights that can be used for structure-based design of PDHK inhibitors.

  12. Characterization of the Saffron Derivative Crocetin as an Inhibitor of Human Lactate Dehydrogenase 5 in the Antiglycolytic Approach against Cancer.

    Science.gov (United States)

    Granchi, Carlotta; Fortunato, Serena; Meini, Serena; Rizzolio, Flavio; Caligiuri, Isabella; Tuccinardi, Tiziano; Lee, Hyang Yeon; Hergenrother, Paul J; Minutolo, Filippo

    2017-07-19

    Inhibition of lactate dehydrogenase (LDH) represents an innovative approach to tackle cancer because this peculiar glycolytic metabolism is characteristic of most invasive tumor cells. An investigation into the biological properties of saffron extracts led to the discover of their LDH-inhibition properties. In particular, the most important saffron components, crocetin, was found to inhibit LDH (IC50 = 54.9 ± 4.7 μM). This carotenoid was independently produced by chemical synthesis, and its LDH-inhibition properties manifested via its antiproliferative activity against two glycolytic cancer cell lines (A549 and HeLa, IC50 = 114.0 ± 8.0 and 113.0 ± 11.1 μM, respectively). The results described in this article suggest that saffron may be a helpful alimentary component in the prevention of cancer that potentially contributes to the efficacy of approved cancer therapies.

  13. Aldehyde dehydrogenase 3B1 (ALDH3B1): immunohistochemical tissue distribution and cellular-specific localization in normal and cancerous human tissues.

    Science.gov (United States)

    Marchitti, Satori A; Orlicky, David J; Brocker, Chad; Vasiliou, Vasilis

    2010-09-01

    Aldehyde dehydrogenase (ALDH) enzymes are critical in the detoxification of endogenous and exogenous aldehydes. Our previous findings indicate that the ALDH3B1 enzyme is expressed in several mouse tissues and is catalytically active toward aldehydes derived from lipid peroxidation, suggesting a potential role against oxidative stress. The aim of this study was to elucidate by immunohistochemistry the tissue, cellular, and subcellular distribution of ALDH3B1 in normal human tissues and in tumors of human lung, colon, breast, and ovary. Our results indicate that ALDH3B1 is expressed in a tissue-specific manner and in a limited number of cell types, including hepatocytes, proximal convoluted tubule cells, cerebellar astrocytes, bronchiole ciliated cells, testis efferent ductule ciliated cells, and histiocytes. ALDH3B1 expression was upregulated in a high percentage of human tumors (lung > breast = ovarian > colon). Increased ALDH3B1 expression in tumor cells may confer a growth advantage or be the result of an induction mechanism mediated by increased oxidative stress. Subcellular localization of ALDH3B1 was predominantly cytosolic in tissues, with the exception of normal human lung and testis, in which localization appeared membrane-bound or membrane-associated. The specificity of ALDH3B1 distribution may prove to be directly related to the functional role of this enzyme in human tissues.

  14. Glucose-6-phosphate dehydrogenase (G6PD. Response of the human erythrocyte and another cells to the decrease in their activity.

    Directory of Open Access Journals (Sweden)

    Javier Fernando Bonilla

    2009-11-01

    Full Text Available Glucose-6-phosphate dehydrogenase is the first enzyme in the pentose phosphate pathway and the main intracellular source of reduced nicotidamineadenine nucleotidephosphate (NADPH, involved in diverse physiological processes such as antioxidant defense, (for instance in the erythrocyte endothelial growth modulation, erithropoyesis, vascularization and phagocitosis. G6PDH deficiency is the most common X-chromosome-linked enzymopathy in human beings. Although it is present in any type cell, its absolute deficiency is incompatible with life. According to WHO, 400 million people are affected by G6PD deficiency in the world but in Colombia, the severe form prevalence is about 3% to 7%. There are no data related to slight and moderate alterations, that also have clinical effects. This paper reviews some G6PD biomolecular aspects, its classification according to activity and electrophoretic mobility, as well as some main clinical aspects related to its activity alteration.

  15. Proteomic Analysis of Prostate Cancer Field Effect

    Science.gov (United States)

    2011-02-01

    EH-domain containing 2 [Homo sapiens] isocitrate dehydrogenase 2 (NADP+), mitochondrial precursor [Homo sapiens] myosin, heavy polypeptide 9, non...dihydropyrimidinase-like 3 [Homo sapiens] isocitrate dehydrogenase 1 (NADP+), soluble [Homo sapiens] catenin (cadherin-associated protein), beta 1, 88kDa [Homo...propeptide [Homo sapiens] heat shock 70kDa protein 1 A [Homo sapiens] glyceraldehyde-3-phosphate dehydrogenase [Homo sapiens] haptoglobin [Homo

  16. Inhibition of human alcohol and aldehyde dehydrogenases by aspirin and salicylate: assessment of the effects on first-pass metabolism of ethanol.

    Science.gov (United States)

    Lee, Shou-Lun; Lee, Yung-Pin; Wu, Min-Li; Chi, Yu-Chou; Liu, Chiu-Ming; Lai, Ching-Long; Yin, Shih-Jiun

    2015-05-01

    Previous studies have reported that aspirin significantly reduced the first-pass metabolism (FPM) of ethanol in humans thereby increasing adverse effects of alcohol. The underlying causes, however, remain poorly understood. Alcohol dehydrogenase (ADH) and aldehyde dehydrogenase (ALDH), principal enzymes responsible for metabolism of ethanol, are complex enzyme families that exhibit functional polymorphisms among ethnic groups and distinct tissue distributions. We investigated the inhibition profiles by aspirin and its major metabolite salicylate of ethanol oxidation by recombinant human ADH1A, ADH1B1, ADH1B2, ADH1B3, ADH1C1, ADH1C2, ADH2, and ADH4, and acetaldehyde oxidation by ALDH1A1 and ALDH2, at pH 7.5 and 0.5 mM NAD(+). Competitive inhibition pattern was found to be a predominant type among the ADHs and ALDHs studied, although noncompetitive and uncompetitive inhibitions were also detected in a few cases. The inhibition constants of salicylate for the ADHs and ALDHs were considerably lower than that of aspirin with the exception of ADH1A that can be ascribed to a substitution of Ala-93 at the bottom of substrate pocket as revealed by molecular docking experiments. Kinetic inhibition equation-based simulations show at higher therapeutic levels of blood plasma salicylate (1.5 mM) that the decrease of activities at 2-10 mM ethanol for ADH1A/ADH2 and ADH1B2/ADH1B3 are predicted to be 75-86% and 31-52%, respectively, and that the activity decline for ALDH1A1 and ALDH2 at 10-50 μM acetaldehyde to be 62-73%. Our findings suggest that salicylate may substantially inhibit hepatic FPM of alcohol at both the ADH and ALDH steps when concurrent intaking aspirin. Copyright © 2015 Elsevier Inc. All rights reserved.

  17. Cytoprotective effect of recombinant human erythropoietin produced in transgenic tobacco plants.

    Directory of Open Access Journals (Sweden)

    Farooqahmed S Kittur

    Full Text Available Asialo-erythropoietin, a desialylated form of human erythropoietin (EPO lacking hematopoietic activity, is receiving increased attention because of its broader protective effects in preclinical models of tissue injury. However, attempts to translate its protective effects into clinical practice is hampered by unavailability of suitable expression system and its costly and limit production from expensive mammalian cell-made EPO (rhuEPO(M by enzymatic desialylation. In the current study, we took advantage of a plant-based expression system lacking sialylating capacity but possessing an ability to synthesize complex N-glycans to produce cytoprotective recombinant human asialo-rhuEPO. Transgenic tobacco plants expressing asialo-rhuEPO were generated by stably co-expressing human EPO and β1,4-galactosyltransferase (GalT genes under the control of double CaMV 35S and glyceraldehyde-3-phosphate gene (GapC promoters, respectively. Plant-produced asialo-rhuEPO (asialo-rhuEPO(P was purified by immunoaffinity chromatography. Detailed N-glycan analysis using NSI-FTMS and MS/MS revealed that asialo-rhuEPO(P bears paucimannosidic, high mannose-type and complex N-glycans. In vitro cytoprotection assays showed that the asialo-rhuEPO(P (20 U/ml provides 2-fold better cytoprotection (44% to neuronal-like mouse neuroblastoma cells from staurosporine-induced cell death than rhuEPO(M (21%. The cytoprotective effect of the asialo-rhuEPO(P was found to be mediated by receptor-initiated phosphorylation of Janus kinase 2 (JAK2 and suppression of caspase 3 activation. Altogether, these findings demonstrate that plants are a suitable host for producing cytoprotective rhuEPO derivative. In addition, the general advantages of plant-based expression system can be exploited to address the cost and scalability issues related to its production.

  18. Effects of the suppression of lactate dehydrogenase A on the growth and invasion of human gastric cancer cells.

    Science.gov (United States)

    Liu, Xiaojun; Yang, Zhongxia; Chen, Zhaofeng; Chen, Rui; Zhao, Da; Zhou, Yongning; Qiao, Liang

    2015-01-01

    Lactate dehydrogenase A (LDH-A), which regulates glycolytic flux by catalyzing pyruvate to lactate in the cytoplasm, is believed to be one of the highly attractive therapeutic targets for cancers. Firstly, we detected the expression of LDH-A in gastric cancer (GC) cells. LDH-A inhibitor oxamate was then used to suppress the LDH-A activity in GC cells. Cell proliferation, lactic acid production, Transwell migration assay and apoptosis were assessed, respectively. The results showed that inhibition of LDH-A by oxamate decreased the lactate production. In the presence of glucose, oxamate inhibited cell proliferation in a dose-dependent manner. Flow cytometry assay further confirmed a pro-apoptotic effect of oxamate, and this was likely through increased expression of Bax, activated caspase-3, and decreased expression of Bcl-2. Therefore, we believe that oxamate inhibits cell growth, suppresses tumor invasion, and induces apoptosis in GC cells. LDH-A may be a potential therapeutic target for GC.

  19. Structure of daidzin, a naturally occurring anti-alcohol-addiction agent, in complex with human mitochondrial aldehyde dehydrogenase.

    Science.gov (United States)

    Lowe, Edward D; Gao, Guang-Yao; Johnson, Louise N; Keung, Wing Ming

    2008-08-14

    The ALDH2*2 gene encoding the inactive variant form of mitochondrial aldehyde dehydrogenase (ALDH2) protects nearly all carriers of this gene from alcoholism. Inhibition of ALDH2 has hence become a possible strategy to treat alcoholism. The natural product 7-O-glucosyl-4'-hydroxyisoflavone (daidzin), isolated from the kudzu vine ( Peruraria lobata), is a specific inhibitor of ALDH2 and suppresses ethanol consumption. Daidzin is the active principle in a herbal remedy for "alcohol addiction" and provides a lead for the design of improved ALDH2. The structure of daidzin/ALDH2 in complex at 2.4 A resolution shows the isoflavone moiety of daidzin binding close to the aldehyde substrate-binding site in a hydrophobic cleft and the glucosyl function binding to a hydrophobic patch immediately outside the isoflavone-binding pocket. These observations provide an explanation for both the specificity and affinity of daidzin (IC50 =80 nM) and the affinity of analogues with different substituents at the glucosyl position.

  20. Glu504Lys Single Nucleotide Polymorphism of Aldehyde Dehydrogenase 2 Gene and the Risk of Human Diseases

    Directory of Open Access Journals (Sweden)

    Yan Zhao

    2015-01-01

    Full Text Available Aldehyde dehydrogenase (ALDH 2 is a mitochondrial enzyme that is known for its important role in oxidation and detoxification of ethanol metabolite acetaldehyde. ALDH2 also metabolizes other reactive aldehydes such as 4-hydroxy-2-nonenal and acrolein. The Glu504Lys single nucleotide polymorphism (SNP of ALDH2 gene, which is found in approximately 40% of the East Asian populations, causes defect in the enzyme activity of ALDH2, leading to alterations in acetaldehyde metabolism and alcohol-induced “flushing” syndrome. Evidence suggests that ALDH2 Glu504Lys SNP is a potential candidate genetic risk factor for a variety of chronic diseases such as cardiovascular disease, cancer, and late-onset Alzheimer’s disease. In addition, the association between ALDH2 Glu504Lys SNP and the development of these chronic diseases appears to be affected by the interaction between the SNP and lifestyle factors such as alcohol consumption as well as by the presence of other genetic variations.

  1. Development of a human dihydroorotate dehydrogenase (hDHODH) pharma-similarity index approach with scaffold-hopping strategy for the design of novel potential inhibitors.

    Science.gov (United States)

    Shih, Kuei-Chung; Lee, Chi-Ching; Tsai, Chi-Neu; Lin, Yu-Shan; Tang, Chuan-Yi

    2014-01-01

    Human dihydroorotate dehydrogenase (hDHODH) is a class-2 dihydroorotate dehydrogenase. Because it is extensively used by proliferating cells, its inhibition in autoimmune and inflammatory diseases, cancers, and multiple sclerosis is of substantial clinical importance. In this study, we had two aims. The first was to develop an hDHODH pharma-similarity index approach (PhSIA) using integrated molecular dynamics calculations, pharmacophore hypothesis, and comparative molecular similarity index analysis (CoMSIA) contour information techniques. The approach, for the discovery and design of novel inhibitors, was based on 25 diverse known hDHODH inhibitors. Three statistical methods were used to verify the performance of hDHODH PhSIA. Fischer's cross-validation test provided a 98% confidence level and the goodness of hit (GH) test score was 0.61. The q(2), r(2), and predictive r(2) values were 0.55, 0.97, and 0.92, respectively, for a partial least squares validation method. In our approach, each diverse inhibitor structure could easily be aligned with contour information, and common substructures were unnecessary. For our second aim, we used the proposed approach to design 13 novel hDHODH inhibitors using a scaffold-hopping strategy. Chemical features of the approach were divided into two groups, and the Vitas-M Laboratory fragment was used to create de novo inhibitors. This approach provides a useful tool for the discovery and design of potential inhibitors of hDHODH, and does not require docking analysis; thus, our method can assist medicinal chemists in their efforts to identify novel inhibitors.

  2. Efficient expression of codon-adapted human acetaldehyde dehydrogenase 2 cDNA with 6×His tag in Pichia pastoris

    Institute of Scientific and Technical Information of China (English)

    ZHAO YuFeng; LEI MingKe; WU YuanXin; ZHANG ZiSheng; WANG CunWen

    2009-01-01

    Human mitochondrial acetaldehyde dehydrogenase 2 (ALDH2) catalyzes the oxidation of acetaldehyde to acetic acid. Therefore, ALDH2 has therapeutic potential in detoxification of acetaldehyde. Furthermore, ALDH2 catalyzes nitroglycerin to nitrate and 1, 2-glyceryldinitrate during therapy for angina pectoris, myocardial infarction, and heart failure. Large quantities of ALDH2 will be needed for potential clinical practice. In this study, Pichia pastoris was used as a platform for expression of human ALDH2.Based on the ALDH2~*1 cDNA sequence, we designed ALDH2 cDNA by choosing the P. pastoris preferred codons and by decreasing the G + C content level. The sequence was synthesized using the overlap extension PCR method. The cDNA and 6×His tags were subcloned into the plasmid pPIC9K.The recombinant protein was expressed in P. pastoris GS115 and purified using Ni~(2+)-Sepharose affinity chromatography. The amount of secreted protein in the culture was 80 mg/L in shake-flask cultivation and 260 mglL in high-density bioreactor fermentation. Secreted ALDH2 was easily purified from the culture supernatant by using Ni2+-Sepharose affinity chromatography. After purification of the fermentation supernatant, the enzyme had a specific activity of 1.2 U/mg protein. The yield was about 16 mg/L in a shake flask culture of P. pastoris GS115 which contained the original human ALDH2~*1 cDNA.

  3. Efficient expression of codon-adapted human acetaldehyde dehydrogenase 2 cDNA with 6×His tag in Pichia pastoris

    Institute of Scientific and Technical Information of China (English)

    2009-01-01

    Human mitochondrial acetaldehyde dehydrogenase 2 (ALDH2) catalyzes the oxidation of acetaldehyde to acetic acid. Therefore, ALDH2 has therapeutic potential in detoxification of acetaldehyde. Further-more, ALDH2 catalyzes nitroglycerin to nitrate and 1, 2-glyceryldinitrate during therapy for angina pectoris, myocardial infarction, and heart failure. Large quantities of ALDH2 will be needed for potential clinical practice. In this study, Pichia pastoris was used as a platform for expression of human ALDH2. Based on the ALDH2*1 cDNA sequence, we designed ALDH2 cDNA by choosing the P. pastoris preferred codons and by decreasing the G + C content level. The sequence was synthesized using the overlap extension PCR method. The cDNA and 6×His tags were subcloned into the plasmid pPIC9K. The recombinant protein was expressed in P. pastoris GS115 and purified using Ni2+-Sepharose affinity chromatography. The amount of secreted protein in the culture was 80 mg/L in shake-flask cultivation and 260 mg/L in high-density bioreactor fermentation. Secreted ALDH2 was easily purified from the culture supernatant by using Ni2+-Sepharose affinity chromatography. After purification of the fermentation supernatant, the enzyme had a specific activity of 1.2 U/mg protein. The yield was about 16 mg/L in a shake flask culture of P. pastoris GS115 which contained the original human ALDH2*1 cDNA.

  4. Effect of Follicular Fluid and Platelet-Activating Factor on Lactate Dehydrogenase C Expression in Human Asthenozoospermic Samples

    Directory of Open Access Journals (Sweden)

    Tahereh Esmaeilpour

    2014-01-01

    Full Text Available Background: Application of follicular fluid (FF and platelet-activating factor (PAF in artificial insemination improves sperm motility. Lactate dehydrogenase C (LDH-C is a key enzyme for sperm motility. In this study, the effects of FF and PAF on the sperm motility index and LDH-C expression were investigated. Moreover, LDH-C expression was compared between asthenozoospermic and normozoospermic samples. Methods: The expression of LDH-C was examined by quantitative real-time polymerase chain reaction (q-RT PCR and western blotting after it was treated with optimized concentrations of FF and PAF in twenty asthenozoospermic samples. Also, LDH-C expression was evaluated in five normozoospermic samples. Results: Samples with 75% FF and 100 nM of PAF had an increase in their percentages of progressive and slowly motile sperms and a decrease in their percentages of non-progressive and non-motile sperms. Moreover, LDH-C mRNA transcripts were not changed following PAF and FF treatment, and LDH-C protein was detected in highly progressive motile specimens treated with FF in the asthenozoospermic samples. Furthermore, LDH-C expression was more detectable in the normal sperms. Conclusion: Our results indicated that PAF had more beneficial effects than FF on sperm motility in the asthenozoospermic samples (P=0.0001, although the LDH-C expressions of the sperms were not changed significantly in both groups. We found no association between LDH-C expression and sperm motility after FF and PAF actions. This finding, however, requires further investigation. The fact that LDH-C protein was detected in the normozoospermic, but not asthenozoospermic, samples could be cited as a reason for the infertility in these patients.

  5. Saturated fatty acids in human visceral adipose tissue are associated with increased 11- β-hydroxysteroid-dehydrogenase type 1 expression.

    Science.gov (United States)

    Petrus, Paul; Rosqvist, Fredrik; Edholm, David; Mejhert, Niklas; Arner, Peter; Dahlman, Ingrid; Rydén, Mikael; Sundbom, Magnus; Risérus, Ulf

    2015-05-02

    Visceral fat accumulation is associated with metabolic disease. It is therefore relevant to study factors that regulate adipose tissue distribution. Recent data shows that overeating saturated fatty acids promotes greater visceral fat storage than overeating unsaturated fatty acids. Visceral adiposity is observed in states of hypercortisolism, and the enzyme 11-β-hydroxysteroid-dehydrogenase type 1 (11β-hsd1) is a major regulator of cortisol activity by converting inactive cortisone to cortisol in adipose tissue. We hypothesized that tissue fatty acid composition regulates body fat distribution through local effects on the expression of 11β-hsd1 and its corresponding gene (HSD11B1) resulting in altered cortisol activity. Visceral- and subcutaneous adipose tissue biopsies were collected during Roux-en-Y gastric bypass surgery from 45 obese women (BMI; 41±4 kg/m2). The fatty acid composition of each biopsy was measured and correlated to the mRNA levels of HSD11B1. 11β-hsd1 protein levels were determined in a subgroup (n=12) by western blot analysis. Our main finding was that tissue saturated fatty acids (e.g. palmitate) were associated with increased 11β-hsd1 gene- and protein-expression in visceral but not subcutaneous adipose tissue. The present study proposes a link between HSD11B1 and saturated fatty acids in visceral, but not subcutaneous adipose tissue. Nutritional regulation of visceral fat mass through HSD11B1 is of interest for the modulation of metabolic risk and warrants further investigation.

  6. Conversion of Suspected Food Carcinogen 5-Hydroxymethylfurfural by Sulfotransferases and Aldehyde Dehydrogenases in Postmitochondrial Tissue Preparations of Humans, Mice, and Rats.

    Science.gov (United States)

    Sachse, Benjamin; Meinl, Walter; Glatt, Hansruedi; Monien, Bernhard H

    2016-01-01

    The food contaminant 5-hydroxymethylfurfural (HMF) is formed by heat- and acid-catalyzed reactions from carbohydrates. More than 80% of HMF is metabolized by oxidation of the aldehyde group in mice and rats. Sulfo conjugation yields mutagenic 5-sulfoxymethylfurfural, the probable cause for the neoplastic effects observed in HMF-treated rodents. Considerable metabolic differences between species hinder assessing the tumorigenic risk associated with human dietary HMF uptake. Here, we assayed HMF turnover catalyzed by sulfotransferases or by aldehyde dehydrogenases (ALDHs) in postmitochondrial preparations from liver, kidney, colon, and lung of humans, mice, and rats. The tissues-specific clearance capacities of HMF sulfo conjugation (CL(SC)) and ALDH-catalyzed oxidation (CL(OX)) were concentrated to the liver. The hepatic clearance CL(SC) in mice (males: 487 µl/min/kg bw, females: 2520 µl/min/kg bw) and rats (males: 430 µl/min/kg bw, females: 198 µl/min/kg bw) were considerably higher than those in humans (males: 21.2 µl/min/kg bw, females: 32.2 µl/min/kg bw). The ALDH-related clearance rates CLOX in mice (males: 3400 ml/min/kg bw, females: 1410 ml/min/kg bw) were higher than those of humans (males: 436 ml/min/kg bw, females: 646 ml/min/kg bw) and rats (males: 627 ml/min/kg bw, females: 679 ml/min/kg bw). The ratio of CL(OX) to CL(SC) was lowest in female mice. This finding indicated that HMF sulfo conjugation was most substantial in the liver of female mice, a target tissue for HMF-induced neoplastic effects, and that humans may be less sensitive regarding HMF sulfo conjugation compared with the rodent models.

  7. Continuous inhibition of 11β-hydroxysteroid dehydrogenase type I in adipose tissue leads to tachyphylaxis in humans and rats but not in mice.

    Science.gov (United States)

    Morentin Gutierrez, P; Gyte, A; deSchoolmeester, J; Ceuppens, P; Swales, J; Stacey, C; Eriksson, J W; Sjöstrand, M; Nilsson, C; Leighton, B

    2015-10-01

    11β-hydroxysteroid dehydrogenase type I (11β-HSD1), a target for Type 2 diabetes mellitus, converts inactive glucocorticoids into bioactive forms, increasing tissue concentrations. We have compared the pharmacokinetic-pharmacodynamic (PK/PD) relationship of target inhibition after acute and repeat administration of inhibitors of 11β-HSD1 activity in human, rat and mouse adipose tissue (AT). Studies included abdominally obese human volunteers, rats and mice. Two specific 11β-HSD1 inhibitors (AZD8329 and COMPOUND-20) were administered as single oral doses or repeat daily doses for 7-9 days. 11β-HSD1 activity in AT was measured ex vivo by conversion of (3) H-cortisone to (3) H-cortisol. In human and rat AT, inhibition of 11β-HSD1 activity was lost after repeat dosing of AZD8329, compared with acute administration. Similarly, in rat AT, there was loss of inhibition of 11β-HSD1 activity after repeat dosing with COMPOUND-20 with continuous drug cover, but effects were substantially reduced if a 'drug holiday' period was maintained daily. Inhibition of 11β-HSD1 activity was not lost in mouse AT after continuous cover with COMPOUND-20 for 7 days. Human and rat AT, but not mouse AT, exhibited tachyphylaxis for inhibition of 11β-HSD1 activity after repeat dosing. Translation of observed efficacy in murine disease models to human for 11β-HSD1 inhibitors may be misleading. Investigators of the effects of 11β-HSD1 inhibitors should confirm that desired levels of enzyme inhibition in AT can be maintained over time after repeat dosing and not rely on results following a single dose. © 2015 The British Pharmacological Society.

  8. Identification of Hydroxysteroid (17β) dehydrogenase type 12 (HSD17B12) as a CD8+ T-cell-defined human tumor antigen of human carcinomas

    OpenAIRE

    2011-01-01

    Hydroxysteroid (17β) dehydrogenase type 12 (HSD17B12) is a multifunctional isoenzyme functional in the conversion of estrone to estradiol (E2), and elongation of long-chain fatty acids, in particular the conversion of palmitic to archadonic (AA) acid, the precursor of sterols and the inflammatory mediator, prostaglandin E2. Its overexpression together with that of COX-2 in breast carcinoma is associated with a poor prognosis. We have identified the HSD17B12114–122 peptide (IYDKIKTGL) as a nat...

  9. Targeting of cell metabolism in human acute myeloid leukemia--more than targeting of isocitrate dehydrogenase mutations and PI3K/AKT/mTOR signaling?

    Science.gov (United States)

    Hauge, Michelle; Bruserud, Øystein; Hatfield, Kimberley Joanne

    2016-03-01

    Targeting of cellular metabolism has emerged as a possible strategy in the treatment of human malignancies, and several experimental studies suggest that this therapeutic approach should also be considered in acute myeloid leukemia (AML). Clinical studies of metabolic intervention in AML patients with isocitrate dehydrogenase mutations have shown promising results. Moreover, metabolic targeting of the PI3K/AKT/mTOR signaling pathway as an anticancer strategy has been extensively studied. In this review, we focus on other emerging therapeutic alternatives for metabolic inhibition in human AML, in particular targeting of glycolysis and the AMP kinase signaling pathway. Pharmacological drugs for these metabolic interventions are already available and they seem to have an acceptable toxicity, even when used in combination with conventional chemotherapy. Future clinical studies of these therapeutic strategies should focus on the following: (i) heterogeneity of patients and the possibility that this treatment is most effective only for certain subsets of patients, (ii) toxic effects in AML patients with an existing disease-induced bone marrow failure prior to treatment, and (iii) whether this strategy should be used as part of a potentially curative treatment and/or as disease-stabilizing treatment to prolong survival in elderly or unfit patients.

  10. Acetaldehyde/alcohol dehydrogenase-2 (EhADH2) and clathrin are involved in internalization of human transferrin by Entamoeba histolytica.

    Science.gov (United States)

    Reyes-López, Magda; Bermúdez-Cruz, Rosa María; Avila, Eva E; de la Garza, Mireya

    2011-01-01

    Transferrin (Tf) is a host glycoprotein capable of binding two ferric-iron ions to become holotransferrin (holoTf), which transports iron in to all cells. Entamoeba histolytica is a parasitic protozoan able to use holoTf as a sole iron source in vitro. The mechanism by which this parasite scavenges iron from holoTf is unknown. An E. histolytica holoTf-binding protein (EhTfbp) was purified by using an anti-human transferrin receptor (TfR) monoclonal antibody. EhTfbp was identified by MS/MS analysis and database searches as E. histolytica acetaldehyde/alcohol dehydrogenase-2 (EhADH2), an iron-dependent enzyme. Both EhTfbp and EhADH2 bound holoTf and were recognized by the anti-human TfR antibody, indicating that they correspond to the same protein. It was found that the amoebae internalized holoTf through clathrin-coated pits, suggesting that holoTf endocytosis could be important for the parasite during colonization and invasion of the intestinal mucosa and liver.

  11. Nitrite reductase activity of rat and human xanthine oxidase, xanthine dehydrogenase, and aldehyde oxidase: evaluation of their contribution to NO formation in vivo.

    Science.gov (United States)

    Maia, Luisa B; Pereira, Vânia; Mira, Lurdes; Moura, José J G

    2015-01-27

    Nitrite is presently considered a NO "storage form" that can be made available, through its one-electron reduction, to maintain NO formation under hypoxia/anoxia. The molybdoenzymes xanthine oxidase/dehydrogenase (XO/XD) and aldehyde oxidase (AO) are two of the most promising mammalian nitrite reductases, and in this work, we characterized NO formation by rat and human XO/XD and AO. This is the first characterization of human enzymes, and our results support the employment of rat liver enzymes as suitable models of the human counterparts. A comprehensive kinetic characterization of the effect of pH on XO and AO-catalyzed nitrite reduction showed that the enzyme's specificity constant for nitrite increase 8-fold, while the Km(NO2(-)) decrease 6-fold, when the pH decreases from 7.4 to 6.3. These results demonstrate that the ability of XO/AO to trigger NO formation would be greatly enhanced under the acidic conditions characteristic of ischemia. The dioxygen inhibition was quantified, and the Ki(O2) values found (24.3-48.8 μM) suggest that in vivo NO formation would be fine-tuned by dioxygen availability. The potential in vivo relative physiological relevance of XO/XD/AO-dependent pathways of NO formation was evaluated using HepG2 and HMEC cell lines subjected to hypoxia. NO formation by the cells was found to be pH-, nitrite-, and dioxygen-dependent, and the relative contribution of XO/XD plus AO was found to be as high as 50%. Collectively, our results supported the possibility that XO/XD and AO can contribute to NO generation under hypoxia inside a living human cell. Furthermore, the molecular mechanism of XO/AO-catalyzed nitrite reduction was revised.

  12. Action of metadoxine on isolated human and rat alcohol and aldehyde dehydrogenases. Effect on enzymes in chronic ethanol-fed rats.

    Science.gov (United States)

    Parés, X; Moreno, A; Peralba, J M; Font, M; Bruseghini, L; Esteras, A

    1991-01-01

    Metadoxine (pyridoxine-pyrrolidone carboxylate) has been reported to accelerate ethanol metabolism. In the present work we have investigated the effect of metadoxine on the activities of isolated alcohol and aldehyde dehydrogenases from rat and man, and on the activity of these enzymes in chronic ethanol-fed rats. Our results indicate that in vitro metadoxine does not activate any of the enzymatic forms of alcohol dehydrogenase (classes I and II) or aldehyde dehydrogenase (low-Km and high-Km, cytosolic and mitochondrial). At concentrations higher than 0.1 mM, metadoxine inhibits rat class II alcohol dehydrogenase, although this would probably not affect the physiological ethanol metabolism. Chronic ethanol intake for 5 weeks results in a 25% decrease of rat hepatic alcohol dehydrogenase (class I) activity as compared with the pair-fed controls. The simultaneous treatment with metadoxine prevents activity loss, suggesting that the positive effect of metadoxine on ethanol metabolism can be explained by the maintenance of normal levels of alcohol dehydrogenase during chronic ethanol intake. No specific effect of chronic exposure to ethanol or to metadoxine was detected on rat aldehyde dehydrogenase activity.

  13. Lack of renal 11 beta-hydroxysteroid dehydrogenase type 2 at birth, a targeted temporal window for neonatal glucocorticoid action in human and mice.

    Directory of Open Access Journals (Sweden)

    Laetitia Martinerie

    Full Text Available BACKGROUND: Glucocorticoid hormones play a major role in fetal organ maturation. Yet, excessive glucocorticoid exposure in utero can result in a variety of detrimental effects, such as growth retardation and increased susceptibility to the development of hypertension. To protect the fetus, maternal glucocorticoids are metabolized into inactive compounds by placental 11beta-hydroxysteroid dehydrogenase type2 (11βHSD2. This enzyme is also expressed in the kidney, where it prevents illicit occupation of the mineralocorticoid receptor by glucocorticoids. We investigated the role of renal 11βHSD2 in the control of neonatal glucocorticoid metabolism in the human and mouse. METHODS: Cortisol (F and cortisone (E concentrations were measured in maternal plasma, umbilical cord blood and human newborn urine using HPLC. 11βHSD2 activity was indirectly assessed by comparing the F/E ratio between maternal and neonatal plasma (placental activity and between plasma and urine in newborns (renal activity. Direct measurement of renal 11βHSD2 activity was subsequently evaluated in mice at various developmental stages. Renal 11βHSD2 mRNA and protein expression were analyzed by quantitative RT-PCR and immunohistochemistry during the perinatal period in both species. RESULTS: We demonstrate that, at variance with placental 11βHSD2 activity, renal 11βHSD2 activity is weak in newborn human and mouse and correlates with low renal mRNA levels and absence of detectable 11βHSD2 protein. CONCLUSIONS: We provide evidence for a weak or absent expression of neonatal renal 11βHSD2 that is conserved among species. This temporal and tissue-specific 11βHSD2 expression could represent a physiological window for glucocorticoid action yet may constitute an important predictive factor for adverse outcomes of glucocorticoid excess through fetal programming.

  14. Insights into the mechanism of oxidation of dihydroorotate to orotate catalysed by human class 2 dihydroorotate dehydrogenase: a QM/MM free energy study.

    Science.gov (United States)

    Alves, Cláudio Nahum; Silva, José Rogério A; Roitberg, Adrian E

    2015-07-21

    The dihydroorotate dehydrogenase (DHOD) enzyme catalyzes the unique redox reaction in the de novo pyrimidine biosynthesis pathway. In this reaction, the oxidation of dihydroorotate (DHO) to orotate (OA) and reduction of the flavin mononucleotide (FMN) cofactor is catalysed by DHOD. The class 2 DHOD, to which the human enzyme belongs, was experimentally shown to follow a stepwise mechanism but the data did not allow the determination of the order of bond-breaking in a stepwise oxidation of DHO. The goal of this study is to understand the reaction mechanism at the molecular level of class 2 DHOD, which may aid in the design of inhibitors that selectively impact the activity of only certain members of the enzyme family. In this paper, the catalytic mechanism of oxidation of DHO to OA in human DHOD was studied using a hybrid Quantum Mechanical/Molecular Mechanical (QM/MM) approach and Molecular Dynamics (MD) simulations. The free energy barriers calculated reveal that the mechanism in human DHOD occurs via a stepwise reaction pathway. In the first step, a proton is abstracted from the C5 of DHO to the deprotonated Ser215 side chain. Whereas, in the second step, the transfer of the hydride or hydride equivalent from the C6 of DHO to the N5 of FMN, where free energy barrier calculated by the DFT/MM level is 10.84 kcal mol(-1). Finally, a residual decomposition analysis was carried out in order to elucidate the influence of the catalytic region residues during DHO oxidation.

  15. Aldehyde dehydrogenase 2 protects human umbilical vein endothelial cells against oxidative damage and increases endothelial nitric oxide production to reverse nitroglycerin tolerance.

    Science.gov (United States)

    Hu, X Y; Fang, Q; Ma, D; Jiang, L; Yang, Y; Sun, J; Yang, C; Wang, J S

    2016-06-10

    Medical nitroglycerin (glyceryl trinitrate, GTN) use is limited principally by tolerance typified by a decrease in nitric oxide (NO) produced by biotransformation. Such tolerance may lead to endothelial dysfunction by inducing oxidative stress. In vivo studies have demonstrated that aldehyde dehydrogenase 2 (ALDH2) plays important roles in GTN biotransformation and tolerance. Thus, modification of ALDH2 expression represents a potentially effective strategy to prevent and reverse GTN tolerance and endothelial dysfunction. In this study, a eukaryotic expression vector containing the ALDH2 gene was introduced into human umbilical vein endothelial cells (HUVECs) by liposome-mediated transfection. An indirect immunofluorescence assay showed that ALDH2 expression increased 24 h after transfection. Moreover, real-time polymerase chain reaction and western blotting revealed significantly higher ALDH2 mRNA and protein expression in the gene-transfected group than in the two control groups. GTN tolerance was induced by treating HUVECs with 10 mM GTN for 16 h + 10 min, which significantly decreased NO levels in control cells, but not in those transfected with ALDH2. Overexpression of ALDH2 increased cell survival against GTN-induced cytotoxicity and conferred protection from oxidative damage resulting from nitrate tolerance, accompanied by decreased production of intracellular reactive oxygen species and reduced expression of heme oxygenase 1. Furthermore, ALDH2 overexpression promoted Akt phosphorylation under GTN tolerance conditions. ALDH2 gene transfection can reverse and prevent tolerance to GTN through its bioactivation and protect against oxidative damage, preventing the development of endothelial dysfunction.

  16. Rational Design of Benzylidenehydrazinyl-Substituted Thiazole Derivatives as Potent Inhibitors of Human Dihydroorotate Dehydrogenase with in Vivo Anti-arthritic Activity

    Science.gov (United States)

    Li, Shiliang; Luan, Guoqin; Ren, Xiaoli; Song, Wenlin; Xu, Liuxin; Xu, Minghao; Zhu, Junsheng; Dong, Dong; Diao, Yanyan; Liu, Xiaofeng; Zhu, Lili; Wang, Rui; Zhao, Zhenjiang; Xu, Yufang; Li, Honglin

    2015-01-01

    Human dihydroorotate dehydrogenase (hDHODH) is an attractive therapeutic target for the treatment of rheumatoid arthritis, transplant rejection and other autoimmune diseases. Based on the X-ray structure of hDHODH in complex with lead compound 7, a series of benzylidenehydrazinyl-substituted thiazole derivatives as potent inhibitors of hDHODH were designed and synthesized, of which 19 and 30 were the most potent with IC50 values in the double-digit nanomolar range. Moreover, compound 19 displayed significant anti-arthritic effects and favorable pharmacokinetic profiles in vivo. Further X-ray structure and SAR analyses revealed that the potencies of the designed inhibitors were partly attributable to additional water-mediated hydrogen bond networks formed by an unexpected buried water between hDHODH and the 2-(2-methylenehydrazinyl)thiazole scaffold. This work not only elucidates promising scaffolds targeting hDHODH for the treatment of rheumatoid arthritis, but also demonstrates that the water-mediated hydrogen bond interaction is an important factor in molecular design and optimization. PMID:26443076

  17. The β and γ subunits play distinct functional roles in the α2βγ heterotetramer of human NAD-dependent isocitrate dehydrogenase

    Science.gov (United States)

    Ma, Tengfei; Peng, Yingjie; Huang, Wei; Liu, Yabing; Ding, Jianping

    2017-01-01

    Human NAD-dependent isocitrate dehydrogenase existing as the α2βγ heterotetramer, catalyzes the decarboxylation of isocitrate into α-ketoglutarate in the Krebs cycle, and is allosterically regulated by citrate, ADP and ATP. To explore the functional roles of the regulatory β and γ subunits, we systematically characterized the enzymatic properties of the holoenzyme and the composing αβ and αγ heterodimers in the absence and presence of regulators. The biochemical and mutagenesis data show that αβ and αγ alone have considerable basal activity but the full activity of α2βγ requires the assembly and cooperative function of both heterodimers. α2βγ and αγ can be activated by citrate or/and ADP, whereas αβ cannot. The binding of citrate or/and ADP decreases the S0.5,isocitrate and thus enhances the catalytic efficiencies of the enzymes, and the two activators can act independently or synergistically. Moreover, ATP can activate α2βγ and αγ at low concentration and inhibit the enzymes at high concentration, but has only inhibitory effect on αβ. Furthermore, the allosteric activation of α2βγ is through the γ subunit not the β subunit. These results demonstrate that the γ subunit plays regulatory role to activate the holoenzyme, and the β subunit the structural role to facilitate the assembly of the holoenzyme.

  18. Mitochondrial targeting of human NADH dehydrogenase (ubiquinone flavoprotein 2 (NDUFV2 and its association with early-onset hypertrophic cardiomyopathy and encephalopathy

    Directory of Open Access Journals (Sweden)

    Kao Mou-Chieh

    2011-05-01

    Full Text Available Abstract Background NADH dehydrogenase (ubiquinone flavoprotein 2 (NDUFV2, containing one iron sulfur cluster ([2Fe-2S] binuclear cluster N1a, is one of the core nuclear-encoded subunits existing in human mitochondrial complex I. Defects in this subunit have been associated with Parkinson's disease, Alzheimer's disease, Bipolar disorder, and Schizophrenia. The aim of this study is to examine the mitochondrial targeting of NDUFV2 and dissect the pathogenetic mechanism of one human deletion mutation present in patients with early-onset hypertrophic cardiomyopathy and encephalopathy. Methods A series of deletion and point-mutated constructs with the c-myc epitope tag were generated to identify the location and sequence features of mitochondrial targeting sequence for NDUFV2 in human cells using the confocal microscopy. In addition, various lengths of the NDUFV2 N-terminal and C-terminal fragments were fused with enhanced green fluorescent protein to investigate the minimal region required for correct mitochondrial import. Finally, a deletion construct that mimicked the IVS2+5_+8delGTAA mutation in NDUFV2 gene and would eventually produce a shortened NDUFV2 lacking 19-40 residues was generated to explore the connection between human gene mutation and disease. Results We identified that the cleavage site of NDUFV2 was located around amino acid 32 of the precursor protein, and the first 22 residues of NDUFV2 were enough to function as an efficient mitochondrial targeting sequence to carry the passenger protein into mitochondria. A site-directed mutagenesis study showed that none of the single-point mutations derived from basic, hydroxylated and hydrophobic residues in the NDUFV2 presequence had a significant effect on mitochondrial targeting, while increasing number of mutations in basic and hydrophobic residues gradually decreased the mitochondrial import efficacy of the protein. The deletion mutant mimicking the human early-onset hypertrophic

  19. Mitochondrial targeting of human NADH dehydrogenase (ubiquinone) flavoprotein 2 (NDUFV2) and its association with early-onset hypertrophic cardiomyopathy and encephalopathy.

    Science.gov (United States)

    Liu, Hsin-Yu; Liao, Pin-Chao; Chuang, Kai-Tun; Kao, Mou-Chieh

    2011-05-06

    NADH dehydrogenase (ubiquinone) flavoprotein 2 (NDUFV2), containing one iron sulfur cluster ([2Fe-2S] binuclear cluster N1a), is one of the core nuclear-encoded subunits existing in human mitochondrial complex I. Defects in this subunit have been associated with Parkinson's disease, Alzheimer's disease, Bipolar disorder, and Schizophrenia. The aim of this study is to examine the mitochondrial targeting of NDUFV2 and dissect the pathogenetic mechanism of one human deletion mutation present in patients with early-onset hypertrophic cardiomyopathy and encephalopathy. A series of deletion and point-mutated constructs with the c-myc epitope tag were generated to identify the location and sequence features of mitochondrial targeting sequence for NDUFV2 in human cells using the confocal microscopy. In addition, various lengths of the NDUFV2 N-terminal and C-terminal fragments were fused with enhanced green fluorescent protein to investigate the minimal region required for correct mitochondrial import. Finally, a deletion construct that mimicked the IVS2+5_+8delGTAA mutation in NDUFV2 gene and would eventually produce a shortened NDUFV2 lacking 19-40 residues was generated to explore the connection between human gene mutation and disease. We identified that the cleavage site of NDUFV2 was located around amino acid 32 of the precursor protein, and the first 22 residues of NDUFV2 were enough to function as an efficient mitochondrial targeting sequence to carry the passenger protein into mitochondria. A site-directed mutagenesis study showed that none of the single-point mutations derived from basic, hydroxylated and hydrophobic residues in the NDUFV2 presequence had a significant effect on mitochondrial targeting, while increasing number of mutations in basic and hydrophobic residues gradually decreased the mitochondrial import efficacy of the protein. The deletion mutant mimicking the human early-onset hypertrophic cardiomyopathy and encephalopathy lacked 19-40 residues in

  20. Human cord blood progenitors with high aldehyde dehydrogenase activity improve vascular density in a model of acute myocardial infarction

    Directory of Open Access Journals (Sweden)

    Creer Michael H

    2010-03-01

    Full Text Available Abstract Human stem cells from adult sources have been shown to contribute to the regeneration of muscle, liver, heart, and vasculature. The mechanisms by which this is accomplished are, however, still not well understood. We tested the engraftment and regenerative potential of human umbilical cord blood-derived ALDHhiLin-, and ALDHloLin- cells following transplantation to NOD/SCID or NOD/SCID β2m null mice with experimentally induced acute myocardial infarction. We used combined nanoparticle labeling and whole organ fluorescent imaging to detect human cells in multiple organs 48 hours post transplantation. Engraftment and regenerative effects of cell treatment were assessed four weeks post transplantation. We found that ALDHhiLin- stem cells specifically located to the site of injury 48 hours post transplantation and engrafted the infarcted heart at higher frequencies than ALDHloLin- committed progenitor cells four weeks post transplantation. We found no donor derived cardiomyocytes and few endothelial cells of donor origin. Cell treatment was not associated with any detectable functional improvement at the four week endpoint. There was, however, a significant increase in vascular density in the central infarct zone of ALDHhiLin- cell-treated mice, as compared to PBS and ALDHloLin- cell-treated mice. Conclusions Our data indicate that adult human stem cells do not become a significant part of the regenerating tissue, but rapidly home to and persist only temporarily at the site of hypoxic injury to exert trophic effects on tissue repair thereby enhancing vascular recovery.

  1. Identification and expression of fructose-1,6-bisphosphate aldolase genes and their relations to oil content in developing seeds of tea oil tree (Camellia oleifera)

    Science.gov (United States)

    Tea oil tree (Camellia oleifera, Co) provides a fine edible oil source in China. Tea oil from the seeds is very beneficial to human health. Fructose-1,6-bisphosphate aldolase (FBA) hydrolyzes fructose-1,6-bisphosphate into dihydroxyacetone phosphate and glyceraldehyde 3-phosphate, two critical metab...

  2. Expression of the human isoform of glutamate dehydrogenase, hGDH2, augments TCA cycle capacity and oxidative metabolism of glutamate during glucose deprivation in astrocytes.

    Science.gov (United States)

    Nissen, Jakob D; Lykke, Kasper; Bryk, Jaroslaw; Stridh, Malin H; Zaganas, Ioannis; Skytt, Dorte M; Schousboe, Arne; Bak, Lasse K; Enard, Wolfgang; Pääbo, Svante; Waagepetersen, Helle S

    2017-03-01

    A key enzyme in brain glutamate homeostasis is glutamate dehydrogenase (GDH) which links carbohydrate and amino acid metabolism mediating glutamate degradation to CO2 and expanding tricarboxylic acid (TCA) cycle capacity with intermediates, i.e. anaplerosis. Humans express two GDH isoforms, GDH1 and 2, whereas most other mammals express only GDH1. hGDH1 is widely expressed in human brain while hGDH2 is confined to astrocytes. The two isoforms display different enzymatic properties and the nature of these supports that hGDH2 expression in astrocytes potentially increases glutamate oxidation and supports the TCA cycle during energy-demanding processes such as high intensity glutamatergic signaling. However, little is known about how expression of hGDH2 affects the handling of glutamate and TCA cycle metabolism in astrocytes. Therefore, we cultured astrocytes from cerebral cortical tissue of hGDH2-expressing transgenic mice. We measured glutamate uptake and metabolism using [(3) H]glutamate, while the effect on metabolic pathways of glutamate and glucose was evaluated by use of (13) C and (14) C substrates and analysis by mass spectrometry and determination of radioactively labeled metabolites including CO2 , respectively. We conclude that hGDH2 expression increases capacity for uptake and oxidative metabolism of glutamate, particularly during increased workload and aglycemia. Additionally, hGDH2 expression increased utilization of branched-chain amino acids (BCAA) during aglycemia and caused a general decrease in oxidative glucose metabolism. We speculate, that expression of hGDH2 allows astrocytes to spare glucose and utilize BCAAs during substrate shortages. These findings support the proposed role of hGDH2 in astrocytes as an important fail-safe during situations of intense glutamatergic activity. GLIA 2017;65:474-488.

  3. Enhanced Aerobic Glycolysis by S-Nitrosoglutathione via HIF-1α Associated GLUT1/Aldolase A Axis in Human Endothelial Cells.

    Science.gov (United States)

    Yan, Jieping; Huang, Xin; Zhu, Danyan; Lou, Yijia

    2017-08-01

    S-nitrosoglutathione (GSNO)-induced apoptosis is associated with reactive oxygen species and loss of mitochondrial Omi/HtrA2 in human endothelial cells (ECs). But its upstream regulation is still not elucidated. Here, we demonstrate that hypoxia induced factor-1α (HIF-1α)-linked aerobic glycolysis is associated with mitochondrial abnormality by treatment of human EC-derived EA.hy926 cells with GSNO (500 µM) for 6 h. GSNO exposure increased the levels of Aldolase A and glucose transporter-1 (GLUT1) mRNAs and proteins. And selectively enhanced aldolase A activity to form glyceraldehyde 3-phosphate, dihydroxyacetone phosphate, which subsequently increased intracellular levels of methylglyoxal and reactive oxygen species in parallel. Using the biotin switch assay, we found that GSNO increased the S-nitrosylating levels of total protein and HIF-1α. Knockdown of HIF-1α with siRNA attenuated its target aldolase A and GLUT1 expression but not VEGF. In contrast, nitrosylation scanvenger dithiothreitol could decrease all the protein levels. It suggested that aerobic glycolytic flux was more dependent on HIF-1α level, and that HIF-1α S-nitrosylation was crucial for its target expression under the normoxic condition. Moreover, GSNO-induced PI3 K (phosphoinositide 3-kinase)/Akt phosphorylation might contribute to HIF-1α stabilization and nucleus translocation, thereby aiding aldolase A and GLUT1 mRNAs upregulation. Taken together, higher concentration GSNO promotes glycolytic flux enhancement and methylglyoxal formation via HIF-1α S-nitrosylation. These findings reveal the mechanism of enhanced glycolysis-associated mitochondrial dysfunction in ECs by GSNO exposure under normoxic and non-hyperglycemic condition. And offer the early potential targets for vascular pathophysiological evaluation. J. Cell. Biochem. 118: 2443-2453, 2017. © 2017 Wiley Periodicals, Inc. © 2017 Wiley Periodicals, Inc.

  4. Identification of a new human mtDNA polymorphism (A14290G in the NADH dehydrogenase subunit 6 gene

    Directory of Open Access Journals (Sweden)

    M. Houshmand

    2006-06-01

    Full Text Available Leber's hereditary optic neuropathy (LHON is a maternally inherited form of retinal ganglion cell degeneration leading to optic atrophy in young adults. Several mutations in different genes can cause LHON (heterogeneity. The ND6 gene is one of the mitochondrial genes that encodes subunit 6 of complex I of the respiratory chain. This gene is a hot spot gene. Fourteen Persian LHON patients were analyzed with single-strand conformational polymorphism and DNA sequencing techniques. None of these patients had four primary mutations, G3460A, G11788A, T14484C, and G14459A, related to this disease. We identified twelve nucleotide substitutions, G13702C, T13879C, T14110C, C14167T, G14199T, A14233G, G14272C, A14290G, G14365C, G14368C, T14766C, and T14798C. Eleven of twelve nucleotide substitutions had already been reported as polymorphism. One of the nucleotide substitutions (A14290G has not been reported. The A14290G nucleotide substitution does not change its amino acid (glutamic acid. We looked for base conservation using DNA star software (MEGALIGN program as a criterion for pathogenic or nonpathogenic nucleotide substitution in A14290G. The results of ND6 gene alignment in humans and in other species (mouse, cow, elegans worm, and Neurospora crassa mold revealed that the 14290th base was not conserved. Fifty normal controls were also investigated for this polymorphism in the Iranian population and two had A14290G polymorphism (4%. This study provides evidence that the mtDNA A14290G allele is a new nonpathogenic polymorphism. We suggest follow-up studies regarding this polymorphism in different populations.

  5. Human 17β-hydroxysteroid dehydrogenase-ligand complexes: crystals of different space groups with various cations and combined seeding and co-crystallization

    Science.gov (United States)

    Zhu, D.-W.; Han, Q.; Qiu, W.; Campbell, R. L.; Xie, B.-X.; Azzi, A.; Lin, S.-X.

    1999-01-01

    Human estrogenic 17β-hydroxysteroid dehydrogenase (17β-HSD1) is responsible for the synthesis of active estrogens that stimulate the proliferation of breast cancer cells. The enzyme has been crystallized using a Mg 2+/PEG (3500)/β-octyl glucoside system [Zhu et al., J. Mol. Biol. 234 (1993) 242]. The space group of these crystals is C2. Here we report that cations can affect 17β-HSD1 crystallization significantly. In the presence of Mn 2+ instead of Mg 2+, crystals have been obtained in the same space group with similar unit cell dimensions. In the presence of Li + and Na + instead of Mg 2+, the space group has been changed to P2 12 12 1. A whole data set for a crystal of 17ß-HSD1 complex with progesterone grown in the presence of Li + has been collected to 1.95 Å resolution with a synchrotron source. The cell dimensions are a=41.91 Å, b=108.21 Å, c=117.00 Å. The structure has been preliminarily determined by molecular replacement, yielding important information on crystal packing in the presence of different cations. In order to further understand the structure-function relationship of 17β-HSD1, enzyme complexes with several ligands have been crystallized. As the steroids have very low aqueous solubility, we used a combined method of seeding and co-crystallization to obtain crystals of 17β-HSD1 complexed with various ligands. This method provides ideal conditions for growing complex crystals, with ligands such as 20α-hydroxysteroid progesterone, testosterone and 17β-methyl-estradiol-NADP +. Several complex structures have been determined with reliable electronic density of the bound ligands.

  6. Caffeine reduces 11β-hydroxysteroid dehydrogenase type 2 expression in human trophoblast cells through the adenosine A(2B receptor.

    Directory of Open Access Journals (Sweden)

    Saina Sharmin

    Full Text Available Maternal caffeine consumption is associated with reduced fetal growth, but the underlying molecular mechanisms are unknown. Since there is evidence that decreased placental 11β-hydroxysteroid dehydrogenase type 2 (11β-HSD2 is linked to fetal growth restriction, we hypothesized that caffeine may inhibit fetal growth partly through down regulating placental 11β-HSD2. As a first step in examining this hypothesis, we studied the effects of caffeine on placental 11β-HSD2 activity and expression using our established primary human trophoblast cells as an in vitro model system. Given that maternal serum concentrations of paraxanthine (the primary metabolite of caffeine were greater in women who gave birth to small-for-gestational age infants than to appropriately grown infants, we also studied the effects of paraxanthine. Our main findings were: (1 both caffeine and paraxanthine decreased placental 11β-HSD2 activity, protein and mRNA in a concentration-dependent manner; (2 this inhibitory effect was mediated by the adenosine A(2B receptor, since siRNA-mediated knockdown of this receptor prevented caffeine- and paraxanthine-induced inhibition of placental 11β-HSD2; and (3 forskolin (an activator of adenyl cyclase and a known stimulator of 11β-HSD2 abrogated the inhibitory effects of both caffeine and paraxanthine, which provides evidence for a functional link between exposure to caffeine and paraxanthine, decreased intracellular levels of cAMP and reduced placental 11β-HSD2. Taken together, these findings reveal that placental 11β-HSD2 is a novel molecular target through which caffeine may adversely affect fetal growth. They also uncover a previously unappreciated role for the adenosine A(2B receptor signaling in regulating placental 11β-HSD2, and consequently fetal development.

  7. RNA-Seq of Human Breast Ductal Carcinoma In Situ Models Reveals Aldehyde Dehydrogenase Isoform 5A1 as a Novel Potential Target

    Science.gov (United States)

    Kaur, Hitchintan; Mao, Shihong; Li, Quanwen; Sameni, Mansoureh; Krawetz, Stephen A.; Sloane, Bonnie F.; Mattingly, Raymond R.

    2012-01-01

    Breast ductal carcinoma in situ (DCIS) is being found in great numbers of women due to the widespread use of mammography. To increase knowledge of DCIS, we determined the expression changes that are common among three DCIS models (MCF10.DCIS, SUM102 and SUM225) compared to the MCF10A model of non-tumorigenic mammary epithelial cells in three dimensional (3D) overlay culture with reconstituted basement membrane (rBM). Extracted mRNA was subjected to 76 cycles of deep sequencing (RNA-Seq) using Illumina Genome Analyzer GAIIx. Analysis of RNA-Seq results showed 295 consistently differentially expressed transcripts in the DCIS models. These differentially expressed genes encode proteins that are associated with a number of signaling pathways such as integrin, fibroblast growth factor and TGFβ signaling, show association with cell-cell signaling, cell-cell adhesion and cell proliferation, and have a notable bias toward localization in the extracellular and plasma membrane compartments. RNA-Seq data was validated by quantitative real-time PCR of selected differentially expressed genes. Aldehyde dehydrogenase 5A1 (ALDH5A1) which is an enzyme that is involved in mitochondrial glutamate metabolism, was over-expressed in all three DCIS models at both the mRNA and protein levels. Disulfiram and valproic acid are known to inhibit ALDH5A1 and are safe for chronic use in humans for other disorders. Both of these drugs significantly inhibited net proliferation of the DCIS 3D rBM overlay models, but had minimal effect on MCF10A 3D rBM overlay models. These results suggest that ALDH5A1 may play an important role in DCIS and potentially serve as a novel molecular therapeutic target. PMID:23236365

  8. Human 3α-hydroxysteroid dehydrogenase type 3: structural clues of 5α-DHT reverse binding and enzyme down-regulation decreasing MCF7 cell growth.

    Science.gov (United States)

    Zhang, Bo; Hu, Xiao-Jian; Wang, Xiao-Qiang; Thériault, Jean-François; Zhu, Dao-Wei; Shang, Peng; Labrie, Fernand; Lin, Sheng-Xiang

    2016-04-15

    Human 3α-HSD3 (3α-hydroxysteroid dehydrogenase type 3) plays an essential role in the inactivation of the most potent androgen 5α-DHT (5α-dihydrotestosterone). The present study attempts to obtain the important structure of 3α-HSD3 in complex with 5α-DHT and to investigate the role of 3α-HSD3 in breast cancer cells. We report the crystal structure of human 3α-HSD3·NADP(+)·A-dione (5α-androstane-3,17-dione)/epi-ADT (epiandrosterone) complex, which was obtained by co-crystallization with 5α-DHT in the presence of NADP(+) Although 5α-DHT was introduced during the crystallization, oxidoreduction of 5α-DHT occurred. The locations of A-dione and epi-ADT were identified in the steroid-binding sites of two 3α-HSD3 molecules per crystal asymmetric unit. An overlay showed that A-dione and epi-ADT were oriented upside-down and flipped relative to each other, providing structural clues for 5α-DHT reverse binding in the enzyme with the generation of different products. Moreover, we report the crystal structure of the 3α-HSD3·NADP(+)·4-dione (4-androstene-3,17-dione) complex. When a specific siRNA (100 nM) was used to suppress 3α-HSD3 expression without interfering with 3α-HSD4, which shares a highly homologous active site, the 5α-DHT concentration increased, whereas MCF7 cell growth was suppressed. The present study provides structural clues for 5α-DHT reverse binding within 3α-HSD3, and demonstrates for the first time that down-regulation of 3α-HSD3 decreases MCF7 breast cancer cell growth. © 2016 The Author(s). Published by Portland Press Limited on behalf of the Biochemical Society.

  9. Antimicrobial properties and death-inducing mechanisms of saccharomycin, a biocide secreted by Saccharomyces cerevisiae

    DEFF Research Database (Denmark)

    Branco, Patrícia; Francisco, Diana; Monteiro, Margarida

    2017-01-01

    We recently found that Saccharomyces cerevisiae (strain CCMI 885) secretes antimicrobial peptides (AMPs) derived from the glycolytic enzyme glyceraldehyde 3-phosphate dehydrogenase (GAPDH) that are active against various wine-related yeast and bacteria. Here, we show that several other S. cerevis......We recently found that Saccharomyces cerevisiae (strain CCMI 885) secretes antimicrobial peptides (AMPs) derived from the glycolytic enzyme glyceraldehyde 3-phosphate dehydrogenase (GAPDH) that are active against various wine-related yeast and bacteria. Here, we show that several other S....... cerevisiae strains also secrete natural biocide fractions during alcoholic fermentation, although at different levels, which correlates with the antagonistic effect exerted against non-Saccharomyces yeasts. We, therefore, term this biocide saccharomycin. The native AMPs were purified by gel...... species during alcoholic fermentations....

  10. Rice ubiquitin ligase EL5 prevents root meristematic cell death under high nitrogen conditions and interacts with a cytosolic GAPDH.

    Science.gov (United States)

    Nishizawa, Yoko; Mochizuki, Susumu; Koiwai, Hanae; Kondo, Katsuhiko; Kishimoto, Kyutaro; Katoh, Etsuko; Minami, Eiichi

    2015-01-01

    Root formation in rice transformants overexpressing mutated EL5 (mEL5) was severely inhibited because of meristematic cell death. Cell death was caused by nitrogen sources, particularly nitrate forms, in the culture medium. Nitrite treatment increased the cytokinin contents in roots, but mEL5 contained more cytokinins than non-transformants. Transcriptome profiling showed overlaps between nitrite-responsive genes in non-transformants and genes with altered expression in untreated mEL5. These results indicate that impairment of EL5 function activates nitrogen signaling despite the absence of a nitrogen source. Physical interaction between the EL5 C-terminal region and a cytosolic glyceraldehyde-3-phosphate dehydrogenase, OsGapC2, was demonstrated in vitro and in vivo. Elucidation of the role of glyceraldehyde-3-phosphate dehydrogenase in oxidative cell death in plants is expected in future.

  11. Glucose-6-phosphate dehydrogenase deficiency

    Science.gov (United States)

    ... medlineplus.gov/ency/article/000528.htm Glucose-6-phosphate dehydrogenase deficiency To use the sharing features on this page, please enable JavaScript. Glucose-6-phosphate dehydrogenase (G6PD) deficiency is a condition in which ...

  12. Ethanol oxidation and the inhibition by drugs in human liver, stomach and small intestine: Quantitative assessment with numerical organ modeling of alcohol dehydrogenase isozymes.

    Science.gov (United States)

    Chi, Yu-Chou; Lee, Shou-Lun; Lai, Ching-Long; Lee, Yung-Pin; Lee, Shiao-Pieng; Chiang, Chien-Ping; Yin, Shih-Jiun

    2016-10-25

    Alcohol dehydrogenase (ADH) is the principal enzyme responsible for metabolism of ethanol. Human ADH constitutes a complex isozyme family with striking variations in kinetic function and tissue distribution. Liver and gastrointestinal tract are the major sites for first-pass metabolism (FPM). Their relative contributions to alcohol FPM and degrees of the inhibitions by aspirin and its metabolite salicylate, acetaminophen and cimetidine remain controversial. To address this issue, mathematical organ modeling of ethanol-oxidizing activities in target tissues and that of the ethanol-drug interactions were constructed by linear combination of the corresponding numerical rate equations of tissue constituent ADH isozymes with the documented isozyme protein contents, kinetic parameters for ethanol oxidation and the drug inhibitions of ADH isozymes/allozymes that were determined in 0.1 M sodium phosphate at pH 7.5 and 25 °C containing 0.5 mM NAD(+). The organ simulations reveal that the ADH activities in mucosae of the stomach, duodenum and jejunum with ADH1C*1/*1 genotype are less than 1%, respectively, that of the ADH1B*1/*1-ADH1C*1/*1 liver at 1-200 mM ethanol, indicating that liver is major site of the FPM. The apparent hepatic KM and Vmax for ethanol oxidation are simulated to be 0.093 ± 0.019 mM and 4.0 ± 0.1 mmol/min, respectively. At 95% clearance in liver, the logarithmic average sinusoidal ethanol concentration is determined to be 0.80 mM in accordance with the flow-limited gradient perfusion model. The organ simulations indicate that higher therapeutic acetaminophen (0.5 mM) inhibits 16% of ADH1B*1/*1 hepatic ADH activity at 2-20 mM ethanol and that therapeutic salicylate (1.5 mM) inhibits 30-31% of the ADH1B*2/*2 activity, suggesting potential significant inhibitions of ethanol FPM in these allelotypes. The result provides systematic evaluations and predictions by computer simulation on potential ethanol FPM in target tissues and hepatic

  13. Relationships between resistance to cross-linking agents and glutathione metabolism, aldehyde dehydrogenase isozymes and adenovirus replication in human tumour cell lines.

    Science.gov (United States)

    Parsons, P G; Lean, J; Kable, E P; Favier, D; Khoo, S K; Hurst, T; Holmes, R S; Bellet, A J

    1990-12-15

    In a panel of 10 human tumour cell lines with no prior exposure to drugs in vitro, resistance to cisplatin correlated with resistance to the nitrogen mustard derivatives Asta Z-7557 (mafosfamide, an activated form of cyclophosphamide), melphalan and chlorambucil. Simultaneous treatment with DL-buthionine-S,R-sulfoximine did not enhance the toxicity of cisplatin or Asta Z-7557, and no correlation was found between drug resistance and cellular levels of metallothioneins (as judged by sensitivity to cadmium chloride), glutathione (GSH), GSH reductase, GSH transferase, or gamma-glutamyltranspeptidase. The two cell lines most resistant to Asta Z-7557 expressed aldehyde dehydrogenase cytosolic isozyme 1, found also in normal ovary, but not isozyme 3. Treatment of resistant cells with cisplatin or Asta Z-7557 inhibited cellular DNA synthesis and replication of adenovirus 5 to a lesser extent than in sensitive cells. The virus could be directly inactivated by both drugs prior to infection, subsequent replication being inhibited to the same extent in sensitive and resistant cells. In contrast to Asta Z-7557 and other DNA damaging agents, cisplatin was much more toxic to adenovirus (D37 0.022-0.048 microM) than to cells (D37 0.25-2.5 microM). The adenovirus 5 mutant Ad5ts125 having a G----A substitution was even more sensitive to cisplatin (D37 7-8 nM) than wild type virus and another mutant. Cisplatin was detoxified less by sonicated resistant resistant cells than sensitive cells, as judged by inactivation of Ad5ts125 added to the reaction mixture. It can be inferred that (i) the major differences in cellular resistance to cisplatin and Asta Z-7557 in the present material did not involve enhanced DNA repair or protection by metallothioneins or GSH, but were associated with the ability to continue cellular and viral DNA synthesis during treatment, (ii) resistance was not associated with less template damage, and (iii) the adenovirus genome may be a suitable probe for

  14. Studies on lipoamide dehydrogenase.

    NARCIS (Netherlands)

    Benen, J.A.E.

    1992-01-01

    At the onset of the investigations described in this thesis progress was being made on the elucidation of the crystal structure of the Azotobactervinelandii lipoamide dehydrogenase. Also the gene encoding this enzyme was cloned in our laboratory. By this, a firm basis was laid to start site directed

  15. Enhancing T3 and cAMP responsive gene participation in the thermogenic regulation of fuel oxidation pathways

    OpenAIRE

    2010-01-01

    OBJECTIVE: We sought to identify glycolysis, glycogenolysis, lipolysis, Krebs cycle, respiratory chain, and oxidative phosphorylation enzymes simultaneously regulated by T3 and cAMP. MATERIALS AND METHODS: We performed in silico analysis of 56 promoters to search for cis-cAMP (CREB) and cis-thyroid (TRE) response elements, considering UCP1, SERCA2 and glyceraldehyde 3-phosphate dehydrogenase as reference. Only regulatory regions with prior in vitro validation were selected. RESULTS: 29/56 enz...

  16. Nuclear GAPDH: changing the fate of Müller cells in diabetes

    OpenAIRE

    Jayaguru, Prathiba; Mohr, Susanne

    2012-01-01

    Müller cells, the primary glial cells are a crucial component of the retinal tissue performing a wide range of functions including maintaining the blood-retinal barrier. Several studies suggest that diabetes leads to Müller cell dysfunction and loss. The pathophysiology of hyperglycemia-induced cellular injury of Müller cells remains only poorly understood. Recently, the concept that translocation of the predominantly cytosolic glycolytic enzyme glyceraldehyde-3-phosphate dehydrogenase (GAPDH...

  17. Phylogenetic Status of an Unrecorded Species of Curvularia, C. spicifera, Based on Current Classification System of Curvularia and Bipolaris Group Using Multi Loci.

    Science.gov (United States)

    Jeon, Sun Jeong; Nguyen, Thi Thuong Thuong; Lee, Hyang Burm

    2015-09-01

    A seed-borne fungus, Curvularia sp. EML-KWD01, was isolated from an indigenous wheat seed by standard blotter method. This fungus was characterized based on the morphological characteristics and molecular phylogenetic analysis. Phylogenetic status of the fungus was determined using sequences of three loci: rDNA internal transcribed spacer, large ribosomal subunit, and glyceraldehyde 3-phosphate dehydrogenase gene. Multi loci sequencing analysis revealed that this fungus was Curvularia spicifera within Curvularia group 2 of family Pleosporaceae.

  18. Cytokine mRNA Expression in Lesions in Cats with Chronic Gingivostomatitis

    OpenAIRE

    Harley, R.; Helps, C. R.; Harbour, D. A.; Gruffydd-Jones, T.J.; Day, M J

    1999-01-01

    Semiquantitative reverse transcription-PCR assays were developed to measure feline interleukin-2 (IL-2), IL-4, IL-5, IL-6, IL-10, and IL-12 (p35 & p40); gamma interferon (IFN-γ); and glyceraldehyde-3-phosphate dehydrogenase mRNA concentrations in biopsies of feline oral mucosa. Biopsies were collected from 30 cats with chronic gingivostomatitis (diseased) prior to each cat receiving one of four treatments. In 23 cases replicate biopsies were collected 3 months after tr...

  19. First Report of Anthracnose Caused by Colletotrichum fioriniae on Chinese Matrimony Vine in Korea

    Science.gov (United States)

    Oo, May Moe; Tweneboah, Solomon

    2016-01-01

    A fungus, Colletotrichum fioriniae, was isolated for the first time from fruits of Chinese matrimony vine (Lycium chinense Mill.) in Korea. It was classified as C. fioriniae based on the morphological characteristics and nucleotide sequence of glyceraldehyde-3-phosphate-dehydrogenase and β-tubulin. To the best of our knowledge, this is the first report of C. fioriniae causing anthracnose of Chinese matrimony vine in Korea. PMID:28154492

  20. Diversity and enzymatic profiling of halotolerant micromycetes from Sebkha El Melah, a Saharan salt flat in Southern Tunisia

    OpenAIRE

    Atef Jaouani; Mohamed Neifar; Valeria Prigione; Amani Ayari; Imed Sbissi; Sonia Ben Amor; Seifeddine Ben Tekaya; Giovanna Cristina Varese; Ameur Cherif; Maher Gtari

    2014-01-01

    Twenty-one moderately halotolerant fungi have been isolated from sample ashes collected from Sebkha El Melah, a Saharan salt flat located in southern Tunisia. Based on morphology and sequence inference from the internal transcribed spacer regions, 28S rRNA gene and other specific genes such as β-tubulin, actin, calmodulin, and glyceraldehyde-3-phosphate dehydrogenase, the isolates were found to be distributed over 15 taxa belonging to 6 genera of Ascomycetes: Cladosporium (n = 3), Alternaria ...

  1. Artificial and natural thermostabilization of subunit enzymes. Do they have similar mechanism?

    Science.gov (United States)

    Trubetskoy, V S; Torchilin, V P

    1985-01-01

    Rabbit skeletal muscle glyceraldehyde-3-phosphate dehydrogenase was stabilized by intramolecular intersubunit crosslinking with diimidoesters. Half-inactivation temperature for optimal cross-linker-treated enzyme preparation increased by 11 degrees C. Stabilization effect correlated with the content of crosslinked fractions in enzyme preparation, as proved by SDS gel-electrophoresis. It is proposed that artificial crosslinks stabilize the enzyme in a similar fashion to salt bridges in the thermophilic bacteria enzymes, i.e. preventing dissociation into inactive subunits.

  2. First Report of Anthracnose Caused by Colletotrichum fioriniae on Chinese Matrimony Vine in Korea.

    Science.gov (United States)

    Oo, May Moe; Tweneboah, Solomon; Oh, Sang-Keun

    2016-12-01

    A fungus, Colletotrichum fioriniae, was isolated for the first time from fruits of Chinese matrimony vine (Lycium chinense Mill.) in Korea. It was classified as C. fioriniae based on the morphological characteristics and nucleotide sequence of glyceraldehyde-3-phosphate-dehydrogenase and β-tubulin. To the best of our knowledge, this is the first report of C. fioriniae causing anthracnose of Chinese matrimony vine in Korea.

  3. Enhanced integrin-mediated human osteoblastic adhesion to porous amorphous calcium phosphate/poly(L-lactic acid) composite

    Institute of Scientific and Technical Information of China (English)

    Huang Xin; Qi Yiying; Li Weixu; Shi Zhongli; Weng Wenjian; Chen Kui; He Rongxin

    2014-01-01

    Background The initial osteoblastic adhesion to materials characterizes the first phase of cell-material interactions and influences all the events leading to the formation of new bone.In a previous work,we developed a novel amorphous calcium phosphate (ACP)/poly(L-lactic acid) (PLLA) material that demonstrated morphologic variations in its microstructure.The aim of this study was to investigate the initial interaction between this material and osteoblastic cells.Cellular attachment and the corresponding signal transduction pathways were investigated.Methods A porous ACP/PLLA composite and PLLA scaffold (as a control) were incubated in fetal bovine serum (FBS) containing phosphate-buffered saline (PBS),and the protein adsorption was determined.Osteoblastic MG63 cells were seeded on the materials and cultured for 1,4,8,or 24 hours.Cell attachment was evaluated using the MTS method.Cell morphology was examined using scanning electron microscopy (SEM).The expression levels of the genes encoding integrin subunits α1,α5,αv,β1,focal adhesion kinase (FAK),and glyceraldehyde-3-phosphate dehydrogenase (GAPDH) were determined using real-time reverse transcription polymerase chain reaction (RT-PCR).Results The ACP/PLLA material significantly increased the protein adsorption by 6.4-fold at 1 hour and 2.4-fold at 24 hours,compared with the pure PLLA scaffold.The attachment of osteoblastic cells to the ACP/PLLA was significantly higher than that on the PLLA scaffold.The SEM observation revealed a polygonal spread shape of cells on the ACP/ PLLA,with the filopodia adhered to the scaffold surface.In contrast,the calls on the PLLA scaffold exhibited a spherical or polygonal morphology.Additionally,real-time RT-PCR showed that the genes encoding the integrin subunits α1,αv,β1,and FAK were expressed at higher levels on the ACP/PLLA composite.Conclusions The ACP/PLLA composite promoted protein adsorption and osteoblastic adhesion.The enhanced cell adhesion may be mediated by

  4. Polymorphisms in the promoter region of the human class II alcohol dehydrogenase (ADH4) gene affect both transcriptional activity and ethanol metabolism in Japanese subjects.

    Science.gov (United States)

    Kimura, Yukiko; Nishimura, Fusae T; Abe, Shuntaro; Fukunaga, Tatsushige; Tanii, Hideji; Saijoh, Kiyofumi

    2009-02-01

    Class II alcohol dehydrogenase (pi-ADH), encoded by alcohol dehydrogenase (ADH4), is considered to contribute to ethanol (EtOH) oxidation in the liver at high concentration. Four single nucleotide polymorphisms (SNPs) were found in the promoter region of this gene. Analysis of genotype distribution in 102 unrelated Japanese subjects revealed that four loci were in strong linkage disequilibrium and could be classified into three haplotypes. The effects of these polymorphisms on transcriptional activity were investigated in HepG2 cells. Transcriptional activity was significantly higher in cells with the -136A allele than in those with the -136C allele. To investigate whether this difference in transcriptional activity caused a difference in EtOH elimination, previous data on blood EtOH changes after 0.4 g/kg body weight alcohol ingestion were analyzed. When analyzed based on aldehyde dehydrogenase-2 gene (ALDH2) (487)Glu/Lys genotype, the significantly lower level of EtOH at peak in subjects with -136C/A and -136A/A genotype compared with subjects with -136C/C genotype indicated that -136 bp was a suggestive locus for differences in EtOH oxidation. This effect was observed only in subjects with ALDH2 (487)Glu/Glu. These results suggested that the SNP at -136bp in the ADH4 promoter had an effect on transcriptional regulation, and that the higher activity of the -136A allele compared with the -136C allele caused a lower level of blood EtOH after alcohol ingestion; that is, individuals with the -136A allele may consume more EtOH and might have a higher risk for development of alcohol dependence than those without the -136A allele.

  5. 异柠檬酸脱氢酶1突变与人脑胶质瘤%Isocitrate dehydrogenase 1 mutations and human gliomas

    Institute of Scientific and Technical Information of China (English)

    路平

    2011-01-01

    癌症基因组学研究表明大部分WHO II级、III级胶质瘤及继发性胶质母细胞瘤(IV级)中,异柠檬酸脱氢酶1(isocitrate dehydrogenase 1,IDH1 )发生了新的点突变.IDH1突变发生在肿瘤早期,与预后关系密切.突变改变了IDH1酶活性,导致α-酮戊二酸和2-羟基戊二酸聚集.本文讨论了IDH1突变与胶质瘤发生和病理诊断的关系以及靶向治疗的潜在意义.%A recent cancer genome-sequencing project revealed that that novel point mutations in isocitrate dehydrogenase 1 (IDH1) in the majority of gliomas at WHO Grade II and III and secondary glioblastomas at grade IV. IDH1 mutations are early events in the development of gliomas,and are related with prolonged survival in gliomas at various grades. Mutated IDH1 shows an altered catalytic activity that results in the elevated levels of α-ketoglutarate and 2-hydroxyglutarate. The correhtions among the gliomas pathological diagnosis, tumor genesis, the therapeutic potential for targeting mutant IDH enzymes are discussed in this review.

  6. Genetics Home Reference: lactate dehydrogenase deficiency

    Science.gov (United States)

    ... Facebook Twitter Home Health Conditions lactate dehydrogenase deficiency lactate dehydrogenase deficiency Printable PDF Open All Close All Enable Javascript to view the expand/collapse boxes. Description Lactate dehydrogenase deficiency is a condition that affects how the ...

  7. 15 Hypoxyprostaglandin dehydrogenase. A review

    DEFF Research Database (Denmark)

    Hansen, Harald S.

    1976-01-01

    A review is given on the enzyme 15 hydroxyprostaglandin dehydrogenase. The determination, activity, distribution, purification, properties and physiological aspects are discussed. 128 references.......A review is given on the enzyme 15 hydroxyprostaglandin dehydrogenase. The determination, activity, distribution, purification, properties and physiological aspects are discussed. 128 references....

  8. Increased in vivo regeneration of cortisol in adipose tissue in human obesity and effects of the 11beta-hydroxysteroid dehydrogenase type 1 inhibitor carbenoxolone.

    Science.gov (United States)

    Sandeep, Thekkepat C; Andrew, Ruth; Homer, Natalie Z M; Andrews, Robert C; Smith, Ken; Walker, Brian R

    2005-03-01

    11beta-Hydroxysteroid dehydrogenase type 1 (11HSD1) regenerates cortisol from cortisone within adipose tissue and liver. 11HSD1 inhibitors may enhance insulin sensitivity in type 2 diabetes and be most efficacious in obesity when 11HSD1 is increased in subcutaneous adipose biopsies. We examined the regeneration of cortisol in vivo in obesity, and the effects of the 11HSD1 inhibitor carbenoxolone. We compared six lean and six obese men and performed a randomized, placebo-controlled crossover study of carbenoxolone in obese men. The obese men had no difference in their whole-body rate of regenerating cortisol (measured with 9,11,12,12-[(2)H(4)]cortisol tracer), but had more rapid conversion of [(3)H]cortisone to [(3)H]cortisol in abdominal subcutaneous adipose tissue (measured with microdialysis). During insulin infusion, adipose 11HSD1 activity fell markedly in lean but not in obese men. Carbenoxolone inhibited whole-body cortisol regeneration, but did not significantly inhibit adipose 11HSD1 and had no effects on insulin sensitivity (measured by [(2)H(2)]glucose infusion with or without hyperinsulinemia). Thus, in vivo cortisol generation is increased selectively within adipose tissue in obesity, perhaps reflecting resistance to insulin-mediated downregulation of 11HSD1. However, obese men are less susceptible than lean men to the insulin-sensitizing effects of carbenoxolone. To be useful in obese patients, 11HSD1 inhibitors will need to inhibit the enzyme more effectively in adipose tissue.

  9. Comparison of a homology model and the crystallographic structure of human 11β-hydroxysteroid dehydrogenase type 1 (11βHSD1) in a structure-based identification of inhibitors

    Science.gov (United States)

    Miguet, Laurence; Zhang, Ziding; Barbier, Maryse; Grigorov, Martin G.

    2006-02-01

    Human 11β-hydroxysteroid dehydrogenase type 1 (11βHSD1) catalyzes the interconversion of cortisone into active cortisol. 11βHSD1 inhibition is a tempting target for the treatment of a host of human disorders that might benefit from blockade of glucocorticoid action, such as obesity, metabolic syndrome, and diabetes type 2. Here, we report an in silico screening study aimed at identifying new selective inhibitors of human 11βHSD1 enzyme. In the first step, homology modeling was employed to build the 3D structure of 11βHSD1. Further, molecular docking was used to validate the predicted model by showing that it was able to discriminate between known 11βHSD1 inhibitors or substrates and non-inhibitors. The homology model was found to reproduce closely the crystal structure that became publicly available in the final stages of this work. Finally, we carried out structure-based virtual screening experiments on both the homology model and the crystallographic structure with a database of 114'000 natural molecules. Among these, 15 molecules were consistently selected as inhibitors based on both the model and crystal structures of the enzyme, implying a good quality for the homology model. Among these putative 11βHSD1 inhibitors, two were flavonone derivatives that have already been shown to be potent inhibitors of the enzyme.

  10. Lactate dehydrogenase-elevating virus

    Science.gov (United States)

    This book chapter describes the taxonomic classification of Lactate dehydrogenase-elevating virus (LDV). Included are: host, genome, classification, morphology, physicochemical and physical properties, nucleic acid, proteins, lipids, carbohydrates, geographic range, phylogenetic properties, biologic...

  11. Galloflavin, a new lactate dehydrogenase inhibitor, induces the death of human breast cancer cells with different glycolytic attitude by affecting distinct signaling pathways.

    Science.gov (United States)

    Farabegoli, F; Vettraino, M; Manerba, M; Fiume, L; Roberti, M; Di Stefano, G

    2012-11-20

    Galloflavin (GF), a recently identified lactate dehydrogenase inhibitor, hinders the proliferation of cancer cells by blocking glycolysis and ATP production. The aim of the present experiments was to study the effect of this compound on breast cancer cell lines reproducing different pathological subtypes of this tumor: MCF-7 (the well differentiated form), MDA-MB-231 (the aggressive triple negative tumor) and MCF-Tam (a sub-line of MCF-7 with acquired tamoxifen resistance). We observed marked differences in the energetic metabolism of these cell lines. Compared to MCF-7 cells, both MDA-MB-231 and MCF-Tam cells exhibited higher LDH levels and glucose uptake and showed lower capacity of oxygen consumption. In spite of these differences, GF exerted similar growth inhibitory effects. This result was explained by the finding of a constitutively activated stress response in MDA-MB-231 and MCF-Tam cells, which reproduce the poor prognosis tumor forms. As a further proof, different signaling pathways were found to be involved in the antiproliferative action of GF. In MCF-7 cells we observed a down regulation of the ERα-mediated signaling needed for cell survival. On the contrary, in MCF-Tam and MDA-MB-231 cells growth inhibition appeared to be contributed by an oxidative stress condition. The prevalent mechanism of cell death was found to be apoptosis induction. Because of the clinical relevance of breast cancer forms having the triple negative and/or chemoresistant phenotype, our results showing comparable effects of GF even on aggressively growing cells encourage further studies to verify the potential of this compound in improving the chemotherapy of breast cancer.

  12. Insulin, CCAAT/Enhancer-Binding Proteins and Lactate Regulate the Human 11β-Hydroxysteroid Dehydrogenase Type 2 Gene Expression in Colon Cancer Cell Lines

    Science.gov (United States)

    Alikhani-Koupaei, Rasoul; Ignatova, Irena D.; Guettinger, Andreas; Frey, Felix J.; Frey, Brigitte M.

    2014-01-01

    11β-Hydroxysteroid dehydrogenases (11beta-HSD) modulate mineralocorticoid receptor transactivation by glucocorticoids and regulate access to the glucocorticoid receptor. The isozyme 11beta-HSD2 is selectively expressed in mineralocorticoid target tissues and its activity is reduced in various disease states with abnormal sodium retention and hypertension, including the apparent mineralocorticoid excess. As 50% of patients with essential hypertension are insulin resistant and hyperinsulinemic, we hypothesized that insulin downregulates the 11beta-HSD2 activity. In the present study we show that insulin reduced the 11beta-HSD2 activity in cancer colon cell lines (HCT116, SW620 and HT-29) at the transcriptional level, in a time and dose dependent manner. The downregulation was reversible and required new protein synthesis. Pathway analysis using mRNA profiling revealed that insulin treatment modified the expression of the transcription factor family C/EBPs (CCAAT/enhancer-binding proteins) but also of glycolysis related enzymes. Western blot and real time PCR confirmed an upregulation of C/EBP beta isoforms (LAP and LIP) with a more pronounced increase in the inhibitory isoform LIP. EMSA and reporter gene assays demonstrated the role of C/EBP beta isoforms in HSD11B2 gene expression regulation. In addition, secretion of lactate, a byproduct of glycolysis, was shown to mediate insulin-dependent HSD11B2 downregulation. In summary, we demonstrate that insulin downregulates HSD11B2 through increased LIP expression and augmented lactate secretion. Such mechanisms are of interest and potential significance for sodium reabsorption in the colon. PMID:25133511

  13. Insulin, CCAAT/enhancer-binding proteins and lactate regulate the human 11β-hydroxysteroid dehydrogenase type 2 gene expression in colon cancer cell lines.

    Directory of Open Access Journals (Sweden)

    Thomas Andrieu

    Full Text Available 11β-Hydroxysteroid dehydrogenases (11beta-HSD modulate mineralocorticoid receptor transactivation by glucocorticoids and regulate access to the glucocorticoid receptor. The isozyme 11beta-HSD2 is selectively expressed in mineralocorticoid target tissues and its activity is reduced in various disease states with abnormal sodium retention and hypertension, including the apparent mineralocorticoid excess. As 50% of patients with essential hypertension are insulin resistant and hyperinsulinemic, we hypothesized that insulin downregulates the 11beta-HSD2 activity. In the present study we show that insulin reduced the 11beta-HSD2 activity in cancer colon cell lines (HCT116, SW620 and HT-29 at the transcriptional level, in a time and dose dependent manner. The downregulation was reversible and required new protein synthesis. Pathway analysis using mRNA profiling revealed that insulin treatment modified the expression of the transcription factor family C/EBPs (CCAAT/enhancer-binding proteins but also of glycolysis related enzymes. Western blot and real time PCR confirmed an upregulation of C/EBP beta isoforms (LAP and LIP with a more pronounced increase in the inhibitory isoform LIP. EMSA and reporter gene assays demonstrated the role of C/EBP beta isoforms in HSD11B2 gene expression regulation. In addition, secretion of lactate, a byproduct of glycolysis, was shown to mediate insulin-dependent HSD11B2 downregulation. In summary, we demonstrate that insulin downregulates HSD11B2 through increased LIP expression and augmented lactate secretion. Such mechanisms are of interest and potential significance for sodium reabsorption in the colon.

  14. Effect of ginger root on cyclooxygenase-1 and 15-hydroxyprostaglandin dehydrogenase expression in colonic mucosa of humans at normal and increased risk for colorectal cancer.

    Science.gov (United States)

    Jiang, Yan; Turgeon, Danielle K; Wright, Benjamin D; Sidahmed, Elkhansa; Ruffin, Mack T; Brenner, Dean E; Sen, Ananda; Zick, Suzanna M

    2013-09-01

    Elevated tissue levels of prostaglandin E2, produced by cyclooxygenase (COX), are an early event in colorectal cancer (CRC). Data suggest the efficacy of nonsteroidal anti-inflammatory drugs, such as cancer preventives, in the inhibition of COX activity; however, side effects of nonsteroidal anti-inflammatory pose unacceptable limitations. Ginger has been reported to have anti-inflammatory activities with significant CRC preventive potential. We investigated whether consumption of 2.0 g ginger daily regulated the level of two key enzymes that control prostaglandin E2 production, COX-1 and NAD(+)-dependent 15-hydroxyprostaglandin dehydrogenase (15-PGDH). Thirty participants at normal and 20 participants at increased risk for CRC were randomized and given 2.0 g/day ginger or placebo for 28 days. Flexible sigmoidoscopy was used to obtain colon biopsies at baseline and the end of the study. Tissue levels of COX-1 and 15-PGDH were assessed using western blotting. After ginger consumption, participants at increased risk for CRC had a significantly reduced colonic COX-1 protein level (23.8±41%) compared with the placebo group (18.9±52%; P=0.03). Protein levels of 15-PGDH in the colon were unchanged. In participants who were at normal risk for CRC, neither protein levels of COX-1 nor 15-PGDH in the colon were altered by ginger consumption. Ginger significantly lowered COX-1 protein expression in participants at increased risk for CRC but not in those at normal risk for CRC. Ginger did not alter 15-PGDH protein expression in either increased or normal-risk participants. Further investigation, in larger studies with a longer ginger intervention, is needed to examine the ability of ginger to impact tissue levels of prostaglandin.

  15. Cloning and characterization of human very-long-chain acyl-CoA dehydrogenase cDNA, chromosomal assignment of the gene and identification in four patients of nine different mutations within the VLCAD gene

    DEFF Research Database (Denmark)

    Andresen, B S; Bross, P; Vianey-Saban, C

    1996-01-01

    Very-long-chain acyl-CoA dehydrogenase (VLCAD) is one of four straight-chain acyl-CoA dehydrogenase (ACD) enzymes, which are all nuclear encoded mitochondrial flavoproteins catalyzing the initial step in fatty acid beta-oxidation. We have used the very fast, Rapid Amplification of cDNA Ends (RACE...

  16. A validated enantioselective LC-MS/MS assay for quantification of a major chiral metabolite of an achiral 11-β-hydroxysteroid-dehydrogenase 1 inhibitor in human plasma: Application to a clinical pharmacokinetic study.

    Science.gov (United States)

    Furlong, Michael T; Ji, Qin C; Iacono, Lisa; Dang, Oanh; Noren, Marzena; Bruce, John; Aubry, Anne-Françoise; Arnold, Mark E

    2016-06-01

    BMS-823778 is a potent 11-β-hydroxysteroid-dehydrogenase 1 (11βHSD-1) inhibitor and a potential therapeutic agent for type 2 diabetes mellitus (T2DM). A high performance liquid chromatography-tandem mass spectrometry (LC-MS/MS) assay was developed and validated to enable reliable separation and quantification of both enantiomers of a chiral hydroxy metabolite (BMT-094817) in human plasma. Following liquid-liquid extraction in a 96-well plate format, chromatographic separation of the metabolite enantiomers was achieved by isocratic elution on a Chiralpak IA-3 column. Chromatographic conditions were optimized to ensure separation of both metabolite enantiomers. Metabolite enantiomers and stable isotope-labeled (SIL) internal standards were detected by positive ion electrospray tandem mass spectrometry. The LC-MS/MS assay was validated over a concentration range of 0.200-200ng/mL. Intra- and inter-assay precision values for replicate quality control samples were less than 9.9% for both enantiomers during the assay validation. Mean quality control accuracy values were within ±7.3%. Assay recoveries were high (>75%) and consistent across the assay range. The metabolite enantiomers were stable in human blood for 2h on ice. The analytes were also stable in human plasma for 25h at room temperature, 34days at -20°C and -70°C, and following five freeze-thaw cycles. No interconversion of the metabolite enantiomers was detected under any bioanalytical stress conditions, from blood collection/processing through extracted sample storage. The validated assay was successfully applied to the quantification of both metabolite enantiomers in human plasma in support of a human pharmacokinetic study.

  17. Novel 11β-hydroxysteroid dehydrogenase 1 inhibitors reduce cortisol levels in keratinocytes and improve dermal collagen content in human ex vivo skin after exposure to cortisone and UV.

    Science.gov (United States)

    Boudon, Stéphanie M; Vuorinen, Anna; Geotti-Bianchini, Piero; Wandeler, Eliane; Kratschmar, Denise V; Heidl, Marc; Campiche, Remo; Jackson, Eileen; Odermatt, Alex

    2017-01-01

    Activity and selectivity assessment of new bi-aryl amide 11β-hydroxysteroid dehydrogenase 1 (11β-HSD1) inhibitors, prepared in a modular manner via Suzuki cross-coupling, are described. Several compounds inhibiting 11β-HSD1 at nanomolar concentrations were identified. Compounds 2b, 3e, 7b and 12e were shown to selectively inhibit 11β-HSD1 over 11β-HSD2, 17β-HSD1 and 17β-HSD2. These inhibitors also potently inhibited 11β-HSD1 activity in intact HEK-293 cells expressing the recombinant enzyme and in intact primary human keratinocytes expressing endogenous 11β-HSD1. Moreover, compounds 2b, 3e and 12e were tested for their activity in human skin biopsies. They were able to prevent, at least in part, both the cortisone- and the UV-mediated decreases in collagen content. Thus, inhibition of 11β-HSD1 by these compounds can be further investigated to delay or prevent UV-mediated skin damage and skin aging.

  18. Fast hybridization solution for the detection of immobilized nucleic acids.

    Science.gov (United States)

    Yang, T T; Kain, S R

    1995-03-01

    We have developed a fast hybridization solution, termed ExpressHyb, for the rapid and sensitive detection of nucleic acids immobilized on membrane supports. This solution reduces typical hybridization times of 12-24 h to as little as 1 h while simultaneously increasing the sensitivity of detection in many applications. Using ExpressHyb, human beta-actin mRNA was detected on a human multiple tissue Northern (MTN) blot following a 30-min hybridization, with optimal detection occurring with a 1-h hybridization interval. The moderately abundant human glyceraldehyde-3-phosphate dehydrogenase (G3PDH) mRNA was detected using similar hybridization conditions and yielded improved signal-to-background characteristics relative to overnight hybridizations in conventional solutions. ExpressHyb can be used with either 32P- or digoxigenin-labeled probes and works effectively with both cDNA and oligonucleotide probes. For non-isotopic detection in particular, ExpressHyb reduces the nonspecific background commonly encountered with this technique. In cDNA library screening, ExpressHyb was found to both reduce the time required for effective hybridizations and to increase the number of positive colonies obtained relative to conventional overnight procedures. Taken together, these results illustrate the broad capability of ExpressHyb Hybridization Solution to improve nucleic acid detection in a variety of important techniques.

  19. Cloning, expression and characterization of a mucin-binding GAPDH from Lactobacillus acidophilus.

    Science.gov (United States)

    Patel, Dhaval K; Shah, Kunal R; Pappachan, Anju; Gupta, Sarita; Singh, Desh Deepak

    2016-10-01

    Glyceraldehyde-3-phosphate dehydrogenase (GAPDH) is a ubiquitous enzyme involved in glycolysis. It is also referred to as a moonlighting protein as it has many diverse functions like regulation of apoptosis, iron homeostasis, cell-matrix interactions, adherence to human colon etc. apart from its principal role in glycolysis. Lactobacilli are lactic acid bacteria which colonize the human gut and confer various health benefits to humans. In the present study, we have cloned, expressed and purified the GAPDH from Lactobacillus acidophilus to get a recombinant product (r-LaGAPDH) and characterized it. Size exclusion chromatography shows that r-LaGAPDH exists as a tetramer in solution and have a mucin binding and hemagglutination activity indicating carbohydrate like binding adhesion mechanism. Fluorescence spectroscopy studies showed an interaction of r-LaGAPDH with mannose, galactose, N-acetylgalactosamine and N-acetylglucosamine with a Kd of 3.6±0.7×10(-3)M, 4.34±0.09×10(-3)M, 4±0.87×10(-3)M and 3.7±0.28×10(-3)M respectively. We hope that this preliminary data will generate more interest in further elucidation of the roles of GAPDH in the adhesion processes of the bacteria.

  20. S-(2-Succinyl)cysteine: a novel chemical modification of tissue proteins by a Krebs cycle intermediate.

    Science.gov (United States)

    Alderson, Nathan L; Wang, Yuping; Blatnik, Matthew; Frizzell, Norma; Walla, Michael D; Lyons, Timothy J; Alt, Nadja; Carson, James A; Nagai, Ryoji; Thorpe, Suzanne R; Baynes, John W

    2006-06-01

    S-(2-Succinyl)cysteine (2SC) has been identified as a chemical modification in plasma proteins, in the non-mercaptalbumin fraction of human plasma albumin, in human skin collagen, and in rat skeletal muscle proteins and urine. 2SC increases in human skin collagen with age and is increased in muscle protein of diabetic vs. control rats. The concentration of 2SC in skin collagen and muscle protein correlated strongly with that of the advanced glycation/lipoxidation end-product (AGE/ALE), N(epsilon)-(carboxymethyl)lysine (CML). 2SC is formed by a Michael addition reaction of cysteine sulfhydryl groups with fumarate at physiological pH. Fumarate, but not succinate, inactivates the sulfhydryl enzyme, glyceraldehyde-3-phosphate dehydrogenase in vitro, in concert with formation of 2SC. 2SC is the first example of spontaneous chemical modification of protein by a metabolic intermediate in the Krebs cycle. These observations identify fumarate as an endogenous electrophile and suggest a role for fumarate in regulation of metabolism.

  1. GLUT3 protein and mRNA in autopsy muscle specimens

    Science.gov (United States)

    Stuart, C. A.; Wen, G.; Jiang, J.

    1999-01-01

    GLUT3 is expressed in rat muscle, but this glucose transporter protein has not been identified previously in adult human skeletal muscle. We quantified the rapidity of disappearance of mRNA and protein from human skeletal muscle at room temperature and at 4 degrees C. Fifty percent of the immunologically detectable GLUT3 protein disappeared by 1 hour at 20 degrees C and by 2 hours at 4 degrees C. mRNA for GLUT3 was decreased 50% by 2.2 hours at 20 degrees C and by 24 hours at 4 degrees C. Half of the measurable mRNAs for GLUT4, glyceraldehyde 3-phosphate dehydrogenase (GAPDH), alpha-actin, and beta-myosin disappeared by 0.8 to 2.1 hours at 20 degrees C and by 5.0 to 16.6 hours at 4 degrees C. Previous conclusions that GLUT3 is not expressed in human muscle were likely drawn because of artifacts related to degradation of GLUT3 protein in the specimens prior to study. Because of the rapid degradation of protein and mRNA, autopsy specimens of muscle must be obtained within 6 hours of death, and even then, protein and mRNA data will likely dramatically underestimate their expression in fresh muscle. Some previously published conclusions and recommendations regarding autopsy specimens are not stringent enough to consistently yield useful protein and mRNA.

  2. 乙醇脱氢酶Ⅰ类基因全长cDNA的克隆与表达%Cloning and Expression of the Full-length cDNAs Encoding Human Class Ⅰ Alcohol Dehydrogenases

    Institute of Scientific and Technical Information of China (English)

    周文婷; 李景鹏; 崔羽; 张永红; 李世荣

    2007-01-01

    Background & Objective:Background &Objective: The class Ⅰ Alcohol Dehydrogenases (ADH) play a key role in hepatic alcohol catabolism. Human ADH is encoded by at least seven genes, and three class Ⅰ ADH genes-ADH1, ADH2 and ADH3, which encode the α, β, and γ subunit respectively, had been isolated and mapped on chromosome 4q21-q25. This experiment tends to clone the human class Ⅰ ADH and investigate its role in the hepatic alcohol catabolism. Methods: A pair of primers were designed and the full-length cDNAs encoding human Class Ⅰ ADH were cloned at one time. Class Ⅰ ADH cDNAs were amplified with RT-PCR from total RNA extracted from fetal human liver and kidney, and cloned into pGEM-T vector. To identify cDNA segments, a pair of differential primers was designed. By using them, a portion of the ADHs which encodes the segment from -4 to 296 was cloned. These cDNA segments then were detected directly when being digested with Kpn Ⅰ and Pst Ⅰ, respectively. Then all the full-length cDNAs were subcloned in the plasmid pTYB11 and expressed in E. Coli. Stably. Alcohol Dehydrogenase activity of catalyzing alcohol were monitored at 340 nm. Results: Here we had successfully the human class Ⅰ ADH cloned and the full-length cDNAs expressed in E.col.I stably. The relative activity of recombinant enzymes metabolizing ethanol was 0.81 ~1.31 U/mg,0.09 ~0.15 U/mg and 0.76~1.11 U/mg, respectively. Conclusions: In the paper, the full-length cDNAs encoding human class Ⅰ AD H were successfully cloned and expressed and the recombinant enzymes showed the activities similar to the ones isolated from liver.%目的:克隆编码人Ⅰ类乙醇脱氢酶基因,并探讨Ⅰ类乙醇脱氢酶(ADH)在乙醇的肝代谢中的作用.方法:从胎儿肝,肾提取的总RNA;经RT-PCR扩增得到cDNA并克隆至pGEM-T载体.cDNA序列用Kpn Ⅰ和Pst Ⅰ酶切鉴定,并检测其在大肠杆菌中表达活性.通过吸光法检测酶的活性.结果:成功克隆了人Ⅰ类乙

  3. Expression pattern, ethanol-metabolizing activities, and cellular localization of alcohol and aldehyde dehydrogenases in human large bowel: association of the functional polymorphisms of ADH and ALDH genes with hemorrhoids and colorectal cancer.

    Science.gov (United States)

    Chiang, Chien-Ping; Jao, Shu-Wen; Lee, Shiao-Pieng; Chen, Pei-Chi; Chung, Chia-Chi; Lee, Shou-Lun; Nieh, Shin; Yin, Shih-Jiun

    2012-02-01

    Alcohol dehydrogenase (ADH) and aldehyde dehydrogenase (ALDH) are principal enzymes responsible for metabolism of ethanol. Functional polymorphisms of ADH1B, ADH1C, and ALDH2 genes occur among racial populations. The goal of this study was to systematically determine the functional expressions and cellular localization of ADHs and ALDHs in human rectal mucosa, the lesions of adenocarcinoma and hemorrhoid, and the genetic association of allelic variations of ADH and ALDH with large bowel disorders. Twenty-one surgical specimens of rectal adenocarcinoma and the adjacent normal mucosa, including 16 paired tissues of rectal tumor, normal mucosae of rectum and sigmoid colon from the same individuals, and 18 surgical mixed hemorrhoid specimens and leukocyte DNA samples from 103 colorectal cancer patients, 67 hemorrhoid patients, and 545 control subjects recruited in previous study, were investigated. The isozyme/allozyme expression patterns of ADH and ALDH were identified by isoelectric focusing and the activities were assayed spectrophotometrically. The protein contents of ADH/ALDH isozymes were determined by immunoblotting using the corresponding purified class-specific antibodies; the cellular activity and protein localizations were detected by immunohistochemistry and histochemistry, respectively. Genotypes of ADH1B, ADH1C, and ALDH2 were determined by polymerase chain reaction-restriction fragment length polymorphisms. At 33mM ethanol, pH 7.5, the activity of ADH1C*1/1 phenotypes exhibited 87% higher than that of the ADH1C*1/*2 phenotypes in normal rectal mucosa. The activity of ALDH2-active phenotypes of rectal mucosa was 33% greater than ALDH2-inactive phenotypes at 200μM acetaldehyde. The protein contents in normal rectal mucosa were in the following order: ADH1>ALDH2>ADH3≈ALDH1A1, whereas those of ADH2, ADH4, and ALDH3A1 were fairly low. Both activity and content of ADH1 were significantly decreased in rectal tumors, whereas the ALDH activity remained

  4. Michael hydratase alcohol dehydrogenase or just alcohol dehydrogenase?

    NARCIS (Netherlands)

    Resch, V.A.; Jin, J.; Chen, B.S.; Hanefeld, U.

    2014-01-01

    The Michael hydratase – alcohol dehydrogenase (MhyADH) from Alicycliphilus denitrificans was previously identified as a bi-functional enzyme performing a hydration of α,β-unsaturated ketones and subsequent oxidation of the formed alcohols. The investigations of the bi-functionality were based on a

  5. Michael hydratase alcohol dehydrogenase or just alcohol dehydrogenase?

    NARCIS (Netherlands)

    Resch, V.A.; Jin, J.; Chen, B.S.; Hanefeld, U.

    2014-01-01

    The Michael hydratase – alcohol dehydrogenase (MhyADH) from Alicycliphilus denitrificans was previously identified as a bi-functional enzyme performing a hydration of α,β-unsaturated ketones and subsequent oxidation of the formed alcohols. The investigations of the bi-functionality were based on a s

  6. Toxic Neuronal Death by Glyeraldehyde-3-Phosphate Dehydrogenase and Mitochondria

    Science.gov (United States)

    2003-08-01

    Effect of macromolecula r crowding upon the st ructure and funct ion of an enzyme: Glycera ldehyde-3-phospha te dehydrogenase. Biochem- istry 20:4821...Leit ing B, Ruel R, Nicholson DW, and Thornber ry NA (1998) Inhibit ion of human caspases by pept ide-based and macromolecula r inh ib- itors. J Biol

  7. 21 CFR 862.1420 - Isocitric dehydrogenase test system.

    Science.gov (United States)

    2010-04-01

    ... 21 Food and Drugs 8 2010-04-01 2010-04-01 false Isocitric dehydrogenase test system. 862.1420 Section 862.1420 Food and Drugs FOOD AND DRUG ADMINISTRATION, DEPARTMENT OF HEALTH AND HUMAN SERVICES (CONTINUED) MEDICAL DEVICES CLINICAL CHEMISTRY AND CLINICAL TOXICOLOGY DEVICES Clinical Chemistry Test...

  8. 21 CFR 862.1440 - Lactate dehydrogenase test system.

    Science.gov (United States)

    2010-04-01

    ... 21 Food and Drugs 8 2010-04-01 2010-04-01 false Lactate dehydrogenase test system. 862.1440 Section 862.1440 Food and Drugs FOOD AND DRUG ADMINISTRATION, DEPARTMENT OF HEALTH AND HUMAN SERVICES (CONTINUED) MEDICAL DEVICES CLINICAL CHEMISTRY AND CLINICAL TOXICOLOGY DEVICES Clinical Chemistry...

  9. Myofibroblast Upregulators are Elevated in Joint Capsules in Posttraumatic Contractures

    Science.gov (United States)

    Hildebrand, Kevin A.; Zhang, Mei; Hart, David A.

    2010-01-01

    We hypothesized specific growth factors are increased in the elbow capsules of patients with post traumatic elbow contractures. A model of surgically induced joint contracture in rabbit knees was developed to study the growth factor expression in joint contractures. This study demonstrates this model mimics the human condition and analyzes how the growth factor levels decrease with time in rabbit knees with contractures. Reverse transcription polymerase chain reaction was used to measure mRNA levels of transforming growth factor-β1, connective tissue growth factor, ED-A of fibronectin, and α-smooth muscle actin normalized to a housekeeping gene, glyceraldehyde-3-phosphate dehydrogenase. In the joint capsules of patients with elbow contractures, mRNA levels were increased for transforming growth factor- β1, connective tissue growth factor, and α-smooth muscle actin. In the joint capsules of rabbit knees with contractures, mRNA levels were increased for transforming growth factor- β1, connective tissue growth factor, ED-A of fibronectin, and α-smooth muscle actin. The mRNA levels for transforming growth factor-β1, connective tissue growth factor, and α-smooth muscle actin decreased with time in rabbit knees. The elevated levels of these myofibroblast up-regulators and fibrogenic growth factors could explain the previously reported increase in myofibroblasts and collagen mRNA levels. The rabbit knee model correlated well with the human post traumatic elbow contractures. PMID:17195814

  10. The effect of water loading on the urinary ratio of cortisone to cortisol in healthy subjects and a new approach to the evaluation of the ratio as an index for in vivo human 11β-hydroxysteroid dehydrogenase 2 activity.

    Science.gov (United States)

    Yokokawa, Akitomo; Takasaka, Toru; Shibasaki, Hiromi; Kasuya, Yasuji; Kawashima, Soko; Yamada, Akira; Furuta, Takashi

    2012-10-01

    Factors that give rise to a large variation in the urinary ratio of free cortisone to cortisol (UFE/UFF) were investigated to accurately estimate 11β-hydroxysteroid dehydrogenase 2 (11β-HSD2) activity in humans in vivo. A water loading test was first carried out in two healthy subjects to examine the effect of water intake or urine volume on the urinary ratio of free cortisone to cortisol (UFE/UFF). The ratio was found to increase by water loading. We also examined urinary concentrations and amounts of cortisol, cortisone, creatinine, Na(+), K(+), and Cl(-), and urine volume, as possible factors affecting the urinary ratio (UFE/UFF), in 60 urine samples obtained from 15 healthy volunteers. Among these factors tested, the urinary concentration of cortisol was most highly correlated with the UFE/UFF ratio (r=-0.858), indicating that the in vivo activity of 11β-HSD2 (UFE/UFF) should fluctuate with the changes of the urinary concentration of cortisol. Based on the findings, we proposed a new estimation method of in vivo activity of 11β-HSD2 in humans, using the UFE/UFF ratio correlated with the urinary concentration of cortisol (UFE/UFF-cortisol concentration). Taking into consideration the intra-individual variabilities in the urinary concentration of cortisol, there were no significant within-day variations in 11β-HSD2 activity. The findings indicate that 11β-HSD2 activities can be accurately evaluated by simply measuring free cortisol and cortisone concentrations in spot urine samples. Furthermore, administrations of glycyrrhetinic acid in three healthy volunteers were performed to confirm the usefulness of the present assessment for the activity of 11β-HSD2. Copyright © 2012 Elsevier Inc. All rights reserved.

  11. 17β-Hydroxysteroid Dehydrogenase Type 2 Inhibition: Discovery of Selective and Metabolically Stable Compounds Inhibiting Both the Human Enzyme and Its Murine Ortholog.

    Directory of Open Access Journals (Sweden)

    Emanuele M Gargano

    Full Text Available Design and synthesis of a new class of inhibitors for the treatment of osteoporosis and its comparative h17β-HSD2 and m17β-HSD2 SAR study are described. 17a is the first compound to show strong inhibition of both h17β-HSD2 and m17β-HSD2, intracellular activity, metabolic stability, selectivity toward h17β-HSD1, m17β-HSD1 and estrogen receptors α and β as well as appropriate physicochemical properties for oral bioavailability. These properties make it eligible for pre-clinical animal studies, prior to human studies.

  12. Effects of iodonium-class flavin dehydrogenase inhibitors on growth, reactive oxygen production, cell cycle progression, NADPH oxidase 1 levels, and gene expression in human colon cancer cells and xenografts.

    Science.gov (United States)

    Doroshow, James H; Gaur, Shikha; Markel, Susan; Lu, Jiamo; van Balgooy, Josephus; Synold, Timothy W; Xi, Bixin; Wu, Xiwei; Juhasz, Agnes

    2013-04-01

    Iodonium-class flavoprotein dehydrogenase inhibitors have been demonstrated to possess antiproliferative potential and to inhibit reactive oxygen production in human tumor cells, although the mechanism(s) that explains the relationship between altered cell growth and the generation of reactive oxygen species (ROS) remains an area of active investigation. Because of the ability of these compounds to inhibit the activity of flavoprotein-containing epithelial NADPH oxidases, we chose to examine the effects of several iodonium-class flavoprotein inhibitors on human colon cancer cell lines that express high, functional levels of a single such oxidase (NADPH oxidase 1, or Nox1). We found that diphenyleneiodonium (DPI), di-2-thienyliodonium (DTI), and iodonium diphenyl inhibited the growth of Caco2, HT-29, and LS-174T colon cancer cells at concentrations (10-250nM for DPI, 0.5-2.5μM for DTI, and 155nM to 10μM for iodonium diphenyl) substantially lower than needed for DU145 human prostate cancer cells, which do not possess functional NADPH oxidase activity. Drug treatment was associated with decreased H2O2 production and diminished intracellular ROS levels, lasting up to 24h, after short-term (1-h) exposure to the iodonium analogs. Decreased tumor cell proliferation was caused, in part, by a profound block in cell cycle progression at the G1/S interface in both LS-174T and HT-29 cells exposed to either DPI or DTI; and the G1 block was produced, for LS-174T cells, by upregulation of p27 and a drug concentration-related decrease in the expression of cyclins D1, A, and E that was partially prevented by exogenous H2O2. Not only did DPI and DTI decrease intracellular ROS, they both also significantly decreased the mRNA expression levels of Nox1, potentially contributing to the prolonged reduction in tumor cell reactive oxygen levels. We also found that DPI and DTI significantly decreased the growth of both HT-29 and LS-174T human tumor xenografts, at dose levels that produced

  13. Disruption of the 11-cis-Retinol Dehydrogenase Gene Leads to Accumulation of cis-Retinols and cis-Retinyl Esters

    OpenAIRE

    Driessen, Carola A. G. G.; Winkens, Huub J.; Hoffmann, Kirstin; Kuhlmann, Leonoor D.; Janssen, Bert P. M.; van Vugt, Anke H M; Van Hooser, J. Preston; Wieringa, B. E.; Deutman, August F; Palczewski, Krzysztof; Ruether, Klaus; Janssen, Jacques J. M.

    2000-01-01

    To elucidate the possible role of 11-cis-retinol dehydrogenase in the visual cycle and/or 9-cis-retinoic acid biosynthesis, we generated mice carrying a targeted disruption of the 11-cis-retinol dehydrogenase gene. Homozygous 11-cis-retinol dehydrogenase mutants developed normally, including their retinas. There was no appreciable loss of photoreceptors. Recently, mutations in the 11-cis-retinol dehydrogenase gene in humans have been associated with fundus albipunctatus. In 11-cis-retinol deh...

  14. The activity of alcohol dehydrogenase (ADH) isoenzymes and aldehyde dehydrogenase (ALDH) in the sera of patients with brain cancer.

    Science.gov (United States)

    Jelski, Wojciech; Laniewska-Dunaj, Magdalena; Orywal, Karolina; Kochanowicz, Jan; Rutkowski, Robert; Szmitkowski, Maciej

    2014-12-01

    Human brain tissue contains various alcohol dehydrogenase (ADH) isoenzymes and possess also aldehyde dehydrogenase (ALDH) activity. In our last experiments we have shown that ADH and ALDH are present also in the brain tumour cells. Moreover the activities of total ADH and class I isoenzymes were significantly higher in cancer tissue than healthy cells. It can suggests that these changes may be reflected by enzyme activity in the serum of patients with brain cancer. Serum samples were taken for routine biochemical investigation from 62 patients suffering from brain cancer (36 glioblastoma, 26 meningioma). For the measurement of the activity of class I and II ADH isoenzymes and ALDH activity, the fluorometric methods were used. The total ADH activity and activity of class III and IV isoenzymes were measured by the photometric method. A statistically significant increase of class I alcohol dehydrogenase isoenzymes was found in the sera of patients with brain cancer. The median activity of this class isoenzyme in the patients group increased about 24 % in the comparison to the control level. The total alcohol dehydrogenase activity was also significantly higher (26 %) among patients with brain tumour than healthy ones. The activities of other tested ADH isoenzymes and total ALDH were unchanged. The increase of the activity of total ADH and class I alcohol dehydrogenase isoenzyme in the sera of patients with brain cancer seems to be caused by the release of this isoenzyme from tumour's cells.

  15. Multifaceted roles of metabolic enzymes of the Paracoccidioides species complex

    Directory of Open Access Journals (Sweden)

    Caroline Maria Marcos

    2014-12-01

    Full Text Available Paracoccidioides species are dimorphic fungi, and are the etiologic agents of paracoccidioidomycosis (PCM, a serious disease of multiple organs. The large number of tissues colonized by this fungus suggests the presence of a variety of surface molecules involved in adhesion. A surprising finding is that the majority of enzymes in the glycolytic pathway, tricarboxylic acid (TCA cycle and glyoxylate cycle in Paracoccidioides spp. has adhesive properties that aid in the interaction with the host extracellular matrix, and so act as ‘moonlighting’ proteins. Moonlighting proteins have multiple functions and add another dimension to cellular complexity, while benefiting cells in several ways. This phenomenon occurs in both eukaryotes and prokaryotes. For example, moonlighting proteins from the glycolytic pathway or TCA cycle can play roles in bacterial pathogens, either by acting as proteins secreted in a conventional pathway or not and/or as cell surface component that facilitate adhesion or adherence . This review outlines the multifuncionality exposed by a variety of Paracoccidioides spp. enzymes including aconitase, aldolase, glyceraldehyde-3-phosphate dehydrogenase, isocitrate lyase, malate synthase, triose phosphate isomerase, fumarase and enolase. The roles that moonlighting activities play in the virulence characteristics of this fungus and several other human pathogens during their interactions with the host are discussed.

  16. Multiple targets of salicylic acid and its derivatives in plants and animals

    Directory of Open Access Journals (Sweden)

    Daniel F. Klessig

    2016-05-01

    Full Text Available Salicylic acid (SA is a critical plant hormone that is involved in many processes, including seed germination, root initiation, stomatal closure, floral induction, thermogenesis, and response to abiotic and biotic stresses. Its central role in plant immunity, although extensively studied, is still only partially understood. Classical biochemical approaches and, more recently, genome-wide high-throughput screens have identified more than two dozen plant SA-binding proteins (SABPs, as well as multiple candidates that have yet to be characterized. Some of these proteins bind SA with high affinity, while the affinity others exhibit is low. Given that SA levels vary greatly even within a particular plant species depending on subcellular location, tissue type, developmental stage, and with respect to both time and location after an environmental stimulus such as infection, the presence of SABPs exhibiting a wide range of affinities for SA may provide great flexibility and multiple mechanisms through which SA can act. SA and its derivatives, both natural and synthetic, also have multiple targets in animals/humans. Interestingly, many of these proteins, like their plant counterparts, are associated with immunity or disease development. Two recently identified SABPs, High Mobility Group Box protein (HMGB and Glyceraldehyde 3-Phosphate Dehydrogenase (GAPDH, are critical proteins that not only serve key structural or metabolic functions, but also play prominent roles in disease responses in both kingdoms.

  17. Omigapil ameliorates the pathology of muscle dystrophy caused by laminin-alpha2 deficiency.

    Science.gov (United States)

    Erb, Michael; Meinen, Sarina; Barzaghi, Patrizia; Sumanovski, Lazar T; Courdier-Früh, Isabelle; Rüegg, Markus A; Meier, Thomas

    2009-12-01

    Laminin alpha2-deficient congenital muscular dystrophy, called MDC1A, is a rare, devastating genetic disease characterized by severe neonatal hypotonia ("floppy infant syndrome"), peripheral neuropathy, inability to stand or walk, respiratory distress, and premature death in early life. Transgenic overexpression of the apoptosis inhibitor protein BCL-2, or deletion of the proapoptotic Bax gene in a mouse model for MDC1A prolongs survival and mitigates pathology, indicating that apoptotic events are involved in the pathology. Here we demonstrate that the proapoptotic glyceraldehyde-3-phosphate dehydrogenase (GAPDH)-Siah1-CBP/p300-p53 pathway is activated in a mouse model for MDC1A. Moreover, we show that omigapil, which inhibits GAPDH-Siah1-mediated apoptosis, ameliorates several pathological hallmarks in the MDC1A mouse model. Specifically, we demonstrate that treatment with omigapil inhibits apoptosis in muscle, reduces body weight loss and skeletal deformation, increases locomotive activity, and protects from early mortality. These data qualify omigapil, which is in late phase of clinical development for human use, as a drug candidate for the treatment of MDC1A.

  18. Myeloperoxidase catalyzes the conjugation of serotonin to thiols via free radicals and tryptamine-4,5-dione.

    Science.gov (United States)

    Kato, Yoji; Peskin, Alexander V; Dickerhof, Nina; Harwood, D Tim; Kettle, Anthony J

    2012-11-19

    Serotonin (5-hydroxytryptamine; 5HT) is a favorable substrate for myeloperoxidase and is likely to be oxidized by this heme enzyme during inflammation. In this study, we have investigated how serotonin becomes conjugated to amino acid residues and proteins when it is oxidized by myeloperoxidase. 5HT formed three adducts with N-acetylcysteine (NAC) when it was incubated with myeloperoxidase, xanthine oxidase, and acetaldehyde. One of the adducts was identified as 5HT-NAC, and the others were conjugates of NAC and tryptamine-4,5-dione (TD). There was no evidence for coupling of oxidized serotonin to amine residues. Glyceraldehyde-3-phosphate dehydrogenase (GAPDH) was exposed to 5HT with the enzymatic system or synthetic TD. Both caused a loss of thiols on GAPDH and covalent attachment of quinones derived from TD to the protein. Biotin-labeled 5HT was used instead of 5HT to confirm the conjugation of 5HT to GAPDH. It was incorporated into the GAPDH when oxidized by myeloperoxidase. Analysis of tryptic peptides of human GAPDH by liquid chromatography with mass spectrometry revealed that an adduct of TD was formed with the peptide containing Cys(152) and Cys(156). Our results indicate that myeloperoxidase can oxidize serotonin to species that form adducts with low molecular weight thiols and cysteine residues in proteins. Low molecular weight conjugates will redox cycle and fuel oxidative stress. Conjugation of serotonin to proteins will affect their function and may provide useful biomarkers of serotonin oxidation during inflammatory events.

  19. A Microchip for Integrated Single-Cell Gene Expression Profiling and Genotoxicity Detection

    Directory of Open Access Journals (Sweden)

    Hui Dong

    2016-09-01

    Full Text Available Microfluidics-based single-cell study is an emerging approach in personalized treatment or precision medicine studies. Single-cell gene expression holds a potential to provide treatment selections with maximized efficacy to help cancer patients based on a genetic understanding of their disease. This work presents a multi-layer microchip for single-cell multiplexed gene expression profiling and genotoxicity detection. Treated by three drug reagents (i.e., methyl methanesulfonate, docetaxel and colchicine with varied concentrations and time lengths, individual human cancer cells (MDA-MB-231 are lysed on-chip, and the released mRNA templates are captured and reversely transcribed into single strand DNA. Glyceraldehyde-3-phosphate dehydrogenase (GAPDH, cyclin-dependent kinase inhibitor 1A (CDKN1A, and aurora kinase A (AURKA genes from single cells are amplified and real-time quantified through multiplex polymerase chain reaction. The microchip is capable of integrating all steps of single-cell multiplexed gene expression profiling, and providing precision detection of drug induced genotoxic stress. Throughput has been set to be 18, and can be further increased following the same approach. Numerical simulation of on-chip single cell trapping and heat transfer has been employed to evaluate the chip design and operation.

  20. Sustained and promoter dependent bone morphogenetic protein expression by rat mesenchymal stem cells after BMP-2 transgene electrotransfer

    Directory of Open Access Journals (Sweden)

    E Ferreira

    2012-07-01

    Full Text Available Transplantation of mesenchymal stem cells (MSCs with electrotransferred bone morphogenetic protein-2 (BMP-2 transgene is an attractive therapeutic modality for the treatment of large bone defects: it provides both stem cells with the ability to form bone and an effective bone inducer while avoiding viral gene transfer. The objective of the present study was to determine the influence of the promoter driving the human BMP-2 gene on the level and duration of BMP-2 expression after transgene electrotransfer into rat MSCs. Cytomegalovirus, elongation factor-1α, glyceraldehyde 3-phosphate dehydrogenase, and beta-actin promoters resulted in a BMP-2 secretion rate increase of 11-, 78-, 66- and 36-fold over respective controls, respectively. In contrast, the osteocalcin promoter had predictable weak activity in undifferentiated MSCs but induced the strongest BMP-2 secretion rates in osteoblastically-differentiated MSCs. Regardless of the promoter driving the transgene, a plateau of maximal BMP-2 secretion persisted for at least 21 d after the hBMP-2 gene electrotransfer. The present study demonstrates the feasibility of gene electrotransfer for efficient BMP-2 transgene delivery into MSCs and for a three-week sustained BMP-2 expression. It also provides the first in vitro evidence for a safe alternative to viral methods that permit efficient BMP-2 gene delivery and expression in MSCs but raise safety concerns that are critical when considering clinical applications.

  1. Identification of proteins susceptible to thiol oxidation in endothelial cells exposed to hypochlorous acid and N-chloramines.

    Science.gov (United States)

    Summers, Fiona A; Forsman Quigley, Anna; Hawkins, Clare L

    2012-08-24

    Hypochlorous acid (HOCl) is a potent oxidant produced by the enzyme myeloperoxidase, which is released by neutrophils under inflammatory conditions. Although important in the immune system, HOCl can also damage host tissue, which contributes to the development of disease. HOCl reacts readily with free amino groups to form N-chloramines, which also cause damage in vivo, owing to the extracellular release of myeloperoxidase and production of HOCl. HOCl and N-chloramines react readily with cellular thiols, which causes dysfunction via enzyme inactivation and modulation of redox signaling processes. In this study, the ability of HOCl and model N-chloramines produced on histamine and ammonia at inflammatory sites, to oxidize specific thiol-containing proteins in human coronary artery endothelial cells was investigated. Using a proteomics approach with the thiol-specific probe, 5-iodoacetamidofluorescein, we show that several proteins including peptidylprolyl isomerase A (cyclophilin A), protein disulfide isomerase, glyceraldehyde-3-phosphate dehydrogenase and galectin-1 are particularly sensitive to oxidation by HOCl and N-chloramines formed at inflammatory sites. This will contribute to cellular dysfunction and may play a role in inflammatory disease pathogenesis. Copyright © 2012 Elsevier Inc. All rights reserved.

  2. Differential dissolved protein expression throughout the life cycle of Giardia lamblia.

    Science.gov (United States)

    Lingdan, Li; Pengtao, Gong; Wenchao, Li; Jianhua, Li; Ju, Yang; Chengwu, Liu; He, Li; Guocai, Zhang; Wenzhi, Ren; Yujiang, Chen; Xichen, Zhang

    2012-12-01

    Giardia lamblia (G. lamblia) has a simple life cycle that alternates between a cyst and a trophozoite, and this parasite is an important human and animal pathogen. To increase our understanding of the molecular basis of the G. lamblia encystment, we have analyzed the soluble proteins expressed by trophozoites and cysts extracted from feces by quantitative proteomic analysis. A total of 63 proteins were identified by isobaric tags for relative and absolute quantitation (iTRAQ) labeling, and were categorized as cytoskeletal proteins, a cell-cycle-specific kinase, metabolic enzymes and stress resistance proteins. Importantly, we demonstrated that the expression of seven proteins differed significantly between trophozoites and cysts. In cysts, the expression of three proteins (one variable surface protein (VSP), ornithine carbamoyltransferase (OTC), β-tubulin) increased, whereas the expression of four proteins (14-3-3 protein, α-tubulin, glyceraldehyde-3-phosphate dehydrogenase (GAPDH), protein disulfide isomerase 2 (PDI-2)) decreased significantly when compared with the levels of these proteins in trophozoites. The mRNA expression patterns of four of these proteins (OTC, α-tubulin, GAPDH, VSP) were similar to the expression levels of the proteins. These seven proteins appear to play an important role in the completion of the life cycle of G. lamblia.

  3. Comparison of DNA and RNA extraction methods for mummified tissues.

    Science.gov (United States)

    Konomi, Nami; Lebwohl, Eve; Zhang, David

    2002-12-01

    Nucleic acids extracted from mummified tissues are valuable materials for the study of ancient human beings. Significant difficulty in extracting nucleic acids from mummified tissues has been reported due to chemical modification and degradation. The goal of this study was to determine a method that is more efficient for DNA and RNA extraction from mummified tissues. Twelve mummy specimens were analyzed with 9 different nucleic acid extraction methods, including guanidium thiocyanate (GTC) and proteinase K/detergent based methods prepared in our laboratory or purchased. Glyceraldehyde 3-phosphate dehydrogenase DNA and beta-actin RNA were used as markers for the presence of adequate DNA and RNA, respectively, for PCR and RT-PCR amplification. Our results show that 5 M GTC is more efficient of releasing nucleic acids from mummified tissue than proteinase K/detergent, and phenol/chloroform extraction with an additional chloroform step is more efficient than phenol/chloroform along. We were able to isolate DNAs from all 12 specimens and RNAs from 8 of 12 specimens, and the nucleic acids were sufficient for PCR and RT-PCR analysis. We further tested hepatitis viruses including hepatitis B virus, hepatitis C virus, hepatitis G virus, and TT virus DNA, and fail to detect these viruses in all 12 specimens.

  4. Validation of reference genes for real-time quantitative RT-PCR studies in Talaromyces marneffei.

    Science.gov (United States)

    Dankai, Wiyada; Pongpom, Monsicha; Vanittanakom, Nongnuch

    2015-11-01

    Talaromyces marneffei (or Penicillium marneffei) is an opportunistic pathogen that can cause disseminated disease in human immunodeficiency virus (HIV)-infected patients, especially in Southeast Asia. T. marneffei is a thermally dimorphic fungus. Typically, T. marneffei has an adaptive morphology. It grows in a filamentous form (mould) at 25°C and can differentiate to produce asexual spores (conidia). In contrast, at 37°C, it grows as yeast cells that divide by fission. This study aimed to validate a quantitative reverse-transcription polymerase chain reaction (qRT-PCR) for gene expression analysis in T. marneffei. Analysis of relative gene expression by qRT-PCR requires normalization of data using a proper reference gene. However, suitable reference genes have not been identified in gene expression studies across different cell types or under different experimental conditions in T. marneffei. In this study, four housekeeping genes were selected for analysis: β-actin (act); glyceraldehyde-3-phosphate dehydrogenase (gapdh); β-tubulin (benA) and 18S rRNA. Two analysis programs; BestKeeper and geNorm software tools were used to validate the expression of the candidate normalized genes. The results indicated that the actin gene was the one which was most stably expressed and was recommended for use as the endogenous control for gene expression analysis of all growth forms in T. marneffei by qRT-PCR under normal and stress conditions.

  5. Type 2 diabetes mellitus: Role of melatonin and oxidative stress.

    Science.gov (United States)

    Zephy, Doddigarla; Ahmad, Jamal

    2015-01-01

    Type 2 diabetes mellitus caused by transfer of susceptible immortal gene from parent to progeny in individuals prone, and/or in contribution of factors such as obesity and physical inactivity results in chronic extracellular hyperglycemia due to insulin resistance or impaired glucose tolerance. Hyperglycemia leads to increased production of superoxide radical in mitochondrial electron transport chain, consequently, inhibit glyceraldehyde-3-phosphate dehydrogenase activity, increase the flux of substrates that direct the expression of genes responsible for activation of polyol, hexosamine, advanced glycation end products and protein kinase-C pathways enzymes. Simultaneously, these pathways add-up free radicals in the body, hamper cell redox state, alter genes of insulin sensitivity and are responsible for the diabetic complications like retinopathy, atherosclerosis, cardiovascular diseases, nephropathy and neuropathy. Experimental evidence suggests that the indoleamine hormone melatonin is capable of influencing in development of diabetic complications by neutralizing the unnecessary production of ROS, protection of beta cells, as they possess low antioxidant potential and normalize redox state in the cell. However, studies reported the beneficial effects of pharmacological supplementation of melatonin in humans but it has not been extensively studied in a multicountric, multicentric which should include all ethnic population.

  6. Pathophysiological roles of peroxynitrite in circulatory shock.

    Science.gov (United States)

    Szabó, Csaba; Módis, Katalin

    2010-09-01

    Peroxynitrite is a reactive oxidant produced from nitric oxide and superoxide, which reacts with proteins, lipids, and DNA, and promotes cytotoxic and proinflammatory responses. Here, we overview the role of peroxynitrite in various forms of circulatory shock. Immunohistochemical and biochemical evidences demonstrate the production of peroxynitrite in various experimental models of endotoxic and hemorrhagic shock both in rodents and in large animals. In addition, biological markers of peroxynitrite have been identified in human tissues after circulatory shock. Peroxynitrite can initiate toxic oxidative reactions in vitro and in vivo. Initiation of lipid peroxidation, direct inhibition of mitochondrial respiratory chain enzymes, inactivation of glyceraldehyde-3-phosphate dehydrogenase, inhibition of membrane Na+/K+ ATPase activity, inactivation of membrane sodium channels, and other oxidative protein modifications contribute to the cytotoxic effect of peroxynitrite. In addition, peroxynitrite is a potent trigger of DNA strand breakage, with subsequent activation of the nuclear enzyme poly(ADP-ribose) polymerase, which promotes cellular energetic collapse and cellular necrosis. Additional actions of peroxynitrite that contribute to the pathogenesis of shock include inactivation of catecholamines and catecholamine receptors (leading to vascular failure) and endothelial and epithelial injury (leading to endothelial and epithelial hyperpermeability and barrier dysfunction), as well as myocyte injury (contributing to loss of cardiac contractile function). Neutralization of peroxynitrite with potent peroxynitrite decomposition catalysts provides cytoprotective and beneficial effects in rodent and large-animal models of circulatory shock.

  7. DNA-enrichment microfluidic chip for chromatin immunoprecipitation.

    Science.gov (United States)

    Oh, Hyun Jik; Park, Joong Yull; Park, Sung Eun; Lee, Bo Yun; Park, Jong Sung; Kim, Suel-Kee; Yoon, Tae Joong; Lee, Sang-Hoon

    2009-04-15

    Chromatin immunoprecipitation (ChIP) is a powerful and widely applied technique for detecting association of individual proteins with specific genomic regions; the technique requires several complex steps and is tedious. In this paper, we develop a microbead-packed microfluidic chip which eliminates most of the laborious, time-consuming, and skill-dependent processes of the ChIP procedure. A computational fluid dynamics model was established to analyze fluidic behavior in a microbead-packed microchannel. With the use of the new chip, a ChIP procedure was performed to purify the GAPDH (glyceraldehyde 3-phosphate dehydrogenase) gene from human embryonic kidney cells (cell line 293). The ChIP capability of the microfluidic chip was evaluated and compared with that of a commercial assay kit; the precipitation performance of both methods was almost identical as shown by quantitative measurement of DNA. However, our chip offers the advantage of low resin volume, and the experimental time is greatly reduced. In addition, our method is less dependent on individual technical skill. Therefore, we expect that our microfluidic chip-based ChIP method will be widely used in DNA-, gene-, and protein-related research and will improve experimental efficiency.

  8. Proteomics Analysis of Ovarian Cancer Cell Lines and Tissues Reveals Drug Resistance-associated Proteins

    Science.gov (United States)

    CRUZ*, ISA N.; COLEY*, HELEN M.; KRAMER, HOLGER B.; MADHURI, THUMULURU KAVITAH; SAFUWAN, NUR A.M.; ANGELINO, ANA RITA; YANG, MIN

    2016-01-01

    Background: Carboplatin and paclitaxel form the cornerstone of chemotherapy for epithelial ovarian cancer, however, drug resistance to these agents continues to present challenges. Despite extensive research, the mechanisms underlying this resistance remain unclear. Materials and Methods: A 2D-gel proteomics method was used to analyze protein expression levels of three human ovarian cancer cell lines and five biopsy samples. Representative proteins identified were validated via western immunoblotting. Ingenuity pathway analysis revealed metabolomic pathway changes. Results: A total of 189 proteins were identified with restricted criteria. Combined treatment targeting the proteasome-ubiquitin pathway resulted in re-sensitisation of drug-resistant cells. In addition, examination of five surgical biopsies of ovarian tissues revealed α-enolase (ENOA), elongation factor Tu, mitochondrial (EFTU), glyceraldehyde-3-phosphate dehydrogenase (G3P), stress-70 protein, mitochondrial (GRP75), apolipoprotein A-1 (APOA1), peroxiredoxin (PRDX2) and annexin A (ANXA) as candidate biomarkers of drug-resistant disease. Conclusion: Proteomics combined with pathway analysis provided information for an effective combined treatment approach overcoming drug resistance. Analysis of cell lines and tissues revealed potential prognostic biomarkers for ovarian cancer. *These Authors contributed equally to this study. PMID:28031236

  9. Evaluation of the expression of sperm proteins in normozoospermic and asthenozoospermic men using monoclonal antibodies

    Directory of Open Access Journals (Sweden)

    Jana Capkova

    2016-01-01

    Full Text Available Recent studies have shown that infertility affects estimated 15% of all couples. Male infertility is the primary or contributory cause in 60% of these cases. Consequently, the application of assisted reproduction is increasing. These methods could benefit from an extended evaluation of sperm quality. For this reason, we analyzed sperm proteins from 30 men with normal spermiograms and 30 men with asthenozoospermia. Ejaculates of both groups were tested by flow cytometry (FCM and fluorescence with a set of well-characterized anti-human sperm Hs-monoclonal antibodies (MoAbs, which were generated in our laboratory. No statistically significant differences were found between normospermics and asthenospermics in the expression of the sperm surface protein clusterin, evaluated with Hs-3 MoAb, and semenogelin, evaluated with Hs-9 MoAb. However, FCM revealed quantitative differences in the acrosomal proteins between normozoospermic and asthenozoospermic men, namely, in glyceraldehyde-3-phosphate dehydrogenase, evaluated with Hs-8 MoAb, valosin-containing protein, evaluated with Hs-14 MoAb, and ATP synthase (cAMP-dependent protein kinase II, PRKAR2A, evaluated with MoAb Hs-36. Asthenozoospermic men displayed a highly reduced expression of intra-acrosomal proteins, with a likely decrease in sperm quality, and thus a negative impact on successful reproduction. Asthenozoospermia seems to be a complex disorder involving intra-acrosomal proteins.

  10. Noninvasive Monitoring of Three-Dimensional Chondrogenic Constructs Using Molecular Beacon Nanosensors.

    Science.gov (United States)

    Tay, Li Min; Wiraja, Christian; Yeo, David C; Wu, Yingnan; Yang, Zheng; Chuah, Yon Jin; Lee, Eng Hin; Kang, Yuejun; Xu, Chenjie

    2017-01-01

    Chondrogenic differentiation of human mesenchymal stem cells (MSCs) in three-dimensional hydrogel holds promise as a method for repairing injured articular cartilage. Given MSC plasticity (its potential to mature into alternative lineages), nondestructive monitoring is critical for the optimization of chondrogenic differentiation conditions and the evaluation of the final product. However, conventional validation/assessments of the differentiation process (i.e., quantitative reverse transcription polymerase chain reaction [qRT-PCR] and histology) are end-point assays requiring disruption of the sample. This report introduces molecular beacon (MB)-based nanosensors to achieve noninvasive monitoring of chondrogenic differentiation. These nanosensors consist of biodegradable poly(lactic-co-glycolic acid) nanoparticles (PLGA NPs) encapsulating MBs to detect Type II Collagen (Col2) and glyceraldehyde-3-phosphate dehydrogenase (GAPDH) mRNAs that serve as lineage-specific and housekeeping biomarkers, respectively. The sustainable release of MBs from MB-NPs allows longitudinal monitoring of MSCs undergoing chondrogenic differentiation over a period of 28 days. Dual-colored MB loading ensures accurate assessment of Col2 mRNA expression level, where potential heterogeneity in nanosensor uptake and retention by MSCs are taken into account. When normalized nanosensor signal was compared against qRT-PCR result, a tight correlation was observed (R(2) = 0.9301). Finally, nanosensor usage was compatible with MSC potency with minimal influence on chondrogenic, adipogenic, and osteogenic differentiation.

  11. Nuclear lipid microdomain as resting place of dexamethasone to impair cell proliferation.

    Science.gov (United States)

    Cataldi, Samuela; Codini, Michela; Cascianelli, Giacomo; Tringali, Sabina; Tringali, Anna Rita; Lazzarini, Andrea; Floridi, Alessandro; Bartoccini, Elisa; Garcia-Gil, Mercedes; Lazzarini, Remo; Ambesi-Impiombato, Francesco Saverio; Curcio, Francesco; Beccari, Tommaso; Albi, Elisabetta

    2014-01-01

    The action of dexamethasone is initiated by, and strictly dependent upon, the interaction of the drug with its receptor followed by its translocation into the nucleus where modulates gene expression. Where the drug localizes at the intranuclear level is not yet known. We aimed to study the localization of the drug in nuclear lipid microdomains rich in sphingomyelin content that anchor active chromatin and act as platform for transcription modulation. The study was performed in non-Hodgkin's T cell human lymphoblastic lymphoma (SUP-T1 cell line). We found that when dexamethasone enters into the nucleus it localizes in nuclear lipid microdomains where influences sphingomyelin metabolism. This is followed after 24 h by a cell cycle block accompanied by the up-regulation of cyclin-dependent kinase inhibitor 1A (CDKN1A), cyclin-dependent kinase inhibitor 1B (CDKN1B), growth arrest and DNA-damage 45A (GADD45A), and glyceraldehyde 3-phosphate dehydrogenase (GAPDH) genes and by the reduction of signal transducer and activator of transcription 3 (STAT3) and phospho signal transducer and activator of transcription 3 (phoshoSTAT3) proteins. After 48 h some cells show morphological changes characteristic of apoptosis while the number of the cells that undergo cell division and express B-cell lymphoma-2 (Bcl-2) is very low. We suggest that the integrity of nuclear lipid microdomains is important for the response to glucocorticoids of cancer cells.

  12. The multifaceted roles of metabolic enzymes in the Paracoccidioides species complex

    Science.gov (United States)

    Marcos, Caroline M.; de Oliveira, Haroldo C.; da Silva, Julhiany de F.; Assato, Patrícia A.; Fusco-Almeida, Ana M.; Mendes-Giannini, Maria J. S.

    2014-01-01

    Paracoccidioides species are dimorphic fungi and are the etiologic agents of paracoccidioidomycosis, which is a serious disease that involves multiple organs. The many tissues colonized by this fungus suggest a variety of surface molecules involved in adhesion. A surprising finding is that most enzymes in the glycolytic pathway, tricarboxylic acid (TCA) cycle and glyoxylate cycle in Paracoccidioides spp. have adhesive properties that aid in interacting with the host extracellular matrix and thus act as ‘moonlighting’ proteins. Moonlighting proteins have multiple functions, which adds a dimension to cellular complexity and benefit cells in several ways. This phenomenon occurs in both eukaryotes and prokaryotes. For example, moonlighting proteins from the glycolytic pathway or TCA cycle can play a role in bacterial pathogenesis by either acting as proteins secreted in a conventional pathway and/or as cell surface components that facilitate adhesion or adherence. This review outlines the multifunctionality exhibited by many Paracoccidioides spp. enzymes, including aconitase, aldolase, glyceraldehyde-3-phosphate dehydrogenase, isocitrate lyase, malate synthase, triose phosphate isomerase, fumarase, and enolase. We discuss the roles that moonlighting activities play in the virulence characteristics of this fungus and several other human pathogens during their interactions with the host. PMID:25566229

  13. Trypanosoma cruzi and Leishmania infantum chagasi Infection in Wild Mammals from Maranhão State, Brazil.

    Science.gov (United States)

    da Costa, Andréa Pereira; Costa, Francisco Borges; Soares, Herbert Sousa; Ramirez, Diego Garcia; Mesquita, Eric Takashi Kamakura de Carvalho; Gennari, Solange Maria; Marcili, Arlei

    2015-11-01

    Trypanosoma and Leishmania are obligate parasites that cause important diseases in human and domestic animals. Wild mammals are the natural reservoirs of these parasites, which are transmitted by hematophagous arthropods. The present study aimed to detect the natural occurrence of trypanosomatids through serological diagnosis, PCR of whole blood and blood culture (hemoculture), and phylogenetic relationships using small subunit ribosomal DNA (SSU rDNA), cytochrome b, and glycosomal glyceraldehyde 3-phosphate dehydrogenase (gGAPDH) genes. Samples from 131 wild animals, including rodents, marsupials, and bats, were sampled in six areas in the state of Maranhão, in a transition zone of semiarid climates northeast of the equatorial humid Amazon. Serological analysis for Leishmania (Leishmania) infantum chagasi was performed in opossums by indirect fluorescent antibody test (IFAT), and all animals were serologically negative. Nine positive hemocultures (6.77%) were isolated and cryopreserved and from mammals of the Didelphimorphia and Chiroptera orders and positioned in phylogenies on the basis of sequences from different genes with reference strains of Trypanosoma cruzi marinkellei and T. cruzi. From primary samples (blood and tissues) only one bat, Pteronotus parnellii, was positive to SSU rDNA and gGAPDH genes and grouped with the L. infantum chagasi branch. The studies conducted in Maranhão State provide knowledge of parasite diversity. It is important to determine the presence of trypanosomatids in wild mammals with synanthropic habits.

  14. Small GTPases and Brucella entry into the endoplasmic reticulum.

    Science.gov (United States)

    de Bolle, Xavier; Letesson, Jean-Jacques; Gorvel, Jean-Pierre

    2012-12-01

    A key determinant for intracellular pathogenic bacteria to ensure their virulence within host cells is their ability to bypass the endocytic pathway and to reach a safe niche of replication. In the case of Brucella, the bacterium targets the ER (endoplasmic reticulum) to create a replicating niche called the BCV (Brucella-containing vacuole). The ER is a suitable strategic place for pathogenic Brucella. Indeed, bacteria can be hidden from host cell defences to persist within the host, and they can take advantage of the membrane reservoir delivered by the ER to replicate. Interaction with the ER leads to the presence on the BCV of the GAPDH (glyceraldehyde-3-phosphate dehydrogenase) and the small GTPase Rab2 known to be located on secretory vesicles that traffic between the ER and the Golgi apparatus. GAPDH and the small GTPase Rab2 controls Brucella replication at late times post-infection. A specific interaction between the human small GTPase Rab2 and a Brucella spp. protein named RicA was identified. Altered kinetics of intracellular trafficking and faster proliferation of the Brucella abortus ΔricA mutant was observed compared with the wild-type strain. RicA is the first reported effector with a proposed function for B. abortus.

  15. Multiple Targets of Salicylic Acid and Its Derivatives in Plants and Animals

    Science.gov (United States)

    Klessig, Daniel F.; Tian, Miaoying; Choi, Hyong Woo

    2016-01-01

    Salicylic acid (SA) is a critical plant hormone that is involved in many processes, including seed germination, root initiation, stomatal closure, floral induction, thermogenesis, and response to abiotic and biotic stresses. Its central role in plant immunity, although extensively studied, is still only partially understood. Classical biochemical approaches and, more recently, genome-wide high-throughput screens have identified more than two dozen plant SA-binding proteins (SABPs), as well as multiple candidates that have yet to be characterized. Some of these proteins bind SA with high affinity, while the affinity of others exhibit is low. Given that SA levels vary greatly even within a particular plant species depending on subcellular location, tissue type, developmental stage, and with respect to both time and location after an environmental stimulus such as infection, the presence of SABPs exhibiting a wide range of affinities for SA may provide great flexibility and multiple mechanisms through which SA can act. SA and its derivatives, both natural and synthetic, also have multiple targets in animals/humans. Interestingly, many of these proteins, like their plant counterparts, are associated with immunity or disease development. Two recently identified SABPs, high mobility group box protein and glyceraldehyde 3-phosphate dehydrogenase, are critical proteins that not only serve key structural or metabolic functions but also play prominent roles in disease responses in both kingdoms. PMID:27303403

  16. A Microchip for Integrated Single-Cell Gene Expression Profiling and Genotoxicity Detection

    Science.gov (United States)

    Dong, Hui; Sun, Hao

    2016-01-01

    Microfluidics-based single-cell study is an emerging approach in personalized treatment or precision medicine studies. Single-cell gene expression holds a potential to provide treatment selections with maximized efficacy to help cancer patients based on a genetic understanding of their disease. This work presents a multi-layer microchip for single-cell multiplexed gene expression profiling and genotoxicity detection. Treated by three drug reagents (i.e., methyl methanesulfonate, docetaxel and colchicine) with varied concentrations and time lengths, individual human cancer cells (MDA-MB-231) are lysed on-chip, and the released mRNA templates are captured and reversely transcribed into single strand DNA. Glyceraldehyde-3-phosphate dehydrogenase (GAPDH), cyclin-dependent kinase inhibitor 1A (CDKN1A), and aurora kinase A (AURKA) genes from single cells are amplified and real-time quantified through multiplex polymerase chain reaction. The microchip is capable of integrating all steps of single-cell multiplexed gene expression profiling, and providing precision detection of drug induced genotoxic stress. Throughput has been set to be 18, and can be further increased following the same approach. Numerical simulation of on-chip single cell trapping and heat transfer has been employed to evaluate the chip design and operation. PMID:27649175

  17. Comparison of two methods for RNA extraction from the nucleus pulposus of intervertebral discs.

    Science.gov (United States)

    Gan, M F; Yang, H L; Qian, J L; Wu, C S; Yuan, C X; Li, X F; Zou, J

    2016-06-03

    RNA extraction from the nucleus pulposus of intervertebral discs has been extensively used in orthopedic studies. We compared two methods for extracting RNA from the nucleus pulposus: liquid nitrogen grinding and enzyme digestion. The RNA was detected by agarose gel electrophoresis, and the purity was evaluated by absorbance ratio using a spectrophotometer. Glyceraldehyde 3-phosphate dehydrogenase (GAPDH) expression was assayed by reverse transcription-polymerase chain reaction (RT-PCR). Thirty human lumbar intervertebral discs were used in this study. The liquid nitrogen-grinding method was used for RNA extraction from 15 samples, and the mean RNA concentration was 491.04 ± 44.16 ng/mL. The enzyme digestion method was used on 15 samples, and the mean RNA concentration was 898.42 ± 38.64 ng/mL. The statistical analysis revealed that there was a significant difference in concentration between the different methods. Apparent 28S, 18S, and 5S bands were detectable in RNA extracted using the enzyme digestion method, whereas no 28S or 18S bands were detected in RNA extracted using the liquid nitrogen-grinding method. The GAPDH band was visible, and no non-specific band was detected in the RT-PCR assay by the enzyme digestion method. Therefore, the enzyme digestion method is an efficient and easy method for RNA extraction from the nucleus pulposus of intervertebral discs for further intervertebral disc degeneration-related studies.

  18. Evolutionary insights from bat trypanosomes: morphological, developmental and phylogenetic evidence of a new species, Trypanosoma (Schizotrypanum) erneyi sp. nov., in African bats closely related to Trypanosoma (Schizotrypanum) cruzi and allied species.

    Science.gov (United States)

    Lima, Luciana; Silva, Flávia Maia da; Neves, Luis; Attias, Márcia; Takata, Carmen S A; Campaner, Marta; de Souza, Wanderley; Hamilton, Patrick B; Teixeira, Marta M G

    2012-11-01

    Parasites of the genus Trypanosoma are common in bats and those of the subgenus Schizotrypanum are restricted to bats throughout the world, with the exception of Trypanosoma (Schizotrypanum) cruzi that also infects other mammals and is restricted to the American Continent. We have characterized trypanosome isolates from Molossidae bats captured in Mozambique, Africa. Morphology and behaviour in culture, supported by phylogenetic inferences using SSU (small subunit) rRNA, gGAPDH (glycosomal glyceraldehyde 3-phosphate dehydrogenase) and Cyt b (cytochrome b) genes, allowed to classify the isolates as a new Schizotrypanum species named Trypanosoma (Schizotrypanum) erneyi sp. nov. This is the first report of a Schizotrypanum species from African bats cultured, characterized morphologically and biologically, and positioned in phylogenetic trees. The unprecedented finding of a new species of the subgenus Schizotrypanum from Africa that is closest related to the America-restricted Trypanosoma (Schizotrypanum) cruzi marinkellei and T. cruzi provides new insights into the origin and evolutionary history of T. cruzi and closely related bat trypanosomes. Altogether, data from our study support the hypothesis of an ancestor trypanosome parasite of bats evolving to infect other mammals, even humans, and adapted to transmission by triatomine bugs in the evolutionary history of T. cruzi in the New World.

  19. Nuclear localization of the mitochondrial factor HIGD1A during metabolic stress.

    Directory of Open Access Journals (Sweden)

    Kurosh Ameri

    Full Text Available Cellular stress responses are frequently governed by the subcellular localization of critical effector proteins. Apoptosis-inducing Factor (AIF or Glyceraldehyde 3-Phosphate Dehydrogenase (GAPDH, for example, can translocate from mitochondria to the nucleus, where they modulate apoptotic death pathways. Hypoxia-inducible gene domain 1A (HIGD1A is a mitochondrial protein regulated by Hypoxia-inducible Factor-1α (HIF1α. Here we show that while HIGD1A resides in mitochondria during physiological hypoxia, severe metabolic stress, such as glucose starvation coupled with hypoxia, in addition to DNA damage induced by etoposide, triggers its nuclear accumulation. We show that nuclear localization of HIGD1A overlaps with that of AIF, and is dependent on the presence of BAX and BAK. Furthermore, we show that AIF and HIGD1A physically interact. Additionally, we demonstrate that nuclear HIGD1A is a potential marker of metabolic stress in vivo, frequently observed in diverse pathological states such as myocardial infarction, hypoxic-ischemic encephalopathy (HIE, and different types of cancer. In summary, we demonstrate a novel nuclear localization of HIGD1A that is commonly observed in human disease processes in vivo.

  20. Green tea and one of its constituents, Epigallocatechine-3-gallate, are potent inhibitors of human 11β-hydroxysteroid dehydrogenase type 1.

    Directory of Open Access Journals (Sweden)

    Jan Hintzpeter

    Full Text Available The microsomal enzyme 11β-hydroxysteroid deydrogenase type 1 (11β-HSD1 catalyzes the interconversion of glucocorticoid receptor-inert cortisone to receptor- active cortisol, thereby acting as an intracellular switch for regulating the access of glucocorticoid hormones to the glucocorticoid receptor. There is strong evidence for an important aetiological role of 11β-HSD1 in various metabolic disorders including insulin resistance, diabetes type 2, hypertension, dyslipidemia and obesity. Hence, modulation of 11β-HSD1 activity with selective inhibitors is being pursued as a new therapeutic approach for the treatment of the metabolic syndrome. Since tea has been associated with health benefits for thousands of years, we sought to elucidate the active principle in tea with regard to diabetes type 2 prevention. Several teas and tea specific polyphenolic compounds were tested for their possible inhibition of cortisone reduction with human liver microsomes and purified human 11β-HSD1. Indeed we found that tea extracts inhibited 11β-HSD1 mediated cortisone reduction, where green tea exhibited the highest inhibitory potency with an IC50 value of 3.749 mg dried tea leaves per ml. Consequently, major polyphenolic compounds from green tea, in particular catechins were tested with the same systems. (--Epigallocatechin gallate (EGCG revealed the highest inhibition of 11β-HSD1 activity (reduction: IC50 = 57.99 µM; oxidation: IC50 = 131.2 µM. Detailed kinetic studies indicate a direct competition mode of EGCG, with substrate and/or cofactor binding. Inhibition constants of EGCG on cortisone reduction were Ki = 22.68 µM for microsomes and Ki = 18.74 µM for purified 11β-HSD1. In silicio docking studies support the view that EGCG binds directly to the active site of 11β-HSD1 by forming a hydrogen bond with Lys187 of the catalytic triade. Our study is the first to provide evidence that the health benefits of green tea and its

  1. Green tea and one of its constituents, Epigallocatechine-3-gallate, are potent inhibitors of human 11β-hydroxysteroid dehydrogenase type 1.

    Science.gov (United States)

    Hintzpeter, Jan; Stapelfeld, Claudia; Loerz, Christine; Martin, Hans-Joerg; Maser, Edmund

    2014-01-01

    The microsomal enzyme 11β-hydroxysteroid deydrogenase type 1 (11β-HSD1) catalyzes the interconversion of glucocorticoid receptor-inert cortisone to receptor- active cortisol, thereby acting as an intracellular switch for regulating the access of glucocorticoid hormones to the glucocorticoid receptor. There is strong evidence for an important aetiological role of 11β-HSD1 in various metabolic disorders including insulin resistance, diabetes type 2, hypertension, dyslipidemia and obesity. Hence, modulation of 11β-HSD1 activity with selective inhibitors is being pursued as a new therapeutic approach for the treatment of the metabolic syndrome. Since tea has been associated with health benefits for thousands of years, we sought to elucidate the active principle in tea with regard to diabetes type 2 prevention. Several teas and tea specific polyphenolic compounds were tested for their possible inhibition of cortisone reduction with human liver microsomes and purified human 11β-HSD1. Indeed we found that tea extracts inhibited 11β-HSD1 mediated cortisone reduction, where green tea exhibited the highest inhibitory potency with an IC50 value of 3.749 mg dried tea leaves per ml. Consequently, major polyphenolic compounds from green tea, in particular catechins were tested with the same systems. (-)-Epigallocatechin gallate (EGCG) revealed the highest inhibition of 11β-HSD1 activity (reduction: IC50 = 57.99 µM; oxidation: IC50 = 131.2 µM). Detailed kinetic studies indicate a direct competition mode of EGCG, with substrate and/or cofactor binding. Inhibition constants of EGCG on cortisone reduction were Ki = 22.68 µM for microsomes and Ki = 18.74 µM for purified 11β-HSD1. In silicio docking studies support the view that EGCG binds directly to the active site of 11β-HSD1 by forming a hydrogen bond with Lys187 of the catalytic triade. Our study is the first to provide evidence that the health benefits of green tea and its polyphenolic compounds may

  2. Proliferative responses to altered 17beta-hydroxysteroid dehydrogenase (17HSD) type 2 expression in human breast cancer cells are dependent on endogenous expression of 17HSD type 1 and the oestradiol receptors.

    Science.gov (United States)

    Jansson, A; Gunnarsson, C; Stål, O

    2006-09-01

    The primary source of oestrogen in premenopausal women is the ovary but, after menopause, oestrogen biosynthesis in peripheral tissue is the exclusive site of formation. An enzyme group that affects the availability of active oestrogens is the 17beta-hydroxysteroid dehydrogenase (17HSD) family. In breast cancer, 17HSD type 1 and type 2 have been mostly investigated and seem to be the principal 17HSD enzymes involved thus far. The question whether 17HSD type 1 or type 2 is of greatest importance in breast tumour development is still not clear. The aim of this study was to investigate how the loss of 17HSD type 2 expression, using siRNA in the non-tumour breast epithelial cells HMEC (human mammal epithelial cells) and MCF10A, and gain of 17HSD type 2 expression, using transient transfection in the breast cancer derived cell lines MCF7 and T47D, affect oestradiol conversion and proliferation rate measured as S-phase fraction. We further investigated how this was related to the endogenous expression of 17HSD type 1 and oestradiol receptors in the examined cell lines. The oestradiol level in the medium changed significantly in the MCF7 transfected cells and the siRNA-treated HMEC cells, but not in T47D or MCF10A. The S-phase fraction decreased in the 17HSD type 2-transfected MCF7 cells and the siRNA-treated HMEC cells. The results seemed to be dependent on the endogenous expression of 17HSD type 1 and the oestradiol receptors. In conclusion, we found that high or low levels of 17HSD type 2 affected the oestradiol concentration significantly. However, the response was dependent on the endogenous expression of 17HSD type 1. Expression of 17HSD type 1 seems to be dominant to 17HSD type 2. Therefore, it may be important to investigate a ratio between 17HSD type 1 and 17HSD type 2.

  3. Increased IMP dehydrogenase gene expression in solid tumor tissues and tumor cell lines

    Energy Technology Data Exchange (ETDEWEB)

    Collart, F.R.; Chubb, C.B.; Mirkin, B.L.; Huberman, E.

    1992-07-10

    IMP dehydrogenase, a regulatory enzyme of guanine nucleotide biosynthesis, may play a role in cell proliferation and malignancy. To assess this possibility, we examined IMP dehydrogenase expression in a series of human solid tumor tissues and tumor cell lines in comparison with their normal counterparts. Increased IMP dehydrogenase gene expression was observed in brain tumors relative to normal brain tissue and in sarcoma cells relative to normal fibroblasts. Similarly, in several B- and T-lymphoid leukemia cell lines, elevated levels of IMP dehydrogenase mRNA and cellular enzyme were observed in comparison with the levels in peripheral blood lymphocytes. These results are consistent with an association between increased IMP dehydrogenase expression and either enhanced cell proliferation or malignant transformation.

  4. Isolation, characterization and evaluation of the Pichia pastoris sorbitol dehydrogenase promoter for expression of heterologous proteins.

    Science.gov (United States)

    Periyasamy, Sankar; Govindappa, Nagaraj; Sreenivas, Suma; Sastry, Kedarnath

    2013-11-01

    Sorbitol is used as a non-repressive carbon source to develop fermentation process for Mut(s) recombinant clones obtained using the AOX1 promoter in Pichia pastoris. Sorbitol dehydrogenase is an enzyme in the carbohydrate metabolism that catalyzes reduction of D-fructose into D-sorbitol in the presence of NADH. The small stretch of 211bps upstream region of sorbitol dehydrogenase coding gene has all the promoter elements like CAAT box, GC box, etc. It is able to promote protein production under repressive as well as non-repressive carbon sources. In this study, the strength of the sorbitol dehydrogenase promoter was evaluated by expression of two heterologous proteins: human serum albumin and erythrina trypsin inhibitor. Sorbitol dehydrogenase promoter allowed constitutive expression of recombinant proteins in all carbon sources that were tested to grow P. pastoris and showed activity similar to GAP promoter. The sorbitol dehydrogenase promoter was active in all the growth phases of the P. pastoris.

  5. Untangling the glutamate dehydrogenase allosteric nightmare.

    Science.gov (United States)

    Smith, Thomas J; Stanley, Charles A

    2008-11-01

    Glutamate dehydrogenase (GDH) is found in all living organisms, but only animal GDH is regulated by a large repertoire of metabolites. More than 50 years of research to better understand the mechanism and role of this allosteric network has been frustrated by its sheer complexity. However, recent studies have begun to tease out how and why this complex behavior evolved. Much of GDH regulation probably occurs by controlling a complex ballet of motion necessary for catalytic turnover and has evolved concomitantly with a long antenna-like feature of the structure of the enzyme. Ciliates, the 'missing link' in GDH evolution, might have created the antenna to accommodate changing organelle functions and was refined in humans to, at least in part, link amino acid catabolism with insulin secretion.

  6. Proteomic Profiling and Identification of Immunodominant Spore Antigens of Bacillus anthracis, Bacillus cereus, and Bacillus thuringiensis‡

    Science.gov (United States)

    DelVecchio, Vito G.; Connolly, Joseph P.; Alefantis, Timothy G.; Walz, Alexander; Quan, Marian A.; Patra, Guy; Ashton, John M.; Whittington, Jessica T.; Chafin, Ryan D.; Liang, Xudong; Grewal, Paul; Khan, Akbar S.; Mujer, Cesar V.

    2006-01-01

    Differentially expressed and immunogenic spore proteins of the Bacillus cereus group of bacteria, which includes Bacillus anthracis, Bacillus cereus, and Bacillus thuringiensis, were identified. Comparative proteomic profiling of their spore proteins distinguished the three species from each other as well as the virulent from the avirulent strains. A total of 458 proteins encoded by 232 open reading frames were identified by matrix-assisted laser desorption ionization-time-of-flight mass spectrometry analysis for all the species. A number of highly expressed proteins, including elongation factor Tu (EF-Tu), elongation factor G, 60-kDa chaperonin, enolase, pyruvate dehydrogenase complex, and others exist as charge variants on two-dimensional gels. These charge variants have similar masses but different isoelectric points. The majority of identified proteins have cellular roles associated with energy production, carbohydrate transport and metabolism, amino acid transport and metabolism, posttranslational modifications, and translation. Novel vaccine candidate proteins were identified using B. anthracis polyclonal antisera from humans postinfected with cutaneous anthrax. Fifteen immunoreactive proteins were identified in B. anthracis spores, whereas 7, 14, and 7 immunoreactive proteins were identified for B. cereus and in the virulent and avirulent strains of B. thuringiensis spores, respectively. Some of the immunodominant antigens include charge variants of EF-Tu, glyceraldehyde-3-phosphate dehydrogenase, dihydrolipoamide acetyltransferase, Δ-1-pyrroline-5-carboxylate dehydrogenase, and a dihydrolipoamide dehydrogenase. Alanine racemase and neutral protease were uniquely immunogenic to B. anthracis. Comparative analysis of the spore immunome will be of significance for further nucleic acid- and immuno-based detection systems as well as next-generation vaccine development. PMID:16957262

  7. Stable shRNA Silencing of Lactate Dehydrogenase A (LDHA) in Human MDA-MB-231 Breast Cancer Cells Fails to Alter Lactic Acid Production, Glycolytic Activity, ATP or Survival.

    Science.gov (United States)

    Mack, Nzinga; Mazzio, Elizabeth A; Bauer, David; Flores-Rozas, Hernan; Soliman, Karam F A

    2017-03-01

    In the US, African Americans have a high death rate from triple-negative breast cancer (TNBC), characterized by lack of hormone receptors (ER, PR, HER2/ERRB2) which are otherwise valuable targets of chemotherapy. There is a need to identify novel targets that negatively impact TNBC tumorigenesis. TNBCs release an abundance of lactic acid, under normoxic, hypoxic and hyperoxic conditions; this referred to as the Warburg effect. Accumulated lactic acid sustains peri-cellular acidity which propels metastatic invasion and malignant aggressive transformation. The source of lactic acid is believed to be via conversion of pyruvate by lactate dehydrogenase (LDH) in the last step of glycolysis, with most studies focusing on the LDHA isoform. In this study, LDHA was silenced using long-term MISSION® shRNA lentivirus in human breast cancer MDA-MB-231 cells. Down-regulation of LDHA transcription and protein expression was confirmed by western blot, immunocytochemistry and qPCR. A number of parameters were measured in fully viable vector controls versus knock-down (KD) clones, including levels of lactic acid produced, glucose consumed, ATP and basic metabolic rates. The data show that lentivirus V-165 generated a knock-down clone most effective in reducing both gene and protein levels to less than 1% of vector controls. Stable KD showed absolutely no changes in cell viability, lactic acid production, ATP, glucose consumption or basic metabolic rate. Given the complete absence of impact on any observed parameter by LDH-A KD and this being somewhat contrary to findings in the literature, further analysis was required to determine why. Whole-transcriptome analytic profile on MDA-MB-231 for LDH subtypes using Agilent Human Genome 4×44k microarrays, where the data show the following component breakdown. Transcripts: 30.47 % LDHA, 69.36% LDHB, 0.12% LDHC and 0.05% LDHD. These findings underscore the importance of alternative isoforms of LDH in cancer cells to produce lactic acid

  8. Two novel variants of human medium chain acyl-CoA dehydrogenase (MCAD). K364R, a folding mutation, and R256T, a catalytic-site mutation resulting in a well-folded but totally inactive protein

    DEFF Research Database (Denmark)

    O'Reilly, Linda P; Andresen, Brage S; Engel, Paul C

    2005-01-01

    Two novel rare mutations, MCAD approximately 842G-->C (R256T) and MCAD approximately 1166A-->G (K364R), have been investigated to assess how far the biochemical properties of the mutant proteins correlate with the clinical phenotype of medium chain acyl-CoA dehydrogenase (MCAD) deficiency. When t...

  9. Direct Enzymatic Assay for Alcohol Oxidase, Alcohol Dehydrogenase, and Formaldehyde Dehydrogenase in Colonies of Hansenula polymorpha

    OpenAIRE

    Eggeling, L; Sahm, H

    1980-01-01

    A procedure is described for the qualitative direct identification of alcohol oxidase, alcohol dehydrogenase, and formaldehyde dehydrogenase in yeast colonies. The method has been applied successfully to isolate mutants of Hansenula polymorpha with altered glucose repression of alcohol oxidase.

  10. Pregnancy Vaccination with Gold Glyco-Nanoparticles Carrying Listeria monocytogenes Peptides Protects against Listeriosis and Brain- and Cutaneous-Associated Morbidities

    Directory of Open Access Journals (Sweden)

    Ricardo Calderón-Gonzalez

    2016-08-01

    Full Text Available Listeriosis is a fatal infection for fetuses and newborns with two clinical main morbidities in the neonatal period, meningitis and diffused cutaneous lesions. In this study, we vaccinated pregnant females with two gold glyconanoparticles (GNP loaded with two peptides, listeriolysin peptide 91–99 (LLO91–99 or glyceraldehyde-3-phosphate dehydrogenase 1–22 peptide (GAPDH1–22. Neonates born to vaccinated mothers were free of bacteria and healthy, while non-vaccinated mice presented clear brain affections and cutaneous diminishment of melanocytes. Therefore, these nanoparticle vaccines are effective measures to offer pregnant mothers at high risk of listeriosis interesting therapies that cross the placenta.

  11. Total protein or high-abundance protein: Which offers the best loading control for Western blotting?

    Science.gov (United States)

    Thacker, Jonathan S; Yeung, Derrick H; Staines, W Richard; Mielke, John G

    2016-03-01

    Western blotting routinely involves a control for variability in the amount of protein across immunoblot lanes. Normalizing a target signal to one found for an abundantly expressed protein is widely regarded as a reliable loading control; however, this approach is being increasingly questioned. As a result, we compared blotting for two high-abundance proteins (actin and glyceraldehyde 3-phosphate dehydrogenase [GAPDH]) and two total protein membrane staining methods (Ponceau and Coomassie Brilliant Blue) to determine the best control for loading variability. We found that Ponceau staining optimally balanced accuracy and precision, and we suggest that this approach be considered as an alternative to normalizing with a high-abundance protein.

  12. Phenotypical and Genotypical Properties of an Arcanobacterium pluranimalium Strain Isolated from a Juvenile Giraffe (Giraffa camelopardalis reticulata

    Directory of Open Access Journals (Sweden)

    Karin Risse

    2014-01-01

    Full Text Available The present study was designed to characterize phenotypically and genotypically an Arcanobacterium pluranimalium strain (A. pluranimalium 4868 following necropsy from a juvenile giraffe. The species identity could be confirmed by phenotypical investigations and by MALDI-TOF MS analysis, by sequencing the 16S rDNA, pluranimaliumlysin encoding gene pla, and glyceraldehyde-3-phosphate dehydrogenase encoding gene gap with sequence similarities to A. pluranimalium reference strain DSM 13483T of 99.2%, 89.9%, and 99.1%, respectively. To our knowledge, the present study is the first phenotypic and genotypic characterization of an A. pluranimalium strain isolated from a giraffe.

  13. Affi-gel blue treatment simplifies the protein composition of sarcoplasmic reticulum vesicles.

    Science.gov (United States)

    Papp, S; Dux, L; Martonosi, A

    1986-04-01

    Sarcoplasmic reticulum vesicles isolated by conventional techniques usually contain, in addition to the recognized sarcoplasmic reticulum components, several other proteins (phosphorylase, myosin, glyceraldehyde-3-phosphate dehydrogenase, etc.) in variable amounts; these proteins complicate the interpretation of chemical modification data. Incubation of sarcoplasmic reticulum vesicles with Affi-Gel blue particles for 1-4 h at 2 degrees C, followed by sedimentation of the Affi-Gel in a clinical centrifuge, simplifies the protein composition by selective adsorption of the accessory proteins, and improves the consistency of the preparations. The Affi-Gel blue treatment is recommended as part of the standard procedure for the isolation of sarcoplasmic reticulum vesicles.

  14. Targets of 3-bromopyruvate, a new, energy depleting, anticancer agent.

    Science.gov (United States)

    Dell'Antone, Paolo

    2009-11-01

    3-bromopyruvate (3-BrPA), a pyruvate analog recently proposed as a possible anticancer drug, was investigated in relation to its capacity to inhibit energy production in fractions obtained from normal cells (rat hepatocytes) and in isolated rat thymocytes . Findings were that main targets of the drug were glyceraldehyde 3-phosphate dehydrogenase, and not hexokinase as suggested for hepatoma cells, and succinate -driven ATP synthesis. Consistently with the above findings, in the normal cells studied (thymocytes ) the drug elicited an important fall in ATP levels. The significance of the present findings in concern with a possible therapeutic usefulness of the drug is discussed.

  15. Bipolaris oryzae, a novel fungal opportunist causing keratitis.

    Science.gov (United States)

    Wang, Luxia; Al-Hatmi, Abdullah M S; Lai, Xuwen; Peng, Lianghong; Yang, Chuanhong; Lai, Huangwen; Li, Jianxun; Meis, Jacques F; de Hoog, G Sybren; Zhuo, Chao; Chen, Min

    2016-05-01

    We report a case of mycotic keratitis caused by Bipolaris oryzae with predisposing trauma from a foreign body. The fungus was identified by sequencing the internal transcribed spacer region, translation elongation factor 1α (TEF1) gene, and partial glyceraldehyde-3-phosphate dehydrogenase (GPDH) gene, and the species identity was confirmed on the basis of its characteristic conidial phenotype. The patient was treated with surgical intervention and antifungal agents, including intravenous fluconazole (FLC), oral itraconazole, topical 0.15% amphotericin B eye drops, and 0.5% FLC eye drops. To our knowledge, this is the first report of mycotic keratitis caused by B. oryzae worldwide.

  16. NMR Structure of rALF-Pm3, an Anti-Lipopolysaccharide Factor from Shrimp: Model of the Possible Lipid A-Binding Site

    OpenAIRE

    Yang, Yinshan; Boze, Helene; Chemardin, Patrick; Padilla, Andre; Moulin, Guy; Tassanakajon, Anchalee; Pugniere, Martine; Roquet, Francoise; Destoumieux Garzon, Delphine; Gueguen, Yannick; Bachere, Evelyne; Aumelas, Andre

    2009-01-01

    The anti-lipopolysaccharide factor ALF-Pm3 is a 98-residue protein identified in hemocytes from the black tiger shrimp Penaeus monodon. It was expressed in Pichia pastoris from the constitutive glyceraldehyde-3-phosphate dehydrogenase promoter as a folded and N-15 uniformly labeled rALF-Pm3 protein. Its 3D structure was established by NMR and consists of three alpha-helices packed against a four-stranded beta-sheet. The C-34-C-55 disulfide bond was shown to be essential for the structure stab...

  17. A theoretical study of the molecular mechanism of the GAPDH Trypanosoma cruzi enzyme involving iodoacetate inhibitor

    Science.gov (United States)

    Carneiro, Agnaldo Silva; Lameira, Jerônimo; Alves, Cláudio Nahum

    2011-10-01

    The glyceraldehyde-3-phosphate dehydrogenase enzyme (GAPDH) is an important biological target for the development of new chemotherapeutic agents against Chagas disease. In this Letter, the inhibition mechanism of GAPDH involving iodoacetate (IAA) inhibitor was studied using the hybrid quantum mechanical/molecular mechanical (QM/MM) approach and molecular dynamic simulations. Analysis of the potential energy surface and potential of mean force show that the covalent attachment of IAA inhibitor to the active site of the enzyme occurs as a concerted process. In addition, the energy terms decomposition shows that NAD+ plays an important role in stabilization of the reagents and transition state.

  18. Conversion of Human Steroid 5[beta]-Reductase (AKR1D1) into 3[beta]-Hydroxysteroid Dehydrogenase by Single Point Mutation E120H: Example of Perfect Enzyme Engineering

    Energy Technology Data Exchange (ETDEWEB)

    Chen, Mo; Drury, Jason E.; Christianson, David W.; Penning, Trevor M. (UPENN)

    2012-10-10

    Human aldo-keto reductase 1D1 (AKR1D1) and AKR1C enzymes are essential for bile acid biosynthesis and steroid hormone metabolism. AKR1D1 catalyzes the 5{beta}-reduction of {Delta}{sup 4}-3-ketosteroids, whereas AKR1C enzymes are hydroxysteroid dehydrogenases (HSDs). These enzymes share high sequence identity and catalyze 4-pro-(R)-hydride transfer from NADPH to an electrophilic carbon but differ in that one residue in the conserved AKR catalytic tetrad, His120 (AKR1D1 numbering), is substituted by a glutamate in AKR1D1. We find that the AKR1D1 E120H mutant abolishes 5{beta}-reductase activity and introduces HSD activity. However, the E120H mutant unexpectedly favors dihydrosteroids with the 5{alpha}-configuration and, unlike most of the AKR1C enzymes, shows a dominant stereochemical preference to act as a 3{beta}-HSD as opposed to a 3{alpha}-HSD. The catalytic efficiency achieved for 3{beta}-HSD activity is higher than that observed for any AKR to date. High resolution crystal structures of the E120H mutant in complex with epiandrosterone, 5{beta}-dihydrotestosterone, and {Delta}{sup 4}-androstene-3,17-dione elucidated the structural basis for this functional change. The glutamate-histidine substitution prevents a 3-ketosteroid from penetrating the active site so that hydride transfer is directed toward the C3 carbonyl group rather than the {Delta}{sup 4}-double bond and confers 3{beta}-HSD activity on the 5{beta}-reductase. Structures indicate that stereospecificity of HSD activity is achieved because the steroid flips over to present its {alpha}-face to the A-face of NADPH. This is in contrast to the AKR1C enzymes, which can invert stereochemistry when the steroid swings across the binding pocket. These studies show how a single point mutation in AKR1D1 can introduce HSD activity with unexpected configurational and stereochemical preference.

  19. Redox proteomic analysis of mytilus edulis gills: effects of the pharmaceutical diclofenac on a non-target organism.

    Science.gov (United States)

    Jaafar, Siti Nur Tahirah; Coelho, Ana Varela; Sheehan, David

    2015-10-01

    Veterinary and human pharmaceuticals are an emerging category of chemical pollutants with potential to cause serious toxicity to non-target organisms. Filter-feeding aquatic organisms such as mussels are especially threatened. In this study, the blue mussel, Mytilus edulis, was exposed to two doses (0.2 mg/L and 1 mg/L) of the anti-inflammatory diclofenac. Effects on the gill, the principal feeding organ of mussels, were investigated. It was noted that, while no effect was evident on gill glutathione transferase or catalase activities, there was a tissue-specific increase in glutathione reductase activity and reduction in total protein thiol groups. Two dimensional electrophoresis was performed and some affected proteins identified by in-gel tryptic digestion and peptide mass fingerprinting. Of these, four unique proteins (caspase 3/7-4, heat-shock cognate protein 70, a predicted enolase-like protein, arginine kinase) were found to be oxidized whilst eight unique proteins (β-tubulin, actin, isocitrate dehydrogenase, arginine kinase, heavy metal-binding HIP, cytosolic malate dehydrogenase, proteasome subunit alpha type 2, Mg: bb02e05 (glyceraldehyde-3-phosphate dehydrogenase) and superoxide dismutase) were found to have altered abundance. In addition, bioinformatic analysis suggested putative identities for six hypothetical proteins which either were oxidized or decreased in abundance. These were; 78 kDa glucose-regulated protein precursor, α-enolase, calreticulin, mitochondrial H + -ATPase, palmitoyl protein thioesterase 1 and initiation factor 5a. It is concluded that diclofenac causes significant oxidative stress to gills and that this affects key structural, metabolic and stress-response proteins.

  20. Inhibition of energy-producing pathways of HepG2 cells by 3-bromopyruvate.

    Science.gov (United States)

    Pereira da Silva, Ana Paula; El-Bacha, Tatiana; Kyaw, Nattascha; dos Santos, Reinaldo Sousa; da-Silva, Wagner Seixas; Almeida, Fabio C L; Da Poian, Andrea T; Galina, Antonio

    2009-02-01

    3-BrPA (3-bromopyruvate) is an alkylating agent with anti-tumoral activity on hepatocellular carcinoma. This compound inhibits cellular ATP production owing to its action on glycolysis and oxidative phosphorylation; however, the specific metabolic steps and mechanisms of 3-BrPA action in human hepatocellular carcinomas, particularly its effects on mitochondrial energetics, are poorly understood. In the present study it was found that incubation of HepG2 cells with a low concentration of 3-BrPA for a short period (150 microM for 30 min) significantly affected both glycolysis and mitochondrial respiratory functions. The activity of mitochondrial hexokinase was not inhibited by 150 microM 3-BrPA, but this concentration caused more than 70% inhibition of GAPDH (glyceraldehyde-3-phosphate dehydrogenase) and 3-phosphoglycerate kinase activities. Additionally, 3-BrPA treatment significantly impaired lactate production by HepG2 cells, even when glucose was withdrawn from the incubation medium. Oxygen consumption of HepG2 cells supported by either pyruvate/malate or succinate was inhibited when cells were pre-incubated with 3-BrPA in glucose-free medium. On the other hand, when cells were pre-incubated in glucose-supplemented medium, oxygen consumption was affected only when succinate was used as the oxidizable substrate. An increase in oligomycin-independent respiration was observed in HepG2 cells treated with 3-BrPA only when incubated in glucose-supplemented medium, indicating that 3-BrPA induces mitochondrial proton leakage as well as blocking the electron transport system. The activity of succinate dehydrogenase was inhibited by 70% by 3-BrPA treatment. These results suggest that the combined action of 3-BrPA on succinate dehydrogenase and on glycolysis, inhibiting steps downstream of the phosphorylation of glucose, play an important role in HepG2 cell death.

  1. Decrease in nicotinamide adenine dinucleotide dehydrogenase is related to skin pigmentation.

    Science.gov (United States)

    Nakama, Mitsuo; Murakami, Yuhko; Tanaka, Hiroshi; Nakata, Satoru

    2012-03-01

    Skin pigmentation is caused by various physical and chemical factors. It might also be influenced by changes in the physiological function of skin with aging. Nicotinamide adenine dinucleotide (NADH) dehydrogenase is an enzyme related to the mitochondrial electron transport system and plays a key role in cellular energy production. It has been reported that the functional decrease in this system causes Parkinson's disease. Another study reports that the amount of NADH dehydrogenase in heart and skeletal muscle decreases with aging. A similar decrease in the skin would probably affect its physiological function. However, no reports have examined the age-related change in levels of NADH dehydrogenase in human skin. In this study, we investigated this change and its effect on skin pigmentation using cultured human epidermal keratinocytes. The mRNA expression of NDUFA1, NDUFB7, and NDUFS2, subunits of NADH dehydrogenase, and its activity were significantly decreased in late passage keratinocytes compared to early passage cells. Conversely, the mRNA expression of melanocyte-stimulating cytokines, interleukin-1 alpha and endothelin 1, was increased in late passage cells. On the other hand, the inhibition of NADH dehydrogenase upregulated the mRNA expression of melanocyte-stimulating cytokines. Moreover, the level of NDUFB7 mRNA was lower in pigmented than in nonpigmented regions of skin in vivo. These results suggest the decrease in NADH dehydrogenase with aging to be involved in skin pigmentation.

  2. Carbohydrate metabolism of Xylella fastidiosa: Detection of glycolytic and pentose phosphate pathway enzymes and cloning and expression of the enolase gene

    Directory of Open Access Journals (Sweden)

    Facincani Agda Paula

    2003-01-01

    Full Text Available The objective of this work was to assess the functionality of the glycolytic pathways in the bacterium Xylella fastidiosa. To this effect, the enzymes phosphoglucose isomerase, aldolase, glyceraldehyde-3-phosphate dehydrogenase and pyruvate kinase of the glycolytic pathway, and glucose 6-phosphate dehydrogenase of the Entner-Doudoroff pathway were studied, followed by cloning and expression studies of the enolase gene and determination of its activity. These studies showed that X. fastidiosa does not use the glycolytic pathway to metabolize carbohydrates, which explains the increased duplication time of this phytopatogen. Recombinant enolase was expressed as inclusion bodies and solubilized with urea (most efficient extractor, Triton X-100, and TCA. Enolase extracted from X. fastidiosa and from chicken muscle and liver is irreversibly inactivated by urea. The purification of enolase was partial and resulted in a low yield. No enzymatic activity was detected for either recombinant and native enolases, aldolase, and glyceraldehyde-3-phosphate dehydrogenase, suggesting that X. fastidiosa uses the Entner-Doudoroff pathway to produce pyruvate. Evidence is presented supporting the idea that the regulation of genes and the presence of isoforms with regulation patterns might make it difficult to understand the metabolism of carbohydrates in X. fastidiosa.

  3. Novel 11β-hydroxysteroid dehydrogenase 1 inhibitors reduce cortisol levels in keratinocytes and improve dermal collagen content in human ex vivo skin after exposure to cortisone and UV

    OpenAIRE

    Boudon, Stéphanie M.; Vuorinen, Anna; Geotti-Bianchini, Piero; Wandeler, Eliane; Kratschmar, Denise V.; Heidl, Marc; Campiche, Remo; Jackson, Eileen; Odermatt, Alex

    2017-01-01

    Activity and selectivity assessment of new bi-aryl amide 11β-hydroxysteroid dehydrogenase 1 (11β-HSD1) inhibitors, prepared in a modular manner via Suzuki cross-coupling, are described. Several compounds inhibiting 11β-HSD1 at nanomolar concentrations were identified. Compounds 2b, 3e, 7b and 12e were shown to selectively inhibit 11β-HSD1 over 11β-HSD2, 17β-HSD1 and 17β-HSD2. These inhibitors also potently inhibited 11β-HSD1 activity in intact HEK-293 cells expressing the recombinant enzyme a...

  4. 21 CFR 862.1670 - Sorbitol dehydrogenase test system.

    Science.gov (United States)

    2010-04-01

    ... 21 Food and Drugs 8 2010-04-01 2010-04-01 false Sorbitol dehydrogenase test system. 862.1670... Systems § 862.1670 Sorbitol dehydrogenase test system. (a) Identification. A sorbitol dehydrogenase test system is a device intended to measure the activity of the enzyme sorbitol dehydrogenase in...

  5. 21 CFR 862.1445 - Lactate dehydrogenase isoenzymes test system.

    Science.gov (United States)

    2010-04-01

    ... 21 Food and Drugs 8 2010-04-01 2010-04-01 false Lactate dehydrogenase isoenzymes test system. 862... Test Systems § 862.1445 Lactate dehydrogenase isoenzymes test system. (a) Identification. A lactate dehydrogenase isoenzymes test system is a device intended to measure the activity of lactate dehydrogenase...

  6. Microbial alcohol dehydrogenases: identification, characterization and engineering

    NARCIS (Netherlands)

    Machielsen, M.P.

    2007-01-01

    Keywords: alcohol dehydrogenase, laboratory evolution, rational protein engineering, Pyrococcus furiosus, biocatalysis, characterization, computational design, thermostability.   Alcohol dehydrogeases (ADHs) catalyze the interconversion of alcohols, aldehydes and ketones. They display a wide variety

  7. Genetics Home Reference: dihydropyrimidine dehydrogenase deficiency

    Science.gov (United States)

    ... of the skin on the palms and soles (hand-foot syndrome); shortness of breath; and hair loss may also ... dehydrogenase deficiency , with its early-onset neurological symptoms, is a rare disorder. Its prevalence is ...

  8. Isocitrate dehydrogenase mutations in gliomas.

    Science.gov (United States)

    Waitkus, Matthew S; Diplas, Bill H; Yan, Hai

    2016-01-01

    Over the last decade, extraordinary progress has been made in elucidating the underlying genetic causes of gliomas. In 2008, our understanding of glioma genetics was revolutionized when mutations in isocitrate dehydrogenase 1 and 2 (IDH1/2) were identified in the vast majority of progressive gliomas and secondary glioblastomas (GBMs). IDH enzymes normally catalyze the decarboxylation of isocitrate to generate α-ketoglutarate (αKG), but recurrent mutations at Arg(132) of IDH1 and Arg(172) of IDH2 confer a neomorphic enzyme activity that catalyzes reduction of αKG into the putative oncometabolite D-2-hydroxyglutate (D2HG). D2HG inhibits αKG-dependent dioxygenases and is thought to create a cellular state permissive to malignant transformation by altering cellular epigenetics and blocking normal differentiation processes. Herein, we discuss the relevant literature on mechanistic studies of IDH1/2 mutations in gliomas, and we review the potential impact of IDH1/2 mutations on molecular classification and glioma therapy.

  9. Advances in the Molecular Biological Research of Human Glucose-6-phosphate Dehydrogenase%人类葡萄糖-6-磷酸脱氢酶的分子生物学研究进展

    Institute of Scientific and Technical Information of China (English)

    刘晗; 蒋玮莹

    2009-01-01

    葡萄糖-6-磷酸脱氢酶(glucose-6-phosphate dehydrogenase,G6PD)缺乏症作为一种全球范围内最常见的酶缺乏症之一,受到研究者们的广泛关注.G6PD催化磷酸戊糖途径的第一步,由此酶催化生成的NADPH+H+对于对抗氧化性损伤是极其重要的.本文将从G6PD的结构与功能,SNP的研究与单体型的建立,抗疟疾选择优势与新的G6PD基因突变检测方法这几方面的研究进展综述如下.%Glucose-6-phosphate dehydrogenase(G6PD)deficiency is one of the most common enzymopathies attracting many researchers.G6PD catalyses the first committed step in the pentose phosphate pathway,and the generation of NADPH by this enzyme is essential for protection against oxidative stress.The progress in research of the structures and functions of G6PD gene'S,SNP and haplotype,new detective techniques of new mutation and recent positive selection of anti-malaria are reviewed.

  10. Characterization of wild-type human medium-chain acyl-CoA dehydrogenase (MCAD) and mutant enzymes present in MCAD-deficient patients by two-dimensional gel electrophoresis

    DEFF Research Database (Denmark)

    Bross, P; Jensen, T G; Andresen, B S;

    1994-01-01

    Two-dimensional gel electrophoresis was used to study and compare wild-type medium-chain acyl-CoA dehydrogenase (MCAD; EC 1.3.99.3) and mis-sense mutant enzyme found in patients with MCAD deficiency. By comparing the patterns for wild-type and mutant MCAD expressed in Escherichia coli or in eukar......Two-dimensional gel electrophoresis was used to study and compare wild-type medium-chain acyl-CoA dehydrogenase (MCAD; EC 1.3.99.3) and mis-sense mutant enzyme found in patients with MCAD deficiency. By comparing the patterns for wild-type and mutant MCAD expressed in Escherichia coli...... of one aspartic acid residue per monomer. Comparison of pulse labeling and steady-state amounts of MCAD protein in overexpressing COS-7 cells confirms that K304E MCAD is synthesized and transported into mitochondria in amounts similar to the wild-type protein, but is degraded much more readily. For wild...

  11. Hydroxysteroid dehydrogenases (HSDs) in bacteria: a bioinformatic perspective.

    Science.gov (United States)

    Kisiela, Michael; Skarka, Adam; Ebert, Bettina; Maser, Edmund

    2012-03-01

    Steroidal compounds including cholesterol, bile acids and steroid hormones play a central role in various physiological processes such as cell signaling, growth, reproduction, and energy homeostasis. Hydroxysteroid dehydrogenases (HSDs), which belong to the superfamily of short-chain dehydrogenases/reductases (SDR) or aldo-keto reductases (AKR), are important enzymes involved in the steroid hormone metabolism. HSDs function as an enzymatic switch that controls the access of receptor-active steroids to nuclear hormone receptors and thereby mediate a fine-tuning of the steroid response. The aim of this study was the identification of classified functional HSDs and the bioinformatic annotation of these proteins in all complete sequenced bacterial genomes followed by a phylogenetic analysis. For the bioinformatic annotation we constructed specific hidden Markov models in an iterative approach to provide a reliable identification for the specific catalytic groups of HSDs. Here, we show a detailed phylogenetic analysis of 3α-, 7α-, 12α-HSDs and two further functional related enzymes (3-ketosteroid-Δ(1)-dehydrogenase, 3-ketosteroid-Δ(4)(5α)-dehydrogenase) from the superfamily of SDRs. For some bacteria that have been previously reported to posses a specific HSD activity, we could annotate the corresponding HSD protein. The dominating phyla that were identified to express HSDs were that of Actinobacteria, Proteobacteria, and Firmicutes. Moreover, some evolutionarily more ancient microorganisms (e.g., Cyanobacteria and Euryachaeota) were found as well. A large number of HSD-expressing bacteria constitute the normal human gastro-intestinal flora. Another group of bacteria were originally isolated from natural habitats like seawater, soil, marine and permafrost sediments. These bacteria include polycyclic aromatic hydrocarbons-degrading species such as Pseudomonas, Burkholderia and Rhodococcus. In conclusion, HSDs are found in a wide variety of microorganisms including

  12. SERUM LACTATE DEHYDROGENASE AS A PROGNOSTIC MARKER IN BREAST CANCER

    Directory of Open Access Journals (Sweden)

    Hardik

    2015-11-01

    Full Text Available : BACKGROUND: Breast cancer a multifactorial disease and one of the most dreaded of human diseases that claims the lives of thousands of women all over the globe every year. This may probably due to the fact that it remains undiagnosed at an early stage perhaps due to lack of awareness amongst the females and the fact that most cancers do not produce any symptoms until the tumour are too large to be removed surgically. Hence there is need to detect cancer at an early stage. AIM: Estimation of diagnostic importance and prognostication of serum Lactate dehydrogenase in cases on breast cancer. SETTINGS AND DESIGN: An observational study was conducted in Acharya Vinoba Bhave Rural Hospital, Sawangi (Meghe, Wardha which included 44 confirmed cases of carcinoma breast and 44 normal healthy females admitted in AVBRH in a span of 2 years. METHODS AND MATERIAL: Determination of serum LDH was done using TC matrix analyser. The values of LDH were obtained on presentation, 21 days after intervention, 2 months after intervention and 6 months after intervention. The values of LDH on presentation in both the groups were compared. The decline in the values of LDH were observed with the due course of treatment. Chisquare test and Student’s Unpaired and paired t test were used for statistical analysis. RESULT: The mean Lactate dehydrogenase on presentation was in study group and control group was 564.38±219.41 IU/L and 404.18±101.32 IU/L respectively (p<0.05. The levels of Lactate dehydrogenase decreased with due course of treatment. The levels of LDH were proportionate to the stage of disease. CONCLUSION: The results of the study concludes cost effective usefulness of serum Lactate dehydrogenase in early detection of breast cancer and to assess its prognostic importance which can be done in smaller laboratories. The traditional model of DS-

  13. Moonlighting proteins in sperm-egg interactions.

    Science.gov (United States)

    Petit, François M; Serres, Catherine; Auer, Jana

    2014-12-01

    Sperm-egg interaction is a highly species-specific step during the fertilization process. The first steps consist of recognition between proteins on the sperm head and zona pellucida (ZP) glycoproteins, the acellular coat that protects the oocyte. We aimed to determine which sperm head proteins interact with ZP2, ZP3 and ZP4 in humans. Two approaches were combined to identify these proteins: immunoblotting human spermatozoa targeted by antisperm antibodies (ASAs) from infertile men and far-Western blotting of human sperm proteins overlaid by each of the human recombinant ZP (hrZP) proteins. We used a proteomic approach with 2D electrophoretic separation of sperm protein revealed using either ASAs eluted from infertile patients or recombinant human ZP glycoproteins expressed in Chinese-hamster ovary (CHO) cells. Only spots highlighted by both methods were analysed by MALDI-MS/MS for identification. We identified proteins already described in human spermatozoa, but implicated in different metabolic pathways such as glycolytic enzymes [phosphokinase type 3 (PK3), enolase 1 (ENO1), glyceraldehyde-3-phosphate dehydrogenase (GAPDH), aldolase A (ALDOA) and triose phosphate isomerase (TPI)], detoxification enzymes [GST Mu (GSTM) and phospholipid hydroperoxide glutathione peroxidase (PHGPx) 4], ion channels [voltage-dependent anion channel 2 (VDAC2)] or structural proteins (outer dense fibre 2). Several proteins were localized on the sperm head by indirect immunofluorescence, and their interaction with ZP proteins was confirmed by co-precipitation experiments. These results confirm the complexity of the sperm-ZP recognition process in humans with the implication of different proteins interacting with the main three ZP glycoproteins. The multiple roles of these proteins suggest that they are multifaceted or moonlighting proteins.

  14. High substrate specificity of ipsdienol dehydrogenase (IDOLDH), a short-chain dehydrogenase from Ips pini bark beetles.

    Science.gov (United States)

    Figueroa-Teran, Rubi; Pak, Heidi; Blomquist, Gary J; Tittiger, Claus

    2016-09-01

    Ips spp. bark beetles use ipsdienol, ipsenol, ipsdienone and ipsenone as aggregation pheromone components and pheromone precursors. For Ips pini, the short-chain oxidoreductase ipsdienol dehydrogenase (IDOLDH) converts (-)-ipsdienol to ipsdienone, and thus likely plays a role in determining pheromone composition. In order to further understand the role of IDOLDH in pheromone biosynthesis, we compared IDOLDH to its nearest functionally characterized ortholog with a solved structure: human L-3-hydroxyacyl-CoA dehydrogenase type II/ amyloid-β binding alcohol dehydrogenase (hHADH II/ABAD), and conducted functional assays of recombinant IDOLDH to determine substrate and product ranges and structural characteristics. Although IDOLDH and hHADH II/ABAD had only 35% sequence identity, their predicted tertiary structures had high identity. We found IDOLDH is a functional homo-tetramer. In addition to oxidizing (-)-ipsdienol, IDOLDH readily converted racemic ipsenol to ipsenone, and stereo-specifically reduced both ketones to their corresponding (-)-alcohols. The (+)-enantiomers were never observed as products. Assays with various substrate analogs showed IDOLDH had high substrate specificity for (-)-ipsdienol, ipsenol, ipsenone and ipsdienone, supporting that IDOLDH functions as a pheromone-biosynthetic enzyme. These results suggest that different IDOLDH orthologs and or activity levels contribute to differences in Ips spp. pheromone composition.

  15. Evidence for distinct dehydrogenase and isomerase sites within a single 3. beta. -hydroxysteroid dehydrogenase/5-ene-4-ene isomerase protein

    Energy Technology Data Exchange (ETDEWEB)

    Luu-The, V.; Takahashi, Masakazu; de Launoit, Y.; Dumont, M.; Lachance, Y.; Labrie, F. (Laval Univ., Quebec City, Quebec (Canada))

    1991-09-10

    Complementary DNA encoding human 3{beta}-hydroxysteroid dehydrogenase/5-ene-4-ene isomerase (3-{beta}-HSD) has been expressed in transfected GH{sub 4}C{sub 1} with use of the cytomegalovirus promoter. The activity of the expressed protein clearly shows that both dehydrogenase and isomerase enzymatic activities are present within a single protein. However, such findings do not indicate whether the two activities reside within one or two closely related catalytic sites. With use of ({sup 3}H)-5-androstenedione, the intermediate compound in dehydroepiandrosterone (DHEA) transformation into 4-androstenedione by 3{beta}-HSD, the present study shows that 4MA (N,N-diethyl-4-methyl-3-oxo-4-aza-5{alpha}-androstane-17{beta}-carboxamide) and its analogues of 5-androstenedione to 4-androstenedione with an approximately 1,000-fold higher K{sub i} value. The present results thus strongly suggest that dehydrogenase and isomerase activities are present at separate sites on the 3-{beta}-HSD protein. Such data suggest that the irreversible step in the transformation of DHEA to 4-androstenedione is due to a separate site possessing isomerase activity that converts the 5-ene-3-keto to a much more stable 4-ene-3-keto configuration.

  16. Comprehensive Identification of Immunodominant Proteins of Brucella abortus and Brucella melitensis Using Antibodies in the Sera from Naturally Infected Hosts

    Directory of Open Access Journals (Sweden)

    Gamal Wareth

    2016-04-01

    Full Text Available Brucellosis is a debilitating zoonotic disease that affects humans and animals. The diagnosis of brucellosis is challenging, as accurate species level identification is not possible with any of the currently available serology-based diagnostic methods. The present study aimed at identifying Brucella (B. species-specific proteins from the closely related species B. abortus and B. melitensis using sera collected from naturally infected host species. Unlike earlier reported investigations with either laboratory-grown species or vaccine strains, in the present study, field strains were utilized for analysis. The label-free quantitative proteomic analysis of the naturally isolated strains of these two closely related species revealed 402 differentially expressed proteins, among which 63 and 103 proteins were found exclusively in the whole cell extracts of B. abortus and B. melitensis field strains, respectively. The sera from four different naturally infected host species, i.e., cattle, buffalo, sheep, and goat were applied to identify the immune-binding protein spots present in the whole protein extracts from the isolated B. abortus and B. melitensis field strains and resolved on two-dimensional gel electrophoresis. Comprehensive analysis revealed that 25 proteins of B. abortus and 20 proteins of B. melitensis were distinctly immunoreactive. Dihydrodipicolinate synthase, glyceraldehyde-3-phosphate dehydrogenase and lactate/malate dehydrogenase from B. abortus, amino acid ABC transporter substrate-binding protein from B. melitensis and fumarylacetoacetate hydrolase from both species were reactive with the sera of all the tested naturally infected host species. The identified proteins could be used for the design of serological assays capable of detecting pan-Brucella, B. abortus- and B. melitensis-specific antibodies.

  17. Comprehensive Identification of Immunodominant Proteins of Brucella abortus and Brucella melitensis Using Antibodies in the Sera from Naturally Infected Hosts.

    Science.gov (United States)

    Wareth, Gamal; Eravci, Murat; Weise, Christoph; Roesler, Uwe; Melzer, Falk; Sprague, Lisa D; Neubauer, Heinrich; Murugaiyan, Jayaseelan

    2016-04-30

    Brucellosis is a debilitating zoonotic disease that affects humans and animals. The diagnosis of brucellosis is challenging, as accurate species level identification is not possible with any of the currently available serology-based diagnostic methods. The present study aimed at identifying Brucella (B.) species-specific proteins from the closely related species B. abortus and B. melitensis using sera collected from naturally infected host species. Unlike earlier reported investigations with either laboratory-grown species or vaccine strains, in the present study, field strains were utilized for analysis. The label-free quantitative proteomic analysis of the naturally isolated strains of these two closely related species revealed 402 differentially expressed proteins, among which 63 and 103 proteins were found exclusively in the whole cell extracts of B. abortus and B. melitensis field strains, respectively. The sera from four different naturally infected host species, i.e., cattle, buffalo, sheep, and goat were applied to identify the immune-binding protein spots present in the whole protein extracts from the isolated B. abortus and B. melitensis field strains and resolved on two-dimensional gel electrophoresis. Comprehensive analysis revealed that 25 proteins of B. abortus and 20 proteins of B. melitensis were distinctly immunoreactive. Dihydrodipicolinate synthase, glyceraldehyde-3-phosphate dehydrogenase and lactate/malate dehydrogenase from B. abortus, amino acid ABC transporter substrate-binding protein from B. melitensis and fumarylacetoacetate hydrolase from both species were reactive with the sera of all the tested naturally infected host species. The identified proteins could be used for the design of serological assays capable of detecting pan-Brucella, B. abortus- and B. melitensis-specific antibodies.

  18. Comparative proteomic analysis of Streptococcus suis biofilms and planktonic cells that identified biofilm infection-related immunogenic proteins.

    Science.gov (United States)

    Wang, Yang; Yi, Li; Wu, Zongfu; Shao, Jing; Liu, Guangjin; Fan, Hongjie; Zhang, Wei; Lu, Chengping

    2012-01-01

    Streptococcus suis (SS) is a zoonotic pathogen that causes severe disease symptoms in pigs and humans. Biofilms of SS bind to extracellular matrix proteins in both endothelial and epithelial cells and cause persistent infections. In this study, the differences in the protein expression profiles of SS grown either as planktonic cells or biofilms were identified using comparative proteomic analysis. The results revealed the existence of 13 proteins of varying amounts, among which six were upregulated and seven were downregulated in the Streptococcus biofilm compared with the planktonic controls. The convalescent serum from mini-pig, challenged with SS, was applied in a Western blot assay to visualize all proteins from the biofilm that were grown in vitro and separated by two-dimensional gel electrophoresis. A total of 10 immunoreactive protein spots corresponding to nine unique proteins were identified by MALDI-TOF/TOF-MS. Of these nine proteins, five (Manganese-dependent superoxide dismutase, UDP-N-acetylglucosamine 1-carboxyvinyltransferase, ornithine carbamoyltransferase, phosphoglycerate kinase, Hypothetical protein SSU05_0403) had no previously reported immunogenic properties in SS to our knowledge. The remaining four immunogenic proteins (glyceraldehyde-3-phosphate dehydrogenase, hemolysin, pyruvate dehydrogenase and DnaK) were identified under both planktonic and biofilm growth conditions. In conclusion, the protein expression pattern of SS, grown as biofilm, was different from the SS grown as planktonic cells. These five immunogenic proteins that were specific to SS biofilm cells may potentially be targeted as vaccine candidates to protect against SS biofilm infections. The four proteins common to both biofilm and planktonic cells can be targeted as vaccine candidates to protect against both biofilm and acute infections.

  19. Mechanisms involved in the inhibition of glycolysis by cyanide and antimycin A in Candida albicans and its reversal by hydrogen peroxide. A common feature in Candida species.

    Science.gov (United States)

    Peña, Antonio; Sánchez, Norma Silvia; González-López, Omar; Calahorra, Martha

    2015-12-01

    In Candida albicans, cyanide and antimycin A inhibited K(+) transport, not only with ethanol-O2 as the substrate, but also with glucose. The reason for this was that they inhibited not only respiration, but also fermentation, decreasing ATP production. Measurements of oxygen levels in cell suspensions allowed identification of the electron pathways involved. NADH fluorescence levels increased in the presence of the inhibitors, indirectly indicating lower levels of NAD(+) and so pointing to glyceraldehyde-3-phosphate dehydrogenase as the limiting step responsible for the inhibition of glycolysis, which was confirmed by the levels of glycolytic intermediaries. The cyanide effect could be reversed by hydrogen peroxide, mainly due to an activity by which H2O2 can be reduced by electrons flowing from NADH through a pathway that can be inhibited by antimycin A, and appears to be a cytochrome c peroxidase. Therefore, the inhibition of glycolysis by the respiratory inhibitors seems to be due to the decreased availability of NAD(+), resulting in a decreased activity of glyceraldehyde-3-phosphate dehydrogenase. Compartmentalization of pyridine nucleotides in favor of the mitochondria can contribute to explaining the low fermentation capacity of C. albicans. Similar results were obtained with three C. albicans strains, Candida dubliniensis and, to a lower degree, Candida parapsilosis.

  20. Glusoce-6-phosphate dehydrogenase- History and diagnosis

    Directory of Open Access Journals (Sweden)

    K Gautam

    2016-09-01

    Full Text Available Glucose-6-phosphate dehydrogenase deficiency is the most common enzymatic defect of red blood cells, which increases the vulnerability of erythrocytes to oxidative stress leading to hemolytic anemia. Since its identification more than 60 years ago, much has been done with respect to its clinical diagnosis, laboratory diagnosis and treatment. Association of G6PD is not just limited to anti malarial drugs, but a vast number of other diseases. In this article, we aimed to review the history of Glucose-6-phosphate dehydrogenase, the diagnostic methods available along with its association with other noncommunicable diseases. 

  1. Production of superoxide/hydrogen peroxide by the mitochondrial 2-oxoadipate dehydrogenase complex.

    Science.gov (United States)

    Goncalves, Renata L S; Bunik, Victoria I; Brand, Martin D

    2016-02-01

    In humans, mutations in dehydrogenase E1 and transketolase domain containing 1 (DHTKD1) are associated with neurological abnormalities and accumulation of 2-oxoadipate, 2-aminoadipate, and reactive oxygen species. The protein encoded by DHTKD1 has sequence and structural similarities to 2-oxoglutarate dehydrogenase, and the 2-oxoglutarate dehydrogenase complex can produce superoxide/H2O2 at high rates. The DHTKD1 enzyme is hypothesized to catalyze the oxidative decarboxylation of 2-oxoadipate, a shared intermediate of the degradative pathways for tryptophan, lysine and hydroxylysine. Here, we show that rat skeletal muscle mitochondria can produce superoxide/H2O2 at high rates when given 2-oxoadipate. We identify the putative mitochondrial 2-oxoadipate dehydrogenase complex as one of the sources and characterize the conditions that favor its superoxide/H2O2 production. Rates increased at higher NAD(P)H/NAD(P)(+) ratios and were higher at each NAD(P)H/NAD(P)(+) ratio when 2-oxoadipate was present, showing that superoxide/H2O2 was produced during the forward reaction from 2-oxoadipate, but not in the reverse reaction from NADH in the absence of 2-oxoadipate. The maximum capacity of the 2-oxoadipate dehydrogenase complex for production of superoxide/H2O2 is comparable to that of site IF of complex I, and seven, four and almost two-fold lower than the capacities of the 2-oxoglutarate, pyruvate and branched-chain 2-oxoacid dehydrogenase complexes, respectively. Regulation by ADP and ATP of H2O2 production driven by 2-oxoadipate was very different from that driven by 2-oxoglutarate, suggesting that site AF of the 2-oxoadipate dehydrogenase complex is a new source of superoxide/H2O2 associated with the NADH isopotential pool in mitochondria.

  2. The conserved Lysine69 residue plays a catalytic role in Mycobacterium tuberculosis shikimate dehydrogenase

    Directory of Open Access Journals (Sweden)

    Rodrigues Valnês

    2009-01-01

    Full Text Available Abstract Background The shikimate pathway is an attractive target for the development of antitubercular agents because it is essential in Mycobacterium tuberculosis, the causative agent of tuberculosis, but absent in humans. M. tuberculosis aroE-encoded shikimate dehydrogenase catalyzes the forth reaction in the shikimate pathway. Structural and functional studies indicate that Lysine69 may be involved in catalysis and/or substrate binding in M. tuberculosis shikimate dehydrogenase. Investigation of the kinetic properties of mutant enzymes can bring important insights about the role of amino acid residues for M. tuberculosis shikimate dehydrogenase. Findings We have performed site-directed mutagenesis, steady-state kinetics, equilibrium binding measurements and molecular modeling for both the wild-type M. tuberculosis shikimate dehydrogenase and the K69A mutant enzymes. The apparent steady-state kinetic parameters for the M. tuberculosis shikimate dehydrogenase were determined; the catalytic constant value for the wild-type enzyme (50 s-1 is 68-fold larger than that for the mutant K69A (0.73 s-1. There was a modest increase in the Michaelis-Menten constant for DHS (K69A = 76 μM; wild-type = 29 μM and NADPH (K69A = 30 μM; wild-type = 11 μM. The equilibrium dissociation constants for wild-type and K69A mutant enzymes are 32 (± 4 μM and 134 (± 21, respectively. Conclusion Our results show that the residue Lysine69 plays a catalytic role and is not involved in substrate binding for the M. tuberculosis shikimate dehydrogenase. These efforts on M. tuberculosis shikimate dehydrogenase catalytic mechanism determination should help the rational design of specific inhibitors, aiming at the development of antitubercular drugs.

  3. Molecular modeling studies of L-arabinitol 4-dehydrogenase of Hypocrea jecorina

    DEFF Research Database (Denmark)

    Tiwari, Manish; Lee, Jung-Kul

    2010-01-01

    in order to provide better insight into the possible catalytic events in these domains. The 3D structure of NAD(+)-dependent LAD1 was developed based on the crystal structure of human sorbitol dehydrogenase as a template. A series of molecular mechanics and dynamics operations were performed to find...

  4. Biochemical characterization of recombinant dihydroorotate dehydrogenase from the opportunistic pathogenic yeast Candida albicans

    DEFF Research Database (Denmark)

    Zameitat, E.; Gojkovic, Zoran; Knecht, Wolfgang

    2006-01-01

    Candida albicans is the most prevalent yeast pathogen in humans, and recently it has become increasingly resistant to the current antifungal agents. In this study we investigated C. albicans dihydroorotate dehydrogenase (DHODH, EC 1.3.99.11), which catalyzes the fourth step of de novo pyrimidine...

  5. Biochemical characterization of recombinant dihydroorotate dehydrogenase from the opportunistic pathogenic yeast Candida albicans

    DEFF Research Database (Denmark)

    Zameitat, E.; Gojkovic, Zoran; Knecht, Wolfgang

    2006-01-01

    Candida albicans is the most prevalent yeast pathogen in humans, and recently it has become increasingly resistant to the current antifungal agents. In this study we investigated C. albicans dihydroorotate dehydrogenase (DHODH, EC 1.3.99.11), which catalyzes the fourth step of de novo pyrimidine...

  6. Engineering of Cellobiose Dehydrogenases for Improved Glucose Sensitivity and Reduced Maltose Affinity

    DEFF Research Database (Denmark)

    Ortiz, Roberto; Rahman, Mahbubur; Zangrilli, Beatrice

    2017-01-01

    Cellobiose dehydrogenase (CDH) is a fungal extracellular flavocytochrome capable of direct electron transfer (DET). Unlike other CDHs, the pH optimum for CDHs from Corynascus thermophilus (CtCDH) and Humicola insolens (HiCDH) is close to the human physiological pH in blood (7.4). These are...

  7. Optimization, Application, and Interpretation of Lactate Dehydrogenase Measurements in Microwell Determination of Cell Number and Toxicity

    NARCIS (Netherlands)

    Wolterbeek, H.T.; Van der Meer, A.J.G.M.

    2005-01-01

    The lactate dehydrogenase (LDH) assay was addressed for its sensitivity, disturbances by foaming, and cell number and size. Cells were from a U-251 MG grade IV human glioblastoma brain tumor cell line used in 100-µl well volumes. Cells were counted by microscopy and Coulter counting; assays were LDH

  8. Serum lactic dehydrogenase isoenzymes and serum hydroxy butyric dehydrogenase in myocardial infarction

    Directory of Open Access Journals (Sweden)

    Kanekar D

    1979-01-01

    Full Text Available Total serum lactate dehydrogenase activity in cases of myocar-dial infarct is difficult to interpret as abnormal values can occur in diseases of liver, kidney and skeletal muscle. The estimation of its isoenzymes is of better diagnostic help because of its tissue specificity. Serum LDH isoenzymes were studied in patients o f myocardial infarction and results are quantitated by densitometry. As LDH 1 represents serum hydroxybutyric dehydrogenase when 2-oxylbutyrate is used as substrate, serum hydroxybutyric dehydro-genase was also estimated in above patients. Greater specificity in diagnosis is achieved with SHBDH because of its myocardial nature and lower incidence of false positive results.

  9. Glucose dehydrogenase polymorphism in man.

    Science.gov (United States)

    King, J; Cook, P J

    1981-05-01

    An isoelectric focusing method for human GDH is described which reveals seven GDH phenotypes. Family studies demonstrate that the variation is genetically determined by three alleles at an autosomal locus with gene frequencies GDH1 = 0.723, GDH2 = 0.194, GDH3 = 0.083. Linkage analysis shows that GDH may be closely linked to PGD on chromosome 1.

  10. Yeast surface display of dehydrogenases in microbial fuel-cells.

    Science.gov (United States)

    Gal, Idan; Schlesinger, Orr; Amir, Liron; Alfonta, Lital

    2016-12-01

    Two dehydrogenases, cellobiose dehydrogenase from Corynascus thermophilus and pyranose dehydrogenase from Agaricus meleagris, were displayed for the first time on the surface of Saccharomyces cerevisiae using the yeast surface display system. Surface displayed dehydrogenases were used in a microbial fuel cell and generated high power outputs. Surface displayed cellobiose dehydrogenase has demonstrated a midpoint potential of -28mV (vs. Ag/AgCl) at pH=6.5 and was used in a mediator-less anode compartment of a microbial fuel cell producing a power output of 3.3μWcm(-2) using lactose as fuel. Surface-displayed pyranose dehydrogenase was used in a microbial fuel cell and generated high power outputs using different substrates, the highest power output that was achieved was 3.9μWcm(-2) using d-xylose. These results demonstrate that surface displayed cellobiose dehydrogenase and pyranose dehydrogenase may successfully be used in microbial bioelectrochemical systems.

  11. Anti-inflammatory peptide regulates the supply of heat shock protein 70 monomers: implications for aging and age-related disease.

    Science.gov (United States)

    Cunningham, Timothy J; Greenstein, Jeffrey I; Loewenstern, Joshua; Degermentzidis, Elias; Yao, Lihua

    2015-04-01

    Reducing the levels of toxic protein aggregates has become a focus of therapy for disorders like Alzheimer's and Parkinson's diseases, as well as for the general deterioration of cells and tissues during aging. One approach has been an attempt to influence the production or activity of a class of reparative chaperones called heat shock proteins (HSPs), of which HSP70 is a promising candidate. Manipulation of HSP70 expression results in disposal of misfolded protein aggregates that accumulate in aging and disease models. Recently, HSP70 has been shown to bind specifically to an amino-terminal sequence of a human diffusible survival evasion peptide (DSEP), dermcidin. This sequence includes CHEC-9, an orally available anti-inflammatory and cell survival peptide. In the present study, we found that the CHEC-9 peptide also binds HSP70 in the cytosol of the cerebral cortex after oral delivery in normal rats. Western analysis of non-heat-denatured, unreduced samples suggested that peptide treatment increased the level of active HSP70 monomers from the pool of chaperone oligomers, a process that may be stimulated by potentiation of the chaperone's adenosine triphosphatase (ATPase). In these samples, a small but consistent gel shift was observed for glyceraldehyde 3-phosphate dehydrogenase (GAPDH), a multifunctional protein whose aggregation is influenced by HSP70. CHEC-9 treatment of an in vitro model of α-synuclein aggregation also results in HSP70-dependent dissolution of these aggregates. HSP70 oligomer-monomer equilibrium and its potential to control protein aggregate disease warrant increased experimental attention, especially if a peptide fragment of an endogenous human protein can influence the process.

  12. Optimization of Adsorptive Immobilization of Alcohol Dehydrogenases

    NARCIS (Netherlands)

    Trivedi, Archana; Heinemann, Matthias; Spiess, Antje C.; Daussmann, Thomas; Büchs, Jochen

    2005-01-01

    In this work, a systematic examination of various parameters of adsorptive immobilization of alcohol dehydrogenases (ADHs) on solid support is performed and the impact of these parameters on immobilization efficiency is studied. Depending on the source of the enzymes, these parameters differently in

  13. Binding of small molecules to lipoamide dehydrogenase

    NARCIS (Netherlands)

    Muiswinkel-Voetberg, van H.

    1972-01-01

    The existence of a monomer-dimer equilibrium with lipoamide dehydrogenase is demonstrated. The equilibrium can be shifted to the monomer side at low ionic strength and low pH by removing the phosphate ions by extensive dialysis. At low ionic strength, I : 0.01 and 0.02, the enzyme

  14. Alcohol dehydrogenase – physiological and diagnostic Importance

    Directory of Open Access Journals (Sweden)

    Magdalena Łaniewska-Dunaj

    2013-08-01

    Full Text Available Alcohol dehydrogenase (ADH is a polymorphic enzyme, existing in multiple isoenzymes divided into several classes and localized in different organs. ADH plays a significant role in the metabolism of many biologically important substances, catalyzing the oxidation or reduction of a wide spectrum of specific substrates. The best characterized function of ADH is protection against excess of ethanol and some other exogenous xenobiotics and products of lipid peroxidation. The isoenzymes of alcohol dehydrogenase also participate in the metabolism of retinol and serotonin. The total alcohol dehydrogenase activity is significantly higher in cancer tissues than in healthy organs (e.g. liver, stomach, colorectum. The changes in activity of particular ADH isoenzymes in the sera of patients with different cancers (especially of the digestive system seem to be caused by release of these isoenzymes from cancer cells, and may play a potential role as markers of this cancer. The particular isoenzymes of ADH present in the serum may indicate the cancer localization. Alcohol dehydrogenase may also be useful for diagnostics of non-cancerous liver diseases (e.g. viral hepatitis, non-alcoholic cirrhosis.

  15. Effects of herbal infusions, tea and carbonated beverages on alcohol dehydrogenase and aldehyde dehydrogenase activity.

    Science.gov (United States)

    Li, Sha; Gan, Li-Qin; Li, Shu-Ke; Zheng, Jie-Cong; Xu, Dong-Ping; Li, Hua-Bin

    2014-01-01

    Various alcoholic beverages containing different concentrations of ethanol are widely consumed, and excessive alcohol consumption may result in serious health problems. The consumption of alcoholic beverages is often accompanied by non-alcoholic beverages, such as herbal infusions, tea and carbonated beverages to relieve drunk symptoms. The aim of this study was to supply new information on the effects of these beverages on alcohol metabolism for nutritionists and the general public, in order to reduce problems associated with excessive alcohol consumption. The effects of 57 kinds of herbal infusions, tea and carbonated beverages on alcohol dehydrogenase and aldehyde dehydrogenase activity were evaluated. Generally, the effects of these beverages on alcohol dehydrogenase and aldehyde dehydrogenase activity are very different. The results suggested that some beverages should not be drank after excessive alcohol consumption, and several beverages may be potential dietary supplements for the prevention and treatment of problems related to excessive alcohol consumption.

  16. Escherichia coli mutants with a temperature-sensitive alcohol dehydrogenase.

    OpenAIRE

    Lorowitz, W; Clark, D.

    1982-01-01

    Mutants of Escherichia coli resistant to allyl alcohol were selected. Such mutants were found to lack alcohol dehydrogenase. In addition, mutants with temperature-sensitive alcohol dehydrogenase activity were obtained. These mutations, designated adhE, are all located at the previously described adh regulatory locus. Most adhE mutants were also defective in acetaldehyde dehydrogenase activity.

  17. Calculations of hydrogen tunnelling and enzyme catalysis: a comparison of liver alcohol dehydrogenase, methylamine dehydrogenase and soybean lipoxygenase

    Science.gov (United States)

    Tresadern, Gary; McNamara, Jonathan P.; Mohr, Matthias; Wang, Hong; Burton, Neil A.; Hillier, Ian H.

    2002-06-01

    Although the potential energy barrier for hydrogen transfer is similar for the enzymes liver alcohol dehydrogenase, methylamine dehydrogenase and soybean lipoxygenase, the degree of tunnelling is predicted to differ greatly, and is reflected by their primary kinetic isotope effects.

  18. Safety, pharmacokinetics and pharmacodynamics of BI 135585, a selective 11β-hydroxysteroid dehydrogenase-1 (HSD1) inhibitor in humans: liver and adipose tissue 11β-HSD1 inhibition after acute and multiple administrations over 2 weeks.

    Science.gov (United States)

    Freude, S; Heise, T; Woerle, H-J; Jungnik, A; Rauch, T; Hamilton, B; Schölch, C; Huang, F; Graefe-Mody, U

    2016-05-01

    To assess the safety and pharmacokinetic and pharmacodynamic characteristics of BI 135585, a selective 11β-hydroxysteroid dehydrogenase-1 (11β-HSD1) inhibitor, after single- and repeated-dose administration. The single-dose study included open-label administration of 200 mg BI 135585 in healthy volunteers, while in the multiple-dose study, we carried out randomized, double-blind administration of 5-200 mg BI 135585 or placebo once daily over 14 days in patients with type 2 diabetes (T2DM). Assessments included 11β-HSD1 inhibition in the liver (urinary tetrahydrocortisol (THF)/tetrahydrocotisone (THE) ratio) and in subcutaneous adipose tissue (AT) ex vivo and determination of hypothalamus-pituitary-adrenal (HPA) axis hormone levels. No major safety issues occurred with BI 135585 administration. The HPA axis was mildly activated with slightly increased, but still normal adrenocorticotropic hormone levels, increased total urinary corticoid excretion but unchanged plasma cortisol levels. After multiple doses of 5-200 mg BI 135585, exposure (area under the curve) increased dose-proportionally and half-life was 55-65 h. The urinary THF/THE ratio decreased, indicating liver 11β-HSD1 inhibition. Median 11β-HSD1 enzyme inhibition in the AT reached 90% after a single dose of BI 135585, but was low (31% or lower) after 14 days of continuous treatment. BI 135585 was safe and well tolerated over 14 days and can be dosed once daily. Future studies are required to clarify the therapeutic potential of BI 135585 in view of its effects on 11β-HSD1 inhibition in AT after single and multiple doses. Enzyme inhibition in the AT was not adequately predicted by the urinary THF/THE ratio. © 2016 John Wiley & Sons Ltd.

  19. Enzymes in Glycolysis and the Citric Acid Cycle in the Yeast and Mycelial Forms of Paracoccidioides brasiliensis

    Science.gov (United States)

    Kanetsuna, Fuminori; Carbonell, Luis M.

    1966-01-01

    Kanetsuna, Fuminori (Instituto Venezolano de Investigaciones Cientificas, Caracas, Venezuela), and Luis M. Carbonell. Enzymes in glycolysis and the citric acid cycle in the yeast and mycelial forms of Paracoccidioides brasiliensis. J. Bacteriol. 92:1315–1320. 1966.—Enzymatic activities in glycolysis, the hexose monophosphate shunt, and the citric acid cycle in cell-free extracts of the yeast and mycelial forms of Paracoccidioides brasiliensis were examined comparatively. Both forms have the enzymes of these pathways. Activities of glucose-6-phosphate dehydrogenase and malic dehydrogenase of the mycelial form were higher than those of the yeast form. Another 15 enzymatic activities of the mycelial form were lower than those of the yeast form. The activity of glyceraldehyde-3-phosphate dehydrogenase showed the most marked difference between the two forms, its activity in the mycelial form being about 20% of that in the yeast form. PMID:5924267

  20. Precise precursor rebalancing for isoprenoids production by fine control of gapA expression in Escherichia coli.

    Science.gov (United States)

    Jung, Juyoung; Lim, Jae Hyung; Kim, Se Yeon; Im, Dae-Kyun; Seok, Joo Yeon; Lee, Seung-Jae V; Oh, Min-Kyu; Jung, Gyoo Yeol

    2016-11-01

    Biosynthesis of isoprenoids via the 1-deoxy-D-xylulose-5-phosphate (DXP) pathway requires equimolar glyceraldehyde 3-phosphate and pyruvate to divert carbon flux toward the products of interest. Here, we demonstrate that precursor balancing is one of the critical steps for the production of isoprenoids in Escherichia coli. First, the implementation of the synthetic lycopene production pathway as a model system and the amplification of the native DXP pathway were accomplished using synthetic constitutive promoters and redesigned 5'-untranslated regions (5'-UTRs). Next, fine-controlled precursor balancing was investigated by tuning phosphoenolpyruvate synthase (PpsA) or glyceraldehyde 3-phosphate dehydrogenase (GAPDH). The results showed that tuning-down of gapA improved the specific lycopene content by 45% compared to the overexpression of ppsA. The specific lycopene content in the strains with down-regulated gapA increased by 97% compared to that in the parental strain. Our results indicate that gapA is the best target for precursor balancing to increase biosynthesis of isoprenoids.

  1. Expression, purification, and characterization of formaldehyde dehydrogenase from Pseudomonas aeruginosa.

    Science.gov (United States)

    Zhang, Wangluo; Chen, Shuai; Liao, Yuanping; Wang, Dingli; Ding, Jianfeng; Wang, Yingming; Ran, Xiaoyuan; Lu, Daru; Zhu, Huaxing

    2013-12-01

    As a member of zinc-containing medium-chain alcohol dehydrogenase family, formaldehyde dehydrogenase (FDH) can oxidize toxic formaldehyde to less active formate with NAD(+) as a cofactor and exists in both prokaryotes and eukaryotes. Most FDHs are well known to be glutathione-dependent in the catalysis of formaldehyde oxidation, but the enzyme from Pseudomonas putida is an exception, which is independent of glutathione. To identify novel glutathione-independent FDHs from other bacterial strains and facilitate the corresponding structural and enzymatic studies, high-level soluble expression and efficient purification of these enzymes need to be achieved. Here, we present molecular cloning, expression, and purification of the FDH from Pseudomonas aeruginosa, which is a Gram-negative pathogenic bacterium causing opportunistic human infection. The FDH of P. aeruginosa shows high sequence identity (87.97%) with that of P. putida. Our results indicated that coexpression with molecular chaperones GroES, GroEL, and Tig has significantly attenuated inclusion body formation and improved the solubility of the recombinant FDH in Escherichiacoli cells. A purification protocol including three chromatographic steps was also established to isolate the recombinant FDH to homogeneity with a yield of ∼3.2 mg from 1L of cell culture. The recombinant P. aeruginosa FDH was properly folded and biologically functional, as demonstrated by the mass spectrometric, crystallographic, and enzymatic characterizations of the purified proteins. Copyright © 2013 Elsevier Inc. All rights reserved.

  2. Effect of the allelic variants of aldehyde dehydrogenase ALDH2*2 and alcohol dehydrogenase ADH1B*2 on blood acetaldehyde concentrations

    Directory of Open Access Journals (Sweden)

    Peng Giia-Sheun

    2009-01-01

    Full Text Available Abstract Alcoholism is a complex behavioural disorder. Molecular genetics studies have identified numerous candidate genes associated with alcoholism. It is crucial to verify the disease susceptibility genes by correlating the pinpointed allelic variations to the causal phenotypes. Alcohol dehydrogenase (ADH and aldehyde dehydrogenase (ALDH are the principal enzymes responsible for ethanol metabolism in humans. Both ADH and ALDH exhibit functional polymorphisms among racial populations; these polymorphisms have been shown to be the important genetic determinants in ethanol metabolism and alcoholism. Here, we briefly review recent advances in genomic studies of human ADH/ALDH families and alcoholism, with an emphasis on the pharmacogenetic consequences of venous blood acetaldehyde in the different ALDH2 genotypes following the intake of various doses of ethanol. This paper illustrates a paradigmatic example of phenotypic verifications in a protective disease gene for substance abuse.

  3. Housekeeping gene stability influences the quantification of osteogenic markers during stem cell differentiation to the osteogenic lineage.

    Science.gov (United States)

    Quiroz, Felipe Garcia; Posada, Olga M; Gallego-Perez, Daniel; Higuita-Castro, Natalia; Sarassa, Carlos; Hansford, Derek J; Agudelo-Florez, Piedad; López, Luis E

    2010-04-01

    Real-time reverse transcription PCR (RT-qPCR) relies on a housekeeping or normalizer gene whose expression remains constant throughout the experiment. RT-qPCR is commonly used for characterization of human bone marrow mesenchymal stem cells (hBMSCs). However, to the best of our knowledge, there are no studies validating the expression stability of the genes used as normalizers during hBMSCs differentiation. This work aimed to study the stability of the housekeeping genes beta-actin, glyceraldehyde-3-phosphate dehydrogenase (GAPDH) and ribosomal protein L13A (RPL13A) during the osteogenic differentiation of hBMSCs. Their stability was evaluated via RT-qPCR in 14 and 20 day differentiation assays to the osteogenic lineage. Different normalization strategies were evaluated to quantify the osteogenic markers collagen type I, bone sialoprotein and osteonectin. Cell differentiation was confirmed via alizarin red staining. The results demonstrated up-regulation of beta-actin with maximum fold changes (MFC) of 4.38. GAPDH and RPL13A were not regulated by osteogenic media after 14 days and presented average fold changes lower than 2 in 20 day cultures. RPL13A (MFC < 2) had a greater stability when normalizing as a function of culture time compared with GAPDH (MFC

  4. Protein degradation in a LAMP-2-deficient B-lymphoblastoid cell line from a patient with Danon disease.

    Science.gov (United States)

    Sánchez-Lanzas, Raul; Alvarez-Castelao, Beatriz; Bermejo, Teresa; Ayuso, Teresa; Tuñón, Teresa; Castaño, José G

    2016-08-01

    Danon disease, a condition characterized by cardiomyopathy, myopathy, and intellectual disability, is caused by mutations in the LAMP-2 gene. Lamp-2A protein, generated by alternative splicing from the Lamp-2 pre-mRNA, is reported to be the lysosomal membrane receptor essential for the chaperone-mediated autophagic pathway (CMA) aimed to selective protein targeting and translocation into the lysosomal lumen for degradation. To study the relevance of Lamp-2 in protein degradation, a lymphoblastoid cell line was obtained by EBV transformation of B-cells from a Danon patient. The derived cell line showed no significant expression of Lamp-2 protein. The steady-state mRNA and protein levels of alpha-synuclein, IΚBα, Rcan1, and glyceraldehyde-3-phosphate dehydrogenase, four proteins reported to be selective substrates of the CMA pathway, were similar in control and Lamp-2-deficient cells. Inhibition of protein synthesis showed that the half-life of alpha-synuclein, IΚBα, and Rcan1 was similar in control and Lamp-2-deficient cells, and its degradation prevented by proteasome inhibitors. Both in control and Lamp-2-deficient cells, induction of CMA and macroautophagy by serum and aminoacid starvation of cells for 8h produced a similar decrease in IΚBα and Rcan1 protein levels and was prevented by the addition of lysosome and autophagy inhibitors. In conclusion, the results presented here showed that Lamp-2 deficiency in human lymphoblastoid cells did not modify the steady-state levels or the degradation of several protein substrates reported as selective substrates of the CMA pathway.

  5. Proteomic identification of secreted proteins of Propionibacterium acnes

    Directory of Open Access Journals (Sweden)

    Holland Carsten

    2010-08-01

    Full Text Available Abstract Background The anaerobic Gram-positive bacterium Propionibacterium acnes is a human skin commensal that resides preferentially within sebaceous follicles; however, it also exhibits many traits of an opportunistic pathogen, playing roles in a variety of inflammatory diseases such as acne vulgaris. To date, the underlying disease-causing mechanisms remain ill-defined and knowledge of P. acnes virulence factors remains scarce. Here, we identified proteins secreted during anaerobic cultivation of a range of skin and clinical P. acnes isolates, spanning the four known phylogenetic groups. Results Culture supernatant proteins of P. acnes were separated by two-dimensional electrophoresis (2-DE and all Coomassie-stained spots were subsequently identified by MALDI mass spectrometry (MALDI-MS. A set of 20 proteins was secreted in the mid-exponential growth phase by the majority of strains tested. Functional annotation revealed that many of these common proteins possess degrading activities, including glycoside hydrolases with similarities to endoglycoceramidase, β-N-acetylglucosaminidase and muramidase; esterases such as lysophospholipase and triacylglycerol lipase; and several proteases. Other secreted factors included Christie-Atkins-Munch-Petersen (CAMP factors, glyceraldehyde 3-phosphate dehydrogenase (GAPDH, and several hypothetical proteins, a few of which are unique to P. acnes. Strain-specific differences were apparent, mostly in the secretion of putative adhesins, whose genes exhibit variable phase variation-like sequence signatures. Conclusions Our proteomic investigations have revealed that the P. acnes secretome harbors several proteins likely to play a role in host-tissue degradation and inflammation. Despite a large overlap between the secretomes of all four P. acnes phylotypes, distinct differences between predicted host-tissue interacting proteins were identified, providing potential insight into the differential virulence

  6. Redox regulation of apurinic/apyrimidinic endonuclease 1 activity in Long-Evans Cinnamon rats during spontaneous hepatitis.

    Science.gov (United States)

    Karmahapatra, Soumendra Krishna; Saha, Tapas; Adhikari, Sanjay; Woodrick, Jordan; Roy, Rabindra

    2014-03-01

    The Long-Evans Cinnamon (LEC) rat is an animal model for Wilson's disease. This animal is genetically predisposed to copper accumulation in the liver, increased oxidative stress, accumulation of DNA damage, and the spontaneous development of hepatocellular carcinoma. Thus, this animal model is useful for studying the relationship of endogenous DNA damage to spontaneous carcinogenesis. In this study, we have investigated the apurinic/apyrimidinic endonuclease 1 (APE1)-mediated excision repair of endogenous DNA damage, apurinic/apyrimidinic (AP)-sites, which is highly mutagenic and implicated in human cancer. We found that the activity was reduced in the liver extracts from the acute hepatitis period of LEC rats as compared with extracts from the age-matched Long-Evans Agouti rats. The acute hepatitis period had also a heightened oxidative stress condition as assessed by an increase in oxidized glutathione level and loss of enzyme activity of glyceraldehyde 3-phosphate dehydrogenase, a key redox-sensitive protein in cells. Interestingly, the activity reduction was not due to changes in protein expression but apparently by reversible protein oxidation as the addition of reducing agents to extracts of the liver from acute hepatitis period reactivated APE1 activity and thus, confirmed the oxidation-mediated loss of APE1 activity under increased oxidative stress. These findings show for the first time in an animal model that the repair mechanism of AP-sites is impaired by increased oxidative stress in acute hepatitis via redox regulation which contributed to the increased accumulation of mutagenic AP-sites in liver DNA.

  7. Sub-MICs of Azithromycin Decrease Biofilm Formation of S. suis and Increase Capsular Polysaccharide Content of S. suis

    Directory of Open Access Journals (Sweden)

    Yanbei Yang

    2016-10-01

    Full Text Available S. suis (Streptococcus suis caused serious disease symptoms in humans and pigs. S. suis is able to form thick biofilms and this increases the difficulty of treatment. After growth with 1/2 MIC of azithromycin, 1/4 MIC of azithromycin, or 1/8 MIC of azithromycin, biofilm formation of S. suis dose-dependently decreased in the present study. Furthermore, scanning electron microscopy analysis revealed the obvious effect of azithromycin against biofilm formation of S. suis. Especially, at two different conditions (1/2 MIC of azithromycin nontreated cells and treated cells, we carried out comparative proteomic analyses of cells by using iTRAQ technology. Finally, the results revealed the existence of 19 proteins of varying amounts. Interestingly, several cell surface proteins (such as ABC superfamily ATP binding cassette transporter (G7SD52, CpsR (K0FG35, Cps1/2H (G8DTL7, CPS16F (E9NQ13, Putative uncharacterized protein (G7SER0, NADP-dependent glyceraldehyde-3-phosphate dehydrogenase (G5L259, Putative uncharacterized protein (G7S2D6, Amino acid permease (B0M0G6 and NsuB (G5L351 were found to be implicated in biofilm formation. More importantly, we also found that azithromycin affected expression of the genes cps1/2H, cpsR and cps16F. Especially, after growth with 1/2 MIC of azithromycin and 1/4 MIC of azithromycin, the capsular polysaccharide (CP content of S. suis was significantly higher.

  8. Sub-MICs of Azithromycin Decrease Biofilm Formation of Streptococcus suis and Increase Capsular Polysaccharide Content of S. suis

    Science.gov (United States)

    Yang, Yan-Bei; Chen, Jian-Qing; Zhao, Yu-Lin; Bai, Jing-Wen; Ding, Wen-Ya; Zhou, Yong-Hui; Chen, Xue-Ying; Liu, Di; Li, Yan-Hua

    2016-01-01

    Streptococcus suis (S. suis) caused serious disease symptoms in humans and pigs. S. suis is able to form thick biofilms and this increases the difficulty of treatment. After growth with 1/2 minimal inhibitory concentration (MIC) of azithromycin, 1/4 MIC of azithromycin, or 1/8 MIC of azithromycin, biofilm formation of S. suis dose-dependently decreased in the present study. Furthermore, scanning electron microscopy analysis revealed the obvious effect of azithromycin against biofilm formation of S. suis. Especially, at two different conditions (1/2 MIC of azithromycin non-treated cells and treated cells), we carried out comparative proteomic analyses of cells by using iTRAQ technology. Finally, the results revealed the existence of 19 proteins of varying amounts. Interestingly, several cell surface proteins (such as ATP-binding cassette superfamily ATP-binding cassette transporter (G7SD52), CpsR (K0FG35), Cps1/2H (G8DTL7), CPS16F (E9NQ13), putative uncharacterized protein (G7SER0), NADP-dependent glyceraldehyde-3-phosphate dehydrogenase (G5L259), putative uncharacterized protein (G7S2D6), amino acid permease (B0M0G6), and NsuB (G5L351)) were found to be implicated in biofilm formation. More importantly, we also found that azithromycin affected expression of the genes cps1/2H, cpsR and cps16F. Especially, after growth with 1/2 MIC of azithromycin and 1/4 MIC of azithromycin, the capsular polysaccharide content of S. suis was significantly higher. PMID:27812354

  9. In-cell Western™ detection of organic cation transporters in bronchial epithelial cell layers cultured at an air-liquid interface on Transwell(®) inserts.

    Science.gov (United States)

    Mukherjee, M; Latif, M L; Pritchard, D I; Bosquillon, C

    2013-01-01

    Organic cation transporters (OCT) have been shown to mediate the transport of inhaled drugs in bronchial epithelial cells and might have important physiological functions in the airway epithelium. However, a quantitative method to evaluate OCT protein expression in physiologically relevant airway epithelial cell culture models is currently lacking. In-cell Western™ (ICW) techniques might fill that gap but to date, have only been performed on cells grown on 96 or 384-well microplates. An ICW assay was designed for measuring levels of the different OCT subtypes in intact layers of the human bronchial epithelial Calu-3 cell line cultured at an air-liquid interface on Transwell(®) inserts. Glyceraldehyde-3-phosphate dehydrogenase (GAPDH) was used as the internal standard for normalisation of cell number between the layers. The protocol was subsequently validated by exposing cell layers to compounds known to cause variations in OCT expression. Antibody signals above the background fluorescence were detected for OCT1, OCT3, OCTN1 and OCTN2 but not for OCT2 in 21day old Calu-3 layers, in agreement with previous studies which had reported OCT2 was absent in the Calu-3 cell line. Furthermore, increases in the fluorescence signal associated with OCT1, OCTN1 and OCTN2 were obtained following treatment of the layers with, respectively, the nitric oxide inducer sodium nitroprusside, the peroxisome proliferator activated receptor α (PPARα) agonist fenofibrate or the PPARγ agonist rosiglitazone, confirming the reliability of the ICW method developed. However, a suitable positive control for OCT3 could not be identified. This novel ICW assay can be exploited to quantify basal OCT protein expression as well as changes in transporter levels following external stimuli in various in vitro models. It can also be easily adapted to probe any protein in epithelial layers maintained on permeable filters. Copyright © 2013 Elsevier Inc. All rights reserved.

  10. Deep RNA-Seq profile reveals biodiversity, plant-microbe interactions and a large family of NBS-LRR resistance genes in walnut (Juglans regia) tissues.

    Science.gov (United States)

    Chakraborty, Sandeep; Britton, Monica; Martínez-García, P J; Dandekar, Abhaya M

    2016-03-01

    Deep RNA-Seq profiling, a revolutionary method used for quantifying transcriptional levels, often includes non-specific transcripts from other co-existing organisms in spite of stringent protocols. Using the recently published walnut genome sequence as a filter, we present a broad analysis of the RNA-Seq derived transcriptome profiles obtained from twenty different tissues to extract the biodiversity and possible plant-microbe interactions in the walnut ecosystem in California. Since the residual nature of the transcripts being analyzed does not provide sufficient information to identify the exact strain, inferences made are constrained to the genus level. The presence of the pathogenic oomycete Phytophthora was detected in the root through the presence of a glyceraldehyde-3-phosphate dehydrogenase. Cryptococcus, the causal agent of cryptococcosis, was found in the catkins and vegetative buds, corroborating previous work indicating that the plant surface supported the sexual cycle of this human pathogen. The RNA-Seq profile revealed several species of the endophytic nitrogen fixing Actinobacteria. Another bacterial species implicated in aerobic biodegradation of methyl tert-butyl ether (Methylibium petroleiphilum) is also found in the root. RNA encoding proteins from the pea aphid were found in the leaves and vegetative buds, while a serine protease from mosquito with significant homology to a female reproductive tract protease from Drosophila mojavensis in the vegetative bud suggests egg-laying activities. The comprehensive analysis of RNA-seq data present also unraveled detailed, tissue-specific information of ~400 transcripts encoded by the largest family of resistance (R) genes (NBS-LRR), which possibly rationalizes the resistance of the specific walnut plant to the pathogens detected. Thus, we elucidate the biodiversity and possible plant-microbe interactions in several walnut (Juglans regia) tissues in California using deep RNA-Seq profiling.

  11. Regulation of metallothionein-III (GIF) mRNA in the brain of patients with Alzheimer disease is not impaired.

    Science.gov (United States)

    Amoureux, M C; Van Gool, D; Herrero, M T; Dom, R; Colpaert, F C; Pauwels, P J

    1997-01-01

    Contradictory results have been reported on the downregulation and role of the brain-specific protein metallothionein-III (MT-III, GIF) in Alzheimer disease (AD). In this article, the importance of MT-III downregulation in AD brain was re-evaluated in temporal and frontal cortex, hippocampus, and cerebellum of 11 AD patients and two groups of five and six control subjects, respectively. Reverse transcription-polymerase chain reaction (RT-PCR) was used to quantify the levels of MT-III mRNA relative to the levels of three constitutive RNAs: beta-actin, glyceraldehyde-3-phosphate dehydrogenase (G3PDH), and ribosomal RNA 18S (rRNA 18S). The distribution of MT-III was similar to that of each of the three constitutive RNAs. The relative levels of each of these RNAs was high in brain regions examined in both AD patients and control subjects. Our findings do not support a downregulation of MT-III mRNA in the frontal cortex as well as the temporal cortex and hippocampus of AD patients. However, the level of MT-III mRNA was not constant in the investigated samples, suggesting that MT-III mRNA regulation could be controlled by factors other than AD pathology. Brain-derived neurotrophic factor (BDNF) mRNA levels were hardly detectable by RT-PCR in human brain tissue; a trend for a decrease was apparent in the temporal cortex of AD patients. In conclusion, the content of MT-III mRNA in the brain of AD patients was not detectably impaired, whereas BDNF mRNA may be affected.

  12. Effects of the peptide pheromone plantaricin A and cocultivation with Lactobacillus sanfranciscensis DPPMA174 on the exoproteome and the adhesion capacity of Lactobacillus plantarum DC400.

    Science.gov (United States)

    Calasso, Maria; Di Cagno, Raffaella; De Angelis, Maria; Campanella, Daniela; Minervini, Fabio; Gobbetti, Marco

    2013-04-01

    This study aimed at investigating the extracellular and cell wall-associated proteins (exoproteome) of Lactobacillus plantarum DC400 when cultivated on modified chemically defined medium (CDM) supplemented with the chemically synthesized pheromone plantaricin A (PlnA) or cocultured with L. plantarum DPPMA20 or Lactobacillus sanfranciscensis DPPMA174. Compared to monoculture, two-dimensional gel electrophoresis (2-DE) analysis showed that the exoproteome of L. plantarum DC400 was affected by PlnA and cocultivation with strains DPPMA20 and, especially, DPPMA174. The highest similarity of the 2-DE maps was found between DC400 cells cultivated in monoculture and in coculture with strain DPPMA20. Almost all extracellular proteins (22 spots) and cell wall-associated proteins (40 spots) which showed decreased or increased levels of synthesis during growth in CDM supplemented with PlnA and/or in coculture with strain DPPMA20 or DPPMA174 were identified. On the basis of the sequences in the Kyoto Encyclopedia of Genes and Genomes database, changes to the exoproteome concerned proteins involved in quorum sensing (QS), the transport system, stress response, carbohydrate metabolism and glycolysis, oxidation/reduction processes, the proteolytic system, amino acid metabolism, cell wall and catabolic processes, and cell shape, growth, and division. Cultivation with PlnA and cocultivation with strains DPPMA20 and, especially, DPMMA174 markedly increased the capacity of L. plantarum DC400 to form biofilms, to adhere to human Caco-2 cells, and to prevent the adhesion of potential intestinal pathogens. These phenotypic traits were in part related to oversynthesized moonlighting proteins (e.g., DnaK and GroEL, pyruvate kinase, enolase, and glyceraldehyde-3-phosphate dehydrogenase) in response to QS mechanisms and interaction with L. plantarum DPPMA20 and, especially, L. sanfranciscensis DPPMA174.

  13. Purification of arogenate dehydrogenase from Phenylobacterium immobile.

    Science.gov (United States)

    Mayer, E; Waldner-Sander, S; Keller, B; Keller, E; Lingens, F

    1985-01-07

    Phenylobacterium immobile, a bacterium which is able to degrade the herbicide chloridazon, utilizes for L-tyrosine synthesis arogenate as an obligatory intermediate which is converted in the final biosynthetic step by a dehydrogenase to tyrosine. This enzyme, the arogenate dehydrogenase, has been purified for the first time in a 5-step procedure to homogeneity as confirmed by electrophoresis. The Mr of the enzyme that consists of two identical subunits amounts to 69000 as established by gel electrophoresis after cross-linking the enzyme with dimethylsuberimidate. The Km values were 0.09 mM for arogenate and 0.02 mM for NAD+. The enzyme has a high specificity with respect to its substrate arogenate.

  14. Hybridizability of gamma-irradiated lactic dehydrogenase

    Energy Technology Data Exchange (ETDEWEB)

    Saito, M.

    1976-03-01

    The hybridizabilities of the gamma-irradiated chicken heart and pig muscle lactic dehydrogenases were estimated by hybridizing the irradiated enzymes with the unirradiated pig heart lactic dehydrogenase. The disc gel electrophoretic patterns of the inter- and intraspecific hybrids showed that the LDH activity of the pig heart isozyme band increased as a function of dose. This observation was analyzed upon the binomial redistribution pattern of the recombined subunits. The result shows that the hybridizabilities of both the chicken heart and pig muscle isozymes decreased along with the loss of catalytic activity and the release from substrate inhibition. The titration of free SH groups of the irradiated chicken isozyme suggested that the unfolding of the peptide chain destroyed the specific tertiary structure needed for the binding of subunits. (auth)

  15. Isocitrate dehydrogenase 1 and 2 mutations in cholangiocarcinoma.

    Science.gov (United States)

    Kipp, Benjamin R; Voss, Jesse S; Kerr, Sarah E; Barr Fritcher, Emily G; Graham, Rondell P; Zhang, Lizhi; Highsmith, W Edward; Zhang, Jun; Roberts, Lewis R; Gores, Gregory J; Halling, Kevin C

    2012-10-01

    Somatic mutations in isocitrate dehydrogenase 1 and 2 genes are common in gliomas and help stratify patients with brain cancer into histologic and molecular subtypes. However, these mutations are considered rare in other solid tumors. The aims of this study were to determine the frequency of isocitrate dehydrogenase 1 and 2 mutations in cholangiocarcinoma and to assess histopathologic differences between specimens with and without an isocitrate dehydrogenase mutation. We sequenced 94 formalin-fixed, paraffin-embedded cholangiocarcinoma (67 intrahepatic and 27 extrahepatic) assessing for isocitrate dehydrogenase 1 (codon 132) and isocitrate dehydrogenase 2 (codons 140 and 172) mutations. Multiple histopathologic characteristics were also evaluated and compared with isocitrate dehydrogenase 1/2 mutation status. Of the 94 evaluated specimens, 21 (22%) had a mutation including 14 isocitrate dehydrogenase 1 and 7 isocitrate dehydrogenase 2 mutations. Isocitrate dehydrogenase mutations were more frequently observed in intrahepatic cholangiocarcinoma than in extrahepatic cholangiocarcinoma (28% versus 7%, respectively; P = .030). The 14 isocitrate dehydrogenase 1 mutations were R132C (n = 9), R132S (n = 2), R132G (n = 2), and R132L (n = 1). The 7 isocitrate dehydrogenase 2 mutations were R172K (n = 5), R172M (n = 1), and R172G (n = 1). Isocitrate dehydrogenase mutations were more frequently observed in tumors with clear cell change (P < .001) and poorly differentiated histology (P = .012). The results of this study show for the first time that isocitrate dehydrogenase 1 and 2 genes are mutated in cholangiocarcinoma. The results of this study are encouraging because it identifies a new potential target for genotype-directed therapeutic trials and may represent a potential biomarker for earlier detection of cholangiocarcinoma in a subset of cases.

  16. Optimization and staining characteristic of immunohistochemical methods in detecting isocitrate dehydrogenase-1 mutations in human gliomas%免疫组化染色检测脑胶质瘤IDH1的优化及染色特点

    Institute of Scientific and Technical Information of China (English)

    黎相照; 薛小磊; 张中满; 张颖芬; 丁彦青; 韩慧霞

    2016-01-01

    Objective To compare the advantages and disadvantages of different immunohistochemical methods in detecting isocitrate dehydrogenase-1 (IDH 1) mutations in gliomas,and to optimize the processes these detection.Methods One hundred and thirty-eighty glioma specimens,collected and conformed by pathology in our hospital from January 2013 to December 2013,were used in our study,including 18 of WHO grade Ⅰ,49 of WHO grade Ⅱ,24 of WHO grade Ⅲ and 47 of WHO grade Ⅳ.Manual immunohistochemical method and automatic immunohistochemical instrument were used to detect the IDH1 mutation.PCR-high resolution melting curve analysis (PCR-HRM) was used to verify the above results.Results There were 65.9% positive specimens those had IDH1 positive tumor cells higher than 75%,and 70.7% positive specimens those were strong staining.Manual immunohistochemical method enjoyed advantages as clean background,clearness and easy reading,and no interpretation difficulty or false-positive result were noted with this method;while automatic immunohistochemical instrument enjoyed dark background,which led to interpretation difficulty or false-positive result;the results of IDH1 staining had significant differences between and automatic immunohistochemical instrument (x2=22.042,P=0.000).The positive detection rate of automatic immunohistochemical instrument was significantly higher than that of manual immunohistochemical method,and the results of IDH1 detection had no significant difference between manual immunohistochemical method and PCR-HRM (x2=0.800,P=0.371).Conclusions The results of IDH1 detection by manual immunohistochemical method are more accurate than that of immunohistochemical instrument.IDH1 gene mutation only has a relationship with the number of positive tumor cells,and not the staining intensity.The specimen can be considered to IDH1 gene mutation when the positive cells are more than 5%.%目的 比较胶质瘤中异柠檬酸脱氢酶-1(IDH1)不同检测方法的优

  17. Structure of a bacterial enzyme regulated by phosphorylation, isocitrate dehydrogenase.

    OpenAIRE

    1989-01-01

    The structure of isocitrate dehydrogenase [threo-DS-isocitrate: NADP+ oxidoreductase (decarboxylating), EC 1.1.1.42] from Escherichia coli has been solved and refined at 2.5 A resolution and is topologically different from that of any other dehydrogenase. This enzyme, a dimer of identical 416-residue subunits, is inactivated by phosphorylation at Ser-113, which lies at the edge of an interdomain pocket that also contains many residues conserved between isocitrate dehydrogenase and isopropylma...

  18. Malate dehydrogenase: a model for structure, evolution, and catalysis.

    OpenAIRE

    1994-01-01

    Malate dehydrogenases are widely distributed and alignment of the amino acid sequences show that the enzyme has diverged into 2 main phylogenetic groups. Multiple amino acid sequence alignments of malate dehydrogenases also show that there is a low degree of primary structural similarity, apart from in several positions crucial for nucleotide binding, catalysis, and the subunit interface. The 3-dimensional structures of several malate dehydrogenases are similar, despite their low amino acid s...

  19. Hemoglobin interacting proteins and implications of spectrin hemoglobin interaction.

    Science.gov (United States)

    Basu, Avik; Chakrabarti, Abhijit

    2015-10-14

    In this report we have analyzed interacting partners of hemoglobin inside erythrocyte and sought possible implications of hemoglobin-spectrin interaction. Our list of identified cytosolic hemoglobin interacting proteins includes redox regulators like peroxiredoxin-2, Cu-Zn superoxide dismutase, catalase, aldehyde dehydrogenase-1, flavin reductase and chaperones like HSP70, α-hemoglobin stabilizing protein. Others include metabolic enzymes like carbonic anhydrase-1, selenium binding protein-1, purine nucleoside phosphorylase and nucleoside diphosphate kinase. Additionally, various membrane proteins like α and β spectrin, ankyrin, band3, protein4.1, actin and glyceraldehyde 3 phosphate dehydrogenase have been shown to interact with hemoglobin. Our result indicates that major membrane skeleton protein spectrin, that also has a chaperone like activity, helps to fold the unstable alpha-globin chains in vitro. Taken together our results could provide insight into a protein network evolved around hemoglobin molecule inside erythrocyte that may add a new perspective in understanding the hemoglobin function and homeostasis.

  20. Proteomic Analysis of the Response of Liangyoupeijiu (Super High-Yield Hybrid Rice) Seedlings to Cold Stress

    Institute of Scientific and Technical Information of China (English)

    Ping-Fang Yang; Xiao-Juan Li; Yu Liang; Yu-Xiang Jing; Shi-Hua Shen; Ting-Yun Kuang

    2006-01-01

    Liangyoupeijiu is a super high-yield hybrid rice. Despite its advantages with respect to yield and grain quality, it is sensitive to cold, which keeps it from being widely cultivated. We subjected Liangyoupeijiu seedlings to 4 ℃ cold treatment, then extracted the leaf proteins. After 2-D gel electrophoresis separation and matrix-assisted laser desorption/ionization time-of-flight mass spectrometry analysis, a series of differentially displayed proteins were identified. Some metabolism-associated proteins were found among the downregulated proteins, such as carbamoyl phosphate synthetase, transketolase 1, dihydrolipoamide dehydrogenase and glyceraldehyde 3-phosphate dehydrogenase. The upregulated proteins included both stress-resistance proteins such as nucleoside diphosphate kinase Ⅰ and proteins that are negative for rice growth, such as FtsH-like protein, plastid fusion and/or translocation factor (Pftf) and actin. Our results indicate that cold may inhibit Liangyoupeijiu growth through decreasing metabolic activity and damaging cell structure.

  1. Dicty_cDB: CFG167 [Dicty_cDB

    Lifescience Database Archive (English)

    Full Text Available DNA clone NF077B10DT 5', mRNA sequence. 44 3e-18 5 BU495005 |BU495005.1 PfESToab82g05.y1 Plasmodium falciparum 3D7 asexual...YDROGENASE ;, mRNA sequence. 72 4e-17 3 BU496632 |BU496632.1 PfESToab52g07.y1 Plasmodium falciparum 3D7 asexual...-3-PHOSPHATE DEHYDROGENASE ;, mRNA sequence. 72 5e-17 3 BI670607 |BI670607.1 PfESToaa02a07.y1 Plasmodium falciparum 3D7 asexual...1 Plasmodium falciparum 3D7 asexual cDNA Plasmodium falciparum cDNA 5' similar to TR:O96369 O96369 GLYCERALD...EHYDE-3-PHOSPHATE DEHYDROGENASE ;, mRNA sequence. 72 7e-17 3 BI815601 |BI815601.1 PfESToaa30e06.y1 Plasmodium falciparum 3D7 asexual

  2. 21 CFR 862.1500 - Malic dehydrogenase test system.

    Science.gov (United States)

    2010-04-01

    ... plasma. Malic dehydrogenase measurements are used in the diagnosis and treatment of muscle and liver diseases, myocardial infarctions, cancer, and blood disorders such as myelogenous (produced in the...

  3. Placental glucose dehydrogenase polymorphism in Koreans.

    Science.gov (United States)

    Kim, Y J; Paik, S G; Park, H Y

    1994-12-01

    The genetic polymorphism of placental glucose dehydrogenase (GDH) was investigated in 300 Korean placentae using horizontal starch gel electrophoresis. The allele frequencies for GDH1, GDH2 and GDH3 were 0.537, 0.440 and 0.005, respectively, which were similar to those in Japanese. We also observed an anodal allele which was similar to the GDH4 originally reported in Chinese populations at a low frequency of 0.015. An additional new cathodal allele (named GDH6) was observed in the present study with a very low frequency of 0.003.

  4. A polymorphic variant in the human electron transfer flavoprotein alpha-chain (alpha-T171) displays decreased thermal stability and is overrepresented in very-long-chain acyl-CoA dehydrogenase-deficient patients with mild childhood presentation

    DEFF Research Database (Denmark)

    Bross, P; Pedersen, P; Nyholm, M;

    1999-01-01

    The consequences of two amino acid polymorphisms of human electron transfer flavoprotein (alpha-T/I171 in the alpha-subunit and beta-M/T154 in the beta-subunit) on the thermal stability of the enzyme are described. The alpha-T171 variant displayed a significantly decreased thermal stability...... thermal stability) was significantly overrepresented. Subgrouping of the VLCAD patients into three phenotypic classes (severe childhood, mild childhood, and adult presentation) revealed that the overrepresentation of the alpha-T171 variant was significant only in patients with mild childhood presentation...

  5. Molecular determinants of the cofactor specificity of ribitol dehydrogenase, a short-chain dehydrogenase/reductase

    DEFF Research Database (Denmark)

    Moon, Hee-Jung; Tiwari, Manish Kumar; Singh, Ranjitha;

    2012-01-01

    Ribitol dehydrogenase from Zymomonas mobilis (ZmRDH) catalyzes the conversion of ribitol to d-ribulose and concomitantly reduces NAD(P)(+) to NAD(P)H. A systematic approach involving an initial sequence alignment-based residue screening, followed by a homology model-based screening and site...

  6. Identity of the subunits and the stoicheiometry of prosthetic groups in trimethylamine dehydrogenase and dimethylamine dehydrogenase.

    Science.gov (United States)

    Kasprzak, A A; Papas, E J; Steenkamp, D J

    1983-01-01

    Trimethylamine dehydrogenases from bacterium W3A1 and Hyphomicrobium X and the dimethylamine dehydrogenase from Hyphomicrobium X were found to contain only one kind of subunit. The millimolar absorption coefficient of a single [4Fe-4S] cluster in trimethylamine dehydrogenase from bacterium W3A1 was estimated to be 14.8 mM-1 . cm-1 at 443 nm. From this value a 1:1 stoicheiometry of the prosthetic groups, 6-S-cysteinyl-FMN and the [4Fe-4S] cluster, was established. Millimolar absorption coefficients of the three enzymes were in the range 49.4-58.7 mM-1 . cm-1 at approx. 440 nm. This range of values is consistent with the presence of two [4Fe-4S] clusters and two flavin residues, for which the millimolar absorption coefficient had earlier been found to be 12.3 mM-1 . cm-1 at 437 nm. The N-terminal amino acid was alanine in each of the three enzymes. Sequence analysis of the first 15 residues from the N-terminus of dimethylamine dehydrogenase indicated a single unique sequence. Two identical subunits, each containing covalently bound 6-S-cysteinyl-FMN and a [4Fe-4S] cluster, in each of the enzymes are therefore indicated. Images Fig. 1. PMID:6882357

  7. Daidzin inhibits mitochondrial aldehyde dehydrogenase and suppresses ethanol intake of Syrian golden hamsters

    OpenAIRE

    Keung, Wing Ming; Klyosov, Anatole A; Vallee, Bert L.

    1997-01-01

    Daidzin is the major active principle in extracts of radix puerariae, a traditional Chinese medication that suppresses the ethanol intake of Syrian golden hamsters. It is the first isoflavone recognized to have this effect. Daidzin is also a potent and selective inhibitor of human mitochondrial aldehyde dehydrogenase (ALDH-2). To establish a link between these two activities, we have tested a series of synthetic structural analogs of daidzin. The results demonstrate a direct correlation betwe...

  8. Triazole inhibitors of Cryptosporidium parvum inosine 5′-monophosphate dehydrogenase

    OpenAIRE

    Maurya, Sushil K.; Gollapalli, Deviprasad R.; Kirubakaran, Sivapriya; Zhang, Minjia; Johnson, Corey R.; Benjamin, Nicole N.; Hedstrom, Lizbeth; Gregory D Cuny

    2009-01-01

    Cryptosporidium parvum is an important human pathogen and potential bioterrorism agent. This protozoan parasite cannot salvage guanine or guanosine and therefore relies on inosine 5′-monophosphate dehydrogenase (IMPDH) for biosynthesis of guanine nucleotides and hence for survival. Since C. parvum IMPDH is highly divergent from the host counterpart, selective inhibitors could potentially be used to treat cryptosporidiosis with minimal effects on its mammalian host. A series of 1,2,3-triazole ...

  9. Purification of methanol dehydrogenase from mouth methylotrophic bacteria of tropical region

    OpenAIRE

    Waturangi, D.; Marko, N.; M. T. Suhartono2)

    2011-01-01

    Aims: Purification of methanol dehydrogenase (MDH) from methylotrophic bacteria was conducted to obtain pure enzyme for further research and industrial applications due to the enzyme’s unique activity that catalyzes oxidation of methanol as an important carbon source in methylotrophic bacteria.Methodology and Results: The enzyme was screened from methylotrophic bacteria isolated from human mouth. Purification of this enzyme was conducted using ammonium sulphate precipitation followed by catio...

  10. Structure and Function of Lactate Dehydrogenase from Hagfish

    Directory of Open Access Journals (Sweden)

    Mitsumasa Okada

    2010-03-01

    Full Text Available The lactate dehydrogenases (LDHs in hagfish have been estimated to be the prototype of those in higher vertebrates. The effects of high hydrostatic pressure from 0.1 to 100 MPa on LDH activities from three hagfishes were examined. The LDH activities of Eptatretus burgeri, living at 45–60 m, were completely lost at 5 MPa. In contrast, LDH-A and -B in Eptatretus okinoseanus maintained 70% of their activities even at 100 MPa. These results show that the deeper the habitat, the higher the tolerance to pressure. To elucidate the molecular mechanisms for adaptation to high pressure, we compared the amino acid sequences and three-dimensional structures of LDHs in these hagfish. There were differences in six amino acids (6, 10, 20, 156, 269, and 341. These amino acidresidues are likely to contribute to the stability of the E. okinoseanus LDH under high-pressure conditions. The amino acids responsible for the pressure tolerance of hagfish are the same in both human and hagfish LDHs, and one substitution that occurred as an adaptation during evolution is coincident with that observed in a human disease. Mutation of these amino acids can cause anomalies that may be implicated in the development of human diseases.

  11. Transcriptional Regulation of Pyruvate Dehydrogenase Kinase

    Directory of Open Access Journals (Sweden)

    Ji Yun Jeong

    2012-10-01

    Full Text Available The pyruvate dehydrogenase complex (PDC activity is crucial to maintains blood glucose and ATP levels, which largely depends on the phosphorylation status by pyruvate dehydrogenase kinase (PDK isoenzymes. Although it has been reported that PDC is phosphorylated and inactivated by PDK2 and PDK4 in metabolically active tissues including liver, skeletal muscle, heart, and kidney during starvation and diabetes, the precise mechanisms by which expression of PDK2 and PDK4 are transcriptionally regulated still remains unclear. Insulin represses the expression of PDK2 and PDK4 via phosphorylation of FOXO through PI3K/Akt signaling pathway. Several nuclear hormone receptors activated due to fasting or increased fat supply, including peroxisome proliferator-activated receptors, glucocorticoid receptors, estrogen-related receptors, and thyroid hormone receptors, also participate in the up-regulation of PDK2 and PDK4; however, the endogenous ligands that bind those nuclear receptors have not been identified. It has been recently suggested that growth hormone, adiponectin, epinephrine, and rosiglitazone also control the expression of PDK4 in tissue-specific manners. In this review, we discuss several factors involved in the expressional regulation of PDK2 and PDK4, and introduce current studies aimed at providing a better understanding of the molecular mechanisms that underlie the development of metabolic diseases such as diabetes.

  12. The activity of class I, II, III and IV of alcohol dehydrogenase (ADH) isoenzymes and aldehyde dehydrogenase (ALDH) in brain cancer.

    Science.gov (United States)

    Laniewska-Dunaj, Magdalena; Jelski, Wojciech; Orywal, Karolina; Kochanowicz, Jan; Rutkowski, Robert; Szmitkowski, Maciej

    2013-07-01

    The brain being highly sensitive to the action of alcohol is potentially susceptible to its carcinogenic effects. Alcohol dehydrogenase (ADH) and aldehyde dehydrogenase (ALDH) are the main enzymes involved in ethanol metabolism, which leads to the generation of carcinogenic acetaldehyde. Human brain tissue contains various ADH isoenzymes and possess also ALDH activity. The purpose of this study was to compare the capacity for ethanol metabolism measured by ADH isoenzymes and ALDH activity in cancer tissues and healthy brain cells. The samples were taken from 62 brain cancer patients (36 glioblastoma, 26 meningioma). For the measurement of the activity of class I and II ADH isoenzymes and ALDH activity, the fluorometric methods were used. The total ADH activity and activity of class III and IV isoenzymes were measured by the photometric method. The total activity of ADH, and activity of class I ADH were significantly higher in cancer cells than in healthy tissues. The other tested classes of ADH and ALDH did not show statistically significant differences of activity in cancer and in normal cells. Analysis of the enzymes activity did not show significant differences depending on the location of the tumor. The differences in the activity of total alcohol dehydrogenase, and class I isoenzyme between cancer tissues and healthy brain cells might be a factor for metabolic changes and disturbances in low mature cancer cells and additionally might be a reason for higher level of acetaldehyde which can intensify the carcinogenesis.

  13. Studies on the structure and function of pyruvate dehydrogenase complexes

    NARCIS (Netherlands)

    Abreu, de R.A.

    1978-01-01

    The aim of the present investigation was to obtain more information of the structure and function of the pyruvate dehydrogenase complexes from Azotobacter vinelandii and Escherichia coli.In chapter 2 a survey is given of the recent literature on pyruvate dehydrogenase complexes.In chapter 3 results

  14. Erythrocyte glucose-6-phosphate dehydrogenase from Brazilian opossum Didelphis marsupialis

    Directory of Open Access Journals (Sweden)

    Barretto O.C. de O.

    2006-01-01

    Full Text Available In a comparative study of erythrocyte metabolism of vertebrates, the specific activity of glucose-6-phosphate dehydrogenase (G6PD of the Brazilian opossum Didelphis marsupialis in a hemolysate was shown to be high, 207 ± 38 IU g-1 Hb-1 min-1 at 37ºC, compared to the human erythrocyte activity of 12 ± 2 IU g-1 Hb-1 min-1 at 37ºC. The apparent high specific activity of the mixture led us to investigate the physicochemical properties of the opossum enzyme. We report that reduced glutathione (GSH in the erythrocytes was only 50% higher than in human erythrocytes, a value lower than expected from the high G6PD activity since GSH is maintained in a reduced state by G6PD activity. The molecular mass, determined by G-200 Sephadex column chromatography at pH 8.0, was 265 kDa, which is essentially the same as that of human G6PD (260 kDa. The Michaelis-Menten constants (Km: 55 µM for glucose-6-phosphate and nicotinamide adenine dinucleotide phosphate (Km: 3.3 µM were similar to those of the human enzyme (Km: 50-70 and Km: 2.9-4.4, respectively. A 450-fold purification of the opossum enzyme was achieved and the specific activity of the purified enzyme, 90 IU/mg protein, was actually lower than the 150 IU/mg protein observed for human G6PD. We conclude that G6PD after purification from the hemolysate of D. marsupialis does not have a high specific activity. Thus, it is quite probable that the red cell hyperactivity reported may be explained by increased synthesis of G6PD molecules per unit of hemoglobin or to reduced inactivation in the RBC hemolysate.

  15. X-ray crystal structure and small-angle X-ray scattering of sheep liver sorbitol dehydrogenase

    DEFF Research Database (Denmark)

    Yennawar, Hemant; Møller, Magda; Gillilan, Richard;

    2011-01-01

    The X-ray crystal structure of sheep liver sorbitol dehydrogenase (slSDH) has been determined using the crystal structure of human sorbitol dehydrogenase (hSDH) as a molecular-replacement model. slSDH crystallized in space group I222 with one monomer in the asymmetric unit. A conserved tetramer...... the substrate-binding pocket together with the acetate designed by nature to fit large polyol substrates. The substrate-binding pocket is seen to be in close proximity to the tetramer interface, which explains the need for the structural integrity of the tetramer for enzyme activity. Small-angle X...

  16. INFLUENCE OF SELECTED PHARMACEUTICALS ON ACTIVATED SLUDGE DEHYDROGENASE ACTIVITY

    Directory of Open Access Journals (Sweden)

    Agnieszka Tomska

    2016-06-01

    The aim of this work was to evaluate the effect of selected antibiotics - sulfanilamide and erythromycin on activated sludge dehydrogenase activity with use of trifenyltetrazolinum chloride (TTC test. Dehydrogenases activity is an indicator of biochemical activity of microorganisms present in activated sludge or the ability to degrade organic compounds in waste water. TTC test is particularly useful for the regularity of the course of treatment, in which the presence of inhibitors of biochemical reactions and toxic compounds are present. It was observed that the dehydrogenase activity decreases with the increase of a antibiotics concentration. The lowest value of the dehydrogenase activity equal to 32.4 μmol TF / gMLSS obtained at sulfanilamide concentration 150mg / l. For this sample, an inhibition of dehydrogenase activity was 31%.

  17. Retinol Dehydrogenases Regulate Vitamin A Metabolism for Visual Function

    Directory of Open Access Journals (Sweden)

    Bhubanananda Sahu

    2016-11-01

    Full Text Available The visual system produces visual chromophore, 11-cis-retinal from dietary vitamin A, all-trans-retinol making this vitamin essential for retinal health and function. These metabolic events are mediated by a sequential biochemical process called the visual cycle. Retinol dehydrogenases (RDHs are responsible for two reactions in the visual cycle performed in retinal pigmented epithelial (RPE cells, photoreceptor cells and Müller cells in the retina. RDHs in the RPE function as 11-cis-RDHs, which oxidize 11-cis-retinol to 11-cis-retinal in vivo. RDHs in rod photoreceptor cells in the retina work as all-trans-RDHs, which reduce all-trans-retinal to all-trans-retinol. Dysfunction of RDHs can cause inherited retinal diseases in humans. To facilitate further understanding of human diseases, mouse models of RDHs-related diseases have been carefully examined and have revealed the physiological contribution of specific RDHs to visual cycle function and overall retinal health. Herein we describe the function of RDHs in the RPE and the retina, particularly in rod photoreceptor cells, their regulatory properties for retinoid homeostasis and future therapeutic strategy for treatment of retinal diseases.

  18. Metabolism of the novel IMP dehydrogenase inhibitor benzamide riboside.

    Science.gov (United States)

    Jäger, Walter; Salamon, Alexandra; Szekeres, Thomas

    2002-04-01

    Benzamide riboside (BR) is a novel anticancer agent exhibiting pronounced activity against several human tumor cell lines via the inhibition of inosine 5'-monophosphate dehydrogenase (IMPDH) that catalyzes the formation of xanthine 5'-monophosphate from inosine 5'-monophosphate and nicotinamide adenine dinucleotide, thereby restricting the biosynthesis of guanylates. Phosphorylation of BR to its 5'-monophosphate derivative appears to be ubiquitous in most cells catalyzed by the enzymes, adenosine kinase, nicotinamide nucleoside kinase and 5' nucleotidase. BR 5'-monophosphate is then converted to the active metabolite benzamide adenine dinucleotide (BAD) by NMN adenylyltransferase, the rate-limiting enzyme in the biosynthesis of NAD. As BAD is more potent in the inhibition of IMPDH than BR and BR 5'-monophosphate, cytotoxicity of BR is closely connected with intercellular metabolism to BAD. However, intracellular BAD level is also affected by BADase activity, a phosphodiesterase which hydrolyzes BAD to BR-5'-monophosphate and AMP. A recent study demonstrates enzymatic deamination of BR to non-cytotoxic benzene carboxylic acid (BR-COOH) as the main hepatic BR biotransformation product in rat liver. As the IMPDH inhibitors tiazofurin and ribavirin exhibit predominant accumulation and biotransformation in liver, hepatic metabolism may be an important factor also for BR activation and inactivation and should be considered in human liver during cancer therapy when BR is used as a single drug or in combination with other anticancer agents.

  19. The role of glutamate dehydrogenase in mammalian ammonia metabolism.

    Science.gov (United States)

    Spanaki, Cleanthe; Plaitakis, Andreas

    2012-01-01

    Glutamate dehydrogenase (GDH) catalyzes the reversible inter-conversion of glutamate to α-ketoglutarate and ammonia. High levels of GDH activity is found in mammalian liver, kidney, brain, and pancreas. In the liver, GDH reaction appears to be close-to-equilibrium, providing the appropriate ratio of ammonia and amino acids for urea synthesis in periportal hepatocytes. In addition, GDH produces glutamate for glutamine synthesis in a small rim of pericentral hepatocytes. Hence, hepatic GDH can be either a source for ammonia or an ammonia scavenger. In the kidney, GDH function produces ammonia from glutamate to control acidosis. In the human, the presence of two differentially regulated isoforms (hGDH1 and hGDH2) suggests a complex role for GDH in ammonia homeostasis. Whereas hGDH1 is sensitive to GTP inhibition, hGDH2 has dissociated its function from GTP control. Furthermore, hGDH2 shows a lower optimal pH than hGDH1. The hGDH2 enzyme is selectively expressed in human astrocytes and Sertoli cells, probably facilitating metabolic recycling processes essential for their supportive role. Here, we report that hGDH2 is also expressed in the epithelial cells lining the convoluted tubules of the renal cortex. As hGDH2 functions more efficiently under acidotic conditions without the operation of the GTP energy switch, its presence in the kidney may increase the efficacy of the organ to maintain acid base equilibrium.

  20. Enantiocomplementary Yarrowia lipolytica Oxidoreductases: Alcohol Dehydrogenase 2 and Short Chain Dehydrogenase/Reductase

    Directory of Open Access Journals (Sweden)

    Margit Winkler

    2013-08-01

    Full Text Available Enzymes of the non-conventional yeast Yarrowia lipolytica seem to be tailor-made for the conversion of lipophilic substrates. Herein, we cloned and overexpressed the Zn-dependent alcohol dehydrogenase ADH2 from Yarrowia lipolytica in Escherichia coli. The purified enzyme was characterized in vitro. The substrate scope for YlADH2 mediated oxidation and reduction was investigated spectrophotometrically and the enzyme showed a broader substrate range than its homolog from Saccharomyces cerevisiae. A preference for secondary compared to primary alcohols in oxidation direction was observed for YlADH2. 2-Octanone was investigated in reduction mode in detail. Remarkably, YlADH2 displays perfect (S-selectivity and together with a highly (R-selective short chain dehydrogenase/ reductase from Yarrowia lipolytica it is possible to access both enantiomers of 2-octanol in >99% ee with Yarrowia lipolytica oxidoreductases.

  1. Fast internal dynamics in alcohol dehydrogenase

    Energy Technology Data Exchange (ETDEWEB)

    Monkenbusch, M.; Stadler, A., E-mail: a.stadler@fz-juelich.de; Biehl, R.; Richter, D. [Jülich Centre for Neutron Science JCNS and Institute for Complex Systems ICS, Forschungszentrum Jülich GmbH, 52425 Jülich (Germany); Ollivier, J. [Institut Laue-Langevin, CS 20156, 38042 Grenoble (France); Zamponi, M. [Jülich Centre for Neutron Science JCNS, Forschungszentrum Jülich GmbH, Outstation at MLZ, Lichtenbergstraße 1, 85747 Garching (Germany)

    2015-08-21

    Large-scale domain motions in alcohol dehydrogenase (ADH) have been observed previously by neutron spin-echo spectroscopy (NSE). We have extended the investigation on the dynamics of ADH in solution by using high-resolution neutron time-of-flight (TOF) and neutron backscattering (BS) spectroscopy in the incoherent scattering range. The observed hydrogen dynamics were interpreted in terms of three mobility classes, which allowed a simultaneous description of the measured TOF and BS spectra. In addition to the slow global protein diffusion and domain motions observed by NSE, a fast internal process could be identified. Around one third of the protons in ADH participate in the fast localized diffusive motion. The diffusion coefficient of the fast internal motions is around two third of the value of the surrounding D{sub 2}O solvent. It is tempting to associate the fast internal process with solvent exposed amino acid residues with dangling side chains.

  2. Fast internal dynamics in alcohol dehydrogenase

    Science.gov (United States)

    Monkenbusch, M.; Stadler, A.; Biehl, R.; Ollivier, J.; Zamponi, M.; Richter, D.

    2015-08-01

    Large-scale domain motions in alcohol dehydrogenase (ADH) have been observed previously by neutron spin-echo spectroscopy (NSE). We have extended the investigation on the dynamics of ADH in solution by using high-resolution neutron time-of-flight (TOF) and neutron backscattering (BS) spectroscopy in the incoherent scattering range. The observed hydrogen dynamics were interpreted in terms of three mobility classes, which allowed a simultaneous description of the measured TOF and BS spectra. In addition to the slow global protein diffusion and domain motions observed by NSE, a fast internal process could be identified. Around one third of the protons in ADH participate in the fast localized diffusive motion. The diffusion coefficient of the fast internal motions is around two third of the value of the surrounding D2O solvent. It is tempting to associate the fast internal process with solvent exposed amino acid residues with dangling side chains.

  3. Novel Diketopiperazine Dihydroorotate Dehydrogenase Inhibitors Purified from Traditional Tibetan Animal Medicine Osteon Myospalacem Baileyi.

    Science.gov (United States)

    Jiang, Lei; Wen, Huaixiu; Shao, Yun; Yu, Ruitao; Liu, Zenggen; Wang, Shuo; Wang, Qilan; Zhao, Xiaohui; Zhang, Peng; Tao, Yanduo; Mei, Lijuan

    2015-10-01

    Traditional Tibetan medicine provides an abundant source of knowledge on human ailments and their treatment. As such, it is necessary to explore their active single compounds used to treat these ailments to discover lead compounds with good pharmacologic properties. In this present work, animal medicine, Osteon Myospalacem Baileyi extracts have been separated using a two-dimensional preparative chromatographic method to obtain single compounds with high purity as part of the following pharmacological research. Five high-purity cyclic dipeptides from chromatography work were studied for their dihydroorotate dehydrogenase inhibitory activity on recombinant human dihydroorotate dehydrogenase enzyme and compound Fr. 1-4 was found to contain satisfying inhibition activity. The molecular modeling study suggests that the active compound Fr. 1-4 may have a teriflunomide-like binding mode. Then, the energy decomposition study suggests that the hydrogen bond between Fr. 1-4 and Arg136 can improve the binding mode to indirectly increase the van der Waals binding energy. All the results above together come to the conclusion that the 2, 5-diketopiperazine structure group can interact with the polar residues well in the active pocket using electrostatic power. If some proper hydrophobic groups can be added to the sides of the 2, 5-diketopiperazine group, it is believed that better 2, 5-diketopiperazine dihydroorotate dehydrogenase inhibitors will be found in the future.

  4. Variants of glycerol dehydrogenase having D-lactate dehydrogenase activity and uses thereof

    Energy Technology Data Exchange (ETDEWEB)

    Wang, Qingzhao; Shanmugam, Keelnatham T.; Ingram, Lonnie O' Neal

    2017-08-29

    The present invention provides methods of designing and generating glycerol dehydrogenase (GlyDH) variants that have altered function as compared to a parent polypeptide. The present invention further provides nucleic acids encoding GlyDH polypeptide variants having altered function as compared to the parent polypeptide. Host cells comprising polynucleotides encoding GlyDH variants and methods of producing lactic acids are also provided in various aspects of the invention.

  5. Pro-haloacetate Nanoparticles for Efficient Cancer Therapy via Pyruvate Dehydrogenase Kinase Modulation

    Science.gov (United States)

    Misra, Santosh K.; Ye, Mao; Ostadhossein, Fatemeh; Pan, Dipanjan

    2016-06-01

    Anticancer agents based on haloacetic acids are developed for inhibition of pyruvate dehydrogenase kinase (PDK), an enzyme responsible for reversing the suppression of mitochondria-dependent apoptosis. Through molecular docking studies mono- and dihaloacetates are identified as potent PDK2 binders and matched their efficiency with dichloroacetic acid. In silico screening directed their conversion to phospholipid prodrugs, which were subsequently self-assembled to pro-haloacetate nanoparticles. Following a thorough physico-chemical characterization, the functional activity of these novel agents was established in wide ranges of human cancer cell lines in vitro and in vivo in rodents. Results indicated that the newly explored PDK modulators can act as efficient agent for cancer regression. A Pyruvate dehydrogenase (PDH) assay mechanistically confirmed that these agents trigger their activity through the mitochondria-dependent apoptosis.

  6. Multiple alcohol dehydrogenases but no functional acetaldehyde dehydrogenase causing excessive acetaldehyde production from ethanol by oral streptococci.

    Science.gov (United States)

    Pavlova, Sylvia I; Jin, Ling; Gasparovich, Stephen R; Tao, Lin

    2013-07-01

    Ethanol consumption and poor oral hygiene are risk factors for oral and oesophageal cancers. Although oral streptococci have been found to produce excessive acetaldehyde from ethanol, little is known about the mechanism by which this carcinogen is produced. By screening 52 strains of diverse oral streptococcal species, we identified Streptococcus gordonii V2016 that produced the most acetaldehyde from ethanol. We then constructed gene deletion mutants in this strain and analysed them for alcohol and acetaldehyde dehydrogenases by zymograms. The results showed that S. gordonii V2016 expressed three primary alcohol dehydrogenases, AdhA, AdhB and AdhE, which all oxidize ethanol to acetaldehyde, but their preferred substrates were 1-propanol, 1-butanol and ethanol, respectively. Two additional dehydrogenases, S-AdhA and TdhA, were identified with specificities to the secondary alcohol 2-propanol and threonine, respectively, but not to ethanol. S. gordonii V2016 did not show a detectable acetaldehyde dehydrogenase even though its adhE gene encodes a putative bifunctional acetaldehyde/alcohol dehydrogenase. Mutants with adhE deletion showed greater tolerance to ethanol in comparison with the wild-type and mutant with adhA or adhB deletion, indicating that AdhE is the major alcohol dehydrogenase in S. gordonii. Analysis of 19 additional strains of S. gordonii, S. mitis, S. oralis, S. salivarius and S. sanguinis showed expressions of up to three alcohol dehydrogenases, but none showed detectable acetaldehyde dehydrogenase, except one strain that showed a novel ALDH. Therefore, expression of multiple alcohol dehydrogenases but no functional acetaldehyde dehydrogenase may contribute to excessive production of acetaldehyde from ethanol by certain oral streptococci.

  7. Cell wall-associated malate dehydrogenase activity from maize roots.

    Science.gov (United States)

    Hadži-Tašković Šukalović, Vesna; Vuletić, Mirjana; Marković, Ksenija; Vučinić, Zeljko

    2011-10-01

    Isolated cell walls from maize (Zea mays L.) roots exhibited ionically and covalently bound NAD-specific malate dehydrogenase activity. The enzyme catalyses a rapid reduction of oxaloacetate and much slower oxidation of malate. The kinetic and regulatory properties of the cell wall enzyme solubilized with 1M NaCl were different from those published for soluble, mitochondrial or plasma membrane malate dehydrogenase with respect to their ATP, Pi, and pH dependence. Isoelectric focusing of ionically-bound proteins and specific staining for malate dehydrogenase revealed characteristic isoforms present in cell wall isolate, different from those present in plasma membranes and crude homogenate. Much greater activity of cell wall-associated malate dehydrogenase was detected in the intensively growing lateral roots compared to primary root with decreased growth rates. Presence of Zn(2+) and Cu(2+) in the assay medium inhibited the activity of the wall-associated malate dehydrogenase. Exposure of maize plants to excess concentrations of Zn(2+) and Cu(2+) in the hydroponic solution inhibited lateral root growth, decreased malate dehydrogenase activity and changed isoform profiles. The results presented show that cell wall malate dehydrogenase is truly a wall-bound enzyme, and not an artefact of cytoplasmic contamination, involved in the developmental processes, and detoxification of heavy metals.

  8. External NAD(P)H dehydrogenases in Acanthamoeba castellanii mitochondria.

    Science.gov (United States)

    Antos-Krzeminska, Nina; Jarmuszkiewicz, Wieslawa

    2014-09-01

    The mitochondrial respiratory chain of plants and some fungi contains multiple rotenone-insensitive NAD(P)H dehydrogenases, of which at least two are located on the outer surface of the inner membrane (i.e., external NADH and external NADPH dehydrogenases). Annotated sequences of the putative alternative NAD(P)H dehydrogenases of the protozoan Acanthamoeba castellanii demonstrated similarity to plant and fungal sequences. We also studied activity of these dehydrogenases in isolated A. castellanii mitochondria. External NADPH oxidation was observed for the first time in protist mitochondria. The coupling parameters were similar for external NADH oxidation and external NADPH oxidation, indicating similar efficiencies of ATP synthesis. Both external NADH oxidation and external NADPH oxidation had an optimal pH of 6.8 independent of relevant ubiquinol-oxidizing pathways, the cytochrome pathway or a GMP-stimulated alternative oxidase. The maximal oxidizing activity with external NADH was almost double that with external NADPH. However, a lower Michaelis constant (K(M)) value for external NADPH oxidation was observed compared to that for external NADH oxidation. Stimulation by Ca(2+) was approximately 10 times higher for external NADPH oxidation, while NADH dehydrogenase(s) appeared to be slightly dependent on Ca(2+). Our results indicate that external NAD(P)H dehydrogenases similar to those in plant and fungal mitochondria function in mitochondria of A. castellanii.

  9. New recombinant bacterium comprises a heterologous gene encoding glycerol dehydrogenase and/or an up-regulated native gene encoding glycerol dehydrogenase, useful for producing ethanol

    DEFF Research Database (Denmark)

    2010-01-01

    from Geobacillus. It is selected from SEQ ID NO. 1-17. Sequences not defined here may be found at ftp://ftp.wipo.int/pub/publishedpctsequences/publication. The heterologous gene encoding glycerol dehydrogenase has been incorporated into the chromosome of the bacterium, or is inserted into a lactate...... glycerol dehydrogenase; and/or (ii) up-regulating a native gene encoding glycerol dehydrogenase; and (b) obtaining the recombinant bacterium. Preferred Bacterium: In the recombinant bacterium above, the inserted heterologous gene and/or the up-regulated native gene is encoding a glycerol dehydrogenase...... selected from glycerol dehydrogenase (E.C 1.1.1.6); glycerol dehydrogenase (NADP(+)) (E.C. 1.1.1.72); glycerol 2-dehydrogenase (NADP(+)) (E.C. 1.1.1.156); and glycerol dehydrogenase (acceptor) (E.C. 1.1.99.22). The heterologous gene encoding a glycerol dehydrogenase is derived from Thermotoga or is derived...

  10. Priapism and glucose-6-phosphate dehydrogenase deficiency: An underestimated correlation?

    Directory of Open Access Journals (Sweden)

    Aldo Franco De Rose

    2016-10-01

    Full Text Available Priapism is a rare clinical condition characterized by a persistent erection unrelated to sexual excitement. Often the etiology is idiopathic. Three cases of priapism in glucose-6-phosphate dehydrogenase (G6PD deficiency patients have been described in literature. We present the case of a 39-year-old man with glucose- 6-phosphate dehydrogenase deficiency, who reached out to our department for the arising of a non-ischemic priapism without arteriolacunar fistula. We suggest that the glucose-6-phosphate dehydrogenase deficiency could be an underestimated risk factor for priapism.

  11. Targeting 6-phosphogluconate dehydrogenase in the oxidative PPP sensitizes leukemia cells to antimalarial agent dihydroartemisinin.

    Science.gov (United States)

    Elf, S; Lin, R; Xia, S; Pan, Y; Shan, C; Wu, S; Lonial, S; Gaddh, M; Arellano, M L; Khoury, H J; Khuri, F R; Lee, B H; Boggon, T J; Fan, J; Chen, J

    2017-01-12

    The oxidative pentose phosphate pathway (PPP) is crucial for cancer cell metabolism and tumor growth. We recently reported that targeting a key oxidative PPP enzyme, 6-phosphogluconate dehydrogenase (6PGD), using our novel small-molecule 6PGD inhibitors Physcion and its derivative S3, shows anticancer effects. Notably, humans with genetic deficiency of either 6PGD or another oxidative PPP enzyme, glucose-6-phosphate dehydrogenase, exhibit non-immune hemolytic anemia upon exposure to aspirin and various antimalarial drugs. Inspired by these clinical observations, we examined the anticancer potential of combined treatment with 6PGD inhibitors and antimalarial drugs. We found that stable knockdown of 6PGD sensitizes leukemia cells to antimalarial agent dihydroartemisinin (DHA). Combined treatment with DHA and Physcion activates AMP-activated protein kinase, leading to synergistic inhibition of human leukemia cell viability. Moreover, our combined therapy synergistically attenuates tumor growth in xenograft nude mice injected with human K562 leukemia cells and cell viability of primary leukemia cells from human patients, but shows minimal toxicity to normal hematopoietic cells in mice as well as red blood cells and mononucleocytes from healthy human donors. Our findings reveal the potential for combined therapy using optimized doses of Physcion and DHA as a novel antileukemia treatment without inducing hemolysis.

  12. Inhibitory effects of ionic liquids on the lactic dehydrogenase activity.

    Science.gov (United States)

    Dong, Xing; Fan, Yunchang; Zhang, Heng; Zhong, Yingying; Yang, Yang; Miao, Juan; Hua, Shaofeng

    2016-05-01

    Ionic liquids (ILs) were widely used in scientific and industrial application and have been reported to possess potential toxicity to the environment and human health. The effects of six typical N-methylimidazolium-based ILs ([Cnmim]X, n=4, 6, 8; X=Br(-), Cl(-), BF4(-), CF3SO3(-)) on the lactic dehydrogenase (LDH) activity and the molecular interaction mechanism of ILs and the LDH were investigated with the aid of spectroscopic techniques. Experimental results showed that the LDH activity was inhibited in the presence of ILs. For the ILs with the same anion but different cations, their inhibitory ability on the LDH activity increased with increasing the alkyl chain length on the IL cation. Thermodynamic parameters, enthalpy change (ΔH) and entropy change (ΔS) were obtained by analyzing the fluorescence behavior of LDH with the addition of ILs. Both positive ΔH and ΔS suggested that hydrophobicity was the major driven force in the interaction process as expected.

  13. Virtual fragment screening for novel inhibitors of 6-phosphogluconate dehydrogenase.

    Science.gov (United States)

    Ruda, Gian Filippo; Campbell, Gordon; Alibu, Vincent P; Barrett, Michael P; Brenk, Ruth; Gilbert, Ian H

    2010-07-15

    The enzyme 6-phosphogluconate dehydrogenase is a potential drug target for the parasitic protozoan Trypanosoma brucei, the causative organism of human African trypanosomiasis. This enzyme has a polar active site to accommodate the phosphate, hydroxyl and carboxylate groups of the substrate, 6-phosphogluconate. A virtual fragment screen was undertaken of the enzyme to discover starting points for the development of inhibitors which are likely to have appropriate physicochemical properties for an orally bioavailable compound. A virtual screening library was developed, consisting of compounds with functional groups that could mimic the phosphate group of the substrate, but which have a higher pKa. Following docking, hits were clustered and appropriate compounds purchased and assayed against the enzyme. Three fragments were identified that had IC50 values in the low micromolar range and good ligand efficiencies. Based on these initial hits, analogues were procured and further active compounds were identified. Some of the fragments identified represent potential starting points for a medicinal chemistry programme to develop potent drug-like inhibitors of the enzyme. Copyright (c) 2010 Elsevier Ltd. All rights reserved.

  14. Glutamate dehydrogenase: structure, allosteric regulation, and role in insulin homeostasis.

    Science.gov (United States)

    Li, Ming; Li, Changhong; Allen, Aron; Stanley, Charles A; Smith, Thomas J

    2014-01-01

    Glutamate dehydrogenase (GDH) is a homohexameric enzyme that catalyzes the reversible oxidative deamination of L-glutamate to 2-oxoglutarate. Only in the animal kingdom is this enzyme heavily allosterically regulated by a wide array of metabolites. The major activators are ADP and leucine and inhibitors include GTP, palmitoyl CoA, and ATP. Spontaneous mutations in the GTP inhibitory site that lead to the hyperinsulinism/hyperammonemia (HHS) syndrome have shed light as to why mammalian GDH is so tightly regulated. Patients with HHS exhibit hypersecretion of insulin upon consumption of protein and concomitantly extremely high levels of ammonium in the serum. The atomic structures of four new inhibitors complexed with GDH complexes have identified three different allosteric binding sites. Using a transgenic mouse model expressing the human HHS form of GDH, at least three of these compounds blocked the dysregulated form of GDH in pancreatic tissue. EGCG from green tea prevented the hyper-response to amino acids in whole animals and improved basal serum glucose levels. The atomic structure of the ECG-GDH complex and mutagenesis studies is directing structure-based drug design using these polyphenols as a base scaffold. In addition, all of these allosteric inhibitors are elucidating the atomic mechanisms of allostery in this complex enzyme.

  15. The structure and allosteric regulation of mammalian glutamate dehydrogenase.

    Science.gov (United States)

    Li, Ming; Li, Changhong; Allen, Aron; Stanley, Charles A; Smith, Thomas J

    2012-03-15

    Glutamate dehydrogenase (GDH) is a homohexameric enzyme that catalyzes the reversible oxidative deamination of l-glutamate to 2-oxoglutarate. Only in the animal kingdom is this enzyme heavily allosterically regulated by a wide array of metabolites. The major activators are ADP and leucine, while the most important inhibitors include GTP, palmitoyl CoA, and ATP. Recently, spontaneous mutations in the GTP inhibitory site that lead to the hyperinsulinism/hyperammonemia (HHS) syndrome have shed light as to why mammalian GDH is so tightly regulated. Patients with HHS exhibit hypersecretion of insulin upon consumption of protein and concomitantly extremely high levels of ammonium in the serum. The atomic structures of four new inhibitors complexed with GDH complexes have identified three different allosteric binding sites. Using a transgenic mouse model expressing the human HHS form of GDH, at least three of these compounds were found to block the dysregulated form of GDH in pancreatic tissue. EGCG from green tea prevented the hyper-response to amino acids in whole animals and improved basal serum glucose levels. The atomic structure of the ECG-GDH complex and mutagenesis studies is directing structure-based drug design using these polyphenols as a base scaffold. In addition, all of these allosteric inhibitors are elucidating the atomic mechanisms of allostery in this complex enzyme.

  16. Crystal structure of Saccharomyces cerevisiae 6-phosphogluconate dehydrogenase Gnd1

    Directory of Open Access Journals (Sweden)

    Zhou Cong-Zhao

    2007-06-01

    Full Text Available Abstract Background As the third enzyme of the pentose phosphate pathway, 6-phosphogluconate dehydrogenase (6PGDH is the main generator of cellular NADPH. Both thioredoxin reductase and glutathione reductase require NADPH as the electron donor to reduce oxidized thioredoxin or glutathione (GSSG. Since thioredoxin and GSH are important antioxidants, it is not surprising that 6PGDH plays a critical role in protecting cells from oxidative stress. Furthermore the activity of 6PGDH is associated with several human disorders including cancer and Alzheimer's disease. The 3D structural investigation would be very valuable in designing small molecules that target this enzyme for potential therapeutic applications. Results The crystal structure of 6-phosphogluconate dehydrogenase (6PGDH/Gnd1 from Saccharomyces cerevisiae has been determined at 2.37 Å resolution by molecular replacement. The overall structure of Gnd1 is a homodimer with three domains for each monomer, a Rossmann fold NADP+ binding domain, an all-α helical domain contributing the majority to hydrophobic interaction between the two subunits and a small C-terminal domain penetrating the other subunit. In addition, two citrate molecules occupied the 6PG binding pocket of each monomer. The intact Gnd1 had a Km of 50 ± 9 μM for 6-phosphogluconate and of 35 ± 6 μM for NADP+ at pH 7.5. But the truncated mutants without the C-terminal 35, 39 or 53 residues of Gnd1 completely lost their 6PGDH activity, despite remaining the homodimer in solution. Conclusion The overall tertiary structure of Gnd1 is similar to those of 6PGDH from other species. The substrate and coenzyme binding sites are well conserved, either from the primary sequence alignment, or from the 3D structural superposition. Enzymatic activity assays suggest a sequential mechanism of catalysis, which is in agreement with previous studies. The C-terminal domain of Gnd1 functions as a hook to further tighten the dimer, but it is not

  17. Mycofactocin-associated mycobacterial dehydrogenases with non-exchangeable NAD cofactors

    Science.gov (United States)

    Haft, Daniel H.; Pierce, Phillip G.; Mayclin, Stephen J.; Sullivan, Amy; Gardberg, Anna S.; Abendroth, Jan; Begley, Darren W.; Phan, Isabelle Q.; Staker, Bart L.; Myler, Peter J.; Marathias, Vasilios M.; Lorimer, Donald D.; Edwards, Thomas E.

    2017-01-01

    During human infection, Mycobacterium tuberculosis (Mtb) survives the normally bacteriocidal phagosome of macrophages. Mtb and related species may be able to combat this harsh acidic environment which contains reactive oxygen species due to the mycobacterial genomes encoding a large number of dehydrogenases. Typically, dehydrogenase cofactor binding sites are open to solvent, which allows NAD/NADH exchange to support multiple turnover. Interestingly, mycobacterial short chain dehydrogenases/reductases (SDRs) within family TIGR03971 contain an insertion at the NAD binding site. Here we present crystal structures of 9 mycobacterial SDRs in which the insertion buries the NAD cofactor except for a small portion of the nicotinamide ring. Line broadening and STD-NMR experiments did not show NAD or NADH exchange on the NMR timescale. STD-NMR demonstrated binding of the potential substrate carveol, the potential product carvone, the inhibitor tricyclazol, and an external redox partner 2,6-dichloroindophenol (DCIP). Therefore, these SDRs appear to contain a non-exchangeable NAD cofactor and may rely on an external redox partner, rather than cofactor exchange, for multiple turnover. Incidentally, these genes always appear in conjunction with the mftA gene, which encodes the short peptide MftA, and with other genes proposed to convert MftA into the external redox partner mycofactocin. PMID:28120876

  18. Malate dehydrogenases from actinomycetes: structural comparison of Thermoactinomyces enzyme with other actinomycete and Bacillus enzymes.

    OpenAIRE

    1984-01-01

    Malate dehydrogenases from bacteria belonging to the genus Thermoactinomyces are tetrameric, like those from Bacillus spp., and exhibit a high degree of structural homology to Bacillus malate dehydrogenase as judged by immunological cross-reactivity. Malate dehydrogenases from other actinomycetes are dimers and do not cross-react with antibodies to Bacillus malate dehydrogenase.

  19. Immunochemical properties of NAD+-linked glycerol dehydrogenases from Escherichia coli and Klebsiella pneumoniae.

    OpenAIRE

    Tang, J C; Forage, R G; Lin, E C

    1982-01-01

    An NAD+-linked glycerol dehydrogenase hyperproduced by a mutant of Escherichia coli K-12 was found to be immunochemically homologous to a minor glycerol dehydrogenase of unknown physiological function in Klebsiella pneumoniae 1033, but not to the glycerol dehydrogenase of the dha system responsible for anaerobic dissimilation of glycerol or to the 2,3-butanediol dehydrogenase of K. pneumoniae.

  20. Genetics Home Reference: glucose-6-phosphate dehydrogenase deficiency

    Science.gov (United States)

    ... enzyme is involved in the normal processing of carbohydrates. It also protects red blood cells from the ... of glucose-6-phosphate dehydrogenase or alter its structure, this enzyme can no longer play its protective ...

  1. 21 CFR 862.1380 - Hydroxybutyric dehydrogenase test system.

    Science.gov (United States)

    2010-04-01

    ... dehydrogenase (HBD) in plasma or serum. HBD measurements are used in the diagnosis and treatment of myocardial infarction, renal damage (such as rejection of transplants), certain hematological diseases (such as...

  2. Prevalence of glucose-6-phosphate dehydrogenase deficiency in ...

    African Journals Online (AJOL)

    Pradeep Kumar

    2016-02-06

    Feb 6, 2016 ... for studies that investigated G6PD deficiency in Indian population. If any author studied .... analyses, (2) case reports, and (3) reviews and editorials. 2.3. ..... Beutler E, editors. Glucose-6-phosphate dehydrogenase. Orlando,.

  3. A novel glutamate dehydrogenase from bovine brain: purification and characterization.

    Science.gov (United States)

    Lee, J; Kim, S W; Cho, S W

    1995-08-01

    A soluble form of novel glutamate dehydrogenase has been purified from bovine brain. The preparation was homogeneous on sodium dodecyl sulfate-polyacrylamide gel electrophoresis and composed of six identical subunits having a subunit size of 57,500 Da. The biochemical properties of glutamate dehydrogenase such as N-terminal amino acids sequences, kinetic parameters, amino acids analysis, and optimum pH were examined in both reductive amination of alpha-ketoglutarate and oxidative deamination of glutamate. N-terminal amino acid sequences of the bovine brain enzyme showed the significant differences in the first 5 amino acids compared to other glutamate dehydrogenases from various sources. These results indicate that glutamate dehydrogenase isolated from bovine brain is a novel polypeptide.

  4. Formaldehyde degradation in Corynebacterium glutamicum involves acetaldehyde dehydrogenase and mycothiol-dependent formaldehyde dehydrogenase.

    Science.gov (United States)

    Lessmeier, Lennart; Hoefener, Michael; Wendisch, Volker F

    2013-12-01

    Corynebacterium glutamicum, a Gram-positive soil bacterium belonging to the actinomycetes, is able to degrade formaldehyde but the enzyme(s) involved in this detoxification process were not known. Acetaldehyde dehydrogenase Ald, which is essential for ethanol utilization, and FadH, characterized here as NAD-linked mycothiol-dependent formaldehyde dehydrogenase, were shown to be responsible for formaldehyde oxidation since a mutant lacking ald and fadH could not oxidize formaldehyde resulting in the inability to grow when formaldehyde was added to the medium. Moreover, C. glutamicum ΔaldΔfadH did not grow with vanillate, a carbon source giving rise to intracellular formaldehyde. FadH from C. glutamicum was purified from recombinant Escherichia coli and shown to be active as a homotetramer. Mycothiol-dependent formaldehyde oxidation revealed Km values of 0.6 mM for mycothiol and 4.3 mM for formaldehyde and a Vmax of 7.7 U mg(-1). FadH from C. glutamicum also possesses zinc-dependent, but mycothiol-independent alcohol dehydrogenase activity with a preference for short chain primary alcohols such as ethanol (Km = 330 mM, Vmax = 9.6 U mg(-1)), 1-propanol (Km = 150 mM, Vmax = 5 U mg(-1)) and 1-butanol (Km = 50 mM, Vmax = 0.8 U mg(-1)). Formaldehyde detoxification system by Ald and mycothiol-dependent FadH is essential for tolerance of C. glutamicum to external stress by free formaldehyde in its habitat and for growth with natural substrates like vanillate, which are metabolized with concomitant release of formaldehyde.

  5. Resurrecting ancestral alcohol dehydrogenases from yeast.

    Science.gov (United States)

    Thomson, J Michael; Gaucher, Eric A; Burgan, Michelle F; De Kee, Danny W; Li, Tang; Aris, John P; Benner, Steven A

    2005-06-01

    Modern yeast living in fleshy fruits rapidly convert sugars into bulk ethanol through pyruvate. Pyruvate loses carbon dioxide to produce acetaldehyde, which is reduced by alcohol dehydrogenase 1 (Adh1) to ethanol, which accumulates. Yeast later consumes the accumulated ethanol, exploiting Adh2, an Adh1 homolog differing by 24 (of 348) amino acids. As many microorganisms cannot grow in ethanol, accumulated ethanol may help yeast defend resources in the fruit. We report here the resurrection of the last common ancestor of Adh1 and Adh2, called Adh(A). The kinetic behavior of Adh(A) suggests that the ancestor was optimized to make (not consume) ethanol. This is consistent with the hypothesis that before the Adh1-Adh2 duplication, yeast did not accumulate ethanol for later consumption but rather used Adh(A) to recycle NADH generated in the glycolytic pathway. Silent nucleotide dating suggests that the Adh1-Adh2 duplication occurred near the time of duplication of several other proteins involved in the accumulation of ethanol, possibly in the Cretaceous age when fleshy fruits arose. These results help to connect the chemical behavior of these enzymes through systems analysis to a time of global ecosystem change, a small but useful step towards a planetary systems biology.

  6. Lactic dehydrogenase and cancer: an overview.

    Science.gov (United States)

    Gallo, Monica; Sapio, Luigi; Spina, Annamaria; Naviglio, Daniele; Calogero, Armando; Naviglio, Silvio

    2015-01-01

    Despite the intense scientific efforts made, there are still many tumors that are difficult to treat and the percentage of patient survival in the long-term is still too low. Thus, new approaches to the treatment of cancer are needed. Cancer is a highly heterogeneous and complex disease, whose development requires a reorganization of cell metabolism. Most tumor cells downregulate mitochondrial oxidative phosphorylation and increase the rate of glucose consumption and lactate release, independently of oxygen availability (Warburg effect). This metabolic rewiring is largely believed to favour tumor growth and survival, although the underlying molecular mechanisms are not completely understood. Importantly, the correlation between the aerobic glycolysis and cancer is widely regarded as a useful biochemical basis for the development of novel anticancer strategies. Among the enzymes involved in glycolysis, lactate dehydrogenase (LDH) is emerging as a very attractive target for possible pharmacological approaches in cancer therapy. This review addresses the state of the art and the perspectives concerning LDH both as a useful diagnostic marker and a relevant molecular target in cancer therapy and management.

  7. Liver alcohol dehydrogenase immobilized on polyvinylidene difluoride.

    Science.gov (United States)

    Roig, M G; Bello, J F; Moreno de Vega, M A; Cachaza, J M; Kennedy, J F

    1990-01-01

    A physical method for immobilization of liver alcohol dehydrogenase (ADH) by hydrophobic adsorption onto a supporting membrane of polyvinylidene difluoride (PVDF) was performed. Simultaneously, a physicochemical characterization of the immobilized enzyme regarding its kinetic behaviour was performed. The activity/pH profile observed points to an effect of pH on activity that is completely different from the case of ADH in solution. The disturbance in the typical bell-shaped profile owing to the fact that the enzyme was immobilized is explained on the basis of a potent limitation to the diffusion of the protons in the support. The findings of the present work also reveal the existence of an effect that limits free external diffusion of the substrate towards and/or the product from the support; this effect seems to be the determinant of the overall rate of the enzymatic reaction and is thus of great importance in the effective kinetic behaviour (v([S])) of immobilized ADH, whose kinetic behaviour is complex (non-Michaelian), as may be seen from the lack of linearity observed in the corresponding double reciprocal and Eadie-Hofstee plots. By non-linear regression numerical analysis of the v([S]) data and application of the F-test for model discrimination, the minimum rate equation necessary to describe the intrinsic kinetic behaviour of PVDF-immobilized ADH proved to be one of the polynomial quotient type of degree 2:2 (in substrate concentration).

  8. Quinohemoprotein alcohol dehydrogenases: structure, function, and physiology.

    Science.gov (United States)

    Toyama, Hirohide; Mathews, F Scott; Adachi, Osao; Matsushita, Kazunobu

    2004-08-01

    Quino(hemo)protein alcohol dehydrogenases (ADH) that have pyrroloquinoline quinone (PQQ) as the prosthetic group are classified into 3 groups, types I, II, and III. Type I ADH is a simple quinoprotein having PQQ as the only prosthetic group, while type II and type III ADHs are quinohemoprotein having heme c as well as PQQ in the catalytic polypeptide. Type II ADH is a soluble periplasmic enzyme and is widely distributed in Proteobacteria such as Pseudomonas, Ralstonia, Comamonas, etc. In contrast, type III ADH is a membrane-bound enzyme working on the periplasmic surface solely in acetic acid bacteria. It consists of three subunits that comprise a quinohemoprotein catalytic subunit, a triheme cytochrome c subunit, and a third subunit of unknown function. The catalytic subunits of all the quino(hemo)protein ADHs have a common structural motif, a quinoprotein-specific superbarrel domain, where PQQ is deeply embedded in the center. In addition, in the type II and type III ADHs this subunit contains a unique heme c domain. Various type II ADHs each have a unique substrate specificity, accepting a wide variety of alcohols, as is discussed on the basis of recent X-ray crystallographic analyses. Electron transfer within both type II and III ADHs is discussed in terms of the intramolecular reaction from PQQ to heme c and also from heme to heme, and in terms of the intermolecular reaction with azurin and ubiquinone, respectively. Unique physiological functions of both types of quinohemoprotein