WorldWideScience

Sample records for human gene families

  1. The human protein disulfide isomerase gene family

    Directory of Open Access Journals (Sweden)

    Galligan James J

    2012-07-01

    Full Text Available Abstract Enzyme-mediated disulfide bond formation is a highly conserved process affecting over one-third of all eukaryotic proteins. The enzymes primarily responsible for facilitating thiol-disulfide exchange are members of an expanding family of proteins known as protein disulfide isomerases (PDIs. These proteins are part of a larger superfamily of proteins known as the thioredoxin protein family (TRX. As members of the PDI family of proteins, all proteins contain a TRX-like structural domain and are predominantly expressed in the endoplasmic reticulum. Subcellular localization and the presence of a TRX domain, however, comprise the short list of distinguishing features required for gene family classification. To date, the PDI gene family contains 21 members, varying in domain composition, molecular weight, tissue expression, and cellular processing. Given their vital role in protein-folding, loss of PDI activity has been associated with the pathogenesis of numerous disease states, most commonly related to the unfolded protein response (UPR. Over the past decade, UPR has become a very attractive therapeutic target for multiple pathologies including Alzheimer disease, Parkinson disease, alcoholic and non-alcoholic liver disease, and type-2 diabetes. Understanding the mechanisms of protein-folding, specifically thiol-disulfide exchange, may lead to development of a novel class of therapeutics that would help alleviate a wide range of diseases by targeting the UPR.

  2. Human heavy-chain variable region gene family nonrandomly rearranged in familial chronic lymphocytic leukemia

    International Nuclear Information System (INIS)

    Shen, A.; Humphries, C.; Tucker, P.; Blattner, F.

    1987-01-01

    The authors have identified a family of human immunoglobulin heavy-chain variable-region (V/sub H/) genes, one member of which is rearranged in two affected members of a family in which the father and four of five siblings developed chronic lymphocytic leukemia. Cloning and sequencing of the rearranged V/sub H/ genes from leukemic lymphocytes of three affected siblings showed that two siblings had rearranged V/sub H/ genes (V/sub H/TS1 and V/sub H/WS1) that were 90% homologous. The corresponding germ-line gene, V/sub H/251, was found to part of a small (four gene) V/sub H/ gene family, which they term V/sub H/V. The DNA sequence homology to V/sub H/WS1 (95%) and V/sub H/TS1 (88%) and identical restriction sites on the 5' side of V/sub H/ confirm that rearrangement of V/sub H/251 followed by somatic mutation produced the identical V/sub H/ gene rearrangements in the two siblings. V/sub H/TS1 is not a functional V/sub H/ gene; a functional V/sub H/ rearrangement was found on the other chromosome of this patient. The other two siblings had different V/sub H/ gene rearrangements. All used different diversity genes. Mechanisms proposed for nonrandom selection of a single V/sub H/ gene include developmental regulation of this V/sub H/ gene rearrangement or selection of a subpopulation of B cells in which this V/sub H/ has been rearranged

  3. Repair of DNA damage in the human metallothionein gene family

    International Nuclear Information System (INIS)

    Leadon, S.A.; Snowden, M.M.

    1987-01-01

    In order to distinguish enhanced repair of a sequence due to its transcriptional activity from enhanced repair due to chromatin alterations brought about by integration of a sequence into the genome, we have investigated the repair of damage both in endogenous genes and in cell lines that contain an integrated gene with an inducible promoter. The endogenous genes we are studying are the metallothioneins (MTs), a multigene family in man consisting of about 10-12 members. Cultured cells were exposed to 10-J/m 2 uv light and allowed to repair in the presence of bromodeoxyuridine. The DNA was then isolated, digested with Eco RI, and fully hybrid density DNA made by semiconservative synthesis was separated from unreplicated DNA by centrifugation in CsCl density gradients. Unreplicated, parental-density DNA was then reacted with a monoclonal antibody against bromouracil. 1 ref., 1 fig., 1 tab

  4. Identification of a novel gene family that includes the interferon-inducible human genes 6–16 and ISG12

    Directory of Open Access Journals (Sweden)

    Parker Nadeene

    2004-01-01

    Full Text Available Abstract Background The human 6–16 and ISG12 genes are transcriptionally upregulated in a variety of cell types in response to type I interferon (IFN. The predicted products of these genes are small (12.9 and 11.5 kDa respectively, hydrophobic proteins that share 36% overall amino acid identity. Gene disruption and over-expression studies have so far failed to reveal any biochemical or cellular roles for these proteins. Results We have used in silico analyses to identify a novel family of genes (the ISG12 gene family related to both the human 6–16 and ISG12 genes. Each ISG12 family member codes for a small hydrophobic protein containing a conserved ~80 amino-acid motif (the ISG12 motif. So far we have detected 46 family members in 25 organisms, ranging from unicellular eukaryotes to humans. Humans have four ISG12 genes: the 6–16 gene at chromosome 1p35 and three genes (ISG12(a, ISG12(b and ISG12(c clustered at chromosome 14q32. Mice have three family members (ISG12(a, ISG12(b1 and ISG12(b2 clustered at chromosome 12F1 (syntenic with human chromosome 14q32. There does not appear to be a murine 6–16 gene. On the basis of phylogenetic analyses, genomic organisation and intron-alignments we suggest that this family has arisen through divergent inter- and intra-chromosomal gene duplication events. The transcripts from human and mouse genes are detectable, all but two (human ISG12(b and ISG12(c being upregulated in response to type I IFN in the cell lines tested. Conclusions Members of the eukaryotic ISG12 gene family encode a small hydrophobic protein with at least one copy of a newly defined motif of ~80 amino-acids (the ISG12 motif. In higher eukaryotes, many of the genes have acquired a responsiveness to type I IFN during evolution suggesting that a role in resisting cellular or environmental stress may be a unifying property of all family members. Analysis of gene-function in higher eukaryotes is complicated by the possibility of

  5. Genomic sequence and organization of two members of a human lectin gene family

    International Nuclear Information System (INIS)

    Gitt, M.A.; Barondes, S.H.

    1991-01-01

    The authors have isolated and sequenced the genomic DNA encoding a human dimeric soluble lactose-binding lectin. The gene has four exons, and its upstream region contains sequences that suggest control by glucocorticoids, heat (environmental) shock, metals, and other factors. They have also isolated and sequenced three exons of the gene encoding another human putative lectin, the existence of which was first indicated by isolation of its cDNA. Comparisons suggest a general pattern of genomic organization of members of this lectin gene family

  6. A shared promoter region suggests a common ancestor for the human VCX/Y, SPANX, and CSAG gene families and the murine CYPT family

    DEFF Research Database (Denmark)

    Hansen, Martin A; Nielsen, John E; Retelska, Dorota

    2008-01-01

    , sequences corresponding to the shared promoter region of the CYPT family were identified at 39 loci. Most loci were located immediately upstream of genes belonging to the VCX/Y, SPANX, or CSAG gene families. Sequence comparison of the loci revealed a conserved CYPT promoter-like (CPL) element featuring TATA...... cell types. The genomic regions harboring the gene families were rich in direct and inverted segmental duplications (SD), which may facilitate gene conversion and rapid evolution. The conserved CPL and the common expression profiles suggest that the human VCX/Y, SPANX, and CSAG2 gene families together......Many testis-specific genes from the sex chromosomes are subject to rapid evolution, which can make it difficult to identify murine genes in the human genome. The murine CYPT gene family includes 15 members, but orthologs were undetectable in the human genome. However, using refined homology search...

  7. Human mast cell tryptase: Multiple cDNAs and genes reveal a multigene serine protease family

    International Nuclear Information System (INIS)

    Vanderslice, P.; Ballinger, S.M.; Tam, E.K.; Goldstein, S.M.; Craik, C.S.; Caughey, G.H.

    1990-01-01

    Three different cDNAs and a gene encoding human skin mast cell tryptase have been cloned and sequenced in their entirety. The deduced amino acid sequences reveal a 30-amino acid prepropeptide followed by a 245-amino acid catalytic domain. The C-terminal undecapeptide of the human preprosequence is identical in dog tryptase and appears to be part of a prosequence unique among serine proteases. The differences among the three human tryptase catalytic domains include the loss of a consensus N-glycosylation site in one cDNA, which may explain some of the heterogeneity in size and susceptibility to deglycosylation seen in tryptase preparations. All three tryptase cDNAs are distinct from a recently reported cDNA obtained from a human lung mast cell library. A skin tryptase cDNA was used to isolate a human tryptase gene, the exons of which match one of the skin-derived cDNAs. The organization of the ∼1.8-kilobase-pair tryptase gene is unique and is not closely related to that of any other mast cell or leukocyte serine protease. The 5' regulatory regions of the gene share features with those of other serine proteases, including mast cell chymase, but are unusual in being separated from the protein-coding sequence by an intron. High-stringency hybridization of a human genomic DNA blot with a fragment of the tryptase gene confirms the presence of multiple tryptase genes. These findings provide genetic evidence that human mast cell tryptases are the products of a multigene family

  8. Expression of REG family genes in human inflammatory bowel diseases and its regulation

    Directory of Open Access Journals (Sweden)

    Chikatsugu Tsuchida

    2017-12-01

    Full Text Available The pathophysiology of inflammatory bowel disease (IBD reflects a balance between mucosal injury and reparative mechanisms. Some regenerating gene (Reg family members have been reported to be expressed in Crohn's disease (CD and ulcerative colitis (UC and to be involved as proliferative mucosal factors in IBD. However, expression of all REG family genes in IBD is still unclear. Here, we analyzed expression of all REG family genes (REG Iα, REG Iβ, REG III, HIP/PAP, and REG IV in biopsy specimens of UC and CD by real-time RT-PCR. REG Iα, REG Iβ, and REG IV genes were overexpressed in CD samples. REG IV gene was also overexpressed in UC samples. We further analyzed the expression mechanisms of REG Iα, REG Iβ, and REG IV genes in human colon cells. The expression of REG Iα was significantly induced by IL-6 or IL-22, and REG Iβ was induced by IL-22. Deletion analyses revealed that three regions (− 220 to − 211, − 179 to − 156, and − 146 to − 130 in REG Iα and the region (− 274 to− 260 in REG Iβ promoter were responsible for the activation by IL-22/IL-6. The promoters contain consensus transcription factor binding sequences for MZF1, RTEF1/TEAD4, and STAT3 in REG Iα, and HLTF/FOXN2F in REG Iβ, respectively. The introduction of siRNAs for MZF1, RTEF1/TEAD4, STAT3, and HLTF/FOXN2F abolished the transcription of REG Iα and REG Iβ. The gene activation mechanisms of REG Iα/REG Iβ may play a role in colon mucosal regeneration in IBD.

  9. Upregulation of human heme oxygenase gene expression by Ets-family proteins.

    Science.gov (United States)

    Deramaudt, B M; Remy, P; Abraham, N G

    1999-03-01

    Overexpression of human heme oxygenase-1 has been shown to have the potential to promote EC proliferation and angiogenesis. Since Ets-family proteins have been shown to play an important role in angiogenesis, we investigated the presence of ETS binding sites (EBS), GGAA/T, and ETS protein contributing to human HO-1 gene expression. Several chloramphenicol acetyltransferase constructs were examined in order to analyze the effect of ETS family proteins on the transduction of HO-1 in Xenopus oocytes and in microvessel endothelial cells. Heme oxygenase promoter activity was up-regulated by FLI-1ERGETS-1 protein(s). Chloramphenicol acetyltransferase (CAT) assays demonstrated that the promoter region (-1500 to +19) contains positive and negative control elements and that all three members of the ETS protein family were responsible for the up-regulation of HHO-1. Electrophoretic mobility shift assays (EMSA), performed with nuclear extracts from endothelial cells overexpressing HHO-1 gene, and specific HHO-1 oligonucleotides probes containing putative EBS resulted in a specific and marked bandshift. Synergistic binding was observed in EMSA between AP-1 on the one hand, FLI-1, ERG, and ETS-1 protein on the other. Moreover, 5'-deletion analysis demonstrated the existence of a negative control element of HHO-1 expression located between positions -1500 and -120 on the HHO-1 promoter. The presence of regulatory sequences for transcription factors such as ETS-1, FLI-1, or ERG, whose activity is associated with cell proliferation, endothelial cell differentiation, and matrix metalloproteinase transduction, may be an indication of the important role that HO-1 may play in coronary collateral circulation, tumor growth, angiogenesis, and hemoglobin-induced endothelial cell injuries.

  10. Transcriptional profiling of the human fibrillin/LTBP gene family, key regulators of mesenchymal cell functions

    DEFF Research Database (Denmark)

    Davis, Margaret R.; Andersson, Robin; Severin, Jessica

    2014-01-01

    in the structure of the extracellular matrix and controlling the bioavailability of TGFβ family members. Genes encoding these proteins show differential expression in mesenchymal cell types which synthesize the extracellular matrix. We have investigated the promoter regions of the seven gene family members using...... of the family members were expressed in a range of mesenchymal and other cell types, often associated with use of alternative promoters or transcription start sites within a promoter in different cell types. FBN3 was the lowest expressed gene, and was found only in embryonic and fetal tissues. The different...

  11. The Toll-like receptor gene family is integrated into human DNA damage and p53 networks.

    Directory of Open Access Journals (Sweden)

    Daniel Menendez

    2011-03-01

    Full Text Available In recent years the functions that the p53 tumor suppressor plays in human biology have been greatly extended beyond "guardian of the genome." Our studies of promoter response element sequences targeted by the p53 master regulatory transcription factor suggest a general role for this DNA damage and stress-responsive regulator in the control of human Toll-like receptor (TLR gene expression. The TLR gene family mediates innate immunity to a wide variety of pathogenic threats through recognition of conserved pathogen-associated molecular motifs. Using primary human immune cells, we have examined expression of the entire TLR gene family following exposure to anti-cancer agents that induce the p53 network. Expression of all TLR genes, TLR1 to TLR10, in blood lymphocytes and alveolar macrophages from healthy volunteers can be induced by DNA metabolic stressors. However, there is considerable inter-individual variability. Most of the TLR genes respond to p53 via canonical as well as noncanonical promoter binding sites. Importantly, the integration of the TLR gene family into the p53 network is unique to primates, a recurrent theme raised for other gene families in our previous studies. Furthermore, a polymorphism in a TLR8 response element provides the first human example of a p53 target sequence specifically responsible for endogenous gene induction. These findings-demonstrating that the human innate immune system, including downstream induction of cytokines, can be modulated by DNA metabolic stress-have many implications for health and disease, as well as for understanding the evolution of damage and p53 responsive networks.

  12. Segmental duplications and evolutionary acquisition of UV damage response in the SPATA31 gene family of primates and humans.

    Science.gov (United States)

    Bekpen, Cemalettin; Künzel, Sven; Xie, Chen; Eaaswarkhanth, Muthukrishnan; Lin, Yen-Lung; Gokcumen, Omer; Akdis, Cezmi A; Tautz, Diethard

    2017-03-06

    Segmental duplications are an abundant source for novel gene functions and evolutionary adaptations. This mechanism of generating novelty was very active during the evolution of primates particularly in the human lineage. Here, we characterize the evolution and function of the SPATA31 gene family (former designation FAM75A), which was previously shown to be among the gene families with the strongest signal of positive selection in hominoids. The mouse homologue for this gene family is a single copy gene expressed during spermatogenesis. We show that in primates, the SPATA31 gene duplicated into SPATA31A and SPATA31C types and broadened the expression into many tissues. Each type became further segmentally duplicated in the line towards humans with the largest number of full-length copies found for SPATA31A in humans. Copy number estimates of SPATA31A based on digital PCR show an average of 7.5 with a range of 5-11 copies per diploid genome among human individuals. The primate SPATA31 genes also acquired new protein domains that suggest an involvement in UV response and DNA repair. We generated antibodies and show that the protein is re-localized from the nucleolus to the whole nucleus upon UV-irradiation suggesting a UV damage response. We used CRISPR/Cas mediated mutagenesis to knockout copies of the gene in human primary fibroblast cells. We find that cell lines with reduced functional copies as well as naturally occurring low copy number HFF cells show enhanced sensitivity towards UV-irradiation. The acquisition of new SPATA31 protein functions and its broadening of expression may be related to the evolution of the diurnal life style in primates that required a higher UV tolerance. The increased segmental duplications in hominoids as well as its fast evolution suggest the acquisition of further specific functions particularly in humans.

  13. Structure and function of the human metallothionein gene family: Final technical report

    International Nuclear Information System (INIS)

    Karin, M.

    1986-01-01

    The full nucleotide sequence of two additional human metallothionein (hMT) genes has been determined. These genes, hMT-I/sub B/ and hMT-I/sub F/, are located within the MT-I gene cluster we have described originally. The hMT-I/sub F/ gene is the first hMT-I gene whose amino acid sequence is in complete agreement with the published sequence of the human MT-I proteins. Therefore it is likely to be an active gene encoding a functional protein. However, since we have just completed the sequence analysis, we have not characterized this gene further yet. The hMT-I/sub B/ gene is closely linked to the hMT-I/sub A/ gene, and two pseudogenes, hMT-I/sub C/ and hMT-I/sub D/ separate the two. From its nucleotide sequence hMT-I/sub B/ seems to be an active gene, encoding a functional protein even though it differs in four positions from the published sequence of human MT-I proteins. This gene is expressed in a human hepatoma cell line, HepG2, and its expression is stimulated by Cd ++ . Using gene fusions to the viral thymidine-kinase gene we find that hMT-I/sub B/, like the hMT-I/sub A/ and hMT-II/sub A/ genes, contains a heavy metal responsive promoterregulatory element within its 5' flanking region. We analyzed the level of hMT-I/sub B/ mRNA in a variety of human cell lines by the S1 nuclease technique, and compared it to the expression of the hMT-II/sub A/ gene. While the hMT-II/sub A/ gene was expressed in all of the cell lines analyzed, the hMT-I/sub B/ gene was expressed in liver and kidney derived cell lines cells. This suggest that the expression of the hMT-I/sub B/ gene is controlled in a tissue specific manner. 13 refs

  14. The role of retrotransposons in gene family expansions in the human and mouse genomes

    Czech Academy of Sciences Publication Activity Database

    Janoušek, Václav; Laukaitis, C. M.; Yanchukov, Alexey; Karn, R. C.

    2016-01-01

    Roč. 8, č. 9 (2016), s. 2632-2650 ISSN 1759-6653 R&D Projects: GA MŠk EE2.3.20.0303 Institutional support: RVO:68081766 Keywords : gene families * transposable elements * retrotransposons * LINE * LTR * SINE Subject RIV: EB - Genetics ; Molecular Biology Impact factor: 3.979, year: 2016

  15. Transduction of Oct6 or Oct9 gene concomitant with Myc family gene induced osteoblast-like phenotypic conversion in normal human fibroblasts.

    Science.gov (United States)

    Mizoshiri, N; Kishida, T; Yamamoto, K; Shirai, T; Terauchi, R; Tsuchida, S; Mori, Y; Ejima, A; Sato, Y; Arai, Y; Fujiwara, H; Yamamoto, T; Kanamura, N; Mazda, O; Kubo, T

    2015-11-27

    Osteoblasts play essential roles in bone formation and regeneration, while they have low proliferation potential. Recently we established a procedure to directly convert human fibroblasts into osteoblasts (dOBs). Transduction of Runx2 (R), Osterix (X), Oct3/4 (O) and L-myc (L) genes followed by culturing under osteogenic conditions induced normal human fibroblasts to express osteoblast-specific genes and produce calcified bone matrix both in vitro and in vivo Intriguingly, a combination of only two factors, Oct3/4 and L-myc, significantly induced osteoblast-like phenotype in fibroblasts, but the mechanisms underlying the direct conversion remains to be unveiled. We examined which Oct family genes and Myc family genes are capable of inducing osteoblast-like phenotypic conversion. As result Oct3/4, Oct6 and Oct9, among other Oct family members, had the capability, while N-myc was the most effective Myc family gene. The Oct9 plus N-myc was the best combination to induce direct conversion of human fibroblasts into osteoblast-like cells. The present findings may greatly contribute to the elucidation of the roles of the Oct and Myc proteins in osteoblast direct reprogramming. The results may also lead to establishment of novel regenerative therapy for various bone resorption diseases. Copyright © 2015 Elsevier Inc. All rights reserved.

  16. Age distribution of human gene families shows significant roles of both large- and small-scale duplications in vertebrate evolution.

    Science.gov (United States)

    Gu, Xun; Wang, Yufeng; Gu, Jianying

    2002-06-01

    The classical (two-round) hypothesis of vertebrate genome duplication proposes two successive whole-genome duplication(s) (polyploidizations) predating the origin of fishes, a view now being seriously challenged. As the debate largely concerns the relative merits of the 'big-bang mode' theory (large-scale duplication) and the 'continuous mode' theory (constant creation by small-scale duplications), we tested whether a significant proportion of paralogous genes in the contemporary human genome was indeed generated in the early stage of vertebrate evolution. After an extensive search of major databases, we dated 1,739 gene duplication events from the phylogenetic analysis of 749 vertebrate gene families. We found a pattern characterized by two waves (I, II) and an ancient component. Wave I represents a recent gene family expansion by tandem or segmental duplications, whereas wave II, a rapid paralogous gene increase in the early stage of vertebrate evolution, supports the idea of genome duplication(s) (the big-bang mode). Further analysis indicated that large- and small-scale gene duplications both make a significant contribution during the early stage of vertebrate evolution to build the current hierarchy of the human proteome.

  17. European gene mapping project (EUROGEM) : Breakpoint panels for human chromosomes based on the CEPH reference families

    NARCIS (Netherlands)

    Attwood, J; Bryant, SP; Bains, R; Povey, R; Povey, S; Rebello, M; Kapsetaki, M; Moschonas, NK; Grzeschik, KH; Otto, M; Dixon, M; Sudworth, HE; Kooy, RF; Wright, A; Teague, P; Terrenato, L; Vergnaud, G; Monfouilloux, S; Weissenbach, J; Alibert, O; Dib, C; Faure, S; Bakker, E; Pearson, NM; Vossen, RHAM; Gal, A; MuellerMyhsok, B; Cann, HM; Spurr, NK

    Meiotic breakpoint panels for human chromosomes 2, 3, 4, 5, 6, 7, 8, 9, 10, 13, 14, 15, 17; 18, 20 and X were constructed from genotypes from the CEPH reference families. Each recombinant chromosome included has a breakpoint well-supported with reference to defined quantitative criteria. The panels

  18. Transduction of Oct6 or Oct9 gene concomitant with Myc family gene induced osteoblast-like phenotypic conversion in normal human fibroblasts

    International Nuclear Information System (INIS)

    Mizoshiri, N.; Kishida, T.; Yamamoto, K.; Shirai, T.; Terauchi, R.; Tsuchida, S.; Mori, Y.; Ejima, A.; Sato, Y.; Arai, Y.; Fujiwara, H.; Yamamoto, T.; Kanamura, N.; Mazda, O.; Kubo, T.

    2015-01-01

    Introduction: Osteoblasts play essential roles in bone formation and regeneration, while they have low proliferation potential. Recently we established a procedure to directly convert human fibroblasts into osteoblasts (dOBs). Transduction of Runx2 (R), Osterix (X), Oct3/4 (O) and L-myc (L) genes followed by culturing under osteogenic conditions induced normal human fibroblasts to express osteoblast-specific genes and produce calcified bone matrix both in vitro and in vivo Intriguingly, a combination of only two factors, Oct3/4 and L-myc, significantly induced osteoblast-like phenotype in fibroblasts, but the mechanisms underlying the direct conversion remains to be unveiled. Materials and Methods: We examined which Oct family genes and Myc family genes are capable of inducing osteoblast-like phenotypic conversion. Results: As result Oct3/4, Oct6 and Oct9, among other Oct family members, had the capability, while N-myc was the most effective Myc family gene. The Oct9 plus N-myc was the best combination to induce direct conversion of human fibroblasts into osteoblast-like cells. Discussion: The present findings may greatly contribute to the elucidation of the roles of the Oct and Myc proteins in osteoblast direct reprogramming. The results may also lead to establishment of novel regenerative therapy for various bone resorption diseases. - Highlights: • Introducing L-myc in a combination with either Oct3/4, Oct6 or Oct9 enables the conversion of fibroblasts to osteoblasts. • A combination of L-myc with Oct3/4 or Oct9 can induce the cells to a phenotype closer to normal osteoblasts. • N-myc was considered the most appropriate Myc family gene for induction of osteoblast-like phenotype in fibroblasts. • The combination of Oct9 plus N-myc has the strongest capability of inducing osteoblast-like phenotype.

  19. Transduction of Oct6 or Oct9 gene concomitant with Myc family gene induced osteoblast-like phenotypic conversion in normal human fibroblasts

    Energy Technology Data Exchange (ETDEWEB)

    Mizoshiri, N. [Department of Immunology, Kyoto Prefectural University of Medicine, Kyoto (Japan); Department of Orthopaedics, Kyoto Prefectural University of Medicine, Kyoto (Japan); Kishida, T. [Department of Immunology, Kyoto Prefectural University of Medicine, Kyoto (Japan); Yamamoto, K. [Department of Immunology, Kyoto Prefectural University of Medicine, Kyoto (Japan); Department of Dental Medicine, Kyoto Prefectural University of Medicine, Kyoto (Japan); Shirai, T.; Terauchi, R.; Tsuchida, S. [Department of Orthopaedics, Kyoto Prefectural University of Medicine, Kyoto (Japan); Mori, Y. [Department of Immunology, Kyoto Prefectural University of Medicine, Kyoto (Japan); Department of Orthopaedics, Kyoto Prefectural University of Medicine, Kyoto (Japan); Ejima, A. [Department of Immunology, Kyoto Prefectural University of Medicine, Kyoto (Japan); Sato, Y. [Department of Immunology, Kyoto Prefectural University of Medicine, Kyoto (Japan); Department of Dental Medicine, Kyoto Prefectural University of Medicine, Kyoto (Japan); Arai, Y.; Fujiwara, H. [Department of Orthopaedics, Kyoto Prefectural University of Medicine, Kyoto (Japan); Yamamoto, T.; Kanamura, N. [Department of Dental Medicine, Kyoto Prefectural University of Medicine, Kyoto (Japan); Mazda, O., E-mail: mazda@koto.kpu-m.ac.jp [Department of Immunology, Kyoto Prefectural University of Medicine, Kyoto (Japan); Kubo, T. [Department of Orthopaedics, Kyoto Prefectural University of Medicine, Kyoto (Japan)

    2015-11-27

    Introduction: Osteoblasts play essential roles in bone formation and regeneration, while they have low proliferation potential. Recently we established a procedure to directly convert human fibroblasts into osteoblasts (dOBs). Transduction of Runx2 (R), Osterix (X), Oct3/4 (O) and L-myc (L) genes followed by culturing under osteogenic conditions induced normal human fibroblasts to express osteoblast-specific genes and produce calcified bone matrix both in vitro and in vivo Intriguingly, a combination of only two factors, Oct3/4 and L-myc, significantly induced osteoblast-like phenotype in fibroblasts, but the mechanisms underlying the direct conversion remains to be unveiled. Materials and Methods: We examined which Oct family genes and Myc family genes are capable of inducing osteoblast-like phenotypic conversion. Results: As result Oct3/4, Oct6 and Oct9, among other Oct family members, had the capability, while N-myc was the most effective Myc family gene. The Oct9 plus N-myc was the best combination to induce direct conversion of human fibroblasts into osteoblast-like cells. Discussion: The present findings may greatly contribute to the elucidation of the roles of the Oct and Myc proteins in osteoblast direct reprogramming. The results may also lead to establishment of novel regenerative therapy for various bone resorption diseases. - Highlights: • Introducing L-myc in a combination with either Oct3/4, Oct6 or Oct9 enables the conversion of fibroblasts to osteoblasts. • A combination of L-myc with Oct3/4 or Oct9 can induce the cells to a phenotype closer to normal osteoblasts. • N-myc was considered the most appropriate Myc family gene for induction of osteoblast-like phenotype in fibroblasts. • The combination of Oct9 plus N-myc has the strongest capability of inducing osteoblast-like phenotype.

  20. Down-regulation of HSP40 gene family following OCT4B1 suppression in human tumor cell lines

    Directory of Open Access Journals (Sweden)

    Mohammad Reza Mirzaei

    2016-02-01

    Full Text Available Objective(s: The OCT4B1, as one of OCT4 variants, is expressed in cancer cell lines and tissues more than other variants and plays an important role in apoptosis and stress (heat shock protein pathways. The present study was designed to determine the effects of OCT4B1 silencing on expressional profile of HSP40 gene family expression in three different human tumor cell lines. Materials and Methods: The OCT4B1 expression was suppressed by specific siRNA transfection in AGS (gastric adenocarcinoma, 5637 (bladder tumor and U-87MG (brain tumor cell lines employing Lipofectamine reagent. Real-time PCR array technique was employed for RNA qualification. The fold changes were calculated using RT2 Profiler PCR array data analysis software version 3.5. Results: Our results indicated that fifteen genes (from 36 studied genes were down-regulated and two genes (DNAJC11 and DNAJC5B were up-regulated in all three studied tumor cell lines by approximately more than two folds. The result of other studied genes (19 genes showed different expressional pattern (up or down-expression based on tumor cell lines. Conclusion: According to the findings of the present study, we may suggest that there is a direct correlation between OCT4B1 expression in tumor cell lines (and tissues and HSP40 family gene expressions to escape from apoptosis and cancer expansion.

  1. Molecular cloning of a human gene that is a member of the nerve growth factor family

    Energy Technology Data Exchange (ETDEWEB)

    Jones, K.R.; Reichardt, L.F. (Howard Hughes Medical Institute, San Francisco, CA (USA))

    1990-10-01

    Cell death within the developing vertebrate nervous system is regulated in part by interactions between neurons and their innervation targets that are mediated by neurotrophic factors. These factors also appear to have a role in the maintenance of the adult nervous system. Two neurotrophic factors, nerve growth factor and brain-derived neurotrophic factor, share substantial amino acid sequence identity. The authors have used a screen that combines polymerase chain reaction amplification of genomic DNA and low-stringency hybridization with degenerate oligonucleotides to isolate human BDNF and a human gene, neurotrophin-3, that is closely related to both nerve growth factor and brain-derived neurotrophic factor. mRNA products of the brain-derived neurotrophic factor and neurotrophin-3 genes were detected in the adult human brain, suggesting that these proteins are involved in the maintenance of the adult nervous system. Neurotrophin-3 is also expected to function in embryonic neural development.

  2. Global and disease-associated genetic variation in the human Fanconi anemia gene family

    OpenAIRE

    Rogers, Kai J.; Fu, Wenqing; Akey, Joshua M.; Monnat, Raymond J.

    2014-01-01

    Fanconi anemia (FA) is a human recessive genetic disease resulting from inactivating mutations in any of 16 FANC (Fanconi) genes. Individuals with FA are at high risk of developmental abnormalities, early bone marrow failure and leukemia. These are followed in the second and subsequent decades by a very high risk of carcinomas of the head and neck and anogenital region, and a small continuing risk of leukemia. In order to characterize base pair-level disease-associated (DA) and population gen...

  3. Global and disease-associated genetic variation in the human Fanconi anemia gene family.

    Science.gov (United States)

    Rogers, Kai J; Fu, Wenqing; Akey, Joshua M; Monnat, Raymond J

    2014-12-20

    Fanconi anemia (FA) is a human recessive genetic disease resulting from inactivating mutations in any of 16 FANC (Fanconi) genes. Individuals with FA are at high risk of developmental abnormalities, early bone marrow failure and leukemia. These are followed in the second and subsequent decades by a very high risk of carcinomas of the head and neck and anogenital region, and a small continuing risk of leukemia. In order to characterize base pair-level disease-associated (DA) and population genetic variation in FANC genes and the segregation of this variation in the human population, we identified 2948 unique FANC gene variants including 493 FA DA variants across 57,240 potential base pair variation sites in the 16 FANC genes. We then analyzed the segregation of this variation in the 7578 subjects included in the Exome Sequencing Project (ESP) and the 1000 Genomes Project (1KGP). There was a remarkably high frequency of FA DA variants in ESP/1KGP subjects: at least 1 FA DA variant was identified in 78.5% (5950 of 7578) individuals included in these two studies. Six widely used functional prediction algorithms correctly identified only a third of the known, DA FANC missense variants. We also identified FA DA variants that may be good candidates for different types of mutation-specific therapies. Our results demonstrate the power of direct DNA sequencing to detect, estimate the frequency of and follow the segregation of deleterious genetic variation in human populations. © The Author 2014. Published by Oxford University Press. All rights reserved. For Permissions, please email: journals.permissions@oup.com.

  4. Human Gene Therapy: Genes without Frontiers?

    Science.gov (United States)

    Simon, Eric J.

    2002-01-01

    Describes the latest advancements and setbacks in human gene therapy to provide reference material for biology teachers to use in their science classes. Focuses on basic concepts such as recombinant DNA technology, and provides examples of human gene therapy such as severe combined immunodeficiency syndrome, familial hypercholesterolemia, and…

  5. Genetic variation in a member of the laminin gene family affects variation in body composition in Drosophila and humans

    Directory of Open Access Journals (Sweden)

    Hunter Gary R

    2008-08-01

    Full Text Available Abstract Background The objective of the present study was to map candidate loci influencing naturally occurring variation in triacylglycerol (TAG storage using quantitative complementation procedures in Drosophila melanogaster. Based on our results from Drosophila, we performed a human population-based association study to investigate the effect of natural variation in LAMA5 gene on body composition in humans. Results We identified four candidate genes that contributed to differences in TAG storage between two strains of D. melanogaster, including Laminin A (LanA, which is a member of the α subfamily of laminin chains. We confirmed the effects of this gene using a viable LanA mutant and showed that female flies homozygous for the mutation had significantly lower TAG storage, body weight, and total protein content than control flies. Drosophila LanA is closely related to human LAMA5 gene, which maps to the well-replicated obesity-linkage region on chromosome 20q13.2-q13.3. We tested for association between three common single nucleotide polymorphisms (SNPs in the human LAMA5 gene and variation in body composition and lipid profile traits in a cohort of unrelated women of European American (EA and African American (AA descent. In both ethnic groups, we found that SNP rs659822 was associated with weight (EA: P = 0.008; AA: P = 0.05 and lean mass (EA: P= 0.003; AA: P = 0.03. We also found this SNP to be associated with height (P = 0.01, total fat mass (P = 0.01, and HDL-cholesterol (P = 0.003 but only in EA women. Finally, significant associations of SNP rs944895 with serum TAG levels (P = 0.02 and HDL-cholesterol (P = 0.03 were observed in AA women. Conclusion Our results suggest an evolutionarily conserved role of a member of the laminin gene family in contributing to variation in weight and body composition.

  6. Molecular cloning of the human eosinophil-derived neurotoxin: A member of the ribonuclease gene family

    International Nuclear Information System (INIS)

    Rosenberg, H.F.; Tenen, D.G.; Ackerman, S.J.

    1989-01-01

    The authors have isolated a 725-base-pair cDNA clone for human eosinophil-derived neurotoxin (EDN). EDN is a distinct cationic protein of the eosinophil's large specific granule known primarily for its ability to induce ataxia, paralysis, and central nervous system cellular degeneration in experimental animals (Gordon phenomenon). The open reading frame encodes a 134-amino acid mature polypeptide with a molecular mass of 15.5 kDa and a 27-residue amino-terminal hydrophobic leader sequence. The sequence of the mature polypeptide is identical to that reported for human urinary ribonuclease, and to the amino-terminal sequence of human liver ribonuclease; the cDNA encodes a tryptophan in position 7. Both EDN and the related granule protein, eosinophil cationic protein, have ribonucleolytic activity; sequence similarities among EDN, eosinophil cationic protein, ribonucleases from liver, urine, and pancreas, and angiogenin define a ribonuclease multigene family. mRNA encoding EDN was detected in uninduced HL-60 cells and was up-regulated in cells induced toward eosinophilic differentiation with B-cell growth factor 2/interleukin 5 and toward neutrophilic differentiation with dimethyl sulfoxide. EDN mRNA was detected in mature neutrophils even though EDN-like neurotoxic activity is not found neutrophil extracts. These results suggest that neutrophils contain a protein that is closely related or identical to EDN

  7. The Human Gene SLC25A29, of Solute Carrier Family 25, Encodes a Mitochondrial Transporter of Basic Amino Acids*

    Science.gov (United States)

    Porcelli, Vito; Fiermonte, Giuseppe; Longo, Antonella; Palmieri, Ferdinando

    2014-01-01

    The human genome encodes 53 members of the solute carrier family 25 (SLC25), also called the mitochondrial carrier family, many of which have been shown to transport carboxylates, amino acids, nucleotides, and cofactors across the inner mitochondrial membrane, thereby connecting cytosolic and matrix functions. In this work, a member of this family, SLC25A29, previously reported to be a mitochondrial carnitine/acylcarnitine- or ornithine-like carrier, has been thoroughly characterized biochemically. The SLC25A29 gene was overexpressed in Escherichia coli, and the gene product was purified and reconstituted in phospholipid vesicles. Its transport properties and kinetic parameters demonstrate that SLC25A29 transports arginine, lysine, homoarginine, methylarginine and, to a much lesser extent, ornithine and histidine. Carnitine and acylcarnitines were not transported by SLC25A29. This carrier catalyzed substantial uniport besides a counter-exchange transport, exhibited a high transport affinity for arginine and lysine, and was saturable and inhibited by mercurial compounds and other inhibitors of mitochondrial carriers to various degrees. The main physiological role of SLC25A29 is to import basic amino acids into mitochondria for mitochondrial protein synthesis and amino acid degradation. PMID:24652292

  8. The human gene SLC25A29, of solute carrier family 25, encodes a mitochondrial transporter of basic amino acids.

    Science.gov (United States)

    Porcelli, Vito; Fiermonte, Giuseppe; Longo, Antonella; Palmieri, Ferdinando

    2014-05-09

    The human genome encodes 53 members of the solute carrier family 25 (SLC25), also called the mitochondrial carrier family, many of which have been shown to transport carboxylates, amino acids, nucleotides, and cofactors across the inner mitochondrial membrane, thereby connecting cytosolic and matrix functions. In this work, a member of this family, SLC25A29, previously reported to be a mitochondrial carnitine/acylcarnitine- or ornithine-like carrier, has been thoroughly characterized biochemically. The SLC25A29 gene was overexpressed in Escherichia coli, and the gene product was purified and reconstituted in phospholipid vesicles. Its transport properties and kinetic parameters demonstrate that SLC25A29 transports arginine, lysine, homoarginine, methylarginine and, to a much lesser extent, ornithine and histidine. Carnitine and acylcarnitines were not transported by SLC25A29. This carrier catalyzed substantial uniport besides a counter-exchange transport, exhibited a high transport affinity for arginine and lysine, and was saturable and inhibited by mercurial compounds and other inhibitors of mitochondrial carriers to various degrees. The main physiological role of SLC25A29 is to import basic amino acids into mitochondria for mitochondrial protein synthesis and amino acid degradation.

  9. The Caenorhabditis chemoreceptor gene families

    Directory of Open Access Journals (Sweden)

    Robertson Hugh M

    2008-10-01

    Full Text Available Abstract Background Chemoreceptor proteins mediate the first step in the transduction of environmental chemical stimuli, defining the breadth of detection and conferring stimulus specificity. Animal genomes contain families of genes encoding chemoreceptors that mediate taste, olfaction, and pheromone responses. The size and diversity of these families reflect the biology of chemoperception in specific species. Results Based on manual curation and sequence comparisons among putative G-protein-coupled chemoreceptor genes in the nematode Caenorhabditis elegans, we identified approximately 1300 genes and 400 pseudogenes in the 19 largest gene families, most of which fall into larger superfamilies. In the related species C. briggsae and C. remanei, we identified most or all genes in each of the 19 families. For most families, C. elegans has the largest number of genes and C. briggsae the smallest number, suggesting changes in the importance of chemoperception among the species. Protein trees reveal family-specific and species-specific patterns of gene duplication and gene loss. The frequency of strict orthologs varies among the families, from just over 50% in two families to less than 5% in three families. Several families include large species-specific expansions, mostly in C. elegans and C. remanei. Conclusion Chemoreceptor gene families in Caenorhabditis species are large and evolutionarily dynamic as a result of gene duplication and gene loss. These dynamics shape the chemoreceptor gene complements in Caenorhabditis species and define the receptor space available for chemosensory responses. To explain these patterns, we propose the gray pawn hypothesis: individual genes are of little significance, but the aggregate of a large number of diverse genes is required to cover a large phenotype space.

  10. The Caenorhabditis chemoreceptor gene families.

    Science.gov (United States)

    Thomas, James H; Robertson, Hugh M

    2008-10-06

    Chemoreceptor proteins mediate the first step in the transduction of environmental chemical stimuli, defining the breadth of detection and conferring stimulus specificity. Animal genomes contain families of genes encoding chemoreceptors that mediate taste, olfaction, and pheromone responses. The size and diversity of these families reflect the biology of chemoperception in specific species. Based on manual curation and sequence comparisons among putative G-protein-coupled chemoreceptor genes in the nematode Caenorhabditis elegans, we identified approximately 1300 genes and 400 pseudogenes in the 19 largest gene families, most of which fall into larger superfamilies. In the related species C. briggsae and C. remanei, we identified most or all genes in each of the 19 families. For most families, C. elegans has the largest number of genes and C. briggsae the smallest number, suggesting changes in the importance of chemoperception among the species. Protein trees reveal family-specific and species-specific patterns of gene duplication and gene loss. The frequency of strict orthologs varies among the families, from just over 50% in two families to less than 5% in three families. Several families include large species-specific expansions, mostly in C. elegans and C. remanei. Chemoreceptor gene families in Caenorhabditis species are large and evolutionarily dynamic as a result of gene duplication and gene loss. These dynamics shape the chemoreceptor gene complements in Caenorhabditis species and define the receptor space available for chemosensory responses. To explain these patterns, we propose the gray pawn hypothesis: individual genes are of little significance, but the aggregate of a large number of diverse genes is required to cover a large phenotype space.

  11. Gene cluster statistics with gene families.

    Science.gov (United States)

    Raghupathy, Narayanan; Durand, Dannie

    2009-05-01

    Identifying genomic regions that descended from a common ancestor is important for understanding the function and evolution of genomes. In distantly related genomes, clusters of homologous gene pairs are evidence of candidate homologous regions. Demonstrating the statistical significance of such "gene clusters" is an essential component of comparative genomic analyses. However, currently there are no practical statistical tests for gene clusters that model the influence of the number of homologs in each gene family on cluster significance. In this work, we demonstrate empirically that failure to incorporate gene family size in gene cluster statistics results in overestimation of significance, leading to incorrect conclusions. We further present novel analytical methods for estimating gene cluster significance that take gene family size into account. Our methods do not require complete genome data and are suitable for testing individual clusters found in local regions, such as contigs in an unfinished assembly. We consider pairs of regions drawn from the same genome (paralogous clusters), as well as regions drawn from two different genomes (orthologous clusters). Determining cluster significance under general models of gene family size is computationally intractable. By assuming that all gene families are of equal size, we obtain analytical expressions that allow fast approximation of cluster probabilities. We evaluate the accuracy of this approximation by comparing the resulting gene cluster probabilities with cluster probabilities obtained by simulating a realistic, power-law distributed model of gene family size, with parameters inferred from genomic data. Surprisingly, despite the simplicity of the underlying assumption, our method accurately approximates the true cluster probabilities. It slightly overestimates these probabilities, yielding a conservative test. We present additional simulation results indicating the best choice of parameter values for data

  12. Expression analysis of the CLCA gene family in mouse and human with emphasis on the nervous system

    NARCIS (Netherlands)

    M. Piirsoo (Marko); D. Meijer (Daniëlle); T. Timmusk (Tnis)

    2009-01-01

    textabstractBackground. Members of the calcium-activated chloride channel (CLCA) gene family have been suggested to possess a variety of functions including cell adhesion and tumor suppression. Expression of CLCA family members has mostly been analyzed in non-neural tissues. Here we describe the

  13. The Caenorhabditis chemoreceptor gene families

    OpenAIRE

    Robertson Hugh M; Thomas James H

    2008-01-01

    Abstract Background Chemoreceptor proteins mediate the first step in the transduction of environmental chemical stimuli, defining the breadth of detection and conferring stimulus specificity. Animal genomes contain families of genes encoding chemoreceptors that mediate taste, olfaction, and pheromone responses. The size and diversity of these families reflect the biology of chemoperception in specific species. Results Based on manual curation and sequence comparisons among putative G-protein-...

  14. Ex Vivo Gene Therapy Using Human Mesenchymal Stem Cells to Deliver Growth Factors in the Skeletal Muscle of a Familial ALS Rat Model.

    Science.gov (United States)

    Suzuki, Masatoshi; Svendsen, Clive N

    2016-01-01

    Therapeutic protein and molecule delivery to target sites by transplanted human stem cells holds great promise for ex vivo gene therapy. Our group has demonstrated the therapeutic benefits of ex vivo gene therapy targeting the skeletal muscles in a transgenic rat model of familial amyotrophic lateral sclerosis (ALS). We used human mesenchymal stem cells (hMSCs) and genetically modified them to release neuroprotective growth factors such as glial cell line-derived neurotrophic factor (GDNF) and vascular endothelial growth factor (VEGF). Intramuscular growth factor delivery via hMSCs can enhance neuromuscular innervation and motor neuron survival in a rat model of ALS (SOD1(G93A) transgenic rats). Here, we describe the protocol of ex vivo delivery of growth factors via lentiviral vector-mediated genetic modification of hMSCs and hMSC transplantation into the skeletal muscle of a familial ALS rat model.

  15. De novo amplification within a silent human cholinesterase gene in a family subjected to prolonged exposure to organophosphorus insecticides

    International Nuclear Information System (INIS)

    Prody, C.A.; Dreyfus, P.; Soreq, H.; Zamir, R.; Zakut, H.

    1989-01-01

    A 100-fold DNA amplification in the CHE gene, coding for serum butyrylcholinesterase (BtChoEase), was found in a farmer expressing silent CHE phenotype. Individuals homozygous for this gene display a defective serum BtChoEase and are particularly vulnerable to poisoning by agricultural organophosphorus insecticides, to which all members of this family had long been exposed. DNA blot hybridization with regional BtChoEase cDNA probes suggested that the amplification was most intense in regions encoding central sequences within BtChoEase cDNA, whereas distal sequences were amplified to a much lower extent. This is in agreement with the onion skin model, based on amplification of genes in cultured cells and primary tumors. The amplification was absent in the grandparents but present at the same extent in one of their sons and in a grandson, with similar DNA blot hybridization patterns. In situ hybridization experiments localized the amplified sequences to the long arm of chromosome 3, close to the site where the authors previously mapped the CHE gene. Altogether, these observations suggest that the initial amplification event occurred early in embryogenesis, spermatogenesis, or oogenesis, where the CHE gene is intensely active and where cholinergic functioning was indicated to be physiologically necessary. These findings demonstrate a de novo amplification in apparently healthy individuals within an autosomal gene producing a target protein to an inhibitor

  16. Genome-Wide Comparative Gene Family Classification

    Science.gov (United States)

    Frech, Christian; Chen, Nansheng

    2010-01-01

    Correct classification of genes into gene families is important for understanding gene function and evolution. Although gene families of many species have been resolved both computationally and experimentally with high accuracy, gene family classification in most newly sequenced genomes has not been done with the same high standard. This project has been designed to develop a strategy to effectively and accurately classify gene families across genomes. We first examine and compare the performance of computer programs developed for automated gene family classification. We demonstrate that some programs, including the hierarchical average-linkage clustering algorithm MC-UPGMA and the popular Markov clustering algorithm TRIBE-MCL, can reconstruct manual curation of gene families accurately. However, their performance is highly sensitive to parameter setting, i.e. different gene families require different program parameters for correct resolution. To circumvent the problem of parameterization, we have developed a comparative strategy for gene family classification. This strategy takes advantage of existing curated gene families of reference species to find suitable parameters for classifying genes in related genomes. To demonstrate the effectiveness of this novel strategy, we use TRIBE-MCL to classify chemosensory and ABC transporter gene families in C. elegans and its four sister species. We conclude that fully automated programs can establish biologically accurate gene families if parameterized accordingly. Comparative gene family classification finds optimal parameters automatically, thus allowing rapid insights into gene families of newly sequenced species. PMID:20976221

  17. Mutation profile of all 49 exons of the human myosin VIIA gene, and haplotype analysis, in Usher 1B families from diverse origins.

    Science.gov (United States)

    Adato, A; Weil, D; Kalinski, H; Pel-Or, Y; Ayadi, H; Petit, C; Korostishevsky, M; Bonne-Tamir, B

    1997-10-01

    Usher syndrome types I (USH1A-USH1E) are a group of autosomal recessive diseases characterized by profound congenital hearing loss, vestibular areflexia, and progressive visual loss due to retinitis pigmentosa. The human myosin VIIA gene, located on 11q14, has been shown to be responsible for Usher syndrome type 1B (USH1B). Haplotypes were constructed in 28 USH1 families by use of the following polymorphic markers spanning the USH1B locus: D11S787, D11S527, D11S1789, D11S906, D11S4186, and OMP. Affected individuals and members of their families from 12 different ethnic origins were screened for the presence of mutations in all 49 exons of the myosin VIIA gene. In 15 families myosin VIIA mutations were detected, verifying their classification as USH1B. All these mutations are novel, including three missense mutations, one premature stop codon, two splicing mutations, one frameshift, and one deletion of >2 kb comprising exons 47 and 48, a part of exon 49, and the introns between them. Three mutations were shared by more than one family, consistent with haplotype similarities. Altogether, 16 USH1B haplotypes were observed in the 15 families; most haplotypes were population specific. Several exonic and intronic polymorphisms were also detected. None of the 20 known USH1B mutations reported so far in other world populations were identified in our families.

  18. Comparative genome analysis of PHB gene family reveals deep evolutionary origins and diverse gene function.

    Science.gov (United States)

    Di, Chao; Xu, Wenying; Su, Zhen; Yuan, Joshua S

    2010-10-07

    PHB (Prohibitin) gene family is involved in a variety of functions important for different biological processes. PHB genes are ubiquitously present in divergent species from prokaryotes to eukaryotes. Human PHB genes have been found to be associated with various diseases. Recent studies by our group and others have shown diverse function of PHB genes in plants for development, senescence, defence, and others. Despite the importance of the PHB gene family, no comprehensive gene family analysis has been carried to evaluate the relatedness of PHB genes across different species. In order to better guide the gene function analysis and understand the evolution of the PHB gene family, we therefore carried out the comparative genome analysis of the PHB genes across different kingdoms. The relatedness, motif distribution, and intron/exon distribution all indicated that PHB genes is a relatively conserved gene family. The PHB genes can be classified into 5 classes and each class have a very deep evolutionary origin. The PHB genes within the class maintained the same motif patterns during the evolution. With Arabidopsis as the model species, we found that PHB gene intron/exon structure and domains are also conserved during the evolution. Despite being a conserved gene family, various gene duplication events led to the expansion of the PHB genes. Both segmental and tandem gene duplication were involved in Arabidopsis PHB gene family expansion. However, segmental duplication is predominant in Arabidopsis. Moreover, most of the duplicated genes experienced neofunctionalization. The results highlighted that PHB genes might be involved in important functions so that the duplicated genes are under the evolutionary pressure to derive new function. PHB gene family is a conserved gene family and accounts for diverse but important biological functions based on the similar molecular mechanisms. The highly diverse biological function indicated that more research needs to be carried out

  19. The role of imprinted genes in humans

    OpenAIRE

    Ishida, Miho; Moore, Gudrun E.

    2013-01-01

    Detailed comprehensive molecular analysis using families and multiple matched tissues is essential to determine whether imprinted genes have a functional role in humans. See research article: http://genomebiology.com/2011/12/3/R25

  20. Expression of members of immunoglobulin gene family in somatic cell hybrids between human B and T cells

    International Nuclear Information System (INIS)

    Kozbor, D.; Burioni, R.; Ar-Rushdi, A.; Zmijewski, C.; Croce, C.M.

    1987-01-01

    Somatic cell hybrids were obtained between human T and B cells and tested for the expression of differentiated traits of both cell lineages. The T-cell parent SUP-T1 is CD3 - , CD4 + , CD1 + , CD8 + , is weakly positive for HLA class I determinants, and has an inversion of chromosome 14 due to a site-specific recombination event between an immunoglobulin heavy-chain variable gene and the joining segment of the T-cell receptor α chain. The B-cell parent, the 6-thioguanine- and ouabain-resistant mutant GM1500, is a lymphoblastoid cell line that secretes IgG2, K chains, and expresses B1, B532, and HLA class I and II antigens. All hybrids expressed characteristics of B cells (Ig + , B1 + , B532 + , EBNA + , HLA antigens), whereas only CD4 among the T-cell markers was expressed. The level of T-cell receptor β-chain transcript was greatly reduced and no RNA of the chimeric T-cell receptor α-chain joining segment-immunoglobulin heavy-chain variable region was detected. Southern blot analysis indicated that absence of T-cell differentiation markers in the hybrids was not due to chromosomal loss. Rather, some B-cell-specific factor present in the hybrids may account for the suppression

  1. Human proton/oligopeptide transporter (POT) genes

    DEFF Research Database (Denmark)

    Botka, C. W.; Wittig, T. W.; Graul, R. C.

    2000-01-01

    The proton-dependent oligopeptide transporters (POT) gene family currently consists of approximately 70 cloned cDNAs derived from diverse organisms. In mammals, two genes encoding peptide transporters, PepT1 and PepT2 have been cloned in several species including humans, in addition to a rat...... histidine/peptide transporter (rPHT1). Because the Candida elegans genome contains five putative POT genes, we searched the available protein and nucleic acid databases for additional mammalian/human POT genes, using iterative BLAST runs and the human expressed sequence tags (EST) database. The apparent...... and introns of the likely human orthologue (termed hPHT2). Northern analyses with EST clones indicated that hPHT1 is primarily expressed in skeletal muscle and spleen, whereas hPHT2 is found in spleen, placenta, lung, leukocytes, and heart. These results suggest considerable complexity of the human POT gene...

  2. Msx homeobox gene family and craniofacial development.

    Science.gov (United States)

    Alappat, Sylvia; Zhang, Zun Yi; Chen, Yi Ping

    2003-12-01

    Vertebrate Msx genes are unlinked, homeobox-containing genes that bear homology to the Drosophila muscle segment homeobox gene. These genes are expressed at multiple sites of tissue-tissue interactions during vertebrate embryonic development. Inductive interactions mediated by the Msx genes are essential for normal craniofacial, limb and ectodermal organ morphogenesis, and are also essential to survival in mice, as manifested by the phenotypic abnormalities shown in knockout mice and in humans. This review summarizes studies on the expression, regulation, and functional analysis of Msx genes that bear relevance to craniofacial development in humans and mice. Key words: Msx genes, craniofacial, tooth, cleft palate, suture, development, transcription factor, signaling molecule.

  3. Gene family size conservation is a good indicator of evolutionary rates.

    Science.gov (United States)

    Chen, Feng-Chi; Chen, Chiuan-Jung; Li, Wen-Hsiung; Chuang, Trees-Juen

    2010-08-01

    The evolution of duplicate genes has been a topic of broad interest. Here, we propose that the conservation of gene family size is a good indicator of the rate of sequence evolution and some other biological properties. By comparing the human-chimpanzee-macaque orthologous gene families with and without family size conservation, we demonstrate that genes with family size conservation evolve more slowly than those without family size conservation. Our results further demonstrate that both family expansion and contraction events may accelerate gene evolution, resulting in elevated evolutionary rates in the genes without family size conservation. In addition, we show that the duplicate genes with family size conservation evolve significantly more slowly than those without family size conservation. Interestingly, the median evolutionary rate of singletons falls in between those of the above two types of duplicate gene families. Our results thus suggest that the controversy on whether duplicate genes evolve more slowly than singletons can be resolved when family size conservation is taken into consideration. Furthermore, we also observe that duplicate genes with family size conservation have the highest level of gene expression/expression breadth, the highest proportion of essential genes, and the lowest gene compactness, followed by singletons and then by duplicate genes without family size conservation. Such a trend accords well with our observations of evolutionary rates. Our results thus point to the importance of family size conservation in the evolution of duplicate genes.

  4. The Human SLC25A33 and SLC25A36 Genes of Solute Carrier Family 25 Encode Two Mitochondrial Pyrimidine Nucleotide Transporters*

    Science.gov (United States)

    Di Noia, Maria Antonietta; Todisco, Simona; Cirigliano, Angela; Rinaldi, Teresa; Agrimi, Gennaro; Iacobazzi, Vito; Palmieri, Ferdinando

    2014-01-01

    The human genome encodes 53 members of the solute carrier family 25 (SLC25), also called the mitochondrial carrier family, many of which have been shown to transport inorganic anions, amino acids, carboxylates, nucleotides, and coenzymes across the inner mitochondrial membrane, thereby connecting cytosolic and matrix functions. Here two members of this family, SLC25A33 and SLC25A36, have been thoroughly characterized biochemically. These proteins were overexpressed in bacteria and reconstituted in phospholipid vesicles. Their transport properties and kinetic parameters demonstrate that SLC25A33 transports uracil, thymine, and cytosine (deoxy)nucleoside di- and triphosphates by an antiport mechanism and SLC25A36 cytosine and uracil (deoxy)nucleoside mono-, di-, and triphosphates by uniport and antiport. Both carriers also transported guanine but not adenine (deoxy)nucleotides. Transport catalyzed by both carriers was saturable and inhibited by mercurial compounds and other inhibitors of mitochondrial carriers to various degrees. In confirmation of their identity (i) SLC25A33 and SLC25A36 were found to be targeted to mitochondria and (ii) the phenotypes of Saccharomyces cerevisiae cells lacking RIM2, the gene encoding the well characterized yeast mitochondrial pyrimidine nucleotide carrier, were overcome by expressing SLC25A33 or SLC25A36 in these cells. The main physiological role of SLC25A33 and SLC25A36 is to import/export pyrimidine nucleotides into and from mitochondria, i.e. to accomplish transport steps essential for mitochondrial DNA and RNA synthesis and breakdown. PMID:25320081

  5. The human SLC25A33 and SLC25A36 genes of solute carrier family 25 encode two mitochondrial pyrimidine nucleotide transporters.

    Science.gov (United States)

    Di Noia, Maria Antonietta; Todisco, Simona; Cirigliano, Angela; Rinaldi, Teresa; Agrimi, Gennaro; Iacobazzi, Vito; Palmieri, Ferdinando

    2014-11-28

    The human genome encodes 53 members of the solute carrier family 25 (SLC25), also called the mitochondrial carrier family, many of which have been shown to transport inorganic anions, amino acids, carboxylates, nucleotides, and coenzymes across the inner mitochondrial membrane, thereby connecting cytosolic and matrix functions. Here two members of this family, SLC25A33 and SLC25A36, have been thoroughly characterized biochemically. These proteins were overexpressed in bacteria and reconstituted in phospholipid vesicles. Their transport properties and kinetic parameters demonstrate that SLC25A33 transports uracil, thymine, and cytosine (deoxy)nucleoside di- and triphosphates by an antiport mechanism and SLC25A36 cytosine and uracil (deoxy)nucleoside mono-, di-, and triphosphates by uniport and antiport. Both carriers also transported guanine but not adenine (deoxy)nucleotides. Transport catalyzed by both carriers was saturable and inhibited by mercurial compounds and other inhibitors of mitochondrial carriers to various degrees. In confirmation of their identity (i) SLC25A33 and SLC25A36 were found to be targeted to mitochondria and (ii) the phenotypes of Saccharomyces cerevisiae cells lacking RIM2, the gene encoding the well characterized yeast mitochondrial pyrimidine nucleotide carrier, were overcome by expressing SLC25A33 or SLC25A36 in these cells. The main physiological role of SLC25A33 and SLC25A36 is to import/export pyrimidine nucleotides into and from mitochondria, i.e. to accomplish transport steps essential for mitochondrial DNA and RNA synthesis and breakdown. © 2014 by The American Society for Biochemistry and Molecular Biology, Inc.

  6. Interferon induced IFIT family genes in host antiviral defense.

    Science.gov (United States)

    Zhou, Xiang; Michal, Jennifer J; Zhang, Lifan; Ding, Bo; Lunney, Joan K; Liu, Bang; Jiang, Zhihua

    2013-01-01

    Secretion of interferons (IFNs) from virus-infected cells is a hallmark of host antiviral immunity and in fact, IFNs exert their antiviral activities through the induction of antiviral proteins. The IFN-induced protein with tetratricopeptide repeats (IFITs) family is among hundreds of IFN-stimulated genes. This family contains a cluster of duplicated loci. Most mammals have IFIT1, IFIT2, IFIT3 and IFIT5; however, bird, marsupial, frog and fish have only IFIT5. Regardless of species, IFIT5 is always adjacent to SLC16A12. IFIT family genes are predominantly induced by type I and type III interferons and are regulated by the pattern recognition and the JAK-STAT signaling pathway. IFIT family proteins are involved in many processes in response to viral infection. However, some viruses can escape the antiviral functions of the IFIT family by suppressing IFIT family genes expression or methylation of 5' cap of viral molecules. In addition, the variants of IFIT family genes could significantly influence the outcome of hepatitis C virus (HCV) therapy. We believe that our current review provides a comprehensive picture for the community to understand the structure and function of IFIT family genes in response to pathogens in human, as well as in animals.

  7. Metagenomic identification of a novel salt tolerance gene from the human gut microbiome which encodes a membrane protein with homology to a brp/blh-family β-carotene 15,15'-monooxygenase.

    Directory of Open Access Journals (Sweden)

    Eamonn P Culligan

    Full Text Available The human gut microbiome consists of at least 3 million non-redundant genes, 150 times that of the core human genome. Herein, we report the identification and characterisation of a novel stress tolerance gene from the human gut metagenome. The locus, assigned brpA, encodes a membrane protein with homology to a brp/blh-family β-carotene monooxygenase. Cloning and heterologous expression of brpA in Escherichia coli confers a significant salt tolerance phenotype. Furthermore, when cultured in the presence of exogenous β-carotene, cell pellets adopt a red/orange pigmentation indicating the incorporation of carotenoids in the cell membrane.

  8. Molecular Evolution of the Glycosyltransferase 6 Gene Family in Primates

    Directory of Open Access Journals (Sweden)

    Eliane Evanovich

    2016-01-01

    Full Text Available Glycosyltransferase 6 gene family includes ABO, Ggta1, iGb3S, and GBGT1 genes and by three putative genes restricted to mammals, GT6m6, GTm6, and GT6m7, only the latter is found in primates. GT6 genes may encode functional and nonfunctional proteins. Ggta1 and GBGT1 genes, for instance, are pseudogenes in catarrhine primates, while iGb3S gene is only inactive in human, bonobo, and chimpanzee. Even inactivated, these genes tend to be conversed in primates. As some of the GT6 genes are related to the susceptibility or resistance to parasites, we investigated (i the selective pressure on the GT6 paralogs genes in primates; (ii the basis of the conservation of iGb3S in human, chimpanzee, and bonobo; and (iii the functional potential of the GBGT1 and GT6m7 in catarrhines. We observed that the purifying selection is prevalent and these genes have a low diversity, though ABO and Ggta1 genes have some sites under positive selection. GT6m7, a putative gene associated with aggressive periodontitis, may have regulatory function, but experimental studies are needed to assess its function. The evolutionary conservation of iGb3S in humans, chimpanzee, and bonobo seems to be the result of proximity to genes with important biological functions.

  9. Chromosomal evolution of the PKD1 gene family in primates

    Directory of Open Access Journals (Sweden)

    Krawczak Michael

    2008-09-01

    Full Text Available Abstract Background The autosomal dominant polycystic kidney disease (ADPKD is mostly caused by mutations in the PKD1 (polycystic kidney disease 1 gene located in 16p13.3. Moreover, there are six pseudogenes of PKD1 that are located proximal to the master gene in 16p13.1. In contrast, no pseudogene could be detected in the mouse genome, only a single copy gene on chromosome 17. The question arises how the human situation originated phylogenetically. To address this question we applied comparative FISH-mapping of a human PKD1-containing genomic BAC clone and a PKD1-cDNA clone to chromosomes of a variety of primate species and the dog as a non-primate outgroup species. Results Comparative FISH with the PKD1-cDNA clone clearly shows that in all primate species studied distinct single signals map in subtelomeric chromosomal positions orthologous to the short arm of human chromosome 16 harbouring the master PKD1 gene. Only in human and African great apes, but not in orangutan, FISH with both BAC and cDNA clones reveals additional signal clusters located proximal of and clearly separated from the PKD1 master genes indicating the chromosomal position of PKD1 pseudogenes in 16p of these species, respectively. Indeed, this is in accordance with sequencing data in human, chimpanzee and orangutan. Apart from the master PKD1 gene, six pseudogenes are identified in both, human and chimpanzee, while only a single-copy gene is present in the whole-genome sequence of orangutan. The phylogenetic reconstruction of the PKD1-tree reveals that all human pseudogenes are closely related to the human PKD1 gene, and all chimpanzee pseudogenes are closely related to the chimpanzee PKD1 gene. However, our statistical analyses provide strong indication that gene conversion events may have occurred within the PKD1 family members of human and chimpanzee, respectively. Conclusion PKD1 must have undergone amplification very recently in hominid evolution. Duplicative

  10. Leiomodins: larger members of the tropomodulin (Tmod) gene family

    Science.gov (United States)

    Conley, C. A.; Fritz-Six, K. L.; Almenar-Queralt, A.; Fowler, V. M.

    2001-01-01

    The 64-kDa autoantigen D1 or 1D, first identified as a potential autoantigen in Graves' disease, is similar to the tropomodulin (Tmod) family of actin filament pointed end-capping proteins. A novel gene with significant similarity to the 64-kDa human autoantigen D1 has been cloned from both humans and mice, and the genomic sequences of both genes have been identified. These genes form a subfamily closely related to the Tmods and are here named the Leiomodins (Lmods). Both Lmod genes display a conserved intron-exon structure, as do three Tmod genes, but the intron-exon structure of the Lmods and the Tmods is divergent. mRNA expression analysis indicates that the gene formerly known as the 64-kDa autoantigen D1 is most highly expressed in a variety of human tissues that contain smooth muscle, earning it the name smooth muscle Leiomodin (SM-Lmod; HGMW-approved symbol LMOD1). Transcripts encoding the novel Lmod gene are present exclusively in fetal and adult heart and adult skeletal muscle, and it is here named cardiac Leiomodin (C-Lmod; HGMW-approved symbol LMOD2). Human C-Lmod is located near the hypertrophic cardiomyopathy locus CMH6 on human chromosome 7q3, potentially implicating it in this disease. Our data demonstrate that the Lmods are evolutionarily related and display tissue-specific patterns of expression distinct from, but overlapping with, the expression of Tmod isoforms. Copyright 2001 Academic Press.

  11. The ACBP gene family in Rhodnius prolixus

    DEFF Research Database (Denmark)

    Majerowicz, David; Hannibal-Bach, Hans K; Castro, Rodolfo S C

    2016-01-01

    The acyl-CoA-binding proteins (ACBP) constitute a family of conserved proteins that bind acyl-CoA with high affinity and protect it from hydrolysis. Thus, ACBPs may have essential roles in basal cellular lipid metabolism. The genome of the insect Rhodnius prolixus encodes five ACBP genes similar...

  12. Genes, Environment, and Human Behavior.

    Science.gov (United States)

    Bloom, Mark V.; Cutter, Mary Ann; Davidson, Ronald; Dougherty, Michael J.; Drexler, Edward; Gelernter, Joel; McCullough, Laurence B.; McInerney, Joseph D.; Murray, Jeffrey C.; Vogler, George P.; Zola, John

    This curriculum module explores genes, environment, and human behavior. This book provides materials to teach about the nature and methods of studying human behavior, raise some of the ethical and public policy dilemmas emerging from the Human Genome Project, and provide professional development for teachers. An extensive Teacher Background…

  13. The Eucalyptus terpene synthase gene family.

    Science.gov (United States)

    Külheim, Carsten; Padovan, Amanda; Hefer, Charles; Krause, Sandra T; Köllner, Tobias G; Myburg, Alexander A; Degenhardt, Jörg; Foley, William J

    2015-06-11

    Terpenoids are abundant in the foliage of Eucalyptus, providing the characteristic smell as well as being valuable economically and influencing ecological interactions. Quantitative and qualitative inter- and intra- specific variation of terpenes is common in eucalypts. The genome sequences of Eucalyptus grandis and E. globulus were mined for terpene synthase genes (TPS) and compared to other plant species. We investigated the relative expression of TPS in seven plant tissues and functionally characterized five TPS genes from E. grandis. Compared to other sequenced plant genomes, Eucalyptus grandis has the largest number of putative functional TPS genes of any sequenced plant. We discovered 113 and 106 putative functional TPS genes in E. grandis and E. globulus, respectively. All but one TPS from E. grandis were expressed in at least one of seven plant tissues examined. Genomic clusters of up to 20 genes were identified. Many TPS are expressed in tissues other than leaves which invites a re-evaluation of the function of terpenes in Eucalyptus. Our data indicate that terpenes in Eucalyptus may play a wider role in biotic and abiotic interactions than previously thought. Tissue specific expression is common and the possibility of stress induction needs further investigation. Phylogenetic comparison of the two investigated Eucalyptus species gives insight about recent evolution of different clades within the TPS gene family. While the majority of TPS genes occur in orthologous pairs some clades show evidence of recent gene duplication, as well as loss of function.

  14. Evolution of the vertebrate insulin receptor substrate (Irs) gene family.

    Science.gov (United States)

    Al-Salam, Ahmad; Irwin, David M

    2017-06-23

    Insulin receptor substrate (Irs) proteins are essential for insulin signaling as they allow downstream effectors to dock with, and be activated by, the insulin receptor. A family of four Irs proteins have been identified in mice, however the gene for one of these, IRS3, has been pseudogenized in humans. While it is known that the Irs gene family originated in vertebrates, it is not known when it originated and which members are most closely related to each other. A better understanding of the evolution of Irs genes and proteins should provide insight into the regulation of metabolism by insulin. Multiple genes for Irs proteins were identified in a wide variety of vertebrate species. Phylogenetic and genomic neighborhood analyses indicate that this gene family originated very early in vertebrae evolution. Most Irs genes were duplicated and retained in fish after the fish-specific genome duplication. Irs genes have been lost of various lineages, including Irs3 in primates and birds and Irs1 in most fish. Irs3 and Irs4 experienced an episode of more rapid protein sequence evolution on the ancestral mammalian lineage. Comparisons of the conservation of the proteins sequences among Irs paralogs show that domains involved in binding to the plasma membrane and insulin receptors are most strongly conserved, while divergence has occurred in sequences involved in interacting with downstream effector proteins. The Irs gene family originated very early in vertebrate evolution, likely through genome duplications, and in parallel with duplications of other components of the insulin signaling pathway, including insulin and the insulin receptor. While the N-terminal sequences of these proteins are conserved among the paralogs, changes in the C-terminal sequences likely allowed changes in biological function.

  15. The claudin gene family: expression in normal and neoplastic tissues

    International Nuclear Information System (INIS)

    Hewitt, Kyle J; Agarwal, Rachana; Morin, Patrice J

    2006-01-01

    The claudin (CLDN) genes encode a family of proteins important in tight junction formation and function. Recently, it has become apparent that CLDN gene expression is frequently altered in several human cancers. However, the exact patterns of CLDN expression in various cancers is unknown, as only a limited number of CLDN genes have been investigated in a few tumors. We identified all the human CLDN genes from Genbank and we used the large public SAGE database to ascertain the gene expression of all 21 CLDN in 266 normal and neoplastic tissues. Using real-time RT-PCR, we also surveyed a subset of 13 CLDN genes in 24 normal and 24 neoplastic tissues. We show that claudins represent a family of highly related proteins, with claudin-16, and -23 being the most different from the others. From in silico analysis and RT-PCR data, we find that most claudin genes appear decreased in cancer, while CLDN3, CLDN4, and CLDN7 are elevated in several malignancies such as those originating from the pancreas, bladder, thyroid, fallopian tubes, ovary, stomach, colon, breast, uterus, and the prostate. Interestingly, CLDN5 is highly expressed in vascular endothelial cells, providing a possible target for antiangiogenic therapy. CLDN18 might represent a biomarker for gastric cancer. Our study confirms previously known CLDN gene expression patterns and identifies new ones, which may have applications in the detection, prognosis and therapy of several human cancers. In particular we identify several malignancies that express CLDN3 and CLDN4. These cancers may represent ideal candidates for a novel therapy being developed based on CPE, a toxin that specifically binds claudin-3 and claudin-4

  16. One Family's Struggles with HPV (Human Papillomavirus)

    Medline Plus

    Full Text Available ... GETVAXED print ads go to GETVAXED.ORG cme Immunizations HPV (Human Papillomavirus) One family's struggles with HPV ... not possible without a visit to your doctor. Immunizations stop disease from spreading. Check with your family ...

  17. Structure and chromosomal localization of the human renal kallikrein gene

    International Nuclear Information System (INIS)

    Evans, B.A.; Yun, Z.X.; Close, J.A.

    1988-01-01

    Glandular kallikreins are a family of proteases encoded by a variable number of genes in different mammalian species. In all species examined, however, one particular kallikrein is functionally conserved in its capacity to release the vasoactive peptide, Lys-bradykinin, from low molecular weight kininogen. This kallikrein is found in the kidney, pancreas, and salivary gland, showing a unique pattern of tissue-specific expression relative to other members of the family. The authors have isolated a genomic clone carrying the human renal kallikrein gene and compared the nucleotide sequence of its promoter region with those of the mouse renal kallikrein gene and another mouse kallikrein gene expressed in a distinct cell type. They find four sequence elements conserved between renal kallikrein genes from the two species. They have also shown that the human gene is localized to 19q13, a position analogous to that of the kallikrein gene family on mouse chromosome 7

  18. Massive expansion of the calpain gene family in unicellular eukaryotes

    Directory of Open Access Journals (Sweden)

    Zhao Sen

    2012-09-01

    Full Text Available Abstract Background Calpains are Ca2+-dependent cysteine proteases that participate in a range of crucial cellular processes. Dysfunction of these enzymes may cause, for instance, life-threatening diseases in humans, the loss of sex determination in nematodes and embryo lethality in plants. Although the calpain family is well characterized in animal and plant model organisms, there is a great lack of knowledge about these genes in unicellular eukaryote species (i.e. protists. Here, we study the distribution and evolution of calpain genes in a wide range of eukaryote genomes from major branches in the tree of life. Results Our investigations reveal 24 types of protein domains that are combined with the calpain-specific catalytic domain CysPc. In total we identify 41 different calpain domain architectures, 28 of these domain combinations have not been previously described. Based on our phylogenetic inferences, we propose that at least four calpain variants were established in the early evolution of eukaryotes, most likely before the radiation of all the major supergroups of eukaryotes. Many domains associated with eukaryotic calpain genes can be found among eubacteria or archaebacteria but never in combination with the CysPc domain. Conclusions The analyses presented here show that ancient modules present in prokaryotes, and a few de novo eukaryote domains, have been assembled into many novel domain combinations along the evolutionary history of eukaryotes. Some of the new calpain genes show a narrow distribution in a few branches in the tree of life, likely representing lineage-specific innovations. Hence, the functionally important classical calpain genes found among humans and vertebrates make up only a tiny fraction of the calpain family. In fact, a massive expansion of the calpain family occurred by domain shuffling among unicellular eukaryotes and contributed to a wealth of functionally different genes.

  19. Massive expansion of the calpain gene family in unicellular eukaryotes.

    Science.gov (United States)

    Zhao, Sen; Liang, Zhe; Demko, Viktor; Wilson, Robert; Johansen, Wenche; Olsen, Odd-Arne; Shalchian-Tabrizi, Kamran

    2012-09-29

    Calpains are Ca2+-dependent cysteine proteases that participate in a range of crucial cellular processes. Dysfunction of these enzymes may cause, for instance, life-threatening diseases in humans, the loss of sex determination in nematodes and embryo lethality in plants. Although the calpain family is well characterized in animal and plant model organisms, there is a great lack of knowledge about these genes in unicellular eukaryote species (i.e. protists). Here, we study the distribution and evolution of calpain genes in a wide range of eukaryote genomes from major branches in the tree of life. Our investigations reveal 24 types of protein domains that are combined with the calpain-specific catalytic domain CysPc. In total we identify 41 different calpain domain architectures, 28 of these domain combinations have not been previously described. Based on our phylogenetic inferences, we propose that at least four calpain variants were established in the early evolution of eukaryotes, most likely before the radiation of all the major supergroups of eukaryotes. Many domains associated with eukaryotic calpain genes can be found among eubacteria or archaebacteria but never in combination with the CysPc domain. The analyses presented here show that ancient modules present in prokaryotes, and a few de novo eukaryote domains, have been assembled into many novel domain combinations along the evolutionary history of eukaryotes. Some of the new calpain genes show a narrow distribution in a few branches in the tree of life, likely representing lineage-specific innovations. Hence, the functionally important classical calpain genes found among humans and vertebrates make up only a tiny fraction of the calpain family. In fact, a massive expansion of the calpain family occurred by domain shuffling among unicellular eukaryotes and contributed to a wealth of functionally different genes.

  20. Genetic recombination at the human RH locus: A family study of the red-cell Evans phenotype reveals a transfer of exons 2-6 from the RHD to the RHCE gene

    Energy Technology Data Exchange (ETDEWEB)

    Huang, C.H.; Chen, Y.; Reid, M. [Lindsley F. Kimball Research Inst., New York, NY (United States); Ghosh, S.

    1996-10-01

    The human RH locus appears to consist of two structural genes, D and CE, which map on the short arm p34-36 of chromosome 1 and specify a most complex system of blood-group genetic polymorphisms. Here we describe a family study of the Evans (also known as {open_quotes}D..{open_quotes}) phenotype, a codominant trait associated with both qualitative and quantitative changes in D-antigen expression. A cataract-causing mutation was also inherited in this family and was apparently cotransmitted with Evans, suggesting a chromosomal linkage of these two otherwise unrelated traits. Southern blot analysis and allele-specific PCR showed the linkage of Evans with a SphI RFLP marker and the presence of a hybrid gene in the RH locus. To delineate the pattern of gene expression, the composition and structure of Rh-polypeptide transcripts were characterized by reverse transcriptase-PCR and nucleotide sequencing. This resulted in the identification of a novel Rh transcript expressed only in the Evans-positive erythroid cells. Sequence analysis showed that the transcript maintained a normal open reading frame but occurred as a CE-D-CE composite in which exons 2-6 of the CE gene were replaced by the homologous counterpart of the D gene. This hybrid gene was predicted to encode a CE-D-CE fusion protein whose surface expression correlates with the Evans phenotype. The mode and consequence of such a recombination event suggest the occurrence, in the RH locus, of a segmental DNA transfer via the mechanism of gene conversion. 31 refs., 6 figs., 1 tab.

  1. Identification and functional analysis of three distinct mutations in the human galactose-1-phosphate uridyltransferase gene associated with galactosemia in a single family

    Energy Technology Data Exchange (ETDEWEB)

    Fridovich-Keil, J.L.; Langley, S.D.; Mazur, L.A.; Lennon, J.C.; Dembure, P.O.; Elsas, L.J. II [Emory Univ. School of Medicine, Atlanta, GA (United States)

    1995-03-01

    We have identified three mutations associated with transferase-deficiency galactosemia in a three-generation family including affected members in two generations and have modeled all three mutations in a yeast-expression system. A sequence of pedigree, biochemical, and molecular analyses of the galactose-1-phosphate uridyltransferase (GALT) enzyme and genetic locus in both affected and carrier individuals revealed three distinct base substitutions in this family, two (Q188R and S135L) that had been reported previously and one (V151A) that was novel. Biochemical analyses of red-blood-cell lysates from the relevant family members suggested that each of these mutations was associated with dramatic impairment of GALT activity in these cells. While this observation was consistent with our previous findings concerning the Q188R mutation expressed both in humans and in a yeast-model system, it was at odds with a report by Reichardt and colleagues, indicating that in their COS cell-expression system the S135L substitution behaved as a neutral polymorphism. To address this apparent paradox, as well as to investigate the functional significance of the newly identified V151A substitution, all three mutations were recreated by site-directed mutagenesis of the otherwise wild-type human GALT sequence and were expressed both individually and in the appropriate allelic combinations in a GALT-deficient strain of the yeast Saccharomyces cerevisiae. The results of these yeast-modeling studies were fully consistent with the patient data, leading us to conclude that, at least within the context of the cell types studied, in the homozygous state Q188R is a mutation that eliminates GALT activity, and S135L and V151A are both mutations that impair GALT activity to <6% of wild-type values. 22 refs., 5 figs.

  2. Dlx homeobox gene family expression in osteoclasts.

    Science.gov (United States)

    Lézot, F; Thomas, B L; Blin-Wakkach, C; Castaneda, B; Bolanos, A; Hotton, D; Sharpe, P T; Heymann, D; Carles, G F; Grigoriadis, A E; Berdal, A

    2010-06-01

    Skeletal growth and homeostasis require the finely orchestrated secretion of mineralized tissue matrices by highly specialized cells, balanced with their degradation by osteoclasts. Time- and site-specific expression of Dlx and Msx homeobox genes in the cells secreting these matrices have been identified as important elements in the regulation of skeletal morphology. Such specific expression patterns have also been reported in osteoclasts for Msx genes. The aim of the present study was to establish the expression patterns of Dlx genes in osteoclasts and identify their function in regulating skeletal morphology. The expression patterns of all Dlx genes were examined during the whole osteoclastogenesis using different in vitro models. The results revealed that Dlx1 and Dlx2 are the only Dlx family members with a possible function in osteoclastogenesis as well as in mature osteoclasts. Dlx5 and Dlx6 were detected in the cultures but appear to be markers of monocytes and their derivatives. In vivo, Dlx2 expression in osteoclasts was examined using a Dlx2/LacZ transgenic mouse. Dlx2 is expressed in a subpopulation of osteoclasts in association with tooth, brain, nerve, and bone marrow volumetric growths. Altogether the present data suggest a role for Dlx2 in regulation of skeletal morphogenesis via functions within osteoclasts. (c) 2010 Wiley-Liss, Inc.

  3. Linkage studies and mutation analysis of the PDEB gene in 23 families with Leber congenital amaurosis

    DEFF Research Database (Denmark)

    Riess, O; Weber, B; Nørremølle, Anne

    1992-01-01

    as to whether mutations in the human PDEB gene might cause LCA. We have previously cloned and characterized the human homologue of the mouse Pdeb gene and have mapped it to chromosome 4p16.3. In this study, a total of 23 LCA families of various ethnic backgrounds have been investigated. Linkage analysis using...

  4. Identification of metalloprotease gene families in sugarcane

    Directory of Open Access Journals (Sweden)

    O.H.P. Ramos

    2001-12-01

    Full Text Available Metalloproteases play a key role in many physiological processes in mammals such as cell migration, tissue remodeling and processing of growth factors. They have also been identified as important factors in the patho-physiology of a number of human diseases, including cancer and hypertension. Many bacterial pathogens rely on proteases in order to infect the host. Several classes of metalloproteases have been described in humans, bacteria, snake venoms and insects. However, the presence and characterization of plant metalloproteases have rarely been described in the literature. In our research, we searched the sugarcane expressed sequence tag (SUCEST DNA library in order to identify, by homology with sequences deposited in other databases, metalloprotease gene families expressed under different conditions. Protein sequences from Arabidopsis thaliana and Glycine max were used to search the SUCEST data bank. Conserved regions corresponding to different metalloprotease domains and sequence motifs were identified in the reads to characterize each group of enzymes. At least four classes of sugarcane metalloproteases have been identified, i.e. matrix metalloproteases, zincins, inverzincins, and ATP-dependent metalloproteases. Each enzyme class was analyzed for its expression in different conditions and tissues.Metaloproteases exercem papéis importantes em muitos processos fisiológicos em mamíferos tais como migração celular, remodelamento tecidual e processamento de fatores de crescimento. Estas enzimas estão envolvidas também na pato-fisiologia de um grande número de doenças humanas como hipertensão e câncer. Muitas bactérias patogênicas dependem de proteases para infectar o hospedeiro. Diversas classes de metaloproteases foram descritas em seres humanos, bactérias, venenos de serpentes e insetos. No entanto, a presença e a caracterização de metaloproteases em plantas estão pouco descritas na literatura. Neste trabalho, foi

  5. Cloning human DNA repair genes

    International Nuclear Information System (INIS)

    Jeggo, P.A.; Carr, A.M.; Lehmann, A.R.

    1994-01-01

    Many human genes involved in the repair of UV damage have been cloned using different procedures and they have been of great value in assisting the understanding of the mechanism of nucleotide excision-repair. Genes involved in repair of ionizing radiation damage have proved more difficult to isolate. Positional cloning has localized the XRCC5 gene to a small region of chromosome 2q33-35, and a series of yeast artificial chromosomes covering this region have been isolated. Very recent work has shown that the XRCC5 gene encodes the 80 kDa subunit of the Ku DNA-binding protein. The Ku80 gene also maps to this region. Studies with fission yeast have shown that radiation sensitivity can result not only from defective DNA repair but also from abnormal cell cycle control following DNA damage. Several genes involved in this 'check-point' control in fission yeast have been isolated and characterized in detail. It is likely that a similar checkpoint control mechanism exists in human cells. (author)

  6. The role of retrotransposons in gene family expansions: insights from the mouse Abp gene family.

    Science.gov (United States)

    Janoušek, Václav; Karn, Robert C; Laukaitis, Christina M

    2013-05-29

    Retrotransposons have been suggested to provide a substrate for non-allelic homologous recombination (NAHR) and thereby promote gene family expansion. Their precise role, however, is controversial. Here we ask whether retrotransposons contributed to the recent expansions of the Androgen-binding protein (Abp) gene families that occurred independently in the mouse and rat genomes. Using dot plot analysis, we found that the most recent duplication in the Abp region of the mouse genome is flanked by L1Md_T elements. Analysis of the sequence of these elements revealed breakpoints that are the relicts of the recombination that caused the duplication, confirming that the duplication arose as a result of NAHR using L1 elements as substrates. L1 and ERVII retrotransposons are considerably denser in the Abp regions than in one Mb flanking regions, while other repeat types are depleted in the Abp regions compared to flanking regions. L1 retrotransposons preferentially accumulated in the Abp gene regions after lineage separation and roughly followed the pattern of Abp gene expansion. By contrast, the proportion of shared vs. lineage-specific ERVII repeats in the Abp region resembles the rest of the genome. We confirmed the role of L1 repeats in Abp gene duplication with the identification of recombinant L1Md_T elements at the edges of the most recent mouse Abp gene duplication. High densities of L1 and ERVII repeats were found in the Abp gene region with abrupt transitions at the region boundaries, suggesting that their higher densities are tightly associated with Abp gene duplication. We observed that the major accumulation of L1 elements occurred after the split of the mouse and rat lineages and that there is a striking overlap between the timing of L1 accumulation and expansion of the Abp gene family in the mouse genome. Establishing a link between the accumulation of L1 elements and the expansion of the Abp gene family and identification of an NAHR-related breakpoint in

  7. One Family's Struggles with HPV (Human Papillomavirus)

    Medline Plus

    Full Text Available ... sq how to do kids infect kids links & resources M.O.V.E. parents for prevention ... go to GETVAXED.ORG cme Immunizations HPV (Human Papillomavirus) One family's struggles with HPV We provide ...

  8. One Family's Struggles with HPV (Human Papillomavirus)

    Medline Plus

    Full Text Available ... getvaxed about GETVAXED print ads go to GETVAXED.ORG cme Immunizations HPV (Human Papillomavirus) One family's struggles ... free-of-charge. Branded videos contain the "PKIDs.ORG" end slate; unbranded videos are provided for organizations ...

  9. The SPINK gene family and celiac disease susceptibility

    NARCIS (Netherlands)

    Wapenaar, M.C.; Monsuur, A.J.; Poell, J.; Slot, R. van 't; Meijer, J.W.R.; Meijer, G.A.; Mulder, C.J.; Mearin, M.L.; Wijmenga, C.

    2007-01-01

    The gene family of serine protease inhibitors of the Kazal type (SPINK) are functional and positional candidate genes for celiac disease (CD). Our aim was to assess the gut mucosal gene expression and genetic association of SPINK1, -2, -4, and -5 in the Dutch CD population. Gene expression was

  10. The SPINK gene family and celiac disease susceptibility

    NARCIS (Netherlands)

    Wapenaar, Martin C.; Monsuur, Alienke J.; Poell, Jos; Slot, Ruben Van 't; Meijer, Jos W. R.; Meijer, Gerrit A.; Mulder, Chris J.; Mearin, Maria Luisa; Wijmenga, Cisca

    The gene family of serine protease inhibitors of the Kazal type (SPINK) are functional and positional candidate genes for celiac disease (CD). Our aim was to assess the gut mucosal gene expression and genetic association of SPINK1, -2, -4, and -5 in the Dutch CD population. Gene expression was

  11. Differential roles of TGIF family genes in mammalian reproduction

    Directory of Open Access Journals (Sweden)

    Renfree Marilyn B

    2011-09-01

    Full Text Available Abstract Background TG-interacting factors (TGIFs belong to a family of TALE-homeodomain proteins including TGIF1, TGIF2 and TGIFLX/Y in human. Both TGIF1 and TGIF2 act as transcription factors repressing TGF-β signalling. Human TGIFLX and its orthologue, Tex1 in the mouse, are X-linked genes that are only expressed in the adult testis. TGIF2 arose from TGIF1 by duplication, whereas TGIFLX arose by retrotransposition to the X-chromosome. These genes have not been characterised in any non-eutherian mammals. We therefore studied the TGIF family in the tammar wallaby (a marsupial mammal to investigate their roles in reproduction and how and when these genes may have evolved their functions and chromosomal locations. Results Both TGIF1 and TGIF2 were present in the tammar genome on autosomes but TGIFLX was absent. Tammar TGIF1 shared a similar expression pattern during embryogenesis, sexual differentiation and in adult tissues to that of TGIF1 in eutherian mammals, suggesting it has been functionally conserved. Tammar TGIF2 was ubiquitously expressed throughout early development as in the human and mouse, but in the adult, it was expressed only in the gonads and spleen, more like the expression pattern of human TGIFLX and mouse Tex1. Tammar TGIF2 mRNA was specifically detected in round and elongated spermatids. There was no mRNA detected in mature spermatozoa. TGIF2 protein was specifically located in the cytoplasm of spermatids, and in the residual body and the mid-piece of the mature sperm tail. These data suggest that tammar TGIF2 may participate in spermiogenesis, like TGIFLX does in eutherians. TGIF2 was detected for the first time in the ovary with mRNA produced in the granulosa and theca cells, suggesting it may also play a role in folliculogenesis. Conclusions The restricted and very similar expression of tammar TGIF2 to X-linked paralogues in eutherians suggests that the evolution of TGIF1, TGIF2 and TGIFLX in eutherians was accompanied by

  12. Genetic recombination as a major cause of mutagenesis in the human globin gene clusters.

    Science.gov (United States)

    Borg, Joseph; Georgitsi, Marianthi; Aleporou-Marinou, Vassiliki; Kollia, Panagoula; Patrinos, George P

    2009-12-01

    Homologous recombination is a frequent phenomenon in multigene families and as such it occurs several times in both the alpha- and beta-like globin gene families. In numerous occasions, genetic recombination has been previously implicated as a major mechanism that drives mutagenesis in the human globin gene clusters, either in the form of unequal crossover or gene conversion. Unequal crossover results in the increase or decrease of the human globin gene copies, accompanied in the majority of cases with minor phenotypic consequences, while gene conversion contributes either to maintaining sequence homogeneity or generating sequence diversity. The role of genetic recombination, particularly gene conversion in the evolution of the human globin gene families has been discussed elsewhere. Here, we summarize our current knowledge and review existing experimental evidence outlining the role of genetic recombination in the mutagenic process in the human globin gene families.

  13. Identification of ALK as the Major Familial Neuroblastoma Predisposition Gene

    Science.gov (United States)

    Mossë, Yalë P; Laudenslager, Marci; Longo, Luca; Cole, Kristina A; Wood, Andrew; Attiyeh, Edward F; Laquaglia, Michael J; Sennett, Rachel; Lynch, Jill E; Perri, Patrizia; Laureys, Geneviève; Speleman, Frank; Hakonarson, Hakon; Torkamani, Ali; Schork, Nicholas J; Brodeur, Garrett M; Tonini, Gian Paolo; Rappaport, Eric; Devoto, Marcella; Maris, John M

    2009-01-01

    SUMMARY Survival rates for the childhood cancer neuroblastoma have not substantively improved despite dramatic escalation in chemotherapy intensity. Like most human cancers, this embryonal malignancy can be inherited, but the genetic etiology of familial and sporadically occurring neuroblastoma was largely unknown. Here we show that germline mutations in the anaplastic lymphoma kinase gene (ALK) explain the majority of hereditary neuroblastomas, and that activating mutations can also be somatically acquired. We first identified a significant linkage signal at the short arm of chromosome 2 (maximum nonparametric LOD=4.23 at rs1344063) using a whole-genome scan in neuroblastoma pedigrees. Resequencing of regional candidate genes identified three separate missense mutations in the tyrosine kinase domain of ALK (G1128A, R1192P and R1275Q) that segregated with the disease in eight separate families. Examination of 491 sporadically occurring human neuroblastoma samples showed that the ALK locus was gained in 22.8%, and highly amplified in an additional 3.3%, and that these aberrations were highly associated with death from disease (P=0.0003). Resequencing of 194 high-risk neuroblastoma samples showed somatically acquired mutations within the tyrosine kinase domain in 12.4%. Nine of the ten mutations map to critical regions of the kinase domain and were predicted to be oncogenic drivers with high probability. Mutations resulted in constitutive phosphorylation consistent with activation, and targeted knockdown of ALK mRNA resulted in profound growth inhibition of 4 of 4 cell lines harboring mutant or amplified ALK, as well as 2 of 6 wild type for ALK. Our results demonstrate that heritable mutations of ALK are the major cause of familial neuroblastoma, and that germline or acquired activation of this cell surface kinase is a tractable therapeutic target for this lethal pediatric malignancy. PMID:18724359

  14. Recurrent APC gene mutations in Polish FAP families

    Directory of Open Access Journals (Sweden)

    Pławski Andrzej

    2007-12-01

    Full Text Available Abstract The molecular diagnostics of genetically conditioned disorders is based on the identification of the mutations in the predisposing genes. Hereditary cancer disorders of the gastrointestinal tracts are caused by mutations of the tumour suppressor genes or the DNA repair genes. Occurrence of recurrent mutation allows improvement of molecular diagnostics. The mutation spectrum in the genes causing hereditary forms of colorectal cancers in the Polish population was previously described. In the present work an estimation of the frequency of the recurrent mutations of the APC gene was performed. Eight types of mutations occurred in 19.4% of our FAP families and these constitute 43% of all Polish diagnosed families.

  15. Patenting human genes: Chinese academic articles' portrayal of gene patents.

    Science.gov (United States)

    Du, Li

    2018-04-24

    The patenting of human genes has been the subject of debate for decades. While China has gradually come to play an important role in the global genomics-based testing and treatment market, little is known about Chinese scholars' perspectives on patent protection for human genes. A content analysis of academic literature was conducted to identify Chinese scholars' concerns regarding gene patents, including benefits and risks of patenting human genes, attitudes that researchers hold towards gene patenting, and any legal and policy recommendations offered for the gene patent regime in China. 57.2% of articles were written by law professors, but scholars from health sciences, liberal arts, and ethics also participated in discussions on gene patent issues. While discussions of benefits and risks were relatively balanced in the articles, 63.5% of the articles favored gene patenting in general and, of the articles (n = 41) that explored gene patents in the Chinese context, 90.2% supported patent protections for human genes in China. The patentability of human genes was discussed in 33 articles, and 75.8% of these articles reached the conclusion that human genes are patentable. Chinese scholars view the patent regime as an important legal tool to protect the interests of inventors and inventions as well as the genetic resources of China. As such, many scholars support a gene patent system in China. These attitudes towards gene patents remain unchanged following the court ruling in the Myriad case in 2013, but arguments have been raised about the scope of gene patents, in particular that the increasing numbers of gene patents may negatively impact public health in China.

  16. Chromosomal localization of the human and mouse hyaluronan synthase genes

    Energy Technology Data Exchange (ETDEWEB)

    Spicer, A.P.; McDonald, J.A. [Mayo Clinic Scottsdale, AZ (United States); Seldin, M.F. [Univ. of California Davis, CA (United States)] [and others

    1997-05-01

    We have recently identified a new vertebrate gene family encoding putative hyaluronan (HA) synthases. Three highly conserved related genes have been identified, designated HAS1, HAS2, and HAS3 in humans and Has1, Has2, and Has3 in the mouse. All three genes encode predicted plasma membrane proteins with multiple transmembrane domains and approximately 25% amino acid sequence identity to the Streptococcus pyogenes HA synthase, HasA. Furthermore, expression of any one HAS gene in transfected mammalian cells leads to high levels of HA biosynthesis. We now report the chromosomal localization of the three HAS genes in human and in mouse. The genes localized to three different positions within both the human and the mouse genomes. HAS1 was localized to the human chromosome 19q13.3-q13.4 boundary and Has1 to mouse Chr 17. HAS2 was localized to human chromosome 8q24.12 and Has2 to mouse Chr 15. HAS3 was localized to human chromosome 16q22.1 and Has3 to mouse Chr 8. The map position for HAS1 reinforces the recently reported relationship between a small region of human chromosome 19q and proximal mouse chromosome 17. HAS2 mapped outside the predicted critical region delineated for the Langer-Giedion syndrome and can thus be excluded as a candidate gene for this genetic syndrome. 33 refs., 2 figs.

  17. Eco RI RFLP in the human IGF II gene

    Energy Technology Data Exchange (ETDEWEB)

    Cocozza, S; Garofalo, S; Robledo, R; Monticelli, A; Conti, A; Chiarotti, L; Frunzio, R; Bruni, C B; Varrone, S

    1988-03-25

    The probe was a 500 bp cDNA containing exons 2-3 and 4 of the human IGF II gene. The clone was isolated by screening a human liver cDNA library with synthetic oligonucleotides. Eco RI digestion of genomic DNA and hybridization with the IGF II probe detects a two allele polymorphism with allelic fragments of 13.5 kb and 10.5 kb. The frequency was studied 38 unrelated Caucasians: Human IGF II gene was localized on the short arm of chromosome 11 (p15) by in situ hybridization. Codominant segregation was observed in 2 Caucasian families (10 individuals).

  18. Repeat-associated plasticity in the Helicobacter pylori RD gene family.

    Science.gov (United States)

    Shak, Joshua R; Dick, Jonathan J; Meinersmann, Richard J; Perez-Perez, Guillermo I; Blaser, Martin J

    2009-11-01

    The bacterium Helicobacter pylori is remarkable for its ability to persist in the human stomach for decades without provoking sterilizing immunity. Since repetitive DNA can facilitate adaptive genomic flexibility via increased recombination, insertion, and deletion, we searched the genomes of two H. pylori strains for nucleotide repeats. We discovered a family of genes with extensive repetitive DNA that we have termed the H. pylori RD gene family. Each gene of this family is composed of a conserved 3' region, a variable mid-region encoding 7 and 11 amino acid repeats, and a 5' region containing one of two possible alleles. Analysis of five complete genome sequences and PCR genotyping of 42 H. pylori strains revealed extensive variation between strains in the number, location, and arrangement of RD genes. Furthermore, examination of multiple strains isolated from a single subject's stomach revealed intrahost variation in repeat number and composition. Despite prior evidence that the protein products of this gene family are expressed at the bacterial cell surface, enzyme-linked immunosorbent assay and immunoblot studies revealed no consistent seroreactivity to a recombinant RD protein by H. pylori-positive hosts. The pattern of repeats uncovered in the RD gene family appears to reflect slipped-strand mispairing or domain duplication, allowing for redundancy and subsequent diversity in genotype and phenotype. This novel family of hypervariable genes with conserved, repetitive, and allelic domains may represent an important locus for understanding H. pylori persistence in its natural host.

  19. The ALMT Gene Family Performs Multiple Functions in Plants

    Directory of Open Access Journals (Sweden)

    Jie Liu

    2018-02-01

    Full Text Available The aluminium activated malate transporter (ALMT gene family is named after the first member of the family identified in wheat (Triticum aestivum L.. The product of this gene controls resistance to aluminium (Al toxicity. ALMT genes encode transmembrane proteins that function as anion channels and perform multiple functions involving the transport of organic anions (e.g., carboxylates and inorganic anions in cells. They share a PF11744 domain and are classified in the Fusaric acid resistance protein-like superfamily, CL0307. The proteins typically have five to seven transmembrane regions in the N-terminal half and a long hydrophillic C-terminal tail but predictions of secondary structure vary. Although widely spread in plants, relatively little information is available on the roles performed by other members of this family. In this review, we summarized functions of ALMT gene families, including Al resistance, stomatal function, mineral nutrition, microbe interactions, fruit acidity, light response and seed development.

  20. Extensive lineage-specific gene duplication and evolution of the spiggin multi-gene family in stickleback

    Directory of Open Access Journals (Sweden)

    Nishida Mutsumi

    2007-11-01

    Full Text Available Abstract Background The threespine stickleback (Gasterosteus aculeatus has a characteristic reproductive mode; mature males build nests using a secreted glue-like protein called spiggin. Although recent studies reported multiple occurrences of genes that encode this glue-like protein spiggin in threespine and ninespine sticklebacks, it is still unclear how many genes compose the spiggin multi-gene family. Results Genome sequence analysis of threespine stickleback showed that there are at least five spiggin genes and two pseudogenes, whereas a single spiggin homolog occurs in the genomes of other fishes. Comparative genome sequence analysis demonstrated that Muc19, a single-copy mucous gene in human and mouse, is an ortholog of spiggin. Phylogenetic and molecular evolutionary analyses of these sequences suggested that an ancestral spiggin gene originated from a member of the mucin gene family as a single gene in the common ancestor of teleosts, and gene duplications of spiggin have occurred in the stickleback lineage. There was inter-population variation in the copy number of spiggin genes and positive selection on some codons, indicating that additional gene duplication/deletion events and adaptive evolution at some amino acid sites may have occurred in each stickleback population. Conclusion A number of spiggin genes exist in the threespine stickleback genome. Our results provide insight into the origin and dynamic evolutionary process of the spiggin multi-gene family in the threespine stickleback lineage. The dramatic evolution of genes for mucous substrates may have contributed to the generation of distinct characteristics such as "bio-glue" in vertebrates.

  1. Radioactive probes for human gene localisation by in situ hybridisation

    International Nuclear Information System (INIS)

    Fennell, S.J.

    1980-07-01

    Radioactive probes of high specific activity have been used for human gene localisation on metaphase chromosome preparations. Human 5S ribosomal RNA was used as a model system, as a probe for the localisation of human 5S ribosomal genes. 125 I-labelled mouse 5S ribosomal RNA was used to study the 5S ribosomal gene content and arrangement in families with translocations on the long arm of chromosome 1 close to or containing the 5S ribosomal RNA locus, by in situ hybridisation to human metaphase chromosomes from peripheral blood cultures. This confirmed the chromosomal assignment of 5S ribosomal genes to 1q 42-43. In situ hybridisation probes were also prepared from recombinant plasmids containing Xenopus laevis oocyte 5S or 28S/18S gene sequences to give [ 3 H]-labelled cRNA and [ 3 H]-labelled nick-translated plasmid DNA. Studies on the kinetics of hybridisation of plasmid probes with and without ribosomal gene sequences questioned the role of plasmid DNA for amplification of signal during gene localisation. Gene localisation was obtained with nick-translated plasmid DNA containing the 28S/18S ribosomal DNA insert after short exposure times, but poor results were obtained using a [ 3 H]-labelled cRNA probe transcribed from the plasmid with the 5S gene insert. (author)

  2. Evaluation of Gene-Based Family-Based Methods to Detect Novel Genes Associated With Familial Late Onset Alzheimer Disease

    Directory of Open Access Journals (Sweden)

    Maria V. Fernández

    2018-04-01

    Full Text Available Gene-based tests to study the combined effect of rare variants on a particular phenotype have been widely developed for case-control studies, but their evolution and adaptation for family-based studies, especially studies of complex incomplete families, has been slower. In this study, we have performed a practical examination of all the latest gene-based methods available for family-based study designs using both simulated and real datasets. We examined the performance of several collapsing, variance-component, and transmission disequilibrium tests across eight different software packages and 22 models utilizing a cohort of 285 families (N = 1,235 with late-onset Alzheimer disease (LOAD. After a thorough examination of each of these tests, we propose a methodological approach to identify, with high confidence, genes associated with the tested phenotype and we provide recommendations to select the best software and model for family-based gene-based analyses. Additionally, in our dataset, we identified PTK2B, a GWAS candidate gene for sporadic AD, along with six novel genes (CHRD, CLCN2, HDLBP, CPAMD8, NLRP9, and MAS1L as candidate genes for familial LOAD.

  3. Molecular evolution of the major chemosensory gene families in insects.

    Science.gov (United States)

    Sánchez-Gracia, A; Vieira, F G; Rozas, J

    2009-09-01

    Chemoreception is a crucial biological process that is essential for the survival of animals. In insects, olfaction allows the organism to recognise volatile cues that allow the detection of food, predators and mates, whereas the sense of taste commonly allows the discrimination of soluble stimulants that elicit feeding behaviours and can also initiate innate sexual and reproductive responses. The most important proteins involved in the recognition of chemical cues comprise moderately sized multigene families. These families include odorant-binding proteins (OBPs) and chemosensory proteins (CSPs), which are involved in peripheral olfactory processing, and the chemoreceptor superfamily formed by the olfactory receptor (OR) and gustatory receptor (GR) families. Here, we review some recent evolutionary genomic studies of chemosensory gene families using the data from fully sequenced insect genomes, especially from the 12 newly available Drosophila genomes. Overall, the results clearly support the birth-and-death model as the major mechanism of evolution in these gene families. Namely, new members arise by tandem gene duplication, progressively diverge in sequence and function, and can eventually be lost from the genome by a deletion or pseudogenisation event. Adaptive changes fostered by environmental shifts are also observed in the evolution of chemosensory families in insects and likely involve reproductive, ecological or behavioural traits. Consequently, the current size of these gene families is mainly a result of random gene gain and loss events. This dynamic process may represent a major source of genetic variation, providing opportunities for FUTURE specific adaptations.

  4. Genomewide analysis of TCP transcription factor gene family in ...

    Indian Academy of Sciences (India)

    Home; Journals; Journal of Genetics; Volume 93; Issue 3. Genomewide ... Teosinte branched1/cycloidea/proliferating cell factor1 (TCP) proteins are a large family of transcriptional regulators in angiosperms. They are ... To the best of our knowledge, this is the first study of a genomewide analysis of apple TCP gene family.

  5. Genome organization and expression of the rat ACBP gene family

    DEFF Research Database (Denmark)

    Mandrup, S; Andreasen, P H; Knudsen, J

    1993-01-01

    pool former. We have molecularly cloned and characterized the rat ACBP gene family which comprises one expressed and four processed pseudogenes. One of these was shown to exist in two allelic forms. A comprehensive computer-aided analysis of the promoter region of the expressed ACBP gene revealed...

  6. APC gene mutations and extraintestinal phenotype of familial adenomatous polyposis

    NARCIS (Netherlands)

    Giardiello, F. M.; Petersen, G. M.; Piantadosi, S.; Gruber, S. B.; Traboulsi, E. I.; Offerhaus, G. J.; Muro, K.; Krush, A. J.; Booker, S. V.; Luce, M. C.; Laken, S. J.; Kinzler, K. W.; Vogelstein, B.; Hamilton, S. R.

    1997-01-01

    Familial adenomatous polyposis (FAP) is caused by germline mutation of the adenomatous polyposis coli (APC) gene on chromosome 5q. This study assessed genotype-phenotype correlations for extraintestinal lesions in FAP. Mutations of the APC gene were compared with the occurrence of seven

  7. Human Service Employees Coping with Job Stress, Family Stress and Work-Family Conflict.

    Science.gov (United States)

    Carbone, Dominic J.

    The intersection of work and family life has always been a popular topic of discussion among family theorists. This study examined human service employees in direct service positions coping with work stress, family stress, and work-family conflict. The effects of work stress, family stress and work-family conflict on depression were examined.…

  8. Death and resurrection of the human IRGM gene.

    Directory of Open Access Journals (Sweden)

    Cemalettin Bekpen

    2009-03-01

    Full Text Available Immunity-related GTPases (IRG play an important role in defense against intracellular pathogens. One member of this gene family in humans, IRGM, has been recently implicated as a risk factor for Crohn's disease. We analyzed the detailed structure of this gene family among primates and showed that most of the IRG gene cluster was deleted early in primate evolution, after the divergence of the anthropoids from prosimians ( about 50 million years ago. Comparative sequence analysis of New World and Old World monkey species shows that the single-copy IRGM gene became pseudogenized as a result of an Alu retrotransposition event in the anthropoid common ancestor that disrupted the open reading frame (ORF. We find that the ORF was reestablished as a part of a polymorphic stop codon in the common ancestor of humans and great apes. Expression analysis suggests that this change occurred in conjunction with the insertion of an endogenous retrovirus, which altered the transcription initiation, splicing, and expression profile of IRGM. These data argue that the gene became pseudogenized and was then resurrected through a series of complex structural events and suggest remarkable functional plasticity where alleles experience diverse evolutionary pressures over time. Such dynamism in structure and evolution may be critical for a gene family locked in an arms race with an ever-changing repertoire of intracellular parasites.

  9. Identification of pathogenic gene variants in small families with intellectually disabled siblings by exome sequencing.

    Science.gov (United States)

    Schuurs-Hoeijmakers, Janneke H M; Vulto-van Silfhout, Anneke T; Vissers, Lisenka E L M; van de Vondervoort, Ilse I G M; van Bon, Bregje W M; de Ligt, Joep; Gilissen, Christian; Hehir-Kwa, Jayne Y; Neveling, Kornelia; del Rosario, Marisol; Hira, Gausiya; Reitano, Santina; Vitello, Aurelio; Failla, Pinella; Greco, Donatella; Fichera, Marco; Galesi, Ornella; Kleefstra, Tjitske; Greally, Marie T; Ockeloen, Charlotte W; Willemsen, Marjolein H; Bongers, Ernie M H F; Janssen, Irene M; Pfundt, Rolph; Veltman, Joris A; Romano, Corrado; Willemsen, Michèl A; van Bokhoven, Hans; Brunner, Han G; de Vries, Bert B A; de Brouwer, Arjan P M

    2013-12-01

    Intellectual disability (ID) is a common neurodevelopmental disorder affecting 1-3% of the general population. Mutations in more than 10% of all human genes are considered to be involved in this disorder, although the majority of these genes are still unknown. We investigated 19 small non-consanguineous families with two to five affected siblings in order to identify pathogenic gene variants in known, novel and potential ID candidate genes. Non-consanguineous families have been largely ignored in gene identification studies as small family size precludes prior mapping of the genetic defect. Using exome sequencing, we identified pathogenic mutations in three genes, DDHD2, SLC6A8, and SLC9A6, of which the latter two have previously been implicated in X-linked ID phenotypes. In addition, we identified potentially pathogenic mutations in BCORL1 on the X-chromosome and in MCM3AP, PTPRT, SYNE1, and ZNF528 on autosomes. We show that potentially pathogenic gene variants can be identified in small, non-consanguineous families with as few as two affected siblings, thus emphasising their value in the identification of syndromic and non-syndromic ID genes.

  10. The roles of segmental and tandem gene duplication in the evolution of large gene families in Arabidopsis thaliana

    Directory of Open Access Journals (Sweden)

    Baumgarten Andrew

    2004-06-01

    Full Text Available Abstract Background Most genes in Arabidopsis thaliana are members of gene families. How do the members of gene families arise, and how are gene family copy numbers maintained? Some gene families may evolve primarily through tandem duplication and high rates of birth and death in clusters, and others through infrequent polyploidy or large-scale segmental duplications and subsequent losses. Results Our approach to understanding the mechanisms of gene family evolution was to construct phylogenies for 50 large gene families in Arabidopsis thaliana, identify large internal segmental duplications in Arabidopsis, map gene duplications onto the segmental duplications, and use this information to identify which nodes in each phylogeny arose due to segmental or tandem duplication. Examples of six gene families exemplifying characteristic modes are described. Distributions of gene family sizes and patterns of duplication by genomic distance are also described in order to characterize patterns of local duplication and copy number for large gene families. Both gene family size and duplication by distance closely follow power-law distributions. Conclusions Combining information about genomic segmental duplications, gene family phylogenies, and gene positions provides a method to evaluate contributions of tandem duplication and segmental genome duplication in the generation and maintenance of gene families. These differences appear to correspond meaningfully to differences in functional roles of the members of the gene families.

  11. Evolution of the YABBY gene family in seed plants.

    Science.gov (United States)

    Finet, Cédric; Floyd, Sandra K; Conway, Stephanie J; Zhong, Bojian; Scutt, Charles P; Bowman, John L

    2016-01-01

    Members of the YABBY gene family of transcription factors in angiosperms have been shown to be involved in the initiation of outgrowth of the lamina, the maintenance of polarity, and establishment of the leaf margin. Although most of the dorsal-ventral polarity genes in seed plants have homologs in non-spermatophyte lineages, the presence of YABBY genes is restricted to seed plants. To gain insight into the origin and diversification of this gene family, we reconstructed the evolutionary history of YABBY gene lineages in seed plants. Our findings suggest that either one or two YABBY genes were present in the last common ancestor of extant seed plants. We also examined the expression of YABBY genes in the gymnosperms Ephedra distachya (Gnetales), Ginkgo biloba (Ginkgoales), and Pseudotsuga menziesii (Coniferales). Our data indicate that some YABBY genes are expressed in a polar (abaxial) manner in leaves and female cones in gymnosperms. We propose that YABBY genes already acted as polarity genes in the last common ancestor of extant seed plants. © 2016 Wiley Periodicals, Inc.

  12. Humanized care in the family health strategy

    Directory of Open Access Journals (Sweden)

    Alana Tamar Oliveira de Sousa

    2010-01-01

    Full Text Available The Health Community Agent (HCA has contributed in a meaningful way to enhance the bond professional-user/family, providing, thus, the humanized care for the users who receive attention from the Family Health Strategy (FHS. This research had the aim to investigate the strategies adopted by the health community agents in order to supply the humanized care for the FHS user. It is an exploratory research of qualitative nature which was accomplished in the Basic Health Units – BHU, placed in the Distrito Sanitário III, in João Pessoa – PB. Thirtyhealth community agents, from the Family Health Strategy, took part in the research. The data were collected by means of a questionnaire related to the objective proposed by the investigation and, afterwards, they were analyzed qualitatively through the Collective Subject Discourse (CSD technique. In this way, it was possible to foresee three main ideas: promoting care based on respect for the user’s singularity as well as the valuing of empathic relationship; home visit, guidance, surveillance, pointing out solutions for the user’sneeds; enhancement of the bond between community and the team responsible for action planning. The Collective Subject Discourse of the participants involved in the research, as regards the humanized care practice, had as core the respect for the patient’s dignity, prioritizing his or her real needs and emphasizing the multidisciplinary task. This investigation enables the reflection about the valuable contribution of the health community agents concerning the promotion of the humanized care having as reference the mentioned strategies.

  13. msh/Msx gene family in neural development.

    Science.gov (United States)

    Ramos, Casto; Robert, Benoît

    2005-11-01

    The involvement of Msx homeobox genes in skull and tooth formation has received a great deal of attention. Recent studies also indicate a role for the msh/Msx gene family in development of the nervous system. In this article, we discuss the functions of these transcription factors in neural-tissue organogenesis. We will deal mainly with the interactions of the Drosophila muscle segment homeobox (msh) gene with other homeobox genes and the repressive cascade that leads to neuroectoderm patterning; the role of Msx genes in neural-crest induction, focusing especially on the differences between lower and higher vertebrates; their implication in patterning of the vertebrate neural tube, particularly in diencephalon midline formation. Finally, we will examine the distinct activities of Msx1, Msx2 and Msx3 genes during neurogenesis, taking into account their relationships with signalling molecules such as BMP.

  14. The sieve element occlusion gene family in dicotyledonous plants.

    Science.gov (United States)

    Ernst, Antonia M; Rüping, Boris; Jekat, Stephan B; Nordzieke, Steffen; Reineke, Anna R; Müller, Boje; Bornberg-Bauer, Erich; Prüfer, Dirk; Noll, Gundula A

    2011-01-01

    Sieve element occlusion (SEO) genes encoding forisome subunits have been identified in Medicago truncatula and other legumes. Forisomes are structural phloem proteins uniquely found in Fabaceae sieve elements. They undergo a reversible conformational change after wounding, from a condensed to a dispersed state, thereby blocking sieve tube translocation and preventing the loss of photoassimilates. Recently, we identified SEO genes in several non-Fabaceae plants (lacking forisomes) and concluded that they most probably encode conventional non-forisome P-proteins. Molecular and phylogenetic analysis of the SEO gene family has identified domains that are characteristic for SEO proteins. Here, we extended our phylogenetic analysis by including additional SEO genes from several diverse species based on recently published genomic data. Our results strengthen the original assumption that SEO genes seem to be widespread in dicotyledonous angiosperms, and further underline the divergent evolution of SEO genes within the Fabaceae.

  15. Predictions of Gene Family Distributions in Microbial Genomes: Evolution by Gene Duplication and Modification

    International Nuclear Information System (INIS)

    Yanai, Itai; Camacho, Carlos J.; DeLisi, Charles

    2000-01-01

    A universal property of microbial genomes is the considerable fraction of genes that are homologous to other genes within the same genome. The process by which these homologues are generated is not well understood, but sequence analysis of 20 microbial genomes unveils a recurrent distribution of gene family sizes. We show that a simple evolutionary model based on random gene duplication and point mutations fully accounts for these distributions and permits predictions for the number of gene families in genomes not yet complete. Our findings are consistent with the notion that a genome evolves from a set of precursor genes to a mature size by gene duplications and increasing modifications. (c) 2000 The American Physical Society

  16. Predictions of Gene Family Distributions in Microbial Genomes: Evolution by Gene Duplication and Modification

    Energy Technology Data Exchange (ETDEWEB)

    Yanai, Itai; Camacho, Carlos J.; DeLisi, Charles

    2000-09-18

    A universal property of microbial genomes is the considerable fraction of genes that are homologous to other genes within the same genome. The process by which these homologues are generated is not well understood, but sequence analysis of 20 microbial genomes unveils a recurrent distribution of gene family sizes. We show that a simple evolutionary model based on random gene duplication and point mutations fully accounts for these distributions and permits predictions for the number of gene families in genomes not yet complete. Our findings are consistent with the notion that a genome evolves from a set of precursor genes to a mature size by gene duplications and increasing modifications. (c) 2000 The American Physical Society.

  17. Phylogenetic analysis of the MS4A and TMEM176 gene families.

    Directory of Open Access Journals (Sweden)

    Jonathan Zuccolo

    2010-02-01

    Full Text Available The MS4A gene family in humans includes CD20 (MS4A1, FcRbeta (MS4A2, Htm4 (MS4A3, and at least 13 other syntenic genes encoding membrane proteins, most having characteristic tetraspanning topology. Expression of MS4A genes is variable in tissues throughout the body; however, several are limited to cells in the hematopoietic system where they have known roles in immune cell functions. Genes in the small TMEM176 group share significant sequence similarity with MS4A genes and there is evidence of immune function of at least one of the encoded proteins. In this study, we examined the evolutionary history of the MS4A/TMEM176 families as well as tissue expression of the phylogenetically earliest members, in order to investigate their possible origins in immune cells.Orthologs of human MS4A genes were found only in mammals; however, MS4A gene homologs were found in most jawed vertebrates. TMEM176 genes were found only in mammals and bony fish. Several unusual MS4A genes having 2 or more tandem MS4A sequences were identified in the chicken (Gallus gallus and early mammals (opossum, Monodelphis domestica and platypus, Ornithorhyncus anatinus. A large number of highly conserved MS4A and TMEM176 genes was found in zebrafish (Danio rerio. The most primitive organism identified to have MS4A genes was spiny dogfish (Squalus acanthus. Tissue expression of MS4A genes in S. acanthias and D. rerio showed no evidence of expression restricted to the hematopoietic system.Our findings suggest that MS4A genes first appeared in cartilaginous fish with expression outside of the immune system, and have since diversified in many species into their modern forms with expression and function in both immune and nonimmune cells.

  18. Phylogenetic Analysis of the MS4A and TMEM176 Gene Families

    Science.gov (United States)

    Zuccolo, Jonathan; Bau, Jeremy; Childs, Sarah J.; Goss, Greg G.; Sensen, Christoph W.; Deans, Julie P.

    2010-01-01

    Background The MS4A gene family in humans includes CD20 (MS4A1), FcRβ (MS4A2), Htm4 (MS4A3), and at least 13 other syntenic genes encoding membrane proteins, most having characteristic tetraspanning topology. Expression of MS4A genes is variable in tissues throughout the body; however, several are limited to cells in the hematopoietic system where they have known roles in immune cell functions. Genes in the small TMEM176 group share significant sequence similarity with MS4A genes and there is evidence of immune function of at least one of the encoded proteins. In this study, we examined the evolutionary history of the MS4A/TMEM176 families as well as tissue expression of the phylogenetically earliest members, in order to investigate their possible origins in immune cells. Principal Findings Orthologs of human MS4A genes were found only in mammals; however, MS4A gene homologs were found in most jawed vertebrates. TMEM176 genes were found only in mammals and bony fish. Several unusual MS4A genes having 2 or more tandem MS4A sequences were identified in the chicken (Gallus gallus) and early mammals (opossum, Monodelphis domestica and platypus, Ornithorhyncus anatinus). A large number of highly conserved MS4A and TMEM176 genes was found in zebrafish (Danio rerio). The most primitive organism identified to have MS4A genes was spiny dogfish (Squalus acanthus). Tissue expression of MS4A genes in S. acanthias and D. rerio showed no evidence of expression restricted to the hematopoietic system. Conclusions/Significance Our findings suggest that MS4A genes first appeared in cartilaginous fish with expression outside of the immune system, and have since diversified in many species into their modern forms with expression and function in both immune and nonimmune cells. PMID:20186339

  19. Transcriptomic and phylogenetic analysis of Culex pipiens quinquefasciatus for three detoxification gene families

    Directory of Open Access Journals (Sweden)

    Yan Liangzhen

    2012-11-01

    Full Text Available Abstract Background The genomes of three major mosquito vectors of human diseases, Anopheles gambiae, Aedes aegypti, and Culex pipiens quinquefasciatus, have been previously sequenced. C. p. quinquefasciatus has the largest number of predicted protein-coding genes, which partially results from the expansion of three detoxification gene families: cytochrome P450 monooxygenases (P450, glutathione S-transferases (GST, and carboxyl/cholinesterases (CCE. However, unlike An. gambiae and Ae. aegypti, which have large amounts of gene expression data, C. p. quinquefasciatus has limited transcriptomic resources. Knowledge of complete gene expression information is very important for the exploration of the functions of genes involved in specific biological processes. In the present study, the three detoxification gene families of C. p. quinquefasciatus were analyzed for phylogenetic classification and compared with those of three other dipteran insects. Gene expression during various developmental stages and the differential expression responsible for parathion resistance were profiled using the digital gene expression (DGE technique. Results A total of 302 detoxification genes were found in C. p. quinquefasciatus, including 71 CCE, 196 P450, and 35 cytosolic GST genes. Compared with three other dipteran species, gene expansion in Culex mainly occurred in the CCE and P450 families, where the genes of α-esterases, juvenile hormone esterases, and CYP325 of the CYP4 subfamily showed the most pronounced expansion on the genome. For the five DGE libraries, 3.5-3.8 million raw tags were generated and mapped to 13314 reference genes. Among 302 detoxification genes, 225 (75% were detected for expression in at least one DGE library. One fourth of the CCE and P450 genes were detected uniquely in one stage, indicating potential developmentally regulated expression. A total of 1511 genes showed different expression levels between a parathion-resistant and a

  20. Runx family genes in a cartilaginous fish, the elephant shark (Callorhinchus milii.

    Directory of Open Access Journals (Sweden)

    Giselle Sek Suan Nah

    Full Text Available The Runx family genes encode transcription factors that play key roles in hematopoiesis, skeletogenesis and neurogenesis and are often implicated in diseases. We describe here the cloning and characterization of Runx1, Runx2, Runx3 and Runxb genes in the elephant shark (Callorhinchus milii, a member of Chondrichthyes, the oldest living group of jawed vertebrates. Through the use of alternative promoters and/or alternative splicing, each of the elephant shark Runx genes expresses multiple isoforms similar to their orthologs in human and other bony vertebrates. The expression profiles of elephant shark Runx genes are similar to those of mammalian Runx genes. The syntenic blocks of genes at the elephant shark Runx gene loci are highly conserved in human, but represented by shorter conserved blocks in zebrafish indicating a higher degree of rearrangements in this teleost fish. Analysis of promoter regions revealed conservation of binding sites for transcription factors, including two tandem binding sites for Runx that are totally conserved in the distal promoter regions of elephant shark Runx1-3. Several conserved noncoding elements (CNEs, which are putative cis-regulatory elements, and miRNA binding sites were identified in the elephant shark and human Runx gene loci. Some of these CNEs and miRNA binding sites are absent in teleost fishes such as zebrafish and fugu. In summary, our analysis reveals that the genomic organization and expression profiles of Runx genes were already complex in the common ancestor of jawed vertebrates.

  1. Positive selection in the SLC11A1 gene in the family Equidae

    DEFF Research Database (Denmark)

    Bayerova, Zuzana; Janova, Eva; Matiasovic, Jan

    2016-01-01

    Immunity-related genes are a suitable model for studying effects of selection at the genomic level. Some of them are highly conserved due to functional constraints and purifying selection, while others are variable and change quickly to cope with the variation of pathogens. The SLC11A1 gene encodes...... a transporter protein mediating antimicrobial activity of macrophages. Little is known about the patterns of selection shaping this gene during evolution. Although it is a typical evolutionarily conserved gene, functionally important polymorphisms associated with various diseases were identified in humans...... and other species. We analyzed the genomic organization, genetic variation, and evolution of the SLC11A1 gene in the family Equidae to identify patterns of selection within this important gene. Nucleotide SLC11A1 sequences were shown to be highly conserved in ten equid species, with more than 97 % sequence...

  2. Small Mutations of the DMD Gene in Taiwanese Families

    Directory of Open Access Journals (Sweden)

    Hsiao-Lin Hwa

    2008-06-01

    Conclusion: Most identified mutations either led to a predictable premature stop codon or resulted in splicing defects, which caused defective function of dystrophin. Our findings extend the mutation spectrum of the DMD gene. Molecular characterization of the affected families is important for genetic counseling and prenatal diagnosis.

  3. Genetic diversity of bitter taste receptor gene family in Sichuan

    Indian Academy of Sciences (India)

    Genetic diversity of bitter taste receptor gene family in Sichuan domestic and Tibetan chicken populations. YUAN SU DIYAN LI UMA GAUR YAN WANG NAN WU BINLONG CHEN HONGXIAN XU HUADONG YIN YAODONG HU QING ZHU. RESEARCH ARTICLE Volume 95 Issue 3 September 2016 pp 675-681 ...

  4. Genomewide analysis of TCP transcription factor gene family in ...

    Indian Academy of Sciences (India)

    2014-12-09

    Dec 9, 2014 ... study of a genomewide analysis of apple TCP gene family. These results provide .... synthesize the first-strand cDNA using the PrimeScript First. Strand cDNA ..... only detected in the stem, leaf and fruit (figure 8). When.

  5. Identification of the trehalose-6-phosphate synthase gene family in ...

    Indian Academy of Sciences (India)

    2015-03-04

    Mar 4, 2015 ... stress, however, our study mainly analysed the TPS gene family under freezing conditions in winter wheat .... size the first-strand cDNA using the Fermentas RevertAid ..... In the stem of Dongnongdongmai 1, TaTPS1, 2, 3, 4, 8,.

  6. Recent advances in human gene-longevity association studies

    DEFF Research Database (Denmark)

    De Benedictis, G; Tan, Q; Jeune, B

    2001-01-01

    This paper reviews the recent literature on genes and longevity. The influence of genes on human life span has been confirmed in studies of life span correlation between related individuals based on family and twin data. Results from major twin studies indicate that approximately 25......% of the variation in life span is genetically determined. Taking advantage of recent developments in molecular biology, researchers are now searching for candidate genes that might have an influence on life span. The data on unrelated individuals emerging from an ever-increasing number of centenarian studies makes...... this possible. This paper summarizes the rich literature dealing with the various aspects of the influence of genes on individual survival. Common phenomena affecting the development of disease and longevity are discussed. The major methodological difficulty one is confronted with when studying the epidemiology...

  7. Evolution of the MAGUK protein gene family in premetazoan lineages

    Directory of Open Access Journals (Sweden)

    Ruiz-Trillo Iñaki

    2010-04-01

    Full Text Available Abstract Background Cell-to-cell communication is a key process in multicellular organisms. In multicellular animals, scaffolding proteins belonging to the family of membrane-associated guanylate kinases (MAGUK are involved in the regulation and formation of cell junctions. These MAGUK proteins were believed to be exclusive to Metazoa. However, a MAGUK gene was recently identified in an EST survey of Capsaspora owczarzaki, an unicellular organism that branches off near the metazoan clade. To further investigate the evolutionary history of MAGUK, we have undertook a broader search for this gene family using available genomic sequences of different opisthokont taxa. Results Our survey and phylogenetic analyses show that MAGUK proteins are present not only in Metazoa, but also in the choanoflagellate Monosiga brevicollis and in the protist Capsaspora owczarzaki. However, MAGUKs are absent from fungi, amoebozoans or any other eukaryote. The repertoire of MAGUKs in Placozoa and eumetazoan taxa (Cnidaria + Bilateria is quite similar, except for one class that is missing in Trichoplax, while Porifera have a simpler MAGUK repertoire. However, Vertebrata have undergone several independent duplications and exhibit two exclusive MAGUK classes. Three different MAGUK types are found in both M. brevicollis and C. owczarzaki: DLG, MPP and MAGI. Furthermore, M. brevicollis has suffered a lineage-specific diversification. Conclusions The diversification of the MAGUK protein gene family occurred, most probably, prior to the divergence between Metazoa+choanoflagellates and the Capsaspora+Ministeria clade. A MAGI-like, a DLG-like, and a MPP-like ancestral genes were already present in the unicellular ancestor of Metazoa, and new gene members have been incorporated through metazoan evolution within two major periods, one before the sponge-eumetazoan split and another within the vertebrate lineage. Moreover, choanoflagellates have suffered an independent MAGUK

  8. PlantTribes: a gene and gene family resource for comparative genomics in plants

    OpenAIRE

    Wall, P. Kerr; Leebens-Mack, Jim; Müller, Kai F.; Field, Dawn; Altman, Naomi S.; dePamphilis, Claude W.

    2007-01-01

    The PlantTribes database (http://fgp.huck.psu.edu/tribe.html) is a plant gene family database based on the inferred proteomes of five sequenced plant species: Arabidopsis thaliana, Carica papaya, Medicago truncatula, Oryza sativa and Populus trichocarpa. We used the graph-based clustering algorithm MCL [Van Dongen (Technical Report INS-R0010 2000) and Enright et al. (Nucleic Acids Res. 2002; 30: 1575–1584)] to classify all of these species’ protein-coding genes into putative gene families, ca...

  9. Characterization of the MLO gene family in Rosaceae and gene expression analysis in Malus domestica.

    Science.gov (United States)

    Pessina, Stefano; Pavan, Stefano; Catalano, Domenico; Gallotta, Alessandra; Visser, Richard G F; Bai, Yuling; Malnoy, Mickael; Schouten, Henk J

    2014-07-22

    Powdery mildew (PM) is a major fungal disease of thousands of plant species, including many cultivated Rosaceae. PM pathogenesis is associated with up-regulation of MLO genes during early stages of infection, causing down-regulation of plant defense pathways. Specific members of the MLO gene family act as PM-susceptibility genes, as their loss-of-function mutations grant durable and broad-spectrum resistance. We carried out a genome-wide characterization of the MLO gene family in apple, peach and strawberry, and we isolated apricot MLO homologs through a PCR-approach. Evolutionary relationships between MLO homologs were studied and syntenic blocks constructed. Homologs that are candidates for being PM susceptibility genes were inferred by phylogenetic relationships with functionally characterized MLO genes and, in apple, by monitoring their expression following inoculation with the PM causal pathogen Podosphaera leucotricha. Genomic tools available for Rosaceae were exploited in order to characterize the MLO gene family. Candidate MLO susceptibility genes were identified. In follow-up studies it can be investigated whether silencing or a loss-of-function mutations in one or more of these candidate genes leads to PM resistance.

  10. DDX11L: a novel transcript family emerging from human subtelomeric regions

    Directory of Open Access Journals (Sweden)

    D'Urso Michele

    2009-05-01

    Full Text Available Abstract Background The subtelomeric regions of human chromosomes exhibit an extraordinary plasticity. To date, due to the high GC content and to the presence of telomeric repeats, the subtelomeric sequences are underrepresented in the genomic libraries and consequently their sequences are incomplete in the finished human genome sequence, and still much remains to be learned about subtelomere organization, evolution and function. Indeed, only in recent years, several studies have disclosed, within human subtelomeres, novel gene family members. Results During a project aimed to analyze genes located in the telomeric region of the long arm of the human X chromosome, we have identified a novel transcript family, DDX11L, members of which map to 1pter, 2q13/14.1, 2qter, 3qter, 6pter, 9pter/9qter, 11pter, 12pter, 15qter, 16pter, 17pter, 19pter, 20pter/20qter, Xpter/Xqter and Yqter. Furthermore, we partially sequenced the underrepresented subtelomeres of human chromosomes showing a common evolutionary origin. Conclusion Our data indicate that an ancestral gene, originated as a rearranged portion of the primate DDX11 gene, and propagated along many subtelomeric locations, is emerging within subtelomeres of human chromosomes, defining a novel gene family. These findings support the possibility that the high plasticity of these regions, sites of DNA exchange among different chromosomes, could trigger the emergence of new genes.

  11. Duplicability of self-interacting human genes.

    LENUS (Irish Health Repository)

    Pérez-Bercoff, Asa

    2010-01-01

    BACKGROUND: There is increasing interest in the evolution of protein-protein interactions because this should ultimately be informative of the patterns of evolution of new protein functions within the cell. One model proposes that the evolution of new protein-protein interactions and protein complexes proceeds through the duplication of self-interacting genes. This model is supported by data from yeast. We examined the relationship between gene duplication and self-interaction in the human genome. RESULTS: We investigated the patterns of self-interaction and duplication among 34808 interactions encoded by 8881 human genes, and show that self-interacting proteins are encoded by genes with higher duplicability than genes whose proteins lack this type of interaction. We show that this result is robust against the system used to define duplicate genes. Finally we compared the presence of self-interactions amongst proteins whose genes have duplicated either through whole-genome duplication (WGD) or small-scale duplication (SSD), and show that the former tend to have more interactions in general. After controlling for age differences between the two sets of duplicates this result can be explained by the time since the gene duplication. CONCLUSIONS: Genes encoding self-interacting proteins tend to have higher duplicability than proteins lacking self-interactions. Moreover these duplicate genes have more often arisen through whole-genome rather than small-scale duplication. Finally, self-interacting WGD genes tend to have more interaction partners in general in the PIN, which can be explained by their overall greater age. This work adds to our growing knowledge of the importance of contextual factors in gene duplicability.

  12. Human DNA repair and recombination genes

    International Nuclear Information System (INIS)

    Thompson, L.H.; Weber, C.A.; Jones, N.J.

    1988-09-01

    Several genes involved in mammalian DNA repair pathways were identified by complementation analysis and chromosomal mapping based on hybrid cells. Eight complementation groups of rodent mutants defective in the repair of uv radiation damage are now identified. At least seven of these genes are probably essential for repair and at least six of them control the incision step. The many genes required for repair of DNA cross-linking damage show overlap with those involved in the repair of uv damage, but some of these genes appear to be unique for cross-link repair. Two genes residing on human chromosome 19 were cloned from genomic transformants using a cosmid vector, and near full-length cDNA clones of each gene were isolated and sequenced. Gene ERCC2 efficiently corrects the defect in CHO UV5, a nucleotide excision repair mutant. Gene XRCC1 normalizes repair of strand breaks and the excessive sister chromatid exchange in CHO mutant EM9. ERCC2 shows a remarkable /approximately/52% overall homology at both the amino acid and nucleotide levels with the yeast RAD3 gene. Evidence based on mutation induction frequencies suggests that ERCC2, like RAD3, might also be an essential gene for viability. 100 refs., 4 tabs

  13. Human gene therapy and imaging: cardiology

    International Nuclear Information System (INIS)

    Wu, Joseph C.; Yla-Herttuala, Seppo

    2005-01-01

    This review discusses the basics of cardiovascular gene therapy, the results of recent human clinical trials, and the rapid progress in imaging techniques in cardiology. Improved understanding of the molecular and genetic basis of coronary heart disease has made gene therapy a potential new alternative for the treatment of cardiovascular diseases. Experimental studies have established the proof-of-principle that gene transfer to the cardiovascular system can achieve therapeutic effects. First human clinical trials provided initial evidence of feasibility and safety of cardiovascular gene therapy. However, phase II/III clinical trials have so far been rather disappointing and one of the major problems in cardiovascular gene therapy has been the inability to verify gene expression in the target tissue. New imaging techniques could significantly contribute to the development of better gene therapeutic approaches. Although the exact choice of imaging modality will depend on the biological question asked, further improvement in image resolution and detection sensitivity will be needed for all modalities as we move from imaging of organs and tissues to imaging of cells and genes. (orig.)

  14. Chromosomal locations of members of a family of novel endogenous human retroviral genomes

    International Nuclear Information System (INIS)

    Horn, T.M.; Huebner, K.; Croce, C.; Callahan, R.

    1986-01-01

    Human cellular DNA contains two distinguishable families of retroviral related sequences. One family shares extensive nucleotide sequence homology with infectious mammalian type C retroviral genomes. The other family contains major regions of homology with the pol genes of infectious type A and B and avian type C and D retroviral genomes. Analysis of the human recombinant clone HLM-2 has shown that the pol gene in the latter family is located within an endogenous proviral genome. The authors show that the proviral genome in HLM-2 and the related recombinant clone HLM-25 are located, respectively, on human chromosomes 1 and 5. Other related proviral genomes are located on chromosomes 7, 8, 11, 14, and 17

  15. BcII RFLP for the human vimentin gene

    Energy Technology Data Exchange (ETDEWEB)

    Marcus, E M; Smith, B A; Telenius, H; Ponder, B A.J.; Mathew, C G.P. [Haddow Laboratories, Surrey (England); Landsvater, R M; Buys, C H.C.M. [State Univ. of Groningen (Netherlands); Ferrari, S [Temple University Medical School, Philadelphia, PA (USA)

    1988-09-26

    A 1.1 kb cDNA clone (hp4F1) encoding the human vimentin gene was identified in a human library by screening with 4F1, a hamster vimentin cDNA. BcII (TGATCA) recognizes a two allele polymorphism: bands A1 at 8.1 kb, and A2 at 3.6 kb. The allele frequency was determined in 47 unrelated Caucasian individuals. The RFLP was mapped to chromosome 10pter-10q23 using somatic cell hybrids and to 10p13 by in situ hybridization. Co-dominant segregation was observed in 2 informative families.

  16. Early evolution of the LIM homeobox gene family

    Energy Technology Data Exchange (ETDEWEB)

    Srivastava, Mansi; Larroux, Claire; Lu, Daniel R; Mohanty, Kareshma; Chapman, Jarrod; Degnan, Bernard M; Rokhsar, Daniel S

    2010-01-01

    LIM homeobox (Lhx) transcription factors are unique to the animal lineage and have patterning roles during embryonic development in flies, nematodes and vertebrates, with a conserved role in specifying neuronal identity. Though genes of this family have been reported in a sponge and a cnidarian, the expression patterns and functions of the Lhx family during development in non-bilaterian phyla are not known. We identified Lhx genes in two cnidarians and a placozoan and report the expression of Lhx genes during embryonic development in Nematostella and the demosponge Amphimedon. Members of the six major LIM homeobox subfamilies are represented in the genomes of the starlet sea anemone, Nematostella vectensis, and the placozoan Trichoplax adhaerens. The hydrozoan cnidarian, Hydra magnipapillata, has retained four of the six Lhx subfamilies, but apparently lost two others. Only three subfamilies are represented in the haplosclerid demosponge Amphimedon queenslandica. A tandem cluster of three Lhx genes of different subfamilies and a gene containing two LIM domains in the genome of T. adhaerens (an animal without any neurons) indicates that Lhx subfamilies were generated by tandem duplication. This tandem cluster in Trichoplax is likely a remnant of the original chromosomal context in which Lhx subfamilies first appeared. Three of the six Trichoplax Lhx genes are expressed in animals in laboratory culture, as are all Lhx genes in Hydra. Expression patterns of Nematostella Lhx genes correlate with neural territories in larval and juvenile polyp stages. In the aneural demosponge, A. queenslandica, the three Lhx genes are expressed widely during development, including in cells that are associated with the larval photosensory ring. The Lhx family expanded and diversified early in animal evolution, with all six subfamilies already diverged prior to the cnidarian-placozoan-bilaterian last common ancestor. In Nematostella, Lhx gene expression is correlated with neural

  17. Early evolution of the LIM homeobox gene family

    Directory of Open Access Journals (Sweden)

    Degnan Bernard M

    2010-01-01

    Full Text Available Abstract Background LIM homeobox (Lhx transcription factors are unique to the animal lineage and have patterning roles during embryonic development in flies, nematodes and vertebrates, with a conserved role in specifying neuronal identity. Though genes of this family have been reported in a sponge and a cnidarian, the expression patterns and functions of the Lhx family during development in non-bilaterian phyla are not known. Results We identified Lhx genes in two cnidarians and a placozoan and report the expression of Lhx genes during embryonic development in Nematostella and the demosponge Amphimedon. Members of the six major LIM homeobox subfamilies are represented in the genomes of the starlet sea anemone, Nematostella vectensis, and the placozoan Trichoplax adhaerens. The hydrozoan cnidarian, Hydra magnipapillata, has retained four of the six Lhx subfamilies, but apparently lost two others. Only three subfamilies are represented in the haplosclerid demosponge Amphimedon queenslandica. A tandem cluster of three Lhx genes of different subfamilies and a gene containing two LIM domains in the genome of T. adhaerens (an animal without any neurons indicates that Lhx subfamilies were generated by tandem duplication. This tandem cluster in Trichoplax is likely a remnant of the original chromosomal context in which Lhx subfamilies first appeared. Three of the six Trichoplax Lhx genes are expressed in animals in laboratory culture, as are all Lhx genes in Hydra. Expression patterns of Nematostella Lhx genes correlate with neural territories in larval and juvenile polyp stages. In the aneural demosponge, A. queenslandica, the three Lhx genes are expressed widely during development, including in cells that are associated with the larval photosensory ring. Conclusions The Lhx family expanded and diversified early in animal evolution, with all six subfamilies already diverged prior to the cnidarian-placozoan-bilaterian last common ancestor. In

  18. Plant ion channels: gene families, physiology, and functional genomics analyses.

    Science.gov (United States)

    Ward, John M; Mäser, Pascal; Schroeder, Julian I

    2009-01-01

    Distinct potassium, anion, and calcium channels in the plasma membrane and vacuolar membrane of plant cells have been identified and characterized by patch clamping. Primarily owing to advances in Arabidopsis genetics and genomics, and yeast functional complementation, many of the corresponding genes have been identified. Recent advances in our understanding of ion channel genes that mediate signal transduction and ion transport are discussed here. Some plant ion channels, for example, ALMT and SLAC anion channel subunits, are unique. The majority of plant ion channel families exhibit homology to animal genes; such families include both hyperpolarization- and depolarization-activated Shaker-type potassium channels, CLC chloride transporters/channels, cyclic nucleotide-gated channels, and ionotropic glutamate receptor homologs. These plant ion channels offer unique opportunities to analyze the structural mechanisms and functions of ion channels. Here we review gene families of selected plant ion channel classes and discuss unique structure-function aspects and their physiological roles in plant cell signaling and transport.

  19. Patenting Human Genes in Europe

    DEFF Research Database (Denmark)

    Minssen, Timo

    2017-01-01

    In accordance with the concept of the book and the assigned scope of the contribution, this chapter describes the European law with respect to the patent-eligibility of isolated DNA sequences. This chapter will further include a brief comparison with recent developments from the US and Australia....... It will, however, not focus on the important debates regarding the patent-eligibility of other biological material, diagnostic methods patents (as data aggregators) or abstract ideas which will be addressed by other contributions. Moreover, the analysis will merely concentrate on patent-eligibility. Other...... patentability requirement will only be briefly touched upon in the discussion part. The paper starts out in section 1.5.2 by discussing the patent-eligibility of isolated human DNA sequences on the European national level and under the Biotechnology Directive. Then the patent-eligibility of isolated human DNA...

  20. A comprehensive family-based replication study of schizophrenia genes

    DEFF Research Database (Denmark)

    Aberg, Karolina A; Liu, Youfang; Bukszár, Jozsef

    2013-01-01

     768 control subjects from 6 databases and, after quality control 6298 individuals (including 3286 cases) from 1811 nuclear families. MAIN OUTCOMES AND MEASURES Case-control status for SCZ. RESULTS Replication results showed a highly significant enrichment of SNPs with small P values. Of the SNPs...... in an independent family-based replication study that, after quality control, consisted of 8107 SNPs. SETTING Linkage meta-analysis, brain transcriptome meta-analysis, candidate gene database, OMIM, relevant mouse studies, and expression quantitative trait locus databases. PATIENTS We included 11 185 cases and 10...

  1. NDP gene mutations in 14 French families with Norrie disease.

    Science.gov (United States)

    Royer, Ghislaine; Hanein, Sylvain; Raclin, Valérie; Gigarel, Nadine; Rozet, Jean-Michel; Munnich, Arnold; Steffann, Julie; Dufier, Jean-Louis; Kaplan, Josseline; Bonnefont, Jean-Paul

    2003-12-01

    Norrie disease is a rare X-inked recessive condition characterized by congenital blindness and occasionally deafness and mental retardation in males. This disease has been ascribed to mutations in the NDP gene on chromosome Xp11.1. Previous investigations of the NDP gene have identified largely sixty disease-causing sequence variants. Here, we report on ten different NDP gene allelic variants in fourteen of a series of 21 families fulfilling inclusion criteria. Two alterations were intragenic deletions and eight were nucleotide substitutions or splicing variants, six of them being hitherto unreported, namely c.112C>T (p.Arg38Cys), c.129C>G (p.His43Gln), c.133G>A (p.Val45Met), c.268C>T (p.Arg90Cys), c.382T>C (p.Cys128Arg), c.23479-1G>C (unknown). No NDP gene sequence variant was found in seven of the 21 families. This observation raises the issue of misdiagnosis, phenocopies, or existence of other X-linked or autosomal genes, the mutations of which would mimic the Norrie disease phenotype. Copyright 2003 Wiley-Liss, Inc.

  2. Structure of gene and pseudogenes of human apoferritin H

    Energy Technology Data Exchange (ETDEWEB)

    Costanzo, F; Colombo, M; Staempfli, S; Santoro, C; Marone, M; Frank, K; Delius, H; Cortese, R

    1986-01-24

    Ferritin is composed of two subunits, H and L. cDNA's coding for these proteins from human liver, lymphocytes and from the monocyte-like cell line U937 have been cloned and sequenced. Southern blot analysis on total human DNA reveals that there are many DNA segments hybridizing to the apoferritin H and L cDNA probes. In view of the tissue heterogeneity of ferritin molecules, it appeared possible that apoferritin molecules could be coded by a family of genes differentially expressed in various tissues. In this paper, the authors describe the cloning and sequencing of the gene coding for human apoferritin H. This gene has three introns; the exon sequence is identical to that of cDNAs isolated from human liver, lymphocytes, HeLa cells and endothelial cells. In addition they show that at least 15 intronless pseudogenes exist, with features suggesting that there were originated by reverse transcription and insertion. On the basis of these results they conclude that only one gene is responsible for the synthesis of the majority of apoferritin H mRNA in various tissues examined, and that probably all the other DNA segments hybridizing with apoferritin cDNA are pseudogenes.

  3. Gene Expression in the Human Endolymphatic Sac

    DEFF Research Database (Denmark)

    Møller, Martin Nue; Kirkeby, Svend; Vikeså, Jonas

    2015-01-01

    a1 sodium-bicarbonate transporter, SLC9a2 sodium-hydrogen transporter, SLC12a3 thiazide-sensitive Na-Cl transporter, and SLC34a2 sodium-phosphate transporter. CONCLUSIONS: Several important ion transporters of the SLC family are expressed in the human endolymphatic sac, including Pendrin...

  4. Evolutionary history of chordate PAX genes: dynamics of change in a complex gene family.

    Directory of Open Access Journals (Sweden)

    Vanessa Rodrigues Paixão-Côrtes

    Full Text Available Paired box (PAX genes are transcription factors that play important roles in embryonic development. Although the PAX gene family occurs in animals only, it is widely distributed. Among the vertebrates, its 9 genes appear to be the product of complete duplication of an original set of 4 genes, followed by an additional partial duplication. Although some studies of PAX genes have been conducted, no comprehensive survey of these genes across the entire taxonomic unit has yet been attempted. In this study, we conducted a detailed comparison of PAX sequences from 188 chordates, which revealed restricted variation. The absence of PAX4 and PAX8 among some species of reptiles and birds was notable; however, all 9 genes were present in all 74 mammalian genomes investigated. A search for signatures of selection indicated that all genes are subject to purifying selection, with a possible constraint relaxation in PAX4, PAX7, and PAX8. This result indicates asymmetric evolution of PAX family genes, which can be associated with the emergence of adaptive novelties in the chordate evolutionary trajectory.

  5. The nitrate transporter (NRT gene family in poplar.

    Directory of Open Access Journals (Sweden)

    Hua Bai

    Full Text Available Nitrate is an important nutrient required for plant growth. It also acts as a signal regulating plant development. Nitrate is actively taken up and transported by nitrate transporters (NRT, which form a large family with many members and distinct functions. In contrast to Arabidopsis and rice there is little information about the NRT family in woody plants such as Populus. In this study, a comprehensive analysis of the Populus NRT family was performed. Sixty-eight PtNRT1/PTR, 6 PtNRT2, and 5 PtNRT3 genes were identified in the P. trichocarpa genome. Phylogenetic analysis confirmed that the genes of the NRT family are divided into three clades: NRT1/PTR with four subclades, NRT2, and NRT3. Topological analysis indicated that all members of PtNRT1/PTR and PtNRT2 have 8 to 12 trans-membrane domains, whereas the PtNRT3 proteins have no or up to two trans-membrane domains. Four PtNRT3 members were predicted as secreted proteins. Microarray analyses revealed tissue-specific expression patterns of PtNRT genes with distinct clusters of NRTs for roots, for the elongation zone of the apical stem segment and the developing xylem and a further cluster for leaves, bark and wood. A comparison of different poplar species (P. trichocarpa, P. tremula, P. euphratica, P. fremontii x P. angustifolia, and P. x canescens showed that the tissue-specific patterns of the NRT genes varied to some extent with species. Bioinformatic analysis of putative cis-regulatory elements in the promoter regions of PtNRT family retrieved motifs suggesting the regulation of the NRT genes by N metabolism, by energy and carbon metabolism, and by phytohormones and stress. Multivariate analysis suggested that the combination and abundance of motifs in distinct promoters may lead to tissue-specificity. Our genome wide analysis of the PtNRT genes provides a valuable basis for functional analysis towards understanding the role of nitrate transporters for tree growth.

  6. Diverse roles of ERECTA family genes in plant development.

    Science.gov (United States)

    Shpak, Elena D

    2013-12-01

    Multiple receptor-like kinases (RLKs) enable intercellular communication that coordinates growth and development of plant tissues. ERECTA family receptors (ERfs) are an ancient family of leucine-rich repeat RLKs that in Arabidopsis consists of three genes: ERECTA, ERL1, and ERL2. ERfs sense secreted cysteine-rich peptides from the EPF/EPFL family and transmit the signal through a MAP kinase cascade. This review discusses the functions of ERfs in stomata development, in regulation of longitudinal growth of aboveground organs, during reproductive development, and in the shoot apical meristem. In addition the role of ERECTA in plant responses to biotic and abiotic factors is examined. Elena D. Shpak (Corresponding author). © 2013 Institute of Botany, Chinese Academy of Sciences.

  7. Molecular study of the perforin gene in familial hematological malignancies

    Directory of Open Access Journals (Sweden)

    El Abed Rim

    2011-09-01

    Full Text Available Abstract Perforin gene (PRF1 mutations have been identified in some patients diagnosed with the familial form of hemophagocytic lymphohistiocytosis (HLH and in patients with lymphoma. The aim of the present study was to determine whether patients with a familial aggregation of hematological malignancies harbor germline perforin gene mutations. For this purpose, 81 unrelated families from Tunisia and France with aggregated hematological malignancies were investigated. The variants detected in the PRF1 coding region amounted to 3.7% (3/81. Two of the three variants identified were previously described: the p.Ala91Val pathogenic mutation and the p.Asn252Ser polymorphism. A new p.Ala 211Val missense substitution was identified in two related Tunisian patients. In order to assess the pathogenicity of this new variation, bioinformatic tools were used to predict its effects on the perforin protein structure and at the mRNA level. The segregation of the mutant allele was studied in the family of interest and a control population was screened. The fact that this variant was not found to occur in 200 control chromosomes suggests that it may be pathogenic. However, overexpression of mutated PRF1 in rat basophilic leukemia cells did not affect the lytic function of perforin differently from the wild type protein.

  8. One Family's Struggles with HPV (Human Papillomavirus)

    Medline Plus

    Full Text Available ... Tos Ferina AAP CME ask your doctor brochure family stories faq meet dr. gary freed meet keri ... media video/audio pneumonia tb overview links & resources families advocacy about civil rights kids' rights sample school ...

  9. Positive selection in the SLC11A1 gene in the family Equidae.

    Science.gov (United States)

    Bayerova, Zuzana; Janova, Eva; Matiasovic, Jan; Orlando, Ludovic; Horin, Petr

    2016-05-01

    Immunity-related genes are a suitable model for studying effects of selection at the genomic level. Some of them are highly conserved due to functional constraints and purifying selection, while others are variable and change quickly to cope with the variation of pathogens. The SLC11A1 gene encodes a transporter protein mediating antimicrobial activity of macrophages. Little is known about the patterns of selection shaping this gene during evolution. Although it is a typical evolutionarily conserved gene, functionally important polymorphisms associated with various diseases were identified in humans and other species. We analyzed the genomic organization, genetic variation, and evolution of the SLC11A1 gene in the family Equidae to identify patterns of selection within this important gene. Nucleotide SLC11A1 sequences were shown to be highly conserved in ten equid species, with more than 97 % sequence identity across the family. Single nucleotide polymorphisms (SNPs) were found in the coding and noncoding regions of the gene. Seven codon sites were identified to be under strong purifying selection. Codons located in three regions, including the glycosylated extracellular loop, were shown to be under diversifying selection. A 3-bp indel resulting in a deletion of the amino acid 321 in the predicted protein was observed in all horses, while it has been maintained in all other equid species. This codon comprised in an N-glycosylation site was found to be under positive selection. Interspecific variation in the presence of predicted N-glycosylation sites was observed.

  10. Good genes, complementary genes and human mate preferences.

    Science.gov (United States)

    Roberts, S Craig; Little, Anthony C

    2008-09-01

    The past decade has witnessed a rapidly growing interest in the biological basis of human mate choice. Here we review recent studies that demonstrate preferences for traits which might reveal genetic quality to prospective mates, with potential but still largely unknown influence on offspring fitness. These include studies assessing visual, olfactory and auditory preferences for potential good-gene indicator traits, such as dominance or bilateral symmetry. Individual differences in these robust preferences mainly arise through within and between individual variation in condition and reproductive status. Another set of studies have revealed preferences for traits indicating complementary genes, focussing on discrimination of dissimilarity at genes in the major histocompatibility complex (MHC). As in animal studies, we are only just beginning to understand how preferences for specific traits vary and inter-relate, how consideration of good and compatible genes can lead to substantial variability in individual mate choice decisions and how preferences expressed in one sensory modality may reflect those in another. Humans may be an ideal model species in which to explore these interesting complexities.

  11. Signals of historical interlocus gene conversion in human segmental duplications.

    Directory of Open Access Journals (Sweden)

    Beth L Dumont

    Full Text Available Standard methods of DNA sequence analysis assume that sequences evolve independently, yet this assumption may not be appropriate for segmental duplications that exchange variants via interlocus gene conversion (IGC. Here, we use high quality multiple sequence alignments from well-annotated segmental duplications to systematically identify IGC signals in the human reference genome. Our analysis combines two complementary methods: (i a paralog quartet method that uses DNA sequence simulations to identify a statistical excess of sites consistent with inter-paralog exchange, and (ii the alignment-based method implemented in the GENECONV program. One-quarter (25.4% of the paralog families in our analysis harbor clear IGC signals by the quartet approach. Using GENECONV, we identify 1477 gene conversion tracks that cumulatively span 1.54 Mb of the genome. Our analyses confirm the previously reported high rates of IGC in subtelomeric regions and Y-chromosome palindromes, and identify multiple novel IGC hotspots, including the pregnancy specific glycoproteins and the neuroblastoma breakpoint gene families. Although the duplication history of a paralog family is described by a single tree, we show that IGC has introduced incredible site-to-site variation in the evolutionary relationships among paralogs in the human genome. Our findings indicate that IGC has left significant footprints in patterns of sequence diversity across segmental duplications in the human genome, out-pacing the contributions of single base mutation by orders of magnitude. Collectively, the IGC signals we report comprise a catalog that will provide a critical reference for interpreting observed patterns of DNA sequence variation across duplicated genomic regions, including targets of recent adaptive evolution in humans.

  12. Bioinformatics Analysis of MAPKKK Family Genes in Medicago truncatula

    Directory of Open Access Journals (Sweden)

    Wei Li

    2016-04-01

    Full Text Available Mitogen‐activated protein kinase kinase kinase (MAPKKK is a component of the MAPK cascade pathway that plays an important role in plant growth, development, and response to abiotic stress, the functions of which have been well characterized in several plant species, such as Arabidopsis, rice, and maize. In this study, we performed genome‐wide and systemic bioinformatics analysis of MAPKKK family genes in Medicago truncatula. In total, there were 73 MAPKKK family members identified by search of homologs, and they were classified into three subfamilies, MEKK, ZIK, and RAF. Based on the genomic duplication function, 72 MtMAPKKK genes were located throughout all chromosomes, but they cluster in different chromosomes. Using microarray data and high‐throughput sequencing‐data, we assessed their expression profiles in growth and development processes; these results provided evidence for exploring their important functions in developmental regulation, especially in the nodulation process. Furthermore, we investigated their expression in abiotic stresses by RNA‐seq, which confirmed their critical roles in signal transduction and regulation processes under stress. In summary, our genome‐wide, systemic characterization and expressional analysis of MtMAPKKK genes will provide insights that will be useful for characterizing the molecular functions of these genes in M. truncatula.

  13. Human amyloid beta protein gene locus: HaeIII RFLP

    Energy Technology Data Exchange (ETDEWEB)

    Taylor, J E; Gonzalez-DeWhitt, P A; Fuller, F; Cordell, B; Frossard, P M [California Biotechnology Inc., Mountain View (USA); Tinklenberg, J R; Davies, H D; Eng, L F; Yesavage, J A [Stanford Univ. School of Medicine, Palo Alto, CA (USA)

    1988-07-25

    A 2.2 kb EcoRI-EcoRI fragment from the 5{prime} end of the human amyloid beta protein cDNA was isolated from a human fibroblast cDNA library and subcloned into pGEM3. HaeIII (GGCC) detects 6 invariant bands at 0.5 kb, 1.0 kb, 1.1 kb, 1.3 kb, 1.4 kb and 1.6 kb and a two-allele polymorphism with bands at either 1.9 kb or 2.1 kb. Its frequency was studied in 50 North Americans. Human amyloid beta protein gene mapped to the long arm of chromosome 21 (21q11.2-21q21) by Southern blot analysis of human-rodent somatic cell hybrids. Co-dominant segregation was observed in two families (15 individuals).

  14. Exome sequencing of Pakistani consanguineous families identifies 30 novel candidate genes for recessive intellectual disability.

    Science.gov (United States)

    Riazuddin, S; Hussain, M; Razzaq, A; Iqbal, Z; Shahzad, M; Polla, D L; Song, Y; van Beusekom, E; Khan, A A; Tomas-Roca, L; Rashid, M; Zahoor, M Y; Wissink-Lindhout, W M; Basra, M A R; Ansar, M; Agha, Z; van Heeswijk, K; Rasheed, F; Van de Vorst, M; Veltman, J A; Gilissen, C; Akram, J; Kleefstra, T; Assir, M Z; Grozeva, D; Carss, K; Raymond, F L; O'Connor, T D; Riazuddin, S A; Khan, S N; Ahmed, Z M; de Brouwer, A P M; van Bokhoven, H; Riazuddin, S

    2017-11-01

    Intellectual disability (ID) is a clinically and genetically heterogeneous disorder, affecting 1-3% of the general population. Although research into the genetic causes of ID has recently gained momentum, identification of pathogenic mutations that cause autosomal recessive ID (ARID) has lagged behind, predominantly due to non-availability of sizeable families. Here we present the results of exome sequencing in 121 large consanguineous Pakistani ID families. In 60 families, we identified homozygous or compound heterozygous DNA variants in a single gene, 30 affecting reported ID genes and 30 affecting novel candidate ID genes. Potential pathogenicity of these alleles was supported by co-segregation with the phenotype, low frequency in control populations and the application of stringent bioinformatics analyses. In another eight families segregation of multiple pathogenic variants was observed, affecting 19 genes that were either known or are novel candidates for ID. Transcriptome profiles of normal human brain tissues showed that the novel candidate ID genes formed a network significantly enriched for transcriptional co-expression (P<0.0001) in the frontal cortex during fetal development and in the temporal-parietal and sub-cortex during infancy through adulthood. In addition, proteins encoded by 12 novel ID genes directly interact with previously reported ID proteins in six known pathways essential for cognitive function (P<0.0001). These results suggest that disruptions of temporal parietal and sub-cortical neurogenesis during infancy are critical to the pathophysiology of ID. These findings further expand the existing repertoire of genes involved in ARID, and provide new insights into the molecular mechanisms and the transcriptome map of ID.

  15. Polymorphism in the interferon-{alpha} gene family

    Energy Technology Data Exchange (ETDEWEB)

    Golovleva, I.; Lundgren, E.; Beckman, L. [Univ. of Umea (Sweden); Kandefer-Szerszen, M. [Maria Curie-Sklodowska Univ., Lublin (Poland)

    1996-09-01

    A pronounced genetic polymorphism of the interferon type I gene family has been assumed on the basis of RFLP analysis of the genomic region as well as the large number of sequences published compared to the number of loci. However, IFNA2 is the only locus that has been carefully analyzed concerning gene frequency, and only naturally occurring rare alleles have been found. We have extended the studies on a variation of expressed sequences by studying the IFNA1, IFNA2, IFNA10, IFNA13, IFNA14, and IFNA17 genes. Genomic white-blood-cell DNA from a population sample of blood donors and from a family material were screened by single-nucleotide primer extension (allele-specific primer extension) of PCR fragments. Because of sequence similarities, in some cases {open_quotes}nested{close_quotes} PCR was used, and, when applicable, restriction analysis or control sequencing was performed. All individuals carried the interferon-{alpha} 1 and interferon-{alpha} 13 variants but not the LeIF D variant. At the IFNA2 and IFNA14 loci only one sequence variant was found, while in the IFNA10 and IFNA17 groups two alleles were detected in each group. The IFNA10 and IFNA17 alleles segregated in families and showed a close fit to the Hardy-Weinberg equilibrium. There was a significant linkage disequilibrium between IFNA10 and IFNA17 alleles. The fact that the extent of genetic polymorphism was lower than expected suggests that a majority of the previously described gene sequences represent nonpolymorphic rare mutants that may have arisen in tumor cell lines. 44 refs., 4 figs., 4 tabs.

  16. The Human-Canine Bond: Closer than Family Ties?

    Science.gov (United States)

    Barker, Sandra B.; Barker, Randolph T.

    1988-01-01

    Used Family Life Space Diagram to compare relationship between human family members with the human-canine relationship. Subjects were 29 dog enthusiasts, 66 typical pet owners, and 27 elementary school students with dogs. Results suggest that individuals may perceive their relationship with their pet dog as being as close as their relationship…

  17. Gene screening in a Chinese family with Marfan syndrome

    Directory of Open Access Journals (Sweden)

    Wen-Jiao Xia

    2016-05-01

    Full Text Available AIM:To analyze the causative gene mutation for Marfan syndrome(MFSwith autosomal dominant hereditary in a Chinese family in Liaoning Province,China. METHODS: Venous blood was collected and candidate gene was selected to design primers according to the clinical phenotype. With genomic polymerase chain reaction(PCRperformed, the coding exons and their flanking intron in sequences of candidate gene were sequenced,DNA fragments separated by agarose gel electrophoresis and direct sequencing method was used to determine the pathogenic gene.RESULTS:Phenotype of the proband was presented as ectopic lentis. Sequencing of the coding regions of FBN1 gene showed the presence of a heterozygous A→G transversion at nucleotide 640 in the 7 exon of FBN1 and the missense mutation made for Glycine into Serine(G214S. CONCLUSION:A heterozygous mutation of FBN1 c.A640G(p.G214Sis responsible for the Marfan syndrome in the four generation Chinese pedigree.

  18. Comparative study of human mitochondrial proteome reveals extensive protein subcellular relocalization after gene duplications

    Directory of Open Access Journals (Sweden)

    Huang Yong

    2009-11-01

    Full Text Available Abstract Background Gene and genome duplication is the principle creative force in evolution. Recently, protein subcellular relocalization, or neolocalization was proposed as one of the mechanisms responsible for the retention of duplicated genes. This hypothesis received support from the analysis of yeast genomes, but has not been tested thoroughly on animal genomes. In order to evaluate the importance of subcellular relocalizations for retention of duplicated genes in animal genomes, we systematically analyzed nuclear encoded mitochondrial proteins in the human genome by reconstructing phylogenies of mitochondrial multigene families. Results The 456 human mitochondrial proteins selected for this study were clustered into 305 gene families including 92 multigene families. Among the multigene families, 59 (64% consisted of both mitochondrial and cytosolic (non-mitochondrial proteins (mt-cy families while the remaining 33 (36% were composed of mitochondrial proteins (mt-mt families. Phylogenetic analyses of mt-cy families revealed three different scenarios of their neolocalization following gene duplication: 1 relocalization from mitochondria to cytosol, 2 from cytosol to mitochondria and 3 multiple subcellular relocalizations. The neolocalizations were most commonly enabled by the gain or loss of N-terminal mitochondrial targeting signals. The majority of detected subcellular relocalization events occurred early in animal evolution, preceding the evolution of tetrapods. Mt-mt protein families showed a somewhat different pattern, where gene duplication occurred more evenly in time. However, for both types of protein families, most duplication events appear to roughly coincide with two rounds of genome duplications early in vertebrate evolution. Finally, we evaluated the effects of inaccurate and incomplete annotation of mitochondrial proteins and found that our conclusion of the importance of subcellular relocalization after gene duplication on

  19. Ethical issues of perinatal human gene therapy.

    Science.gov (United States)

    Fletcher, J C; Richter, G

    1996-01-01

    This paper examines some key ethical issues raised by trials of human gene therapy in the perinatal period--i.e., in infants, young children, and the human fetus. It describes five resources in ethics for researchers' considerations prior to such trials: (1) the history of ethical debate about gene therapy, (2) a literature on the relevance of major ethical principles for clinical research, (3) a body of widely accepted norms and practices, (4) knowledge of paradigm cases, and (5) researchers' own professional integrity. The paper also examines ethical concerns that must be met prior to any trial: benefits to and safety of subjects, informed assent of children and informed parental permission, informed consent of pregnant women in fetal gene therapy, protection of privacy, and concerns about fairness in the selection of subjects. The paper criticizes the position that cases of fetal gene therapy should be restricted only to those where the pregnant woman has explicitly refused abortion. Additional topics include concerns about genetic enhancement and germ-line gene therapy.

  20. The Tomato Terpene Synthase Gene Family1[W][OA

    Science.gov (United States)

    Falara, Vasiliki; Akhtar, Tariq A.; Nguyen, Thuong T.H.; Spyropoulou, Eleni A.; Bleeker, Petra M.; Schauvinhold, Ines; Matsuba, Yuki; Bonini, Megan E.; Schilmiller, Anthony L.; Last, Robert L.; Schuurink, Robert C.; Pichersky, Eran

    2011-01-01

    Compounds of the terpenoid class play numerous roles in the interactions of plants with their environment, such as attracting pollinators and defending the plant against pests. We show here that the genome of cultivated tomato (Solanum lycopersicum) contains 44 terpene synthase (TPS) genes, including 29 that are functional or potentially functional. Of these 29 TPS genes, 26 were expressed in at least some organs or tissues of the plant. The enzymatic functions of eight of the TPS proteins were previously reported, and here we report the specific in vitro catalytic activity of 10 additional tomato terpene synthases. Many of the tomato TPS genes are found in clusters, notably on chromosomes 1, 2, 6, 8, and 10. All TPS family clades previously identified in angiosperms are also present in tomato. The largest clade of functional TPS genes found in tomato, with 12 members, is the TPS-a clade, and it appears to encode only sesquiterpene synthases, one of which is localized to the mitochondria, while the rest are likely cytosolic. A few additional sesquiterpene synthases are encoded by TPS-b clade genes. Some of the tomato sesquiterpene synthases use z,z-farnesyl diphosphate in vitro as well, or more efficiently than, the e,e-farnesyl diphosphate substrate. Genes encoding monoterpene synthases are also prevalent, and they fall into three clades: TPS-b, TPS-g, and TPS-e/f. With the exception of two enzymes involved in the synthesis of ent-kaurene, the precursor of gibberellins, no other tomato TPS genes could be demonstrated to encode diterpene synthases so far. PMID:21813655

  1. Sequence of the intron/exon junctions of the coding region of the human androgen receptor gene and identification of a point mutation in a family with complete androgen insensitivity

    International Nuclear Information System (INIS)

    Lubahn, D.B.; Simental, J.A.; Higgs, H.N.; Wilson, E.M.; French, F.S.; Brown, T.R.; Migeon, C.J.

    1989-01-01

    Androgens act through a receptor protein (AR) to mediate sex differentiation and development of the male phenotype. The authors have isolated the eight exons in the amino acid coding region of the AR gene from a human X chromosome library. Nucleotide sequences of the AR gene intron/exon boundaries were determined for use in designing synthetic oligonucleotide primers to bracket coding exons for amplification by the polymerase chain reaction. Genomic DNA was amplified from 46, XY phenotypic female siblings with complete androgen insensitivity syndrome. AR binding affinity for dihydrotestosterone in the affected siblings was lower than in normal males, but the binding capacity was normal. Sequence analysis of amplified exons demonstrated within the AR steroid-binding domain (exon G) a single guanine to adenine mutation, resulting in replacement of valine with methionine at amino acid residue 866. As expected, the carrier mother had both normal and mutant AR genes. Thus, a single point mutation in the steroid-binding domain of the AR gene correlated with the expression of an AR protein ineffective in stimulating male sexual development

  2. Update of the human secretoglobin (SCGB gene superfamily and an example of 'evolutionary bloom' of androgen-binding protein genes within the mouse Scgb gene superfamily

    Directory of Open Access Journals (Sweden)

    Jackson Brian C

    2011-10-01

    Full Text Available Abstract The secretoglobins (SCGBs comprise a family of small, secreted proteins found in animals exclusively of mammalian lineage. There are 11 human SCGB genes and five pseudogenes. Interestingly, mice have 68 Scgb genes, four of which are highly orthologous to human SCGB genes; the remainder represent an 'evolutionary bloom' and make up a large gene family represented by only six counterparts in humans. SCGBs are found in high concentrations in many mammalian secretions, including fluids of the lung, lacrimal gland, salivary gland, prostate and uterus. Whereas the biological activities of most individual SCGBs have not been fully characterised, what already has been discovered suggests that this family has an important role in the modulation of inflammation, tissue repair and tumorigenesis. In mice, the large Scgb1b and Scgb2b gene families encode the androgen-binding proteins, which have been shown to play a role in mate selection. Although much has been learned about SCGBs in recent years, clearly more research remains to be done to allow a better understanding of the roles of these proteins in human health and disease. Such information is predicted to reveal valuable novel drug targets for the treatment of inflammation, as well as designing biomarkers that might identify tissue damage or cancer.

  3. RFLP for the human retinoic acid receptor gene RAR-. beta

    Energy Technology Data Exchange (ETDEWEB)

    Datson, N A; Oostra, B A [Erasmus Univ., Rotterdam (Netherlands); van der Saag, P T [Netherlands Institute for Developmental Biology, Utrecht (Netherlands)

    1989-11-11

    1.4 kb Mae I fragment containing the entire RAR-{beta} ORF was cloned into the Sma I site of pTZ18U, yielding the plasmid pCOD20. Msp I digestion of genomic DNA and hybridization with the pCOD20 probe detects a two allele polymorphism with allelic fragments of 8.1 and 7.7 kb. The human RAR-{beta} gene has been localized to the p24 band of chromosome 3. Co-dominant segregation of the alleles was observed in 4 Caucasian families.

  4. Amelogenesis Imperfecta: 1 Family, 2 Phenotypes, and 2 Mutated Genes.

    Science.gov (United States)

    Prasad, M K; Laouina, S; El Alloussi, M; Dollfus, H; Bloch-Zupan, A

    2016-12-01

    Amelogenesis imperfecta (AI) is a clinically and genetically heterogeneous group of diseases characterized by enamel defects. The authors have identified a large consanguineous Moroccan family segregating different clinical subtypes of hypoplastic and hypomineralized AI in different individuals within the family. Using targeted next-generation sequencing, the authors identified a novel heterozygous nonsense mutation in COL17A1 (c.1873C>T, p.R625*) segregating with hypoplastic AI and a novel homozygous 8-bp deletion in C4orf26 (c.39_46del, p.Cys14Glyfs*18) segregating with hypomineralized-hypoplastic AI in this family. This study highlights the phenotypic and genotypic heterogeneity of AI that can exist even within a single consanguineous family. Furthermore, the identification of novel mutations in COL17A1 and C4orf26 and their correlation with distinct AI phenotypes can contribute to a better understanding of the pathophysiology of AI and the contribution of these genes to amelogenesis. © International & American Associations for Dental Research 2016.

  5. Human estrogen receptor (ESR) gene locus: PssI dimorphism

    Energy Technology Data Exchange (ETDEWEB)

    Coleman, R T; Taylor, J E; Frossard, P M [California Biotechnology Inc., Mountain View, CA (USA); Shine, J J [Garvan Institute, Darlinghurst (Australia)

    1988-07-25

    pESR-2, a 2.1 kb partial cDNA containing the entire translated sequence of the human estrogen receptor mRNA isolated from MCF-7 human breast cancer cells, was subcloned in the Eco RI site of pBR322. PssI (PuGGNCCPy) identifies a single two-allele polymorphism with bands at either 1.7 or 1.4 kb, as well as invariant bands at 12.6, 9.3, 4.1, 3.7, 2.4, 2.2, and 1.2 kb. Its frequency was studied in 77 unrelated North American Caucasians. The human estrogen receptor gene has been localized to 6q24 -- q27 by in situ hybridization. Co-dominant segregation is demonstrated in one family (8 individuals).

  6. Microevolution of Virulence-Related Genes in Helicobacter pylori Familial Infection.

    Directory of Open Access Journals (Sweden)

    Yoshikazu Furuta

    Full Text Available Helicobacter pylori, a bacterial pathogen that can infect human stomach causing gastritis, ulcers and cancer, is known to have a high degree of genome/epigenome diversity as the result of mutation and recombination. The bacteria often infect in childhood and persist for the life of the host. One of the reasons of the rapid evolution of H. pylori is that it changes its genome drastically for adaptation to a new host. To investigate microevolution and adaptation of the H. pylori genome, we undertook whole genome sequencing of the same or very similar sequence type in multi-locus sequence typing (MLST with seven genes in members of the same family consisting of parents and children in Japan. Detection of nucleotide substitutions revealed likely transmission pathways involving children. Nonsynonymous (amino acid changing mutations were found in virulence-related genes (cag genes, vacA, hcpDX, tnfα, ggt, htrA and the collagenase gene, outer membrane protein (OMP genes and other cell surface-related protein genes, signal transduction genes and restriction-modification genes. We reconstructed various pathways by which H. pylori can adapt to a new human host, and our results raised the possibility that the mutational changes in virulence-related genes have a role in adaptation to a child host. Changes in restriction-modification genes might remodel the methylome and transcriptome to help adaptation. This study has provided insights into H. pylori transmission and virulence and has implications for basic research as well as clinical practice.

  7. The evolutionary history of the SAL1 gene family in eutherian mammals

    Directory of Open Access Journals (Sweden)

    Callebaut Isabelle

    2011-05-01

    Full Text Available Abstract Background SAL1 (salivary lipocalin is a member of the OBP (Odorant Binding Protein family and is involved in chemical sexual communication in pig. SAL1 and its relatives may be involved in pheromone and olfactory receptor binding and in pre-mating behaviour. The evolutionary history and the selective pressures acting on SAL1 and its orthologous genes have not yet been exhaustively described. The aim of the present work was to study the evolution of these genes, to elucidate the role of selective pressures in their evolution and the consequences for their functions. Results Here, we present the evolutionary history of SAL1 gene and its orthologous genes in mammals. We found that (1 SAL1 and its related genes arose in eutherian mammals with lineage-specific duplications in rodents, horse and cow and are lost in human, mouse lemur, bushbaby and orangutan, (2 the evolution of duplicated genes of horse, rat, mouse and guinea pig is driven by concerted evolution with extensive gene conversion events in mouse and guinea pig and by positive selection mainly acting on paralogous genes in horse and guinea pig, (3 positive selection was detected for amino acids involved in pheromone binding and amino acids putatively involved in olfactory receptor binding, (4 positive selection was also found for lineage, indicating a species-specific strategy for amino acid selection. Conclusions This work provides new insights into the evolutionary history of SAL1 and its orthologs. On one hand, some genes are subject to concerted evolution and to an increase in dosage, suggesting the need for homogeneity of sequence and function in certain species. On the other hand, positive selection plays a role in the diversification of the functions of the family and in lineage, suggesting adaptive evolution, with possible consequences for speciation and for the reinforcement of prezygotic barriers.

  8. Differential expression pattern of UBX family genes in Caenorhabditis elegans

    International Nuclear Information System (INIS)

    Yamauchi, Seiji; Sasagawa, Yohei; Ogura, Teru; Yamanaka, Kunitoshi

    2007-01-01

    UBX (ubiquitin regulatory X)-containing proteins belong to an evolutionary conserved protein family and determine the specificity of p97/VCP/Cdc48p function by binding as its adaptors. Caenorhabditis elegans was found to possess six UBX-containing proteins, named UBXN-1 to -6. However, no general or specific function of them has been revealed. During the course of understanding not only their function but also specified function of p97, we investigated spatial and temporal expression patterns of six ubxn genes in this study. Transcript analyses showed that the expression pattern of each ubxn gene was different throughout worm's development and may show potential developmental dynamics in their function, especially ubxn-5 was expressed specifically in the spermatogenic germline, suggesting a crucial role in spermatogenesis. In addition, as ubxn-4 expression was induced by ER stress, it would function as an ERAD factor in C. elegans. In vivo expression analysis by using GFP translational fusion constructs revealed that six ubxn genes show distinct expression patterns. These results altogether demonstrate that the expression of all six ubxn genes of C. elegans is differently regulated

  9. The roles of gene duplication, gene conversion and positive selection in rodent Esp and Mup pheromone gene families with comparison to the Abp family.

    Science.gov (United States)

    Karn, Robert C; Laukaitis, Christina M

    2012-01-01

    Three proteinaceous pheromone families, the androgen-binding proteins (ABPs), the exocrine-gland secreting peptides (ESPs) and the major urinary proteins (MUPs) are encoded by large gene families in the genomes of Mus musculus and Rattus norvegicus. We studied the evolutionary histories of the Mup and Esp genes and compared them with what is known about the Abp genes. Apparently gene conversion has played little if any role in the expansion of the mouse Class A and Class B Mup genes and pseudogenes, and the rat Mups. By contrast, we found evidence of extensive gene conversion in many Esp genes although not in all of them. Our studies of selection identified at least two amino acid sites in β-sheets as having evolved under positive selection in the mouse Class A and Class B MUPs and in rat MUPs. We show that selection may have acted on the ESPs by determining K(a)/K(s) for Exon 3 sequences with and without the converted sequence segment. While it appears that purifying selection acted on the ESP signal peptides, the secreted portions of the ESPs probably have undergone much more rapid evolution. When the inner gene converted fragment sequences were removed, eleven Esp paralogs were present in two or more pairs with K(a)/K(s) >1.0 and thus we propose that positive selection is detectable by this means in at least some mouse Esp paralogs. We compare and contrast the evolutionary histories of all three mouse pheromone gene families in light of their proposed functions in mouse communication.

  10. Human serum amyloid genes--molecular characterization

    International Nuclear Information System (INIS)

    Sack, G.H.; Lease, J.J.

    1986-01-01

    Three clones containing human genes for serum amyloid A protein (SAA) have been isolated and characterized. Each of two clones, GSAA 1 and 2 (of 12.8 and 15.9 kilobases, respectively), contains two exons, accouting for amino acids 12-58 and 58-103 of mature SAA; the extreme 5' termini and 5' untranslated regions have not yet been defined but are anticipated to be close based on studies of murine SAA genes. Initial amino acid sequence comparisons show 78/89 identical residues. At 4 of the 11 discrepant residues, the amino acid specified by the codon is the same as the corresponding residue in murine SAA. Identification of regions containing coding regions has permitted use of selected subclones for blot hybridization studies of larger human SAA chromosomal gene organization. The third clone, GSAA 3 also contains SAA coding information by DNA sequence analysis but has a different organization which has not yet been fully described. We have reported the isolation of clones of human DNA hybridizing with pRS48 - a plasmid containing a complementary DNA (cDNA) clone for murine serum amyloid A (SAA; 1, 2). We now present more detailed data confirming the identity and defining some of the organizational features of these clones

  11. Comparing Families of Suicide Attempters, Human

    African Journals Online (AJOL)

    Rezaei: Family process and content of suicide attempters and HIV positive patients. Annals of Medical ... the exclusion criteria (psychotic disorders, suicidal ideation, addiction, refusing ..... A review of mood disorders among juvenile offenders.

  12. One Family's Struggles with HPV (Human Papillomavirus)

    Medline Plus

    Full Text Available ... tb overview links & resources families advocacy about civil rights kids' rights sample school policies school letter someone you know ... organizations wishing to create their own end slates. Right-click any link to download to your computer. ...

  13. One Family's Struggles with HPV (Human Papillomavirus)

    Medline Plus

    Full Text Available ... find a doctor find health information helpful articles antibiotics colds fevers injection tips sports travel in health ... your family doctor to see if you could benefit. Copyright 1996 - by PKIDs. All rights reserved. home ...

  14. One Family's Struggles with HPV (Human Papillomavirus)

    Medline Plus

    Full Text Available ... cmv hepatitis overview current news glossary injection tips kids infect kids labs links & resources milk thistle pediatric hepatitis report ... overview links & resources families advocacy about civil rights kids' rights sample school policies school letter someone you ...

  15. One Family's Struggles with HPV (Human Papillomavirus)

    Medline Plus

    Full Text Available ... freed meet keri russell posters grand article rich media video/audio pneumonia tb overview links & resources families ... hib hpv pertussis (whooping cough) pneumococcal rotavirus shingles media room Flu's Gonna Lose M.O.V.E. ...

  16. Global Analysis of miRNA Gene Clusters and Gene Families Reveals Dynamic and Coordinated Expression

    Directory of Open Access Journals (Sweden)

    Li Guo

    2014-01-01

    Full Text Available To further understand the potential expression relationships of miRNAs in miRNA gene clusters and gene families, a global analysis was performed in 4 paired tumor (breast cancer and adjacent normal tissue samples using deep sequencing datasets. The compositions of miRNA gene clusters and families are not random, and clustered and homologous miRNAs may have close relationships with overlapped miRNA species. Members in the miRNA group always had various expression levels, and even some showed larger expression divergence. Despite the dynamic expression as well as individual difference, these miRNAs always indicated consistent or similar deregulation patterns. The consistent deregulation expression may contribute to dynamic and coordinated interaction between different miRNAs in regulatory network. Further, we found that those clustered or homologous miRNAs that were also identified as sense and antisense miRNAs showed larger expression divergence. miRNA gene clusters and families indicated important biological roles, and the specific distribution and expression further enrich and ensure the flexible and robust regulatory network.

  17. A conserved gene family encodes transmembrane proteins with fibronectin, immunoglobulin and leucine-rich repeat domains (FIGLER

    Directory of Open Access Journals (Sweden)

    Haga Christopher L

    2007-09-01

    Full Text Available Abstract Background In mouse the cytokine interleukin-7 (IL-7 is required for generation of B lymphocytes, but human IL-7 does not appear to have this function. A bioinformatics approach was therefore used to identify IL-7 receptor related genes in the hope of identifying the elusive human cytokine. Results Our database search identified a family of nine gene candidates, which we have provisionally named fibronectin immunoglobulin leucine-rich repeat (FIGLER. The FIGLER 1–9 genes are predicted to encode type I transmembrane glycoproteins with 6–12 leucine-rich repeats (LRR, a C2 type Ig domain, a fibronectin type III domain, a hydrophobic transmembrane domain, and a cytoplasmic domain containing one to four tyrosine residues. Members of this multichromosomal gene family possess 20–47% overall amino acid identity and are differentially expressed in cell lines and primary hematopoietic lineage cells. Genes for FIGLER homologs were identified in macaque, orangutan, chimpanzee, mouse, rat, dog, chicken, toad, and puffer fish databases. The non-human FIGLER homologs share 38–99% overall amino acid identity with their human counterpart. Conclusion The extracellular domain structure and absence of recognizable cytoplasmic signaling motifs in members of the highly conserved FIGLER gene family suggest a trophic or cell adhesion function for these molecules.

  18. Tetranucleotide repeat polymorphism at the human prostatic acid phosphatase (ACPP) gene

    Energy Technology Data Exchange (ETDEWEB)

    Polymeropoulos, M H; Xiao, Hong; Rath, D S; Merril, C R [National Inst. of Mental Health Neuroscience Center, Washington, DC (United States)

    1991-09-11

    The polymorphic (AAAT){sub n} repeat begins at base pair 2342 of the human prostatic acid phosphatase gene on chromosome 3q21-qter. The polymorphism can be typed using the polymerase chain reaction (PCR) as described previously. The predicted length of the amplified sequence was 275 bp. Co-dominant segregation was observed in two informative families. The human prostatic acid phosphatase gene has been assigned to chromosome 3q21-qter.

  19. New families of human regulatory RNA structures identified by comparative analysis of vertebrate genomes.

    Science.gov (United States)

    Parker, Brian J; Moltke, Ida; Roth, Adam; Washietl, Stefan; Wen, Jiayu; Kellis, Manolis; Breaker, Ronald; Pedersen, Jakob Skou

    2011-11-01

    Regulatory RNA structures are often members of families with multiple paralogous instances across the genome. Family members share functional and structural properties, which allow them to be studied as a whole, facilitating both bioinformatic and experimental characterization. We have developed a comparative method, EvoFam, for genome-wide identification of families of regulatory RNA structures, based on primary sequence and secondary structure similarity. We apply EvoFam to a 41-way genomic vertebrate alignment. Genome-wide, we identify 220 human, high-confidence families outside protein-coding regions comprising 725 individual structures, including 48 families with known structural RNA elements. Known families identified include both noncoding RNAs, e.g., miRNAs and the recently identified MALAT1/MEN β lincRNA family; and cis-regulatory structures, e.g., iron-responsive elements. We also identify tens of new families supported by strong evolutionary evidence and other statistical evidence, such as GO term enrichments. For some of these, detailed analysis has led to the formulation of specific functional hypotheses. Examples include two hypothesized auto-regulatory feedback mechanisms: one involving six long hairpins in the 3'-UTR of MAT2A, a key metabolic gene that produces the primary human methyl donor S-adenosylmethionine; the other involving a tRNA-like structure in the intron of the tRNA maturation gene POP1. We experimentally validate the predicted MAT2A structures. Finally, we identify potential new regulatory networks, including large families of short hairpins enriched in immunity-related genes, e.g., TNF, FOS, and CTLA4, which include known transcript destabilizing elements. Our findings exemplify the diversity of post-transcriptional regulation and provide a resource for further characterization of new regulatory mechanisms and families of noncoding RNAs.

  20. Evolution of the NANOG pseudogene family in the human and chimpanzee genomes

    Directory of Open Access Journals (Sweden)

    Maughan Peter J

    2006-02-01

    Full Text Available Abstract Background The NANOG gene is expressed in mammalian embryonic stem cells where it maintains cellular pluripotency. An unusually large family of pseudogenes arose from it with one unprocessed and ten processed pseudogenes in the human genome. This article compares the NANOG gene and its pseudogenes in the human and chimpanzee genomes and derives an evolutionary history of this pseudogene family. Results The NANOG gene and all pseudogenes except NANOGP8 are present at their expected orthologous chromosomal positions in the chimpanzee genome when compared to the human genome, indicating that their origins predate the human-chimpanzee divergence. Analysis of flanking DNA sequences demonstrates that NANOGP8 is absent from the chimpanzee genome. Conclusion Based on the most parsimonious ordering of inferred source-gene mutations, the deduced evolutionary origins for the NANOG pseudogene family in the human and chimpanzee genomes, in order of most ancient to most recent, are NANOGP6, NANOGP5, NANOGP3, NANOGP10, NANOGP2, NANOGP9, NANOGP7, NANOGP1, and NANOGP4. All of these pseudogenes were fixed in the genome of the human-chimpanzee common ancestor. NANOGP8 is the most recent pseudogene and it originated exclusively in the human lineage after the human-chimpanzee divergence. NANOGP1 is apparently an unprocessed pseudogene. Comparison of its sequence to the functional NANOG gene's reading frame suggests that this apparent pseudogene remained functional after duplication and, therefore, was subject to selection-driven conservation of its reading frame, and that it may retain some functionality or that its loss of function may be evolutionarily recent.

  1. Phylogenetic relationships of the Fox (Forkhead) gene family in the Bilateria

    Science.gov (United States)

    Mazet, Francoise; Yu, Jr Kai; Liberles, David A.; Holland, Linda Z.; Shimeld, Sebastian M.

    2003-01-01

    The Forkhead or Fox gene family encodes putative transcription factors. There are at least four Fox genes in yeast, 16 in Drosophila melanogaster (Dm) and 42 in humans. Recently, vertebrate Fox genes have been classified into 17 groups named FoxA to FoxQ. Here, we extend this analysis to invertebrates, using available sequences from D. melanogaster, Anopheles gambiae (Ag), Caenorhabditis elegans (Ce), the sea squirt Ciona intestinalis (Ci) and amphioxus Branchiostoma floridae (Bf), from which we also cloned several Fox genes. Phylogenetic analyses lend support to the previous overall subclassification of vertebrate genes, but suggest that four subclasses (FoxJ, L, N and Q) could be further subdivided to reflect their relationships to invertebrate genes. We were unable to identify orthologs of Fox subclasses E, H, I, J, M and Q1 in D. melanogaster, A. gambiae or C. elegans, suggesting either considerable loss in ecdysozoans or the evolution of these subclasses in the deuterostome lineage. Our analyses suggest that the common ancestor of protostomes and deuterostomes had a minimum complement of 14 Fox genes.

  2. Cloning and chromosomal localization of the three human syntrophin genes

    Energy Technology Data Exchange (ETDEWEB)

    Feener, C.A.; Anderson, M.D.S.; Selig, S. [Children`s Hospital, Boston, MA (United States)] [and others

    1994-09-01

    Dystrophin, the protein product the Duchenne muscular dystrophy locus, is normally found to be associated with a complex of proteins. Among these dystrophin-associated proteins are the syntrophins, a group of 59 kDa membrane-associated proteins. When the syntrophins are purified based upon their association with dystrophin, they have been shown previously to form two distinct groups, the acidic ({alpha}) and basic ({beta}) forms. Based on peptide and rodent cDNA sequences, three separate syntrophin genes have been cloned and characterized from human tissues. The predicted amino acid sequences from these cDNA reveal that these proteins are related but are distinct with respect to charge, as predicted from their biochemistry. The family consists of one acidic ({alpha}-syntrophin, analogous to mouse syntrophin-1) and two basic ({beta}{sub 1}-syntrophin; and {beta}{sub 2}-syntrophin, analogous to mouse syntrophin-2) genes. Each of the three genes are widely expressed in a variety of human tissues, but the relative abundance of the three are unique with respect to each other. {alpha}-syntrophin is expressed primarily in skeletal muscle and heart as a single transcript. {beta}{sub 1}-syntrophin is expressed widely in up to five distinct transcript sizes, and is most abundant in brain. The human chromosomal locations of the three syntrophins are currently being mapped. {beta}{sub 1}-syntrophin maps to chromosome 8q23-24 and {beta}{sub 2}-syntrophin to chromosome 16. The {alpha}-syntrophin gene will be mapped accordingly. Although all three genes are candidates for neuromuscular diseases, the predominant expression of {alpha}-syntrophin in skeletal muscle and heart makes it a strong candidate to be involved in a neuromuscular disease.

  3. Hepatocyte specific expression of human cloned genes

    Energy Technology Data Exchange (ETDEWEB)

    Cortese, R

    1986-01-01

    A large number of proteins are specifically synthesized in the hepatocyte. Only the adult liver expresses the complete repertoire of functions which are required at various stages during development. There is therefore a complex series of regulatory mechanisms responsible for the maintenance of the differentiated state and for the developmental and physiological variations in the pattern of gene expression. Human hepatoma cell lines HepG2 and Hep3B display a pattern of gene expression similar to adult and fetal liver, respectively; in contrast, cultured fibroblasts or HeLa cells do not express most of the liver specific genes. They have used these cell lines for transfection experiments with cloned human liver specific genes. DNA segments coding for alpha1-antitrypsin and retinol binding protein (two proteins synthesized both in fetal and adult liver) are expressed in the hepatoma cell lines HepG2 and Hep3B, but not in HeLa cells or fibroblasts. A DNA segment coding for haptoglobin (a protein synthesized only after birth) is only expressed in the hepatoma cell line HepG2 but not in Hep3B nor in non hepatic cell lines. The information for tissue specific expression is located in the 5' flanking region of all three genes. In vivo competition experiments show that these DNA segments bind to a common, apparently limiting, transacting factor. Conventional techniques (Bal deletions, site directed mutagenesis, etc.) have been used to precisely identify the DNA sequences responsible for these effects. The emerging picture is complex: they have identified multiple, separate transcriptional signals, essential for maximal promoter activation and tissue specific expression. Some of these signals show a negative effect on transcription in fibroblast cell lines.

  4. Analysis of the WUSCHEL-RELATED HOMEOBOX gene family in Pinus pinaster: New insights into the gene family evolution.

    Science.gov (United States)

    Alvarez, José M; Bueno, Natalia; Cañas, Rafael A; Avila, Concepción; Cánovas, Francisco M; Ordás, Ricardo J

    2018-02-01

    WUSCHEL-RELATED HOMEOBOX (WOX) genes are key players controlling stem cells in plants and can be divided into three clades according to the time of their appearance during plant evolution. Our knowledge of stem cell function in vascular plants other than angiosperms is limited, they separated from gymnosperms ca 300 million years ago and their patterning during embryogenesis differs significantly. For this reason, we have used the model gymnosperm Pinus pinaster to identify WOX genes and perform a thorough analysis of their gene expression patterns. Using transcriptomic data from a comprehensive range of tissues and stages of development we have shown three major outcomes: that the P. pinaster genome encodes at least fourteen members of the WOX family spanning all the major clades, that the genome of gymnosperms contains a WOX gene with no homologues in angiosperms representing a transitional stage between intermediate- and WUS-clade proteins, and that we can detect discrete WUS and WOX5 transcripts for the first time in a gymnosperm. Copyright © 2017 Elsevier Masson SAS. All rights reserved.

  5. Lineage-specific evolution of the vertebrate Otopetrin gene family revealed by comparative genomic analyses

    Directory of Open Access Journals (Sweden)

    Ryan Joseph F

    2011-01-01

    Full Text Available Abstract Background Mutations in the Otopetrin 1 gene (Otop1 in mice and fish produce an unusual bilateral vestibular pathology that involves the absence of otoconia without hearing impairment. The encoded protein, Otop1, is the only functionally characterized member of the Otopetrin Domain Protein (ODP family; the extended sequence and structural preservation of ODP proteins in metazoans suggest a conserved functional role. Here, we use the tools of sequence- and cytogenetic-based comparative genomics to study the Otop1 and the Otop2-Otop3 genes and to establish their genomic context in 25 vertebrates. We extend our evolutionary study to include the gene mutated in Usher syndrome (USH subtype 1G (Ush1g, both because of the head-to-tail clustering of Ush1g with Otop2 and because Otop1 and Ush1g mutations result in inner ear phenotypes. Results We established that OTOP1 is the boundary gene of an inversion polymorphism on human chromosome 4p16 that originated in the common human-chimpanzee lineage more than 6 million years ago. Other lineage-specific evolutionary events included a three-fold expansion of the Otop genes in Xenopus tropicalis and of Ush1g in teleostei fish. The tight physical linkage between Otop2 and Ush1g is conserved in all vertebrates. To further understand the functional organization of the Ushg1-Otop2 locus, we deduced a putative map of binding sites for CCCTC-binding factor (CTCF, a mammalian insulator transcription factor, from genome-wide chromatin immunoprecipitation-sequencing (ChIP-seq data in mouse and human embryonic stem (ES cells combined with detection of CTCF-binding motifs. Conclusions The results presented here clarify the evolutionary history of the vertebrate Otop and Ush1g families, and establish a framework for studying the possible interaction(s of Ush1g and Otop in developmental pathways.

  6. Ekhaya : Human displacement and the yearning for familial ...

    African Journals Online (AJOL)

    Ekhaya : Human displacement and the yearning for familial homecoming. From Throne (Cathedra) to Home ( Oikos ) in a grassroots ecclesiology of place and space: Fides Quaerens Domum et Locum [Faith Seeking Home and Space

  7. Relaxin gene family in teleosts: phylogeny, syntenic mapping, selective constraint, andexpression analysis

    Directory of Open Access Journals (Sweden)

    Glen Peter

    2009-12-01

    Full Text Available Abstract Background In recent years, the relaxin family of signaling molecules has been shown to play diverse roles in mammalian physiology, but little is known about its diversity or physiology in teleosts, an infraclass of the bony fishes comprising ~ 50% of all extant vertebrates. In this paper, 32 relaxin family sequences were obtained by searching genomic and cDNA databases from eight teleost species; phylogenetic, molecular evolutionary, and syntenic data analyses were conducted to understand the relationship and differential patterns of evolution of relaxin family genes in teleosts compared with mammals. Additionally, real-time quantitative PCR was used to confirm and assess the tissues of expression of five relaxin family genes in Danio rerio and in situ hybridization used to assess the site-specific expression of the insulin 3-like gene in D. rerio testis. Results Up to six relaxin family genes were identified in each teleost species. Comparative syntenic mapping revealed that fish possess two paralogous copies of human RLN3, which we call rln3a and rln3b, an orthologue of human RLN2, rln, two paralogous copies of human INSL5, insl5a and insl5b, and an orthologue of human INSL3, insl3. Molecular evolutionary analyses indicated that: rln3a, rln3b and rln are under strong evolutionary constraint, that insl3 has been subject to moderate rates of sequence evolution with two amino acids in insl3/INSL3 showing evidence of positively selection, and that insl5b exhibits a higher rate of sequence evolution than its paralogue insl5a suggesting that it may have been neo-functionalized after the teleost whole genome duplication. Quantitative PCR analyses in D. rerio indicated that rln3a and rln3b are expressed in brain, insl3 is highly expressed in gonads, and that there was low expression of both insl5 genes in adult zebrafish. Finally, in situ hybridization of insl3 in D. rerio testes showed highly specific hybridization to interstitial Leydig

  8. One Family's Struggles with HPV (Human Papillomavirus)

    Medline Plus

    Full Text Available ... families advocacy about civil rights kids' rights sample school policies school letter someone you know has hbv/hcv ask the advice nurse ask the experts back-to-school health clinical trials disclosing to kids estate planning ...

  9. High-throughput analysis of candidate imprinted genes and allele-specific gene expression in the human term placenta

    Directory of Open Access Journals (Sweden)

    Clark Taane G

    2010-04-01

    Full Text Available Abstract Background Imprinted genes show expression from one parental allele only and are important for development and behaviour. This extreme mode of allelic imbalance has been described for approximately 56 human genes. Imprinting status is often disrupted in cancer and dysmorphic syndromes. More subtle variation of gene expression, that is not parent-of-origin specific, termed 'allele-specific gene expression' (ASE is more common and may give rise to milder phenotypic differences. Using two allele-specific high-throughput technologies alongside bioinformatics predictions, normal term human placenta was screened to find new imprinted genes and to ascertain the extent of ASE in this tissue. Results Twenty-three family trios of placental cDNA, placental genomic DNA (gDNA and gDNA from both parents were tested for 130 candidate genes with the Sequenom MassArray system. Six genes were found differentially expressed but none imprinted. The Illumina ASE BeadArray platform was then used to test 1536 SNPs in 932 genes. The array was enriched for the human orthologues of 124 mouse candidate genes from bioinformatics predictions and 10 human candidate imprinted genes from EST database mining. After quality control pruning, a total of 261 informative SNPs (214 genes remained for analysis. Imprinting with maternal expression was demonstrated for the lymphocyte imprinted gene ZNF331 in human placenta. Two potential differentially methylated regions (DMRs were found in the vicinity of ZNF331. None of the bioinformatically predicted candidates tested showed imprinting except for a skewed allelic expression in a parent-specific manner observed for PHACTR2, a neighbour of the imprinted PLAGL1 gene. ASE was detected for two or more individuals in 39 candidate genes (18%. Conclusions Both Sequenom and Illumina assays were sensitive enough to study imprinting and strong allelic bias. Previous bioinformatics approaches were not predictive of new imprinted genes

  10. Extensive changes in the expression of the opioid genes between humans and chimpanzees.

    Science.gov (United States)

    Cruz-Gordillo, Peter; Fedrigo, Olivier; Wray, Gregory A; Babbitt, Courtney C

    2010-01-01

    The various means by which the body perceives, transmits, and resolves the experiences of pain and nociception are mediated by a host of molecules, including neuropeptides within the opioid gene signaling pathway. The peptide ligands and receptors encoded by this group of genes have been linked to behavioral disorders as well as a number of psychiatric affective disorders. Our aim was to explore the recent evolutionary history of these two gene families by taking a comparative genomics approach, specifically through a comparison between humans and chimpanzees. Our analyses indicate differential expression of these genes between the two species, more than expected based on genome-wide comparisons, indicating that differential expression is pervasive among the opioid genes. Of the 8 family members, three genes showed significant expression differences (PENK, PNOC, and OPRL1), with two others marginally significant (OPRM1 and OPRD1). Accelerated substitution rates along human and chimpanzee lineages within the putative regulatory regions of OPRM1, POMC, and PDYN between the human and chimpanzee branches are consistent with positive selection. Collectively, these results suggest that there may have been a selective advantage to modulating the expression of the opioid genes in humans compared with our closest living relatives. Information about the cognitive roles mediated by these genes in humans may help to elucidate the trait consequences of these putatively adaptive expression changes. Copyright © 2010 S. Karger AG, Basel.

  11. Molecular evolution of the keratin associated protein gene family in mammals, role in the evolution of mammalian hair.

    Science.gov (United States)

    Wu, Dong-Dong; Irwin, David M; Zhang, Ya-Ping

    2008-08-23

    Hair is unique to mammals. Keratin associated proteins (KRTAPs), which contain two major groups: high/ultrahigh cysteine and high glycine-tyrosine, are one of the major components of hair and play essential roles in the formation of rigid and resistant hair shafts. The KRTAP family was identified as being unique to mammals, and near-complete KRTAP gene repertoires for eight mammalian genomes were characterized in this study. An expanded KRTAP gene repertoire was found in rodents. Surprisingly, humans have a similar number of genes as other primates despite the relative hairlessness of humans. We identified several new subfamilies not previously reported in the high/ultrahigh cysteine KRTAP genes. Genes in many subfamilies of the high/ultrahigh cysteine KRTAP genes have evolved by concerted evolution with frequent gene conversion events, yielding a higher GC base content for these gene sequences. In contrast, the high glycine-tyrosine KRTAP genes have evolved more dynamically, with fewer gene conversion events and thus have a lower GC base content, possibly due to positive selection. Most of the subfamilies emerged early in the evolution of mammals, thus we propose that the mammalian ancestor should have a diverse KRTAP gene repertoire. We propose that hair content characteristics have evolved and diverged rapidly among mammals because of rapid divergent evolution of KRTAPs between species. In contrast, subfamilies of KRTAP genes have been homogenized within each species due to concerted evolution.

  12. Dietary methanol regulates human gene activity.

    Directory of Open Access Journals (Sweden)

    Anastasia V Shindyapina

    Full Text Available Methanol (MeOH is considered to be a poison in humans because of the alcohol dehydrogenase (ADH-mediated conversion of MeOH to formaldehyde (FA, which is toxic. Our recent genome-wide analysis of the mouse brain demonstrated that an increase in endogenous MeOH after ADH inhibition led to a significant increase in the plasma MeOH concentration and a modification of mRNA synthesis. These findings suggest endogenous MeOH involvement in homeostasis regulation by controlling mRNA levels. Here, we demonstrate directly that study volunteers displayed increasing concentrations of MeOH and FA in their blood plasma when consuming citrus pectin, ethanol and red wine. A microarray analysis of white blood cells (WBC from volunteers after pectin intake showed various responses for 30 significantly differentially regulated mRNAs, most of which were somehow involved in the pathogenesis of Alzheimer's disease (AD. There was also a decreased synthesis of hemoglobin mRNA, HBA and HBB, the presence of which in WBC RNA was not a result of red blood cells contamination because erythrocyte-specific marker genes were not significantly expressed. A qRT-PCR analysis of volunteer WBCs after pectin and red wine intake confirmed the complicated relationship between the plasma MeOH content and the mRNA accumulation of both genes that were previously identified, namely, GAPDH and SNX27, and genes revealed in this study, including MME, SORL1, DDIT4, HBA and HBB. We hypothesized that human plasma MeOH has an impact on the WBC mRNA levels of genes involved in cell signaling.

  13. Positive selection on gene expression in the human brain

    DEFF Research Database (Denmark)

    Khaitovich, Philipp; Tang, Kun; Franz, Henriette

    2006-01-01

    Recent work has shown that the expression levels of genes transcribed in the brains of humans and chimpanzees have changed less than those of genes transcribed in other tissues [1] . However, when gene expression changes are mapped onto the evolutionary lineage in which they occurred, the brain...... shows more changes than other tissues in the human lineage compared to the chimpanzee lineage [1] , [2] and [3] . There are two possible explanations for this: either positive selection drove more gene expression changes to fixation in the human brain than in the chimpanzee brain, or genes expressed...... in the brain experienced less purifying selection in humans than in chimpanzees, i.e. gene expression in the human brain is functionally less constrained. The first scenario would be supported if genes that changed their expression in the brain in the human lineage showed more selective sweeps than other genes...

  14. Molecular evolution of the polyamine oxidase gene family in Metazoa

    Directory of Open Access Journals (Sweden)

    Polticelli Fabio

    2012-06-01

    Full Text Available Abstract Background Polyamine oxidase enzymes catalyze the oxidation of polyamines and acetylpolyamines. Since polyamines are basic regulators of cell growth and proliferation, their homeostasis is crucial for cell life. Members of the polyamine oxidase gene family have been identified in a wide variety of animals, including vertebrates, arthropodes, nematodes, placozoa, as well as in plants and fungi. Polyamine oxidases (PAOs from yeast can oxidize spermine, N1-acetylspermine, and N1-acetylspermidine, however, in vertebrates two different enzymes, namely spermine oxidase (SMO and acetylpolyamine oxidase (APAO, specifically catalyze the oxidation of spermine, and N1-acetylspermine/N1-acetylspermidine, respectively. Little is known about the molecular evolutionary history of these enzymes. However, since the yeast PAO is able to catalyze the oxidation of both acetylated and non acetylated polyamines, and in vertebrates these functions are addressed by two specialized polyamine oxidase subfamilies (APAO and SMO, it can be hypothesized an ancestral reference for the former enzyme from which the latter would have been derived. Results We analysed 36 SMO, 26 APAO, and 14 PAO homologue protein sequences from 54 taxa including various vertebrates and invertebrates. The analysis of the full-length sequences and the principal domains of vertebrate and invertebrate PAOs yielded consensus primary protein sequences for vertebrate SMOs and APAOs, and invertebrate PAOs. This analysis, coupled to molecular modeling techniques, also unveiled sequence regions that confer specific structural and functional properties, including substrate specificity, by the different PAO subfamilies. Molecular phylogenetic trees revealed a basal position of all the invertebrates PAO enzymes relative to vertebrate SMOs and APAOs. PAOs from insects constitute a monophyletic clade. Two PAO variants sampled in the amphioxus are basal to the dichotomy between two well supported

  15. HLA non-class II genes may confer type I diabetes susceptibility in a Mapuche (Amerindian) affected family.

    Science.gov (United States)

    Pérez-Bravo, Francisco; Martinez-Laso, Jorge; Martin-Villa, Jose M; Moscoso, Juan; Moreno, Almudena; Serrano-Vela, Juan I; Zamora, Jorge; Asenjo, Silvia; Gleisner, Andrea; Arnaiz-Villena, Antonio

    2006-01-01

    A rare case of type I diabetes is studied in an Amerindian (Mapuche) family from Chile, analyzing glutamic acid decarboxylase, islet-cell autoantibodies and human leukocyte antigen (HLA) genes. The affected sib is the only one that has one specific HLA haplotype combination that differs from the other sibs only in the HLA class I genes. It is concluded that HLA diabetes susceptibility factors may be placed outside the class II region or even that susceptibility factors do not exist in the HLA region in this Amerindian family.

  16. Discrimination of Deletion and Duplication Subtypes of the Deleted in Azoospermia Gene Family in the Context of Frequent Interloci Gene Conversion

    Science.gov (United States)

    Vaszkó, Tibor; Papp, János; Krausz, Csilla; Casamonti, Elena; Géczi, Lajos; Olah, Edith

    2016-01-01

    Due to its palindromic setup, AZFc (Azoospermia Factor c) region of chromosome Y is one of the most unstable regions of the human genome. It contains eight gene families expressed mainly in the testes. Several types of rearrangement resulting in changes in the cumulative copy number of the gene families were reported to be associated with diseases such as male infertility and testicular germ cell tumors. The best studied AZFc rearrangement is gr/gr deletion. Its carriers show widespread phenotypic variation from azoospermia to normospermia. This phenomenon was initially attributed to different gr/gr subtypes that would eliminate distinct members of the affected gene families. However, studies conducted to confirm this hypothesis have brought controversial results, perhaps, in part, due to the shortcomings of the utilized subtyping methodology. This proof-of-concept paper is meant to introduce here a novel method aimed at subtyping AZFc rearrangements. It is able to differentiate the partial deletion and partial duplication subtypes of the Deleted in Azoospermia (DAZ) gene family. The keystone of the method is the determination of the copy number of the gene family member-specific variant(s) in a series of sequence family variant (SFV) positions. Most importantly, we present a novel approach for the correct interpretation of the variant copy number data to determine the copy number of the individual DAZ family members in the context of frequent interloci gene conversion.Besides DAZ1/DAZ2 and DAZ3/DAZ4 deletions, not yet described rearrangements such as DAZ2/DAZ4 deletion and three duplication subtypes were also found by the utilization of the novel approach. A striking feature is the extremely high concordance among the individual data pointing to a certain type of rearrangement. In addition to being able to identify DAZ deletion subtypes more reliably than the methods used previously, this approach is the first that can discriminate DAZ duplication subtypes as well

  17. Targeting the human lysozyme gene on bovine αs1- casein gene ...

    African Journals Online (AJOL)

    Targeting an exogenous gene into a favorable gene locus and for expression under endogenous regulators is an ideal method in mammary gland bioreactor research. For this purpose, a gene targeting vector was constructed to targeting the human lysozyme gene on bovine αs1-casein gene locus. In this case, the ...

  18. Genomewide analysis of MATE-type gene family in maize reveals ...

    Indian Academy of Sciences (India)

    Huasheng Zhu and Jiandong Wu contributed equally to this work. As a group of secondary active transporters, the MATE gene family consists of multiple genes that widely exist in ..... Roots of the stress-treated plants were collected at 0,.

  19. Injury, inflammation and the emergence of human specific genes

    Science.gov (United States)

    2016-07-12

    genes in circulating and resident human immune cells can be studied in mice after the transplantation and engraft- ment of human hemato- lymphoid immune...Martinek J, Strowig T, Gearty SV, Teichmann LL, et al. Development and function of human innate immune cells in a humanized mouse model. Nat Bio...normal wound repair and regeneration, we hypothesize that the preponderance of human-specific genes expressed in human inflammatory cells is commensurate

  20. TreeFam: a curated database of phylogenetic trees of animal gene families

    DEFF Research Database (Denmark)

    Li, Heng; Coghlan, Avril; Ruan, Jue

    2006-01-01

    TreeFam is a database of phylogenetic trees of gene families found in animals. It aims to develop a curated resource that presents the accurate evolutionary history of all animal gene families, as well as reliable ortholog and paralog assignments. Curated families are being added progressively......, based on seed alignments and trees in a similar fashion to Pfam. Release 1.1 of TreeFam contains curated trees for 690 families and automatically generated trees for another 11 646 families. These represent over 128 000 genes from nine fully sequenced animal genomes and over 45 000 other animal proteins...

  1. Genome-wide analysis of the ATP-binding cassette (ABC) transporter gene family in sea lamprey and Japanese lamprey.

    Science.gov (United States)

    Ren, Jianfeng; Chung-Davidson, Yu-Wen; Yeh, Chu-Yin; Scott, Camille; Brown, Titus; Li, Weiming

    2015-06-06

    Lampreys are extant representatives of the jawless vertebrate lineage that diverged from jawed vertebrates around 500 million years ago. Lamprey genomes contain information crucial for understanding the evolution of gene families in vertebrates. The ATP-binding cassette (ABC) gene family is found from prokaryotes to eukaryotes. The recent availability of two lamprey draft genomes from sea lamprey Petromyzon marinus and Japanese lamprey Lethenteron japonicum presents an opportunity to infer early evolutionary events of ABC genes in vertebrates. We conducted a genome-wide survey of the ABC gene family in two lamprey draft genomes. A total of 37 ABC transporters were identified and classified into seven subfamilies; namely seven ABCA genes, 10 ABCB genes, 10 ABCC genes, three ABCD genes, one ABCE gene, three ABCF genes, and three ABCG genes. The ABCA subfamily has expanded from three genes in sea squirts, seven and nine in lampreys and zebrafish, to 13 and 16 in human and mouse. Conversely, the multiple copies of ABCB1-, ABCG1-, and ABCG2-like genes found in sea squirts have contracted in the other species examined. ABCB2 and ABCB3 seem to be new additions in gnathostomes (not in sea squirts or lampreys), which coincides with the emergence of the gnathostome-specific adaptive immune system. All the genes in the ABCD, ABCE and ABCF subfamilies were conserved and had undergone limited duplication and loss events. In the sea lamprey transcriptomes, the ABCE and ABCF gene subfamilies were ubiquitously and highly expressed in all tissues while the members in other gene subfamilies were differentially expressed. Thirteen more lamprey ABC transporter genes were identified in this study compared with a previous study. By concatenating the same gene sequences from the two lampreys, more full length sequences were obtained, which significantly improved both the assignment of gene names and the phylogenetic trees compared with a previous analysis using partial sequences. The ABC

  2. Structure and chromosomal localization of the human lymphotoxin gene

    International Nuclear Information System (INIS)

    Nedwin, G.E.; Jarrett-Nedwin, J.; Smith, D.H.; Naylor, S.L.; Sakaguchi, A.Y.; Goeddel, D.V.; Gray, P.W.

    1987-01-01

    The authors have isolated, sequenced, and determined the chromosomal localization of the gene encoding human lymphotoxin (LT). The single copy gene was isolated from a human genomic library using a /sup 32/P-labeled 116 bp synthetic DNA fragment whose sequence was based on the NH/sub 2/-terminal amino acid sequence of LT. The gene spans 3 kb of DNA and is interrupted by three intervening sequences. The LT gene is located on human chromosome 6, as determined by Southern blot analysis of human-murine hybrid DNA. Putative transcriptional control regions and areas of homology with the promoters of interferon and other genes are identified

  3. The ABC gene family in arthropods: comparative genomics and role in insecticide transport and resistance.

    Science.gov (United States)

    Dermauw, Wannes; Van Leeuwen, Thomas

    2014-02-01

    About a 100 years ago, the Drosophila white mutant marked the birth of Drosophila genetics. The white gene turned out to encode the first well studied ABC transporter in arthropods. The ABC gene family is now recognized as one of the largest transporter families in all kingdoms of life. The majority of ABC proteins function as primary-active transporters that bind and hydrolyze ATP while transporting a large diversity of substrates across lipid membranes. Although extremely well studied in vertebrates for their role in drug resistance, less is known about the role of this family in the transport of endogenous and exogenous substances in arthropods. The ABC families of five insect species, a crustacean and a chelicerate have been annotated in some detail. We conducted a thorough phylogenetic analysis of the seven arthropod and human ABC protein subfamilies, to infer orthologous relationships that might suggest conserved function. Most orthologous relationships were found in the ABCB half transporter, ABCD, ABCE and ABCF subfamilies, but specific expansions within species and lineages are frequently observed and discussed. We next surveyed the role of ABC transporters in the transport of xenobiotics/plant allelochemicals and their involvement in insecticide resistance. The involvement of ABC transporters in xenobiotic resistance in arthropods is historically not well documented, but an increasing number of studies using unbiased differential gene expression analysis now points to their importance. We give an overview of methods that can be used to link ABC transporters to resistance. ABC proteins have also recently been implicated in the mode of action and resistance to Bt toxins in Lepidoptera. Given the enormous interest in Bt toxicology in transgenic crops, such findings will provide an impetus to further reveal the role of ABC transporters in arthropods. Copyright © 2014 The Authors. Published by Elsevier Ltd.. All rights reserved.

  4. Cytokinin Regulation of Gene Expression in the AHP Gene Family in Arabidopsis thaliana

    Czech Academy of Sciences Publication Activity Database

    Hradilová, Jana; Malbeck, Jiří; Brzobohatý, Břetislav

    2007-01-01

    Roč. 26, č. 3 (2007), s. 229-244 ISSN 0721-7595 R&D Projects: GA MŠk LN00A081; GA MŠk 1M06030; GA MŠk(CZ) LC06034; GA AV ČR(CZ) IAA600380507; GA AV ČR IAA600040612 Institutional research plan: CEZ:AV0Z50380511; CEZ:AV0Z50040702 Source of funding: V - iné verejné zdroje ; V - iné verejné zdroje ; V - iné verejné zdroje ; V - iné verejné zdroje Keywords : gene expression * AHP gene family * cytokinin signal transduction Subject RIV: EF - Botanics Impact factor: 2.220, year: 2007

  5. Identification and expression profiling analysis of TCP family genes involved in growth and development in maize.

    Science.gov (United States)

    Chai, Wenbo; Jiang, Pengfei; Huang, Guoyu; Jiang, Haiyang; Li, Xiaoyu

    2017-10-01

    The TCP family is a group of plant-specific transcription factors. TCP genes encode proteins harboring bHLH structure, which is implicated in DNA binding and protein-protein interactions and known as the TCP domain. TCP genes play important roles in plant development and have been evolutionarily and functionally elaborated in various plants, however, no overall phylogenetic analysis or expression profiling of TCP genes in Zea mays has been reported. In the present study, a systematic analysis of molecular evolution and functional prediction of TCP family genes in maize ( Z . mays L.) has been conducted. We performed a genome-wide survey of TCP genes in maize, revealing the gene structure, chromosomal location and phylogenetic relationship of family members. Microsynteny between grass species and tissue-specific expression profiles were also investigated. In total, 29 TCP genes were identified in the maize genome, unevenly distributed on the 10 maize chromosomes. Additionally, ZmTCP genes were categorized into nine classes based on phylogeny and purifying selection may largely be responsible for maintaining the functions of maize TCP genes. What's more, microsynteny analysis suggested that TCP genes have been conserved during evolution. Finally, expression analysis revealed that most TCP genes are expressed in the stem and ear, which suggests that ZmTCP genes influence stem and ear growth. This result is consistent with the previous finding that maize TCP genes represses the growth of axillary organs and enables the formation of female inflorescences. Altogether, this study presents a thorough overview of TCP family in maize and provides a new perspective on the evolution of this gene family. The results also indicate that TCP family genes may be involved in development stage in plant growing conditions. Additionally, our results will be useful for further functional analysis of the TCP gene family in maize.

  6. Molecular cloning of RBCS genes in Selaginella and the evolution of the rbcS gene family

    Directory of Open Access Journals (Sweden)

    Wang Bo

    2015-01-01

    Full Text Available Rubisco small subunits (RBCS are encoded by a nuclear rbcS multigene family in higher plants and green algae. However, owing to the lack of rbcS sequences in lycophytes, the characteristics of rbcS genes in lycophytes is unclear. Recently, the complete genome sequence of the lycophyte Selaginella moellendorffii provided the first insight into the rbcS gene family in lycophytes. To understand further the characteristics of rbcS genes in other Selaginella, the full length of rbcS genes (rbcS1 and rbcS2 from two other Selaginella species were isolated. Both rbcS1 and rbcS2 genes shared more than 97% identity among three Selaginella species. RBCS proteins from Selaginella contained the Pfam RBCS domain F00101, which was a major domain of other plant RBCS proteins. To explore the evolution of the rbcS gene family across Selaginella and other plants, we identified and performed comparative analysis of the rbcS gene family among 16 model plants based on a genome-wide analysis. The results showed that (i two rbcS genes were obtained in Selaginella, which is the second fewest number of rbcS genes among the 16 representative plants; (ii an expansion of rbcS genes occurred in the moss Physcomitrella patens; (iii only RBCS proteins from angiosperms contained the Pfam PF12338 domains, and (iv a pattern of concerted evolution existed in the rbcS gene family. Our study provides new insights into the evolution of the rbcS gene family in Selaginella and other plants.

  7. Elevated expression and potential roles of human Sp5, a member of Sp transcription factor family, in human cancers

    International Nuclear Information System (INIS)

    Chen Yongxin; Guo Yingqiu; Ge Xijin; Itoh, Hirotaka; Watanabe, Akira; Fujiwara, Takeshi; Kodama, Tatsuhiko; Aburatani, Hiroyuki

    2006-01-01

    In this report, we describe the expression and function of human Sp5, a member of the Sp family of zinc finger transcription factors. Like other family members, the Sp5 protein contains a Cys2His2 zinc finger DNA binding domain at the C-terminus. Our experiments employing Gal4-Sp5 fusion proteins reveal multiple transcriptional domains, including a N-terminal activity domain, an intrinsic repressive element, and a C-terminal synergistic domain. Elevated expression of Sp5 was noted in several human tumors including hepatocellular carcinoma, gastric cancer, and colon cancer. To study the effects of the Sp5 protein on growth properties of human cancer cells and facilitate the identification of its downstream genes, we combined an inducible gene expression system with microarray analysis to screen for its transcriptional targets. Transfer of Sp5 into MCF-7 cells that expressed no detectable endogenous Sp5 protein elicited significant growth promotion activity. Several of the constitutively deregulated genes have been associated with tumorigenesis (CDC25C, CEACAM6, TMPRSS2, XBP1, MYBL1, ABHD2, and CXCL12) and Wnt/β-Catenin signaling pathways (BAMBI, SIX1, IGFBP5, AES, and p21 WAF1 ). This information could be utilized for further mechanistic research and for devising optimized therapeutic strategies against human cancers

  8. Titin is a candidate gene for stroke volume response to endurance training: the HERITAGE Family Study.

    Science.gov (United States)

    Rankinen, Tuomo; Rice, Treva; Boudreau, Anik; Leon, Arthur S; Skinner, James S; Wilmore, Jack H; Rao, D C; Bouchard, Claude

    2003-09-29

    A genome-wide linkage scan for endurance training-induced changes in submaximal exercise stroke volume (DeltaSV50) in the HERITAGE Family Study revealed two chromosomal regions (2q31-q32 and 10p11.2) with at least suggestive evidence of linkage among white families. Here we report a further characterization of the quantitative trait locus (QTL) in chromosome 2q31 and provide evidence that titin (TTN) is likely a candidate gene involved. The original linkage was detected with two markers (D2S335 and D2S1391), and the QTL covered approximately 25 million base pairs (Mb). We added 12 microsatellite markers resulting in an average marker density of one marker per 2.3 Mb. The evidence of linkage increased from P = 0.006 to P = 0.0002 and 0.00002 in the multi- and single-point analyses, respectively. The strongest evidence of linkage was seen with two markers in and near the TTN gene. Transmission/disequilibrium test (TDT) with the same marker set provided evidence for association with one of the TTN markers (D2S385; P = 0.004). TTN is a major contributor to the elasticity of cardiomyocytes and a key regulator of the Frank-Starling mechanism. Since TTN is the largest gene in the human genome, the challenge is to identify the DNA sequence variants contributing to the interindividual differences in cardiac adaptation to endurance training.

  9. Chromosomal location of the human gene for DNA polymerase β

    International Nuclear Information System (INIS)

    McBride, O.W.; Zmudzka, B.Z.; Wilson, S.H.

    1987-01-01

    Inhibition studies indicate that DNA polymerase β has a synthetic role in DNA repair after exposure of mammalian cells to some types of DNA-damaging agents. The primary structure of the enzyme is highly conserved in vertebrates, and nearly full-length cDNAs for the enzyme were recently cloned from mammalian cDNA libraries. Southern blot analysis of DNA from a panel of human-rodent somatic cell hybrids, using portions of the cDNA as probe, indicates that the gene for human DNA polymerase β is single copy and located on the short arm or proximal long arm of chromosome 8 (8pter-8q22). A restriction fragment length polymorphism (RFLP) was detected in normal individuals by using a probe from the 5' end of the cDNA, and this RFLP probably is due to an insertion or duplication of DNA in 20-25% of the population. This restriction site can be used as one marker for chromosome 8 genetic linkage studies and for family studies of traits potentially involving this DNA repair gene

  10. Molecular characterization of edestin gene family in Cannabis sativa L.

    Science.gov (United States)

    Docimo, Teresa; Caruso, Immacolata; Ponzoni, Elena; Mattana, Monica; Galasso, Incoronata

    2014-11-01

    Globulins are the predominant class of seed storage proteins in a wide variety of plants. In many plant species globulins are present in several isoforms encoded by gene families. The major seed storage protein of Cannabis sativa L. is the globulin edestin, widely known for its nutritional potential. In this work, we report the isolation of seven cDNAs encoding for edestin from the C. sativa variety Carmagnola. Southern blot hybridization is in agreement with the number of identified edestin genes. All seven sequences showed the characteristic globulin features, but they result to be divergent members/forms of two edestin types. According to their sequence similarity four forms named CsEde1A, CsEde1B, CsEde1C, CsEde1D have been assigned to the edestin type 1 and the three forms CsEde2A, CsEde2B, CsEde2C to the edestin type 2. Analysis of the coding sequences revealed a high percentage of similarity (98-99%) among the different forms belonging to the same type, which decreased significantly to approximately 64% between the forms belonging to different types. Quantitative RT-PCR analysis revealed that both edestin types are expressed in developing hemp seeds and the amount of CsEde1 was 4.44 ± 0.10 higher than CsEde2. Both edestin types exhibited a high percentage of arginine (11-12%), but CsEde2 resulted particularly rich in methionine residues (2.36%) respect to CsEde1 (0.82%). The amino acid composition determined in CsEde1 and CsEde2 types suggests that these seed proteins can be used to improve the nutritional quality of plant food-stuffs. Copyright © 2014 Elsevier Masson SAS. All rights reserved.

  11. RFLP for the human pepsinogen C gene (PGC)

    Energy Technology Data Exchange (ETDEWEB)

    Azuma, T; Pals, G; Taggart, R T

    1988-10-11

    PGC 301 is a 1224 bp cDNA clone containing exons 2-9 of the human pepsinogen C (progastericsin) coding sequence. 100 bp deletion/insertion polymorphism is observed with five restriction endonucleases; BamHI, EcoRI, MstII, PstI, and SacI. The same RFLP is observed with these enzymes. The polymorphic region is located between exons 7 and 8. The frequency was estimated from 40 unrelated Caucasians, with the large fragment allele 82.5% and the small fragment allele 17.5%. PGC gene has been assigned to 6p21.1-pter by somatic cell hybrids. Mendelian inheritance was demonstrated in two families.

  12. Evolutionary study of vertebrate and invertebrate members of the dystrophin and utrophin gene family

    Energy Technology Data Exchange (ETDEWEB)

    Roberts, R.G.; Nicholson, L.; Bobrow, M. [Paediatric Research Unit, London (United Kingdom)] [and others

    1994-09-01

    Vertebrates express two members of the dystrophin gene family. The prototype, dystrophin, is expressed in muscle and neural tissue, and is defective in the human disorders Duchenne and Becker muscular dystrophy (DMD, BMD). The dystrophin homologue utrophin is more generally expressed but has not yet been associated with a genetic disorder. The function of neither protein is clear. A comparison of human utrophin with the known dystrophins (human, mouse, chicken, Torpedo) suggests that dystrophin and utrophin diverged before the vertebrate radiation. We have used reverse-transcript PCR (RT-PCR) directed by degenerate primers to characterize dystrophin and utrophin transcripts from a range of vertebrate and invertebrate animals. Our results suggest that the duplication leading to distinct dystrophin and utrophin genes occurred close to the point of divergence of urochordates from the cephalochordate-vertebrate lineage. This divergence may have occurred to fulfill a novel role which arose at this point, or may reflect a need for separate regulation of the neuromuscular and other functions of the ancient dystrophin. Our data include sequences of the first non-human utrophins to be characterized, and show these to be substantially more divergent than their cognate dystrophins. In addition, our results provide a large body of information regarding the tolerance of amino acid positions in the cysteine-rich and C-terminal domains to substitution. This will aid the interpretations of DMD and BMD missense mutations in these regions.

  13. The IQD gene family in soybean: structure, phylogeny, evolution and expression.

    Directory of Open Access Journals (Sweden)

    Lin Feng

    Full Text Available Members of the plant-specific IQ67-domain (IQD protein family are involved in plant development and the basal defense response. Although systematic characterization of this family has been carried out in Arabidopsis, tomato (Solanum lycopersicum, Brachypodium distachyon and rice (Oryza sativa, systematic analysis and expression profiling of this gene family in soybean (Glycine max have not previously been reported. In this study, we identified and structurally characterized IQD genes in the soybean genome. A complete set of 67 soybean IQD genes (GmIQD1-67 was identified using Blast search tools, and the genes were clustered into four subfamilies (IQD I-IV based on phylogeny. These soybean IQD genes are distributed unevenly across all 20 chromosomes, with 30 segmental duplication events, suggesting that segmental duplication has played a major role in the expansion of the soybean IQD gene family. Analysis of the Ka/Ks ratios showed that the duplicated genes of the GmIQD family primarily underwent purifying selection. Microsynteny was detected in most pairs: genes in clade 1-3 might be present in genome regions that were inverted, expanded or contracted after the divergence; most gene pairs in clade 4 showed high conservation with little rearrangement among these gene-residing regions. Of the soybean IQD genes examined, six were most highly expressed in young leaves, six in flowers, one in roots and two in nodules. Our qRT-PCR analysis of 24 soybean IQD III genes confirmed that these genes are regulated by MeJA stress. Our findings present a comprehensive overview of the soybean IQD gene family and provide insights into the evolution of this family. In addition, this work lays a solid foundation for further experiments aimed at determining the biological functions of soybean IQD genes in growth and development.

  14. Gene expression studies on human keratinocytes transduced with human growth hormone gene for a possible utilization in gene therapy

    International Nuclear Information System (INIS)

    Mathor, Monica Beatriz.

    1994-01-01

    Taking advantage of the recent progress in the DNA-recombinant techniques and of the potentiality of normal human keratinocytes primary culture to reconstitute the epidermis, it was decided to genetically transform these keratinocytes to produce human growth hormone under controllable conditions that would be used in gene therapy at this hormone deficient patients. The first step to achieve this goal was to standardize infection of keratinocytes with retrovirus producer cells containing a construct which included the gene of bacterial b-galactosidase. The best result was obtained cultivating the keratinocytes for 3 days in a 2:1 mixture of retrovirus producer cells and 3T3-J2 fibroblasts irradiated with 60 Gy, and splitting these infected keratinocytes on 3T3-J2 fibroblasts feeder layer. Another preliminary experiment was to infect normal human keratinocytes with interleukin-6 gene (hIL-6) that, in pathologic conditions, could be reproduced by keratinocytes and secreted to the blood stream. Thus, we verify that infected keratinocytes secrete an average amount of 500 ng/10 6 cell/day of cytokin during the in vitro life time, that certify the stable character of the injection. These keratinocytes, when grafted in mice, secrete hIL-6 to the blood stream reaching levels of 40 pg/ml of serum. After these preliminary experiments, we construct a retroviral vector with the human growth hormone gene (h GH) driven by human metallothionein promoter (h PMT), designated DChPMTGH. Normal human keratinocytes were infected with DChPMTGH producer cells, following previously standardized protocol, obtaining infected keratinocytes secreting to the culture media 340 ng h GH/10 6 cell/day without promoter activation. This is the highest level of h GH secreted in human keratinocytes primary culture described in literature. The h GH value increases approximately 10 times after activation with 100 μM Zn +2 for 8-12 hours. (author). 158 refs., 42 figs., 6 tabs

  15. Diagnostic Yield of Sequencing Familial Hypercholesterolemia Genes in Severe Hypercholesterolemia

    Science.gov (United States)

    Khera, Amit V.; Won, Hong-Hee; Peloso, Gina M.; Lawson, Kim S.; Bartz, Traci M.; Deng, Xuan; van Leeuwen, Elisabeth M.; Natarajan, Pradeep; Emdin, Connor A.; Bick, Alexander G.; Morrison, Alanna C.; Brody, Jennifer A.; Gupta, Namrata; Nomura, Akihiro; Kessler, Thorsten; Duga, Stefano; Bis, Joshua C.; van Duijn, Cornelia M.; Cupples, L. Adrienne; Psaty, Bruce; Rader, Daniel J.; Danesh, John; Schunkert, Heribert; McPherson, Ruth; Farrall, Martin; Watkins, Hugh; Lander, Eric; Wilson, James G.; Correa, Adolfo; Boerwinkle, Eric; Merlini, Piera Angelica; Ardissino, Diego; Saleheen, Danish; Gabriel, Stacey; Kathiresan, Sekar

    2017-01-01

    Background About 7% of US adults have severe hypercholesterolemia (untreated LDL cholesterol ≥190 mg/dl). Such high LDL levels may be due to familial hypercholesterolemia (FH), a condition caused by a single mutation in any of three genes. Lifelong elevations in LDL cholesterol in FH mutation carriers may confer CAD risk beyond that captured by a single LDL cholesterol measurement. Objectives Assess the prevalence of a FH mutation among those with severe hypercholesterolemia and determine whether CAD risk varies according to mutation status beyond the observed LDL cholesterol. Methods Three genes causative for FH (LDLR, APOB, PCSK9) were sequenced in 26,025 participants from 7 case-control studies (5,540 CAD cases, 8,577 CAD-free controls) and 5 prospective cohort studies (11,908 participants). FH mutations included loss-of-function variants in LDLR, missense mutations in LDLR predicted to be damaging, and variants linked to FH in ClinVar, a clinical genetics database. Results Among 8,577 CAD-free control participants, 430 had LDL cholesterol ≥190 mg/dl; of these, only eight (1.9%) carried a FH mutation. Similarly, among 11,908 participants from 5 prospective cohorts, 956 had LDL cholesterol ≥190 mg/dl and of these, only 16 (1.7%) carried a FH mutation. Within any stratum of observed LDL cholesterol, risk of CAD was higher among FH mutation carriers when compared with non-carriers. When compared to a reference group with LDL cholesterol <130 mg/dl and no mutation, participants with LDL cholesterol ≥190 mg/dl and no FH mutation had six-fold higher risk for CAD (OR 6.0; 95%CI 5.2–6.9) whereas those with LDL cholesterol ≥190 mg/dl as well as a FH mutation demonstrated twenty-two fold increased risk (OR 22.3; 95%CI 10.7–53.2). Conclusions Among individuals with LDL cholesterol ≥190 mg/dl, gene sequencing identified a FH mutation in <2%. However, for any given observed LDL cholesterol, FH mutation carriers are at substantially increased risk for CAD

  16. Widespread of horizontal gene transfer in the human genome.

    Science.gov (United States)

    Huang, Wenze; Tsai, Lillian; Li, Yulong; Hua, Nan; Sun, Chen; Wei, Chaochun

    2017-04-04

    A fundamental concept in biology is that heritable material is passed from parents to offspring, a process called vertical gene transfer. An alternative mechanism of gene acquisition is through horizontal gene transfer (HGT), which involves movement of genetic materials between different species. Horizontal gene transfer has been found prevalent in prokaryotes but very rare in eukaryote. In this paper, we investigate horizontal gene transfer in the human genome. From the pair-wise alignments between human genome and 53 vertebrate genomes, 1,467 human genome regions (2.6 M bases) from all chromosomes were found to be more conserved with non-mammals than with most mammals. These human genome regions involve 642 known genes, which are enriched with ion binding. Compared to known horizontal gene transfer regions in the human genome, there were few overlapping regions, which indicated horizontal gene transfer is more common than we expected in the human genome. Horizontal gene transfer impacts hundreds of human genes and this study provided insight into potential mechanisms of HGT in the human genome.

  17. Widespread of horizontal gene transfer in the human genome

    OpenAIRE

    Huang, Wenze; Tsai, Lillian; Li, Yulong; Hua, Nan; Sun, Chen; Wei, Chaochun

    2017-01-01

    Background A fundamental concept in biology is that heritable material is passed from parents to offspring, a process called vertical gene transfer. An alternative mechanism of gene acquisition is through horizontal gene transfer (HGT), which involves movement of genetic materials between different species. Horizontal gene transfer has been found prevalent in prokaryotes but very rare in eukaryote. In this paper, we investigate horizontal gene transfer in the human genome. Results From the pa...

  18. Search for intracranial aneurysm susceptibility gene(s using Finnish families

    Directory of Open Access Journals (Sweden)

    Ryynänen Markku

    2002-08-01

    Full Text Available Abstract Background Cerebrovascular disease is the third leading cause of death in the United States, and about one-fourth of cerebrovascular deaths are attributed to ruptured intracranial aneurysms (IA. Epidemiological evidence suggests that IAs cluster in families, and are therefore probably genetic. Identification of individuals at risk for developing IAs by genetic tests will allow concentration of diagnostic imaging on high-risk individuals. We used model-free linkage analysis based on allele sharing with a two-stage design for a genome-wide scan to identify chromosomal regions that may harbor IA loci. Methods We previously estimated sibling relative risk in the Finnish population at between 9 and 16, and proceeded with a genome-wide scan for loci predisposing to IA. In 85 Finnish families with two or more affected members, 48 affected sibling pairs (ASPs were available for our genetic study. Power calculations indicated that 48 ASPs were adequate to identify chromosomal regions likely to harbor predisposing genes and that a liberal stage I lod score threshold of 0.8 provided a reasonable balance between detection of false positive regions and failure to detect real loci with moderate effect. Results Seven chromosomal regions exceeded the stage I lod score threshold of 0.8 and five exceeded 1.0. The most significant region, on chromosome 19q, had a maximum multipoint lod score (MLS of 2.6. Conclusions Our study provides evidence for the locations of genes predisposing to IA. Further studies are necessary to elucidate the genes and their role in the pathophysiology of IA, and to design genetic tests.

  19. Fast and simple protein-alignment-guided assembly of orthologous gene families from microbiome sequencing reads.

    Science.gov (United States)

    Huson, Daniel H; Tappu, Rewati; Bazinet, Adam L; Xie, Chao; Cummings, Michael P; Nieselt, Kay; Williams, Rohan

    2017-01-25

    Microbiome sequencing projects typically collect tens of millions of short reads per sample. Depending on the goals of the project, the short reads can either be subjected to direct sequence analysis or be assembled into longer contigs. The assembly of whole genomes from metagenomic sequencing reads is a very difficult problem. However, for some questions, only specific genes of interest need to be assembled. This is then a gene-centric assembly where the goal is to assemble reads into contigs for a family of orthologous genes. We present a new method for performing gene-centric assembly, called protein-alignment-guided assembly, and provide an implementation in our metagenome analysis tool MEGAN. Genes are assembled on the fly, based on the alignment of all reads against a protein reference database such as NCBI-nr. Specifically, the user selects a gene family based on a classification such as KEGG and all reads binned to that gene family are assembled. Using published synthetic community metagenome sequencing reads and a set of 41 gene families, we show that the performance of this approach compares favorably with that of full-featured assemblers and that of a recently published HMM-based gene-centric assembler, both in terms of the number of reference genes detected and of the percentage of reference sequence covered. Protein-alignment-guided assembly of orthologous gene families complements whole-metagenome assembly in a new and very useful way.

  20. Mutation analysis of the MCHR1 gene in human obesity

    DEFF Research Database (Denmark)

    Wermter, Anne-Kathrin; Reichwald, Kathrin; Büch, Thomas

    2005-01-01

    The importance of the melanin-concentrating hormone (MCH) system for regulation of energy homeostasis and body weight has been demonstrated in rodents. We analysed the human MCH receptor 1 gene (MCHR1) with respect to human obesity....

  1. Immunoglobulin gene usage in the human anti-pathogen response.

    Science.gov (United States)

    Newkirk, M M; Rioux, J D

    1995-09-01

    The human antibody response to foreign pathogens is generated to a relatively small number of target surface proteins and carbohydrates that nonetheless have an extensive array of epitopes. The study of human monoclonal antibodies to different pathogens shows that there are a diversity of mechanisms used to generate a sufficient repertoire of antibodies to combat the invading pathogens. Although many different immunoglobulin gene elements are used to construct the anti-pathogen response, some elements are used more often than would be expected if all elements were used randomly. For example, the immune response to Haemophilus influenzae polysaccharide appears to be quite narrow, being restricted primarily to a specific heavy-chain gene, 3-15, and a lambda light-chain family II member, 4A. In contrast, for the immune response to cytomegalovirus proteins, a wider group of gene elements is needed. It is also surprising that despite an investigator bias for IgG- rather than IgM-secreting immortal B cells (because of their high affinity and neutralizing abilities), 26% of light chains and 13% of heavy chains showed a very low level of somatic mutation, equivalent to an IgM molecule that has not undergone affinity maturation. Although some highly mutated IgG molecules are present in the anti-pathogen response, most of the monoclonal antibodies specific for viruses or bacteria have a level of somatic hypermutation similar to that of the adult IgM repertoire. A number of studies have shown that there are similarities in the antibody responses to pathogens and to self (autoantibodies).(ABSTRACT TRUNCATED AT 250 WORDS)

  2. Pvu-II RFLP at the human lipoprotein lipase (LPL) gene locus

    Energy Technology Data Exchange (ETDEWEB)

    Li, S; Oka, K; Galton, D; Stocks, J

    1988-03-25

    Human lipoprotein lipase (LPL) cDNA, 1.6 Kbp, was isolated from human adipose cDNA library and subcloned into Bam HI site of pIB131. Pvu-II identifies a two allele polymorphism with bands at 7.0 Kb, 4.4 Kb and 2.5 Kb. The frequency was studied in 34 caucasians. The gene was assigned to 8p22. Co-dominant inheritance was demonstrated in a 2 generation family.

  3. P63 gene mutations and human developmental syndromes.

    NARCIS (Netherlands)

    Brunner, H.G.; Hamel, B.C.J.; Bokhoven, J.H.L.M. van

    2002-01-01

    The P63 gene is a recently discovered member of the p53 family. While P53 is ubiquitously expressed, p63 is expressed specifically in embryonic ectoderm and in the basal regenerative layers of epithelial tissues in the adult. Complete abrogation of P63 gene function in an animal model points to the

  4. Bioinformatics and phylogenetic analysis of human Tp73 gene ...

    African Journals Online (AJOL)

    The Tp73 gene encoding p73 protein belongs to the Tp53 gene family and it functions in the initiation of cell-cycle arrest or apoptosis and also involves in regulating a series of pathways including breast cancer, neuroblastoma and cholorectal cancer. New discoveries about the control and function of p73 are still in progress ...

  5. Bioinformatic prediction and functional characterization of human KIAA0100 gene

    Directory of Open Access Journals (Sweden)

    He Cui

    2017-02-01

    Full Text Available Our previous study demonstrated that human KIAA0100 gene was a novel acute monocytic leukemia-associated antigen (MLAA gene. But the functional characterization of human KIAA0100 gene has remained unknown to date. Here, firstly, bioinformatic prediction of human KIAA0100 gene was carried out using online softwares; Secondly, Human KIAA0100 gene expression was downregulated by the clustered regularly interspaced short palindromic repeats (CRISPR/CRISPR-associated (Cas 9 system in U937 cells. Cell proliferation and apoptosis were next evaluated in KIAA0100-knockdown U937 cells. The bioinformatic prediction showed that human KIAA0100 gene was located on 17q11.2, and human KIAA0100 protein was located in the secretory pathway. Besides, human KIAA0100 protein contained a signalpeptide, a transmembrane region, three types of secondary structures (alpha helix, extended strand, and random coil , and four domains from mitochondrial protein 27 (FMP27. The observation on functional characterization of human KIAA0100 gene revealed that its downregulation inhibited cell proliferation, and promoted cell apoptosis in U937 cells. To summarize, these results suggest human KIAA0100 gene possibly comes within mitochondrial genome; moreover, it is a novel anti-apoptotic factor related to carcinogenesis or progression in acute monocytic leukemia, and may be a potential target for immunotherapy against acute monocytic leukemia.

  6. Identification and characterization of human GUKH2 gene in silico.

    Science.gov (United States)

    Katoh, Masuko; Katoh, Masaru

    2004-04-01

    Drosophila Guanylate-kinase holder (Gukh) is an adaptor molecule bridging Discs large (Dlg) and Scribble (Scrib), which are implicated in the establishment and maintenance of epithelial polarity. Here, we searched for human homologs of Drosophila gukh by using bioinformatics, and identified GUKH1 and GUKH2 genes. GUKH1 was identical to Nance-Horan syndrome (NHS) gene, while GUKH2 was a novel gene. FLJ35425 (AK092744.1), DKFZp686P1949 (BX647246.1) and KIAA1357 (AB037778.1) cDNAs were derived from human GUKH2 gene. Nucleotide sequence of GUKH2 cDNA was determined by assembling 5'-part of FLJ35425 cDNA and entire region of DKFZp686P1949 cDNA. Human GUKH2 gene consists of 8 exons. Exon 5 (132 bp) of GUKH2 gene was spliced out in GUKH2 cDNA due to alternative splicing. GUKH2-REPS1 locus at human chromosome 6q24.1 and GUKH1-REPS2 locus at human chromosome Xp22.22-p22.13 are paralogous regions within the human genome. Mouse Gukh2 and zebrafish gukh2 genes were also identified. N-terminal part of human GUKH2, mouse Gukh2 and zebrafish gukh2 proteins were completely divergent from human GUKH1 protein. Human GUKH2 and GUKH1, consisting of eight GUKH homology (GKH1-GKH8) domains and Proline-rich domain, showed 28.5% total-amino-acid identity. GKH1, GKH4, GKH5, GKH7 and GKH8 domains were conserved among human GUKH1, human GUKH2 and Drosophila Gukh. Because human homologs of Drosophila dlg (DLG1-DLG7) as well as human homologs of Drosophila scrib (SCRIB, ERBB2IP and Densin-180) are cancer-associated genes, human homologs of Drosophila gukh (GUKH1 and GUKH2) are predicted cancer-associated genes.

  7. Expression of the human growth hormone variant gene in cultured fibroblasts and transgenic mice

    International Nuclear Information System (INIS)

    Selden, R.F.; Wagner, T.E.; Blethen, S.; Yun, J.S.; Rowe, M.E.; Goodman, H.M.

    1988-01-01

    The nucleotide sequence of the human growth hormone variant gene, one of the five members of the growth hormone gene family, predicts that it encodes a growth hormone-like protein. As a first step in determining whether this gene is functional in humans, the authors have expressed a mouse methallothionein I/human growth hormone variant fusion gene in mouse L cells and in transgenic mice. The growth hormone variant protein expressed in transiently transfected L cells is distinct from growth hormone itself with respect to reactivity with anti-growth hormone monoclonal antibodies, behavior during column chromatography, and isoelectric point. Transgenic mice expressing the growth hormone variant protein are 1.4- to 1.9-fold larger than nontransgenic controls, suggesting that the protein has growth-promoting properties

  8. Molecular analysis of the NDP gene in two families with Norrie disease.

    Science.gov (United States)

    Rivera-Vega, M Refugio; Chiñas-Lopez, Silvet; Vaca, Ana Luisa Jimenez; Arenas-Sordo, M Luz; Kofman-Alfaro, Susana; Messina-Baas, Olga; Cuevas-Covarrubias, Sergio Alberto

    2005-04-01

    To describe the molecular defects in the Norrie disease protein (NDP) gene in two families with Norrie disease (ND). We analysed two families with ND at molecular level through polymerase chain reaction, DNA sequence analysis and GeneScan. Two molecular defects found in the NDP gene were: a missense mutation (265C > G) within codon 97 that resulted in the interchange of arginine by proline, and a partial deletion in the untranslated 3' region of exon 3 of the NDP gene. Clinical findings were more severe in the family that presented the partial deletion. We also diagnosed the carrier status of one daughter through GeneScan; this method proved to be a useful tool for establishing female carriers of ND. Here we report two novel mutations in the NDP gene in Mexican patients and propose that GeneScan is a viable mean of establishing ND carrier status.

  9. FGF: A web tool for Fishing Gene Family in a whole genome database

    DEFF Research Database (Denmark)

    Zheng, Hongkun; Shi, Junjie; Fang, Xiaodong

    2007-01-01

    to efficiently search for and identify gene families. The FGF output displays the results as visual phylogenetic trees including information on gene structure, chromosome position, duplication fate and selective pressure. It is particularly useful to identify pseudogenes and detect changes in gene structure. FGF...

  10. FGF: A web tool for Fishing Gene Family in a whole genome database

    DEFF Research Database (Denmark)

    Zheng, Hongkun; Shi, Junjie; Fang, Xiaodong

    2007-01-01

    Gene duplication is an important process in evolution. The availability of genome sequences of a number of organisms has made it possible to conduct comprehensive searches for duplicated genes enabling informative studies of their evolution. We have established the FGF (Fishing Gene Family) progr...... is freely available on a web server at http://fgf.genomics.org.cn/...

  11. Multiple independent insertions of 5S rRNA genes in the spliced-leader gene family of trypanosome species.

    Science.gov (United States)

    Beauparlant, Marc A; Drouin, Guy

    2014-02-01

    Analyses of the 5S rRNA genes found in the spliced-leader (SL) gene repeat units of numerous trypanosome species suggest that such linkages were not inherited from a common ancestor, but were the result of independent 5S rRNA gene insertions. In trypanosomes, 5S rRNA genes are found either in the tandemly repeated units coding for SL genes or in independent tandemly repeated units. Given that trypanosome species where 5S rRNA genes are within the tandemly repeated units coding for SL genes are phylogenetically related, one might hypothesize that this arrangement is the result of an ancestral insertion of 5S rRNA genes into the tandemly repeated SL gene family of trypanosomes. Here, we use the types of 5S rRNA genes found associated with SL genes, the flanking regions of the inserted 5S rRNA genes and the position of these insertions to show that most of the 5S rRNA genes found within SL gene repeat units of trypanosome species were not acquired from a common ancestor but are the results of independent insertions. These multiple 5S rRNA genes insertion events in trypanosomes are likely the result of frequent founder events in different hosts and/or geographical locations in species having short generation times.

  12. Gender in childhood obesity: family environment, hormones, and genes.

    Science.gov (United States)

    Wisniewski, Amy B; Chernausek, Steven D

    2009-01-01

    The prevalence of obesity among children in the United States represents a pool of latent morbidity. Though the prevalence of obesity has increased in both boys and girls, the causes and consequences differ between the sexes. Thus, interventions proposed to treat and prevent childhood obesity will need to account for these differences. This review examines gender differences in the presentation of obesity in children and describes environmental, hormonal, and genetic factors that contribute to observed gender differences. A search of peer-reviewed, published literature was performed with PubMed for articles published from January 1974 through October 2008. Search terms used were obesity, sex, gender, hormones, family environment, body composition, adiposity, and genes. Studies of children aged 0 to 18 years were included, and only articles published in English were reviewed for consideration. Articles that illustrated gender differences in either the presentation or underlying mechanisms of obesity in children were reviewed for content, and their bibliographies were used to identify other relevant literature. Gender differences in childhood obesity have been understudied partially because of how we define the categories of overweight and obesity. Close examination of studies revealed that gender differences were common, both before and during puberty. Boys and girls differ in body composition, patterns of weight gain, hormone biology, and the susceptibility to certain social, ethnic, genetic, and environmental factors. Our understanding of how gender differences in pediatric populations relate to the pathogenesis of obesity and the subsequent development of associated comorbid states is critical to developing and implementing both therapeutic and preventive interventions.

  13. Gene Structures, Evolution and Transcriptional Profiling of the WRKY Gene Family in Castor Bean (Ricinus communis L.).

    Science.gov (United States)

    Zou, Zhi; Yang, Lifu; Wang, Danhua; Huang, Qixing; Mo, Yeyong; Xie, Guishui

    2016-01-01

    WRKY proteins comprise one of the largest transcription factor families in plants and form key regulators of many plant processes. This study presents the characterization of 58 WRKY genes from the castor bean (Ricinus communis L., Euphorbiaceae) genome. Compared with the automatic genome annotation, one more WRKY-encoding locus was identified and 20 out of the 57 predicted gene models were manually corrected. All RcWRKY genes were shown to contain at least one intron in their coding sequences. According to the structural features of the present WRKY domains, the identified RcWRKY genes were assigned to three previously defined groups (I-III). Although castor bean underwent no recent whole-genome duplication event like physic nut (Jatropha curcas L., Euphorbiaceae), comparative genomics analysis indicated that one gene loss, one intron loss and one recent proximal duplication occurred in the RcWRKY gene family. The expression of all 58 RcWRKY genes was supported by ESTs and/or RNA sequencing reads derived from roots, leaves, flowers, seeds and endosperms. Further global expression profiles with RNA sequencing data revealed diverse expression patterns among various tissues. Results obtained from this study not only provide valuable information for future functional analysis and utilization of the castor bean WRKY genes, but also provide a useful reference to investigate the gene family expansion and evolution in Euphorbiaceus plants.

  14. In-silico human genomics with GeneCards

    Directory of Open Access Journals (Sweden)

    Stelzer Gil

    2011-10-01

    Full Text Available Abstract Since 1998, the bioinformatics, systems biology, genomics and medical communities have enjoyed a synergistic relationship with the GeneCards database of human genes (http://www.genecards.org. This human gene compendium was created to help to introduce order into the increasing chaos of information flow. As a consequence of viewing details and deep links related to specific genes, users have often requested enhanced capabilities, such that, over time, GeneCards has blossomed into a suite of tools (including GeneDecks, GeneALaCart, GeneLoc, GeneNote and GeneAnnot for a variety of analyses of both single human genes and sets thereof. In this paper, we focus on inhouse and external research activities which have been enabled, enhanced, complemented and, in some cases, motivated by GeneCards. In turn, such interactions have often inspired and propelled improvements in GeneCards. We describe here the evolution and architecture of this project, including examples of synergistic applications in diverse areas such as synthetic lethality in cancer, the annotation of genetic variations in disease, omics integration in a systems biology approach to kidney disease, and bioinformatics tools.

  15. Novel gene PUS3 c.A212G mutation in Ukrainian family with intellectual disability

    Directory of Open Access Journals (Sweden)

    Gulkovskyi R. V.

    2015-04-01

    Full Text Available Aim. To evaluate a possible role of a novel c.A212G substitution in the PUS3 gene at intellectual disability (ID. Methods. The observed group consisted of the ID Ukrainian family members (parents and two affected children and the control group – of 300 healthy individuals from general population of Ukraine. Sanger sequencing of the PUS3 gene exon 1 was performed for the family members. Polymorphic variants of c.A212G were analyzed using ARMS PCR. The homology models of wild type and p.Y71C mutant catalytic domains of human Pus3 were generated using the crystal structure of the human Pus1 catalytic domain (PDB ID: 4NZ6 as a template. Results. It was shown that the father of the affected siblings was the c.A212G substitution heterozygous carrier whereas the mother was a wild type allele homozygote, and the exom sequencing result was confirmed – the affected children are 212G homozygotes. We supposed de novo mutation in the maternal germ line. A low frequency of 212G allele (0.0017 was shown in the population of Ukraine. Homology modelling of the wild type and p.Y71C mutant catalytic domain of human Pus3 revealed that substitution p.Y71C is located in close proximity to its active site. Conclusions. The absence of hypoproteinemia in our patients, homozygous for the 212C allele allows us to assume that the mutation c.A212G PUS3 is rather neutral and cannot be the major cause of ID. However, considering a low frequency of the 212G allele in the population and close localization of p.Y71C substitution to the active site of hPus3 we cannot exclude that the c.A212G mutation in PUS3 may be a modifier for some pathologies including syndromic ID.

  16. Human reporter genes: potential use in clinical studies

    Energy Technology Data Exchange (ETDEWEB)

    Serganova, Inna [Department of Neurology, Memorial Sloan-Kettering Cancer Center, New York, NY 10021 (United States); Ponomarev, Vladimir [Department of Radiology, Memorial Sloan-Kettering Cancer Center, New York, NY 10021 (United States); Blasberg, Ronald [Department of Neurology, Memorial Sloan-Kettering Cancer Center, New York, NY 10021 (United States); Department of Radiology, Memorial Sloan-Kettering Cancer Center, New York, NY 10021 (United States)], E-mail: blasberg@neuro1.mskcc.org

    2007-10-15

    The clinical application of positron-emission-tomography-based reporter gene imaging will expand over the next several years. The translation of reporter gene imaging technology into clinical applications is the focus of this review, with emphasis on the development and use of human reporter genes. Human reporter genes will play an increasingly more important role in this development, and it is likely that one or more reporter systems (human gene and complimentary radiopharmaceutical) will take leading roles. Three classes of human reporter genes are discussed and compared: receptors, transporters and enzymes. Examples of highly expressed cell membrane receptors include specific membrane somatostatin receptors (hSSTrs). The transporter group includes the sodium iodide symporter (hNIS) and the norepinephrine transporter (hNET). The endogenous enzyme classification includes human mitochondrial thymidine kinase 2 (hTK2). In addition, we also discuss the nonhuman dopamine 2 receptor and two viral reporter genes, the wild-type herpes simplex virus 1 thymidine kinase (HSV1-tk) gene and the HSV1-tk mutant (HSV1-sr39tk). Initial applications of reporter gene imaging in patients will be developed within two different clinical disciplines: (a) gene therapy and (b) adoptive cell-based therapies. These studies will benefit from the availability of efficient human reporter systems that can provide critical monitoring information for adenoviral-based, retroviral-based and lenteviral-based gene therapies, oncolytic bacterial and viral therapies, and adoptive cell-based therapies. Translational applications of noninvasive in vivo reporter gene imaging are likely to include: (a) quantitative monitoring of gene therapy vectors for targeting and transduction efficacy in clinical protocols by imaging the location, extent and duration of transgene expression; (b) monitoring of cell trafficking, targeting, replication and activation in adoptive T-cell and stem/progenitor cell therapies

  17. Human reporter genes: potential use in clinical studies

    International Nuclear Information System (INIS)

    Serganova, Inna; Ponomarev, Vladimir; Blasberg, Ronald

    2007-01-01

    The clinical application of positron-emission-tomography-based reporter gene imaging will expand over the next several years. The translation of reporter gene imaging technology into clinical applications is the focus of this review, with emphasis on the development and use of human reporter genes. Human reporter genes will play an increasingly more important role in this development, and it is likely that one or more reporter systems (human gene and complimentary radiopharmaceutical) will take leading roles. Three classes of human reporter genes are discussed and compared: receptors, transporters and enzymes. Examples of highly expressed cell membrane receptors include specific membrane somatostatin receptors (hSSTrs). The transporter group includes the sodium iodide symporter (hNIS) and the norepinephrine transporter (hNET). The endogenous enzyme classification includes human mitochondrial thymidine kinase 2 (hTK2). In addition, we also discuss the nonhuman dopamine 2 receptor and two viral reporter genes, the wild-type herpes simplex virus 1 thymidine kinase (HSV1-tk) gene and the HSV1-tk mutant (HSV1-sr39tk). Initial applications of reporter gene imaging in patients will be developed within two different clinical disciplines: (a) gene therapy and (b) adoptive cell-based therapies. These studies will benefit from the availability of efficient human reporter systems that can provide critical monitoring information for adenoviral-based, retroviral-based and lenteviral-based gene therapies, oncolytic bacterial and viral therapies, and adoptive cell-based therapies. Translational applications of noninvasive in vivo reporter gene imaging are likely to include: (a) quantitative monitoring of gene therapy vectors for targeting and transduction efficacy in clinical protocols by imaging the location, extent and duration of transgene expression; (b) monitoring of cell trafficking, targeting, replication and activation in adoptive T-cell and stem/progenitor cell therapies

  18. Undefined familial colorectal cancer and the role of pleiotropism in cancer susceptibility genes.

    Science.gov (United States)

    Dobbins, Sara E; Broderick, Peter; Chubb, Daniel; Kinnersley, Ben; Sherborne, Amy L; Houlston, Richard S

    2016-10-01

    Although family history is a major risk factor for colorectal cancer (CRC) a genetic diagnosis cannot be obtained in over 50 % of familial cases when screened for known CRC cancer susceptibility genes. The genetics of undefined-familial CRC is complex and recent studies have implied additional clinically actionable mutations for CRC in susceptibility genes for other cancers. To clarify the contribution of non-CRC susceptibility genes to undefined-familial CRC we conducted a mutational screen of 114 cancer susceptibility genes in 847 patients with early-onset undefined-familial CRC and 1609 controls by analysing high-coverage exome sequencing data. We implemented American College of Medical Genetics and Genomics standards and guidelines for assigning pathogenicity to variants. Globally across all 114 cancer susceptibility genes no statistically significant enrichment of likely pathogenic variants was shown (6.7 % cases 57/847, 5.3 % controls 85/1609; P = 0.15). Moreover there was no significant enrichment of mutations in genes such as TP53 or BRCA2 which have been proposed for clinical testing in CRC. In conclusion, while we identified genes that may be considered interesting candidates as determinants of CRC risk warranting further research, there is currently scant evidence to support a role for genes other than those responsible for established CRC syndromes in the clinical management of familial CRC.

  19. Determinants of human adipose tissue gene expression

    DEFF Research Database (Denmark)

    Viguerie, Nathalie; Montastier, Emilie; Maoret, Jean-José

    2012-01-01

    weight maintenance diets. For 175 genes, opposite regulation was observed during calorie restriction and weight maintenance phases, independently of variations in body weight. Metabolism and immunity genes showed inverse profiles. During the dietary intervention, network-based analyses revealed strong...... interconnection between expression of genes involved in de novo lipogenesis and components of the metabolic syndrome. Sex had a marked influence on AT expression of 88 transcripts, which persisted during the entire dietary intervention and after control for fat mass. In women, the influence of body mass index...... on expression of a subset of genes persisted during the dietary intervention. Twenty-two genes revealed a metabolic syndrome signature common to men and women. Genetic control of AT gene expression by cis signals was observed for 46 genes. Dietary intervention, sex, and cis genetic variants independently...

  20. MboI RFLP at the human renin (ren) gene locus

    Energy Technology Data Exchange (ETDEWEB)

    Masharani, U; Frossard, P M

    1988-03-25

    1.5kb full length human renin cDNA was isolated from a human kidney cDNA library and subcloned into pUC9. MboI (GATC) detects a single two allele polymorphism with fragments at either 1.4kb or 1.0kb. The frequency was studied in 80 unrelated North American. The human renin gene was assigned to chromosome 1 by southern blot analysis of DNA from human-rodent somatic cell hybrids. Codominant segregation was observed in 1 family (7 individuals).

  1. Conservation, Divergence, and Genome-Wide Distribution of PAL and POX A Gene Families in Plants.

    Science.gov (United States)

    Rawal, H C; Singh, N K; Sharma, T R

    2013-01-01

    Genome-wide identification and phylogenetic and syntenic comparison were performed for the genes responsible for phenylalanine ammonia lyase (PAL) and peroxidase A (POX A) enzymes in nine plant species representing very diverse groups like legumes (Glycine max and Medicago truncatula), fruits (Vitis vinifera), cereals (Sorghum bicolor, Zea mays, and Oryza sativa), trees (Populus trichocarpa), and model dicot (Arabidopsis thaliana) and monocot (Brachypodium distachyon) species. A total of 87 and 1045 genes in PAL and POX A gene families, respectively, have been identified in these species. The phylogenetic and syntenic comparison along with motif distributions shows a high degree of conservation of PAL genes, suggesting that these genes may predate monocot/eudicot divergence. The POX A family genes, present in clusters at the subtelomeric regions of chromosomes, might be evolving and expanding with higher rate than the PAL gene family. Our analysis showed that during the expansion of POX A gene family, many groups and subgroups have evolved, resulting in a high level of functional divergence among monocots and dicots. These results will act as a first step toward the understanding of monocot/eudicot evolution and functional characterization of these gene families in the future.

  2. Conservation, Divergence, and Genome-Wide Distribution of PAL and POX A Gene Families in Plants

    Directory of Open Access Journals (Sweden)

    H. C. Rawal

    2013-01-01

    Full Text Available Genome-wide identification and phylogenetic and syntenic comparison were performed for the genes responsible for phenylalanine ammonia lyase (PAL and peroxidase A (POX A enzymes in nine plant species representing very diverse groups like legumes (Glycine max and Medicago truncatula, fruits (Vitis vinifera, cereals (Sorghum bicolor, Zea mays, and Oryza sativa, trees (Populus trichocarpa, and model dicot (Arabidopsis thaliana and monocot (Brachypodium distachyon species. A total of 87 and 1045 genes in PAL and POX A gene families, respectively, have been identified in these species. The phylogenetic and syntenic comparison along with motif distributions shows a high degree of conservation of PAL genes, suggesting that these genes may predate monocot/eudicot divergence. The POX A family genes, present in clusters at the subtelomeric regions of chromosomes, might be evolving and expanding with higher rate than the PAL gene family. Our analysis showed that during the expansion of POX A gene family, many groups and subgroups have evolved, resulting in a high level of functional divergence among monocots and dicots. These results will act as a first step toward the understanding of monocot/eudicot evolution and functional characterization of these gene families in the future.

  3. Identification of a novel Gig2 gene family specific to non-amniote vertebrates.

    Directory of Open Access Journals (Sweden)

    Yi-Bing Zhang

    Full Text Available Gig2 (grass carp reovirus (GCRV-induced gene 2 is first identified as a novel fish interferon (IFN-stimulated gene (ISG. Overexpression of a zebrafish Gig2 gene can protect cultured fish cells from virus infection. In the present study, we identify a novel gene family that is comprised of genes homologous to the previously characterized Gig2. EST/GSS search and in silico cloning identify 190 Gig2 homologous genes in 51 vertebrate species ranged from lampreys to amphibians. Further large-scale search of vertebrate and invertebrate genome databases indicate that Gig2 gene family is specific to non-amniotes including lampreys, sharks/rays, ray-finned fishes and amphibians. Phylogenetic analysis and synteny analysis reveal lineage-specific expansion of Gig2 gene family and also provide valuable evidence for the fish-specific genome duplication (FSGD hypothesis. Although Gig2 family proteins exhibit no significant sequence similarity to any known proteins, a typical Gig2 protein appears to consist of two conserved parts: an N-terminus that bears very low homology to the catalytic domains of poly(ADP-ribose polymerases (PARPs, and a novel C-terminal domain that is unique to this gene family. Expression profiling of zebrafish Gig2 family genes shows that some duplicate pairs have diverged in function via acquisition of novel spatial and/or temporal expression under stresses. The specificity of this gene family to non-amniotes might contribute to a large extent to distinct physiology in non-amniote vertebrates.

  4. Saltatory Evolution of the Ectodermal Neural Cortex Gene Family at the Vertebrate Origin

    Science.gov (United States)

    Feiner, Nathalie; Murakami, Yasunori; Breithut, Lisa; Mazan, Sylvie; Meyer, Axel; Kuraku, Shigehiro

    2013-01-01

    The ectodermal neural cortex (ENC) gene family, whose members are implicated in neurogenesis, is part of the kelch repeat superfamily. To date, ENC genes have been identified only in osteichthyans, although other kelch repeat-containing genes are prevalent throughout bilaterians. The lack of elaborate molecular phylogenetic analysis with exhaustive taxon sampling has obscured the possible link of the establishment of this gene family with vertebrate novelties. In this study, we identified ENC homologs in diverse vertebrates by means of database mining and polymerase chain reaction screens. Our analysis revealed that the ENC3 ortholog was lost in the basal eutherian lineage through single-gene deletion and that the triplication between ENC1, -2, and -3 occurred early in vertebrate evolution. Including our original data on the catshark and the zebrafish, our comparison revealed high conservation of the pleiotropic expression pattern of ENC1 and shuffling of expression domains between ENC1, -2, and -3. Compared with many other gene families including developmental key regulators, the ENC gene family is unique in that conventional molecular phylogenetic inference could identify no obvious invertebrate ortholog. This suggests a composite nature of the vertebrate-specific gene repertoire, consisting not only of de novo genes introduced at the vertebrate origin but also of long-standing genes with no apparent invertebrate orthologs. Some of the latter, including the ENC gene family, may be too rapidly evolving to provide sufficient phylogenetic signals marking orthology to their invertebrate counterparts. Such gene families that experienced saltatory evolution likely remain to be explored and might also have contributed to phenotypic evolution of vertebrates. PMID:23843192

  5. CRDB: database of chemosensory receptor gene families in vertebrate.

    Directory of Open Access Journals (Sweden)

    Dong Dong

    Full Text Available Chemosensory receptors (CR are crucial for animals to sense the environmental changes and survive on earth. The emergence of whole-genome sequences provides us an opportunity to identify the entire CR gene repertoires. To completely gain more insight into the evolution of CR genes in vertebrates, we identified the nearly all CR genes in 25 vertebrates using homology-based approaches. Among these CR gene repertoires, nearly half of them were identified for the first time in those previously uncharacterized species, such as the guinea pig, giant panda and elephant, etc. Consistent with previous findings, we found that the numbers of CR genes vary extensively among different species, suggesting an extreme form of 'birth-and-death' evolution. For the purpose of facilitating CR gene analysis, we constructed a database with the goals to provide a resource for CR genes annotation and a web tool for exploring their evolutionary patterns. Besides a search engine for the gene extraction from a specific chromosome region, an easy-to-use phylogenetic analysis tool was also provided to facilitate online phylogeny study of CR genes. Our work can provide a rigorous platform for further study on the evolution of CR genes in vertebrates.

  6. Genomic assessment of the evolution of the prion protein gene family in vertebrates.

    Science.gov (United States)

    Harrison, Paul M; Khachane, Amit; Kumar, Manish

    2010-05-01

    Prion diseases are devastating neurological disorders caused by the propagation of particles containing an alternative beta-sheet-rich form of the prion protein (PrP). Genes paralogous to PrP, called Doppel and Shadoo, have been identified, that also have neuropathological relevance. To aid in the further functional characterization of PrP and its relatives, we annotated completely the PrP gene family (PrP-GF), in the genomes of 42 vertebrates, through combined strategic application of gene prediction programs and advanced remote homology detection techniques (such as HMMs, PSI-TBLASTN and pGenThreader). We have uncovered several previously undescribed paralogous genes and pseudogenes. We find that current high-quality genomic evidence indicates that the PrP relative Doppel, was likely present in the last common ancestor of present-day Tetrapoda, but was lost in the bird lineage, since its divergence from reptiles. Using the new gene annotations, we have defined the consensus of structural features that are characteristic of the PrP and Doppel structures, across diverse Tetrapoda clades. Furthermore, we describe in detail a transcribed pseudogene derived from Shadoo that is conserved across primates, and that overlaps the meiosis gene, SYCE1, thus possibly regulating its expression. In addition, we analysed the locus of PRNP/PRND for significant conservation across the genomic DNA of eleven mammals, and determined the phylogenetic penetration of non-coding exons. The genomic evidence indicates that the second PRNP non-coding exon found in even-toed ungulates and rodents, is conserved in all high-coverage genome assemblies of primates (human, chimp, orang utan and macaque), and is, at least, likely to have fallen out of use during primate speciation. Furthermore, we have demonstrated that the PRNT gene (at the PRNP human locus) is conserved across at least sixteen mammals, and evolves like a long non-coding RNA, fashioned from fragments of ancient, long

  7. Targeting the human lysozyme gene on bovine αs1- casein gene ...

    African Journals Online (AJOL)

    ajl yemi

    2011-11-28

    Nov 28, 2011 ... Targeting an exogenous gene into a favorable gene locus and for expression under endogenous regulators is ... case, the expression of human lysozyme could be regulated by the endogenous cis-element of αs1- casein gene in .... Mouse mammary epithelial C127 cells (Cell Bank, Chinese. Academy of ...

  8. A Patient With Desmoid Tumors and Familial FAP Having Frame Shift Mutation of the APC Gene

    Directory of Open Access Journals (Sweden)

    Sanambar Sadighi

    2017-02-01

    Full Text Available Desmoids tumors, characterized by monoclonal proliferation of myofibroblasts, could occur in 5-10% of patients with familial adenomatous polyposis (FAP as an extra-colonic manifestation of the disease. FAP can develop when there is a germ-line mutation in the adenomatous polyposis coli gene. Although mild or attenuated FAP may follow mutations in 5΄ extreme of the gene, it is more likely that 3΄ extreme mutations haveamore severe manifestation of thedisease. A 28-year-old woman was admitted to the Cancer Institute of Iran with an abdominal painful mass. She had strong family history of FAP and underwent prophylactic total colectomy. Pre-operative CT scans revealed a large mass. Microscopic observation showed diffuse fibroblast cell infiltration of the adjacent tissue structures. Peripheral blood DNA extraction followed by adenomatous polyposis coli gene exon by exon sequencing was performed to investigate the mutation in adenomatous polyposis coli gene. Analysis of DNA sequencing demonstrated a mutation of 4 bpdeletions at codon 1309-1310 of the exon 16 of adenomatous polyposis coli gene sequence which was repeated in 3 members of the family. Some of them had desmoid tumor without classical FAP history. Even when there is no familial history of adenomatous polyposis, the adenomatous polyposis coli gene mutation should be investigated in cases of familial desmoids tumors for a suitable prevention. The 3΄ extreme of the adenomatous polyposis coli gene is still the best likely location in such families.

  9. Ancient signals: comparative genomics of plant MAPK and MAPKK gene families

    DEFF Research Database (Denmark)

    Hamel, Louis-Philippe; Nicole, Marie-Claude; Sritubtim, Somrudee

    2006-01-01

    MAPK signal transduction modules play crucial roles in regulating many biological processes in plants, and their components are encoded by highly conserved genes. The recent availability of genome sequences for rice and poplar now makes it possible to examine how well the previously described...... Arabidopsis MAPK and MAPKK gene family structures represent the broader evolutionary situation in plants, and analysis of gene expression data for MPK and MKK genes in all three species allows further refinement of those families, based on functionality. The Arabidopsis MAPK nomenclature appears sufficiently...

  10. Altered gene expression in human placentas after IVF/ICSI.

    Science.gov (United States)

    Nelissen, Ewka C M; Dumoulin, John C M; Busato, Florence; Ponger, Loïc; Eijssen, Lars M; Evers, Johannes L H; Tost, Jörg; van Montfoort, Aafke P A

    2014-12-01

    Is gene expression in placental tissue of IVF/ICSI patients altered when compared with a spontaneously conceived group, and are these alterations due to loss of imprinting (LOI) in the case of imprinted genes? An altered imprinted gene expression of H19 and Pleckstrin homology-like domain family A member 2 (PHLDA2), which was not due to LOI, was observed in human placentas after IVF/ICSI and several biological pathways were significantly overrepresented and mostly up-regulated. Genomic imprinting plays an important role in placental biology and in placental adaptive responses triggered by external stimuli. Changes in placental development and function can have dramatic effects on the fetus and its ability to cope with the intrauterine environment. An increased frequency of placenta-related problems as well as an adverse perinatal outcome is seen in IVF/ICSI derived pregnancies, but the role of placental epigenetic deregulation is not clear yet. In this prospective cohort study, a total of 115 IVF/ICSI and 138 control couples were included during pregnancy. After applying several exclusion criteria (i.e. preterm birth or stillbirth, no placental samples, pregnancy complications or birth defects), respectively, 81 and 105 placentas from IVF/ICSI and control pregnancies remained for analysis. Saliva samples were collected from both parents. We quantitatively analysed the mRNA expression of several growth-related imprinted genes [H19, insulin-like growth factor 2 (IGF2), PHLDA2, cyclin-dependent kinase inhibitor 1C (CDKN1C), mesoderm-specific transcript homolog (MEST) isoform α and β by quantitative PCR] after standardization against three housekeeping genes [Succinate dehydrogenase A (SDHA), YWHAZ and TATA-binding protein (TBP)]. A quantitative allele-specific expression analysis of the differentially expressed imprinted genes was performed to investigate LOI, independent of the mechanism of imprinting. Furthermore, a microarray analysis was carried out (n = 10 in

  11. Human gene therapy: novel approaches to improve the current gene delivery systems.

    Science.gov (United States)

    Cucchiarini, Magali

    2016-06-01

    Even though gene therapy made its way through the clinics to treat a number of human pathologies since the early years of experimental research and despite the recent approval of the first gene-based product (Glybera) in Europe, the safe and effective use of gene transfer vectors remains a challenge in human gene therapy due to the existence of barriers in the host organism. While work is under active investigation to improve the gene transfer systems themselves, the use of controlled release approaches may offer alternative, convenient tools of vector delivery to achieve a performant gene transfer in vivo while overcoming the various physiological barriers that preclude its wide use in patients. This article provides an overview of the most significant contributions showing how the principles of controlled release strategies may be adapted for human gene therapy.

  12. Episomal Nonviral Gene Therapy Vectors Slow Progression of Atherosclerosis in a Model of Familial Hypercholesterolemia

    Directory of Open Access Journals (Sweden)

    Alastair G Kerr

    2016-01-01

    Full Text Available Familial hypercholesterolemia (FH is a life-threatening genetic disorder characterized by elevated levels of plasma low-density lipoprotein cholesterol (LDL-cholesterol. Current attempts at gene therapy for FH have been limited by the use of strong heterologous promoters which lack genomic DNA elements essential for regulated expression. Here, we have combined a minigene vector expressing the human LDLR cDNA from a 10 kb native human LDLR locus genomic DNA promoter element, with an efficient miRNA targeting 3-hydroxy-3-methylgutaryl-coenzyme A reductase (Hmgcr, to further enhance LDLR expression. We show that the combined vector suppresses endogenous Hmgcr transcripts in vivo, leading to an increase in LDLR transgene expression. In a diet-induced Ldlr-/- mouse model of FH, we show that administration of the combined vector reduces atherogenic plasma lipids by ≃32%. Finally, we demonstrate that our episomal nonviral vectors are able to reduce atherosclerosis by ≃40% after 12 weeks in vivo. Taken together, the vector system we describe exploits the normal cellular regulation of the LDLR to provide prolonged expression of LDLR through targeted knockdown of Hmgcr. This novel gene therapy system could act alone, or in synergy with current therapies that modulate intracellular cholesterol, such as statins, greatly enhancing its therapeutic application for FH.

  13. Different level of population differentiation among human genes

    Directory of Open Access Journals (Sweden)

    Zhang Ya-Ping

    2011-01-01

    Full Text Available Abstract Background During the colonization of the world, after dispersal out of African, modern humans encountered changeable environments and substantial phenotypic variations that involve diverse behaviors, lifestyles and cultures, were generated among the different modern human populations. Results Here, we study the level of population differentiation among different populations of human genes. Intriguingly, genes involved in osteoblast development were identified as being enriched with higher FST SNPs, a result consistent with the proposed role of the skeletal system in accounting for variation among human populations. Genes involved in the development of hair follicles, where hair is produced, were also found to have higher levels of population differentiation, consistent with hair morphology being a distinctive trait among human populations. Other genes that showed higher levels of population differentiation include those involved in pigmentation, spermatid, nervous system and organ development, and some metabolic pathways, but few involved with the immune system. Disease-related genes demonstrate excessive SNPs with lower levels of population differentiation, probably due to purifying selection. Surprisingly, we find that Mendelian-disease genes appear to have a significant excessive of SNPs with high levels of population differentiation, possibly because the incidence and susceptibility of these diseases show differences among populations. As expected, microRNA regulated genes show lower levels of population differentiation due to purifying selection. Conclusion Our analysis demonstrates different level of population differentiation among human populations for different gene groups.

  14. Different level of population differentiation among human genes.

    Science.gov (United States)

    Wu, Dong-Dong; Zhang, Ya-Ping

    2011-01-14

    During the colonization of the world, after dispersal out of African, modern humans encountered changeable environments and substantial phenotypic variations that involve diverse behaviors, lifestyles and cultures, were generated among the different modern human populations. Here, we study the level of population differentiation among different populations of human genes. Intriguingly, genes involved in osteoblast development were identified as being enriched with higher FST SNPs, a result consistent with the proposed role of the skeletal system in accounting for variation among human populations. Genes involved in the development of hair follicles, where hair is produced, were also found to have higher levels of population differentiation, consistent with hair morphology being a distinctive trait among human populations. Other genes that showed higher levels of population differentiation include those involved in pigmentation, spermatid, nervous system and organ development, and some metabolic pathways, but few involved with the immune system. Disease-related genes demonstrate excessive SNPs with lower levels of population differentiation, probably due to purifying selection. Surprisingly, we find that Mendelian-disease genes appear to have a significant excessive of SNPs with high levels of population differentiation, possibly because the incidence and susceptibility of these diseases show differences among populations. As expected, microRNA regulated genes show lower levels of population differentiation due to purifying selection. Our analysis demonstrates different level of population differentiation among human populations for different gene groups.

  15. De novo origin of human protein-coding genes.

    Directory of Open Access Journals (Sweden)

    Dong-Dong Wu

    2011-11-01

    Full Text Available The de novo origin of a new protein-coding gene from non-coding DNA is considered to be a very rare occurrence in genomes. Here we identify 60 new protein-coding genes that originated de novo on the human lineage since divergence from the chimpanzee. The functionality of these genes is supported by both transcriptional and proteomic evidence. RNA-seq data indicate that these genes have their highest expression levels in the cerebral cortex and testes, which might suggest that these genes contribute to phenotypic traits that are unique to humans, such as improved cognitive ability. Our results are inconsistent with the traditional view that the de novo origin of new genes is very rare, thus there should be greater appreciation of the importance of the de novo origination of genes.

  16. De Novo Origin of Human Protein-Coding Genes

    Science.gov (United States)

    Wu, Dong-Dong; Irwin, David M.; Zhang, Ya-Ping

    2011-01-01

    The de novo origin of a new protein-coding gene from non-coding DNA is considered to be a very rare occurrence in genomes. Here we identify 60 new protein-coding genes that originated de novo on the human lineage since divergence from the chimpanzee. The functionality of these genes is supported by both transcriptional and proteomic evidence. RNA–seq data indicate that these genes have their highest expression levels in the cerebral cortex and testes, which might suggest that these genes contribute to phenotypic traits that are unique to humans, such as improved cognitive ability. Our results are inconsistent with the traditional view that the de novo origin of new genes is very rare, thus there should be greater appreciation of the importance of the de novo origination of genes. PMID:22102831

  17. Ultra Large Gene Families: A Matter of Adaptation or Genomic Parasites?

    Directory of Open Access Journals (Sweden)

    Philipp H. Schiffer

    2016-08-01

    Full Text Available Gene duplication is an important mechanism of molecular evolution. It offers a fast track to modification, diversification, redundancy or rescue of gene function. However, duplication may also be neutral or (slightly deleterious, and often ends in pseudo-geneisation. Here, we investigate the phylogenetic distribution of ultra large gene families on long and short evolutionary time scales. In particular, we focus on a family of NACHT-domain and leucine-rich-repeat-containing (NLR-genes, which we previously found in large numbers to occupy one chromosome arm of the zebrafish genome. We were interested to see whether such a tight clustering is characteristic for ultra large gene families. Our data reconfirm that most gene family inflations are lineage-specific, but we can only identify very few gene clusters. Based on our observations we hypothesise that, beyond a certain size threshold, ultra large gene families continue to proliferate in a mechanism we term “run-away evolution”. This process might ultimately lead to the failure of genomic integrity and drive species to extinction.

  18. Characterization and gene expression analysis of the cir multi-gene family of plasmodium chabaudi chabaudi (AS

    Directory of Open Access Journals (Sweden)

    Lawton Jennifer

    2012-03-01

    Full Text Available Abstract Background The pir genes comprise the largest multi-gene family in Plasmodium, with members found in P. vivax, P. knowlesi and the rodent malaria species. Despite comprising up to 5% of the genome, little is known about the functions of the proteins encoded by pir genes. P. chabaudi causes chronic infection in mice, which may be due to antigenic variation. In this model, pir genes are called cirs and may be involved in this mechanism, allowing evasion of host immune responses. In order to fully understand the role(s of CIR proteins during P. chabaudi infection, a detailed characterization of the cir gene family was required. Results The cir repertoire was annotated and a detailed bioinformatic characterization of the encoded CIR proteins was performed. Two major sub-families were identified, which have been named A and B. Members of each sub-family displayed different amino acid motifs, and were thus predicted to have undergone functional divergence. In addition, the expression of the entire cir repertoire was analyzed via RNA sequencing and microarray. Up to 40% of the cir gene repertoire was expressed in the parasite population during infection, and dominant cir transcripts could be identified. In addition, some differences were observed in the pattern of expression between the cir subgroups at the peak of P. chabaudi infection. Finally, specific cir genes were expressed at different time points during asexual blood stages. Conclusions In conclusion, the large number of cir genes and their expression throughout the intraerythrocytic cycle of development indicates that CIR proteins are likely to be important for parasite survival. In particular, the detection of dominant cir transcripts at the peak of P. chabaudi infection supports the idea that CIR proteins are expressed, and could perform important functions in the biology of this parasite. Further application of the methodologies described here may allow the elucidation of CIR sub-family

  19. KIR And HLA Haplotype Analysis in a Family Lacking The KIR 2DL1-2DP1 Genes

    Directory of Open Access Journals (Sweden)

    Vojvodić Svetlana

    2015-06-01

    Full Text Available The killer cell immunoglobulin-like receptor (KIR gene cluster exhibits extensive allelic and haplotypic diversity that is observed as presence/absence of genes, resulting in expansion and contraction of KIR haplotypes and by allelic variation of individual KIR genes. We report a case of KIR pseudogene 2DP1 and 2DL1 gene absence in members of one family with the children suffering from acute myelogenous leukemia (AML. Killer cell immunoglo-bulin-like receptor low resolution genotyping was performed by the polymerase chain reaction (PCR-sequencespecific primers (SSP/sequence-specific oligonucleotide (SSO method and haplotype assignment was done by gene content analysis. Both parents and the maternal grandfather, shared the same Cen-B2 KIR haplotype, containing KIR 3DL3, -2DS2, -2DL2 and -3DP1 genes. The second haplotype in the KIR genotype of the mother and grandfather was Tel-A1 with KIR 2DL4 (normal and deleted variant, -3DL1, -22 bp deletion variant of the 2DS4 gene and -3DL2, while the second haplotype in the KIR genotype of the father was Tel-B1 with 2DL4 (normal variant, -3DS1, -2DL5, -2DS5, -2DS1 and 3DL2 genes. Haplotype analysis in all three offsprings revealed that the children inherited the Cen-B2 haplotype with the same gene content but two of the children inherited a deleted variant of the 2DL4 gene, while the third child inherited a normal one. The second haplotype of all three offspring contained KIR 2DL4, -2DL5, -2DS1, -2DS4 (del 22bp variant, -2DS5, -3DL1 and -3DL2 genes, which was the basis of the assumption that there is a hybrid haplotype and that the present 3DL1 gene is a variant of the 3DS1 gene. Due to consanguinity among the ancestors, the results of KIR segregation analysis showed the existence of a very rare KIR genotype in the offspring. The family who is the subject of this case is even more interesting because the father was 10/10 human leukocyte antigen (HLA-matched to his daughter, all members of the family have

  20. Molecular genetic characterization of the RD-114 gene family of endogenous feline retroviral sequences.

    Science.gov (United States)

    Reeves, R H; O'Brien, S J

    1984-01-01

    RD-114 is a replication-competent, xenotropic retrovirus which is homologous to a family of moderately repetitive DNA sequences present at ca. 20 copies in the normal cellular genome of domestic cats. To examine the extent and character of genomic divergence of the RD-114 gene family as well as to assess their positional association within the cat genome, we have prepared a series of molecular clones of endogenous RD-114 DNA segments from a genomic library of cat cellular DNA. Their restriction endonuclease maps were compared with each other as well as to that of the prototype-inducible RD-114 which was molecularly cloned from a chronically infected human cell line. The endogenous sequences analyzed were similar to each other in that they were colinear with RD-114 proviral DNA, were bounded by long terminal redundancies, and conserved many restriction sites in the gag and pol regions. However, the env regions of many of the sequences examined were substantially deleted. Several of the endogenous RD-114 genomes contained a novel envelope sequence which was unrelated to the env gene of the prototype RD-114 env gene but which, like RD-114 and endogenous feline leukemia virus provirus, was found only in species of the genus Felis, and not in other closely related Felidae genera. The endogenous RD-114 sequences each had a distinct cellular flank which indicates that these sequences are not tandem but dispersed nonspecifically throughout the genome. Southern analysis of cat cellular DNA confirmed the conclusions about conserved restriction sites in endogenous sequences and indicated that a single locus may be responsible for the production of the major inducible form of RD-114. Images PMID:6090693

  1. Identification and validation of suitable endogenous reference genes for gene expression studies in human peripheral blood

    Directory of Open Access Journals (Sweden)

    Turner Renee J

    2009-08-01

    Full Text Available Abstract Background Gene expression studies require appropriate normalization methods. One such method uses stably expressed reference genes. Since suitable reference genes appear to be unique for each tissue, we have identified an optimal set of the most stably expressed genes in human blood that can be used for normalization. Methods Whole-genome Affymetrix Human 2.0 Plus arrays were examined from 526 samples of males and females ages 2 to 78, including control subjects and patients with Tourette syndrome, stroke, migraine, muscular dystrophy, and autism. The top 100 most stably expressed genes with a broad range of expression levels were identified. To validate the best candidate genes, we performed quantitative RT-PCR on a subset of 10 genes (TRAP1, DECR1, FPGS, FARP1, MAPRE2, PEX16, GINS2, CRY2, CSNK1G2 and A4GALT, 4 commonly employed reference genes (GAPDH, ACTB, B2M and HMBS and PPIB, previously reported to be stably expressed in blood. Expression stability and ranking analysis were performed using GeNorm and NormFinder algorithms. Results Reference genes were ranked based on their expression stability and the minimum number of genes needed for nomalization as calculated using GeNorm showed that the fewest, most stably expressed genes needed for acurate normalization in RNA expression studies of human whole blood is a combination of TRAP1, FPGS, DECR1 and PPIB. We confirmed the ranking of the best candidate control genes by using an alternative algorithm (NormFinder. Conclusion The reference genes identified in this study are stably expressed in whole blood of humans of both genders with multiple disease conditions and ages 2 to 78. Importantly, they also have different functions within cells and thus should be expressed independently of each other. These genes should be useful as normalization genes for microarray and RT-PCR whole blood studies of human physiology, metabolism and disease.

  2. The human PDI family: Versatility packed into a single fold

    DEFF Research Database (Denmark)

    Appenzeller-Herzog, Christian; Ellgaard, Lars

    2007-01-01

    in promoting oxidative protein folding in the ER has been extended in recent years to include roles in other processes such as ER-associated degradation (ERAD), trafficking, calcium homeostasis, antigen presentation and virus entry. Some of these functions are performed by non-catalytic members of the family...... that lack the active-site cysteines. Regardless of their function, all human PDIs contain at least one domain of approximately 100 amino acid residues with structural homology to thioredoxin. As we learn more about the individual proteins of the family, a complex picture is emerging that emphasizes as much...... their differences as their similarities, and underlines the versatility of the thioredoxin fold. Here, we primarily explore the diversity of cellular functions described for the human PDIs. Udgivelsesdato: 2007-Dec-3...

  3. Evolution of the defensin-like gene family in grass genomes

    Indian Academy of Sciences (India)

    that the DEFL gene family is subjected to purifying selection. However, sliding window analysis .... sorghum from DOE-JGI Community Sequencing Program ..... This work was supported by the National Key Technologies Re- search and ...

  4. Complexity of rice Hsp100 gene family: lessons from rice genome ...

    Indian Academy of Sciences (India)

    Madhu Sudhan

    2007-03-29

    Mar 29, 2007 ... Chaperonins are a class of molecular chaperones found in prokaryotes and in the ... Keywords. Chaperone, gene family, Hsp100, Oryza sativa ..... Sculpting the proteome with AAA+ proteases and disassembly machines; Cell ...

  5. Exclusion of known gene for enamel development in two Brazilian families with amelogenesis imperfecta.

    Science.gov (United States)

    Santos, Maria C L G; Hart, P Suzanne; Ramaswami, Mukundhan; Kanno, Cláudia M; Hart, Thomas C; Line, Sergio R P

    2007-01-31

    Amelogenesis imperfecta (AI) is a genetically heterogeneous group of diseases that result in defective development of tooth enamel. Mutations in several enamel proteins and proteinases have been associated with AI. The object of this study was to evaluate evidence of etiology for the six major candidate gene loci in two Brazilian families with AI. Genomic DNA was obtained from family members and all exons and exon-intron boundaries of the ENAM, AMBN, AMELX, MMP20, KLK4 and Amelotin gene were amplified and sequenced. Each family was also evaluated for linkage to chromosome regions known to contain genes important in enamel development. The present study indicates that the AI in these two families is not caused by any of the known loci for AI or any of the major candidate genes proposed in the literature. These findings indicate extensive genetic heterogeneity for non-syndromic AI.

  6. A family with X-linked anophthalmia: exclusion of SOX3 as a candidate gene.

    Science.gov (United States)

    Slavotinek, Anne; Lee, Stephen S; Hamilton, Steven P

    2005-10-01

    We report on a four-generation family with X-linked anophthalmia in four affected males and show that this family has LOD scores consistent with linkage to Xq27, the third family reported to be linked to the ANOP1 locus. We sequenced the SOX3 gene at Xq27 as a candidate gene for the X-linked anophthalmia based on the high homology of this gene to SOX2, a gene previously mutated in bilateral anophthlamia. However, no amino acid sequence alterations were identified in SOX3. We have improved the definition of the phenotype in males with anophthalmia linked to the ANOP1 locus, as microcephaly, ocular colobomas, and severe renal malformations have not been described in families linked to ANOP1. (c) 2005 Wiley-Liss, Inc.

  7. "It's good to know": experiences of gene identification and result disclosure in familial epilepsies.

    Science.gov (United States)

    Vears, Danya F; Dunn, Karen L; Wake, Samantha A; Scheffer, Ingrid E

    2015-05-01

    Recognition of the role of genetics in the epilepsies has increased dramatically, impacting on clinical practice across many epilepsy syndromes. There is limited research investigating the impact of gene identification on individuals and families with epilepsy. While research has focused on the impact of delivering genetic information to families at the time of diagnosis in genetic diseases more broadly, little is known about how genetic results in epileptic diseases influences people's lives many years after it has been conveyed. This study used qualitative methods to explore the experience of receiving a genetic result in people with familial epilepsy. Interviews were conducted with individuals with familial epilepsies in whom the underlying genetic mutation had been identified. Recorded interviews underwent thematic analysis. 20 individuals from three families with different epilepsy syndromes and causative genes were interviewed. Multiple generations within families were studied. The mean time from receiving the genetic result prior to interview was 10.9 years (range 5-14 years). Three major themes were identified: 1) living with epilepsy: an individual's experience of the severity of epilepsy in their family influenced their view. 2) Clinical utility of the test: participants expressed varying reactions to receiving a genetic result. While for some it provided helpful information and relief, others were not surprised by the finding given the familial context. Some valued the use of genetic information for reproductive decision-making, particularly in the setting of severely affected family members. While altruistic reasons for participating in genetic research were discussed, participants emphasised the benefit of participation to them and their families. 3) 'Talking about the family genes': individuals reported poor communication between family members about their epilepsy and its genetic implications. The results provide important insights into the family

  8. Gene structure, phylogeny and expression profile of the sucrose synthase gene family in cacao (Theobroma cacao L.).

    Science.gov (United States)

    Li, Fupeng; Hao, Chaoyun; Yan, Lin; Wu, Baoduo; Qin, Xiaowei; Lai, Jianxiong; Song, Yinghui

    2015-09-01

    In higher plants, sucrose synthase (Sus, EC 2.4.1.13) is widely considered as a key enzyme involved in sucrose metabolism. Although, several paralogous genes encoding different isozymes of Sus have been identified and characterized in multiple plant genomes, to date detailed information about the Sus genes is lacking for cacao. This study reports the identification of six novel Sus genes from economically important cacao tree. Analyses of the gene structure and phylogeny of the Sus genes demonstrated evolutionary conservation in the Sus family across cacao and other plant species. The expression of cacao Sus genes was investigated via real-time PCR in various tissues, different developmental phases of leaf, flower bud and pod. The Sus genes exhibited distinct but partially redundant expression profiles in cacao, with TcSus1, TcSus5 and TcSus6, being the predominant genes in the bark with phloem, TcSus2 predominantly expressing in the seed during the stereotype stage. TcSus3 and TcSus4 were significantly detected more in the pod husk and seed coat along the pod development, and showed development dependent expression profiles in the cacao pod. These results provide new insights into the evolution, and basic information that will assist in elucidating the functions of cacao Sus gene family.

  9. Gene-Environment Interplay, Family Relationships, and Child Adjustment

    Science.gov (United States)

    Horwitz, Briana N.; Neiderhiser, Jenae M.

    2011-01-01

    This paper reviews behavioral genetic research from the past decade that has moved beyond simply studying the independent influences of genes and environments. The studies considered in this review have instead focused on understanding gene-environment interplay, including genotype-environment correlation (rGE) and genotype x environment…

  10. Identification and analysis of YELLOW protein family genes in the silkworm, Bombyx mori

    Directory of Open Access Journals (Sweden)

    Yi Yong-Zhu

    2006-08-01

    Full Text Available Abstract Background The major royal jelly proteins/yellow (MRJP/YELLOW family possesses several physiological and chemical functions in the development of Apis mellifera and Drosophila melanogaster. Each protein of the family has a conserved domain named MRJP. However, there is no report of MRJP/YELLOW family proteins in the Lepidoptera. Results Using the YELLOW protein sequence in Drosophila melanogaster to BLAST silkworm EST database, we found a gene family composed of seven members with a conserved MRJP domain each and named it YELLOW protein family of Bombyx mori. We completed the cDNA sequences with RACE method. The protein of each member possesses a MRJP domain and a putative cleavable signal peptide consisting of a hydrophobic sequence. In view of genetic evolution, the whole Bm YELLOW protein family composes a monophyletic group, which is distinctly separate from Drosophila melanogaster and Apis mellifera. We then showed the tissue expression profiles of Bm YELLOW protein family genes by RT-PCR. Conclusion A Bombyx mori YELLOW protein family is found to be composed of at least seven members. The low homogeneity and unique pattern of gene expression by each member among the family ensure us to prophesy that the members of Bm YELLOW protein family would play some important physiological functions in silkworm development.

  11. Chromosomal localization of the human diazepam binding inhibitor gene

    International Nuclear Information System (INIS)

    DeBernardi, M.A.; Crowe, R.R.; Mocchetti, I.; Shows, T.B.; Eddy, R.L.; Costa, E.

    1988-01-01

    The authors have used in situ chromosome hybridization and human-mouse somatic cell hybrids to map the gene(s) for human diazepam binding inhibitor (DBI), an endogenous putative modulator of the γ-aminobutyric acid receptor acting at the allosteric regulatory center of this receptor that includes the benzodiazepine recognition site. In 784 chromosome spreads hybridized with human DBI cDNA, the distribution of 1,476 labeled sites revealed a significant clustering of autoradiographic grains (11.3% of total label) on the long arm of chromosome 2 (2q). Furthermore, 63.5% of the grains found on 2q were located on 2q12-21, suggesting regional mapping of DBI gene(s) to this segment. Secondary hybridization signals were frequently observed on other chromosomes and they were statistically significant mainly for chromosomes 5, 6, 11, and 14. In addition, DNA from 32 human-mouse cell hybrids was digested with BamHI and probed with human DBI cDNA. A 3.5-kilobase band, which probably represents the human DBI gene, was assigned to chromosome 2. Four higher molecular weight bands, also detected in BamHI digests, could not be unequivocally assigned. A chromosome 2 location was excluded for the 27-, 13-, and 10-kilobase bands. These results assign a human DBI gene to chromosome 2 (2q12-21) and indicate that three of the four homologous sequences detected by the human DBI probe are located on three other chromosomes

  12. X-exome sequencing of 405 unresolved families identifies seven novel intellectual disability genes

    OpenAIRE

    Hu, H.; Haas, S.A.; Chelly, J.; Van Esch, H.; Raynaud, M.; de Brouwer, A.P.M.; Weinert, S.; Froyen, G.; Frints, S.G.M.; Laumonnier, F.; Zemojtel, T.; Love, M.I.; Richard, H.; Emde, A.K.; Bienek, M.

    2016-01-01

    X-linked intellectual disability (XLID) is a clinically and genetically heterogeneous disorder. During the past two decades in excess of 100 X-chromosome ID genes have been identified. Yet, a large number of families mapping to the X-chromosome remained unresolved suggesting that more XLID genes or loci are yet to be identified. Here, we have investigated 405 unresolved families with XLID. We employed massively parallel sequencing of all X-chromosome exons in the index males. The majority of ...

  13. Distinct Gene Expression Signatures in Lynch Syndrome and Familial Colorectal Cancer Type X

    DEFF Research Database (Denmark)

    Valentin, Mev; Therkildsen, Christina; Veerla, Srinivas

    2013-01-01

    Heredity is estimated to cause at least 20% of colorectal cancer. The hereditary nonpolyposis colorectal cancer subset is divided into Lynch syndrome and familial colorectal cancer type X (FCCTX) based on presence of mismatch repair (MMR) gene defects.......Heredity is estimated to cause at least 20% of colorectal cancer. The hereditary nonpolyposis colorectal cancer subset is divided into Lynch syndrome and familial colorectal cancer type X (FCCTX) based on presence of mismatch repair (MMR) gene defects....

  14. Novel genetic variants in miR-191 gene and familial ovarian cancer

    International Nuclear Information System (INIS)

    Shen, Jie; DiCioccio, Richard; Odunsi, Kunle; Lele, Shashikant B; Zhao, Hua

    2010-01-01

    Half of the familial aggregation of ovarian cancer can't be explained by any known risk genes, suggesting the existence of other genetic risk factors. Some of these unknown factors may not be traditional protein encoding genes. MicroRNA (miRNA) plays a critical role in tumorigenesis, but it is still unknown if variants in miRNA genes lead to predisposition to cancer. Considering the fact that miRNA regulates a number of tumor suppressor genes (TSGs) and oncogenes, genetic variations in miRNA genes could affect the levels of expression of TSGs or oncogenes and, thereby, cancer risk. To test this hypothesis in familial ovarian cancer, we screened for genetic variants in thirty selected miRNA genes, which are predicted to regulate key ovarian cancer genes and are reported to be misexpressed in ovarian tumor tissues, in eighty-three patients with familial ovarian cancer. All of the patients are non-carriers of any known BRCA1/2 or mismatch repair (MMR) gene mutations. Seven novel genetic variants were observed in four primary or precursor miRNA genes. Among them, three rare variants were found in the precursor or primary precursor of the miR-191 gene. In functional assays, the one variant located in the precursor of miR-191 resulted in conformational changes in the predicted secondary structures, and consequently altered the expression of mature miR-191. In further analysis, we found that this particular variant exists in five family members who had ovarian cancer. Our findings suggest that there are novel genetic variants in miRNA genes, and those certain genetic variants in miRNA genes can affect the expression of mature miRNAs and, consequently, might alter the regulation of TSGs or oncogenes. Additionally, the variant might be potentially associated with the development of familial ovarian cancer

  15. Truncating mutation in the NHS gene: phenotypic heterogeneity of Nance-Horan syndrome in an asian Indian family.

    Science.gov (United States)

    Ramprasad, Vedam Lakshmi; Thool, Alka; Murugan, Sakthivel; Nancarrow, Derek; Vyas, Prateep; Rao, Srinivas Kamalakar; Vidhya, Authiappan; Ravishankar, Krishnamoorthy; Kumaramanickavel, Govindasamy

    2005-01-01

    A four-generation family containing eight affected males who inherited X-linked developmental lens opacity and microcornea was studied. Some members in the family had mild to moderate nonocular clinical features suggestive of Nance-Horan syndrome. The purpose of the study was to map genetically the gene in the large 57-live-member Asian-Indian pedigree. PCR-based genotyping was performed on the X-chromosome, by using fluorescent microsatellite markers (10-cM intervals). Parametric linkage analysis was performed by using two disease models, assuming either recessive or dominant X-linked transmission by the MLINK/ILINK and FASTLINK (version 4.1P) programs (http:www.hgmp.mrc.ac.uk/; provided in the public domain by the Human Genome Mapping Project Resources Centre, Cambridge, UK). The NHS gene at the linked region was screened for mutation. By fine mapping, the disease gene was localized to Xp22.13. Multipoint analysis placed the peak LOD of 4.46 at DSX987. The NHS gene mapped to this region. Mutational screening in all the affected males and carrier females (heterozygous form) revealed a truncating mutation 115C-->T in exon 1, resulting in conversion of glutamine to stop codon (Q39X), but was not observed in unaffected individuals and control subjects. conclusions. A family with X-linked Nance-Horan syndrome had severe ocular, but mild to moderate nonocular, features. The clinical phenotype of the truncating mutation (Q39X) in the NHS gene suggests allelic heterogeneity at the NHS locus or the presence of modifier genes. X-linked families with cataract should be carefully examined for both ocular and nonocular features, to exclude Nance-Horan syndrome. RT-PCR analysis did not suggest nonsense-mediated mRNA decay as the possible mechanism for clinical heterogeneity.

  16. Identification of Human HK Genes and Gene Expression Regulation Study in Cancer from Transcriptomics Data Analysis

    Science.gov (United States)

    Zhang, Zhang; Liu, Jingxing; Wu, Jiayan; Yu, Jun

    2013-01-01

    The regulation of gene expression is essential for eukaryotes, as it drives the processes of cellular differentiation and morphogenesis, leading to the creation of different cell types in multicellular organisms. RNA-Sequencing (RNA-Seq) provides researchers with a powerful toolbox for characterization and quantification of transcriptome. Many different human tissue/cell transcriptome datasets coming from RNA-Seq technology are available on public data resource. The fundamental issue here is how to develop an effective analysis method to estimate expression pattern similarities between different tumor tissues and their corresponding normal tissues. We define the gene expression pattern from three directions: 1) expression breadth, which reflects gene expression on/off status, and mainly concerns ubiquitously expressed genes; 2) low/high or constant/variable expression genes, based on gene expression level and variation; and 3) the regulation of gene expression at the gene structure level. The cluster analysis indicates that gene expression pattern is higher related to physiological condition rather than tissue spatial distance. Two sets of human housekeeping (HK) genes are defined according to cell/tissue types, respectively. To characterize the gene expression pattern in gene expression level and variation, we firstly apply improved K-means algorithm and a gene expression variance model. We find that cancer-associated HK genes (a HK gene is specific in cancer group, while not in normal group) are expressed higher and more variable in cancer condition than in normal condition. Cancer-associated HK genes prefer to AT-rich genes, and they are enriched in cell cycle regulation related functions and constitute some cancer signatures. The expression of large genes is also avoided in cancer group. These studies will help us understand which cell type-specific patterns of gene expression differ among different cell types, and particularly for cancer. PMID:23382867

  17. a photoreceptor gene mutation in an indigenous black african family

    African Journals Online (AJOL)

    MUTATION IN AN INDIGENOUS. BLACK AFRICAN FAMILY WITH. RETINITIS PIGMENTOSA. IDENTIFIED USING A RAPID. SCREENING APPROACH FOR. COMMON RHODOPSIN. MUTATIONS. JGreenberg, T Franz, R Goliath, R Ramesar. Hereditary retinal degenerations may be subdivided into those affecting ...

  18. The mechanism of gene targeting in human somatic cells.

    Directory of Open Access Journals (Sweden)

    Yinan Kan

    2014-04-01

    Full Text Available Gene targeting in human somatic cells is of importance because it can be used to either delineate the loss-of-function phenotype of a gene or correct a mutated gene back to wild-type. Both of these outcomes require a form of DNA double-strand break (DSB repair known as homologous recombination (HR. The mechanism of HR leading to gene targeting, however, is not well understood in human cells. Here, we demonstrate that a two-end, ends-out HR intermediate is valid for human gene targeting. Furthermore, the resolution step of this intermediate occurs via the classic DSB repair model of HR while synthesis-dependent strand annealing and Holliday Junction dissolution are, at best, minor pathways. Moreover, and in contrast to other systems, the positions of Holliday Junction resolution are evenly distributed along the homology arms of the targeting vector. Most unexpectedly, we demonstrate that when a meganuclease is used to introduce a chromosomal DSB to augment gene targeting, the mechanism of gene targeting is inverted to an ends-in process. Finally, we demonstrate that the anti-recombination activity of mismatch repair is a significant impediment to gene targeting. These observations significantly advance our understanding of HR and gene targeting in human cells.

  19. [Analysis of the NDP gene in a Chinese family with X-linked recessive Norrie disease].

    Science.gov (United States)

    Mei, Libin; Huang, Yanru; Pan, Qian; Liang, Desheng; Wu, Lingqian

    2015-05-01

    The purpose of the current research was to investigate the NDP (Norrie disease protein) gene in one Chinese family with Norrie disease (ND) and to characterize the related clinical features. Clinical data of the proband and his family members were collected. Complete ophthalmic examinations were carried out on the proband. Genomic DNA was extracted from peripheral blood leukocytes of 35 family members. Molecular analysis of the NDP gene was performed by polymerase chain reaction and direct sequencing of all exons and flanking regions. A hemizygous NDP missense mutation c.362G > A (p.Arg121Gln) in exon 3 was identified in the affected members, but not in any of the unaffected family individuals. The missense mutation c.362G > A in NDP is responsible for the Norrie disease in this family. This discovery will help provide the family members with accurate and reliable genetic counseling and prenatal diagnosis.

  20. Clinically relevant known and candidate genes for obesity and their overlap with human infertility and reproduction.

    Science.gov (United States)

    Butler, Merlin G; McGuire, Austen; Manzardo, Ann M

    2015-04-01

    Obesity is a growing public health concern now reaching epidemic status worldwide for children and adults due to multiple problems impacting on energy intake and expenditure with influences on human reproduction and infertility. A positive family history and genetic factors are known to play a role in obesity by influencing eating behavior, weight and level of physical activity and also contributing to human reproduction and infertility. Recent advances in genetic technology have led to discoveries of new susceptibility genes for obesity and causation of infertility. The goal of our study was to provide an update of clinically relevant candidate and known genes for obesity and infertility using high resolution chromosome ideograms with gene symbols and tabular form. We used computer-based internet websites including PubMed to search for combinations of key words such as obesity, body mass index, infertility, reproduction, azoospermia, endometriosis, diminished ovarian reserve, estrogen along with genetics, gene mutations or variants to identify evidence for development of a master list of recognized obesity genes in humans and those involved with infertility and reproduction. Gene symbols for known and candidate genes for obesity were plotted on high resolution chromosome ideograms at the 850 band level. Both infertility and obesity genes were listed separately in alphabetical order in tabular form and those highlighted when involved with both conditions. By searching the medical literature and computer generated websites for key words, we found documented evidence for 370 genes playing a role in obesity and 153 genes for human reproduction or infertility. The obesity genes primarily affected common pathways in lipid metabolism, deposition or transport, eating behavior and food selection, physical activity or energy expenditure. Twenty-one of the obesity genes were also associated with human infertility and reproduction. Gene symbols were plotted on high resolution

  1. Identification of the WRKY gene family and functional analysis of two genes in Caragana intermedia.

    Science.gov (United States)

    Wan, Yongqing; Mao, Mingzhu; Wan, Dongli; Yang, Qi; Yang, Feiyun; Mandlaa; Li, Guojing; Wang, Ruigang

    2018-02-09

    WRKY transcription factors, one of the largest families of transcriptional regulators in plants, play important roles in plant development and various stress responses. The WRKYs of Caragana intermedia are still not well characterized, although many WRKYs have been identified in various plant species. We identified 53 CiWRKY genes from C. intermedia transcriptome data, 28 of which exhibited complete open reading frames (ORFs). These CiWRKYs were divided into three groups via phylogenetic analysis according to their WRKY domains and zinc finger motifs. Conserved domain analysis showed that the CiWRKY proteins contain a highly conserved WRKYGQK motif and two variant motifs (WRKYGKK and WKKYEEK). The subcellular localization of CiWRKY26 and CiWRKY28-1 indicated that these two proteins localized exclusively to nuclei, supporting their role as transcription factors. The expression patterns of the 28 CiWRKYs with complete ORFs were examined through quantitative real-time PCR (qRT-PCR) in various tissues and under different abiotic stresses (drought, cold, salt, high-pH and abscisic acid (ABA)). The results showed that each CiWRKY responded to at least one stress treatment. Furthermore, overexpression of CiWRKY75-1 and CiWRKY40-4 in Arabidopsis thaliana suppressed the drought stress tolerance of the plants and delayed leaf senescence, respectively. Fifty-three CiWRKY genes from the C. intermedia transcriptome were identified and divided into three groups via phylogenetic analysis. The expression patterns of the 28 CiWRKYs under different abiotic stresses suggested that each CiWRKY responded to at least one stress treatment. Overexpression of CiWRKY75-1 and CiWRKY40-4 suppressed the drought stress tolerance of Arabidopsis and delayed leaf senescence, respectively. These results provide a basis for the molecular mechanism through which CiWRKYs mediate stress tolerance.

  2. Exertional Heat Illness and Human Gene Expression

    National Research Council Canada - National Science Library

    Sonna, L.A; Sawka, M. N; Lilly, C. M

    2007-01-01

    Microarray analysis of gene expression at the level of RNA has generated new insights into the relationship between cellular responses to acute heat shock in vitro, exercise, and exertional heat illness...

  3. Identification of a novel FBN1 gene mutation in a large Pakistani family with Marfan syndrome

    NARCIS (Netherlands)

    Micheal, S.; Khan, M.I.; Akhtar, F.; Weiss, M.M.; Islam, F.; Ali, M.; Qamar, R.; Maugeri, A.; Hollander, A.I. den

    2012-01-01

    PURPOSE: To describe a novel mutation in the fibrillin-1 (FBN1) gene in a large Pakistani family with autosomal dominant Marfan syndrome (MFS). METHODS: Blood samples were collected of 11 family members affected with Marfan syndrome, and DNA was isolated by phenol-extraction. The coding exons of

  4. More than 9,000,000 unique genes in human gut bacterial community: estimating gene numbers inside a human body.

    Science.gov (United States)

    Yang, Xing; Xie, Lu; Li, Yixue; Wei, Chaochun

    2009-06-29

    Estimating the number of genes in human genome has been long an important problem in computational biology. With the new conception of considering human as a super-organism, it is also interesting to estimate the number of genes in this human super-organism. We presented our estimation of gene numbers in the human gut bacterial community, the largest microbial community inside the human super-organism. We got 552,700 unique genes from 202 complete human gut bacteria genomes. Then, a novel gene counting model was built to check the total number of genes by combining culture-independent sequence data and those complete genomes. 16S rRNAs were used to construct a three-level tree and different counting methods were introduced for the three levels: strain-to-species, species-to-genus, and genus-and-up. The model estimates that the total number of genes is about 9,000,000 after those with identity percentage of 97% or up were merged. By combining completed genomes currently available and culture-independent sequencing data, we built a model to estimate the number of genes in human gut bacterial community. The total number of genes is estimated to be about 9 million. Although this number is huge, we believe it is underestimated. This is an initial step to tackle this gene counting problem for the human super-organism. It will still be an open problem in the near future. The list of genomes used in this paper can be found in the supplementary table.

  5. Differential and correlation analyses of microarray gene expression data in the CEPH Utah families

    DEFF Research Database (Denmark)

    Tan, Qihua; Zhao, Jinghua; Li, Shuxia

    2008-01-01

    -regulated genes identifies cell-cell signaling as an important functional category implicated in human aging. Sex-dependent gene expression is characterized by genes that may escape X-inactivation and, most interestingly, such a pattern is not affected by the aging process. Analysis on sibship correlation on gene...... expression revealed a large number of significant genes suggesting the importance of a genetic mechanism in regulating transcriptional activities. In addition, we observe an interesting pattern of sibship correlation on gene expression that increases exponentially with the mean of gene expression reflecting...

  6. A new polymorphic and multicopy MHC gene family related to nonmammalian class I

    Energy Technology Data Exchange (ETDEWEB)

    Leelayuwat, C.; Degli-Esposti, M.A.; Abraham, L.J. [Univ. of Western Australia, Perth (Australia); Townend, D.C. [Sir Charles Gairdner Hospital, Perth (Australia); Dawkins, R.L. [Royal Perth Hospital, Perth (Australia)]|[Univ. of Western Australia, Perth (Australia)]|[Sir Charles Gairdner Hospital, Perth (Australia)

    1994-12-31

    The authors have used genomic analysis to characterize a region of the central major histocompatibility complex (MHC) spanning {approximately} 300 kilobases (kb) between TNF and HLA-B. This region has been suggested to carry genetic factors relevant to the development of autoimmune diseases such as myasthenia gravis (MG) and insulin dependent diabetes mellitus (IDDM). Genomic sequence was analyzed for coding potential, using two neural network programs, GRAIL and GeneParser. A genomic probe, JAB, containing putative coding sequences (PERB11) located 60 kb centromeric of HLA-B, was used for northern analysis of human tissues. Multiple transcripts were detected. Southern analysis of genomic DNA and overlapping YAC clones, covering the region from BAT1 to HLA-F, indicated that there are at least five copies of PERB11, four of which are located within this region of the MHC. The partial cDNA sequence of PERB11 was obtained from poly-A RNA derived from skeletal muscle. The putative amino acid sequence of PERB11 shares {approximately} 30% identity to MHC class I molecules from various species, including reptiles, chickens, and frogs, as well as to other MHC class I-like molecules, such as the IgG FcR of the mouse and rat and the human Zn-{alpha}2-glycoprotein. From direct comparison of amino acid sequences, it is concluded that PERB11 is a distinct molecule more closely related to nonmammalian than known mammalian MHC class I molecules. Genomic sequence analysis of PERB11 from five MHC ancestral haplotypes (AH) indicated that the gene is polymorphic at both DNA and protein level. The results suggest that the authors have identified a novel polymorphic gene family with multiple copies within the MHC. 48 refs., 10 figs., 2 tabs.

  7. The SOD gene family in tomato: identification, phylogenetic relationships and expression patterns

    Directory of Open Access Journals (Sweden)

    kun feng

    2016-08-01

    Full Text Available Superoxide dismutases (SODs are critical antioxidant enzymes that protect organisms from reactive oxygen species (ROS caused by adverse conditions, and have been widely found in the cytoplasm, chloroplasts, and mitochondria of eukaryotic and prokaryotic cells. Tomato (Solanum lycopersicum L. is an important economic crop and is cultivated worldwide. However, abiotic and biotic stresses severely hinder growth and development of the plant, which affects the production and quality of the crop. To reveal the potential roles of SOD genes under various stresses, we performed a systematic analysis of the tomato SOD gene family and analyzed the expression patterns of SlSOD genes in response to abiotic stresses at the whole-genome level. The characteristics of the SlSOD gene family were determined by analyzing gene structure, conserved motifs, chromosomal distribution, phylogenetic relationships, and expression patterns. We determined that there are at least nine SOD genes in tomato, including four Cu/ZnSODs, three FeSODs, and one MnSOD, and they are unevenly distributed on 12 chromosomes. Phylogenetic analyses of SOD genes from tomato and other plant species were separated into two groups with a high bootstrap value, indicating that these SOD genes were present before the monocot-dicot split. Additionally, many cis-elements that respond to different stresses were found in the promoters of nine SlSOD genes. Gene expression analysis based on RNA-seq data showed that most genes were expressed in all tested tissues, with the exception of SlSOD6 and SlSOD8, which were only expressed in young fruits. Microarray data analysis showed that most members of the SlSOD gene family were altered under salt- and drought-stress conditions. This genome-wide analysis of SlSOD genes helps to clarify the function of SlSOD genes under different stress conditions and provides information to aid in further understanding the evolutionary relationships of SOD genes in plants.

  8. Genome-Wide Identification and Analysis of the TIFY Gene Family in Grape

    Science.gov (United States)

    Zhang, Yucheng; Gao, Min; Singer, Stacy D.; Fei, Zhangjun; Wang, Hua; Wang, Xiping

    2012-01-01

    Background The TIFY gene family constitutes a plant-specific group of genes with a broad range of functions. This family encodes four subfamilies of proteins, including ZML, TIFY, PPD and JASMONATE ZIM-Domain (JAZ) proteins. JAZ proteins are targets of the SCFCOI1 complex, and function as negative regulators in the JA signaling pathway. Recently, it has been reported in both Arabidopsis and rice that TIFY genes, and especially JAZ genes, may be involved in plant defense against insect feeding, wounding, pathogens and abiotic stresses. Nonetheless, knowledge concerning the specific expression patterns and evolutionary history of plant TIFY family members is limited, especially in a woody species such as grape. Methodology/Principal Findings A total of two TIFY, four ZML, two PPD and 11 JAZ genes were identified in the Vitis vinifera genome. Phylogenetic analysis of TIFY protein sequences from grape, Arabidopsis and rice indicated that the grape TIFY proteins are more closely related to those of Arabidopsis than those of rice. Both segmental and tandem duplication events have been major contributors to the expansion of the grape TIFY family. In addition, synteny analysis between grape and Arabidopsis demonstrated that homologues of several grape TIFY genes were found in the corresponding syntenic blocks of Arabidopsis, suggesting that these genes arose before the divergence of lineages that led to grape and Arabidopsis. Analyses of microarray and quantitative real-time RT-PCR expression data revealed that grape TIFY genes are not a major player in the defense against biotrophic pathogens or viruses. However, many of these genes were responsive to JA and ABA, but not SA or ET. Conclusion The genome-wide identification, evolutionary and expression analyses of grape TIFY genes should facilitate further research of this gene family and provide new insights regarding their evolutionary history and regulatory control. PMID:22984514

  9. Natural killer cell receptor genes in the family Equidae: not only Ly49.

    Directory of Open Access Journals (Sweden)

    Jan Futas

    Full Text Available Natural killer (NK cells have important functions in immunity. NK recognition in mammals can be mediated through killer cell immunoglobulin-like receptors (KIR and/or killer cell lectin-like Ly49 receptors. Genes encoding highly variable NK cell receptors (NKR represent rapidly evolving genomic regions. No single conservative model of NKR genes was observed in mammals. Single-copy low polymorphic NKR genes present in one mammalian species may expand into highly polymorphic multigene families in other species. In contrast to other non-rodent mammals, multiple Ly49-like genes appear to exist in the horse, while no functional KIR genes were observed in this species. In this study, Ly49 and KIR were sought and their evolution was characterized in the entire family Equidae. Genomic sequences retrieved showed the presence of at least five highly conserved polymorphic Ly49 genes in horses, asses and zebras. These findings confirmed that the expansion of Ly49 occurred in the entire family. Several KIR-like sequences were also identified in the genome of Equids. Besides a previously identified non-functional KIR-Immunoglobulin-like transcript fusion gene (KIR-ILTA and two putative pseudogenes, a KIR3DL-like sequence was analyzed. In contrast to previous observations made in the horse, the KIR3DL sequence, genomic organization and mRNA expression suggest that all Equids might produce a functional KIR receptor protein molecule with a single non-mutated immune tyrosine-based inhibition motif (ITIM domain. No evidence for positive selection in the KIR3DL gene was found. Phylogenetic analysis including rhinoceros and tapir genomic DNA and deduced amino acid KIR-related sequences showed differences between families and even between species within the order Perissodactyla. The results suggest that the order Perissodactyla and its family Equidae with expanded Ly49 genes and with a potentially functional KIR gene may represent an interesting model for

  10. Natural Killer Cell Receptor Genes in the Family Equidae: Not only Ly49

    Science.gov (United States)

    Futas, Jan; Horin, Petr

    2013-01-01

    Natural killer (NK) cells have important functions in immunity. NK recognition in mammals can be mediated through killer cell immunoglobulin-like receptors (KIR) and/or killer cell lectin-like Ly49 receptors. Genes encoding highly variable NK cell receptors (NKR) represent rapidly evolving genomic regions. No single conservative model of NKR genes was observed in mammals. Single-copy low polymorphic NKR genes present in one mammalian species may expand into highly polymorphic multigene families in other species. In contrast to other non-rodent mammals, multiple Ly49-like genes appear to exist in the horse, while no functional KIR genes were observed in this species. In this study, Ly49 and KIR were sought and their evolution was characterized in the entire family Equidae. Genomic sequences retrieved showed the presence of at least five highly conserved polymorphic Ly49 genes in horses, asses and zebras. These findings confirmed that the expansion of Ly49 occurred in the entire family. Several KIR-like sequences were also identified in the genome of Equids. Besides a previously identified non-functional KIR-Immunoglobulin-like transcript fusion gene (KIR-ILTA) and two putative pseudogenes, a KIR3DL-like sequence was analyzed. In contrast to previous observations made in the horse, the KIR3DL sequence, genomic organization and mRNA expression suggest that all Equids might produce a functional KIR receptor protein molecule with a single non-mutated immune tyrosine-based inhibition motif (ITIM) domain. No evidence for positive selection in the KIR3DL gene was found. Phylogenetic analysis including rhinoceros and tapir genomic DNA and deduced amino acid KIR-related sequences showed differences between families and even between species within the order Perissodactyla. The results suggest that the order Perissodactyla and its family Equidae with expanded Ly49 genes and with a potentially functional KIR gene may represent an interesting model for evolutionary biology of

  11. carboxylate synthase gene family in Arabidopsis, rice, grapevine

    African Journals Online (AJOL)

    Yomi

    2012-01-16

    Jan 16, 2012 ... evolutionary relationships of ACS genes in the four plant species. Chromosomal .... classification was consistent with the report from. Jakubowicz et al. ..... Analysis of the genome sequence of the flowering plant Arabidopsis ...

  12. New mutations in the NHS gene in Nance-Horan Syndrome families from the Netherlands

    NARCIS (Netherlands)

    Florijn, Ralph J.; Loves, Willem; Maillette de Buy Wenniger-Prick, Liesbeth J. J. M.; Mannens, Marcel M. A. M.; Tijmes, Nel; Brooks, Simon P.; Hardcastle, Alison J.; Bergen, Arthur A. B.

    2006-01-01

    Mutations in the NHS gene cause Nance-Horan Syndrome (NHS), a rare X-chromosomal recessive disorder with variable features, including congenital cataract, microphthalmia, a peculiar form of the ear and dental anomalies. We investigated the NHS gene in four additional families with NHS from the

  13. Germline heterozygous variants in genes associated with familial hemophagocytic lymphohistiocytosis as a cause of increased bleeding

    DEFF Research Database (Denmark)

    Fager Ferrari, Marcus; Leinoe, Eva; Rossing, Maria

    2018-01-01

    Familial hemophagocytic lymphohistiocytosis (FHL) is caused by biallelic variants in genes regulating granule secretion in cytotoxic lymphocytes. In FHL3-5, the affected genes UNC13D, STX11 and STXBP2 have further been shown to regulate the secretion of platelet granules, giving rise to compromised...

  14. X-exome sequencing of 405 unresolved families identifies seven novel intellectual disability genes

    NARCIS (Netherlands)

    Hu, H; Haas, S.A.; Chelly, J.; Esch, H. Van; Raynaud, M.; Brouwer, A.P. de; Weinert, S.; Froyen, G.; Frints, S.G.; Laumonnier, F.; Zemojtel, T.; Love, M.I.; Richard, H.; Emde, A.K.; Bienek, M.; Jensen, C.; Hambrock, M.; Fischer, U.; Langnick, C.; Feldkamp, M.; Wissink-Lindhout, W.; Lebrun, N.; Castelnau, L.; Rucci, J.; Montjean, R.; Dorseuil, O.; Billuart, P.; Stuhlmann, T.; Shaw, M.; Corbett, M.A.; Gardner, A.; Willis-Owen, S.; Tan, C.; Friend, K.L.; Belet, S.; Roozendaal, K.E. van; Jimenez-Pocquet, M.; Moizard, M.P.; Ronce, N.; Sun, R.; O'Keeffe, S.; Chenna, R.; Bommel, A. van; Goke, J.; Hackett, A.; Field, M.; Christie, L.; Boyle, J.; Haan, E.; Nelson, J.; Turner, G.; Baynam, G.; Gillessen-Kaesbach, G.; Muller, U.; Steinberger, D.; Budny, B.; Badura-Stronka, M.; Latos-Bielenska, A.; Ousager, L.B.; Wieacker, P.; Rodriguez Criado, G.; Bondeson, M.L.; Anneren, G.; Dufke, A.; Cohen, M.; Maldergem, L. Van; Vincent-Delorme, C.; Echenne, B.; Simon-Bouy, B.; Kleefstra, T.; Willemsen, M.H.; Fryns, J.P.; Devriendt, K.; Ullmann, R.; Vingron, M.; Wrogemann, K.; Wienker, T.F.; Tzschach, A.; Bokhoven, H. van; Gecz, J.; Jentsch, T.J.; Chen, W.; Ropers, H.H.; Kalscheuer, V.M.

    2016-01-01

    X-linked intellectual disability (XLID) is a clinically and genetically heterogeneous disorder. During the past two decades in excess of 100 X-chromosome ID genes have been identified. Yet, a large number of families mapping to the X-chromosome remained unresolved suggesting that more XLID genes or

  15. X-exome sequencing of 405 unresolved families identifies seven novel intellectual disability genes

    DEFF Research Database (Denmark)

    Hu, H; Haas, S A; Chelly, J

    2016-01-01

    X-linked intellectual disability (XLID) is a clinically and genetically heterogeneous disorder. During the past two decades in excess of 100 X-chromosome ID genes have been identified. Yet, a large number of families mapping to the X-chromosome remained unresolved suggesting that more XLID genes...

  16. Expressional and Biochemical Characterization of Rice Disease Resistance Gene Xa3/Xa26 Family

    Institute of Scientific and Technical Information of China (English)

    Songjie Xu; Yinglong Cao; Xianghua Li; Shiping Wang

    2007-01-01

    The rice (Oryza sativa L.) Xa3/Xa26 gene, conferring race-specific resistance to bacterial blight disease and encoding a leucine-rich repeat (LRR) receptor kinase-like protein, belongs to a multigene family consisting of tandem clustered homologous genes, colocalizing with several uncharacterized genes for resistance to bacterial blight or fungal blast. To provide more information on the expressional and biochemical characteristics of the Xa3/Xa26 family, we analyzed the family members. Four Xa3/Xa26 family members in the indica rice variety Teqing, which carries a bacterial blight resistance gene with a chromosomal location tightly linked to Xa3/Xa26, and five Xa3/Xa26 family members in the japonica rice variety Nipponbare, which carries at least one uncharacterized blast resistance gene, were constitutively expressed in leaf tissue. The result suggests that some of the family members may be candidates of these uncharacterized resistance genes. At least five putative N-glycosylation sites in the LRR domain of XA3/XA26 protein are not glycosylated. The XA3/XA26 and its family members MRKa and MRKc all possess the consensus sequences of paired cysteines, which putatively function in dimerization of the receptor proteins for signal transduction, immediately before the first LRR and immediately after the last LRR. However, no homo-dimer between the XA3/XA26 molecules or hetero-dimer between XA3/XA26 and MRKa or MRKc were formed, indicating that XA3/XA26 protein might function either as a monomer or a hetero-dimer formed with other protein outside of the XA3/XA26 family. These results provide valuable information for further extensive investigation into this multiple protein family.

  17. CD150 is a member of a family of genes that encode glycoproteins on the surface of hematopoietic cells.

    Science.gov (United States)

    Wang, N; Morra, M; Wu, C; Gullo, C; Howie, D; Coyle, T; Engel, P; Terhorst, C

    2001-07-01

    Human CD150 (SLAM) is a glycoprotein expressed on the surface of T, B, natural killer, and dendritic cells. The extracellular domain of CD150 is the receptor for measles virus and CD150 acts as a co-activator on T and B cells. We characterized the mouse and human CD150 genes, each of which comprises seven exons spanning approximately 32 kb. Mouse CD150 mRNA was detected in T cells and in most thymocyte subsets, except CD4-8- cells. Surprisingly, the CD4-8- thymocytes of CD3gammadeltanull mice, but not of Ragnull or severe combined immunodeficiency mice, expressed CD150. Whereas high levels of CD150 were found in Th1 cells, only small amounts were detectable in Th2 cells. CD150 expression was up-regulated upon in vitro activation of mouse T cells by anti-CD3. The complete mouse CD150 gene is highly homologous to its human orthologue in terms of nucleotide sequences and intron/exon organization. The human genomic sequences indicate that all isoforms detected so far have arisen from alternative splicing events. As judged by fluorescence in situ hybridization, mouse CD150 mapped to Chromosome (Chr) 1, band 1H2.2-2.3, and human CD150 was found on Chr 1q22. Human and mouse CD150 share sequence homologies with six other genes, five of which - CD84, CD229 (Ly-9), CD244 (2B4), CD48, and 19A - are localized in a 250-kb segment in close proximity to the human gene. Their location and their sequence similarities strongly suggest that the CD150 family of cell surface receptors arose via successive duplications of a common ancestral gene.

  18. Production of Recombinant Adenovirus Containing Human Interlukin-4 Gene

    OpenAIRE

    Mojarrad, Majid; Abdolazimi, Yassan; Hajati, Jamshid; Modarressi, Mohammad Hossein

    2011-01-01

    Objective(s) Recombinant adenoviruses are currently used for a variety of purposes, including in vitro gene transfer, in vivo vaccination, and gene therapy. Ability to infect many cell types, high efficiency in gene transfer, entering both dividing and non dividing cells, and growing to high titers make this virus a good choice for using in various experiments. In the present experiment, a recombinant adenovirus containing human IL-4 coding sequence was made. IL-4 has several characteristics ...

  19. Characteristics of functional enrichment and gene expression level of human putative transcriptional target genes.

    Science.gov (United States)

    Osato, Naoki

    2018-01-19

    Transcriptional target genes show functional enrichment of genes. However, how many and how significantly transcriptional target genes include functional enrichments are still unclear. To address these issues, I predicted human transcriptional target genes using open chromatin regions, ChIP-seq data and DNA binding sequences of transcription factors in databases, and examined functional enrichment and gene expression level of putative transcriptional target genes. Gene Ontology annotations showed four times larger numbers of functional enrichments in putative transcriptional target genes than gene expression information alone, independent of transcriptional target genes. To compare the number of functional enrichments of putative transcriptional target genes between cells or search conditions, I normalized the number of functional enrichment by calculating its ratios in the total number of transcriptional target genes. With this analysis, native putative transcriptional target genes showed the largest normalized number of functional enrichments, compared with target genes including 5-60% of randomly selected genes. The normalized number of functional enrichments was changed according to the criteria of enhancer-promoter interactions such as distance from transcriptional start sites and orientation of CTCF-binding sites. Forward-reverse orientation of CTCF-binding sites showed significantly higher normalized number of functional enrichments than the other orientations. Journal papers showed that the top five frequent functional enrichments were related to the cellular functions in the three cell types. The median expression level of transcriptional target genes changed according to the criteria of enhancer-promoter assignments (i.e. interactions) and was correlated with the changes of the normalized number of functional enrichments of transcriptional target genes. Human putative transcriptional target genes showed significant functional enrichments. Functional

  20. The importance of melanoma inhibitory activity gene family in the tumor progression of oral cancer.

    Science.gov (United States)

    Sasahira, Tomonori; Bosserhoff, Anja Katrin; Kirita, Tadaaki

    2018-05-01

    Oral squamous cell carcinoma has a high potential for locoregional invasion and nodal metastasis. Consequently, early detection of such malignancies is of immense importance. The melanoma inhibitory activity (MIA) gene family comprises MIA, MIA2, transport and Golgi organization protein 1 (TANGO), and otoraplin (OTOR). These members of the MIA gene family have a highly conserved Src homology 3 (SH3)-like structure. Although the molecules of this family share 34-45% amino acid homology and 47-59% cDNA sequence homology, those members, excluding OTOR, play different tumor-associated functions. MIA has a pivotal role in the progression and metastasis of melanoma; MIA2 and TANGO have been suggested to possess tumor-suppressive functions; and OTOR is uniquely expressed in cochlea of the inner ear. Therefore, the definite functions of the MIA gene family in cancer cells remain unclear. Since the members of the MIA gene family are secreted proteins, these molecules might be useful tumor markers that can be detected in the body fluids, including serum and saliva. In this review, we described the molecular biological functions of the MIA gene family in oral cancer. © 2018 Japanese Society of Pathology and John Wiley & Sons Australia, Ltd.

  1. Members of a large retroposon family are determinants of post-transcriptional gene expression in Leishmania.

    Directory of Open Access Journals (Sweden)

    Frédéric Bringaud

    2007-09-01

    Full Text Available Trypanosomatids are unicellular protists that include the human pathogens Leishmania spp. (leishmaniasis, Trypanosoma brucei (sleeping sickness, and Trypanosoma cruzi (Chagas disease. Analysis of their recently completed genomes confirmed the presence of non-long-terminal repeat retrotransposons, also called retroposons. Using the 79-bp signature sequence common to all trypanosomatid retroposons as bait, we identified in the Leishmania major genome two new large families of small elements--LmSIDER1 (785 copies and LmSIDER2 (1,073 copies--that fulfill all the characteristics of extinct trypanosomatid retroposons. LmSIDERs are approximately 70 times more abundant in L. major compared to T. brucei and are found almost exclusively within the 3'-untranslated regions (3'UTRs of L. major mRNAs. We provide experimental evidence that LmSIDER2 act as mRNA instability elements and that LmSIDER2-containing mRNAs are generally expressed at lower levels compared to the non-LmSIDER2 mRNAs. The considerable expansion of LmSIDERs within 3'UTRs in an organism lacking transcriptional control and their role in regulating mRNA stability indicate that Leishmania have probably recycled these short retroposons to globally modulate the expression of a number of genes. To our knowledge, this is the first example in eukaryotes of the domestication and expansion of a family of mobile elements that have evolved to fulfill a critical cellular function.

  2. Duplications and losses in gene families of rust pathogens highlight putative effectors

    Directory of Open Access Journals (Sweden)

    Amanda L. Pendleton

    2014-06-01

    Full Text Available Rust fungi are a group of fungal pathogens that cause some of the world’s most destructive diseases of trees and crops. A shared characteristic among rust fungi is obligate biotrophy, the inability to complete a lifecycle without a host. This dependence on a host species likely affects patterns of gene expansion, contraction, and innovation within rust pathogen genomes. The establishment of disease by biotrophic pathogens is reliant upon effector proteins that are encoded in the fungal genome and secreted from the pathogen into the host’s cell apoplast or within the cells. This study uses a comparative genomic approach to elucidate putative effectors and determine their evolutionary histories. We used OrthoMCL to identify nearly 20,000 gene families in proteomes of sixteen diverse fungal species, which include fifteen basidiomycetes and one ascomycete. We inferred patterns of duplication and loss for each gene family and identified families with distinctive patterns of expansion/contraction associated with the evolution of rust fungal genomes. To recognize potential contributors for the unique features of rust pathogens, we identified families harboring secreted proteins that: i arose or expanded in rust pathogens relative to other fungi, or ii contracted or were lost in rust fungal genomes. While the origin of rust fungi appears to be associated with considerable gene loss, there are many gene duplications associated with each sampled rust fungal genome. We also highlight two putative effector gene families that have expanded in Cqf that we hypothesize have roles in pathogenicity.

  3. Duplications and losses in gene families of rust pathogens highlight putative effectors.

    Science.gov (United States)

    Pendleton, Amanda L; Smith, Katherine E; Feau, Nicolas; Martin, Francis M; Grigoriev, Igor V; Hamelin, Richard; Nelson, C Dana; Burleigh, J Gordon; Davis, John M

    2014-01-01

    Rust fungi are a group of fungal pathogens that cause some of the world's most destructive diseases of trees and crops. A shared characteristic among rust fungi is obligate biotrophy, the inability to complete a lifecycle without a host. This dependence on a host species likely affects patterns of gene expansion, contraction, and innovation within rust pathogen genomes. The establishment of disease by biotrophic pathogens is reliant upon effector proteins that are encoded in the fungal genome and secreted from the pathogen into the host's cell apoplast or within the cells. This study uses a comparative genomic approach to elucidate putative effectors and determine their evolutionary histories. We used OrthoMCL to identify nearly 20,000 gene families in proteomes of 16 diverse fungal species, which include 15 basidiomycetes and one ascomycete. We inferred patterns of duplication and loss for each gene family and identified families with distinctive patterns of expansion/contraction associated with the evolution of rust fungal genomes. To recognize potential contributors for the unique features of rust pathogens, we identified families harboring secreted proteins that: (i) arose or expanded in rust pathogens relative to other fungi, or (ii) contracted or were lost in rust fungal genomes. While the origin of rust fungi appears to be associated with considerable gene loss, there are many gene duplications associated with each sampled rust fungal genome. We also highlight two putative effector gene families that have expanded in Cqf that we hypothesize have roles in pathogenicity.

  4. Naturally occurring mutations in the human 5-lipoxygenase gene promoter that modify transcription factor binding and reporter gene transcription.

    Science.gov (United States)

    In, K H; Asano, K; Beier, D; Grobholz, J; Finn, P W; Silverman, E K; Silverman, E S; Collins, T; Fischer, A R; Keith, T P; Serino, K; Kim, S W; De Sanctis, G T; Yandava, C; Pillari, A; Rubin, P; Kemp, J; Israel, E; Busse, W; Ledford, D; Murray, J J; Segal, A; Tinkleman, D; Drazen, J M

    1997-03-01

    Five lipoxygenase (5-LO) is the first committed enzyme in the metabolic pathway leading to the synthesis of the leukotrienes. We examined genomic DNA isolated from 25 normal subjects and 31 patients with asthma (6 of whom had aspirin-sensitive asthma) for mutations in the known transcription factor binding regions and the protein encoding region of the 5-LO gene. A family of mutations in the G + C-rich transcription factor binding region was identified consisting of the deletion of one, deletion of two, or addition of one zinc finger (Sp1/Egr-1) binding sites in the region 176 to 147 bp upstream from the ATG translation start site where there are normally 5 Sp1 binding motifs in tandem. Reporter gene activity directed by any of the mutant forms of the transcription factor binding region was significantly (P < 0.05) less effective than the activity driven by the wild type transcription factor binding region. Electrophoretic mobility shift assays (EMSAs) demonstrated the capacity of wild type and mutant transcription factor binding regions to bind nuclear extracts from human umbilical vein endothelial cells (HUVECs). These data are consistent with a family of mutations in the 5-LO gene that can modify reporter gene transcription possibly through differences in Sp1 and Egr-1 transactivation.

  5. A family-based association study identified CYP17 as a candidate gene for obesity susceptibility in Caucasians.

    Science.gov (United States)

    Yan, H; Guo, Y; Yang, T-L; Zhao, L-J; Deng, H-W

    2012-08-06

    The cytochrome P450c17α gene (CYP17) encodes a key biosynthesis enzyme of estrogen, which is critical in regulating adipogenesis and adipocyte development in humans. We therefore hypothesized that CYP17 is a candidate gene for predicting obesity. In order to test this hypothesis, we performed a family-based association test to investigate the relationship between the CYP17 gene and obesity phenotypes in a large sample comprising 1873 subjects from 405 Caucasian nuclear families of European origin recruited by the Osteoporosis Research Center of Creighton University, USA. Both single SNPs and haplotypes were tested for associations with obesity-related phenotypes, including body mass index (BMI) and fat mass. We identified three SNPs to be significantly associated with BMI, including rs3740397, rs6163, and rs619824. We further characterized the linkage disequilibrium structure for CYP17 and found that the whole CYP17 gene was located in a single-linkage disequilibrium block. This block was observed to be significantly associated with BMI. A major haplotype in this block was significantly associated with both BMI and fat mass. In conclusion, we suggest that the CYP17 gene has an effect on obesity in the Caucasian population. Further independent studies will be needed to confirm our findings.

  6. Common mutations identified in the MLH1 gene in familial Lynch syndrome

    Directory of Open Access Journals (Sweden)

    Jisha Elias

    2017-12-01

    In this study we identified three families with Lynch syndrome from a rural cancer center in western India (KCHRC, Goraj, Gujarat, where 70-75 CRC patients are seen annually. DNA isolated from the blood of consented family members of all three families (8-10 members/family was subjected to NGS sequencing methods on an Illumina HiSeq 4000 platform. We identified unique mutations in the MLH1 gene in all three HNPCC family members. Two of the three unrelated families shared a common mutation (154delA and 156delA. Total 8 members of a family were identified as carriers for 156delA mutation of which 5 members were unaffected while 3 were affected (age of onset: 1 member <30yrs & 2 were>40yr. The family with 154delA mutation showed 2 affected members (>40yr carrying the mutations.LYS618DEL mutation found in 8 members of the third family showed that both affected and unaffected carried the mutation. Thus the common mutations identified in the MLH1 gene in two unrelated families had a high risk for lynch syndrome especially above the age of 40.

  7. Understanding the mechanisms of ATPase beta family genes for cellular thermotolerance in crossbred bulls.

    Science.gov (United States)

    Deb, Rajib; Sajjanar, Basavaraj; Singh, Umesh; Alex, Rani; Raja, T V; Alyethodi, Rafeeque R; Kumar, Sushil; Sengar, Gyanendra; Sharma, Sheetal; Singh, Rani; Prakash, B

    2015-12-01

    Na+/K+-ATPase is an integral membrane protein composed of a large catalytic subunit (alpha), a smaller glycoprotein subunit (beta), and gamma subunit. The beta subunit is essential for ion recognition as well as maintenance of the membrane integrity. Present study was aimed to analyze the expression pattern of ATPase beta subunit genes (ATPase B1, ATPase B2, and ATPase B3) among the crossbred bulls under different ambient temperatures (20-44 °C). The present study was also aimed to look into the relationship of HSP70 with the ATPase beta family genes. Our results demonstrated that among beta family genes, transcript abundance of ATPase B1 and ATPase B2 is significantly (P ATPase Β1, ATPase B2, and ATPase B3 is highly correlated (P ATPase beta family genes for cellular thermotolerance in cattle.

  8. Genome-Wide Analysis of the RNA Helicase Gene Family in Gossypium raimondii

    Directory of Open Access Journals (Sweden)

    Jie Chen

    2014-03-01

    Full Text Available The RNA helicases, which help to unwind stable RNA duplexes, and have important roles in RNA metabolism, belong to a class of motor proteins that play important roles in plant development and responses to stress. Although this family of genes has been the subject of systematic investigation in Arabidopsis, rice, and tomato, it has not yet been characterized in cotton. In this study, we identified 161 putative RNA helicase genes in the genome of the diploid cotton species Gossypium raimondii. We classified these genes into three subfamilies, based on the presence of either a DEAD-box (51 genes, DEAH-box (52 genes, or DExD/H-box (58 genes in their coding regions. Chromosome location analysis showed that the genes that encode RNA helicases are distributed across all 13 chromosomes of G. raimondii. Syntenic analysis revealed that 62 of the 161 G. raimondii helicase genes (38.5% are within the identified syntenic blocks. Sixty-six (40.99% helicase genes from G. raimondii have one or several putative orthologs in tomato. Additionally, GrDEADs have more conserved gene structures and more simple domains than GrDEAHs and GrDExD/Hs. Transcriptome sequencing data demonstrated that many of these helicases, especially GrDEADs, are highly expressed at the fiber initiation stage and in mature leaves. To our knowledge, this is the first report of a genome-wide analysis of the RNA helicase gene family in cotton.

  9. Association of ALOX15 gene polymorphisms with obesity-related phenotypes in Chinese nuclear families with male offspring

    Institute of Scientific and Technical Information of China (English)

    Yao-hua KE; Chun WANG; Yun-qiu HU; Miao LI; Yu-juan LIU; Wen-zhen FU; Zhen-lin ZHANG; Wen-jin XIAO; Jin-wei HE; Hao ZHANG; Jin-bo YU; Wei-wei HU; Jie-mei GU; Gao GAO; Hua YUE

    2012-01-01

    Aim:Genetic variation in ALOX12,which encoded human 12-lipoxygenase,was found to be associated with fat mass in young Chinese men.The objective of this study was to investigate the relationship between single nucleotide polymorphisms (SNPs) and haplotypes in the ALOX15 gene and obesity-related phenotypes in Chinese nuclear families with male offspring.Methods:We recruited 1,296 subjects from 427 nuclear families with male offspring and genotyped five SNPs (rs9894225,rs748694,rs2619112,rs2619118,and rs916055) in the ALOX15 gene locus.The total fat mass (TFM),trunk fat mass (tFM),leg fat mass (LFM) and arm fat mass (AFM) were measured using dual-energy X-ray absorptiometry (DXA).The percentage of fat mass (PFM) was the ratio of TFM and body weight.The association between SNPs and haplotypes of ALOX15 and obesity-related phenotypic variation was measured using quantitative transmission disequilibrium test (QTDT).Results:Using QTDT to measure family-based genetic association,we found that rs916055 had a statistically significant association with PFM (P=0.038),whereas rs916055 had a marginal but statistically insignificant association with tFM (P=0.093).The multipleparameter 1000 permutations test agreed with the family-based association results:both showed that rs916055 had a statistically significant association with PFM (P=0.033).Conclusion:rs916055 in ALOX15 gene was significantly associated with the percentage of fat mass in Chinese nuclear families with male offspring in the family-based association study using QTDT approach.

  10. Scattered Families : Transnational family life of Afghan refugees in the Netherlands in the light of the human rights based protection of the family

    NARCIS (Netherlands)

    Muller, P.H.A.M|info:eu-repo/dai/nl/165624647

    2009-01-01

    This study focuses on family life of Afghan refugees in the Netherlands, within and across borders. While family life constitutes a foundation in the lives of human beings, the disruption of the family through external causes has a huge impact on the people involved. In the case of refugees, many of

  11. Characterization of the avian Trojan gene family reveals contrasting evolutionary constraints.

    Directory of Open Access Journals (Sweden)

    Petar Petrov

    Full Text Available "Trojan" is a leukocyte-specific, cell surface protein originally identified in the chicken. Its molecular function has been hypothesized to be related to anti-apoptosis and the proliferation of immune cells. The Trojan gene has been localized onto the Z sex chromosome. The adjacent two genes also show significant homology to Trojan, suggesting the existence of a novel gene/protein family. Here, we characterize this Trojan family, identify homologues in other species and predict evolutionary constraints on these genes. The two Trojan-related proteins in chicken were predicted as a receptor-type tyrosine phosphatase and a transmembrane protein, bearing a cytoplasmic immuno-receptor tyrosine-based activation motif. We identified the Trojan gene family in ten other bird species and found related genes in three reptiles and a fish species. The phylogenetic analysis of the homologues revealed a gradual diversification among the family members. Evolutionary analyzes of the avian genes predicted that the extracellular regions of the proteins have been subjected to positive selection. Such selection was possibly a response to evolving interacting partners or to pathogen challenges. We also observed an almost complete lack of intracellular positively selected sites, suggesting a conserved signaling mechanism of the molecules. Therefore, the contrasting patterns of selection likely correlate with the interaction and signaling potential of the molecules.

  12. Characterization of the avian Trojan gene family reveals contrasting evolutionary constraints.

    Science.gov (United States)

    Petrov, Petar; Syrjänen, Riikka; Smith, Jacqueline; Gutowska, Maria Weronika; Uchida, Tatsuya; Vainio, Olli; Burt, David W

    2015-01-01

    "Trojan" is a leukocyte-specific, cell surface protein originally identified in the chicken. Its molecular function has been hypothesized to be related to anti-apoptosis and the proliferation of immune cells. The Trojan gene has been localized onto the Z sex chromosome. The adjacent two genes also show significant homology to Trojan, suggesting the existence of a novel gene/protein family. Here, we characterize this Trojan family, identify homologues in other species and predict evolutionary constraints on these genes. The two Trojan-related proteins in chicken were predicted as a receptor-type tyrosine phosphatase and a transmembrane protein, bearing a cytoplasmic immuno-receptor tyrosine-based activation motif. We identified the Trojan gene family in ten other bird species and found related genes in three reptiles and a fish species. The phylogenetic analysis of the homologues revealed a gradual diversification among the family members. Evolutionary analyzes of the avian genes predicted that the extracellular regions of the proteins have been subjected to positive selection. Such selection was possibly a response to evolving interacting partners or to pathogen challenges. We also observed an almost complete lack of intracellular positively selected sites, suggesting a conserved signaling mechanism of the molecules. Therefore, the contrasting patterns of selection likely correlate with the interaction and signaling potential of the molecules.

  13. Enamelin/ameloblastin gene polymorphisms in autosomal amelogenesis imperfecta among Syrian families.

    Science.gov (United States)

    Dashash, Mayssoon; Bazrafshani, Mohamed Riza; Poulton, Kay; Jaber, Saaed; Naeem, Emad; Blinkhorn, Anthony Stevenson

    2011-02-01

      This study was undertaken to investigate whether a single G deletion within a series of seven G residues (codon 196) at the exon 9-intron 9 boundary of the enamelin gene ENAM and a tri-nucleotide deletion at codon 180 in exon 7 (GGA vs deletion) of ameloblastin gene AMBN could have a role in autosomal amelogenesis imperfecta among affected Syrian families.   A new technique - size-dependent, deletion screening - was developed to detect nucleotide deletion in ENAM and AMBN genes. Twelve Syrian families with autosomal-dominant or -recessive amelogenesis imperfecta were included.   A homozygous/heterozygous mutation in the ENAM gene (152/152, 152/153) was identified in affected members of three families with autosomal-dominant amelogenesis imperfecta and one family with autosomal-recessive amelogenesis imperfecta. A heterozygous mutation (222/225) in the AMBN gene was identified. However, no disease causing mutations was found. The present findings provide useful information for the implication of ENAM gene polymorphism in autosomal-dominant/-recessive amelogenesis imperfecta.   Further investigations are required to identify other genes responsible for the various clinical phenotypes. © 2010 Blackwell Publishing Asia Pty Ltd.

  14. Identification and description of three families with familial Alzheimer disease that segregate variants in the SORL1 gene.

    Science.gov (United States)

    Thonberg, Håkan; Chiang, Huei-Hsin; Lilius, Lena; Forsell, Charlotte; Lindström, Anna-Karin; Johansson, Charlotte; Björkström, Jenny; Thordardottir, Steinunn; Sleegers, Kristel; Van Broeckhoven, Christine; Rönnbäck, Annica; Graff, Caroline

    2017-06-09

    Alzheimer disease (AD) is a progressive neurodegenerative disorder and the most common form of dementia. The majority of AD cases are sporadic, while up to 5% are families with an early onset AD (EOAD). Mutations in one of the three genes: amyloid beta precursor protein (APP), presenilin 1 (PSEN1) or presenilin 2 (PSEN2) can be disease causing. However, most EOAD families do not carry mutations in any of these three genes, and candidate genes, such as the sortilin-related receptor 1 (SORL1), have been suggested to be potentially causative. To identify AD causative variants, we performed whole-exome sequencing on five individuals from a family with EOAD and a missense variant, p.Arg1303Cys (c.3907C > T) was identified in SORL1 which segregated with disease and was further characterized with immunohistochemistry on two post mortem autopsy cases from the same family. In a targeted re-sequencing effort on independent index patients from 35 EOAD-families, a second SORL1 variant, c.3050-2A > G, was found which segregated with the disease in 3 affected and was absent in one unaffected family member. The c.3050-2A > G variant is located two nucleotides upstream of exon 22 and was shown to cause exon 22 skipping, resulting in a deletion of amino acids Gly1017- Glu1074 of SORL1. Furthermore, a third SORL1 variant, c.5195G > C, recently identified in a Swedish case control cohort included in the European Early-Onset Dementia (EU EOD) consortium study, was detected in two affected siblings in a third family with familial EOAD. The finding of three SORL1-variants that segregate with disease in three separate families with EOAD supports the involvement of SORL1 in AD pathology. The cause of these rare monogenic forms of EOAD has proven difficult to find and the use of exome and genome sequencing may be a successful route to target them.

  15. Diverse expression of sucrose transporter gene family in Zea mays

    Indian Academy of Sciences (India)

    2015-03-04

    Mar 4, 2015 ... In this study, we identified four sucrose transporter genes. (ZmSUT1 .... strand synthesis was done with forward and reverse primers designed at .... Qazi H. A., Paranjpe S. and Bhargava S. 2012 Stem sugar accu- mulation in ...

  16. Gene Panel Testing in Epileptic Encephalopathies and Familial Epilepsies

    DEFF Research Database (Denmark)

    Møller, Rikke S.; Larsen, Line H.G.; Johannesen, Katrine M.

    2016-01-01

    -causing variant in 49 (23%) of the 216 patients. The variants were found in 19 different genes including SCN1A, STXBP1, CDKL5, SCN2A, SCN8A, GABRA1, KCNA2, and STX1B. Patients with neonatal-onset epilepsies had the highest rate of positive findings (57%). The overall yield for patients with EEs was 32%, compared...

  17. Gene Panel Testing in Epileptic Encephalopathies and Familial Epilepsies

    DEFF Research Database (Denmark)

    Møller, Rikke S; Larsen, Line H G; Johannesen, Katrine M

    2016-01-01

    In recent years, several genes have been causally associated with epilepsy. However, making a genetic diagnosis in a patient can still be difficult, since extensive phenotypic and genetic heterogeneity has been observed in many monogenic epilepsies. This study aimed to analyze the genetic basis o...

  18. Genetic diversity of bitter taste receptor gene family in Sichuan ...

    Indian Academy of Sciences (India)

    Previous research had revealed that chicken has only three bitter taste receptor genes (Tas2r1, ... Journal of Genetics, DOI 10.1007/s12041-016-0684-4, Vol. ..... between red-winged blackbirds and European starlings. ... Academic Press,.

  19. Are mice pigmentary genes throwing light on humans?

    Directory of Open Access Journals (Sweden)

    Bose S

    1993-01-01

    Full Text Available In this article the rapid advances made in the molecular genetics of inherited disorders of hypo and hyperpigmentation during the past three years are reviewed. The main focus is on studies in mice as compared to homologues in humans. The main hypomelanotic diseases included are, piebaldism (white spotting due to mutations of c-KIT, PDGF and MGF genes; vitiligo (microphathalmia mice mutations of c-Kit and c-fms genes; Waardenburg syndrome (splotch locus mutations of mice PAX-3 or human Hup-2 genes; albinism (mutations of tyrosinase genes, Menkes disease (Mottled mouse, premature graying (mutations in light/brown locus/gp75/ TRP-1; Griscelli disease (mutations in TRP-1 and steel; Prader-willi and Angelman syndromes, tyrosinase-positive oculocutaneous albinism and hypomelanosis of lto (mutations of pink-eyed dilution gene/mapping to human chromosomes 15 q 11.2 - q12; and human platelet storage pool deficiency diseases due to defects in pallidin, an erythrocyte membrane protein (pallid mouse / mapping to 4.2 pallidin gene. The genetic characterization of hypermelanosis includes, neurofibromatosis 1 (Café-au-lait spots and McCune-Albright Syndrome. Rapid evolving knowledge about pigmentary genes will increase further the knowledge about these hypo and hyperpigmentary disorders.

  20. Translational selection in human: More pronounced in housekeeping genes

    KAUST Repository

    Ma, Lina

    2014-07-10

    Background: Translational selection is a ubiquitous and significant mechanism to regulate protein expression in prokaryotes and unicellular eukaryotes. Recent evidence has shown that translational selection is weakly operative in highly expressed genes in human and other vertebrates. However, it remains unclear whether translational selection acts differentially on human genes depending on their expression patterns.Results: Here we report that human housekeeping (HK) genes that are strictly defined as genes that are expressed ubiquitously and consistently in most or all tissues, are under stronger translational selection.Conclusions: These observations clearly show that translational selection is also closely associated with expression pattern. Our results suggest that human HK genes are more efficiently and/or accurately translated into proteins, which will inevitably open up a new understanding of HK genes and the regulation of gene expression.Reviewers: This article was reviewed by Yuan Yuan, Baylor College of Medicine; Han Liang, University of Texas MD Anderson Cancer Center (nominated by Dr Laura Landweber) Eugene Koonin, NCBI, NLM, NIH, United States of America Sandor Pongor, International Centre for Genetic Engineering and biotechnology (ICGEB), Italy. © 2014 Ma et al.; licensee BioMed Central Ltd.

  1. The zebrafish progranulin gene family and antisense transcripts

    Directory of Open Access Journals (Sweden)

    Baranowski David

    2005-11-01

    Full Text Available Abstract Background Progranulin is an epithelial tissue growth factor (also known as proepithelin, acrogranin and PC-cell-derived growth factor that has been implicated in development, wound healing and in the progression of many cancers. The single mammalian progranulin gene encodes a glycoprotein precursor consisting of seven and one half tandemly repeated non-identical copies of the cystine-rich granulin motif. A genome-wide duplication event hypothesized to have occurred at the base of the teleost radiation predicts that mammalian progranulin may be represented by two co-orthologues in zebrafish. Results The cDNAs encoding two zebrafish granulin precursors, progranulins-A and -B, were characterized and found to contain 10 and 9 copies of the granulin motif respectively. The cDNAs and genes encoding the two forms of granulin, progranulins-1 and -2, were also cloned and sequenced. Both latter peptides were found to be encoded by precursors with a simplified architecture consisting of one and one half copies of the granulin motif. A cDNA encoding a chimeric progranulin which likely arises through the mechanism of trans-splicing between grn1 and grn2 was also characterized. A non-coding RNA gene with antisense complementarity to both grn1 and grn2 was identified which may have functional implications with respect to gene dosage, as well as in restricting the formation of the chimeric form of progranulin. Chromosomal localization of the four progranulin (grn genes reveals syntenic conservation for grna only, suggesting that it is the true orthologue of mammalian grn. RT-PCR and whole-mount in situ hybridization analysis of zebrafish grns during development reveals that combined expression of grna and grnb, but not grn1 and grn2, recapitulate many of the expression patterns observed for the murine counterpart. This includes maternal deposition, widespread central nervous system distribution and specific localization within the epithelial

  2. Cloning and characterization of human DNA repair genes

    International Nuclear Information System (INIS)

    Thompson, L.H.; Brookman, K.W.; Weber, C.A.; Salazar, E.P.; Stewart, S.A.; Carrano, A.V.

    1987-01-01

    The isolation of two addition human genes that give efficient restoration of the repair defects in other CHO mutant lines is reported. The gene designated ERCC2 (Excision Repair Complementing Chinese hamster) corrects mutant UV5 from complementation group 1. They recently cloned this gene by first constructing a secondary transformant in which the human gene was shown to have become physically linked to the bacterial gpt dominant-marker gene by cotransfer in calcium phosphate precipitates in the primary transfection. Transformants expressing both genes were recovered by selecting for resistance to both UV radiation and mycophenolic acid. Using similar methods, the human gene that corrects CHO mutant EM9 was isolated in cosmids and named XRCC1 (X-ray Repair Complementing Chinese hamster). In this case, transformants were recovered by selecting for resistance to CldUrd, which kills EM9 very efficiently. In both genomic and cosmid transformants, the XRCC1 gene restored resistance to the normal range. DNA repair was studied using the kinetics of strand-break rejoining, which was measured after exposure to 137 Cs γ-rays

  3. HuMiChip: Development of a Functional Gene Array for the Study of Human Microbiomes

    Energy Technology Data Exchange (ETDEWEB)

    Tu, Q.; Deng, Ye; Lin, Lu; Hemme, Chris L.; He, Zhili; Zhou, Jizhong

    2010-05-17

    Microbiomes play very important roles in terms of nutrition, health and disease by interacting with their hosts. Based on sequence data currently available in public domains, we have developed a functional gene array to monitor both organismal and functional gene profiles of normal microbiota in human and mouse hosts, and such an array is called human and mouse microbiota array, HMM-Chip. First, seed sequences were identified from KEGG databases, and used to construct a seed database (seedDB) containing 136 gene families in 19 metabolic pathways closely related to human and mouse microbiomes. Second, a mother database (motherDB) was constructed with 81 genomes of bacterial strains with 54 from gut and 27 from oral environments, and 16 metagenomes, and used for selection of genes and probe design. Gene prediction was performed by Glimmer3 for bacterial genomes, and by the Metagene program for metagenomes. In total, 228,240 and 801,599 genes were identified for bacterial genomes and metagenomes, respectively. Then the motherDB was searched against the seedDB using the HMMer program, and gene sequences in the motherDB that were highly homologous with seed sequences in the seedDB were used for probe design by the CommOligo software. Different degrees of specific probes, including gene-specific, inclusive and exclusive group-specific probes were selected. All candidate probes were checked against the motherDB and NCBI databases for specificity. Finally, 7,763 probes covering 91.2percent (12,601 out of 13,814) HMMer confirmed sequences from 75 bacterial genomes and 16 metagenomes were selected. This developed HMM-Chip is able to detect the diversity and abundance of functional genes, the gene expression of microbial communities, and potentially, the interactions of microorganisms and their hosts.

  4. Identification of DNA repair genes in the human genome

    International Nuclear Information System (INIS)

    Hoeijmakers, J.H.J.; van Duin, M.; Westerveld, A.; Yasui, A.; Bootsma, D.

    1986-01-01

    To identify human DNA repair genes we have transfected human genomic DNA ligated to a dominant marker to excision repair deficient xeroderma pigmentosum (XP) and CHO cells. This resulted in the cloning of a human gene, ERCC-1, that complements the defect of a UV- and mitomycin-C sensitive CHO mutant 43-3B. The ERCC-1 gene has a size of 15 kb, consists of 10 exons and is located in the region 19q13.2-q13.3. Its primary transcript is processed into two mRNAs by alternative splicing of an internal coding exon. One of these transcripts encodes a polypeptide of 297 aminoacids. A putative DNA binding protein domain and nuclear location signal could be identified. Significant AA-homology is found between ERCC-1 and the yeast excision repair gene RAD10. 58 references, 6 figures, 1 table

  5. The SULTR gene family in maize (Zea mays L.): Gene cloning and expression analyses under sulfate starvation and abiotic stress.

    Science.gov (United States)

    Huang, Qin; Wang, Meiping; Xia, Zongliang

    2018-01-01

    Sulfur is an essential macronutrient required for plant growth, development and stress responses. The family of sulfate transporters (SULTRs) mediates the uptake and translocation of sulfate in higher plants. However, basic knowledge of the SULTR gene family in maize (Zea mays L.) is scarce. In this study, a genome-wide bioinformatic analysis of SULTR genes in maize was conducted, and the developmental expression patterns of the genes and their responses to sulfate starvation and abiotic stress were further investigated. The ZmSULTR family includes eight putative members in the maize genome and is clustered into four groups in the phylogenetic tree. These genes displayed differential expression patterns in various organs of maize. For example, expression of ZmSULTR1;1 and ZmSULTR4;1 was high in roots, and transcript levels of ZmSULTR3;1 and ZmSULTR3;3 were high in shoots. Expression of ZmSULTR1;2, ZmSULTR2;1, ZmSULTR3;3, and ZmSULTR4;1 was high in flowers. Also, these eight genes showed differential responses to sulfate deprivation in roots and shoots of maize seedlings. Transcript levels of ZmSULTR1;1, ZmSULTR1;2, and ZmSULTR3;4 were significantly increased in roots during 12-day-sulfate starvation stress, while ZmSULTR3;3 and ZmSULTR3;5 only showed an early response pattern in shoots. In addition, dynamic transcriptional changes determined via qPCR revealed differential expression profiles of these eight ZmSULTR genes in response to environmental stresses such as salt, drought, and heat stresses. Notably, all the genes, except for ZmSULTR3;3, were induced by drought and heat stresses. However, a few genes were induced by salt stress. Physiological determination showed that two important thiol-containing compounds, cysteine and glutathione, increased significantly under these abiotic stresses. The results suggest that members of the SULTR family might function in adaptations to sulfur deficiency stress and adverse growing environments. This study will lay a

  6. Automated discovery of functional generality of human gene expression programs.

    Directory of Open Access Journals (Sweden)

    Georg K Gerber

    2007-08-01

    Full Text Available An important research problem in computational biology is the identification of expression programs, sets of co-expressed genes orchestrating normal or pathological processes, and the characterization of the functional breadth of these programs. The use of human expression data compendia for discovery of such programs presents several challenges including cellular inhomogeneity within samples, genetic and environmental variation across samples, uncertainty in the numbers of programs and sample populations, and temporal behavior. We developed GeneProgram, a new unsupervised computational framework based on Hierarchical Dirichlet Processes that addresses each of the above challenges. GeneProgram uses expression data to simultaneously organize tissues into groups and genes into overlapping programs with consistent temporal behavior, to produce maps of expression programs, which are sorted by generality scores that exploit the automatically learned groupings. Using synthetic and real gene expression data, we showed that GeneProgram outperformed several popular expression analysis methods. We applied GeneProgram to a compendium of 62 short time-series gene expression datasets exploring the responses of human cells to infectious agents and immune-modulating molecules. GeneProgram produced a map of 104 expression programs, a substantial number of which were significantly enriched for genes involved in key signaling pathways and/or bound by NF-kappaB transcription factors in genome-wide experiments. Further, GeneProgram discovered expression programs that appear to implicate surprising signaling pathways or receptor types in the response to infection, including Wnt signaling and neurotransmitter receptors. We believe the discovered map of expression programs involved in the response to infection will be useful for guiding future biological experiments; genes from programs with low generality scores might serve as new drug targets that exhibit minimal

  7. Genome-Wide Analysis of the Aquaporin Gene Family in Chickpea (Cicer arietinum L.).

    Science.gov (United States)

    Deokar, Amit A; Tar'an, Bunyamin

    2016-01-01

    Aquaporins (AQPs) are essential membrane proteins that play critical role in the transport of water and many other solutes across cell membranes. In this study, a comprehensive genome-wide analysis identified 40 AQP genes in chickpea ( Cicer arietinum L.). A complete overview of the chickpea AQP (CaAQP) gene family is presented, including their chromosomal locations, gene structure, phylogeny, gene duplication, conserved functional motifs, gene expression, and conserved promoter motifs. To understand AQP's evolution, a comparative analysis of chickpea AQPs with AQP orthologs from soybean, Medicago, common bean, and Arabidopsis was performed. The chickpea AQP genes were found on all of the chickpea chromosomes, except chromosome 7, with a maximum of six genes on chromosome 6, and a minimum of one gene on chromosome 5. Gene duplication analysis indicated that the expansion of chickpea AQP gene family might have been due to segmental and tandem duplications. CaAQPs were grouped into four subfamilies including 15 NOD26-like intrinsic proteins (NIPs), 13 tonoplast intrinsic proteins (TIPs), eight plasma membrane intrinsic proteins (PIPs), and four small basic intrinsic proteins (SIPs) based on sequence similarities and phylogenetic position. Gene structure analysis revealed a highly conserved exon-intron pattern within CaAQP subfamilies supporting the CaAQP family classification. Functional prediction based on conserved Ar/R selectivity filters, Froger's residues, and specificity-determining positions suggested wide differences in substrate specificity among the subfamilies of CaAQPs. Expression analysis of the AQP genes indicated that some of the genes are tissue-specific, whereas few other AQP genes showed differential expression in response to biotic and abiotic stresses. Promoter profiling of CaAQP genes for conserved cis -acting regulatory elements revealed enrichment of cis -elements involved in circadian control, light response, defense and stress responsiveness

  8. Genetic effects on gene expression across human tissues

    NARCIS (Netherlands)

    Battle, Alexis; Brown, Christopher D.; Engelhardt, Barbara E.; Montgomery, Stephen B.; Aguet, François; Ardlie, Kristin G.; Cummings, Beryl B.; Gelfand, Ellen T.; Getz, Gad; Hadley, Kane; Handsaker, Robert E.; Huang, Katherine H.; Kashin, Seva; Karczewski, Konrad J.; Lek, Monkol; Li, Xiao; MacArthur, Daniel G.; Nedzel, Jared L.; Nguyen, Duyen T.; Noble, Michael S.; Segrè, Ayellet V.; Trowbridge, Casandra A.; Tukiainen, Taru; Abell, Nathan S.; Balliu, Brunilda; Barshir, Ruth; Basha, Omer; Bogu, Gireesh K.; Brown, Andrew; Castel, Stephane E.; Chen, Lin S.; Chiang, Colby; Conrad, Donald F.; Cox, Nancy J.; Damani, Farhan N.; Davis, Joe R.; Delaneau, Olivier; Dermitzakis, Emmanouil T.; Eskin, Eleazar; Ferreira, Pedro G.; Frésard, Laure; Gamazon, Eric R.; Garrido-Martín, Diego; Gewirtz, Ariel D. H.; Gliner, Genna; Gloudemans, Michael J.; Guigo, Roderic; Hall, Ira M.; Han, Buhm; He, Yuan

    2017-01-01

    Characterization of the molecular function of the human genome and its variation across individuals is essential for identifying the cellular mechanisms that underlie human genetic traits and diseases. The Genotype-Tissue Expression (GTEx) project aims to characterize variation in gene expression

  9. Genome-wide evolutionary characterization and expression analyses of WRKY family genes in Brachypodium distachyon.

    Science.gov (United States)

    Wen, Feng; Zhu, Hong; Li, Peng; Jiang, Min; Mao, Wenqing; Ong, Chermaine; Chu, Zhaoqing

    2014-06-01

    Members of plant WRKY gene family are ancient transcription factors that function in plant growth and development and respond to biotic and abiotic stresses. In our present study, we have investigated WRKY family genes in Brachypodium distachyon, a new model plant of family Poaceae. We identified a total of 86 WRKY genes from B. distachyon and explored their chromosomal distribution and evolution, domain alignment, promoter cis-elements, and expression profiles. Combining the analysis of phylogenetic tree of BdWRKY genes and the result of expression profiling, results showed that most of clustered gene pairs had higher similarities in the WRKY domain, suggesting that they might be functionally redundant. Neighbour-joining analysis of 301 WRKY domains from Oryza sativa, Arabidopsis thaliana, and B. distachyon suggested that BdWRKY domains are evolutionarily more closely related to O. sativa WRKY domains than those of A. thaliana. Moreover, tissue-specific expression profile of BdWRKY genes and their responses to phytohormones and several biotic or abiotic stresses were analysed by quantitative real-time PCR. The results showed that the expression of BdWRKY genes was rapidly regulated by stresses and phytohormones, and there was a strong correlation between promoter cis-elements and the phytohormones-induced BdWRKY gene expression. © The Author 2014. Published by Oxford University Press on behalf of Kazusa DNA Research Institute.

  10. Targeted sequencing of established and candidate colorectal cancer genes in the Colon Cancer Family Registry Cohort.

    Science.gov (United States)

    Raskin, Leon; Guo, Yan; Du, Liping; Clendenning, Mark; Rosty, Christophe; Lindor, Noralane M; Gruber, Stephen B; Buchanan, Daniel D

    2017-11-07

    The underlying genetic cause of colorectal cancer (CRC) can be identified for 5-10% of all cases, while at least 20% of CRC cases are thought to be due to inherited genetic factors. Screening for highly penetrant mutations in genes associated with Mendelian cancer syndromes using next-generation sequencing (NGS) can be prohibitively expensive for studies requiring large samples sizes. The aim of the study was to identify rare single nucleotide variants and small indels in 40 established or candidate CRC susceptibility genes in 1,046 familial CRC cases (including both MSS and MSI-H tumor subtypes) and 1,006 unrelated controls from the Colon Cancer Family Registry Cohort using a robust and cost-effective DNA pooling NGS strategy. We identified 264 variants in 38 genes that were observed only in cases, comprising either very rare (minor allele frequency cancer susceptibility genes BAP1, CDH1, CHEK2, ENG, and MSH3 . For the candidate CRC genes, we identified likely pathogenic variants in the helicase domain of POLQ and in the LRIG1 , SH2B3 , and NOS1 genes and present their clinicopathological characteristics. Using a DNA pooling NGS strategy, we identified novel germline mutations in established CRC susceptibility genes in familial CRC cases. Further studies are required to support the role of POLQ , LRIG1 , SH2B3 and NOS1 as CRC susceptibility genes.

  11. Human γ-globin genes silenced independently of other genes in the β-globin locus.

    NARCIS (Netherlands)

    N.O. Dillon (Niall); F.G. Grosveld (Frank)

    1991-01-01

    textabstractErythropoiesis during human development is characterized by switches in expression of beta-like globin genes during the transition from the embryonic through fetal to adult stages. Activation and high-level expression of the genes is directed by the locus control region (LCR), located 5'

  12. Gene × Smoking Interactions on Human Brain Gene Expression: Finding Common Mechanisms in Adolescents and Adults

    Science.gov (United States)

    Wolock, Samuel L.; Yates, Andrew; Petrill, Stephen A.; Bohland, Jason W.; Blair, Clancy; Li, Ning; Machiraju, Raghu; Huang, Kun; Bartlett, Christopher W.

    2013-01-01

    Background: Numerous studies have examined gene × environment interactions (G × E) in cognitive and behavioral domains. However, these studies have been limited in that they have not been able to directly assess differential patterns of gene expression in the human brain. Here, we assessed G × E interactions using two publically available datasets…

  13. Genome-wide analysis of the WRKY gene family in physic nut (Jatropha curcas L.).

    Science.gov (United States)

    Xiong, Wangdan; Xu, Xueqin; Zhang, Lin; Wu, Pingzhi; Chen, Yaping; Li, Meiru; Jiang, Huawu; Wu, Guojiang

    2013-07-25

    The WRKY proteins, which contain highly conserved WRKYGQK amino acid sequences and zinc-finger-like motifs, constitute a large family of transcription factors in plants. They participate in diverse physiological and developmental processes. WRKY genes have been identified and characterized in a number of plant species. We identified a total of 58 WRKY genes (JcWRKY) in the genome of the physic nut (Jatropha curcas L.). On the basis of their conserved WRKY domain sequences, all of the JcWRKY proteins could be assigned to one of the previously defined groups, I-III. Phylogenetic analysis of JcWRKY genes with Arabidopsis and rice WRKY genes, and separately with castor bean WRKY genes, revealed no evidence of recent gene duplication in JcWRKY gene family. Analysis of transcript abundance of JcWRKY gene products were tested in different tissues under normal growth condition. In addition, 47 WRKY genes responded to at least one abiotic stress (drought, salinity, phosphate starvation and nitrogen starvation) in individual tissues (leaf, root and/or shoot cortex). Our study provides a useful reference data set as the basis for cloning and functional analysis of physic nut WRKY genes. Copyright © 2013 Elsevier B.V. All rights reserved.

  14. Genome-wide investigation and transcriptome analysis of the WRKY gene family in Gossypium.

    Science.gov (United States)

    Ding, Mingquan; Chen, Jiadong; Jiang, Yurong; Lin, Lifeng; Cao, YueFen; Wang, Minhua; Zhang, Yuting; Rong, Junkang; Ye, Wuwei

    2015-02-01

    WRKY transcription factors play important roles in various stress responses in diverse plant species. In cotton, this family has not been well studied, especially in relation to fiber development. Here, the genomes and transcriptomes of Gossypium raimondii and Gossypium arboreum were investigated to identify fiber development related WRKY genes. This represents the first comprehensive comparative study of WRKY transcription factors in both diploid A and D cotton species. In total, 112 G. raimondii and 109 G. arboreum WRKY genes were identified. No significant gene structure or domain alterations were detected between the two species, but many SNPs distributed unequally in exon and intron regions. Physical mapping revealed that the WRKY genes in G. arboreum were not located in the corresponding chromosomes of G. raimondii, suggesting great chromosome rearrangement in the diploid cotton genomes. The cotton WRKY genes, especially subgroups I and II, have expanded through multiple whole genome duplications and tandem duplications compared with other plant species. Sequence comparison showed many functionally divergent sites between WRKY subgroups, while the genes within each group are under strong purifying selection. Transcriptome analysis suggested that many WRKY genes participate in specific fiber development processes such as fiber initiation, elongation and maturation with different expression patterns between species. Complex WRKY gene expression such as differential Dt and At allelic gene expression in G. hirsutum and alternative splicing events were also observed in both diploid and tetraploid cottons during fiber development process. In conclusion, this study provides important information on the evolution and function of WRKY gene family in cotton species.

  15. LINE FUSION GENES: a database of LINE expression in human genes

    Directory of Open Access Journals (Sweden)

    Park Hong-Seog

    2006-06-01

    Full Text Available Abstract Background Long Interspersed Nuclear Elements (LINEs are the most abundant retrotransposons in humans. About 79% of human genes are estimated to contain at least one segment of LINE per transcription unit. Recent studies have shown that LINE elements can affect protein sequences, splicing patterns and expression of human genes. Description We have developed a database, LINE FUSION GENES, for elucidating LINE expression throughout the human gene database. We searched the 28,171 genes listed in the NCBI database for LINE elements and analyzed their structures and expression patterns. The results show that the mRNA sequences of 1,329 genes were affected by LINE expression. The LINE expression types were classified on the basis of LINEs in the 5' UTR, exon or 3' UTR sequences of the mRNAs. Our database provides further information, such as the tissue distribution and chromosomal location of the genes, and the domain structure that is changed by LINE integration. We have linked all the accession numbers to the NCBI data bank to provide mRNA sequences for subsequent users. Conclusion We believe that our work will interest genome scientists and might help them to gain insight into the implications of LINE expression for human evolution and disease. Availability http://www.primate.or.kr/line

  16. Isolating human DNA repair genes using rodent-cell mutants

    International Nuclear Information System (INIS)

    Thompson, L.H.; Weber, C.A.; Brookman, K.W.; Salazar, E.P.; Stewart, S.A.; Mitchell, D.L.

    1987-01-01

    The DNA repair systems of rodent and human cells appear to be at least as complex genetically as those in lower eukaryotes and bacteria. The use of mutant lines of rodent cells as a means of identifying human repair genes by functional complementation offers a new approach toward studying the role of repair in mutagenesis and carcinogenesis. In each of six cases examined using hybrid cells, specific human chromosomes have been identified that correct CHO cell mutations affecting repair of damage from uv or ionizing radiations. This finding suggests that both the repair genes and proteins may be virtually interchangeable between rodent and human cells. Using cosmid vectors, human repair genes that map to chromosome 19 have cloned as functional sequences: ERCC2 and XRCC1. ERCC1 was found to have homology with the yeast excision repair gene RAD10. Transformants of repair-deficient cell lines carrying the corresponding human gene show efficient correction of repair capacity by all criteria examined. 39 refs., 1 fig., 1 tab

  17. Characterization of a gene from the EDM1-PSACH region of human chromosome 19p

    Energy Technology Data Exchange (ETDEWEB)

    Lennon, G.G.; Giorgi, D.; Martin, J.R. [Lawrence Livermore National Lab., CA (United States)] [and others

    1994-09-01

    Genetic linkage mapping has indicated that both multiple epiphyseal dysplasia (EDM1), a dominantly inherited chondrodysplasia, and pseudoachondroplasia (PSACH), a skeletal disorder associated with dwarfism, map to a 2-3 Mb region of human chromosome 19p. We have isolated a partial cDNA from this region using hybrid selection, and report on progress towards the characterization of the genomic structure and transcription of the corresponding gene. Sequence analysis of the cDNA to date indicates that this gene is likely to be expressed within extracellular matrix tissues. Defects in this gene or neighboring gene family members may therefore lead to EDM1, PSACH, or other connective tissue and skeletal disorders.

  18. Human ETS2 gene on chromosome 21 is not rearranged in Alzheimer disease

    International Nuclear Information System (INIS)

    Sacchi, N.; Nalbantoglu, J.; Sergovich, F.R.; Papas, T.S.

    1988-01-01

    The human ETS2 gene, a member of the ETS gene family, with sequence homology with the retroviral ets sequence of the avian erythroblastosis retrovirus E26 is located on chromosome 21. Molecular genetic analysis of Down syndrome (DS) patients with partial trisomy 21 allowed us to reinforce the supposition that ETS2 may be a gene of the minimal DS genetic region. It was originally proposed that a duplication of a portion of the DS region represents the genetic basis of Alzheimer disease, a condition associated also with DS. No evidence of either rearrangements or duplications of ETS2 could be detected in DNA from fibroblasts and brain tissue of Alzheimer disease patients with either the sporadic or the familiar form of the disease. Thus, an altered ETS2 gene dosage does not seem to be a genetic cause or component of Alzheimer disease

  19. Gene mapping in an anophthalmic pedigree of a consanguineous Pakistani family opened new horizons for research

    Directory of Open Access Journals (Sweden)

    Saleha S

    2016-06-01

    Full Text Available Clinical anophthalmia is a rare inherited disease of the eye and phenotype refers to the absence of ocular tissue in the orbit of eye. Patients may have unilateral or bilateral anophthalmia, and generally have short palpebral fissures and small orbits. Anophthalmia may be isolated or associated with a broader syndrome and may have genetic or environmental causes. However, genetic cause has been defined in only a small proportion of cases, therefore, a consanguineous Pakistani family of the Pashtoon ethnic group, with isolated clinical anophthalmia was investigated using linkage mapping. A family pedigree was created to trace the possible mode of inheritance of the disease. Blood samples were collected from affected as well as normal members of this family, and screened for disease-associated mutations. This family was analyzed for linkage to all the known loci of clinical anophthalmia, using microsatellite short tandem repeat (STR markers. Direct sequencing was performed to find out disease-associated mutations in the candidate gene. This family with isolated clinical anophthalmia, was mapped to the SOX2 gene that is located at chromosome 3q26.3-q27. However, on exonic and regulatory regions mutation screening of the SOX2 gene, the disease-associated mutation was not identified. It showed that another gene responsible for development of the eye might be present at chromosome 3q26.3-q27 and needs to be identified and screened for the disease-associated mutation in this family.

  20. Gene mapping in an anophthalmic pedigree of a consanguineous Pakistani family opened new horizons for research

    Science.gov (United States)

    Ajmal, M; Zafar, S; Hameed, A

    2016-01-01

    ABSTRACT Clinical anophthalmia is a rare inherited disease of the eye and phenotype refers to the absence of ocular tissue in the orbit of eye. Patients may have unilateral or bilateral anophthalmia, and generally have short palpebral fissures and small orbits. Anophthalmia may be isolated or associated with a broader syndrome and may have genetic or environmental causes. However, genetic cause has been defined in only a small proportion of cases, therefore, a consanguineous Pakistani family of the Pashtoon ethnic group, with isolated clinical anophthalmia was investigated using linkage mapping. A family pedigree was created to trace the possible mode of inheritance of the disease. Blood samples were collected from affected as well as normal members of this family, and screened for disease-associated mutations. This family was analyzed for linkage to all the known loci of clinical anophthalmia, using microsatellite short tandem repeat (STR) markers. Direct sequencing was performed to find out disease-associated mutations in the candidate gene. This family with isolated clinical anophthalmia, was mapped to the SOX2 gene that is located at chromosome 3q26.3-q27. However, on exonic and regulatory regions mutation screening of the SOX2 gene, the disease-associated mutation was not identified. It showed that another gene responsible for development of the eye might be present at chromosome 3q26.3-q27 and needs to be identified and screened for the disease-associated mutation in this family. PMID:27785411

  1. Gene Environment Interactions and Predictors of Colorectal Cancer in Family-Based, Multi-Ethnic Groups.

    Science.gov (United States)

    Shiao, S Pamela K; Grayson, James; Yu, Chong Ho; Wasek, Brandi; Bottiglieri, Teodoro

    2018-02-16

    For the personalization of polygenic/omics-based health care, the purpose of this study was to examine the gene-environment interactions and predictors of colorectal cancer (CRC) by including five key genes in the one-carbon metabolism pathways. In this proof-of-concept study, we included a total of 54 families and 108 participants, 54 CRC cases and 54 matched family friends representing four major racial ethnic groups in southern California (White, Asian, Hispanics, and Black). We used three phases of data analytics, including exploratory, family-based analyses adjusting for the dependence within the family for sharing genetic heritage, the ensemble method, and generalized regression models for predictive modeling with a machine learning validation procedure to validate the results for enhanced prediction and reproducibility. The results revealed that despite the family members sharing genetic heritage, the CRC group had greater combined gene polymorphism rates than the family controls ( p relation to gene-environment interactions in the prevention of CRC.

  2. Aux/IAA Gene Family in Plants: Molecular Structure, Regulation, and Function

    Directory of Open Access Journals (Sweden)

    Jie Luo

    2018-01-01

    Full Text Available Auxin plays a crucial role in the diverse cellular and developmental responses of plants across their lifespan. Plants can quickly sense and respond to changes in auxin levels, and these responses involve several major classes of auxin-responsive genes, including the Auxin/Indole-3-Acetic Acid (Aux/IAA family, the auxin response factor (ARF family, small auxin upregulated RNA (SAUR, and the auxin-responsive Gretchen Hagen3 (GH3 family. Aux/IAA proteins are short-lived nuclear proteins comprising several highly conserved domains that are encoded by the auxin early response gene family. These proteins have specific domains that interact with ARFs and inhibit the transcription of genes activated by ARFs. Molecular studies have revealed that Aux/IAA family members can form diverse dimers with ARFs to regulate genes in various ways. Functional analyses of Aux/IAA family members have indicated that they have various roles in plant development, such as root development, shoot growth, and fruit ripening. In this review, recently discovered details regarding the molecular characteristics, regulation, and protein–protein interactions of the Aux/IAA proteins are discussed. These details provide new insights into the molecular basis of the Aux/IAA protein functions in plant developmental processes.

  3. A family of hyperelastic models for human brain tissue

    Science.gov (United States)

    Mihai, L. Angela; Budday, Silvia; Holzapfel, Gerhard A.; Kuhl, Ellen; Goriely, Alain

    2017-09-01

    Experiments on brain samples under multiaxial loading have shown that human brain tissue is both extremely soft when compared to other biological tissues and characterized by a peculiar elastic response under combined shear and compression/tension: there is a significant increase in shear stress with increasing axial compression compared to a moderate increase with increasing axial tension. Recent studies have revealed that many widely used constitutive models for soft biological tissues fail to capture this characteristic response. Here, guided by experiments of human brain tissue, we develop a family of modeling approaches that capture the elasticity of brain tissue under varying simple shear superposed on varying axial stretch by exploiting key observations about the behavior of the nonlinear shear modulus, which can be obtained directly from the experimental data.

  4. Characterization and distribution of repetitive elements in association with genes in the human genome.

    Science.gov (United States)

    Liang, Kai-Chiang; Tseng, Joseph T; Tsai, Shaw-Jenq; Sun, H Sunny

    2015-08-01

    Repetitive elements constitute more than 50% of the human genome. Recent studies implied that the complexity of living organisms is not just a direct outcome of a number of coding sequences; the repetitive elements, which do not encode proteins, may also play a significant role. Though scattered studies showed that repetitive elements in the regulatory regions of a gene control gene expression, no systematic survey has been done to report the characterization and distribution of various types of these repetitive elements in the human genome. Sequences from 5' and 3' untranslated regions and upstream and downstream of a gene were downloaded from the Ensembl database. The repetitive elements in the neighboring of each gene were identified and classified using cross-matching implemented in the RepeatMasker. The annotation and distribution of distinct classes of repetitive elements associated with individual gene were collected to characterize genes in association with different types of repetitive elements using systems biology program. We identified a total of 1,068,400 repetitive elements which belong to 37-class families and 1235 subclasses that are associated with 33,761 genes and 57,365 transcripts. In addition, we found that the tandem repeats preferentially locate proximal to the transcription start site (TSS) of genes and the major function of these genes are involved in developmental processes. On the other hand, interspersed repetitive elements showed a tendency to be accumulated at distal region from the TSS and the function of interspersed repeat-containing genes took part in the catabolic/metabolic processes. Results from the distribution analysis were collected and used to construct a gene-based repetitive element database (GBRED; http://www.binfo.ncku.edu.tw/GBRED/index.html). A user-friendly web interface was designed to provide the information of repetitive elements associated with any particular gene(s). This is the first study focusing on the gene

  5. Dichotomy in the NRT gene families of dicots and grass species.

    Directory of Open Access Journals (Sweden)

    Darren Plett

    Full Text Available A large proportion of the nitrate (NO(3(- acquired by plants from soil is actively transported via members of the NRT families of NO(3(- transporters. In Arabidopsis, the NRT1 family has eight functionally characterised members and predominantly comprises low-affinity transporters; the NRT2 family contains seven members which appear to be high-affinity transporters; and there are two NRT3 (NAR2 family members which are known to participate in high-affinity transport. A modified reciprocal best hit (RBH approach was used to identify putative orthologues of the Arabidopsis NRT genes in the four fully sequenced grass genomes (maize, rice, sorghum, Brachypodium. We also included the poplar genome in our analysis to establish whether differences between Arabidopsis and the grasses may be generally applicable to monocots and dicots. Our analysis reveals fundamental differences between Arabidopsis and the grass species in the gene number and family structure of all three families of NRT transporters. All grass species possessed additional NRT1.1 orthologues and appear to lack NRT1.6/NRT1.7 orthologues. There is significant separation in the NRT2 phylogenetic tree between NRT2 genes from dicots and grass species. This indicates that determination of function of NRT2 genes in grass species will not be possible in cereals based simply on sequence homology to functionally characterised Arabidopsis NRT2 genes and that proper functional analysis will be required. Arabidopsis has a unique NRT3.2 gene which may be a fusion of the NRT3.1 and NRT3.2 genes present in all other species examined here. This work provides a framework for future analysis of NO(3(- transporters and NO(3(- transport in grass crop species.

  6. Sex bias in copy number variation of olfactory receptor gene family depends on ethnicity

    Directory of Open Access Journals (Sweden)

    Farideh eShadravan

    2013-03-01

    Full Text Available Gender plays a pivotal role in the human genetic identity and is also manifested in many genetic disorders particularly mental retardation. In this study its effect on copy number variation (CNV, known to cause genetic disorders was explored. As the olfactory receptor (OR repertoire comprises the largest human gene family, it was selected for this study, which was carried out within and between three populations, derived from 150 individuals from the 1000 Genome Project. Analysis of 3872 CNVs detected among 791 OR loci, in which 307 loci showed CNV, revealed the following novel findings: Sex bias in CNV was significantly more prevalent in uncommon than common CNV variants of OR pseudogenes, in which the male genome showed more CNVs; and in one-copy number loss compared to complete deletion of OR pseudogenes; both findings implying a more recent evolutionary role for gender. Sex bias in copy number gain was also detected. Another novel finding was that the observed six bias was largely dependent on ethnicity and was in general absent in East Asians. Using a CNV public database for sick children (ISCA the application of these findings for improving clinical molecular diagnostics is discussed by showing an example of sex bias in CNV among kids with autism. Additional clinical relevance is discussed, as the most polymorphic CNV-enriched OR cluster in the human genome, located on chr 15q11.2, is found near the PWS/AS bi-directionally imprinted region associated with two well-known mental retardation syndromes. As olfaction represents the primitive cognition in most mammals, arguably in competition with the development of a larger brain, the extensive retention of OR pseudogenes in females of this study, might point to a parent-of-origin indirect regulatory role for OR pseudogenes in the embryonic development of human brain. Thus any perturbation in the temporal regulation of olfactory system could lead to developmental delay disorders including

  7. The role of IL-4 gene 70 bp VNTR and ACE gene I/D variants in Familial Mediterranean fever.

    Science.gov (United States)

    Yigit, Serbülent; Tural, Sengul; Tekcan, Akın; Tasliyurt, Turker; Inanir, Ahmet; Uzunkaya, Süheyla; Kismali, Gorkem

    2014-05-01

    Familial Mediterranean fever (FMF) is characterized by recurrent attacks of fever and inflammation in the peritoneum, synovium, or pleura, accompanied by pain. It is an autosomal recessive disease caused by mutations in the MEFV (MEditerranean FeVer) gene. Patients with similar genotypes exhibit phenotypic diversity. As a result, the variations in different genes could be responsible for the clinical findings of this disease. In previous studies genes encoding Angiotensin-Converting Enzyme (ACE) and IL-4 (Interleukin-4) were found to be associated with rheumatologic and autoimmune diseases. In the present study we hypothesized whether ACE I/D or IL-4 70 bp variable tandem repeats (VNTR) genes are associated with FMF and its clinical findings in Turkish patients. Genomic DNA obtained from 670 persons (339 patients with FMF and 331 healthy controls) was used in the study. Genotypes for an ACE gene I/D polymorphism and IL-4 gene 70 bp VNTR were determined by polymerase chain reaction with specific primers. To our knowledge, this is the first study examining ACE gene I/D polymorphism and IL-4 gene 70 bp VNTR polymorphism in FMF patients. As a result, there was a statistically significant difference between the groups with respect to genotype distribution (pACE gene DD genotype was associated with an increased risk in FMF [pACE genotype frequencies according to the clinical characteristics, we found a statistically significant association between DD+ID genotype and fever (p=0.04). In addition IL-4 gene P1P1 genotype was associated with FMF (pACE gene and P1 allele or P1P1 genotype of IL-4 gene may be important molecular markers for susceptibility of FMF. Copyright © 2014 Elsevier Ltd. All rights reserved.

  8. Ancestral Variations of the PCDHG Gene Cluster Predispose to Dyslexia in a Multiplex Family

    Directory of Open Access Journals (Sweden)

    Teesta Naskar

    2018-02-01

    Full Text Available Dyslexia is a heritable neurodevelopmental disorder characterized by difficulties in reading and writing. In this study, we describe the identification of a set of 17 polymorphisms located across 1.9 Mb region on chromosome 5q31.3, encompassing genes of the PCDHG cluster, TAF7, PCDH1 and ARHGAP26, dominantly inherited with dyslexia in a multi-incident family. Strikingly, the non-risk form of seven variations of the PCDHG cluster, are preponderant in the human lineage, while risk alleles are ancestral and conserved across Neanderthals to non-human primates. Four of these seven ancestral variations (c.460A > C [p.Ile154Leu], c.541G > A [p.Ala181Thr], c.2036G > C [p.Arg679Pro] and c.2059A > G [p.Lys687Glu] result in amino acid alterations. p.Ile154Leu and p.Ala181Thr are present at EC2: EC3 interacting interface of γA3-PCDH and γA4-PCDH respectively might affect trans-homophilic interaction and hence neuronal connectivity. p.Arg679Pro and p.Lys687Glu are present within the linker region connecting trans-membrane to extracellular domain. Sequence analysis indicated the importance of p.Ile154, p.Arg679 and p.Lys687 in maintaining class specificity. Thus the observed association of PCDHG genes encoding neural adhesion proteins reinforces the hypothesis of aberrant neuronal connectivity in the pathophysiology of dyslexia. Additionally, the striking conservation of the identified variants indicates a role of PCDHG in the evolution of highly specialized cognitive skills critical to reading.

  9. [PAX3 gene mutation analysis for two Waardenburg syndrome type Ⅰ families and their prenatal diagnosis].

    Science.gov (United States)

    Bai, Y; Liu, N; Kong, X D; Yan, J; Qin, Z B; Wang, B

    2016-12-07

    Objective: To analyze the mutations of PAX3 gene in two Waardenburg syndrome type Ⅰ (WS1) pedigrees and make prenatal diagnosis for the high-risk 18-week-old fetus. Methods: PAX3 gene was first analyzed by Sanger sequencing and multiplex ligation-dependent probe amplification(MLPA) for detecting pathogenic mutation of the probands of the two pedigrees. The mutations were confirmed by MLPA and Sanger in parents and unrelated healthy individuals.Prenatal genetic diagnosis for the high-risk fetus was performed by amniotic fluid cell after genotyping. Results: A heterozygous PAX3 gene gross deletion (E7 deletion) was identified in all patients from WS1-01 family, and not found in 20 healthy individuals.Prenatal diagnosis in WS1-01 family indicated that the fetus was normal. Molecular studies identified a novel deletion mutation c. 1385_1386delCT within the PAX3 gene in all affected WS1-02 family members, but in none of the unaffected relatives and 200 healthy individuals. Conclusions: PAX3 gene mutation is etiological for two WS1 families. Sanger sequencing plus MLPA is effective and accurate for making gene diagnosis and prenatal diagnosis.

  10. Distribution of mutations in the PEX gene in families with X-linked hypophosphataemic rickets (HYP).

    Science.gov (United States)

    Rowe, P S; Oudet, C L; Francis, F; Sinding, C; Pannetier, S; Econs, M J; Strom, T M; Meitinger, T; Garabedian, M; David, A; Macher, M A; Questiaux, E; Popowska, E; Pronicka, E; Read, A P; Mokrzycki, A; Glorieux, F H; Drezner, M K; Hanauer, A; Lehrach, H; Goulding, J N; O'Riordan, J L

    1997-04-01

    Mutations in the PEX gene at Xp22.1 (phosphate-regulating gene with homologies to endopeptidases, on the X-chromosome), are responsible for X-linked hypophosphataemic rickets (HYP). Homology of PEX to the M13 family of Zn2+ metallopeptidases which include neprilysin (NEP) as prototype, has raised important questions regarding PEX function at the molecular level. The aim of this study was to analyse 99 HYP families for PEX gene mutations, and to correlate predicted changes in the protein structure with Zn2+ metallopeptidase gene function. Primers flanking 22 characterised exons were used to amplify DNA by PCR, and SSCP was then used to screen for mutations. Deletions, insertions, nonsense mutations, stop codons and splice mutations occurred in 83% of families screened for in all 22 exons, and 51% of a separate set of families screened in 17 PEX gene exons. Missense mutations in four regions of the gene were informative regarding function, with one mutation in the Zn2+-binding site predicted to alter substrate enzyme interaction and catalysis. Computer analysis of the remaining mutations predicted changes in secondary structure, N-glycosylation, protein phosphorylation and catalytic site molecular structure. The wide range of mutations that align with regions required for protease activity in NEP suggests that PEX also functions as a protease, and may act by processing factor(s) involved in bone mineral metabolism.

  11. Chicken genome analysis reveals novel genes encoding biotin-binding proteins related to avidin family

    Directory of Open Access Journals (Sweden)

    Nordlund Henri R

    2005-03-01

    Full Text Available Abstract Background A chicken egg contains several biotin-binding proteins (BBPs, whose complete DNA and amino acid sequences are not known. In order to identify and characterise these genes and proteins we studied chicken cDNAs and genes available in the NCBI database and chicken genome database using the reported N-terminal amino acid sequences of chicken egg-yolk BBPs as search strings. Results Two separate hits showing significant homology for these N-terminal sequences were discovered. For one of these hits, the chromosomal location in the immediate proximity of the avidin gene family was found. Both of these hits encode proteins having high sequence similarity with avidin suggesting that chicken BBPs are paralogous to avidin family. In particular, almost all residues corresponding to biotin binding in avidin are conserved in these putative BBP proteins. One of the found DNA sequences, however, seems to encode a carboxy-terminal extension not present in avidin. Conclusion We describe here the predicted properties of the putative BBP genes and proteins. Our present observations link BBP genes together with avidin gene family and shed more light on the genetic arrangement and variability of this family. In addition, comparative modelling revealed the potential structural elements important for the functional and structural properties of the putative BBP proteins.

  12. The progress of radiosensitive genes of human brain glioma

    International Nuclear Information System (INIS)

    Wang Xi; Liu Qiang

    2008-01-01

    Human gliomas are one of the most aggressive tumors in brain which grow infiltrativly. Surgery is the mainstay of treatment. But as the tumor could not be entirely cut off, it is easy to relapse. Radiotherapy plays an important role for patients with gliomas after surgery. The efficacy of radiotherapy is associated with radio sensitivity of human gliomas. This paper makes a summary of current situation and progress for radiosensitive genes of human brain gliomas. (authors)

  13. Two Paralogous Families of a Two-Gene Subtilisin Operon Are Widely Distributed in Oral Treponemes

    Science.gov (United States)

    Correia, Frederick F.; Plummer, Alvin R.; Ellen, Richard P.; Wyss, Chris; Boches, Susan K.; Galvin, Jamie L.; Paster, Bruce J.; Dewhirst, Floyd E.

    2003-01-01

    Certain oral treponemes express a highly proteolytic phenotype and have been associated with periodontal diseases. The periodontal pathogen Treponema denticola produces dentilisin, a serine protease of the subtilisin family. The two-gene operon prcA-prtP is required for expression of active dentilisin (PrtP), a putative lipoprotein attached to the treponeme's outer membrane or sheath. The purpose of this study was to examine the diversity and structure of treponemal subtilisin-like proteases in order to better understand their distribution and function. The complete sequences of five prcA-prtP operons were determined for Treponema lecithinolyticum, “Treponema vincentii,” and two canine species. Partial operon sequences were obtained for T. socranskii subsp. 04 as well as 450- to 1,000-base fragments of prtP genes from four additional treponeme strains. Phylogenetic analysis demonstrated that the sequences fall into two paralogous families. The first family includes the sequence from T. denticola. Treponemes possessing this operon family express chymotrypsin-like protease activity and can cleave the substrate N-succinyl-alanyl-alanyl-prolyl-phenylalanine-p-nitroanilide (SAAPFNA). Treponemes possessing the second paralog family do not possess chymotrypsin-like activity or cleave SAAPFNA. Despite examination of a range of protein and peptide substrates, the specificity of the second protease family remains unknown. Each of the fully sequenced prcA and prtP genes contains a 5′ hydrophobic leader sequence with a treponeme lipobox. The two paralogous families of treponeme subtilisins represent a new subgroup within the subtilisin family of proteases and are the only subtilisin lipoprotein family. The present study demonstrated that the subtilisin paralogs comprising a two-gene operon are widely distributed among treponemes. PMID:14617650

  14. Characterization and gene expression analysis of the cir multi-gene family of plasmodium chabaudi chabaudi (AS)

    KAUST Repository

    Lawton, Jennifer

    2012-03-29

    Background: The pir genes comprise the largest multi-gene family in Plasmodium, with members found in P. vivax, P. knowlesi and the rodent malaria species. Despite comprising up to 5% of the genome, little is known about the functions of the proteins encoded by pir genes. P. chabaudi causes chronic infection in mice, which may be due to antigenic variation. In this model, pir genes are called cirs and may be involved in this mechanism, allowing evasion of host immune responses. In order to fully understand the role(s) of CIR proteins during P. chabaudi infection, a detailed characterization of the cir gene family was required.Results: The cir repertoire was annotated and a detailed bioinformatic characterization of the encoded CIR proteins was performed. Two major sub-families were identified, which have been named A and B. Members of each sub-family displayed different amino acid motifs, and were thus predicted to have undergone functional divergence. In addition, the expression of the entire cir repertoire was analyzed via RNA sequencing and microarray. Up to 40% of the cir gene repertoire was expressed in the parasite population during infection, and dominant cir transcripts could be identified. In addition, some differences were observed in the pattern of expression between the cir subgroups at the peak of P. chabaudi infection. Finally, specific cir genes were expressed at different time points during asexual blood stages.Conclusions: In conclusion, the large number of cir genes and their expression throughout the intraerythrocytic cycle of development indicates that CIR proteins are likely to be important for parasite survival. In particular, the detection of dominant cir transcripts at the peak of P. chabaudi infection supports the idea that CIR proteins are expressed, and could perform important functions in the biology of this parasite. Further application of the methodologies described here may allow the elucidation of CIR sub-family A and B protein

  15. Characterization and gene expression analysis of the cir multi-gene family of plasmodium chabaudi chabaudi (AS)

    KAUST Repository

    Lawton, Jennifer; Brugat, Thibaut; Yan, Yam Xue; Reid, Adam James; Bö hme, Ulrike; Otto, Thomas Dan; Pain, Arnab; Jackson, Andrew; Berriman, Matthew; Cunningham, Deirdre; Preiser, Peter; Langhorne, Jean

    2012-01-01

    Background: The pir genes comprise the largest multi-gene family in Plasmodium, with members found in P. vivax, P. knowlesi and the rodent malaria species. Despite comprising up to 5% of the genome, little is known about the functions of the proteins encoded by pir genes. P. chabaudi causes chronic infection in mice, which may be due to antigenic variation. In this model, pir genes are called cirs and may be involved in this mechanism, allowing evasion of host immune responses. In order to fully understand the role(s) of CIR proteins during P. chabaudi infection, a detailed characterization of the cir gene family was required.Results: The cir repertoire was annotated and a detailed bioinformatic characterization of the encoded CIR proteins was performed. Two major sub-families were identified, which have been named A and B. Members of each sub-family displayed different amino acid motifs, and were thus predicted to have undergone functional divergence. In addition, the expression of the entire cir repertoire was analyzed via RNA sequencing and microarray. Up to 40% of the cir gene repertoire was expressed in the parasite population during infection, and dominant cir transcripts could be identified. In addition, some differences were observed in the pattern of expression between the cir subgroups at the peak of P. chabaudi infection. Finally, specific cir genes were expressed at different time points during asexual blood stages.Conclusions: In conclusion, the large number of cir genes and their expression throughout the intraerythrocytic cycle of development indicates that CIR proteins are likely to be important for parasite survival. In particular, the detection of dominant cir transcripts at the peak of P. chabaudi infection supports the idea that CIR proteins are expressed, and could perform important functions in the biology of this parasite. Further application of the methodologies described here may allow the elucidation of CIR sub-family A and B protein

  16. Genetic recombination within the human T-cell receptor α-chain gene complex

    International Nuclear Information System (INIS)

    Robinson, M.A.; Kindt, T.J.

    1987-01-01

    Genetic analyses of the human T-cell receptor (TCR) α-chain genes indicate that recombination events may occur frequently within this gene complex. Examination of the inheritance of restriction fragment length polymorphisms (RFLP) detected by using probes for constant or variable region gene segments made it possible to assign TCRα haplotypes to the 16 parents and 43 offspring of eight families studied. A total of six RFLP, three for the constant region and three for variable region segments, were examined in the present studies. Most enzyme and probe combinations tested revealed no polymorphism and those finally selected for the study showed limited polymorphism in that only two or, in one case, three allelic forms of the gene were seen. In spite of limited variability at this level, extensive heterogeneity was observed for the combinations of markers present in haplotypes, suggesting that frequent recombination events have occurred. Most strikingly, multiple combinations of RFLP occurring in close proximity of the TCRα constant region gene were observed in this study. A high recombination frequency for the TCRα gene complex is further supported by the observation that two children, one in each of two families, inherited recombinant TCRα haplotypes

  17. The Mycobacterium leprae antigen 85 complex gene family: identification of the genes for the 85A, 85C, and related MPT51 proteins

    NARCIS (Netherlands)

    Rinke de Wit, T. F.; Bekelie, S.; Osland, A.; Wieles, B.; Janson, A. A.; Thole, J. E.

    1993-01-01

    The genes for two novel members (designated 85A and 85C) of the Mycobacterium leprae antigen 85 complex family of proteins and the gene for the closely related M. leprae MPT51 protein were isolated. The complete DNA sequence of the M. leprae 85C gene and partial sequences of the 85A and MPT51 genes

  18. Isolation and characterization of the human uracil DNA glycosylase gene

    International Nuclear Information System (INIS)

    Vollberg, T.M.; Siegler, K.M.; Cool, B.L.; Sirover, M.A.

    1989-01-01

    A series of anti-human placental uracil DNA glycosylase monoclonal antibodies was used to screen a human placental cDNA library in phage λgt11. Twenty-seven immunopositive plaques were detected and purified. One clone containing a 1.2-kilobase (kb) human cDNA insert was chosen for further study by insertion into pUC8. The resultant recombinant plasmid selected by hybridization a human placental mRNA that encoded a 37-kDa polypeptide. This protein was immunoprecipitated specifically by an anti-human placenta uracil DNA glycosylase monoclonal antibody. RNA blot-hybridization (Northern) analysis using placental poly(A) + RNA or total RNA from four different human fibroblast cell strains revealed a single 1.6-kb transcript. Genomic blots using DNA from each cell strain digested with either EcoRI or PstI revealed a complex pattern of cDNA-hydridizing restriction fragments. The genomic analysis for each enzyme was highly similar in all four human cell strains. In contrast, a single band was observed when genomic analysis was performed with the identical DNA digests with an actin gene probe. During cell proliferation there was an increase in the level of glycosylase mRNA that paralleled the increase in uracil DNA glycosylase enzyme activity. The isolation of the human uracil DNA glycosylase gene permits an examination of the structure, organization, and expression of a human DNA repair gene

  19. Taq I RFLP in the human cellular retinol-binding protein (CRBP) gene

    Energy Technology Data Exchange (ETDEWEB)

    Pellegrino, A [Istituto di Ricovero e Cura a Carattere Scientifico SANATRIX, Vena (Italy); Garofalo, S; Cocozza, S; Monticelli, A; Varrone, S [CNR Universita degli Studi di Napoli (Italy); Faraonio, R; Colantuoni, V [Universita degli Studi di Napoli (Italy)

    1988-08-11

    The probe was a Pst I - Bam HI fragment of cDNA, about 600 bp long, encoding for the human CRBP gene. The clone was isolated by screening a human liver cDNA library in the expression vector pEX with antibodies against rat CRBP. Taq I digestion of genomic DNA and hybridization with the CRBP probe detects a two allele polymorphism with allelic fragments of 3.0 kb and 2.7 kb. There are two invariant bands at 2.4 and 2.2 kb. Human CRBP gene has been mapped on the long arm of chromosome 3 using somatic cell hybrids. Co-dominant segregation was observed in two caucasian families (10 individuals).

  20. HindIII identifies a two allele DNA polymorphism of the human cannabinoid receptor gene (CNR)

    Energy Technology Data Exchange (ETDEWEB)

    Caenazzo, L.; Hoehe, M.R.; Hsieh, W.T.; Berrettini, W.H.; Bonner, T.I.; Gershon, E.S. (National Inst. of Health, Bethesda, MD (United States))

    1991-09-11

    HCNR p5, a 0.9 kb BamHI/EcoRI fragment from the human cannabinoid receptor gene inserted into pUC19, was used as probe. The fragment is located in an intron approximately 14 kb 5{prime} of the initiation codon. This fragment is a clean single copy sequence by genomic blotting. Hybridization of human genomic DNA digested with HindIII identified a two allele RFLP with bands at 5.5 (A1) and 3.3 kb (A2). The human cannabinoid receptor gene has been genetically mapped in CEPH reference pedigrees to the centromeric/q region of chromosome 6. In situ hybridization localizes it to 6q14-q15. Codominant segregation has been observed in 26 informative two- and three-generation CEPH pedigrees and in 14 medium-sized disease families.

  1. Analysis of factor VIII gene inversions in 164 unrelated hemophilia A families

    Energy Technology Data Exchange (ETDEWEB)

    Vnencak-Jones, L.; Phillips, J.A. III; Janco, R.L. [Vanderbilt Univ. School of Medicine, Nashville, TN (United States)] [and others

    1994-09-01

    Hemophilia A is an X-linked recessive disease with variable phenotype and both heterogeneous and wide spread mutations in the factor VIII (F8) gene. As a result, diagnostic carrier or prenatal testing often relies upon laborious DNA linkage analysis. Recently, inversion mutations resulting from an intrachromosomal recombination between DNA sequences in one of two A genes {approximately}500 kb upstream from the F8 gene and a homologous A gene in intron 22 of the F8 gene were identified and found in 45% of severe hemophiliacs. We have analyzed banked DNA collected since 1986 from affected males or obligate carrier females representing 164 unrelated hemophilia A families. The disease was sporadic in 37%, familial in 54% and in 10% of families incomplete information was given. A unique deletion was identified in 1/164, a normal pattern was observed in 110/164 (67%), and 53/164 (32%) families had inversion mutations with 43/53 (81%) involving the distal A gene (R3 pattern) and 10/53 (19%) involving the proximal A gene (R2 pattern). While 19% of all rearrangements were R2, in 35 families with severe disease (< 1% VIII:C activity) all 16 rearrangements seen were R3. In 18 families with the R3 pattern and known activities, 16 (89%) had levels < 1%, with the remaining 2 families having {le} 2.4% activity. Further, 18 referrals specifically noted the production of inhibitors and 8/18 (45%) had the R3 pattern. Our findings demonstrate that the R3 inversion mutation patterns is (1) only seen with VIII:C activity levels of {le} 2.4%, (2) seen in 46% of families with severe hemophilia, (3) seen in 45% of hemophiliacs known to have inhibitors, (4) not correlated with sporadic or familial disease and (5) not in disequilibrium with the Bcl I or Taq I intron 18 or ST14 polymorphisms. Finally, in families positive for an inversion mutation, direct testing offers a highly accurate and less expensive alternative to DNA linkage analysis.

  2. A comparison of 100 human genes using an alu element-based instability model.

    Directory of Open Access Journals (Sweden)

    George W Cook

    Full Text Available The human retrotransposon with the highest copy number is the Alu element. The human genome contains over one million Alu elements that collectively account for over ten percent of our DNA. Full-length Alu elements are randomly distributed throughout the genome in both forward and reverse orientations. However, full-length widely spaced Alu pairs having two Alus in the same (direct orientation are statistically more prevalent than Alu pairs having two Alus in the opposite (inverted orientation. The cause of this phenomenon is unknown. It has been hypothesized that this imbalance is the consequence of anomalous inverted Alu pair interactions. One proposed mechanism suggests that inverted Alu pairs can ectopically interact, exposing both ends of each Alu element making up the pair to a potential double-strand break, or "hit". This hypothesized "two-hit" (two double-strand breaks potential per Alu element was used to develop a model for comparing the relative instabilities of human genes. The model incorporates both 1 the two-hit double-strand break potential of Alu elements and 2 the probability of exon-damaging deletions extending from these double-strand breaks. This model was used to compare the relative instabilities of 50 deletion-prone cancer genes and 50 randomly selected genes from the human genome. The output of the Alu element-based genomic instability model developed here is shown to coincide with the observed instability of deletion-prone cancer genes. The 50 cancer genes are collectively estimated to be 58% more unstable than the randomly chosen genes using this model. Seven of the deletion-prone cancer genes, ATM, BRCA1, FANCA, FANCD2, MSH2, NCOR1 and PBRM1, were among the most unstable 10% of the 100 genes analyzed. This algorithm may lay the foundation for comparing genetic risks posed by structural variations that are unique to specific individuals, families and people groups.

  3. A comparison of 100 human genes using an alu element-based instability model.

    Science.gov (United States)

    Cook, George W; Konkel, Miriam K; Walker, Jerilyn A; Bourgeois, Matthew G; Fullerton, Mitchell L; Fussell, John T; Herbold, Heath D; Batzer, Mark A

    2013-01-01

    The human retrotransposon with the highest copy number is the Alu element. The human genome contains over one million Alu elements that collectively account for over ten percent of our DNA. Full-length Alu elements are randomly distributed throughout the genome in both forward and reverse orientations. However, full-length widely spaced Alu pairs having two Alus in the same (direct) orientation are statistically more prevalent than Alu pairs having two Alus in the opposite (inverted) orientation. The cause of this phenomenon is unknown. It has been hypothesized that this imbalance is the consequence of anomalous inverted Alu pair interactions. One proposed mechanism suggests that inverted Alu pairs can ectopically interact, exposing both ends of each Alu element making up the pair to a potential double-strand break, or "hit". This hypothesized "two-hit" (two double-strand breaks) potential per Alu element was used to develop a model for comparing the relative instabilities of human genes. The model incorporates both 1) the two-hit double-strand break potential of Alu elements and 2) the probability of exon-damaging deletions extending from these double-strand breaks. This model was used to compare the relative instabilities of 50 deletion-prone cancer genes and 50 randomly selected genes from the human genome. The output of the Alu element-based genomic instability model developed here is shown to coincide with the observed instability of deletion-prone cancer genes. The 50 cancer genes are collectively estimated to be 58% more unstable than the randomly chosen genes using this model. Seven of the deletion-prone cancer genes, ATM, BRCA1, FANCA, FANCD2, MSH2, NCOR1 and PBRM1, were among the most unstable 10% of the 100 genes analyzed. This algorithm may lay the foundation for comparing genetic risks posed by structural variations that are unique to specific individuals, families and people groups.

  4. ANALYSES ON DIFFERENTIALLY EXPRESSED GENES ASSOCIATED WITH HUMAN BREAST CANCER

    Institute of Scientific and Technical Information of China (English)

    MENG Xu-li; DING Xiao-wen; XU Xiao-hong

    2006-01-01

    Objective: To investigate the molecular etiology of breast cancer by way of studying the differential expression and initial function of the related genes in the occurrence and development of breast cancer. Methods: Two hundred and eighty-eight human tumor related genes were chosen for preparation of the oligochips probe. mRNA was extracted from 16 breast cancer tissues and the corresponding normal breast tissues, and cDNA probe was prepared through reverse-transcription and hybridized with the gene chip. A laser focused fluorescent scanner was used to scan the chip. The different gene expressions were thereafter automatically compared and analyzed between the two sample groups. Cy3/Cy5>3.5 meant significant up-regulation. Cy3/Cy5<0.25 meant significant down-regulation. Results: The comparison between the breast cancer tissues and their corresponding normal tissues showed that 84 genes had differential expression in the Chip. Among the differently expressed genes, there were 4 genes with significant down-regulation and 6 with significant up-regulation. Compared with normal breast tissues, differentially expressed genes did partially exist in the breast cancer tissues. Conclusion: Changes in multi-gene expression regulations take place during the occurrence and development of breast cancer; and the research on related genes can help understanding the mechanism of tumor occurrence.

  5. Mutation analysis of pre-mRNA splicing genes in Chinese families with retinitis pigmentosa

    Science.gov (United States)

    Pan, Xinyuan; Chen, Xue; Liu, Xiaoxing; Gao, Xiang; Kang, Xiaoli; Xu, Qihua; Chen, Xuejuan; Zhao, Kanxing; Zhang, Xiumei; Chu, Qiaomei; Wang, Xiuying

    2014-01-01

    Purpose Seven genes involved in precursor mRNA (pre-mRNA) splicing have been implicated in autosomal dominant retinitis pigmentosa (adRP). We sought to detect mutations in all seven genes in Chinese families with RP, to characterize the relevant phenotypes, and to evaluate the prevalence of mutations in splicing genes in patients with adRP. Methods Six unrelated families from our adRP cohort (42 families) and two additional families with RP with uncertain inheritance mode were clinically characterized in the present study. Targeted sequence capture with next-generation massively parallel sequencing (NGS) was performed to screen mutations in 189 genes including all seven pre-mRNA splicing genes associated with adRP. Variants detected with NGS were filtered with bioinformatics analyses, validated with Sanger sequencing, and prioritized with pathogenicity analysis. Results Mutations in pre-mRNA splicing genes were identified in three individual families including one novel frameshift mutation in PRPF31 (p.Leu366fs*1) and two known mutations in SNRNP200 (p.Arg681His and p.Ser1087Leu). The patients carrying SNRNP200 p.R681H showed rapid disease progression, and the family carrying p.S1087L presented earlier onset ages and more severe phenotypes compared to another previously reported family with p.S1087L. In five other families, we identified mutations in other RP-related genes, including RP1 p. Ser781* (novel), RP2 p.Gln65* (novel) and p.Ile137del (novel), IMPDH1 p.Asp311Asn (recurrent), and RHO p.Pro347Leu (recurrent). Conclusions Mutations in splicing genes identified in the present and our previous study account for 9.5% in our adRP cohort, indicating the important role of pre-mRNA splicing deficiency in the etiology of adRP. Mutations in the same splicing gene, or even the same mutation, could correlate with different phenotypic severities, complicating the genotype–phenotype correlation and clinical prognosis. PMID:24940031

  6. Gene therapy, human nature and the churches.

    Science.gov (United States)

    Dunstan, G R

    1991-12-01

    Moral analysis must begin with respect for the empirical features, the "facts of the case". Major advances in genetic knowledge and technology -- as in other sciences -- inevitably change mental attitudes. But they could not change human nature, a product of the distinctively human cerebral cortex. Human capacities like compassion and justice are our own and for us to guard. To ask (as some do) about a "right" to inherit a non-manipulated genome is to ask an unanswerable question: the language of rights is inappropriate in this context. Parents have a duty to safeguard and to serve the interests of their potential child. The medical duty is to help in that task in ways which they have limited freedom to choose. The role of churches is to be faithful to their deposit of faith and their theological principles, including that of freedom of conscience. Churches are too easily led in practice to over-rule conscience on grounds of authority, ecclesiastical or biblical, not sustained by convincing reason. This is most evident in some declarations concerning human reproduction. Better were it for them to help their faithful in moral reasoning, the ethics of choice; to keep consciences tender.

  7. Hidden Markov Models for Human Genes

    DEFF Research Database (Denmark)

    Baldi, Pierre; Brunak, Søren; Chauvin, Yves

    1997-01-01

    We analyse the sequential structure of human genomic DNA by hidden Markov models. We apply models of widely different design: conventional left-right constructs and models with a built-in periodic architecture. The models are trained on segments of DNA sequences extracted such that they cover com...

  8. Systematic identification of human housekeeping genes possibly useful as references in gene expression studies.

    Science.gov (United States)

    Caracausi, Maria; Piovesan, Allison; Antonaros, Francesca; Strippoli, Pierluigi; Vitale, Lorenza; Pelleri, Maria Chiara

    2017-09-01

    The ideal reference, or control, gene for the study of gene expression in a given organism should be expressed at a medium‑high level for easy detection, should be expressed at a constant/stable level throughout different cell types and within the same cell type undergoing different treatments, and should maintain these features through as many different tissues of the organism. From a biological point of view, these theoretical requirements of an ideal reference gene appear to be best suited to housekeeping (HK) genes. Recent advancements in the quality and completeness of human expression microarray data and in their statistical analysis may provide new clues toward the quantitative standardization of human gene expression studies in biology and medicine, both cross‑ and within‑tissue. The systematic approach used by the present study is based on the Transcriptome Mapper tool and exploits the automated reassignment of probes to corresponding genes, intra‑ and inter‑sample normalization, elaboration and representation of gene expression values in linear form within an indexed and searchable database with a graphical interface recording quantitative levels of expression, expression variability and cross‑tissue width of expression for more than 31,000 transcripts. The present study conducted a meta‑analysis of a pool of 646 expression profile data sets from 54 different human tissues and identified actin γ 1 as the HK gene that best fits the combination of all the traditional criteria to be used as a reference gene for general use; two ribosomal protein genes, RPS18 and RPS27, and one aquaporin gene, POM121 transmembrane nucleporin C, were also identified. The present study provided a list of tissue‑ and organ‑specific genes that may be most suited for the following individual tissues/organs: Adipose tissue, bone marrow, brain, heart, kidney, liver, lung, ovary, skeletal muscle and testis; and also provides in these cases a representative

  9. Characterization of human cardiac myosin heavy chain genes

    International Nuclear Information System (INIS)

    Yamauchi-Takihara, K.; Sole, M.J.; Liew, J.; Ing, D.; Liew, C.C.

    1989-01-01

    The authors have isolated and analyzed the structure of the genes coding for the α and β forms of the human cardiac myosin heavy chain (MYHC). Detailed analysis of four overlapping MYHC genomic clones shows that the α-MYHC and β-MYHC genes constitute a total length of 51 kilobases and are tandemly linked. The β-MYHC-encoding gene, predominantly expressed in the normal human ventricle and also in slow-twitch skeletal muscle, is located 4.5 kilobases upstream of the α-MYHC-encoding gene, which is predominantly expressed in normal human atrium. The authors have determined the nucleotide sequences of the β form of the MYHC gene, which is 100% homologous to the cardiac MYHC cDNA clone (pHMC3). It is unlikely that the divergence of a few nucleotide sequences from the cardiac β-MYHC cDNA clone (pHMC3) reported in a MYHC cDNA clone (PSMHCZ) from skeletal muscle is due to a splicing mechanism. This finding suggests that the same β form of the cardiac MYHC gene is expressed in both ventricular and slow-twitch skeletal muscle. The promoter regions of both α- and β-MYHC genes, as well as the first four coding regions in the respective genes, have also been sequenced. The sequences in the 5'-flanking region of the α- and β-MYHC-encoding genes diverge extensively from one another, suggesting that expression of the α- and β-MYHC genes is independently regulated

  10. The polyphenol oxidase gene family in land plants: Lineage-specific duplication and expansion

    Directory of Open Access Journals (Sweden)

    Tran Lan T

    2012-08-01

    Full Text Available Abstract Background Plant polyphenol oxidases (PPOs are enzymes that typically use molecular oxygen to oxidize ortho-diphenols to ortho-quinones. These commonly cause browning reactions following tissue damage, and may be important in plant defense. Some PPOs function as hydroxylases or in cross-linking reactions, but in most plants their physiological roles are not known. To better understand the importance of PPOs in the plant kingdom, we surveyed PPO gene families in 25 sequenced genomes from chlorophytes, bryophytes, lycophytes, and flowering plants. The PPO genes were then analyzed in silico for gene structure, phylogenetic relationships, and targeting signals. Results Many previously uncharacterized PPO genes were uncovered. The moss, Physcomitrella patens, contained 13 PPO genes and Selaginella moellendorffii (spike moss and Glycine max (soybean each had 11 genes. Populus trichocarpa (poplar contained a highly diversified gene family with 11 PPO genes, but several flowering plants had only a single PPO gene. By contrast, no PPO-like sequences were identified in several chlorophyte (green algae genomes or Arabidopsis (A. lyrata and A. thaliana. We found that many PPOs contained one or two introns often near the 3’ terminus. Furthermore, N-terminal amino acid sequence analysis using ChloroP and TargetP 1.1 predicted that several putative PPOs are synthesized via the secretory pathway, a unique finding as most PPOs are predicted to be chloroplast proteins. Phylogenetic reconstruction of these sequences revealed that large PPO gene repertoires in some species are mostly a consequence of independent bursts of gene duplication, while the lineage leading to Arabidopsis must have lost all PPO genes. Conclusion Our survey identified PPOs in gene families of varying sizes in all land plants except in the genus Arabidopsis. While we found variation in intron numbers and positions, overall PPO gene structure is congruent with the phylogenetic

  11. Genome-wide identification of the SWEET gene family in wheat.

    Science.gov (United States)

    Gao, Yue; Wang, Zi Yuan; Kumar, Vikranth; Xu, Xiao Feng; Yuan, De Peng; Zhu, Xiao Feng; Li, Tian Ya; Jia, Baolei; Xuan, Yuan Hu

    2018-02-05

    The SWEET (sugars will eventually be exported transporter) family is a newly characterized group of sugar transporters. In plants, the key roles of SWEETs in phloem transport, nectar secretion, pollen nutrition, stress tolerance, and plant-pathogen interactions have been identified. SWEET family genes have been characterized in many plant species, but a comprehensive analysis of SWEET members has not yet been performed in wheat. Here, 59 wheat SWEETs (hereafter TaSWEETs) were identified through homology searches. Analyses of phylogenetic relationships, numbers of transmembrane helices (TMHs), gene structures, and motifs showed that TaSWEETs carrying 3-7 TMHs could be classified into four clades with 10 different types of motifs. Examination of the expression patterns of 18 SWEET genes revealed that a few are tissue-specific while most are ubiquitously expressed. In addition, the stem rust-mediated expression patterns of SWEET genes were monitored using a stem rust-susceptible cultivar, 'Little Club' (LC). The resulting data showed that the expression of five out of the 18 SWEETs tested was induced following inoculation. In conclusion, we provide the first comprehensive analysis of the wheat SWEET gene family. Information regarding the phylogenetic relationships, gene structures, and expression profiles of SWEET genes in different tissues and following stem rust disease inoculation will be useful in identifying the potential roles of SWEETs in specific developmental and pathogenic processes. Copyright © 2017 Elsevier B.V. All rights reserved.

  12. Evolutionary Pattern and Regulation Analysis to Support Why Diversity Functions Existed within PPAR Gene Family Members

    Directory of Open Access Journals (Sweden)

    Tianyu Zhou

    2015-01-01

    Full Text Available Peroxisome proliferators-activated receptor (PPAR gene family members exhibit distinct patterns of distribution in tissues and differ in functions. The purpose of this study is to investigate the evolutionary impacts on diversity functions of PPAR members and the regulatory differences on gene expression patterns. 63 homology sequences of PPAR genes from 31 species were collected and analyzed. The results showed that three isolated types of PPAR gene family may emerge from twice times of gene duplication events. The conserved domains of HOLI (ligand binding domain of hormone receptors domain and ZnF_C4 (C4 zinc finger in nuclear in hormone receptors are essential for keeping basic roles of PPAR gene family, and the variant domains of LCRs may be responsible for their divergence in functions. The positive selection sites in HOLI domain are benefit for PPARs to evolve towards diversity functions. The evolutionary variants in the promoter regions and 3′ UTR regions of PPARs result into differential transcription factors and miRNAs involved in regulating PPAR members, which may eventually affect their expressions and tissues distributions. These results indicate that gene duplication event, selection pressure on HOLI domain, and the variants on promoter and 3′ UTR are essential for PPARs evolution and diversity functions acquired.

  13. Evolutionary Pattern and Regulation Analysis to Support Why Diversity Functions Existed within PPAR Gene Family Members.

    Science.gov (United States)

    Zhou, Tianyu; Yan, Xiping; Wang, Guosong; Liu, Hehe; Gan, Xiang; Zhang, Tao; Wang, Jiwen; Li, Liang

    2015-01-01

    Peroxisome proliferators-activated receptor (PPAR) gene family members exhibit distinct patterns of distribution in tissues and differ in functions. The purpose of this study is to investigate the evolutionary impacts on diversity functions of PPAR members and the regulatory differences on gene expression patterns. 63 homology sequences of PPAR genes from 31 species were collected and analyzed. The results showed that three isolated types of PPAR gene family may emerge from twice times of gene duplication events. The conserved domains of HOLI (ligand binding domain of hormone receptors) domain and ZnF_C4 (C4 zinc finger in nuclear in hormone receptors) are essential for keeping basic roles of PPAR gene family, and the variant domains of LCRs may be responsible for their divergence in functions. The positive selection sites in HOLI domain are benefit for PPARs to evolve towards diversity functions. The evolutionary variants in the promoter regions and 3' UTR regions of PPARs result into differential transcription factors and miRNAs involved in regulating PPAR members, which may eventually affect their expressions and tissues distributions. These results indicate that gene duplication event, selection pressure on HOLI domain, and the variants on promoter and 3' UTR are essential for PPARs evolution and diversity functions acquired.

  14. Evolutionary mechanisms driving the evolution of a large polydnavirus gene family coding for protein tyrosine phosphatases

    Directory of Open Access Journals (Sweden)

    Serbielle Céline

    2012-12-01

    Full Text Available Abstract Background Gene duplications have been proposed to be the main mechanism involved in genome evolution and in acquisition of new functions. Polydnaviruses (PDVs, symbiotic viruses associated with parasitoid wasps, are ideal model systems to study mechanisms of gene duplications given that PDV genomes consist of virulence genes organized into multigene families. In these systems the viral genome is integrated in a wasp chromosome as a provirus and virus particles containing circular double-stranded DNA are injected into the parasitoids’ hosts and are essential for parasitism success. The viral virulence factors, organized in gene families, are required collectively to induce host immune suppression and developmental arrest. The gene family which encodes protein tyrosine phosphatases (PTPs has undergone spectacular expansion in several PDV genomes with up to 42 genes. Results Here, we present strong indications that PTP gene family expansion occurred via classical mechanisms: by duplication of large segments of the chromosomally integrated form of the virus sequences (segmental duplication, by tandem duplications within this form and by dispersed duplications. We also propose a novel duplication mechanism specific to PDVs that involves viral circle reintegration into the wasp genome. The PTP copies produced were shown to undergo conservative evolution along with episodes of adaptive evolution. In particular recently produced copies have undergone positive selection in sites most likely involved in defining substrate selectivity. Conclusion The results provide evidence about the dynamic nature of polydnavirus proviral genomes. Classical and PDV-specific duplication mechanisms have been involved in the production of new gene copies. Selection pressures associated with antagonistic interactions with parasitized hosts have shaped these genes used to manipulate lepidopteran physiology with evidence for positive selection involved in

  15. Identification and characterization of NF-YB family genes in tung tree.

    Science.gov (United States)

    Yang, Susu; Wang, Yangdong; Yin, Hengfu; Guo, Haobo; Gao, Ming; Zhu, Huiping; Chen, Yicun

    2015-12-01

    The NF-YB transcription factor gene family encodes a subunit of the CCAAT box-binding factor (CBF), a highly conserved trimeric activator that strongly binds to the CCAAT box promoter element. Studies on model plants have shown that NF-YB proteins participate in important developmental and physiological processes, but little is known about NF-YB proteins in trees. Here, we identified seven NF-YB transcription factor-encoding genes in Vernicia fordii, an important oilseed tree in China. A phylogenetic analysis separated the genes into two groups; non-LEC1 type (VfNF-YB1, 5, 7, 9, 11, 13) and LEC1-type (VfNF-YB 14). A gene structure analysis showed that VfNF-YB 5 has three introns and the other genes have no introns. The seven VfNF-YB sequences contain highly conserved domains, a disordered region at the N terminus, and two long helix structures at the C terminus. Phylogenetic analyses showed that VfNF-YB family genes are highly homologous to GmNF-YB genes, and many of them are closely related to functionally characterized NF-YBs. In expression analyses of various tissues (root, stem, leaf, and kernel) and the root during pathogen infection, VfNF-YB1, 5, and 11 were dominantly expressed in kernels, and VfNF-YB7 and 9 were expressed only in the root. Different VfNF-YB family genes showed different responses to pathogen infection, suggesting that they play different roles in the pathogen response. Together, these findings represent the first extensive evaluation of the NF-YB family in tung tree and provide a foundation for dissecting the functions of VfNF-YB genes in seed development, stress adaption, fatty acid synthesis, and pathogen response.

  16. Human Intellectual Disability Genes Form Conserved Functional Modules in Drosophila

    Science.gov (United States)

    Oortveld, Merel A. W.; Keerthikumar, Shivakumar; Oti, Martin; Nijhof, Bonnie; Fernandes, Ana Clara; Kochinke, Korinna; Castells-Nobau, Anna; van Engelen, Eva; Ellenkamp, Thijs; Eshuis, Lilian; Galy, Anne; van Bokhoven, Hans; Habermann, Bianca; Brunner, Han G.; Zweier, Christiane; Verstreken, Patrik; Huynen, Martijn A.; Schenck, Annette

    2013-01-01

    Intellectual Disability (ID) disorders, defined by an IQ below 70, are genetically and phenotypically highly heterogeneous. Identification of common molecular pathways underlying these disorders is crucial for understanding the molecular basis of cognition and for the development of therapeutic intervention strategies. To systematically establish their functional connectivity, we used transgenic RNAi to target 270 ID gene orthologs in the Drosophila eye. Assessment of neuronal function in behavioral and electrophysiological assays and multiparametric morphological analysis identified phenotypes associated with knockdown of 180 ID gene orthologs. Most of these genotype-phenotype associations were novel. For example, we uncovered 16 genes that are required for basal neurotransmission and have not previously been implicated in this process in any system or organism. ID gene orthologs with morphological eye phenotypes, in contrast to genes without phenotypes, are relatively highly expressed in the human nervous system and are enriched for neuronal functions, suggesting that eye phenotyping can distinguish different classes of ID genes. Indeed, grouping genes by Drosophila phenotype uncovered 26 connected functional modules. Novel links between ID genes successfully predicted that MYCN, PIGV and UPF3B regulate synapse development. Drosophila phenotype groups show, in addition to ID, significant phenotypic similarity also in humans, indicating that functional modules are conserved. The combined data indicate that ID disorders, despite their extreme genetic diversity, are caused by disruption of a limited number of highly connected functional modules. PMID:24204314

  17. Nucleotide sequence of a human tRNA gene heterocluster

    International Nuclear Information System (INIS)

    Chang, Y.N.; Pirtle, I.L.; Pirtle, R.M.

    1986-01-01

    Leucine tRNA from bovine liver was used as a hybridization probe to screen a human gene library harbored in Charon-4A of bacteriophage lambda. The human DNA inserts from plaque-pure clones were characterized by restriction endonuclease mapping and Southern hybridization techniques, using both [3'- 32 P]-labeled bovine liver leucine tRNA and total tRNA as hybridization probes. An 8-kb Hind III fragment of one of these γ-clones was subcloned into the Hind III site of pBR322. Subsequent fine restriction mapping and DNA sequence analysis of this plasmid DNA indicated the presence of four tRNA genes within the 8-kb DNA fragment. A leucine tRNA gene with an anticodon of AAG and a proline tRNA gene with an anticodon of AGG are in a 1.6-kb subfragment. A threonine tRNA gene with an anticodon of UGU and an as yet unidentified tRNA gene are located in a 1.1-kb subfragment. These two different subfragments are separated by 2.8 kb. The coding regions of the three sequenced genes contain characteristic internal split promoter sequences and do not have intervening sequences. The 3'-flanking region of these three genes have typical RNA polymerase III termination sites of at least four consecutive T residues

  18. Origins of De Novo Genes in Human and Chimpanzee.

    Science.gov (United States)

    Ruiz-Orera, Jorge; Hernandez-Rodriguez, Jessica; Chiva, Cristina; Sabidó, Eduard; Kondova, Ivanela; Bontrop, Ronald; Marqués-Bonet, Tomàs; Albà, M Mar

    2015-12-01

    The birth of new genes is an important motor of evolutionary innovation. Whereas many new genes arise by gene duplication, others originate at genomic regions that did not contain any genes or gene copies. Some of these newly expressed genes may acquire coding or non-coding functions and be preserved by natural selection. However, it is yet unclear which is the prevalence and underlying mechanisms of de novo gene emergence. In order to obtain a comprehensive view of this process, we have performed in-depth sequencing of the transcriptomes of four mammalian species--human, chimpanzee, macaque, and mouse--and subsequently compared the assembled transcripts and the corresponding syntenic genomic regions. This has resulted in the identification of over five thousand new multiexonic transcriptional events in human and/or chimpanzee that are not observed in the rest of species. Using comparative genomics, we show that the expression of these transcripts is associated with the gain of regulatory motifs upstream of the transcription start site (TSS) and of U1 snRNP sites downstream of the TSS. In general, these transcripts show little evidence of purifying selection, suggesting that many of them are not functional. However, we find signatures of selection in a subset of de novo genes which have evidence of protein translation. Taken together, the data support a model in which frequently-occurring new transcriptional events in the genome provide the raw material for the evolution of new proteins.

  19. AtTZF gene family localizes to cytoplasmic foci

    OpenAIRE

    Pomeranz, Marcelo; Lin, Pei-Chi; Finer, John; Jang, Jyan-Chyun

    2010-01-01

    In eukaryotes, mRNA turnover and translational repression represent important regulatory steps in gene expression. Curiously, when under cellular stresses, factors involved in these processes aggregate into cytoplasmic foci known as Processing bodies (P-bodies) and Stress Granules (SGs). In animals, CCCH Tandem Zinc Finger (TZF) proteins play important roles in mRNA decay within P-bodies. TTP, a P-body localized mammalian TZF, can bind to the 3'UTRs of mRNAs containing AU-rich elements (AREs)...

  20. A mutation in the Norrie disease gene (NDP) associated with X-linked familial exudative vitreoretinopathy.

    Science.gov (United States)

    Chen, Z Y; Battinelli, E M; Fielder, A; Bundey, S; Sims, K; Breakefield, X O; Craig, I W

    1993-10-01

    Familial exudative vitreoretinopathy (FEVR) is a hereditary disorder characterized by an abnormality of the peripheral retina. Both autosomal dominant (adFEVR) and X-linked (XLFEVR) forms have been described, but the biochemical defect(s) underlying the symptoms are unknown. Molecular analysis of the Norrie gene locus (NDP) in a four generation FEVR family (shown previously to exhibit linkage to the X-chromosome markers DXS228 and MAOA (Xp11.4-p11.3)) reveals a missense mutation in the highly conserved region of the NDP gene, which caused a neutral amino acid substitution (Leu124Phe), was detected in all of the affected males, but not in the unaffected family members, nor in normal controls. The observations suggest that phenotypes of both XLFEVR and Norrie disease can result from mutations in the same gene.

  1. [Mutation analysis of FGFR3 gene in a family featuring hereditary dwarfism].

    Science.gov (United States)

    Zhang, Qiong; Jiang, Hai-ou; Quan, Qing-li; Li, Jun; He, Ting; Huang, Xue-shuang

    2011-12-01

    To investigate the clinical symptoms and potential mutation in FGFR3 gene for a family featuring hereditary dwarfism in order to attain diagnosis and provide prenatal diagnosis. Five patients and two unaffected relatives from the family, in addition with 100 healthy controls, were recruited. Genome DNA was extracted. Exons 10 and 13 of the FGFR3 gene were amplified using polymerase chain reaction (PCR). PCR products were sequenced in both directions. All patients had similar features including short stature, short limbs, lumbar hyperlordosis but normal craniofacial features. A heterozygous mutation G1620T (N540K) was identified in the cDNA from all patients but not in the unaffected relatives and 100 control subjects. A heterozygous G380R mutation was excluded. The hereditary dwarfism featured by this family has been caused by hypochondroplasia (HCH) due to a N540K mutation in the FGFR3 gene.

  2. Phylogenomic approaches to common problems encountered in the analysis of low copy repeats: The sulfotransferase 1A gene family example

    Directory of Open Access Journals (Sweden)

    Benner Steven A

    2005-03-01

    Full Text Available Abstract Background Blocks of duplicated genomic DNA sequence longer than 1000 base pairs are known as low copy repeats (LCRs. Identified by their sequence similarity, LCRs are abundant in the human genome, and are interesting because they may represent recent adaptive events, or potential future adaptive opportunities within the human lineage. Sequence analysis tools are needed, however, to decide whether these interpretations are likely, whether a particular set of LCRs represents nearly neutral drift creating junk DNA, or whether the appearance of LCRs reflects assembly error. Here we investigate an LCR family containing the sulfotransferase (SULT 1A genes involved in drug metabolism, cancer, hormone regulation, and neurotransmitter biology as a first step for defining the problems that those tools must manage. Results Sequence analysis here identified a fourth sulfotransferase gene, which may be transcriptionally active, located on human chromosome 16. Four regions of genomic sequence containing the four human SULT1A paralogs defined a new LCR family. The stem hominoid SULT1A progenitor locus was identified by comparative genomics involving complete human and rodent genomes, and a draft chimpanzee genome. SULT1A expansion in hominoid genomes was followed by positive selection acting on specific protein sites. This episode of adaptive evolution appears to be responsible for the dopamine sulfonation function of some SULT enzymes. Each of the conclusions that this bioinformatic analysis generated using data that has uncertain reliability (such as that from the chimpanzee genome sequencing project has been confirmed experimentally or by a "finished" chromosome 16 assembly, both of which were published after the submission of this manuscript. Conclusion SULT1A genes expanded from one to four copies in hominoids during intra-chromosomal LCR duplications, including (apparently one after the divergence of chimpanzees and humans. Thus, LCRs may

  3. Automated Identification of Core Regulatory Genes in Human Gene Regulatory Networks.

    Directory of Open Access Journals (Sweden)

    Vipin Narang

    Full Text Available Human gene regulatory networks (GRN can be difficult to interpret due to a tangle of edges interconnecting thousands of genes. We constructed a general human GRN from extensive transcription factor and microRNA target data obtained from public databases. In a subnetwork of this GRN that is active during estrogen stimulation of MCF-7 breast cancer cells, we benchmarked automated algorithms for identifying core regulatory genes (transcription factors and microRNAs. Among these algorithms, we identified K-core decomposition, pagerank and betweenness centrality algorithms as the most effective for discovering core regulatory genes in the network evaluated based on previously known roles of these genes in MCF-7 biology as well as in their ability to explain the up or down expression status of up to 70% of the remaining genes. Finally, we validated the use of K-core algorithm for organizing the GRN in an easier to interpret layered hierarchy where more influential regulatory genes percolate towards the inner layers. The integrated human gene and miRNA network and software used in this study are provided as supplementary materials (S1 Data accompanying this manuscript.

  4. Characterization of the human gene (TBXAS1) encoding thromboxane synthase.

    Science.gov (United States)

    Miyata, A; Yokoyama, C; Ihara, H; Bandoh, S; Takeda, O; Takahashi, E; Tanabe, T

    1994-09-01

    The gene encoding human thromboxane synthase (TBXAS1) was isolated from a human EMBL3 genomic library using human platelet thromboxane synthase cDNA as a probe. Nucleotide sequencing revealed that the human thromboxane synthase gene spans more than 75 kb and consists of 13 exons and 12 introns, of which the splice donor and acceptor sites conform to the GT/AG rule. The exon-intron boundaries of the thromboxane synthase gene were similar to those of the human cytochrome P450 nifedipine oxidase gene (CYP3A4) except for introns 9 and 10, although the primary sequences of these enzymes exhibited 35.8% identity each other. The 1.2-kb of the 5'-flanking region sequence contained potential binding sites for several transcription factors (AP-1, AP-2, GATA-1, CCAAT box, xenobiotic-response element, PEA-3, LF-A1, myb, basic transcription element and cAMP-response element). Primer-extension analysis indicated the multiple transcription-start sites, and the major start site was identified as an adenine residue located 142 bases upstream of the translation-initiation site. However, neither a typical TATA box nor a typical CAAT box is found within the 100-b upstream of the translation-initiation site. Southern-blot analysis revealed the presence of one copy of the thromboxane synthase gene per haploid genome. Furthermore, a fluorescence in situ hybridization study revealed that the human gene for thromboxane synthase is localized to band q33-q34 of the long arm of chromosome 7. A tissue-distribution study demonstrated that thromboxane synthase mRNA is widely expressed in human tissues and is particularly abundant in peripheral blood leukocyte, spleen, lung and liver. The low but significant levels of mRNA were observed in kidney, placenta and thymus.

  5. Characterization of the bovine pregnancy-associated glycoprotein gene family – analysis of gene sequences, regulatory regions within the promoter and expression of selected genes

    Directory of Open Access Journals (Sweden)

    Walker Angela M

    2009-04-01

    Full Text Available Abstract Background The Pregnancy-associated glycoproteins (PAGs belong to a large family of aspartic peptidases expressed exclusively in the placenta of species in the Artiodactyla order. In cattle, the PAG gene family is comprised of at least 22 transcribed genes, as well as some variants. Phylogenetic analyses have shown that the PAG family segregates into 'ancient' and 'modern' groupings. Along with sequence differences between family members, there are clear distinctions in their spatio-temporal distribution and in their relative level of expression. In this report, 1 we performed an in silico analysis of the bovine genome to further characterize the PAG gene family, 2 we scrutinized proximal promoter sequences of the PAG genes to evaluate the evolution pressures operating on them and to identify putative regulatory regions, 3 we determined relative transcript abundance of selected PAGs during pregnancy and, 4 we performed preliminary characterization of the putative regulatory elements for one of the candidate PAGs, bovine (bo PAG-2. Results From our analysis of the bovine genome, we identified 18 distinct PAG genes and 14 pseudogenes. We observed that the first 500 base pairs upstream of the translational start site contained multiple regions that are conserved among all boPAGs. However, a preponderance of conserved regions, that harbor recognition sites for putative transcriptional factors (TFs, were found to be unique to the modern boPAG grouping, but not the ancient boPAGs. We gathered evidence by means of Q-PCR and screening of EST databases to show that boPAG-2 is the most abundant of all boPAG transcripts. Finally, we provided preliminary evidence for the role of ETS- and DDVL-related TFs in the regulation of the boPAG-2 gene. Conclusion PAGs represent a relatively large gene family in the bovine genome. The proximal promoter regions of these genes display differences in putative TF binding sites, likely contributing to observed

  6. Estimating immunoregulatory gene networks in human herpesvirus type 6-infected T cells

    International Nuclear Information System (INIS)

    Takaku, Tomoiku; Ohyashiki, Junko H.; Zhang, Yu; Ohyashiki, Kazuma

    2005-01-01

    The immune response to viral infection involves complex network of dynamic gene and protein interactions. We present here the dynamic gene network of the host immune response during human herpesvirus type 6 (HHV-6) infection in an adult T-cell leukemia cell line. Using a pathway-focused oligonucleotide DNA microarray, we found a possible association between chemokine genes regulating Th1/Th2 balance and genes regulating T-cell proliferation during HHV-6B infection. Gene network analysis using an integrated comprehensive workbench, VoyaGene, revealed that a gene encoding a TEC-family kinase, ITK, might be a putative modulator in the host immune response against HHV-6B infection. We conclude that Th2-dominated inflammatory reaction in host cells may play an important role in HHV-6B-infected T cells, thereby suggesting the possibility that ITK might be a therapeutic target in diseases related to dysregulation of Th1/Th2 balance. This study describes a novel approach to find genes related with the complex host-virus interaction using microarray data employing the Bayesian statistical framework

  7. Application of DETECTER, an evolutionary genomic tool to analyze genetic variation, to the cystic fibrosis gene family

    Directory of Open Access Journals (Sweden)

    De Kee Danny W

    2006-03-01

    Full Text Available Abstract Background The medical community requires computational tools that distinguish missense genetic differences having phenotypic impact within the vast number of sense mutations that do not. Tools that do this will become increasingly important for those seeking to use human genome sequence data to predict disease, make prognoses, and customize therapy to individual patients. Results An approach, termed DETECTER, is proposed to identify sites in a protein sequence where amino acid replacements are likely to have a significant effect on phenotype, including causing genetic disease. This approach uses a model-dependent tool to estimate the normalized replacement rate at individual sites in a protein sequence, based on a history of those sites extracted from an evolutionary analysis of the corresponding protein family. This tool identifies sites that have higher-than-average, average, or lower-than-average rates of change in the lineage leading to the sequence in the population of interest. The rates are then combined with sequence data to determine the likelihoods that particular amino acids were present at individual sites in the evolutionary history of the gene family. These likelihoods are used to predict whether any specific amino acid replacements, if introduced at the site in a modern human population, would have a significant impact on fitness. The DETECTER tool is used to analyze the cystic fibrosis transmembrane conductance regulator (CFTR gene family. Conclusion In this system, DETECTER retrodicts amino acid replacements associated with the cystic fibrosis disease with greater accuracy than alternative approaches. While this result validates this approach for this particular family of proteins only, the approach may be applicable to the analysis of polymorphisms generally, including SNPs in a human population.

  8. Gene Transfer and Molecular Cloning of the Human NGF Receptor

    Science.gov (United States)

    Chao, Moses V.; Bothwell, Mark A.; Ross, Alonzo H.; Koprowski, Hilary; Lanahan, Anthony A.; Buck, C. Randall; Sehgal, Amita

    1986-04-01

    Nerve growth factor (NGF) and its receptor are important in the development of cells derived from the neural crest. Mouse L cell transformants have been generated that stably express the human NGF receptor gene transfer with total human DNA. Affinity cross-linking, metabolic labeling and immunoprecipitation, and equilibrium binding with 125I-labeled NGF revealed that this NGF receptor had the same size and binding characteristics as the receptor from human melanoma cells and rat PC12 cells. The sequences encoding the NGF receptor were molecularly cloned using the human Alu repetitive sequence as a probe. A cosmid clone that contained the human NGF receptor gene allowed efficient transfection and expression of the receptor.

  9. Data Resources for Biodemographic Studies on Familial Clustering of Human Longevity

    Directory of Open Access Journals (Sweden)

    1999-09-01

    Full Text Available The main cause that hampered many previous biodemographic studies of human longevity is the lack of appropriate data. At the same time, many existing data resources (millions of genealogical records are under-utilized, because their very existence is not widely known, let alone the quality and scientific value of these data sets are not yet validated. The purpose of this work is to review the data resources that could be used in familial studies of human longevity. This is an extended and supplemented version of the previous study made by the authors upon the request of the National Institute on Aging (1998 NIH Professional Service Contract. The review describes: (1 data resources developed for biodemographic studies, (2 data collected in the projects on historical demography, (3 data resources for long lived individuals and their families, (4 publicly available computerized genealogical data resources, (5 published genealogical and family history data. The review also contains the description of databases developed by the participants of the Research Workshops "Genes, Genealogies, and Longevity" organized by the Max Planck Institute for Demographic Research.

  10. Sex-Dependent Gene Expression in Human Pluripotent Stem Cells

    Directory of Open Access Journals (Sweden)

    Daniel Ronen

    2014-08-01

    Full Text Available Males and females have a variety of sexually dimorphic traits, most of which result from hormonal differences. However, differences between male and female embryos initiate very early in development, before hormonal influence begins, suggesting the presence of genetically driven sexual dimorphisms. By comparing the gene expression profiles of male and X-inactivated female human pluripotent stem cells, we detected Y-chromosome-driven effects. We discovered that the sex-determining gene SRY is expressed in human male pluripotent stem cells and is induced by reprogramming. In addition, we detected more than 200 differentially expressed autosomal genes in male and female embryonic stem cells. Some of these genes are involved in steroid metabolism pathways and lead to sex-dependent differentiation in response to the estrogen precursor estrone. Thus, we propose that the presence of the Y chromosome and specifically SRY may drive sex-specific differences in the growth and differentiation of pluripotent stem cells.

  11. Chromosomal localization of the human vesicular amine transporter genes

    Energy Technology Data Exchange (ETDEWEB)

    Peter, D.; Finn, P.; Liu, Y.; Roghani, A.; Edwards, R.H.; Klisak, I.; Kojis, T.; Heinzmann, C.; Sparkes, R.S. (UCLA School of Medicine, Los Angeles, CA (United States))

    1993-12-01

    The physiologic and behavioral effects of pharmacologic agents that interfere with the transport of monoamine neurotransmitters into vesicles suggest that vesicular amine transport may contribute to human neuropsychiatric disease. To determine whether an alteration in the genes that encode vesicular amine transport contributes to the inherited component of these disorders, the authors have isolated a human cDNA for the brain transporter and localized the human vesciular amine transporter genes. The human brain synaptic vesicle amine transporter (SVAT) shows unexpected conservation with rat SVAT in the regions that diverge extensively between rat SVAT and the rat adrenal chromaffin granule amine transporter (CGAT). Using the cloned sequences with a panel of mouse-human hybrids and in situ hybridization for regional localization, the adrenal CGAT gene (or VAT1) maps to human chromosome 8p21.3 and the brain SVAT gene (or VAT2) maps to chromosome 10q25. Both of these sites occur very close to if not within previously described deletions that produce severe but viable phenotypes. 26 refs., 3 figs., 1 tab.

  12. Characterization of human septic sera induced gene expression modulation in human myocytes

    Science.gov (United States)

    Hussein, Shaimaa; Michael, Paul; Brabant, Danielle; Omri, Abdelwahab; Narain, Ravin; Passi, Kalpdrum; Ramana, Chilakamarti V.; Parrillo, Joseph E.; Kumar, Anand; Parissenti, Amadeo; Kumar, Aseem

    2009-01-01

    To gain a better understanding of the gene expression changes that occurs during sepsis, we have performed a cDNA microarray study utilizing a tissue culture model that mimics human sepsis. This study utilized an in vitro model of cultured human fetal cardiac myocytes treated with 10% sera from septic patients or 10% sera from healthy volunteers. A 1700 cDNA expression microarray was used to compare the transcription profile from human cardiac myocytes treated with septic sera vs normal sera. Septic sera treatment of myocytes resulted in the down-regulation of 178 genes and the up-regulation of 4 genes. Our data indicate that septic sera induced cell cycle, metabolic, transcription factor and apoptotic gene expression changes in human myocytes. Identification and characterization of gene expression changes that occur during sepsis may lead to the development of novel therapeutics and diagnostics. PMID:19684886

  13. Genome-wide identification and characterization of WRKY gene family in Salix suchowensis.

    Science.gov (United States)

    Bi, Changwei; Xu, Yiqing; Ye, Qiaolin; Yin, Tongming; Ye, Ning

    2016-01-01

    WRKY proteins are the zinc finger transcription factors that were first identified in plants. They can specifically interact with the W-box, which can be found in the promoter region of a large number of plant target genes, to regulate the expressions of downstream target genes. They also participate in diverse physiological and growing processes in plants. Prior to this study, a plenty of WRKY genes have been identified and characterized in herbaceous species, but there is no large-scale study of WRKY genes in willow. With the whole genome sequencing of Salix suchowensis, we have the opportunity to conduct the genome-wide research for willow WRKY gene family. In this study, we identified 85 WRKY genes in the willow genome and renamed them from SsWRKY1 to SsWRKY85 on the basis of their specific distributions on chromosomes. Due to their diverse structural features, the 85 willow WRKY genes could be further classified into three main groups (group I-III), with five subgroups (IIa-IIe) in group II. With the multiple sequence alignment and the manual search, we found three variations of the WRKYGQK heptapeptide: WRKYGRK, WKKYGQK and WRKYGKK, and four variations of the normal zinc finger motif, which might execute some new biological functions. In addition, the SsWRKY genes from the same subgroup share the similar exon-intron structures and conserved motif domains. Further studies of SsWRKY genes revealed that segmental duplication events (SDs) played a more prominent role in the expansion of SsWRKY genes. Distinct expression profiles of SsWRKY genes with RNA sequencing data revealed that diverse expression patterns among five tissues, including tender roots, young leaves, vegetative buds, non-lignified stems and barks. With the analyses of WRKY gene family in willow, it is not only beneficial to complete the functional and annotation information of WRKY genes family in woody plants, but also provide important references to investigate the expansion and evolution of

  14. Diagnosing CADASIL using MRI: evidence from families with known mutations of Notch 3 gene

    International Nuclear Information System (INIS)

    Chawda, S.J.; Lange, R.P.J. de; St-Clair, D.; Hourihan, M.D.; Halpin, S.F.S.

    2000-01-01

    Clinical data and MRI findings are presented on 18 subjects from two families with neuropathologically confirmed CADASIL. DNA analysis revealed mutations in exon 4 of Notch 3 gene in both families. All family members with mutations in Notch 3 gene had extensive abnormalities on MRI, principally lesions in the white matter of the frontal lobes and in the external capsules. Of several family members in whom a diagnosis of CADASIL was suspected on the basis of minor symptoms, one had MRI changes consistent with CADASIL; none of these cases carried a mutation in the Notch 3 gene. MRI and clinical features that may alert the radiologist to the diagnosis of CADASIL are reviewed. However, a wide differential diagnosis exists for the MRI appearances of CADASIL, including multiple sclerosis and small-vessel disease secondary to hypertension. The definitive diagnosis cannot be made on MRI alone and requires additional evidence, where available, from a positive family history and by screening DNA for mutations of Notch 3 gene. (orig.)

  15. New mutations in the NHS gene in Nance-Horan Syndrome families from the Netherlands.

    Science.gov (United States)

    Florijn, Ralph J; Loves, Willem; Maillette de Buy Wenniger-Prick, Liesbeth J J M; Mannens, Marcel M A M; Tijmes, Nel; Brooks, Simon P; Hardcastle, Alison J; Bergen, Arthur A B

    2006-09-01

    Mutations in the NHS gene cause Nance-Horan Syndrome (NHS), a rare X-chromosomal recessive disorder with variable features, including congenital cataract, microphthalmia, a peculiar form of the ear and dental anomalies. We investigated the NHS gene in four additional families with NHS from the Netherlands, by dHPLC and direct sequencing. We identified an unique mutation in each family. Three out of these four mutations were not reported before. We report here the first splice site sequence alteration mutation and three protein truncating mutations. Our results suggest that X-linked cataract and NHS are allelic disorders.

  16. Evaluation of the norrie disease gene in a family with incontinentia pigmenti.

    Science.gov (United States)

    Shastry, B S; Trese, M T

    2000-01-01

    Incontinentia pigmenti (IP) is an ectodermal multisystem disorder which can affect dental, ocular, cardiac and neurologic structures. The ocular changes of IP can have a very similar appearance to the retinal detachment of X-linked familial exudative vitreoretinopathy, which has been shown to be caused by the mutations in the Norrie disease gene. Therefore, it is of interest to determine whether similar mutations in the gene can account for the retinal pathology in patients with IP. To test our hypothesis, we have analyzed the entire Norrie disease gene for a family with IP, by single strand conformational polymorphism followed by DNA sequencing. The sequencing data revealed no disease-specific sequence alterations. These data suggest that ocular findings of IP are perhaps associated with different genes and there is no direct relationship between the genotype and phenotype. Copyright 2000 S. Karger AG, Basel

  17. Evolutionary relationship and structural characterization of the EPF/EPFL gene family.

    Directory of Open Access Journals (Sweden)

    Naoki Takata

    Full Text Available EPF1-EPF2 and EPFL9/Stomagen act antagonistically in regulating leaf stomatal density. The aim of this study was to elucidate the evolutionary functional divergence of EPF/EPFL family genes. Phylogenetic analyses showed that AtEPFL9/Stomagen-like genes are conserved only in vascular plants and are closely related to AtEPF1/EPF2-like genes. Modeling showed that EPF/EPFL peptides share a common 3D structure that is constituted of a scaffold and loop. Molecular dynamics simulation suggested that AtEPF1/EPF2-like peptides form an additional disulfide bond in their loop regions and show greater flexibility in these regions than AtEPFL9/Stomagen-like peptides. This study uncovered the evolutionary relationship and the conformational divergence of proteins encoded by the EPF/EPFL family genes.

  18. Evolutionary relationship and structural characterization of the EPF/EPFL gene family.

    Science.gov (United States)

    Takata, Naoki; Yokota, Kiyonobu; Ohki, Shinya; Mori, Masashi; Taniguchi, Toru; Kurita, Manabu

    2013-01-01

    EPF1-EPF2 and EPFL9/Stomagen act antagonistically in regulating leaf stomatal density. The aim of this study was to elucidate the evolutionary functional divergence of EPF/EPFL family genes. Phylogenetic analyses showed that AtEPFL9/Stomagen-like genes are conserved only in vascular plants and are closely related to AtEPF1/EPF2-like genes. Modeling showed that EPF/EPFL peptides share a common 3D structure that is constituted of a scaffold and loop. Molecular dynamics simulation suggested that AtEPF1/EPF2-like peptides form an additional disulfide bond in their loop regions and show greater flexibility in these regions than AtEPFL9/Stomagen-like peptides. This study uncovered the evolutionary relationship and the conformational divergence of proteins encoded by the EPF/EPFL family genes.

  19. Global gene expression profiling of individual human oocytes and embryos demonstrates heterogeneity in early development.

    Directory of Open Access Journals (Sweden)

    Lisa Shaw

    Full Text Available Early development in humans is characterised by low and variable embryonic viability, reflected in low fecundity and high rates of miscarriage, relative to other mammals. Data from assisted reproduction programmes provides additional evidence that this is largely mediated at the level of embryonic competence and is highly heterogeneous among embryos. Understanding the basis of this heterogeneity has important implications in a number of areas including: the regulation of early human development, disorders of pregnancy, assisted reproduction programmes, the long term health of children which may be programmed in early development, and the molecular basis of pluripotency in human stem cell populations. We have therefore investigated global gene expression profiles using polyAPCR amplification and microarray technology applied to individual human oocytes and 4-cell and blastocyst stage embryos. In order to explore the basis of any variability in detail, each developmental stage is replicated in triplicate. Our data show that although transcript profiles are highly stage-specific, within each stage they are relatively variable. We describe expression of a number of gene families and pathways including apoptosis, cell cycle and amino acid metabolism, which are variably expressed and may be reflective of embryonic developmental competence. Overall, our data suggest that heterogeneity in human embryo developmental competence is reflected in global transcript profiles, and that the vast majority of existing human embryo gene expression data based on pooled oocytes and embryos need to be reinterpreted.

  20. Genome-wide identification and characterization of the SBP-box gene family in Petunia.

    Science.gov (United States)

    Zhou, Qin; Zhang, Sisi; Chen, Feng; Liu, Baojun; Wu, Lan; Li, Fei; Zhang, Jiaqi; Bao, Manzhu; Liu, Guofeng

    2018-03-12

    SQUAMOSA PROMOTER BINDING PROTEIN (SBP)-box genes encode a family of plant-specific transcription factors (TFs) that play important roles in many growth and development processes including phase transition, leaf initiation, shoot and inflorescence branching, fruit development and ripening etc. The SBP-box gene family has been identified and characterized in many species, but has not been well studied in Petunia, an important ornamental genus. We identified 21 putative SPL genes of Petunia axillaris and P. inflata from the reference genome of P. axillaris N and P. inflata S6, respectively, which were supported by the transcriptome data. For further confirmation, all the 21 genes were also cloned from P. hybrida line W115 (Mitchel diploid). Phylogenetic analysis based on the highly conserved SBP domains arranged PhSPLs in eight groups, analogous to those from Arabidopsis and tomato. Furthermore, the Petunia SPL genes had similar exon-intron structure and the deduced proteins contained very similar conserved motifs within the same subgroup. Out of 21 PhSPL genes, fourteen were predicted to be potential targets of PhmiR156/157, and the putative miR156/157 response elements (MREs) were located in the coding region of group IV, V, VII and VIII genes, but in the 3'-UTR regions of group VI genes. SPL genes were also identified from another two wild Petunia species, P. integrifolia and P. exserta, based on their transcriptome databases to investigate the origin of PhSPLs. Phylogenetic analysis and multiple alignments of the coding sequences of PhSPLs and their orthologs from wild species indicated that PhSPLs were originated mainly from P. axillaris. qRT-PCR analysis demonstrated differential spatiotemperal expression patterns of PhSPL genes in petunia and many were expressed predominantly in the axillary buds and/or inflorescences. In addition, overexpression of PhSPL9a and PhSPL9b in Arabidopsis suggested that these genes play a conserved role in promoting the vegetative

  1. Phylogenetic analysis of the expansion of the MATH-BTB gene family in the grasses.

    Science.gov (United States)

    Juranić, Martina; Dresselhaus, Thomas

    2014-01-01

    MATH-BTB proteins are known to act as substrate-specific adaptors of cullin3 (CUL3)-based ubiquitin E3 ligases to target protein for ubiquitination. In a previous study we reported the presence of 31 MATH-BTB genes in the maize genome and determined the regulatory role of the MATH-BTB protein MAB1 during meiosis to mitosis transition. In contrast to maize, there are only 6 homologous genes in the model plant Arabidopsis, while this family has largely expanded in grasses. Here, we report a phylogenetic analysis of the MATH-BTB gene family in 9 land plant species including various mosses, eudicots, and grasses. We extend a previous classification of the plant MATH-BTB family and additionally arrange the expanded group into 5 grass-specific clades. Synteny studies indicate that expansion occurred to a large extent due to local gene duplications. Expression studies of 3 closely related MATH-BTB genes in maize (MAB1-3) indicate highly specific expression pattern. In summary, this work provides a solid base for further studies comparing genetic and functional information of the MATH-BTB family especially in the grasses.

  2. [Study of gene mutation and pathogenetic mechanism for a family with Waardenburg syndrome].

    Science.gov (United States)

    Chen, Hongsheng; Liao, Xinbin; Liu, Yalan; He, Chufeng; Zhang, Hua; Jiang, Lu; Feng, Yong; Mei, Lingyun

    2017-08-10

    To explore the pathogenetic mechanism of a family affected with Waardenburg syndrome. Clinical data of the family was collected. Potential mutation of the MITF, SOX10 and SNAI2 genes were screened. Plasmids for wild type (WT) and mutant MITF proteins were constructed to determine their exogenous expression and subcellular distribution by Western blotting and immunofluorescence assay, respectively. A heterozygous c.763C>T (p.R255X) mutation was detected in exon 8 of the MITF gene in the proband and all other patients from the family. No pathological mutation of the SOX10 and SNAI2 genes was detected. The DNA sequences of plasmids of MITF wild and mutant MITF R255X were confirmed. Both proteins were detected with the expected size. WT MITF protein only localized in the nucleus, whereas R255X protein showed aberrant localization in the nucleus as well as the cytoplasm. The c.763C>T mutation of the MITF gene probably underlies the disease in this family. The mutation can affect the subcellular distribution of MITF proteins in vitro, which may shed light on the molecular mechanism of Waardenburg syndrome caused by mutations of the MITF gene.

  3. Prevalence of variations in melanoma susceptibility genes among Slovenian melanoma families

    Directory of Open Access Journals (Sweden)

    Besic Nikola

    2008-09-01

    Full Text Available Abstract Background Two high-risk genes have been implicated in the development of CM (cutaneous melanoma. Germline mutations of the CDKN2A gene are found in CDK4 gene reported to date. Beside those high penetrance genes, certain allelic variants of the MC1R gene modify the risk of developing the disease. The aims of our study were: to determine the prevalence of germline CDKN2A mutations and variants in members of families with familial CM and in patients with multiple primary CM; to search for possible CDK4 mutations, and to determine the frequency of variations in the MC1R gene. Methods From January 2001 until January 2007, 64 individuals were included in the study. The group included 28 patients and 7 healthy relatives belonging to 25 families, 26 patients with multiple primary tumors and 3 children with CM. Additionally 54 healthy individuals were included as a control group. Mutations and variants of the melanoma susceptibility genes were identified by direct sequencing. Results Seven families with CDKN2A mutations were discovered (7/25 or 28.0%. The L94Q mutation found in one family had not been previously reported in other populations. The D84N variant, with possible biological impact, was discovered in the case of patient without family history but with multiple primary CM. Only one mutation carrier was found in the control group. Further analysis revealed that c.540C>T heterozygous carriers were more common in the group of CM patients and their healthy relatives (11/64 vs. 2/54. One p14ARF variant was discovered in the control group and no mutations of the CDK4 gene were found. Most frequently found variants of the MC1R gene were T314T, V60L, V92M, R151C, R160W and R163Q with frequencies slightly higher in the group of patients and their relatives than in the group of controls, but the difference was statistically insignificant. Conclusion The present study has shown high prevalence of p16INK4A mutations in Slovenian population of

  4. Comprehensive identification and expression analysis of Hsp90s gene family in Solanum lycopersicum.

    Science.gov (United States)

    Zai, W S; Miao, L X; Xiong, Z L; Zhang, H L; Ma, Y R; Li, Y L; Chen, Y B; Ye, S G

    2015-07-14

    Heat shock protein 90 (Hsp90) is a protein produced by plants in response to adverse environmental stresses. In this study, we identified and analyzed Hsp90 gene family members using a bioinformatic method based on genomic data from tomato (Solanum lycopersicum L.). The results illustrated that tomato contains at least 7 Hsp90 genes distributed on 6 chromosomes; protein lengths ranged from 267-794 amino acids. Intron numbers ranged from 2-19 in the genes. The phylogenetic tree revealed that Hsp90 genes in tomato (Solanum lycopersicum L.), rice (Oryza sativa L.), and Arabidopsis (Arabidopsis thaliana L.) could be divided into 5 groups, which included 3 pairs of orthologous genes and 4 pairs of paralogous genes. Expression analysis of RNA-sequence data showed that the Hsp90-1 gene was specifically expressed in mature fruits, while Hsp90-5 and Hsp90-6 showed opposite expression patterns in various tissues of cultivated and wild tomatoes. The expression levels of the Hsp90-1, Hsp90-2, and Hsp90- 3 genes in various tissues of cultivated tomatoes were high, while both the expression levels of genes Hsp90-3 and Hsp90-4 were low. Additionally, quantitative real-time polymerase chain reaction showed that these genes were involved in the responses to yellow leaf curl virus in tomato plant leaves. Our results provide a foundation for identifying the function of the Hsp90 gene in tomato.

  5. The human cumulus--oocyte complex gene-expression profile

    Science.gov (United States)

    Assou, Said; Anahory, Tal; Pantesco, Véronique; Le Carrour, Tanguy; Pellestor, Franck; Klein, Bernard; Reyftmann, Lionel; Dechaud, Hervé; De Vos, John; Hamamah, Samir

    2006-01-01

    BACKGROUND The understanding of the mechanisms regulating human oocyte maturation is still rudimentary. We have identified transcripts differentially expressed between immature and mature oocytes, and cumulus cells. METHODS Using oligonucleotides microarrays, genome wide gene expression was studied in pooled immature and mature oocytes or cumulus cells from patients who underwent IVF. RESULTS In addition to known genes such as DAZL, BMP15 or GDF9, oocytes upregulated 1514 genes. We show that PTTG3 and AURKC are respectively the securin and the Aurora kinase preferentially expressed during oocyte meiosis. Strikingly, oocytes overexpressed previously unreported growth factors such as TNFSF13/APRIL, FGF9, FGF14, and IL4, and transcription factors including OTX2, SOX15 and SOX30. Conversely, cumulus cells, in addition to known genes such as LHCGR or BMPR2, overexpressed cell-tocell signaling genes including TNFSF11/RANKL, numerous complement components, semaphorins (SEMA3A, SEMA6A, SEMA6D) and CD genes such as CD200. We also identified 52 genes progressively increasing during oocyte maturation, comprising CDC25A and SOCS7. CONCLUSION The identification of genes up and down regulated during oocyte maturation greatly improves our understanding of oocyte biology and will provide new markers that signal viable and competent oocytes. Furthermore, genes found expressed in cumulus cells are potential markers of granulosa cell tumors. PMID:16571642

  6. Characterization of Soybean WRKY Gene Family and Identification of Soybean WRKY Genes that Promote Resistance to Soybean Cyst Nematode.

    Science.gov (United States)

    Yang, Yan; Zhou, Yuan; Chi, Yingjun; Fan, Baofang; Chen, Zhixiang

    2017-12-19

    WRKY proteins are a superfamily of plant transcription factors with important roles in plants. WRKY proteins have been extensively analyzed in plant species including Arabidopsis and rice. Here we report characterization of soybean WRKY gene family and their functional analysis in resistance to soybean cyst nematode (SCN), the most important soybean pathogen. Through search of the soybean genome, we identified 174 genes encoding WRKY proteins that can be classified into seven groups as established in other plants. WRKY variants including a WRKY-related protein unique to legumes have also been identified. Expression analysis reveals both diverse expression patterns in different soybean tissues and preferential expression of specific WRKY groups in certain tissues. Furthermore, a large number of soybean WRKY genes were responsive to salicylic acid. To identify soybean WRKY genes that promote soybean resistance to SCN, we first screened soybean WRKY genes for enhancing SCN resistance when over-expressed in transgenic soybean hairy roots. To confirm the results, we transformed five WRKY genes into a SCN-susceptible soybean cultivar and generated transgenic soybean lines. Transgenic soybean lines overexpressing three WRKY transgenes displayed increased resistance to SCN. Thus, WRKY genes could be explored to develop new soybean cultivars with enhanced resistance to SCN.

  7. Taking stock of work-family initiatives: How announcements of "family-friendly" human resource decisions affect shareholder value.

    OpenAIRE

    Michelle M. Arthur; Alison Cook

    2004-01-01

    This study examines share price reactions to 231 work-family human resource policies adopted by Fortune 500 companies and announced in the Wall Street Journal between 1971 and 1996. Consistent with past research, the results suggest that firm announcements of work-family initiatives positively affected shareholder return. The authors also empirically test three hypotheses concerning how the timing of work-family initiatives influences shareholder reaction. They find that a pioneering company ...

  8. X-exome sequencing of 405 unresolved families identifies seven novel intellectual disability genes.

    Science.gov (United States)

    Hu, H; Haas, S A; Chelly, J; Van Esch, H; Raynaud, M; de Brouwer, A P M; Weinert, S; Froyen, G; Frints, S G M; Laumonnier, F; Zemojtel, T; Love, M I; Richard, H; Emde, A-K; Bienek, M; Jensen, C; Hambrock, M; Fischer, U; Langnick, C; Feldkamp, M; Wissink-Lindhout, W; Lebrun, N; Castelnau, L; Rucci, J; Montjean, R; Dorseuil, O; Billuart, P; Stuhlmann, T; Shaw, M; Corbett, M A; Gardner, A; Willis-Owen, S; Tan, C; Friend, K L; Belet, S; van Roozendaal, K E P; Jimenez-Pocquet, M; Moizard, M-P; Ronce, N; Sun, R; O'Keeffe, S; Chenna, R; van Bömmel, A; Göke, J; Hackett, A; Field, M; Christie, L; Boyle, J; Haan, E; Nelson, J; Turner, G; Baynam, G; Gillessen-Kaesbach, G; Müller, U; Steinberger, D; Budny, B; Badura-Stronka, M; Latos-Bieleńska, A; Ousager, L B; Wieacker, P; Rodríguez Criado, G; Bondeson, M-L; Annerén, G; Dufke, A; Cohen, M; Van Maldergem, L; Vincent-Delorme, C; Echenne, B; Simon-Bouy, B; Kleefstra, T; Willemsen, M; Fryns, J-P; Devriendt, K; Ullmann, R; Vingron, M; Wrogemann, K; Wienker, T F; Tzschach, A; van Bokhoven, H; Gecz, J; Jentsch, T J; Chen, W; Ropers, H-H; Kalscheuer, V M

    2016-01-01

    X-linked intellectual disability (XLID) is a clinically and genetically heterogeneous disorder. During the past two decades in excess of 100 X-chromosome ID genes have been identified. Yet, a large number of families mapping to the X-chromosome remained unresolved suggesting that more XLID genes or loci are yet to be identified. Here, we have investigated 405 unresolved families with XLID. We employed massively parallel sequencing of all X-chromosome exons in the index males. The majority of these males were previously tested negative for copy number variations and for mutations in a subset of known XLID genes by Sanger sequencing. In total, 745 X-chromosomal genes were screened. After stringent filtering, a total of 1297 non-recurrent exonic variants remained for prioritization. Co-segregation analysis of potential clinically relevant changes revealed that 80 families (20%) carried pathogenic variants in established XLID genes. In 19 families, we detected likely causative protein truncating and missense variants in 7 novel and validated XLID genes (CLCN4, CNKSR2, FRMPD4, KLHL15, LAS1L, RLIM and USP27X) and potentially deleterious variants in 2 novel candidate XLID genes (CDK16 and TAF1). We show that the CLCN4 and CNKSR2 variants impair protein functions as indicated by electrophysiological studies and altered differentiation of cultured primary neurons from Clcn4(-/-) mice or after mRNA knock-down. The newly identified and candidate XLID proteins belong to pathways and networks with established roles in cognitive function and intellectual disability in particular. We suggest that systematic sequencing of all X-chromosomal genes in a cohort of patients with genetic evidence for X-chromosome locus involvement may resolve up to 58% of Fragile X-negative cases.

  9. New mutation of the MPZ gene in a family with the Dejerine-Sottas disease phenotype.

    Science.gov (United States)

    Floroskufi, Paraskewi; Panas, Marios; Karadima, Georgia; Vassilopoulos, Demetris

    2007-05-01

    Charcot-Marie-Tooth disease type 1B is associated with mutations in the myelin protein zero gene. In the present study a new myelin protein zero gene mutation (c.89T>C,Ile30Thr) was detected in a family with the Dejerine-Sottas disease phenotype. The results support the hypothesis that severe, early-onset neuropathy may be related to either an alteration of a conserved amino acid or a disruption of the tertiary structure of myelin protein zero.

  10. Genome-wide analysis of the GRAS gene family in Prunus mume.

    Science.gov (United States)

    Lu, Jiuxing; Wang, Tao; Xu, Zongda; Sun, Lidan; Zhang, Qixiang

    2015-02-01

    Prunus mume is an ornamental flower and fruit tree in Rosaceae. We investigated the GRAS gene family to improve the breeding and cultivation of P. mume and other Rosaceae fruit trees. The GRAS gene family encodes transcriptional regulators that have diverse functions in plant growth and development, such as gibberellin and phytochrome A signal transduction, root radial patterning, and axillary meristem formation and gametogenesis in the P. mume genome. Despite the important roles of these genes in plant growth regulation, no findings on the GRAS genes of P. mume have been reported. In this study, we discerned phylogenetic relationships of P. mume GRAS genes, and their locations, structures in the genome and expression levels of different tissues. Out of 46 identified GRAS genes, 45 were located on the 8 P. mume chromosomes. Phylogenetic results showed that these genes could be classified into 11 groups. We found that Group X was P. mume-specific, and three genes of Group IX clustered with the rice-specific gene Os4. We speculated that these genes existed before the divergence of dicotyledons and monocotyledons and were lost in Arabidopsis. Tissue expression analysis indicated that 13 genes showed high expression levels in roots, stems, leaves, flowers and fruits, and were related to plant growth and development. Functional analysis of 24 GRAS genes and an orthologous relationship analysis indicated that many functioned during plant growth and flower and fruit development. Our bioinformatics analysis provides valuable information to improve the economic, agronomic and ecological benefits of P. mume and other Rosaceae fruit trees.

  11. Genome-wide analysis of the WRKY gene family in cotton.

    Science.gov (United States)

    Dou, Lingling; Zhang, Xiaohong; Pang, Chaoyou; Song, Meizhen; Wei, Hengling; Fan, Shuli; Yu, Shuxun

    2014-12-01

    WRKY proteins are major transcription factors involved in regulating plant growth and development. Although many studies have focused on the functional identification of WRKY genes, our knowledge concerning many areas of WRKY gene biology is limited. For example, in cotton, the phylogenetic characteristics, global expression patterns, molecular mechanisms regulating expression, and target genes/pathways of WRKY genes are poorly characterized. Therefore, in this study, we present a genome-wide analysis of the WRKY gene family in cotton (Gossypium raimondii and Gossypium hirsutum). We identified 116 WRKY genes in G. raimondii from the completed genome sequence, and we cloned 102 WRKY genes in G. hirsutum. Chromosomal location analysis indicated that WRKY genes in G. raimondii evolved mainly from segmental duplication followed by tandem amplifications. Phylogenetic analysis of alga, bryophyte, lycophyta, monocot and eudicot WRKY domains revealed family member expansion with increasing complexity of the plant body. Microarray, expression profiling and qRT-PCR data revealed that WRKY genes in G. hirsutum may regulate the development of fibers, anthers, tissues (roots, stems, leaves and embryos), and are involved in the response to stresses. Expression analysis showed that most group II and III GhWRKY genes are highly expressed under diverse stresses. Group I members, representing the ancestral form, seem to be insensitive to abiotic stress, with low expression divergence. Our results indicate that cotton WRKY genes might have evolved by adaptive duplication, leading to sensitivity to diverse stresses. This study provides fundamental information to inform further analysis and understanding of WRKY gene functions in cotton species.

  12. Nomenclature for alleles of the human carboxylesterase 1 gene

    DEFF Research Database (Denmark)

    Rasmussen, Henrik B.; Madsen, Majbritt B.; Bjerre, Ditte

    2017-01-01

    The carboxylesterase 1 gene (CES1) in humans encodes a hydrolase, which is implicated in the metabolism of several commonly used drugs 1. This gene is located on chromosome 16 with a highly homologous pseudogene, CES1P1, in its proximity. A duplicated segment of CES1 replaces most of CES1P1 in some...... appears to be low 8,13. The formation of hybrids consisting of a gene and a related pseudogene has been reported for other genes than CES1. This includes the hybrids of the gene encoding cytochrome P450 2D6 (CYP2D6) and pseudogene CYP2D7, that is, the so-called CYP2D7/D6 hybrids 14......,15. These are categorized as CYP2D6 variants and not as variants of pseudogene CYP2D716....

  13. Genome-wide association study identifies candidate genes for male fertility traits in humans.

    Science.gov (United States)

    Kosova, Gülüm; Scott, Nicole M; Niederberger, Craig; Prins, Gail S; Ober, Carole

    2012-06-08

    Despite the fact that hundreds of genes are known to affect fertility in animal models, relatively little is known about genes that influence natural fertility in humans. To broadly survey genes contributing to variation in male fertility, we conducted a genome-wide association study (GWAS) of two fertility traits (family size and birth rate) in 269 married men who are members of a founder population of European descent that proscribes contraception and has large family sizes. Associations between ∼250,000 autosomal SNPs and the fertility traits were examined. A total of 41 SNPs with p ≤ 1 × 10(-4) for either trait were taken forward to a validation study of 123 ethnically diverse men from Chicago who had previously undergone semen analyses. Nine (22%) of the SNPs associated with reduced fertility in the GWAS were also associated with one or more of the ten measures of reduced sperm quantity and/or function, yielding 27 associations with p values LRRC32, which encodes a latent transforming growth factor β (TGF-β) receptor on regulatory T cells. We suggest that mutations in these genes that are more severe may account for some of the unexplained infertility (or subfertility) in the general population. Copyright © 2012 The American Society of Human Genetics. Published by Elsevier Inc. All rights reserved.

  14. Gene expression in the aging human brain: an overview.

    Science.gov (United States)

    Mohan, Adith; Mather, Karen A; Thalamuthu, Anbupalam; Baune, Bernhard T; Sachdev, Perminder S

    2016-03-01

    The review aims to provide a summary of recent developments in the study of gene expression in the aging human brain. Profiling differentially expressed genes or 'transcripts' in the human brain over the course of normal aging has provided valuable insights into the biological pathways that appear activated or suppressed in late life. Genes mediating neuroinflammation and immune system activation in particular, show significant age-related upregulation creating a state of vulnerability to neurodegenerative and neuropsychiatric disease in the aging brain. Cellular ionic dyshomeostasis and age-related decline in a host of molecular influences on synaptic efficacy may underlie neurocognitive decline in later life. Critically, these investigations have also shed light on the mobilization of protective genetic responses within the aging human brain that help determine health and disease trajectories in older age. There is growing interest in the study of pre and posttranscriptional regulators of gene expression, and the role of noncoding RNAs in particular, as mediators of the phenotypic diversity that characterizes human brain aging. Gene expression studies in healthy brain aging offer an opportunity to unravel the intricately regulated cellular underpinnings of neurocognitive aging as well as disease risk and resiliency in late life. In doing so, new avenues for early intervention in age-related neurodegenerative disease could be investigated with potentially significant implications for the development of disease-modifying therapies.

  15. Mechanosensitive promoter region in the human HB-GAM gene

    DEFF Research Database (Denmark)

    Liedert, Astrid; Kassem, Moustapha; Claes, Lutz

    2009-01-01

    Mechanical loading is essential for maintaining bone mass in the adult skeleton. However, the underlying process of the transfer of the physical stimulus into a biochemical response, which is termed mechanotransduction is poorly understood. Mechanotransduction results in the modulation of gene...... cells. Analysis of the human HB-GAM gene upstream regulatory region with luciferase reporter gene assays revealed that the upregulation of HB-GAM expression occurred at the transcriptional level and was mainly dependent on the HB-GAM promoter region most upstream containing three potential AP-1 binding...

  16. P450XXI (steroid 21-hydroxylase) gene deletions are not found in family studies of congenital adrenal hyperplasia

    International Nuclear Information System (INIS)

    Matteson, K.J.; Phillips, J.A. III; Miller, W.L.; Chung, B.C.; Orlando, P.J.; Frisch, H.; Ferrandez, A.; Burr, I.M.

    1987-01-01

    Congenital adrenal hyperplasia (CAH) is a common genetic disorder due to defective 21-hydroxylation of steroid hormones. The human P450XXIA2 gene encodes cytochrome P450c21 [steroid 21-monooxygenase (steroid 21-hydroxylase)], which mediates 21-hydroxylation. The P450XXIA2 gene may be distinguished from the duplicated P450XXIA1 pseudogene by cleavage with the restriction endonuclease Taq I, with the XXIA2 gene characterized by a 3.7-kilobase (kb) fragment and the XXIA1 pseudogene characterized by a 3.2-kb fragment. Restriction endonuclease mapping by several laboratories has suggested that deletion of the P450XXIA2 gene occurs in about 25% of patients with CAH, as their genomic DNA lacks detectable 3.7-kb Taq I fragments. The authors have cloned human P450c21 cDNA and used it to study genomic DNA prepared from 51 persons in 10 families, each of which includes 2 or more persons with CAH. After Taq I digestion, apparent deletions are seen in 7 of the 20 alleles of the probands; using EcoRI, apparent deletions are seen in 9 of the 20 alleles. However, the apparently deleted alleles seen with Taq I do not coincide with those seen with EcoRI. Furthermore, studies with Bgl II, EcoRI, Kpn I, and Xba I yield normal patterns with at least two enzymes in all cases. Since all probands yielded normal patterns with at least two of the five enzymes used, they conclude that the P450XXIA2 gene deletions widely reported in CAH patients probably represent gene conversions, unequal crossovers,or polymorphisms rather than simple gene deletions

  17. Relation between HLA genes, human skin volatiles and attractiveness of humans to malaria mosquitoes

    NARCIS (Netherlands)

    Verhulst, N.O.; Beijleveld, H.; Qiu, Y.T.; Maliepaard, C.A.; Verduyn, W.; Haasnoot, G.W.; Claas, F.H.J.; Mumm, R.; Bouwmeester, H.J.; Takken, W.; Loon, van J.J.A.; Smallegange, R.C.

    2013-01-01

    Chemical cues are considered to be the most important cues for mosquitoes to find their hosts and humans can be ranked for attractiveness to mosquitoes based on the chemical cues they emit. Human leukocyte antigen (HLA) genes are considered to be involved in the regulation of human body odor and may

  18. Roles of the Y chromosome genes in human cancers

    Directory of Open Access Journals (Sweden)

    Tatsuo Kido

    2015-06-01

    Full Text Available Male and female differ genetically by their respective sex chromosome composition, that is, XY as male and XX as female. Although both X and Y chromosomes evolved from the same ancestor pair of autosomes, the Y chromosome harbors male-specific genes, which play pivotal roles in male sex determination, germ cell differentiation, and masculinization of various tissues. Deletions or translocation of the sex-determining gene, SRY, from the Y chromosome causes disorders of sex development (previously termed as an intersex condition with dysgenic gonads. Failure of gonadal development results not only in infertility, but also in increased risks of germ cell tumor (GCT, such as gonadoblastoma and various types of testicular GCT. Recent studies demonstrate that either loss of Y chromosome or ectopic expression of Y chromosome genes is closely associated with various male-biased diseases, including selected somatic cancers. These observations suggest that the Y-linked genes are involved in male health and diseases in more frequently than expected. Although only a small number of protein-coding genes are present in the male-specific region of Y chromosome, the impacts of Y chromosome genes on human diseases are still largely unknown, due to lack of in vivo models and differences between the Y chromosomes of human and rodents. In this review, we highlight the involvement of selected Y chromosome genes in cancer development in men.

  19. DRUMS: a human disease related unique gene mutation search engine.

    Science.gov (United States)

    Li, Zuofeng; Liu, Xingnan; Wen, Jingran; Xu, Ye; Zhao, Xin; Li, Xuan; Liu, Lei; Zhang, Xiaoyan

    2011-10-01

    With the completion of the human genome project and the development of new methods for gene variant detection, the integration of mutation data and its phenotypic consequences has become more important than ever. Among all available resources, locus-specific databases (LSDBs) curate one or more specific genes' mutation data along with high-quality phenotypes. Although some genotype-phenotype data from LSDB have been integrated into central databases little effort has been made to integrate all these data by a search engine approach. In this work, we have developed disease related unique gene mutation search engine (DRUMS), a search engine for human disease related unique gene mutation as a convenient tool for biologists or physicians to retrieve gene variant and related phenotype information. Gene variant and phenotype information were stored in a gene-centred relational database. Moreover, the relationships between mutations and diseases were indexed by the uniform resource identifier from LSDB, or another central database. By querying DRUMS, users can access the most popular mutation databases under one interface. DRUMS could be treated as a domain specific search engine. By using web crawling, indexing, and searching technologies, it provides a competitively efficient interface for searching and retrieving mutation data and their relationships to diseases. The present system is freely accessible at http://www.scbit.org/glif/new/drums/index.html. © 2011 Wiley-Liss, Inc.

  20. Nucleotide sequence of the human N-myc gene

    International Nuclear Information System (INIS)

    Stanton, L.W.; Schwab, M.; Bishop, J.M.

    1986-01-01

    Human neuroblastomas frequently display amplification and augmented expression of a gene known as N-myc because of its similarity to the protooncogene c-myc. It has therefore been proposed that N-myc is itself a protooncogene, and subsequent tests have shown that N-myc and c-myc have similar biological activities in cell culture. The authors have now detailed the kinship between N-myc and c-myc by determining the nucleotide sequence of human N-myc and deducing the amino acid sequence of the protein encoded by the gene. The topography of N-myc is strikingly similar to that of c-myc: both genes contain three exons of similar lengths; the coding elements of both genes are located in the second and third exons; and both genes have unusually long 5' untranslated regions in their mRNAs, with features that raise the possibility that expression of the genes may be subject to similar controls of translation. The resemblance between the proteins encoded by N-myc and c-myc sustains previous suspicions that the genes encode related functions

  1. Genome-wide survey and characterization of the WRKY gene family in Populus trichocarpa.

    Science.gov (United States)

    He, Hongsheng; Dong, Qing; Shao, Yuanhua; Jiang, Haiyang; Zhu, Suwen; Cheng, Beijiu; Xiang, Yan

    2012-07-01

    WRKY transcription factors participate in diverse physiological and developmental processes in plants. They have highly conserved WRKYGQK amino acid sequences in their N-termini, followed by the novel zinc-finger-like motifs, Cys₂His₂ or Cys₂HisCys. To date, numerous WRKY genes have been identified and characterized in a number of herbaceous species. Survey and characterization of WRKY genes in a ligneous species would facilitate a better understanding of the evolutionary processes and functions of this gene family. In this study, 104 poplar WRKY genes (PtWRKY) were identified in the latest poplar genome sequence. According to their structural features, the predicted members were divided into the previously defined groups I-III, as described in rice. In addition, chromosomal localization of the genes demonstrated that there might be WRKY gene hot spots in 2.3 Mb regions on chromosome 14. Furthermore, approximately 83% (86 out of 104) WRKY genes participated in gene duplication events, including 69% (29 out of 42) gene pairs which exhibited segmental duplication. Using semi-quantitative RT-PCR, the expression patterns of subgroup III genes were investigated under different stresses [cold, drought, salinity and salicylic acid (SA)]. The data revealed that these genes presented different expression levels in response to various stress conditions. Expression analysis exhibited PtWRKY76 gene induced markedly in 0.1 mM SA or 25% PEG-6000 treatment. The results presented here provide a fundamental clue for cloning specific function genes in further studies and applications. This study identified 104 poplar WRKY genes and demonstrated WRKY gene hot spots on chromosome 14. Furthermore, semi-quantitative RT-PCR showed variable stress responses in subgroup III.

  2. A scale invariant clustering of genes on human chromosome 7

    Directory of Open Access Journals (Sweden)

    Kendal Wayne S

    2004-01-01

    Full Text Available Abstract Background Vertebrate genes often appear to cluster within the background of nontranscribed genomic DNA. Here an analysis of the physical distribution of gene structures on human chromosome 7 was performed to confirm the presence of clustering, and to elucidate possible underlying statistical and biological mechanisms. Results Clustering of genes was confirmed by virtue of a variance of the number of genes per unit physical length that exceeded the respective mean. Further evidence for clustering came from a power function relationship between the variance and mean that possessed an exponent of 1.51. This power function implied that the spatial distribution of genes on chromosome 7 was scale invariant, and that the underlying statistical distribution had a Poisson-gamma (PG form. A PG distribution for the spatial scattering of genes was validated by stringent comparisons of both the predicted variance to mean power function and its cumulative distribution function to data derived from chromosome 7. Conclusion The PG distribution was consistent with at least two different biological models: In the microrearrangement model, the number of genes per unit length of chromosome represented the contribution of a random number of smaller chromosomal segments that had originated by random breakage and reconstruction of more primitive chromosomes. Each of these smaller segments would have necessarily contained (on average a gamma distributed number of genes. In the gene cluster model, genes would be scattered randomly to begin with. Over evolutionary timescales, tandem duplication, mutation, insertion, deletion and rearrangement could act at these gene sites through a stochastic birth death and immigration process to yield a PG distribution. On the basis of the gene position data alone it was not possible to identify the biological model which best explained the observed clustering. However, the underlying PG statistical model implicated neutral

  3. Genetic Variants Contribute to Gene Expression Variability in Humans

    Science.gov (United States)

    Hulse, Amanda M.; Cai, James J.

    2013-01-01

    Expression quantitative trait loci (eQTL) studies have established convincing relationships between genetic variants and gene expression. Most of these studies focused on the mean of gene expression level, but not the variance of gene expression level (i.e., gene expression variability). In the present study, we systematically explore genome-wide association between genetic variants and gene expression variability in humans. We adapt the double generalized linear model (dglm) to simultaneously fit the means and the variances of gene expression among the three possible genotypes of a biallelic SNP. The genomic loci showing significant association between the variances of gene expression and the genotypes are termed expression variability QTL (evQTL). Using a data set of gene expression in lymphoblastoid cell lines (LCLs) derived from 210 HapMap individuals, we identify cis-acting evQTL involving 218 distinct genes, among which 8 genes, ADCY1, CTNNA2, DAAM2, FERMT2, IL6, PLOD2, SNX7, and TNFRSF11B, are cross-validated using an extra expression data set of the same LCLs. We also identify ∼300 trans-acting evQTL between >13,000 common SNPs and 500 randomly selected representative genes. We employ two distinct scenarios, emphasizing single-SNP and multiple-SNP effects on expression variability, to explain the formation of evQTL. We argue that detecting evQTL may represent a novel method for effectively screening for genetic interactions, especially when the multiple-SNP influence on expression variability is implied. The implication of our results for revealing genetic mechanisms of gene expression variability is discussed. PMID:23150607

  4. Diversification and evolution of the SDG gene family in Brassica rapa after the whole genome triplication.

    Science.gov (United States)

    Dong, Heng; Liu, Dandan; Han, Tianyu; Zhao, Yuxue; Sun, Ji; Lin, Sue; Cao, Jiashu; Chen, Zhong-Hua; Huang, Li

    2015-11-24

    Histone lysine methylation, controlled by the SET Domain Group (SDG) gene family, is part of the histone code that regulates chromatin function and epigenetic control of gene expression. Analyzing the SDG gene family in Brassica rapa for their gene structure, domain architecture, subcellular localization, rate of molecular evolution and gene expression pattern revealed common occurrences of subfunctionalization and neofunctionalization in BrSDGs. In comparison with Arabidopsis thaliana, the BrSDG gene family was found to be more divergent than AtSDGs, which might partly explain the rich variety of morphotypes in B. rapa. In addition, a new evolutionary pattern of the four main groups of SDGs was presented, in which the Trx group and the SUVR subgroup evolved faster than the E(z), Ash groups and the SUVH subgroup. These differences in evolutionary rate among the four main groups of SDGs are perhaps due to the complexity and variability of the regions that bind with biomacromolecules, which guide SDGs to their target loci.

  5. [Genome-wide identification and bioinformatic analysis of PPR gene family in tomato].

    Science.gov (United States)

    Ding, Anming; Li, Ling; Qu, Xu; Sun, Tingting; Chen, Yaqiong; Zong, Peng; Li, Zunqiang; Gong, Daping; Sun, Yuhe

    2014-01-01

    Pentatricopeptide repeats (PPRs) genes constitute one of the largest gene families in plants, which play a broad and essential role in plant growth and development. In this study, the protein sequences annotated by the tomato (S. lycopersicum L.) genome project were screened with the Pfam PPR sequences. A total of 471 putative PPR-encoding genes were identified. Based on the motifs defined in A. thaliana L., protein structure and conserved sequences for each tomato motif were analyzed. We also analyzed phylogenetic relationship, subcellular localization, expression and GO analysis of the identified gene sequences. Our results demonstrate that tomato PPR gene family contains two subfamilies, P and PLS, each accounting for half of the family. PLS subfamily can be divided into four subclasses i.e., PLS, E, E+ and DYW. Each subclass of sequences forms a clade in the phylogenetic tree. The PPR motifs were found highly conserved among plants. The tomato PPR genes were distributed over 12 chromosomes and most of them lack introns. The majority of PPR proteins harbor mitochondrial or chloroplast localization sequences, whereas GO analysis showed that most PPR proteins participate in RNA-related biological processes.

  6. Rapid expansion of the protein disulfide isomerase gene family facilitates the folding of venom peptides

    DEFF Research Database (Denmark)

    Safavi-Hemami, Helena; Li, Qing; Jackson, Ronneshia L.

    2016-01-01

    Formation of correct disulfide bonds in the endoplasmic reticulum is a crucial step for folding proteins destined for secretion. Protein disulfide isomerases (PDIs) play a central role in this process. We report a previously unidentified, hypervariable family of PDIs that represents the most...... diverse gene family of oxidoreductases described in a single genus to date. These enzymes are highly expressed specifically in the venom glands of predatory cone snails, animals that synthesize a remarkably diverse set of cysteine-rich peptide toxins (conotoxins). Enzymes in this PDI family, termed...

  7. The nuclear IκB family of proteins controls gene regulation and immune homeostasis.

    Science.gov (United States)

    MaruYama, Takashi

    2015-10-01

    The inhibitory IκB family of proteins is subdivided into two groups based on protein localization in the cytoplasm or in the nucleus. These proteins interact with NF-κB, a major transcription factor regulating the expression of many inflammatory cytokines, by modulating its transcriptional activity. However, nuclear IκB family proteins not only interact with NF-κB to change its transcriptional activity, but they also bind to chromatin and control gene expression. This review provides an overview of nuclear IκB family proteins and their role in immune homeostasis. Copyright © 2015 Elsevier B.V. All rights reserved.

  8. Evolutionary Conservation in Genes Underlying Human Psychiatric Disorders

    Directory of Open Access Journals (Sweden)

    Lisa Michelle Ogawa

    2014-05-01

    Full Text Available Many psychiatric diseases observed in humans have tenuous or absent analogs in other species. Most notable among these are schizophrenia and autism. One hypothesis has posited that these diseases have arisen as a consequence of human brain evolution, for example, that the same processes that led to advances in cognition, language, and executive function also resulted in novel diseases in humans when dysfunctional. Here, the molecular evolution of genes associated with these and other psychiatric disorders are compared among species. Genes associated with psychiatric disorders are drawn from the literature and orthologous sequences are collected from eleven primate species (human, chimpanzee, bonobo, gorilla, orangutan, gibbon, macaque, baboon, marmoset, squirrel monkey, and galago and thirty one non-primate mammalian species. Evolutionary parameters, including dN/dS, are calculated for each gene and compared between disease classes and among species, focusing on humans and primates compared to other mammals and on large-brained taxa (cetaceans, rhinoceros, walrus, bear, and elephant compared to their small-brained sister species. Evidence of differential selection in primates supports the hypothesis that schizophrenia and autism are a cost of higher brain function. Through this work a better understanding of the molecular evolution of the human brain, the pathophysiology of disease, and the genetic basis of human psychiatric disease is gained.

  9. Comparative genomic analysis of the WRKY III gene family in populus, grape, arabidopsis and rice.

    Science.gov (United States)

    Wang, Yiyi; Feng, Lin; Zhu, Yuxin; Li, Yuan; Yan, Hanwei; Xiang, Yan

    2015-09-08

    WRKY III genes have significant functions in regulating plant development and resistance. In plant, WRKY gene family has been studied in many species, however, there still lack a comprehensive analysis of WRKY III genes in the woody plant species poplar, three representative lineages of flowering plant species are incorporated in most analyses: Arabidopsis (a model plant for annual herbaceous dicots), grape (one model plant for perennial dicots) and Oryza sativa (a model plant for monocots). In this study, we identified 10, 6, 13 and 28 WRKY III genes in the genomes of Populus trichocarpa, grape (Vitis vinifera), Arabidopsis thaliana and rice (Oryza sativa), respectively. Phylogenetic analysis revealed that the WRKY III proteins could be divided into four clades. By microsynteny analysis, we found that the duplicated regions were more conserved between poplar and grape than Arabidopsis or rice. We dated their duplications by Ks analysis of Populus WRKY III genes and demonstrated that all the blocks were formed after the divergence of monocots and dicots. Strong purifying selection has played a key role in the maintenance of WRKY III genes in Populus. Tissue expression analysis of the WRKY III genes in Populus revealed that five were most highly expressed in the xylem. We also performed quantitative real-time reverse transcription PCR analysis of WRKY III genes in Populus treated with salicylic acid, abscisic acid and polyethylene glycol to explore their stress-related expression patterns. This study highlighted the duplication and diversification of the WRKY III gene family in Populus and provided a comprehensive analysis of this gene family in the Populus genome. Our results indicated that the majority of WRKY III genes of Populus was expanded by large-scale gene duplication. The expression pattern of PtrWRKYIII gene identified that these genes play important roles in the xylem during poplar growth and development, and may play crucial role in defense to drought

  10. Emergence of a Homo sapiens-specific gene family and chromosome 16p11.2 CNV susceptibility.

    Science.gov (United States)

    Nuttle, Xander; Giannuzzi, Giuliana; Duyzend, Michael H; Schraiber, Joshua G; Narvaiza, Iñigo; Sudmant, Peter H; Penn, Osnat; Chiatante, Giorgia; Malig, Maika; Huddleston, John; Benner, Chris; Camponeschi, Francesca; Ciofi-Baffoni, Simone; Stessman, Holly A F; Marchetto, Maria C N; Denman, Laura; Harshman, Lana; Baker, Carl; Raja, Archana; Penewit, Kelsi; Janke, Nicolette; Tang, W Joyce; Ventura, Mario; Banci, Lucia; Antonacci, Francesca; Akey, Joshua M; Amemiya, Chris T; Gage, Fred H; Reymond, Alexandre; Eichler, Evan E

    2016-08-11

    Genetic differences that specify unique aspects of human evolution have typically been identified by comparative analyses between the genomes of humans and closely related primates, including more recently the genomes of archaic hominins. Not all regions of the genome, however, are equally amenable to such study. Recurrent copy number variation (CNV) at chromosome 16p11.2 accounts for approximately 1% of cases of autism and is mediated by a complex set of segmental duplications, many of which arose recently during human evolution. Here we reconstruct the evolutionary history of the locus and identify bolA family member 2 (BOLA2) as a gene duplicated exclusively in Homo sapiens. We estimate that a 95-kilobase-pair segment containing BOLA2 duplicated across the critical region approximately 282 thousand years ago (ka), one of the latest among a series of genomic changes that dramatically restructured the locus during hominid evolution. All humans examined carried one or more copies of the duplication, which nearly fixed early in the human lineage--a pattern unlikely to have arisen so rapidly in the absence of selection (P sapiens-specific duplication. In summary, the duplicative transposition of BOLA2 at the root of the H. sapiens lineage about 282 ka simultaneously increased copy number of a gene associated with iron homeostasis and predisposed our species to recurrent rearrangements associated with disease.

  11. Gene Environment Interactions and Predictors of Colorectal Cancer in Family-Based, Multi-Ethnic Groups

    Directory of Open Access Journals (Sweden)

    S. Pamela K. Shiao

    2018-02-01

    Full Text Available For the personalization of polygenic/omics-based health care, the purpose of this study was to examine the gene–environment interactions and predictors of colorectal cancer (CRC by including five key genes in the one-carbon metabolism pathways. In this proof-of-concept study, we included a total of 54 families and 108 participants, 54 CRC cases and 54 matched family friends representing four major racial ethnic groups in southern California (White, Asian, Hispanics, and Black. We used three phases of data analytics, including exploratory, family-based analyses adjusting for the dependence within the family for sharing genetic heritage, the ensemble method, and generalized regression models for predictive modeling with a machine learning validation procedure to validate the results for enhanced prediction and reproducibility. The results revealed that despite the family members sharing genetic heritage, the CRC group had greater combined gene polymorphism rates than the family controls (p < 0.05, on MTHFR C677T, MTR A2756G, MTRR A66G, and DHFR 19 bp except MTHFR A1298C. Four racial groups presented different polymorphism rates for four genes (all p < 0.05 except MTHFR A1298C. Following the ensemble method, the most influential factors were identified, and the best predictive models were generated by using the generalized regression models, with Akaike’s information criterion and leave-one-out cross validation methods. Body mass index (BMI and gender were consistent predictors of CRC for both models when individual genes versus total polymorphism counts were used, and alcohol use was interactive with BMI status. Body mass index status was also interactive with both gender and MTHFR C677T gene polymorphism, and the exposure to environmental pollutants was an additional predictor. These results point to the important roles of environmental and modifiable factors in relation to gene–environment interactions in the prevention of CRC.

  12. Resources, attractiveness, family commitment; reproductive decisions in human mate choice.

    Science.gov (United States)

    Bereczkei, T; Voros, S; Gal, A; Bernath, L

    1997-08-01

    This study of reproductive decisions in human mate selection used data from "lonely hearts" advertisements to examine a series of predictions based on the mate preferences of male and females relating to age; physical appearance; financial condition and socioeconomic status; family commitment and personal traits; short- and long-term mating; and marital status and preexisting children. The sample consisted of 1000 personal advertisements (500 male) placed in two daily, national papers between February and October 1994 in Hungary. The research procedure included a pilot study of 150 advertisers (75 male) to refine the categories examined. Analysis was performed using 1) a matrix with one axis referring to offers and the other to demands of males and females separately; 2) a matrix of offers only to derive correlated traits of claims by males and females; and 3) a matrix with columns describing sex, offers, demands, advertiser's age, and required age and a row for each of the 1000 samples. It was found that men preferred younger mates, while women preferred older ones. Men were more likely to seek physical attractiveness, while women were more likely to seek financial resources (ranked 7th) and high status (ranked 6th). Women strongly preferred male domestic virtue and family commitment, and twice as many women as men demanded long-term relationships. Women more frequently declared preexisting children, and men exhibited a reluctance to accept these children. Both males and females employed "trade-off" strategies, making greater demands if they felt they had attractive offers.

  13. Identification of pathogenic gene variants in small families with intellectually disabled siblings by exome sequencing

    NARCIS (Netherlands)

    Schuurs-Hoeijmakers, J.H.M.; Silfhout, A.T. van; Vissers, L.E.L.M.; Vondervoort, I.I.G.M. van de; Bon, B.W.M. van; Ligt, J. de; Gilissen, C.F.; Hehir-Kwa, J.Y.; Neveling, K.; Rosario, M. del; Hira, G.; Reitano, S.; Vitello, A.; Failla, P.; Greco, D.; Fichera, M.; Galesi, O.; Kleefstra, T.; Greally, M.T.; Ockeloen, C.W.; Willemsen, M.H.; Bongers, E.M.; Janssen, I.M.; Pfundt, R.P.; Veltman, J.A.; Romano, C; Willemsen, M.A.; Bokhoven, H. van; Brunner, H.G.; Vries, L.B.A. de; Brouwer, A.P. de

    2013-01-01

    BACKGROUND: Intellectual disability (ID) is a common neurodevelopmental disorder affecting 1-3% of the general population. Mutations in more than 10% of all human genes are considered to be involved in this disorder, although the majority of these genes are still unknown. OBJECTIVES: We investigated

  14. Genome-wide identification and expression analysis of the WRKY gene family in cassava

    Directory of Open Access Journals (Sweden)

    Yunxie eWei

    2016-02-01

    Full Text Available The WRKY family, a large family of transcription factors (TFs found in higher plants, plays central roles in many aspects of physiological processes and adaption to environment. However, little information is available regarding the WRKY family in cassava (Manihot esculenta. In the present study, 85 WRKY genes were identified from the cassava genome and classified into three groups according to conserved WRKY domains and zinc-finger structure. Conserved motif analysis showed that all of the identified MeWRKYs had the conserved WRKY domain. Gene structure analysis suggested that the number of introns in MeWRKY genes varied from 1 to 5, with the majority of MeWRKY genes containing 3 exons. Expression profiles of MeWRKY genes in different tissues and in response to drought stress were analyzed using the RNA-seq technique. The results showed that 72 MeWRKY genes had differential expression in their transcript abundance and 78 MeWRKY genes were differentially expressed in response to drought stresses in different accessions, indicating their contribution to plant developmental processes and drought stress resistance in cassava. Finally, the expression of 9 WRKY genes was analyzed by qRT-PCR under osmotic, salt, ABA, H2O2, and cold treatments, indicating that MeWRKYs may be involved in different signaling pathways. Taken together, this systematic analysis identifies some tissue-specific and abiotic stress-responsive candidate MeWRKY genes for further functional assays in planta, and provides a solid foundation for understanding of abiotic stress responses and signal transduction mediated by WRKYs in cassava.

  15. Genome-Wide Identification and Expression Analysis of the WRKY Gene Family in Cassava.

    Science.gov (United States)

    Wei, Yunxie; Shi, Haitao; Xia, Zhiqiang; Tie, Weiwei; Ding, Zehong; Yan, Yan; Wang, Wenquan; Hu, Wei; Li, Kaimian

    2016-01-01

    The WRKY family, a large family of transcription factors (TFs) found in higher plants, plays central roles in many aspects of physiological processes and adaption to environment. However, little information is available regarding the WRKY family in cassava (Manihot esculenta). In the present study, 85 WRKY genes were identified from the cassava genome and classified into three groups according to conserved WRKY domains and zinc-finger structure. Conserved motif analysis showed that all of the identified MeWRKYs had the conserved WRKY domain. Gene structure analysis suggested that the number of introns in MeWRKY genes varied from 1 to 5, with the majority of MeWRKY genes containing three exons. Expression profiles of MeWRKY genes in different tissues and in response to drought stress were analyzed using the RNA-seq technique. The results showed that 72 MeWRKY genes had differential expression in their transcript abundance and 78 MeWRKY genes were differentially expressed in response to drought stresses in different accessions, indicating their contribution to plant developmental processes and drought stress resistance in cassava. Finally, the expression of 9 WRKY genes was analyzed by qRT-PCR under osmotic, salt, ABA, H2O2, and cold treatments, indicating that MeWRKYs may be involved in different signaling pathways. Taken together, this systematic analysis identifies some tissue-specific and abiotic stress-responsive candidate MeWRKY genes for further functional assays in planta, and provides a solid foundation for understanding of abiotic stress responses and signal transduction mediated by WRKYs in cassava.

  16. Three novel PHEX gene mutations in four Chinese families with X-linked dominant hypophosphatemic rickets

    Energy Technology Data Exchange (ETDEWEB)

    Kang, Qing-lin [Department of Orthopedic Surgery, Shanghai Jiao Tong University Affiliated Sixth People' s Hospital, Shanghai 200233 (China); Xu, Jia [Department of Orthopedic Surgery, Shanghai Jiao Tong University Affiliated Sixth People' s Hospital, Shanghai 200233 (China); Metabolic Bone Disease and Genetic Research Unit, Department of Osteoporosis and Bone Diseases, Shanghai Jiao Tong University Affiliated Sixth People' s Hospital, Shanghai 200233 (China); Medical College of Soochow University, Suzhou, Jiangsu province 215000 (China); Zhang, Zeng [Department of Orthopedic Surgery, Shanghai Jiao Tong University Affiliated Sixth People' s Hospital, Shanghai 200233 (China); Metabolic Bone Disease and Genetic Research Unit, Department of Osteoporosis and Bone Diseases, Shanghai Jiao Tong University Affiliated Sixth People' s Hospital, Shanghai 200233 (China); He, Jin-wei [Metabolic Bone Disease and Genetic Research Unit, Department of Osteoporosis and Bone Diseases, Shanghai Jiao Tong University Affiliated Sixth People' s Hospital, Shanghai 200233 (China); Lu, Lian-song [Department of Orthopedic Surgery, Shanghai Jiao Tong University Affiliated Sixth People' s Hospital, Shanghai 200233 (China); Medical College of Soochow University, Suzhou, Jiangsu province 215000 (China); Fu, Wen-zhen [Metabolic Bone Disease and Genetic Research Unit, Department of Osteoporosis and Bone Diseases, Shanghai Jiao Tong University Affiliated Sixth People' s Hospital, Shanghai 200233 (China); Zhang, Zhen-lin, E-mail: zzl2002@medmail.com.cn [Metabolic Bone Disease and Genetic Research Unit, Department of Osteoporosis and Bone Diseases, Shanghai Jiao Tong University Affiliated Sixth People' s Hospital, Shanghai 200233 (China)

    2012-07-13

    Highlights: Black-Right-Pointing-Pointer In our study, all of the patients were of Han Chinese ethnicity, which were rarely reported. Black-Right-Pointing-Pointer We identified three novel PHEX gene mutations in four unrelated families with XLH. Black-Right-Pointing-Pointer We found that the relationship between the phenotype and genotype of the PHEX gene was not invariant. Black-Right-Pointing-Pointer We found that two PHEX gene sites, p.534 and p.731, were conserved. -- Abstract: Background: X-linked hypophosphatemia (XLH), the most common form of inherited rickets, is a dominant disorder that is characterized by renal phosphate wasting with hypophosphatemia, abnormal bone mineralization, short stature, and rachitic manifestations. The related gene with inactivating mutations associated with XLH has been identified as PHEX, which is a phosphate-regulating gene with homologies to endopeptidases on the X chromosome. In this study, a variety of PHEX mutations were identified in four Chinese families with XLH. Methods: We investigated four unrelated Chinese families who exhibited typical features of XLH by using PCR to analyze mutations that were then sequenced. The laboratory and radiological investigations were conducted simultaneously. Results: Three novel mutations were found in these four families: one frameshift mutation, c.2033dupT in exon 20, resulting in p.T679H; one nonsense mutation, c.1294A > T in exon 11, resulting in p.K432X; and one missense mutation, c.2192T > C in exon 22, resulting in p.F731S. Conclusions: We found that the PHEX gene mutations were responsible for XLH in these Chinese families. Our findings are useful for understanding the genetic basis of Chinese patients with XLH.

  17. Three novel PHEX gene mutations in four Chinese families with X-linked dominant hypophosphatemic rickets

    International Nuclear Information System (INIS)

    Kang, Qing-lin; Xu, Jia; Zhang, Zeng; He, Jin-wei; Lu, Lian-song; Fu, Wen-zhen; Zhang, Zhen-lin

    2012-01-01

    Highlights: ► In our study, all of the patients were of Han Chinese ethnicity, which were rarely reported. ► We identified three novel PHEX gene mutations in four unrelated families with XLH. ► We found that the relationship between the phenotype and genotype of the PHEX gene was not invariant. ► We found that two PHEX gene sites, p.534 and p.731, were conserved. -- Abstract: Background: X-linked hypophosphatemia (XLH), the most common form of inherited rickets, is a dominant disorder that is characterized by renal phosphate wasting with hypophosphatemia, abnormal bone mineralization, short stature, and rachitic manifestations. The related gene with inactivating mutations associated with XLH has been identified as PHEX, which is a phosphate-regulating gene with homologies to endopeptidases on the X chromosome. In this study, a variety of PHEX mutations were identified in four Chinese families with XLH. Methods: We investigated four unrelated Chinese families who exhibited typical features of XLH by using PCR to analyze mutations that were then sequenced. The laboratory and radiological investigations were conducted simultaneously. Results: Three novel mutations were found in these four families: one frameshift mutation, c.2033dupT in exon 20, resulting in p.T679H; one nonsense mutation, c.1294A > T in exon 11, resulting in p.K432X; and one missense mutation, c.2192T > C in exon 22, resulting in p.F731S. Conclusions: We found that the PHEX gene mutations were responsible for XLH in these Chinese families. Our findings are useful for understanding the genetic basis of Chinese patients with XLH.

  18. Comprehensive Genomic Identification and Expression Analysis of the Phosphate Transporter (PHT) Gene Family in Apple.

    Science.gov (United States)

    Sun, Tingting; Li, Mingjun; Shao, Yun; Yu, Lingyan; Ma, Fengwang

    2017-01-01

    Elemental phosphorus (Pi) is essential to plant growth and development. The family of phosphate transporters (PHTs) mediates the uptake and translocation of Pi inside the plants. Members include five sub-cellular phosphate transporters that play different roles in Pi uptake and transport. We searched the Genome Database for Rosaceae and identified five clusters of phosphate transporters in apple ( Malus domestica ), including 37 putative genes. The MdPHT1 family contains 14 genes while MdPHT2 has two, MdPHT3 has seven, MdPHT4 has 11, and MdPHT5 has three. Our overview of this gene family focused on structure, chromosomal distribution and localization, phylogenies, and motifs. These genes displayed differential expression patterns in various tissues. For example, expression was high for MdPHT1;12, MdPHT3;6 , and MdPHT3;7 in the roots, and was also increased in response to low-phosphorus conditions. In contrast, MdPHT4;1, MdPHT4;4 , and MdPHT4;10 were expressed only in the leaves while transcript levels of MdPHT1;4, MdPHT1;12 , and MdPHT5;3 were highest in flowers. In general, these 37 genes were regulated significantly in either roots or leaves in response to the imposition of phosphorus and/or drought stress. The results suggest that members of the PHT family function in plant adaptations to adverse growing environments. Our study will lay a foundation for better understanding the PHT family evolution and exploring genes of interest for genetic improvement in apple.

  19. Novel mutations in Norrie disease gene in Japanese patients with Norrie disease and familial exudative vitreoretinopathy.

    Science.gov (United States)

    Kondo, Hiroyuki; Qin, Minghui; Kusaka, Shunji; Tahira, Tomoko; Hasebe, Haruyuki; Hayashi, Hideyuki; Uchio, Eiichi; Hayashi, Kenshi

    2007-03-01

    To search for mutations in the Norrie disease gene (NDP) in Japanese patients with familial exudative vitreoretinopathy (FEVR) and Norrie disease (ND) and to delineate the mutation-associated clinical features. Direct sequencing after polymerase chain reaction of all exons of the NDP gene was performed on blood collected from 62 probands (31 familial and 31 simplex) with FEVR, from 3 probands with ND, and from some of their family members. The clinical symptoms and signs in the patients with mutations were assessed. X-inactivation in the female carriers was examined in three FEVR families by using leukocyte DNA. Four novel mutations-I18K, K54N, R115L, and IVS2-1G-->A-and one reported mutation, R97P, in the NDP gene were identified in six families. The severity of vitreoretinopathy varied among these patients. Three probands with either K54N or R115L had typical features of FEVR, whereas the proband with R97P had those of ND. Families with IVS2-1G-->A exhibited either ND or FEVR characteristics. A proband with I18K presented with significant phenotypic heterogeneity between the two eyes. In addition, affected female carriers in a family harboring the K54N mutation presented with different degrees of vascular abnormalities in the periphery of the retina. X-inactivation profiles indicated that the skewing was not significantly different between affected and unaffected women. These observations indicate that mutations of the NDP gene can cause ND and 6% of FEVR cases in the Japanese population. The X-inactivation assay with leukocytes may not be predictive of the presence of a mutation in affected female carriers.

  20. Evolutionary Relationship and Structural Characterization of the EPF/EPFL Gene Family

    OpenAIRE

    Takata, Naoki; Yokota, Kiyonobu; Ohki, Shinya; Mori, Masashi; Taniguchi, Toru; Kurita, Manabu

    2013-01-01

    EPF1-EPF2 and EPFL9/Stomagen act antagonistically in regulating leaf stomatal density. The aim of this study was to elucidate the evolutionary functional divergence of EPF/EPFL family genes. Phylogenetic analyses showed that AtEPFL9/Stomagen-like genes are conserved only in vascular plants and are closely related to AtEPF1/EPF2-like genes. Modeling showed that EPF/EPFL peptides share a common 3D structure that is constituted of a scaffold and loop. Molecular dynamics simulation suggested that...

  1. Whole genome duplications and expansion of the vertebrate GATA transcription factor gene family

    Directory of Open Access Journals (Sweden)

    Bowerman Bruce

    2009-08-01

    Full Text Available Abstract Background GATA transcription factors influence many developmental processes, including the specification of embryonic germ layers. The GATA gene family has significantly expanded in many animal lineages: whereas diverse cnidarians have only one GATA transcription factor, six GATA genes have been identified in many vertebrates, five in many insects, and eleven to thirteen in Caenorhabditis nematodes. All bilaterian animal genomes have at least one member each of two classes, GATA123 and GATA456. Results We have identified one GATA123 gene and one GATA456 gene from the genomic sequence of two invertebrate deuterostomes, a cephalochordate (Branchiostoma floridae and a hemichordate (Saccoglossus kowalevskii. We also have confirmed the presence of six GATA genes in all vertebrate genomes, as well as additional GATA genes in teleost fish. Analyses of conserved sequence motifs and of changes to the exon-intron structure, and molecular phylogenetic analyses of these deuterostome GATA genes support their origin from two ancestral deuterostome genes, one GATA 123 and one GATA456. Comparison of the conserved genomic organization across vertebrates identified eighteen paralogous gene families linked to multiple vertebrate GATA genes (GATA paralogons, providing the strongest evidence yet for expansion of vertebrate GATA gene families via genome duplication events. Conclusion From our analysis, we infer the evolutionary birth order and relationships among vertebrate GATA transcription factors, and define their expansion via multiple rounds of whole genome duplication events. As the genomes of four independent invertebrate deuterostome lineages contain single copy GATA123 and GATA456 genes, we infer that the 0R (pre-genome duplication invertebrate deuterostome ancestor also had two GATA genes, one of each class. Synteny analyses identify duplications of paralogous chromosomal regions (paralogons, from single ancestral vertebrate GATA123 and GATA456

  2. Cytotoxicity and gene expression profiling of polyhexamethylene guanidine hydrochloride in human alveolar A549 cells.

    Science.gov (United States)

    Jung, Ha-Na; Zerin, Tamanna; Podder, Biswajit; Song, Ho-Yeon; Kim, Yong-Sik

    2014-06-01

    In Korea, lung disease of children and pregnant women associated with humidifier disinfectant use has become a major concern. A common sterilizer is polyhexamethylene guanidine (PHMG), a member of the guanidine family of antiseptics. This study was done to elucidate the putative cytotoxic effect of PHMG and the PHMG-mediated altered gene expression in human alveolar epithelial A549 cells in vitro. Cell viability analyses revealed the potent cytotoxicity of PHMG, with cell death evident at as low as 5 μg/mL. Death was dose- and time-dependent, and was associated with formation of intracellular reactive oxygen species, and apoptosis significantly, at even 2 μg/mL concentration. The gene expression profile in A549 cells following 24 h exposure to 5 μg/mL of PHMG was investigated using DNA microarray analysis. Changes in gene expression relevant to the progression of cell death included induction of genes related to apoptosis, autophagy, fibrosis, and cell cycle. However, the expressions of genes encoding antioxidant and detoxifying enzymes were down-regulated or not affected. The altered expression of selected genes was confirmed by quantitative reverse transcription-polymerase chain reaction and Western blot analyses. The collective data suggest that PHMG confers cellular toxicity through the generation of intracellular reactive oxygen species and alteration of gene expression. Copyright © 2014 Elsevier Ltd. All rights reserved.

  3. The SLC24 gene family of Na⁺/Ca²⁺-K⁺ exchangers: from sight and smell to memory consolidation and skin pigmentation.

    Science.gov (United States)

    Schnetkamp, Paul P M

    2013-01-01

    Members of the SLC24 gene family encode K(+)-dependent Na(+)/Ca(2+) exchangers (NCKX) that utilize both the inward Na(+) and outward K(+) gradients to extrude Ca(2+) from cells. There are five human SLC24 genes that play a role in biological process as diverse as vision in retinal rod and cone photoreceptors, olfaction, skin pigmentation and at least three of the five genes are also widely expressed in the brain. Here I review the functional, physiological and structural features of NCKX proteins that have emerged in the past few years. Copyright © 2012 Elsevier Ltd. All rights reserved.

  4. The human oxytocin gene promoter is regulated by estrogens.

    Science.gov (United States)

    Richard, S; Zingg, H H

    1990-04-15

    Gonadal steroids affect brain function primarily by altering the expression of specific genes, yet the specific mechanisms by which neuronal target genes undergo such regulation are unknown. Recent evidence suggests that the expression of the neuropeptide gene for oxytocin (OT) is modulated by estrogens. We therefore examined the possibility that this regulation occurred via a direct interaction of the estrogen-receptor complex with cis-acting elements flanking the OT gene. DNA-mediated gene transfer experiments were performed using Neuro-2a neuroblastoma cells and chimeric plasmids containing portions of the human OT gene 5'-glanking region linked to the chloramphenicol acetyltransferase gene. We identified a 19-base pair region located at -164 to -146 upstream of the transcription start site which is capable of conferring estrogen responsiveness to the homologous as well as to a heterologous promoter. The hormonal response is strictly dependent on the presence of intracellular estrogen receptors, since estrogen induced stimulation occurred only in Neuro-2a cells co-transfected with an expression vector for the human estrogen receptor. The identified region contains a novel imperfect palindrome (GGTGACCTTGACC) with sequence similarity to other estrogen response elements (EREs). To define cis-acting elements that function in synergism with the ERE, sequences 3' to the ERE were deleted, including the CCAAT box, two additional motifs corresponding to the right half of the ERE palindrome (TGACC), as well as a CTGCTAA heptamer similar to the "elegans box" found in Caenorhabditis elegans. Interestingly, optimal function of the identified ERE was fully independent of these elements and only required a short promoter region (-49 to +36). Our studies define a molecular mechanism by which estrogens can directly modulate OT gene expression. However, only a subset of OT neurons are capable of binding estrogens, therefore, direct action of estrogens on the OT gene may be

  5. Gene Structures, Evolution, Classification and Expression Profiles of the Aquaporin Gene Family in Castor Bean (Ricinus communis L..

    Directory of Open Access Journals (Sweden)

    Zhi Zou

    Full Text Available Aquaporins (AQPs are a class of integral membrane proteins that facilitate the passive transport of water and other small solutes across biological membranes. Castor bean (Ricinus communis L., Euphobiaceae, an important non-edible oilseed crop, is widely cultivated for industrial, medicinal and cosmetic purposes. Its recently available genome provides an opportunity to analyze specific gene families. In this study, a total of 37 full-length AQP genes were identified from the castor bean genome, which were assigned to five subfamilies, including 10 plasma membrane intrinsic proteins (PIPs, 9 tonoplast intrinsic proteins (TIPs, 8 NOD26-like intrinsic proteins (NIPs, 6 X intrinsic proteins (XIPs and 4 small basic intrinsic proteins (SIPs on the basis of sequence similarities. Functional prediction based on the analysis of the aromatic/arginine (ar/R selectivity filter, Froger's positions and specificity-determining positions (SDPs showed a remarkable difference in substrate specificity among subfamilies. Homology analysis supported the expression of all 37 RcAQP genes in at least one of examined tissues, e.g., root, leaf, flower, seed and endosperm. Furthermore, global expression profiles with deep transcriptome sequencing data revealed diverse expression patterns among various tissues. The current study presents the first genome-wide analysis of the AQP gene family in castor bean. Results obtained from this study provide valuable information for future functional analysis and utilization.

  6. Childhood temperament: passive gene-environment correlation, gene-environment interaction, and the hidden importance of the family environment.

    Science.gov (United States)

    Lemery-Chalfant, Kathryn; Kao, Karen; Swann, Gregory; Goldsmith, H Hill

    2013-02-01

    Biological parents pass on genotypes to their children, as well as provide home environments that correlate with their genotypes; thus, the association between the home environment and children's temperament can be genetically (i.e., passive gene-environment correlation) or environmentally mediated. Furthermore, family environments may suppress or facilitate the heritability of children's temperament (i.e., gene-environment interaction). The sample comprised 807 twin pairs (mean age = 7.93 years) from the longitudinal Wisconsin Twin Project. Important passive gene-environment correlations emerged, such that home environments were less chaotic for children with high effortful control, and this association was genetically mediated. Children with high extraversion/surgency experienced more chaotic home environments, and this correlation was also genetically mediated. In addition, heritability of children's temperament was moderated by home environments, such that effortful control and extraversion/surgency were more heritable in chaotic homes, and negative affectivity was more heritable under crowded or unsafe home conditions. Modeling multiple types of gene-environment interplay uncovered the complex role of genetic factors and the hidden importance of the family environment for children's temperament and development more generally.

  7. Members of the barley NAC transcription factor gene family show differential co-regulation with senescence-associated genes during senescence of flag leaves

    DEFF Research Database (Denmark)

    Christiansen, Michael W; Gregersen, Per L.

    2014-01-01

    -expressed with members of the NAC gene family. In conclusion, a list of up to 15 NAC genes from barley that are strong candidates for being regulatory factors of importance for senescence and biotic stress-related traits affecting the productivity of cereal crop plants has been generated. Furthermore, a list of 71...... in the NAC transcription factor family during senescence of barley flag leaves was studied. Several members of the NAC transcription factor gene family were up-regulated during senescence in a microarray experiment, together with a large range of senescence-associated genes, reflecting the coordinated...... activation of degradation processes in senescing barley leaf tissues. This picture was confirmed in a detailed quantitative reverse transcription–PCR (qRT–PCR) experiment, which also showed distinct gene expression patterns for different members of the NAC gene family, suggesting a group of ~15 out of the 47...

  8. Genome-wide analysis of the GRAS gene family in physic nut (Jatropha curcas L.).

    Science.gov (United States)

    Wu, Z Y; Wu, P Z; Chen, Y P; Li, M R; Wu, G J; Jiang, H W

    2015-12-29

    GRAS proteins play vital roles in plant growth and development. Physic nut (Jatropha curcas L.) was found to have a total of 48 GRAS family members (JcGRAS), 15 more than those found in Arabidopsis. The JcGRAS genes were divided into 12 subfamilies or 15 ancient monophyletic lineages based on the phylogenetic analysis of GRAS proteins from both flowering and lower plants. The functions of GRAS genes in 9 subfamilies have been reported previously for several plants, while the genes in the remaining 3 subfamilies were of unknown function; we named the latter families U1 to U3. No member of U3 subfamily is present in Arabidopsis and Poaceae species according to public genome sequence data. In comparison with the number of GRAS genes in Arabidopsis, more were detected in physic nut, resulting from the retention of many ancient GRAS subfamilies and the formation of tandem repeats during evolution. No evidence of recent duplication among JcGRAS genes was observed in physic nut. Based on digital gene expression data, 21 of the 48 genes exhibited differential expression in four tissues analyzed. Two members of subfamily U3 were expressed only in buds and flowers, implying that they may play specific roles. Our results provide valuable resources for future studies on the functions of GRAS proteins in physic nut.

  9. Characterization and expression of the cytochrome P450 gene family in diamondback moth, Plutella xylostella (L.).

    Science.gov (United States)

    Yu, Liying; Tang, Weiqi; He, Weiyi; Ma, Xiaoli; Vasseur, Liette; Baxter, Simon W; Yang, Guang; Huang, Shiguo; Song, Fengqin; You, Minsheng

    2015-03-10

    Cytochrome P450 monooxygenases are present in almost all organisms and can play vital roles in hormone regulation, metabolism of xenobiotics and in biosynthesis or inactivation of endogenous compounds. In the present study, a genome-wide approach was used to identify and analyze the P450 gene family of diamondback moth, Plutella xylostella, a destructive worldwide pest of cruciferous crops. We identified 85 putative cytochrome P450 genes from the P. xylostella genome, including 84 functional genes and 1 pseudogene. These genes were classified into 26 families and 52 subfamilies. A phylogenetic tree constructed with three additional insect species shows extensive gene expansions of P. xylostella P450 genes from clans 3 and 4. Gene expression of cytochrome P450s was quantified across multiple developmental stages (egg, larva, pupa and adult) and tissues (head and midgut) using P. xylostella strains susceptible or resistant to insecticides chlorpyrifos and fiprinol. Expression of the lepidopteran specific CYP367s predominantly occurred in head tissue suggesting a role in either olfaction or detoxification. CYP340s with abundant transposable elements and relatively high expression in the midgut probably contribute to the detoxification of insecticides or plant toxins in P. xylostella. This study will facilitate future functional studies of the P. xylostella P450s in detoxification.

  10. Identification of Candidate Gene Variants in Korean MODY Families by Whole-Exome Sequencing.

    Science.gov (United States)

    Shim, Ye Jee; Kim, Jung Eun; Hwang, Su-Kyeong; Choi, Bong Seok; Choi, Byung Ho; Cho, Eun-Mi; Jang, Kyoung Mi; Ko, Cheol Woo

    2015-01-01

    To date, 13 genes causing maturity-onset diabetes of the young (MODY) have been identified. However, there is a big discrepancy in the genetic locus between Asian and Caucasian patients with MODY. Thus, we conducted whole-exome sequencing in Korean MODY families to identify causative gene variants. Six MODY probands and their family members were included. Variants in the dbSNP135 and TIARA databases for Koreans and the variants with minor allele frequencies >0.5% of the 1000 Genomes database were excluded. We selected only the functional variants (gain of stop codon, frameshifts and nonsynonymous single-nucleotide variants) and conducted a case-control comparison in the family members. The selected variants were scanned for the previously introduced gene set implicated in glucose metabolism. Three variants c.620C>T:p.Thr207Ile in PTPRD, c.559C>G:p.Gln187Glu in SYT9, and c.1526T>G:p.Val509Gly in WFS1 were respectively identified in 3 families. We could not find any disease-causative alleles of known MODY 1-13 genes. Based on the predictive program, Thr207Ile in PTPRD was considered pathogenic. Whole-exome sequencing is a valuable method for the genetic diagnosis of MODY. Further evaluation is necessary about the role of PTPRD, SYT9 and WFS1 in normal insulin release from pancreatic beta cells. © 2015 S. Karger AG, Basel.

  11. Novel glucokinase gene mutation in the first Macedonian family tested for MODY.

    Science.gov (United States)

    Kocova, M; Elblova, L; Pruhova, S; Lebl, J; Dusatkova, P

    2017-08-01

    We present a boy with mild hyperglycemia detected during an upper respiratory infection. Novel splicing mutation in the intron 1 of the GCK gene (c.45+1G>A) was detected, and was subsequently confirmed in his father. This is the first case of genetically confirmed Macedonian family with MODY. Copyright © 2017 Elsevier B.V. All rights reserved.

  12. [The mutation analysis of PAH gene and prenatal diagnosis in classical phenylketonuria family].

    Science.gov (United States)

    Yan, Yousheng; Hao, Shengju; Yao, Fengxia; Sun, Qingmei; Zheng, Lei; Zhang, Qinghua; Zhang, Chuan; Yang, Tao; Huang, Shangzhi

    2014-12-01

    To characterize the mutation spectrum of phenylalanine hydroxylase (PAH) gene and perform prenatal diagnosis for families with classical phenylketonuria. By stratified sequencing, mutations were detected in the exons and flaking introns of PAH gene of 44 families with classical phenylketonuria. 47 fetuses were diagnosed by combined sequencing with linkage analysis of three common short tandem repeats (STR) (PAH-STR, PAH-26 and PAH-32) in the PAH gene. Thirty-one types of mutations were identified. A total of 84 mutations were identified in 88 alleles (95.45%), in which the most common mutation have been R243Q (21.59%), EX6-96A>G (6.82%), IVS4-1G>A (5.86%) and IVS7+2T>A (5.86%). Most mutations were found in exons 3, 5, 6, 7, 11 and 12. The polymorphism information content (PIC) of these three STR markers was 0.71 (PAH-STR), 0.48 (PAH-26) and 0.40 (PAH-32), respectively. Prenatal diagnosis was performed successfully with the combined method in 47 fetuses of 44 classical phenylketonuria families. Among them, 11 (23.4%) were diagnosed as affected, 24 (51.1%) as carriers, and 12 (25.5%) as unaffected. Prenatal diagnosis can be achieved efficiently and accurately by stratified sequencing of PAH gene and linkage analysis of STR for classical phenylketonuria families.

  13. Novel duplication mutation of the DYSF gene in a Pakistani family with Miyoshi Myopathy

    Directory of Open Access Journals (Sweden)

    Muhammad I. Ullah

    2017-12-01

    Full Text Available Objectives: To identify the underlying gene mutation in a large consanguineous Pakistani family. Methods: This is an observational descriptive study carried out at the Department of Biochemistry, Shifa International Hospital, Quaid-i-Azam University, and Atta-ur-Rahman School of Applied Biosciences, National University of Sciences and Technology, Islamabad, Pakistan from 2013-2016. Genomic DNA of all recruited family members was extracted and the Trusight one sequencing panel was used to assess genes associated with a neuro-muscular phenotype. Comparative modeling of mutated and wild-type protein was carried out by PyMOL tool. Results: Clinical investigations of an affected individual showed typical features of Miyoshi myopathy (MM like elevated serum creatine kinase (CK levels, distal muscle weakness, myopathic changes in electromyography (EMG and muscle histopathology. Sequencing with the Ilumina Trusight one sequencing panel revealed a novel 22 nucleotide duplication (CTTCAACTTGTTTGACTCTCCT in the DYSF gene (NM_001130987.1_c.897-918dup; p.Gly307Leufs5X, which results in a truncating frameshift mutation and perfectly segregated with the disease in this family. Protein modeling studies suggested a disruption in spatial configuration of the putative mutant protein. Conclusion: A novel duplication of 22 bases (c.897_918dup; p.Gly307Leufs5X in the DYSF gene was identified in a family suffering from Miyoshi myopathy. Protein homology analysis proposes a disruptive impact of this mutation on protein function.

  14. Identification of the 14-3-3 gene family in Rafflesia cantleyi

    Science.gov (United States)

    Rosli, Khadijah; Wan, Kiew-Lian

    2018-04-01

    Rafflesia is known to be the largest flower in the world. Due to its size and appearance, it is considered to be very unique. Little is known about the molecular biology of this rare parasitic flowering plant as it is very difficult to locate and has a short life-span as a flower. Physiological activities in plants are regulated by signalling regulators such as the members of the 14-3-3 gene family. The number of members of this gene family varies in plants and there are thirteen known members in Arabidopsis thaliana. Their role is to bind to phosphorylated targets to complete signal transduction processes. Sequence comparison using BLAST of transcriptome data from three different Rafflesia cantleyi floral bud stages against the Swissprot database revealed 27 transcripts annotated as members of this gene family. All of the transcripts were expressed during floral bud stage 1 (S1) while 14 and four transcripts were expressed during floral bud stages 2 (S2) and 3 (S3), respectively. Significant downregulation was recorded for six and nine transcripts at S1 vs. S2 and S2 vs. S3 respectively. This gene family may play a critical role as signalling regulators during the development of Rafflesia floral bud.

  15. [Analysis of USH2A gene mutation in a Chinese family affected with Usher syndrome].

    Science.gov (United States)

    Li, Pengcheng; Liu, Fei; Zhang, Mingchang; Wang, Qiufen; Liu, Mugen

    2015-08-01

    To investigate the disease-causing mutation in a Chinese family affected with Usher syndrome type II. All of the 11 members from the family underwent comprehensive ophthalmologic examination and hearing test, and their genomic DNA were isolated from venous leukocytes. PCR and direct sequencing of USH2A gene were performed for the proband. Wild type and mutant type minigene vectors containing exon 42, intron 42 and exon 43 of the USH2A gene were constructed and transfected into Hela cells by lipofectamine reagent. Reverse transcription (RT)-PCR was carried out to verify the splicing of the minigenes. Pedigree analysis and clinical diagnosis indicated that the patients have suffered from autosomal recessive Usher syndrome type II. DNA sequencing has detected a homozygous c.8559-2A>G mutation of the USH2A gene in the proband, which has co-segregated with the disease in the family. The mutation has affected a conserved splice site in intron 42, which has led to inactivation of the splice site. Minigene experiment has confirmed the retaining of intron 42 in mature mRNA. The c.8559-2A>G mutation in the USH2A gene probably underlies the Usher syndrome type II in this family. The splice site mutation has resulted in abnormal splicing of USH2A pre-mRNA.

  16. [Gene mutation analysis and prenatal diagnosis of a family with Bartter syndrome].

    Science.gov (United States)

    Li, Long; Ma, Na; Li, Xiu-Rong; Gong, Fei; DU, Juan

    2016-08-01

    To investigate the mutation of related genes and prenatal diagnosis of a family with Bartter syndrome (BS). The high-throughput capture sequencing technique and PCR-Sanger sequencing were used to detect pathogenic genes in the proband of this family and analyze the whole family at the genomic level. After the genetic cause was clarified, the amniotic fluid was collected from the proband's mother who was pregnant for 5 months for prenatal diagnosis. The proband carried compound heterozygous mutations of c.88C>T(p.Arg30*) and c.968+2T>A in the CLCNKB gene; c.88C>T(p.Arg30*) had been reported as a pathogenic mutation, and c.968+2T>A was a new mutation. Pedigree analysis showed that the two mutations were inherited from the mother and father, respectively. Prenatal diagnosis showed that the fetus did not inherit the mutations from parents and had no mutations at the two loci. The follow-up visit confirmed that the infant was in a healthy state, which proved the accuracy of genetic diagnosis and prenatal diagnosis. The compound heterozygous mutations c.88C>T(p.Arg30*) and c.968+2T>A in the CLCNKB gene are the cause of BS in the proband, and prenatal diagnosis can prevent the risk of recurrence of BS in this family.

  17. Identifying human disease genes through cross-species gene mapping of evolutionary conserved processes.

    Directory of Open Access Journals (Sweden)

    Martin Poot

    2011-05-01

    Full Text Available Understanding complex networks that modulate development in humans is hampered by genetic and phenotypic heterogeneity within and between populations. Here we present a method that exploits natural variation in highly diverse mouse genetic reference panels in which genetic and environmental factors can be tightly controlled. The aim of our study is to test a cross-species genetic mapping strategy, which compares data of gene mapping in human patients with functional data obtained by QTL mapping in recombinant inbred mouse strains in order to prioritize human disease candidate genes.We exploit evolutionary conservation of developmental phenotypes to discover gene variants that influence brain development in humans. We studied corpus callosum volume in a recombinant inbred mouse panel (C57BL/6J×DBA/2J, BXD strains using high-field strength MRI technology. We aligned mouse mapping results for this neuro-anatomical phenotype with genetic data from patients with abnormal corpus callosum (ACC development.From the 61 syndromes which involve an ACC, 51 human candidate genes have been identified. Through interval mapping, we identified a single significant QTL on mouse chromosome 7 for corpus callosum volume with a QTL peak located between 25.5 and 26.7 Mb. Comparing the genes in this mouse QTL region with those associated with human syndromes (involving ACC and those covered by copy number variations (CNV yielded a single overlap, namely HNRPU in humans and Hnrpul1 in mice. Further analysis of corpus callosum volume in BXD strains revealed that the corpus callosum was significantly larger in BXD mice with a B genotype at the Hnrpul1 locus than in BXD mice with a D genotype at Hnrpul1 (F = 22.48, p<9.87*10(-5.This approach that exploits highly diverse mouse strains provides an efficient and effective translational bridge to study the etiology of human developmental disorders, such as autism and schizophrenia.

  18. A novel AVP gene mutation in a Turkish family with neurohypophyseal diabetes insipidus.

    Science.gov (United States)

    Ilhan, M; Tiryakioglu, N O; Karaman, O; Coskunpinar, E; Yildiz, R S; Turgut, S; Tiryakioglu, D; Toprak, H; Tasan, E

    2016-03-01

    Familial neurohypophyseal diabetes insipidus (FNDI) is a rare, autosomal dominant, inherited disorder which is characterized by severe polydipsia and polyuria generally presenting in early childhood. In the present study, we aimed to analyze the AVP gene in a Turkish family with FNDI. Four patients with neurohypophyseal diabetes insipidus and ten healthy members of the family were studied. Diabetes insipidus was diagnosed by the water deprivation test in affected family members. Mutation analysis was performed by sequencing the whole coding region of AVP-NPII gene using DNA isolated from peripheral blood samples. Urine osmolality was low (C in all patients. c.-3A>C mutation in 5'UTR of AVP gene in this family might lead to the truncation of signal peptide, aggregation of AVP in the cytoplasm instead of targeting in the endoplasmic reticulum, thereby could disrupt AVP secretion without causing neuronal cytotoxicity, which might explain the presence of bright spot. The predicted effect of this mutation should be investigated by further in vitro molecular studies.

  19. Familial Dilated Cardiomyopathy Caused by a Novel Frameshift in the BAG3 Gene.

    Directory of Open Access Journals (Sweden)

    Rocio Toro

    Full Text Available Dilated cardiomyopathy, a major cause of chronic heart failure and cardiac transplantation, is characterized by left ventricular or biventricular heart dilatation. In nearly 50% of cases the pathology is inherited, and more than 60 genes have been reported as disease-causing. However, in 30% of familial cases the mutation remains unidentified even after comprehensive genetic analysis. This study clinically and genetically assessed a large Spanish family affected by dilated cardiomyopathy to search for novel variations.Our study included a total of 100 family members. Clinical assessment was performed in alive, and genetic analysis was also performed in alive and 1 deceased relative. Genetic screening included resequencing of 55 genes associated with sudden cardiac death, and Sanger sequencing of main disease-associated genes. Genetic analysis identified a frame-shift variation in BAG3 (p.H243Tfr*64 in 32 patients. Genotype-phenotype correlation identified substantial heterogeneity in disease expression. Of 32 genetic carriers (one deceased, 21 relatives were clinically affected, and 10 were asymptomatic. Seventeen of the symptomatic genetic carriers exhibited proto-diastolic septal knock by echocardiographic assessment.We report p.H243Tfr*64_BAG3 as a novel pathogenic variation responsible for familial dilated cardiomyopathy. This variation correlates with a more severe phenotype of the disease, mainly in younger individuals. Genetic analysis in families, even asymptomatic individuals, enables early identification of individuals at risk and allows implementation of preventive measures.

  20. Cognitive genomics: Linking genes to behavior in the human brain

    Directory of Open Access Journals (Sweden)

    Genevieve Konopka

    2017-02-01

    Full Text Available Correlations of genetic variation in DNA with functional brain activity have already provided a starting point for delving into human cognitive mechanisms. However, these analyses do not provide the specific genes driving the associations, which are complicated by intergenic localization as well as tissue-specific epigenetics and expression. The use of brain-derived expression datasets could build upon the foundation of these initial genetic insights and yield genes and molecular pathways for testing new hypotheses regarding the molecular bases of human brain development, cognition, and disease. Thus, coupling these human brain gene expression data with measurements of brain activity may provide genes with critical roles in brain function. However, these brain gene expression datasets have their own set of caveats, most notably a reliance on postmortem tissue. In this perspective, I summarize and examine the progress that has been made in this realm to date, and discuss the various frontiers remaining, such as the inclusion of cell-type-specific information, additional physiological measurements, and genomic data from patient cohorts.

  1. Law-medicine interfacing: patenting of human genes and mutations.

    Science.gov (United States)

    Fialho, Arsenio M; Chakrabarty, Ananda M

    2011-08-01

    Mutations, Single Nucleotide Polymorphisms (SNPs), deletions and genetic rearrangements in specific genes in the human genome account for not only our physical characteristics and behavior, but can lead to many in-born and acquired diseases. Such changes in the genome can also predispose people to cancers, as well as significantly affect the metabolism and efficacy of many drugs, resulting in some cases in acute toxicity to the drug. The testing of the presence of such genetic mutations and rearrangements is of great practical and commercial value, leading many of these genes and their mutations/deletions and genetic rearrangements to be patented. A recent decision by a judge in the Federal District Court in the Southern District of New York, has created major uncertainties, based on the revocation of BRCA1 and BRCA2 gene patents, in the eligibility of all human and presumably other gene patents. This article argues that while patents on BRCA1 and BRCA2 genes could be challenged based on a lack of utility, the patenting of the mutations and genetic rearrangements is of great importance to further development and commercialization of genetic tests that can save human lives and prevent suffering, and should be allowed.

  2. The SKP1-like gene family of Arabidopsis exhibits a high degree of differential gene expression and gene product interaction during development.

    Directory of Open Access Journals (Sweden)

    Mohammad H Dezfulian

    Full Text Available The Arabidopsis thaliana genome encodes several families of polypeptides that are known or predicted to participate in the formation of the SCF-class of E3-ubiquitin ligase complexes. One such gene family encodes the Skp1-like class of polypeptide subunits, where 21 genes have been identified and are known to be expressed in Arabidopsis. Phylogenetic analysis based on deduced polypeptide sequence organizes the family of ASK proteins into 7 clades. The complexity of the ASK gene family, together with the close structural similarity among its members raises the prospect of significant functional redundancy among select paralogs. We have assessed the potential for functional redundancy within the ASK gene family by analyzing an expanded set of criteria that define redundancy with higher resolution. The criteria used include quantitative expression of locus-specific transcripts using qRT-PCR, assessment of the sub-cellular localization of individual ASK:YFP auto-fluorescent fusion proteins expressed in vivo as well as the in planta assessment of individual ASK-F-Box protein interactions using bimolecular fluorescent complementation techniques in combination with confocal imagery in live cells. The results indicate significant functional divergence of steady state transcript abundance and protein-protein interaction specificity involving ASK proteins in a pattern that is poorly predicted by sequence-based phylogeny. The information emerging from this and related studies will prove important for defining the functional intersection of expression, localization and gene product interaction that better predicts the formation of discrete SCF complexes, as a prelude to investigating their molecular mode of action.

  3. Gene expression and adaptive noncoding changes during human evolution.

    Science.gov (United States)

    Babbitt, Courtney C; Haygood, Ralph; Nielsen, William J; Wray, Gregory A

    2017-06-05

    Despite evidence for adaptive changes in both gene expression and non-protein-coding, putatively regulatory regions of the genome during human evolution, the relationship between gene expression and adaptive changes in cis-regulatory regions remains unclear. Here we present new measurements of gene expression in five tissues of humans and chimpanzees, and use them to assess this relationship. We then compare our results with previous studies of adaptive noncoding changes, analyzing correlations at the level of gene ontology groups, in order to gain statistical power to detect correlations. Consistent with previous studies, we find little correlation between gene expression and adaptive noncoding changes at the level of individual genes; however, we do find significant correlations at the level of biological function ontology groups. The types of function include processes regulated by specific transcription factors, responses to genetic or chemical perturbations, and differentiation of cell types within the immune system. Among functional categories co-enriched with both differential expression and noncoding adaptation, prominent themes include cancer, particularly epithelial cancers, and neural development and function.

  4. Positioning the expanded akirin gene family of Atlantic salmon within the transcriptional networks of myogenesis

    International Nuclear Information System (INIS)

    Macqueen, Daniel J.; Bower, Neil I.; Johnston, Ian A.

    2010-01-01

    Research highlights: → The expanded akirin gene family of Atlantic salmon was characterised. → akirin paralogues are regulated between mono- and multi-nucleated muscle cells. → akirin paralogues positioned within known genetic networks controlling myogenesis. → Co-expression of akirin paralogues is evident across cell types/during myogenesis. → Selection has likely maintained common regulatory elements among akirin paralogues. -- Abstract: Vertebrate akirin genes usually form a family with one-to-three members that regulate gene expression during the innate immune response, carcinogenesis and myogenesis. We recently established that an expanded family of eight akirin genes is conserved across salmonid fish. Here, we measured mRNA levels of the akirin family of Atlantic salmon (Salmo salar L.) during the differentiation of primary myoblasts cultured from fast-skeletal muscle. Using hierarchical clustering and correlation, the data was positioned into a network of expression profiles including twenty further genes that regulate myogenesis. akirin1(2b) was not significantly regulated during the maturation of the cell culture. akirin2(1a) and 2(1b), along with IGF-II and several igfbps, were most highly expressed in mononuclear cells, then significantly and constitutively downregulated as differentiation proceeded and myotubes formed/matured. Conversely, akirin1(1a), 1(1b), 1(2a), 2(2a) and 2(2b) were expressed at lowest levels when mononuclear cells dominated the culture and highest levels when confluent layers of myotubes were evident. However, akirin1(2a) and 2(2a) were first upregulated earlier than akirin1(1a), 1(1b) and 2(2b), when rates of myoblast proliferation were highest. Interestingly, akirin1(1b), 1(2a), 2(2a) and 2(2b) formed part of a module of co-expressed genes involved in muscle differentiation, including myod1a, myog, mef2a, 14-3-3β and 14-3-3γ. All akirin paralogues were expressed ubiquitously across ten tissues, although mRNA levels

  5. Positioning the expanded akirin gene family of Atlantic salmon within the transcriptional networks of myogenesis

    Energy Technology Data Exchange (ETDEWEB)

    Macqueen, Daniel J., E-mail: djm59@st-andrews.ac.uk [Laboratory of Physiological and Evolutionary Genomics, Scottish Oceans Institute, University of St Andrews, St Andrews, Fife KY16 8LB (United Kingdom); Bower, Neil I., E-mail: nib@st-andrews.ac.uk [Laboratory of Physiological and Evolutionary Genomics, Scottish Oceans Institute, University of St Andrews, St Andrews, Fife KY16 8LB (United Kingdom); Johnston, Ian A., E-mail: iaj@st-andrews.ac.uk [Laboratory of Physiological and Evolutionary Genomics, Scottish Oceans Institute, University of St Andrews, St Andrews, Fife KY16 8LB (United Kingdom)

    2010-10-01

    Research highlights: {yields} The expanded akirin gene family of Atlantic salmon was characterised. {yields} akirin paralogues are regulated between mono- and multi-nucleated muscle cells. {yields} akirin paralogues positioned within known genetic networks controlling myogenesis. {yields} Co-expression of akirin paralogues is evident across cell types/during myogenesis. {yields} Selection has likely maintained common regulatory elements among akirin paralogues. -- Abstract: Vertebrate akirin genes usually form a family with one-to-three members that regulate gene expression during the innate immune response, carcinogenesis and myogenesis. We recently established that an expanded family of eight akirin genes is conserved across salmonid fish. Here, we measured mRNA levels of the akirin family of Atlantic salmon (Salmo salar L.) during the differentiation of primary myoblasts cultured from fast-skeletal muscle. Using hierarchical clustering and correlation, the data was positioned into a network of expression profiles including twenty further genes that regulate myogenesis. akirin1(2b) was not significantly regulated during the maturation of the cell culture. akirin2(1a) and 2(1b), along with IGF-II and several igfbps, were most highly expressed in mononuclear cells, then significantly and constitutively downregulated as differentiation proceeded and myotubes formed/matured. Conversely, akirin1(1a), 1(1b), 1(2a), 2(2a) and 2(2b) were expressed at lowest levels when mononuclear cells dominated the culture and highest levels when confluent layers of myotubes were evident. However, akirin1(2a) and 2(2a) were first upregulated earlier than akirin1(1a), 1(1b) and 2(2b), when rates of myoblast proliferation were highest. Interestingly, akirin1(1b), 1(2a), 2(2a) and 2(2b) formed part of a module of co-expressed genes involved in muscle differentiation, including myod1a, myog, mef2a, 14-3-3{beta} and 14-3-3{gamma}. All akirin paralogues were expressed ubiquitously across ten

  6. Gene expression profiles in adenosine-treated human mast cells ...

    African Journals Online (AJOL)

    Gene expression profiles in adenosine-treated human mast cells. ... SW Kang, JE Jeong, CH Kim, SH Choi, SH Chae, SA Jun, HJ Cha, JH Kim, YM Lee, YS ... beta 4, ring finger protein, high-mobility group, calmodulin 2, RAN binding protein, ...

  7. Ethical perception of human gene in transgenic banana | Amin ...

    African Journals Online (AJOL)

    Transgenic banana has been developed to prevent hepatitis B through vaccination. Its production seems to be an ideal alternative for cheaper vaccines. The objective of this paper is to assess the ethical perception of transgenic banana which involved the transfer of human albumin gene, and to compare their ethical ...

  8. Global patterns of diversity and selection in human tyrosinase gene.

    Science.gov (United States)

    Hudjashov, Georgi; Villems, Richard; Kivisild, Toomas

    2013-01-01

    Global variation in skin pigmentation is one of the most striking examples of environmental adaptation in humans. More than two hundred loci have been identified as candidate genes in model organisms and a few tens of these have been found to be significantly associated with human skin pigmentation in genome-wide association studies. However, the evolutionary history of different pigmentation genes is rather complex: some loci have been subjected to strong positive selection, while others evolved under the relaxation of functional constraints in low UV environment. Here we report the results of a global study of the human tyrosinase gene, which is one of the key enzymes in melanin production, to assess the role of its variation in the evolution of skin pigmentation differences among human populations. We observe a higher rate of non-synonymous polymorphisms in the European sample consistent with the relaxation of selective constraints. A similar pattern was previously observed in the MC1R gene and concurs with UV radiation-driven model of skin color evolution by which mutations leading to lower melanin levels and decreased photoprotection are subject to purifying selection at low latitudes while being tolerated or even favored at higher latitudes because they facilitate UV-dependent vitamin D production. Our coalescent date estimates suggest that the non-synonymous variants, which are frequent in Europe and North Africa, are recent and have emerged after the separation of East and West Eurasian populations.

  9. Designer Babies? Teacher Views on Gene Technology and Human Medicine.

    Science.gov (United States)

    Schibeci, Renato

    1999-01-01

    Summarizes the views of a sample of primary and high school teachers on the application of gene technology to human medicine. In general, high school teachers are more positive about these developments than primary teachers, and both groups of teachers are more positive than interested lay publics. Highlights ways in which this topic can be…

  10. A human gut microbial gene catalogue established by metagenomic sequencing

    DEFF Research Database (Denmark)

    dos Santos, Marcelo Bertalan Quintanilha; Sicheritz-Pontén, Thomas; Nielsen, Henrik Bjørn

    2010-01-01

    To understand the impact of gut microbes on human health and well-being it is crucial to assess their genetic potential. Here we describe the Illumina-based metagenomic sequencing, assembly and characterization of 3.3 million non-redundant microbial genes, derived from 576.7 gigabases of sequence...

  11. Gene therapy in nonhuman primate models of human autoimmune disease

    NARCIS (Netherlands)

    t'Hart, B. A.; Vervoordeldonk, M.; Heeney, J. L.; Tak, P. P.

    2003-01-01

    Before autoimmune diseases in humans can be treated with gene therapy, the safety and efficacy of the used vectors must be tested in valid experimental models. Monkeys, such as the rhesus macaque or the common marmoset, provide such models. This publication reviews the state of the art in monkey

  12. Mutational landscape of the human Y chromosome-linked genes ...

    Indian Academy of Sciences (India)

    Mutational landscape of the human Y chromosome-linked genes and loci in patients with hypogonadism. Deepali Pathak, Sandeep Kumar Yadav, Leena Rawal and Sher Ali. J. Genet. 94, 677–687. Table 1. Details showing age, sex, karyotype, clinical features and diagnosis results of the patients with H. Hormone profile.

  13. Genome-Wide Identification and Expression Analysis of WRKY Gene Family in Capsicum annuum L.

    Science.gov (United States)

    Diao, Wei-Ping; Snyder, John C; Wang, Shu-Bin; Liu, Jin-Bing; Pan, Bao-Gui; Guo, Guang-Jun; Wei, Ge

    2016-01-01

    The WRKY family of transcription factors is one of the most important families of plant transcriptional regulators with members regulating multiple biological processes, especially in regulating defense against biotic and abiotic stresses. However, little information is available about WRKYs in pepper (Capsicum annuum L.). The recent release of completely assembled genome sequences of pepper allowed us to perform a genome-wide investigation for pepper WRKY proteins. In the present study, a total of 71 WRKY genes were identified in the pepper genome. According to structural features of their encoded proteins, the pepper WRKY genes (CaWRKY) were classified into three main groups, with the second group further divided into five subgroups. Genome mapping analysis revealed that CaWRKY were enriched on four chromosomes, especially on chromosome 1, and 15.5% of the family members were tandemly duplicated genes. A phylogenetic tree was constructed depending on WRKY domain' sequences derived from pepper and Arabidopsis. The expression of 21 selected CaWRKY genes in response to seven different biotic and abiotic stresses (salt, heat shock, drought, Phytophtora capsici, SA, MeJA, and ABA) was evaluated by quantitative RT-PCR; Some CaWRKYs were highly expressed and up-regulated by stress treatment. Our results will provide a platform for functional identification and molecular breeding studies of WRKY genes in pepper.

  14. Embryonic expression of zebrafish MiT family genes tfe3b, tfeb, and tfec.

    Science.gov (United States)

    Lister, James A; Lane, Brandon M; Nguyen, Anhthu; Lunney, Katherine

    2011-11-01

    The MiT family comprises four genes in mammals: Mitf, Tfe3, Tfeb, and Tfec, which encode transcription factors of the basic-helix-loop-helix/leucine zipper class. Mitf is well-known for its essential role in the development of melanocytes, however the functions of the other members of this family, and of interactions between them, are less well understood. We have now characterized the complete set of MiT genes from zebrafish, which totals six instead of four. The zebrafish genome contain two mitf (mitfa and mitfb), two tfe3 (tfe3a and tfe3b), and single tfeb and tfec genes; this distribution is shared with other teleosts. We present here the sequence and embryonic expression patterns for the zebrafish tfe3b, tfeb, and tfec genes, and identify a new isoform of tfe3a. These findings will assist in elucidating the roles of the MiT gene family over the course of vertebrate evolution. Copyright © 2011 Wiley-Liss, Inc.

  15. Characterization of vNr-13, the first alphaherpesvirus gene of the bcl-2 family

    International Nuclear Information System (INIS)

    Aouacheria, Abdel; Banyai, Michelle; Rigal, Dominique; Schmidt, Carl J.; Gillet, Germain

    2003-01-01

    The Bcl-2 family, including antiapoptotic and proapoptotic members, plays key regulating roles in programmed cell death. We report the characterization of a new member of the bcl-2 family, encoded by herpesvirus of turkeys (HVT). The product of this gene shares 80% homology with Nr-13, an apoptosis inhibitor, which is overexpressed in avian cells transformed by the v-src oncogene. This new gene, that we propose to call vnr-13, is the first member of the bcl-2 family to be isolated among α-herpesviruses. Results from cells expressing the HVT-vnr-13 gene product show that the encoded protein inhibits apoptosis and also reduces the rate of cellular proliferation. Contrary to all bcl-2 homologues found in γ-herpesvirus, which are intronless, vnr-13 has the same organization as the cellular nr-13 gene. Hence, the HVT vnr-13 gene may have been acquired from a reverse transcriptase product of an unspliced precursor RNA, or via direct recombination with the host chromosomal DNA

  16. The Vitis vinifera sugar transporter gene family: phylogenetic overview and macroarray expression profiling

    Directory of Open Access Journals (Sweden)

    Atanassova Rossitza

    2010-11-01

    Full Text Available Abstract Background In higher plants, sugars are not only nutrients but also important signal molecules. They are distributed through the plant via sugar transporters, which are involved not only in sugar long-distance transport via the loading and the unloading of the conducting complex, but also in sugar allocation into source and sink cells. The availability of the recently released grapevine genome sequence offers the opportunity to identify sucrose and monosaccharide transporter gene families in a woody species and to compare them with those of the herbaceous Arabidopsis thaliana using a phylogenetic analysis. Results In grapevine, one of the most economically important fruit crop in the world, it appeared that sucrose and monosaccharide transporter genes are present in 4 and 59 loci, respectively and that the monosaccharide transporter family can be divided into 7 subfamilies. Phylogenetic analysis of protein sequences has indicated that orthologs exist between Vitis and Arabidospis. A search for cis-regulatory elements in the promoter sequences of the most characterized transporter gene families (sucrose, hexoses and polyols transporters, has revealed that some of them might probably be regulated by sugars. To profile several genes simultaneously, we created a macroarray bearing cDNA fragments specific to 20 sugar transporter genes. This macroarray analysis has revealed that two hexose (VvHT1, VvHT3, one polyol (VvPMT5 and one sucrose (VvSUC27 transporter genes, are highly expressed in most vegetative organs. The expression of one hexose transp